Generation of an ABCG2GFPn-puro transgenic line - A tool to study ABCG2 expression in mice
International Nuclear Information System (INIS)
Orford, Michael; Mean, Richard; Lapathitis, George; Genethliou, Nicholas; Panayiotou, Elena; Panayi, Helen; Malas, Stavros
2009-01-01
The ATP-binding cassette (ABC) transporter 2 (ABCG2) is expressed by stem cells in many organs and in stem cells of solid tumors. These cells are isolated based on the side population (SP) phenotype, a Hoechst 3342 dye efflux property believed to be conferred by ABCG2. Because of the limitations of this approach we generated transgenic mice that express Nuclear GFP (GFPn) coupled to the Puromycin-resistance gene, under the control of ABCG2 promoter/enhancer sequences. We show that ABCG2 is expressed in neural progenitors of the developing forebrain and spinal cord and in embryonic and adult endothelial cells of the brain. Using the neurosphere assay, we isolated tripotent ABCG2-expressing neural stem cells from embryonic mouse brain. This transgenic line is a powerful tool for studying the expression of ABCG2 in many tissues and for performing functional studies in different experimental settings.
Generation of an ABCG2{sup GFPn-puro} transgenic line - A tool to study ABCG2 expression in mice
Energy Technology Data Exchange (ETDEWEB)
Orford, Michael; Mean, Richard; Lapathitis, George; Genethliou, Nicholas; Panayiotou, Elena; Panayi, Helen [The Cyprus Institute of Neurology and Genetics, Airport Avenue, No. 6, Agios Dometios 2370, Nicosia (Cyprus); Malas, Stavros, E-mail: smalas@cing.ac.cy [The Cyprus Institute of Neurology and Genetics, Airport Avenue, No. 6, Agios Dometios 2370, Nicosia (Cyprus); Department of Biological Sciences, University of Cyprus, P.O. Box 20537, 1678 Nicosia (Cyprus)
2009-06-26
The ATP-binding cassette (ABC) transporter 2 (ABCG2) is expressed by stem cells in many organs and in stem cells of solid tumors. These cells are isolated based on the side population (SP) phenotype, a Hoechst 3342 dye efflux property believed to be conferred by ABCG2. Because of the limitations of this approach we generated transgenic mice that express Nuclear GFP (GFPn) coupled to the Puromycin-resistance gene, under the control of ABCG2 promoter/enhancer sequences. We show that ABCG2 is expressed in neural progenitors of the developing forebrain and spinal cord and in embryonic and adult endothelial cells of the brain. Using the neurosphere assay, we isolated tripotent ABCG2-expressing neural stem cells from embryonic mouse brain. This transgenic line is a powerful tool for studying the expression of ABCG2 in many tissues and for performing functional studies in different experimental settings.
Energy Technology Data Exchange (ETDEWEB)
Wang, Juan; Xin, Beibei; Wang, Hui; He, Xiaodan [School of Medicine, Nankai University, 94 Weijin Road, Tianjin 300071 (China); Wei, Wei; Zhang, Ti [Tianjin Medical University Cancer Institute and Hospital, Huanhu West Road, Tianjin 300060 (China); Shen, Xiaohong, E-mail: zebal2014@163.com [School of Medicine, Nankai University, 94 Weijin Road, Tianjin 300071 (China)
2016-08-01
Gastrin is absent in most normal adult pancreatic tissues but is highly expressed in pancreatic cancer tissues. Although Gastrin expression was reported to be associated with tumor proliferation in human pancreatic cancer, studies on the relationship between Gastrin and tumor metastasis in pancreatic cancer are rare. In this study, we performed an analysis to determine the effects of Gastrin on modulating the side populations, cell proportion and tumor cell metastatic potential and invasion activity and explored its mechanisms in pancreatic cancer. We indicated that Gastrin and ABCG2 were widely expressed in pancreatic cancer cell lines and overexpressed in cancer tissues. Gastrin induced ABCG2 expression, and this effect was mediated by NF-κB activation. Gastrin regulated the SP proportion of BxPC-3 cells via modulating ABCG2 expression. Through the regulation of the functions of NF-κB/ABCG2, Gastrin functionally promoted the migration and invasion in pancreatic cancer cell. The present study indicated that Gastrin induced ABCG2 expression by activating NF-κB and thereby modulated the SP proportion, tumor cell metastatic potential and invasion activity in pancreatic cancer. Gastrin could serve as an effective therapeutic target for the metastasis of pancreatic cancer. - Highlights: • Gastrin induces ABCG2 expression mediated by NF-κB activation. • Gastrin regulates NF-κB's function that binds to the ABCG2 promoter in BxPC-3 cells. • Gastrin promotes the SP proportion in BxPC-3 cells by modulating ABCG2 expression via activation of NF-κB molecule. • Gastrin induces an increase in migration and invasion potential in pancreatic cancer cell by regulating NF-κB/ABCG2 signaling.
Gadd45a promotes DNA demethylation through TDG
Li, Zheng; Gu, Tian-Peng; Weber, Alain R.; Shen, Jia-Zhen; Li, Bin-Zhong; Xie, Zhi-Guo; Yin, Ruichuan; Guo, Fan; Liu, Xiaomeng; Tang, Fuchou; Wang, Hailin; Sch?r, Primo; Xu, Guo-Liang
2015-01-01
Growth arrest and DNA-damage-inducible protein 45 (Gadd45) family members have been implicated in DNA demethylation in vertebrates. However, it remained unclear how they contribute to the demethylation process. Here, we demonstrate that Gadd45a promotes active DNA demethylation through thymine DNA glycosylase (TDG) which has recently been shown to excise 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) generated in Ten-eleven-translocation (Tet)?initiated oxidative demethylation. The conn...
Promoter demethylation of Keap1 gene in human diabetic cataractous lenses
Energy Technology Data Exchange (ETDEWEB)
Palsamy, Periyasamy [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States); Ayaki, Masahiko [Shizuoka National Hospital, Saitama (Japan); Elanchezhian, Rajan [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States); Shinohara, Toshimichi, E-mail: tshinohara@unmc.edu [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States)
2012-07-06
Highlights: Black-Right-Pointing-Pointer We found significant Keap1 promoter demethylation in diabetic cataractous lenses. Black-Right-Pointing-Pointer Demethylation of Keap1 gene upregulated the expression of Keap1 mRNA and protein. Black-Right-Pointing-Pointer Elevated levels of Keap1 are known to decrease the levels of Nrf2. Black-Right-Pointing-Pointer Thereby, the levels of antioxidant enzymes are suppressed by decreased Nrf2 level. -- Abstract: Age-related cataracts (ARCs) are the major cause of visual impairments worldwide, and diabetic adults tend to have an earlier onset of ARCs. Although age is the strongest risk factor for cataracts, little is known how age plays a role in the development of ARCs. It is known that oxidative stress in the lens increases with age and more so in the lenses of diabetics. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. We hypothesized that hyperglycemia will lead to a dysfunction of the Nrf2-dependent antioxidative protection in the lens of diabetics. We studied the methylation status of the CpG islands in 15 clear and 21 diabetic cataractous lenses. Our results showed significant levels of demethylated DNA in the Keap1 promoter in the cataractous lenses from diabetic patients. In contrast, highly methylated DNA was found in the clear lens and tumorized human lens epithelial cell (HLEC) lines (SRA01/04). HLECs treated with a demethylation agent, 5-aza-2 Prime deoxycytidine (5-Aza), had a 10-fold higher levels of Keap1 mRNA, 3-fold increased levels of Keap1 protein, produced higher levels of ROS, and increased cell death. Our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which
Promoter demethylation of Keap1 gene in human diabetic cataractous lenses
International Nuclear Information System (INIS)
Palsamy, Periyasamy; Ayaki, Masahiko; Elanchezhian, Rajan; Shinohara, Toshimichi
2012-01-01
Highlights: ► We found significant Keap1 promoter demethylation in diabetic cataractous lenses. ► Demethylation of Keap1 gene upregulated the expression of Keap1 mRNA and protein. ► Elevated levels of Keap1 are known to decrease the levels of Nrf2. ► Thereby, the levels of antioxidant enzymes are suppressed by decreased Nrf2 level. -- Abstract: Age-related cataracts (ARCs) are the major cause of visual impairments worldwide, and diabetic adults tend to have an earlier onset of ARCs. Although age is the strongest risk factor for cataracts, little is known how age plays a role in the development of ARCs. It is known that oxidative stress in the lens increases with age and more so in the lenses of diabetics. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. We hypothesized that hyperglycemia will lead to a dysfunction of the Nrf2-dependent antioxidative protection in the lens of diabetics. We studied the methylation status of the CpG islands in 15 clear and 21 diabetic cataractous lenses. Our results showed significant levels of demethylated DNA in the Keap1 promoter in the cataractous lenses from diabetic patients. In contrast, highly methylated DNA was found in the clear lens and tumorized human lens epithelial cell (HLEC) lines (SRA01/04). HLECs treated with a demethylation agent, 5-aza-2′deoxycytidine (5-Aza), had a 10-fold higher levels of Keap1 mRNA, 3-fold increased levels of Keap1 protein, produced higher levels of ROS, and increased cell death. Our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which then increases the targeting of Nrf2 for proteosomal degradation. Decreased Nrf2 activity represses the
Wang, De-Shen; Patel, Atish; Shukla, Suneet; Zhang, Yun-Kai; Wang, Yi-Jun; Kathawala, Rishil J; Robey, Robert W; Zhang, Li; Yang, Dong-Hua; Talele, Tanaji T; Bates, Susan E; Ambudkar, Suresh V; Xu, Rui-Hua; Chen, Zhe-Sheng
2014-06-30
ABCG2 is a potential biomarker causing multidrug resistance (MDR) in Non-Small Cell Lung Cancer (NSCLC). We conducted this study to investigate whether Icotinib, a small-molecule inhibitor of EGFR tyrosine kinase, could interact with ABCG2 transporter in NSCLC. Our results showed that Icotinib reversed ABCG2-mediated MDR by antagonizing the drug efflux function of ABCG2. Icotinib stimulated the ATPase activity in a concentration-dependent manner and inhibited the photolabeling of ABCG2 with [125I]-Iodoarylazidoprazosin, demonstrating that it interacts at the drug-binding pocket. Homology modeling predicted the binding conformation of Icotinib at Asn629 centroid-based grid of ABCG2. However, Icotinib at reversal concentration did not affect the expression levels of AKT and ABCG2. Furthermore, a combination of Icotinib and topotecan exhibited significant synergistic anticancer activity against NCI-H460/MX20 tumor xenografts. However, the inhibition of transport activity of ABCG2 was insufficient to overcome pemetrexed resistance in NCI-H460/MX20 cells, which was due to the co-upregulated thymidylate synthase (TS) and ABCG2 expression. This is the first report to show that the up-regulation of TS in ABCG2-overexpressing cell line NCI-H460/MX20 may play a role of resistance to pemetrexate. Our findings suggested different possible strategies of overcoming the resistance of topotecan and pemetrexed in the NSCLC patients.
Directory of Open Access Journals (Sweden)
Ping Peng
Full Text Available To investigate the association of ABCG1, GALNT2 and HMGCR genes promoter DNA methylation with coronary heart disease (CHD and explore the interaction between their methylation status and the CHD patients' clinical characteristics in Han Chinese population.Methylation-specific polymerase chain reaction (MSP technology was used to examine the role of the aberrant gene promoter methylation in CHD in Han Chinese population. A total of 85 CHD patients and 54 participants without CHD confirmed by angiography were recruited. 82.8% of the participants with ABCG1 gene promoter hypermethylation have CHD, while only 17.4% of the participants without hypermethylation have it. The average age of the participants with GALNT2 gene promoter hypermethylation is 62.10 ± 8.21, while that of the participants without hypermethylation is 57.28 ± 9.87; in the former group, 75.4% of the participants have CHD, compared to only 50% in the latter group. As for the HMGCR gene, the average age of the participants with promoter hypermethylation is 63.24 ± 8.10 and that of the participants without hypermethylation is 57.79 ± 9.55; its promoter hypermethylation is likely to be related to smoking. Our results indicated a significant statistical association of promoter methylation of the ABCG1 gene with increased risk of CHD (OR = 19.966; 95% CI, 7.319-54.468; P*<0.001; P*: adjusted for age, gender, smoking, lipid level, hypertension, and diabetes. Similar results were obtained for that of the GALNT2 gene (OR = 2.978; 95% CI, 1.335-6.646; P* = 0.008, but not of HMGCR gene (OR = 1.388; 95% CI, 0.572-3.371; P* = 0.469.The present work provides evidence to support the association of promoter DNA methylation status with the risk profile of CHD. Our data indicates that promoter DNA hypermethylation of the ABCG1 and GALNT2 genes, but not the HMGCR gene, is associated with an increased risk of CHD. CHD, smoking and aging are likely to be the important factors influencing DNA
Contrasting roles of the ABCG2 Q141K variant in prostate cancer
Energy Technology Data Exchange (ETDEWEB)
Sobek, Kathryn M. [Department of Urology, University of Pittsburgh School of Medicine, Pittsburgh, PA (United States); Cummings, Jessica L. [Department of Urology, University of Pittsburgh School of Medicine, Pittsburgh, PA (United States); Department of Critical Care Medicine, University of Pittsburgh, Pittsburgh, PA (United States); Bacich, Dean J. [Department of Urology, University of Pittsburgh School of Medicine, Pittsburgh, PA (United States); Department of Urology, University of Texas Health Science Center, San Antonio, TX (United States); O’Keefe, Denise S., E-mail: OKeefeD@uthscsa.edu [Department of Urology, University of Pittsburgh School of Medicine, Pittsburgh, PA (United States); Department of Urology, University of Texas Health Science Center, San Antonio, TX (United States)
2017-05-01
ABCG2 is a membrane transport protein that effluxes growth-promoting molecules, such as folates and dihydrotestosterone, as well as chemotherapeutic agents. Therefore it is important to determine how variants of ABCG2 affect the transporter function in order to determine whether modified treatment regimens may be necessary for patients harboring ABCG2 variants. Previous studies have demonstrated an association between the ABCG2 Q141K variant and overall survival after a prostate cancer diagnosis. We report here that in patients with recurrent prostate cancer, those who carry the ABCG2 Q141K variant had a significantly shorter time to PSA recurrence post-prostatectomy than patients homozygous for wild-type ABCG2 (P=0.01). Transport studies showed that wild-type ABCG2 was able to efflux more folic acid than the Q141K variant (P<0.002), suggesting that retained tumoral folate contributes to the decreased time to PSA recurrence in the Q141K variant patients. In a seemingly conflicting study, it was previously reported that docetaxel-treated Q141K variant prostate cancer patients have a longer survival time. We found this may be due to less efficient docetaxel efflux in cells with the Q141K variant versus wild-type ABCG2. In human prostate cancer tissues, confocal microscopy revealed that all genotypes had a mixture of cytoplasmic and plasma membrane staining, with noticeably less staining in the two homozygous KK patients. In conclusion, the Q141K variant plays contrasting roles in prostate cancer: 1) by decreasing folate efflux, increased intracellular folate levels result in enhanced tumor cell proliferation and therefore time to recurrence decreases; and 2) in patients treated with docetaxel, by decreasing its efflux, intratumoral docetaxel levels and tumor cell drug sensitivity increase and therefore patient survival time increases. Taken together, these data suggest that a patient's ABCG2 genotype may be important when determining a personalized treatment
The multidrug transporter ABCG2 (BCRP) is inhibited by plant-derived cannabinoids.
Holland, M L; Lau, D T T; Allen, J D; Arnold, J C
2007-11-01
Cannabinoids are used therapeutically for the palliation of the adverse side effects associated with cancer chemotherapy. However, cannabinoids also inhibit both the activity and expression of the multidrug transporter, P-glycoprotein in vitro. Here we address the interaction of cannabinol (CBN), cannabidiol (CBD) and delta 9-tetrahydrocannabinol (THC) with the related multidrug transporter, ABCG2. Cannabinoid inhibition of Abcg2/ABCG2 was assessed using flow cytometric analysis of substrate accumulation and ATPase activity assays. The cytotoxicity and chemosensitization by cannabinoids was determined with cell viability assays. Expression of cannabinoid and vanilloid receptors was assessed using reverse transcriptase polymerase chain reaction, and cannabinoid modulation of ABCG2 expression was examined using immunoblotting. CBN, CBD and THC increased the intracellular accumulation of the Abcg2/ABCG2 substrate, mitoxantrone, in an over-expressing cell line. The THC metabolite, (-)-11-nor-9-carboxy-delta 9-THC was much less potent. The plant cannabinoids inhibited both basal and substrate stimulated ATPase activity of human ABCG2. Cannabinoid cytotoxicity occurred in the absence of known cannabinoid cell surface receptors, and only at concentrations higher than those required for Abcg2/ABCG2 inhibition. Sub-toxic concentrations of the cannabinoids resensitized the overexpressing cell line to the cytotoxic effect of Abcg2/ABCG2 substrates, mitoxantrone and topotecan. This occurred in the absence of any effect on ABCG2 expression. Cannabinoids are novel Abcg2/ABCG2 inhibitors, reversing the Abcg2-mediated multidrug-resistant phenotype in vitro. This finding may have implications for the co-administration of cannabinoids with pharmaceuticals that are ABCG2 substrates.
Role of Abcg2 During Mouse Embroyonic Stem Cell Diffferentiation
Role of Abcg2 During Mouse Embryonic Stem Cell Differentiation. Abcg2 is a multidrug resistance ATP-binding cassette (ABC) transporter whose activity may be considered a hallmark of stem cell plasticity. The role of Abcg2 during early embryogenesis, however, is unclear. Studies...
The cholesterol transporter ABCG1 links cholesterol homeostasis and tumour immunity.
Sag, Duygu; Cekic, Caglar; Wu, Runpei; Linden, Joel; Hedrick, Catherine C
2015-02-27
ATP-binding cassette transporter G1 (ABCG1) promotes cholesterol efflux from cells and regulates intracellular cholesterol homeostasis. Here we demonstrate a role of ABCG1 as a mediator of tumour immunity. Abcg1(-/-) mice have dramatically suppressed subcutaneous MB49-bladder carcinoma and B16-melanoma growth and prolonged survival. We show that reduced tumour growth in Abcg1(-/-) mice is myeloid cell intrinsic and is associated with a phenotypic shift of the macrophages from a tumour-promoting M2 to a tumour-fighting M1 within the tumour. Abcg1(-/-) macrophages exhibit an intrinsic bias towards M1 polarization with increased NF-κB activation and direct cytotoxicity for tumour cells in vitro. Overall, our study demonstrates that the absence of ABCG1 inhibits tumour growth through modulation of macrophage function within the tumour, and illustrates a link between cholesterol homeostasis and cancer.
Wang, Yu; Lin, Zhijian; Zhang, Bing; Nie, Anzheng; Bian, Meng
2017-01-01
Excessive production and/or reduced excretion of uric acid could lead to hyperuricemia, which could be a major cause of disability. Hyperuricemia has received increasing attention in the last few decades due to its global prevalence. Cichorium intybus L., commonly known as chicory, is a perennial herb of the asteraceae family. It was previously shown to exert potent hypouricemic effects linked with decreasing uric acid formation in the liver by down-regulating the activity of xanthine oxidase, and increasing uric acid excretion by up-regulating the renal OAT3 mRNA expression. The present study aimed to evaluate its extra-renal excretion and possible molecular mechanism underlying the transporter responsible for intestinal uric acid excretion in vivo. Chicory was administered intragastrically to hyperuricemic rats induced by drinking 10% fructose water. The uricosuric effect was evaluated by determining the serum uric acid level as well as the intestinal uric acid excretion by HPLC. The location and expression levels of ATP-binding cassette transporter, sub-family G, member 2 (ABCG2) in jejunum and ileum were analyzed. The administration of chicory decreased the serum uric acid level significantly and increased the intestinal uric acid excretion obviously in hyperuricemic rats induced by 10% fructose drinking. Staining showed that ABCG2 was expressed in the apical membrane of the epithelium and glands of the jejunum and ileum in rats. Further examination showed that chicory enhanced the mRNA and protein expressions of ABCG2 markedly in a dose-dependent manner in jejunum and ileum. These findings indicate that chicory increases uric acid excretion by intestines, which may be related to the stimulation of intestinal uric acid excretion via down-regulating the mRNA and protein expressions of ABCG2.
TET1 promotes cisplatin-resistance via demethylating the vimentin promoter in ovarian cancer.
Han, Xi; Zhou, Yuanyuan; You, Yuanyi; Lu, Jiaojiao; Wang, Lijie; Hou, Huilian; Li, Jing; Chen, Wei; Zhao, Le; Li, Xu
2017-04-01
The development of chemo-resistance impairs the outcome of the first line platinum-based chemotherapies for ovarian cancer. Deregulation of DNA methylation/demethylation provides a critical mechanism for the occurrence of chemo-resistance. The ten-eleven translocation (TET) family of dioxygenases including TET1/2/3 plays an important part in DNA demethylation, but their roles in cisplatin resistance have not been elucidated. Using cisplatin-sensitive and cisplatin-resistant ovarian cancer cell models, we found that TET1 was significantly upregulated in cisplatin-resistant CP70 cells compared with that in cisplatin-sensitive A2780 cells. Ectopic expression of TET1 in A2780 cells promoted cisplatin resistance and decreased cytotoxicity induced by cisplatin, while inhibition of TET1 by siRNA transfection in CP70 cells attenuated cisplatin resistance and enhanced cytotoxicity of cisplatin. Increased TET1 induced re-expression of vimentin through active DNA demethylation, and cause partial epithelial-to-mesenchymal (EMT) in A2780 cells. Contrarily, knocking down of TET1 in CP70 cells reduced vimentin expression and reversed EMT process. Immunohistochemical analysis of TET1 in human ovarian cancer tissues revealed that TET1 existed in nucleus and cytoplasm in ovarian cancer tissues. And the expression of nuclear TET1 was positively correlated with residual tumor and chemotherapeutic response. Thus, TET1 expression causes resistance to cisplatin and one of the targets of TET1 action is vimentin in ovarian cancer. © 2017 International Federation for Cell Biology.
ABCG2 inhibition as a therapeutic approach for overcoming ...
Indian Academy of Sciences (India)
2016-02-16
Feb 16, 2016 ... Breast cancer resistance protein (BCRP, ABCP or MXR)/ATP-binding cassette subfamily G member 2 (ABCG2) was characterized as a multidrug resistance efflux transporter in 1998. ABCG2 physiologically acts as a part of a self- defence mechanism for the organism; it enhances eliminating of toxic ...
ABCG2 Inhibition as a Therapeutic Approach for Overcoming ...
Indian Academy of Sciences (India)
Breast cancer resistance protein (BCRP, ABCP or MXR) / ATP-binding cassette subfamily G member 2 (ABCG2) was characterized as a multidrug resistance efflux transporter in 1998. ABCG2 physiologically acts as a part of a self-defense mechanism for the organism; it enhances eliminating of toxic xenobiotic substances ...
Tet1 and Tet2 maintain mesenchymal stem cell homeostasis via demethylation of the P2rX7 promoter.
Yang, Ruili; Yu, Tingting; Kou, Xiaoxing; Gao, Xiang; Chen, Chider; Liu, Dawei; Zhou, Yanheng; Shi, Songtao
2018-06-01
Ten-eleven translocation (Tet) family-mediated DNA oxidation represents an epigenetic modification capable of converting 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC), which regulates various biological processes. However, it is unknown whether Tet family affects mesenchymal stem cells (MSCs) or the skeletal system. Here we show that depletion of Tet1 and Tet2 results in impaired self-renewal and differentiation of bone marrow MSCs (BMMSCs) and a significant osteopenia phenotype. Tet1 and Tet2 deficiency reduces demethylation of the P2rX7 promoter and downregulates exosome release, leading to intracellular accumulation of miR-297a-5p, miR-297b-5p, and miR-297c-5p. These miRNAs inhibit Runx2 signaling to impair BMMSC function. We show that overexpression of P2rX7 rescues the impaired BMMSCs and osteoporotic phenotype in Tet1 and Tet2 double knockout mice. These results indicate that Tet1 and Tet2 play a critical role in maintaining BMMSC and bone homeostasis through demethylation of P2rX7 to control exosome and miRNA release. This Tet/P2rX7/Runx2 cascade may serve as a target for the development of novel therapies for osteopenia disorders.
ABCG2 in peptic ulcer: gene expression and mutation analysis.
Salagacka-Kubiak, Aleksandra; Żebrowska, Marta; Wosiak, Agnieszka; Balcerczak, Mariusz; Mirowski, Marek; Balcerczak, Ewa
2016-08-01
The aim of this study was to evaluate the participation of polymorphism at position C421A and mRNA expression of the ABCG2 gene in the development of peptic ulcers, which is a very common and severe disease. ABCG2, encoded by the ABCG2 gene, has been found inter alia in the gastrointestinal tract, where it plays a protective role eliminating xenobiotics from cells into the extracellular environment. The materials for the study were biopsies of gastric mucosa taken during a routine endoscopy. For genotyping by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) at position C421A, DNA was isolated from 201 samples, while for the mRNA expression level by real-time PCR, RNA was isolated from 60 patients. The control group of healthy individuals consisted of 97 blood donors. The dominant genotype in the group of peptic ulcer patients and healthy individuals was homozygous CC. No statistically significant differences between healthy individuals and the whole group of peptic ulcer patients and, likewise, between the subgroups of peptic ulcer patients (infected and uninfected with Helicobacter pylori) were found. ABCG2 expression relative to GAPDH expression was found in 38 of the 60 gastric mucosa samples. The expression level of the gene varies greatly among cases. The statistically significant differences between the intensity (p = 0.0375) of H. pylori infection and ABCG2 gene expression have been shown. It was observed that the more intense the infection, the higher the level of ABCG2 expression.
Directory of Open Access Journals (Sweden)
Jun-O Jin
Full Text Available Breast cancer resistance protein (ABCG2, a member of the ATP-binding cassette transporters has been identified as a major determinant of multidrug resistance (MDR in cancer cells, but ABC transporter inhibition has limited therapeutic value in vivo. In this research, we demonstrated that inhibition of efflux transporters ABCG2 induced the generation of tolerogenic DCs from human peripheral blood myeloid DCs (mDCs. ABCG2 expression was present in mDCs and was further increased by LPS stimulation. Treatment of CD1c+ mDCs with an ABCG2 inhibitor, Ko143, during LPS stimulation caused increased production of IL-10 and decreased production of pro-inflammatory cytokines and decreased expression of CD83 and CD86. Moreover, inhibition of ABCG2 in monocyte-derived DCs (MDDCs abrogated the up-regulation of co-stimulatory molecules and production of pro-inflammatory cytokines in these cells in response to LPS. Furthermore, CD1c+ mDCs stimulated with LPS plus Ko143 inhibited the proliferation of allogeneic and superantigen-specific syngenic CD4+ T cells and promoted expansion of CD25+FOXP3+ regulatory T (Treg cells in an IL-10-dependent fashion. These tolerogenic effects of ABCG2 inhibition could be abolished by ERK inhibition. Thus, we demonstrated that inhibition of ABCG2 in LPS-stimulated mDCs can potently induce tolerogenic potentials in these cells, providing crucial new information that could lead to development of better strategies to combat MDR cancer.
International Nuclear Information System (INIS)
Matsukura, Hiroshi; Aisaki, Ken-ichi; Igarashi, Katsuhide; Matsushima, Yuko; Kanno, Jun; Muramatsu, Masaaki; Sudo, Katsuko; Sato, Noriko
2011-01-01
Highlights: → Genistein (GEN) is a phytoestrogen found in soy products. → GEN demethylated/unsilenced the steroidogenic factor 1 gene in endometrial tissue. → GEN thus altered mRNA expression in uteri of ovariectomized (OVX) mice. → A high-resolution melting assay was used to screen for epigenetic change. → We isolated an endometrial cell clone that was epigenetically modulated by GEN. -- Abstract: It has recently been demonstrated that genistein (GEN), a phytoestrogen in soy products, is an epigenetic modulator in various types of cells; but its effect on endometrium has not yet been determined. We investigated the effects of GEN on mouse uterine cells, in vivo and in vitro. Oral administration of GEN for 1 week induced mild proliferation of the endometrium in ovariectomized (OVX) mice, which was accompanied by the induction of steroidogenic factor 1 (SF-1) gene expression. GEN administration induced demethylation of multiple CpG sites in the SF-1 promoter; these sites are extensively methylated and thus silenced in normal endometrium. The GEN-mediated promoter demethylation occurred predominantly on the luminal side, as opposed to myometrium side, indicating that the epigenetic change was mainly shown in regenerated cells. Primary cultures of endometrial stromal cell colonies were screened for GEN-mediated alterations of DNA methylation by a high-resolution melting (HRM) method. One out of 20 colony-forming cell clones showed GEN-induced demethylation of SF-1. This clone exhibited a high proliferation capacity with continuous colony formation activity through multiple serial clonings. We propose that only a portion of endometrial cells are capable of receiving epigenetic modulation by GEN.
Energy Technology Data Exchange (ETDEWEB)
Matsukura, Hiroshi, E-mail: hmatsukura.epi@mri.tmd.ac.jp [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan); Aisaki, Ken-ichi; Igarashi, Katsuhide; Matsushima, Yuko; Kanno, Jun [Division of Cellular and Molecular Toxicology, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan); Muramatsu, Masaaki [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan); Sudo, Katsuko [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan); Animal Research Center, Tokyo Medical University, 6-1-1 Shinjuku, Shinjuku-ku, Tokyo 160-8402 (Japan); Sato, Noriko, E-mail: nsato.epi@tmd.ac.jp [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan)
2011-08-26
Highlights: {yields} Genistein (GEN) is a phytoestrogen found in soy products. {yields} GEN demethylated/unsilenced the steroidogenic factor 1 gene in endometrial tissue. {yields} GEN thus altered mRNA expression in uteri of ovariectomized (OVX) mice. {yields} A high-resolution melting assay was used to screen for epigenetic change. {yields} We isolated an endometrial cell clone that was epigenetically modulated by GEN. -- Abstract: It has recently been demonstrated that genistein (GEN), a phytoestrogen in soy products, is an epigenetic modulator in various types of cells; but its effect on endometrium has not yet been determined. We investigated the effects of GEN on mouse uterine cells, in vivo and in vitro. Oral administration of GEN for 1 week induced mild proliferation of the endometrium in ovariectomized (OVX) mice, which was accompanied by the induction of steroidogenic factor 1 (SF-1) gene expression. GEN administration induced demethylation of multiple CpG sites in the SF-1 promoter; these sites are extensively methylated and thus silenced in normal endometrium. The GEN-mediated promoter demethylation occurred predominantly on the luminal side, as opposed to myometrium side, indicating that the epigenetic change was mainly shown in regenerated cells. Primary cultures of endometrial stromal cell colonies were screened for GEN-mediated alterations of DNA methylation by a high-resolution melting (HRM) method. One out of 20 colony-forming cell clones showed GEN-induced demethylation of SF-1. This clone exhibited a high proliferation capacity with continuous colony formation activity through multiple serial clonings. We propose that only a portion of endometrial cells are capable of receiving epigenetic modulation by GEN.
Hegedüs, Csilla; Truta-Feles, Krisztina; Antalffy, Géza; Várady, György; Német, Katalin; Ozvegy-Laczka, Csilla; Kéri, György; Orfi, László; Szakács, Gergely; Settleman, Jeffrey; Váradi, András; Sarkadi, Balázs
2012-08-01
Human ABCG2 is a plasma membrane glycoprotein that provides physiological protection against xenobiotics. ABCG2 also significantly influences biodistribution of drugs through pharmacological tissue barriers and confers multidrug resistance to cancer cells. Moreover, ABCG2 is the molecular determinant of the side population that is characteristically enriched in normal and cancer stem cells. Numerous tumors depend on unregulated EGFR signaling, thus inhibition of this receptor by small molecular weight inhibitors such as gefitinib, and the novel second generation agents vandetanib, pelitinib and neratinib, is a promising therapeutic option. In the present study, we provide detailed biochemical characterization regarding the interaction of these EGFR inhibitors with ABCG2. We show that ABCG2 confers resistance to gefitinib and pelitinib, whereas the intracellular action of vandetanib and neratinib is unaltered by the presence of the transporter. At higher concentrations, however, all these EGFR inhibitors inhibit ABCG2 function, thereby promoting accumulation of ABCG2 substrate drugs. We also report enhanced expression of ABCG2 in gefitinib-resistant non-small cell lung cancer cells, suggesting potential clinical relevance of ABCG2 in acquired drug resistance. Since ABCG2 has important impact on both the pharmacological properties and anti-cancer efficiencies of drugs, our results regarding the novel EGFR inhibitors should provide useful information about their therapeutic applicability against ABCG2-expressing cancer cells depending on EGFR signaling. In addition, the finding that these EGFR inhibitors efficiently block ABCG2 function may help to design novel drug-combination therapeutic strategies. Copyright © 2012 Elsevier Inc. All rights reserved.
Haider, Ameena J; Cox, Megan H; Jones, Natalie; Goode, Alice J; Bridge, Katherine S; Wong, Kelvin; Briggs, Deborah; Kerr, Ian D
2015-07-17
ABCG2 is an ABC (ATP-binding cassette) transporter with a physiological role in urate transport in the kidney and is also implicated in multi-drug efflux from a number of organs in the body. The trafficking of the protein and the mechanism by which it recognizes and transports diverse drugs are important areas of research. In the current study, we have made a series of single amino acid mutations in ABCG2 on the basis of sequence analysis. Mutant isoforms were characterized for cell surface expression and function. One mutant (I573A) showed disrupted glycosylation and reduced trafficking kinetics. In contrast with many ABC transporter folding mutations which appear to be 'rescued' by chemical chaperones or low temperature incubation, the I573A mutation was not enriched at the cell surface by either treatment, with the majority of the protein being retained in the endoplasmic reticulum (ER). Two other mutations (P485A and M549A) showed distinct effects on transport of ABCG2 substrates reinforcing the role of TM helix 3 in drug recognition and transport and indicating the presence of intracellular coupling regions in ABCG2. © 2015 Authors.
[Construction and identification of eukaryotic plasmid pGC-silencer-U6/Neo/GFP/ABCG2].
Yu, Yanping; Zhang, Song; Kong, Weijia
2010-09-01
To construct three short hairpin RNA (shRNA) interference expression plasmid vectors of human ABCG2 gene, to assay the expression of ABCG2 in a human nasopharyngeal carcinoma (NPC) cell line, CEN-2 cell line, and to detect the RNAi effect of shRNA. Targeting ABCG2 gene sequence, three plasmid expression vectors coding for shRNA and a control vector containing random DNA fragment were constructed. The recombinant plasmids were amplified in Ecoli. DH5 and then identified by restriction digestion, PCR and sequencing. The recombinant plasmids were transfected into CEN-2 cells. ABCG2 expression was assayed by real-time quantitative PCR and Western blot. The construction of pGC-silencer-U6/Neo/GFP/ABCG2 was succeed. The shRNA plasmids significantly down-regulated the ABCG2 expression in CEN-2 cells, at both mRNA level and protein level. Recombinant plasmid 1 had the strongest effect compared with plasmids 2 and 3 (P < 0.05), with an inhibition ratio of 75% at the mRNA level and 68% at the protein level. pGC-silencer-U6/Neo/GFP/ABCG2 has been successfully constructed and it can down-regulate ABCG2 expression after transfected into CEN-2 cells, which could help further studies of ABCG2 functions CEN-2 cell line and contribute to the NPC gene therapy.
Directory of Open Access Journals (Sweden)
Guang Zhang
2013-01-01
Full Text Available Background. Despite improvement in treatment, the prognosis of hepatocellular carcinoma (HCC remains disastrous. Cancer stem cells (CSCs may be responsible for cancer malignant behaviors. ATP-binding cassette, subfamily G, member 2 (ABCG2 is widely expressed in both normal and cancer stem cells and may play an important role in cancer malignant behaviors. Methods. The expression of ABCG2 in HCC tissues and SMMC-7721 cells was examined, and the relevance of ABCG2 expression with clinical characteristics was analyzed. ABCG2+ and ABCG2− cells were sorted, and the potential of tumorigenicity was determined. Expression level of ABCG2 was manipulated by RNA interference and overexpression. Malignant behaviors including proliferation, drug resistance, migration, and invasion were studied in vitro. Results. Expression of ABCG2 was found in a minor group of cells in HCC tissues and cell lines. ABCG2 expression showed tendencies of association with unfavorable prognosis factors. ABCG2 positive cells showed a superior tumorigenicity. Upregulation of ABCG2 enhanced the capacity of proliferation, doxorubicin resistance, migration, and invasion potential, while downregulation of ABCG2 significantly decreased these malignant behaviors. Conclusion. Our results indicate that ABCG2 is a potential CSC marker for HCC. Its expression level has a close relationship with tumorigenicity, proliferation, drug resistance, and metastasis ability.
Implications of ABCG2 Expression on Irinotecan Treatment of Colorectal Cancer Patients
DEFF Research Database (Denmark)
Nielsen, Dorte Lisbet; Palshof, Jesper Andreas; Bruenner, Nils
2017-01-01
Background: One of the main chemotherapeutic drugs used on a routine basis in patients with metastatic colorectal cancer ((m)CRC) is the topoisomerase-1 inhibitor, irinotecan. However, its usefulness is limited by the pre-existing or inevitable development of resistance. The ATP-binding cassette...... to irinotecan treatment in CRC patients. Results: Few studies have evaluated the association between ABCG2 gene or protein expression and prognosis in CRC patients. Discordant results were reported. The discrepancies might be explained by the use of different criteria for interpretation of results...... (ABC) transporter ABCG2/breast cancer resistance protein (BRCP) through its function in xenobiotic clearance might play an important role in irinotecan resistance. With a goal to evaluate the clinical significance of ABCG2 measurements, we here review the current literature on ABCG2 in relation...
Expressions of ABCG2, CD133, and Podoplanin in Salivary Adenoid Cystic Carcinoma
Directory of Open Access Journals (Sweden)
Wuwei Li
2014-01-01
Full Text Available Adenoid cystic carcinoma (ACC is one of the most common salivary gland malignant tumors with a high risk of recurrence and metastasis. Current studies on cancer stem cells (CSCs have verified that CSCs are the driving force behind tumor initiation and progression, suggesting that new cancer therapies may be established by effectively targeting and killing the CSCs. The primary goal of this study is to investigate the expression patterns of ABCG2, CD133, and podoplanin in ACC of minor salivary glands by immunohistochemistry analysis. We found that ABCG2 was weakly expressed in normal looking salivary gland tissues. A significant upregulation of ABCG2 expression in ACC was observed with a similar expression pattern of Ki-67. CD133 was detected in apical membrane of epithelial cells and podoplanin was expressed positively in myoepithelial cells of both normal looking tissue and ACC. However, no significant difference was found of the expression pattern of CD133 and podoplanin between normal looking tissues and ACC. Our observations suggest that CSCs may exist in quiescent cells with ABCG2 positive staining, which are surrounded by cells with positive expression of ABCG2 and Ki-67 in ACC, and costaining with ABCG2 and Ki-67 may help predict the location of CSCs.
Hedgehog Pathway Inhibitor HhAntag691 Is a Potent Inhibitor of ABCG2/BCRP and ABCB1/Pgp
Directory of Open Access Journals (Sweden)
Yimao Zhang
2009-01-01
Full Text Available HhAntag691 (GDC-0449, a low-molecular weight inhibitor of the tumor-promoting hedgehog (Hh signaling pathway, has been used to treat medulloblastoma in animal models and has recently entered clinical trials for a variety of solid tumors. Here, we show that HhAntag691 inhibits multiple ATP-binding cassette (ABC transporters. ATP-binding cassette transporters are within a family of membrane proteins, the overexpression of which is associated with multidrug resistance, a major impediment to successful cancer treatment. HhAntag691 is a potent inhibitor of two ABC transporters, ABCG2/BCRP and ABCB1/Pgp, and is a mild inhibitor of ABCC1/MRP1. In ABCG2-overexpressing HEK293 cells, HhAntag691 increased retention of the fluorescent ABCG2 substrate BODIPY-prazosin and resensitized these cells to mitoxantrone, an antineoplastic ABCG2 substrate. In Madin-Darby canine kidney II cells engineered to overexpress Pgp or MRP1, HhAntag691 increased the retention of calcein-AM and resensitized them to colchicine. HhAntag691 also resensitized human non-small cell lung carcinoma cells NCI-H460/par and NCI-H460/MX20, which overexpress ABCG2 in response to mitoxantrone, to mitoxantrone, and to topotecan or SN-38. The IC50 values of HhAntag691 for inhibition of ABCG2 and Pgp were ∼1.4 and ∼3.0 µM, respectively. Because ABC transporters are highly expressed at the blood-brain barrier and on many tumor cells, they contribute significantly to treatment failure of many types of cancer, particularly of those within the neuraxis. In addition to its effect on Hh signaling, the ability of HhAntag691 and related compounds to inhibit two key ABC transporters could contribute to their effectiveness in treating malignancies.
Functional non-synonymous variants of ABCG2 and gout risk.
Stiburkova, Blanka; Pavelcova, Katerina; Zavada, Jakub; Petru, Lenka; Simek, Pavel; Cepek, Pavel; Pavlikova, Marketa; Matsuo, Hirotaka; Merriman, Tony R; Pavelka, Karel
2017-11-01
Common dysfunctional variants of ATP binding cassette subfamily G member 2 (Junior blood group) (ABCG2), a high-capacity urate transporter gene, that result in decreased urate excretion are major causes of hyperuricemia and gout. In the present study, our objective was to determine the frequency and effect on gout of common and rare non-synonymous and other functional allelic variants in the ABCG2 gene. The main cohort recruited from the Czech Republic consisted of 145 gout patients; 115 normouricaemic controls were used for comparison. We amplified, directly sequenced and analysed 15 ABCG2 exons. The associations between genetic variants and clinical phenotype were analysed using the t-test, Fisher's exact test and a logistic and linear regression approach. Data from a New Zealand Polynesian sample set and the UK Biobank were included for the p.V12M analysis. In the ABCG2 gene, 18 intronic (one dysfunctional splicing) and 11 exonic variants were detected: 9 were non-synonymous (2 common, 7 rare including 1 novel), namely p.V12M, p.Q141K, p.R147W, p.T153M, p.F373C, p.T434M, p.S476P, p.D620N and p.K360del. The p.Q141K (rs2231142) variant had a significantly higher minor allele frequency (0.23) in the gout patients compared with the European-origin population (0.09) and was significantly more common among gout patients than among normouricaemic controls (odds ratio = 3.26, P gout (42 vs 48 years, P = 0.0143) and a greater likelihood of a familial history of gout (41% vs 27%, odds ratio = 1.96, P = 0.053). In a meta-analysis p.V12M exerted a protective effect from gout (P gout. Non-synonymous allelic variants of ABCG2 had a significant effect on earlier onset of gout and the presence of a familial gout history. ABCG2 should thus be considered a common and significant risk factor for gout. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Directory of Open Access Journals (Sweden)
Anne Ripperger
2018-05-01
Full Text Available The ATP-binding cassette transporter ABCG2 (BCRP and MXR is involved in the absorption, distribution, and elimination of numerous drugs. Thus, drugs that are able to reduce the activity of ABCG2, e.g., antihypertensive AT1 receptor antagonists (ARBs, may cause drug-drug interactions and compromise drug safety and efficacy. In addition, genetic variability within the ABCG2 gene may influence the ability of the transporter to interact with ARBs. Thus, the aim of this study was to characterize the ARB-ABCG2 interaction in the light of naturally occurring variations (F489L, R482G or amino acid substitutions with in silico-predicted relevance for the ARB-ABCG2 interaction (Y469A; M483F; Y570A. For this purpose, ABCG2 variants were expressed in HEK293 cells and the impact of ARBs on ABCG2 activity was studied in vitro using the pheophorbide A (PhA efflux assay. First, we demonstrated that both the F489L and the Y469A substitution, respectively, reduced ABCG2 protein levels in these cells. Moreover, both substitutions enhanced the inhibitory effect of candesartan cilexetil, irbesartan, losartan, and telmisartan on ABCG2-mediated PhA efflux, whereas the R482G substitution blunted the inhibitory effect of candesartan cilexetil and telmisartan in this regard. In contrast, the ARB-ABCG2 interaction was not altered in cells expressing either the M483F or the Y570A variant, respectively. In conclusion, our data indicate that the third transmembrane helix and adjacent regions of ABCG2 may be of major importance for the interaction of ARBs with the ABC transporter. Moreover, we conclude from our data that individuals carrying the F489L polymorphism may be at increased risk of developing ABCG2-related drug-drug interactions in multi-drug regimens involving ARBs.
Structural basis of small-molecule inhibition of human multidrug transporter ABCG2
DEFF Research Database (Denmark)
Jackson, Scott M; Manolaridis, Ioannis; Kowal, Julia
2018-01-01
requires high-resolution structural insight. Here, we present cryo-EM structures of human ABCG2 bound to synthetic derivatives of the fumitremorgin C-related inhibitor Ko143 or the multidrug resistance modulator tariquidar. Both compounds are bound to the central, inward-facing cavity of ABCG2, blocking...
International Nuclear Information System (INIS)
Halwachs, Sandra; Schäfer, Ingo; Kneuer, Carsten; Seibel, Peter; Honscha, Walther
2016-01-01
In humans, the ATP-binding cassette efflux transporter ABCG2 contributes to the fetoprotective barrier function of the placenta, potentially limiting the toxicity of transporter substrates to the fetus. During testing of chemicals including pesticides, developmental toxicity studies are performed in rabbit. Despite its toxicological relevance, ABCG2-mediated transport of pesticides in rabbit placenta has not been yet elucidated. We therefore generated polarized MDCK II cells expressing the ABCG2 transporter from rabbit placenta (rbABCG2) and evaluated interaction of the efflux transporter with selected insecticides, fungicides, and herbicides. The Hoechst H33342 accumulation assay indicated that 13 widely used pesticidal active substances including azoxystrobin, carbendazim, chlorpyrifos, chlormequat, diflufenican, dimethoate, dimethomorph, dithianon, ioxynil, methiocarb, propamocarb, rimsulfuron and toclofos-methyl may be rbABCG2 inhibitors and/or substrates. No such evidence was obtained for chlorpyrifos-methyl, epoxiconazole, glyphosate, imazalil and thiacloprid. Moreover, chlorpyrifos (CPF), dimethomorph, tolclofos-methyl and rimsulfuron showed concentration-dependent inhibition of H33342 excretion in rbABCG2-transduced MDCKII cells. To further evaluate the role of rbABCG2 in pesticide transport across the placenta barrier, we generated polarized MDCKII-rbABCG2 monolayers. Confocal microscopy confirmed correct localization of rbABCG2 protein in the apical plasma membrane. In transepithelial flux studies, we showed the time-dependent preferential basolateral to apical (B > A) directed transport of [ 14 C] CPF across polarized MDCKII-rbABCG2 monolayers which was significantly inhibited by the ABCG2 inhibitor fumitremorgin C (FTC). Using this novel in vitro cell culture model, we altogether showed functional secretory activity of the ABCG2 transporter from rabbit placenta and identified several pesticides like the insecticide CPF as potential rbABCG2 substrates
Energy Technology Data Exchange (ETDEWEB)
Halwachs, Sandra [Institute of Pharmacology, Pharmacy and Toxicology, Faculty of Veterinary Medicine, Universität Leipzig, Leipzig (Germany); Schäfer, Ingo [Molecular Cell Therapy, Center for Biotechnology and Biomedicine, Faculty of Medicine, Universität Leipzig, Leipzig (Germany); Kneuer, Carsten [Federal Institute for Risk Assessment (BfR), Pesticide Safety, Max-Dohrn-Straße 8-10, D-10589 Berlin (Germany); Seibel, Peter [Molecular Cell Therapy, Center for Biotechnology and Biomedicine, Faculty of Medicine, Universität Leipzig, Leipzig (Germany); Honscha, Walther, E-mail: honscha@vetmed.uni-leipzig.de [Institute of Pharmacology, Pharmacy and Toxicology, Faculty of Veterinary Medicine, Universität Leipzig, Leipzig (Germany)
2016-08-15
In humans, the ATP-binding cassette efflux transporter ABCG2 contributes to the fetoprotective barrier function of the placenta, potentially limiting the toxicity of transporter substrates to the fetus. During testing of chemicals including pesticides, developmental toxicity studies are performed in rabbit. Despite its toxicological relevance, ABCG2-mediated transport of pesticides in rabbit placenta has not been yet elucidated. We therefore generated polarized MDCK II cells expressing the ABCG2 transporter from rabbit placenta (rbABCG2) and evaluated interaction of the efflux transporter with selected insecticides, fungicides, and herbicides. The Hoechst H33342 accumulation assay indicated that 13 widely used pesticidal active substances including azoxystrobin, carbendazim, chlorpyrifos, chlormequat, diflufenican, dimethoate, dimethomorph, dithianon, ioxynil, methiocarb, propamocarb, rimsulfuron and toclofos-methyl may be rbABCG2 inhibitors and/or substrates. No such evidence was obtained for chlorpyrifos-methyl, epoxiconazole, glyphosate, imazalil and thiacloprid. Moreover, chlorpyrifos (CPF), dimethomorph, tolclofos-methyl and rimsulfuron showed concentration-dependent inhibition of H33342 excretion in rbABCG2-transduced MDCKII cells. To further evaluate the role of rbABCG2 in pesticide transport across the placenta barrier, we generated polarized MDCKII-rbABCG2 monolayers. Confocal microscopy confirmed correct localization of rbABCG2 protein in the apical plasma membrane. In transepithelial flux studies, we showed the time-dependent preferential basolateral to apical (B > A) directed transport of [{sup 14}C] CPF across polarized MDCKII-rbABCG2 monolayers which was significantly inhibited by the ABCG2 inhibitor fumitremorgin C (FTC). Using this novel in vitro cell culture model, we altogether showed functional secretory activity of the ABCG2 transporter from rabbit placenta and identified several pesticides like the insecticide CPF as potential rbABCG2
Zhang, Lanfang; Guo, Xiaohe; Zhang, Dezhong; Fan, Yingying; Qin, Lei; Dong, Shuping; Zhang, Lanfang
2017-09-01
Cisplatin resistance has long been a major problem that restricts its use. A novel paradigm in tumor biology suggests that gastric tumor chemo-resistance is driven by gastric cancer stem cell-like (GCSCs). Growing evidence has indicated that microRNAs (miRNAs) contributes to chemo-resistance in gastric cancer (GC). Here, Lgr5 + cells derived from gastric cancer cell lines displayed stem cell-like features. Flow cytometry demonstrated the presence of a variable fraction of Lgr5 in 19 out of 20 GC specimens. By comparing the miRNA expression profiles of Lgr5 + GCSCs and Lrg5 - cells, we established the upregulation of miR-132 in Lgr5 + GCSCs. The enhanced miR-132 expression correlated chemo-resistance in GC patients. Kaplan-Meier survival curve showed that patients with low miR-132 expression survived obviously longer. Functional assays results indicated that miR-132 promoted cisplatin resistance in Lgr5 + GCSCs in vitro and in vivo. Further dual-luciferase reporter gene assays revealed that SIRT1 was the direct target of miR-132. The expression of miR-132 was inversely correlated with SIRT1 in gastric cancer specimens. Furthermore, through PCR array we discovered ABCG2 was one of the downstream targets of SIRT1. Overexpression of SIRT1 down-regulated ABCG2 expression by promoting the de-acetylation of the transcription factor CREB. CREB was further activated ABCG2 via binding to the promoter of ABCG2 to induce transcription. Thus, we concluded that miR-132 regulated SIRT1/CREB/ABCG2 signaling pathway contributing to the cisplatin resistance and might serve as a novel therapeutic target against gastric cancer. © 2017 Wiley Periodicals, Inc.
Abcg5/Abcg8-independent pathways contribute to hepatobiliary cholesterol secretion in mice
Plosch, Torsten; van der Veen, Jelske N.; Havinga, Rick; Huijkman, Nicolette C. A.; Bloks, Vincent W.; Kuipers, Folkert
The ATP-binding cassette (ABC) half-transporters ABCG5 and ABCG8 heterodimerize into a functional complex that mediates the secretion of plant sterols and cholesterol by hepatocytes into bile and their apical efflux from enterocytes. We addressed the putative rate-controlling role of Abcg5/Abcg8 in
Effect of ABCG2/BCRP Expression on Efflux and Uptake of Gefitinib in NSCLC Cell Lines.
Directory of Open Access Journals (Sweden)
Maricla Galetti
Full Text Available BCRP/ABCG2 emerged as an important multidrug resistance protein, because it confers resistance to several classes of cancer chemotherapeutic agents and to a number of novel molecularly-targeted therapeutics such as tyrosine kinase inhibitors. Gefitinib is an orally active, selective EGFR tyrosine kinase inhibitor used in the treatment of patients with advanced non small cell lung cancer (NSCLC carrying activating EGFR mutations. Membrane transporters may affect the distribution and accumulation of gefitinib in tumour cells; in particular a reduced intracellular level of the drug may result from poor uptake, enhanced efflux or increased metabolism.The present study, performed in a panel of NSCLC cell lines expressing different ABCG2 plasma membrane levels, was designed to investigate the effect of the efflux transporter ABCG2 on intracellular gefitinib accumulation, by dissecting the contribution of uptake and efflux processes.Our findings indicate that gefitinib, in lung cancer cells, inhibits ABCG2 activity, as previously reported. In addition, we suggest that ABCG2 silencing or overexpression affects intracellular gefitinib content by modulating the uptake rather than the efflux. Similarly, overexpression of ABCG2 affected the expression of a number of drug transporters, altering the functional activities of nutrient and drug transport systems, in particular inhibiting MPP, glucose and glutamine uptake.Therefore, we conclude that gefitinib is an inhibitor but not a substrate for ABCG2 and that ABCG2 overexpression may modulate the expression and activity of other transporters involved in the uptake of different substrates into the cells.
Functional characterization of the human multidrug transporter, ABCG2, expressed in insect cells
DEFF Research Database (Denmark)
Ozvegy, C.; Litman, Thomas; Szakacs, G.
2001-01-01
ABCG2 (also called MXR (3), BCRP (4), or ABCP (5) is a recently-identified ABC half-transporter, which causes multidrug resistance in cancer. Here we report that the expression of the ABCG2 protein in Sf9 insect cells resulted in a high-capacity, vanadate-sensitive ATPase activity in isolated...
ROLE OF ATP BINDING CASSETTE SUB-FAMILY MEMBER 2 (ABCG2) IN MOUSE EMBRYONIC STEM CELL DEVELOPMENT.
ATP binding cassette sub-family member 2 (ABCG2), is a member of the ABC transporter superfamily and a principal xenobiotic transporter. ABCG2 is also highly expressed in certain stem cell populations where it is thought to be related to stem cell plasticity, although the role o...
Elferink, Ronald P. J. Oude; Ottenhoff, Roelof; Fricker, Gert; Seward, David J.; Ballatori, Nazzareno; Boyer, James
2004-01-01
The ABC transporters bile salt export pump ( BSEP; encoded by the ABCB11 gene), MDR3 P-glycoprotein (ABCB4), and sterolin 1 and 2 (ABCG5 and ABCG8) are crucial for the excretion of bile salt, phospholipid, and cholesterol, respectively, into the bile of mammals. The current paradigm is that
DNA demethylation upregulated Nrf2 expression in Alzheimer's disease cellular model
Directory of Open Access Journals (Sweden)
Huimin eCao
2016-01-01
Full Text Available Nuclear factor erythroid 2-related factor 2 (Nrf2 is an important transcription factor in the defense against oxidative stress. Cumulative evidence has shown that oxidative stress plays a key role in the pathogenesis of Alzheimer's disease (AD. Previous animal and clinical studies had observed decreased expression of Nrf2 in AD. However, the underlying regulation mechanisms of Nrf2 in AD remain unclear. Here, we used the DNA methyltransferases (Dnmts inhibitor 5-aza-2′-deoxycytidine (5-Aza to test whether Nrf2 expression was regulated by methylation in N2a cells characterizing by expressing human Swedish mutant amyloid precursor protein (N2a/APPswe. We found 5-Aza treatment increased Nrf2 at both mRNA and protein levels via down-regulating the expression of Dnmts and DNA demethylation. In addition, 5-Aza mediated upregulation of Nrf2 expression was concomitant with increased nuclear translocation of Nrf2 and higher expression of Nrf2 downstream target gene NAD(PH:quinone oxidoreductas (NQO1. Our study showed that DNA demethylation promoted the Nrf2 cell signaling pathway, which may enhance the antioxidant system against AD development.
The structure of the human ABC transporter ABCG2 reveals a novel mechanism for drug extrusion.
Khunweeraphong, Narakorn; Stockner, Thomas; Kuchler, Karl
2017-10-23
The human ABC transporter ABCG2 (Breast Cancer Resistance Protein, BCRP) is implicated in anticancer resistance, in detoxification across barriers and linked to gout. Here, we generate a novel atomic model of ABCG2 using the crystal structure of ABCG5/G8. Extensive mutagenesis verifies the structure, disclosing hitherto unrecognized essential residues and domains in the homodimeric ABCG2 transporter. The elbow helix, the first intracellular loop (ICL1) and the nucleotide-binding domain (NBD) constitute pivotal elements of the architecture building the transmission interface that borders a central cavity which acts as a drug trap. The transmission interface is stabilized by salt-bridge interactions between the elbow helix and ICL1, as well as within ICL1, which is essential to control the conformational switch of ABCG2 to the outward-open drug-releasing conformation. Importantly, we propose that ICL1 operates like a molecular spring that holds the NBD dimer close to the membrane, thereby enabling efficient coupling of ATP hydrolysis during the catalytic cycle. These novel mechanistic data open new opportunities to therapeutically target ABCG2 in the context of related diseases.
Chua, Vivian Y L; Larma, Irma; Harvey, Jennet; Thomas, Marc A; Bentel, Jacqueline M
2016-10-01
Elevated expression of the efflux transporter, ATP-binding cassette subfamily G isoform 2 (ABCG2) on the plasma membrane of cancer cells contributes to the development of drug resistance and is a key characteristic of cancer stem cells. In this study, gene expression analysis identified that treatment of the MCF-7 and T-47D breast cancer cell lines with the androgen, 5α-dihydrotestosterone (DHT), and the Hedgehog signaling inhibitor, cyclopamine downregulated ABCG2 mRNA levels. In MCF-7 cells, and in Hoechst 33342(lo) /CD44(hi) /CD24(lo) breast cancer stem-like cells isolated from MCF-7 cultures, ABCG2 was accumulated in cell-to-cell junction complexes and in large cytoplasmic aggresome-like vesicles. DHT treatments, which decreased cellular ABCG2 protein levels, led to diminished ABCG2 localization in both cell-to-cell junction complexes and in cytoplasmic vesicles. In contrast, cyclopamine, which did not alter ABCG2 protein levels, induced accumulation of ABCG2 in cytoplasmic vesicles, reducing its localization in cell-to-cell junction complexes. The reduced localization of ABCG2 at the plasma membrane of MCF-7 cells was associated with decreased efflux of the ABCG2 substrate, mitoxantrone, and increased sensitivity of cyclopamine-treated cultures to the cytotoxic effects of mitoxantrone. Together, these findings indicate that DHT and cyclopamine reduce ABCG2 activity in breast cancer cells by distinct mechanisms, providing evidence to advocate the adjunct use of analogous pharmaceutics to increase or prolong the efficacy of breast cancer treatments. J. Cell. Biochem. 117: 2249-2259, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Choi, Jee-Hye; Min, Na Young; Park, Jina; Kim, Jin Hong; Park, Soo Hyun; Ko, Young Jong; Kang, Yoonsung; Moon, Young Joon; Rhee, Sangmyung; Ham, Seung Wook; Park, Ae Ja; Lee, Kwang-Ho
2010-01-01
Trichostatin A (TSA), an inhibitor of histone deacetylase, is a well-known antitumor agent that effectively and selectively induces tumor growth arrest and apoptosis. Recently, it was reported that hTERT is one of the primary targets for TSA-induced apoptosis in cancer cells but the mechanism of which has not yet been elucidated. In the present study, to better understand the epigenetic regulation mechanism responsible for the repression of hTERT by TSA, we examined expression of hTERT in the HCT116 colon cancer cell line after treatment with TSA and performed site-specific CpG methylation analysis of the hTERT promoter. We found that TSA-induced the demethylation of site-specific CpGs on the promoter of hTERT, which was caused by down-regulation of DNA methyltransferase 1 (DNMT1). Among the demethylated region, the 31st-33rd CpGs contained a binding site for CTCF, an inhibitor of hTERT transcription. ChIP analysis revealed that TSA-induced demethylation of the 31st-33rd CpGs promoted CTCF binding on hTERT promoter, leading to repression of hTERT. Taken together, down-regulation of DNMT1 by TSA caused demethylation of a CTCF binding site on the hTERT promoter, the result of which was repression of hTERT via recruitment of CTCF to the promoter. Copyright 2009 Elsevier Inc. All rights reserved.
Zhang, Yun-Kai; Zhang, Guan-Nan; Wang, Yi-Jun; Patel, Bhargav A.; Talele, Tanaji T.; Yang, Dong-Hua; Chen, Zhe-Sheng
2016-05-01
ATP-Binding Cassette transporters are involved in the efflux of xenobiotic compounds and are responsible for decreasing drug accumulation in multidrug resistant (MDR) cells. Discovered by structure-based virtual screening algorithms, bafetinib, a Bcr-Abl/Lyn tyrosine kinase inhibitor, was found to have inhibitory effects on both ABCB1- and ABCG2-mediated MDR in this in-vitro investigation. Bafetinib significantly sensitized ABCB1 and ABCG2 overexpressing MDR cells to their anticancer substrates and increased the intracellular accumulation of anticancer drugs, particularly doxorubicin and [3H]-paclitaxel in ABCB1 overexpressing cells; mitoxantrone and [3H]-mitoxantrone in ABCG2 overexpressing cells, respectively. Bafetinib stimulated ABCB1 ATPase activities while inhibited ABCG2 ATPase activities. There were no significant changes in the expression level or the subcellular distribution of ABCB1 and ABCG2 in the cells exposed to 3 μM of bafetinib. Overall, our study indicated that bafetinib reversed ABCB1- and ABCG2-mediated MDR by blocking the drug efflux function of these transporters. These findings might be useful in developing combination therapy for MDR cancer treatment.
Localization of the ABCG2 mitoxantrone resistance-associated protein in normal tissues
DEFF Research Database (Denmark)
Fetsch, Patricia A; Abati, Andrea; Litman, Thomas
2006-01-01
was consistently found in alveolar pneumocytes, sebaceous glands, transitional epithelium of bladder, interstitial cells of testes, prostate epithelium, endocervical cells of uterus, squamous epithelium of cervix, small and large intestinal mucosa/epithelial cells, islet and acinar cells of pancreas, zona...... ABCG2 have a significant secretory function. These data suggest a dual function for ABCG2 in some tissues: the excretion of toxins and xenobiotics including anti-cancer agents and a potential, as-yet undefined role in the secretion of endogenous substrates....
ABCG2 inhibition as a therapeutic approach for overcoming
Indian Academy of Sciences (India)
2016-02-16
Feb 16, 2016 ... the permeability of multi-protein channel complexes. (receptors) .... ABCG2 overexpression is likely to be the cause of high- ... with low or absent function. ..... derivatives, is a water-soluble topoisomerase I inhibitor that.
DEFF Research Database (Denmark)
Henriksen, Ulla Birk; Fog, Jacob U; Litman, Thomas
2005-01-01
cysteines predicted to be on the extracellular face of ABCG2. Upon mutation of Cys-592 or Cys-608 to alanine (C592A and C608A), ABCG2 migrated as a dimer in SDS-PAGE under non-reducing conditions; however, mutation of Cys-603 to Ala (C603A) caused the transporter to migrate as a single monomeric band....... Despite this change, C603A displayed efficient membrane targeting and preserved transport function. Because the transporter migrated as a dimer in SDS-PAGE, when only Cys-603 was present (C592A-C608A), the data suggest that Cys-603 forms a symmetrical intermolecular disulfide bridge in the ABCG2 homodimer...
Population-specific association between ABCG2 variants and tophaceous disease in people with gout.
He, Wendy; Phipps-Green, Amanda; Stamp, Lisa K; Merriman, Tony R; Dalbeth, Nicola
2017-03-07
Tophi contribute to musculoskeletal disability, joint damage and poor health-related quality of life in people with gout. The aim of this study was to examine the role of SLC2A9 and ABCG2 variants in tophaceous disease in people with gout. Participants (n = 1778) with gout fulfilling the 1977 American Rheumatism Association (ARA) classification criteria, who were recruited from primary and secondary care, attended a detailed study visit. The presence of palpable tophi was recorded. SLC2A9 rs11942223, ABCG2 rs2231142 and ABCG2 rs10011796 were genotyped. Data were analysed according to tophus status. Compared to participants without tophi, those with tophi were older, had longer disease duration and higher serum creatinine, and were more likely to be of Māori or Pacific (Polynesian) ancestry. SLC2A9 rs11942223 was not associated with tophi. However, the risk alleles for both ABCG2 single nucleotide polymorphisms (SNPs) were present more frequently in those with tophi (OR (95% CI) 1.24 (1.02-1.51) for rs2231142 and 1.33 (1.01-1.74) for rs10011796, p gout.
Spatial control of protein phosphatase 2A (de)methylation
International Nuclear Information System (INIS)
Longin, Sari; Zwaenepoel, Karen; Martens, Ellen; Louis, Justin V.; Rondelez, Evelien; Goris, Jozef; Janssens, Veerle
2008-01-01
Reversible methylation of the protein phosphatase 2A catalytic subunit (PP2A C ) is an important regulatory mechanism playing a crucial role in the selective recruitment of regulatory B subunits. Here, we investigated the subcellular localization of leucine carboxyl methyltransferase (LCMT1) and protein phosphatase methylesterase (PME-1), the two enzymes catalyzing this process. The results show that PME-1 is predominantly localized in the nucleus and harbors a functional nuclear localization signal, whereas LCMT1 is underrepresented in the nucleus and mainly localizes to the cytoplasm, Golgi region and late endosomes. Indirect immunofluorescence with methylation-sensitive anti-PP2A C antibodies revealed a good correlation with the methylation status of PP2A C , demethylated PP2A C being substantially nuclear. Throughout mitosis, demethylated PP2A C is associated with the mitotic spindle and during cytokinesis with the cleavage furrow. Overexpression of PME-1, but not of an inactive mutant, results in increased demethylation of PP2A C in the nucleus, whereas overexpression of a cytoplasmic PME-1 mutant lacking the NLS results in increased demethylation in the cytoplasm-in all cases, however, without any obvious functional consequences. PME-1 associates with an inactive PP2A population, regardless of its esterase activity or localization. We propose that stabilization of this inactive, nuclear PP2A pool is a major in vivo function of PME-1
Correlation of HIF-2α, ABCG2 and OCT-4 with chemotherapy resistance in human gastric cancer
Directory of Open Access Journals (Sweden)
Hong-mei ZHANG
2015-11-01
Full Text Available Objective To investigate the correlation of HIF-2α, ABCG2 and OCT-4 with chemotherapy resistant gastric cancer in humans. Methods Fifty-two patients who were confirmed to have advanced gastric cancer with the aid of electronic endoscopy and pathology in the Department of Gastroenterology, Affiliated Hospital of Weifang Medical College, were enrolled in the study. According to the effect of FOL-FOX4 chemotherapy that these patients had experienced, they were divided into three groups: CR+PR (complete remission+partial remission group, SD (stable disease group and PD (progressive disease group. The expression levels of HIF-2α, ABCG2, and OCT-4 mRNA and protein were assessed in different groups by using RT-PCR and immunocytochemistry. Results Two patients achieved CR , 19 achieved PR , 25 showed SD, and 6 showed PD. In other words, CR+PR were seen in 21 patients (40.4%, SD in 25(48.1%, PD in 6(11.5%. In CR+PR group, the expression levels of HIF-2α, ABCG2 and OCT4 mRNA and protein were low, but the above mentioned expressions were significantly increased in SD group and PD group. The expression levels of HIF-2α, ABCG2 and Oct-4 mRNA and protein were highest in the PD group, lower in the SD group, and lowest in the CR + PR groups (all P<0.05. Conclusions The expression of the markers HIF-2α, ABCG2 and OCT4 in human tumor tissues is related to the effect of chemotherapy for gastric cancer. A high expression of tumor markers is perhaps the main reason for low efficacy of chemotherapy due to drug resistance. DOI: 10.11855/j.issn.0577-7402.2015.10.09
Directory of Open Access Journals (Sweden)
Pranav Gupta
2018-02-01
Full Text Available Background/Aims: The overexpression of ATP-Binding Cassette (ABC transporters has known to be one of the major obstacles impeding the success of chemotherapy in drug resistant cancers. In this study, we evaluated voruciclib, a CDK 4/6 inhibitor, for its chemo-sensitizing activity in ABCB1- and ABCG2- overexpressing cells. Methods: Cytotoxicity and reversal effect of voruciclib was determined by MTT assay. The intracellular accumulation and efflux of ABCB1 and ABCG2 substrates were measured by scintillation counter. The effects on expression and intracellular localization of ABCB1 and ABCG2 proteins were determined by Western blotting and immunofluorescence, respectively. Vanadate-sensitive ATPase assay was done to determine the effect of voruciclib on the ATPase activity of ABCB1 and ABCG2. Flow cytometric analysis was done to determine the effect of voruciclib on apoptosis of ABCB1 and ABCG2-overexpressing cells and docking analysis was done to determine the interaction of voruciclib with ABCB1 and ACBG2 protein. Results: Voruciclib significantly potentiated the effect of paclitaxel and doxorubicin in ABCB1-overexpressing cells, as well as mitoxantrone and SN-38 in ABCG2-overexpressing cells. Voruciclib moderately sensitized ABCC10- overexpressing cells to paclitaxel, whereas it did not alter the cytotoxicity of substrates of ABCC1. Furthermore, voruciclib increased the intracellular accumulation and decreased the efflux of substrate anti-cancer drugs from ABCB1- or ABCG2-overexpressing cells. However, voruciclib did not alter the expression or the sub-cellular localization of ABCB1 or ABCG2. Voruciclib stimulated the ATPase activity of both ABCB1 and ABCG2 in a concentration-dependent manner. Lastly, voruciclib exhibited a drug-induced apoptotic effect in ABCB1- or ABCG2- overexpressing cells. Conclusion: Voruciclib is currently a phase I clinical trial drug. Our findings strongly support its potential use in combination with conventional anti
Directory of Open Access Journals (Sweden)
Gozzi GJ
2015-07-01
Full Text Available Gustavo Jabor Gozzi,1,2 Zouhair Bouaziz,3 Evelyn Winter,1,4 Nathalia Daflon-Yunes,1 Mylène Honorat,1 Nathalie Guragossian,3 Christelle Marminon,3 Glaucio Valdameri,1,2 Andre Bollacke,5 Jean Guillon,6 Noël Pinaud,7 Mathieu Marchivie,8 Silvia M Cadena,2 Joachim Jose,5 Marc Le Borgne,3 Attilio Di Pietro11Equipe Labellisée Ligue 2014, BMSSI UMR5086 CNRS/Lyon I University, IBCP, Lyon, France; 2Department of Biochemistry and Molecular Biology, Federal University of Paraná, Curitiba, Paraná, Brazil; 3Faculty of Pharmacy – ISPB, EA 4446 Biomolecules, Cancer and Chemoresistance, Health SFR of East Lyon CNRS UMS3453 - INSERM US7, University of Lyon, Lyon I University, Lyon Cedex 8, France; 4Department of Pharmaceutical Sciences, PGFAR, Federal University of Santa Catarina, Florianopolis, Santa Catarina, Brazil; 5Institute of Pharmaceutical and Medicinal Chemistry, University of Münster, Münster, Germany; 6ARNA Laboratory, Pharmaceutical Sciences UFR, INSERM U869, University of Bordeaux, Bordeaux Cedex, France; 7ISM – CNRS UMR 5255, University of Bordeaux Cedex, France; 8ICMCB CNRS-UPR 9048, University of Bordeaux, Pessac Cedex, FranceAbstract: Ketonic indeno[1,2-b]indole-9,10-dione derivatives, initially designed as human casein kinase II (CK2 inhibitors, were recently shown to be converted into efficient inhibitors of drug efflux by the breast cancer resistance protein ABCG2 upon suited substitutions including a N5-phenethyl on C-ring and hydrophobic groups on D-ring. A series of ten phenolic and seven p-quinonic derivatives were synthesized and screened for inhibition of both CK2 and ABCG2 activities. The best phenolic inhibitors were about threefold more potent against ABCG2 than the corresponding ketonic derivatives, and showed low cytotoxicity. They were selective for ABCG2 over both P-glycoprotein and MRP1 (multidrug resistance protein 1, whereas the ketonic derivatives also interacted with MRP1, and they additionally displayed a lower
International Nuclear Information System (INIS)
Li, Yan; Ohms, Stephen J.; Shannon, Frances M.; Sun, Chao; Fan, Jun Y.
2012-01-01
Highlights: ► DNA methylation is dynamic and flexible and changes rapidly upon cell activation. ► DNA methylation controls the inducible gene expression in a given cell type. ► Some enzymes are involved in maintaining the methylation profile of immune cells. -- Abstract: DNA demethylation has been found to occur at the promoters of a number of actively expressed cytokines and is believed to play a critical role in transcriptional regulation. While many DNA demethylation studies have focused on T cell activation, proliferation and differentiation, changes in DNA methylation in other types of immune cells are less well studied. We found that the expression of two cytokines (IL-2 and GM-CSF) responded differently to activation in three types of immune cells: EL4, A20 and RAW264.7 cells. Using the McrBC and MeDIP approaches, we observed decreases in DNA methylation at a genome-wide level and at the promoters of the genes of these cytokines. The expression of several potential enzymes/co-enzymes involved in the DNA demethylation pathways seemed to be associated with immune cell activation.
Directory of Open Access Journals (Sweden)
Christopher A Hamm
Full Text Available Abnormal patterns of DNA methylation are observed in several types of human cancer. While localized DNA methylation of CpG islands has been associated with gene silencing, the effect that genome-wide loss of methylation has on tumorigenesis is not completely known. To examine its effect on tumorigenesis, we induced DNA demethylation in a rat model of human chondrosarcoma using 5-aza-2-deoxycytidine. Rat specific pyrosequencing assays were utilized to assess the methylation levels in both LINEs and satellite DNA sequences following 5-aza-2-deoxycytidine treatment. Loss of DNA methylation was accompanied by an increase in invasiveness of the rat chondrosarcoma cells, in vitro, as well as by an increase in tumor growth in vivo. Subsequent microarray analysis provided insight into the gene expression changes that result from 5-aza-2-deoxycytidine induced DNA demethylation. In particular, two genes that may function in tumorigenesis, sox-2 and midkine, were expressed at low levels in control cells but upon 5-aza-2-deoxycytidine treatment these genes became overexpressed. Promoter region DNA analysis revealed that these genes were methylated in control cells but became demethylated following 5-aza-2-deoxycytidine treatment. Following withdrawal of 5-aza-2-deoxycytidine, the rat chondrosarcoma cells reestablished global DNA methylation levels that were comparable to that of control cells. Concurrently, invasiveness of the rat chondrosarcoma cells, in vitro, decreased to a level indistinguishable to that of control cells. Taken together these experiments demonstrate that global DNA hypomethylation induced by 5-aza-2-deoxycytidine may promote specific aspects of tumorigenesis in rat chondrosarcoma cells.
Genome-wide Identification and Expression Analysis of Half-size ABCG Genes in Malus × domestica
Directory of Open Access Journals (Sweden)
Juanjuan MA
2018-03-01
Full Text Available Half-size adenosine triphosphate-binding cassette transporter subgroup G (ABCG genes play crucial roles in regulating the movements of a variety of substrates and have been well studied in several plants. However, half-size ABCGs have not been characterized in detail in apple (Malus × domestica Borkh.. Here, we performed a genome-wide identification and expression analysis of the half-size ABCG gene family in apple. A total of 46 apple half-size ABCGs were identified and divided into six clusters according to the phylogenetic analysis. A gene structural analysis showed that most half-size ABCGs in the same cluster shared a similar exon–intron organization. A gene duplication analysis showed that segmental, tandem and whole-genome duplications could account for the expansion of half-size ABCG transporters in M. domestica. Moreover, a promoter scan, digital expression analysis and RNA-seq revealed that MdABCG21 may be involved in root's cytokinin transport and that ABCG17 may be involved in the lateral bud development of M. spectabilis ‘Bly114’ by mediating cytokinin transport. The data presented here lay the foundation for further investigations into the biological and physiological processes and functions of half-size ABCG genes in apple. Keywords: apple, ABCG gene, duplication, gene expression
DEFF Research Database (Denmark)
Cederbye, Camilla Natasha; Palshof, Jesper Andreas; Hansen, Tine Plato
2016-01-01
cancer (CRC), probably because of the use of different antibodies and scoring approaches. In this study, we systematically studied six commercially available anti-ABCG2 antibodies, using cell lines with up-regulation of ABCG2, and selected one antibody for validation in CRC tissue. Furthermore, we...... sections, especially when more than one core was used. In conclusion, here, we provide validated results to guide future studies on the associations between ABCG2 immunoreactivity in tumor cells and the benefits of chemotherapeutic treatment in patients with CRC...
Manzini, L; Halwachs, S; Girolami, F; Badino, P; Honscha, W; Nebbia, C
2017-12-01
The ATP-binding cassette efflux transporter ABCG2 plays a key role in the mammary excretion of drugs and toxins in humans and animals. Aflatoxins (AF) are worldwide contaminants of food and feed commodities, while PCB 126 is a dioxin-like PCB which may contaminate milk and dairy products. Both compounds are known human carcinogens. The interactions between AF and bovine ABCG2 (bABCG2) as well as the effects of PCB 126 on its efflux activity have been investigated by means of the Hoechst H33342 transport assay in MDCKII cells stably expressing mammary bABCG2. Both AFB1 and its main milk metabolite AFM1 showed interaction with bABCG2 even at concentrations approaching the legal limits in feed and food commodities. Moreover, PCB 126 significantly enhanced bABCG2 functional activity. Specific inhibitors of either AhR (CH233191) or ABCG2 (Ko143) were able to reverse the PCB 126-induced increase in bABCG2 transport activity, showing the specific upregulation of the efflux protein by the AhR pathway. The incubation of PCB 126-pretreated cells with AFM1 was able to substantially reverse such effect, with still unknown mechanism(s). Overall, results from this study point to AFB1 and AFM1 as likely bABCG2 substrates. The PCB 126-dependent increased activity of the transporter could enhance the ABCG2-mediated excretion into dairy milk of chemicals (i.e., drugs and toxins) potentially harmful to neonates and consumers. © 2017 John Wiley & Sons Ltd.
Wang, Fang; Liang, Yong-Ju; Wu, Xing-Ping; Su, Xiao-Dong; Fu, Li-Wu
2012-03-01
S1-M1-80 cells, derived from human colon carcinoma S1 cells, are mitoxantrone-selected ABCG2-overexpressing cells and are widely used in in vitro studies of multidrug resistance(MDR). In this study, S1-M1-80 cell xenografts were established to investigate whether the MDR phenotype and cell biological properties were maintained in vivo. Our results showed that the proliferation, cell cycle, and ABCG2 expression level in S1-M1-80 cells were similar to those in cells isolated from S1-M1-80 cell xenografts (named xS1-M1-80 cells). Consistently, xS1-M1-80 cells exhibited high levels of resistance to ABCG2 substrates such as mitoxantrone and topotecan, but remained sensitive to the non-ABCG2 substrate cisplatin. Furthermore, the specific ABCG2 inhibitor Ko143 potently sensitized xS1-M1-80 cells to mitoxantrone and topotecan. These results suggest that S1-M1-80 cell xenografts in nude mice retain their original cytological characteristics at 9 weeks. Thus, this model could serve as a good system for further investigation of ABCG2-mediated MDR.
Kort, Anita; Durmus, Selvi; Sparidans, Rolf W; Wagenaar, Els; Beijnen, Jos H; Schinkel, Alfred H
2015-07-01
Regorafenib is a novel multikinase inhibitor, currently approved for the treatment of metastasized colorectal cancer and advanced gastrointestinal stromal tumors. We investigated whether regorafenib is a substrate for the multidrug efflux transporters ABCG2 and ABCB1 and whether oral availability, brain and testis accumulation of regorafenib and its active metabolites are influenced by these transporters. We used in vitro transport assays to assess human (h)ABCB1- or hABCG2- or murine (m)Abcg2-mediated active transport at high and low concentrations of regorafenib. To study the single and combined roles of Abcg2 and Abcb1a/1b in oral regorafenib disposition and the impact of Cyp3a-mediated metabolism, we used appropriate knockout mouse strains. Regorafenib was transported well by mAbcg2 and hABCG2 and modestly by hABCB1 in vitro. Abcg2 and to a lesser extent Abcb1a/1b limited brain and testis accumulation of regorafenib and metabolite M2 (brain only) in mice. Regorafenib oral availability was not increased in Abcg2(-/-);Abcb1a/1b(-/-) mice. Up till 2 h, metabolite M5 was undetectable in plasma and organs. Brain and testis accumulation of regorafenib and brain accumulation of metabolite M2 are restricted by Abcg2 and Abcb1a/1b. Inhibition of these transporters may be of clinical relevance for patients with brain (micro)metastases positioned behind an intact blood-brain barrier.
Energy Technology Data Exchange (ETDEWEB)
Li, Yan [College of Animal Science and Technology, Northwest A and F University, Yangling, Shaanxi 712100 (China); Department of Genome Biology, John Curtin School of Medical Research, The Australian National University, ACT 2601 (Australia); Ohms, Stephen J. [ACRF Biomolecular Resource Facility, John Curtin School of Medical Research, The Australian National University, ACT 2601 (Australia); Shannon, Frances M. [Department of Genome Biology, John Curtin School of Medical Research, The Australian National University, ACT 2601 (Australia); The University of Canberra, ACT 2602 (Australia); Sun, Chao, E-mail: sunchao2775@163.com [College of Animal Science and Technology, Northwest A and F University, Yangling, Shaanxi 712100 (China); Fan, Jun Y., E-mail: jun.fan@anu.edu.au [Department of Genome Biology, John Curtin School of Medical Research, The Australian National University, ACT 2601 (Australia)
2012-03-23
Highlights: Black-Right-Pointing-Pointer DNA methylation is dynamic and flexible and changes rapidly upon cell activation. Black-Right-Pointing-Pointer DNA methylation controls the inducible gene expression in a given cell type. Black-Right-Pointing-Pointer Some enzymes are involved in maintaining the methylation profile of immune cells. -- Abstract: DNA demethylation has been found to occur at the promoters of a number of actively expressed cytokines and is believed to play a critical role in transcriptional regulation. While many DNA demethylation studies have focused on T cell activation, proliferation and differentiation, changes in DNA methylation in other types of immune cells are less well studied. We found that the expression of two cytokines (IL-2 and GM-CSF) responded differently to activation in three types of immune cells: EL4, A20 and RAW264.7 cells. Using the McrBC and MeDIP approaches, we observed decreases in DNA methylation at a genome-wide level and at the promoters of the genes of these cytokines. The expression of several potential enzymes/co-enzymes involved in the DNA demethylation pathways seemed to be associated with immune cell activation.
Expression of ABCG2 and Bmi-1 in oral potentially malignant lesions and oral squamous cell carcinoma
International Nuclear Information System (INIS)
Dalley, Andrew J; Pitty, Luke P; Major, Aidan G; AbdulMajeed, Ahmad A; Farah, Camile S
2014-01-01
Early diagnosis is vital for effective treatment of oral squamous cell carcinoma (OSCC). The optimal time for clinical intervention is prior to malignancy when patients present with oral potentially malignant lesions such as leukoplakia or erythroplakia. Transformation rates for oral dysplasia vary greatly and more rigorous methods are needed to predict the malignant potential of oral lesions. We hypothesized that the expression of two putative stem cell markers, ABCG2 and Bmi-1, would correlate with disease severity for non diseased, potentially malignant and OSCC specimens and cell lines derived from an equivalent range of tissues. We compared immunoreactive protein and relative gene expression of ABCG2 and Bmi-1 in eight cell lines derived from source tissues ranging in disease severity from normal (OKF6-TERT2) through mild and moderate/severe dysplasia (DOK, POE-9n) to OSCC (PE/CA-PJ15, SCC04, SCC25, SCC09, SCC15). We also analyzed immunoreactive protein expression of ABCG2 and Bmi-1 in 189 tissue samples with the same range of disease severity. A trend between oral lesion severity to ABCG2 and Bmi-1 immunostain intensity was observed. Flow cytometry of oral cell lines confirmed this trend and gave good correlation with RT-PCR results for ABCG2 (r = 0.919, P = 0.001; Pearson) but not Bmi-1 (r = −0.311). The results provide evidence of increased density of ABCG2 and Bmi-1-positive populations in malignant and oral potentially malignant lesions and derived cell lines, but that intragroup variability within IHC, flow cytometry, and RT-PCR results compromise the diagnostic potential of these techniques for discriminating oral dysplasia from normal tissue or OSCC
Shukla, Suneet; Wu, Chung-Pu; Nandigama, Krishnamachary; Ambudkar, Suresh V.
2008-01-01
Vitamin K3 (Menadione; 2-methyl-1,4-naphthoquinone) is a structural precursor of vitamins K1 and K2 which are essential for blood clotting. The naturally occurring structural analog of this vitamin, plumbagin (5-hydroxy-menadione), is known to modulate cellular proliferation, apoptosis, carcinogenesis, and radioresistance. We, here, report that both vitamin K3 and plumbagin are substrates of the multidrug resistance-linked ATP binding cassette (ABC) drug transporter, ABCG2. Vitamin K3 and plumbagin specifically inhibited the ABCG2-mediated efflux of mitoxantrone, but did not have any effect on the ABCB1-mediated efflux of rhodamine 123. This inhibition of ABCG2 function was due to their interaction at the substrate-binding site(s). They inhibited the binding of [125I]-Iodoarylazidoprazosin (IAAP), a substrate of ABCG2, to this transporter in a concentration-dependent manner with IC50 values of 7.3 and 22.6 μM, respectively, but had no effect on the binding of this photoaffinity analog to ABCB1. Both compounds stimulated ABCG2-mediated ATP hydrolysis and also inhibited the mitoxantrone-stimulated ATPase activity of this transporter, but did not have any significant effect on the ATPase activity of ABCB1. In a cytotoxicity assay, ABCG2-expressing HEK cells were 2.8- and 2.3-fold resistant to plumbagin and vitamin K3, respectively, compared to the control cells, suggesting that they are substrates of this transporter. Collectively, these data demonstrate for the first time that vitamin K3 is a substrate of the ABCG2 transporter. Thus, ABCG2 may have a role in the regulation of vitamin K3 levels in the body. In addition, vitamin K3 and its structural derivative, plumbagin, could potentially be used to modulate ABCG2 function. PMID:18065489
Ren, Y C; Jin, T B; Sun, X D; Geng, T T; Zhang, M X; Wang, L; Feng, T; Kang, L L; Chen, C
2016-02-11
Previous studies have shown that the PDK2 and ABCG2 genes play important roles in many aspects of gout development in European populations. However, a detailed genotype-phenotype analysis was not performed. The aim of the present study was to investigate the potential association between variants in these two genes and metabolism-related quantitative phenotypes relevant to gout in a Chinese Tibetan population. In total, 316 Chinese Tibetan gout patients were recruited from rheumatology outpatient clinics and 6 single nucleotide polymorphisms in PDK2 and ABCG2 were genotyped, which were possible etiologic variants as identified in the HapMap Chinese Han Beijing population. A significant difference in blood glucose levels was detected between different genotypes of rs2728109 (P = 0.005) in the PDK2 gene. We also detected a significant difference in the mean serum uric levels between different genotypes of rs3114018 (P = 0.004) in the ABCG2 gene. All P values remained significant after Bonferroni's correction for multiple testing. Our data demonstrate potential roles for PDK2 and ABCG2 polymorphisms in the metabolic phenotypes of Tibetan gout patients, which may provide new insights into the etiology of gout. Further studies are required to confirm these findings.
Abdel Gaber, Sara A; Müller, Patricia; Zimmermann, Wolfgang; Hüttenberger, Dirk; Wittig, Rainer; Abdel Kader, Mahmoud H; Stepp, Herbert
2018-01-01
Photodynamic therapy (PDT) of malignant brain tumors is a promising adjunct to standard treatment, especially if tumor stem cells thought to be responsible for tumor progression and therapy resistance were also susceptible to this kind of treatment. However, some photosensitizers have been reported to be substrates of ABCG2, one of the membrane transporters mediating resistance to chemotherapy. Here we investigate, whether inhibition of ABCG2 can restore sensitivity to photosensitizer chlorin e6-mediated PDT. Accumulation of chlorin e6 in wild type U87 and doxycycline-inducible U251 glioblastoma cells with or without induction of ABCG2 expression or ABCG2 inhibition by KO143 was analyzed using flow cytometry. In U251 cells, ABCG2 was inducible by doxycycline after stable transfection with a tet-on expression plasmid. Tumor sphere cultivation under low attachment conditions was used to enrich for cells with stem cell-like properties. PDT was done on monolayer cell cultures by irradiation with laser light at 665nm. Elevated levels of ABCG2 in U87 cells grown as tumor spheres or in U251 cells after ABCG2 induction led to a 6-fold lower accumulation of chlorin e6 and the light dose needed to reduce cell viability by 50% (LD50) was 2.5 to 4-fold higher. Both accumulation and PDT response can be restored by KO143, an efficient non-toxic inhibitor of ABCG2. Glioblastoma stem cells might escape phototoxic destruction by ABCG2-mediated reduction of photosensitizer accumulation. Inhibition of ABCG2 during photosensitizer accumulation and irradiation promises to restore full susceptibility of this crucial tumor cell population to photodynamic treatment. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Sihui Li
2018-04-01
Full Text Available Summary: The arginine methylation status of histones dynamically changes during many cellular processes, including hematopoietic stem/progenitor cell (HSPC development. The arginine methyltransferases and the readers that transduce the histone codes have been defined. However, whether arginine demethylation actively occurs in cells and what enzyme demethylates the methylarginine residues during various cellular processes are unknown. We report that JMJD1B, previously identified as a lysine demethylase for H3K9me2, mediates arginine demethylation of H4R3me2s and its intermediate, H4R3me1. We show that demethylation of H4R3me2s and H3K9me2s in promoter regions is correlated with active gene expression. Furthermore, knockout of JMJD1B blocks demethylation of H4R3me2s and/or H3K9me2 at distinct clusters of genes and impairs the activation of genes important for HSPC differentiation and development. Consequently, JMJD1B−/− mice show defects in hematopoiesis. Altogether, our study demonstrates that demethylase-mediated active arginine demethylation process exists in eukaryotes and that JMJD1B demethylates both H4R3me2s and H3K9me2 for epigenetic programming during hematopoiesis. : Li et al. identify the arginine demethylase (RDM activity of JMJD1B, a known lysine demethylase (KDM. They reveal that JMJD1B actively mediates demethylation of histone markers H4R3me2s and H3K9me2 in hematopoietic stem/progenitor cells (HSPCs. Keywords: JMJD1B, KDM3B, PRMT5, arginine demethylase, histone, epigenetic programming, gene expression, hematopoiesis
Sugimoto, Ryusei; Watanabe, Hiroshi; Ikegami, Komei; Enoki, Yuki; Imafuku, Tadashi; Sakaguchi, Yoshiaki; Murata, Michiya; Nishida, Kento; Miyamura, Shigeyuki; Ishima, Yu; Tanaka, Motoko; Matsushita, Kazutaka; Komaba, Hirotaka; Fukagawa, Masafumi; Otagiri, Masaki; Maruyama, Toru
2017-03-01
Hyperuricemia occurs with increasing frequency among patients with hyperparathyroidism. However, the molecular mechanism by which the serum parathyroid hormone (PTH) affects serum urate levels remains unknown. This was studied in uremic rats with secondary hyperparathyroidism where serum urate levels were found to be increased and urate excretion in the intestine and kidney decreased, presumably due to down-regulation of the expression of the urate exporter ABCG2 in intestinal and renal epithelial membranes. These effects were prevented by administration of the calcimimetic cinacalcet, a PTH suppressor, suggesting that PTH may down-regulate ABCG2 expression. This was directly tested in intestinal Caco-2 cells where the expression of ABCG2 on the plasma membrane was down-regulated by PTH (1-34) while its mRNA level remained unchanged. Interestingly, an inactive PTH derivative (13-34) had no effect, suggesting that a posttranscriptional regulatory system acts through the PTH receptor to regulate ABCG2 plasma membrane expression. As found in an animal study, additional clinical investigations showed that treatment with cinacalcet resulted in significant reductions in serum urate levels together with decreases in PTH levels in patients with secondary hyperparathyroidism undergoing dialysis. Thus, PTH down-regulates ABCG2 expression on the plasma membrane to suppress intestinal and renal urate excretion, and the effects of PTH can be prevented by cinacalcet treatment. Copyright © 2016 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.
Goler-Baron, Vicky; Assaraf, Yehuda G.
2012-01-01
Multidrug resistance (MDR) remains a dominant impediment to curative cancer chemotherapy. Efflux transporters of the ATP-binding cassette (ABC) superfamily including ABCG2, ABCB1 and ABCC1 mediate MDR to multiple structurally and functionally distinct antitumor agents. Recently we identified a novel mechanism of MDR in which ABCG2-rich extracellular vesicles (EVs) form in between attached neighbor breast cancer cells and highly concentrate various chemotherapeutics in an ABCG2-dependent manner, thereby sequestering them away from their intracellular targets. Hence, development of novel strategies to overcome MDR modalities is a major goal of cancer research. Towards this end, we here developed a novel approach to selectively target and kill MDR cancer cells. We show that illumination of EVs that accumulated photosensitive cytotoxic drugs including imidazoacridinones (IAs) and topotecan resulted in intravesicular formation of reactive oxygen species (ROS) and severe damage to the EVs membrane that is shared by EVs-forming cells, thereby leading to tumor cell lysis and the overcoming of MDR. Furthermore, consistent with the weak base nature of IAs, MDR cells that are devoid of EVs but contained an increased number of lysosomes, highly accumulated IAs in lysosomes and upon photosensitization were efficiently killed via ROS-dependent lysosomal rupture. Combining targeted lysis of IAs-loaded EVs and lysosomes elicited a synergistic cytotoxic effect resulting in MDR reversal. In contrast, topotecan, a bona fide transport substrate of ABCG2, accumulated exclusively in EVs of MDR cells but was neither detected in lysosomes of normal breast epithelial cells nor in non-MDR breast cancer cells. This exclusive accumulation in EVs enhanced the selectivity of the cytotoxic effect exerted by photodynamic therapy to MDR cells without harming normal cells. Moreover, lysosomal alkalinization with bafilomycin A1 abrogated lysosomal accumulation of IAs, consequently preventing
DEFF Research Database (Denmark)
Andersen, Vibeke; Svenningsen, Katrine; Knudsen, Lina Almind
2015-01-01
transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1....../Mdr1a, abcc2/Mrp2, abcg2/Bcrp, knock-out mice, tight junction, membrane lipid function. RESULTS: Recently, human studies reported that changes in the levels of ABC transporters were early events in the adenoma-carcinoma sequence leading to CRC. A link between ABCB1, high fat diet and gut microbes...
Shukla, Suneet; Wu, Chung-Pu; Nandigama, Krishnamachary; Ambudkar, Suresh V
2007-12-01
Vitamin K3 (menadione; 2-methyl-1,4-naphthoquinone) is a structural precursor of vitamins K1 and K2, which are essential for blood clotting. The naturally occurring structural analogue of this vitamin, plumbagin (5-hydroxy-menadione), is known to modulate cellular proliferation, apoptosis, carcinogenesis, and radioresistance. We here report that both vitamin K3 and plumbagin are substrates of the multidrug resistance-linked ATP binding cassette drug transporter, ABCG2. Vitamin K3 and plumbagin specifically inhibited the ABCG2-mediated efflux of mitoxantrone but did not have any effect on the ABCB1-mediated efflux of rhodamine 123. This inhibition of ABCG2 function was due to their interaction at the substrate-binding site(s). Vitamin K3 and plumbagin inhibited the binding of [(125)I]iodoarylazidoprazosin, a substrate of ABCG2, to this transporter in a concentration-dependent manner with IC(50) values of 7.3 and 22.6 micromol/L, respectively, but had no effect on the binding of the photoaffinity analogue to ABCB1. Both compounds stimulated ABCG2-mediated ATP hydrolysis and also inhibited the mitoxantrone-stimulated ATPase activity of the ABCG2 transporter, but did not have any significant effect on the ATPase activity of ABCB1. In a cytotoxicity assay, ABCG2-expressing HEK cells were 2.8- and 2.3-fold resistant to plumbagin and vitamin K3, respectively, compared with the control cells, suggesting that they are substrates of this transporter. Collectively, these data show for the first time that vitamin K3 is a substrate of the ABCG2 transporter. Thus, ABCG2 may have a role in the regulation of vitamin K3 levels in the body. In addition, vitamin K3 and its structural derivative, plumbagin, could potentially be used to modulate ABCG2 function.
Vitamin C induces specific demethylation of H3K9me2 in mouse embryonic stem cells via Kdm3a/b.
Ebata, Kevin T; Mesh, Kathryn; Liu, Shichong; Bilenky, Misha; Fekete, Alexander; Acker, Michael G; Hirst, Martin; Garcia, Benjamin A; Ramalho-Santos, Miguel
2017-01-01
Histone methylation patterns regulate gene expression and are highly dynamic during development. The erasure of histone methylation is carried out by histone demethylase enzymes. We had previously shown that vitamin C enhances the activity of Tet enzymes in embryonic stem (ES) cells, leading to DNA demethylation and activation of germline genes. We report here that vitamin C induces a remarkably specific demethylation of histone H3 lysine 9 dimethylation (H3K9me2) in naïve ES cells. Vitamin C treatment reduces global levels of H3K9me2, but not other histone methylation marks analyzed, as measured by western blot, immunofluorescence and mass spectrometry. Vitamin C leads to widespread loss of H3K9me2 at large chromosomal domains as well as gene promoters and repeat elements. Vitamin C-induced loss of H3K9me2 occurs rapidly within 24 h and is reversible. Importantly, we found that the histone demethylases Kdm3a and Kdm3b are required for vitamin C-induced demethylation of H3K9me2. Moreover, we show that vitamin C-induced Kdm3a/b-mediated H3K9me2 demethylation and Tet-mediated DNA demethylation are independent processes at specific loci. Lastly, we document Kdm3a/b are partially required for the upregulation of germline genes by vitamin C. These results reveal a specific role for vitamin C in histone demethylation in ES cells and document that DNA methylation and H3K9me2 cooperate to silence germline genes in pluripotent cells.
DEFF Research Database (Denmark)
Robey, R W; Medina-Pérez, W Y; Nishiyama, K
2001-01-01
We sought to characterize the interactions of flavopiridol with members of the ATP-binding cassette (ABC) transporter family. Cells overexpressing multidrug resistance-1 (MDR-1) and multidrug resistance-associated protein (MRP) did not exhibit appreciable flavopiridol resistance, whereas cell lines...... overexpressing the ABC half-transporter, ABCG2 (MXR/BCRP/ABCP1), were found to be resistant to flavopiridol. Flavopiridol at a concentration of 10 microM was able to prevent MRP-mediated calcein efflux, whereas Pgp-mediated transport of rhodamine 123 was unaffected at flavopiridol concentrations of up to 100...... analysis revealed overexpression of the ABCG2 gene. Western blot confirmed overexpression of ABCG2; neither P-glycoprotein nor MRP overexpression was detected. These results suggest that ABCG2 plays a role in resistance to flavopiridol....
Zhou, Danqiu; Liu, Yunqing; Zhang, Xinju; Gu, Xiaoye; Wang, Hua; Luo, Xinhua; Zhang, Jin; Zou, Hejian; Guan, Ming
2014-05-22
Gout is a common type of arthritis that is characterized by hyperuricemia, tophi and joint inflammation. Genetic variations in the ABCG2 gene have been reported to influence serum uric acid levels and to participate in the pathogenesis of gout, but no further data have been reported in the Han Chinese population. Peripheral blood DNA was isolated from 352 male patients with gout and 350 gout-free normal male controls. High-resolution melting analysis and Sanger sequencing were performed to identify the genetic polymorphisms V12M, Q141K and Q126X in the ABCG2 gene. Genotype and haplotype analyses were utilized to determine the disease odds ratios (ORs). A prediction model for gout risk using ABCG2 protein function was established based on the genotype combination of Q126X and Q141K. For Q141K, the A allele frequency was 49.6% in the gout patients and 30.9% in the controls (OR 2.20, 95% confidence interval (CI): 1.77-2.74, p=8.99×10⁻¹³). Regarding Q126X, the T allele frequency was 4.7% in the gout patients and 1.7% in the controls (OR 2.91, 95% CI: 1.49-5.68, p=1.57×10⁻³). The A allele frequency for V12M was lower (18.3%) in the gout patients than in the controls (29%) (OR 0.55, 95% CI 0.43-0.71, p=2.55×10⁻⁶). In the order of V12M, Q126X and Q141K, the GCA and GTC haplotypes indicated increased disease risk (OR=2.30 and 2.71, respectively). Patients with mild to severe ABCG2 dysfunction accounted for 78.4% of gout cases. The ABCG2 126X and 141K alleles are associated with an increased risk of gout, whereas 12M has a protective effect on gout susceptibility in the Han Chinese population. ABCG2 dysfunction can be used to evaluate gout risk.
Base-oxidant promoted metal-free N-demethylation of arylamines
Indian Academy of Sciences (India)
A metal-free oxidative N-demethylation of arylamines with triethylamine as a base and tert-butyl hydroperoxide (TBHP) as oxidant is reported in this paper. The reaction is general, practical, inexpensive, non-toxic, and the method followed is environmentally benign, with moderate to good yields.
Cellular Localization and Trafficking of the Human ABCG1 Transporter
Neufeld, Edward B.; O’Brien, Katherine; Walts, Avram D.; Stonik, John A.; Demosky, Steven J.; Malide, Daniela; Combs, Christian A.; Remaley, Alan T.
2014-01-01
We have developed a suitable heterologous cell expression system to study the localization, trafficking, and site(s) of function of the human ABCG1 transporter. Increased plasma membrane (PM) and late endosomal (LE) cholesterol generated by ABCG1 was removed by lipoproteins and liposomes, but not apoA-I. Delivery of ABCG1 to the PM and LE was required for ABCG1-mediated cellular cholesterol efflux. ABCG1 LEs frequently contacted the PM, providing a collisional mechanism for transfer of ABCG1-mobilized cholesterol, similar to ABCG1-mediated PM cholesterol efflux to lipoproteins. ABCG1-mobilized LE cholesterol also trafficked to the PM by a non-vesicular pathway. Transfer of ABCG1-mobilized cholesterol from the cytoplasmic face of LEs to the PM and concomitant removal of cholesterol from the outer leaflet of the PM bilayer by extracellular acceptors suggests that ABCG1 mobilizes cholesterol on both sides of the lipid bilayer for removal by acceptors. ABCG1 increased uptake of HDL into LEs, consistent with a potential ABCG1-mediated cholesterol efflux pathway involving HDL resecretion. Thus, ABCG1 at the PM mobilizes PM cholesterol and ABCG1 in LE/LYS generates mobile pools of cholesterol that can traffic by both vesicular and non-vesicular pathways to the PM where it can also be transferred to extracellular acceptors with a lipid surface. PMID:25405320
Monkey liver cytochrome P450 2C9 is involved in caffeine 7-N-demethylation to form theophylline.
Utoh, Masahiro; Murayama, Norie; Uno, Yasuhiro; Onose, Yui; Hosaka, Shinya; Fujino, Hideki; Shimizu, Makiko; Iwasaki, Kazuhide; Yamazaki, Hiroshi
2013-12-01
Caffeine (1,3,7-trimethylxanthine) is a phenotyping substrate for human cytochrome P450 1A2. 3-N-Demethylation of caffeine is the main human metabolic pathway, whereas monkeys extensively mediate the 7-N-demethylation of caffeine to form pharmacological active theophylline. Roles of monkey P450 enzymes in theophylline formation from caffeine were investigated using individual monkey liver microsomes and 14 recombinantly expressed monkey P450 enzymes, and the results were compared with those for human P450 enzymes. Caffeine 7-N-demethylation activity in microsomes from 20 monkey livers was not strongly inhibited by α-naphthoflavone, quinidine or ketoconazole, and was roughly correlated with diclofenac 4'-hydroxylation activities. Monkey P450 2C9 had the highest activity for caffeine 7-N-demethylation. Kinetic analysis revealed that monkey P450 2C9 had a high Vmax/Km value for caffeine 7-N-demethylation, comparable to low Km value for monkey liver microsomes. Caffeine could dock favorably with monkey P450 2C9 modeled for 7-N-demethylation and with human P450 1A2 for 3-N-demethylation. The primary metabolite theophylline was oxidized to 8-hydroxytheophylline in similar ways by liver microsomes and by recombinant P450s in both humans and monkeys. These results collectively suggest a high activity for monkey liver P450 2C9 toward caffeine 7-N-demethylation, whereas, in humans, P450 1A2-mediated caffeine 3-N-demethylation is dominant.
Energy Technology Data Exchange (ETDEWEB)
Putnik, Milica, E-mail: milica.putnik@ki.se [Department of Biosciences and Nutrition, Novum, Karolinska Institutet, Huddinge S-14183 (Sweden); Zhao, Chunyan, E-mail: chunyan.zhao@ki.se [Department of Biosciences and Nutrition, Novum, Karolinska Institutet, Huddinge S-14183 (Sweden); Gustafsson, Jan-Ake, E-mail: jan-ake.gustafsson@ki.se [Department of Biosciences and Nutrition, Novum, Karolinska Institutet, Huddinge S-14183 (Sweden); Department of Biology and Biochemistry, Science and Engineering Research Center Bldg, University of Houston, Houston, TX 77204-5056 (United States); Dahlman-Wright, Karin, E-mail: karin.dahlman-wright@ki.se [Department of Biosciences and Nutrition, Novum, Karolinska Institutet, Huddinge S-14183 (Sweden)
2012-09-14
Highlights: Black-Right-Pointing-Pointer Estrogen signaling and demethylation can both control gene expression in breast cancers. Black-Right-Pointing-Pointer Cross-talk between these mechanisms is investigated in human MCF-7 breast cancer cells. Black-Right-Pointing-Pointer 137 genes are influenced by both 17{beta}-estradiol and demethylating agent 5-aza-2 Prime -deoxycytidine. Black-Right-Pointing-Pointer A set of genes is identified as targets of both estrogen signaling and demethylation. Black-Right-Pointing-Pointer There is no direct molecular interplay of mediators of estrogen and epigenetic signaling. -- Abstract: Estrogen signaling and epigenetic modifications, in particular DNA methylation, are involved in regulation of gene expression in breast cancers. Here we investigated a potential regulatory cross-talk between these two pathways by identifying their common target genes and exploring underlying molecular mechanisms in human MCF-7 breast cancer cells. Gene expression profiling revealed that the expression of approximately 140 genes was influenced by both 17{beta}-estradiol (E2) and a demethylating agent 5-aza-2 Prime -deoxycytidine (DAC). Gene ontology (GO) analysis suggests that these genes are involved in intracellular signaling cascades, regulation of cell proliferation and apoptosis. Based on previously reported association with breast cancer, estrogen signaling and/or DNA methylation, CpG island prediction and GO analysis, we selected six genes (BTG3, FHL2, PMAIP1, BTG2, CDKN1A and TGFB2) for further analysis. Tamoxifen reverses the effect of E2 on the expression of all selected genes, suggesting that they are direct targets of estrogen receptor. Furthermore, DAC treatment reactivates the expression of all selected genes in a dose-dependent manner. Promoter CpG island methylation status analysis revealed that only the promoters of BTG3 and FHL2 genes are methylated, with DAC inducing demethylation, suggesting DNA methylation directs repression of
International Nuclear Information System (INIS)
Putnik, Milica; Zhao, Chunyan; Gustafsson, Jan-Åke; Dahlman-Wright, Karin
2012-01-01
Highlights: ► Estrogen signaling and demethylation can both control gene expression in breast cancers. ► Cross-talk between these mechanisms is investigated in human MCF-7 breast cancer cells. ► 137 genes are influenced by both 17β-estradiol and demethylating agent 5-aza-2′-deoxycytidine. ► A set of genes is identified as targets of both estrogen signaling and demethylation. ► There is no direct molecular interplay of mediators of estrogen and epigenetic signaling. -- Abstract: Estrogen signaling and epigenetic modifications, in particular DNA methylation, are involved in regulation of gene expression in breast cancers. Here we investigated a potential regulatory cross-talk between these two pathways by identifying their common target genes and exploring underlying molecular mechanisms in human MCF-7 breast cancer cells. Gene expression profiling revealed that the expression of approximately 140 genes was influenced by both 17β-estradiol (E2) and a demethylating agent 5-aza-2′-deoxycytidine (DAC). Gene ontology (GO) analysis suggests that these genes are involved in intracellular signaling cascades, regulation of cell proliferation and apoptosis. Based on previously reported association with breast cancer, estrogen signaling and/or DNA methylation, CpG island prediction and GO analysis, we selected six genes (BTG3, FHL2, PMAIP1, BTG2, CDKN1A and TGFB2) for further analysis. Tamoxifen reverses the effect of E2 on the expression of all selected genes, suggesting that they are direct targets of estrogen receptor. Furthermore, DAC treatment reactivates the expression of all selected genes in a dose-dependent manner. Promoter CpG island methylation status analysis revealed that only the promoters of BTG3 and FHL2 genes are methylated, with DAC inducing demethylation, suggesting DNA methylation directs repression of these genes in MCF-7 cells. In a further analysis of the potential interplay between estrogen signaling and DNA methylation, E2 treatment
DEFF Research Database (Denmark)
Andersen, Vibeke; Svenningsen, Katrine; Almind Knudsen, Lina
2015-01-01
AIM: To evaluate ATP-binding cassette (ABC) transporters in colonic pathophysiology as they had recently been related to colorectal cancer (CRC) development. METHODS: Literature search was conducted on PubMed using combinations of the following terms: ABC transporters, ATP binding cassette...... with glucocorticoids. The evidence for the involvement of ABCC2 and ABCG2 in colonic pathophysiology was weak. CONCLUSION: ABCB1, diet, and gut microbes mutually interact in colonic inflammation, a well-known risk factor for CRC. Further insight may be translated into preventive and treatment strategies....... transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1...
Demethylating agent, 5-azacytidine, reverses differentiation of embryonic stem cells
International Nuclear Information System (INIS)
Tsuji-Takayama, Kazue; Inoue, Toshiya; Ijiri, Yoshihiro; Otani, Takeshi; Motoda, Ryuichi; Nakamura, Shuji; Orita, Kunzo
2004-01-01
The de novo methylation activity is essential for embryonic development as well as embryonic stem (ES) cell differentiation, where the intensive and extensive DNA methylation was detected. In this study, we investigated the effects of a demethylating agent, 5-azacytidine (5-AzaC), on differentiated ES cells in order to study the possibility of reversing the differentiation process. We first induced differentiation of ES cells by forming embryoid bodies, and then the cells were treated with 5-AzaC. The cells showed some undifferentiated features such as stem cell-like morphology with unclear cell-to-cell boundary and proliferative responsiveness to LIF. Moreover, 5-AzaC increased the expressions of ES specific markers, SSEA-1, and alkaline phosphatase activity as well as ES specific genes, Oct4, Nanog, and Sox2. We also found that 5-AzaC demethylated the promoter region of H19 gene, a typical methylated gene during embryonic differentiation. These results indicate that 5-AzaC reverses differentiation state of ES cells through its DNA demethylating activity to differentiation related genes
DGAT1 and ABCG2 polymorphism in Indian cattle (Bos indicus and buffalo (Bubalus bubalis breeds
Directory of Open Access Journals (Sweden)
Mishra Bina
2006-11-01
Full Text Available Abstract Background Indian cattle (Bos indicus and riverine buffalo (Bubalus bubalis give a poor yield of milk but it has a high fat and protein percentage compared to taurine cattle. The identification of QTLs (Quantitative Trait Loci on BTA14 and BTA6 and its subsequent fine mapping has led to identification of two non conservative mutations affecting milk production and composition. Our objective was to estimate the frequency of K232A (DGAT1 – diacylglycerol – acyltransferase 1 and Y581S (ABCG2 – ATP binding cassette sub family G member 2 polymorphisms in diverse cattle and buffalo breeds of India having large variation in terms of milk production. Results We screened the reported missense mutations in six cattle and five buffalo breeds. The DGAT1K and ABCG2Y alleles were found to be fixed in Indian cattle and buffalo breeds studied. Conclusion This study provides an indirect evidence that all the Indian cattle and buffalo breeds have fixed alleles with respect to DGAT1 and ABCG2 genes reported to be responsible for higher milk fat yield, higher fat and protein percent.
DEFF Research Database (Denmark)
Özvegy-Laczka, Csilla; Laczkó, Rozália; Hegedűs, Csilla
2008-01-01
D3 monoclonal antibody shows a function-dependent reactivity to an extracellular epitope of the ABCG2 transporter. In the current experiments we have further characterized the 5D3-ABCG2 interaction. The effect of chemical cross-linking and the modulation of extracellular S-S bridges...... on the transporter function and 5D3 reactivity of ABCG2 were investigated in depth. We found that several protein cross-linkers greatly increased 5D3 labeling in ABCG2 expressing HEK cells; however, there was no correlation between covalent dimer formation, the inhibition of transport activity, and the increase in 5...
Effect of polymorphisms in the ABCG2, LEPR and SCD1 genes on ...
African Journals Online (AJOL)
Sahand Rayaneh
2016-06-24
Jun 24, 2016 ... Abstract. This study was performed to investigate the association between polymorphisms in the ABCG2 (ATP- binding cassette sub-family G member 2), LEPR (leptin receptor) and SCD1 (stearoyl-coenzyme A desaturase 1) genes and milk production traits in Holstein dairy cows in Iran. The analysis was ...
Kang, Hui-Yuan; Wang, Xin-Rong; Gao, Li; Wang, Wei; Li, Mian-Yang; Wang, Li-Li; Wang, Cheng-Bin; Yu, Li
2015-04-01
To evaluate significance of ID4 gene mehtylation in demethylating myelodysplastic syndrome(MDS) cell Line MUTZ1 and 2 patients with MDS. The methylation-specific PCR (MS-PCR) and reverse transcription-PCR (RT-PCR) were applied to identify the methylation status and gene expression of ID4 gene in MDS cell line MUTZ1, a patient with aplastic anemia(AA) and a donor with normal bone marrow (NBM). RT-PCR was applied to detect the ID4 gene expression status in MUTZ1 cell line treated with decitabine at 3 different concentrations. Then bisulfite sequencing PCR (BSP) was applied to detect ID4 gene methylation status in 2 MDS parients treated with decitabine. The MDS cell line MUTZ-1 displayed a complete methylation of ID4 gene promoter with little mRNA expression. Inversely, bone marrow of an AA patient and NBM showed complete unmethylation of this gene with intensity mRNA expression. With the increase of decitabine concentration, ID4 gene mRNA expression was more and more increased. After decitabine treatment, ID4 gene methylation-positive frequencies of both the 2 MDS patients were much more decreased than that of the first treatment. So, ID4 gene mRNA expression inhibited by promoter hypemethylation could be recovered by using demethylation medicine. ID4 as a new potential anti-oncogene suggests that its methylation may become a marker for selection and assessment of therapeutic schedules in patients with MDS.
Theoretical study on the N-demethylation mechanism of theobromine catalyzed by P450 isoenzyme 1A2.
Tao, Jing; Kang, Yuan; Xue, Zhiyu; Wang, Yongting; Zhang, Yan; Chen, Qiu; Chen, Zeqin; Xue, Ying
2015-09-01
Theobromine, a widely consumed pharmacological active substance, can cause undesirable muscle stiffness, nausea and anorexia in high doses ingestion. The main N-demethylation metabolic mechanism of theobromine catalyzed by P450 isoenzyme 1A2 (CYP1A2) has been explored in this work using the unrestricted hybrid density functional method UB3LYP in conjunction with the LACVP(Fe)/6-31G (H, C, N, O, S, Cl) basis set. Single-point calculations including empirical dispersion corrections were carried out at the higher 6-311++G** basis set. Two N-demethylation pathways were characterized, i.e., 3-N and 7-N demethylations, which involve the initial N-methyl hydroxylation to form carbinolamines and the subsequent carbinolamines decomposition to yield monomethylxanthines and formaldehydes. Our results have shown that the rate-limiting N-methyl hydroxylation occurs via a hydrogen atom transfer (HAT) mechanism, which proceeds in a spin-selective mechanism (SSM) in the gas phase. The carbinolamines generated are prone to decomposition via the contiguous heteroatom-assisted proton-transfer. Strikingly, 3-N demethylation is more favorable than 7-N demethylation due to its lower free energy barrier and 7-methylxanthine therefore is the optimum product reported for the demethylation of theobromine catalyzed by CYP1A2, which are in good agreement with the experimental observation. This work has first revealed the detail N-demethylation mechanisms of theobromine at the theoretical level. It can offer more significant information for the metabolism of purine alkaloid. Copyright © 2015 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Vlaming, Maria L.H.; Läppchen, Tilman; Jansen, Harm T.; Kivits, Suzanne; Driel, Andy van; Steeg, Evita van de; Hoorn, José W. van der; Sio, Charles F.; Steinbach, Oliver C.; DeGroot, Jeroen
2015-01-01
Introduction: The efflux transporters P-glycoprotein (P-gp, ABCB1) and breast cancer resistance protein (BCRP, ABCG2) are expressed at the blood–brain barrier (BBB), and can limit the access of a wide range of drugs to the brain. In this study we developed a PET-CT imaging method for non-invasive, quantitative analysis of the effect of ABCB1 and ABCG2 on brain penetration of the anti-cancer drug gefitinib, and demonstrated the applicability of this method for identification and quantification of potential modulators of ABCB1 and ABCB2 using the dual inhibitor elacridar. Methods: In vitro cellular accumulation studies with [ 14 C]-gefitinib were conducted in LLC-PK1, MDCKII, and the corresponding ABCB1/Abcb1a and ABCG2/Abcg2 overexpressing cell lines. Subsequently, in vivo brain penetration of [ 18 F]-gefitinib was quantified by PET-CT imaging studies in wild-type, Abcg2 −/− , Abcb1a/1b −/− , and Abcb1a/1b;Abcg2 −/− mice. Results: In vitro studies showed that [ 14 C]-gefitinib is a substrate of the human ABCB1 and ABCG2 transporters. After i.v. administration of [ 18 F]-gefitinib (1 mg/kg), PET-CT imaging showed 2.3-fold increased brain levels of [ 18 F]-gefitinib in Abcb1a/1b;Abcg2 −/− mice, compared to wild-type. Levels in single knockout animals were not different from wild-type, showing that Abcb1a/1b and Abcg2 together limit access of [ 18 F]-gefitinib to the brain. Furthermore, enhanced brain accumulation of [ 18 F]-gefitinib after administration of the ABCB1 and ABCG2 inhibitor elacridar (10 mg/kg) could be quantified with PET-CT imaging. Conclusions: PET-CT imaging with [ 18 F]-gefitinib is a powerful tool to non-invasively assess potential ABCB1- and ABCG2-mediated drug–drug interactions (DDIs) in vivo. Advances in knowledge and implications for patient care: This minimally-invasive, [ 18 F]-based PET-CT imaging method shows the interplay of ABCB1 and ABCG2 at the BBB in vivo. The method may be applied in the future to assess ABCB1 and
Structure and function of ABCG2-rich extracellular vesicles mediating multidrug resistance.
Directory of Open Access Journals (Sweden)
Vicky Goler-Baron
2011-01-01
Full Text Available Multidrug resistance (MDR is a major impediment to curative cancer chemotherapy. The ATP-Binding Cassette transporters ABCG2, ABCB1 and ABCC2 form a unique defense network against multiple structurally and functionally distinct chemotherapeutics, thereby resulting in MDR. Thus, deciphering novel mechanisms of MDR and their overcoming is a major goal of cancer research. Recently we have shown that overexpression of ABCG2 in the membrane of novel extracellular vesicles (EVs in breast cancer cells results in mitoxantrone resistance due to its dramatic sequestration in EVs. However, nothing is known about EVs structure, biogenesis and their ability to concentrate multiple antitumor agents. To this end, we here found that EVs are structural and functional homologues of bile canaliculi, are apically localized, sealed structures reinforced by an actin-based cytoskeleton and secluded from the extracellular milieu by the tight junction proteins occludin and ZO-1. Apart from ABCG2, ABCB1 and ABCC2 were also selectively targeted to the membrane of EVs. Moreover, Ezrin-Radixin-Moesin protein complex selectively localized to the border of the EVs membrane, suggesting a key role for the tethering of MDR pumps to the actin cytoskeleton. The ability of EVs to concentrate and sequester different antitumor drugs was also explored. Taking advantage of the endogenous fluorescence of anticancer drugs, we found that EVs-forming breast cancer cells display high level resistance to topotecan, imidazoacridinones and methotrexate via efficient intravesicular drug concentration hence sequestering them away from their cellular targets. Thus, we identified a new modality of anticancer drug compartmentalization and resistance in which multiple chemotherapeutics are actively pumped from the cytoplasm and highly concentrated within the lumen of EVs via a network of MDR transporters differentially targeted to the EVs membrane. We propose a composite model for the structure and
DEFF Research Database (Denmark)
Andersen, Vibeke; Vogel, Lotte K.; Kopp, Tine Iskov
2015-01-01
Development of colorectal cancer (CRC) may result from a dysfunctional interplay between diet, gut microbes and the immune system. The ABC transport proteins ABCB1 (P-glycoprotein, Multidrug resistance protein 1, MDR1), ABCC2 (MRP2) and ABCG2 (BCRP) are involved in transport of various compounds...
Rajput, Pallavi; Pandey, Vijaya; Kumar, Vijay
2016-08-01
The well-studied Pol II transcription factor Sp1 has not been investigated for its regulatory role in rDNA transcription. Here, we show that Sp1 bound to specific sites on rDNA and localized into the nucleoli during the G1 phase of cell cycle to activate rDNA transcription. It facilitated the recruitment of Pol I pre-initiation complex and impeded the binding of nucleolar remodeling complex (NoRC) to rDNA resulting in the formation of euchromatin active state. More importantly, Sp1 also orchestrated the site-specific binding of Gadd45a-nucleotide excision repair (NER) complex resulting in active demethylation and transcriptional activation of rDNA. Interestingly, knockdown of Sp1 impaired rDNA transcription due to reduced engagement of the Gadd45a-NER complex and hypermethylation of rDNA. Thus, the present study unveils a novel role of Sp1 in rDNA transcription involving promoter demethylation. Copyright © 2016 Elsevier B.V. All rights reserved.
Oxidative demethylation of monomethylmercury in sediments
International Nuclear Information System (INIS)
Oremland, R.S.
1991-01-01
Previous studies suggested that demethylation of monomethylmercury proceeds in nature by a simple organo-mercury lyase reaction resulting in the production of CH 4 and Hg 2+ , which is further reduced to Hg 0 . Addition of 14 CH 3 HgI to sediments resulted in the production of mainly 14 CO 2 and some 14 CH 4 . In the case of estuarine sediments, production of both these gases was only observed under anaerobiosis, and was totally inhibited by MoO 4 2- , which indicated the involvement of sulfate-reducing bacteria. In the case of anaerobic freshwater sediments, results with inhibitors indicated that both methanogens and sulfate reducers were involved in this oxidative demethylation. Aerobic incubation of estuarine sediments resulted in the production of only 14 CH 4 , indicating the importance of the organo-mercurial lyase reaction under this condition. However, in freshwater sediments, this reaction was not observed, and the oxidative demethylation reaction was predominant either under aerobic or anaerobic conditions. A methylotrophic methanogen (GS-16) was able to form traces of 14 CH 4 and 14 CO 2 from 14 CH 3 HgI, and some strains of sulfate-reducers formed traces of 14 CH 4 . Addition of methanol to anaerobic freshwater sediments partially inhibited production of 14 CH 4 and 14 CO 2 , but not CH 4 . These results suggest that oxidative demethylation proceeds by an established pathway for C-1 metabolism
Ishikawa, Toshihisa; Aw, Wanping; Kaneko, Kiyoko
2013-11-04
In mammals, excess purine nucleosides are removed from the body by breakdown in the liver and excretion from the kidneys. Uric acid is the end product of purine metabolism in humans. Two-thirds of uric acid in the human body is normally excreted through the kidney, whereas one-third undergoes uricolysis (decomposition of uric acid) in the gut. Elevated serum uric acid levels result in gout and could be a risk factor for cardiovascular disease and diabetes. Recent studies have shown that human ATP-binding cassette transporter ABCG2 plays a role of renal excretion of uric acid. Two non-synonymous single nucleotide polymorphisms (SNPs), i.e., 421C>A (major) and 376C>T (minor), in the ABCG2 gene result in impaired transport activity, owing to ubiquitination-mediated proteosomal degradation and truncation of ABCG2, respectively. These genetic polymorphisms are associated with hyperuricemia and gout. Allele frequencies of those SNPs are significantly higher in Asian populations than they are in African and Caucasian populations. A rapid and isothermal genotyping method has been developed to detect the SNP 421C>A, where one drop of peripheral blood is sufficient for the detection. Development of simple genotyping methods would serve to improve prevention and early therapeutic intervention for high-risk individuals in personalized healthcare.
The ABCG5/8 Cholesterol Transporter and Myocardial Infarction Versus Gallstone Disease
DEFF Research Database (Denmark)
Stender, Stefan; Frikke-Schmidt, Ruth; Nordestgaard, Børge G
2014-01-01
OBJECTIVES: The study sought to test the hypothesis that genetic variation in ABCG5/8, the transporter responsible for intestinal and hepatobiliary cholesterol efflux, may simultaneously influence plasma and biliary cholesterol levels, and hence risk of myocardial infarction (MI) and gallstone...... disease in opposite directions. BACKGROUND: High plasma levels of low-density lipoprotein (LDL) cholesterol are a causal risk factor for MI, whereas high levels of biliary cholesterol promote gallstone formation. METHODS: A total of 60,239 subjects from Copenhagen were included, including 5,647 with MI...... and 3,174 with symptomatic gallstone disease. Subjects were genotyped for 6 common, nonsynonymous and functional variants in ABCG5/8, and a combined weighted genotype score was calculated. RESULTS: Combined, weighted genotype scores were associated with stepwise decreases in LDL cholesterol of up to 5...
Qiu, Ya; Liu, Hua; Qing, Yufeng; Yang, Min; Tan, Xiaoyao; Zhao, Mingcai; Lin, Monica; Zhou, Jingguo
2014-09-01
Individual genetic association studies examining the relationship between the ABCG2 gene polymorphisms and gout have yielded inconsistent results. This study aims to evaluate the association between the ABCG2 gene variants and gout using meta-analysis. Relevant studies were identified by searching databases extensively. The odds ratio (OR) was calculated using a random-effect or fixed-effect model. A Q statistic was used to evaluate homogeneity, and Egger's test and funnel plot were used to assess publication bias. Subgroup analyses on ethnicities and sex were also performed. A total of 7 studies, including 2185 gout patients and 8028 controls from 5 countries or regions, were included and identified for the current meta-analysis. It was found that the A allele or AA genotype of the ABCG2 Q141K polymorphism (rs2231142) had an increased risk of gout in the general population (A allele, p gout (p gout.
ERRα induces H3K9 demethylation by LSD1 to promote cell invasion
Carnesecchi, Julie; Forcet, Christelle; Zhang, Ling; Tribollet, Violaine; Barenton, Bruno; Boudra, Rafik; Cerutti, Catherine; Billas, Isabelle M. L.; Sérandour, Aurélien A.; Carroll, Jason S.; Beaudoin, Claude; Vanacker, Jean-Marc
2017-01-01
Lysine Specific Demethylase 1 (LSD1) removes mono- and dimethyl groups from lysine 4 of histone H3 (H3K4) or H3K9, resulting in repressive or activating (respectively) transcriptional histone marks. The mechanisms that control the balance between these two antagonist activities are not understood. We here show that LSD1 and the orphan nuclear receptor estrogen-related receptor α (ERRα) display commonly activated genes. Transcriptional activation by LSD1 and ERRα involves H3K9 demethylation at the transcriptional start site (TSS). Strikingly, ERRα is sufficient to induce LSD1 to demethylate H3K9 in vitro. The relevance of this mechanism is highlighted by functional data. LSD1 and ERRα coregulate several target genes involved in cell migration, including the MMP1 matrix metallo-protease, also activated through H3K9 demethylation at the TSS. Depletion of LSD1 or ERRα reduces the cellular capacity to invade the extracellular matrix, a phenomenon that is rescued by MMP1 reexpression. Altogether our results identify a regulatory network involving a direct switch in the biochemical activities of a histone demethylase, leading to increased cell invasion. PMID:28348226
ERRα induces H3K9 demethylation by LSD1 to promote cell invasion.
Carnesecchi, Julie; Forcet, Christelle; Zhang, Ling; Tribollet, Violaine; Barenton, Bruno; Boudra, Rafik; Cerutti, Catherine; Billas, Isabelle M L; Sérandour, Aurélien A; Carroll, Jason S; Beaudoin, Claude; Vanacker, Jean-Marc
2017-04-11
Lysine Specific Demethylase 1 (LSD1) removes mono- and dimethyl groups from lysine 4 of histone H3 (H3K4) or H3K9, resulting in repressive or activating (respectively) transcriptional histone marks. The mechanisms that control the balance between these two antagonist activities are not understood. We here show that LSD1 and the orphan nuclear receptor estrogen-related receptor α (ERRα) display commonly activated genes. Transcriptional activation by LSD1 and ERRα involves H3K9 demethylation at the transcriptional start site (TSS). Strikingly, ERRα is sufficient to induce LSD1 to demethylate H3K9 in vitro. The relevance of this mechanism is highlighted by functional data. LSD1 and ERRα coregulate several target genes involved in cell migration, including the MMP1 matrix metallo-protease, also activated through H3K9 demethylation at the TSS. Depletion of LSD1 or ERRα reduces the cellular capacity to invade the extracellular matrix, a phenomenon that is rescued by MMP1 reexpression. Altogether our results identify a regulatory network involving a direct switch in the biochemical activities of a histone demethylase, leading to increased cell invasion.
Luo, Yong-Li; Ma, Guang-Xu; Luo, Yong-Fang; Kuang, Ce-Yan; Jiang, Ai-Yun; Li, Guo-Qing; Zhou, Rong-Qiong
2018-03-01
Toxocara canis is a zoonotic parasite with worldwide distribution. ATP-binding cassette (ABC) transporters are integral membrane proteins which involve in a range of biological processes in various organisms. In present study, the full-length coding sequence of abcg-5 gene of T. canis (Tc-abcg-5) was cloned and characterized. A 633 aa polypeptide containing two conserved Walker A and Walker B motifs was predicted from a continuous 1902 nt open reading frame. Quantitative real-time PCR was employed to determine the transcriptional levels of Tc-abcg-5 gene in adult male and female worms, which indicated high mRNA level of Tc-abcg-5 in the reproductive tract of adult female T. canis. Tc-abcg-5 was expressed to produce rabbit polyclonal antiserum against recombinant TcABCG5. Indirect-fluorescence immunohistochemical assays were carried out to detect the tissue distribution of TcABCG5, which showed predominant distribution of TcABCG5 in the uterus (especially in the germ cells) of adult female T. canis. Tissue transcription and expression pattern of Tc-abcg-5 indicated that Tc-abcg-5 might play essential roles in the reproduction of this parasitic nematode.
Directory of Open Access Journals (Sweden)
Kiyoko Kaneko
2013-11-01
Full Text Available In mammals, excess purine nucleosides are removed from the body by breakdown in the liver and excretion from the kidneys. Uric acid is the end product of purine metabolism in humans. Two-thirds of uric acid in the human body is normally excreted through the kidney, whereas one-third undergoes uricolysis (decomposition of uric acid in the gut. Elevated serum uric acid levels result in gout and could be a risk factor for cardiovascular disease and diabetes. Recent studies have shown that human ATP-binding cassette transporter ABCG2 plays a role of renal excretion of uric acid. Two non-synonymous single nucleotide polymorphisms (SNPs, i.e., 421C>A (major and 376C>T (minor, in the ABCG2 gene result in impaired transport activity, owing to ubiquitination-mediated proteosomal degradation and truncation of ABCG2, respectively. These genetic polymorphisms are associated with hyperuricemia and gout. Allele frequencies of those SNPs are significantly higher in Asian populations than they are in African and Caucasian populations. A rapid and isothermal genotyping method has been developed to detect the SNP 421C>A, where one drop of peripheral blood is sufficient for the detection. Development of simple genotyping methods would serve to improve prevention and early therapeutic intervention for high-risk individuals in personalized healthcare.
Otero, J A; Barrera, B; de la Fuente, A; Prieto, J G; Marqués, M; Álvarez, A I; Merino, G
2015-01-01
The ATP-binding cassette transporter ABCG2 restricts the exposure of certain drugs and natural compounds in different tissues and organs. Its expression in the mammary gland is induced during lactation and is responsible for the active secretion of many compounds into milk, including antimicrobial agents. This particular function of ABCG2 may affect drug efficacy against mastitis and the potential presence of drug residues in the milk. Previous in vitro and in vivo studies showed increased transport of several compounds, including fluoroquinolones, by the bovine ABCG2 Y581S polymorphism. Our main purpose was to study the potential effect of this bovine ABCG2 polymorphism on the secretion into milk of the antimicrobial danofloxacin administered at the therapeutic dose of 6mg/kg used for mastitis treatment. In addition, the effect of this polymorphism on the relative mRNA and protein levels of ABCG2 by quantitative real-time PCR and Western blot were studied. Danofloxacin 18% (6mg/kg) was administered to 6 Y/Y homozygous and 5 Y/S heterozygous cows. Danofloxacin levels in milk and milk-to-plasma concentration ratios were almost 1.5- and 2-fold higher, respectively, in Y/S cows compared with the Y/Y cows, showing a higher capacity of this variant to transport danofloxacin into milk. Furthermore, the higher activity of this polymorphism is not linked to higher ABCG2 mRNA or protein levels. These results demonstrate the relevant effect of the Y581S polymorphism of the bovine ABCG2 transporter in the secretion into milk of danofloxacin after administration of 6mg/kg, with potentially important consequences for mastitis treatment and for milk residue handling. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Malur, Anagha; Huizar, Isham; Wells, Greg; Barna, Barbara P.; Malur, Achut G.; Thomassen, Mary Jane
2011-01-01
but improved significantly after lenti-ABCG1 treatment. Data demonstrate that in vivo instillation of lenti-ABCG1 in GM-CSF KO mice is sufficient to restore pulmonary homeostasis by: (1) upregulating ABCG1; (2) reducing intra and extracellular lipids; and (3) improving lung function. Results suggest that the ABCG1 lipid transporter is the key downstream target of GM-CSF-induced PPARγ necessary for surfactant catabolism.
A novel ABCG-like transporter of Trypanosoma cruzi is involved in natural resistance to benznidazole
Directory of Open Access Journals (Sweden)
Bianca Zingales
2015-05-01
Full Text Available Benznidazole (BZ is one of the two drugs used for Chagas disease treatment. Nevertheless therapeutic failures of BZ have been reported, which were mostly attributed to variable drug susceptibility among Trypanosoma cruzi strains. ATP-binding cassette (ABC transporters are involved in a variety of translocation processes and some members have been implicated in drug resistance. Here we report the characterisation of the first T. cruzi ABCG transporter gene, named TcABCG1, which is over-expressed in parasite strains naturally resistant to BZ. Comparison of TcABCG1 gene sequence of two TcI BZ-resistant strains with CL Brener BZ-susceptible strain showed several single nucleotide polymorphisms, which determined 11 amino acid changes. CL Brener transfected with TcI transporter genes showed 40-47% increased resistance to BZ, whereas no statistical significant increment in drug resistance was observed when CL Brener was transfected with the homologous gene. Only in the parasites transfected with TcI genes there was 2-2.6-fold increased abundance of TcABCG1 transporter protein. The analysis in wild type strains also suggests that the level of TcABCG1 transporter is related to BZ natural resistance. The characteristics of untranslated regions of TcABCG1 genes of BZ-susceptible and resistant strains were investigated by computational tools.
Directory of Open Access Journals (Sweden)
Xuyong LIN, , , , ,
2009-04-01
Full Text Available Background and objective Increasing reports showed that some tumor stem cells were selfrenewal and multi-lineage differentiated in tumors, similar to the normal stem cells in human body. The aim of this study is to observe the expression of stem cell markers in lung squamous carcinoma tissues. Methods Fifty-four lung cancer specimens from surgery were analyzed for CK19, Notch3, CD133, P75NTR, STRO-1 and ABCG2 expression by using S-P immunohistochemistry. In addition, ten normal lung tissue samples were included as control. Results CK19, Notch3, CD133 and ABCG2 were expressed in 54 Lung cancer tissues, without expression of P75NTR and STRO-1. The expressionrate of CK19, Notch3, CD133 and ABCG2 was 66.67% (36/54, 87.04% (47/54, 50% (27/54, and 61.11% (33/54 respectively. The levels of expression of Notch3, CD133 and ABCG2 were significantly lower in high differentiation group than those in moderate and low differentiation group (P <0.05. The levels of expression of CK19, CD133 and ABCG2 were significantly higher in lymph node metastasis group than those in non-metastasis group (P <0.05. The percentage of total positive cells of four stem cell markers in serial tissue sections was lower than 2%. Conclusion There was expression ofsome stem cell markers in pulmonary squamous carcinomas, and there was relationship between expression degree withdifferentiation degree and lymph node metastasis.
Bloks, VW; Bakker-van Waarde, WM; Verkade, HJ; Kema, IP; Wolters, H; Vink, E; Groen, AK; Kuipers, F
Aim/hypothesis., Type I diabetes is associated with altered hepatic bile formation and increased intestinal cholesterol absorption. The aim of this study was to evaluate whether altered expression of the ATP-Binding Cassette half-transporters Abcg5 and Abcg8, recently implicated in control of both
Energy Technology Data Exchange (ETDEWEB)
Malur, Anagha; Huizar, Isham [Program in Lung Cell Biology and Translational Research, Division of Pulmonary, Critical Care and Sleep Medicine, East Carolina University, Greenville, NC (United States); Wells, Greg [Department of Microbiology and Immunology, East Carolina University, Greenville, NC (United States); Barna, Barbara P. [Program in Lung Cell Biology and Translational Research, Division of Pulmonary, Critical Care and Sleep Medicine, East Carolina University, Greenville, NC (United States); Malur, Achut G. [Department of Microbiology and Immunology, East Carolina University, Greenville, NC (United States); Thomassen, Mary Jane, E-mail: thomassenm@ecu.edu [Program in Lung Cell Biology and Translational Research, Division of Pulmonary, Critical Care and Sleep Medicine, East Carolina University, Greenville, NC (United States); Department of Microbiology and Immunology, East Carolina University, Greenville, NC (United States)
2011-11-18
analysis of bronchoalveolar lavage fluid. Lung compliance was diminished in untreated GMCSF KO mice but improved significantly after lenti-ABCG1 treatment. Data demonstrate that in vivo instillation of lenti-ABCG1 in GM-CSF KO mice is sufficient to restore pulmonary homeostasis by: (1) upregulating ABCG1; (2) reducing intra and extracellular lipids; and (3) improving lung function. Results suggest that the ABCG1 lipid transporter is the key downstream target of GM-CSF-induced PPAR{gamma} necessary for surfactant catabolism.
Studzian, Maciej; Bartosz, Grzegorz; Pulaski, Lukasz
2015-08-01
ABCG2, a metabolite and xenobiotic transporter located at the plasma membrane (predominantly in barrier tissues and progenitor cells), undergoes a direct progressive endocytosis process from plasma membrane to intracellular compartments upon binding of 5D3 monoclonal antibody. This antibody is specific to an external epitope on the protein molecule and locks it in a discrete conformation within its activity cycle, presumably providing a structural trigger for the observed internalization phenomenon. Using routine and novel assays, we show that ABCG2 is endocytosed by a mixed mechanism: partially via a rapid, clathrin-dependent pathway and partially in a cholesterol-dependent, caveolin-independent manner. While the internalization process is entirely dynamin-dependent and converges initially at the early endosome, subsequent intracellular fate of ABCG2 is again twofold: endocytosis leads to only partial lysosomal degradation, while a significant fraction of the protein is retained in a post-endosomal compartment with the possibility of at least partial recycling back to the cell surface. This externally triggered, conformation-related trafficking pathway may serve as a general regulatory paradigm for membrane transporters, and its discovery was made possible thanks to consistent application of quantitative methods. Copyright © 2015 Elsevier B.V. All rights reserved.
Ben Cheikh, Yosra; Xuereb, Benoit; Boulangé-Lecomte, Céline; Le Foll, Frank
2018-02-01
Among the cellular protection arsenal, ABC transporters play an important role in xenobiotic efflux in marine organisms. Two pumps belonging to B and C subfamily has been identified in Mytilus edulis. In this study, we investigated the presence of the third major subtype ABCG2/BCRP protein in mussel tissues. Transcript was expressed in hemocytes and with higher level in gills. Molecular characterization revealed that mussel ABCG2 transporter shares the sequence and organizational structure with mammalian and molluscan orthologs. Overall identity of the predicted amino acid sequence with corresponding homologs from other organisms was between 49% and 98%. Moreover, protein efflux activity was demonstrated using a combination of fluorescent allocrites and specific inhibitors. The accumulation of bodipy prazosin and pheophorbide A was heterogeneous in gills and hemocytes. Most of the used blockers enhanced probe accumulation at different levels, most significantly for bodipy prazosin. Moreover, Mrp classical blocker MK571 showed a polyspecificity. In conclusion, our data demonstrate that several ABC transporters contribute to MXR phenotype in the blue mussel including ABCG2 that forms an active pump in hemocytes and gills. Efforts are needed to distinguish between the different members and to explore their single function and specificity towards allocrites and chemosensitizers. Copyright © 2017 Elsevier B.V. All rights reserved.
Biochemistry and occurrence of O-demethylation in plant metabolism
Directory of Open Access Journals (Sweden)
Jillian Hagel
2010-07-01
Full Text Available Demethylases play a pivitol role in numerous biological processes from covalent histone modification and DNA repair to specialized metabolism in plants and microorganisms. Enzymes that catalyze O- and N-demethylation include 2-oxoglutarate (2OG/Fe(II-dependent dioxygenases, cytochromes P450, Rieske-domain proteins and flavin adenine dinucleotide (FAD-dependent oxidases. Proposed mechanisms for demethylation by 2OG/Fe(II-dependent enzymes involve hydroxylation at the O- or N-linked methyl group followed by formaldehyde elimination. Members of this enzyme family catalyze a wide variety of reactions in diverse plant metabolic pathways. Recently, we showed that 2OG/Fe(II-dependent dioxygenases catalyze the unique O-demethylation steps of morphine biosynthesis in opium poppy, which provides a rational basis for the widespread occurrence of demethylases in benzylisoquinoline alkaloid metabolism.
DEFF Research Database (Denmark)
Litman, Thomas; Jensen, Ulla; Hansen, Alastair
2002-01-01
Recent studies have characterized the ABC half-transporter associated with mitoxantrone resistance in human cancer cell lines. Encoded by the ABCG2 gene, overexpression confers resistance to camptothecins, as well as to mitoxantrone. We developed four polyclonal antibodies against peptides corres...
Khan, Adil Mehraj; Rampal, Satyavan; Sood, Naresh Kumar
2018-03-01
Adenosine triphosphate-binding cassette (ABC) sub-family G member-2 (ABCG-2) is a transporter protein, implicated for multi-drug efflux from tissues. This study evaluated the effect of fluoroquinolones; levofloxacin, pazufloxacin and enrofloxacin, and non-steroidal anti-inflammatory drug, meloxicam; on the immunolocalization of ABCG-2 transporter protein of rabbit retinas. Thirty-two male rabbits were randomly divided in to eight groups. Control group was gavaged, 2% benzyl alcohol in 5% dextrose since these chemicals are excipients of the drug preparations used in the treatment groups of this study. Four groups were exclusively gavaged, levofloxacin hemihydrate (10 mg/kg body weight b.i.d 12 h), pazufloxacin mesylate (10 mg/kg body weight b.i.d 12 h), enrofloxacin (20 mg/kg body weight o.d.), and meloxicam (0.2 mg/kg body weight o.d.), respectively. Three other groups were co-gavaged meloxicam with above fluoroquinolones, respectively. These drugs were administered for 21 days. ABCG-2 immunolocalization was mild in the retinas of control and levofloxacin-alone-treated groups. The immunolocalization intensity was significantly higher in meloxicam-alone-treated group when compared to control and levofloxacin-alone-treated groups. Immunolocalization of this transporter increased in the levofloxacin-meloxicam co-treated group when compared to the levofloxacin-alone-treated group. Highest immunolocalization was observed in the enrofloxacin-meloxicam co-treated group although the immunolocalization of all treatment groups, except the levofloxacin-alone-treated group, was significantly higher than the control and levofloxacin-alone-treated groups.
International Nuclear Information System (INIS)
Mossman, David; Kim, Kyu-Tae; Scott, Rodney J
2010-01-01
DNA methylation and histone acetylation are epigenetic modifications that act as regulators of gene expression. Aberrant epigenetic gene silencing in tumours is a frequent event, yet the factors which dictate which genes are targeted for inactivation are unknown. DNA methylation and histone acetylation can be modified with the chemical agents 5-aza-2'-deoxycytidine (5-aza-dC) and Trichostatin A (TSA) respectively. The aim of this study was to analyse de-methylation and re-methylation and its affect on gene expression in colorectal cancer cell lines treated with 5-aza-dC alone and in combination with TSA. We also sought to identify methylation patterns associated with long term reactivation of previously silenced genes. Colorectal cancer cell lines were treated with 5-aza-dC, with and without TSA, to analyse global methylation decreases by High Performance Liquid Chromatography (HPLC). Re-methylation was observed with removal of drug treatments. Expression arrays identified silenced genes with differing patterns of expression after treatment, such as short term reactivation or long term reactivation. Sodium bisulfite sequencing was performed on the CpG island associated with these genes and expression was verified with real time PCR. Treatment with 5-aza-dC was found to affect genomic methylation and to a lesser extent gene specific methylation. Reactivated genes which remained expressed 10 days post 5-aza-dC treatment featured hypomethylated CpG sites adjacent to the transcription start site (TSS). In contrast, genes with uniformly hypermethylated CpG islands were only temporarily reactivated. These results imply that 5-aza-dC induces strong de-methylation of the genome and initiates reactivation of transcriptionally inactive genes, but this does not require gene associated CpG island de-methylation to occur. In addition, for three of our selected genes, hypomethylation at the TSS of an epigenetically silenced gene is associated with the long term reversion of
Promoter de-methylation of cyclin D2 by sulforaphane in prostate cancer cells
Directory of Open Access Journals (Sweden)
Hsu Anna
2011-10-01
Full Text Available Abstract Sulforaphane (SFN, an isothiocyanate derived from cruciferous vegetables, induces potent anti-proliferative effects in prostate cancer cells. One mechanism that may contribute to the anti-proliferative effects of SFN is the modulation of epigenetic marks, such as inhibition of histone deacetylase (HDAC enzymes. However, the effects of SFN on other common epigenetic marks such as DNA methylation are understudied. Promoter hyper-methylation of cyclin D2, a major regulator of cell cycle, is correlated with prostate cancer progression, and restoration of cyclin D2 expression exerts anti-proliferative effects on LnCap prostate cancer cells. Our study aimed to investigate the effects of SFN on DNA methylation status of cyclin D2 promoter, and how alteration in promoter methylation impacts cyclin D2 gene expression in LnCap cells. We found that SFN significantly decreased the expression of DNA methyltransferases (DNMTs, especially DNMT1 and DNMT3b. Furthermore, SFN significantly decreased methylation in cyclin D2 promoter regions containing c-Myc and multiple Sp1 binding sites. Reduced methlyation of cyclin D2 promoter corresponded to an increase in cyclin D2 transcript levels, suggesting that SFN may de-repress methylation-silenced cyclin D2 by impacting epigenetic pathways. Our results demonstrated the ability of SFN to epigenetically modulate cyclin D2 expression, and provide novel insights into the mechanisms by which SFN may regulate gene expression as a prostate cancer chemopreventive agent.
Czech Academy of Sciences Publication Activity Database
Campa, D.; Pardini, Barbara; Naccarati, Alessio; Vodičková, Ludmila; Novotný, J.; Försti, A.; Hemminki, K.; Barale, R.; Vodička, Pavel; Canzian, F.
2008-01-01
Roč. 645, 1-2 (2008), s. 56-60 ISSN 0027-5107 R&D Projects: GA ČR GA310/07/1430 Institutional research plan: CEZ:AV0Z50390512; CEZ:AV0Z50390703 Keywords : ABCG2 * Transporter * Colorectal cancer Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.198, year: 2008
Sjostedt, N.; Heuvel, J.J.M.W. van den; Koenderink, J.B.; Kidron, H.
2017-01-01
PURPOSE: To study the function and expression of nine naturally occurring single-nucleotide polymorphisms (G406R, F431L, S441N, P480L, F489L, M515R, L525R, A528T and T542A) that are predicted to reside in the transmembrane regions of the ABC transporter ABCG2. METHODS: The transport activity of the
Maeda, Akimitsu; Ando, Hitoshi; Ura, Takashi; Komori, Azusa; Hasegawa, Ayako; Taniguchi, Hiroya; Kadowaki, Shigenori; Muro, Kei; Tajika, Masahiro; Kobara, Makiko; Matsuzaki, Masahide; Hashimoto, Naoya; Maeda, Mieko; Kojima, Yasushi; Aoki, Masahiro; Kondo, Eisaku; Mizutani, Akiyoshi; Fujimura, Akio
2017-05-01
Due to the occurrence of severe adverse drug reactions to regorafenib, a drug used in cancer therapy, the identification of a predictive marker(s) is needed to increase the therapeutic applicability of this compound. We therefore investigated whether polymorphisms in the ABCG2 and SLCO1B genes are associated with adverse drug reactions to regorafenib. For these analyses, 37 Japanese cancer patients were treated with regorafenib, genotyped for polymorphisms in ABCG2 and SLCO1B, and evaluated for drug-related adverse drug reactions. There was no association between the ABCG2 421C>A variant and adverse drug reactions to regorafenib. After treatment, the incidences of increased aspartate aminotransferase (AST) and alanine aminotransferase (ALT) as well as increased total bilirubin (grade ≥ 2) were 8%, 4%, and 12%, and 42%, 25%, and 25% among SLCO1B1*1b carriers and non-carriers, respectively. There were no significant associations between elevated ALT and bilirubin and the SLCO1B1*1b allele. However, there were significantly lower incidences of increased AST (8% vs. 42%) and anemia (16% vs. 50%) in SLCO1B1*1b carriers than in non-carriers. The absence of SLCO1B1*1b allele appears to be associated with the development of adverse drug reactions to regorafenib; however, further studies involving larger test groups and other populations are needed to confirm these findings. .
Targeted DNA demethylation of the Arabidopsis genome using the human TET1 catalytic domain
Gallego-Bartolomé, Javier; Gardiner, Jason; Liu, Wanlu; Papikian, Ashot; Ghoshal, Basudev; Kuo, Hsuan Yu; Zhao, Jenny Miao-Chi; Jacobsen, Steven E.
2018-01-01
DNA methylation is an important epigenetic modification involved in gene regulation and transposable element silencing. Changes in DNA methylation can be heritable and, thus, can lead to the formation of stable epialleles. A well-characterized example of a stable epiallele in plants is fwa, which consists of the loss of DNA cytosine methylation (5mC) in the promoter of the FLOWERING WAGENINGEN (FWA) gene, causing up-regulation of FWA and a heritable late-flowering phenotype. Here we demonstrate that a fusion between the catalytic domain of the human demethylase TEN-ELEVEN TRANSLOCATION1 (TET1cd) and an artificial zinc finger (ZF) designed to target the FWA promoter can cause highly efficient targeted demethylation, FWA up-regulation, and a heritable late-flowering phenotype. Additional ZF–TET1cd fusions designed to target methylated regions of the CACTA1 transposon also caused targeted demethylation and changes in expression. Finally, we have developed a CRISPR/dCas9-based targeted demethylation system using the TET1cd and a modified SunTag system. Similar to the ZF–TET1cd fusions, the SunTag–TET1cd system is able to target demethylation and activate gene expression when directed to the FWA or CACTA1 loci. Our study provides tools for targeted removal of 5mC at specific loci in the genome with high specificity and minimal off-target effects. These tools provide the opportunity to develop new epialleles for traits of interest, and to reactivate expression of previously silenced genes, transgenes, or transposons. PMID:29444862
Bloks, VW; Bakker-van Waarde, WW; Verkade, HJ; Kema, IP; Havinga, R; Wolters, H; Schaap, FG; Sauer, PJJ; Vink, E; Groen, AK; Kuipers, F
ABSTRACT: P234 Downregulation of Hepatic and Intestinal ATP-Binding-Cassette Transporters Abcg5 and Abcg8 Expression Associated with Altered Sterol Fluxes in Rats with Streptozotocin-Induced Diabetes Vincent W. Bloks, Willie W. Bakker-van Waarde, Henkjan J. Verkade, Ido P. Kema, Rick Havinga, Henk
Arabidopsis ABCG14 protein controls the acropetal translocation of root-synthesized cytokinins
Zhang, Kewei; Novak, Ondrej; Wei, Zhaoyang; Gou, Mingyue; Zhang, Xuebin; Yu, Yong; Yang, Huijun; Cai, Yuanheng; Strnad, Miroslav; Liu, Chang-Jun
2014-02-01
Cytokinins are a major group of phytohormones regulating plant growth, development and stress responses. However, in contrast to the well-defined polar transport of auxins, the molecular basis of cytokinin transport is poorly understood. Here we show that an ATP-binding cassette transporter in Arabidopsis, AtABCG14, is essential for the acropetal (root to shoot) translocation of the root-synthesized cytokinins. AtABCG14 is expressed primarily in the pericycle and stelar cells of roots. Knocking out AtABCG14 strongly impairs the translocation of trans-zeatin (tZ)-type cytokinins from roots to shoots, thereby affecting the plant’s growth and development. AtABCG14 localizes to the plasma membrane of transformed cells. In planta feeding of C14 or C13-labelled tZ suggests that it acts as an efflux pump and its presence in the cells directly correlates with the transport of the fed cytokinin. Therefore, AtABCG14 is a transporter likely involved in the long-distance translocation of cytokinins in planta.
Huls, M.; Brown, C.D.; Windass, A.S.; Sayer, R.; Heuvel, J.J.M.W. van den; Heemskerk, S.; Russel, F.G.M.; Masereeuw, R.
2008-01-01
The Breast Cancer Resistance Protein (BCRP/ABCG2) is a transporter restricting absorption and enhancing excretion of many compounds including anticancer drugs. This transporter is highly expressed in many tissues; however, in human kidney, only the mRNA was found in contrast to the mouse kidney,
Crowe, Andrew; Keelan, Jeffrey A
2012-10-01
Human choriocarcinoma-derived BeWo cells express high levels of breast cancer resistance protein (BCRP/ABCG2) with no functional P-glycoprotein (P-gp) (ABCB1) activity, making them a potential model to study bidirectional ABCG2-mediated drug transport. However, the original BeWo clone (B24) available to researchers does not form confluent monolayers with tight junctions required by the model. Our aim was to adapt culture conditions to attempt to generate confluent BeWo monolayers for drug transport studies using the standard B24 clone. BeWo cells (B24; American Type Culture collection [ATCC]) were cultured in six-well plates or polycarbonate millicell inserts in a number of media formulations, growth supplements, and basement membrane substitutes. Cells were examined for confluence by microscopy, and transepithelial electrical resistance (TEER) was measured daily; monolayer permeability was assessed when TEER had stabilized. Optimal growth rates were achieved in culture conditions consisting of Medium 199 (M199) supplemented with epidermal growth factor (EGF; 20 ng/mL), vitamin supplements, and 10% fetal calf serum (FCS) with collagen coating. A TEER of 170 Ω in 0.6 cm(2) inserts was achieved 2 weeks after seeding under optimal conditions. The cell-impermeable diffusion marker 5(6) carboxy-2,7dichlorodihydrofluorescein (C-DCDHF) had a permeability coefficient of 3.5×10(-6) cm/s, indicative of minimal paracellular permeability. ABCG2 expression, as determined by immunoblotting, remained unaffected by confluency. In conclusion, we describe culture conditions for the B24 BeWo clone that facilitate the formation of monolayers with tighter junctions and reduced paracellular transport compared to previously published models. These growth conditions provide a good model of ABCG2-mediated drug transport in a human placental cell line.
[ROLE OF SLC2A9 AND ABCG2 GENE POLYMORPHISMS IN ORIGIN OF HYPERURICEMIA AND GOUT].
Fadieieva, A; Prystupa, L; Pogorelova, O; Kirichenko, N; Dudchenko, I
2016-03-01
The polymorphisms V253I, Q126X, Q141K of SLC2A9 and ABCG2 genes were characterized. GCA и GTC haplotypes of Q126X and Q141K variants can be predictors of gout. The relationship of these polymorphisms with hyperuricaemia according to gender, metabolic syndrome components, with the response to allopurinol was analyzed. It has been established that Q141K polymorphism can directly modulate BCRP-mediated allopurinol and oxypurinol efflux, the K allele is associated with a lower reduction in serum uric acid in response to allopurinol treatment.
The ABCG5 ABCG8 sterol transporter and phytosterols: implications for cardiometabolic disease
Sabeva, Nadezhda S.; Liu, Jingjing; Graf, Gregory A.
2014-01-01
Purpose of review This review summarizes recent developments in the activity, regulation, and physiology of the ABCG5 ABCG8 (G5G8) transporter and the use of its xenobiotic substrates, phytosterols, as cholesterol lowering agents in the treatment of cardiovascular disease. Recent progress has significant implications for the role of G5G8 and its substrates in complications associated with features of the metabolic syndrome. Recent findings Recent reports expand the clinical presentation of sitosterolemia to include platelet and adrenal dysfunction. The G5G8 sterol transporter is critical to hepatobiliary excretion of cholesterol under nonpathological conditions and has been linked to the cholesterol gallstone susceptibility. Finally, the cardiovascular benefits of cholesterol lowering through the use of phytosterol supplements were offset by vascular dysfunction, suggesting that alternative strategies to reduced cholesterol absorption offer greater benefit. Summary Insulin resistance elevates G5G8 and increases susceptibility to cholesterol gallstones. However, this transporter is critical for the exclusion of phytosterols from the absorptive pathways in the intestine. Challenging the limits of this protective mechanism through phytosterol supplementation diminishes the cardioprotective benefits of cholesterol lowering in mouse models of cardiovascular disease. PMID:19306529
Phytosterol Feeding Causes Toxicity in ABCG5/G8 Knockout Mice
McDaniel, Allison L.; Alger, Heather M.; Sawyer, Janet K.; Kelley, Kathryn L.; Kock, Nancy D.; Brown, J. Mark; Temel, Ryan E.; Rudel, Lawrence L.
2014-01-01
Plant sterols, or phytosterols, are very similar in structure to cholesterol and are abundant in typical diets. The reason for poor absorption of plant sterols by the body is still unknown. Mutations in the ABC transporters G5 and G8 are known to cause an accumulation of plant sterols in blood and tissues (sitosterolemia). To determine the significance of phytosterol exclusion from the body, we fed wild-type and ABCG5/G8 knockout mice a diet enriched with plant sterols. The high-phytosterol diet was extremely toxic to the ABCG5/G8 knockout mice but had no adverse effects on wild-type mice. ABCG5/G8 knockout mice died prematurely and developed a phenotype that included high levels of plant sterols in many tissues, liver abnormalities, and severe cardiac lesions. This study is the first to report such toxic effects of phytosterol accumulation in ABCG5/G8 knockout mice. We believe these new data support the conclusion that plant sterols are excluded from the body because they are toxic when present at high levels. PMID:23380580
Toussaint, Frédéric; Pierman, Baptiste; Bertin, Aurélie; Lévy, Daniel; Boutry, Marc
2017-05-04
Pleiotropic drug resistance (PDR) transporters belong to the ABCG subfamily of ATP-binding cassette (ABC) transporters and are involved in the transport of various molecules across plasma membranes. During evolution, PDR genes appeared independently in fungi and in plants from a duplication of a half-size ABC gene. The enzymatic properties of purified PDR transporters from yeast have been characterized. This is not the case for any plant PDR transporter, or, incidentally, for any purified plant ABC transporter. Yet, plant PDR transporters play important roles in plant physiology such as hormone signaling or resistance to pathogens or herbivores. Here, we describe the expression, purification, enzymatic characterization and 2D analysis by electron microscopy of NpABCG5/NpPDR5 from Nicotiana plumbaginifolia , which has been shown to be involved in the plant defense against herbivores. We constitutively expressed NpABCG5/NpPDR5, provided with a His-tag in a homologous system: suspension cells from Nicotiana tabacum (Bright Yellow 2 line). NpABCG5/NpPDR5 was targeted to the plasma membrane and was solubilized by dodecyl maltoside and purified by Ni-affinity chromatography. The ATP-hydrolyzing specific activity (27 nmol min -1 mg -1 ) was stimulated seven-fold in the presence of 0.1% asolectin. Electron microscopy analysis indicated that NpABCG5/NpPDR5 is monomeric and with dimensions shorter than those of known ABC transporters. Enzymatic data (optimal pH and sensitivity to inhibitors) confirmed that plant and fungal PDR transporters have different properties. These data also show that N. tabacum suspension cells are a convenient host for the purification and biochemical characterization of ABC transporters. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.
Arsenic Demethylation by a C·As Lyase in Cyanobacterium Nostoc sp. PCC 7120.
Yan, Yu; Ye, Jun; Xue, Xi-Mei; Zhu, Yong-Guan
2015-12-15
Arsenic, a ubiquitous toxic substance, exists mainly as inorganic forms in the environment. It is perceived that organoarsenicals can be demethylated and degraded into inorganic arsenic by microorganisms. Few studies have focused on the mechanism of arsenic demethylation in bacteria. Here, we investigated arsenic demethylation in a typical freshwater cyanobacterium Nostoc sp. PCC 7120. This bacterium was able to demethylate monomethylarsenite [MAs(III)] rapidly to arsenite [As(III)] and also had the ability to demethylate monomethylarsenate [MAs(V)] to As(III). The NsarsI encoding a C·As lyase responsible for MAs(III) demethylation was cloned from Nostoc sp. PCC 7120 and heterologously expressed in an As-hypersensitive strain Escherichia coli AW3110 (ΔarsRBC). Expression of NsarsI was shown to confer MAs(III) resistance through arsenic demethylation. The purified NsArsI was further identified and functionally characterized in vitro. NsArsI existed mainly as the trimeric state, and the kinetic data were well-fit to the Hill equation with K0.5 = 7.55 ± 0.33 μM for MAs(III), Vmax = 0.79 ± 0.02 μM min(-1), and h = 2.7. Both of the NsArsI truncated derivatives lacking the C-terminal 10 residues (ArsI10) or 23 residues (ArsI23) had a reduced ability of MAs(III) demethylation. These results provide new insights for understanding the important role of cyanobacteria in arsenic biogeochemical cycling in the environment.
Bradley, Elizabeth W.; Carpio, Lomeli R.; McGee-Lawrence, Meghan E.; Becerra, Clara Castillejo; Amanatullah, Derek F.; Ta, Lauren E.; Otero, Miguel; Goldring, Mary B.; Kakar, Sanjeev; Westendorf, Jennifer J.
2016-01-01
OBJECTIVE Osteoarthritis (OA) is the most common form of arthritis and a leading cause of disability. OA is characterized by articular chondrocyte deterioration, subchondral bone changes and debilitating pain. One strategy to promote cartilage regeneration and repair is to accelerate proliferation and matrix production of articular chondrocytes. We previously reported that the protein phosphatase Phlpp1 controls chondrocyte differentiation by regulating the activities of anabolic kinases. Here we examined the role of Phlpp1 in osteoarthritis progression in a murine model. We also assessed PHLPP1 expression and promoter methylation. DESIGN Knee joints of WT and Phlpp1−/− mice were surgically destabilized by transection of the medial meniscal ligament (DMM). Mice were assessed for signs of OA progression via radiographic and histological analyses, and pain assessment for mechanical hypersensitivity using the von Frey assay. Methylation of the PHLPP1 promoter and PHLPP1 expression was evaluated in human articular cartilage and chondrocyte cell lines. RESULTS Following DMM surgeries, Phlpp1 deficient mice showed fewer signs of OA and cartilage degeneration. Mechanical allodynia associated with DMM surgeries was also attenuated in Phlpp1−/− mice. PHLPP1 was highly expressed in human articular cartilage from OA patients, but was undetectable in cartilage specimens from femoral neck fractures. Higher PHLPP1 levels correlated with less PHLPP1 promoter CpG methylation in cartilage from OA patients. Blocking cytosine methylation or treatment with inflammatory mediators enhanced PHLPP1 expression in human chondrocyte cell lines. CONCLUSION Phlpp1 deficiency protects against OA progression while CpG demethylation and inflammatory responses promote PHLPP1 expression. PMID:26746148
International Nuclear Information System (INIS)
Lawrence, Paul; Conderino, Joseph S.; Rieder, Elizabeth
2014-01-01
Previously, RNA helicase A (RHA) re-localization from the nucleus to the cytoplasm in foot-and-mouth disease virus (FMDV) infected cells was shown to coincide with loss of RHA methylated arginine residues at its C-terminus. The potential interaction between RHA and Jumonji C-domain (JmjC) protein 6 (JMJD6) arginine demethylase in infected cells was investigated. Treatment with N-oxalylglycine (NOG) inhibitor of JmjC demethylases prevented FMDV-induced RHA demethylation and re-localization, and also decreased viral protein synthesis and virus titers. Physical interaction between JMJD6 and RHA was demonstrated via reciprocal co-immunoprecipitation, where RHA preferentially bound JMJD6 monomers. Nuclear efflux of demethylated RHA (DM-RHA) coincided with nuclear influx of JMJD6, which was not observed using another picornavirus. A modified biochemical assay demonstrated JMJD6 induced dose-dependent demethylation of RHA and two RHA-derived isoforms, which could be inhibited by NOG. We propose a role for JMJD6 in RHA demethylation stimulated by FMDV, that appears to facilitate virus replication. - Highlights: • We examined the role of JMJD6 in FMDV-induced RHA demethylation process. • Using an arginine demethylation assay showed that JMJD6 is involved in RHA demethylation. • A demethylases inhibitor reduced cytoplasmic accumulation of RHA and FMDV titers
Energy Technology Data Exchange (ETDEWEB)
Lawrence, Paul; Conderino, Joseph S.; Rieder, Elizabeth, E-mail: elizabeth.rieder@ars.usda.gov
2014-03-15
Previously, RNA helicase A (RHA) re-localization from the nucleus to the cytoplasm in foot-and-mouth disease virus (FMDV) infected cells was shown to coincide with loss of RHA methylated arginine residues at its C-terminus. The potential interaction between RHA and Jumonji C-domain (JmjC) protein 6 (JMJD6) arginine demethylase in infected cells was investigated. Treatment with N-oxalylglycine (NOG) inhibitor of JmjC demethylases prevented FMDV-induced RHA demethylation and re-localization, and also decreased viral protein synthesis and virus titers. Physical interaction between JMJD6 and RHA was demonstrated via reciprocal co-immunoprecipitation, where RHA preferentially bound JMJD6 monomers. Nuclear efflux of demethylated RHA (DM-RHA) coincided with nuclear influx of JMJD6, which was not observed using another picornavirus. A modified biochemical assay demonstrated JMJD6 induced dose-dependent demethylation of RHA and two RHA-derived isoforms, which could be inhibited by NOG. We propose a role for JMJD6 in RHA demethylation stimulated by FMDV, that appears to facilitate virus replication. - Highlights: • We examined the role of JMJD6 in FMDV-induced RHA demethylation process. • Using an arginine demethylation assay showed that JMJD6 is involved in RHA demethylation. • A demethylases inhibitor reduced cytoplasmic accumulation of RHA and FMDV titers.
DEFF Research Database (Denmark)
Henriksen, Ulla Birk; Gether, Ulrik; Litman, Thomas
2005-01-01
The ATP binding cassette (ABC) half-transporter ABCG2 (MXR/BCRP/ABCP) is associated with mitoxantrone resistance accompanied by cross-resistance to a broad spectrum of cytotoxic drugs. Here we investigate the functional consequences of mutating a highly conserved lysine in the Walker A motif...
Directory of Open Access Journals (Sweden)
Abbass Ghanbari-Niaki
2014-03-01
Full Text Available Objective(s: ABC transporters comprise a large family of transmembrane proteins that use the energy provided by ATP hydrolysis to translocate a variety of substrates across biological membranes. All members of the human ABCG subfamily, except for ABCG2, are cholesterol-transporter. The aim of this study was to determine the liver, the small intestine and kidney ABCG5 relative gene expression in response to treadmill-running training in female rats. Materials and Methods: Twenty Wistar rats (6-8 weeks old and 125-135 g weight were used. Animals were randomly assigned to saline-control (SC, saline-training (ST, and Baneh-control (BC, and Baneh-training (BT groups. Training groups did the exercise on a motor-driven treadmill at 25 m/min (0% grade for 60 min/day for eight weeks (5 days/week. Rats were fed orally, with Baneh extraction and saline for six weeks. The two-way ANOVA was employed for statistical analysis. ABCG5 relative gene expression was detected by Real-time PCR method. Results:The current findings indicate that the Baneh-treated tissues had significantly lower levels of ABCG5 gene expression in the liver, small intestine, and kidneys (P< 0.001, P< 0.003, P< 0.001, respectively, when compared with saline-treated tissues. However, a higher level of gene expression was observed in exercise groups. A lower level of HDL-c but not triglyceride (TG and total cholesterol (TC levels were found in Baneh-treated animals at rest. Conclusion: Exercise training increases ABCG5 relative gene expression in the liver, small intestine and kidney tissues; therefore exercise training may adjust the reduction of ABCG5 relative gene expression in Baneh-training group.
Gál, Zita; Hegedüs, Csilla; Szakács, Gergely; Váradi, András; Sarkadi, Balázs; Özvegy-Laczka, Csilla
2015-02-01
Human ABCG2 is a plasma membrane glycoprotein causing multidrug resistance in cancer. Membrane cholesterol and bile acids are efficient regulators of ABCG2 function, while the molecular nature of the sterol-sensing sites has not been elucidated. The cholesterol recognition amino acid consensus (CRAC, L/V-(X)(1-5)-Y-(X)(1-5)-R/K) sequence is one of the conserved motifs involved in cholesterol binding in several proteins. We have identified five potential CRAC motifs in the transmembrane domain of the human ABCG2 protein. In order to define their roles in sterol-sensing, the central tyrosines of these CRACs (Y413, 459, 469, 570 and 645) were mutated to S or F and the mutants were expressed both in insect and mammalian cells. We found that mutation in Y459 prevented protein expression; the Y469S and Y645S mutants lost their activity; while the Y570S, Y469F, and Y645F mutants retained function as well as cholesterol and bile acid sensitivity. We found that in the case of the Y413S mutant, drug transport was efficient, while modulation of the ATPase activity by cholesterol and bile acids was significantly altered. We suggest that the Y413 residue within a putative CRAC motif has a role in sterol-sensing and the ATPase/drug transport coupling in the ABCG2 multidrug transporter. Copyright © 2014. Published by Elsevier B.V.
Tu, Hung-Pin; Chung, Chia-Min; Min-Shan Ko, Albert; Lee, Su-Shin; Lai, Han-Ming; Lee, Chien-Hung; Huang, Chung-Ming; Liu, Chiu-Shong; Ko, Ying-Chin
2016-09-01
The aim of the present study was to evaluate the contribution of urate transporter genes and alcohol use to the risk of gout/tophi. Eight variants of ABCG2, SLC2A9, SLC22A12, SLC22A11 and SLC17A3 were genotyped in male individuals in a case-control study with 157 gout (33% tophi), 106 asymptomatic hyperuricaemia and 295 control subjects from Taiwan. The multilocus profiles of the genetic risk scores for urate gene variants were used to evaluate the risk of asymptomatic hyperuricaemia, gout and tophi. ABCG2 Q141K (T), SLC2A9 rs1014290 (A) and SLC22A12 rs475688 (C) under an additive model and alcohol use independently predicted the risk of gout (respective odds ratio for each factor=2.48, 2.03, 1.95 and 2.48). The additive composite Q141K, rs1014290 and rs475688 scores of high-risk alleles were associated with gout risk (Pgout and tophi risk (P for interaction=0.0452, 0.0033). The synergistic effect of genetic urate score 5-6 and alcohol use indicates that these combined factors correlate with gout and tophi occurrence.
Wei, Tingyi; Chen, Wen; Wang, Xiukun; Zhang, Man; Chen, Jiayu; Zhu, Songcheng; Chen, Long; Yang, Dandan; Wang, Guiying; Jia, Wenwen; Yu, Yangyang; Duan, Tao; Wu, Minjuan; Liu, Houqi; Gao, Shaorong; Kang, Jiuhong
2015-01-01
The maturation of induced pluripotent stem cells (iPS) is one of the limiting steps of somatic cell reprogramming, but the underlying mechanism is largely unknown. Here, we reported that knockdown of histone deacetylase 2 (HDAC2) specifically promoted the maturation of iPS cells. Further studies showed that HDAC2 knockdown significantly increased histone acetylation, facilitated TET1 binding and DNA demethylation at the promoters of iPS cell maturation-related genes during the transition of pre-iPS cells to a fully reprogrammed state. We also found that HDAC2 competed with TET1 in the binding of the RbAp46 protein at the promoters of maturation genes and knockdown of TET1 markedly prevented the activation of these genes. Collectively, our data not only demonstrated a novel intrinsic mechanism that the HDAC2-TET1 switch critically regulates iPS cell maturation, but also revealed an underlying mechanism of the interplay between histone acetylation and DNA demethylation in gene regulation. PMID:25934799
Myllynen, Päivi; Kummu, Maria; Kangas, Tiina; Ilves, Mika; Immonen, Elina; Rysä, Jaana; Pirilä, Rauna; Lastumäki, Anni; Vähäkangas, Kirsi H
2008-10-15
We have studied the role of ATP binding cassette (ABC) transporters in fetal exposure to carcinogens using 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) a known substrate for ABC transporters as a model compound. In perfusion of human term placenta, transfer of (14)C-PhIP (2 microM) through the placenta resulted in fetal-to-maternal concentration ratio (FM ratio) of 0.72+/-0.09 at 6 h. The specific ABCG2 inhibitor KO143 increased the transfer of (14)C-PhIP from maternal to fetal circulation (FM ratio 0.90+/-0.08 at 6 h, p<0.05) while the ABCC1/ABCC2 inhibitor probenecid had no effect (FM ratio at 6 h 0.75+/-0.10, p=0.84). There was a negative correlation between the expression of ABCG2 protein in perfused tissue and the FM ratio of (14)C-PhIP (R=-0.81, p<0.01) at the end of the perfusion. The expression of ABCC2 protein did not correlate with FM ratio of PhIP (R: -0.11, p=0.76). In addition, PhIP induced the expression of ABC transporters in BeWo cells at mRNA level. In conclusion, our data indicates that ABCG2 decreases placental transfer of (14)C-PhIP in perfused human placenta. Also, PhIP may modify ABC transporter expression in choriocarcinoma cells.
Zago, V H S; Scherrer, D Z; Parra, E S; Panzoldo, N B; Alexandre, F; Nakandakare, E R; Quintão, E C R; de Faria, E C
2015-03-01
ATP binding cassette transporter G1 (ABCG1) promotes lipidation of nascent high-density lipoprotein (HDL) particles, acting as an intracellular transporter. SNP rs1893590 (c.-204A > C) of ABCG1 gene has been previously studied and reported as functional over plasma HDL-C and lipoprotein lipase activity. This study aimed to investigate the relationships of SNP rs1893590 with plasma lipids and lipoproteins in a large Brazilian population. Were selected 654 asymptomatic and normolipidemic volunteers from both genders. Clinical and anthropometrical data were taken and blood samples were drawn after 12 h fasting. Plasma lipids and lipoproteins, as well as HDL particle size and volume were determined. Genomic DNA was isolated for SNP rs1893590 detection by TaqMan(®) OpenArray(®) Real-Time PCR Plataform (Applied Biosystems). Mann-Whitney U, Chi square and two-way ANOVA were the used statistical tests. No significant differences were found in the comparison analyses between the allele groups for all studied parameters. Conversely, significant interactions were observed between SNP and age over plasma HDL-C, were volunteers under 60 years with AA genotype had increased HDL-C (p = 0.048). Similar results were observed in the group with body mass index (BMI) m(2), where volunteers with AA genotype had higher HDL-C levels (p = 0.0034), plus an increased HDL particle size (p = 0.01). These findings indicate that SNP rs1893590 of ABCG1 has a significant impact over HDL-C under asymptomatic clinical conditions in an age and BMI dependent way.
Coller, Janet K; Michalakas, Jennifer R; James, Heather M; Farquharson, Aaron L; Colvill, Joel; White, Jason M; Somogyi, Andrew A
2012-11-01
Management of pain in opioid dependent individuals is problematic due to numerous issues including cross-tolerance to opioids. Hence there is a need to find alternative analgesics to classical opioids and tramadol is potentially one such alternative. Methadone inhibits CYP2D6 in vivo and in vitro. We aimed to investigate the effect of methadone on the pathways of tramadol metabolism: O-demethylation (CYP2D6) to the opioid-active metabolite M1 and N-demethylation (CYP3A4) to M2 in subjects maintained on methadone or buprenorphine as a control. Compared with subjects on buprenorphine, methadone reduced the clearance of tramadol to active O-desmethyl-tramadol (M1) but had no effect on N-desmethyltramadol (M2) formation. Similar to other analgesics whose active metabolites are formed by CYP2D6 such as codeine, reduced formation of O-desmethyltramadol (M1) is likely to result in reduced analgesia for subjects maintained on methadone. Hence alternative analgesics whose metabolism is independent of CYP2D6 should be utilized in this patient population. To compare the O- (CYP2D6 mediated) and N- (CYP3A4 mediated) demethylation metabolism of tramadol between methadone and buprenorphine maintained CYP2D6 extensive metabolizer subjects. METHODS Nine methadone and seven buprenorphine maintained subjects received a single 100 mg dose of tramadol hydrochloride. Blood was collected at 4 h and assayed for tramadol, methadone, buprenorphine and norbuprenorphine (where appropriate) and all urine over 4 h was assayed for tramadol and its M1 and M2 metabolites. The urinary metabolic ratio [median (range)] for O-demethylation (M1) was significantly lower (P= 0.0002, probability score 1.0) in the subjects taking methadone [0.071 (0.012-0.103)] compared with those taking buprenorphine [0.192 (0.108-0.392)], but there was no significant difference (P= 0.21, probability score 0.69) in N-demethylation (M2). The percentage of dose [median (range)] recovered as M1 was significantly lower
DEFF Research Database (Denmark)
Dayeh, Tasnim; Tuomi, Tiinamaija; Almgren, Peter
2016-01-01
Identification of subjects with a high risk of developing type 2 diabetes (T2D) is fundamental for prevention of the disease. Consequently, it is essential to search for new biomarkers that can improve the prediction of T2D. The aim of this study was to examine whether 5 DNA methylation loci...... muscle from diabetic vs. non-diabetic subjects. DNA methylation at the ABCG1 locus cg06500161 in blood DNA was associated with an increased risk for future T2D (OR = 1.09, 95% CI = 1.02-1.16, P-value = 0.007, Q-value = 0.018), while DNA methylation at the PHOSPHO1 locus cg02650017 in blood DNA...... was associated with a decreased risk for future T2D (OR = 0.85, 95% CI = 0.75-0.95, P-value = 0.006, Q-value = 0.018) after adjustment for age, gender, fasting glucose, and family relation. Furthermore, the level of DNA methylation at the ABCG1 locus cg06500161 in blood DNA correlated positively with BMI, HbA1c...
Fast Curing Bio-Based Phenolic Resins via Lignin Demethylated under Mild Reaction Condition
Jiongjiong Li; Jizhi Zhang; Shifeng Zhang; Qiang Gao; Jianzhang Li; Wei Zhang
2017-01-01
Demethylation technique has been used to enhance lignin reactivity for preparation of phenolic resins. However, the demethylation efficiency and the demethylated lignin (DL) reactivity were still unsatisfactory. To improve the demethylation efficiency, alkali lignin was demethylated under different mild conditions using sodium sulfite as a catalyst. Lignin and DL were characterized by 1H-NMR (nuclear magnetic resonance) and Fourier transform infrared (FT-IR) spectroscopy to determine the deme...
Kappus, Mojdeh S.; Murphy, Andrew J.; Abramowicz, Sandra; Ntonga, Vusisizwe; Welch, Carrie L.; Tall, Alan R.; Westerterp, Marit
2014-01-01
Objective Liver X Receptor (LXR) activators decrease atherosclerosis in mice. LXR activators (1) directly up-regulate genes involved in reverse cholesterol transport (RCT) and (2) exert anti-inflammatory effects mediated by transrepression of NFκB target genes. We investigated whether myeloid cell deficiency of ATP-binding cassette transporters A1 and G1 (ABCA1/G1), principal targets of LXR that promote macrophage cholesterol efflux and initiate RCT, would abolish the beneficial effects of LXR activation on atherosclerosis. Approach and Results LXR activator T0901317 (T0) substantially reduced inflammatory gene expression in macrophages lacking ABCA1/G1. Ldlr−/− mice were transplanted with Abca1−/−Abcg1−/− or wild-type bone marrow (BM) and fed a Western-type diet (WTD) for 6 weeks with or without T0 supplementation. Abca1/g1 BM deficiency increased atherosclerotic lesion complexity and inflammatory cell infiltration into the adventitia and myocardium. T0 markedly decreased lesion area, complexity and inflammatory cell infiltration in the Abca1−/−Abcg1−/− BM transplanted mice. To investigate whether this was due to macrophage Abca1/g1 deficiency, Ldlr−/− mice were transplanted with LysmCreAbca1fl/flAbcg1fl/fl or Abca1fl/flAbcg1fl/fl BM and fed WTD with or without the more specific LXR agonist GW3965 for 12 weeks. GW3965 decreased lesion size in both groups and the decrease was more prominent in the LysmCreAbca1fl/flAbcg1fl/fl group. Conclusions The results suggest that anti-inflammatory effects of LXR activators are of key importance to their anti-atherosclerotic effects in vivo independent of cholesterol efflux pathways mediated by macrophage ABCA1/G1. This has implications for the development of LXR activators that lack adverse effects on lipogenic genes while maintaining the ability to trans-repress inflammatory genes. PMID:24311381
Gender Differences in Global but Not Targeted Demethylation in iPSC Reprogramming
Directory of Open Access Journals (Sweden)
Inês Milagre
2017-01-01
Full Text Available Global DNA demethylation is an integral part of reprogramming processes in vivo and in vitro, but whether it occurs in the derivation of induced pluripotent stem cells (iPSCs is not known. Here, we show that iPSC reprogramming involves both global and targeted demethylation, which are separable mechanistically and by their biological outcomes. Cells at intermediate-late stages of reprogramming undergo transient genome-wide demethylation, which is more pronounced in female cells. Global demethylation requires activation-induced cytidine deaminase (AID-mediated downregulation of UHRF1 protein, and abolishing demethylation leaves thousands of hypermethylated regions in the iPSC genome. Independently of AID and global demethylation, regulatory regions, particularly ESC enhancers and super-enhancers, are specifically targeted for hypomethylation in association with transcription of the pluripotency network. Our results show that global and targeted DNA demethylation are conserved and distinct reprogramming processes, presumably because of their respective roles in epigenetic memory erasure and in the establishment of cell identity.
Demethylation of arsenic limits its volatilization in fungi
International Nuclear Information System (INIS)
Su, Shiming; Zeng, Xibai; Feng, Qiufen; Bai, Lingyu; Zhang, Lili; Jiang, Sheng; Li, Aiguo; Duan, Ran; Wang, Xiurong; Wu, Cuixia; Wang, Yanan
2015-01-01
Arsenic (As) biomethylation is increasingly being regarded as a promising method to volatize As from the environment; however, the As volatilization efficiency of most microorganisms is low. Here, the speciation transformation of dimethylarsinic acid (DMA) as an important methylation intermediate in the cells of Fusarium oxysporum CZ-8F1, Penicillium janthinellum SM-12F4, and Trichoderma asperellum SM-12F1 were investigated. These fungal strains have been certified to volatilize As from As-loaded environment. In situ X-ray absorption near edge structure (XANES) indicated that demethylation of DMA with methylarsonic acid (MMA), arsenate [As(V)], and arsenite [As(III)] as intermediates or products occurred in fungal cells after exposure to DMA for 15 days. 36.7–55.7% of the original DMA could lose one or two methyl groups and be changed into MMA or inorganic As. Chromatographic separation of the cell lysates also supported these findings. Thus it comes that demethylation might be a remarkable internal factor limiting As volatilization efficiency. - Highlights: • XAS and chromatographic separation were used to study the speciation change of DMA. • DMA demethylation with MMA, As(V), and As(III) as products occurred in fungal cells. • Demethylation might be responsible for the limited volatilization efficiency of As. - Demethylation might be responsible for the limited methylation efficiency of As
Ligand Binding Affinities of Arctigenin and Its Demethylated Metabolites to Estrogen Receptor Alpha
Directory of Open Access Journals (Sweden)
Masao Hattori
2013-01-01
Full Text Available Phytoestrogens are defined as plant-derived compounds with estrogen-like activities according to their chemical structures and activities. Plant lignans are generally categorized as phytoestrogens. It was reported that (−-arctigenin, the aglycone of arctiin, was demethylated to (−-dihydroxyenterolactone (DHENL by Eubacterium (E. sp. ARC-2. Through stepwise demethylation, E. sp. ARC-2 produced six intermediates, three mono-desmethylarctigenins and three di-desmethylarctigenins. In the present study, ligand binding affinities of (−-arctigenin and its seven metabolites, including DHENL, were investigated for an estrogen receptor alpha, and found that demethylated metabolites had stronger binding affinities than (−-arctigenin using a ligand binding screen assay method. The IC50 value of (2R,3R-2-(4-hydroxy-3-methoxybenzyl-3-(3,4-dihydroxybenzyl-butyrolactone was 7.9 × 10−4 M.
Hsieh, Victar; Kim, Mi-Jurng; Gelissen, Ingrid C.; Brown, Andrew J.; Sandoval, Cecilia; Hallab, Jeannette C.; Kockx, Maaike; Traini, Mathew; Jessup, Wendy; Kritharides, Leonard
2014-01-01
The objective of this study was to examine the influence of cholesterol in post-translational control of ABCA1 and ABCG1 protein expression. Using CHO cell lines stably expressing human ABCA1 or ABCG1, we observed that the abundance of these proteins is increased by cell cholesterol loading. The response to increased cholesterol is rapid, is independent of transcription, and appears to be specific for these membrane proteins. The effect is mediated through cholesterol-dependent inhibition of transporter protein degradation. Cell cholesterol loading similarly regulates degradation of endogenously expressed ABCA1 and ABCG1 in human THP-1 macrophages. Turnover of ABCA1 and ABCG1 is strongly inhibited by proteasomal inhibitors and is unresponsive to inhibitors of lysosomal proteolysis. Furthermore, cell cholesterol loading inhibits ubiquitination of ABCA1 and ABCG1. Our findings provide evidence for a rapid, cholesterol-dependent, post-translational control of ABCA1 and ABCG1 protein levels, mediated through a specific and sterol-sensitive mechanism for suppression of transporter protein ubiquitination, which in turn decreases proteasomal degradation. This provides a mechanism for acute fine-tuning of cholesterol transporter activity in response to fluctuations in cell cholesterol levels, in addition to the longer term cholesterol-dependent transcriptional regulation of these genes. PMID:24500716
La, Honggui; Ding, Bo; Mishra, Gyan Prakash; Zhou, Bo; Yang, Hongmei; Bellizzi, Maria Del Rosario; Chen, Songbiao; Meyers, Blake C.; Peng, Zhaohua; Zhu, Jian-Kang; Wang, Guoliang
2011-01-01
DNA 5-methylcytosine (5-meC) is an important epigenetic mark for transcriptional gene silencing in many eukaryotes. In Arabidopsis, 5-meC DNA glycosylase/lyases actively remove 5-meC to counter-act transcriptional gene silencing in a locus-specific manner, and have been suggested to maintain the expression of transposons. However, it is unclear whether plant DNA demethylases can promote the transposition of transposons. Here we report the functional characterization of the DNA glycosylase/lyase DNG701 in rice. DNG701 encodes a large (1,812 amino acid residues) DNA glycosylase domain protein. Recombinant DNG701 protein showed 5-meC DNA glycosylase and lyase activities in vitro. Knockout or knockdown of DNG701 in rice plants led to DNA hypermethylation and reduced expression of the retrotransposon Tos17. Tos17 showed less transposition in calli derived from dng701 knockout mutant seeds compared with that in wild-type calli. Overexpression of DNG701 in both rice calli and transgenic plants substantially reduced DNA methylation levels of Tos17 and enhanced its expression. The overexpression also led to more frequent transposition of Tos17 in calli. Our results demonstrate that rice DNG701 is a 5-meC DNA glycosylase/lyase responsible for the demethylation of Tos17 and this DNA demethylase plays a critical role in promoting Tos17 transposition in rice calli.
La, Honggui
2011-09-06
DNA 5-methylcytosine (5-meC) is an important epigenetic mark for transcriptional gene silencing in many eukaryotes. In Arabidopsis, 5-meC DNA glycosylase/lyases actively remove 5-meC to counter-act transcriptional gene silencing in a locus-specific manner, and have been suggested to maintain the expression of transposons. However, it is unclear whether plant DNA demethylases can promote the transposition of transposons. Here we report the functional characterization of the DNA glycosylase/lyase DNG701 in rice. DNG701 encodes a large (1,812 amino acid residues) DNA glycosylase domain protein. Recombinant DNG701 protein showed 5-meC DNA glycosylase and lyase activities in vitro. Knockout or knockdown of DNG701 in rice plants led to DNA hypermethylation and reduced expression of the retrotransposon Tos17. Tos17 showed less transposition in calli derived from dng701 knockout mutant seeds compared with that in wild-type calli. Overexpression of DNG701 in both rice calli and transgenic plants substantially reduced DNA methylation levels of Tos17 and enhanced its expression. The overexpression also led to more frequent transposition of Tos17 in calli. Our results demonstrate that rice DNG701 is a 5-meC DNA glycosylase/lyase responsible for the demethylation of Tos17 and this DNA demethylase plays a critical role in promoting Tos17 transposition in rice calli.
Zander, Serge A. L.; Kersbergen, Ariena; Sol, Wendy; Gonggrijp, Maaike; van de Wetering, Koen; Jonkers, Jos; Borst, Piet; Rottenberg, Sven
2012-01-01
In addition to their role in drug resistance, the ATP-binding cassette (ABC) transporters ABCG2 and ABCB1 have been suggested to protect cells from a broad range of substances that may foster tumorigenesis. Phytoestrogens or their metabolites are substrates of these transporters and the influence of
ERRα induces H3K9 demethylation by LSD1 to promote cell invasion
Carnesecchi, Julie; Forcet, Christelle; Zhang, Ling; Tribollet, Violaine; Barenton, Bruno; Boudra, Rafik; Cerutti, Catherine; Billas, Isabelle M. L.; Sérandour, Aurélien A.; Carroll, Jason S.; Beaudoin, Claude; Vanacker, Jean-Marc
2017-01-01
Dynamic demethylation of histone residues plays a crucial role in the regulation of gene expression. Lysine Specific Demethylase 1 (LSD1) can remove both transcriptionally permissive and repressive histone marks. How these activities are controlled is not clearly understood. Here, we show that the estrogen-related receptor α (ERRα) induces LSD1 to erase repressive marks in vitro. Through such a mechanism, LSD1 and ERRα commonly activate a set of transcriptional targets that include genes invo...
Chen, Piaojuan; Li, Yi; Zhao, Lihua; Hou, Zhimin; Yan, Maokai; Hu, Bingyan; Liu, Yanhui; Azam, Syed Muhammad; Zhang, Ziyan; Rahman, Zia Ur; Liu, Liping; Qin, Yuan
2017-01-01
Pineapple ( Ananas comosus L .) cultivation commonly relies on asexual reproduction which is easily impeded by many factors in agriculture production. Sexual reproduction might be a novel approach to improve the pineapple planting. However, genes controlling pineapple sexual reproduction are still remain elusive. In different organisms a conserved superfamily proteins known as ATP binding cassette (ABC) participate in various biological processes. Whereas, till today the ABC gene family has not been identified in pineapple. Here 100 ABC genes were identified in the pineapple genome and grouped into eight subfamilies (5 ABCAs , 20 ABCB s, 16 ABCCs , 2 ABCDs , one ABCEs , 5 ABCFs , 42 ABCGs and 9 ABCIs ). Gene expression profiling revealed the dynamic expression pattern of ABC gene family in various tissues and different developmental stages. AcABCA5, AcABCB6, AcABCC4 , AcABCC7 , AcABCC9 , AcABCG26 , AcABCG38 and AcABCG42 exhibited preferential expression in ovule and stamen. Over-expression of AcABCG38 in the Arabidopsis double mutant abcg1-2abcg16-2 partially restored its pollen abortion defects, indicating that AcABCG38 plays important roles in pollen development. Our study on ABC gene family in pineapple provides useful information for developing sexual pineapple plantation which could be utilized to improve pineapple agricultural production.
O2 -independent demethylation of trimethylamine N-oxide by Tdm of Methylocella silvestris.
Zhu, Yijun; Ksibe, Amira Z; Schäfer, Hendrik; Blindauer, Claudia A; Bugg, Timothy D H; Chen, Yin
2016-11-01
Bacterial trimethylamine N-oxide (TMAO) demethylase, Tdm, carries out an unusual oxygen-independent demethylation reaction, resulting in the formation of dimethylamine and formaldehyde. In this study, site-directed mutagenesis, homology modelling and metal analyses by inorganic mass spectrometry have been applied to gain insight into metal stoichiometry and underlying catalytic mechanism of Tdm of Methylocella silvestris BL2. Herein, we demonstrate that active Tdm has 1 molar equivalent of Zn 2+ and 1 molar equivalent of non-haem Fe 2+ . We further investigated Zn 2+ - and Fe 2+ -binding sites through homology modelling and site-directed mutagenesis and found that Zn 2+ is coordinated by a 3-sulfur-1-O motif. An aspartate residue (D198) likely bridges Fe 2+ and Zn 2+ centres, either directly or indirectly via H-bonding through a neighbouring H 2 O molecule. H276 contributes to Fe 2+ binding, mutation of which results in an inactive enzyme, and the loss of iron, but not zinc. Site-directed mutagenesis of Tdm also led to the identification of three hydrophobic aromatic residues likely involved in substrate coordination (F259, Y305, W321), potentially through a cation-π interaction. Furthermore, a crossover experiment using a substrate analogue gave direct evidence that a trimethylamine-alike intermediate was produced during the Tdm catalytic cycle, suggesting TMAO has a dual role of being both a substrate and an oxygen donor for formaldehyde formation. Together, our results provide novel insight into the role of Zn 2+ and Fe 2+ in the catalysis of TMAO demethylation by this unique oxygen-independent enzyme. © 2016 The Authors. The FEBS Journal published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.
Sesink, A.L.A.; Arts, I.C.W.; Boer, de V.C.J.; Breedveld, P.; Schellens, J.H.M.; Hollman, P.C.H.; Russel, F.G.M.
2005-01-01
The intestinal absorption of the flavonoid quercetin in rats is limited by the secretion of glucuronidated metabolites back into the gut lumen. The objective of this study was to determine the role of the intestinal efflux transporters breast cancer resistance protein (Bcrp1)/Abcg2 and multidrug
Sesink, A.L.; Arts, I.C.; Boer, V.C. de; Breedveld, P.; Schellens, J.H.; Hollman, P.C.H.; Russel, F.G.M.
2005-01-01
The intestinal absorption of the flavonoid quercetin in rats is limited by the secretion of glucuronidated metabolites back into the gut lumen. The objective of this study was to determine the role of the intestinal efflux transporters breast cancer resistance protein (Bcrp1)/Abcg2 and multidrug
Directory of Open Access Journals (Sweden)
Eadie Brennan D
2009-02-01
Full Text Available Abstract Background Cognitive deficits are a hallmark feature of both Down Syndrome (DS and Alzheimer's Disease (AD. Extra copies of the genes on chromosome 21 may also play an important role in the accelerated onset of AD in DS individuals. Growing evidence suggests an important function for cholesterol in the pathogenesis of AD, particularly in APP metabolism and production of Aβ peptides. The ATP-Binding Cassette-G1 (ABCG1 transporter is located on chromosome 21, and participates in the maintenance of tissue cholesterol homeostasis. Results To assess the role of ABCG1 in DS-related cognition, we evaluated the cognitive performance of mice selectively over-expressing the ABCG1 gene from its endogenous regulatory signals. Both wild-type and ABCG1 transgenic mice performed equivalently on several behavioral tests, including measures of anxiety, as well as on reference and working memory tasks. No deficits in hippocampal CA1 synaptic plasticity as determined with electrophysiological studies were apparent in mice over-expressing ABCG1. Conclusion These findings indicate that although ABCG1 may play a role in maintaining cellular or tissue cholesterol homeostasis, it is unlikely that excess ABCG1 expression contributes to the cognitive deficits in DS individuals.
Jebbink, Jiska; Veenboer, Geertruda; Boussata, Souad; Keijser, Remco; Kremer, Andreas E.; Elferink, Ronald Oude; van der Post, Joris; Afink, Gijs; Ris-Stalpers, Carrie
2015-01-01
To investigate total bile acid (TBA) levels in maternal (MB) and umbilical cord blood (UCB) in normotensive, preeclamptic (PE), and PE pregnancies complicated by hemolysis elevated liver enzymes and low platelets (HELLP) syndrome in the context of ABCG2 placental gene expression levels, a recently
Genistein and Glyceollin Effects on ABCC2 (MRP2 and ABCG2 (BCRP in Caco-2 Cells
Directory of Open Access Journals (Sweden)
Chandler Schexnayder
2015-12-01
Full Text Available The goal of the present study was to determine the effects of glyceollins on intestinal ABCC2 (ATP Binding Cassette C2, multidrug resistance protein 2, MRP2 and ABCG2 (ATP Binding Cassette G2, breast cancer resistance protein, BCRP function using the Caco-2 cell intestinal epithelial cell model. Glyceollins are soy-derived phytoestrogens that demonstrate anti-proliferative activity in several sources of cancer cells. 5 (and 6-carboxy-2′,7′-dichloroflourescein (CDF was used as a prototypical MRP2 substrate; whereas BODIPY-prazosin provided an indication of BCRP function. Comparison studies were conducted with genistein. Glyceollins were shown to inhibit MRP2-mediated CDF transport, with activity similar to the MRP2 inhibitor, MK-571. They also demonstrated concentration-dependent inhibition BCRP-mediated efflux of BODIPY-prazosin, with a potency similar to that of the recognized BCRP inhibitor, Ko143. In contrast, genistein did not appear to alter MRP2 activity and even provided a modest increase in BCRP efflux of BODIPY-prazosin. In particular, glyceollin inhibition of these two important intestinal efflux transporters suggests the potential for glyceollin to alter the absorption of other phytochemicals with which it might be co-administered as a dietary supplement, as well as alteration of the absorption of pharmaceuticals that may be administered concomitantly.
Fast Curing Bio-Based Phenolic Resins via Lignin Demethylated under Mild Reaction Condition
Directory of Open Access Journals (Sweden)
Jiongjiong Li
2017-09-01
Full Text Available Demethylation technique has been used to enhance lignin reactivity for preparation of phenolic resins. However, the demethylation efficiency and the demethylated lignin (DL reactivity were still unsatisfactory. To improve the demethylation efficiency, alkali lignin was demethylated under different mild conditions using sodium sulfite as a catalyst. Lignin and DL were characterized by 1H-NMR (nuclear magnetic resonance and Fourier transform infrared (FT-IR spectroscopy to determine the demethylation mechanism. With the demethylation of lignin, the methoxyl group content decreased from 1.93 m mol/g to 1.09 m mol/g, and the phenolic hydroxyl group content increased from 0.56 m mol/g to 0.82 m mol/g. These results revealed that methoxyl groups were attacked by SO32−, and some methoxyl groups were converted to phenolic hydroxyl groups by a nucleophilic substitution reaction, generating DL with high reactivity. The chemical properties of lignin-based phenolic resins were studied by 13C-NMR and FT-IR spectroscopy, and their physical properties were also investigated. The results indicated that lignin-based phenolic resins exhibited faster curing rate and shorter gel time. In addition, the bonding strength increased from 0.92 MPa to 1.07 MPa, and the formaldehyde emission decreased from 0.58 mg/L to 0.22 mg/L after lignin demethylated at the optimum condition.
Directory of Open Access Journals (Sweden)
Edward B. Neufeld
2014-12-01
Full Text Available We have previously shown that GFP-tagged human ABCG1 on the plasma membrane (PM and in late endosomes (LE mobilizes sterol on both sides of the membrane lipid bilayer, thereby increasing cellular cholesterol efflux to lipid surfaces. In the present study, we examined ABCG1-induced changes in membrane cholesterol distribution, organization, and mobility. ABCG1-GFP expression increased the amount of mobile, non-sphingomyelin(SM-associated cholesterol at the PM and LE, but not the amount of SM-associated-cholesterol or SM. ABCG1-mobilized non-SM-associated-cholesterol rapidly cycled between the PM and LE and effluxed from the PM to extracellular acceptors, or, relocated to intracellular sites of esterification. ABCG1 increased detergent-soluble pools of PM and LE cholesterol, generated detergent-resistant, non-SM-associated PM cholesterol, and increased resistance to both amphotericin B-induced (cholesterol-mediated and lysenin-induced (SM-mediated cytolysis, consistent with altered organization of both PM cholesterol and SM. ABCG1 itself resided in detergent-soluble membrane domains. We propose that PM and LE ABCG1 residing at the phase boundary between ordered (Lo and disordered (Ld membrane lipid domains alters SM and cholesterol organization thereby increasing cholesterol flux between Lo and Ld, and hence, the amount of cholesterol available for removal by acceptors on either side of the membrane bilayer for either efflux or esterification.
International Nuclear Information System (INIS)
Oremland, R.S.; Culbertson, C.W.; Winfrey, M.R.
1991-01-01
The biogeochemical cycling of mercury has received considerable attention because of the toxicity of methylmercury, its bioaccumulation in biota, and its biomagnification in aquatic food chains. The formation of methylmercury is mediated primarily by microorganisms. Demethylation of monomethylmercury in freshwater and estuarine sediments and in bacterial cultures was investigated with 14 CH 3 HgI. Under anaerobiosis, results with inhibitors indicated partial involvement of both sulfate reducers and methanogens, the former dominated estuarine sediments, while both were active in freshwaters. Aerobes were the most significant demethylators in estuarine sediments, but were unimportant in freshwater sediments. Products of anaerobic demthylation were mainly 14 CO 2 as well as lesser amounts of 14 CH 4 . Acetogenic activity resulted in fixation of some 14 CO 2 produced from 14 CH 3 HgI into acetate. Aerobic demethylation in estuarine sediments produced only 14 CH 4 , while aerobic demethylation in freshwater sediments produced small amounts of both 14 CH 4 and 14 CO 2 . Two species of Desulfovibrio produced only traces of 14 CH 4 from 14 CH 3 HgI, while a culture of a methylotrophic methanogen formed traces of 14 CO 2 and 14 CH 4 when grown on trimethylamine in the presence of the 14 CH 3 HgI. These results indicate that both aerobes and anaerobes demethylate mercury in sediments, but that either group may dominate in a particular sediment type. Aerobic demethylation in the estuarine sediments appeared to proceed by the previously characterized organomercurial-lyase pathway, because methane was the sole product. This indicates the presence of an oxidative pathway, possibly one in which methylmercury serves as an analog of one-carbon substrates
Hu, Xiangang; Mu, Li; Lu, Kaicheng; Kang, Jia; Zhou, Qixing
2014-06-25
The demethylation of methylmercury has received substantial attention. Here, a novel chemical method for the demethylation of methylmercury is proposed. The low-toxicity graphene-fulvic acid (FA, a ubiquitous material in the environment) was synthesized without the use of a chemical reagent. The hybridized graphene-FA presented an indirect open band gap of 2.25-2.87 eV as well as adequate aqueous dispersion. More importantly, the hybridized graphene-FA exhibited 6- and 10-fold higher photocatalytic efficiencies for the demethylation of methylmercury than FA and free FA with graphene, respectively. This result implies that immobilized, rather than free, FA accelerated the catalysis. Furthermore, inorganic mercuric ion, elemental mercury, and mercuric oxide were identified as the primary demethylation products. For free FA with graphene, graphene quenches the excited-state FA, inhibiting the demethylation by electron transfer. In contrast, the graphene of the self-assembled graphene-FA serves as an electron reservoir, causing electron-hole pair separation. Graphene-FA showed a negligible toxicity toward microalgae compared to graphene. The above results reveal that the green synthesis of graphene and organic molecules is a convenient strategy for obtaining effective cocatalysts.
Kuromori, Takashi; Fujita, Miki; Urano, Kaoru; Tanabata, Takanari; Sugimoto, Eriko; Shinozaki, Kazuo
2016-10-01
In addition to improving drought tolerance, improvement of water use efficiency is a major challenge in plant physiology. Due to their trade-off relationships, it is generally considered that achieving stress tolerance is incompatible with maintaining stable growth. Abscisic acid (ABA) is a key phytohormone that regulates the balance between intrinsic growth and environmental responses. Previously, we identified AtABCG25 as a cell-membrane ABA transporter that export ABA from the inside to the outside of cells. AtABCG25-overexpressing plants showed a lower transpiration phenotype without any growth retardation. Here, we dissected this useful trait using precise phenotyping approaches. AtABCG25 overexpression stimulated a local ABA response in guard cells. Furthermore, AtABCG25 overexpression enhanced drought tolerance, probably resulting from maintenance of water contents over the common threshold for survival after drought stress treatment. Finally, we observed enhanced water use efficiency by overexpression of AtABCG25, in addition to drought tolerance. These results were consistent with the function of AtABCG25 as an ABA efflux transporter. This unique trait may be generally useful for improving the water use efficiency and drought tolerance of plants. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Cigarette smoke promotes drug resistance and expansion of cancer stem cell-like side population.
Directory of Open Access Journals (Sweden)
Yi An
Full Text Available It is well known that many patients continue to smoke cigarettes after being diagnosed with cancer. Although smoking cessation has typically been presumed to possess little therapeutic value for cancer, a growing body of evidence suggests that continued smoking is associated with reduced efficacy of treatment and a higher incidence of recurrence. We therefore investigated the effect of cigarette smoke condensate (CSC on drug resistance in the lung cancer and head and neck cancer cell lines A549 and UMSCC-10B, respectively. Our results showed that CSC significantly increased the cellular efflux of doxorubicin and mitoxantrone. This was accompanied by membrane localization and increased expression of the multi-drug transporter ABCG2. The induced efflux of doxorubicin was reversed upon addition of the specific ABCG2 inhibitor Fumitremorgin C, confirming the role of ABCG2. Treatment with CSC increased the concentration of phosphorylated Akt, while addition of the PI3K inhibitor LY294002 blocked doxorubicin extrusion, suggesting that Akt activation is required for CSC-induced drug efflux. In addition, CSC was found to promote resistance to doxorubicin as determined by MTS assays. This CSC-induced doxurbicin-resistance was mitigated by mecamylamine, a nicotinic acetylcholine receptor inhibitor, suggesting that nicotine is at least partially responsible for the effect of CSC. Lastly, CSC increased the size of the side population (SP, which has been linked to a cancer stem cell-like phenotype. In summary, CSC promotes chemoresistance via Akt-mediated regulation of ABCG2 activity, and may also increase the proportion of cancer stem-like cells, contributing to tumor resilience. These findings underscore the importance of smoking cessation following a diagnosis of cancer, and elucidate the mechanisms of continued smoking that may be detrimental to treatment.
Lemmen, Julia; Tozakidis, Iasson E P; Bele, Prachee; Galla, Hans-Joachim
2013-03-21
ATP-driven efflux transporters are considered to be the major hurdle in the treatment of central nervous system (CNS) diseases. Abcb1 (P-glycoprotein) and Abcg2 (breast cancer resistance protein/brain multidrug resistance protein) belong to the best known ABC-transporters. These ABC-transporters limit the permeability of the blood-brain barrier and protect the brain against toxic compounds in the blood but on the other hand they also reduce the efficacy of CNS pharmacotherapy. Even after 40 years of extensive research, the regulatory mechanisms of these efflux transporters are still not completely understood. To unravel the efflux transporter regulation, we analyzed the effect of the nuclear receptor CAR (constitutive androstane receptor) on the expression of Abcb1 and Abcg2 in primary cultures of porcine brain capillary endothelial cells (PBCEC). CAR is a xenobiotic-activated transcription factor, which is, like the other important nuclear receptor pregnane X receptor (PXR), highly expressed in barrier tissue and known to be a positive regulator of ABC-transporters. We demonstrate that activation of porcine CAR by the human CAR (hCAR) ligand CITCO (6-(4-chlorophenyl)-imidazo[2,1-b]thiazole-5-carbaldehyde) leads to an up-regulation of both transporters, whereas the mouse-specific CAR ligand TCPOBOP (1,4-bis-[2-(3,5-dichloropyridyloxy)]benzene) had no effect on transporter expression. The stimulation of PBCEC with CITCO caused a significant up-regulation of both efflux-transporters on RNA-level, protein level and transport level. Furthermore the additional application of a CAR inhibitor significantly decreased the transporter expression to control niveau. In conclusion our data prove CAR activation only by the human ligand CITCO leading to an increased ABC-transporter expression and transport activity. Copyright © 2013 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Zambrano, Pilar; Sandoval, Karina; Trejo-Becerril, Catalina; Chanona-Vilchis, Jose; Duenas-González, Alfonso; Segura-Pacheco, Blanca; Perez-Cardenas, Enrique; Cetina, Lucely; Revilla-Vazquez, Alma; Taja-Chayeb, Lucía; Chavez-Blanco, Alma; Angeles, Enrique; Cabrera, Gustavo
2005-01-01
The antihypertensive compound hydralazine is a known demethylating agent. This phase I study evaluated the tolerability and its effects upon DNA methylation and gene reactivation in patients with untreated cervical cancer. Hydralazine was administered to cohorts of 4 patients at the following dose levels: I) 50 mg/day, II) 75 mg/day, III) 100 mg/day and IV) 150 mg/day. Tumor biopsies and peripheral blood samples were taken the day before and after treatment. The genes APC, MGMT; ER, GSTP1, DAPK, RARβ, FHIT and p16 were evaluated pre and post-treatment for DNA promoter methylation and gene expression by MSP (Methylation-Specific PCR) and RT-PCR respectively in each of the tumor samples. Methylation of the imprinted H19 gene and the 'normally methylated' sequence clone 1.2 was also analyzed. Global DNA methylation was analyzed by capillary electrophoresis and cytosine extension assay. Toxicity was evaluated using the NCI Common Toxicity Criteria. Hydralazine was well tolerated. Toxicities were mild being the most common nausea, dizziness, fatigue, headache and palpitations. Overall, 70% of the pretreatment samples and all the patients had at least one methylated gene. Rates of demethylation at the different dose levels were as follows: 50 mg/day, 40%; 75 mg/day, 52%, 100 mg/day, 43%, and 150 mg/day, 32%. Gene expression analysis showed only 12 informative cases, of these 9 (75%) re-expressed the gene. There was neither change in the methylation status of H19 and clone 1.2 nor changes in global DNA methylation. Hydralazine at doses between 50 and 150 mg/day is well tolerated and effective to demethylate and reactivate the expression of tumor suppressor genes without affecting global DNA methylation
International Nuclear Information System (INIS)
Shafiee, A.; Trzaskos, J.M.; Paik, Y.K.; Gaylor, J.L.
1986-01-01
With [ 3 H-24,25]-dihydrolanosterol as substrate, large-scale metabolic formation of intermediates of lanosterol demethylation was carried out to identify all compounds in the metabolic process. Utilizing knowledge of electron transport of lanosterol demethylation, we interrupted the demethylation reaction allowing accumulation and confirmation of the structure of the oxygenated intermediates lanost-8-en-3 beta,32-diol and 3 beta-hydroxylanost-8-en-32-al, as well as the demethylation product 4,4-dimethyl-cholesta-8,14-dien-3 beta-ol. Further metabolism of the delta 8.14-diene intermediate to a single product 4,4-dimethyl-cholest-8-en-3 beta-ol occurs under interruption conditions in the presence of 0.5 mM CN-1. With authentic compounds, each intermediate has been rigorously characterized by high performance liquid chromatography and gas-liquid chromatography plus mass spectral analysis of isolated and derivatized sterols. Intermediates that accumulated in greater abundance were further characterized by ultraviolet, 1 H-NMR, and infrared spectroscopy of the isolated sterols
Directory of Open Access Journals (Sweden)
Zahra Tavoosi
2015-01-01
Full Text Available ABCA1 and ABCG1 genes encode the cholesterol transporter proteins that play a key role in cholesterol and phospholipids homeostasis. This study was aimed at evaluating and comparing ABCA1 and ABCG1 genes expression in metabolic syndrome patients and healthy individuals. This case-control study was performed on 36 patients with metabolic syndrome and the same number of healthy individuals in Hamadan (west of Iran during 2013-2014. Total RNA was extracted from mononuclear cells and purified using RNeasy Mini Kit column. The expression of ABCA1 and ABCG1 genes was performed by qRT-PCR. Lipid profile and fasting blood glucose were measured using colorimetric procedures. ABCG1 expression in metabolic syndrome patients was significantly lower (about 75% compared to that of control group, while for ABCA1 expression, there was no significant difference between the two studied groups. Comparison of other parameters such as HDL-C, FBS, BMI, waist circumference, and systolic and diastolic blood pressure between metabolic syndrome patients and healthy individuals showed significant differences (P<0.05. Decrease in ABCG1 expression in metabolic syndrome patients compared to healthy individuals suggests that hyperglycemia, related metabolites, and hyperlipidemia over the transporter capacity resulted in decreased expression of ABCG1. Absence of a significant change in ABCA1 gene expression between two groups can indicate a different regulation mechanism for ABCA1 expression.
Shukla, Suneet; Wu, Chung-Pu; Nandigama, Krishnamachary; Ambudkar, Suresh V.
2007-01-01
Vitamin K3 (Menadione; 2-methyl-1,4-naphthoquinone) is a structural precursor of vitamins K1 and K2 which are essential for blood clotting. The naturally occurring structural analog of this vitamin, plumbagin (5-hydroxy-menadione), is known to modulate cellular proliferation, apoptosis, carcinogenesis, and radioresistance. We, here, report that both vitamin K3 and plumbagin are substrates of the multidrug resistance-linked ATP binding cassette (ABC) drug transporter, ABCG2. Vitamin K3 and plu...
Directory of Open Access Journals (Sweden)
К. Yu. Khristenko
2016-01-01
Full Text Available Overexpression of ABC drug transporters can cause multidrug resistance (MDR in cancer cells, which is a major obstacle in the success of cancer chemotherapy. Our study revealed a correlation between the expression of invasive breast cancer resistance-associated proteins, such as P-glycoprotein (ABCB1, MRP2 (ABCC2, BCRP (ABCG2 in tumor cells and pathologic response to neoadjuvant chemotherapy. The response to neoadjuvant chemotherapy was shown to be associated with a lack of BCRP expression in tumor cells. The pathologic tumor response was correlated with the presence of positive MRP2 expression and the expression level of P-glycoprotein in cells of invasive breast cancer.
Chemical groups and structural characterization of lignin via thiol-mediated demethylation
Lihong Hu; Hui Pan; Yonghong Zhou; Chung-Yun Hse; Chengguo Liu; Baofang Zhang; Bin Xu
2014-01-01
A new approach to increase the reactivity of lignin by thiol-mediated demethylation was investigated in this study. Demethylated lignin was characterized by the changes in its hydroxyl and methoxyl groups, molecular weight, and other properties using titration and spectroscopy methods including FT-IR, 1H NMR, UV,and GPC. The total...
Chen, Lili; Jiang, Bowen; Zhong, Chunge; Guo, Jun; Zhang, Lihao; Mu, Teng; Zhang, Qiuhua; Bi, Xiuli
2018-03-08
Freeze-dried black raspberry (BRB) powder is considered as a potential cancer chemopreventive agent. In this study, we fed azoxymethane (AOM)/dextran sodium sulfate (DSS)-treated C57BL/6J mice with a diet containing BRB anthocyanins for 12 weeks, and this led to a reduction in colon carcinogenesis. These animals had consistently lower tumor multiplicity compared with AOM/DSS-treated mice not receiving BRB anthocyanins. In AOM/DSS-treated mice, the number of pathogenic bacteria, including Desulfovibrio sp. and Enterococcus spp., was increased significantly, whereas probiotics such as Eubacterium rectale, Faecalibacterium prausnitzii and Lactobacillus were dramatically decreased, but BRB anthocyanins supplement could reverse this imbalance in gut microbiota. BRB anthocyanins also caused the demethylation of the SFRP2 gene promoter, resulting in increased expression of SFRP2, both at the mRNA and protein levels. Furthermore, the expression levels of DNMT31 and DNMT3B, as well as of p-STAT3 were downregulated by BRB anthocyanins in these animals. Taken together, these results suggested that BRB anthocyanins could modulate the composition of gut commensal microbiota, and changes in inflammation and the methylation status of the SFRP2 gene may play a central role in the chemoprevention of CRC.
Bartholomeusz, Trixie Ann; Molinié, Roland; Roscher, Albrecht; Felpin, François-Xavier; Gillet, Françoise; Lebreton, Jacques; Mesnard, François; Robins, Richard J
2005-08-01
The metabolism of (R,S)-N-methylanabasine and (R,S)-N-methylanatabine has been studied in a cell suspension culture of Nicotiana plumbaginifolia. Both substrates are effectively demethylated, anabasine or anatabine, respectively, accumulating in the medium. Similarly, there is strong stereoselectivity for the (R)-isomers of both substrates. The kinetics of metabolism of (R,S)-N-methylanabasine differ significantly from those of nicotine in that no further degradation of the initial demethylation product occurs. (R,S)-N-Methylanatabine, however, shows kinetics closer to those of nicotine, with loss of alkaloid from the system. Further more, (R,S)-N-methylanabasine does not diminish (S)-nicotine demethylation, indicating a lack of competition. However, the metabolism of (S)-nicotine is affected by the presence of (R,S)-N-methylanabasine. Hence, the demethylation of the piperidine homologues of nicotine is seen to be similar but not identical to that of the pyridine analogues. The implications of these different metabolic profiles in relation to the demethylation activity are discussed.
Directory of Open Access Journals (Sweden)
Salvatore Serravalle
2016-01-01
Full Text Available T-Acute Lymphoblastic Leukemia (T-ALL remains a subgroup of pediatric ALL, with a lower response to standard chemotherapy. Some recent studies established the fundamental role of epigenetic aberrations such as DNA hypermethylation, to influence patients’ outcome and response to chemotherapy. Moreover, L-asparaginase is an important chemotherapeutic agent for treatment of ALL and resistance to this drug has been linked to ASNS expression, which can be silenced through methylation. Therefore, we tested whether the sensitivity of T-ALL cell lines towards L-asparaginase is correlated to the epigenetic status of ASNS gene and whether the sensitivity can be modified by concurrent demethylating treatment. Hence we treated different T-ALL cell lines with L-asparaginase and correlated different responses to the treatment with ASNS expression. Then we demonstrated that the ASNS expression was dependent on the methylation status of the promoter. Finally we showed that, despite the demethylating effect on the ASNS gene expression, the combined treatment with the demethylating agent Decitabine could synergistically improve the L-asparaginase sensitivity in those T-ALL cell lines characterized by hypermethylation of the ASNS gene. In conclusion, this preclinical study identified an unexpected synergistic activity of L-asparaginase and Decitabine in the subgroup of T-ALL with low ASNS expression due to hypermethylation of the ASNS promoter, while it did not restore sensitivity in the resistant cell lines characterized by higher ASNS expression.
DEFF Research Database (Denmark)
Rocchi, E; Khodjakov, A; Volk, E L
2000-01-01
by Western blot and immunohistochemistry. This protein is highly overexpressed in several drug-resistant cell lines and localizes predominantly to the plasma membrane, instead of to intracellular membranes as seen with all other known half-transporters. Therefore, BCRP/MXR is unique among the ABC half......The products of the ABC gene family can be generally classified as either full-transporters of half-transporters. Full-transporters are expressed in the plasma membrane, whereas half-transporters are usually found in intracellular membranes. Recently, an ABC half-transporter, the ABCG2 gene product......-transporters by being localized to the plasma membrane....
Czech Academy of Sciences Publication Activity Database
Agrawal, K.; Das, V.; Otmar, Miroslav; Krečmerová, Marcela; Džubák, P.; Hajdúch, M.
2015-01-01
Roč. 14, Suppl 2 (2015), B72 ISSN 1535-7163. [AACR-NCI-EORTC International Conference: Molecular Targets and Cancer Therapeutics. 05.11.2015-09.11.2015, Boston] R&D Projects: GA MPO(CZ) FR-TI4/625; GA MŠk(CZ) LO1304 Institutional support: RVO:61388963 Keywords : demethylation * epigenetic drugs * fluorescence detection system Subject RIV: CC - Organic Chemistry
Saito, Kuniaki; Mukasa, Akitake; Nagae, Genta; Aihara, Koki; Otani, Ryohei; Takayanagi, Shunsaku; Omata, Mayu; Tanaka, Shota; Shibahara, Junji; Takahashi, Miwako; Momose, Toshimitsu; Shimamura, Teppei; Miyano, Satoru; Narita, Yoshitaka; Ueki, Keisuke; Nishikawa, Ryo; Nagane, Motoo; Aburatani, Hiroyuki; Saito, Nobuhito
2014-01-01
Low-grade gliomas often undergo malignant progression, and these transformations are a leading cause of death in patients with low-grade gliomas. However, the molecular mechanisms underlying malignant tumor progression are still not well understood. Recent evidence indicates that epigenetic deregulation is an important cause of gliomagenesis; therefore, we examined the impact of epigenetic changes during malignant progression of low-grade gliomas. Specifically, we used the Illumina Infinium Human Methylation 450K BeadChip to perform genome-wide DNA methylation analysis of 120 gliomas and four normal brains. This study sample included 25 matched-pairs of initial low-grade gliomas and recurrent tumors (temporal heterogeneity) and 20 of the 25 recurring tumors recurred as malignant progressions, and one matched-pair of newly emerging malignant lesions and pre-existing lesions (spatial heterogeneity). Analyses of methylation profiles demonstrated that most low-grade gliomas in our sample (43/51; 84%) had a CpG island methylator phenotype (G-CIMP). Remarkably, approximately 50% of secondary glioblastomas that had progressed from low-grade tumors with the G-CIMP status exhibited a characteristic partial demethylation of genomic DNA during malignant progression, but other recurrent gliomas showed no apparent change in DNA methylation pattern. Interestingly, we found that most loci that were demethylated during malignant progression were located outside of CpG islands. The information of histone modifications patterns in normal human astrocytes and embryonal stem cells also showed that the ratio of active marks at the site corresponding to DNA demethylated loci in G-CIMP-demethylated tumors was significantly lower; this finding indicated that most demethylated loci in G-CIMP-demethylated tumors were likely transcriptionally inactive. A small number of the genes that were upregulated and had demethylated CpG islands were associated with cell cycle-related pathway. In
Demethylation of methylmercury in growing rice plants: An evidence of self-detoxification
International Nuclear Information System (INIS)
Xu, Xiaohan; Zhao, Jiating; Li, Yunyun; Fan, Yuqin; Zhu, Nali; Gao, Yuxi; Li, Bai; Liu, Hanyu; Li, Yu-Feng
2016-01-01
Mercury (Hg) is a global pollutant that poses a serious threat to human and the environment. Rice was found as an important source for human exposure to Hg in some areas. In this study, the transportation and transformation of IHg and MeHg in rice plants exposed to IHg or MeHg were investigated. The IHg and MeHg concentrations in rice roots and shoots collected every five days were analyzed by HPLC-ICP-MS and SR-XANES. When exposed to MeHg, the percent of IHg in rice roots and shoots increased while MeHg decreased significantly, suggesting prominent demethylation of MeHg occurred. However no notable MeHg was found in both roots and shoots of rice plant when exposed to IHg. SR-XANES analysis further confirmed the demethylation of MeHg with rice. This study provides a new finding that demethylation of MeHg could occur in growing rice, which may be a self-defense process of rice plant. - Graphical abstract: Inorganic mercury in Rice (Oryza sativa L.) plants exposed to methylmercury was detected: An evidence of rice plant against methylmercury phytotoxicity. Display Omitted - Highlights: • Demethylation of MeHg in rice plant was found in rice root. • Hg in rice roots mainly present as MeHg-SR or RS-Hg-SR form. • MeHg-SR in roots can be gradually transformed to RS-Hg-SR with rice growth. - Demethylation of MeHg in growing rice.
DEFF Research Database (Denmark)
Johansen, T N; Stensbøl, T B; Nielsen, B
2001-01-01
We have previously described (RS)-2-amino-3-(3-carboxy-5-methyl-4-isoxazolyl)propionic acid (ACPA) as a potent agonist at the (RS)-2-amino-3-(3-hydroxy-5-methyl-4-isoxazolyl)propionic acid (AMPA) receptor subtype of (S)-glutamic acid (Glu) receptors. We now report the chromatographic resolution...... of ACPA and (RS)-2-amino-3-(3-carboxy-4-isoxazolyl)propionic acid (demethyl-ACPA) using a Sumichiral OA-5000 column. The configuration of the enantiomers of both compounds have been assigned based on X-ray crystallographic analyses, supported by circular dichroism spectra and elution orders on chiral HPLC...... columns. Furthermore, the enantiopharmacology of ACPA and demethyl-ACPA was investigated using radioligand binding and cortical wedge electrophysiological assay systems and cloned metabotropic Glu receptors. (S)-ACPA showed high affinity in AMPA binding (IC(50) = 0.025 microM), low affinity in kainic acid...
Demethylation of host-cell DNA at the site of avian retrovirus integration
Czech Academy of Sciences Publication Activity Database
Hejnar, Jiří; Elleder, Daniel; Hájková, P.; Walter, J.; Blažková, Jana; Svoboda, Jan
2003-01-01
Roč. 2003, č. 311 (2003), s. 641-648 ISSN 0006-291X Institutional research plan: CEZ:AV0Z5052915 Keywords : DNA methylation and demethylation * integration of retroviruses * gene silencing Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.836, year: 2003
Directory of Open Access Journals (Sweden)
Damien Marechal
Full Text Available Down syndrome (DS results from one extra copy of human chromosome 21 and leads to several alterations including intellectual disabilities and locomotor defects. The transchromosomic Tc1 mouse model carrying an extra freely-segregating copy of human chromosome 21 was developed to better characterize the relation between genotype and phenotype in DS. The Tc1 mouse exhibits several locomotor and cognitive deficits related to DS. In this report we analyzed the contribution of the genetic dosage of 13 conserved mouse genes located between Abcg1 and U2af1, in the telomeric part of Hsa21. We used the Ms2Yah model carrying a deletion of the corresponding interval in the mouse genome to rescue gene dosage in the Tc1/Ms2Yah compound mice to determine how the different behavioral phenotypes are affected. We detected subtle changes with the Tc1/Ms2Yah mice performing better than the Tc1 individuals in the reversal paradigm of the Morris water maze. We also found that Tc1/Ms2Yah compound mutants performed better in the rotarod than the Tc1 mice. This data support the impact of genes from the Abcg1-U2af1 region as modifiers of Tc1-dependent memory and locomotor phenotypes. Our results emphasize the complex interactions between triplicated genes inducing DS features.
Czech Academy of Sciences Publication Activity Database
Agrawal, K.; Das, V.; Otmar, Miroslav; Krečmerová, Marcela; Džubák, P.; Hajdúch, M.
91A, č. 2 (2017), s. 133-143 ISSN 1552-4922 R&D Projects: GA MZd(CZ) NV15-31984A; GA MŠk(CZ) LO1304; GA MŠk(CZ) LM2015064; GA TA ČR(CZ) TE01020028 Institutional support: RVO:61388963 Keywords : DNA methylation * DNA methylation inhibitors * demethylation detection system * epigenetic drugs * high content screening Subject RIV: CC - Organic Chemistry OBOR OECD: Organic chemistry Impact factor: 3.222, year: 2016
Arctigenin promotes cholesterol efflux from THP-1 macrophages through PPAR-γ/LXR-α signaling pathway
Energy Technology Data Exchange (ETDEWEB)
Xu, Xiaolin [Department of Cardiothoracic Surgery, Huashan Hospital, Fudan University, Shanghai 200032 (China); Li, Qian [Department of Integrative Medicine and Neurobiology, School of Basic Medical Sciences, Shanghai Medical College, Fudan University, Shanghai (China); Pang, Liewen; Huang, Guoqian; Huang, Jiechun; Shi, Meng; Sun, Xiaotian [Department of Cardiothoracic Surgery, Huashan Hospital, Fudan University, Shanghai 200032 (China); Wang, Yiqing [Department of Cardiothoracic Surgery, Huashan Hospital, Fudan University, Shanghai 200032 (China)
2013-11-15
Highlights: •Arctigenin enhanced cholesterol efflux in oxLDL-loaded THP-1 macrophages. •The expression of ABCA1, ABCG1 and apoE was upregulated in arctigenin-treated cells. •Arctigenin promoted the expression of PPAR-γ and LXR-α. •Inhibition of PPAR-γ or LXR-α reversed arctigenin-mediated biological effects. •Arctigenin promotes cholesterol efflux via activation of PPAR-γ/LXR-α/ABCA1 pathway. -- Abstract: Cholesterol efflux from macrophages is a critical mechanism to prevent the development of atherosclerosis. Here, we sought to investigate the effects of arctigenin, a bioactive component of Arctium lappa, on the cholesterol efflux in oxidized low-density lipoprotein (oxLDL)-loaded THP-1 macrophages. Our data showed that arctigenin significantly accelerated apolipoprotein A-I- and high-density lipoprotein-induced cholesterol efflux in both dose- and time-dependent manners. Moreover, arctigenin treatment enhanced the expression of ATP binding cassette transporter A1 (ABCA1), ABCG1, and apoE, all of which are key molecules in the initial step of cholesterol efflux, at both mRNA and protein levels. Arctigenin also caused a concentration-dependent elevation in the expression of peroxisome proliferator-activated receptor-gamma (PPAR-γ) and liver X receptor-alpha (LXR-α). The arctigenin-mediated induction of ABCA1, ABCG1, and apoE was abolished by specific inhibition of PPAR-γ or LXR-α using small interfering RNA technology. Our results collectively indicate that arctigenin promotes cholesterol efflux in oxLDL-loaded THP-1 macrophages through upregulation of ABCA1, ABCG1 and apoE, which is dependent on the enhanced expression of PPAR-γ and LXR-α.
Arctigenin promotes cholesterol efflux from THP-1 macrophages through PPAR-γ/LXR-α signaling pathway
International Nuclear Information System (INIS)
Xu, Xiaolin; Li, Qian; Pang, Liewen; Huang, Guoqian; Huang, Jiechun; Shi, Meng; Sun, Xiaotian; Wang, Yiqing
2013-01-01
Highlights: •Arctigenin enhanced cholesterol efflux in oxLDL-loaded THP-1 macrophages. •The expression of ABCA1, ABCG1 and apoE was upregulated in arctigenin-treated cells. •Arctigenin promoted the expression of PPAR-γ and LXR-α. •Inhibition of PPAR-γ or LXR-α reversed arctigenin-mediated biological effects. •Arctigenin promotes cholesterol efflux via activation of PPAR-γ/LXR-α/ABCA1 pathway. -- Abstract: Cholesterol efflux from macrophages is a critical mechanism to prevent the development of atherosclerosis. Here, we sought to investigate the effects of arctigenin, a bioactive component of Arctium lappa, on the cholesterol efflux in oxidized low-density lipoprotein (oxLDL)-loaded THP-1 macrophages. Our data showed that arctigenin significantly accelerated apolipoprotein A-I- and high-density lipoprotein-induced cholesterol efflux in both dose- and time-dependent manners. Moreover, arctigenin treatment enhanced the expression of ATP binding cassette transporter A1 (ABCA1), ABCG1, and apoE, all of which are key molecules in the initial step of cholesterol efflux, at both mRNA and protein levels. Arctigenin also caused a concentration-dependent elevation in the expression of peroxisome proliferator-activated receptor-gamma (PPAR-γ) and liver X receptor-alpha (LXR-α). The arctigenin-mediated induction of ABCA1, ABCG1, and apoE was abolished by specific inhibition of PPAR-γ or LXR-α using small interfering RNA technology. Our results collectively indicate that arctigenin promotes cholesterol efflux in oxLDL-loaded THP-1 macrophages through upregulation of ABCA1, ABCG1 and apoE, which is dependent on the enhanced expression of PPAR-γ and LXR-α
Almeida, Luciana O; Neto, Marinaldo P C; Sousa, Lucas O; Tannous, Maryna A; Curti, Carlos; Leopoldino, Andreia M
2017-04-18
Epigenetic modifications are essential in the control of normal cellular processes and cancer development. DNA methylation and histone acetylation are major epigenetic modifications involved in gene transcription and abnormal events driving the oncogenic process. SET protein accumulates in many cancer types, including head and neck squamous cell carcinoma (HNSCC); SET is a member of the INHAT complex that inhibits gene transcription associating with histones and preventing their acetylation. We explored how SET protein accumulation impacts on the regulation of gene expression, focusing on DNA methylation and histone acetylation. DNA methylation profile of 24 tumour suppressors evidenced that SET accumulation decreased DNA methylation in association with loss of 5-methylcytidine, formation of 5-hydroxymethylcytosine and increased TET1 levels, indicating an active DNA demethylation mechanism. However, the expression of some suppressor genes was lowered in cells with high SET levels, suggesting that loss of methylation is not the main mechanism modulating gene expression. SET accumulation also downregulated the expression of 32 genes of a panel of 84 transcription factors, and SET directly interacted with chromatin at the promoter of the downregulated genes, decreasing histone acetylation. Gene expression analysis after cell treatment with 5-aza-2'-deoxycytidine (5-AZA) and Trichostatin A (TSA) revealed that histone acetylation reversed transcription repression promoted by SET. These results suggest a new function for SET in the regulation of chromatin dynamics. In addition, TSA diminished both SET protein levels and SET capability to bind to gene promoter, suggesting that administration of epigenetic modifier agents could be efficient to reverse SET phenotype in cancer.
Li, Fa-gui; Chu, Yi; Meng, Dong-mei; Tong, Ya-wen
2011-12-01
To assess the association between a C421A single nucleotide polymorphism (SNP) in exon 5 of ATP-binding cassette, sub-family G (WHITE), member 2 (ABCG2) gene and susceptibility of primary gout in Han Chinese males. For 200 male patients with primary gout and 235 controls, the genotype of C421A locus was analyzed by PCR and direct sequencing. Blood glucose, uric acid, total cholesterol, triglycerides, creatinine and urea nitrogen was measured by an automatic biochemical analyzer. Compared with the controls, there was a higher frequency for AA genotype and A allele of the rs2231142 SNP in gout patients (22.5% vs. 8.5% by genotype; 44.9% vs. 32.3% by allele). The association with gout reached significance (chi-square =15.91, Pgout patients were significantly higher than those of controls (Pgout in Han Chinese males.
Matsuda, Shuichi; Takano, Sho; Sato, Moeko; Furukawa, Kaoru; Nagasawa, Hidetaka; Yoshikawa, Shoko; Kasuga, Jun; Tokuji, Yoshihiko; Yazaki, Kazufumi; Nakazono, Mikio; Takamure, Itsuro; Kato, Kiyoaki
2016-03-07
Water stress is one of the major environmental stresses that affect agricultural production worldwide. Water loss from plants occurs primarily through stomatal pores. Here, we report that an Oryza sativa half-size ATP-binding cassette (ABC) subfamily G protein, RCN1/OsABCG5, is involved in stomatal closure mediated by phytohormone abscisic acid (ABA) accumulation in guard cells. We found that the GFP-RCN1/OsABCG5-fusion protein was localized at the plasma membrane in guard cells. The percentage of guard cell pairs containing both ABA and GFP-RCN1/OsABCG5 increased after exogenous ABA treatment, whereas they were co-localized in guard cell pairs regardless of whether exogenous ABA was applied. ABA application resulted in a smaller increase in the percentage of guard cell pairs containing ABA in rcn1 mutant (A684P) and RCN1-RNAi than in wild-type plants. Furthermore, polyethylene glycol (drought stress)-inducible ABA accumulation in guard cells did not occur in rcn1 mutants. Stomata closure mediated by exogenous ABA application was strongly reduced in rcn1 mutants. Finally, rcn1 mutant plants had more rapid water loss from detached leaves than the wild-type plants. These results indicate that in response to drought stress, RCN1/OsABCG5 is involved in accumulation of ABA in guard cells, which is indispensable for stomatal closure. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.
Chao, Yu-Chieh; Xie, Fang; Li, Xueyang; Guo, Ruijuan; Yang, Ning; Zhang, Chen; Shi, Rong; Guan, Yun; Yue, Yun; Wang, Yun
2016-07-01
Repeated administration of morphine may result in opioid-induced hypersensitivity (OIH), which involves altered expression of numerous genes, including brain-derived neurotrophic factor (BDNF) in dorsal root ganglion (DRG) neurons. Yet, it remains unclear how BDNF expression is increased in DRG neurons after repeated morphine treatment. DNA methylation is an important mechanism of epigenetic control of gene expression. In the current study, we hypothesized that the demethylation regulation of certain BDNF gene promoters in DRG neurons may contribute to the development of OIH. Real-time RT-PCR was used to assess changes in the mRNA transcription levels of major BDNF exons including exon I, II, IV, VI, as well as total BDNF mRNA in DRGs from rats after repeated morphine administration. The levels of exon IV and total BDNF mRNA were significantly upregulated by repeated morphine administration, as compared to that in saline control group. Further, ELISA array and immunocytochemistry study revealed a robust upregulation of BDNF protein expression in DRG neurons after repeated morphine exposure. Correspondingly, the methylation levels of BDNF exon IV promoter showed a significant downregulation by morphine treatment. Importantly, intrathecal administration of a BDNF antibody, but not control IgG, significantly inhibited mechanical hypersensitivity that developed in rats after repeated morphine treatment. Conversely, intrathecal administration of an inhibitor of DNA methylation, 5-aza-2'-deoxycytidine (5-aza-dC) markedly upregulated the BDNF protein expression in DRG neurons and enhanced the mechanical allodynia after repeated morphine exposure. Together, our findings suggest that demethylation regulation of BDNF gene promoter may be implicated in the development of OIH through epigenetic control of BDNF expression in DRG neurons. Copyright © 2016 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
von Kampen, Oliver; Buch, Stephan; Nothnagel, Michael
2013-01-01
The sterolin locus (ABCG5/ABCG8) confers susceptibility for cholesterol gallstone disease in humans. Both the responsible variant and the molecular mechanism causing an increased incidence of gallstones in these patients have as yet not been identified. Genetic mapping utilized patient samples from...... Germany (2,808 cases, 2,089 controls), Chile (680 cases, 442 controls), Denmark (366 cases, 766 controls), India (247 cases, 224 controls), and China (280 cases, 244 controls). Analysis of allelic imbalance in complementary DNA (cDNA) samples from human liver (n = 22) was performed using pyrosequencing....... Transiently transfected HEK293 cells were used for [(3) H]-cholesterol export assays, analysis of protein expression, and localization of allelic constructs. Through fine mapping in German and Chilean samples, an ∼250 kB disease-associated interval could be defined for this locus. Lack of allelic imbalance...
Directory of Open Access Journals (Sweden)
Eviatar Nevo
2013-10-01
Full Text Available Wild barley eibi1 mutant with HvABCG31 gene mutation has low capacity to retain leaf water, a phenotype associated with reduced cutin deposition and a thin cuticle. To better understand how such a mutant plant survives, we performed a genome-wide gene expression analysis. The leaf transcriptomes between the near-isogenic lines eibi1 and the wild type were compared using the 22-k Barley1 Affymetrix microarray. We found that the pleiotropic effect of the single gene HvABCG31 mutation was linked to the co-regulation of metabolic processes and stress-related system. The cuticle development involved cytochrome P450 family members and fatty acid metabolism pathways were significantly up-regulated by the HvABCG31 mutation, which might be anticipated to reduce the levels of cutin monomers or wax and display conspicuous cuticle defects. The candidate genes for responses to stress were induced by eibi1 mutant through activating the jasmonate pathway. The down-regulation of co-expressed enzyme genes responsible for DNA methylation and histone deacetylation also suggested that HvABCG31 mutation may affect the epigenetic regulation for barley development. Comparison of transcriptomic profiling of barley under biotic and abiotic stresses revealed that the functions of HvABCG31 gene to high-water loss rate might be different from other osmotic stresses of gene mutations in barley. The transcriptional profiling of the HvABCG31 mutation provided candidate genes for further investigation of the physiological and developmental changes caused by the mutant.
Early de novo DNA methylation and prolonged demethylation in the muscle lineage.
Tsumagari, Koji; Baribault, Carl; Terragni, Jolyon; Varley, Katherine E; Gertz, Jason; Pradhan, Sirharsa; Badoo, Melody; Crain, Charlene M; Song, Lingyun; Crawford, Gregory E; Myers, Richard M; Lacey, Michelle; Ehrlich, Melanie
2013-03-01
Myogenic cell cultures derived from muscle biopsies are excellent models for human cell differentiation. We report the first comprehensive analysis of myogenesis-specific DNA hyper- and hypo-methylation throughout the genome for human muscle progenitor cells (both myoblasts and myotubes) and skeletal muscle tissue vs. 30 non-muscle samples using reduced representation bisulfite sequencing. We also focused on four genes with extensive hyper- or hypo-methylation in the muscle lineage (PAX3, TBX1, MYH7B/MIR499 and OBSCN) to compare DNA methylation, DNaseI hypersensitivity, histone modification, and CTCF binding profiles. We found that myogenic hypermethylation was strongly associated with homeobox or T-box genes and muscle hypomethylation with contractile fiber genes. Nonetheless, there was no simple relationship between differential gene expression and myogenic differential methylation, rather only for subsets of these genes, such as contractile fiber genes. Skeletal muscle retained ~30% of the hypomethylated sites but only ~3% of hypermethylated sites seen in myogenic progenitor cells. By enzymatic assays, skeletal muscle was 2-fold enriched globally in genomic 5-hydroxymethylcytosine (5-hmC) vs. myoblasts or myotubes and was the only sample type enriched in 5-hmC at tested myogenic hypermethylated sites in PAX3/CCDC140 andTBX1. TET1 and TET2 RNAs, which are involved in generation of 5-hmC and DNA demethylation, were strongly upregulated in myoblasts and myotubes. Our findings implicate de novo methylation predominantly before the myoblast stage and demethylation before and after the myotube stage in control of transcription and co-transcriptional RNA processing. They also suggest that, in muscle, TET1 or TET2 are involved in active demethylation and in formation of stable 5-hmC residues.
Wu, Huifang; Thatcher, Linn N; Bernard, Denzil; Parrish, Damon A; Deschamps, Jeffrey R; Rice, Kenner C; MacKerell, Alexander D; Coop, Andrew
2005-06-23
[reaction: see text] L-Selectride is an efficient agent for the 3-O-demethylation of opioids and is known to cleave the least hindered methoxyl group in a molecule. The treatment of a 3,4-dimethoxymorphinan containing a 6-ketal with L-Selectride gave selective 4-O-demethylation, rather than cleavage of the less hindered 3-methoxyl. In contrast, a 3,4-dimethoxymorphinan lacking a 6-ketal gave selective 3-O-demethylation, suggesting that the regiochemistry of L-Selectride-mediated O-demethylation can be manipulated through altering the position of coordination of the lithium ion.
International Nuclear Information System (INIS)
Müller, Imke; Wischnewski, Frank; Pantel, Klaus; Schwarzenbach, Heidi
2010-01-01
The aim of the current study was to analyze the involvement of methyl-CpG binding proteins (MBDs) and histone modifications on the regulation of CD44, Cyclin D2, GLIPR1 and PTEN in different cellular contexts such as the prostate cancer cells DU145 and LNCaP, and the breast cancer cells MCF-7. Since global chromatin changes have been shown to occur in tumours and regions of tumour-associated genes are affected by epigenetic modifications, these may constitute important regulatory mechanisms for the pathogenesis of malignant transformation. In DU145, LNCaP and MCF-7 cells mRNA expression levels of CD44, Cyclin D2, GLIPR1 and PTEN were determined by quantitative RT-PCR at the basal status as well as after treatment with demethylating agent 5-aza-2'-deoxycytidine and/or histone deacetylase inhibitor Trichostatin A. Furthermore, genomic DNA was bisulfite-converted and sequenced. Chromatin immunoprecipitation was performed with the stimulated and unstimulated cells using antibodies for MBD1, MBD2 and MeCP2 as well as 17 different histone antibodies. Comparison of the different promoters showed that MeCP2 and MBD2a repressed promoter-specifically Cyclin D2 in all cell lines, whereas in MCF-7 cells MeCP2 repressed cell-specifically all methylated promoters. Chromatin immunoprecipitation showed that all methylated promoters associated with at least one MBD. Treatment of the cells by the demethylating agent 5-aza-2'-deoxycytidine (5-aza-CdR) caused dissociation of the MBDs from the promoters. Only MBD1v1 bound and repressed methylation-independently all promoters. Real-time amplification of DNA immunoprecipitated by 17 different antibodies showed a preferential enrichment for methylated lysine of histone H3 (H3K4me1, H3K4me2 and H3K4me3) at the particular promoters. Notably, the silent promoters were associated with unmodified histones which were acetylated following treatment by 5-aza-CdR. This study is one of the first to reveal the histone code and MBD profile
Wiersma, Harmen; Nijstad, Niels; de Boer, Jan Freark; Out, Ruud; Hogewerf, Wytse; Van Berkel, Theo J.; Kuipers, Folkert; Tietge, Uwe J. F.
Objective: The ATP Binding Cassette transporter G1 (ABCG1) has been implicated in cholesterol efflux towards HDL and reverse cholesterol transport (RCT). Biliary cholesterol secretion is considered as an important step in RCT. The aim of the present study was to determine the consequences of Abcg1
KDM1A triggers androgen-induced miRNA transcription via H3K4me2 demethylation and DNA oxidation.
Yang, Shu; Zhang, Jiyuan; Zhang, Yalong; Wan, Xuechao; Zhang, Congzhe; Huang, Xiaohui; Huang, Wenhua; Pu, Honglei; Pei, Chaohan; Wu, Hai; Huang, Yan; Huang, Shengdong; Li, Yao
2015-06-15
Androgen receptor (AR) is a ligand dependent transcription factor that regulates the transcription of target genes. AR activity is closely involved in the maintenance and progression of prostate cancer. After the binding with androgen, AR moves into nucleus and binds to DNA sequence containing androgen response elements (ARE). Flavin-dependent monoamine oxidase KDM1A is necessary for AR driven transcription while the mechanism remains unclear. The association between androgen-dependent transcription and oxidation was tested through pharmaceutical inhibitions and siRNA knockdown of DNA oxidation repair components in prostate cancer cells. The recruitment of involved proteins and the histone methylation dynamics on ARE region was explored by chromatin immunoprecipitation (ChIP). Oxidation inhibition reduced AR dependent expression of KLK3, TMPRSS2, hsa-miR-125b2, and hsa-miR-133b. And such reduction could be restored by H2 O2 treatment. KDM1A recruitment and H3K4me2 demethylation on ARE regions, which produce H2 O2 , are associated with AR targets transcription. AR targets transcription and coupled oxidation recruit 8-oxoguanine-DNA glycosylase (OGG1) and the nuclease APEX1 to ARE regions. Such recruitment depends on KDM1A, and is necessary for AR targets transcription. Our work underlined the importance of histone demethylation and DNA oxidation/repairing machinery in androgen-dependent transcription. The present finds have implications for research into new druggable targets for prostate cancer relying on the cascade of AR activity regulation. © 2015 Wiley Periodicals, Inc.
Cho, Bongsup P; Yang, Tianle; Blankenship, Lonnie R; Moody, Joanna D; Churchwell, Mona; Beland, Frederick A; Culp, Sandra J
2003-03-01
Malachite green (MG), a triphenylmethane dye used to treat fungal and protozoan infections in fish, undergoes sequential oxidation to produce various N-demethylated derivatives (monodes-, dides(sym)-, dides(unsym)-, trides-, and tetrades-) both before and after reduction to leucomalachite green (LMG). The close structure resemblance of the metabolites with aromatic amine carcinogens implicates a potential genotoxicity from exposure to MG. The availability of the synthetic standards is important for metabolic and DNA adduct studies of MG. This paper describes a simple and versatile method for the synthesis of MG, LMG, and their N-demethylated metabolites. The synthesis involves a coupling of 4-(dimethylamino)benzophenone or 4-nitrobenzophenone with the aryllithium reagents derived from appropriately substituted 4-bromoaniline derivatives, followed by treatment with HCl in methanol. The resulting cationic MG and their leuco analogues showed systematic UV/vis spectral and tandem mass fragmentation patterns consistent with sequential N-demethylation. The extensive (1)H and (13)C spectral assignments of the metabolites were aided by the availability of (13)C(7)-labeled MG and LMG. The results indicate the existence of a resonance structure with the cationic charge located in the central methane carbon (C(7)). The synthetic procedure is general in scope so that it can be extended to the preparation of N-demethylated metabolites of other structurally related N-methylated triphenylmethane dyes.
International Nuclear Information System (INIS)
Lee, Kwan Soo; Kim, Kee D.
2010-01-01
We have developed a new and efficient method for the demethylation of various types of aryl methyl ethers using readily available, stable, and easily handled magnesium iodide in [BMIM]BF 4 ionic liquid. Owing to its simplicity and mild reaction conditions the protocol reported herein may serve as a useful alternative to the existing methods for the deprotection of aryl methyl ethers to the corresponding phenolic derivatives. Demethylation of aryl methyl ethers to the corresponding phenols are very important reactions in organic synthesis. A number of methods have been reported for the cleavage of highly stable aryl methyl ethers utilizing strong acids or bases such as aluminum chloride, boron tribromide, cerium chloride, alkaline thiolate, methyl magnesium iodide, and L-Selectride. However, all of these methods invariably suffered from one or more drawbacks such as harsh reaction conditions, long reaction times, difficulty of manipulation, use of exotic reagents, and low reaction yields. Furthermore, in the most of known methods for demethylation of aryl methyl ethers, use of large excess amounts of demethylating agents have been generally required. Thus, it is highly desirable to develop an improved convenient and efficient procedure for demethylation reactions of aryl methyl ethers
Energy Technology Data Exchange (ETDEWEB)
Lee, Kwan Soo [KAIST, Daejeon (Korea, Republic of); Kim, Kee D. [Sangji University, Wonju (Korea, Republic of)
2010-12-15
We have developed a new and efficient method for the demethylation of various types of aryl methyl ethers using readily available, stable, and easily handled magnesium iodide in [BMIM]BF{sub 4} ionic liquid. Owing to its simplicity and mild reaction conditions the protocol reported herein may serve as a useful alternative to the existing methods for the deprotection of aryl methyl ethers to the corresponding phenolic derivatives. Demethylation of aryl methyl ethers to the corresponding phenols are very important reactions in organic synthesis. A number of methods have been reported for the cleavage of highly stable aryl methyl ethers utilizing strong acids or bases such as aluminum chloride, boron tribromide, cerium chloride, alkaline thiolate, methyl magnesium iodide, and L-Selectride. However, all of these methods invariably suffered from one or more drawbacks such as harsh reaction conditions, long reaction times, difficulty of manipulation, use of exotic reagents, and low reaction yields. Furthermore, in the most of known methods for demethylation of aryl methyl ethers, use of large excess amounts of demethylating agents have been generally required. Thus, it is highly desirable to develop an improved convenient and efficient procedure for demethylation reactions of aryl methyl ethers.
Zhang, Lili; Spencer, Kylee L.; Voruganti, V. Saroja; Jorgensen, Neal W.; Fornage, Myriam; Best, Lyle G.; Brown-Gentry, Kristin D.; Cole, Shelley A.; Crawford, Dana C.; Deelman, Ewa; Franceschini, Nora; Gaffo, Angelo L.; Glenn, Kimberly R.; Heiss, Gerardo; Jenny, Nancy S.; Kottgen, Anna; Li, Qiong; Liu, Kiang; Matise, Tara C.; North, Kari E.; Umans, Jason G.; Kao, W. H. Linda
2013-01-01
A loss-of-function mutation (Q141K, rs2231142) in the ATP-binding cassette, subfamily G, member 2 gene (ABCG2) has been shown to be associated with serum uric acid levels and gout in Asians, Europeans, and European and African Americans; however, less is known about these associations in other populations. Rs2231142 was genotyped in 22,734 European Americans, 9,720 African Americans, 3,849 Mexican Americans, and 3,550 American Indians in the Population Architecture using Genomics and Epidemiology (PAGE) Study (2008–2012). Rs2231142 was significantly associated with serum uric acid levels (P = 2.37 × 10−67, P = 3.98 × 10−5, P = 6.97 × 10−9, and P = 5.33 × 10−4 in European Americans, African Americans, Mexican Americans, and American Indians, respectively) and gout (P = 2.83 × 10−10, P = 0.01, and P = 0.01 in European Americans, African Americans, and Mexican Americans, respectively). Overall, the T allele was associated with a 0.24-mg/dL increase in serum uric acid level (P = 1.37 × 10−80) and a 1.75-fold increase in the odds of gout (P = 1.09 × 10−12). The association between rs2231142 and serum uric acid was significantly stronger in men, postmenopausal women, and hormone therapy users compared with their counterparts. The association with gout was also significantly stronger in men than in women. These results highlight a possible role of sex hormones in the regulation of ABCG2 urate transporter and its potential implications for the prevention, diagnosis, and treatment of hyperuricemia and gout. PMID:23552988
Directory of Open Access Journals (Sweden)
Xuan Qiu
Full Text Available We devised an aerosol based demethylation therapy to achieve therapeutic efficacy in premalignant or in situ lesions of lung cancer, without systemic toxicity. Optimum regimens of aerosolized azacytidine (Aza were designed and used in orthotopic human non-small cell lung cancer xenograft models. The therapeutic efficacy and toxicity of aerosol Aza were compared with intravenously administered Aza. We observed that 80% of the droplets of the aerosol Aza measured ∼0.1-5 microns, which resulted in deposition in the lower bronchial airways. An animal model that phenocopies field carcinogeneisis in humans was developed by intratracheal inoculation of the human lung cancer cells in mice, thus resulting in their distribution throughout the entire airway space. Aerosolized Aza significantly prolonged the survival of mice bearing endo-bronchial lung tumors. The aerosol treatment did not cause any detectable lung toxicity or systemic toxicity. A pre-pharmacokinetic study in mice demonstrated that lung deposition of aerosolized Aza was significantly higher than the intravenous route. Lung tumors were resected after aerosol treatment and the methylation levels of 24 promoters of tumor-suppresser genes related to lung cancer were analyzed. Aerosol Aza significantly reduced the methylation level in 9 of these promoters and reexpressed several genes tested. In conclusion, aerosol Aza at non-cytotoxic doses appears to be effective and results in DNA demethylation and tumor suppressor gene re-expression. The therapeutic index of aerosol Aza is >100-fold higher than that of intravenous Aza. These results provide a preclinical rationale for a phase I clinical trial of aerosol Aza to be initiated at our Institution.
Directory of Open Access Journals (Sweden)
Schwarzenbach Heidi
2010-06-01
Full Text Available Abstract Background The aim of the current study was to analyze the involvement of methyl-CpG binding proteins (MBDs and histone modifications on the regulation of CD44, Cyclin D2, GLIPR1 and PTEN in different cellular contexts such as the prostate cancer cells DU145 and LNCaP, and the breast cancer cells MCF-7. Since global chromatin changes have been shown to occur in tumours and regions of tumour-associated genes are affected by epigenetic modifications, these may constitute important regulatory mechanisms for the pathogenesis of malignant transformation. Methods In DU145, LNCaP and MCF-7 cells mRNA expression levels of CD44, Cyclin D2, GLIPR1 and PTEN were determined by quantitative RT-PCR at the basal status as well as after treatment with demethylating agent 5-aza-2'-deoxycytidine and/or histone deacetylase inhibitor Trichostatin A. Furthermore, genomic DNA was bisulfite-converted and sequenced. Chromatin immunoprecipitation was performed with the stimulated and unstimulated cells using antibodies for MBD1, MBD2 and MeCP2 as well as 17 different histone antibodies. Results Comparison of the different promoters showed that MeCP2 and MBD2a repressed promoter-specifically Cyclin D2 in all cell lines, whereas in MCF-7 cells MeCP2 repressed cell-specifically all methylated promoters. Chromatin immunoprecipitation showed that all methylated promoters associated with at least one MBD. Treatment of the cells by the demethylating agent 5-aza-2'-deoxycytidine (5-aza-CdR caused dissociation of the MBDs from the promoters. Only MBD1v1 bound and repressed methylation-independently all promoters. Real-time amplification of DNA immunoprecipitated by 17 different antibodies showed a preferential enrichment for methylated lysine of histone H3 (H3K4me1, H3K4me2 and H3K4me3 at the particular promoters. Notably, the silent promoters were associated with unmodified histones which were acetylated following treatment by 5-aza-CdR. Conclusions This study is one
Extra-Renal Elimination of Uric Acid via Intestinal Efflux Transporter BCRP/ABCG2
Hosomi, Atsushi; Nakanishi, Takeo; Fujita, Takuya; Tamai, Ikumi
2012-01-01
Urinary excretion accounts for two-thirds of total elimination of uric acid and the remainder is excreted in feces. However, the mechanism of extra-renal elimination is poorly understood. In the present study, we aimed to clarify the mechanism and the extent of elimination of uric acid through liver and intestine using oxonate-treated rats and Caco-2 cells as a model of human intestinal epithelium. In oxonate-treated rats, significant amounts of externally administered and endogenous uric acid were recovered in the intestinal lumen, while biliary excretion was minimal. Accordingly, direct intestinal secretion was thought to be a substantial contributor to extra-renal elimination of uric acid. Since human efflux transporter BCRP/ABCG2 accepts uric acid as a substrate and genetic polymorphism causing a decrease of BCRP activity is known to be associated with hyperuricemia and gout, the contribution of rBcrp to intestinal secretion was examined. rBcrp was confirmed to transport uric acid in a membrane vesicle study, and intestinal regional differences of expression of rBcrp mRNA were well correlated with uric acid secretory activity into the intestinal lumen. Bcrp1 knockout mice exhibited significantly decreased intestinal secretion and an increased plasma concentration of uric acid. Furthermore, a Bcrp inhibitor, elacridar, caused a decrease of intestinal secretion of uric acid. In Caco-2 cells, uric acid showed a polarized flux from the basolateral to apical side, and this flux was almost abolished in the presence of elacridar. These results demonstrate that BCRP contributes at least in part to the intestinal excretion of uric acid as extra-renal elimination pathway in humans and rats. PMID:22348008
A New Synthetic Route to Dihydrobenzopyran Via Tandem Demethylation Cyclisation
Directory of Open Access Journals (Sweden)
G. Shanmugam
2000-06-01
Full Text Available A tandem demethylation-cyclisation reaction resulting in the formation of pyran rings using AlCl3/EtSH reagent under mild reaction conditions is reported. X-ray diffraction studies on the intermediate support the suggested mechanism.
Long, Xin Hua; Zhou, Yun Fei; Peng, Ai Fen; Zhang, Zhi Hong; Chen, Xuan Yin; Chen, Wen Zhao; Liu, Jia Ming; Huang, Shan Hu; Liu, Zhi Li
2015-05-01
Previous studies demonstrated that increased Homo sapiens valosin-containing protein (VCP) may be involved in osteosarcoma (OS) metastasis. However, the underlying mechanism of VCP over-expression in OS remains unknown. In the present study, we found a significantly negative correlation between miR-129-5p and VCP protein expression in OS tissues with pulmonary metastasis (Spearman's rho, rs = -0.948). Bioinformatical prediction, Luciferase reporter assay, Western blot, and RT-PCR assays performed on OS cells indicated that VCP is a target of miR-129-5p. In addition, three CPG islands in the region of miR-129-5p promoter were detected by bioinformatical prediction, and significantly higher expression of miR-129-5p and lower methylation level of miR-129-2 gene in OS cells treated with 5-Aza-2'-deoxycytidine (a potent DNA demethylating agent) than in those untreated cells were observed. Furthermore, lower migratory and invasive ability was found in cells with elevated miR-129-5p than in those with decreased miR-129-5p. These findings indicated that increased miR-129-5p may be mediated by demethylation and inhibit OS cell migration and invasion by targeting VCP in OS, and targeting miR-129-5p/VCP signaling pathway may serve as a therapeutic strategy for OS management, although further studies will be necessary.
Directory of Open Access Journals (Sweden)
Benitez-Bribiesca Luis
2006-08-01
Full Text Available Abstract Background The development of resistance to cytotoxic chemotherapy continues to be a major obstacle for successful anticancer therapy. It has been shown that cells exposed to toxic concentrations of commonly used cancer chemotherapy agents develop DNA hypermetylation. Hence, demethylating agents could play a role in overcoming drug resistance. Methods MCF-7 cells were rendered adriamycin-resistant by weekly treatment with adriamycin. Wild-type and the resulting MCF-7/Adr cells were analyzed for global DNA methylation. DNA methyltransferase activity and DNA methyltransferase (dnmt gene expression were also determined. MCF-7/Adr cells were then subjected to antisense targeting of dnmt1, -3a, and -b genes and to treatment with the DNA methylation inhibitor hydralazine to investigate whether DNA demethylation restores sensitivity to adriamycin. Results MCF-7/Adr cells exhibited the multi-drug resistant phenotype as demonstrated by adriamycin resistance, mdr1 gene over-expression, decreased intracellular accumulation of adriamycin, and cross-resistance to paclitaxel. The mdr phenotype was accompanied by global DNA hypermetylation, over-expression of dnmt genes, and increased DNA methyltransferase activity as compared with wild-type MCF-7 cells. DNA demethylation through antisense targeting of dnmts or hydralazine restored adriamycin sensitivity of MCF-7/Adr cells to a greater extent than verapamil, a known inhibitor of mdr protein, suggesting that DNA demethylation interferes with the epigenetic reprogramming that participates in the drug-resistant phenotype. Conclusion We provide evidence that DNA hypermethylation is at least partly responsible for development of the multidrug-resistant phenotype in the MCF-7/Adr model and that hydralazine, a known DNA demethylating agent, can revert the resistant phenotype.
[Inactivation of PMS2 gene by promoter methylation in nasopharyngeal carcinoma].
Ni, H F; Jiang, B; Zhou, Z; Li, Y; Yuan, X Y; Cao, X L; Huang, G W
2016-11-23
Objective: To investigate the inactivation of PMS2 gene mediated by promoter methylation and its regulatory mechanism in nasopharyngeal carcinoma (NPC). Methods: Fifty-four NPC tissues, 16 normal nasopharyngeal epithelia (NNE), 5 NPC cell lines (CNE1, CNE2, TWO3, HNE1 and HONE1) and 1 normal nasopharyngeal epithelial cell line (NP69) were collected.Methylation-specific PCR (MSP) was used to detect the PMS2 promoter methylation, semi-quantitative reverse transcription PCR (qRT-PCR) was applied to determine its mRNA expression, and immunohistochemistry (IHC) was used to detect the protein expression of PMS2. The expressions of PMS2 mRNA in CNE1 and CNE2 cells before and after treated with methyltransferase inhibitor 5-aza-2-deoxycytidine were analyzed by qRT-PCR. The impact of methylation and demethylation on the mRNA expression of PMS2, and the association of mRNA and protein expression of PMS2 with clinicopathological features of nasopharyngeal cancer were analyzed. Results: Methylation of PMS2 gene was detected in all of the five NPC cell lines, but not in normal nasopharyngeal epithelial NP69 cells. The methylation rate of PMS2 gene in NPC tissues was 63% (34/54), significantly higher than that of the normal nasopharyngeal epithelia (0/16, P PMS2 mRNA and protein were significantly down-regulated in the 54 NPC tissues when compared with those in the 16 NNE tissues ( P PMS2 mRNA was restored in the CNE1 and CNE2 cells.However, the expressions of PMS2 mRNA and protein were not significantly correlated with patients' age, gender, TNM stage, histopathologic type or lymph node metastasis ( P >0.05 for all). Conclusions: Promoter methylation-mediated inactivation of PMS2 gene participates in carcinogenesis and development of NPC. PMS2 may be a candidate tumor suppressor in the treatment for patients with inactivation of PMS2 promoter methylation.
ERRα protein is stabilized by LSD1 in a demethylation-independent manner.
Directory of Open Access Journals (Sweden)
Julie Carnesecchi
Full Text Available The LSD1 histone demethylase is highly expressed in breast tumors where it constitutes a factor of poor prognosis and promotes traits of cancer aggressiveness such as cell invasiveness. Recent work has shown that the Estrogen-Related Receptor α (ERRα induces LSD1 to demethylate the Lys 9 of histone H3. This results in the transcriptional activation of a number of common target genes, several of which being involved in cellular invasion. High expression of ERRα protein is also a factor of poor prognosis in breast tumors. Here we show that, independently of its demethylase activities, LSD1 protects ERRα from ubiquitination, resulting in overexpression of the latter protein. Our data also suggests that the elevation of LSD1 mRNA and protein in breast cancer (as compared to normal tissue may be a key event to increase ERRα protein, independently of its corresponding mRNA.
ERRα protein is stabilized by LSD1 in a demethylation-independent manner.
Carnesecchi, Julie; Cerutti, Catherine; Vanacker, Jean-Marc; Forcet, Christelle
2017-01-01
The LSD1 histone demethylase is highly expressed in breast tumors where it constitutes a factor of poor prognosis and promotes traits of cancer aggressiveness such as cell invasiveness. Recent work has shown that the Estrogen-Related Receptor α (ERRα) induces LSD1 to demethylate the Lys 9 of histone H3. This results in the transcriptional activation of a number of common target genes, several of which being involved in cellular invasion. High expression of ERRα protein is also a factor of poor prognosis in breast tumors. Here we show that, independently of its demethylase activities, LSD1 protects ERRα from ubiquitination, resulting in overexpression of the latter protein. Our data also suggests that the elevation of LSD1 mRNA and protein in breast cancer (as compared to normal tissue) may be a key event to increase ERRα protein, independently of its corresponding mRNA.
Enhanced photo(geno)toxicity of demethylated chlorpromazine metabolites
Energy Technology Data Exchange (ETDEWEB)
Palumbo, Fabrizio [Instituto de Tecnología Química UPV-CSIC/Departamento de Química, Universitat Politècnica de València, Camino de Vera s/n, 46022 Valencia (Spain); Garcia-Lainez, Guillermo [Instituto de Investigación Sanitaria (IIS) La Fe, Hospital Universitari i Politècnic La Fe, Avenida de Fernando Abril Martorell 106, 46026 Valencia (Spain); Limones-Herrero, Daniel [Instituto de Tecnología Química UPV-CSIC/Departamento de Química, Universitat Politècnica de València, Camino de Vera s/n, 46022 Valencia (Spain); Coloma, M. Dolores; Escobar, Javier [Instituto de Investigación Sanitaria (IIS) La Fe, Hospital Universitari i Politècnic La Fe, Avenida de Fernando Abril Martorell 106, 46026 Valencia (Spain); Jiménez, M. Consuelo [Instituto de Tecnología Química UPV-CSIC/Departamento de Química, Universitat Politècnica de València, Camino de Vera s/n, 46022 Valencia (Spain); Miranda, Miguel A., E-mail: mmiranda@qim.upv.es [Instituto de Tecnología Química UPV-CSIC/Departamento de Química, Universitat Politècnica de València, Camino de Vera s/n, 46022 Valencia (Spain); and others
2016-12-15
Chlorpromazine (CPZ) is an anti-psychotic drug widely used to treat disorders such as schizophrenia or manic-depression. Unfortunately, CPZ exhibits undesirable side effects such as phototoxic and photoallergic reactions in humans. In general, the influence of drug metabolism on this type of reactions has not been previously considered in photosafety testing. Thus, the present work aims to investigate the possible photo(geno)toxic potential of drug metabolites, using CPZ as an established reference compound. In this case, the metabolites selected for the study are demethylchlorpromazine (DMCPZ), didemethylchlorpromazine (DDMCPZ) and chlorpromazine sulfoxide (CPZSO). The demethylated CPZ metabolites DMCPZ and DDMCPZ maintain identical chromophore to the parent drug. In this work, it has been found that the nature of the aminoalkyl side chain modulates the hydrophobicity and the photochemical properties (for instance, the excited state lifetimes), but it does not change the photoreactivity pattern, which is characterized by reductive photodehalogenation, triggered by homolytic carbon-chlorine bond cleavage with formation of highly reactive aryl radical intermediates. Accordingly, these metabolites are phototoxic to cells, as revealed by the 3T3 NRU assay; their photo-irritation factors are even higher than that of CPZ. The same trend is observed in photogenotoxicity studies, both with isolated and with cellular DNA, where DMCPZ and DDMCPZ are more active than CPZ itself. In summary, side-chain demethylation of CPZ, as a consequence of Phase I biotransformation, does not result a photodetoxification. Instead, it leads to metabolites that exhibit in an even enhanced photo(geno)toxicity. - Highlights: • Demethylated CPZ metabolites are phototoxic to cells, as revealed by the NRU assay. • Single cell electrophoresis (Comet Assay) confirms the photodamage to cellular DNA. • DNA single strand breaks formation is observed on agarose gel electrophoresis.
Enhanced photo(geno)toxicity of demethylated chlorpromazine metabolites
International Nuclear Information System (INIS)
Palumbo, Fabrizio; Garcia-Lainez, Guillermo; Limones-Herrero, Daniel; Coloma, M. Dolores; Escobar, Javier; Jiménez, M. Consuelo; Miranda, Miguel A.
2016-01-01
Chlorpromazine (CPZ) is an anti-psychotic drug widely used to treat disorders such as schizophrenia or manic-depression. Unfortunately, CPZ exhibits undesirable side effects such as phototoxic and photoallergic reactions in humans. In general, the influence of drug metabolism on this type of reactions has not been previously considered in photosafety testing. Thus, the present work aims to investigate the possible photo(geno)toxic potential of drug metabolites, using CPZ as an established reference compound. In this case, the metabolites selected for the study are demethylchlorpromazine (DMCPZ), didemethylchlorpromazine (DDMCPZ) and chlorpromazine sulfoxide (CPZSO). The demethylated CPZ metabolites DMCPZ and DDMCPZ maintain identical chromophore to the parent drug. In this work, it has been found that the nature of the aminoalkyl side chain modulates the hydrophobicity and the photochemical properties (for instance, the excited state lifetimes), but it does not change the photoreactivity pattern, which is characterized by reductive photodehalogenation, triggered by homolytic carbon-chlorine bond cleavage with formation of highly reactive aryl radical intermediates. Accordingly, these metabolites are phototoxic to cells, as revealed by the 3T3 NRU assay; their photo-irritation factors are even higher than that of CPZ. The same trend is observed in photogenotoxicity studies, both with isolated and with cellular DNA, where DMCPZ and DDMCPZ are more active than CPZ itself. In summary, side-chain demethylation of CPZ, as a consequence of Phase I biotransformation, does not result a photodetoxification. Instead, it leads to metabolites that exhibit in an even enhanced photo(geno)toxicity. - Highlights: • Demethylated CPZ metabolites are phototoxic to cells, as revealed by the NRU assay. • Single cell electrophoresis (Comet Assay) confirms the photodamage to cellular DNA. • DNA single strand breaks formation is observed on agarose gel electrophoresis.
Directory of Open Access Journals (Sweden)
Ling Yang
2013-01-01
Full Text Available Abstract Background To evaluate the promoter methylation status of MUC2 gene and mRNA expression in patients with hepatocellular carcinoma. Methods We analyzed MUC2 methylation by MSP, and MUC2 mRNA by real-time PCR in 74 HCC. Results MUC2 mRNA were lower in HCC tissues (Mean -ΔCt = −4.70 than that in Non-HCC tissues (Mean -ΔCt = −2.98. Expression of MUC2 was elevated in only 23 (31.08% of the 74 HCC patients. MUC2 promoter was hypermethylated in 62.2% (46/74 of HCCs, and in only 18.9% (14/74 of non-tumor samples. MUC2 mRNA were lower in HCC patients with hypermethylation (Mean -ΔΔCt = −2.25 than those with demethylation (Mean -ΔΔCt = −0.22, and there is a decreased tendency for MUC2 mRNA in HCC patients with promoter hypermethylation (p = 0.011. There was a significantly correlation found between MUC2 mRNA and HBV and AFP in HCC. The loss of MUC2 mRNA and hypermethylation could be poor prognostic factors. After treated by 5-Aza-CdR and TSA, we found that MUC2 mRNA induced significantly in 7721, Huh7 and HepG2 cells. Conclusion The results suggested that MUC2 mRNA silenced by promoter hypermethylation is associated with high levels HBV in HCC.
A non-heme iron-mediated chemical demethylation in DNA and RNA.
Yi, Chengqi; Yang, Cai-Guang; He, Chuan
2009-04-21
DNA methylation is arguably one of the most important chemical signals in biology. However, aberrant DNA methylation can lead to cytotoxic or mutagenic consequences. A DNA repair protein in Escherichia coli, AlkB, corrects some of the unwanted methylations of DNA bases by a unique oxidative demethylation in which the methyl carbon is liberated as formaldehyde. The enzyme also repairs exocyclic DNA lesions--that is, derivatives in which the base is augmented with an additional heterocyclic subunit--by a similar mechanism. Two proteins in humans that are homologous to AlkB, ABH2 and ABH3, repair the same spectrum of lesions; another human homologue of AlkB, FTO, is linked to obesity. In this Account, we describe our studies of AlkB, ABH2, and ABH3, including our development of a general strategy to trap homogeneous protein-DNA complexes through active-site disulfide cross-linking. AlkB uses a non-heme mononuclear iron(II) and the cofactors 2-ketoglutarate (2KG) and dioxygen to effect oxidative demethylation of the DNA base lesions 1-methyladenine (1-meA), 3-methylcytosine (3-meC), 1-methylguanine (1-meG), and 3-methylthymine (3-meT). ABH3, like AlkB, works better on single-stranded DNA (ssDNA) and is capable of repairing damaged bases in RNA. Conversely, ABH2 primarily repairs lesions in double-stranded DNA (dsDNA); it is the main housekeeping enzyme that protects the mammalian genome from 1-meA base damage. The AlkB-family proteins have moderate affinities for their substrates and bind DNA in a non-sequence-specific manner. Knowing that these proteins flip the damaged base out from the duplex DNA and insert it into the active site for further processing, we first engineered a disulfide cross-link in the active site to stabilize the Michaelis complex. Based on the detailed structural information afforded by the active-site cross-linked structures, we can readily install a cross-link away from the active site to obtain the native-like structures of these complexes
Nicotine demethylation in Nicotiana cell suspension cultures: N'-formylnornicotine is not involved.
Bartholomeusz, Trixie Ann; Bhogal, Ramneek K; Molinié, Roland; Felpin, François-Xavier; Mathé-Allainmat, Monique; Meier, Anna-Carolin; Dräger, Birgit; Lebreton, Jacques; Roscher, Albrecht; Robins, Richard J; Mesnard, François
2005-10-01
Nicotine or nornicotine enriched with stable isotopes in either the N'-methyl group or the pyrrolidine-N were fed to Nicotiana plumbaginifolia suspension cell cultures that do not form endogenous nicotine. The metabolism of these compounds was investigated by analysing the incorporation of isotope into other alkaloids using gas chromatography-mass spectroscopy (GC-MS). Nicotine metabolism primarily resulted in the accumulation of nornicotine, the N'-demethylation product. In addition, six minor metabolites appeared during the course of nicotine metabolism, four of which were identified as cotinine, myosmine, N'-formylnornicotine and N'-carboethoxynornicotine. While cotinine was formed from [(13)C,(2)H(3)-methyl]nicotine without dilution of label, N'-formylnornicotine was labelled at only about 6% of the level of nicotine and N'-carboethoxynornicotine was unlabelled. Feeding with [1'-(15)N]nornicotine resulted in incorporation without dilution of label into both N'-formylnornicotine and N'-carboethoxynornicotine. This pattern strongly indicates that, while nornicotine and cotinine are derived directly from nicotine, N'-formylnornicotine and N'-carboethoxynornicotine are metabolites of nornicotine. Thus, it is directly demonstrated that N'-formylnornicotine is not an intermediate in nicotine demethylation.
International Nuclear Information System (INIS)
Myllynen, Paeivi; Kummu, Maria; Kangas, Tiina; Ilves, Mika; Immonen, Elina; Rysae, Jaana; Pirilae, Rauna; Lastumaeki, Anni; Vaehaekangas, Kirsi H.
2008-01-01
We have studied the role of ATP binding cassette (ABC) transporters in fetal exposure to carcinogens using 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) a known substrate for ABC transporters as a model compound. In perfusion of human term placenta, transfer of 14 C-PhIP (2 μM) through the placenta resulted in fetal-to-maternal concentration ratio (FM ratio) of 0.72 ± 0.09 at 6 h. The specific ABCG2 inhibitor KO143 increased the transfer of 14 C-PhIP from maternal to fetal circulation (FM ratio 0.90 ± 0.08 at 6 h, p 14 C-PhIP (R = - 0.81, p 14 C-PhIP in perfused human placenta. Also, PhIP may modify ABC transporter expression in choriocarinoma cells
Suzuki, Toshikazu; Farrar, Jason E; Yegnasubramanian, Srinivasan; Zahed, Muhammed; Suzuki, Nobuo; Arceci, Robert J
2008-09-01
Demethylation of 5-methylcytosine in genomic DNA is believed to be one of the mechanisms underlying replicative life-span of mammalian cells. Both proliferation associated SNF2-like gene (PASG, also termed Lsh) and DNA methyltransferase 3B (Dnmt3b) knockout mice result in embryonic genomic hypomethylation and a replicative senescent phenotype. However, it is unclear whether gradual demethylation of DNA during somatic cell division is directly involved in senescence. In this study, we retrovirally transduced TIG-7 human fibroblasts with a shRNA against PASG and compared the rate of change in DNA methylation as well as the replicative life-span to control cells under low (3%) and ambient (20%) oxygen. Expression of PASG protein was decreased by approximately 80% compared to control cells following transduction of PASG shRNA gene. The rate of cell growth was the same in both control and PASG-suppressed cells. The rate of demethylation of DNA was significantly increased in PASG-suppressed cells as compared control cells. However, decreased PASG expression did not shorten the replicative life-span of TIG-7 cells. Culture under low oxygen extended the life-span of TIG-7 cells but did not alter the rate of DNA demethylation. While knockout of PASG during development results in genomic hypomethylation and premature senescence, our results show that while downregulation of PASG expression in a somatic cell also leads to DNA hypomethylation, there is no associated senescent phenotype. These results suggest differences in cellular consequences of hypomethylation mediated by PASG during development compared to that in somatic cells.
Ishikawa, Toshihisa; Tamura, Ai; Saito, Hikaru; Wakabayashi, Kanako; Nakagawa, Hiroshi
2005-10-01
In the post-genome-sequencing era, emerging genomic technologies are shifting the paradigm for drug discovery and development. Nevertheless, drug discovery and development still remain high-risk and high-stakes ventures with long and costly timelines. Indeed, the attrition of drug candidates in preclinical and development stages is a major problem in drug design. For at least 30% of the candidates, this attrition is due to poor pharmacokinetics and toxicity. Thus, pharmaceutical companies have begun to seriously re-evaluate their current strategies of drug discovery and development. In that light, we propose that a transport mechanism-based design might help to create new, pharmacokinetically advantageous drugs, and as such should be considered an important component of drug design strategy. Performing enzyme- and/or cell-based drug transporter, interaction tests may greatly facilitate drug development and allow the prediction of drug-drug interactions. We recently developed methods for high-speed functional screening and quantitative structure-activity relationship analysis to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function. These methods would provide a practical tool to screen synthetic and natural compounds, and these data can be applied to the molecular design of new drugs. In this review article, we present an overview on the genetic polymorphisms of human ABC transporter ABCG2 and new camptothecin analogues that can circumvent AGCG2-associated multidrug resistance of cancer.
Westerterp, Marit; Murphy, Andrew J.; Wang, Mi; Pagler, Tamara A.; Vengrenyuk, Yuliya; Kappus, Mojdeh S.; Gorman, Darren J.; Nagareddy, Prabhakara R.; Zhu, Xuewei; Abramowicz, Sandra; Parks, John S.; Welch, Carrie; Fisher, Edward A.; Wang, Nan; Yvan-Charvet, Laurent; Tall, Alan R.
2013-01-01
Rationale Plasma HDL levels are inversely correlated with atherosclerosis. Although it is widely assumed that this is due to the ability of HDL to promote cholesterol efflux from macrophage foam cells, direct experimental support for this hypothesis is lacking. Objective To assess the role of macrophage cholesterol efflux pathways in atherogenesis. Methods and Results We developed MAC-ABCDKO mice with efficient deletion of the ATP Binding Cassette Transporters A1 and G1 (ABCA1 and ABCG1) in macrophages but not in hematopoietic stem or progenitor populations. MAC-ABCDKO bone marrow (BM) was transplanted into Ldlr-/- recipients. On the chow diet, these mice had similar plasma cholesterol and blood monocyte levels but increased atherosclerosis compared to controls. On the Western type diet (WTD), MAC-ABCDKO BM transplanted Ldlr-/- mice had disproportionate atherosclerosis, considering they also had lower VLDL/LDL cholesterol levels than controls. ABCA1/G1 deficient macrophages in lesions showed increased inflammatory gene expression. Unexpectedly, WTD-fed MAC-ABCDKO BM transplanted Ldlr-/- mice displayed monocytosis and neutrophilia in the absence of HSPC proliferation. Mechanistic studies revealed increased expression of M-CSF and G-CSF in splenic macrophage foam cells, driving BM monocyte and neutrophil production. Conclusion These studies 1) show that macrophage deficiency of ABCA1/G1 is pro-atherogenic likely by promoting plaque inflammation and 2) uncover a novel positive feedback loop in which cholesterol-laden splenic macrophages signal BM progenitors to produce monocytes, with suppression by macrophage cholesterol efflux pathways. PMID:23572498
[The Role of 5-Aza-CdR on Methylation of Promoter in RASSF1A Gene in Endometrial Carcinoma].
Huang, Li-ping; Chen, Chen; Wang, Xue-ping; Liu, Hui
2015-05-01
To explore the effect of demethylating drug 5-Aza-2'-deoxycytidine (5-Aza-CdR) on methtylation status of the Ras-association domain familylA gene (RASSF1A) in human endometrial carcinoma. Randomly'assign the human endometrial carcinoma cell line HEC-1-B into groups and use demethylating drug 5-Aza-CdR of different concentration to treat them. Then Methylation-specific polymerase chain reaction (MSP), real-time PCR, Western blot, TUNEL technology were used to analyze methylation status of RASSF1A promoter CpG islands, RASSF1A mRNA expression, RASSF1A protein expression and apoptosis of HEC-1-B cell. High DNA methylation in RASSF1A gene promoter region, low RASSF1A mRNA level and protein expression and out of control of human endometrial carcinoma cell HEC-1-B apoptosis were observed. 5-Aza-CdR of different concentration could reverse RASSF1A gene's methylation status, recover the expression of mRNA and protein, and control the growth of HEC-1-B by inducing apoptosis. Aberrant methylation of RASSF1A in endometrial cancer as a therapeutic target, demethylating agent 5-Aza-CdR could be an effective way of gene therapy.
Hassani, Saeed; Khaleghian, Ali; Ahmadian, Shahin; Alizadeh, Shaban; Alimoghaddam, Kamran; Ghavamzadeh, Ardeshir; Ghaffari, Seyed H
2018-01-01
PML-RARα perturbs the normal epigenetic setting, which is essential to oncogenic transformation in acute promyelocytic leukemia (APL). Transcription induction and recruitment of DNA methyltransferases (DNMTs) by PML-RARα and subsequent hypermethylation are components of this perturbation. Arsenic trioxide (ATO), an important drug in APL therapy, concurrent with degradation of PML-RARα induces cell cycle change and apoptosis. How ATO causes cell cycle alteration has remained largely unexplained. Here, we investigated DNA methylation patterns of cell cycle regulatory genes promoters, the effects of ATO on the methylated genes and cell cycle distribution in an APL cell line, NB4. Analysis of promoter methylation status of 22 cell cycle related genes in NB4 revealed that CCND1, CCNE1, CCNF, CDKN1A, GADD45α, and RBL1 genes were methylated 60.7, 84.6, 58.6, 8.7, 33.4, and 73.7%, respectively, that after treatment with 2 μM ATO for 48 h, turn into 0.6, 13.8, 0.1, 6.6, 10.7, and 54.5% methylated. ATO significantly reduced the expression of DNMT1, 3A, and 3B. ATO induced the expression of CCND1, CCNE1, and GADD45α genes, suppressed the expression of CCNF and CDKN1A genes, which were consistent with decreased number of cells in G1 and S phases and increased number of cells in G2/M phase. In conclusion, demethylation and alteration in the expression level of the cell cycle related genes may be possible mechanisms in ATO-induced cell cycle arrest in APL cells. It may suggest that ATO by demethylation of CCND1 and CCNE1 and their transcriptional activation accelerates G1 and S transition into the G2/M cell cycle arrest.
Lee, Seung-Tae; Wiemels, Joseph L
2016-02-18
The epigenetic landscape of cancer includes both focal hypermethylation and broader hypomethylation in a genome-wide manner. By means of a comprehensive genomic analysis on 6637 tissues of 21 tumor types, we here show that the degrees of overall methylation in CpG island (CGI) and demethylation in intergenic regions, defined as 'backbone', largely vary among different tumors. Depending on tumor type, both CGI methylation and backbone demethylation are often associated with clinical, epidemiological and biological features such as age, sex, smoking history, anatomic location, histological type and grade, stage, molecular subtype and biological pathways. We found connections between CGI methylation and hypermutability, microsatellite instability, IDH1 mutation, 19p gain and polycomb features, and backbone demethylation with chromosomal instability, NSD1 and TP53 mutations, 5q and 19p loss and long repressive domains. These broad epigenetic patterns add a new dimension to our understanding of tumor biology and its clinical implications. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
International Nuclear Information System (INIS)
Spudich, E.N.; Takahashi, T.; Spudich, J.L.
1989-01-01
This work demonstrates that phototaxis stimuli in the archaebacterium Halobacterium halobium control a methylation/demethylation system in vivo through photoactivation of sensory rhodopsin I (SR-I) in either its attractant or repellent signaling form as well as through the repellent receptor sensory rhodopsin II (SR-II, also called phoborhodopsin). The effects of positive stimuli that suppress swimming reversals (i.e., an increase in attractant or decrease in repellent light) and negative stimuli that induce swimming reversals (i.e., a decrease in attractant or increase in repellent light) through each photoreceptor were monitored by assaying release of volatile [3H]methyl groups. This assay has been used to measure [3H]methanol produced during the process of adaptation to chemotactic stimuli in eubacteria. In H. halobium positive photostimuli produce a transient increase in the rate of demethylation followed by a decrease below the unstimulated value, whereas negative photostimuli cause an increase followed by a rate similar to that of the unstimulated value. Photoactivation of the SR-I attractant and simultaneous photoactivation of the SR-II repellent receptors cancel in their effects on demethylation, demonstrating the methylation system is regulated by an integrated signal. Analysis of mutants indicates that the source for the volatile methyl groups is intrinsic membrane proteins distinct from the chromoproteins that share the membrane. A methyl-accepting protein (94 kDa) previously correlated in amount with the SR-I chromoprotein (25 kDa) is shown here to be missing in a recently isolated SR-I-SR-II+ mutant (Flx3b), thus confirming the association of this protein with SR-I. Photoactivated SR-II in mutant Flx3b controls demethylation, predicting the existence of a photomodulated methyl-accepting component distinct from the 94-kDa protein of SR-I
Zhang, Changsong; Ling, Yang; Zhang, Chenghui; Xu, Yun; Gao, Lu; Li, Rong; Zhu, Jing; Fan, Lieying; Wei, Lixin
2012-01-01
Background: To evaluate the promoter methylation status of RECK gene and mRNA expression in patients with hepatocellular carcinoma (HCC). Methods: We analyzed RECK methylation by MSP, and RECK mRNA by real-time PCR in 74 HCC. The liver cell lines (7721, Chang and Hep-G2) were treated with 5-Aza-CdR and TSA. Results: RECK mRNA were lower in HCC tissues (Mean -∆Ct = -3.29) than that in Non-Hcc tissues (Mean -∆Ct = -2.42). Expression of RECK was elevated in only 24 (32.43%) of the 74 HCC patients but decreased (-∆∆Ct=0.5) (Mean -∆∆Ct = -1.75) than those with demethylation (∆MI<0.5) (Mean -∆∆Ct = 0.05), and there is a decreased tendency for RECK mRNA in HCC patients with promoter hypermethylation (p = 0.002). There was a significantly correlation found between RECK mRNA and poor survival after surgery. After treated by 5-Aza-CdR and TSA, we found that RECK mRNA induced different changes in 7721, Chang and Hep-G2 cells. And RECK demethylation also induced by epigenetic inhibitors. Conclusion: The results suggested that the hypermethylation may lead to promoter silencing of RECK mRNA and associated with poor survival in HCC. PMID:22419890
Alivand, Mohammad Reza; Soheili, Zahra-Soheila; Pornour, Majid; Solali, Saeed; Sabouni, Farzaneh
2017-10-01
CpG methylation of DNA takes part in a specific epigenetic memory that plays crucial roles in the differentiation and abnormality of the cells. The methylation pattern aberration of genomes is affected in three ways, namely DNA methyltransferase (DNMT), ten-eleven translocation (TET), and methyl-binding domain (MBD) proteins. Of these, TET enzymes have recently been demonstrated to be master modifier enzymes in the DNA methylation process. Additionally, recent studies emphasize that not only epigenetic phenomena play a role in controlling hypoxia pathway, but the hypoxia condition also triggers hypomethylation of genomes that may help with the expression of hypoxia pathway genes. In this study, we suggested that TET1 and TET2 could play a role in the demethylation of genomes under chemical hypoxia conditions. Herein, the evaluating methylation status and mRNA expression of mentioned genes were utilized through real-time PCR and methylation-specific PCR (MSP), respectively. Our results showed that TET1 and TET2 genes were overexpressed (P < 0.05) under chemical hypoxia conditions in Retinal Pigment Epithelial (RPE) cells, whereas the promoter methylation status of them were hypomethylated in the same condition. Therefore, chemical hypoxia not only causes overexpression of TET1 and TET2 but also could gradually do promoter demethylation of same genes. This is the first study to show the relationship between epigenetics and the expression of mentioned genes related to hypoxia pathways. Furthermore, it seems that these associations in RPE cells are subjected to chemical hypoxia as a mechanism that could play a crucial role in methylation pattern changes of hypoxia-related diseases such as cancer and ischemia. J. Cell. Biochem. 118: 3193-3204, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Arid5b facilitates chondrogenesis by recruiting the histone demethylase Phf2 to Sox9-regulated genes
Hata, Kenji; Takashima, Rikako; Amano, Katsuhiko; Ono, Koichiro; Nakanishi, Masako; Yoshida, Michiko; Wakabayashi, Makoto; Matsuda, Akio; Maeda, Yoshinobu; Suzuki, Yutaka; Sugano, Sumio; Whitson, Robert H.; Nishimura, Riko; Yoneda, Toshiyuki
2013-11-01
Histone modification, a critical step for epigenetic regulation, is an important modulator of biological events. Sox9 is a transcription factor critical for endochondral ossification; however, proof of its epigenetic regulation remains elusive. Here we identify AT-rich interactive domain 5b (Arid5b) as a transcriptional co-regulator of Sox9. Arid5b physically associates with Sox9 and synergistically induces chondrogenesis. Growth of Arid5b-/- mice is retarded with delayed endochondral ossification. Sox9-dependent chondrogenesis is attenuated in Arid5b-deficient cells. Arid5b recruits Phf2, a histone lysine demethylase, to the promoter region of Sox9 target genes and stimulates H3K9me2 demethylation of these genes. In the promoters of chondrogenic marker genes, H3K9me2 levels are increased in Arid5b-/- chondrocytes. Finally, we show that Phf2 knockdown inhibits Sox9-induced chondrocyte differentiation. Our findings establish an epigenomic mechanism of skeletal development, whereby Arid5b promotes chondrogenesis by facilitating Phf2-mediated histone demethylation of Sox9-regulated chondrogenic gene promoters.
Demethylation of Circulating Estrogen Receptor Alpha Gene in Cerebral Ischemic Stroke.
Directory of Open Access Journals (Sweden)
Hsiu-Fen Lin
Full Text Available Estrogen is involved in neuron plasticity and can promote neuronal survival in stroke. Its actions are mostly exerted via estrogen receptor alpha (ERα. Previous animal studies have shown that ERα is upregulated by DNA demethylation following ischemic injury. This study investigated the methylation levels in the ERα promoter in the peripheral blood of ischemic stroke patients.The study included 201 ischemic stroke patients, and 217 age- and sex-comparable healthy controls. The quantitative methylation level in the 14 CpG sites of the ERα promoter was measured by pyrosequencing in each participant. Multivariate regression model was used to adjust for stroke traditional risk factors. Stroke subtypes and sex-specific analysis were also conducted.The results demonstrated that the stroke cases had a lower ERα methylation level than controls in all 14 CpG sites, and site 13 and site 14 had significant adjusted p-values of 0.035 and 0.026, respectively. Stroke subtypes analysis showed that large-artery atherosclerosis and cardio-embolic subtypes had significantly lower methylation levels than the healthy controls at CpG site 5, site 9, site 12, site 13 and site 14 with adjusted p = 0.039, 0.009, 0.025, 0.046 and 0.027 respectively. However, the methylation level for the patients with small vessel subtype was not significant. We combined the methylation data from the above five sites for further sex-specific analysis. The results showed that the significant association only existed in women (adjusted p = 0.011, but not in men (adjusted p = 0.300.Female stroke cases have lower ERα methylation levels than those in the controls, especially in large-artery and cardio-embolic stroke subtypes. The study implies that women suffering from ischemic stroke of specific subtype may undergo different protective mechanisms to reduce the brain injury.
Adoptive cancer immunotherapy using DNA-demethylated T helper cells as antigen-presenting cells
DEFF Research Database (Denmark)
Kirkin, Alexei F.; Dzhandzhugazyan, Karine N.; Guldberg, Per
2018-01-01
In cancer cells, cancer/testis (CT) antigens become epigenetically derepressed through DNA demethylation and constitute attractive targets for cancer immunotherapy. Here we report that activated CD4+ T helper cells treated with a DNA-demethylating agent express a broad repertoire of endogenous CT...... antigens and can be used as antigen-presenting cells to generate autologous cytotoxic T lymphocytes (CTLs) and natural killer cells. In vitro, activated CTLs induce HLA-restricted lysis of tumor cells of different histological types, as well as cells expressing single CT antigens. In a phase 1 trial of 25...... patients with recurrent glioblastoma multiforme, cytotoxic lymphocytes homed to the tumor, with tumor regression ongoing in three patients for 14, 22, and 27 months, respectively. No treatment-related adverse effects were observed. This proof-of-principle study shows that tumor-reactive effector cells can...
Xu, Xiaolin; Li, Qian; Pang, Liewen; Huang, Guoqian; Huang, Jiechun; Shi, Meng; Sun, Xiaotian; Wang, Yiqing
2013-11-15
Cholesterol efflux from macrophages is a critical mechanism to prevent the development of atherosclerosis. Here, we sought to investigate the effects of arctigenin, a bioactive component of Arctium lappa, on the cholesterol efflux in oxidized low-density lipoprotein (oxLDL)-loaded THP-1 macrophages. Our data showed that arctigenin significantly accelerated apolipoprotein A-I- and high-density lipoprotein-induced cholesterol efflux in both dose- and time-dependent manners. Moreover, arctigenin treatment enhanced the expression of ATP binding cassette transporter A1 (ABCA1), ABCG1, and apoE, all of which are key molecules in the initial step of cholesterol efflux, at both mRNA and protein levels. Arctigenin also caused a concentration-dependent elevation in the expression of peroxisome proliferator-activated receptor-gamma (PPAR-γ) and liver X receptor-alpha (LXR-α). The arctigenin-mediated induction of ABCA1, ABCG1, and apoE was abolished by specific inhibition of PPAR-γ or LXR-α using small interfering RNA technology. Our results collectively indicate that arctigenin promotes cholesterol efflux in oxLDL-loaded THP-1 macrophages through upregulation of ABCA1, ABCG1 and apoE, which is dependent on the enhanced expression of PPAR-γ and LXR-α. Copyright © 2013 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Etienne Paubelle
Full Text Available The prognosis of acute myeloid leukemia (AML in elderly (≥65 years patients is poor and treatment remains non-consensual especially for those who are not eligible for intensive therapies. Our group has shown that in vitro the iron chelator deferasirox (DFX synergizes with vitamin D (VD to promote monocyte differentiation in primary AML cells. Herein, we present results from a retrospective case-control study in which the association of DFX (1-2 g/d and 25-hydroxycholecalciferol (100,000 IU/week (DFX/VD was proposed to patients following demethylating agents failure. Median survival of patients treated with DFX/VD combination (n = 17 was significantly increased in comparison with matched patients receiving best supportive care (BSC alone (n = 13 (10.4 versus 4 months respectively. In addition, the only factor associated to an increased overall survival in DFX/VD-treated patients was serum VD levels. We conclude that DFX/VD treatment correlated with increased overall survival of AML patients in this retrospective cohort of elderly patients.
Wei, Shu; Hua, Hai-Rong; Chen, Qian-Quan; Zhang, Ying; Chen, Fei; Li, Shu-Qing; Li, Fan; Li, Jia-Li
2017-03-18
Brain development and aging are associated with alterations in multiple epigenetic systems, including DNA methylation and demethylation patterns. Here, we observed that the levels of the 5-hydroxymethylcytosine (5hmC) ten-eleven translocation (TET) enzyme-mediated active DNA demethylation products were dynamically changed and involved in postnatal brain development and aging in tree shrews ( Tupaia belangeri chinensis ). The levels of 5hmC in multiple anatomic structures showed a gradual increase throughout postnatal development, whereas a significant decrease in 5hmC was found in several brain regions in aged tree shrews, including in the prefrontal cortex and hippocampus, but not the cerebellum. Active changes in Tet mRNA levels indicated that TET2 and TET3 predominantly contributed to the changes in 5hmC levels. Our findings provide new insight into the dynamic changes in 5hmC levels in tree shrew brains during postnatal development and aging processes.
International Nuclear Information System (INIS)
Gillio-Tos, Anna; Carvalho, Newton S; Maestri, Carlos A; Lacerda, Hadriano M; Zugna, Daniela; Richiardi, Lorenzo; Merletti, Franco; Bicalho, Maria da Graça; Fiano, Valentina; Grasso, Chiara; Tarallo, Valentina; De Marco, Laura; Trevisan, Morena; Xavier, MarinaBarbaradeSousa; Slowik, Renata
2012-01-01
The causal association between persistent human papillomavirus (HPV) infection and cervical cancer has been established, but the mechanisms that favor HPV persistence in cervical cells are still unknown. The diminished capability of the immune system to control and resolve HPV infection is one of several hypotheses. The tolerogenic protein HLA-G has shown aberrant expression in a variety of cancers, which has been suggested as a mechanism for tumor escape from immunosurveillance. In the present study we evaluate the role of epigenetic modification (promoter de-methylation) of the HLA-G gene on susceptibility to HPV infection and development of high-grade cervical lesions. A case–control study was carried out in Curitiba, Brazil, between February and June 2010. A total of 789 women aged 15–47 years were recruited: 510 controls with normal cervical cytology, and 279 cases with histologically confirmed cervical intraepithelial neoplasia grade 2 (CIN2, N = 150) or grade 3 (CIN3, N = 129). All women were administered a questionnaire by interview, which collected information on demographic and lifestyle factors, and a cervical sample was collected. HPV DNA detection was performed by GP5+/GP6+ primer-mediated PCR. HPV-positive samples were genotyped by multiplex PCR. A pilot analysis of HLA-G promoter methylation was carried out in a subset of the study population (96 cases and 76 controls) by pyrosequencing. HLA-G methylation and HPV infection status of cases and controls were compared, and confounding factors were computed by t Student and non-parametric Wilcoxon tests. Comparison of HLA-G methylation between cases and controls was assessed by the Bonferroni correction. The association of HLA-G methylation with CIN2/3 was evaluated by logistic regression. HPV prevalence was 19.6% in controls and 94.3% in CIN2/3 cases. HPV16, 31, 33, 35 and 18 were the most prevalent types. Methylation analysis of seven CpGs in the HLA-G promoter did not reveal any spontaneous de-methylation
Odagiri, Haruki; Kadomatsu, Tsuyoshi; Endo, Motoyoshi; Masuda, Tetsuro; Morioka, Masaki Suimye; Fukuhara, Shigetomo; Miyamoto, Takeshi; Kobayashi, Eisuke; Miyata, Keishi; Aoi, Jun; Horiguchi, Haruki; Nishimura, Naotaka; Terada, Kazutoyo; Yakushiji, Toshitake; Manabe, Ichiro; Mochizuki, Naoki; Mizuta, Hiroshi; Oike, Yuichi
2014-01-21
The tumor microenvironment can enhance the invasive capacity of tumor cells. We showed that expression of angiopoietin-like protein 2 (ANGPTL2) in osteosarcoma (OS) cell lines increased and the methylation of its promoter decreased with time when grown as xenografts in mice compared with culture. Compared with cells grown in normal culture conditions, the expression of genes encoding DNA demethylation-related enzymes increased in tumor cells implanted into mice or grown in hypoxic, serum-starved culture conditions. ANGPTL2 expression in OS cell lines correlated with increased tumor metastasis and decreased animal survival by promoting tumor cell intravasation mediated by the integrin α5β1, p38 mitogen-activated protein kinase, and matrix metalloproteinases. The tolloid-like 1 (TLL1) protease cleaved ANGPTL2 into fragments in vitro that did not enhance tumor progression when overexpressed in xenografts. Expression of TLL1 was weak in OS patient tumors, suggesting that ANGPTL2 may not be efficiently cleaved upon secretion from OS cells. These findings demonstrate that preventing ANGPTL2 signaling stimulated by the tumor microenvironment could inhibit tumor cell migration and metastasis.
Dharmapuri, Gangappa; Doneti, Ravinder; Philip, Gundala Harold; Kalle, Arunasree M
2015-07-01
Imatinib mesylate, a tyrosine kinase inhibitor, is very effective in the treatment of chronic myeloid leukemia (CML). However, development of resistance to imatinib therapy is also a very common mechanism observed with long-term administration of the drug. Our previous studies have highlighted the role of cyclooxygenase-2 (COX-2) in regulating the expression of multidrug resistant protein-1 (MDR1), P-gp, in imatinib-resistant K562 cells (IR-K562) via PGE2-cAMP-PKC-NF-κB pathway and inhibition of COX-2 by celecoxib, a COX-2 specific inhibitor, inhibits this pathway and reverses the drug resistance. Studies have identified that not only MDR1 but other ATP-binding cassette transport proteins (ABC transporters) are involved in the development of imatinib resistance. Here, we tried to study the role of COX-2 in the regulation of other ABC transporters such as MRP1, MRP2, MRP3, ABCA2 and ABCG2 that have been already implicated in imatinib resistance development. The results of the study clearly indicated that overexpression of COX-2 lead to upregulation of MRP family proteins in IR-K562 cells and celecoxib down-regulated the ABC transporters through Wnt and MEK signaling pathways. The study signifies that celecoxib in combination with the imatinib can be a good alternate treatment strategy for the reversal of imatinib resistance. Copyright © 2015 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Toribio E, E.
2005-01-01
The methylation of the DNA is an epigenetic modification that has an important paper in the regulation of the functionality of the genome of the organisms. It can be altered by demethylation processes, either natural or experimentally induced. The 5-azacytidine (Aza) is a compound that causes the demethylation of the DNA (dm-DNA), inducing with it, expression genic and increase in the frequency of the Sister Chromatid Exchange (SCE). The SCE is a genotoxicity indicator, caused by diverse mutagens and carcinogen. Since the biological meaning and the formation mechanism of this phenomenon has not been totally illustrious, the exploration of the relation between the dm-DNA and the induction of SCE, it could offer new knowledge to explain those queries. The purpose of this work was to study in cells of the mouse bone marrow In vivo, the effect of the Aza on the induction of SCE, based on two aspects: 1) dose answer and 2) the effectiveness of multiple exhibition. To six groups of three to five animals, they are administered Aza to dose of 5, 10, 15 or 20 mg/Kg of weight; in sharp or multiple form, previously to the bromodeoxyuridine supply and 24 h was sacrificed after this; 2 h after an injection with colchicine. Preparations of those metaphases were made, those which were dyed by means of a technique of fluorescence more Giemsa. It was observed that to sharp low dose, the Aza produced an increment in the frequency of SCE that although small it was proportional and statistically significant. To sharp and multiple high doses, the Aza doesn't cause additional increments of SCE, but if toxicity at cellular level and of individuals. It is concluded that a relationship exists between the dm-DNA and the induction of SCE. It is suggested that the total demethylation of the DNA causes 2 SCE/Cell in cells of the mouse bone marrow, or that the cytotoxicity prevents to evidence a bigger induction. (Author)
Zhu, Ru-Gang; Sun, Yan-Di; Hou, Yu-Ting; Fan, Jun-Gang; Chen, Gang; Li, Tuo-Ping
2017-06-25
Haw pectin penta-oligogalacturonide (HPPS) has important role in improving cholesterol metabolism and promoting the conversion of cholesterol to bile acids (BA) in mice fed high-cholesterol diet (HCD). However, the mechanism is not clear. This study aims to investigate the effects of HPPS on cholesterol accumulation and the regulation of hepatic BA synthesis and transport in HCD-fed mice. Results showed that HPPS significantly decreased plasma and hepatic TC levels but increased plasma high-density lipoprotein cholesterol (HDL-C) and apolipoprotein A-I (apoA-I) levels, compared to HCD. BA analysis showed that HPPS markedly decreased hepatic and small intestine BA levels but increased the gallbladder BA levels, and finally decreased the total BA pool size, compared to HCD. Studies of molecular mechanism revealed that HPPS promoted hepatic ATP-binding cassette transporter A1 (ABCA1), ATP-binding cassette transporter G1 (ABCG1), and scavenger receptor BI (SR-BI) expression but did not affect ATB binding cassette transporter G5/G8 (ABCG5/8) expression. HPPS inactivated hepatic farnesoid X receptor (FXR) and target genes expression, which resulted in significant increase of cholesterol 7α-hydroxylase 1 (CYP7A1) and sterol 12α-hydroxylase (CYP8B1) expression, with up-regulations of 204.2% and 33.5% for mRNA levels, respectively, compared with HCD. In addition, HPPS markedly enhanced bile salt export pump (BSEP) expression but didn't affect the sodium/taurocholate co-transporting polypeptide (NTCP) expression. In conclusion, the study revealed that HPPS reduced cholesterol accumulation by promoting BA synthesis in the liver and excretion in the feces, and might promote macrophage-to-liver reverse cholesterol transport (RCT) but did not liver-to-fecal RCT. Copyright © 2017 Elsevier B.V. All rights reserved.
ATP binding cassette G1-dependent cholesterol efflux during inflammation.
de Beer, Maria C; Ji, Ailing; Jahangiri, Anisa; Vaughan, Ashley M; de Beer, Frederick C; van der Westhuyzen, Deneys R; Webb, Nancy R
2011-02-01
ATP binding cassette transporter G1 (ABCG1) mediates the transport of cellular cholesterol to HDL, and it plays a key role in maintaining macrophage cholesterol homeostasis. During inflammation, HDL undergoes substantial remodeling, acquiring lipid changes and serum amyloid A (SAA) as a major apolipoprotein. In the current study, we investigated whether remodeling of HDL that occurs during acute inflammation impacts ABCG1-dependent efflux. Our data indicate that lipid free SAA acts similarly to apolipoprotein A-I (apoA-I) in mediating sequential efflux from ABCA1 and ABCG1. Compared with normal mouse HDL, acute phase (AP) mouse HDL containing SAA exhibited a modest but significant 17% increase in ABCG1-dependent efflux. Interestingly, AP HDL isolated from mice lacking SAA (SAAKO mice) was even more effective in promoting ABCG1 efflux. Hydrolysis with Group IIA secretory phospholipase A(2) (sPLA(2)-IIA) significantly reduced the ability of AP HDL from SAAKO mice to serve as a substrate for ABCG1-mediated cholesterol transfer, indicating that phospholipid (PL) enrichment, and not the presence of SAA, is responsible for alterations in efflux. AP human HDL, which is not PL-enriched, was somewhat less effective in mediating ABCG1-dependent efflux compared with normal human HDL. Our data indicate that inflammatory remodeling of HDL impacts ABCG1-dependent efflux independent of SAA.
Lirk, P.; Hollmann, M. W.; Fleischer, M.; Weber, N. C.; Fiegl, H.
2014-01-01
Lidocaine demethylates deoxyribonucleic acid (DNA) in breast cancer cells. This modification of epigenetic information may be of therapeutic relevance in the perioperative period, because a decrease in methylation can reactivate tumour suppressor genes and inhibit tumour growth. The objectives of
Directory of Open Access Journals (Sweden)
Marumi Ohno
Full Text Available Cytoplasmic constitutive active/androstane receptor (CAR retention protein (CCRP and also known as DNAJC7 is a co-chaperone previously characterized to retain nuclear receptor CAR in the cytoplasm of HepG2 cells. Here we have produced CCRP knockout (KO mice and demonstrated that CCRP regulates CAR at multiple steps in activation of the cytochrome (Cyp 2b10 gene in liver: nuclear accumulation, RNA polymerase II recruitment and epigenetic modifications. Phenobarbital treatment greatly increased nuclear CAR accumulation in the livers of KO males as compared to those of wild type (WT males. Despite this accumulation, phenobarbital-induced activation of the Cyp2b10 gene was significantly attenuated. In ChIP assays, a CAR/retinoid X receptor-α (RXRα heterodimer binding to the Cyp2b10 promoter was already increased before phenobarbital treatment and further pronounced after treatment. However, RNA polymerase II was barely recruited to the promoter even after phenobarbital treatment. Histone H3K27 on the Cyp2b10 promoter was de-methylated only after phenobarbital treatment in WT but was fully de-methylated before treatment in KO males. Thus, CCRP confers phenobarbital-induced de-methylation capability to the promoter as well as the phenobarbital responsiveness of recruiting RNA polymerase II, but is not responsible for the binding between CAR and its cognate sequence, phenobarbital responsive element module. In addition, KO males developed steatotic livers and increased serum levels of total cholesterol and high density lipoprotein in response to fasting. CCRP appears to be involved in various hepatic regulations far beyond CAR-mediated drug metabolism.
International Nuclear Information System (INIS)
Wang, Shumin; Ma, Ning; Murata, Mariko; Huang, Guangwu; Zhang, Zhe; Xiao, Xue; Zhou, Xiaoying; Huang, Tingting; Du, Chunping; Yu, Nana; Mo, Yingxi; Lin, Longde; Zhang, Jinyan
2010-01-01
Epigenetic silencing of tumor suppressor genes play important roles in NPC tumorgenesis. Tissue factor pathway inhibitor-2 (TFPI-2), is a protease inhibitor. Recently, TFPI-2 was suggested to be a tumor suppressor gene involved in tumorigenesis and metastasis in some cancers. In this study, we investigated whether TFPI-2 was inactivated epigenetically in nasopharyngeal carcinoma (NPC). Transcriptional expression levels of TFPI-2 was evaluated by RT-PCR. Methylation status were investigated by methylation specific PCR and bisulfate genomic sequencing. The role of TFPI-2 as a tumor suppressor gene in NPC was addressed by re-introducing TFPI-2 expression into the NPC cell line CNE2. TFPI-2 mRNA transcription was inactivated in NPC cell lines. TFPI-2 was aberrantly methylated in 66.7% (4/6) NPC cell lines and 88.6% (62/70) of NPC primary tumors, but not in normal nasopharyngeal epithelia. TFPI-2 expression could be restored in NPC cells after demethylation treatment. Ectopic expression of TFPI-2 in NPC cells induced apoptosis and inhibited cell proliferation, colony formation and cell migration. Epigenetic inactivation of TFPI-2 by promoter hypermethylation is a frequent and tumor specific event in NPC. TFPI-2 might be considering as a putative tumor suppressor gene in NPC
Nickel, Sabrina; Selo, Mohammed Ali; Fallack, Juliane; Clerkin, Caoimhe G; Huwer, Hanno; Schneider-Daum, Nicole; Lehr, Claus-Michael; Ehrhardt, Carsten
2017-12-01
Breast cancer resistance protein (BCRP/ABCG2) has previously been identified with high expression levels in human lung. The subcellular localisation and functional activity of the transporter in lung epithelia, however, remains poorly investigated. The aim of this project was to study BCRP expression and activity in freshly isolated human alveolar epithelial type 2 (AT2) and type 1-like (AT1-like) cells in primary culture, and to compare these findings with data obtained from the NCI-H441 cell line. BCRP expression levels in AT2 and AT1-like cells and in different passages of NCI-H441 cells were determined using q-PCR and immunoblot. Transporter localisation was confirmed by confocal laser scanning microscopy. Efflux and transport studies using the BCRP substrate BODIPY FL prazosin and the inhibitor Ko143 were carried out to assess BCRP activity in the different cell models. BCRP expression decreased during transdifferentiation from AT2 to AT1-like phenotype. Culturing NCI-H441 cells at an air-liquid interface or submersed did not change BCRP abundance, however, BCRP levels increased with passage number. BCRP was localised to the apical membrane and cytosol in NCI-H441 cells. In primary cells, the protein was found predominantly in the nucleus. Functional studies were consistent with expression data. BCRP is differently expressed in AT2 and AT1-like cells with lower abundance and activity in the latter ones. Nuclear BCRP might play a transcriptional role in distal lung epithelium. In NCI-H441 cells, BCRP is expressed in apical cell membranes and its activity is consistent with the localisation pattern.
Daughtry, Kelly D; Xiao, Youli; Stoner-Ma, Deborah; Cho, Eunsun; Orville, Allen M; Liu, Pinghua; Allen, Karen N
2012-02-08
Herein, the structure resulting from in situ turnover in a chemically challenging quaternary ammonium oxidative demethylation reaction was captured via crystallographic analysis and analyzed via single-crystal spectroscopy. Crystal structures were determined for the Rieske-type monooxygenase, stachydrine demethylase, in the unliganded state (at 1.6 Å resolution) and in the product complex (at 2.2 Å resolution). The ligand complex was obtained from enzyme aerobically cocrystallized with the substrate stachydrine (N,N-dimethylproline). The ligand electron density in the complex was interpreted as proline, generated within the active site at 100 K by the absorption of X-ray photon energy and two consecutive demethylation cycles. The oxidation state of the Rieske iron-sulfur cluster was characterized by UV-visible spectroscopy throughout X-ray data collection in conjunction with resonance Raman spectra collected before and after diffraction data. Shifts in the absorption band wavelength and intensity as a function of absorbed X-ray dose demonstrated that the Rieske center was reduced by solvated electrons generated by X-ray photons; the kinetics of the reduction process differed dramatically for the liganded complex compared to unliganded demethylase, which may correspond to the observed turnover in the crystal.
Matern, Andreas; Pedrolli, Danielle; Großhennig, Stephanie; Johansson, Jörgen; Mack, Matthias
2016-12-01
The riboflavin analogs roseoflavin (RoF) and 8-demethyl-8-aminoriboflavin (AF) are produced by the bacteria Streptomyces davawensis and Streptomyces cinnabarinus Riboflavin analogs have the potential to be used as broad-spectrum antibiotics, and we therefore studied the metabolism of riboflavin (vitamin B 2 ), RoF, and AF in the human pathogen Listeria monocytogenes, a bacterium which is a riboflavin auxotroph. We show that the L. monocytogenes protein Lmo1945 is responsible for the uptake of riboflavin, RoF, and AF. Following import, these flavins are phosphorylated/adenylylated by the bifunctional flavokinase/flavin adenine dinucleotide (FAD) synthetase Lmo1329 and adenylylated by the unique FAD synthetase Lmo0728, the first monofunctional FAD synthetase to be described in bacteria. Lmo1329 generates the cofactors flavin mononucleotide (FMN) and FAD, whereas Lmo0728 produces FAD only. The combined activities of Lmo1329 and Lmo0728 are responsible for the intracellular formation of the toxic cofactor analogs roseoflavin mononucleotide (RoFMN), roseoflavin adenine dinucleotide (RoFAD), 8-demethyl-8-aminoriboflavin mononucleotide (AFMN), and 8-demethyl-8-aminoriboflavin adenine dinucleotide (AFAD). In vivo reporter gene assays and in vitro transcription/translation experiments show that the L. monocytogenes FMN riboswitch Rli96, which controls expression of the riboflavin transport gene lmo1945, is negatively affected by riboflavin/FMN and RoF/RoFMN but not by AF/AFMN. Treatment of L. monocytogenes with RoF or AF leads to drastically reduced FMN/FAD levels. We suggest that the reduced flavin cofactor levels in combination with concomitant synthesis of inactive cofactor analogs (RoFMN, RoFAD, AFMN, and AFAD) explain why RoF and AF contribute to antibiotic activity in L. monocytogenes IMPORTANCE: The riboflavin analogs roseoflavin (RoF) and 8-demethyl-8-aminoriboflavin (AF) are small molecules which are produced by Streptomyces davawensis and Streptomyces cinnabarinus
Caspase 8 and maspin are downregulated in breast cancer cells due to CpG site promoter methylation
International Nuclear Information System (INIS)
Wu, Yanyuan; Alvarez, Monica; Slamon, Dennis J; Koeffler, Phillip; Vadgama, Jaydutt V
2010-01-01
Epigenetic changes associated with promoter DNA methylation results in silencing of several tumor suppressor genes that lead to increased risk for tumor formation and for progression of the cancer. Methylation specific PCR (MSP) and bisulfite sequencing were used for determination of proapoptotic gene Caspase 8 (CASP8) and the tumor suppressor gene maspin promoter methylation in four breast cancer and two non-tumorigenic breast cell lines. Involvement of histone H3 methylation in those cell lines were examined by CHIP assay. The CpG sites in the promoter region of CASP8 and maspin were methylated in all four breast cancer cell lines but not in two non-tumorigenic breast cell lines. Demethylation agent 5-aza-2'-deoxycytidine (5-aza-dc) selectively inhibits DNA methyltransferases, DNMT3a and DNMT3b, and restored CASP8 and maspin gene expression in breast cancer cells. 5-aza-dc also reduced histone H3k9me2 occupancy on CASP8 promoter in SKBR3cells, but not in MCF-7 cells. Combination of histone deacetylase inhibitor Trichostatin A (TSA) and 5-aza-dc significant decrease in nuclear expression of Di-methyl histone H3-Lys27 and slight increase in acetyl histone H3-Lys9 in MCF-7 cells. CASP8 mRNA and protein level in MCF-7 cells were increased by the 5-aza-dc in combination with TSA. Data from our study also demonstrated that treatment with 5-FU caused a significant increase in unmethylated CASP8 and in CASP8 mRNA in all 3 cancer lines. CASP8 and maspin expression were reduced in breast cancer cells due to promoter methylation. Selective application of demethylating agents could offer novel therapeutic opportunities in breast cancer
Gromicho, Marta; Dinis, Joana; Magalhães, Marta; Fernandes, Alexandra R; Tavares, Purificação; Laires, António; Rueff, José; Rodrigues, António Sebastião
2011-10-01
About 20% of patients with chronic myeloid leukemia (CML) do not respond to treatment with imatinib either initially or because of acquired resistance. To study the development of CML drug resistance, an in vitro experimental system comprising cell lines with different resistance levels was established by exposing K562 cells to increasing concentrations of imatinib and dasatinib anticancer agents. The mRNA levels of BCR- ABL1 and of genes involved in drug transport or redistribution (ABCB1, ABCC1, ABCC3, ABCG2, MVP, and SLC22A1) were measured and the ABL1 kinase domain sequenced. Results excluded BCR- ABL1 overexpression and mutations as relevant resistance mechanisms. Most studied transporters were overexpressed in the majority of resistant cell lines. Their expression pattern was dynamic: varying with resistance level and chronic drug exposure. Studied efflux transporters may have an important role at the initial stages of resistance, but after prolonged exposure and for higher doses of drugs other mechanisms might take place.
The autoradiolytic and the γ-induced demethylation of solid thymine-(methyl-14C)
International Nuclear Information System (INIS)
Merwitz, O.
1980-01-01
The autoradiolytic and the γ-induced demethylation of solid thymine were measured qualitatively and quantitatively for the first time with specially purified thymine-(methyl- 14 C). Analogous experiments with thymine-(methyl- 3 H) and radio-gaschromatographic analysis provided proof for the formation of molecular hydrogen and methane. Ethane was not detected. The results are discussed in connection with e.s.r.-spectroscopic studies. (author)
Gilmour, C. C.; Ghosh, U.; Santillan, E. F. U.; Soren, A.; Bell, J. T.; Butera, D.; McBurney, A. W.; Brown, S.; Henry, E.; Vlassopoulos, D.
2015-12-01
In-situ sorbent amendments are a low-impact approach for remediation of contaminants in sediments, particular in habitats like wetlands that provide important ecosystem services. Laboratory microcosm trials (Gilmour et al. 2013) and early field trials show that activated carbon (AC) can effectively increase partitioning of both inorganic Hg and methylmercury to the solid phase. Sediment-water partitioning can serve as a proxy for Hg and MeHg bioavailability in soils. One consideration in using AC in remediation is its potential impact on organisms. For mercury, a critical consideration is the potential impact on net MeHg accumulation and bioavailability. In this study, we specifically evaluated the impact of AC on rates of methylmercury production and degradation, and on overall microbial activity, in 4 different Hg-contaminated salt marsh soils. The study was done over 28 days in anaerobic, sulfate-reducing slurries. A double label of enriched mercury isotopes (Me199Hg and inorganic 201Hg) was used to separately follow de novo Me201Hg production and Me199Hg degradation. AC amendments decreased both methylation and demethylation rate constants relative to un-amended controls, but the impact on demethylation was stronger. The addition of 5% (dry weight) regenerated AC to soil slurries drove demethylation rate constants to nearly zero; i.e. MeHg sorption to AC almost totally blocked its degradation. The net impact was increased solid phase MeHg concentrations in some of the soil slurries with the highest methylation rate constants. However, the net impact of AC amendments was to increase MeHg (and inorganic Hg) partitioning to the soil phase and decrease concentrations in the aqueous phase. AC significantly decreased aqueous phase inorganic Hg and MeHg concentrations after 28 days. Overall, the efficacy of AC in reducing aqueous MeHg was highest in the soils with the highest MeHg concentrations. The AC addition did not significantly impact microbial activity, as
Szilagyi, John T; Vetrano, Anna M; Laskin, Jeffrey D; Aleksunes, Lauren M
2017-07-01
The breast cancer resistance protein (BCRP/ABCG2) is an efflux transporter in the placental barrier. By transporting chemicals from the fetal to the maternal circulation, BCRP limits fetal exposure to a range of drugs, toxicants, and endobiotics such as bile acids and hormones. The purpose of the present studies was to 1) determine whether BCRP localizes to highly-ordered, cholesterol-rich lipid raft microdomains in placenta microvillous membranes, and 2) determine the impact of cholesterol on BCRP-mediated placental transport in vitro. BCRP expression was analyzed in lipid rafts isolated from placentas from healthy, term pregnancies and BeWo trophoblasts by density gradient ultracentrifugation. BeWo cells were also tested for their ability to efflux BCRP substrates after treatment with the cholesterol sequestrant methyl-β-cyclodextrin (MβCD, 5 mM, 1 h) or the cholesterol synthesis inhibitor pravastatin (200 μM, 48 h). BCRP was found to co-localize with lipid raft proteins in detergent-resistant, lipid raft-containing fractions from placental microvillous membranes and BeWo cells. Treatment of BeWo cells with MβCD redistributed BCRP protein into higher density non-lipid raft fractions. Repletion of the cells with cholesterol restored BCRP localization to lipid raft-containing fractions. Treatment of BeWo cells with MβCD or pravastatin increased cellular retention of two BCRP substrates, the fluorescent dye Hoechst 33342 and the mycotoxin zearalenone. Repletion with cholesterol restored BCRP transporter activity. Taken together, these data demonstrate that cholesterol may play a critical role in the post-translational regulation of BCRP in placental lipid rafts. Copyright © 2017 Elsevier Ltd. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Marschner, Karel; Musil, Stanislav; Dědina, Jiří
2016-01-01
Roč. 88, č. 12 (2016), s. 6366-6373 ISSN 0003-2700 R&D Projects: GA ČR GA14-23532S Institutional support: RVO:68081715 Keywords : arsenic speciation analysis * hydride generation * demethylation Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 6.320, year: 2016
FOXP3 Expression in GARP-Transduced Helper T Cells Is Not Associated with FOXP3 TSDR Demethylation.
Kehrmann, Jan; Zeschnigk, Michael; Buer, Jan; Probst-Kepper, Michael
2011-10-01
AIM: Glycoprotein A repetitions predominant (GARP or LRRC32) represents a human regulatory CD4+ CD25(hi) FOXP3+ T (T(reg)) cell-specific receptor that controls FOXP3. Ectopic expression of GARP in helper T (T(h)) cells has been shown to be sufficient for the induction of FOXP3 and generation of a stable regulatory phenotype. Since expression of FOXP3 in Treg cells is epigenetically controlled by a conserved motif, the so-called T(reg)-specific demethylated region (TSDR), we asked whether GARP-mediated upregulation of FOXP3 in Th cells is similarly accompanied by demethylation of the TSDR. METHODS: DNA methylation of the FOXP3 TSDR was analyzed by direct sequencing of polymerase chain reaction (PCR) products from bisulfite-treated genomic DNA. RESULTS: Although GARP-transduced T(h) cells exhibit constitutive FOXP3 expression and a regulatory phenotype, the FOXP3 TSDR is completely methylated as in naive T(h) cells. GARP-mediated FOXP3 upregulation in T(h) cells is not associated with T(reg)-specific demethylation of the FOXP3 TSDR. CONCLUSION: Although GARP-engineered T(h) cells exhibit stable FOXP3 expression and a phenotypic reprogramming towards T(reg) cells in vitro, these cells do not completely mimic the epigenotype of natural T(reg) cells. Thus, concepts based on the genetic modification of T(h) cells as cellular therapies to treat autoimmune diseases or to control transplantation tolerance should be critically tested before any clinical application.
Diaz-Trujillo, Caucasella; Chong, Pablo; Stergiopoulos, Ioannis; Cordovez, Viviane; Guzman, Mauricio; De Wit, Pierre J G M; Meijer, Harold J G; Scalliet, Gabriel; Sierotzki, Helge; Lilia Peralta, Esther; Arango Isaza, Rafael E; Kema, Gerrit H J
2017-11-04
The Dothideomycete Pseudocercospora fijiensis, previously Mycosphaerella fijiensis, is the causal agent of black Sigatoka, one of the most destructive diseases of bananas and plantains. Disease management depends on fungicide applications, with a major contribution from sterol demethylation-inhibitors (DMIs). The continued use of DMIs places considerable selection pressure on natural P. fijiensis populations, enabling the selection of novel genotypes with reduced sensitivity. The hitherto explanatory mechanism for this reduced sensitivity was the presence of non-synonymous point mutations in the target gene Pfcyp51, encoding the sterol 14α-demethylase enzyme. Here, we demonstrate a second mechanism involved in DMI sensitivity of P. fijiensis. We identified a 19-bp element in the wild-type (wt) Pfcyp51 promoter that concatenates in strains with reduced DMI sensitivity. A polymerase chain reaction (PCR) assay identified up to six Pfcyp51 promoter repeats in four field populations of P. fijiensis in Costa Rica. We used transformation experiments to swap the wt promoter of a sensitive field isolate with a promoter from a strain with reduced DMI sensitivity that comprised multiple insertions. Comparative in vivo phenotyping showed a functional and proportional up-regulation of Pfcyp51, which consequently decreased DMI sensitivity. Our data demonstrate that point mutations in the Pfcyp51 coding domain, as well as promoter inserts, contribute to the reduced DMI sensitivity of P. fijiensis. These results provide new insights into the importance of the appropriate use of DMIs and the need for the discovery of new molecules for black Sigatoka management. © 2017 The Authors. Molecular Plant Pathology published by British Society for Plant Pathology and John Wiley & Sons Ltd.
Edwards, H. G. M.; Munshi, T.; Anstis, M.
2005-05-01
The FT Raman spectrum of caffeine was analysed along with that of its demethylated analogues, theobromine and theophylline. The similar but not identical structures of these three compounds allowed a more detailed assignment of the Raman bands. Noticeable differences in the Raman spectra of these compounds were apparent and key marker bands have been identified for the spectroscopic identification of these three compounds.
Methylation of the ATM promoter in glioma cells alters ionizing radiation sensitivity
International Nuclear Information System (INIS)
Roy, Kanaklata; Wang, Lilin; Makrigiorgos, G. Mike; Price, Brendan D.
2006-01-01
Glioblastomas are among the malignancies most resistant to radiation therapy. In contrast, cells lacking the ATM protein are highly sensitive to ionizing radiation. The relationship between ATM protein expression and radiosensitivity in 3 glioma cell lines was examined. T98G cells exhibited normal levels of ATM protein, whereas U118 and U87 cells had significantly lower levels of ATM and increased (>2-fold) sensitivity to ionizing radiation compared to T98G cells. The ATM promoter was methylated in U87 cells. Demethylation by azacytidine treatment increased ATM protein levels in the U87 cells and decreased their radiosensitivity. In contrast, the ATM promoter in U118 cells was not methylated. Further, expression of exogenous ATM did not significantly alter the radiosensitivity of U118 cells. ATM expression is therefore heterogeneous in the glioma cells examined. In conclusion, methylation of the ATM promoter may account for the variable radiosensitivity and heterogeneous ATM expression in a fraction of glioma cells
International Nuclear Information System (INIS)
Schneider, J.F.; Schoeller, D.A.; Nemchausky, B.; Bayer, J.L.; Klein, P.
1978-01-01
Interval sampling of expired breath as a simple, non-invasive assessment of the effect of liver disease upon hepatic microsomal drug metabolism, has been demonstrated with [ 14 C] dimethylaminoantipyrine (aminopyrine). In order to eliminate radiation risk the authors have validated the use of aminopyrine labeled with the stable, non-radioactive isotope 13 C. Simultaneous oral administration of both [ 14 C]- and [ 13 C] aminopyrine to five adult subjects without liver disease as well as five patients with known liver disease, resulted in the excretion of label at nearly identical rates in both individual time collections (r=0.94) as well as cumulative excretion for three hours (r=0.97). An oral dose of 2-mg/kg of [ 13 C) aminopyrine resulted in rates of production of 13 CO 2 significantly greater than baseline variations in 13 CO 2 production in the fasting, resting subject. Measurements of a single peak value at one half hour correlated closely with the determination of cumulative appearance over three hours (r=0.96). A consistent reproducible increase in the peak production of 13 CO 2 was observed when five patients received phenobarbital. Stable isotope labeled aminopyrine may be used to detect the effects of disease and treatment upon hepatic N-demethylation activity in human subjects without incurring any risk from radiation. Furthermore, the availability of another isotopic carbon label should make possible the study of direct drug-drug interaction utilizing CO 2 analysis. (Auth.)
Energy Technology Data Exchange (ETDEWEB)
Tan, Min [Department of Respiratory Medicine, Shanghai Tenth People’s Hospital, Tongji University, Shanghai 200072 (China); Wu, Junjie, E-mail: wujunjiesh@126.com [Department of Pneumology, Changhai Hospital of Shanghai, Second Military Medical University, Shanghai 200433 (China); State Key Laboratory of Genetic Engineering and Ministry of Education Key Laboratory of Contemporary Anthropology, School of Life Sciences, Fudan University, Shanghai 200433 (China); Cai, Yong, E-mail: dryongcai@126.com [Department of Radiation Oncology, Shanghai Pulmonary Hospital, Tongji University School of Medicine, Shanghai 200433 (China)
2013-09-06
Highlights: •Dnmt3A and Dnmt3B are involved in the down-regulation of WIF-1 expression in non-small-cell lung cancer. •MiR-29 family members could restore WIF-1 expression through demethylation. •MiR-29s suppress Wnt/β-catenin signaling pathway and inhibit tumor growth. •The expression of miR-29a and miR-29b could be regulated partially in a positive feedback loop. -- Abstract: Wnt inhibitory factor-1 (WIF-1) silencing induced by promoter hypermethylation is a common mechanism of aberrant activation of the Wnt signaling pathway in non-small-cell lung cancer (NSCLC). However, the activity of regulators associated with the methylation of the WIF-1 gene remains unclear. Here, we investigated the role of three DNA methyltransferases (DNMT1, DNMT3A and DNMT3B) in the expression of WIF-1. The three DNMTs were up-regulated in NSCLC tumor tissues and suppression of DNMT3A and DNMT3B restored the expression of WIF-1 in NSCLC cells. The miR-29 family (miR-29a, -29b, and -29c), which negatively regulates DNMT3A and DNMT3B, was examined in association with the Wnt/β-catenin signaling pathway. A positive correlation between the expression of WIF-1 and that of MiR-29s was observed in NSCLC tissues. Methylation-specific PCR and Western blotting indicated that miR-29s positively regulate WIF-1 expression by inhibiting the methylation of its promoter. Furthermore, miR-29 overexpression downregulated β-catenin expression, inhibited cell proliferation and induced apoptosis. The expression of miR-29a and miR-29b was partially regulated by DNMT3A and DNMT3B in a positive feedback loop. Taken together, our findings show that miR-29s suppress the Wnt signaling pathway through demethylation of WIF-1 in NSCLC.
Mitochondrial control through nutritionally regulated global histone H3 lysine-4 demethylation.
Soloveychik, Maria; Xu, Mengshu; Zaslaver, Olga; Lee, Kwanyin; Narula, Ashrut; Jiang, River; Rosebrock, Adam P; Caudy, Amy A; Meneghini, Marc D
2016-11-29
Histone demethylation by Jumonji-family proteins is coupled with the decarboxylation of α-ketoglutarate (αKG) to yield succinate, prompting hypotheses that their activities are responsive to levels of these metabolites in the cell. Consistent with this paradigm we show here that the Saccharomyces cerevisiae Jumonji demethylase Jhd2 opposes the accumulation of H3K4me3 in fermenting cells only when they are nutritionally manipulated to contain an elevated αKG/succinate ratio. We also find that Jhd2 opposes H3K4me3 in respiratory cells that do not exhibit such an elevated αKG/succinate ratio. While jhd2∆ caused only limited gene expression defects in fermenting cells, transcript profiling and physiological measurements show that JHD2 restricts mitochondrial respiratory capacity in cells grown in non-fermentable carbon in an H3K4me-dependent manner. In association with these phenotypes, we find that JHD2 limits yeast proliferative capacity under physiologically challenging conditions as measured by both replicative lifespan and colony growth on non-fermentable carbon. JHD2's impact on nutrient response may reflect an ancestral role of its gene family in mediating mitochondrial regulation.
Mitochondrial control through nutritionally regulated global histone H3 lysine-4 demethylation
Soloveychik, Maria; Xu, Mengshu; Zaslaver, Olga; Lee, Kwanyin; Narula, Ashrut; Jiang, River; Rosebrock, Adam P.; Caudy, Amy A.; Meneghini, Marc D.
2016-01-01
Histone demethylation by Jumonji-family proteins is coupled with the decarboxylation of α-ketoglutarate (αKG) to yield succinate, prompting hypotheses that their activities are responsive to levels of these metabolites in the cell. Consistent with this paradigm we show here that the Saccharomyces cerevisiae Jumonji demethylase Jhd2 opposes the accumulation of H3K4me3 in fermenting cells only when they are nutritionally manipulated to contain an elevated αKG/succinate ratio. We also find that Jhd2 opposes H3K4me3 in respiratory cells that do not exhibit such an elevated αKG/succinate ratio. While jhd2∆ caused only limited gene expression defects in fermenting cells, transcript profiling and physiological measurements show that JHD2 restricts mitochondrial respiratory capacity in cells grown in non-fermentable carbon in an H3K4me-dependent manner. In association with these phenotypes, we find that JHD2 limits yeast proliferative capacity under physiologically challenging conditions as measured by both replicative lifespan and colony growth on non-fermentable carbon. JHD2’s impact on nutrient response may reflect an ancestral role of its gene family in mediating mitochondrial regulation. PMID:27897198
El Kasmi, Karim C.; Anderson, Aimee L.; Devereaux, Michael W.; Vue, Padade M.; Zhang, Wujuan; Setchell, Kenneth D. R.; Karpen, Saul J.; Sokol, Ronald J.
2014-01-01
Parenteral nutrition–associated liver disease (PNALD) is a serious complication of PN in infants who do not tolerate enteral feedings, especially those with acquired or congenital intestinal diseases. Yet, the mechanisms underlying PNALD are poorly understood. It has been suggested that a component of soy oil (SO) lipid emulsions in PN solutions, such as plant sterols (phytosterols), may be responsible for PNALD, and that use of fish oil (FO)–based lipid emulsions may be protective. We used a mouse model of PNALD combining PN infusion with intestinal injury to demonstrate that SO-based PN solution causes liver damage and hepatic macrophage activation and that PN solutions that are FO-based or devoid of all lipids prevent these processes. We have furthermore demonstrated that a factor in the SO lipid emulsions, stigmasterol, promotes cholestasis, liver injury, and liver macrophage activation in this model and that this effect may be mediated through suppression of canalicular bile transporter expression (Abcb11/BSEP, Abcc2/MRP2) via antagonism of the nuclear receptors Fxr and Lxr, and failure of up-regulation of the hepatic sterol exporters (Abcg5/g8/ABCG5/8). This study provides experimental evidence that plant sterols in lipid emulsions are a major factor responsible for PNALD and that the absence or reduction of plant sterols is one of the mechanisms for hepatic protection in infants receiving FO-based PN or lipid minimization PN treatment. Modification of lipid constituents in PN solutions is thus a promising strategy to reduce incidence and severity of PNALD. PMID:24107776
Directory of Open Access Journals (Sweden)
Li-Juan Fu
2014-01-01
Full Text Available DNA (cytosine-5- methylation silencing of GSTP1 function occurs in prostate adenocarcinoma (PCa. Previous studies have shown that there is an inverse relationship between dietary lycopene intake and the risk of PCa. However, it is unknown whether lycopene reactivates the tumor suppressor gene glutathioneS-transferase-π (GSTP1 by demethylation of the hypermethylated CpGs that act to silence the GSTP1 promoter. Here, we demonstrated that lycopene treatment significantly decreased the methylation levels of the GSTP1 promoter and increased the mRNA and protein levels of GSTP1 in an androgen-independent PC-3 cell line. In contrast, lycopene treatment did not demethylate the GSTP1 promoter or increase GSTP1 expression in the androgen-dependent LNCaP cell line. DNA methyltransferase (DNMT 3A protein levels were downregulated in PC-3 cells following lycopene treatment; however, DNMT1 and DNMT3B levels were unchanged. Furthermore, the long interspersed element (LINE-1 and short interspersed element ALU were not demethylated when treated by lycopene. In LNCaP cells, lycopene treatment did not affect any detected DNMT protein expression, and the methylation levels of LINE-1 and ALU were decreased. These results indicated that the protective effect of lycopene on the prostate is different between androgen-dependent and androgen-independent derived PCa cells. Further, in vivo studies should be conducted to confirm these promising results and to evaluate the potential role of lycopene in the protection of the prostate.
de Kanel, J; Vickery, W E; Waldner, B; Monahan, R M; Diamond, F X
1998-05-01
A forensic procedure for the quantitative confirmation of lysergic acid diethylamide (LSD) and the qualitative confirmation of its metabolite, N-demethyl-LSD, in blood, serum, plasma, and urine samples is presented. The Zymark RapidTrace was used to perform fully automated solid-phase extractions of all specimen types. After extract evaporation, confirmations were performed using liquid chromatography (LC) followed by positive electrospray ionization (ESI+) mass spectrometry/mass spectrometry (MS/MS) without derivatization. Quantitation of LSD was accomplished using LSD-d3 as an internal standard. The limit of quantitation (LOQ) for LSD was 0.05 ng/mL. The limit of detection (LOD) for both LSD and N-demethyl-LSD was 0.025 ng/mL. The recovery of LSD was greater than 95% at levels of 0.1 ng/mL and 2.0 ng/mL. For LSD at 1.0 ng/mL, the within-run and between-run (different day) relative standard deviation (RSD) was 2.2% and 4.4%, respectively.
International Nuclear Information System (INIS)
Hamelin, Stéphanie; Planas, Dolors; Amyot, Marc
2015-01-01
Wetlands in large rivers are important sites of production of the neurotoxin methylmercury (MeHg), and the periphyton growing on wetland macrophytes are increasingly recognized as key players in this production and transfer in food webs. Information is lacking about mercury methylation (K m ) and demethylation (K d ) rates in periphytic biofilms from the Northern Hemisphere, as well as about the drivers of net MeHg production, hampering ecosystem modeling of Hg cycling. Mercury methylation and demethylation rates were measured in periphytic biofilms growing on submerged plants in a shallow fluvial lake located in a temperate cold region (St. Lawrence River, Quebec, Canada). Incubations were performed in situ within macrophyte beds using low-level spikes of 199 HgO and Me 200 Hg stable isotopes as tracers. A direct relationship was observed between K m (0.002 to 0.137 d −1 ) and [MeHg] in periphyton. A similar relationship was found between K d (0.096 to 0.334 d −1 ) and [inorganic Hg]. Periphyton of Lake St. Pierre reached high levels of net MeHg production that were two orders of magnitude higher than those found in local sediment. This production varied through the plant growing season and was mainly driven by environmental variables such as depth of growth, available light, dissolved oxygen, temperature, plant community structure, and productivity of the habitat. - Highlights: • Periphyton Hg methylation and demethylation were studied in a large fluvial lake. • Addition of stable Hg isotopes was used to obtain in situ rates for these processes. • Net methylation was higher in periphyton than in local sediments. • Methylation and demethylation rates fluctuated during the summer. • Key drivers of rates were depth, light, temperature, and community structure
Energy Technology Data Exchange (ETDEWEB)
Hamelin, Stéphanie; Planas, Dolors [GRIL, Département de sciences biologiques, Université du Québec à Montréal, C.P. 8888, Succursale Centre-Ville, Montreal, Quebec H3C 3P8 (Canada); Amyot, Marc [GRIL, Département de sciences biologiques, Université de Montréal, C.P. 6128, Succursale Centre-Ville, Montréal, Quebec H3C 3J7 (Canada)
2015-04-15
Wetlands in large rivers are important sites of production of the neurotoxin methylmercury (MeHg), and the periphyton growing on wetland macrophytes are increasingly recognized as key players in this production and transfer in food webs. Information is lacking about mercury methylation (K{sub m}) and demethylation (K{sub d}) rates in periphytic biofilms from the Northern Hemisphere, as well as about the drivers of net MeHg production, hampering ecosystem modeling of Hg cycling. Mercury methylation and demethylation rates were measured in periphytic biofilms growing on submerged plants in a shallow fluvial lake located in a temperate cold region (St. Lawrence River, Quebec, Canada). Incubations were performed in situ within macrophyte beds using low-level spikes of {sup 199}HgO and Me{sup 200}Hg stable isotopes as tracers. A direct relationship was observed between K{sub m} (0.002 to 0.137 d{sup −1}) and [MeHg] in periphyton. A similar relationship was found between K{sub d} (0.096 to 0.334 d{sup −1}) and [inorganic Hg]. Periphyton of Lake St. Pierre reached high levels of net MeHg production that were two orders of magnitude higher than those found in local sediment. This production varied through the plant growing season and was mainly driven by environmental variables such as depth of growth, available light, dissolved oxygen, temperature, plant community structure, and productivity of the habitat. - Highlights: • Periphyton Hg methylation and demethylation were studied in a large fluvial lake. • Addition of stable Hg isotopes was used to obtain in situ rates for these processes. • Net methylation was higher in periphyton than in local sediments. • Methylation and demethylation rates fluctuated during the summer. • Key drivers of rates were depth, light, temperature, and community structure.
Directory of Open Access Journals (Sweden)
Roman T Kellenberger
Full Text Available Plants have to fine-tune their signals to optimise the trade-off between herbivore deterrence and pollinator attraction. An important mechanism in mediating plant-insect interactions is the regulation of gene expression via DNA methylation. However, the effect of herbivore-induced DNA methylation changes on pollinator-relevant plant signalling has not been systematically investigated. Here, we assessed the impact of foliar herbivory on DNA methylation and floral traits in the model crop plant Brassica rapa. Methylation-sensitive amplified fragment length polymorphism (MSAP analysis showed that leaf damage by the caterpillar Pieris brassicae was associated with genome-wide methylation changes in both leaves and flowers of B. rapa as well as a downturn in flower number, morphology and scent. A comparison to plants with jasmonic acid-induced defence showed similar demethylation patterns in leaves, but both the floral methylome and phenotype differed significantly from P. brassicae infested plants. Standardised genome-wide demethylation with 5-azacytidine in five different B. rapa full-sib groups further resulted in a genotype-specific downturn of floral morphology and scent, which significantly reduced the attractiveness of the plants to the pollinator bee Bombus terrestris. These results suggest that DNA methylation plays an important role in adjusting plant signalling in response to changing insect communities.
DEFF Research Database (Denmark)
Kristensen, Line Hyltoft; Nielsen, Anders Laerke; Helgstrand, Charlotte
2012-01-01
Dynamic methylations and demethylations of histone lysine residues are important for gene regulation and are facilitated by histone methyltransferases and histone demethylases (HDMs). KDM5B/Jarid1B/PLU1 is an H3K4me3/me2 specific lysine demethylase belonging to the family of JmjC domain containing...... lysine specific HDMs (JHDMs). Several studies have linked KDM5B to breast, prostate and skin cancer, highlighting its potential as a drug target. However, most inhibitor studies have focused on other JHDMs, and inhibitors for KDM5B remain to be explored. Here, we report the expression, purification...... and characterization of the catalytic core of recombinant KDM5B (residues 1-769, ccKDM5B). We show that ccKDM5B, recombinantly expressed in insect cells, demethylates H3K4me3 and H3K4me2 in vitro. The kinetic characterization showed that ccKDM5B has a K(m) (app) value of 0.5 µM for its tri-methylated substrate H3...
Van Moerkercke, Alex; Galván-Ampudia, Carlos S; Verdonk, Julian C; Haring, Michel A; Schuurink, Robert C
2012-05-01
In which cells of the flower volatile biosynthesis takes place is unclear. In rose and snapdragon, some enzymes of the volatile phenylpropanoid/benzenoid pathway have been shown to be present in the epidermal cells of petals. It is therefore generally believed that the production of these compounds occurs in these cells. However, whether the entire pathway is active in these cells and whether it is exclusively active in these cells remains to be proven. Cell-specific transcription factors activating these genes will determine in which cells they are expressed. In petunia, the transcription factor EMISSION OF BENZENOIDS II (EOBII) activates the ODORANT1 (ODO1) promoter and the promoter of the biosynthetic gene isoeugenol synthase (IGS). The regulator ODO1 in turn activates the promoter of the shikimate gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Here the identification of a new target gene of ODO1, encoding an ABC transporter localized on the plasma membrane, PhABCG1, which is co-expressed with ODO1, is described. PhABCG1 expression is up-regulated in petals overexpressing ODO1 through activation of the PhABCG1 promoter. Interestingly, the ODO1, PhABCG1, and IGS promoters were active in petunia protoplasts originating from both epidermal and mesophyll cell layers of the petal, suggesting that the volatile phenylpropanoid/benzenoid pathway in petunia is active in these different cell types. Since volatile release occurs from epidermal cells, trafficking of (volatile) compounds between cell layers must be involved, but the exact function of PhABCG1 remains to be resolved.
DEFF Research Database (Denmark)
Noehr-Jensen, L; Zwisler, S T; Larsen, F
2009-01-01
Tramadol is O–demethylated to the active metabolite (+)–O–desmethyltramadol ((+)–M1) via CYP2D6, an enzyme that is weakly inhibited by escitalopram. We investigated the possibility of a pharmacokinetic (PK) and pharmacodynamic (PD) effect of escitalopram on tramadol metabolism. Fifteen healthy...... subjects completed this randomized, double–blind, three–phase, crossover trial. Combinations of escitalopram 20 mg/day or placebo together with tramadol 150 mg or placebo were used. Blood samples for pharmacokinetics were drawn at 0–24 h after medication. The analgesic effect of (+)–M was assessed...... AUEC1–12 of CPT were 4,140 and 4,388 cm·s after placebo and escitalopram, respectively (P = 0.71). Although escitalopram is a weak inhibitor of CYP2D6, it does not impair the analgesic effect of tramadol....
Díaz-Trujillo, C.; Chong, P.; Stergiopoulos, I.; Meijer, H.J.G.; Wit, de P.J.G.M.; Kema, G.H.J.
2017-01-01
The Dothideomycete Pseudocercospora fijiensis, previously Mycosphaerella fijiensis, is the causal agent of black Sigatoka, one of the most destructive diseases of bananas and plantains. Disease management depends on fungicide applications with a major share for sterol demethylation-inhibitors
Díaz-Trujillo, C.; Chong, P.; Stergiopoulos, I.; Meijer, H.J.G.; Wit, de P.J.G.M.; Kema, G.H.J.
2018-01-01
The Dothideomycete Pseudocercospora fijiensis, previously Mycosphaerella fijiensis, is the causal agent of black Sigatoka, one of the most destructive diseases of bananas and plantains. Disease management depends on fungicide applications with a major share for sterol demethylation-inhibitors
Äijö, Tarmo; Huang, Yun; Mannerström, Henrik; Chavez, Lukas; Tsagaratou, Ageliki; Rao, Anjana; Lähdesmäki, Harri
2016-03-14
We present a generative model, Lux, to quantify DNA methylation modifications from any combination of bisulfite sequencing approaches, including reduced, oxidative, TET-assisted, chemical-modification assisted, and methylase-assisted bisulfite sequencing data. Lux models all cytosine modifications (C, 5mC, 5hmC, 5fC, and 5caC) simultaneously together with experimental parameters, including bisulfite conversion and oxidation efficiencies, as well as various chemical labeling and protection steps. We show that Lux improves the quantification and comparison of cytosine modification levels and that Lux can process any oxidized methylcytosine sequencing data sets to quantify all cytosine modifications. Analysis of targeted data from Tet2-knockdown embryonic stem cells and T cells during development demonstrates DNA modification quantification at unprecedented detail, quantifies active demethylation pathways and reveals 5hmC localization in putative regulatory regions.
DEFF Research Database (Denmark)
Kristensen, D G; Nielsen, J E; Jørgensen, Anne
2014-01-01
cells were assessed by quantitative measurements. The expression of TET1, TET2, APOBEC1, MBD4, APEX1, PARP1, DNMT1, DNMT3A, DNMT3B and DNMT3L in adult testis specimens with CIS and in human fetal testis was investigated by immunohistochemistry and immunofluorescence.Results:DNA from micro-dissected CIS...... cells contained very low levels of 5hmC produced by ten eleven translocation (TET) enzymes. CIS cells and fetal germ cells expressed the suggested initiator of active demethylation, APOBEC1, and the base excision repair proteins MBD4, APEX1 and PARP1, whereas TETs - the alternative initiators were...
Directory of Open Access Journals (Sweden)
Svetlana V Kostyuk
Full Text Available Hypermethylation is observed in the promoter regions of suppressor genes in the tumor cancer cells. Reactivation of these genes by demethylation of their promoters is a prospective strategy of the anticancer therapy. Previous experiments have shown that symmetric dimeric bisbenzimidazoles DBP(n are able to block DNA methyltransferase activities. It was also found that DBP(n produces a moderate effect on the activation of total gene expression in HeLa-TI population containing epigenetically repressed avian sarcoma genome.It is shown that DBP(n are able to penetrate the cellular membranes and accumulate in breast carcinoma cell MCF-7, mainly in the mitochondria and in the nucleus, excluding the nucleolus. The DBP(n are non-toxic to the cells and have a weak overall demethylation effect on genomic DNA. DBP(n demethylate the promoter regions of the tumor suppressor genes PTEN and RARB. DBP(n promotes expression of the genes RARB, PTEN, CDKN2A, RUNX3, Apaf-1 and APC "silent" in the MCF-7 because of the hypermethylation of their promoter regions. Simultaneously with the demethylation of the DNA in the nucleus a significant increase in the methylation level of rRNA genes in the nucleolus was detected. Increased rDNA methylation correlated with a reduction of the rRNA amount in the cells by 20-30%. It is assumed that during DNA methyltransferase activity inhibition by the DBP(n in the nucleus, the enzyme is sequestered in the nucleolus and provides additional methylation of the rDNA that are not shielded by DBP(n.It is concluded that DBP (n are able to accumulate in the nucleus (excluding the nucleolus area and in the mitochondria of cancer cells, reducing mitochondrial potential. The DBP (n induce the demethylation of a cancer cell's genome, including the demethylation of the promoters of tumor suppressor genes. DBP (n significantly increase the methylation of ribosomal RNA genes in the nucleoli. Therefore the further study of these compounds is needed
Directory of Open Access Journals (Sweden)
Ling Lu
Full Text Available It has been documented all-trans retinoic acid (atRA promotes the development of TGF-β-induced CD4(+Foxp3(+ regulatory T cells (iTreg that play a vital role in the prevention of autoimmune responses, however, molecular mechanisms involved remain elusive. Our objective, therefore, was to determine how atRA promotes the differentiation of iTregs.Addition of atRA to naïve CD4(+CD25(- cells stimulated with anti-CD3/CD28 antibodies in the presence of TGF-β not only increased Foxp3(+ iTreg differentiation, but maintained Foxp3 expression through apoptosis inhibition. atRA/TGF-β-treated CD4(+ cells developed complete anergy and displayed increased suppressive activity. Infusion of atRA/TGF-β-treated CD4(+ cells resulted in the greater effects on suppressing symptoms and protecting the survival of chronic GVHD mice with typical lupus-like syndromes than did CD4(+ cells treated with TGF-β alone. atRA did not significantly affect the phosphorylation levels of Smad2/3 and still promoted iTreg differentiation in CD4(+ cells isolated from Smad3 KO and Smad2 conditional KO mice. Conversely, atRA markedly increased ERK1/2 activation, and blockade of ERK1/2 signaling completely abolished the enhanced effects of atRA on Foxp3 expression. Moreover, atRA significantly increased histone methylation and acetylation within the promoter and conserved non-coding DNA sequence (CNS elements at the Foxp3 gene locus and the recruitment of phosphor-RNA polymerase II, while DNA methylation in the CNS3 was not significantly altered.We have identified the cellular and molecular mechanism(s by which atRA promotes the development and maintenance of iTregs. These results will help to enhance the quantity and quality of development of iTregs and may provide novel insights into clinical cell therapy for patients with autoimmune diseases and those needing organ transplantation.
Pulakazhi Venu, Vivek Krishna; Adijiang, Ayinuer; Seibert, Tara; Chen, Yong-Xiang; Shi, Chunhua; Batulan, Zarah; O'Brien, Edward R
2017-06-01
Recently, we demonstrated that heat shock protein (HSP)-27 is protective against the development of experimental atherosclerosis, reducing plaque cholesterol content by more than 30%. Moreover, elevated HSP-27 levels are predictive of relative freedom from clinical cardiovascular events. HSP-27 signaling occurs via the activation of NF-κB, which induces a marked up-regulation in expression of granulocyte-monocyte colony-stimulating factor (GM-CSF), a cytokine that is known to alter ABC transporters involved in reverse cholesterol transport (RCT). Therefore, we hypothesized that HSP-27-derived GM-CSF has a potent role in impeding plaque formation by promoting macrophage RCT and sought to better characterize this pathway. Treatment of THP-1 cells, RAW-Blue cells, and primary macrophages with recombinant HSP-27 resulted in NF-κB activation via TLR-4 and was inhibited by various pharmacologic blockers of this pathway. Moreover, HSP-27-induced upregulation of GM-CSF expression was dependent on TLR-4 signaling. Recombinant (r)HSP-27 treatment of ApoE -/- female (but not male) mice for 4 wk yielded reductions in plaque area and cholesterol clefts of 33 and 47%, respectively, with no effect on GM-CSF -/- ApoE -/- mice. With 12 wk of rHSP-27 treatment, both female and male mice showed reductions in plaque burden (55 and 42%, respectively) and a 60% reduction in necrotic core area but no treatment effect in GM-CSF -/- ApoE -/- mice. In vitro functional studies revealed that HSP-27 enhanced the expression of ABCA1 and ABCG1, as well as facilitated cholesterol efflux in vitro by ∼10%. These novel findings establish a paradigm for HSP-27-mediated RCT and set the stage for the development of HSP-27 atheroprotective therapeutics.-Pulakazhi Venu, V. K., Adijiang, A., Seibert, T., Chen, Y.-X., Shi, C., Batulan, Z., O'Brien, E. R. Heat shock protein 27-derived atheroprotection involves reverse cholesterol transport that is dependent on GM-CSF to maintain ABCA1 and ABCG1
(/sup 125/I) 7-iodo-6-demethyl-6-deoxytetracycline HCl: its use in the study of bone mineralization
Energy Technology Data Exchange (ETDEWEB)
Belbeck, L W; Bowen, B M; Garnett, E S [McMaster Univ., Hamilton, Ontario (Canada); Porter, J K; Teare, F W
1979-06-01
/sup 125/I 7-iodo-6-demethyl-6-deoxytetracycline can be used in a non-invasive method to indicate sites of active bone mineralization. Sequential doses of this agent have been used to follow bone repair in a fractured femur of a dog without resorting to bone biopsy. Metabolic problems that involve bone may also be studied with this potentially useful radiopharmaceutical.
Kerry, N L; Somogyi, A A; Bochner, F; Mikus, G
1994-01-01
1. The enzyme kinetics of dextromethorphan O-demethylation in liver microsomes from three extensive metabolisers (EM) with respect to CYP2D6 indicated high (Km1 2.2-9.4 microM) and low (Km2 55.5-307.3 microM) affinity sites whereas microsomes from two poor metabolisers (PM) indicated a single site (Km 560 and 157 microM). Similar differences were shown for 3-methoxymorphinan O-demethylation to 3-hydroxymorphinan (Km 6.9-9.6 microM in EM subjects; Km 307 and 213 microM in PM subjects). 2. Dextromethorphan O-demethylation was inhibited competitively by quinidine (Ki 0.1 microM), rac-perhexiline (Ki 0.4 microM), dextropropoxyphene (Ki 6 microM), rac-methadone (Ki 8 microM), and 3-methoxymorphinan (Ki 15 microM). These compounds were also potent inhibitors of 3-methoxymorphinan O-demethylation with IC50 values ranging from 0.02-12 microM. Anti-LKM1 serum inhibited both dextromethorphan and 3-methoxymorphinan O-demethylations in a titre-dependent manner. 3. The Michaelis-Menten constant for dextromethorphan N-demethylation to 3-methoxymorphinan (Km 632-977 microM) and dextrorphan N-demethylation to 3-hydroxymorphinan (Km 1571-4286 microM) did not differ between EM and PM microsomes. These N-demethylation reactions were not inhibited by quinidine and rac-methadone or LKM1 antibodies. 4. Dextromethorphan and 3-methoxymorphinan are metabolised by the same P450 isoform, CYP2D6, whereas the N-demethylation reactions are not carried out by CYP2D6. PMID:7826826
Manzar, Gohar S; Kim, Eun-Mi; Zavazava, Nicholas
2017-08-25
Type 1 diabetes (T1D) can be managed by transplanting either the whole pancreas or isolated pancreatic islets. However, cadaveric pancreas is scarcely available for clinical use, limiting this approach. As such, there is a great need to identify alternative sources of clinically usable pancreatic tissues. Here, we used induced pluripotent stem (iPS) cells derived from patients with T1D to generate glucose-responsive, insulin-producing cells (IPCs) via 3D culture. Initially, T1D iPS cells were resistant to differentiation, but transient demethylation treatment significantly enhanced IPC yield. The cells responded to high-glucose stimulation by secreting insulin in vitro The shape, size, and number of their granules, as observed by transmission electron microscopy, were identical to those found in cadaveric β cells. When the IPCs were transplanted into immunodeficient mice that had developed streptozotocin-induced diabetes, they promoted a dramatic decrease in hyperglycemia, causing the mice to become normoglycemic within 28 days. None of the mice died or developed teratomas. Because the cells are derived from "self," immunosuppression is not required, providing a much safer and reliable treatment option for T1D patients. Moreover, these cells can be used for drug screening, thereby accelerating drug discovery. In conclusion, our approach eliminates the need for cadaveric pancreatic tissue.
International Nuclear Information System (INIS)
Noetzel, Erik; Veeck, Jürgen; Niederacher, Dieter; Galm, Oliver; Horn, Felicitas; Hartmann, Arndt; Knüchel, Ruth; Dahl, Edgar
2008-01-01
Inhibitor of DNA binding/Inhibitor of differentiation 4 (ID4) is a critical factor for cell proliferation and differentiation in normal vertebrate development. ID4 has regulative functions for differentiation and growth of the developing brain. The role of ID1, ID2 and ID3 are expected to be oncogenic due to their overexpression in pancreatic cancer and colorectal adenocarcinomas, respectively. Aside from these findings, loss of ID3 expression was demonstrated in ovarian cancer. The aim of the present study was to reveal the factual role of ID4 in carcinogenesis in more detail, since its role for the pathogenesis of human breast cancer has been discussed controversially, assigning both oncogenic and tumour suppressive functions. ID4 promoter methylation, ID4 mRNA expression and ID4 protein expression were analysed in primary human breast cancer specimens using methylation-specific PCR (MSP) (n=170), semiquantitative realtime RT-PCR (n=46) and immunhistochemistry (n=3), respectively. In order to demonstrate a functional association of ID4 promoter methylation with its gene silencing, we performed DNA demethylation analysis with four human breast cell lines using MSP and semiquantitative realtime RT-PCR. In addition, we performed correlations of ID4 promoter methylation with ID4 mRNA and ID4 protein expression in matched samples of breast tumour and corresponding normal tissue. We carried out statistical analyses in order to find correlations between ID4 promoter methylation and clinicopathological parameters. Frequent ID4 promoter methylation was observed in primary breast cancer samples (69%, 117/170). We found a tight correlation (P<0.0001) between ID4 promoter methylation and loss of ID4 expression in primary breast cancer 3 specimens. Demethylating treatment with breast cancer cell lines was associated with clear ID4 mRNA re-expression. Tumours with ID4 promoter methylation showed distinct loss of ID4 expression on both transcription and protein level
Promoter2.0: for the recognition of PolII promoter sequences
DEFF Research Database (Denmark)
Knudsen, Steen; Knudsen, Steen
1999-01-01
transcription start sites. On standardized test setsconsisting of human genomic DNA, the performance of Promoter2.0 compares well with other softwaredeveloped for the same purpose. Availability : Promoter2.0 is available as a Web server at http://www.cbs.dtu.dk/services/promoter/ Contact : steen@cbs.dtu.dk...
Energy Technology Data Exchange (ETDEWEB)
Zhang, Heyu [Central Laboratory, Peking University School of Stomatology, Beijing (China); Nan, Xu [Center for Human Disease Genomics, Department of Immunology, Key Laboratory of Medical Immunology, Ministry of Health, School of Basic Medical Sciences, Peking University, Beijing (China); Li, Xuefen [Central Laboratory, Peking University School of Stomatology, Beijing (China); Chen, Yan; Zhang, Jianyun [Department of Oral Pathology, Peking University School of Stomatology, Beijing (China); Sun, Lisha [Central Laboratory, Peking University School of Stomatology, Beijing (China); Han, Wenlin [Center for Human Disease Genomics, Department of Immunology, Key Laboratory of Medical Immunology, Ministry of Health, School of Basic Medical Sciences, Peking University, Beijing (China); Li, Tiejun, E-mail: litiejun22@vip.sina.com [Department of Oral Pathology, Peking University School of Stomatology, Beijing (China)
2014-05-02
Highlights: • Down-regulation of CMTM5 expression in OSCC tissues was found. • The promoter methylation status of CMTM5 was measured. • CMTM5-v1 inhibited cell proliferation and migration and induced apoptosis. • CMTM5 might act as a putative tumor suppressor gene in OSCC. - Abstract: Oral squamous cell carcinoma (OSCC) is one of the most common types of malignancies in the head and neck region. CKLF-like MARVEL transmembrane domain-containing member 5 (CMTM5) has been recently implicated as a tumor suppressor gene in several cancer types. Herein, we examined the expression and function of CMTM5 in oral squamous cell carcinoma. CMTM5 was down-regulated in oral squamous cell lines and tumor samples from patients with promoter methylation. Treatment with the demethylating agent 5-aza-2′-deoxycytidine restored CMTM5 expression. In the OSCC cell lines CAL27 and GNM, the ectopic expression of CMTM5-v1 strongly inhibited cell proliferation and migration and induced apoptosis. In addition, CMTM5-v1 inhibited tumor formation in vivo. Therefore, CMTM5 might act as a putative tumor suppressor gene through promoter methylation in oral squamous cell carcinoma.
International Nuclear Information System (INIS)
Zhang, Heyu; Nan, Xu; Li, Xuefen; Chen, Yan; Zhang, Jianyun; Sun, Lisha; Han, Wenlin; Li, Tiejun
2014-01-01
Highlights: • Down-regulation of CMTM5 expression in OSCC tissues was found. • The promoter methylation status of CMTM5 was measured. • CMTM5-v1 inhibited cell proliferation and migration and induced apoptosis. • CMTM5 might act as a putative tumor suppressor gene in OSCC. - Abstract: Oral squamous cell carcinoma (OSCC) is one of the most common types of malignancies in the head and neck region. CKLF-like MARVEL transmembrane domain-containing member 5 (CMTM5) has been recently implicated as a tumor suppressor gene in several cancer types. Herein, we examined the expression and function of CMTM5 in oral squamous cell carcinoma. CMTM5 was down-regulated in oral squamous cell lines and tumor samples from patients with promoter methylation. Treatment with the demethylating agent 5-aza-2′-deoxycytidine restored CMTM5 expression. In the OSCC cell lines CAL27 and GNM, the ectopic expression of CMTM5-v1 strongly inhibited cell proliferation and migration and induced apoptosis. In addition, CMTM5-v1 inhibited tumor formation in vivo. Therefore, CMTM5 might act as a putative tumor suppressor gene through promoter methylation in oral squamous cell carcinoma
Saluz, H P; Feavers, I M; Jiricny, J; Jost, J P
1988-01-01
Genomic sequencing was used to study the in vivo methylation pattern of two CpG sites in the promoter region of the avian vitellogenin gene. The CpG at position +10 was fully methylated in DNA isolated from tissues that do not express the gene but was unmethylated in the liver of mature hens and estradiol-treated roosters. In the latter tissue, this site became demethylated and DNase I hypersensitive after estradiol treatment. A second CpG (position -52) was unmethylated in all tissues examined. In vivo genomic footprinting with dimethyl sulfate revealed different patterns of DNA protection in silent and expressed genes. In rooster liver cells, at least 10 base pairs of DNA, including the methylated CpG, were protected by protein(s). Gel-shift assays indicated that a protein factor, present in rooster liver nuclear extract, bound at this site only when it was methylated. In hen liver cells, the same unmethylated CpG lies within a protected region of approximately equal to 20 base pairs. In vitro DNase I protection and gel-shift assays indicate that this sequence is bound by a protein, which binds both double- and single-stranded DNA. For the latter substrate, this factor was shown to bind solely the noncoding (i.e., mRNA-like) strand. Images PMID:3413118
Park, Jin-Sup; Frost, Jennifer M; Park, Kyunghyuk; Ohr, Hyonhwa; Park, Guen Tae; Kim, Seohyun; Eom, Hyunjoo; Lee, Ilha; Brooks, Janie S; Fischer, Robert L; Choi, Yeonhee
2017-02-21
The DEMETER (DME) DNA glycosylase initiates active DNA demethylation via the base-excision repair pathway and is vital for reproduction in Arabidopsis thaliana DME-mediated DNA demethylation is preferentially targeted to small, AT-rich, and nucleosome-depleted euchromatic transposable elements, influencing expression of adjacent genes and leading to imprinting in the endosperm. In the female gametophyte, DME expression and subsequent genome-wide DNA demethylation are confined to the companion cell of the egg, the central cell. Here, we show that, in the male gametophyte, DME expression is limited to the companion cell of sperm, the vegetative cell, and to a narrow window of time: immediately after separation of the companion cell lineage from the germline. We define transcriptional regulatory elements of DME using reporter genes, showing that a small region, which surprisingly lies within the DME gene, controls its expression in male and female companion cells. DME expression from this minimal promoter is sufficient to rescue seed abortion and the aberrant DNA methylome associated with the null dme-2 mutation. Within this minimal promoter, we found short, conserved enhancer sequences necessary for the transcriptional activities of DME and combined predicted binding motifs with published transcription factor binding coordinates to produce a list of candidate upstream pathway members in the genetic circuitry controlling DNA demethylation in gamete companion cells. These data show how DNA demethylation is regulated to facilitate endosperm gene imprinting and potential transgenerational epigenetic regulation, without subjecting the germline to potentially deleterious transposable element demethylation.
DNA demethylation activates genes in seed maternal integument development in rice (Oryza sativa L.).
Wang, Yifeng; Lin, Haiyan; Tong, Xiaohong; Hou, Yuxuan; Chang, Yuxiao; Zhang, Jian
2017-11-01
DNA methylation is an important epigenetic modification that regulates various plant developmental processes. Rice seed integument determines the seed size. However, the role of DNA methylation in its development remains largely unknown. Here, we report the first dynamic DNA methylomic profiling of rice maternal integument before and after pollination by using a whole-genome bisulfite deep sequencing approach. Analysis of DNA methylation patterns identified 4238 differentially methylated regions underpin 4112 differentially methylated genes, including GW2, DEP1, RGB1 and numerous other regulators participated in maternal integument development. Bisulfite sanger sequencing and qRT-PCR of six differentially methylated genes revealed extensive occurrence of DNA hypomethylation triggered by double fertilization at IAP compared with IBP, suggesting that DNA demethylation might be a key mechanism to activate numerous maternal controlling genes. These results presented here not only greatly expanded the rice methylome dataset, but also shed novel insight into the regulatory roles of DNA methylation in rice seed maternal integument development. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Meclofenamic acid selectively inhibits FTO demethylation of m6A over ALKBH5
Huang, Yue; Yan, Jingli; Li, Qi; Li, Jiafei; Gong, Shouzhe; Zhou, Hu; Gan, Jianhua; Jiang, Hualiang; Jia, Gui-Fang; Luo, Cheng; Yang, Cai-Guang
2015-01-01
Two human demethylases, the fat mass and obesity-associated (FTO) enzyme and ALKBH5, oxidatively demethylate abundant N6-methyladenosine (m6A) residues in mRNA. Achieving a method for selective inhibition of FTO over ALKBH5 remains a challenge, however. Here, we have identified meclofenamic acid (MA) as a highly selective inhibitor of FTO. MA is a non-steroidal, anti-inflammatory drug that mechanistic studies indicate competes with FTO binding for the m6A-containing nucleic acid. The structure of FTO/MA has revealed much about the inhibitory function of FTO. Our newfound understanding, revealed herein, of the part of the nucleotide recognition lid (NRL) in FTO, for example, has helped elucidate the principles behind the selectivity of FTO over ALKBH5. Treatment of HeLa cells with the ethyl ester form of MA (MA2) has led to elevated levels of m6A modification in mRNA. Our collective results highlight the development of functional probes of the FTO enzyme that will (i) enable future biological studies and (ii) pave the way for the rational design of potent and specific inhibitors of FTO for use in medicine. PMID:25452335
Osteoponin Promoter Controlled by DNA Methylation: Aberrant Methylation in Cloned Porcine Genome
Directory of Open Access Journals (Sweden)
Chih-Jie Shen
2014-01-01
Full Text Available Cloned animals usually exhibited many defects in physical characteristics or aberrant epigenetic reprogramming, especially in some important organ development. Osteoponin (OPN is an extracellular-matrix protein involved in heart and bone development and diseases. In this study, we investigated the correlation between OPN mRNA and its promoter methylation changes by the 5-aza-dc treatment in fibroblast cell and promoter assay. Aberrant methylation of porcine OPN was frequently found in different tissues of somatic nuclear transferred cloning pigs, and bisulfite sequence data suggested that the OPN promoter region −2615 to −2239 nucleotides (nt may be a crucial regulation DNA element. In pig ear fibroblast cell culture study, the demethylation of OPN promoter was found in dose-dependent response of 5-aza-dc treatment and followed the OPN mRNA reexpression. In cloned pig study, discrepant expression pattern was identified in several cloned pig tissues, especially in brain, heart, and ear. Promoter assay data revealed that four methylated CpG sites presenting in the −2615 to −2239 nt region cause significant downregulation of OPN promoter activity. These data suggested that methylation in the OPN promoter plays a crucial role in the regulation of OPN expression that we found in cloned pigs genome.
Genomic imprinting of IGF2 in marsupials is methylation dependent
Directory of Open Access Journals (Sweden)
Imumorin Ikhide
2008-05-01
Full Text Available Abstract Background- Parent-specific methylation of specific CpG residues is critical to imprinting in eutherian mammals, but its importance to imprinting in marsupials and, thus, the evolutionary origins of the imprinting mechanism have been the subject of controversy. This has been particularly true for the imprinted Insulin-like Growth Factor II (IGF2, a key regulator of embryonic growth in vertebrates and a focal point of the selective forces leading to genomic imprinting. The presence of the essential imprinting effector, DNMT3L, in marsupial genomes and the demonstration of a differentially methylated region (DMR in the retrotransposon-derived imprinted gene, PEG10, in tammar wallaby argue for a role for methylation in imprinting, but several studies have found no evidence of parent-specific methylation at other imprinted loci in marsupials. Results- We performed the most extensive search to date for allele-specific patterns of CpG methylation within CpG isochores or CpG enriched segments across a 22 kilobase region surrounding the IGF2 gene in the South American opossum Monodelphis domestica. We identified a previously unknown 5'-untranslated exon for opossum IGF2, which is flanked by sequences defining a putative neonatal promoter, a DMR and an active Matrix Attachment Region (MAR. Demethylation of this DMR in opossum neonatal fibroblasts results in abherrant biallelic expression of IGF2. Conclusion- The demonstration of a DMR and an active MAR in the 5' flank of opossum IGF2 mirrors the regulatory features of the 5' flank of Igf2 in mice. However, demethylation induced activation of the maternal allele of IGF2 in opossum differs from the demethylation induced repression of the paternal Igf2 allele in mice. While it can now be concluded that parent-specific DNA methylation is an epigentic mark common to Marsupialia and Eutheria, the molecular mechanisms of transcriptional silencing at imprinted loci have clearly evolved along independent
Muscle Contraction Induces Acute Hydroxymethylation of the Exercise-Responsive Gene Nr4a3
DEFF Research Database (Denmark)
Pattamaprapanont, Pattarawan; Garde, Christian; Fabre, Odile
2016-01-01
stimulated over time is required to determine whether contraction-induced demethylation is preceded by changes in the hydroxymethylcytosine level. Here, we established an acute skeletal muscle contraction model to mimic the effects of acute exercise on gene expression. We used this model to investigate...... promoters. Exercise induces dynamic DNA demethylation at gene promoters; however, the contribution of the demethylation precursor hydroxymethylcytosine is unknown. Given the evanescent nature of hydroxymethylcytosine, a muscle contraction model that allows for the collection of samples that are repeatedly...... the effect of muscle contraction on DNA demethylation and hydroxymethylation. First, we performed an acute exercise study in healthy humans to identify an exercise-responsive gene that we could study in culture. We identified the nuclear receptor subfamily 4 group A member 3 (Nr4a3) gene with the highest...
Melanocortin 1 Receptor Deficiency Promotes Atherosclerosis in Apolipoprotein E-/- Mice.
Rinne, Petteri; Kadiri, James J; Velasco-Delgado, Mauricio; Nuutinen, Salla; Viitala, Miro; Hollmén, Maija; Rami, Martina; Savontaus, Eriika; Steffens, Sabine
2018-02-01
The MC1-R (melanocortin 1 receptor) is expressed by monocytes and macrophages where it mediates anti-inflammatory actions. MC1-R also protects against macrophage foam cell formation primarily by promoting cholesterol efflux through the ABCA1 (ATP-binding cassette transporter subfamily A member 1) and ABCG1 (ATP-binding cassette transporter subfamily G member 1). In this study, we aimed to investigate whether global deficiency in MC1-R signaling affects the development of atherosclerosis. Apoe -/- (apolipoprotein E deficient) mice were crossed with recessive yellow (Mc1r e/e ) mice carrying dysfunctional MC1-R and fed a high-fat diet to induce atherosclerosis. Apoe -/- Mc1r e/e mice developed significantly larger atherosclerotic lesions in the aortic sinus and in the whole aorta compared with Apoe -/- controls. In terms of plaque composition, MC1-R deficiency was associated with less collagen and smooth muscle cells and increased necrotic core, indicative of more vulnerable lesions. These changes were accompanied by reduced Abca1 and Abcg1 expression in the aorta. Furthermore, Apoe -/- Mc1r e/e mice showed a defect in bile acid metabolism that aggravated high-fat diet-induced hypercholesterolemia and hepatic lipid accumulation. Flow cytometric analysis of leukocyte profile revealed that dysfunctional MC1-R enhanced arterial accumulation of classical Ly6C high monocytes and macrophages, effects that were evident in mice fed a normal chow diet but not under high-fat diet conditions. In support of enhanced arterial recruitment of Ly6C high monocytes, these cells had increased expression of L-selectin and P-selectin glycoprotein ligand 1. The present study highlights the importance of MC1-R in the development of atherosclerosis. Deficiency in MC1-R signaling exacerbates atherosclerosis by disturbing cholesterol handling and by increasing arterial monocyte accumulation. © 2017 The Authors.
Caffeine demethylation measured by breath analysis in experimental liver injury in the rat
Energy Technology Data Exchange (ETDEWEB)
Schaad, H.J.; Renner, E.L.; Wietholtz, H.; Preisig, R. [University of Berne, Department of Clinical Pharmaceology, Berne (Switzerland); Arnaud, M.J. [Nestle Research Center, Nestec Ltd., Vevey (Switzerland)
1995-01-01
To assess the effect of experimental liver injury on caffeine metabolism, 1 {mu}{sup C}i/kg b.w. of [3-methyl{sup 14}C]-caffeine (together with 5 mg/kg b.w. of the cold compound) was injected i.p. to four different experimental groups and respective controls of unanesthetized male Sprague-Dawley rats. Exhaled {sup 14}CO{sub 2} was completely collected during 4 h and peak exhalation rate and fraction of dose recovered were calculated. 1/3 hepatectomy affected {sup 14}CO{sub 2} exhalation to a limited extent, decreasing solely peak exhalation rate (p<0.05 compared to sham-operated control). 2/3 hepatectomy, on the other hand, resulted in significant reduction (p<0.01) in both peak exhalation rate (by 59%) and fraction of dose recovered (by 47%), that were proportionate to the loss of liver mass (50%). End-to-side portocaval shunt led to the well-documented hepatic `atrophy`, liver weight being diminished on average to 50% within 2 weeks of surgery; however, reductions in peak exhalation rate (by 75%) and fraction of dose recovered (by 64%) were even more pronounced. Finally, 48 h bile duct ligation was equivalent to `functional 2/3 hepatectomy`, peak exhalation rate (by 65%) and fraction of dose recovered (by 56%) being markedly diminished despite increased liver weight. These results indicate that {sup 14}CO{sub 2} exhalation curves following administration of specifically labelled caffeine are quantitative indicators of acute or chronic loss of functioning liver mass. In addition, the 3-demethylation pathway appears to be particularly sensitive to the inhibitory effects of cholestasis on microsomal function. (au) (30 refs.).
Energy Technology Data Exchange (ETDEWEB)
Patties, Ina; Jahns, Jutta; Kortmann, Rolf-Dieter; Glasow, Annegret [Dept. of Radiotherapy and Radiooncology, Universitaetsklinikum Leipzig AoeR (Germany); Hildebrandt, Guido [Dept. of Radiotherapy and Radiooncology, Universitaetsklinikum Leipzig AoeR (Germany); Dept. of Radiotherapy, Univ. of Rostock (Germany)
2009-05-15
Background and purpose: in recent years, epigenetic modulators were introduced into tumor therapy. Here, the authors investigated the antitumor effect of 5-aza-2'-deoxycytidine-(5-aza-dC-)induced demethylation combined with irradiation on human medulloblastoma (MB) cells, which form the most common malignant brain tumor in children. Material and methods: three MB cell lines were treated with 5-aza-dC in a low-dose (0.1 {mu}M, 6 days) or high-dose (3/5 {mu}M, 3 days) setting and irradiated with 2, 4, 6, or 8 Gy single dose on an X-ray unit. Methylation status and mRNA expression of three candidate genes were analyzed by methylation-specific PCR (polymerase chain reaction) and quantitative real-time RT-PCR. Cell survival and mortality were determined by trypan blue exclusion test. Proliferation was analyzed by BrdU incorporation assay, and long-term cell survival was assessed by clonogenic assay. Results: 5-aza-dC treatment resulted in partial promoter demethylation and increased expression of hypermethylated candidate genes. A significant decrease of vital cell count, proliferation inhibition and increase of mortality was observed in 5-aza-dC-treated as well as in irradiated MB cells, whereby combination of both treatments led to additive effects. Although high-dose 5-aza-dC treatment was more effective in terms of demethylation, clonogenic assay revealed no differences between high- and low-dose settings indicating no relevance of 5-aza-dC-induced demethylation for decreased cell survival. MB cells pretreated with 5-aza-dC showed significantly lower plating efficiencies than untreated cells at all irradiation doses investigated. Analysis of surviving curves in irradiated MB cells, however, revealed no significant differences of {alpha}-, {beta}-values and 2-Gy surviving fraction with or without 5-aza-dC treatment. Conclusion: 5-aza-dC did not enhance radiation sensitivity of MB cells but significantly reduced the clonogenicity versus irradiation alone, which
Baksh, Aron; Kepplinger, Bernhard; Isah, Hadiza A; Probert, Michael R; Clegg, William; Wills, Corinne; Goodfellow, Michael; Errington, Jeff; Allenby, Nick; Hall, Michael J
2017-08-01
The actinomycete DEM20745, collected from non-rhizosphere soil adjacent to Paraserianthes falactaria trees (Cangkringan, Indonesia), is an efficient producer of the anticancer ansamycin polyketide 17-O-demethyl-geldanamycin (17-O-DMG), a biosynthetic precursor of the Hsp90 inhibitor geldanamycin (GDM). In DEM20745, 17-O-DMG is the major ansamycin product observed reaching a maximum titre of 17 mg/L in the fermentation broth. 17-O-DMG has the potential to be a key starting material for the semi-synthesis of GDM analogues for use in anticancer therapy. Thus, this preferential biosynthesis of 17-O-DMG facilitates easy access to this important molecule and provides further insight in the biosynthesis of the geldanamycins.
Directory of Open Access Journals (Sweden)
Isabela T Pereira
Full Text Available Metastasis accounts for more than 90% of cancer deaths. Cells from primary solid tumors may invade adjacent tissues and migrate to distant sites where they establish new colonies. The tumor microenvironment is now recognized as an important participant in the signaling that induces cancer cell migration. An essential process for metastasis is extracellular matrix (ECM degradation by metalloproteases (MMPs, which allows tumor cells to invade local tissues and to reach blood vessels. The members of this protein family include gelatinase A, or MMP-2, which is responsible for the degradation of type IV collagen, the most abundant component of the basal membrane, that separates epithelial cells in the stroma. It is known that fibronectin is capable of promoting the expression of MMP-2 in MCF7 breast cancer cells in culture. In addition, it was already shown that the MMP2 gene expression is regulated by epigenetic mechanisms. In this work, we showed that fibronectin was able to induce MMP2 expression by 30% decrease in its promoter methylation. In addition, a histone marker for an open chromatin conformation was significantly increased. These results indicate a new role for fibronectin in the communication between cancer cells and the ECM, promoting epigenetic modifications.
Epigenetics Reactivation of Nrf2 in Prostate TRAMP C1 Cells by Curcumin Analogue FN1.
Li, Wenji; Pung, Doug; Su, Zheng-Yuan; Guo, Yue; Zhang, Chengyue; Yang, Anne Yuqing; Zheng, Xi; Du, Zhi-Yun; Zhang, Kun; Kong, Ah-Ng
2016-04-18
It has previously been shown that curcumin can effectively inhibit prostate cancer proliferation and progression in TRAMP mice, potentially acting through the hypomethylation of the Nrf2 gene promoter and hence activation of the Nrf2 pathway to enhance cell antioxidative defense. FN1 is a synthetic curcumin analogue that shows stronger anticancer activity than curcumin in other reports. We aimed to explore the epigenetic modification of FN1 that restores Nrf2 expression in TRAMP-C1 cells. Stably transfected HepG2-C8 cells were used to investigate the effect of FN1 on the Nrf2- antioxidant response element (ARE) pathway. Real-time quantitative PCR and Western blotting were applied to study the influence of FN1 on endogenous Nrf2 and its downstream genes. Bisulfite genomic sequencing (BGS) and methylated DNA immunoprecipitation (MeDIP) were then performed to examine the methylation profile of the Nrf2 promoter. An anchorage-independent colony-formation analysis was conducted to examine the tumor inhibition activity of FN1. Epigenetic modification enzymes, including DNMTs and HDACs, were investigated by Western blotting. The luciferase reporter assay indicated that FN1 was more potent than curcumin in activating the Nrf2-ARE pathway. FN1 increased the expression of Nrf2 and its downstream detoxifying enzymes. FN1 significantly inhibited the colony formation of TRAMP-C1 cells. BGS and MeDIP assays revealed that FN1 treatment (250 nM for 3 days) reduced the percentage of CpG methylation of the Nrf2 promoter. FN1 also downregulated epigenetic modification enzymes. In conclusion, our results suggest that FN1 is a novel anticancer agent for prostate cancer. In the TRAMP-C1 cell line, FN1 can increase the level of Nrf2 and downstream genes via activating the Nrf2-ARE pathway and inhibit the colony formation potentially through the decreased expression of keap1 coupled with CpG demethylation of the Nrf2 promoter. This CpG demethylation effect may come from decreased
Schulte, Simone Laura; Waha, Andreas; Steiger, Barbara; Denkhaus, Dorota; Dörner, Evelyn; Calaminus, Gabriele; Leuschner, Ivo; Pietsch, Torsten
2016-01-01
CNS germinomas represent a unique germ cell tumor entity characterized by undifferentiated tumor cells and a high response rate to current treatment protocols. Limited information is available on their underlying genomic, epigenetic and biological alterations. We performed a genome-wide analysis of genomic copy number alterations in 49 CNS germinomas by molecular inversion profiling. In addition, CpG dinucleotide methylation was studied by immunohistochemistry for methylated cytosine residues. Mutational analysis was performed by resequencing of candidate genes including KIT and RAS family members. Ras/Erk and Akt pathway activation was analyzed by immunostaining with antibodies against phospho-Erk, phosho-Akt, phospho-mTOR and phospho-S6. All germinomas coexpressed Oct4 and Kit but showed an extensive global DNA demethylation compared to other tumors and normal tissues. Molecular inversion profiling showed predominant genomic instability in all tumors with a high frequency of regional gains and losses including high level gene amplifications. Activating mutations of KIT exons 11, 13, and 17 as well as a case with genomic KIT amplification and activating mutations or amplifications of RAS gene family members including KRAS, NRAS and RRAS2 indicated mutational activation of crucial signaling pathways. Co-activation of Ras/Erk and Akt pathways was present in 83% of germinomas. These data suggest that CNS germinoma cells display a demethylated nuclear DNA similar to primordial germ cells in early development. This finding has a striking coincidence with extensive genomic instability. In addition, mutational activation of Kit-, Ras/Raf/Erk- and Akt- pathways indicate the biological importance of these pathways and their components as potential targets for therapy. PMID:27391150
Directory of Open Access Journals (Sweden)
Wang Yifei
2004-09-01
Full Text Available Abstract Background Astrocytoma is a common aggressive intracranial tumor and presents a formidable challenge in the clinic. Association of altered DNA methylation patterns of the promoter CpG islands with the expression profile of cancer-related genes, has been found in many human tumors. Therefore, DNA methylation status as such may serve as an epigenetic biomarker for both diagnosis and prognosis of human tumors, including astrocytoma. Methods We used the methylation specific PCR in conjunction with sequencing verification to establish the methylation profile of the promoter CpG island of thirty four genes in astrocytoma tissues from fifty three patients (The WHO grading:. I: 14, II: 15, III: 12 and IV: 12 cases, respectively. In addition, compatible tissues (normal tissues distant from lesion from three non-astrocytoma patients were included as the control. Results Seventeen genes (ABL, APC, APAF1, BRCA1, CSPG2, DAPK1, hMLH1, LKB1, PTEN, p14ARF, p15INK4b, p27KIP1, p57KIP2, RASSF1C, RB1, SURVIVIN, and VHL displayed a uniformly unmethylated pattern in all the astrocytoma and non-astrocytoma tissues examined. However, the MAGEA1 gene that was inactivated and hypermethylated in non-astrocytoma tissues, was partially demethylated in 24.5% of the astrocytoma tissues (co-existence of the hypermethylated and demethylated alleles. Of the astrocytoma associated hypermethylated genes, the methylation pattern of the CDH13, cyclin a1, DBCCR1, EPO, MYOD1, and p16INK4a genes changed in no more than 5.66% (3/53 of astrocytoma tissues compared to non-astrocytoma controls, while the RASSF1A, p73, AR, MGMT, CDH1, OCT6,, MT1A, WT1, and IRF7 genes were more frequently hypermethylated in 69.8%, 47.2%, 41.5%, 35.8%, 32%, 30.2%, 30.2%, 30.2% and 26.4% of astrocytoma tissues, respectively. Demethylation mediated inducible expression of the CDH13, MAGEA1, MGMT, p73 and RASSF1A genes was established in an astrocytoma cell line (U251, demonstrating that expression of
Hypomethylation and up-regulation of PD-1 in T cells by azacytidine in MDS/AML patients
DEFF Research Database (Denmark)
Ørskov, Andreas D; Treppendahl, Marianne B; Skovbo, Anni
2015-01-01
receptor PD-1 is regulated by DNA methylation. In 12 of 27 patients (44%) PD-1 promoter demethylation was observed in sorted peripheral blood T cells isolated over consecutive cycles of treatment with 5-azacytidine (5-aza). The PD-1 promoter demethylation correlated with an increase in PD-1 expression...... HMA treatment can be a possible resistance mechanism, which may be overcome by combination therapy with a PD-1 pathway inhibitor....
Gelston, Eloise A; Coller, Janet K; Lopatko, Olga V; James, Heather M; Schmidt, Helmut; White, Jason M; Somogyi, Andrew A
2012-01-01
AIMS To compare the O-demethylation (CYP2D6-mediated), N-demethylation (CYP3A4-mediated) and 6-glucuronidation (UGT2B4/7-mediated) metabolism of codeine between methadone- and buprenorphine-maintained CYP2D6 extensive metabolizer subjects. METHODS Ten methadone- and eight buprenorphine-maintained subjects received a single 60 mg dose of codeine phosphate. Blood was collected at 3 h and urine over 6 h and assayed for codeine, norcodeine, morphine, morphine-3- and -6-glucuronides and codeine-6-glucuronide. RESULTS The urinary metabolic ratio for O-demethylation was significantly higher (P = 0.0044) in the subjects taking methadone (mean ± SD, 2.8 ± 3.1) compared with those taking buprenorphine (0.60 ± 0.43), likewise for 6-glucuronide formation (0.31 ± 0.24 vs. 0.053 ± 0.027; P D6 and UGTs 2B4 and 2B7 reactions in vivo, even though it is not a substrate for these enzymes. Plasma morphine was not altered, owing to the opposing effects of inhibition of both formation and elimination; however, morphine-6-glucuronide (analgesically active) concentrations were substantially reduced. Drug interactions with methadone are likely to include drugs metabolized by various UGTs and CYP2D6. PMID:22092298
Kitagishi, Hiroaki; Kurosawa, Shun; Kano, Koji
2016-11-22
The intramolecular oxidation of ROCH 3 to ROCH 2 OH, where the latter compound spontaneously decomposed to ROH and HCHO, was observed during the reaction of the supramolecular complex (met-hemoCD3) with cumene hydroperoxide in aqueous solution. Met-hemoCD3 is composed of meso-tetrakis(4-sulfonatophenyl)porphinatoiron(III) (Fe III TPPS) and a per-O-methylated β-cyclodextrin dimer having an -OCH 2 PyCH 2 O- linker (Py=pyridine-3,5-diyl). The O=Fe IV TPPS complex was formed by the reaction of met-hemoCD3 with cumene hydroperoxide, and isolated by gel-filtration chromatography. Although the isolated O=Fe IV TPPS complex in the cyclodextrin cage was stable in aqueous solution at 25 °C, it was gradually converted to Fe II TPPS (t 1/2 =7.6 h). This conversion was accompanied by oxidative O-demethylation of an OCH 3 group in the cyclodextrin dimer. The results indicated that hydrogen abstraction by O=Fe IV TPPS from ROCH 3 yields HO-Fe III TPPS and ROCH 2 . . This was followed by radical coupling to afford Fe II TPPS and ROCH 2 OH. The hemiacetal (ROCH 2 OH) immediately decomposed to ROH and HCHO. This study revealed the ability of oxoferryl porphyrin to induce two-electron oxidation. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
ABC transporter genes and risk of type 2 diabetes
DEFF Research Database (Denmark)
Schou, Jesper; Tybjærg-Hansen, Anne; Møller, Holger J
2012-01-01
of both genes, were genotyped in the Copenhagen City Heart Study (CCHS) (n = 10,185). Two loss-of-function mutations (ABCA1 N1800H and ABCG1 g.-376C>T) (n = 322) and a common variant (ABCG1 g.-530A>G) were further genotyped in the Copenhagen General Population Study (CGPS) (n = 30,415). RESULTS: Only one...
Frequent down-regulation of ABC transporter genes in prostate cancer.
Demidenko, Rita; Razanauskas, Deividas; Daniunaite, Kristina; Lazutka, Juozas Rimantas; Jankevicius, Feliksas; Jarmalaite, Sonata
2015-10-12
ATP-binding cassette (ABC) transporters are transmembrane proteins responsible for the efflux of a wide variety of substrates, including steroid metabolites, through the cellular membranes. For better characterization of the role of ABC transporters in prostate cancer (PCa) development, the profile of ABC transporter gene expression was analyzed in PCa and noncancerous prostate tissues (NPT). TaqMan Low Density Array (TLDA) human ABC transporter plates were used for the gene expression profiling in 10 PCa and 6 NPT specimens. ABCB1 transcript level was evaluated in a larger set of PCa cases (N = 78) and NPT (N = 15) by real-time PCR, the same PCa cases were assessed for the gene promoter hypermethylation by methylation-specific PCR. Expression of eight ABC transporter genes (ABCA8, ABCB1, ABCC6, ABCC9, ABCC10, ABCD2, ABCG2, and ABCG4) was significantly down-regulated in PCa as compared to NPT, and only two genes (ABCC4 and ABCG1) were up-regulated. Down-regulation of ABC transporter genes was prevalent in the TMPRSS2-ERG-negative cases. A detailed analysis of ABCB1 expression confirmed TLDA results: a reduced level of the transcript was identified in PCa in comparison to NPT (p = 0.048). Moreover, the TMPRSS2-ERG-negative PCa cases showed significantly lower expression of ABCB1 in comparison to NPT (p = 0.003) or the fusion-positive tumors (p = 0.002). Promoter methylation of ABCB1 predominantly occurred in PCa and was rarely detected in NPT (p ABC transporter genes in PCa, especially in the TMPRSS2-ERG-negative tumors.
Rodríguez-Cortez, Virginia C.; del Pino-Molina, Lucia; Rodríguez-Ubreva, Javier; Ciudad, Laura; Gómez-Cabrero, David; Company, Carlos; Urquiza, José M.; Tegnér, Jesper; Rodríguez-Gallego, Carlos; López-Granados, Eduardo; Ballestar, Esteban
2015-01-01
Common variable immunodeficiency (CVID), the most frequent primary immunodeficiency characterized by loss of B-cell function, depends partly on genetic defects, and epigenetic changes are thought to contribute to its aetiology. Here we perform a high-throughput DNA methylation analysis of this disorder using a pair of CVID-discordant MZ twins and show predominant gain of DNA methylation in CVID B cells with respect to those from the healthy sibling in critical B lymphocyte genes, such as PIK3CD, BCL2L1, RPS6KB2, TCF3 and KCNN4. Individual analysis confirms hypermethylation of these genes. Analysis in naive, unswitched and switched memory B cells in a CVID patient cohort shows impaired ability to demethylate and upregulate these genes in transitioning from naive to memory cells in CVID. Our results not only indicate a role for epigenetic alterations in CVID but also identify relevant DNA methylation changes in B cells that could explain the clinical manifestations of CVID individuals. PMID:26081581
Alivand, Mohammad Reza; Sabouni, Farzaneh; Soheili, Zahra-Soheila
2016-09-01
To survey the changes of promoter CpG methylation status and mRNA expression of IL17RC (interleukin 17 receptor C) gene in retinal pigment epithelium (RPE) cells under chemical hypoxia condition for choroidal neovascularization (CNV) modeling in vitro. RPE cells were cultured in both untreated as a control group and treated by cobalt chloride media as a hypoxia group for various concentrations (100-150μM) and times (24-36 hrs.) To confirm chemical hypoxia condition, mRNA expression of HIF (Hypoxia Inducible Factor) -1α, -2α, and Vascular Endothelial Growth Factor (VEGF) was compared between two groups by Real-time PCR. Also, in normoxia and hypoxia conditions, IL17RC expression changes and promoter CpG methylation status were evaluated by Real-time PCR and methylation-specific PCR (MSP) techniques, respectively. Overexpression of HIF-1α, HIF-2α, and VEGF was significant in hypoxia versus normoxia conditions. Our data showed overexpression of IL17RC (2.1- to 6.3-fold) and decreasing of its promoter methylation in comparison with hypoxia and normoxia conditions. It was found that there are significant association between promoter methylation status and expression of IL17RC in chemical hypoxia condition. Therefore, methylation of IL17RC could play as a marker in CNV and degeneration of RPE cells in vitro. Additionally, HIF-α and methylation phenomena may be considered as critical targets for blocking in angiogenesis of age-related degeneration in future studies.
22 CFR 101.2 - Promotion of American interests.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Promotion of American interests. 101.2 Section... FUNCTIONS § 101.2 Promotion of American interests. Officers of the Foreign Service shall further the.... (g) By taking appropriate steps to facilitate the promotion of such import trade into the United...
Directory of Open Access Journals (Sweden)
Kiss Nimrod B
2012-09-01
Full Text Available Abstract Background In this study we aimed to quantify tumor suppressor gene (TSG promoter methylation densities levels in primary neuroblastoma tumors and cell lines. A subset of these TSGs is associated with a CpG island methylator phenotype (CIMP in other tumor types. Methods The study panel consisted of 38 primary tumors, 7 established cell lines and 4 healthy references. Promoter methylation was determined by bisulphate Pyrosequencing for 14 TSGs; and LINE-1 repeat element methylation was used as an indicator of global methylation levels. Results Overall mean TSG Z-scores were significantly increased in cases with adverse outcome, but were unrelated to global LINE-1 methylation. CIMP with hypermethylation of three or more gene promoters was observed in 6/38 tumors and 7/7 cell lines. Hypermethylation of one or more TSG (comprising TSGs BLU, CASP8, DCR2, CDH1, RASSF1A and RASSF2 was evident in 30/38 tumors. By contrast only very low levels of promoter methylation were recorded for APC, DAPK1, NORE1A, P14, P16, TP73, PTEN and RARB. Similar involvements of methylation instability were revealed between cell line models and neuroblastoma tumors. Separate analysis of two proposed CASP8 regulatory regions revealed frequent and significant involvement of CpG sites between exon 4 and 5, but modest involvement of the exon 1 region. Conclusions/significance The results highlight the involvement of TSG methylation instability in neuroblastoma tumors and cell lines using quantitative methods, support the use of DNA methylation analyses as a prognostic tool for this tumor type, and underscore the relevance of developing demethylating therapies for its treatment.
Energy Technology Data Exchange (ETDEWEB)
Toribio E, E
2005-07-01
The methylation of the DNA is an epigenetic modification that has an important paper in the regulation of the functionality of the genome of the organisms. It can be altered by demethylation processes, either natural or experimentally induced. The 5-azacytidine (Aza) is a compound that causes the demethylation of the DNA (dm-DNA), inducing with it, expression genic and increase in the frequency of the Sister Chromatid Exchange (SCE). The SCE is a genotoxicity indicator, caused by diverse mutagens and carcinogen. Since the biological meaning and the formation mechanism of this phenomenon has not been totally illustrious, the exploration of the relation between the dm-DNA and the induction of SCE, it could offer new knowledge to explain those queries. The purpose of this work was to study in cells of the mouse bone marrow In vivo, the effect of the Aza on the induction of SCE, based on two aspects: 1) dose answer and 2) the effectiveness of multiple exhibition. To six groups of three to five animals, they are administered Aza to dose of 5, 10, 15 or 20 mg/Kg of weight; in sharp or multiple form, previously to the bromodeoxyuridine supply and 24 h was sacrificed after this; 2 h after an injection with colchicine. Preparations of those metaphases were made, those which were dyed by means of a technique of fluorescence more Giemsa. It was observed that to sharp low dose, the Aza produced an increment in the frequency of SCE that although small it was proportional and statistically significant. To sharp and multiple high doses, the Aza doesn't cause additional increments of SCE, but if toxicity at cellular level and of individuals. It is concluded that a relationship exists between the dm-DNA and the induction of SCE. It is suggested that the total demethylation of the DNA causes 2 SCE/Cell in cells of the mouse bone marrow, or that the cytotoxicity prevents to evidence a bigger induction. (Author)
Energy Technology Data Exchange (ETDEWEB)
Toribio E, E
2005-07-01
The methylation of the DNA is an epigenetic modification that has an important paper in the regulation of the functionality of the genome of the organisms. It can be altered by demethylation processes, either natural or experimentally induced. The 5-azacytidine (Aza) is a compound that causes the demethylation of the DNA (dm-DNA), inducing with it, expression genic and increase in the frequency of the Sister Chromatid Exchange (SCE). The SCE is a genotoxicity indicator, caused by diverse mutagens and carcinogen. Since the biological meaning and the formation mechanism of this phenomenon has not been totally illustrious, the exploration of the relation between the dm-DNA and the induction of SCE, it could offer new knowledge to explain those queries. The purpose of this work was to study in cells of the mouse bone marrow In vivo, the effect of the Aza on the induction of SCE, based on two aspects: 1) dose answer and 2) the effectiveness of multiple exhibition. To six groups of three to five animals, they are administered Aza to dose of 5, 10, 15 or 20 mg/Kg of weight; in sharp or multiple form, previously to the bromodeoxyuridine supply and 24 h was sacrificed after this; 2 h after an injection with colchicine. Preparations of those metaphases were made, those which were dyed by means of a technique of fluorescence more Giemsa. It was observed that to sharp low dose, the Aza produced an increment in the frequency of SCE that although small it was proportional and statistically significant. To sharp and multiple high doses, the Aza doesn't cause additional increments of SCE, but if toxicity at cellular level and of individuals. It is concluded that a relationship exists between the dm-DNA and the induction of SCE. It is suggested that the total demethylation of the DNA causes 2 SCE/Cell in cells of the mouse bone marrow, or that the cytotoxicity prevents to evidence a bigger induction. (Author)
Berim, Anna; Gang, David R.
2013-01-01
Lipophilic flavonoids found in the Lamiaceae exhibit unusual 6- and 8-hydroxylations whose enzymatic basis is unknown. We show that crude protein extracts from peltate trichomes of sweet basil (Ocimum basilicum L.) cultivars readily hydroxylate position 6 of 7-O-methylated apigenin but not apigenin itself. The responsible protein was identified as a P450 monooxygenase from the CYP82 family, a family not previously reported to be involved in flavonoid metabolism. This enzyme prefers flavones but also accepts flavanones in vitro and requires a 5-hydroxyl in addition to a 7-methoxyl residue on the substrate. A peppermint (Mentha × piperita L.) homolog displayed identical substrate requirements, suggesting that early 7-O-methylation of flavones might be common in the Lamiaceae. This hypothesis is further substantiated by the pioneering discovery of 2-oxoglutarate-dependent flavone demethylase activity in basil, which explains the accumulation of 7-O-demethylated flavone nevadensin. PMID:23184958
Frequent down-regulation of ABC transporter genes in prostate cancer
International Nuclear Information System (INIS)
Demidenko, Rita; Razanauskas, Deividas; Daniunaite, Kristina; Lazutka, Juozas Rimantas; Jankevicius, Feliksas; Jarmalaite, Sonata
2015-01-01
ATP-binding cassette (ABC) transporters are transmembrane proteins responsible for the efflux of a wide variety of substrates, including steroid metabolites, through the cellular membranes. For better characterization of the role of ABC transporters in prostate cancer (PCa) development, the profile of ABC transporter gene expression was analyzed in PCa and noncancerous prostate tissues (NPT). TaqMan Low Density Array (TLDA) human ABC transporter plates were used for the gene expression profiling in 10 PCa and 6 NPT specimens. ABCB1 transcript level was evaluated in a larger set of PCa cases (N = 78) and NPT (N = 15) by real-time PCR, the same PCa cases were assessed for the gene promoter hypermethylation by methylation-specific PCR. Expression of eight ABC transporter genes (ABCA8, ABCB1, ABCC6, ABCC9, ABCC10, ABCD2, ABCG2, and ABCG4) was significantly down-regulated in PCa as compared to NPT, and only two genes (ABCC4 and ABCG1) were up-regulated. Down-regulation of ABC transporter genes was prevalent in the TMPRSS2-ERG-negative cases. A detailed analysis of ABCB1 expression confirmed TLDA results: a reduced level of the transcript was identified in PCa in comparison to NPT (p = 0.048). Moreover, the TMPRSS2-ERG-negative PCa cases showed significantly lower expression of ABCB1 in comparison to NPT (p = 0.003) or the fusion-positive tumors (p = 0.002). Promoter methylation of ABCB1 predominantly occurred in PCa and was rarely detected in NPT (p < 0.001). The study suggests frequent down-regulation of the ABC transporter genes in PCa, especially in the TMPRSS2-ERG-negative tumors. The online version of this article (doi:10.1186/s12885-015-1689-8) contains supplementary material, which is available to authorized users
Energy Technology Data Exchange (ETDEWEB)
Yu, Kyung Sook [Therapeutic Antibody Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon 305-806 (Korea, Republic of); Jo, Ji Yoon; Kim, Su Jin [Therapeutic Antibody Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon 305-806 (Korea, Republic of); Department of Functional Genomics, University of Science and Technology, Daejeon 305-333 (Korea, Republic of); Lee, Yangsoon [Therapeutic Antibody Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon 305-806 (Korea, Republic of); Bae, Jong Hwan [NeoPharm Co. Ltd., Daejeon 305-510 (Korea, Republic of); Chung, Young-Hwa [Department of Cogno-Mechatronics Engineering, BK21 Nanofusion Technology Team, Pusan National University, Busan 609-736 (Korea, Republic of); Koh, Sang Seok, E-mail: sskoh@kribb.re.kr [Therapeutic Antibody Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon 305-806 (Korea, Republic of); Department of Functional Genomics, University of Science and Technology, Daejeon 305-333 (Korea, Republic of)
2011-04-29
Highlights: {yields} Elafin expression is epigenetically silenced in human melanoma cells. {yields} Foxa2 expression in melanoma cells is silenced by promoter hypermethylation. {yields} Foxa2 directs activation of the elafin promoter in vivo. {yields} Foxa2 expression induces apoptosis of melanoma cells via elafin re-expression. -- Abstract: Elafin, a serine protease inhibitor, induces the intrinsic apoptotic pathway in human melanoma cells, where its expression is transcriptionally silenced. However, it remains unknown how the elafin gene is repressed in melanoma cells. We here demonstrate that elafin expression is modulated via epigenetically regulated expression of the transcription factor Foxa2. Treatment of melanoma cells with a DNA methyltransferase inhibitor induced elafin expression, which was specifically responsible for reduced proliferation and increased apoptosis. Suppression of Foxa2 transcription, mediated by DNA hypermethylation in its promoter region, was released in melanoma cells upon treatment with the demethylating agent. Luciferase reporter assays indicated that the Foxa2 binding site in the elafin promoter was critical for the activation of the promoter. Chromatin immunoprecipitation assays further showed that Foxa2 bound to the elafin promoter in vivo. Analyses of melanoma cells with varied levels of Foxa2 revealed a correlated expression between Foxa2 and elafin and the ability of Foxa2 to induce apoptosis. Our results collectively suggest that, in melanoma cells, Foxa2 expression is silenced and therefore elafin is maintained unexpressed to facilitate cell proliferation in the disease melanoma.
Huang, Z H; Gage, D A; Bieber, L L; Sweeley, C C
1991-11-15
A novel approach to the analysis of acylcarnitines has been developed. It involves a direct esterification using propyl chloroformate in aqueous propanol followed by ion-pair extraction with potassium iodide into chloroform and subsequent on-column N-demethylation of the resulting acylcarnitine propyl ester iodides. The products, acyl N-demethylcarnitine propyl esters, are volatile and are easily analyzed by gas chromatography-chemical ionization mass spectrometry. For medium-chain-length (C4-C12) acylcarnitine standards, detection limits are demonstrated to be well below 1 ng starting material using selected ion monitoring. Well-separated gas chromatographic peaks and structure-specific mass spectra are obtained with samples of synthetic and biological origin. Seven acylcarnitines have been characterized in the urine of a patient suffering from medium-chain acyl-CoA dehydrogenase deficiency.
Canfrán-Duque, Alberto; Rotllan, Noemi; Zhang, Xinbo; Fernández-Fuertes, Marta; Ramírez-Hidalgo, Cristina; Araldi, Elisa; Daimiel, Lidia; Busto, Rebeca; Fernández-Hernando, Carlos; Suárez, Yajaira
2017-09-01
Atherosclerosis, the major cause of cardiovascular disease, is a chronic inflammatory disease characterized by the accumulation of lipids and inflammatory cells in the artery wall. Aberrant expression of microRNAs has been implicated in the pathophysiological processes underlying the progression of atherosclerosis. Here, we define the contribution of miR-21 in hematopoietic cells during atherogenesis. Interestingly, we found that miR-21 is the most abundant miRNA in macrophages and its absence results in accelerated atherosclerosis, plaque necrosis, and vascular inflammation. miR-21 expression influences foam cell formation, sensitivity to ER-stress-induced apoptosis, and phagocytic clearance capacity. Mechanistically, we discovered that the absence of miR-21 in macrophages increases the expression of the miR-21 target gene, MKK3, promoting the induction of p38-CHOP and JNK signaling. Both pathways enhance macrophage apoptosis and promote the post-translational degradation of ABCG1, a transporter that regulates cholesterol efflux in macrophages. Altogether, these findings reveal a major role for hematopoietic miR-21 in atherogenesis. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.
PCFT/SLC46A1 promoter methylation and restoration of gene expression in human leukemia cells
International Nuclear Information System (INIS)
Gonen, Nitzan; Bram, Eran E.; Assaraf, Yehuda G.
2008-01-01
The proton-coupled folate transporter (PCFT/SLC46A1) displays optimal and prominent folate and antifolate transport activity at acidic pH in human carcinoma cells but poor activity in leukemia cells. Consistently herein, human leukemia cell lines expressed poor PCFT transcript levels, whereas various carcinoma cell lines showed substantial PCFT gene expression. We identified a CpG island with high density at nucleotides -200 through +100 and explored its role in PCFT promoter silencing. Leukemia cells with barely detectable PCFT transcripts consistently harbored 85-100% methylation of this CpG island, whereas no methylation was found in carcinoma cells. Treatment with 5-Aza-2'-deoxycytidine which induced demethylation but not with the histone deacetylase inhibitor trichostatin A, restored 50-fold PCFT expression only in leukemia cells. These findings constitute the first demonstration of the dominant epigenetic silencing of the PCFT gene in leukemia cells. The potential translational implications of the restoration of PCFT expression in chemotherapy of leukemia are discussed
Kappus, Mojdeh S; Murphy, Andrew J; Abramowicz, Sandra; Ntonga, Vusisizwe; Welch, Carrie L; Tall, Alan R; Westerterp, Marit
2014-02-01
Liver X receptor (LXR) activators decrease atherosclerosis in mice. LXR activators (1) directly upregulate genes involved in reverse cholesterol transport and (2) exert anti-inflammatory effects mediated by transrepression of nuclear factor-κB target genes. We investigated whether myeloid cell deficiency of ATP-binding cassette transporters A1 and G1 (ABCA1/G1), principal targets of LXR that promote macrophage cholesterol efflux and initiate reverse cholesterol transport, would abolish the beneficial effects of LXR activation on atherosclerosis. LXR activator T0901317 substantially reduced inflammatory gene expression in macrophages lacking ABCA1/G1. Ldlr(-/-) mice were transplanted with Abca1(-/-)Abcg1(-/-) or wild-type bone marrow (BM) and fed a Western-type diet for 6 weeks with or without T0901317 supplementation. Abca1/g1 BM deficiency increased atherosclerotic lesion complexity and inflammatory cell infiltration into the adventitia and myocardium. T0901317 markedly decreased lesion area, complexity, and inflammatory cell infiltration in the Abca1(-/-)Abcg1(-/-) BM-transplanted mice. To investigate whether this was because of macrophage Abca1/g1 deficiency, Ldlr(-/-) mice were transplanted with LysmCreAbca1(fl/fl)Abcg1(fl/fl) or Abca1(fl/fl)Abcg1(fl/fl) BM and fed Western-type diet with or without the more specific LXR agonist GW3965 for 12 weeks. GW3965 decreased lesion size in both groups, and the decrease was more prominent in the LysmCreAbca1(fl/fl)Abcg1(fl/fl) group. The results suggest that anti-inflammatory effects of LXR activators are of key importance to their antiatherosclerotic effects in vivo independent of cholesterol efflux pathways mediated by macrophage ABCA1/G1. This has implications for the development of LXR activators that lack adverse effects on lipogenic genes while maintaining the ability to transrepress inflammatory genes.
Bae, S I; Cheriyath, V; Jacobs, B S; Reu, F J; Borden, E C
2008-01-17
Human melanoma cell lines, SK-MEL-3 and SK-MEL-28, despite induction of the proapoptotic cytokine, Apo2L/TRAIL, did not undergo apoptosis in response to interferons (IFN-alpha2b or IFN-beta). Postulating that genes important for apoptosis induction by IFNs might be silenced by methylation, the DNA demethylating agent 5-aza-2'-deoxycytidine (5-AZAdC) was assessed. DR4 (TRAIL-R1) was identified as one of the genes reactivated by 5-AZAdC with a >3-fold increase in 8 of 10 melanoma cell lines. Pretreatment with 5-AZAdC sensitized SK-MEL-3 and SK-MEL-28 cells to apoptosis induced by IFN-alpha2b and IFN-beta; methylation-specific PCR and bisulfite sequencing confirmed demethylation of 5'CpG islands of DR4 and flow cytometry showed an increase in DR4 protein on the cell surface. In cells with reactivated DR4, neutralizing mAB to TRAIL reduced apoptosis in response to IFN-beta or Apo2L/TRAIL. To further confirm the role of DR4, it was expressed by retroviral vector in SK-MEL-3 and SK-MEL-28 cells with reversal of resistance to IFN-beta and Apo2L/TRAIL. Thus, reexpressing DR4 by 5-AZAdC or retroviral transfection in melanoma cell in which promoter methylation had suppressed its expression, potentiated apoptosis by IFN-alpha2b, IFN-beta and Apo2L/TRAIL. Reactivation of silenced proapoptotic genes by inhibitors of DNA methylation may enhance clinical response to IFNs or Apo2L/TRAIL.
Promoter methylation inhibits BRD7 expression in human nasopharyngeal carcinoma cells
International Nuclear Information System (INIS)
Liu, Huaying; Li, Guiyuan; Zhang, Liming; Niu, Zhaoxia; Zhou, Ming; Peng, Cong; Li, Xiayu; Deng, Tan; Shi, Lei; Tan, Yixin
2008-01-01
Nasopharyngeal carcinoma (NPC) is a head and neck malignancy with high occurrence in South-East Asia and Southern China. Recent findings suggest that epigenetic inactivation of multiple tumor suppressor genes plays an important role in the tumourigenesis of NPC. BRD7 is a NPC-associated bromodomain gene that exhibits a much higher-level of mRNA expression in normal than in NPC biopsies and cell lines. In this study, we explored the role of DNA methylation in regulation of BRD7 transcription. The presence of CpG islands within BRD7 promoter was predicted by EMBOSS CpGplot and Softberry CpGFinder, respectively. Nested methylation-specific PCR and RT-PCR were employed to detect the methylation status of BRD7 promoter and the mRNA expression of BRD7 gene in tumor cell lines as well as clinical samples. Electrophoretic mobility shift assays (EMSA) and luciferase assay were used to detect the effects of cytosine methylation on the nuclear protein binding to BRD7 promoter. We found that DNA methylation suppresses BRD7 expression in NPC cells. In vitro DNA methylation in NPC cells silenced BRD7 promoter activity and inhibited the binding of the nuclear protein (possibly Sp1) to Sp1 binding sites in the BRD7 promoter. In contrast, inhibition of DNA methylation augments induction of endogenous BRD7 mRNA in NPC cells. We also found that methylation frequency of BRD7 promoter is much higher in the tumor and matched blood samples from NPC patients than in the blood samples from normal individuals. BRD7 promoter demethylation is a prerequisite for high level induction of BRD7 gene expression. DNA methylation of BRD7 promoter might serve as a diagnostic marker in NPC
Lithium modulation of the human inositol monophosphatase 2 (IMPA2) promoter
International Nuclear Information System (INIS)
Seelan, Ratnam S.; Parthasarathy, Latha K.; Parthasarathy, Ranga N.
2004-01-01
The inositol-signaling pathway is a therapeutic target for lithium in the treatment of bipolar disorder. Inositol monophosphatases (IMPases) play a key role in inositol signaling. Lithium's ability to inhibit IMPase 1 is well known, but its effect on IMPase 2 or on the transcriptional regulation of these genes has not been studied. Here, we report the identification and characterization of the minimal promoter of IMPA2 (encoding IMPase 2) in HeLa (epithelial) and SK-N-AS (neuronal) cells. IMPA2 promoter activity appears to be contributed by different elements in the 5' flanking region, suggesting that the gene is differentially regulated in neuronal and non-neuronal cells. Furthermore, IMPA2 promoter activity in both cell lines is downregulated, in a dose-dependent manner, by lithium after treatment for only 24 h. This effect is also observed in vivo. Our results suggest a possible role for IMPA2 in bipolar disorder
International Nuclear Information System (INIS)
Lee, Junga; Scheri, Richard C.; Curtis, Lawrence R.
2008-01-01
Organochlorine (OC) insecticides continue to occur in tissues of humans and wildlife throughout the world although they were banned in the United States a few decades ago. Low doses of the OC insecticide chlordecone (CD) alter hepatic disposition of lipophilic xenobiotics and perturb lipid homeostasis in rainbow trout, mice and rats. CD pretreatment altered tissue and hepatic subcellular distribution of exogenous [ 14 C]cholesterol (CH) equivalents 4 and 16 h after a bolus intraperitoneal (ip) injection of 5 ml corn oil/kg that contained 10 mg CH/kg. CD pretreatment altered tissue distribution of exogenously administered [ 14 C]CH by decreased hepatic and renal accumulation, and increased biliary excretion up to 300%. Biliary excretion of polar [ 14 C]CH metabolites was not altered by CD. CD pretreatment decreased subcellular distribution of [ 14 C]CH equivalents in hepatic cytosol and microsomes and lipoprotein-rich fraction-to-homogenate ratio. CD pretreatment increased the ratio of [ 14 C]CH equivalents in high density lipoprotein (HDL) to that in plasma and reduced [ 14 C]CH equivalents in the non-HDL fraction 4 h after a bolus lipid dose. CD pretreatment increased plasma non-HDL total CH by 80% 4 h after a bolus lipid dose. Scavenger receptor class B type I (SR-BI) and ATP-binding cassette transporter G8 (ABCG8) proteins were quantified by western blotting in hepatic membranes from control and CD treated mice. Liver membrane contents of SR-BI and ABCG8 proteins were unchanged by CD pretreatment. The data demonstrated that a single dose of CD altered CH homeostasis and lipoprotein metabolism
Lee, Junga; Scheri, Richard C; Curtis, Lawrence R
2008-06-15
Organochlorine (OC) insecticides continue to occur in tissues of humans and wildlife throughout the world although they were banned in the United States a few decades ago. Low doses of the OC insecticide chlordecone (CD) alter hepatic disposition of lipophilic xenobiotics and perturb lipid homeostasis in rainbow trout, mice and rats. CD pretreatment altered tissue and hepatic subcellular distribution of exogenous [(14)C]cholesterol (CH) equivalents 4 and 16 h after a bolus intraperitoneal (ip) injection of 5 ml corn oil/kg that contained 10 mg CH/kg. CD pretreatment altered tissue distribution of exogenously administered [(14)C]CH by decreased hepatic and renal accumulation, and increased biliary excretion up to 300%. Biliary excretion of polar [(14)C]CH metabolites was not altered by CD. CD pretreatment decreased subcellular distribution of [(14)C]CH equivalents in hepatic cytosol and microsomes and lipoprotein-rich fraction-to-homogenate ratio. CD pretreatment increased the ratio of [(14)C]CH equivalents in high density lipoprotein (HDL) to that in plasma and reduced [(14)C]CH equivalents in the non-HDL fraction 4 h after a bolus lipid dose. CD pretreatment increased plasma non-HDL total CH by 80% 4 h after a bolus lipid dose. Scavenger receptor class B type I (SR-BI) and ATP-binding cassette transporter G8 (ABCG8) proteins were quantified by western blotting in hepatic membranes from control and CD treated mice. Liver membrane contents of SR-BI and ABCG8 proteins were unchanged by CD pretreatment. The data demonstrated that a single dose of CD altered CH homeostasis and lipoprotein metabolism.
Fantacuzzi, Marialuigia; Bettoni, Giancarlo; D'Orazio, Giovanni; Fanali, Salvatore
2006-03-01
The enantiomeric separation of some demethylated analogues of clofibric acid, namely 2-(6-chloro-benzothiazol-2-ylsulfanyl)-, 2-(6-methoxy-benzothiazol-2-ylsulfanyl)-, 2-(quinolin-2-yloxy)-, 2-(6-chloro-quinolin-2-yloxy)-, 2-(7-chloro-quinolin-4-yloxy)-propionic acid (compounds A-E, respectively), has been studied by CZE and nano-LC using for the first technique two beta-CD derivatives and vancomycin added to the BGE and vancomycin-modified silica particles for the second one, with the aim to find the optimum experimental conditions for the baseline resolution. The type and the concentration of the chiral selector added to the BGE, the buffer pH, the type of organic modifier and its concentration, the capillary temperature and the applied voltage played a very important role in the enantioresolution of the analysed compounds. The use of 6-monodeoxy-6-monoamino-beta-CD allowed to achieve baseline resolution of four of five clofibric acid derivatives in less than 10 min while heptakis-(2,3,6-tri-O-methyl)-beta-CD partially resolved the same compounds in their enantiomers. Employing vancomycin as the chiral selector in CZE, the counter-current partial filling method was chosen achieving baseline resolution of four analytes. All the studied compounds were enantioresolved employing a capillary column packed with vancomycin stationary phase by nano-LC, and the resolution was strongly influenced by the concentration of the organic modifier and by the pH of the mobile phase. The best results were achieved at pH 4.5 in presence of 60% of methanol (MeOH). However, longer analysis times were observed in the experiments carried out by nano-LC.
Skrobik, Yoanna; Leger, Caroline; Cossette, Mariève; Michaud, Veronique; Turgeon, Jacques
2013-04-01
Delirium and sedative-induced coma are described as incremental manifestations of cerebral dysfunction. Both may be associated with sedative or opiate doses and pharmacokinetic or pharmacogenetic variables, such as drug plasma levels (exposure), drug metabolism, and/or their transport across the blood-brain barrier. To compare biological and drug treatment characteristics in patients with coma and/or delirium while in the ICU. In 99 patients receiving IV fentanyl, midazolam, or both, we evaluated drug doses, covariates likely to influence drug effects (age, body mass index, and renal and hepatic dysfunction); delirium risk factors; concomitant administration of CYP3A and P-glycoprotein substrates/inhibitors; ABCB1, ABCG2, and CYP3A5 genetic polymorphisms; and fentanyl and midazolam plasma levels. Delirium and coma were evaluated daily. In patients with only coma (n=15), only delirium (n=7), and neither ever (n=14), we measured plasma levels of tumor necrosis factor-α, interleukin (IL)-1β, IL-1RA, IL-6, IL-8, IL-10, IL-17,macrophage inflammatory protein-1β, and monocyte chemotactic protein-1. Time to first coma was associated with fentanyl and midazolam doses (p=0.03 and p=0.01, respectively). The number of days in coma was associated with the number of days of coadministration of CYP3A inhibitors (r=0.30; p=0.006). Plasma levels of fentanyl were higher in patients with clinical coma (3.7±4.7 vs. 2.0±1.8 ng/mL, p=0.0001) as were midazolam plasma levels (1050±2232 vs. 168±249 ng/mL, p=0.0001). Delirium occurrence was unrelated to midazolam administration, cumulative doses, or serum levels. Days with delirium were associated with days of coadministration of P-glycoprotein inhibitor (r=0.35; p=0.0004). Delirious patients had higher levels of the inflammatory mediator IL-6 than comatose patients (129.3 vs. 35.0 pg/mL, p=0.05). Coma is associated with fentanyl and midazolam exposure; delirium is unrelated to midazolam and may be linked to inflammatory status
AAHD's Health Promotion and Wellness, Part 2: Health Promotion Programs
Exceptional Parent, 2011
2011-01-01
This article is part 2 of a 4-part series on "Health Promotion and Wellness" from the American Association on Health and Disability (AAHD). According to the U.S. Census Bureau, more than 54 million people--one in five Americans--have a disability, and these Americans are more likely to report: (1) Being in poorer overall health; (2) Having less…
Shanak, Siba; Helms, Volkhard
2014-12-01
Adenine and cytosine methylation are two important epigenetic modifications of DNA sequences at the levels of the genome and transcriptome. To characterize the differential roles of methylating adenine or cytosine with respect to their hydration properties, we performed conventional MD simulations and free energy perturbation calculations for two particular DNA sequences, namely the brain-derived neurotrophic factor (BDNF) promoter and the R.DpnI-bound DNA that are known to undergo methylation of C5-methyl cytosine and N6-methyl adenine, respectively. We found that a single methylated cytosine has a clearly favorable hydration free energy over cytosine since the attached methyl group has a slightly polar character. In contrast, capping the strongly polar N6 of adenine with a methyl group gives a slightly unfavorable contribution to its free energy of solvation. Performing the same demethylation in the context of a DNA double-strand gave quite similar results for the more solvent-accessible cytosine but much more unfavorable results for the rather buried adenine. Interestingly, the same demethylation reactions are far more unfavorable when performed in the context of the opposite (BDNF or R.DpnI target) sequence. This suggests a natural preference for methylation in a specific sequence context. In addition, free energy calculations for demethylating adenine or cytosine in the context of B-DNA vs. Z-DNA suggest that the conformational B-Z transition of DNA transition is rather a property of cytosine methylated sequences but is not preferable for the adenine-methylated sequences investigated here.
Aberrant methylation of GCNT2 is tightly related to lymph node metastasis of primary CRC.
Nakamura, Kazunori; Yamashita, Keishi; Sawaki, Hiromichi; Waraya, Mina; Katoh, Hiroshi; Nakayama, Nobukazu; Kawamata, Hiroshi; Nishimiya, Hiroshi; Ema, Akira; Narimatsu, Hisashi; Watanabe, Masahiko
2015-03-01
Glycoprotein expression profile is dramatically altered in human cancers; however, specific glycogenes have not been fully identified. A comprehensive real-time polymerase chain reaction (PCR) system for glycogenes (CRPS-G) identified several outstanding glycogenes. GCNT2 was of particular interest after GCNT2 expression and epigenetics were rigorously investigated in primary colorectal cancer (CRC). The highlights of this work can be summarized as follows: (i) Expression of GCNT2 was remarkably suppressed. (ii) Silenced expression of GCNT2 was reactivated by combined demethylating agents. (iii) Promoter DNA methylation of GCNT2 was silenced in CRC cell lines and tissues. Hypomethylation of GCNT2 variant 2 is tightly associated with lymph node metastasis in primary CRC. (iv) GCNT2 methylation level in the normal tissues also showed a close association with that in the tumor tissues and reflected lymph node metastasis. We identified aberrant expression of GCNT2, which can be explained by promoter DNA hypermethylation. Hypomethylation of the GCNT2 variant 2 reflected lymph node metastasis of CRC in the tumor and normal tissues. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Directory of Open Access Journals (Sweden)
de Souza Emanuel M
2009-03-01
Full Text Available Abstract Background ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. Methods First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP. Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. Results The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM; tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC was 76.2% compared with 25.5% in invasive ductal carcinoma
International Nuclear Information System (INIS)
Seniski, Gerusa G; Zanata, Silvio M; Costa, Fabrício F; Klassen, Giseli; Camargo, Anamaria A; Ierardi, Daniela F; Ramos, Edneia AS; Grochoski, Mariana; Ribeiro, Enilze SF; Cavalli, Iglenir J; Pedrosa, Fabio O; Souza, Emanuel M de
2009-01-01
ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR) treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP). Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR) demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM); tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC) was 76.2% compared with 25.5% in invasive ductal carcinoma (IDC), and this difference was
Transgelin gene is frequently downregulated by promoter DNA hypermethylation in breast cancer.
Sayar, Nilufer; Karahan, Gurbet; Konu, Ozlen; Bozkurt, Betul; Bozdogan, Onder; Yulug, Isik G
2015-01-01
CpG hypermethylation in gene promoters is a frequent mechanism of tumor suppressor gene silencing in various types of cancers. It usually occurs at early steps of cancer progression and can be detected easily, giving rise to development of promising biomarkers for both detection and progression of cancer, including breast cancer. 5-aza-2'-deoxycytidine (AZA) is a DNA demethylating and anti-cancer agent resulting in induction of genes suppressed via DNA hypermethylation. Using microarray expression profiling of AZA- or DMSO-treated breast cancer and non-tumorigenic breast (NTB) cells, we identified for the first time TAGLN gene as a target of DNA hypermethylation in breast cancer. TAGLN expression was significantly and frequently downregulated via promoter DNA hypermethylation in breast cancer cells compared to NTB cells, and also in 13/21 (61.9 %) of breast tumors compared to matched normal tissues. Analyses of public microarray methylation data showed that TAGLN was also hypermethylated in 63.02 % of tumors compared to normal tissues; relapse-free survival of patients was worse with higher TAGLN methylation; and methylation levels could discriminate between tumors and healthy tissues with 83.14 % sensitivity and 100 % specificity. Additionally, qRT-PCR and immunohistochemistry experiments showed that TAGLN expression was significantly downregulated in two more independent sets of breast tumors compared to normal tissues and was lower in tumors with poor prognosis. Colony formation was increased in TAGLN silenced NTB cells, while decreased in overexpressing BC cells. TAGLN gene is frequently downregulated by DNA hypermethylation, and TAGLN promoter methylation profiles could serve as a future diagnostic biomarker, with possible clinical impact regarding the prognosis in breast cancer.
Carnosol promotes endothelial differentiation under H2O2-induced oxidative stress
Directory of Open Access Journals (Sweden)
Ou Shulin
2017-01-01
Full Text Available Oxidative stress causes deregulation of endothelial cell differentiation. Carnosol is a potent antioxidant and antiinflammatory compound. In the present study, we examined whether the antioxidant effect of carnosol might protect bone marrow stem cells against H2O2-induced oxidative stress and promote endothelial differentiation. We examined cell viability by the MTT assay; oxidative stress and apoptosis were analyzed through changes in ROS levels, apoptotic ratio and caspase-3 activity; changes in protein expression of OCT-4, Flk-1, CD31 and Nrf-2 were assessed by Western blot analysis. H2O2 treatment increased oxidative stress and reduced cell viability, while the stem cell marker OCT-4 and endothelial markers Flk-1, CD31 were significantly downregulated as a result of the treatment with H2O2. Treatment with carnosol improved the antioxidant status, increased OCT-4 expression and promoted endothelial differentiation. This study provides evidence that carnosol could increase the antioxidant defense mechanism and promote endothelial differentiation.
mTORC2 Promotes Tumorigenesis via Lipid Synthesis.
Guri, Yakir; Colombi, Marco; Dazert, Eva; Hindupur, Sravanth K; Roszik, Jason; Moes, Suzette; Jenoe, Paul; Heim, Markus H; Riezman, Isabelle; Riezman, Howard; Hall, Michael N
2017-12-11
Dysregulated mammalian target of rapamycin (mTOR) promotes cancer, but underlying mechanisms are poorly understood. We describe an mTOR-driven mouse model that displays hepatosteatosis progressing to hepatocellular carcinoma (HCC). Longitudinal proteomic, lipidomics, and metabolomic analyses revealed that hepatic mTORC2 promotes de novo fatty acid and lipid synthesis, leading to steatosis and tumor development. In particular, mTORC2 stimulated sphingolipid (glucosylceramide) and glycerophospholipid (cardiolipin) synthesis. Inhibition of fatty acid or sphingolipid synthesis prevented tumor development, indicating a causal effect in tumorigenesis. Increased levels of cardiolipin were associated with tubular mitochondria and enhanced oxidative phosphorylation. Furthermore, increased lipogenesis correlated with elevated mTORC2 activity and HCC in human patients. Thus, mTORC2 promotes cancer via formation of lipids essential for growth and energy production. Copyright © 2017 Elsevier Inc. All rights reserved.
Karthikeyan, Chandrabose; Lee, Crystal; Moore, Joshua; Mittal, Roopali; Suswam, Esther A; Abbott, Kodye L; Pondugula, Satyanarayana R; Manne, Upender; Narayanan, Narayanan K; Trivedi, Piyush; Tiwari, Amit K
2015-02-01
Naturally occurring condensed quinolines have anticancer properties. In efforts to find active analogues, we designed and synthesized eight polycyclic heterocycles with a pyrimido[1″,2″:1,5]pyrazolo[3,4-b]quinoline framework (IND series). The compounds were evaluated for activity against colon (HCT-116 and S1-MI-80), prostate (PC3 and DU-145), breast (MCF-7 and MDAMB-231), ovarian (ov2008 and A2780), and hepatocellular (HepG2) cancer cells and against non-cancerous Madin Darby canine kidney (MDCK), mouse embryonic fibroblast (NIH/3T3), and human embryonic kidney cells (HEK293). IND-2, a 4-chloro-2-methyl pyrimido[1″,2″:1,5]pyrazolo[3,4-b]quinoline, exhibited more than ten-fold selectivity and potent cytotoxic activity against colon cancer cells relative to the other cancer and non-cancer cells. With five additional colon cancer cell lines (HT-29, HCT-15, LS-180, LS-174, and LoVo), IND-2 had similar cytotoxicity and selectivity, and sub-micromolar concentrations caused changes in the morphology of HCT-116 and HCT-15 cells. IND-2 did not activate the transactivating function of the pregnane X receptor (PXR), indicating that it does not induce PXR-regulated ABCB1 or ABCG2 transporters. Indeed, IND-2 was not a substrate of ABCB1 or ABCG2, and it induced cytotoxicity in HEK293 cells overexpressing ABCB1 or ABCG2 to the same extent as in normal HEK293 cells. IND-2 was cytotoxic to resistant colon carcinoma S1-MI-80 cells, approximately three- and five-fold more than SN-38 and topotecan, respectively. In HCT-116 colon cancer cells, IND-2 produced concentration-dependent changes in mitochondrial membrane potential, leading to apoptosis, and sub-micromolar concentrations caused chromosomal DNA fragmentation. These findings suggest that, by increasing apoptosis, IND-2 has potential therapeutic efficacy for colorectal cancer. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Jun Zhang
Full Text Available The pregnane X receptor (PXR was previously known as a xenobiotic receptor. Several recent studies suggested that PXR also played an important role in lipid homeostasis but the underlying mechanism remains to be clearly defined. In this study, we found that rifampicin, an agonist of human PXR, induced lipid accumulation in HepG2 cells. Lipid analysis showed the total cholesterol level increased. However, the free cholesterol and triglyceride levels were not changed. Treatment of HepG2 cells with rifampicin induced the expression of the free fatty acid transporter CD36 and ABCG1, as well as several lipogenic enzymes, including stearoyl-CoA desaturase-1 (SCD1, long chain free fatty acid elongase (FAE, and lecithin-cholesterol acyltransferase (LCAT, while the expression of acyl:cholesterol acetyltransferase(ACAT1 was not affected. Moreover, in PXR over-expressing HepG2 cells (HepG2-PXR, the SCD1 expression was significantly higher than in HepG2-Vector cells, even in the absence of rifampicin. Down-regulation of PXR by shRNA abolished the rifampicin-induced SCD1 gene expression in HepG2 cells. Promoter analysis showed that the human SCD1 gene promoter is activated by PXR and a novel DR-7 type PXR response element (PXRE response element was located at -338 bp of the SCD1 gene promoter. Taken together, these results indicated that PXR activation promoted lipid synthesis in HepG2 cells and SCD1 is a novel PXR target gene.
GSTT2 promoter polymorphisms and colorectal cancer risk
Directory of Open Access Journals (Sweden)
Ahn Sun-A
2007-01-01
Full Text Available Abstract Background Glutathione S-transferases are a group of enzymes that participate in detoxification and defense mechanisms against toxic carcinogens and other compounds. These enzymes play an important role in human carcinogenesis. In the present study, we sought to determine whether GSTT2 promoter single nucleotide polymorphisms (SNPs are associated with colorectal cancer risk. Methods A total of 436 colorectal cancer patients and 568 healthy controls were genotyped for three GSTT2 promoter SNPs (-537G>A, -277T>C and -158G>A, using real-time TaqMan assay and direct sequencing. An electrophoretic mobility shift assay (EMSA was performed to determine the effects of polymorphisms on protein binding to the GSTT2 promoter. Results The -537A allele (-537G/A or A/A was significantly associated with colorectal cancer risk (OR = 1.373, p = 0.025, while the -158A allele (-158G/A or A/A was involved in protection against colorectal cancer (OR = 0.539, p = 0.032. Haplotype 2 (-537A, -277T, -158G was significantly associated with colorectal cancer risk (OR = 1.386, p = 0.021, while haplotype 4 (-537G, -277C, -158A protected against colorectal cancer (OR = 0.539, p = 0.032. EMSA data revealed lower promoter binding activity in the -537A allele than its -537G counterpart. Conclusion Our results collectively suggest that SNPs and haplotypes of the GSTT2 promoter region are associated with colorectal cancer risk in the Korean population.
Energy Technology Data Exchange (ETDEWEB)
Li, Jing [Department of Geratory, Linzi District People’s Hospital of Zibo City, Zibo, Shandong (China); Zhang, Suhua, E-mail: drsuhuangzhang@qq.com [Department of HealthCare, Qilu Hospital of Shandong University (Qingdao), Qingdao City, Qingdao (China)
2016-08-05
Transformation of macrophages into foam cells plays a critical role in the pathogenesis of atherosclerosis. The aim of this study was to determine the expression and biological roles of microRNA (miR)-150 in the formation of macrophage foam cells and to identify its functional target(s). Exposure to 50 μg/ml oxidized low-density lipoprotein (oxLDL) led to a significant upregulation of miR-150 in THP-1 macrophages. Overexpression of miR-150 inhibited oxLDL-induced lipid accumulation in THP-1 macrophages, while knockdown of miR-150 enhanced lipid accumulation. apoA-I- and HDL-mediated cholesterol efflux was increased by 66% and 43%, respectively, in miR-150-overexpressing macrophages relative to control cells. In contrast, downregulation of miR-150 significantly reduced cholesterol efflux from oxLDL-laden macrophages. Bioinformatic analysis and luciferase reporter assay revealed adiponectin receptor 2 (AdipoR2) as a direct target of miR-150. Small interfering RNA-mediated downregulation of AdipoR2 phenocopied the effects of miR-150 overexpression, reducing lipid accumulation and facilitating cholesterol efflux in oxLDL-treated THP-1 macrophages. Knockdown of AdipoR2 induced the expression of proliferator-activated receptor gamma (PPARγ), liver X receptor alpha (LXRα), ABCA1, and ABCG1. Moreover, pharmacological inhibition of PPARγ or LXRα impaired AdipoR2 silencing-induced upregulation of ABCA1 and ABCG1. Taken together, our results indicate that miR-150 can attenuate oxLDL-induced lipid accumulation in macrophages via promotion of cholesterol efflux. The suppressive effects of miR-150 on macrophage foam cell formation are mediated through targeting of AdipoR2. Delivery of miR-150 may represent a potential approach to prevent macrophage foam cell formation in atherosclerosis. -- Highlights: •miR-150 inhibits macrophage foam cell formation. •miR-150 accelerates cholesterol efflux from oxLDL-laden macrophages. •miR-150 suppresses macrophage foam cell
Directory of Open Access Journals (Sweden)
María-Teresa eSolís
2015-06-01
Full Text Available Microspores are reprogrammed by stress in vitro towards embryogenesis. This process is an important tool in breeding to obtain double-haploid plants. DNA methylation is a major epigenetic modification that changes in differentiation and proliferation. We have shown changes in global DNA methylation during microspore reprogramming. 5-Azacytidine (AzaC cannot be methylated and leads to DNA hypomethylation. AzaC is a useful demethylating agent to study DNA dynamics, with a potential application in microspore embryogenesis. This work analyzes the effects of short and long AzaC treatments on microspore embryogenesis initiation and progression in two species, the dicot Brassica napus and the monocot Hordeum vulgare. This involved the quantitative analyses of proembryo and embryo production, the quantification of DNA methylation, 5mdC immunofluorescence and confocal microscopy, and the analysis of chromatin organization (condensation/ decondensation by light and electron microscopy. Four days of AzaC treatments (2.5 µM increased embryo induction, response associated with a decrease of DNA methylation, modified 5mdC and heterochromatin patterns compared to untreated embryos. By contrast, longer AzaC treatments diminished embryo production. Similar effects were found in both species, indicating that DNA demethylation promotes microspore reprogramming, totipotency acquisition and embryogenesis initiation, while embryo differentiation requires de novo DNA methylation and is prevented by AzaC. This suggests a role for DNA methylation in the repression of microspore reprogramming and possibly totipotency acquisition.Results provide new insights into the role of epigenetic modifications in microspore embryogenesis and suggest a potential benefit of inhibitors, such as AzaC, to improve the process efficiency in biotechnology and breeding programs.
Czech Academy of Sciences Publication Activity Database
Vlková, Veronika; Štěpánek, Ivan; Hrušková, Veronika; Šenigl, Filip; Mayerová, Veronika; Šrámek, Martin; Šímová, Jana; Bieblová, Jana; Indrová, Marie; Hejhal, Tomáš; Dérian, N.; Klatzmann, D.; Six, A.; Reiniš, Milan
2014-01-01
Roč. 5, č. 16 (2014), s. 6923-35 ISSN 1949-2553 R&D Projects: GA ČR GAP301/10/2174; GA MZd NT14461 EU Projects: European Commission(XE) 18933 - CLINIGENE Grant - others:French state funds within the Investissements d’Avenir program(FR) ANR-11-IDEX-0004-02 Institutional support: RVO:68378050 Keywords : IFNγ signalling pathway * DNA demethylation * tumour Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.359, year: 2014
Farrow, Scott C.; Facchini, Peter J.
2013-01-01
In opium poppy, the antepenultimate and final steps in morphine biosynthesis are catalyzed by the 2-oxoglutarate/Fe(II)-dependent dioxygenases, thebaine 6-O-demethylase (T6ODM) and codeine O-demethylase (CODM). Further investigation into the biochemical functions of CODM and T6ODM revealed extensive and unexpected roles for such enzymes in the metabolism of protopine, benzo[c]phenanthridine, and rhoeadine alkaloids. When assayed with a wide range of benzylisoquinoline alkaloids, CODM, T6ODM, and the functionally unassigned paralog DIOX2, renamed protopine O-dealkylase, showed novel and efficient dealkylation activities, including regio- and substrate-specific O-demethylation and O,O-demethylenation. Enzymes catalyzing O,O-demethylenation, which cleave a methylenedioxy bridge leaving two hydroxyl groups, have previously not been reported in plants. Similar cleavage of methylenedioxy bridges on substituted amphetamines is catalyzed by heme-dependent cytochromes P450 in mammals. Preferred substrates for O,O-demethylenation by CODM and protopine O-dealkylase were protopine alkaloids that serve as intermediates in the biosynthesis of benzo[c]phenanthridine and rhoeadine derivatives. Virus-induced gene silencing used to suppress the abundance of CODM and/or T6ODM transcripts indicated a direct physiological role for these enzymes in the metabolism of protopine alkaloids, and they revealed their indirect involvement in the formation of the antimicrobial benzo[c]phenanthridine sanguinarine and certain rhoeadine alkaloids in opium poppy. PMID:23928311
Farrow, Scott C; Facchini, Peter J
2013-10-04
In opium poppy, the antepenultimate and final steps in morphine biosynthesis are catalyzed by the 2-oxoglutarate/Fe(II)-dependent dioxygenases, thebaine 6-O-demethylase (T6ODM) and codeine O-demethylase (CODM). Further investigation into the biochemical functions of CODM and T6ODM revealed extensive and unexpected roles for such enzymes in the metabolism of protopine, benzo[c]phenanthridine, and rhoeadine alkaloids. When assayed with a wide range of benzylisoquinoline alkaloids, CODM, T6ODM, and the functionally unassigned paralog DIOX2, renamed protopine O-dealkylase, showed novel and efficient dealkylation activities, including regio- and substrate-specific O-demethylation and O,O-demethylenation. Enzymes catalyzing O,O-demethylenation, which cleave a methylenedioxy bridge leaving two hydroxyl groups, have previously not been reported in plants. Similar cleavage of methylenedioxy bridges on substituted amphetamines is catalyzed by heme-dependent cytochromes P450 in mammals. Preferred substrates for O,O-demethylenation by CODM and protopine O-dealkylase were protopine alkaloids that serve as intermediates in the biosynthesis of benzo[c]phenanthridine and rhoeadine derivatives. Virus-induced gene silencing used to suppress the abundance of CODM and/or T6ODM transcripts indicated a direct physiological role for these enzymes in the metabolism of protopine alkaloids, and they revealed their indirect involvement in the formation of the antimicrobial benzo[c]phenanthridine sanguinarine and certain rhoeadine alkaloids in opium poppy.
Directory of Open Access Journals (Sweden)
Bina S. Siddiqui
2008-08-01
Full Text Available A simple, rapid, solvent-free, room temperature one pot synthesis of benzene ring acylated and demethylated analogues of harmine using acyl halides/acid anhydrides and AlCl3 has been developed. Eight different acyl halides/acid anhydrides were used in the synthesis. The resulting mixture of products was separated by column chromatography to afford 10- and 12-monoacyl analogues, along with 10,12-diacyl-11-hydroxy products. In five cases the corresponding 10-acyl-11-hydroxy analogues were also obtained. Yields from the eight syntheses (29 products in total were in the 6-34% range and all compounds were fully characterized.
Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene
International Nuclear Information System (INIS)
Mavrothalassitis, G.J.; Watson, D.K.; Papas, T.S.
1990-01-01
The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical TATA and CAAT elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1,400 base pairs (bp) upstream from the first major transcription initiation site. A G+C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with TATA-less promoters
Directory of Open Access Journals (Sweden)
Nicola J Brown
Full Text Available Under normoxia, non-malignant cells rely on oxidative phosphorylation for their ATP production, whereas cancer cells rely on Glycolysis; a phenomenon known as the Warburg effect. We aimed to elucidate the mechanisms contributing to the Warburg effect in human breast cancer.Lactate Dehydrogenase (LDH isoenzymes were profiled using zymography. LDH-B subunit expression was assessed by reverse transcription PCR in cells, and by Immunohistochemistry in breast tissues. LDH-B promoter methylation was assessed by sequencing bisulfite modified DNA.Absent or decreased expression of LDH isoenzymes 1-4, were seen in T-47D and MCF7 cells. Absence of LDH-B mRNA was seen in T-47D cells, and its expression was restored following treatment with the demethylating agent 5'Azacytadine. LDH-B promoter methylation was identified in T-47D and MCF7 cells, and in 25/25 cases of breast cancer tissues, but not in 5/5 cases of normal breast tissues. Absent immuno-expression of LDH-B protein (<10% cells stained, was seen in 23/26 (88% breast cancer cases, and in 4/8 cases of adjacent ductal carcinoma in situ lesions. Exposure of breast cancer cells to hypoxia (1% O(2, for 48 hours resulted in significant increases in lactate levels in both MCF7 (14.0 fold, p = 0.002, and T-47D cells (2.9 fold, p = 0.009, but not in MDA-MB-436 (-0.9 fold, p = 0.229, or MCF10AT (1.2 fold, p = 0.09 cells.Loss of LDH-B expression is an early and frequent event in human breast cancer occurring due to promoter methylation, and is likely to contribute to an enhanced glycolysis of cancer cells under hypoxia.
Shimazu, Yayoi; Shimazu, Yutaka; Hishizawa, Masakatsu; Hamaguchi, Masahide; Nagai, Yuya; Sugino, Noriko; Fujii, Sumie; Kawahara, Masahiro; Kadowaki, Norimitsu; Nishikawa, Hiroyoshi; Sakaguchi, Shimon; Takaori-Kondo, Akifumi
2016-02-01
Adult T-cell leukemia (ATL) is an aggressive T-cell malignancy caused by human T-cell leukemia virus type 1. Because of its immunosuppressive property and resistance to treatment, patients with ATL have poor prognoses. ATL cells possess the regulatory T cell (Treg) phenotype, such as CD4 and CD25, and usually express forkhead box P3 (FOXP3). However, the mechanisms of FOXP3 expression and its association with Treg-like characteristics in ATL remain unclear. Selective demethylation of the Treg-specific demethylated region (TSDR) in the FOXP3 gene leads to stable FOXP3 expression and defines natural Tregs. Here, we focus on the functional and clinical relationship between the epigenetic pattern of the TSDR and ATL. Analysis of DNA methylation in specimens from 26 patients with ATL showed that 15 patients (58%) hypomethylated the TSDR. The FOXP3(+) cells were mainly observed in the TSDR-hypomethylated cases. The TSDR-hypomethylated ATL cells exerted more suppressive function than the TSDR-methylated ATL cells. Thus, the epigenetic analysis of the FOXP3 gene identified a distinct subtype with Treg properties in heterogeneous ATL. Furthermore, we observed that the hypomethylation of TSDR was associated with poor outcomes in ATL. These results suggest that the DNA methylation status of the TSDR is an important hallmark to define this heterogeneous disease and to predict ATL patient prognosis. ©2015 American Association for Cancer Research.
Base-oxidant promoted metal-free N-demethylation of arylamines
Indian Academy of Sciences (India)
alkylation damage repair, cancer metastatic chemopre- vention and also for drug metabolism.3 In classical methods, enzymatic processes are mostly responsible for this conversion in which metal complexes4 and various oxidases or peroxidases, like horseradish per- oxidase, lipogenase, cytochrome P-450, bleomycin,.
Impact of CYP2C8*3 polymorphism on in vitro metabolism of imatinib to N-desmethyl imatinib.
Khan, Muhammad Suleman; Barratt, Daniel T; Somogyi, Andrew A
2016-01-01
1. Imatinib is metabolized to N-desmethyl imatinib by CYPs 3A4 and 2C8. The effect of CYP2C8*3 genotype on N-desmethyl imatinib formation was unknown. 2. We examined imatinib N-demethylation in human liver microsomes (HLMs) genotyped for CYP2C8*3, in CYP2C8*3/*3 pooled HLMs and in recombinant CYP2C8 and CYP3A4 enzymes. Effects of CYP-selective inhibitors on N-demethylation were also determined. 3. A single-enzyme Michaelis-Menten model with autoinhibition best fitted CYP2C8*1/*1 HLM (n = 5) and recombinant CYP2C8 kinetic data (median ± SD Ki = 139 ± 61 µM and 149 µM, respectively). Recombinant CYP3A4 showed two-site enzyme kinetics with no autoinhibition. Three of four CYP2C8*1/*3 HLMs showed single-enzyme kinetics with no autoinhibition. Binding affinity was higher in CYP2C8*1/*3 than CYP2C8*1/*1 HLM (median ± SD Km = 6 ± 2 versus 11 ± 2 µM, P=0.04). CYP2C8*3/*3 (pooled HLM) also showed high binding affinity (Km = 4 µM) and single-enzyme weak autoinhibition (Ki = 449 µM) kinetics. CYP2C8 inhibitors reduced HLM N-demethylation by 47-75%, compared to 0-30% for CYP3A4 inhibitors. 4. In conclusion, CYP2C8*3 is a gain-of-function polymorphism for imatinib N-demethylation, which appears to be mainly mediated by CYP2C8 and not CYP3A4 in vitro in HLM.
DEFF Research Database (Denmark)
Møller, A M; Jensen, N M; Pildal, J
2001-01-01
This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single-s......-tolerant subjects. In conclusion, we found no evidence supporting the hypothesis that genetic variability in the minimal promoter of the GLUT2 is associated with type 2 diabetes or prediabetic phenotypes in the Danish population.......This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single...
Energy Technology Data Exchange (ETDEWEB)
Xue, Shanshan [Department of Physiology and Pathophysiology, Tianjin Medical University, Tianjin, 300070 (China); Department of Pediatrics, Baodi District People’s Hospital of Tianjin City, Tianjin, 301800 (China); Wang, Jiaxing [Department of Physiology and Pathophysiology, Peking University Health Science Center, Beijing, 100191 (China); Zhang, Xu; Shi, Ying; Li, Bochuan; Bao, Qiankun [Department of Physiology and Pathophysiology, Tianjin Medical University, Tianjin, 300070 (China); Pang, Wei [Department of Physiology and Pathophysiology, Peking University Health Science Center, Beijing, 100191 (China); Ai, Ding [Department of Physiology and Pathophysiology, Tianjin Medical University, Tianjin, 300070 (China); Zhu, Yi [Department of Physiology and Pathophysiology, Tianjin Medical University, Tianjin, 300070 (China); Department of Physiology and Pathophysiology, Peking University Health Science Center, Beijing, 100191 (China); He, Jinlong, E-mail: hejinlong@tmu.edu.cn [Department of Physiology and Pathophysiology, Tianjin Medical University, Tianjin, 300070 (China)
2016-08-19
Activated vascular endothelium inflammation under persistent hyperlipidemia is the initial step of atherogenesis. ATP-binding cassette G1 (ABCG1) is a crucial factor maintaining sterol and lipid homeostasis by transporting cholesterol efflux to high-density lipoprotein. In this study, we investigated the protective effects of ABCG1 in endothelial inflammation activation during early-stage atherogenesis in mice and the underlying mechanisms. Endothelial cell (EC)-specific ABCG1 transgenic (EC-ABCG1-Tg) mice were generated and cross-bred with low-density lipoprotein receptor–deficient (Ldlr{sup −/−}) mice. After a 4-week Western-type diet, the mice were sacrificed for assessing atherosclerosis. Human umbilical vein ECs were treated with different flows, and ABCG1 was adenovirally overexpressed to investigate the mechanism in vitro. Compared with Ldlr{sup −/−} mouse aortas, EC-ABCG1-Tg/Ldlr{sup −/−} aortas showed decreased early-stage lesions. Furthermore, the lesion area in the EC-ABCG1-Tg/Ldlr{sup −/−} mouse aortic arch but not thoracic aorta was significantly reduced, which suggests a protective role of ABCG1 under atheroprone flow. In vitro, overexpression of ABCG1 attenuated EC activation caused by oscillatory shear stress. Overexpression of ABCG1 blunted cholesterol-activated ECs in vitro. In exploring the mechanisms of ABCG1 attenuating endothelial inflammation, we found that ABCG1 inhibited oscillatory flow-activated nuclear factor kappa B and NLRP3 inflammasome in ECs. ABCG1 may play a protective role in early-stage atherosclerosis by reducing endothelial activation induced by oscillatory shear stress via suppressing the inflammatory response. - Highlights: • EC-ABCG1-Tg mice in a Ldlr{sup −/−} background showed decreased atherosclerosis. • Overexpression of ABCG1 in ECs decreased OSS-induced EC activation. • NLRP3 and NF-κB might be an underlying mechanism of ABCG1 protective role.
Cyclooxygenase 2 Promotes Parathyroid Hyperplasia in ESRD
Zhang, Qian; Qiu, Junsi; Li, Haiming; Lu, Yanwen; Wang, Xiaoyun; Yang, Junwei; Wang, Shaoqing; Zhang, Liyin; Gu, Yong; Hao, Chuan-Ming
2011-01-01
Hyperplasia of the PTG underlies the secondary hyperparathyroidism (SHPT) observed in CKD, but the mechanism underlying this hyperplasia is incompletely understood. Because aberrant cyclooxygenase 2 (COX2) expression promotes epithelial cell proliferation, we examined the effects of COX2 on the parathyroid gland in uremia. In patients with ESRD who underwent parathyroidectomy, clusters of cells within the parathyroid glands had increased COX2 expression. Some COX2-positive cells exhibited two nuclei, consistent with proliferation. Furthermore, nearly 78% of COX2-positive cells expressed proliferating cell nuclear antigen (PCNA). In the 5/6-nephrectomy rat model, rats fed a high-phosphate diet had significantly higher serum PTH levels and larger parathyroid glands than sham-operated rats. Compared with controls, the parathyroid glands of uremic rats exhibited more PCNA-positive cells and greater COX2 expression in the chief cells. Treatment with COX2 inhibitor celecoxib significantly reduced PCNA expression, attenuated serum PTH levels, and reduced the size of the glands. In conclusion, COX2 promotes the pathogenesis of hyperparathyroidism in ESRD, suggesting that inhibiting the COX2 pathway could be a potential therapeutic target. PMID:21335517
Directory of Open Access Journals (Sweden)
Li Li
Full Text Available Aerial plant surfaces are covered by epicuticular waxes that among other purposes serve to control water loss. Maize glossy mutants originally identified by their "glossy" phenotypes exhibit alterations in the accumulation of epicuticular waxes. By combining data from a BSR-Seq experiment and the newly developed Seq-Walking technology, GRMZM2G118243 was identified as a strong candidate for being the glossy13 gene. The finding that multiple EMS-induced alleles contain premature stop codons in GRMZM2G118243, and the one knockout allele of gl13, validates the hypothesis that gene GRMZM2G118243 is gl13. Consistent with this, GRMZM2G118243 is an ortholog of AtABCG32 (Arabidopsis thaliana, HvABCG31 (barley and OsABCG31 (rice, which encode ABCG subfamily transporters involved in the trans-membrane transport of various secondary metabolites. We therefore hypothesize that gl13 is involved in the transport of epicuticular waxes onto the surfaces of seedling leaves.
Directory of Open Access Journals (Sweden)
Jennifer Hochscherf
2017-12-01
Full Text Available Protein kinase CK2, a member of the eukaryotic protein kinase superfamily, is associated with cancer and other human pathologies and thus an attractive drug target. The indeno[1,2-b]indole scaffold is a novel lead structure to develop ATP-competitive CK2 inhibitors. Some indeno[1,2-b]indole-based CK2 inhibitors additionally obstruct ABCG2, an ABC half transporter overexpressed in breast cancer and co-responsible for drug efflux and resistance. Comprehensive derivatization studies revealed substitutions of the indeno[1,2-b]indole framework that boost either the CK2 or the ABCG2 selectivity or even support the dual inhibition potential. The best indeno[1,2-b]indole-based CK2 inhibitor described yet (IC50 = 25 nM is 5-isopropyl-4-(3-methylbut-2-enyl-oxy-5,6,7,8-tetrahydroindeno[1,2-b]indole-9,10-dione (4p. Herein, we demonstrate the membrane permeability of 4p and describe co-crystal structures of 4p with CK2α and CK2α′, the paralogs of human CK2 catalytic subunit. As expected, 4p occupies the narrow, hydrophobic ATP site of CK2α/CK2α′, but surprisingly with a unique orientation: its hydrophobic substituents point towards the solvent while its two oxo groups are hydrogen-bonded to a hidden water molecule. An equivalent water molecule was found in many CK2α structures, but never as a critical mediator of ligand binding. This unexpected binding mode is independent of the interdomain hinge/helix αD region conformation and of the salt content in the crystallization medium.
International Nuclear Information System (INIS)
Kato, Toshiro; Kawase, Yasuo
1976-01-01
A direct evidence of the inhibitory effect in a cell-free system of S. cerevisiae was experimentally studied, and the site of action of Denmert (S-n-butyl S'-p-tert-butylbenzyl N-3-pyridyldithiocarbon-imidate) in sterol biosynthesis was examined. 14 C-labeled lanosterol and 14-desmethyl-lanosterol were biosynthetically prepared. DL-mevalonate-2- 14 C was incubated with yeast cell-free homogenates for 3 hr at 28 deg C while being shaked vigorously in atmospheric oxygen. The resultant 14 C-labeled sterol was extracted and chromatographed on a silicic acid-Hyflo Super Cel column. 4,4-dimethyl sterol thus obtained was acetylated with acetic anhydride and pyridine. The separation of lanosteryl acetate and 14-desmethyl lanosteryl acetate was accomplished on alumina thin-layer plates. After the saponification of each steryl acetate, the quantity of the sterol was assessed by gas chromatography with cholesterol as an internal standard. The incubation of the 14 C-labeled sterol was achieved under the same conditions as those for the DL-mevalonate-2- 14 C except the addition of the substrate which was dispersed in 0.1M phosphate buffer. Denmert inhibited the conversion of 14 C-labeled lanosterol to 4-desmethyl sterol, while the conversion of 14 C-labeled 14-desmethyl lanosterol to 4-desmethyl sterol was hardly affected by the fungicide. Therefore, Denmert is a potent selective inhibitor of the demethylation at the C-14 position in ergosterol biosynthesis. The fungicide, triarimol, exhibited the same effect on sterol biosynthesis as that of Denmert. (Iwakiri, K.)
Identification of functional DNA variants in the constitutive promoter region of MDM2
Directory of Open Access Journals (Sweden)
Lalonde Marie-Eve
2012-09-01
Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.
Characterization of the promoter of human CRTh2, a prostaglandin D{sub 2} receptor
Energy Technology Data Exchange (ETDEWEB)
Quapp, Russell; Madsen, Norman [Department of Medicine, Division of Pulmonary Medicine, Pulmonary Research Group, 574B Heritage Medical Research Centre, University of Alberta, Edmonton, AB, T6G 2S2 (Canada); Cameron, Lisa [Department of Medicine, Division of Pulmonary Medicine, Pulmonary Research Group, 574B Heritage Medical Research Centre, University of Alberta, Edmonton, AB, T6G 2S2 (Canada)
2007-11-30
Chemoattractant-receptor homologous molecule expressed on Th2 cells (CRTh2) is a receptor for prostaglandin (PG)D{sub 2}, a lipid mediator involved in allergic inflammation. CRTh2 is expressed by Th2 cells, eosinophils and basophils and PDG{sub 2}-CRTh2 signaling induces calcium mobilization, cell migration and expression of the Th2 cytokines IL-4, IL-5, and IL-13. Despite the role of CRTh2 in allergic inflammation, transcriptional regulation of this gene has not been studied. Here, we demonstrated that a reporter construct of the CRTh2 promoter was induced following T cell stimulation. This activity could be further enhanced by over-expression of GATA-3, but not NFAT2 or STAT6. Electromobility shift assay demonstrated GATA-3 binding to a probe from the CRTh2 promoter. This study provides the first detailed analysis of transcriptional regulation of the human CRTh2 promoter. These findings may help identify strategies to attenuate expression of this gene and influence the maintenance and proliferation of Th2 cells in allergic inflammation.
H2A/K pseudogene mutation may promote cell proliferation
Energy Technology Data Exchange (ETDEWEB)
Guo, Jisheng; Jing, Ruirui; Lv, Xin; Wang, Xiaoyue; Li, Junqiang; Li, Lin; Li, Cuiling; Wang, Daoguang; Bi, Baibing; Chen, Xinjun [Cancer Research Center, Shandong University School of Medicine, Jinan 250012 (China); Yang, Jing-Hua, E-mail: sdu_crc_group1@126.com [Cancer Research Center, Shandong University School of Medicine, Jinan 250012 (China); Department of Surgery, VA Boston Healthcare System, Boston University School of Medicine, Boston 510660, MA (United States)
2016-05-15
Highlights: • The mutant H2A/K pseudogene is active. • The mutant H2A/K pseudogene can promote cell proliferation. - Abstract: Little attention has been paid to the histone H2A/K pseudogene. Results from our laboratory showed that 7 of 10 kidney cancer patients carried a mutant H2A/K pseudogene; therefore, we were interested in determining the relationship between mutant H2A/K and cell proliferation. We used shotgun and label-free proteomics methods to study whether mutant H2A/K lncRNAs affected cell proliferation. Quantitative proteomic analysis indicated that the expression of mutant H2A/K lncRNAs resulted in the upregulation of many oncogenes, which promoted cell proliferation. Further interaction analyses revealed that a proliferating cell nuclear antigen (PCNA)-protein interaction network, with PCNA in the center, contributes to cell proliferation in cells expressing the mutant H2A/K lncRNAs. Western blotting confirmed the critical upregulation of PCNA by mutant H2A/K lncRNA expression. Finally, the promotion of cell proliferation by mutant H2A/K lncRNAs (C290T, C228A and A45G) was confirmed using cell proliferation assays. Although we did not determine the exact mechanism by which the oncogenes were upregulated by the mutant H2A/K lncRNAs, we confirmed that the mutant H2A/K lncRNAs promoted cell proliferation by upregulating PCNA and other oncogenes. The hypothesis that cell proliferation is promoted by the mutant H2A/K lncRNAs was supported by the protein expression and cell proliferation assay results. Therefore, mutant H2A/K lncRNAs may be a new factor in renal carcinogenesis.
Characterization and sequence analysis of the F2 promoter from corynephage BFK20
International Nuclear Information System (INIS)
Koptides, M.; Ugorcakova, J.; Baloghova, E.; Bukovska, G.; Timko, J.
1994-01-01
F2 promoter from corynephage BFK20 was isolated and characterized. It was functional in Escherichia coli and Corynebacterium glutamicum. Cloning of the F2 promoter into the pJUP05 promoter probe vector caused an increase of the neomycin phosphotransferase II specific activity. According to the Northern blot hybridization the nptII gene was expressed from the cloned F2 promoter. The apparent transcription start point in E. coli and C. glutamicum was determined. The-35 region of F2 promoter showed high similarity to that of E. coli promoter consensus sequence, but its - 10 region was G+C rich and had no significant homology to that. (author)
Directory of Open Access Journals (Sweden)
Adena S Spiro
Full Text Available The ABC transporters P-glycoprotein (P-gp, Abcb1 and breast cancer resistance protein (Bcrp, Abcg2 regulate the CNS disposition of many drugs. The main psychoactive constituent of cannabis Δ(9-tetrahydrocannabinol (THC has affinity for P-gp and Bcrp, however it is unknown whether these transporters modulate the brain accumulation of THC and its functional effects on the CNS. Here we aim to show that mice devoid of Abcb1 and Abcg2 retain higher brain THC levels and are more sensitive to cannabinoid-induced hypothermia than wild-type (WT mice. Abcb1a/b (-/-, Abcg2 (-/- and wild-type (WT mice were injected with THC before brain and blood were collected and THC concentrations determined. Another cohort of mice was examined for THC-induced hypothermia by measuring rectal body temperature. Brain THC concentrations were higher in both Abcb1a/b (-/- and Abcg2 (-/- mice than WT mice. ABC transporter knockout mice exhibited delayed elimination of THC from the brain with the effect being more prominent in Abcg2 (-/- mice. ABC transporter knockout mice were more sensitive to THC-induced hypothermia compared to WT mice. These results show P-gp and Bcrp prolong the brain disposition and hypothermic effects of THC and offer a novel mechanism for both genetic vulnerability to the psychoactive effects of cannabis and drug interactions between CNS therapies and cannabis.
Directory of Open Access Journals (Sweden)
Mingquan Chen
Full Text Available FBP1, fructose-1,6-bisphosphatase-1, a gluconeogenesis regulatory enzyme, catalyzes the hydrolysis of fructose 1,6-bisphosphate to fructose 6-phosphate and inorganic phosphate. The mechanism that it functions to antagonize glycolysis and was epigenetically inactivated through NF-kappaB pathway in gastric cancer has been reported. However, its role in the liver carcinogenesis still remains unknown. Here, we investigated the expression and DNA methylation of FBP1 in primary HCC and colon tumor. FBP1 was lowly expressed in 80% (8/10 human hepatocellular carcinoma, 66.7% (6/9 liver cancer cell lines and 100% (6/6 colon cancer cell lines, but was higher in paired adjacent non-tumor tissues and immortalized normal cell lines, which was well correlated with its promoter methylation status. Methylation was further detected in primary HCCs, gastric and colon tumor tissues, but none or occasionally in paired adjacent non-tumor tissues. Detailed methylation analysis of 29 CpG sites at a 327-bp promoter region by bisulfite genomic sequencing confirmed its methylation. FBP1 silencing could be reversed by chemical demethylation treatment with 5-aza-2'-deoxycytidine (Aza, indicating direct epigenetic silencing. Restoring FBP1 expression in low expressed cells significantly inhibited cell growth and colony formation ability through the induction of G2-M phase cell cycle arrest. Moreover, the observed effects coincided with an increase in reactive oxygen species (ROS generation. In summary, epigenetic inactivation of FBP1 is also common in human liver and colon cancer. FBP1 appears to be a functional tumor suppressor involved in the liver and colon carcinogenesis.
MIWI2 as an Effector of DNA Methylation and Gene Silencing in Embryonic Male Germ Cells
Directory of Open Access Journals (Sweden)
Kanako Kojima-Kita
2016-09-01
Full Text Available During the development of mammalian embryonic germ cells, global demethylation and de novo DNA methylation take place. In mouse embryonic germ cells, two PIWI family proteins, MILI and MIWI2, are essential for the de novo DNA methylation of retrotransposons, presumably through PIWI-interacting RNAs (piRNAs. Although piRNA-associated MIWI2 has been reported to play critical roles in the process, its molecular mechanisms have remained unclear. To identify the mechanism, transgenic mice were produced; they contained a fusion protein of MIWI2 and a zinc finger (ZF that recognized the promoter region of a type A LINE-1 gene. The ZF-MIWI2 fusion protein brought about DNA methylation, suppression of the type A LINE-1 gene, and a partial rescue of the impaired spermatogenesis of MILI-null mice. In addition, ZF-MIWI2 was associated with the proteins involved in DNA methylation. These data indicate that MIWI2 functions as an effector of de novo DNA methylation of the retrotransposon.
Directory of Open Access Journals (Sweden)
Cheng-Bin Chen
2010-08-01
Full Text Available The aim of the study was the explain the mechanism related to therapeutic effects of Uremic Clearance Granules (Niaoduqing Keli in Chinese on adenine-induced Chronic Renal Failure in rats. Thirty 8-week-old male Wistar rats were selected and randomly divided in to 3 groups: Normal Control Group (NCGconsisted of 10 rats, Chronic Renal Failure Pathological Control Group (PCG 10 rats, and Uremic Clearance Granules Treatment Group (UCG 10 rats. Each rat in PCG and UCG was fed with adenine-enriched diets, containing 10 g adenine per kg food for 6 weeks. After fed with adenine, each rat in UCG was administered orally with 2 ml solution of Uremic Clearance Granules for 6 weeks. The concentration of Uremic Clearance Granules solution was 0.42 g/ml which was 10 times of human. On days 42 and 84, the serum levels of creatinine, Blood Urea Nitrogen and homocysteine were determined. The methylation of TGFbeta1 promoter was tested by methylation-specific PCR. TGF-beta1 mRNA and protein expression in rat renal cortex were analyzed by real-time RT-PCR and Immunohistochemistry. (1 Experimented on model of Chronic Renal Failure in rats, the preparation was proved to be able to reduce serum creatinine, Blood Urea Nitrogen, and homocysteine (p<0.05, improve renal function. (2 The expression of TGF-beta1 in mRNA and protein level were down-regulated. (3 TGF-beta1 promoter was demethylated at some loci in PCG, and was recovered in UCG. After treatment with Uremic Clearance Granules, the Chronic Renal Failure Wistar rat's kidney function was recovered. The recovery may be result of the remethylation of TGF-beta1 promoter and then lead to TGF-beta1 be transcripted and translated normally. The experimental study explain the molecular mechanism by which Uremic Clearance Granules treat Chronic Renal Failure.
Huang, M-Y; Xuan, F; Liu, W; Cui, H-J
2017-01-19
It is generally known that histone demethylases regulate gene transcription by altering the methylate status on histones, but their roles in cancers and the underlying molecular mechanisms still remain unclear. MYC-induced nuclear antigen (MINA) is reported to be a histone demethylase and highly expressed in many cancers. Here, for the first time, we show that MINA is involved in glioblastoma carcinogenesis and reveal the probable mechanisms of it in cell-cycle control. Kaplan-Meier analysis of progression-free survival showed that high MINA expression was strongly correlated with poor outcome and advancing tumor stage. MINA knockdown significantly repressed the cell proliferation and tumorigenesis abilities of glioblastoma cells in vitro and in vivo that were rescued by overexpressing the full-length MINA afterwards. Microarray analysis after knockdown of MINA revealed that MINA probably regulated glioblastoma carcinogenesis through the predominant cell-cycle pathways. Further investigation showed that MINA deficiency led to a cell-cycle arrest in G1 and G2 phases. And among the downstream genes, we found that cyclins and cyclin-dependent kinases were directly activated by MINA via the demethylation of H3K9me3.
CO2 methanation on the catalyst of Ni/MCM-41 promoted with CeO2.
Wang, Xiaoliu; Zhu, Lingjun; Liu, Yincong; Wang, Shurong
2018-06-01
CO 2 as a raw feed combined with renewable hydrogen for the production of useful chemicals and alternative energy products is one of the solutions to environmental and energy problems. In this study, a series of Ni-xCeO 2 /MCM-41 catalysts with a nickel content of 20wt% were prepared through deposition precipitation method for CO 2 methanation. Different characterization methods, including BET, XRD, TEM, SEM, H 2 -TPR and H 2 -TPD were applied to help explore the influence mechanism of CeO 2 on Ni/MCM-41 in CO 2 methanation. It was found that all CeO 2 -promoted catalysts exhibited enhanced catalytic activity when compared to Ni/MCM-41. The catalyst modified with 20wt% CeO 2 showed the best catalytic performance, with CO 2 conversion and CH 4 selectivity of 85.6% and 99.8%, respectively, at the temperature of 380°C under atmospheric pressure. The synergetic effects among Ni 0 active sites, the promoter and the support, including nickel dispersion improvement and increased CO 2 adsorption sites due to the addition of CeO 2 , were considered as important factors for high reactivity of the promoted catalysts. The stability test showed that the promoted catalyst maintained its high reactivity after 30h. Copyright © 2017 Elsevier B.V. All rights reserved.
Promoter2.0: for the recognition of PolII promoter sequences
DEFF Research Database (Denmark)
Knudsen, Steen; Knudsen, Steen
1999-01-01
Motivation : A new approach to the prediction of eukaryotic PolII promoters from DNA sequence takesadvantage of a combination of elements similar to neural networks and genetic algorithms to recognize a set ofdiscrete subpatterns with variable separation as one pattern: a promoter. The neural...... of optimization, the algorithm was able todiscriminate between vertebrate promoter and non-promoter sequences in a test set with a correlationcoefficient of 0.63. In addition, all five known transcription start sites on the plus strand of the completeadenovirus genome were within 161 bp of 35 predicted...
TiO2 promoted by two different non-noble metal cocatalysts for enhanced photocatalytic H2 evolution
International Nuclear Information System (INIS)
Lin, Jing-Dong; Yan, Shi; Huang, Qin-Dong; Fan, Mei-Ting; Yuan, You-Zhu; Tan, Timothy Thatt-Yang; Liao, Dai-Wei
2014-01-01
TiO 2 photocatalysts modified by cobalt and nickel cocatalysts were prepared via polymerized complex method (PCM) and evaluated by photocatalytic hydrogen evolution. Hydrogen generation in 6 h for the TiO 2 promoted by cobalt and nickel (0.1%Co + 0.2%Ni/TiO 2 ) is about two times (2456 μmol H 2 ) compared to that of TiO 2 promoted only by cobalt (1180 μmol H 2 for 0.1%Co/TiO 2 ) or nickel (1127 μmol H 2 for 0.2%Ni/TiO 2 ), and mechanically mixed TiO 2 promoted by cobalt and TiO 2 promoted by nickel (0.1%Co/TiO 2 :0.2%Ni/TiO 2 = 1:1 (m/m), 1282 μmol H 2 ). The high photocatalytic H 2 evolution activity over TiO 2 promoted by cobalt and nickel is ascribed to enhanced photo response due to the presence of cobalt and nickel impurity level, and effective separation of photogenerated electrons and holes due to the synergistic effect of cobalt and nickel, which serve as active sites for H 2 evolution reaction (HER) and oxidation reaction (OR) respectively. This study demonstrates a viable strategy to design more active photocatalysts for photocatalytic H 2 evolution by substituting noble metals with more abundant elements using as HER and OR cocatalysts, respectively.
Guo, Mengjie; Dai, Xiaohua; Hu, Dongmin; Zhang, Yu; Sun, Yong; Ren, Weilong; Wang, Liping
2016-09-01
P-glycoprotein ( P-GP: , encoding gene Abcb1) and Breast Cancer Resistance Protein ( BCRP: , encoding gene Abcg2) are transport proteins that play a major role in modulating the bioavailability of oral drugs in humans and rodents. It has been shown that rifampicin is the typical inducer of P-gp in rodents by activating the nuclear receptor. However, its effect on Abcb1, Abcg2, CYP3A, and chicken xenobiotic-sensing orphan nuclear receptor ( CXR: ) mRNA expression in broilers is poorly understood. This study explored the effect of rifampicin on mRNA expression of Abcb1, Abcg2, CYP3A37, CXR as well as its effect on the pharmacokinetics of enrofloxacin in broilers. The mRNA levels of Abcb1, Abcg2, CYP3A37, and CXR were significantly increased in the liver (except Abcg2), kidney, jejunum, and ileum (P 0.05) after treated with rifampicin. Further analysis revealed that the variation tendencies of Abcb1, Abcg2, and CYP3A37 expression levels were significantly correlated with CXR mRNA expression levels in liver, kidney, jejunum, and ileum. Coadministration of rifampicin significantly changed the pharmacokinetic behavior of enrofloxacin orally administered by showing clearly lower AUC0-∞, AUC0-t, and Cmax as well as longer Tmax. The bioavailability of orally administered enrofloxacin was decreased from 72.5% to 24.8% by rifampicin. However, rifampicin did not significantly change the pharmacokinetics of enrofloxacin following intravenous administration. Our study shows that rifampicin up-regulated the small intestinal level of P-gp and BCRP and suggests that P-gp and BCRP are key factors that affected pharmacokinetic behavior of orally administered enrofloxacin by limiting its absorption from the intestine in broilers. © 2016 Poultry Science Association Inc.
Dual effects of the PI3K inhibitor ZSTK474 on multidrug efflux pumps in resistant cancer cells.
Muthiah, Divya; Callaghan, Richard
2017-11-15
ZSTK474 is a potent phosphoinositide 3-kinase (PI3K) inhibitor that reduces cell proliferation via G 1 -arrest. However, there is little information on the susceptibility of this anticancer drug to resistance conferred by the multidrug pumps P-glycoprotein (ABCB1) and ABCG2. We have demonstrated that ZSTK474 generated cytotoxicity in cells over-expressing either pump with potency similar to that in drug sensitive cells. In addition, the co-administration of ZSTK474 with the cytotoxic anti-cancer drugs vinblastine and mitoxantrone caused a potentiated cytotoxic effect in both drug sensitive and efflux pump expressing cells. These observations suggest that ZSTK474 is unaffected by the presence of multidrug efflux pumps and may circumvent their activities. Indeed, ZSTK474 increased the cellular accumulation of calcein-AM and mitoxantrone in cells expressing ABCB1 and ABCG2, respectively. ZSTK474 treatment also resulted in reduced expression of both efflux pumps in multidrug resistant cancer cells. Measurement of ABCB1 or ABCG2 mRNA levels demonstrated that the reduction was not due to altered transcription. Similarly, inhibitor studies showed that the proteasomal degradation pathway for ABCB1 and the lysosomal route for ABCG2 degradation were unaffected by ZSTK474. Thus the mechanism underlying reduced ABCB1 and ABCG2 levels caused by ZSTK474 was due to a reduction in overall protein synthesis; a process influenced by the PI3K pathway. In summary, ZSTK474 is not susceptible to efflux by the resistance mediators ABCB1 and ABCG2. Moreover, it inhibits the drug transport function of the pumps and leads to a reduction in their cellular expression levels. Our observations demonstrate that ZSTK474 is a powerful anticancer drug. Copyright © 2017 Elsevier B.V. All rights reserved.
Induction of NFATc2 expression by interleukin 6 promotes T helper type 2 differentiation.
Diehl, Sean; Chow, Chi-Wing; Weiss, Linda; Palmetshofer, Alois; Twardzik, Thomas; Rounds, Laura; Serfling, Edgar; Davis, Roger J; Anguita, Juan; Rincón, Mercedes
2002-07-01
Interleukin (IL)-6 is produced by professional antigen-presenting cells (APCs) such as B cells, macrophages, and dendritic cells. It has been previously shown that APC-derived IL-6 promotes the differentiation of naive CD4+ T cells into effector T helper type 2 (Th2) cells. Here, we have studied the molecular mechanism for IL-6-mediated Th2 differentiation. During the activation of CD4+ T cells, IL-6 induces the production of IL-4, which promotes the differentiation of these cells into effector Th2 cells. Regulation of IL-4 gene expression by IL-6 is mediated by nuclear factor of activated T cells (NFAT), as inhibition of NFAT prevents IL-6-driven IL-4 production and Th2 differentiation. IL-6 upregulates NFAT transcriptional activity by increasing the levels of NFATc2. The ability of IL-6 to promote Th2 differentiation is impaired in CD4+ T cells that lack NFATc2, demonstrating that NFATc2 is required for regulation of IL-4 gene expression by IL-6. Regulation of NFATc2 expression and NFAT transcriptional activity represents a novel pathway by which IL-6 can modulate gene expression.
Aquaporin 2 promotes cell migration and epithelial morphogenesis.
Chen, Ying; Rice, William; Gu, Zhizhan; Li, Jian; Huang, Jianmin; Brenner, Michael B; Van Hoek, Alfred; Xiong, Jianping; Gundersen, Gregg G; Norman, Jim C; Hsu, Victor W; Fenton, Robert A; Brown, Dennis; Lu, Hua A Jenny
2012-09-01
The aquaporin 2 (AQP2) water channel, expressed in kidney collecting ducts, contributes critically to water homeostasis in mammals. Animals lacking or having significantly reduced levels of AQP2, however, have not only urinary concentrating abnormalities but also renal tubular defects that lead to neonatal mortality from renal failure. Here, we show that AQP2 is not only a water channel but also an integrin-binding membrane protein that promotes cell migration and epithelial morphogenesis. AQP2 expression modulates the trafficking and internalization of integrin β1, facilitating its turnover at focal adhesions. In vitro, disturbing the interaction between AQP2 and integrin β1 by mutating the RGD motif led to reduced endocytosis, retention of integrin β1 at the cell surface, and defective cell migration and tubulogenesis. Similarly, in vivo, AQP2-null mice exhibited significant retention of integrin β1 at the basolateral membrane and had tubular abnormalities. In summary, these data suggest that the water channel AQP2 interacts with integrins to promote renal epithelial cell migration, contributing to the structural and functional integrity of the mammalian kidney.
Khan, Hafizurrahman; Singh, Radha Dutt; Tiwari, Ratnakar; Gangopadhyay, Siddhartha; Roy, Somendu Kumar; Singh, Dhirendra; Srivastava, Vikas
2017-07-01
Mercury is one of the major heavy metal pollutants occurring in elemental, inorganic and organic forms. Due to ban on most inorganic mercury containing products, human exposure to mercury generally occurs as methylmercury (MeHg) by consumption of contaminated fish and other sea food. Animal and epidemiological studies indicate that MeHg affects neural and renal function. Our study is focused on nephrotoxic potential of MeHg. In this study, we have shown for the first time how MeHg could epigenetically modulate matrix metalloproteinase 9(MMP9) to promote nephrotoxicity using an animal model of sub chronic MeHg exposure. MeHg caused renal toxicity as was seen by increased levels of serum creatinine and expression of early nephrotoxicity markers (KIM-1, Clusterin, IP-10, and TIMP). MeHg exposure also correlated strongly with induction of MMP9 mRNA and protein in a dose dependent manner. Further, while induction of MMP9 promoted cytoskeleton disruption and loss of cell-cell adhesion (loss of F-actin, Vimentin and Fibronectin), inhibition of MMP9 was found to reduce these disruptions. Mechanistic studies by ChIP analysis showed that MeHg modulated MMP9 by promoting demethylation of its regulatory region to increase its expression. Bisulfite sequencing identified critical CpGs in the first exon of MMP9 which were demethylated following MeHg exposure. ChIP studies also showed loss of methyl binding protein, MeCP2 and transcription factor PEA3 at the demethylated site confirming decreased CpG methylation. Our studies thus show how MeHg could epigenetically modulate MMP9 to promote cytoskeleton disruption leading to loss of renal function. Copyright © 2017 Elsevier B.V. All rights reserved.
HMGA2 promotes adipogenesis by activating C/EBPβ-mediated expression of PPARγ
Energy Technology Data Exchange (ETDEWEB)
Xi, Yang; Shen, Wanjing; Ma, Lili; Zhao, Ming; Zheng, Jiachen [Diabetes Center, and Zhejiang Provincial Key Laboratory of Pathophysiology, Institute of Biochemistry and Molecular Biology, School of Medicine, Ningbo University, Ningbo 315211 (China); Bu, Shizhong, E-mail: bushizhong@nbu.edu.cn [Diabetes Center, and Zhejiang Provincial Key Laboratory of Pathophysiology, Institute of Biochemistry and Molecular Biology, School of Medicine, Ningbo University, Ningbo 315211 (China); Hino, Shinjiro [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto, 860-0811 (Japan); Nakao, Mitsuyoshi, E-mail: mnakao@gpo.kumamoto-u.ac.jp [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto, 860-0811 (Japan); Core Research for Evolutional Science and Technology (CREST), Japan Agency for Medical Research and Development, Tokyo (Japan)
2016-04-15
Adipogenesis is orchestrated by a highly ordered network of transcription factors including peroxisome-proliferator activated receptor-gamma (PPARγ) and CCAAT-enhancer binding protein (C/EBP) family proteins. High mobility group protein AT-hook 2 (HMGA2), an architectural transcription factor, has been reported to play an essential role in preadipocyte proliferation, and its overexpression has been implicated in obesity in mice and humans. However, the direct role of HMGA2 in regulating the gene expression program during adipogenesis is not known. Here, we demonstrate that HMGA2 is required for C/EBPβ-mediated expression of PPARγ, and thus promotes adipogenic differentiation. We observed a transient but marked increase of Hmga2 transcript at an early phase of differentiation of mouse 3T3-L1 preadipocytes. Importantly, Hmga2 knockdown greatly impaired adipocyte formation, while its overexpression promoted the formation of mature adipocytes. We found that HMGA2 colocalized with C/EBPβ in the nucleus and was required for the recruitment of C/EBPβ to its binding element at the Pparγ2 promoter. Accordingly, HMGA2 and C/EBPβ cooperatively enhanced the Pparγ2 promoter activity. Our results indicate that HMGA2 is an essential constituent of the adipogenic transcription factor network, and thus its function may be affected during the course of obesity. - Highlights: • Overexpression of HMGA2 has been implicated in obesity in mice and humans. • HMGA2 is required for adipocyte formation. • HMGA2 colocalizes with C/EBPβ and is required for C/EBPβ recruitment to Pparγ2 promoter. • HMGA2 and C/EBPβ cooperatively enhance the Pparγ2 promoter activity.
HMGA2 promotes adipogenesis by activating C/EBPβ-mediated expression of PPARγ
International Nuclear Information System (INIS)
Xi, Yang; Shen, Wanjing; Ma, Lili; Zhao, Ming; Zheng, Jiachen; Bu, Shizhong; Hino, Shinjiro; Nakao, Mitsuyoshi
2016-01-01
Adipogenesis is orchestrated by a highly ordered network of transcription factors including peroxisome-proliferator activated receptor-gamma (PPARγ) and CCAAT-enhancer binding protein (C/EBP) family proteins. High mobility group protein AT-hook 2 (HMGA2), an architectural transcription factor, has been reported to play an essential role in preadipocyte proliferation, and its overexpression has been implicated in obesity in mice and humans. However, the direct role of HMGA2 in regulating the gene expression program during adipogenesis is not known. Here, we demonstrate that HMGA2 is required for C/EBPβ-mediated expression of PPARγ, and thus promotes adipogenic differentiation. We observed a transient but marked increase of Hmga2 transcript at an early phase of differentiation of mouse 3T3-L1 preadipocytes. Importantly, Hmga2 knockdown greatly impaired adipocyte formation, while its overexpression promoted the formation of mature adipocytes. We found that HMGA2 colocalized with C/EBPβ in the nucleus and was required for the recruitment of C/EBPβ to its binding element at the Pparγ2 promoter. Accordingly, HMGA2 and C/EBPβ cooperatively enhanced the Pparγ2 promoter activity. Our results indicate that HMGA2 is an essential constituent of the adipogenic transcription factor network, and thus its function may be affected during the course of obesity. - Highlights: • Overexpression of HMGA2 has been implicated in obesity in mice and humans. • HMGA2 is required for adipocyte formation. • HMGA2 colocalizes with C/EBPβ and is required for C/EBPβ recruitment to Pparγ2 promoter. • HMGA2 and C/EBPβ cooperatively enhance the Pparγ2 promoter activity.
Wang, Yan; Cordewener, Jan H G; America, Antoine H P; Shan, Weixing; Bouwmeester, Klaas; Govers, Francine
2015-09-01
L-type lectin receptor kinases (LecRK) are potential immune receptors. Here, we characterized two closely-related Arabidopsis LecRK, LecRK-IX.1 and LecRK-IX.2, of which T-DNA insertion mutants showed compromised resistance to Phytophthora brassicae and Phytophthora capsici, with double mutants showing additive susceptibility. Overexpression of LecRK-IX.1 or LecRK-IX.2 in Arabidopsis and transient expression in Nicotiana benthamiana increased Phytophthora resistance but also induced cell death. Phytophthora resistance required both the lectin domain and kinase activity, but for cell death, the lectin domain was not needed. Silencing of the two closely related mitogen-activated protein kinase genes NbSIPK and NbNTF4 in N. benthamiana completely abolished LecRK-IX.1-induced cell death but not Phytophthora resistance. Liquid chromatography-mass spectrometry analysis of protein complexes coimmunoprecipitated in planta with LecRK-IX.1 or LecRK-IX.2 as bait, resulted in the identification of the N. benthamiana ABC transporter NbPDR1 as a potential interactor of both LecRK. The closest homolog of NbPDR1 in Arabidopsis is ABCG40, and coimmunoprecipitation experiments showed that ABCG40 associates with LecRK-IX.1 and LecRK-IX.2 in planta. Similar to the LecRK mutants, ABCG40 mutants showed compromised Phytophthora resistance. This study shows that LecRK-IX.1 and LecRK-IX.2 are Phytophthora resistance components that function independent of each other and independent of the cell-death phenotype. They both interact with the same ABC transporter, suggesting that they exploit similar signal transduction pathways.
Directory of Open Access Journals (Sweden)
Eunsohl Lee
2016-09-01
Full Text Available Cancer metastasis is a multistep process associated with the induction of an epithelial-mesenchymal transition (EMT and cancer stem cells (CSCs. Although significant progress has been made in understanding the molecular mechanisms regulating EMT and the CSC phenotype, little is known of how these processes are regulated by epigenetics. Here we demonstrate that reduced expression of DNA methyltransferase 1 (DNMT1 plays an important role in the induction of EMT and the CSC phenotype by prostate cancer (PCa cells, with enhanced tumorigenesis and metastasis. First, we observed that reduction of DNMT1 by 5-azacitidine (5-Aza promotes EMT induction as well as CSCs and sphere formation in vitro. Reduced expression of DNMT1 significantly increased PCa migratory potential. We showed that the increase of EMT and CSC activities by reduction of DNMT1 is associated with the increase of protein kinase C. Furthermore, we confirmed that silencing DNMT1 is correlated with enhancement of the induction of EMT and the CSC phenotype in PCa cells. Additionally, chromatin immunoprecipitation assay reveals that reduction of DNMT1 promotes the suppression of H3K9me3 and H3K27me3 on the Zeb2 and KLF4 promoter region in PCa cells. Critically, we found in an animal model that significant tumor growth and more disseminated tumor cells in most osseous tissues were observed following injection of 5-Aza pretreated–PCa cells compared with vehicle-pretreated PCa cells. Our results suggest that epigenetic alteration of histone demethylation regulated by reduction of DNMT1 may control induction of EMT and the CSC phenotype, which facilitates tumorigenesis in PCa cells and has important therapeutic implications in targeting epigenetic regulation.
The Usage of Web 2.0 as a Media Promotion in Indonesia University Libraries
Directory of Open Access Journals (Sweden)
Nove E. Variant Anna
2015-04-01
Full Text Available The usage of web 2.0 has become popular among young people in Indonesia. One of the purpose of using web 2.0 is for promotion in some university libraries. The emerging of the web 2.0 as promotional media is corelating with the development of digital library. The paper aims are (1 to describe the usage of web 2.0 for academic libraries promotion. (2 to describe the information / content of those web 2.0. (3 to describe the promotion activity through web 2.0. This research population is all university libraries in Indonesia, but only 40 university libraries that conduct promotion through web 2.0. The website observation is done between May-July 2013. The research results are (1 the university libraries in Indonesia are use facebook, twitter, and flicker to promote library programs and interaction with users. The web 2.0 consist of information about new book release, user education, general information about library services, and information literacy. (3 some of univerity libraries taking seriously and actively promote their library services, but some of them are don’t use the web 2.0.
The Usage of Web 2.0 as a Media Promotion in Indonesia University Libraries
Directory of Open Access Journals (Sweden)
Nove E. Variant Anna
2018-01-01
Full Text Available The usage of web 2.0 has become popular among young people in Indonesia. One of the purpose of using web 2.0 is for promotion in some university libraries. The emerging of the web 2.0 as promotional media is corelating with the development of digital library. The paper aims are (1 to describe the usage of web 2.0 for academic libraries promotion. (2 to describe the information / content of those web 2.0. (3 to describe the promotion activity through web 2.0. This research population is all university libraries in Indonesia, but only 40 university librraries that conduct promotion through web 2.0. The website observation is done between May-July 2013. The research results are (1 the university libraries in Indonesia are use facebook, twitter, and flikr to promote library programs and interaction with users. The web 2.0 consist of information about new book release, user education, general information about library services, and information literacy. (3 some of univerity libraries taking seriously and actively promote their library services, but some of them are don’t use the web 2.0.
Kot, Marta; Daniel, Władysława A
2009-01-01
The aim of the present study was to test the effect of diethyldithiocarbamate (DDC), which is regarded as a cytochrome P450 (CYP) CYP2A6 and CYP2E1 inhibitor, and ticlopidine, an efficient CYP2B6, CYP2C19 and CYP2D6 inhibitor, on the activity of human CYP1A2 and the metabolism of caffeine (1-N-, 3-N- and 7-N-demethylation, and C-8-hydroxylation). The experiment was carried out in vitro using human cDNA-expressed CYP1A2 (Supersomes) and human pooled liver microsomes. The effects of DDC and ticlopidine were compared to those of furafylline (a strong CYP1A2 inhibitor). A comparative in vitro study provides clear evidence that ticlopidine and DDC, applied at concentrations that inhibit the above-mentioned CYP isoforms, potently (as compared to furafylline) inhibit human CYP1A2 and caffeine metabolism, in particular 1-N- and 3-N-demethylation.
Directory of Open Access Journals (Sweden)
Francescopaolo Di Cello
Full Text Available Downregulation of the tight junction protein claudin 1 is a frequent event in breast cancer and is associated with recurrence, metastasis, and reduced survival, suggesting a tumor suppressor role for this protein. Tumor suppressor genes are often epigenetically silenced in cancer. Downregulation of claudin 1 via DNA promoter methylation may thus be an important determinant in breast cancer development and progression. To investigate if silencing of claudin 1 has an epigenetic etiology in breast cancer we compared gene expression and methylation data from 217 breast cancer samples and 40 matched normal samples available through the Cancer Genome Atlas (TCGA. Moreover, we analyzed claudin 1 expression and methylation in 26 breast cancer cell lines. We found that methylation of the claudin 1 promoter CpG island is relatively frequent in estrogen receptor positive (ER+ breast cancer and is associated with low claudin 1 expression. In contrast, the claudin 1 promoter was not methylated in most of the ER-breast cancers samples and some of these tumors overexpress claudin 1. In addition, we observed that the demethylating agents, azacitidine and decitabine can upregulate claudin 1 expression in breast cancer cell lines that have a methylated claudin 1 promoter. Taken together, our results indicate that DNA promoter methylation is causally associated with downregulation of claudin 1 in a subgroup of breast cancer that includes mostly ER+ tumors, and suggest that epigenetic therapy to restore claudin 1 expression might represent a viable therapeutic strategy in this subtype of breast cancer.
Wang, Xinxuan; Feng, Zhihui; Li, Qimeng; Yi, Baicheng; Xu, Qiong
2018-04-13
Dental pulp inflammation is a bacterially driven inflammation process characterized by the local accumulation of cytokines/chemokines that participate in destructive processes in the pulp. Multiple mechanisms are involved in dental pulp inflammation, including epigenetic events, such as DNA methylation/demethylation. Ten-eleven translocation 2 (TET2) is a recently discovered DNA methylcytosine dioxygenase that plays important roles in inflammatory disease. However, its role in the inflammatory response of dental pulp is unknown. We observed elevated mRNA and protein levels of TET2 after lipopolysaccharide (LPS) stimulation in human dental pulp cells (hDPCs). To identify the effects of TET2 on cytokine expression, TET2 was knocked down and cytokines were detected using a cytokine antibody array after LPS stimulation. The protein expression of GM-CSF, IL-6, IL-8 and RANTES decreased in the LPS-induced hDPCs following TET2 knockdown. The downregulated expression levels of IL-6 and IL-8 were further confirmed by real-time quantitative polymerase chain reaction (qRT-PCR) and enzyme-linked immunosorbent assay (ELISA). Additionally, the phosphorylation levels of IKK-α/β, p65 and IκBα of the NF-κB signaling pathway were decreased in the TET2-silenced group. Furthermore, the global 5-hydroxymethylcytosine (5hmC) level was significantly decreased and the genomic 5-methylcytosine (5mC) level was increased in the TET2-deficient hDPCs; TET2 depletion resulted in a decrease in the 5hmC level of the MyD88 promoter following LPS stimulation. These findings indicate that TET2 knockdown inhibits LPS-induced inflammatory response in hDPCs by downregulating MyD88 hydroxymethylation. Thus, TET2-dependent DNA demethylation might play an important role in dental pulp inflammation as an epigenetic regulator.
Directory of Open Access Journals (Sweden)
Régis T. Costello
2015-01-01
Full Text Available Epigenetic drugs modify DNA methylation and are used in refractory anemia with excess of blasts (RAEB. These drugs may reactivate anti-oncogene expression and restore a normal phenotype instead of inducing antitumor toxicity, although they also have immunosuppressive effects on T-lymphocytes [1] In RAEB and acute myeloid leukemia, a defect in natural killer (NK cell cytotoxicity has been shown, which relies on abnormal expression of activating receptors. Previous study has shown that 5-azacytidine impaired mRNA synthesis and induced apoptosis in NK cells [2]. In this study we investigated the effect of the demethylating drug 5-azacytidine (Vidaza® on NK receptors with the hypothesis that demethylation of the promoters of activating NK receptor genes induces gene reactivation and thus may increase their expression.
Directory of Open Access Journals (Sweden)
Ha-Won Jeong
2011-04-01
Full Text Available Our previous work shows that the stem cell factor SALL4 plays a central role in embryonic and leukemic stem cells. In this study, we report that SALL4 expression was higher in drug resistant primary acute myeloid leukemic patients than those from drug-responsive cases. In addition, while overexpression of SALL4 led to drug resistance in cell lines, cells with decreased SALL4 expression were more sensitive to drug treatments than the parental cells. This led to our investigation of the implication of SALL4 in drug resistance and its role in side population (SP cancer stem cells. SALL4 expression was higher in SP cells compared to non-SP cells by 2-4 fold in various malignant hematopoietic cell lines. Knocking down of SALL4 in isolated SP cells resulted in a reduction of SP cells, indicating that SALL4 is required for their self-renewal. The SP phenotype is known to be mediated by members of the ATP-binding cassette (ABC drug transport protein family, such as ABCG2 and ABCA3. Using chromatin-immunoprecipitation (ChIP, quantitative reverse transcription polymerase chain reaction (qRT-PCR and electrophoretic mobility shift assay(EMSA, we demonstrated that SALL4 was able to bind to the promoter region of ABCA3 and activate its expression while regulating the expression of ABCG2 indirectly. Furthermore, SALL4 expression was positively correlated to those of ABCG2 and ABCA3 in primary leukemic patient samples. Taken together, our results suggest a novel role for SALL4 in drug sensitivity, at least in part through the maintenance of SP cells, and therefore may be responsible for drug-resistance in leukemia. We are the first to demonstrate a direct link between stem cell factor SALL4, SP and drug resistance in leukemia.
MECP2 promoter methylation and X chromosome inactivation in autism.
Nagarajan, Raman P; Patzel, Katherine A; Martin, Michelle; Yasui, Dag H; Swanberg, Susan E; Hertz-Picciotto, Irva; Hansen, Robin L; Van de Water, Judy; Pessah, Isaac N; Jiang, Ruby; Robinson, Wendy P; LaSalle, Janine M
2008-06-01
Epigenetic mechanisms have been proposed to play a role in the etiology of autism. This hypothesis is supported by the discovery of increased MECP2 promoter methylation associated with decreased MeCP2 protein expression in autism male brain. To further understand the influence of female X chromosome inactivation (XCI) and neighboring methylation patterns on aberrant MECP2 promoter methylation in autism, multiple methylation analyses were peformed on brain and blood samples from individuals with autism. Bisulfite sequencing analyses of a region 0.6 kb upstream of MECP2 in brain DNA samples revealed an abrupt transition from a highly methylated region in both sexes to a region unmethylated in males and subject to XCI in females. Chromatin immunoprecipitation analysis demonstrated that the CCTC-binding factor (CTCF) bound to this transition region in neuronal cells, consistent with a chromatin boundary at the methylation transition. Male autism brain DNA samples displayed a slight increase in methylation in this transition region, suggesting a possible aberrant spreading of methylation into the MECP2 promoter in autism males across this boundary element. In addition, autistic female brain DNA samples showed evidence for aberrant MECP2 promoter methylation as an increase in the number of bisulfite sequenced clones with undefined XCI status for MECP2 but not androgen receptor (AR). To further investigate the specificity of MECP2 methylation alterations in autism, blood DNA samples from females and mothers of males with autism were also examined for XCI skewing at AR, but no significant increase in XCI skewing was observed compared to controls. These results suggest that the aberrant MECP2 methylation in autism brain DNA samples is due to locus-specific rather than global X chromosome methylation changes.
International Nuclear Information System (INIS)
Hylander, Lars D.; Ahlgren, Ingemar; Erikson, Rolf; Lantz, Peter; Toernblom, Erik; Forsberg, Bruce R.; Guimaraes, Jean R.D.; Meili, Markus; Montenegro Guillen, Salvador; Vammen, Katherine; Altamirano, Maximina; Zelaya, Argentina; Sarria Sacasa, Karla; Jimenez, Mario
2001-01-01
Increased awareness about the toxicity of mercury (Hg) has during the latest decades resulted in reduced Hg use in industrialised countries. Developing countries, on the contrary, have largely increased their anthropogenic Hg emissions caused by its use in gold mining, transfer of Hg emitting factories from developed countries, and increased burning of coal without appropriate flue gas cleaning. These increased emissions occur mainly in the tropics, where the fate of Hg is not well documented. The aim of the present study is to increase the knowledge about Hg levels and transformations in two tropical areas affected by anthropogenic Hg emissions - the Pantanal wetland in Brazil, housing gold miners using the amalgamation method, and Lake Xolotilan (Managua) in Nicaragua, where a chlor-alkali plant relocated from the USA has emitted much Hg. Actual Hg content in water, biota, and sediment will be determined by atomic fluorescence spectrophotometry and atomic absorption spectrophotometry. Mercury inethylation capacity in sediments and selected biota will be determined with in-situ incubations with 203 Hg and subsequent radiological measurements. Factors affecting the methylation and demethylation rates will be identified by varying environmental conditions such as pH, redox potential, conductivity, light, temperature, geochemical factors and population of bacteria. Sediment turnover will be studied by determining fallout cesium ( 137 Cs) in sediment profiles. The study is expected to increase the knowledge about Hg-transformations in the tropics and point out proper measures to reduce health hazards due to Hg-exposure. (author)
Directory of Open Access Journals (Sweden)
Shimrat Mamrut
Full Text Available Oxytocin is a peptide hormone, well known for its role in labor and suckling, and most recently for its involvement in mammalian social behavior. All central and peripheral actions of oxytocin are mediated through the oxytocin receptor, which is the product of a single gene. Transcription of the oxytocin receptor is subject to regulation by gonadal steroid hormones, and is profoundly elevated in the uterus and mammary glands during parturition. DNA methylation is a major epigenetic mechanism that regulates gene transcription, and has been linked to reduced expression of the oxytocin receptor in individuals with autism. Here, we hypothesized that transcription of the mouse oxytocin receptor is regulated by DNA methylation of specific sites in its promoter, in a tissue-specific manner. Hypothalamus-derived GT1-7, and mammary-derived 4T1 murine cell lines displayed negative correlations between oxytocin receptor transcription and methylation of the gene promoter, and demethylation caused a significant enhancement of oxytocin receptor transcription in 4T1 cells. Using a reporter gene assay, we showed that methylation of specific sites in the gene promoter, including an estrogen response element, significantly inhibits transcription. Furthermore, methylation of the oxytocin receptor promoter was found to be differentially correlated with oxytocin receptor expression in mammary glands and the uterus of virgin and post-partum mice, suggesting that it plays a distinct role in oxytocin receptor transcription among tissues and under different physiological conditions. Together, these results support the hypothesis that the expression of the mouse oxytocin receptor gene is epigenetically regulated by DNA methylation of its promoter.
Energy Technology Data Exchange (ETDEWEB)
Walesch, Sara K.; Richter, Antje M. [Institute for Genetics, Justus-Liebig-University Giessen, D-35392 Giessen (Germany); Helmbold, Peter [Department of Dermatology, University of Heidelberg, D-69120 Heidelberg (Germany); Dammann, Reinhard H., E-mail: reinhard.dammann@gen.bio.uni-giessen.de [Institute for Genetics, Justus-Liebig-University Giessen, D-35392 Giessen (Germany)
2015-07-07
Epigenetic inactivation of tumor-related genes is an important characteristic in the pathology of human cancers, including melanomagenesis. We analyzed the epigenetic inactivation of Claudin 11 (CLDN11) in malignant melanoma (MM) of the skin, including six melanoma cell lines, 39 primary melanoma, 41 metastases of MM and 52 nevus cell nevi (NCN). CLDN11 promoter hypermethylation was found in 19 out of 39 (49%) of the primary MM and in 21 out of 41 (51%) of the MM metastases, but only in eight out of 52 (15%) of NCN (p = 0.001 and p = 0.0003, respectively). Moreover, a significant increase in the methylation level of CLDN11 from primary melanomas to MM metastases was revealed (p = 0.003). Methylation of CLDN11 was significantly more frequent in skin metastases (79%) compared to brain metastases (31%; p = 0.007). CLDN11 methylation was also found in five out of six MM cell lines (83%) and its promoter hypermethylation correlated with a reduced expression. Treatment of MM cell lines with a DNA methylation inhibitor reactivated CLDN11 transcription by its promoter demethylation. In summary, CLDN11 proved to be an epigenetically inactivated tumor related gene in melanomagenesis, and analysis of CLDN11 methylation level represents a potential tool for assisting in the discrimination between malignant melanoma and nevus cell nevi.
EXSPRESSION OF MDR-GENES AND MONORESISTANCE GENES IN NON-SMALL-CELL LUNG CANCER
Directory of Open Access Journals (Sweden)
E. L. Yumov
2014-01-01
Full Text Available We studied the expression of multidrug resistance genes (MDR and monoresistance genes in normal bronchial tissue and tumor tissue of the non-small cell lung cancer (NSCLC after neoadjuvant chemotherapy (NACT (vinorelbine-carboplatine. The study included 30 patients with NSCLC (Т2–4N0–3M0. Normal bronchial tissue, normal lung tissue and tumor tissue collected during surgery following neoadjuvant chemotherapy (NACT served as a material of the study. The expression levels of MDR genes (ABCB1, ABCB2, ABCC1, ABCC2, ABCС5, ABCG1, ABCG2, GSTP and MVP, and monoresistance genes (BRCA1, ERCC1, RRM1, TOP1, TOP2A, TUBB3 and TYMS were estimated by quantitative reverse transcriptase PCR (RT-qPCR. The expression levels of some MDR genes and monoresistance genes (АВСВ1, АВСВ2, ABCG1, ERCC1, GSTP1 and MVP were significantly higher in the bronchi than in tumor tissue. The expression of ABCG1, ABCG2 and ERCC1 genes was higher in patients with T1-2 cancer than in patients with T3-4 cancer. Patients with adenocarcinoma had higher expression of BRCA1, MVP and ABCB1 genes than patients with squamous cell lung cancer. A tendency towards reduction in the expression level of MDR-genes and monoresistance genes was observed in patients with partial tumor regression compared to that observed in patients with stable disease. These findings were consistent with the previous data on reduction in the MDR-gene expression after chemotherapy with a good response in breast cancer patients.
Directory of Open Access Journals (Sweden)
Khanabdali R
2015-12-01
Full Text Available Ramin Khanabdali,1 Anbarieh Saadat,1 Maizatul Fazilah,1 Khairul Fidaa’ Khairul Bazli,1 Rida-e-Maria Qazi,2 Ramla Sana Khalid,2 Durriyyah Sharifah Hasan Adli,1 Soheil Zorofchian Moghadamtousi,1 Nadia Naeem,2 Irfan Khan,2 Asmat Salim,2 ShamsulAzlin Ahmad Shamsuddin,1 Gokula Mohan1 1Institute of Biological Sciences, Faculty of Science, University of Malaya, Kuala Lumpur, Malaysia; 2Dr Panjwani Center for Molecular Medicine and Drug Research, International Center for Chemical and Biological Sciences, University of Karachi, Karachi, Pakistan Abstract: Small molecules, growth factors, and cytokines have been used to induce differentiation of stem cells into different lineages. Similarly, demethylating agents can trigger differentiation in adult stem cells. Here, we investigated the in vitro differentiation of rat bone marrow mesenchymal stem cells (MSCs into cardiomyocytes by a demethylating agent, zebularine, as well as neuronal-like cells by β-mercaptoethanol in a growth factor or cytokines-free media. Isolated bone marrow-derived MSCs cultured in Dulbecco’s Modified Eagle’s Medium exhibited a fibroblast-like morphology. These cells expressed positive markers for CD29, CD44, and CD117 and were negative for CD34 and CD45. After treatment with 1 µM zebularine for 24 hours, the MSCs formed myotube-like structures after 10 days in culture. Expression of cardiac-specific genes showed that treated MSCs expressed significantly higher levels of cardiac troponin-T, Nkx2.5, and GATA-4 compared with untreated cells. Immunocytochemical analysis showed that differentiated cells also expressed cardiac proteins, GATA-4, Nkx 2.5, and cardiac troponin-T. For neuronal differentiation, MSCs were treated with 1 and 10 mM β-mercaptoethanol overnight for 3 hours in complete and serum-free Dulbecco’s Modified Eagle’s Medium, respectively. Following overnight treatment, neuron-like cells with axonal and dendritic-like projections originating from the
International Nuclear Information System (INIS)
Hurst, Helen C
2001-01-01
Overexpression of the ERBB2 proto-oncogene is associated with amplification of the gene in breast cancer but increased activity of the promoter also plays a significant role. Members of two transcription factor families (AP-2 and Ets) show increased binding to the promoter in over-expressing cells. Consequently, strategies have been devised to target promoter activity, either through the DNA binding sites for these factors, or through another promoter sequence, a polypurine-polypyrimidine repeat structure. The promoter has also been exploited for its tumour-specific activity to direct the accumulation of cytotoxic compounds selectively within cancer cells. Our current understanding of the ERBB2 promoter is reviewed and the status of these therapeutic avenues is discussed
Effects of emodin on the demethylation of tumor-suppressor genes in pancreatic cancer PANC-1 cells.
Zhang, Hao; Chen, Liang; Bu, He-Qi; Yu, Qing-Jiang; Jiang, Dan-Dan; Pan, Feng-Ping; Wang, Yu; Liu, Dian-Lei; Lin, Sheng-Zhang
2015-06-01
Emodin, a natural anthraquinone derivative isolated from Rheum palmatum, has been reported to inhibit the growth of pancreatic cancer cells through different modes of action; yet, the detailed mechanism remains unclear. In the present study, we hypothesized that emodin exerts its antitumor effect by participating in the regulation of the DNA methylation level. Our research showed that emodin inhibited the growth of pancreatic cancer PANC-1 cells in a dose- and time-dependent manner. Dot-blot results showed that 40 µM emodin significantly inhibited genomic 5 mC expression in the PANC-1 cells, and mRNA-Seq showed that different concentrations of emodin could alter the gene expression profile in the PANC-1 cells. BSP confirmed that the methylation levels of P16, RASSF1A and ppENK were decreased, while concomitantly the unmethylated status was increased. RT-PCR and western blotting results confirmed that the low expression or absence of expression of mRNA and protein in the PANC-1 cells was re-expressed following treatment with emodin. In conclusion, our study for the first time suggests that emodin inhibits pancreatic cancer cell growth, which may be related to the demethylation of tumor-suppressor genes. The related mechanism may be through the inhibition of methyltransferase expression.
Ultrasound promoted and SiO2/CCl3COOH mediated synthesis of 2 ...
Indian Academy of Sciences (India)
First one-pot synthesis of 2-aryl-1-arylmethyl-1H- benzimidazole derivatives from ... to promote chemical reactions is called sonochemistry .... −1): 1615, 2845, 2980, 3036, 3067; 1H NMR (500MHz,. CDCl3):δ 5.38 (s, 2H, CH2), 6.65 (d, J = 8.0 ...
Czech Academy of Sciences Publication Activity Database
Sabat, Nazarii; Smolen, Sabina; Nauš, Petr; Perlíková, Pavla; Cebová, M.; Poštová Slavětínská, Lenka; Hocek, Michal
2017-01-01
Roč. 49, č. 20 (2017), s. 4623-4650 ISSN 0039-7881 R&D Projects: GA ČR(CZ) GA16-00178S; GA MZd(CZ) NV15-31984A Grant - others:AV ČR(CZ) AP1501 Program:Akademická prémie - Praemium Academiae Institutional support: RVO:61388963 Keywords : deazapurines * pyrrolo[2,3-d]pyrimidines * nucleobases * Suzuki-Miyaura cross-coupling * deprotection * demethylation Subject RIV: CC - Organic Chemistry OBOR OECD: Organic chemistry Impact factor: 2.650, year: 2016
Directory of Open Access Journals (Sweden)
Wen-Ting Yang
Full Text Available OBJECTIVE: The KLF4 gene has been shown to be inactivated in cervical carcinogenesis as a tumor suppressor. However, the mechanism of KLF4 silencing in cervical carcinomas has not yet been identified. DNA methylation plays a key role in stable suppression of gene expression. METHODS: The methylation status of the KLF4 promoter CpG islands was analyzed by bisulfite sequencing (BSQ in tissues of normal cervix and cervical cancer. KLF4 gene expression was detected by RT-PCR, immunohistochemistry and western blot. KLF4 promoter methylation in cervical cancer cell line was determined by BSQ and methylation-specific polymerase chain reaction (MS-PCR. Cell proliferation ability was detected by cell growth curve and MTT assay. RESULTS: The methylated allele was found in 41.90% of 24 cervical cancer tissues but only in 11.11% of 11 normal cervix tissues (P<0.005. KLF4 mRNA levels were significantly reduced in cervical cancer tissues compared with normal cervix tissues (P<0.01 and KLF4 mRNA expression showed a significant negative correlation with the promoter hypermethylation (r = -0.486, P = 0.003. Cervical cancer cell lines also showed a significant negative correlation between KLF4 expression and hypermethylation. After treatment with the demethylating agent 5-Azacytidine (5-Aza, the expression of KLF4 in the cervical cancer cell lines at both mRNA and protein levels was drastically increased, the cell proliferation ability was inhibited and the chemosensitivity for cisplatin was significantly increased. CONCLUSION: KLF4 gene is inactivated by methylation-induced silencing mechanisms in a large subset of cervical carcinomas and KLF4 promoter hypermethylation inactivates the gene's function as a tumor suppressor in cervical carcinogenesis.
DEFF Research Database (Denmark)
Møller, A M; Jensen, N M; Pildal, J
2001-01-01
This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single......-tolerant subjects. In conclusion, we found no evidence supporting the hypothesis that genetic variability in the minimal promoter of the GLUT2 is associated with type 2 diabetes or prediabetic phenotypes in the Danish population.......-strand conformational polymorphism and heteroduplex analysis followed by direct sequencing of identified variants on genomic DNA from 96 randomly recruited Danish type 2 diabetic patients. We identified 4 nucleotide variants, -447g-->a, -149c-->a, -122t-->c, and -44g-->a. None of the variants were positioned in known...
Directory of Open Access Journals (Sweden)
Bee Kee Ooi
2017-11-01
Full Text Available Oxidative stress is an important risk factor contributing to the pathogenesis of cardiovascular diseases. Oxidative stress that results from excessive reactive oxygen species (ROS production accounts for impaired endothelial function, a process which promotes atherosclerotic lesion or fatty streaks formation (foam cells. Nuclear factor erythroid 2-related factor 2 (Nrf2 is a transcription factor involved in cellular redox homeostasis. Upon exposure to oxidative stress, Nrf2 is dissociated from its inhibitor Keap-1 and translocated into the nucleus, where it results in the transcriptional activation of cell defense genes. Nrf2 has been demonstrated to be involved in the protection against foam cells formation by regulating the expression of antioxidant proteins (HO-1, Prxs, and GPx1, ATP-binding cassette (ABC efflux transporters (ABCA1 and ABCG1 and scavenger receptors (scavenger receptor class B (CD36, scavenger receptor class A (SR-A and lectin-type oxidized LDL receptor (LOX-1. However, Nrf2 has also been reported to exhibit pro-atherogenic effects. A better understanding on the mechanism of Nrf2 in oxidative stress-induced cardiac injury, as well as the regulation of cholesterol uptake and efflux, are required before it can serve as a novel therapeutic target for cardiovascular diseases prevention and treatment.
Simulation and modeling CO2 absorption in biogas with DEA promoted K2CO3 solution in packed column
Nurkhamidah, Siti; Altway, Ali; Airlangga, Bramantyo; Emilia, Dwi Putri
2017-05-01
Absorption of carbon dioxide (CO2) using potassium carbonate (K2CO3) is one of biogas purification method. However, K2CO3 have slow mass transfer in liquid phase. So it is necessary to eliminate the disadvantage of CO2 absorption using K2CO3 by adding promotor (activator). Diethanol amine (DEA) is one of promotor which can increase its reaction rate. Simulation and modeling research of the CO2 absorption from biogas with DEA promoted K2CO3 solution has not been conducted. Thus, the main goal of this research is create model and simulation for the CO2 absorption from biogas with DEA promoted K2CO3 solution, then observe the influence of promoter concentration. DEA concentration varies between 1-5 %wt. From the simulation, we concluded that the CO2 removal rise with the increasing of promoter concentration. The highest CO2 removal is 54.5318 % at 5 % wt DEA concentration.
Common variants in the TPH2 promoter confer susceptibility to paranoid schizophrenia.
Yi, Zhenghui; Zhang, Chen; Lu, Weihong; Song, Lisheng; Liu, Dentang; Xu, Yifeng; Fang, Yiru
2012-07-01
Serotonergic system-related genes may be good candidates in investigating the genetic basis of schizophrenia. Our previous study suggested that promoter region of tryptophan hydroxylase 2 gene (TPH2) may confer the susceptibility to paranoid schizophrenia. In this study, we investigated whether common variants within TPH2 promoter may predispose to paranoid schizophrenia in Han Chinese. A total of 509 patients who met DSM-IV criteria for paranoid schizophrenia and 510 matched healthy controls were recruited for this study. Five polymorphisms within TPH2 promoter region were tested. No statistically significant differences were found in allele or genotype frequencies between schizophrenic patients and healthy controls. The frequency of the rs4448731T-rs6582071A-rs7963803A-rs4570625T-rs11178997A haplotype was significantly higher in cases compared to the controls (P = 0.003; OR = 1.49; 95% CI, 1.15-1.95). Our results suggest that the common variants within TPH2 promoter are associated with paranoid schizophrenia in Han Chinese. Further studies in larger samples are warranted to elucidate the role of TPH2 in the etiology of paranoid schizophrenia.
MRG15 activates the cdc2 promoter via histone acetylation in human cells
International Nuclear Information System (INIS)
Pena, AndreAna N.; Tominaga, Kaoru; Pereira-Smith, Olivia M.
2011-01-01
Chromatin remodeling is required for transcriptional activation and repression. MRG15 (MORF4L1), a chromatin modulator, is a highly conserved protein and is present in complexes containing histone acetyltransferases (HATs) as well as histone deacetylases (HDACs). Loss of expression of MRG15 in mice and Drosophila results in embryonic lethality and fibroblast and neural stem/progenitor cells cultured from Mrg15 null mouse embryos exhibit marked proliferative defects when compared with wild type cells. To determine the role of MRG15 in cell cycle progression we performed chromatin immunoprecipitation with an antibody to MRG15 on normal human fibroblasts as they entered the cell cycle from a quiescent state, and analyzed various cell cycle gene promoters. The results demonstrated a 3-fold increase in MRG15 occupancy at the cdc2 promoter during S phase of the cell cycle and a concomitant increase in acetylated histone H4. H4 lysine 12 was acetylated at 24 h post-serum stimulation while there was no change in acetylation of lysine 16. HDAC1 and 2 were decreased at this promoter during cell cycle progression. Over-expression of MRG15 in HeLa cells activated a cdc2 promoter-reporter construct in a dose-dependent manner, whereas knockdown of MRG15 resulted in decreased promoter activity. In order to implicate HAT activity, we treated cells with the HAT inhibitor anacardic acid and determined that HAT inhibition results in loss of expression of cdc2 mRNA. Further, chromatin immunoprecipitation with Tip60 localizes the protein to the same 110 bp stretch of the cdc2 promoter pulled down by MRG15. Additionally, we determined that cotransfection of MRG15 with the known associated HAT Tip60 had a cooperative effect in activating the cdc2 promoter. These results suggest that MRG15 is acting in a HAT complex involving Tip60 to modify chromatin via acetylation of histone H4 at the cdc2 promoter to activate transcription.
MRG15 activates the cdc2 promoter via histone acetylation in human cells
Energy Technology Data Exchange (ETDEWEB)
Pena, AndreAna N., E-mail: andreana.pena@gmail.com [Sam and Ann Barshop Institute for Longevity and Aging Studies, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Tominaga, Kaoru; Pereira-Smith, Olivia M. [Sam and Ann Barshop Institute for Longevity and Aging Studies, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States)
2011-07-01
Chromatin remodeling is required for transcriptional activation and repression. MRG15 (MORF4L1), a chromatin modulator, is a highly conserved protein and is present in complexes containing histone acetyltransferases (HATs) as well as histone deacetylases (HDACs). Loss of expression of MRG15 in mice and Drosophila results in embryonic lethality and fibroblast and neural stem/progenitor cells cultured from Mrg15 null mouse embryos exhibit marked proliferative defects when compared with wild type cells. To determine the role of MRG15 in cell cycle progression we performed chromatin immunoprecipitation with an antibody to MRG15 on normal human fibroblasts as they entered the cell cycle from a quiescent state, and analyzed various cell cycle gene promoters. The results demonstrated a 3-fold increase in MRG15 occupancy at the cdc2 promoter during S phase of the cell cycle and a concomitant increase in acetylated histone H4. H4 lysine 12 was acetylated at 24 h post-serum stimulation while there was no change in acetylation of lysine 16. HDAC1 and 2 were decreased at this promoter during cell cycle progression. Over-expression of MRG15 in HeLa cells activated a cdc2 promoter-reporter construct in a dose-dependent manner, whereas knockdown of MRG15 resulted in decreased promoter activity. In order to implicate HAT activity, we treated cells with the HAT inhibitor anacardic acid and determined that HAT inhibition results in loss of expression of cdc2 mRNA. Further, chromatin immunoprecipitation with Tip60 localizes the protein to the same 110 bp stretch of the cdc2 promoter pulled down by MRG15. Additionally, we determined that cotransfection of MRG15 with the known associated HAT Tip60 had a cooperative effect in activating the cdc2 promoter. These results suggest that MRG15 is acting in a HAT complex involving Tip60 to modify chromatin via acetylation of histone H4 at the cdc2 promoter to activate transcription.
PPARγ regulates the expression of cholesterol metabolism genes in alveolar macrophages
International Nuclear Information System (INIS)
Baker, Anna D.; Malur, Anagha; Barna, Barbara P.; Kavuru, Mani S.; Malur, Achut G.; Thomassen, Mary Jane
2010-01-01
Peroxisome proliferator-activated receptor-gamma (PPARγ) is a nuclear transcription factor involved in lipid metabolism that is constitutively expressed in the alveolar macrophages of healthy individuals. PPARγ has recently been implicated in the catabolism of surfactant by alveolar macrophages, specifically the cholesterol component of surfactant while the mechanism remains unclear. Studies from other tissue macrophages have shown that PPARγ regulates cholesterol influx, efflux, and metabolism. PPARγ promotes cholesterol efflux through the liver X receptor-alpha (LXRα) and ATP-binding cassette G1 (ABCG1). We have recently shown that macrophage-specific PPARγ knockout (PPARγ KO) mice accumulate cholesterol-laden alveolar macrophages that exhibit decreased expression of LXRα and ABCG1 and reduced cholesterol efflux. We hypothesized that in addition to the dysregulation of these cholesterol efflux genes, the expression of genes involved in cholesterol synthesis and influx was also dysregulated and that replacement of PPARγ would restore regulation of these genes. To investigate this hypothesis, we have utilized a Lentivirus expression system (Lenti-PPARγ) to restore PPARγ expression in the alveolar macrophages of PPARγ KO mice. Our results show that the alveolar macrophages of PPARγ KO mice have decreased expression of key cholesterol synthesis genes and increased expression of cholesterol receptors CD36 and scavenger receptor A-I (SRA-I). The replacement of PPARγ (1) induced transcription of LXRα and ABCG1; (2) corrected suppressed expression of cholesterol synthesis genes; and (3) enhanced the expression of scavenger receptors CD36. These results suggest that PPARγ regulates cholesterol metabolism in alveolar macrophages.
Pokemon and MEF2D co-operationally promote invasion of hepatocellular carcinoma.
Hong, Xin; Hong, Xing-Yu; Li, Tao; He, Cheng-Yan
2015-12-01
Hepatocellular carcinoma (HCC) is one of the most deadly human malignancy, and frequent invasion and metastasis is closely associated with its poor prognosis. However, the molecular mechanism underlying HCC invasion is still not completely elucidated. Pokemon is a well-established oncogene for HCC growth, but its contribution to HCC invasion has not been studied yet. In this paper, Pokemon was found to be overexpressed in MHCC-97H HCC cell line, which possesses higher invasiveness. Downregulation of Pokemon abolished the invasion of MHCC-97H HCC cell lines. Pokemon overexpression was able to enhance the invasion of MHCC-97L cells with lower invasiveness. MEF2D, an oncogene promoting the invasion of HCC cells, was further detected to be upregulated and downregulated when Pokemon was overexpressed and silenced, respectively. Online database analysis indicated that one Pokemon recognition site was located within the promoter of MEF2D. Chromatin co-precipitation, luciferase, and qPCR assays all proved that Pokemon can promote the expression of MEF2D in HCC cells. Restoration of MEF2D expression can prevent the impaired invasion of HCC cells with Pokemon silencing, while suppression of MEF2D abolished the effect of Pokemon overexpression on HCC invasion. More interestingly, MEF2D was also found to increase the transcription of Pokemon by binding myocyte enhancer factor 2 (MEF2) sites within its promoter region, implying an auto-regulatory circuit consisting of these two oncogenes that can promote HCC invasion. Our findings can contribute to the understanding of molecular mechanism underlying HCC invasion, and provided evidence that targeting this molecular loop may be a promising strategy for anti-invasion therapy.
Williams, Christopher S; Zhang, Baolin; Smith, J Joshua; Jayagopal, Ashwath; Barrett, Caitlyn W; Pino, Christopher; Russ, Patricia; Presley, Sai H; Peng, DunFa; Rosenblatt, Daniel O; Haselton, Frederick R; Yang, Jin-Long; Washington, M Kay; Chen, Xi; Eschrich, Steven; Yeatman, Timothy J; El-Rifai, Wael; Beauchamp, R Daniel; Chang, Min S
2011-10-01
The acquisition of a mesenchymal phenotype is a critical step in the metastatic progression of epithelial carcinomas. Adherens junctions (AJs) are required for suppressing this epithelial-mesenchymal transition (EMT) but less is known about the role of tight junctions (TJs) in this process. Here, we investigated the functions of blood vessel epicardial substance (BVES, also known as POPDC1 and POP1), an integral membrane protein that regulates TJ formation. BVES was found to be underexpressed in all stages of human colorectal carcinoma (CRC) and in adenomatous polyps, indicating its suppression occurs early in transformation. Similarly, the majority of CRC cell lines tested exhibited decreased BVES expression and promoter DNA hypermethylation, a modification associated with transcriptional silencing. Treatment with a DNA-demethylating agent restored BVES expression in CRC cell lines, indicating that methylation represses BVES expression. Reexpression of BVES in CRC cell lines promoted an epithelial phenotype, featuring decreased proliferation, migration, invasion, and anchorage-independent growth; impaired growth of an orthotopic xenograft; and blocked metastasis. Conversely, interfering with BVES function by expressing a dominant-negative mutant in human corneal epithelial cells induced mesenchymal features. These biological outcomes were associated with changes in AJ and TJ composition and related signaling. Therefore, BVES prevents EMT, and its epigenetic silencing may be an important step in promoting EMT programs during colon carcinogenesis.
RLIM interacts with Smurf2 and promotes TGF-β induced U2OS cell migration
International Nuclear Information System (INIS)
Huang, Yongsheng; Yang, Yang; Gao, Rui; Yang, Xianmei; Yan, Xiaohua; Wang, Chenji; Jiang, Sirui; Yu, Long
2011-01-01
Highlights: → RLIM directly binds to Smurf2. → RLIM enhances TGF-β responsiveness in U2OS cells. → RLIM promotes TGF-β driven migration of osteosarcoma U2OS cells. -- Abstract: TGF-β (transforming growth factor-β), a pleiotropic cytokine that regulates diverse cellular processes, has been suggested to play critical roles in cell proliferation, migration, and carcinogenesis. Here we found a novel E3 ubiquitin ligase RLIM which can directly bind to Smurf2, enhancing TGF-β responsiveness in osteosarcoma U2OS cells. We constructed a U2OS cell line stably over-expressing RLIM and demonstrated that RLIM promoted TGF-β-driven migration of U2OS cells as tested by wound healing assay. Our results indicated that RLIM is an important positive regulator in TGF-β signaling pathway and cell migration.
Overexpression of HMGA2-LPP fusion transcripts promotes expression of the α 2 type XI collagen gene
International Nuclear Information System (INIS)
Kubo, Takahiro; Matsui, Yoshito; Goto, Tomohiro; Yukata, Kiminori; Yasui, Natsuo
2006-01-01
In a subset of human lipomas, a specific t (3; 12) chromosome translocation gives rise to HMGA2-LPP fusion protein, containing the amino (N)-terminal DNA binding domains of HMGA2 fused to the carboxyl (C)-terminal LIM domains of LPP. In addition to its role in adipogenesis, several observations suggest that HMGA2-LPP is linked to chondrogenesis. Here, we analyzed whether HMGA2-LPP promotes chondrogenic differentiation, a marker of which is transactivation of the α 2 type XI collagen gene (Col11a2). Real-time PCR analysis showed that HMGA2-LPP and COL11A2 were co-expressed. Luciferase assay demonstrated that either of HMGA2-LPP, wild-type HMGA2 or the N-terminal HMGA2 transactivated the Col11a2 promoter in HeLa cells, while the C-terminal LPP did not. RT-PCR analysis revealed that HMGA2-LPP transcripts in lipomas with the fusion were 591-fold of full-length HMGA2 transcripts in lipomas without the fusion. These results indicate that in vivo overexpression of HMGA2-LPP promotes chondrogenesis by upregulating cartilage-specific collagen gene expression through the N-terminal DNA binding domains
Collaborative interplay between FGF-2 and VEGF-C promotes lymphangiogenesis and metastasis
DEFF Research Database (Denmark)
Cao, Renhai; Ji, Hong; Feng, Ninghan
2012-01-01
Interplay between various lymphangiogenic factors in promoting lymphangiogenesis and lymphatic metastasis remains poorly understood. Here we show that FGF-2 and VEGF-C, two lymphangiogenic factors, collaboratively promote angiogenesis and lymphangiogenesis in the tumor microenvironment, leading...... endothelial cell tip cell formation is a prerequisite for FGF-2-stimulated lymphangiogenesis. In the tumor microenvironment, the reciprocal interplay between FGF-2 and VEGF-C collaboratively stimulated tumor growth, angiogenesis, intratumoral lymphangiogenesis, and metastasis. Thus, intervention and targeting...
Genetic regulation of serum phytosterol levels and risk of coronary artery disease.
Teupser, Daniel; Baber, Ronny; Ceglarek, Uta; Scholz, Markus; Illig, Thomas; Gieger, Christian; Holdt, Lesca M; Leichtle, Alexander; Greiser, Karin H; Huster, Dominik; Linsel-Nitschke, Patrick; Schäfer, Arne; Braund, Peter S; Tiret, Laurence; Stark, Klaus; Raaz-Schrauder, Dorette; Fiedler, Georg M; Wilfert, Wolfgang; Beutner, Frank; Gielen, Stephan; Grosshennig, Anika; König, Inke R; Lichtner, Peter; Heid, Iris M; Kluttig, Alexander; El Mokhtari, Nour E; Rubin, Diana; Ekici, Arif B; Reis, André; Garlichs, Christoph D; Hall, Alistair S; Matthes, Gert; Wittekind, Christian; Hengstenberg, Christian; Cambien, Francois; Schreiber, Stefan; Werdan, Karl; Meitinger, Thomas; Loeffler, Markus; Samani, Nilesh J; Erdmann, Jeanette; Wichmann, H-Erich; Schunkert, Heribert; Thiery, Joachim
2010-08-01
Phytosterols are plant-derived sterols that are taken up from food and can serve as biomarkers of cholesterol uptake. Serum levels are under tight genetic control. We used a genomic approach to study the molecular regulation of serum phytosterol levels and potential links to coronary artery disease (CAD). A genome-wide association study for serum phytosterols (campesterol, sitosterol, brassicasterol) was conducted in a population-based sample from KORA (Cooperative Research in the Region of Augsburg) (n=1495) with subsequent replication in 2 additional samples (n=1157 and n=1760). Replicated single-nucleotide polymorphisms (SNPs) were tested for association with premature CAD in a metaanalysis of 11 different samples comprising 13 764 CAD cases and 13 630 healthy controls. Genetic variants in the ATP-binding hemitransporter ABCG8 and at the blood group ABO locus were significantly associated with serum phytosterols. Effects in ABCG8 were independently related to SNPs rs4245791 and rs41360247 (combined P=1.6 x 10(-50) and 6.2 x 10(-25), respectively; n=4412). Serum campesterol was elevated 12% for each rs4245791 T-allele. The same allele was associated with 40% decreased hepatic ABCG8 mRNA expression (P=0.009). Effects at the ABO locus were related to SNP rs657152 (combined P=9.4x10(-13)). Alleles of ABCG8 and ABO associated with elevated phytosterol levels displayed significant associations with increased CAD risk (rs4245791 odds ratio, 1.10; 95% CI, 1.06 to 1.14; P=2.2 x 10(-6); rs657152 odds ratio, 1.13; 95% CI, 1.07 to 1.19; P=9.4 x 10(-6)), whereas alleles at ABCG8 associated with reduced phytosterol levels were associated with reduced CAD risk (rs41360247 odds ratio, 0.84; 95% CI, 0.78 to 0.91; P=1.3 x 10(-5)). Common variants in ABCG8 and ABO are strongly associated with serum phytosterol levels and show concordant and previously unknown associations with CAD.
International Nuclear Information System (INIS)
Sernbo, Sandra; Gustavsson, Elin; Brennan, Donal J; Gallagher, William M; Rexhepaj, Elton; Rydnert, Frida; Jirström, Karin; Borrebaeck, Carl AK; Ek, Sara
2011-01-01
The neural transcription factor SOX11 has been described as a prognostic marker in epithelial ovarian cancers (EOC), however its role in individual histological subtypes and tumour grade requires further clarification. Furthermore, methylation-dependent silencing of SOX11 has been reported for B cell lymphomas and indicates that epigenetic drugs may be used to re-express this tumour suppressor, but information on SOX11 promoter methylation in EOC is still lacking. SOX11 expression and clinicopathological data was compared using χ 2 test in a cohort of 154 cases of primary invasive EOC. Kaplan-Meier analysis and the log rank test were applied to evaluate ovarian cancer-specific survival (OCSS) and overall survival (OS) in strata, according to SOX11 expression. Also, the methylation status of the SOX11 promoter was determined by sodium bisulfite sequencing and methylation specific PCR (MSP). Furthermore, the effect of ectopic overexpression of SOX11 on proliferation was studied through [3H]-thymidine incorporation. SOX11 expression was associated with an improved survival of patients with high grade EOC, although not independent of stage. Further analyses of EOC cell lines showed that SOX11 mRNA and protein were expressed in two of five cell lines, correlating with promoter methylation status. Demethylation was successfully performed using 5'-Aza-2'deoxycytidine (5-Aza-dC) resulting in SOX11 mRNA and protein expression in a previously negative EOC cell line. Furthermore, overexpression of SOX11 in EOC cell lines confirmed the growth regulatory role of SOX11. SOX11 is a functionally associated protein in EOC with prognostic value for high-grade tumours. Re-expression of SOX11 in EOC indicates a potential use of epigenetic drugs to affect cellular growth in SOX11-negative tumours
LENUS (Irish Health Repository)
Sernbo, Sandra
2011-09-24
Abstract Background The neural transcription factor SOX11 has been described as a prognostic marker in epithelial ovarian cancers (EOC), however its role in individual histological subtypes and tumour grade requires further clarification. Furthermore, methylation-dependent silencing of SOX11 has been reported for B cell lymphomas and indicates that epigenetic drugs may be used to re-express this tumour suppressor, but information on SOX11 promoter methylation in EOC is still lacking. Methods SOX11 expression and clinicopathological data was compared using χ2 test in a cohort of 154 cases of primary invasive EOC. Kaplan-Meier analysis and the log rank test were applied to evaluate ovarian cancer-specific survival (OCSS) and overall survival (OS) in strata, according to SOX11 expression. Also, the methylation status of the SOX11 promoter was determined by sodium bisulfite sequencing and methylation specific PCR (MSP). Furthermore, the effect of ectopic overexpression of SOX11 on proliferation was studied through [3H]-thymidine incorporation. Results SOX11 expression was associated with an improved survival of patients with high grade EOC, although not independent of stage. Further analyses of EOC cell lines showed that SOX11 mRNA and protein were expressed in two of five cell lines, correlating with promoter methylation status. Demethylation was successfully performed using 5\\'-Aza-2\\'deoxycytidine (5-Aza-dC) resulting in SOX11 mRNA and protein expression in a previously negative EOC cell line. Furthermore, overexpression of SOX11 in EOC cell lines confirmed the growth regulatory role of SOX11. Conclusions SOX11 is a functionally associated protein in EOC with prognostic value for high-grade tumours. Re-expression of SOX11 in EOC indicates a potential use of epigenetic drugs to affect cellular growth in SOX11-negative tumours.
DEFF Research Database (Denmark)
Kopp, Tine Iskov; Andersen, Vibeke; Tjonneland, Anne
2015-01-01
to assess whether polymorphisms in ABCB1, ABCC2 and ABCG2 were associated with risk of colorectal cancer (CRC) and to investigate gene-environment (dietary factors, smoking and use of non-steroidal anti-inflammatory drugs) and gene-gene interactions between previously studied polymorphisms in IL1B and IL10......The ATP-binding cassette (ABC) transporter family transports various molecules across the enterocytes in the gut protecting the intestine against potentially harmful substances. Moreover, ABC transporters are involved in mucosal immune defence through interaction with cytokines. The study aimed...... of the polymorphisms were associated with CRC, but ABCB1 and ABCG2 haplotypes were associated with risk of CRC. ABCB1/rs1045642 interacted with intake of cereals and fiber (p-Value for interaction (Pint) = 0.001 and 0.01, respectively). In a three-way analysis, both ABCB1/rs1045642 and ABCG2/rs2231137 in combination...
International Nuclear Information System (INIS)
Yang, Min; Li, Wei; Liu, Yi-Ying; Fu, Shuang; Qiu, Guang-Bin; Sun, Kai-Lai; Fu, Wei-Neng
2012-01-01
MYCT1, previously named MTLC, is a novel candidate tumor suppressor gene. MYCT1 was cloned from laryngeal squamous cell cancer (LSCC) and has been found to be down-regulated in LSCC; however, the regulatory details have not been fully elucidated. Here, we sought to investigate the methylation status of the CpG islands of MYCT1 and mRNA levels by bisulfite-specific PCR (BSP) based on sequencing restriction enzyme digestion, reverse transcription and real-time quantitative polymerase chain reaction (RQ-PCR). The function of specific sites in the proximal promoter of MYCT1 in LSCC was measured by transient transfection, luciferase assays, electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation assay (ChIP). The results suggested hypermethylation of 12 CpG sites of the promoter in both laryngeal cancer tissues and the laryngeal cancer line Hep-2 cell. The hypermethylation of the site CGCG (−695 to −692), which has been identified as the c-Myc binding site, was identified in laryngeal cancer tissues (59/73) compared to paired mucosa (13/73); in addition, statistical analysis revealed that the methylation status of this site significantly correlated with cancer cell differentiation(p < 0.01). The mRNA level of MYCT1 increased in Hep-2 cells treated with 5-aza-C (p < 0.01). The luciferase activity from mutant transfectants pGL3-MYCT1m (−852/+12, mut-695-C > A, mut-693-C > G) was significantly reduced compared with the wild type pGL3-MYCT1 (−852/+12), while the luciferase activity from wild transfectants pGL3-MYCT1 (−852/+12) rose after 5-aza treatment in Hep-2 cells. Finally, EMSA and ChIP confirmed that the methylation of the CGCG (−695 to −692) site prevented c-Myc from binding of the site and demethylation treatment of the 5′ flanking region of MYCT1 by 5-aza induced the increased occupation of the core promoter by c-Myc (p < 0.01). In summary, this study concluded that hypermethylation contributed to the transcriptional down
Energy Technology Data Exchange (ETDEWEB)
Imagawa, Kei, E-mail: k.Imagawa@soton.ac.uk [University of Southampton Medical School, Bone and Joint Research Group, Southampton (United Kingdom); Tohoku University School of Medicine, Sendai (Japan); Andres, MC de [University of Southampton Medical School, Bone and Joint Research Group, Southampton (United Kingdom); Hashimoto, Ko [Hospital for Special Surgery, NY (United States); Pitt, Dominic [University of Southampton Medical School, Bone and Joint Research Group, Southampton (United Kingdom); Itoi, Eiji [Tohoku University School of Medicine, Sendai (Japan); Goldring, Mary B. [Hospital for Special Surgery, NY (United States); Roach, Helmtrud I.; Oreffo, Richard O.C. [University of Southampton Medical School, Bone and Joint Research Group, Southampton (United Kingdom)
2011-02-18
Research highlights: {yields} Glucosamine and a NF-kB inhibitor reduce inflammation in OA. {yields} Cytokine induced demethylation of CpG site in IL1{beta} promoter prevented by glucosamine. {yields} Glucosamine and NF-kB inhibitor have epigenetic effects on human chondrocytes. -- Abstract: Objective: Idiopathic osteoarthritis is the most common form of osteoarthritis (OA) world-wide and remains the leading cause of disability and the associated socio-economic burden in an increasing aging population. Traditionally, OA has been viewed as a degenerative joint disease characterized by progressive destruction of the articular cartilage and changes in the subchondral bone culminating in joint failure. However, the etiology of OA is multifactorial involving genetic, mechanical and environmental factors. Treatment modalities include analgesia, joint injection with steroids or hyaluronic acid, oral supplements including glucosamine and chondroitin sulfate, as well as physiotherapy. Thus, there is significant interest in the discovery of disease modifying agents. One such agent, glucosamine (GlcN) is commonly prescribed even though the therapeutic efficacy and mechanism of action remain controversial. Inflammatory cytokines, including IL-1{beta}, and proteinases such as MMP-13 have been implicated in the pathogenesis and progression of OA together with an associated CpG demethylation in their promoters. We have investigated the potential of GlcN to modulate NF-kB activity and cytokine-induced abnormal gene expression in articular chondrocytes and, critically, whether this is associated with an epigenetic process. Method: Human chondrocytes were isolated from the articular cartilage of femoral heads, obtained with ethical permission, following fractured neck of femur surgery. Chondrocytes were cultured for 5 weeks in six separate groups; (i) control culture, (ii) cultured with a mixture of 2.5 ng/ml IL-1{beta} and 2.5 ng/ml oncostatin M (OSM), (iii) cultured with 2 mM N
International Nuclear Information System (INIS)
Imagawa, Kei; Andres, MC de; Hashimoto, Ko; Pitt, Dominic; Itoi, Eiji; Goldring, Mary B.; Roach, Helmtrud I.; Oreffo, Richard O.C.
2011-01-01
Research highlights: → Glucosamine and a NF-kB inhibitor reduce inflammation in OA. → Cytokine induced demethylation of CpG site in IL1β promoter prevented by glucosamine. → Glucosamine and NF-kB inhibitor have epigenetic effects on human chondrocytes. -- Abstract: Objective: Idiopathic osteoarthritis is the most common form of osteoarthritis (OA) world-wide and remains the leading cause of disability and the associated socio-economic burden in an increasing aging population. Traditionally, OA has been viewed as a degenerative joint disease characterized by progressive destruction of the articular cartilage and changes in the subchondral bone culminating in joint failure. However, the etiology of OA is multifactorial involving genetic, mechanical and environmental factors. Treatment modalities include analgesia, joint injection with steroids or hyaluronic acid, oral supplements including glucosamine and chondroitin sulfate, as well as physiotherapy. Thus, there is significant interest in the discovery of disease modifying agents. One such agent, glucosamine (GlcN) is commonly prescribed even though the therapeutic efficacy and mechanism of action remain controversial. Inflammatory cytokines, including IL-1β, and proteinases such as MMP-13 have been implicated in the pathogenesis and progression of OA together with an associated CpG demethylation in their promoters. We have investigated the potential of GlcN to modulate NF-kB activity and cytokine-induced abnormal gene expression in articular chondrocytes and, critically, whether this is associated with an epigenetic process. Method: Human chondrocytes were isolated from the articular cartilage of femoral heads, obtained with ethical permission, following fractured neck of femur surgery. Chondrocytes were cultured for 5 weeks in six separate groups; (i) control culture, (ii) cultured with a mixture of 2.5 ng/ml IL-1β and 2.5 ng/ml oncostatin M (OSM), (iii) cultured with 2 mM N-acetyl GlcN (Sigma
Geber, Christian; Ostad Haji, Elnaz; Schlicht, Konrad; Hiemke, Christoph; Tadić, André
2013-06-01
: We describe a female patient who was an extensive metabolizer of cytochrome P450 isoenzyme (CYP) 2D6 and an intermediate metabolizer of CYP2C19 (genotype: CYP2C19 *1/*2). She exhibited high serum concentrations of venlafaxine and O-desmethylvenlafaxine and developed severe tremor after comedication with cotrimoxazole (sulfamethazole/trimethoprim). Venlafaxine is mainly metabolized by O- and N-demethylation. O-demethylation is catalyzed by the highly polymorphic CYP2D6 and N-demethylation by several enzymes, CYP2C19, CYP2C9, and CYP3A4. The observed overall pharmacokinetic effect was most probably the result of decreased N-demethylation of venlafaxine by (1) reduced expression of CYP2C19 due to a genetic deficit and (2) inhibition of CYP2C9 by cotrimoxazole.
Promoter characterization and genomic organization of the human X11β gene APBA2.
LENUS (Irish Health Repository)
Hao, Yan
2012-02-15
Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.
Pancreatic stellate cells enhance stem cell-like phenotypes in pancreatic cancer cells
International Nuclear Information System (INIS)
Hamada, Shin; Masamune, Atsushi; Takikawa, Tetsuya; Suzuki, Noriaki; Kikuta, Kazuhiro; Hirota, Morihisa; Hamada, Hirofumi; Kobune, Masayoshi; Satoh, Kennichi; Shimosegawa, Tooru
2012-01-01
Highlights: ► Pancreatic stellate cells (PSCs) promote the progression of pancreatic cancer. ► Pancreatic cancer cells co-cultured with PSCs showed enhanced spheroid formation. ► Expression of stem cell-related genes ABCG2, Nestin and LIN28 was increased. ► Co-injection of PSCs enhanced tumorigenicity of pancreatic cancer cells in vivo. ► This study suggested a novel role of PSCs as a part of the cancer stem cell niche. -- Abstract: The interaction between pancreatic cancer cells and pancreatic stellate cells (PSCs), a major profibrogenic cell type in the pancreas, is receiving increasing attention. There is accumulating evidence that PSCs promote the progression of pancreatic cancer by increasing cancer cell proliferation and invasion as well as by protecting them from radiation- and gemcitabine-induced apoptosis. Recent studies have identified that a portion of cancer cells, called “cancer stem cells”, within the entire cancer tissue harbor highly tumorigenic and chemo-resistant phenotypes, which lead to the recurrence after surgery or re-growth of the tumor. The mechanisms that maintain the “stemness” of these cells remain largely unknown. We hypothesized that PSCs might enhance the cancer stem cell-like phenotypes in pancreatic cancer cells. Indirect co-culture of pancreatic cancer cells with PSCs enhanced the spheroid-forming ability of cancer cells and induced the expression of cancer stem cell-related genes ABCG2, Nestin and LIN28. In addition, co-injection of PSCs enhanced tumorigenicity of pancreatic cancer cells in vivo. These results suggested a novel role of PSCs as a part of the cancer stem cell niche.
Kawasumi, Ryosuke; Narita, Shodai; Miyamoto, Kazunori; Tominaga, Ken-Ichi; Takita, Ryo; Uchiyama, Masanobu
2017-12-21
The iodoform reaction has long been used as a qualitative test for acetyl and/or ethanol units in organic molecules. However, its synthetic applications are quite limited. Here, we describe a tuned iodoform reaction for oxidative demethylation reaction with I 2 and t-BuOK in t-BuOH, in which in situ-generated t-BuOI serves as the chemoselective iodinating agent. This system enables one-step conversion of levulinic acid to succinic acid, a major four-carbon chemical feedstock. This oxidative demethylation is also applicable to other compounds containing an acetyl group/ethanol unit, affording the corresponding carboxylic acids in a selective manner.
Directory of Open Access Journals (Sweden)
Robinson Claire M
2012-08-01
Full Text Available Abstract Background Pulmonary fibrosis is a debilitating and lethal disease with no effective treatment options. Understanding the pathological processes at play will direct the application of novel therapeutic avenues. Hypoxia has been implicated in the pathogenesis of pulmonary fibrosis yet the precise mechanism by which it contributes to disease progression remains to be fully elucidated. It has been shown that chronic hypoxia can alter DNA methylation patterns in tumour-derived cell lines. This epigenetic alteration can induce changes in cellular phenotype with promoter methylation being associated with gene silencing. Of particular relevance to idiopathic pulmonary fibrosis (IPF is the observation that Thy-1 promoter methylation is associated with a myofibroblast phenotype where loss of Thy-1 occurs alongside increased alpha smooth muscle actin (α-SMA expression. The initial aim of this study was to determine whether hypoxia regulates DNA methylation in normal human lung fibroblasts (CCD19Lu. As it has been reported that hypoxia suppresses Thy-1 expression during lung development we also studied the effect of hypoxia on Thy-1 promoter methylation and gene expression. Methods CCD19Lu were grown for up to 8 days in hypoxia and assessed for global changes in DNA methylation using flow cytometry. Real-time PCR was used to quantify expression of Thy-1, α-SMA, collagen I and III. Genomic DNA was bisulphite treated and methylation specific PCR (MSPCR was used to examine the methylation status of the Thy-1 promoter. Results Significant global hypermethylation was detected in hypoxic fibroblasts relative to normoxic controls and was accompanied by increased expression of myofibroblast markers. Thy-1 mRNA expression was suppressed in hypoxic cells, which was restored with the demethylating agent 5-aza-2′-deoxycytidine. MSPCR revealed that Thy-1 became methylated following fibroblast exposure to 1% O2. Conclusion These data suggest that global and
Mutational analysis of the UCP2 core promoter and relationships of variants with obesity
DEFF Research Database (Denmark)
Dalgaard, Louise T; Andersen, Gitte; Larsen, Lesli H
2003-01-01
To identify polymorphisms in the human uncoupling protein 2 gene (UCP2) promoter and to investigate whether these were associated with obesity or weight gain.......To identify polymorphisms in the human uncoupling protein 2 gene (UCP2) promoter and to investigate whether these were associated with obesity or weight gain....
Gene Expression in Class 2 Integrons Is SOS-Independent and Involves Two Pc Promoters.
Jové, Thomas; Da Re, Sandra; Tabesse, Aurore; Gassama-Sow, Amy; Ploy, Marie-Cécile
2017-01-01
Integrons are powerful bacterial genetic elements that permit the expression and dissemination of antibiotic-resistance gene cassettes. They contain a promoter Pc that allows the expression of gene cassettes captured through site-specific recombination catalyzed by IntI, the integron-encoded integrase. Class 1 and 2 integrons are found in both clinical and environmental settings. The regulation of intI and of Pc promoters has been extensively studied in class 1 integrons and the regulatory role of the SOS response on intI expression has been shown. Here we investigated class 2 integrons. We characterized the P intI2 promoter and showed that intI2 expression is not regulated via the SOS response. We also showed that, unlike class 1 integrons, class 2 integrons possess not one but two active Pc promoters that are located within the attI2 region that seem to contribute equally to gene cassette expression. Class 2 integrons mostly encode an inactive truncated integrase, but the rare class 2 integrons that encode an active integrase are associated with less efficient Pc2 promoter variants. We propose an evolutionary model for class 2 integrons in which the absence of repression of the integrase gene expression led to mutations resulting in either inactive integrase or Pc variants of weaker activity, thereby reducing the potential fitness cost of these integrons.
The histone demethylase Jhdm1a regulates hepatic gluconeogenesis.
Directory of Open Access Journals (Sweden)
Dongning Pan
Full Text Available Hepatic gluconeogenesis is required for maintaining blood glucose homeostasis; yet, in diabetes mellitus, this process is unrestrained and is a major contributor to fasting hyperglycemia. To date, the impacts of chromatin modifying enzymes and chromatin landscape on gluconeogenesis are poorly understood. Through catalyzing the removal of methyl groups from specific lysine residues in the histone tail, histone demethylases modulate chromatin structure and, hence, gene expression. Here we perform an RNA interference screen against the known histone demethylases and identify a histone H3 lysine 36 (H3K36 demethylase, Jhdm1a, as a key negative regulator of gluconeogenic gene expression. In vivo, silencing of Jhdm1a promotes liver glucose synthesis, while its exogenous expression reduces blood glucose level. Importantly, the regulation of gluconeogenesis by Jhdm1a requires its demethylation activity. Mechanistically, we find that Jhdm1a regulates the expression of a major gluconeogenic regulator, C/EBPα. This is achieved, at least in part, by its USF1-dependent association with the C/EBPα promoter and its subsequent demethylation of dimethylated H3K36 on the C/EBPα locus. Our work provides compelling evidence that links histone demethylation to transcriptional regulation of gluconeogenesis and has important implications for the treatment of diabetes.
The Histone Demethylase Jhdm1a Regulates Hepatic Gluconeogenesis
Zou, Tie; Yao, Annie Y.; Cooper, Marcus P.; Boyartchuk, Victor; Wang, Yong-Xu
2012-01-01
Hepatic gluconeogenesis is required for maintaining blood glucose homeostasis; yet, in diabetes mellitus, this process is unrestrained and is a major contributor to fasting hyperglycemia. To date, the impacts of chromatin modifying enzymes and chromatin landscape on gluconeogenesis are poorly understood. Through catalyzing the removal of methyl groups from specific lysine residues in the histone tail, histone demethylases modulate chromatin structure and, hence, gene expression. Here we perform an RNA interference screen against the known histone demethylases and identify a histone H3 lysine 36 (H3K36) demethylase, Jhdm1a, as a key negative regulator of gluconeogenic gene expression. In vivo, silencing of Jhdm1a promotes liver glucose synthesis, while its exogenous expression reduces blood glucose level. Importantly, the regulation of gluconeogenesis by Jhdm1a requires its demethylation activity. Mechanistically, we find that Jhdm1a regulates the expression of a major gluconeogenic regulator, C/EBPα. This is achieved, at least in part, by its USF1-dependent association with the C/EBPα promoter and its subsequent demethylation of dimethylated H3K36 on the C/EBPα locus. Our work provides compelling evidence that links histone demethylation to transcriptional regulation of gluconeogenesis and has important implications for the treatment of diabetes. PMID:22719268
Characterization of the promoter region of the human c-erbB-2 protooncogene
International Nuclear Information System (INIS)
Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.
1987-01-01
Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors
International Nuclear Information System (INIS)
Kuemin, Daniel; Hofmann, Christian; Uckert, Wolfgang; Both, Gerald W.; Loeser, Peter
2004-01-01
Activation of the adenoviral E2 promoter is an early step in adenovirus gene expression. For members of the mast- and aviadenoviruses, this requires induction of the cellular transcription factor E2F by virally encoded gene products such as E1A, E4orf6/7 and orf22/GAM-1. The newly recognized genus atadenovirus, of which the ovine isolate OAdV is the prototype, lacks any sequence homology to those genes. To find a possible link between E2 promoter activation and OAdV gene expression, we utilized a screening method to search for genes within the OAdV genome that were capable of stimulating the viral E2 promoter. One such gene, E43, was identified within the proposed E4 region toward the right-hand end of the OAdV genome. The E43 gene product was also found to be capable of stimulating E2F-1-dependent gene expression. A closer inspection of the E2 promoter revealed the presence of a non-palindromic E2F binding site within the OAdV E2 promoter. Mutation of this site markedly reduced both E2F-1- and E43-dependent promoter activation. Moreover, a direct protein-protein interaction of the E43 gene product with E2F, but not with the retinoblastoma protein pRb, suggested a possible cooperation between these two proteins in activating the E2 promoter. The importance of the E43 gene product for virus replication is also underlined by the finding that an OAdV recombinant with a functionally inactivated E43 gene showed severely inhibited virus growth
Directory of Open Access Journals (Sweden)
Rachel M. Woodfint
2017-01-01
Full Text Available Identification of tissue- and stage-specific gene promoters is valuable for delineating the functional roles of specific genes in genetically engineered animals. Here, through the comparison of gene expression in different tissues by analysis of a microarray database, the intestinal specificity of mucin 2 (MUC2 expression was identified in mice and humans, and further confirmed in chickens by RT-PCR (reverse transcription-PCR analysis. An analysis of cis-acting elements in avian MUC2 gene promoters revealed conservation of binding sites, within a 2.9 kb proximal promoter region, for transcription factors such as caudal type homeobox 2 (CDX2, GATA binding protein 4 (GATA4, hepatocyte nuclear factor 4 α (HNF4A, and transcription factor 4 (TCF4 that are important for maintaining intestinal homeostasis and functional integrity. By generating transgenic quail, we demonstrated that the 2.9 kb chicken MUC2 promoter could drive green fluorescent protein (GFP reporter expression exclusively in the small intestine, large intestine, and ceca. Fluorescence image analysis further revealed GFP expression in intestine epithelial cells. The GFP expression was barely detectable in the embryonic intestine, but increased during post-hatch development. The spatiotemporal expression pattern of the reporter gene confirmed that the 2.9 kb MUC2 promoter could retain the regulatory element to drive expression of target genes in intestinal tissues after hatching. This new transgene expression system, using the MUC2 promoter, will provide a new method of overexpressing target genes to study gene function in the avian intestine.
Nagarajan, Raman P; Hogart, Amber R; Gwye, Ynnez; Martin, Michelle R; LaSalle, Janine M
2006-01-01
Mutations in MECP2, encoding methyl CpG binding protein 2 (MeCP2), cause most cases of Rett syndrome (RTT), an X-linked neurodevelopmental disorder. Both RTT and autism are "pervasive developmental disorders" and share a loss of social, cognitive and language skills and a gain in repetitive stereotyped behavior, following apparently normal perinatal development. Although MECP2 coding mutations are a rare cause of autism, MeCP2 expression defects were previously found in autism brain. To further study the role of MeCP2 in autism spectrum disorders (ASDs), we determined the frequency of MeCP2 expression defects in brain samples from autism and other ASDs. We also tested the hypotheses that MECP2 promoter mutations or aberrant promoter methylation correlate with reduced expression in cases of idiopathic autism. MeCP2 immunofluorescence in autism and other neurodevelopmental disorders was quantified by laser scanning cytometry and compared with control postmortem cerebral cortex samples on a large tissue microarray. A significant reduction in MeCP2 expression compared to age-matched controls was found in 11/14 autism (79%), 9/9 RTT (100%), 4/4 Angelman syndrome (100%), 3/4 Prader-Willi syndrome (75%), 3/5 Down syndrome (60%), and 2/2 attention deficit hyperactivity disorder (100%) frontal cortex samples. One autism female was heterozygous for a rare MECP2 promoter variant that correlated with reduced MeCP2 expression. A more frequent occurrence was significantly increased MECP2 promoter methylation in autism male frontal cortex compared to controls. Furthermore, percent promoter methylation of MECP2 significantly correlated with reduced MeCP2 protein expression. These results suggest that both genetic and epigenetic defects lead to reduced MeCP2 expression and may be important in the complex etiology of autism.
Directory of Open Access Journals (Sweden)
Hemant Malhotra
2015-01-01
Full Text Available Background & objectives: Imatinib is the standard first-line treatment for chronic myeloid leukaemia (CML patients. About 20 to 30 per cent patients develop resistance to imatinib and fail imatinib treatment. One of the mechanisms proposed is varying expression levels of the drug transporters. This study was aimed to determine the expression levels of imatinib transporter genes (OCT1, ABCB1, ABCG2 in CML patients and to correlate these levels with molecular response. Methods: Sixty three CML chronic phase patients who were on 400 mg/day imatinib for more than two years were considered for gene expression analysis study for OCT1, ABCB1 and ABCG2 genes. These were divided into responders and non-responders. The relative transcript expression levels of the three genes were compared between these two categories. The association between the expression values of these three genes was also determined. Results: No significant difference in the expression levels of OCT1, ABCB1 and ABCG2 was found between the two categories. The median transcript expression levels of OCT1, ABCB1 and ABCG2 genes in responders were 26.54, 10.78 and 0.64 versus 33.48, 7.09 and 0.53 in non-responders, respectively. A positive association was observed between the expression of the ABCB1 and ABCG2 transporter genes (r=0.407, P<0.05 while no association was observed between the expression of either of the ABC transporter genes with the OCT1 gene. Interpretation & conclusions: Our findings demonstrated that the mRNA expression levels of imatinib transporter genes were not correlated with molecular response in CML patients. Further studies need to be done on a large sample of CML patients to confirm these findings.
International Nuclear Information System (INIS)
Hylander, Lars D.; Ahlgren, Ingemar; Broberg, Anders; Lantz, Peter; Tornblom, Erik; Forsberg, Bruce R.; Guimaraes, Jean R.D.; Mauro, Jane; Markus, Meili; Guillen Montenegro, Salvador; Vammen, Katherine; Sacasa, Sarria Karla; Regnell, Olof
2002-01-01
Increased awareness about the toxicity of mercury (Hg) has during the latest decades resulted in reduced use of Hg in industrialised countries. Developing countries, on the contrary, have largely increased their anthropogenic Hg emissions caused by its use in gold mining, transfer of Hg emitting factories from developed countries, and increased burning of coal without appropriate flue gas cleaning. The contribution of global Hg sources and the importance of other parameters to increased Hg levels encountered in hydroelectric reservoirs and other areas after flooding is not well understood, especially not in the tropics. The aim of the present study is to increase the knowledge about Hg transformations in tropical areas. Total Hg content in water, biota, and sediment will be determined by atomic absorption and fluorescence spectrophotometry and methyl Hg content in biota by gaschromatography after extraction with acids, hydroxides, and organic solvents. Mercury methylation capacity in sediments, water, and selected biota will be determined with 203 Hg and subsequent radiological measurements of insitu incubations. Factors affecting the methylation and demethylation rates will be identified with laboratory incubations with 203 Hg at varying environmental conditions such as organic matter, pH, redox potential, conductivity, light, temperature, geochemical factors and populations of bacteria. The populations of bacteria will be determined to quantity by isotope techniques. The first experiments indicate markedly larger methylation capacity as well as bacterial production of incubated samples of Eichhornia crassipes, originating from Brazil, compared to Myriophyllum spicatum from Sweden. The results are the first step to better understand the importance of environmental parameters and bacterial production for methylation of Hg. (author)
Directory of Open Access Journals (Sweden)
Choi Sang-Wook
2010-11-01
Full Text Available Abstract Background The transitional-CpG sites between weakly methylated genes and densely methylated retroelements are overmethylated in the gastric mucosa infected with Helicobacter pylori (H. pylori and they are undermethylated in the gastric cancers depending on the level of loss of heterozygosity (LOH events. This study delineated the transitional-CpG methylation patterns of CpG-island-containing and -lacking genes in view of the retroelements. Methods The transitional-CpG sites of eight CpG-island-containing genes and six CpG-island-lacking genes were semi-quantitatively examined by performing radioisotope-labelling methylation-specific PCR under stringent conditions. The level of LOH in the gastric cancers was estimated using the 40 microsatellite markers on eight cancer-associated chromosomes. Each gene was scored as overmethylated or undermethylated based on an intermediate level of transitional-CpG methylation common in the H. pylori-negative gastric mucosa. Results The eight CpG-island genes examined were overmethylated depending on the proximity to the nearest retroelement in the H. pylori-positive gastric mucosa. The six CpG-island-lacking genes were similarly methylated in the H. pylori-positive and -negative gastric mucosa. In the gastric cancers, long transitional-CpG segments of the CpG-island genes distant from the retroelements remained overmethylated, whereas the overmethylation of short transitional-CpG segments close to the retroelements was not significant. Both the CpG-island-containing and -lacking genes tended to be decreasingly methylated in a LOH-level-dependent manner. Conclusions The overmethylated genes under the influence of retroelement methylation in the H. pylori-infected stomach are demethylated in the gastric cancers influenced by LOH.
CO_2 capture from flue gas using clathrate formation in the presence of thermodynamic promoters
International Nuclear Information System (INIS)
Kim, Soyoung; Choi, Sung-Deuk; Seo, Yongwon
2017-01-01
Tetrahydrofuran (THF) as a water-soluble sII clathrate former, cyclopentane (CP) as a water-insoluble sII clathrate former, and tetra n-butyl ammonium chloride (TBAC) as a water-soluble semiclathrate former were used to investigate their thermodynamic promotion effects on clathrate-based CO_2 capture from simulated flue gas. The phase equilibria of CO_2 (20%) + N_2 (80%) + promoter clathrates at different promoter concentrations revealed that the presence of THF, CP, and TBAC could significantly reduce the clathrate formation pressure. THF solutions provided the highest gas uptake and steepest CO_2 concentration changes in the vapor phase, whereas TBAC solutions showed the highest CO_2 selectivity (∼61%) in the clathrate phase. CP solutions exhibited a slower formation rate, but their final gas uptake and CO_2 selectivity in the clathrate phase were comparable to the THF solutions. Raman spectroscopy confirmed the enclathration of both CO_2 and N_2 in the clathrate cages and a structural transition due to the inclusion of promoters in the clathrate phase. The overall experimental results indicate that TBAC is a viable thermodynamic promoter for clathrate-based CO_2 capture from simulated flue gas, considering the lower pressure requirement for clathrate formation, higher CO_2 enrichment in the clathrate phase, non-toxicity, and non-volatility. - Highlights: • Clathrate-based CO_2 capture was investigated in the presence of thermodynamic promoters. • THF, CP, and TBAC demonstrated a significant thermodynamic promotion for CO_2 (20%) + N_2 (80%) clathrates. • The highest gas uptake was observed for the THF (5.6 mol%) solution. • TBAC solutions showed the highest CO_2 selectivity in the clathrate phase (∼61%). • Raman spectroscopy confirmed the guest gas enclathration and clathrate structure.
Lio, Chan-Wang; Zhang, Jiayuan; González-Avalos, Edahí; Hogan, Patrick G; Chang, Xing; Rao, Anjana
2016-11-21
Ten-eleven translocation (TET) enzymes oxidize 5-methylcytosine, facilitating DNA demethylation and generating new epigenetic marks. Here we show that concomitant loss of Tet2 and Tet3 in mice at early B cell stage blocked the pro- to pre-B cell transition in the bone marrow, decreased Irf4 expression and impaired the germline transcription and rearrangement of the Igκ locus. Tet2/3-deficient pro-B cells showed increased CpG methylation at the Igκ 3' and distal enhancers that was mimicked by depletion of E2A or PU.1, as well as a global decrease in chromatin accessibility at enhancers. Importantly, re-expression of the Tet2 catalytic domain in Tet2/3-deficient B cells resulted in demethylation of the Igκ enhancers and restored their chromatin accessibility. Our data suggest that TET proteins and lineage-specific transcription factors cooperate to influence chromatin accessibility and Igκ enhancer function by modulating the modification status of DNA.
Genome-wide function of H2B ubiquitylation in promoter and genic regions.
Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B; Pugh, B Franklin
2011-11-01
Nucleosomal organization in and around genes may contribute substantially to transcriptional regulation. The contribution of histone modifications to genome-wide nucleosomal organization has not been systematically evaluated. In the present study, we examine the role of H2BK123 ubiquitylation, a key regulator of several histone modifications, on nucleosomal organization at promoter, genic, and transcription termination regions in Saccharomyces cerevisiae. Using high-resolution MNase chromatin immunoprecipitation and sequencing (ChIP-seq), we map nucleosome positioning and occupancy in mutants of the H2BK123 ubiquitylation pathway. We found that H2B ubiquitylation-mediated nucleosome formation and/or stability inhibits the assembly of the transcription machinery at normally quiescent promoters, whereas ubiquitylation within highly active gene bodies promotes transcription elongation. This regulation does not proceed through ubiquitylation-regulated histone marks at H3K4, K36, and K79. Our findings suggest that mechanistically similar functions of H2B ubiquitylation (nucleosome assembly) elicit different functional outcomes on genes depending on its positional context in promoters (repressive) versus transcribed regions (activating).
Liang, Feng; Kong, Qi; Guo, Yongqi; Wang, Yu; Sun, Dejie; Liu, Shi; Cai, Jinling; Guan, Yongbiao; Ding, Rigao
2015-08-01
Meditinib (ME) is a novel tyrosine kinase inhibitor used as an antichronic myeloid leukemia drug. A simple, sensitive and specific LC/MS/MS method was developed and validated for the analysis of ME and its metabolite demethylation meditinib (PI) in monkey plasma using naltrexone as the internal standard. Sample preparation involved protein precipitation with methanol. The analysis was carried out on an Agilent C8 column (3.5 µm, 2.1 × 50 mm). Elution was achieved with a mobile phase gradient varying the proportion of a water solution containing 0.1% formic acid (solvent A) and a 0.1% formic acid in methanol solution (solvent B) at a flow rate of 300 μL/min. The method had a linear calibration curve over the concentration range of 2-1000 ng/mL for ME and 2-1000 ng/mL for PI. The lower limits of quantification of ME and PI were 2 and 2 ng/mL, respectively. The intra- and inter-day precision values were 85%. The assay has been successfully used for pharmacokinetic evaluation of ME and PI using the monkey as an animal model, and those data are reported for the first time. Copyright © 2015 John Wiley & Sons, Ltd.
DEFF Research Database (Denmark)
Putluru, Siva Sankar Reddy; Jensen, Anker Degn; Riisager, Anders
2011-01-01
V2O5/TiO2 and heteropoly acid promoted V2O5/TiO2 catalysts were prepared and characterized by N2 physisorption, XRPD and NH3-TPD. The influence of the calcination temperature from 400 to 700 1C on crystallinity and acidic properties was studied and compared with the activity for the selective...... catalytic reduction (SCR) of NO with ammonia. The SCR activity of heteropoly acid promoted catalysts was found to be much higher than for unpromoted catalysts. The stability of heteropoly acid promoted catalysts is dependent on calcination temperature and there is a gradual decrease in SCR activity...... and acidity with increase in calcination temperatures. Furthermore, the heteropoly acid promoted V2O5/TiO2 catalysts showed excellent alkali deactivation resistance and might therefore be alternative deNOx catalysts in biomass fired power plants....
Directory of Open Access Journals (Sweden)
N. V. Litviakov
2013-01-01
Full Text Available The paper examined 106 patients with breast cancer (BC treated with neoadjuvant chemotherapy (NАС. In the biopsy material, derived from primary tumor before NAC and surgical samples after chemotherapy the expression of 8 multidrug resistance genes (MDR ABCB1, АВСВ2, ABCC1, ABCC2, АВСС5, ABCG1, ABCG2 и MVP was evaluated using quantitative RT-PCR. During the NAC course 75 % of patients manifested gradient phenomenon for gene expression that means a unidirectional change in the expression of all five MDR genes ABCB1, ABCC1, ABCC2, ABCG1 и ABCG2 closely associated with the NAC efficacy: the reduction in MDR gene expression was related to good response to NAC while the expression increase associated with poor response to NAC. In 25% of patients there was no such change in studied gene expression that means the lack of a gradient phenomenon. The objective was to study whether gradient phenomenon for MDR gene expression during NAC is related to disease free survival in breast cancer patients. Five-year metastasis-free survival in patients having a gradient phenomenon was 73 % versus 39 % in patients who lack a gradient phenomenon (log-rank test p=0,0018. So, the presence of a gradient phenomenon in patients is appeared to be associated with a good disease prognosis. It is assumed that the gradiThe paper examined 106 patients with breast cancer (BC treated with neoadjuvant chemotherapy (NАС. In the biopsy material, derived from primary tumor before NAC and surgical samples after chemotherapy the expression of 8 multidrug resistance genes (MDR ABCB1, АВСВ2, ABCC1, ABCC2, АВСС5, ABCG1, ABCG2 и MVP was evaluated using quantitative RT-PCR. During the NAC course 75 % of patients manifested gradient phenomenon for gene expression that means a unidirectional change in the expression of all five MDR genes ABCB1, ABCC1, ABCC2, ABCG1 и ABCG2 closely associated with the NAC efficacy: the reduction in MDR gene expression was related to good
Kodach, L.L.; Jacobs, R.J.; Voorneveld, P.W.; Wildenberg, M.E.; Verspaget, H.W.; van Wezel, T.; Morreau, H.; Hommes, D.W.; Peppelenbosch, M.P.; van den Brink, G.R.; Hardwick, J.C.H.
2011-01-01
Promoter hypermethylation is an important and potentially reversible mechanism of tumour suppressor gene silencing in cancer. Compounds that demethylate tumour suppressor genes and induce differentiation of cancer cells, but do not have toxic side effects, would represent an exciting option in
Indian Academy of Sciences (India)
Userman
Base-oxidant promoted metal free N-demethylation of arylamines. VINAYAK BOTLA, CHIRANJEEVI BARREDDI, RAMANA V DAGGUPATI and CHANDRASEKHARAM MALAPAKA. I&PC Division, CSIR-Indian Institute of Chemical Technology, Uppal Road, Tarnaka, Hyderabad 500 007, India. e-mail: chandra@iict.res.in.
Zhang, Changsong; Li, Ke; Wei, Lixin; Li, Zhengyou; Yu, Ping; Teng, Lijuan; Wu, Kusheng; Zhu, Jin
2007-01-01
Background Aberrant promoter methylation is an important mechanism for gene silencing. Aims To evaluate the promoter methylation status of p300 gene in patients with oesophageal squamous cell carcinoma (OSCC). Methods The methylation status of p300 promoter was analysed by methylation‐specific PCR (MSP) in 50 OSCC tissues and the matching non‐cancerous tissues. Oesophageal cancer cell lines (ECa‐109 and TE‐10) were treated with the demethylation agent 5‐aza‐2′‐deoxycytidine (5‐Aza‐CdR), and p300 mRNA expression was detected by RT‐PCR. Results p300 methylation was found in 42% (21/50) of the OSCC tissues, but in only 20% (10/50) of the corresponding non‐cancerous tissues (p = 0.017). In OSCC samples, 65% of those with deep tumour invasion (adventitia) and 63% samples with metastasis revealed p300 promoter methylation (p<0.05). p300 mRNA expression was observed in 19.0% (4/21) of methylated tumours and 58.6% (17/29) of unmethylated tumours (p = 0.005). In addition, p300 mRNA expression was observed in 40% (4/10) of methylated non‐neoplastic tissues and 87.5% (35/40) of unmethylated non‐tumours (p = 0.001). The demethylation caused by 5‐Aza‐CdR increased the p300 mRNA expression levels in oesophageal cancer cell lines. Conclusions p300 transcription silenced by promoter hypermethylation could play a role in the pathogenesis of oesophageal squamous cell carcinoma. PMID:17965222
The Obesity-Associated FTO Gene Encodes a 2-Oxoglutarate–Dependent Nucleic Acid Demethylase
Gerken, Thomas; Girard, Christophe A.; Tung, Yi-Chun Loraine; Webby, Celia J.; Saudek, Vladimir; Hewitson, Kirsty S.; Yeo, Giles S. H.; McDonough, Michael A.; Cunliffe, Sharon; McNeill, Luke A.; Galvanovskis, Juris; Rorsman, Patrik; Robins, Peter; Prieur, Xavier; Coll, Anthony P.; Ma, Marcella; Jovanovic, Zorica; Farooqi, I. Sadaf; Sedgwick, Barbara; Barroso, Inês; Lindahl, Tomas; Ponting, Chris P.; Ashcroft, Frances M.; O'Rahilly, Stephen; Schofield, Christopher J.
2009-01-01
Variants in the FTO (fat mass and obesity associated) gene are associated with increased body mass index in humans. Here, we show by bioinformatics analysis that FTO shares sequence motifs with Fe(II)- and 2-oxoglutarate–dependent oxygenases. We find that recombinant murine Fto catalyzes the Fe(II)- and 2OG-dependent demethylation of 3-methylthymine in single-stranded DNA, with concomitant production of succinate, formaldehyde, and carbon dioxide. Consistent with a potential role in nucleic acid demethylation, Fto localizes to the nucleus in transfected cells. Studies of wild-type mice indicate that Fto messenger RNA (mRNA) is most abundant in the brain, particularly in hypothalamic nuclei governing energy balance, and that Fto mRNA levels in the arcuate nucleus are regulated by feeding and fasting. Studies can now be directed toward determining the physiologically relevant FTO substrate and how nucleic acid methylation status is linked to increased fat mass. PMID:17991826
Michaelis, Martin; Rothweiler, Florian; Löschmann, Nadine; Sharifi, Mohsen; Ghafourian, Taravat; Cinatl, Jindrich
2015-07-10
The PKCβ inhibitor enzastaurin was tested in parental neuroblastoma and rhabdomyosarcoma cell lines, their vincristine-resistant sub-lines, primary neuroblastoma cells, ABCB1-transduced, ABCG2-transduced, and p53-depleted cells. Enzastaurin IC50s ranged from 3.3 to 9.5 μM in cell lines and primary cells independently of the ABCB1, ABCG2, or p53 status. Enzastaurin 0.3125 μM interfered with ABCB1-mediated drug transport. PKCα and PKCβ may phosphorylate and activate ABCB1 under the control of p53. However, enzastaurin exerted similar effects on ABCB1 in the presence or absence of functional p53. Also, enzastaurin inhibited PKC signalling only in concentrations ≥ 1.25 μM. The investigated cell lines did not express PKCβ. PKCα depletion reduced PKC signalling but did not affect ABCB1 activity. Intracellular levels of the fluorescent ABCB1 substrate rhodamine 123 rapidly decreased after wash-out of extracellular enzastaurin, and enzastaurin induced ABCB1 ATPase activity resembling the ABCB1 substrate verapamil. Computational docking experiments detected a direct interaction of enzastaurin and ABCB1. These data suggest that enzastaurin directly interferes with ABCB1 function. Enzastaurin further inhibited ABCG2-mediated drug transport but by a different mechanism since it reduced ABCG2 ATPase activity. These findings are important for the further development of therapies combining enzastaurin with ABC transporter substrates.
RBP2 Promotes Adult Acute Lymphoblastic Leukemia by Upregulating BCL2.
Directory of Open Access Journals (Sweden)
Xiaoming Wang
Full Text Available Despite recent increases in the cure rate of acute lymphoblastic leukemia (ALL, adult ALL remains a high-risk disease that exhibits a high relapse rate. In this study, we found that the histone demethylase retinoblastoma binding protein-2 (RBP2 was overexpressed in both on-going and relapse cases of adult ALL, which revealed that RBP2 overexpression was not only involved in the pathogenesis of ALL but that its overexpression might also be related to relapse of the disease. RBP2 knockdown induced apoptosis and attenuated leukemic cell viability. Our results demonstrated that BCL2 is a novel target of RBP2 and supported the notion of RBP2 being a regulator of BCL2 expression via directly binding to its promoter. As the role of RBP2 in regulating apoptosis was confirmed, RBP2 overexpression and activation of BCL2 might play important roles in ALL development and progression.
The promotive effect of N 2 fixers, Bacillus circulans and ...
African Journals Online (AJOL)
The promotive effect of N 2 fixers, Bacillus circulans and Saccharomyces cerevisiae on the viability of native arbuscular mycorrhizal fungi and the impact on the productivity of alfalfa ( Medicago sativa l.)
International Nuclear Information System (INIS)
Wanek, Thomas; Traxl, Alexander; Bankstahl, Jens P.; Bankstahl, Marion; Sauberer, Michael; Langer, Oliver; Kuntner, Claudia
2015-01-01
Introduction: Transport of 2-[ 18 F]fluoro-2-deoxy-D-glucose ([ 18 F]FDG) by the multidrug efflux transporters P-glycoprotein (ABCB1) and breast cancer resistance protein (ABCG2) at the blood–brain barrier (BBB) may confound the interpretation of [ 18 F]FDG brain PET data. Aim of this study was to assess the influence of ABCB1 and ABCG2 at the BBB on brain distribution of [ 18 F]FDG in vivo by performing [ 18 F]FDG PET scans in wild-type and transporter knockout mice and by evaluating changes in [ 18 F]FDG brain distribution after transporter inhibition. Methods: Dynamic small-animal PET experiments (60 min) were performed with [ 18 F]FDG in groups of wild-type and transporter knockout mice (Abcb1a/b (−/−) , Abcg2 (−/−) and Abcb1a/b (−/−) Abcg2 (−/−) ) and in wild-type rats without and with i.v. pretreatment with the known ABCB1 inhibitor tariquidar (15 mg/kg, given at 2 h before PET). Blood was sampled from animals from the orbital sinus vein at the end of the PET scans and measured in a gamma counter. Brain uptake of [ 18 F]FDG was expressed as the brain-to-blood radioactivity concentration ratio in the last PET time frame (K b,brain ). Results: K b,brain values of [ 18 F]FDG were not significantly different between different mouse types both without and with tariquidar pretreatment. The blood-to-brain transfer rate constant of [ 18 F]FDG was significantly lower in tariquidar-treated as compared with vehicle-treated rats (0.350 ± 0.025 mL/min/g versus 0.416 ± 0.024 mL/min/g, p = 0.026, paired t-test) but K b,brain values were not significantly different between both rat groups. Conclusion: Our results show that [ 18 F]FDG is not transported by Abcb1 at the mouse and rat BBB in vivo. In addition we found no evidence for Abcg2 transport of [ 18 F]FDG at the mouse BBB. Advances in knowledge and implications for patient care: Our findings imply that functional activity of ABCB1 and ABCG2 at the BBB does not need to be taken into account when
Understanding promotion of photocatalytic activity of TiO2 by Au nanoparticles
Amrollahi Buky, Rezvaneh; Hamdy, Mohamed S.; Mul, Guido
2014-01-01
Au nanoparticles prepared by deposition–precipitation were evaluated in promoting photocatalytic activity of TiO2 (P25) in the oxidation of methylcyclohexane. At 375 nm and in particular at 425 nm, Au was found to significantly enhance the rate induced by P25. Illumination of Au-promoted P25 at 525
Kot, Marta; Daniel, Władysława A
2008-04-01
The aim of the present study was to estimate the relative contribution of rat P450 isoforms to the metabolism of caffeine and to assess the usefulness of caffeine as a marker substance for estimating the activity of P450 in rat liver and its potential for pharmacokinetic interactions in pharmacological experiments. The results obtained using rat cDNA-expressed P450s indicated that 8-hydroxylation was the main oxidation pathway of caffeine (70%) in the rat. CYP1A2 was found to be a key enzyme catalyzing 8-hydroxylation (72%) and substantially contributing to 3-N-demethylation (47%) and 1-N-demethylation (37.5%) at a caffeine concentration of 0.1mM (relevant to "the maximum therapeutic concentration in humans"). Furthermore, CYP2C11 considerably contributed to 3-N-demethylation (31%). The CYP2C subfamily (66%) - mainly CYP2C6 (27%) and CYP2C11 (29%) - played a major role in catalyzing 7-N-demethylation. At higher substrate concentrations, the contribution of CYP1A2 to the metabolism of caffeine decreased in favor of CYP2C11 (N-demethylations) and CYP3A2 (mainly 8-hydroxylation). The obtained results were confirmed with liver microsomes (inhibition and correlation studies). Therefore, caffeine may be used as a marker substance for assessing the activity of CYP1A2 in rats, using 8-hydroxylation (but not 3-N-demethylation-like in humans); moreover, caffeine may also be used to simultaneously, preliminarily estimate the activity of CYP2C using 7-N-demethylation as a marker reaction. Hence caffeine pharmacokinetics in rats may be changed by drugs affecting the activity of CYP1A2 and/or CYP2C, e.g. by some antidepressants.
International Nuclear Information System (INIS)
Halvorsen, Bente; Holm, Sverre; Yndestad, Arne; Scholz, Hanne; Sagen, Ellen Lund; Nebb, Hilde; Holven, Kirsten B.; Dahl, Tuva B.; Aukrust, Pål
2014-01-01
Highlights: • IL-10 promotes reverse cholesterol efflux from lipid loaded macrophages. • IL-10 increases the expression of ABCA-1 and ABCG-1. • IL-10 exhibits cross-talk with the nuclear receptor LXRα. - Abstract: Interleukin (IL)-10 is a prototypical anti-inflammatory cytokine that has been shown to attenuate atherosclerosis development. In addition to its anti-inflammatory properties, the anti-atherogenic effect of IL-10 has recently also been suggested to reflect a complex effect of IL-10 on lipid metabolism in macrophages. In the present study we examined the effects of IL-10 on cholesterol efflux mechanism in lipid-loaded THP-1 macrophages. Our main findings were: (i) IL-10 significantly enhanced cholesterol efflux induced by fetal-calf serum, high-density lipoprotein (HDL) 2 and apolipoprotein A-1. (ii) The IL-10-mediated effects on cholesterol efflux were accompanied by an increased IL-10-mediated expression of the ATP-binding cassette transporters ABCA1 and ABCG1, that was further enhanced when the cells were co-activated with the liver X receptor (LXR)α agonist (22R)-hydroxycholesterol. (iii) The effect of LXRα activation on the IL-10-mediated effects on the ATP-binding cassette transporters seems to include enhancing effects on the IL-10 receptor 1 (IL10R1) expression and interaction with STAT-3 signaling. (iv) These enhancing effects on ABCA1 and ABCG1 was not seen when the cells were stimulated with the IL-10 family members IL-22 and IL-24. This study suggests that the anti-atherogenic properties of IL-10 may include enhancing effects on cholesterol efflux mechanism that involves cross-talk with LXRα activation
PPAR{gamma} regulates the expression of cholesterol metabolism genes in alveolar macrophages
Energy Technology Data Exchange (ETDEWEB)
Baker, Anna D.; Malur, Anagha; Barna, Barbara P.; Kavuru, Mani S. [Department of Internal Medicine, Division of Pulmonary, Critical Care, and Sleep Medicine, East Carolina University (United States); Malur, Achut G. [Department of Microbiology and Immunology, East Carolina University (United States); Thomassen, Mary Jane, E-mail: thomassenm@ecu.edu [Department of Internal Medicine, Division of Pulmonary, Critical Care, and Sleep Medicine, East Carolina University (United States); Department of Microbiology and Immunology, East Carolina University (United States)
2010-03-19
Peroxisome proliferator-activated receptor-gamma (PPAR{gamma}) is a nuclear transcription factor involved in lipid metabolism that is constitutively expressed in the alveolar macrophages of healthy individuals. PPAR{gamma} has recently been implicated in the catabolism of surfactant by alveolar macrophages, specifically the cholesterol component of surfactant while the mechanism remains unclear. Studies from other tissue macrophages have shown that PPAR{gamma} regulates cholesterol influx, efflux, and metabolism. PPAR{gamma} promotes cholesterol efflux through the liver X receptor-alpha (LXR{alpha}) and ATP-binding cassette G1 (ABCG1). We have recently shown that macrophage-specific PPAR{gamma} knockout (PPAR{gamma} KO) mice accumulate cholesterol-laden alveolar macrophages that exhibit decreased expression of LXR{alpha} and ABCG1 and reduced cholesterol efflux. We hypothesized that in addition to the dysregulation of these cholesterol efflux genes, the expression of genes involved in cholesterol synthesis and influx was also dysregulated and that replacement of PPAR{gamma} would restore regulation of these genes. To investigate this hypothesis, we have utilized a Lentivirus expression system (Lenti-PPAR{gamma}) to restore PPAR{gamma} expression in the alveolar macrophages of PPAR{gamma} KO mice. Our results show that the alveolar macrophages of PPAR{gamma} KO mice have decreased expression of key cholesterol synthesis genes and increased expression of cholesterol receptors CD36 and scavenger receptor A-I (SRA-I). The replacement of PPAR{gamma} (1) induced transcription of LXR{alpha} and ABCG1; (2) corrected suppressed expression of cholesterol synthesis genes; and (3) enhanced the expression of scavenger receptors CD36. These results suggest that PPAR{gamma} regulates cholesterol metabolism in alveolar macrophages.
Energy Technology Data Exchange (ETDEWEB)
Halvorsen, Bente, E-mail: Bente.Halvorsen@rr-research.no [Research Institute of Internal Medicine, Oslo University Hospital Rikshospitalet, Oslo (Norway); Institute of Clinical Medicine, University of Oslo, Oslo (Norway); K.G. Jebsen Inflammation Research Center, University of Oslo, Oslo (Norway); Holm, Sverre [Research Institute of Internal Medicine, Oslo University Hospital Rikshospitalet, Oslo (Norway); Yndestad, Arne [Research Institute of Internal Medicine, Oslo University Hospital Rikshospitalet, Oslo (Norway); Institute of Clinical Medicine, University of Oslo, Oslo (Norway); K.G. Jebsen Inflammation Research Center, University of Oslo, Oslo (Norway); Scholz, Hanne [Section for Transplantation, Institute for Surgical Research, Oslo University Hospital Rikshospitalet, Oslo (Norway); Sagen, Ellen Lund [Research Institute of Internal Medicine, Oslo University Hospital Rikshospitalet, Oslo (Norway); Nebb, Hilde [Department of Nutrition, Institute for Basic Medical Sciences, University of Oslo, Oslo (Norway); Institute of Clinical Medicine, University of Oslo, Oslo (Norway); Holven, Kirsten B. [Department of Nutrition, Institute for Basic Medical Sciences, University of Oslo, Oslo (Norway); Dahl, Tuva B. [Research Institute of Internal Medicine, Oslo University Hospital Rikshospitalet, Oslo (Norway); Institute of Clinical Medicine, University of Oslo, Oslo (Norway); Aukrust, Pål [Research Institute of Internal Medicine, Oslo University Hospital Rikshospitalet, Oslo (Norway); Section of Clinical Immunology and Infectious Diseases, Oslo University Hospital Rikshospitalet, Oslo (Norway); Institute of Clinical Medicine, University of Oslo, Oslo (Norway); K.G. Jebsen Inflammation Research Center, University of Oslo, Oslo (Norway)
2014-08-08
Highlights: • IL-10 promotes reverse cholesterol efflux from lipid loaded macrophages. • IL-10 increases the expression of ABCA-1 and ABCG-1. • IL-10 exhibits cross-talk with the nuclear receptor LXRα. - Abstract: Interleukin (IL)-10 is a prototypical anti-inflammatory cytokine that has been shown to attenuate atherosclerosis development. In addition to its anti-inflammatory properties, the anti-atherogenic effect of IL-10 has recently also been suggested to reflect a complex effect of IL-10 on lipid metabolism in macrophages. In the present study we examined the effects of IL-10 on cholesterol efflux mechanism in lipid-loaded THP-1 macrophages. Our main findings were: (i) IL-10 significantly enhanced cholesterol efflux induced by fetal-calf serum, high-density lipoprotein (HDL){sub 2} and apolipoprotein A-1. (ii) The IL-10-mediated effects on cholesterol efflux were accompanied by an increased IL-10-mediated expression of the ATP-binding cassette transporters ABCA1 and ABCG1, that was further enhanced when the cells were co-activated with the liver X receptor (LXR)α agonist (22R)-hydroxycholesterol. (iii) The effect of LXRα activation on the IL-10-mediated effects on the ATP-binding cassette transporters seems to include enhancing effects on the IL-10 receptor 1 (IL10R1) expression and interaction with STAT-3 signaling. (iv) These enhancing effects on ABCA1 and ABCG1 was not seen when the cells were stimulated with the IL-10 family members IL-22 and IL-24. This study suggests that the anti-atherogenic properties of IL-10 may include enhancing effects on cholesterol efflux mechanism that involves cross-talk with LXRα activation.
Promoter methylation of MLH1, PMS2, MSH2 and p16 is a phenomenon of advanced-stage HCCs.
Hinrichsen, Inga; Kemp, Matthias; Peveling-Oberhag, Jan; Passmann, Sandra; Plotz, Guido; Zeuzem, Stefan; Brieger, Angela
2014-01-01
Epigenetic silencing of tumour suppressor genes has been observed in various cancers. Looking at hepatocellular carcinoma (HCC) specific protein silencing was previously demonstrated to be associated with the Hepatitis C virus (HCV). However, the proposed HCV dependent promoter methylation of DNA mismatch repair (MMR) genes and thereby enhanced progression of hepatocarcinogenesis has been the subject of controversial discussion. We investigated promoter methylation pattern of the MMR genes MLH1, MSH2 and PMS2 as well as the cyclin-dependent kinase inhibitor 2A gene (p16) in 61 well characterized patients with HCCs associated with HCV, Hepatitis B virus infection or alcoholic liver disease. DNA was isolated from formalin-fixed, paraffin-embedded tumour and non-tumour adjacent tissue and analysed by methylation-specific PCR. Moreover, microsatellite analysis was performed in tissues showing methylation in MMR gene promoters. Our data demonstrated that promoter methylation of MLH1, MSH2, PMS2 and p16 is present among all considered HCCs. Hereby, promoter silencing was detectable more frequently in advanced-stage HCCs than in low-stage ones. However, there was no significant correlation between aberrant DNA methylation of MMR genes or p16 and HCV infection in related HCC specimens. In summary, we show that promoter methylation of essential MMR genes and p16 is detectable in HCCs most dominantly in pT3 stage tumour cases. Since loss of MMR proteins was previously described to be not only responsible for tumour development but also for chemotherapy resistance, the knowledge of mechanisms jointly responsible for HCC progression might enable significant improvement of individual HCC therapy in the future.
Promoter methylation of MLH1, PMS2, MSH2 and p16 is a phenomenon of advanced-stage HCCs.
Directory of Open Access Journals (Sweden)
Inga Hinrichsen
Full Text Available Epigenetic silencing of tumour suppressor genes has been observed in various cancers. Looking at hepatocellular carcinoma (HCC specific protein silencing was previously demonstrated to be associated with the Hepatitis C virus (HCV. However, the proposed HCV dependent promoter methylation of DNA mismatch repair (MMR genes and thereby enhanced progression of hepatocarcinogenesis has been the subject of controversial discussion. We investigated promoter methylation pattern of the MMR genes MLH1, MSH2 and PMS2 as well as the cyclin-dependent kinase inhibitor 2A gene (p16 in 61 well characterized patients with HCCs associated with HCV, Hepatitis B virus infection or alcoholic liver disease. DNA was isolated from formalin-fixed, paraffin-embedded tumour and non-tumour adjacent tissue and analysed by methylation-specific PCR. Moreover, microsatellite analysis was performed in tissues showing methylation in MMR gene promoters. Our data demonstrated that promoter methylation of MLH1, MSH2, PMS2 and p16 is present among all considered HCCs. Hereby, promoter silencing was detectable more frequently in advanced-stage HCCs than in low-stage ones. However, there was no significant correlation between aberrant DNA methylation of MMR genes or p16 and HCV infection in related HCC specimens. In summary, we show that promoter methylation of essential MMR genes and p16 is detectable in HCCs most dominantly in pT3 stage tumour cases. Since loss of MMR proteins was previously described to be not only responsible for tumour development but also for chemotherapy resistance, the knowledge of mechanisms jointly responsible for HCC progression might enable significant improvement of individual HCC therapy in the future.
The flavonoid fisetin promotes osteoblasts differentiation through Runx2 transcriptional activity.
Léotoing, Laurent; Davicco, Marie-Jeanne; Lebecque, Patrice; Wittrant, Yohann; Coxam, Véronique
2014-06-01
Flavonoids represent a group of polyphenolic compounds commonly found in daily nutrition with proven health benefits. Among this group, the flavonol fisetin has been previously shown to protect bone by repressing osteoclast differentiation. In the present study, we investigated the role of fisetin in regulating osteoblasts physiology. In vivo mice treated with LPSs exhibited osteoporosis features associated with a dramatic repression of osteoblast marker expression. In this model, inhibition of osteocalcin and type I collagen alpha 1 transcription was partially countered by a daily consumption of fisetin. Interestingly, in vitro, fisetin promoted both osteoblast alkaline phosphatase activity and mineralization process. To decipher how fisetin may exert its positive effect on osteoblastogenesis, we analyzed its ability to control the runt-related transcription factor 2 (Runx2), a key organizer in developing and maturing osteoblasts. While fisetin did not impact Runx2 mRNA and protein levels, it upregulated its transcriptional activity. Actually, fisetin stimulated the luciferase activity of a reporter plasmid driven by the osteocalcin gene promoter that contains Runx2 binding sites and promoted the mRNA expression of osteocalcin and type I collagen alpha 1 targets. Bone sparing properties of fisetin also rely on its positive influence on osteoblast differentiation and activity. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Joseph Kwong
2006-04-01
Full Text Available Suppression of ovarian tumor growth by chromosome 3p was demonstrated in a previous study. Deleted in Lung and Esophageal Cancer 1 (DLEC1 on 3p22.3 is a candidate tumor suppressor in lung, esophageal, and renal cancers. The potential involvement of DLEC1 in epithelial ovarian cancer remains unknown. In the present study, DLEC1 downregulation was found in ovarian cancer cell lines and primary ovarian tumors. Focus-expressed DLEC1 in two ovarian cancer cell lines resulted in 41% to 52% inhibition of colony formation. No chromosomal loss of chromosome 3p22.3 in any ovarian cancer cell line or tissue was found. Promoter hypermethylation of DLEC1 was detected in ovarian cancer cell lines with reduced DLEC1 transcripts, whereas methylation was not detected in normal ovarian epithelium and DLEC1-expressing ovarian cancer cell lines. Treatment with demethylating agent enhanced DLEC1 expression in 90% (9 of 10 of ovarian cancer cell lines. DLEC1 promoter methylation was examined in 13 high-grade ovarian tumor tissues with DLEC1 downregulation, in which 54% of the tumors showed DLEC1 methylation. In addition, 80% of ovarian cancer cell lines significantly upregulated DLEC1 transcripts after histone deacetylase inhibitor treatment. Therefore, our results suggested that DLEC1 suppressed the growth of ovarian cancer cells and that its downregulation was closely associated with promoter hypermethylation and histone hypoacetylation.
Zha, W J; Li, S H; Zhou, L; Chen, Z J; Liu, K; Yang, G C; Hu, G; He, G C; You, A Q
2015-03-30
The ATP-binding cassette (ABC) transporters belong to a large superfamily of proteins that have important physiological functions in all living organisms. In insects, ABC transporters have important functions in the transport of molecules, and are also involved in insecticide resistance, metabolism, and development. In this study, the Nilaparvata lugens Stal (Hemiptera: Delphacidae) ABCG (NlABCG) gene was identified and characterized. The complete mRNA sequence of NlABCG was 2608-bp long, with an open reading frame of 2064 bp encoding a protein comprised of 687 amino acids. The conserved regions include three N-glycosylation and 34 phosphorylation sites, as well as seven transmembrane domains. The amino acid identity with the closely related species Acyrthosiphon pisum was 42.8%. Developmental expression analysis using quantitative real-time reverse transcriptase PCR suggested that the NlABCG transcript was expressed at all developmental stages of N. lugens. The lowest expression of NlABCG was in the 1st instar, and levels increased with larval growth. The transcript profiles of NlABCG were analyzed in various tissues from a 5th instar nymph, and the highest expression was observed in the midgut. These results suggest that the sequence, characteristics, and expression of NlABCG are highly conserved, and basic information is provided for its functional analysis.
Promoted V2O5/TiO2 catalysts for selective catalytic reduction of NO with NH3 at low temperatures
DEFF Research Database (Denmark)
Putluru, Siva Sankar Reddy; Schill, Leonhard; Godiksen, Anita
2016-01-01
characterized by N2 physisorption, XRPD, NH3-TPD, H2-TPR, Raman, FTIR and EPR spectroscopy to investigate the properties of the catalysts. XRPD, Raman and FTIR showed that promotion with 15 wt.% HPA does not cause V2O5 to be present in crystalline form, also at a loading of 5 wt.% V2O5. Hence, use of HPAs does......The influence of varying the V2O5 content (3–6 wt.%) was studied for the selective catalytic reduction (SCR) of nitrogen oxides by ammonia on heteropoly acid (HPA)- and tungsten oxide (WO3)-promoted V2O5/TiO2 catalysts. The SCR activity and alkali deactivation resistance of HPA-promoted V2O5/TiO2...... catalysts was found to be much higher than for WO3-promoted catalysts. By increasing the vanadium content from 3 to 5 wt.% the catalysts displayed a two fold increase in activity at 225 °C and retained their initial activity after alkali doping at a molar K/V ratio of 0.181. Furthermore, the catalysts were...
Li, Wenji; Su, Zheng-Yuan; Guo, Yue; Zhang, Chengyue; Wu, Renyi; Gao, Linbo; Zheng, Xi; Du, Zhi-Yun; Zhang, Kun; Kong, Ah-Ng
2018-02-19
The carcinogenesis of prostate cancer (PCa) in TRAMP model is highly correlated with hypermethylation in the promoter region of Nrf2 and the accompanying reduced transcription of Nrf2 and its regulated detoxifying genes. We aimed to investigate the effects of (3E,5E)-3,5-bis-(3,4,5-trimethoxybenzylidene)-tetrahydro-thiopyran-4-one (F10) and (3E,5E)-3,5-bis-(3,4,5-trimethoxy-benzylidene)-tetrahydropyran-4-one (E10), two synthetic curcumin derivatives, on restoring Nrf2 activity in TRAMP C1 cells. HepG2-C8 cells transfected with an antioxidant-response element (ARE)-luciferase vector were treated with F10, E10, curcumin, and sulforaphane (SFN) to compare their effects on Nrf2-ARE pathways. We performed real-time quantitative PCR and Western blotting to investigate the effects of F10 and E10 on Nrf2, correlated phase II detoxification genes. We also measured expression and activity of DNMTand HDAC enzymes. Enrichment of H3K27me3 on the promoter region of Nrf2 was explored with a chromatin immunoprecipitation (ChIP) assay. Methylation of the CpG region in Nrf2 promoter was doubly examined by bisulfite genomic sequencing (BGS) and methylation DNA immunoprecipitation (MeDIP). Compared with curcumin and SFN, F10 is more potent in activating Nrf2-ARE pathways. Both F10 and E10 enhanced level of Nrf2 and the correlated phase II detoxifying genes. BGS and MeDIP assays indicated that F10 but not E10 hypomethylated the Nrf2 promoter. F10 also downregulated the protein level of DNMT1, DNMT3a, DNMT3b, HDAC1, HDAC4, and HDAC7 and the activity of DNMTs and HDACs. F10 but not E10 effectively reduced the accumulation of H3k27me3 on the promoter of Nrf2. F10 and E10 can activate the Nrf2-ARE pathway and increase the level of Nrf2 and correlated phase II detoxification genes. The reactivation effect on Nrf2 by F10 in TRAMP C1 may come from demethylation, decrease of HDACs, and inhibition of H3k27me3 accumulation.
Elmeliegy, Mohamed A; Carcaboso, Angel M; Tagen, Michael; Bai, Feng; Stewart, Clinton F
2011-01-01
To study the role of drug transporters in central nervous system (CNS) penetration and cellular accumulation of erlotinib and its metabolite, OSI-420. After oral erlotinib administration to wild-type and ATP-binding cassette (ABC) transporter-knockout mice (Mdr1a/b(-/-), Abcg2(-/-), Mdr1a/b(-/-)Abcg2(-/-), and Abcc4(-/-)), plasma was collected and brain extracellular fluid (ECF) was sampled using intracerebral microdialysis. A pharmacokinetic model was fit to erlotinib and OSI-420 concentration-time data, and brain penetration (P(Brain)) was estimated by the ratio of ECF-to-unbound plasma area under concentration-time curves. Intracellular accumulation of erlotinib was assessed in cells overexpressing human ABC transporters or SLC22A solute carriers. P(Brain) in wild-type mice was 0.27 ± 0.11 and 0.07 ± 0.02 (mean ± SD) for erlotinib and OSI-420, respectively. Erlotinib and OSI-420 P(Brain) in Abcg2(-/-) and Mdr1a/b(-/-)Abcg2(-/-) mice were significantly higher than in wild-type mice. Mdr1a/b(-/-) mice showed similar brain ECF penetration as wild-type mice (0.49 ± 0.37 and 0.04 ± 0.02 for erlotinib and OSI-420, respectively). In vitro, erlotinib and OSI-420 accumulation was significantly lower in cells overexpressing breast cancer resistance protein (BCRP) than in control cells. Only OSI-420, not erlotinib, showed lower accumulation in cells overexpressing P-glycoprotein (P-gp) than in control cells. The P-gp/BCRP inhibitor elacridar increased erlotinib and OSI-420 accumulation in BCRP-overexpressing cells. Erlotinib uptake was higher in OAT3- and OCT2-transfected cells than in empty vector control cells. Abcg2 is the main efflux transporter preventing erlotinib and OSI-420 penetration in mouse brain. Erlotinib and OSI-420 are substrates for SLC22A family members OAT3 and OCT2. Our findings provide a mechanistic basis for erlotinib CNS penetration, cellular uptake, and efflux mechanisms. ©2010 AACR.
Wang, Qi; Li, Juanjuan; Wu, Wei; Shen, Ruizhe; Jiang, He; Qian, Yuting; Tang, Yanping; Bai, Tingting; Wu, Sheng; Wei, Lumin; Zang, Yi; Zhang, Ji; Wang, Lifu
2016-03-08
The importance of Pituitary homeobox 2 (Pitx2) in malignancy remains enigmatic, and Pitx2 has not been previously implicated in pancreatic ductal adenocarcinoma (PDAC). In this study, we performed gene expression profiling of human PDAC tissues and identified Pitx2 as a promising candidate. Pitx2 expression was decreased from 2.6- to 19-fold in human PDAC tissues from microarray units. Immunochemistry staining showed that Pitx2 expression was moderate to intense in normal pancreatic and pancreatic intraepithelial neoplastic lesions, whereas low in human PDAC tissues. The Pitx2 levels correlated with overall patient survival post-operatively in PDAC. Induction of Pitx2 expression partly inhibited the malignant phenotype of PDAC cells. Interestingly, low Pitx2 expression was correlated with Smad4 mutant inactivation, but not with Pitx2 DNA-methylation. Furthermore, Smad4 protein bound to Pitx2 promoter and stimulated Pitx2 expression in PDAC. In addition, Pitx2 protein bound to the promoter of the protein phosphatase 2A regulatory subunit B55α (PPP2R2A) and upregulated PPP2R2A expression, which may activate dephosphorylation of Akt in PDAC. These findings provide new mechanistic insights into Pitx2 as a tumor suppressor in the downstream of Smad4. And Pitx2 protein promotes PPP2R2A expression which may inhibit Akt pathway. Therefore, we propose that the Smad4-Pitx2-PPP2R2A axis, a new signaling pathway, suppresses the pancreatic carcinogenesis.
Tang, Juan; Guo, Yun-Shan; Yu, Xiao-Ling; Huang, Wan; Zheng, Ming; Zhou, Ying-Hui; Nan, Gang; Wang, Jian-Chao; Yang, Hai-Jiao; Yu, Jing-Min; Jiang, Jian-Li; Chen, Zhi-Nan
2015-10-27
Oscillations in intracellular Ca2+ concentrations ([Ca2+]i) mediate various cellular function. Although it is known that [Ca2+]i oscillations are susceptible to dysregulation in tumors, the tumor-specific regulators of [Ca2+]i oscillations are poorly characterized. We discovered that CD147 promotes hepatocellular carcinoma (HCC) metastasis and proliferation by enhancing the amplitude and frequency of [Ca2+]i oscillations in HCC cells. CD147 activates two distinct signaling pathways to regulate [Ca2+]i oscillations. By activating FAK-Src-IP3R1 signaling pathway, CD147 promotes Ca2+ release from endoplasmic reticulum (ER) and enhances the amplitude of [Ca2+]i oscillations. Furthermore, CD147 accelerates ER Ca2+refilling and enhances the frequency of [Ca2+]i oscillations through activating CaMKP-PAK1-PP2A-PLB-SERCA signaling pathway. Besides, CD147-promoted ER Ca2+ release and refilling are tightly regulated by changing [Ca2+]i. CD147 may activate IP3R1 channel under low [Ca2+]i conditions and CD147 may activate SERCA pump under high [Ca2+]i conditions. CD147 deletion suppresses HCC tumorigenesis and increases the survival rate of liver-specific CD147 knockout mice by regulating [Ca2+]i oscillations in vivo. Together, these results reveal that CD147 functions as a critical regulator of ER-dependent [Ca2+]i oscillations to promote oncogenic progression in HCC.
Park, Sin-Hye; Paek, Ji Hun; Shin, Daekeun; Lee, Jae-Yong; Lim, Soon Sung; Kang, Young-Hee
2015-04-01
The cellular accumulation of cholesterol is critical in the development and progression of atherosclerosis. ATP-binding cassette (ABC) transporters play an essential role in mediating the efflux of excess cholesterol. In the current study, we investigated whether purple Perilla frutescens extracts (PPE) at a non-toxic concentration of 1-10 µg/ml stimulate the induction of the ABC transporters, ABCA1 and ABCG1, and cholesterol efflux from lipid-laden J774A.1 murine macrophages exposed to 50 ng/ml oxidized low-density lipoprotein (LDL). Purple perilla, an annual herb in the mint family and its constituents, have been reported to exhibit antioxidant and cytostatic activity, as well as to exert anti-allergic effects. Our results revealed that treatment with oxidized LDL for 24 h led to the accumulation of lipid droplets in the macrophages. PPE suppressed the oxidized LDL-induced foam cell formation by blocking the induction of scavenger receptor B1. However, PPE promoted the induction of the ABC transporters, ABCA1 and ABCG1, and subsequently accelerated cholesterol efflux from the lipid-loaded macrophages. The liver X receptor (LXR) agonist, TO-091317, and the peroxisome proliferator-activated receptor (PPAR) agonist, pioglitazone, increased ABCA1 expression and treatment with 10 µg/ml PPE further enhanced this effect. PPE did not induce LXRα and PPARγ expression per se, but enhanced their expression in the macrophages exposed to oxidized LDL. α-asarone was isolated from PPE and characterized as a major component enhancing the induction of ABCA1 and ABCG1 in macrophages exposed to oxidized LDL. α-asarone, but not β-asarone was effective in attenuating foam cell formation and enhancing cholesterol efflux, revealing an isomeric difference in their activity. The results from the present study demonstrate that PPE promotes cholesterol efflux from macrophages by activating the interaction of PPARγ-LXRα-ABC transporters.
Energy Technology Data Exchange (ETDEWEB)
Kunz, S.; Schmitz, H.J.; Schrenk, D. [Kaiserslautern Univ. (Germany). Dept. of Food Chemistry and Environmental Toxicology; Buchmann, A.; Schwarz, M. [Tuebingen Univ. (Germany). Inst. of Toxicology; Schilling, B.; Paepke, O. [ERGO Research, Hamburg (Germany); Robertson, L.W.; Lehmler, H.J. [Iowa Univ, Iowa City, IA (United States). Dept. of Occupational and Environmental Health
2004-09-15
Polychlorinated biphenyls (PCBs) are potent persistent environmental pollutants exhibiting neurotoxic, teratogenic and tumor-promoting effects in experimental animal models. PCB congeners can be divided into 'dioxin-like' and 'non-dioxin-like' congeners on the basis of their ability to act as aryl hydrocarbon receptor (AhR) agonists. Like the most toxic dioxin congener 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) 'dioxin-like' PCBs bind to the AhR and show characteristic effects on the expression of AhR-regulated genes including the induction of cytochrome P450 (CYP) 1A1. On the other hand, 'non-dioxin-like' PCB congeners have a lower or no binding affinity to the AhR, but exhibit a 'phenobarbital-type' induction of CYP 2B1/2 activity. The tumor-promoting potency of several PCBs has been demonstrated in two-stage initiation-promotion experiments in rat liver. Preneoplastic cell clones, targets for tumor promotion, can be identified as phenotypically altered foci showing characteristic enzyme patterns including the decreased activity of adenosine triphosphatase (ATPase) or the increased expression of the placental form of gluthatione S-transferase (GSTP). In the present study, the effect of the 'non-dioxin-like' 2,4,4'-trichlorobiphenyl (PCB 28) and 2,2',4,5,5'-pentachlorobiphenyl (PCB 101) on the promotion of enzyme-altered hepatic foci was investigated in female Wistar rats after initiation with diethylnitrosamine (DEN).
CNPY2 promoted the proliferation of renal cell carcinoma cells and increased the expression of TP53
International Nuclear Information System (INIS)
Taniguchi, Hidefumi; Ito, Saya; Ueda, Takashi; Morioka, Yukako; Kayukawa, Naruhiro; Ueno, Akihisa; Nakagawa, Hideo; Fujihara, Atsuko; Ushijima, So; Kanazawa, Motohiro; Hongo, Fumiya; Ukimura, Osamu
2017-01-01
Renal cell carcinoma (RCC) is the most common type of kidney cancer. However, the mechanisms underlying the progression of the disease are not well understood. The data in this report suggest that canopy FGF signaling regulator 2 (CNPY2) is a promoter of RCC progression. We found that CNPY2 significantly promoted growth of RCC cells and upregulated TP53 gene expression. Although TP53 is widely known as a tumor suppressor, in RCC TP53 promoted tumor cell growth. A typical p53 target gene, CDKN1A, was upregulated by both p53 and CNPY2 in RCC cells, suggesting that CNPY2 increased the expression level of TP53. Consistent with these results, CNPY2 and TP53 expression levels were positively correlated in RCC patients. These findings suggested that CNPY2 promoted cancer cell growth in RCC through regulating TP53 gene expression. - Highlights: • CNPY2 promoted growth of renal cell carcinoma (RCC) cells. • TP53 expression levels were increased by CNPY2 in RCC cells. • Growth of RCC cells was promoted by TP53. • CNPY2 expression positively correlated with TP53 expression in RCC patients.
Characterization of the human cytochrome P450 enzymes involved in the metabolism of dihydrocodeine
Kirkwood, L. C.; Nation, R. L.; Somogyi, A. A.
1997-01-01
Aims Using human liver microsomes from donors of the CYP2D6 poor and extensive metabolizer genotypes, the role of individual cytochromes P-450 in the oxidative metabolism of dihydrocodeine was investigated. Methods The kinetics of formation of N- and O-demethylated metabolites, nordihydrocodeine and dihydromorphine, were determined using microsomes from six extensive and one poor metabolizer and the effects of chemical inhibitors selective for individual P-450 enzymes of the 1A, 2A, 2C, 2D, 2E and 3A families and of LKM1 (anti-CYP2D6) antibodies were studied. Results Nordihydrocodeine was the major metabolite in both poor and extensive metabolizers. Kinetic constants for N-demethylation derived from the single enzyme Michaelis-Menten model did not differ between the two groups. Troleandomycin and erythromycin selectively inhibited N-demethylation in both extensive and poor metabolizers. The CYP3A inducer, α-naphthoflavone, increased N-demethylation rates. The kinetics of formation of dihydromorphine in both groups were best described by a single enzyme Michaelis-Menten model although inhibition studies in extensive metabolizers suggested involvement of two enzymes with similar Km values. The kinetic constants for O-demethylation were significantly different in extensive and poor metabolizers. The extensive metabolizers had a mean intrinsic clearance to dihydromorphine more than ten times greater than the poor metabolizer. The CYP2D6 chemical inhibitors, quinidine and quinine, and LKM1 antibodies inhibited O-demethylation in extensive metabolizers; no effect was observed in microsomes from a poor metabolizer. Conclusions CYP2D6 is the major enzyme mediating O-demethylation of dihydrocodeine to dihydromorphine. In contrast, nordihydrocodeine formation is predominantly catalysed by CYP3A. PMID:9431830
Journal of Chemical Sciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
... catalyzed by chiral half-sandwich Ruthenium complexes derived from Proline .... Base-oxidant promoted metal-free N-demethylation of arylamines .... and Graph theory:Water cluster low energy structures and completeness of search ... The knowledge of degree of completeness of energy landscape search by stochastic ...
Energy Technology Data Exchange (ETDEWEB)
Suarez, C; Diaz, A; Paz, D; Jimeno, M L
1992-07-01
The main bio radioactive degradation products from catalytic hydrogen exchange of gentamicin C, (C1 + C2 + Cla) in basic form, are generated by N-demethylation in 3{sup -}N and 6-N positions. Their structures were confirmed by 1HNMR and 13CNMR. These derivatives were fractionated by chromatography on silica gel. Antibacterial activities were similar to those of the parent antibiotics. Tritium exchange, under vacuum or nitrogen, is highly increased (4:1) when gentamicin are in basic form. In contrast with gentamicin sulfate, hydrolytic sub products as gramine, genta mines, garosamine and purpurosamines are practically absent. To properly optimize the exchange process, the composition of the gentamicin C complex must be taken into account. The exchange decreases in the order C2 > C1> Cla. Because of 6'-N-demethyl gentamicin C1 is C2, the radiochemical yield of C2 appears enhanced in the H2O-3H exchange of a mixture of them. Radioactivity distribution among the components and subunits of these three gentamicin were studied by strong and mild hydrolysis, and by methanolysis. (Author) 18 refs.
Dvorak, Kaitlyn M; Pettee, Krista M; Rubinic-Minotti, Kaitlin; Su, Robin; Nestor-Kalinoski, Andrea; Eisenmann, Kathryn M
2018-01-01
The tumor microenvironment (TME) promotes tumor cell invasion and metastasis. An important step in the shift to a pro-cancerous microenvironment is the transformation of normal stromal fibroblasts to carcinoma-associated fibroblasts (CAFs). CAFs are present in a majority of solid tumors and can directly promote tumor cell motility via cytokine, chemokine and growth factor secretion into the TME. The exact effects that the TME has upon cytoskeletal regulation in motile tumor cells remain enigmatic. The conserved formin family of cytoskeleton regulating proteins plays an essential role in the assembly and/or bundling of unbranched actin filaments. Mammalian Diaphanous-related formin 2 (mDia2/DIAPH3/Drf3/Dia) assembles a dynamic F-actin cytoskeleton that underlies tumor cell migration and invasion. We therefore sought to understand whether CAF-derived chemokines impact breast tumor cell motility through modification of the formin-assembled F-actin cytoskeleton. In MDA-MB-231 cells, conditioned media (CM) from WS19T CAFs, a human breast tumor-adjacent CAF line, significantly and robustly increased wound closure and invasion relative to normal human mammary fibroblast (HMF)-CM. WS19T-CM also promoted proteasome-mediated mDia2 degradation in MDA-MB-231 cells relative to control HMF-CM and WS21T CAF-CM, a breast CAF cell line that failed to promote robust MDA-MB-231 migration. Cytokine array analysis of CM identified up-regulated secreted factors in WS19T relative to control WS21T CM. We identified CXCL12 as a CM factor influencing loss of mDia2 protein while increasing MDA-MB-231 cell migration. Our data suggest a mechanism whereby CAFs promote tumor cell migration and invasion through CXCL12 secretion to regulate the mDia2-directed cytoskeleton in breast tumor cells.
The miR-599 promotes non-small cell lung cancer cell invasion via SATB2
International Nuclear Information System (INIS)
Tian, Wenjun; Wang, Guanghai; Liu, Yiqing; Huang, Zhenglan; Zhang, Caiqing; Ning, Kang; Yu, Cuixiang; Shen, Yajuan; Wang, Minghui; Li, Yuantang; Wang, Yong; Zhang, Bingchang; Zhao, Yaoran
2017-01-01
MicroRNAs (miRNAs) play important roles in the pathogenesis of many types of cancers by negatively regulating gene expression at posttranscriptional level. Here, we identified that miR-599 is up-regulated in non-small cell lung cancer (NSCLC) patients. It promoted NSCLC cell proliferation by negatively regulating SATB2. In NSCLC cell lines, CCK-8 proliferation assay indicated that the cell proliferation is promoted by miR-599 mimics. Transwell assay showed that miR-599 mimics promoted the invasion and migration of NSCLC cells. Luciferase assays confirmed that miR-599 directly binds to the 3'untranslated region of SATB2, and western blotting showed that miR-599 suppresses the expression of SATB2 at the protein level. This study indicates that miR-599 promotes proliferation and invasion of NSCLC cell lines via SATB2. The miR-599 may represent a potential therapeutic target for NSCLC treatment. - Highlights: • miR-599 is up-regulated in NSCLC. • miR-599 promotes the proliferation and invasion of NSCLC cells. • miR-599 inhibitors inhibits the proliferation and invasion of NSCLC cells. • miR-599 targets 3′ UTR of SATB2 in NSCLC cells. • miR-599 inhibits SATB2 in NSCLC cells.
Mdm2 is a novel activator of ApoCIII promoter which is antagonized by p53 and SHP inhibition
Energy Technology Data Exchange (ETDEWEB)
Yang, Zhihong; Zhang, Yuxia [Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84132 (United States); Wang, Li, E-mail: l.wang@hsc.utah.edu [Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84132 (United States)
2012-01-13
Highlights: Black-Right-Pointing-Pointer Mdm2 enhances HNF4{alpha} activation of the ApoCIII promoter via interaction with HNF4{alpha}. Black-Right-Pointing-Pointer p53 antagonizes the effect of Mdm2 activation of the ApoCIII promoter. Black-Right-Pointing-Pointer SHP strengthens p53 inhibition but abolishes Mdm2 activation of the ApoCIII promoter. Black-Right-Pointing-Pointer Mdm2 alters the enrichment of HNF4{alpha}, p53 and SHP to the ApoCIII promoter. -- Abstract: We examined the effect of Mdm2 on regulation of the ApoCIII promoter and its cross-talk with p53 and nuclear receptor SHP. Overexpression of Mdm2 markedly enhanced ApoCIII promoter activity by HNF4{alpha}. A direct association of Mdm2 protein with the HNF4{alpha} protein was observed by co-immunoprecipitation. Ectopic expression of p53 decreased HNF4{alpha} activation of the ApoCIII promoter and antagonized the effect of Mdm2. Co-expression of SHP further strengthened p53 inhibition and abolished Mdm2 activation of the ApoCIII promoter. Mdm2 inhibited p53-mediated enrichment of HNF4{alpha} to the ApoCIII promoter while simultaneously reducing p53 binding and increasing recruitment of SHP to the ApoCIII promoter. The results from this study implicate a potentially important function of Mdm2 in regulation of lipoprotein metabolism.
Mdm2 is a novel activator of ApoCIII promoter which is antagonized by p53 and SHP inhibition
International Nuclear Information System (INIS)
Yang, Zhihong; Zhang, Yuxia; Wang, Li
2012-01-01
Highlights: ► Mdm2 enhances HNF4α activation of the ApoCIII promoter via interaction with HNF4α. ► p53 antagonizes the effect of Mdm2 activation of the ApoCIII promoter. ► SHP strengthens p53 inhibition but abolishes Mdm2 activation of the ApoCIII promoter. ► Mdm2 alters the enrichment of HNF4α, p53 and SHP to the ApoCIII promoter. -- Abstract: We examined the effect of Mdm2 on regulation of the ApoCIII promoter and its cross-talk with p53 and nuclear receptor SHP. Overexpression of Mdm2 markedly enhanced ApoCIII promoter activity by HNF4α. A direct association of Mdm2 protein with the HNF4α protein was observed by co-immunoprecipitation. Ectopic expression of p53 decreased HNF4α activation of the ApoCIII promoter and antagonized the effect of Mdm2. Co-expression of SHP further strengthened p53 inhibition and abolished Mdm2 activation of the ApoCIII promoter. Mdm2 inhibited p53-mediated enrichment of HNF4α to the ApoCIII promoter while simultaneously reducing p53 binding and increasing recruitment of SHP to the ApoCIII promoter. The results from this study implicate a potentially important function of Mdm2 in regulation of lipoprotein metabolism.
MODEL2TALK : An Intervention to Promote Productive Classroom Talk
van der Veen, Chiel; van der Wilt, Femke; van Kruistum, Claudia; van Oers, Bert; Michaels, Sarah
2017-01-01
This article describes the MODEL2TALK intervention, which aims to promote young children's oral communicative competence through productive classroom talk. Productive classroom talk provides children in early childhood education with many opportunities to talk and think together. Results from a
Energy Technology Data Exchange (ETDEWEB)
Fang, Zejun [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China); Gong, Chaoju [Department of Pathology and Pathophysiology, Zhejiang University School of Medicine, Hangzhou, Zhejiang, 310058 (China); Liu, Hong [Zhejiang Normal University – Jinhua People' s Hospital Joint Center for Biomedical Research, Jinhua, Zhejiang, 321004 (China); Zhang, Xiaomin; Mei, Lingming [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China); Song, Mintao [Department of Pathophysiology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences (CAMS), School of Basic Medicine, Peking Union Medical College (PUMC), Beijing, 100005 (China); Qiu, Lanlan; Luo, Shuchai; Zhu, Zhihua; Zhang, Ronghui; Gu, Hongqian [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China); Chen, Xiang, E-mail: sychenxiang@126.com [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China)
2015-08-21
As the ribonucleotide reductase small subunit, the high expression of ribonucleotide reductase small subunit M2 (RRM2) induces cancer and contributes to tumor growth and invasion. In several colorectal cancer (CRC) cell lines, we found that the expression levels of RRM2 were closely related to the transcription factor E2F1. Mechanistic studies were conducted to determine the molecular basis. Ectopic overexpression of E2F1 promoted RRM2 transactivation while knockdown of E2F1 reduced the levels of RRM2 mRNA and protein. To further investigate the roles of RRM2 which was activated by E2F1 in CRC, CCK-8 assay and EdU incorporation assay were performed. Overexpression of E2F1 promoted cell proliferation in CRC cells, which was blocked by RRM2 knockdown attenuation. In the migration and invasion tests, overexpression of E2F1 enhanced the migration and invasion of CRC cells which was abrogated by silencing RRM2. Besides, overexpression of RRM2 reversed the effects of E2F1 knockdown partially in CRC cells. Examination of clinical CRC specimens demonstrated that both RRM2 and E2F1 were elevated in most cancer tissues compared to the paired normal tissues. Further analysis showed that the protein expression levels of E2F1 and RRM2 were parallel with each other and positively correlated with lymph node metastasis (LNM), TNM stage and distant metastasis. Consistently, the patients with low E2F1 and RRM2 levels have a better prognosis than those with high levels. Therefore, we suggest that E2F1 can promote CRC proliferation, migration, invasion and metastasis by regulating RRM2 transactivation. Understanding the role of E2F1 in activating RRM2 transcription will help to explain the relationship between E2F1 and RRM2 in CRC and provide a novel predictive marker for diagnosis and prognosis of the disease. - Highlights: • E2F1 promotes RRM2 transactivation in CRC cells. • E2F1 promotes the proliferation of CRC cells by activating RRM2. • E2F1 promotes the migration and
HNF1 alpha activates the aminopeptidase N promoter in intestinal (Caco-2) cells
DEFF Research Database (Denmark)
Olsen, Jørgen; Laustsen, Lotte; Troelsen, J
1994-01-01
The importance of HNF1 binding proteins for intestinal aminopeptidase N expression was investigated using the Caco-2 cell-line. Aminopeptidase N promoter activity in Caco-2 cells depends on the HNF1 element (positions -85 to -58) and co-transfection with an HNF1 alpha expression vector demonstrates...... a direct activation of the promoter by HNF1 alpha through this element. Electrophoretic mobility shift assays using nuclear extracts from Caco-2 cells show the presence of high amounts of HNF1 binding proteins irrespective of their state of differentiation....
SAV1 promotes Hippo kinase activation through antagonizing the PP2A phosphatase STRIPAK
Energy Technology Data Exchange (ETDEWEB)
Bae, Sung Jun [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Ni, Lisheng [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Osinski, Adam [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Tomchick, Diana R. [Department of Biophysics, University of Texas Southwestern Medical Center, Dallas, United States; Brautigam, Chad A. [Department of Biophysics, University of Texas Southwestern Medical Center, Dallas, United States; Department of Microbiology, University of Texas Southwestern Medical Center, Dallas, United States; Luo, Xuelian [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Department of Biophysics, University of Texas Southwestern Medical Center, Dallas, United States
2017-10-24
The Hippo pathway controls tissue growth and homeostasis through a central MST-LATS kinase cascade. The scaffold protein SAV1 promotes the activation of this kinase cascade, but the molecular mechanisms remain unknown. Here, we discover SAV1-mediated inhibition of the PP2A complex STRIPAKSLMAP as a key mechanism of MST1/2 activation. SLMAP binding to autophosphorylated MST2 linker recruits STRIPAK and promotes PP2A-mediated dephosphorylation of MST2 at the activation loop. Our structural and biochemical studies reveal that SAV1 and MST2 heterodimerize through their SARAH domains. Two SAV1–MST2 heterodimers further dimerize through SAV1 WW domains to form a heterotetramer, in which MST2 undergoes trans-autophosphorylation. SAV1 directly binds to STRIPAK and inhibits its phosphatase activity, protecting MST2 activation-loop phosphorylation. Genetic ablation of SLMAP in human cells leads to spontaneous activation of the Hippo pathway and alleviates the need for SAV1 in Hippo signaling. Thus, SAV1 promotes Hippo activation through counteracting the STRIPAKSLMAP PP2A phosphatase complex.
Alkali promotion of N-2 dissociation over Ru(0001)
DEFF Research Database (Denmark)
Mortensen, Jens Jørgen; Hammer, Bjørk; Nørskov, Jens Kehlet
1998-01-01
Using self-consistent density functional calculations, we show that adsorbed Na and Cs lower the barrier for dissociation of N2 on Ru(0001). Since N2 dissociation is a crucial step in the ammonia synthesis reaction, we explain in this way the experimental observation that alkali metals promote th...... the ammonia synthesis reaction over Ru catalysts. We also show that the origin of this effect is predominantly a direct electrostatic attraction between the adsorbed alkali atoms and the dissociating molecule....
A growth hormone receptor SNP promotes lung cancer by impairment of SOCS2-mediated degradation
DEFF Research Database (Denmark)
Chhabra, Y.; Wong, H. Y.; Nikolajsen, Louise Fletcher
2018-01-01
Both humans and mice lacking functional growth hormone (GH) receptors are known to be resistant to cancer. Further, autocrine GH has been reported to act as a cancer promoter. Here we present the first example of a variant of the GH receptor (GHR) associated with cancer promotion, in this case lu......-mesenchymal transition and metastases (TWIST1, SNAI2, EGFR, MYC and CCND1) at 2 h after a GH pulse. This is consistent with prolonged GH signalling acting to promote cancer progression in lung cancer.Oncogene advance online publication, 2 October 2017; doi:10.1038/onc.2017.352....
Enhancing promotional strategies within social marketing programs: use of Web 2.0 social media.
Thackeray, Rosemary; Neiger, Brad L; Hanson, Carl L; McKenzie, James F
2008-10-01
The second generation of Internet-based applications (i.e., Web 2.0), in which users control communication, holds promise to significantly enhance promotional efforts within social marketing campaigns. Web 2.0 applications can directly engage consumers in the creative process by both producing and distributing information through collaborative writing, content sharing, social networking, social bookmarking, and syndication. Web 2.0 can also enhance the power of viral marketing by increasing the speed at which consumers share experiences and opinions with progressively larger audiences. Because of the novelty and potential effectiveness of Web 2.0, social marketers may be enticed to prematurely incorporate related applications into promotional plans. However, as strategic issues such as priority audience preferences, selection of appropriate applications, tracking and evaluation, and related costs are carefully considered, Web 2.0 will expand to allow health promotion practitioners more direct access to consumers with less dependency on traditional communication channels.
The role of ghrelin and ghrelin-receptor gene variants and promoter activity in type 2 diabetes.
Garcia, Edwin A; King, Peter; Sidhu, Kally; Ohgusu, Hideko; Walley, Andrew; Lecoeur, Cecile; Gueorguiev, Maria; Khalaf, Sahira; Davies, Derek; Grossman, Ashley B; Kojima, Masayasu; Petersenn, Stephan; Froguel, Phillipe; Korbonits, Márta
2009-08-01
Ghrelin and its receptor play an important role in glucose metabolism and energy homeostasis, and therefore they are functional candidates for genes carrying susceptibility alleles for type 2 diabetes. We assessed common genetic variation of the ghrelin (GHRL; five single nucleotide polymorphisms (SNP)) and the ghrelin-receptor (GHSR) genes (four SNPs) in 610 Caucasian patients with type 2 diabetes and 820 controls. In addition, promoter reporter assays were conducted to model the regulatory regions of both genes. Neither GHRL nor GHSR gene SNPs were associated with type 2 diabetes. One of the ghrelin haplotypes showed a marginal protective role in type 2 diabetes. We observed profound differences in the regulation of the GHRL gene according to promoter sequence variants. There are three different GHRL promoter haplotypes represented in the studied cohort causing up to 45% difference in the level of gene expression, while the promoter region of GHSR gene is primarily represented by a single haplotype. The GHRL and GHSR gene variants are not associated with type 2 diabetes, although GHRL promoter variants have significantly different activities.
Metabolism of tert-butylhydroquinone to S-substituted conjugates in the male fischer 344 rat
Peters, M.M.C.G.; Lau, S.S.; Dulik, D.; Murphy, D.; Ommen, B. van; Bladeren, P.J. van; Monks, T.J.
1996-01-01
tert-Butyl-4-hydroxyanisole (BHA) and its demethylated analog, tert- butyl-hydroquinone (TBHQ), are antioxidants used in food. Both BHA and TBHQ have been shown to promote kidney and bladder carcinogenesis in the rat. We have previously demonstrated that glutathione (GSH) conjugates of a variety of
DEFF Research Database (Denmark)
Andersen, Vibeke; Østergaard, Mette; Christensen, Jane
2009-01-01
(rs5275) polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Results Carriers of the variant......Background The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1) and Breast Cancer Resistance Protein (BCRP/ABCG2) may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA) and polycyclic aromatic hydrocarbons (PAH). Cyclooxygenase-2 (COX-2) derived...... prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC), and to investigate possible interactions with lifestyle factors...
Directory of Open Access Journals (Sweden)
Rui Moreira
2018-03-01
Full Text Available In this work, a Mo2C catalyst that was supported on commercial carbon nanofibers (CNF was synthetized and tested in the hydrodeoxygenation (HDO of guaiacol. The effects of operating conditions (temperature and pressure and reaction time (2 and 4 h on the conversion of guaiacol and products selectivity were studied. The major reaction products were cresol and phenol, followed by xylenols and toluene. The use of more severe operating conditions during the HDO of guaiacol caused a diversification in the reaction pathways, and consequently in the selectivity to products. The formation of phenol may have occurred by demethylation of guaiacol, followed by dehydroxylation of catechol, together with other reaction pathways, including direct guaiacol demethoxylation, and demethylation of cresols. X-ray diffraction (XRD analysis of spent catalysts did not reveal any significant changes as compared to the fresh catalyst.
Directory of Open Access Journals (Sweden)
Rafael Estrada-Avilés
Full Text Available Calsequestrin-2 (CASQ2 is the main Ca2+-binding protein inside the sarcoplasmic reticulum of cardiomyocytes. Previously, we demonstrated that MEF-2 and SRF binding sites within the human CASQ2 gene (hCASQ2 promoter region are functional in neonatal cardiomyocytes. In this work, we investigated if the calcineurin/NFAT pathway regulates hCASQ2 expression in neonatal cardiomyocytes. The inhibition of NFAT dephosphorylation with CsA or INCA-6, reduced both the luciferase activity of hCASQ2 promoter constructs (-3102/+176 bp and -288/+176 bp and the CASQ2 mRNA levels in neonatal rat cardiomyocytes. Additionally, NFATc1 and NFATc3 over-expressing neonatal cardiomyocytes showed a 2-3-fold increase in luciferase activity of both hCASQ2 promoter constructs, which was prevented by CsA treatment. Site-directed mutagenesis of the -133 bp MEF-2 binding site prevented trans-activation of hCASQ2 promoter constructs induced by NFAT overexpression. Chromatin Immunoprecipitation (ChIP assays revealed NFAT and MEF-2 enrichment within the -288 bp to +76 bp of the hCASQ2 gene promoter. Besides, a direct interaction between NFAT and MEF-2 proteins was demonstrated by protein co-immunoprecipitation experiments. Taken together, these data demonstrate that NFAT interacts with MEF-2 bound to the -133 bp binding site at the hCASQ2 gene promoter. In conclusion, in this work, we demonstrate that the Ca2+-calcineurin/NFAT pathway modulates the transcription of the hCASQ2 gene in neonatal cardiomyocytes.
Židková, Monika; Linhart, Igor; Balíková, Marie; Himl, Michal; Dvořáčková, Veronika; Lhotková, Eva; Páleníček, Tomáš
2018-06-01
1. Methylone (3,4-methylenedioxy-N-methylcathinone, MDMC), which appeared on the illicit drug market in 2004, is a frequently abused synthetic cathinone derivative. Known metabolic pathways of MDMC include N-demethylation to normethylone (3,4-methylenedioxycathinone, MDC), aliphatic chain hydroxylation and oxidative demethylenation followed by monomethylation and conjugation with glucuronic acid and/or sulphate. 2. Three new phase II metabolites, amidic conjugates of MDC with succinic, glutaric and adipic acid, were identified in the urine of rats dosed subcutaneously with MDMC.HCl (20 mg/kg body weight) by LC-ESI-HRMS using synthetic reference standards to support identification. 3. The main portion of administered MDMC was excreted unchanged. Normethylone, was a major urinary metabolite, of which a minor part was conjugated with dicarboxylic acids. 4. Previously identified ring-opened metabolites 4-hydroxy-3-methoxymethcathinone (4-OH-3-MeO-MC), 3-hydroxy-4-methoxymeth-cathinone (3-OH-4-MeO-MC) and 3,4-dihydroxymethcathinone (3,4-di-OH-MC) mostly in conjugated form with glucuronic and/or sulphuric acids were also detected. 5. Also, ring-opened metabolites derived from MDC, namely, 4-hydroxy-3-methoxycathinone (4-OH-3-MeO-C), 3-hydroxy-4-methoxycathinone (3-OH-4-MeO-C) and 3,4-dihydroxycathinone (3,4-di-OH-C) were identified for the first time in vivo.
International Nuclear Information System (INIS)
Suarez, C.; Diaz, A.; Paz, D.; Jimeno, M. L.
1992-01-01
The main bio radioactive degradation products from catalytic hydrogen exchange of gentamicin C, (C1 + C2 + Cla) in basic form, are generated by N-demethylation in 3 - N and 6-N positions. Their structures were confirmed by 1HNMR and 13CNMR. These derivatives were fractionated by chromatography on silica gel. Antibacterial activities were similar to those of the parent antibiotics. Tritium exchange, under vacuum or nitrogen, is highly increased (4:1) when gentamicin are in basic form. In contrast with gentamicin sulfate, hydrolytic sub products as gramine, genta mines, garosamine and purpurosamines are practically absent. To properly optimize the exchange process, the composition of the gentamicin C complex must be taken into account. The exchange decreases in the order C2 > C1> Cla. Because of 6'-N-demethyl gentamicin C1 is C2, the radiochemical yield of C2 appears enhanced in the H2O-3H exchange of a mixture of them. Radioactivity distribution among the components and subunits of these three gentamicin were studied by strong and mild hydrolysis, and by methanolysis. (Author) 18 refs
Role of CeO2 promoter in NiO/α-Al2O3 catalyst for dry reforming of methane
Loc, Luu Cam; Phuong, Phan Hong; Tri, Nguyen
2017-09-01
A series of Ni/α-Al2O3 (NiAl) catalysts promoted by CeO2 was prepared by co-impregnation methods with content of (NiO+CeO2) being in the range of 10-30 wt%. The NiO:CeO2 weight ratio was fluctuated at 1:1, 1:2 and 1:3. Several techniques, including X-ray powder diffraction (XRD), Hydrogen temperature-programmed reduction (H2-TPR), and transmission electron microscopy (TEM) were used to investigate catalysts' physico-chemical properties. The activity of these catalysts in dry reforming of CH4 was investigated at temperature range of 550-800 °C. The results revealed that the most suitable CeO2 promoted Ni catalyst contained 20 wt% of (NiO+CeO2) and NiO:CeO2 weight ratio of 1:2. The best catalytic performance of catalyst [20(1Ni2Ce)Al] due to a better reducibility resulted in a higher amount of free small particle NiO. At 700 °C and CH4:CO2 molar ratio of 1:1, the conversion of CH4 and CO2 on the most suitable CeO2 promoted Ni catalyst reached 86% and 67%, respectively; H2 and CO selectivity of 90% and H2:CO molar ratio of 1.15 were obtained. Being similar to MgO [1], promoter CeO2 could improve catalytic activity of Ni/α-Al2O3 catalyst at a lower range of temperature. Besides, both MgO and CeO2 had a great impact on improving coke resistance of Ni catalysts. At higher temperature, the role of CeO2 as well as MgO in preventing coke formation on catalyst was clarified by temperature-programmed oxidation (TPO) technique. Coke amount formed after 30-h TOS on 20(1Ni2Ce) catalyst was found to be 22.18 mgC/gcat, being less than on non-promoted catalyst (36.75 mgC/gcat), but more than on 20(1Ni2Mg)Al one (5.25 mgC/gcat).
Kehrmann, Jan; Tatura, Roman; Zeschnigk, Michael; Probst-Kepper, Michael; Geffers, Robert; Steinmann, Joerg; Buer, Jan
2014-07-01
The epigenetic regulation of transcription factor genes is critical for T-cell lineage specification. A specific methylation pattern within a conserved region of the lineage specifying transcription factor gene FOXP3, the Treg-specific demethylated region (TSDR), is restricted to regulatory T (Treg) cells and is required for stable expression of FOXP3 and suppressive function. We analysed the impact of hypomethylating agents 5-aza-2'-deoxycytidine and epigallocatechin-3-gallate on human CD4(+) CD25(-) T cells for generating demethylation within FOXP3-TSDR and inducing functional Treg cells. Gene expression, including lineage-specifying transcription factors of the major T-cell lineages and their leading cytokines, functional properties and global transcriptome changes were analysed. The FOXP3-TSDR methylation pattern was determined by using deep amplicon bisulphite sequencing. 5-aza-2'-deoxycytidine induced FOXP3-TSDR hypomethylation and expression of the Treg-cell-specific genes FOXP3 and LRRC32. Proliferation of 5-aza-2'-deoxycytidine-treated cells was reduced, but the cells did not show suppressive function. Hypomethylation was not restricted to FOXP3-TSDR and expression of master transcription factors and leading cytokines of T helper type 1 and type 17 cells were induced. Epigallocatechin-3-gallate induced global DNA hypomethylation to a lesser extent than 5-aza-2'-deoxycitidine, but no relevant hypomethylation within FOXP3-TSDR or expression of Treg-cell-specific genes. Neither of the DNA methyltransferase inhibitors induced fully functional human Treg cells. 5-aza-2'-deoxycitidine-treated cells resembled Treg cells, but they did not suppress proliferation of responder cells, which is an essential capability to be used for Treg cell transfer therapy. Using a recently developed targeted demethylation technology might be a more promising approach for the generation of functional Treg cells. © 2014 John Wiley & Sons Ltd.
Predictability of Joint Promotion Examinations in SS2 on Academic ...
African Journals Online (AJOL)
This research studied the predictability of joint SS2 promotion examinations of all the command secondary schools in Nigeria on academic performance of students in Senior School Certificate Examinations. The sample consists of 120 students selected at the Command Secondary School, Abakaliki and Command Day ...
DEFF Research Database (Denmark)
Sohoni, Sujata Vijay; Fazio, Alessandro; Workman, Christopher
2014-01-01
The objective of this study was the application of the synthetic promoter library (SPL) technology for modulation of actinorhodin production in Streptomyces coelicolor A3(2). The SPL technology was used to optimize the expression of a pathway specific positive transcriptional regulator Actll orf4...... constitutive promoter. ScoSPL20 demonstrated exceptional productivity despite having a comparatively weak expression from the promoter. Interestingly, the ScoSPL20 promoter was activated at a much earlier stage of growth compared to the wild type, demonstrating the advantage of fine-tuning and temporal tuning......, which activates the transcription of the S. coelicolor actinorhodin biosynthetic gene cluster. The native actll orf4 promoter was replaced with synthetic promoters, generating a S. coelicolor library with a broad range of expression levels of actll orf4. The resulting library was screened based...
Promotion of Nb2O5 on the wustite-based iron catalyst for ammonia synthesis
International Nuclear Information System (INIS)
Han, Wenfeng; Huang, Shiliang; Cheng, Tianhong; Tang, Haodong; Li, Ying; Liu, Huazhang
2015-01-01
Highlights: • Niobium enhances the reduction of wustite-based ammonia synthesis catalyst significantly. • Nb 2 O 5 inhibits the segregation or formation of solid solutions on the catalyst surface. • Nb 2 O 5 doping enhances the growth rates of [2 1 1] and [2 0 0] planes rather than their amounts. - Abstract: Niobium was selected and investigated as a potential promoter for wustite-based catalyst (WBC) for ammonia synthesis. Experiments on reduction performance, activity test and H 2 -TGA, in situ XRD as well as XPS were carried out to obtain the promotion effect and mechanism involved. Niobium as a promoter was confirmed to enhance the reduction of WBC significantly. This behavior is highly desired for industry in terms of catalyst regeneration and lesser pretreatment time for fabrication regardless the unimproved catalytic performance for Nb 2 O 5 -doped wustite-based catalyst (Nb-WBC). Possible reasons for these phenomena are discussed. It is suggested that Nb 2 O 5 is not favorable for the segregation or formation of solid solutions on the catalyst surface, which are difficult to be reduced. However, it seems that niobium does not promote the growth of [2 1 1] plane, which is active for ammonia synthesis.
Liu, Yuan; Chen, Zhijun; Cheng, Haixia; Chen, Juan; Qian, Jing
2017-01-03
Retinopathy of prematurity (ROP) is characterized by late-phase pathologic retinal vasoproliferation. Gremlin is a novel vascular endothelial growth factors (VEGF) receptor 2 (VEGFR2) agonist and promotes angiogenic response. We demonstrated that gremlin expression was significantly increased in retinas of ROP model mice, which was correlated with VEGF upregulation. In retinal pigmentation epithelial (RPE) cells, gremlin activated VEGFR2-Akt-mTORC2 (mammalian target of rapamycin complex 2) signaling, and promoted cell proliferation, migration and VEGF production. VEGFR inhibition (by SU5416) or shRNA knockdown almost abolished gremlin-mediated pleiotropic functions in RPE cells. Further, pharmacological inhibition of Akt-mTOR, or shRNA knockdown of key mTORC2 component (Rictor or Sin1) also attenuated gremlin-exerted activities in RPE cells. We conclude that gremlin promotes RPE cell proliferation, migration and VEGF production possibly via activating VEGFR2-Akt-mTORC2 signaling. Gremlin could be a novel therapeutic target of ROP or other retinal vasoproliferation diseases.
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Characterization of placental cholesterol transport
DEFF Research Database (Denmark)
Lindegaard, Marie L; Wassif, Christopher A; Vaisman, Boris
2008-01-01
Patients with Smith-Lemli-Opitz syndrome (SLOS) are born with multiple congenital abnormalities. Postnatal cholesterol supplementation is provided; however, it cannot correct developmental malformations due to in utero cholesterol deficit. Increased transport of cholesterol from maternal to fetal...... circulation might attenuate congenital malformations. The cholesterol transporters Abca1, Abcg1, and Sr-b1 are present in placenta; however, their potential role in placental transport remains undetermined. In mice, expression analyses showed that Abca1 and Abcg1 transcripts increased 2-3-fold between...... embryonic days 13.5 and 18.5 in placental tissue; whereas, Sr-b1 expression decreased. To examine the functional role of Abca1, Abcg1 and Sr-b1 we measured the maternal-fetal transfer of (14)C-cholesterol in corresponding mutant embryos. Disruption of either Abca1 or Sr-b1 decreased cholesterol transfer...
Promoting Reflective Thinking Skills by Using Web 2.0 Application
Abdullah, Mohamed
2015-01-01
The study aims to investigate are using Web 2.0 applications promoting reflective thinking skills for higher education student in faculty for education. Although the literature reveals that technology integration is a trend in higher education and researchers and educators have increasingly shared their ideas and examples of implementations of Web…
Multicomponent Biginelli's synthesis of 3,4-dihydropyrimidin-2(1H-ones promoted by SnCl2.2H2O
Directory of Open Access Journals (Sweden)
Russowsky Dennis
2004-01-01
Full Text Available The ability of SnCl2.2H2O as catalyst to promote the Biginelli three-component condensation reaction from a diversity of aromatic aldehydes, ethyl acetoacetate and urea or thiourea is described. The reaction was carried out in acetonitrile or ethanol as solvents in neutral media and represents an improvement of the classical Biginelli protocol and an advantage in comparison with FeCl3.6H2O, NiCl2.6H2O and CoCl2.6H2O which were used with HCl as co-catalyst. The synthesis of 3,4-dihydropyrimidinones was achieved in good to excelent yields.
Ramoutar, D; Cowles, R S; Requintina, E; Alm, S R
2010-10-01
In 2007-2008, the "annual bluegrass weevil," Listronotus maculicollis Kirby (Coleoptera: Curculionidae), a serious pest of Poa annua L. (Poales: Poaceae) on U.S. golf courses, was shown to be resistant to two pyrethroids, bifenthrin and lambda-cyhalothrin. In 2008, we showed that bifenthrin resistance was principally mediated by oxidase detoxification (cytochrome P450 [P450]). P450s can be inhibited by demethylation inhibitor fungicides and gibberellin inhibitor plant growth regulators, both of which are commonly used on golf courses. We tested these compounds for synergistic activity with bifenthin against a pyrethroid-resistant population of L. maculicollis. The LD50 value for bifenthrin was significantly reduced from 87 ng per insect (without synergists) to 9.6-40 ng per insect after exposure to the fungicides fenarimol, fenpropimorph, prochloraz, propiconazole, and pyrifenox and the plant growth regulators flurprimidol, paclobutrazol, and trinexapac-ethyl. Simulated field exposure with formulated products registered for use on turf revealed enhanced mortality when adult weevils were exposed to bifenthrin (25% mortality, presented alone) combined with field dosages of propiconizole, fenarimol, flurprimidol, or trinexapac-ethyl (range, 49-70% mortality).
A DEMETER-like DNA demethylase governs tomato fruit ripening.
Liu, Ruie; How-Kit, Alexandre; Stammitti, Linda; Teyssier, Emeline; Rolin, Dominique; Mortain-Bertrand, Anne; Halle, Stefanie; Liu, Mingchun; Kong, Junhua; Wu, Chaoqun; Degraeve-Guibault, Charlotte; Chapman, Natalie H; Maucourt, Mickael; Hodgman, T Charlie; Tost, Jörg; Bouzayen, Mondher; Hong, Yiguo; Seymour, Graham B; Giovannoni, James J; Gallusci, Philippe
2015-08-25
In plants, genomic DNA methylation which contributes to development and stress responses can be actively removed by DEMETER-like DNA demethylases (DMLs). Indeed, in Arabidopsis DMLs are important for maternal imprinting and endosperm demethylation, but only a few studies demonstrate the developmental roles of active DNA demethylation conclusively in this plant. Here, we show a direct cause and effect relationship between active DNA demethylation mainly mediated by the tomato DML, SlDML2, and fruit ripening- an important developmental process unique to plants. RNAi SlDML2 knockdown results in ripening inhibition via hypermethylation and repression of the expression of genes encoding ripening transcription factors and rate-limiting enzymes of key biochemical processes such as carotenoid synthesis. Our data demonstrate that active DNA demethylation is central to the control of ripening in tomato.
FGF‐2 promotes osteocyte differentiation through increased E11/podoplanin expression
Ikpegbu, Ekele; Basta, Lena; Clements, Dylan N.; Fleming, Robert; Vincent, Tonia L.; Buttle, David J.; Pitsillides, Andrew A.; Farquharson, Colin
2018-01-01
E11/podoplanin is critical in the early stages of osteoblast‐to‐osteocyte transitions (osteocytogenesis), however, the upstream events which regulate E11 expression are unknown. The aim of this study was to examine the effects of FGF‐2 on E11‐mediated osteocytogenesis and to reveal the nature of the underlying signaling pathways regulating this process. Exposure of MC3T3 osteoblast‐like cells and murine primary osteoblasts to FGF‐2 (10 ng/ml) increased E11 mRNA and protein expression (p 70% reduction of basal E11 mRNA expression (p < 0.05) and effectively abrogated FGF‐2‐related changes in E11 expression and dendrite formation. FGF‐2 strongly activated the ERK signaling pathway in osteoblast‐like cells but inhibition of this pathway did not block the ability of FGF‐2 to enhance E11 expression or to promote acquisition of the osteocyte phenotype. The results of this study highlight a novel mechanism by which FGF‐2 can regulate osteoblast differentiation and osteocyte formation. Specifically, the data suggests that FGF‐2 promotes osteocytogenesis through increased E11 expression and further studies will identify if this regulatory pathway is essential for bone development and maintenance in health and disease. PMID:29215722
Direct inhibition of TNF-α promoter activity by Fanconi anemia protein FANCD2.
Directory of Open Access Journals (Sweden)
Nobuko Matsushita
Full Text Available Fanconi anemia (FA, an inherited disease, is associated with progressive bone marrow failure, predisposition to cancer, and genomic instability. Genes corresponding to 15 identified FA complementation groups have been cloned, and each gene product functions in the response to DNA damage induced by cross-linking agents and/or in protection against genome instability. Interestingly, overproduction of inflammatory cytokines such as tumor necrosis factor alpha (TNF-α and aberrant activation of NF-κB-dependent transcriptional activity have been observed in FA cells. Here we demonstrated that FANCD2 protein inhibits NF-κB activity in its monoubiquitination-dependent manner. Furthermore, we detected a specific association between FANCD2 and an NF-κB consensus element in the TNF-α promoter by electrophoretic mobility shift assays (EMSA and chromatin immunoprecipitation (ChIP assay. Therefore, we propose FANCD2 deficiency promotes transcriptional activity of the TNF-α promoter and induces overproduction of TNF-which then sustains prolonged inflammatory responses. These results also suggest that artificial modulation of TNFα production could be a promising therapeutic approach to FA.
saRNA-guided Ago2 targets the RITA complex to promoters to stimulate transcription.
Portnoy, Victoria; Lin, Szu Hua Sharon; Li, Kathy H; Burlingame, Alma; Hu, Zheng-Hui; Li, Hao; Li, Long-Cheng
2016-03-01
Small activating RNAs (saRNAs) targeting specific promoter regions are able to stimulate gene expression at the transcriptional level, a phenomenon known as RNA activation (RNAa). It is known that RNAa depends on Ago2 and is associated with epigenetic changes at the target promoters. However, the precise molecular mechanism of RNAa remains elusive. Using human CDKN1A (p21) as a model gene, we characterized the molecular nature of RNAa. We show that saRNAs guide Ago2 to and associate with target promoters. saRNA-loaded Ago2 facilitates the assembly of an RNA-induced transcriptional activation (RITA) complex, which, in addition to saRNA-Ago2 complex, includes RHA and CTR9, the latter being a component of the PAF1 complex. RITA interacts with RNA polymerase II to stimulate transcription initiation and productive elongation, accompanied by monoubiquitination of histone 2B. Our results establish the existence of a cellular RNA-guided genome-targeting and transcriptional activation mechanism and provide important new mechanistic insights into the RNAa process.
Energy Technology Data Exchange (ETDEWEB)
Suarez, C.; Diaz, A.; Paz, D.; Jimeno, M. L.
1992-07-01
The main bio radioactive degradation products from catalytic hydrogen exchange of gentamicin C, (C1 + C2 + Cla) in basic form, are generated by N-demethylation in 3{sup -}N and 6-N positions. Their structures were confirmed by 1HNMR and 13CNMR. These derivatives were fractionated by chromatography on silica gel. Antibacterial activities were similar to those of the parent antibiotics. Tritium exchange, under vacuum or nitrogen, is highly increased (4:1) when gentamicin are in basic form. In contrast with gentamicin sulfate, hydrolytic sub products as gramine, genta mines, garosamine and purpurosamines are practically absent. To properly optimize the exchange process, the composition of the gentamicin C complex must be taken into account. The exchange decreases in the order C2 > C1> Cla. Because of 6'-N-demethyl gentamicin C1 is C2, the radiochemical yield of C2 appears enhanced in the H2O-3H exchange of a mixture of them. Radioactivity distribution among the components and subunits of these three gentamicin were studied by strong and mild hydrolysis, and by methanolysis. (Author) 18 refs.
Directory of Open Access Journals (Sweden)
Deepti Jain
Full Text Available Plants respond to different forms of stresses by inducing transcription of a common and distinct set of genes by concerted actions of a cascade of transcription regulators. We previously reported that a gene, CaZF encoding a C2H2-zinc finger family protein from chickpea (Cicer arietinum imparted high salinity tolerance when expressed in tobacco plants. We report here that in addition to promoting tolerance against dehydration, salinity and high temperature, the CaZF overexpressing plants exhibited similar phenotype of growth and development like the plants overexpressing CAP2, encoding an AP2-family transcription factor from chickpea. To investigate any relationship between these two genes, we performed gene expression analysis in the overexpressing plants, promoter-reporter analysis and chromatin immunoprecipitation. A number of transcripts that exhibited enhanced accumulation upon expression of CAP2 or CaZF in tobacco plants were found common. Transient expression of CAP2 in chickpea leaves resulted in increased accumulation of CaZF transcript. Gel mobility shift and transient promoter-reporter assays suggested that CAP2 activates CaZF promoter by interacting with C-repeat elements (CRTs in CaZF promoter. Chromatin immunoprecipitation (ChIP assay demonstrated an in vivo interaction of CAP2 protein with CaZF promoter.
Impact of Ni promotion on the hydrogenation pathways of phenanthrene on MoS 2 /γ-Al 2 O 3
Energy Technology Data Exchange (ETDEWEB)
Schachtl, Eva; Yoo, Jong Suk; Gutiérrez, Oliver Y.; Studt, Felix; Lercher, Johannes A.
2017-08-01
The reaction network and elementary steps of the hydrogenation of phenanthrene are explored on parent and Ni-promoted MoS2/c-Al2O3. Two pathways were identified, i.e., Path 1: Phenanthrene _ 9,10-dihydrophenanthrene (DiHPhe)?1,2,3,4,4a,9,10,10a-octahydro-phenanthrene (asymOHPhe), and Path 2: Phenanthrene ?1,2,3,4-tetrahydrophenanthrene (TetHPhe)?1,2,3,4,5,6,7,8-octahydrophenan threne. The steps TetHPhe?asymOHPhe (hydrogenation), and DiHPhe?TetHPhe (hydrogenationisomerization) become notable at phenanthrene conversions above 20%. The reaction preferentially proceeds via Path 1 (90% selectivity) on MoS2/Al2O3. Ni promotion (Ni/(Ni + Mo) molar ratio of 0.3 at the edges on MoS2) increases the hydrogenation activity per active edge twofold and leads to 50% selectivity to both pathways. The reaction orders in H2 vary from _0.8 on MoS2/Al2O3 to _1.2 on Ni-MoS2/Al2O3, whereas the reaction orders in phenanthrene (_0.6) hardly depend on Ni promotion. The reaction orders in H2S are zero on MoS2/Al2O3 and slightly negative on Ni-MoS2/Al2O3. DFT calculations indicate that phenanthrene is preferentially adsorbed parallel to the basal planes, while H is located at the edges perpendicular to the basal planes. Theory also suggests that Ni atoms, incorporated preferentially on the S-edges, increase the stability of hydrogenated intermediates. Hydrogenation of phenanthrene proceeds through quasi-equilibrated adsorption of the reactants followed by consecutive addition of hydrogen pairs to the adsorbed hydrocarbon. The rate determining steps for the formation of DiHPhe and TetHPhe are the addition of the first and second hydrogen pair, respectively. The concentration of SH groups (activated H at the edges) increases with Ni promotion linearly correlating the rates of Path 1 and Path 2, albeit with different functions. The enhancing effect of Ni on Path 2 is attributed to accelerated hydrogen addition to adsorbed hydrocarbons without important changes in their coverages.
P2Y2 Receptor and EGFR Cooperate to Promote Prostate Cancer Cell Invasion via ERK1/2 Pathway.
Li, Wei-Hua; Qiu, Ying; Zhang, Hong-Quan; Tian, Xin-Xia; Fang, Wei-Gang
2015-01-01
As one member of G protein-coupled P2Y receptors, P2Y2 receptor can be equally activated by extracellular ATP and UTP. Our previous studies have proved that activation of P2Y2 receptor by extracellular ATP could promote prostate cancer cell invasion and metastasis in vitro and in vivo via regulating the expressions of some epithelial-mesenchymal transition/invasion-related genes (including IL-8, E-cadherin, Snail and Claudin-1), and the most significant change in expression of IL-8 was observed after P2Y2 receptor activation. However, the signaling pathway downstream of P2Y2 receptor and the role of IL-8 in P2Y2-mediated prostate cancer cell invasion remain unclear. Here, we found that extracellular ATP/UTP induced activation of EGFR and ERK1/2. After knockdown of P2Y2 receptor, the ATP -stimulated phosphorylation of EGFR and ERK1/2 was significantly suppressed. Further experiments showed that inactivation of EGFR and ERK1/2 attenuated ATP-induced invasion and migration, and suppressed ATP-mediated IL-8 production. In addition, knockdown of IL-8 inhibited ATP-mediated invasion and migration of prostate cancer cells. These findings suggest that P2Y2 receptor and EGFR cooperate to upregulate IL-8 production via ERK1/2 pathway, thereby promoting prostate cancer cell invasion and migration. Thus blocking of the P2Y2-EGFR-ERK1/2 pathway may provide effective therapeutic interventions for prostate cancer.
Kessels, Jana Elena; Wessels, Inga; Haase, Hajo; Rink, Lothar; Uciechowski, Peter
2016-09-01
The distribution of intracellular zinc, predominantly regulated through zinc transporters and zinc binding proteins, is required to support an efficient immune response. Epigenetic mechanisms such as DNA methylation are involved in the expression of these genes. In demethylation experiments using 5-Aza-2'-deoxycytidine (AZA) increased intracellular (after 24 and 48h) and total cellular zinc levels (after 48h) were observed in the myeloid cell line HL-60. To uncover the mechanisms that cause the disturbed zinc homeostasis after DNA demethylation, the expression of human zinc transporters and zinc binding proteins were investigated. Real time PCR analyses of 14 ZIP (solute-linked carrier (SLC) SLC39A; Zrt/IRT-like protein), and 9 ZnT (SLC30A) zinc transporters revealed significantly enhanced mRNA expression of the zinc importer ZIP1 after AZA treatment. Because ZIP1 protein was also enhanced after AZA treatment, ZIP1 up-regulation might be the mediator of enhanced intracellular zinc levels. The mRNA expression of ZIP14 was decreased, whereas zinc exporter ZnT3 mRNA was also significantly increased; which might be a cellular reaction to compensate elevated zinc levels. An enhanced but not significant chromatin accessibility of ZIP1 promoter region I was detected by chromatin accessibility by real-time PCR (CHART) assays after demethylation. Additionally, DNA demethylation resulted in increased mRNA accumulation of zinc binding proteins metallothionein (MT) and S100A8/S100A9 after 48h. MT mRNA was significantly enhanced after 24h of AZA treatment also suggesting a reaction of the cell to restore zinc homeostasis. These data indicate that DNA methylation is an important epigenetic mechanism affecting zinc binding proteins and transporters, and, therefore, regulating zinc homeostasis in myeloid cells. Copyright © 2016 Elsevier GmbH. All rights reserved.
Solubility and viscosity for CO_2 capture process using MEA promoted DEAE aqueous solution
International Nuclear Information System (INIS)
Fu, Dong; Wang, LeMeng; Zhang, Pan; Mi, ChenLu
2016-01-01
Highlights: • Solubility of CO_2 in MEA promoted DEAE aqueous solution was measured. • Mass fraction and temperature dependences of solubility were illustrated. • Viscosities of carbonated MEA–DEAE solutions were measured and calculated. • Temperature, mass fraction and CO_2 loading dependences of viscosity were illustrated. - Abstract: The saturated solubility of CO_2 in monoethanolamine (MEA) promoted 2-diethylaminoethanol (DEAE) aqueous solution was investigated at temperatures ranging from (303.2 to 323.2) K. The mass fraction and temperature dependences of the saturated solubility and CO_2 loading are illustrated. The viscosities of both CO_2-unloaded and CO_2-loaded DEAE–MEA aqueous solutions were measured and then calculated by using the Weiland equation. The effects of temperature, mass fraction and CO_2 loading on viscosities are demonstrated.
Insulin Promoter Factor 1 variation is associated with type 2 diabetes in African Americans
Directory of Open Access Journals (Sweden)
Wang Xiaoqin
2005-10-01
Full Text Available Abstract Background Defective insulin secretion is a key defect in the pathogenesis of type 2 diabetes (T2DM. The β-cell specific transcription factor, insulin promoter factor 1 gene (IPF1, is essential to pancreatic development and the maintenance of β-cell mass. We hypothesized that regulatory or coding variants in IPF1 contribute to defective insulin secretion and thus T2DM. Methods We screened 71 Caucasian and 69 African American individuals for genetic variants in the promoter region, three highly conserved upstream regulatory sequences (PH1, PH2 and PH3, the human β-cell specific enhancer, and the two exons with adjacent introns. We tested for an association of each variant with T2DM Caucasians (192 cases and 192 controls and African Americans (341 cases and 186 controls. Results We identified 8 variants in the two populations, including a 3 bp insertion in exon 2 (InsCCG243 in African Americans that resulted in an in-frame proline insertion in the transactivation domain. No variant was associated with T2DM in Caucasians, but polymorphisms at -3766 in the human β-cell enhancer, at -2877 bp in the PH1 domain, and at -108 bp in the promoter region were associated with T2DM in African American subjects (p Conculsion The common alleles of regulatory variants in the 5' enhancer and promoter regions of the IPF1 gene increase susceptibility to type 2 diabetes among African American individuals, likely as a result of gene-gene or gene-environment interactions. In contrast, IPF1 is not a cause of type 2 diabetes in Caucasians. A previously described InsCCG243 variant may contribute to diabetes susceptibility in African American individuals, but is of low penetrance.
Ets2 in tumor fibroblasts promotes angiogenesis in breast cancer.
Directory of Open Access Journals (Sweden)
Julie A Wallace
Full Text Available Tumor fibroblasts are active partners in tumor progression, but the genes and pathways that mediate this collaboration are ill-defined. Previous work demonstrates that Ets2 function in stromal cells significantly contributes to breast tumor progression. Conditional mouse models were used to study the function of Ets2 in both mammary stromal fibroblasts and epithelial cells. Conditional inactivation of Ets2 in stromal fibroblasts in PyMT and ErbB2 driven tumors significantly reduced tumor growth, however deletion of Ets2 in epithelial cells in the PyMT model had no significant effect. Analysis of gene expression in fibroblasts revealed a tumor- and Ets2-dependent gene signature that was enriched in genes important for ECM remodeling, cell migration, and angiogenesis in both PyMT and ErbB2 driven-tumors. Consistent with these results, PyMT and ErbB2 tumors lacking Ets2 in fibroblasts had fewer functional blood vessels, and Ets2 in fibroblasts elicited changes in gene expression in tumor endothelial cells consistent with this phenotype. An in vivo angiogenesis assay revealed the ability of Ets2 in fibroblasts to promote blood vessel formation in the absence of tumor cells. Importantly, the Ets2-dependent gene expression signatures from both mouse models were able to distinguish human breast tumor stroma from normal stroma, and correlated with patient outcomes in two whole tumor breast cancer data sets. The data reveals a key function for Ets2 in tumor fibroblasts in signaling to endothelial cells to promote tumor angiogenesis. The results highlight the collaborative networks that orchestrate communication between stromal cells and tumor cells, and suggest that targeting tumor fibroblasts may be an effective strategy for developing novel anti-angiogenic therapies.
Electrochemical study on the cationic promotion of the catalytic SO2 oxidation in pyrosulfate melts
DEFF Research Database (Denmark)
Petrushina, Irina; Bjerrum, Niels; Cappeln, Frederik Vilhelm
1998-01-01
The electrochemical behavior of the molten V2O5-M2S2O7 (M = K, Cs, or Na) system was studied using a gold working electrode at 440 degrees C in argon and air atmosphere. The aim of the present investigation was to find a possible correlation between the promoting effect of Cs+ and Na+ ions...... on the catalytic oxidation of SO2 in the V2O5-M2S2O7 system and the effect of these alkali cations on the electrochemical behavior of V2O5 in the alkali pyrosulfate melts It has been shown that Na+ ions had a promoting effect on the V(V) reversible arrow V(IV) electrochemical reaction. Sodium ions accelerate both...... in the catalytic SO, oxidation most likely is the oxidation of V(IV) to V(V) and the Na+ and Cs+ promoting effect is based on the acceleration of this stage. It has also been proposed that voltammetric measurements can be used for fast optimization of the composition of the vanadium catalyst (which...
Haam, Keeok; Kim, Hee-Jin; Lee, Kyung-Tae; Kim, Jeong-Hwan; Kim, Mirang; Kim, Seon-Young; Noh, Seung-Moo; Song, Kyu-Sang; Kim, Yong Sung
2014-09-01
BTB and CNC homology 2 (BACH2) is a lymphoid-specific transcription factor with a prominent role in B-cell development. Genetic polymorphisms within a single locus encoding BACH2 are associated with various autoimmune diseases and allergies. In this study, restriction landmark genomic scanning revealed methylation at a NotI site in a CpG island covering the BACH2 promoter in gastric cancer cell lines and primary gastric tumors. Increased methylation of the BACH2 promoter was observed in 52% (43/83) of primary gastric tumors, and BACH2 hypermethylation was significantly associated with decreased gene expression. Treatment with 5-aza-2'-deoxycytidine and/or trichostatin. A restored BACH2 expression in BACH2-silenced gastric cancer cell lines, and knockdown of BACH2 using short hairpin RNA (i.e. RNA interference) increased cell proliferation in gastric cancer cells. Clinicopathologic data showed that decreased BACH2 expression occurred significantly more frequently in intestinal-type (27/44, 61%) compared with diffuse-type (13/50, 26%) gastric cancers (P<0.001). Furthermore, BACH2 promoter methylation paralleled that of previously identified targets, such as LRRC3B, LIMS2, PRKD1 and POPDC3, in a given set of gastric tumors. We propose that concerted methylation in many promoters plays a role in accelerating gastric tumor formation and that methylated promoter loci may be targets for therapeutic treatment, such as the recently introduced technique of epigenetic editing. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Hwang, Jung-Ah; Kim, Yujin; Hong, Seung-Hyun; Lee, Jieun; Cho, Yong Gu; Han, Ji-Youn; Kim, Young-Ho; Han, Joungho; Shim, Young Mog; Lee, Yeon-Su; Kim, Duk-Hwan
2013-01-01
Background This study was aimed at investigating the functional significance of heparan sulfate (glucosamine) 3-O-sulfotransferase 2 (HS3ST2) hypermethylation in non-small cell lung cancer (NSCLC). Methodology/ Principal Findings HS3ST2 hypermethylation was characterized in six lung cancer cell lines, and its clinical significance was analyzed using 298 formalin-fixed paraffin-embedded tissues and 26 fresh-frozen tissues from 324 NSCLC patients. MS-HRM (methylation-specific high-resolution melting) and EpiTYPERTM assays showed substantial hypermethylation of CpG island at the promoter region of HS3ST2 in six lung cancer cell lines. The silenced gene was demethylated and re-expressed by treatment with 5-aza-2′-deoxycytidine (5-Aza-dC). A promoter assay also showed the core promoter activity of HS3ST2 was regulated by methylation. Exogenous expression of HS3ST2 in lung cancer cells H460 and H23 inhibited cell migration, invasion, cell proliferation and whereas knockdown of HS3ST2 in NHBE cells induced cell migration, invasion, and cell proliferation in vitro. A negative correlation was observed between mRNA and methylation levels of HS3ST2 in 26 fresh-frozen tumors tissues (ρ = -0.51, P = 0.009; Spearman’s rank correlation). HS3ST2 hypermethylation was found in 95 (32%) of 298 primary NSCLCs. Patients with HS3ST2 hypermethylation in 193 node-negative stage I-II NSCLCs with a median follow-up period of 5.8 years had poor overall survival (hazard ratio = 2.12, 95% confidence interval = 1.25–3.58, P = 0.005) compared to those without HS3ST2 hypermethylation, after adjusting for age, sex, tumor size, adjuvant therapy, recurrence, and differentiation. Conclusions/ Significance The present study suggests that HS3ST2 hypermethylation may be an independent prognostic indicator for overall survival in node-negative stage I-II NSCLC. PMID:24265783
Sox2 promotes survival of satellite glial cells in vitro
International Nuclear Information System (INIS)
Koike, Taro; Wakabayashi, Taketoshi; Mori, Tetsuji; Hirahara, Yukie; Yamada, Hisao
2015-01-01
Sox2 is a transcriptional factor expressed in neural stem cells. It is known that Sox2 regulates cell differentiation, proliferation and survival of the neural stem cells. Our previous study showed that Sox2 is expressed in all satellite glial cells of the adult rat dorsal root ganglion. In this study, to examine the role of Sox2 in satellite glial cells, we establish a satellite glial cell-enriched culture system. Our culture method succeeded in harvesting satellite glial cells with the somata of neurons in the dorsal root ganglion. Using this culture system, Sox2 was downregulated by siRNA against Sox2. The knockdown of Sox2 downregulated ErbB2 and ErbB3 mRNA at 2 and 4 days after siRNA treatment. MAPK phosphorylation, downstream of ErbB, was also inhibited by Sox2 knockdown. Because ErbB2 and ErbB3 are receptors that support the survival of glial cells in the peripheral nervous system, apoptotic cells were also counted. TUNEL-positive cells increased at 5 days after siRNA treatment. These results suggest that Sox2 promotes satellite glial cell survival through the MAPK pathway via ErbB receptors. - Highlights: • We established satellite glial cell culture system. • Function of Sox2 in satellite glial cell was examined using siRNA. • Sox2 knockdown downregulated expression level of ErbB2 and ErbB3 mRNA. • Sox2 knockdown increased apoptotic satellite glial cell. • Sox2 promotes satellite glial cell survival through ErbB signaling
Sox2 promotes survival of satellite glial cells in vitro
Energy Technology Data Exchange (ETDEWEB)
Koike, Taro, E-mail: koiket@hirakata.kmu.ac.jp; Wakabayashi, Taketoshi; Mori, Tetsuji; Hirahara, Yukie; Yamada, Hisao
2015-08-14
Sox2 is a transcriptional factor expressed in neural stem cells. It is known that Sox2 regulates cell differentiation, proliferation and survival of the neural stem cells. Our previous study showed that Sox2 is expressed in all satellite glial cells of the adult rat dorsal root ganglion. In this study, to examine the role of Sox2 in satellite glial cells, we establish a satellite glial cell-enriched culture system. Our culture method succeeded in harvesting satellite glial cells with the somata of neurons in the dorsal root ganglion. Using this culture system, Sox2 was downregulated by siRNA against Sox2. The knockdown of Sox2 downregulated ErbB2 and ErbB3 mRNA at 2 and 4 days after siRNA treatment. MAPK phosphorylation, downstream of ErbB, was also inhibited by Sox2 knockdown. Because ErbB2 and ErbB3 are receptors that support the survival of glial cells in the peripheral nervous system, apoptotic cells were also counted. TUNEL-positive cells increased at 5 days after siRNA treatment. These results suggest that Sox2 promotes satellite glial cell survival through the MAPK pathway via ErbB receptors. - Highlights: • We established satellite glial cell culture system. • Function of Sox2 in satellite glial cell was examined using siRNA. • Sox2 knockdown downregulated expression level of ErbB2 and ErbB3 mRNA. • Sox2 knockdown increased apoptotic satellite glial cell. • Sox2 promotes satellite glial cell survival through ErbB signaling.
Dymond, Angela W; Elks, Cathy; Martin, Paul; Carlile, David J; Mariani, Gabriella; Lovick, Susan; Huang, Yifan; Lorch, Ulrike; Brown, Helen; So, Karen
2017-06-01
Emerging data on selumetinib, a MEK1/2 inhibitor in clinical development, suggest a possible difference in pharmacokinetics (PK) between Japanese and Western patients. This pooled analysis sought to assess the effect of ethnicity on selumetinib exposure in healthy Western and Asian subjects, and to identify any association between genetic variants in the UGT1A1, CYP2C19 and ABCG2 genes and observed differences in selumetinib PK. A pooled analysis of data from ten Phase I studies, one in Asian subjects (encompassing Japanese, non-Japanese Asian and Indian Asian subjects) and nine in Western subjects, was conducted. Key findings were derived from the collective exposure data across doses of 25, 35, 50 and 75 mg selumetinib; primary variables were dose-normalized AUC and C max . PK data from 308 subjects (10 studies) were available for the pooled analysis; genetic data from 87 subjects (3 studies) were available for the pharmacogenetic analysis. Dose-normalized AUC and C max were 35% (95% CI: 25-47%) and 39% (95% CI: 24-56%) higher in the pooled Asian group, respectively, compared with Western subjects. PK exposure parameters were similar between the Japanese, non-Japanese Asian and Indian groups. There was no evidence that the polymorphisms assessed in the genes UGT1A1, CYP2C19 and ABCG2 account for observed PK differences. Selumetinib exposure was higher in healthy Asian subjects compared with Western subjects, and these data provide valuable insight for clinicians to consider when treating patients of Asian ethnicity with selumetinib.
FGF-2 promotes osteocyte differentiation through increased E11/podoplanin expression.
Ikpegbu, Ekele; Basta, Lena; Clements, Dylan N; Fleming, Robert; Vincent, Tonia L; Buttle, David J; Pitsillides, Andrew A; Staines, Katherine A; Farquharson, Colin
2018-07-01
E11/podoplanin is critical in the early stages of osteoblast-to-osteocyte transitions (osteocytogenesis), however, the upstream events which regulate E11 expression are unknown. The aim of this study was to examine the effects of FGF-2 on E11-mediated osteocytogenesis and to reveal the nature of the underlying signaling pathways regulating this process. Exposure of MC3T3 osteoblast-like cells and murine primary osteoblasts to FGF-2 (10 ng/ml) increased E11 mRNA and protein expression (p 70% reduction of basal E11 mRNA expression (p < 0.05) and effectively abrogated FGF-2-related changes in E11 expression and dendrite formation. FGF-2 strongly activated the ERK signaling pathway in osteoblast-like cells but inhibition of this pathway did not block the ability of FGF-2 to enhance E11 expression or to promote acquisition of the osteocyte phenotype. The results of this study highlight a novel mechanism by which FGF-2 can regulate osteoblast differentiation and osteocyte formation. Specifically, the data suggests that FGF-2 promotes osteocytogenesis through increased E11 expression and further studies will identify if this regulatory pathway is essential for bone development and maintenance in health and disease. © 2017 The Authors. Journal of Cellular Physiology Published by Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Tingxiu Xiang
Full Text Available Breast cancer (BrCa is a complex disease driven by aberrant gene alterations and environmental factors. Recent studies reveal that abnormal epigenetic gene regulation also plays an important role in its pathogenesis. Ubiquitin carboxyl- terminal esterase L1 (UCHL1 is a tumor suppressor silenced by promoter methylation in multiple cancers, but its role and alterations in breast tumorigenesis remain unclear.We found that UCHL1 was frequently downregulated or silenced in breast cancer cell lines and tumor tissues, but readily expressed in normal breast tissues and mammary epithelial cells. Promoter methylation of UCHL1 was detected in 9 of 10 breast cancer cell lines (90% and 53 of 66 (80% primary tumors, but rarely in normal breast tissues, which was statistically correlated with advanced clinical stage and progesterone receptor status. Pharmacologic demethylation reactivated UCHL1 expression along with concomitant promoter demethylation. Ectopic expression of UCHL1 significantly suppressed the colony formation and proliferation of breast tumor cells, through inducing G0/G1 cell cycle arrest and apoptosis. Subcellular localization study showed that UCHL1 increased cytoplasmic abundance of p53. We further found that UCHL1 induced p53 accumulation and reduced MDM2 protein level, and subsequently upregulated the expression of p21, as well as cleavage of caspase3 and PARP, but not in catalytic mutant UCHL1 C90S-expressed cells.UCHL1 exerts its tumor suppressive functions by inducing G0/G1cell cycle arrest and apoptosis in breast tumorigenesis, requiring its deubiquitinase activity. Its frequent silencing by promoter CpG methylation may serve as a potential tumor marker for breast cancer.
Yamada, H; Vijayachandra, K; Penner, C; Glick, A
2001-06-01
Inactivation of the transforming growth factor beta (TGFbeta)-signaling pathway and gene silencing through hypermethylation of promoter CpG islands are two frequent alterations in human and experimental cancers. Here we report that nonneoplastic TGFbeta1-/- keratinocyte cell lines exhibit increased sensitivity to cell killing by alkylating agents, and this is due to lack of expression of the DNA repair enzyme O(6)-methylguanine DNA methyltransferase (MGMT). In TGFbeta1-/- but not TGFbeta1+/- cell lines, the CpG dinucleotides in the MGMT promoter are hypermethylated, as measured by restriction enzyme analysis and methylation specific polymerase chain reaction. In one unstable TGFbeta1+/- cell line, loss of the wild type TGFbeta1 allele correlates with the appearance of methylation in the MGMT promoter. Bisulfite sequencing shows that in the KO3 TGFbeta1-/- cell line nearly all of the 28 CpG sites in the MGMT promoter 475 base pairs upstream of the start site of transcription are methylated, whereas most are unmethylated in the H1 TGFbeta1+/- line. Treatment of the TGFbeta1-/- cell lines with 5-azacytidine causes reexpression of MGMT mRNA and demethylation of CpG islands in the promoter. Analysis of the time course of methylation using methylation-specific polymerase chain reaction shows a lack of methylation in primary TGFbeta1-/- keratinocytes and increasing methylation with passage number of immortalized clones. Subcloning of early passage clones reveals a remarkable heterogeneity and instability of the methylation state in the TGFbeta1-/- keratinocytes. Thus, the TGFbeta1-/- genotype does not directly regulate MGMT methylation but predisposes cells to immortalization-associated MGMT hypermethylation.
Jeurissen, S.M.F.; Claassen, F.W.; Havlik, J.; Bouwmans, E.E.; Cnubben, N.H.P.; Sudhölter, E.J.R.; Rietjens, I.M.C.M.; Beek, T.A. van
2007-01-01
An on-line HPLC screening method for detection of inhibitors of human cytochrome P450 1A2 in extracts was developed. HPLC separation of extracts is connected to a continuous methoxyresorufin-O-demethylation (MROD) assay in which recombinant human P450 1A2 converts methoxyresorufin to its fluorescent
International Nuclear Information System (INIS)
Schmidt, H.
1982-01-01
Albino mice were subcutaneously injected with carbon 14 dimethyl aminopyrines, the methyl group of which can be metabolised in the organism into carbon dioxide 14. The following results were obtained: In the carbon dioxide 14 exhalation of neonate, young and adult animals after administration of carbon 14 aminopyrine, distinct differences were noted. The maximum of elimination via the lungs occurs after 20-30 minutes in grown-up mice, in neonates or young animals distinctly later (60-90 min). The carbon dioxide 14 exhalation was also measured after additional subcutaneous application of methrotrexate. In mice aged 8 and 10 days a distinct decrease in carbon dioxide 14 exhalation was found. By contrast, a rise in carbon dioxide 14 exhaled was found in mice aged 2 days. The orientating experiments with folic acid and carbon 14 dimethyl aminopyrine show that leucovorin leads to a distinct increase in carbon dioxide 14 exhalation during the first 30 minutes. As a cause of the different degrees of stimulation respectively inhibition of demethylation, different biochemical ways of formaldehyde formation are pointed out. One of these probably includes the folate-dependent reaction. (orig./MG) [de