WorldWideScience

Sample records for aa spatial evaluation

  1. err aA spatial evaluation of socio demographics surrounding National Priorities List sites in Florida using a distance-based approach

    Directory of Open Access Journals (Sweden)

    Kiros Gebre-Egziabher

    2009-06-01

    Full Text Available Abstract Background Over the last two decades, various spatial techniques have been demonstrated using geographical information systems (GIS to adequately estimate and characterize inequities of minority populations living near environmentally hazardous facilities. However, these methods have produced mixed results. In this study, we use recently developed variations of the "distance based" approach to spatially evaluate and compare demographic and socioeconomic disparities surrounding the worst hazardous waste sites in Florida. Methods We used data from the 2000 US Census Bureau and the Florida Department of Environmental Protection to identify selected socio and economic variables within one (1 mile of 71 National Priorities List (NPL or Superfund sites in Florida. ArcMap (ESRI, v. 9.2 was used to map the centroid locations of each of the NPL sites as well as identify and estimate the number of host and non-host tracts. The unit of analysis in this study was at the census tract level. Logistic regression (SAS v9.1.3 was used to determine if race/ethnicity and socioeconomic indicators are significant predictors of the location of NPL sites. Results There were significant differences in race/ethnicity composition and socio-economic factors between NPL host census tracts and non-host census tracts in Florida. The percentages of Blacks (OR = 5.7, p Conclusion The recently developed distance-based method supports previous studies and suggests that race and ethnicity play substantial roles in where hazardous facilities are located in Florida. Recommendations include using distance-based methods to evaluate socio and demographic characteristics surrounding other less known environmental hazardous facilities, such as landfills, or Toxic Release Inventory (TRI sites.

  2. EValuation of the thixoformability of AA7004 and AA7075 alloys

    Directory of Open Access Journals (Sweden)

    Eugenio José Zoqui

    2010-09-01

    Full Text Available This study involved a complete evaluation of the thixoformability of AA7004 and AA7075 alloys, from their microstructural characterization to their viscous behavior. The alloys were subjected to globularization heat treatments for 0, 30, 90 and 210 seconds in two conditions of solid fractions, 45 and 60%, and to viscosity assays under the same conditions. Heat treatments promote the globularization of primary phase particles; hence, the best viscosity results were achieved for alloys with low solid fractions heat-treated for 210 seconds. Alloys AA7004 and AA7075 showed an apparent viscosity of 10(4 to 10(5 (Pa.s. The behavior of materials in this range is similar to that of molten glass and they show high formability. However, the AA7075 alloy showed a better performance than the AA7004 due to the smaller size of its primary particles and original grains, their lower growth during reheating, and depending on the condition, their viscosity of 10(4 Pa.s, which is extremely low for thixoforming standards.

  3. Diffraction efficiency improvement in high spatial frequency holographic gratings stored in PVA/AA photopolymers: several ACPA concentrations

    International Nuclear Information System (INIS)

    High spatial frequency in holographic gratings is difficult to obtain due to limitations of the recording material. In this paper, the results obtained after storing holographic transmission gratings with a spatial frequency of 2656 lines/mm in a material based on polyvinyl alcohol and acrylamide (PVA/AA) are presented. A chain transfer agent, 4, 4′-azobis (4-cyanopentanoic acid) (ACPA) was incorporated in the composition of the material to improve the response of the material at a high spatial frequency. Different concentrations of ACPA were used in order to find the optimal concentration giving maximum diffraction efficiency for high spatial frequencies. (paper)

  4. Evaluation of Perceived Spatial Audio Quality

    Directory of Open Access Journals (Sweden)

    Jan Berg

    2006-04-01

    Full Text Available The increased use of audio applications capable of conveying enhanced spatial quality puts focus on how such a quality should be evaluated. Different approaches to evaluation of perceived quality are briefly discussed and a new technique is introduced. In a series of experiment, attributes were elicited from subjects, tested and subsequently used for derivation of evaluation scales that were feasible for subjective evaluation of the spatial quality of certain multichannel stimuli. The findings of these experiments led to the development of a novel method for evaluation of spatial audio in surround sound systems. Parts of the method were subsequently implemented in the OPAQUE software prototype designed to facilitate the elicitation process. The prototype was successfully tested in a pilot experiment. The experiments show that attribute scales derived from subjects' personal constructs are functional for evaluation of perceived spatial audio quality. Finally, conclusions on the importance of spatial quality evaluation of new applications are made.

  5. Immunological evaluation of OMV(PagL)+Bap(1-487aa) and AbOmpA(8-346aa)+Bap(1-487aa) as vaccine candidates against Acinetobacter baumannii sepsis infection.

    Science.gov (United States)

    Badmasti, Farzad; Ajdary, Soheila; Bouzari, Saeid; Fooladi, Abbas Ali Imani; Shahcheraghi, Fereshteh; Siadat, Seyed Davar

    2015-10-01

    Acinetobacter baumannii is an important nosocomial pathogen that causes a high morbidity and mortality rate in infected patients with sepsis form. The surface exposed virulence proteins and serum resistance factors helping to dissemination of this bacterium to bloodstream are the most promising vaccine candidates against this microorganism. In this project we immunologically evaluated OMV(PagL)+Bap(1-487aa) and AbOmpA (8-346aa)+Bap(1-487aa) as combination forms as well as Bap(1-487aa), AbOmpA(8-346aa) and OMV(PagL) singly, with addition of alum adjuvant as vaccine candidates. The titers of total IgG, IgG1 and IgG2c as well as concentration of IL-4 and IFN-γ and survival rates were measured in a C57BL/6 murine model with disseminated sepsis. The ratio of IgG1/IgG2c and profile of IL-4/IFN-γ in OMV (PagL)+Bap (1-487aa) formulation shows the humoral and cellular immune responses have been induced robustly and have created a full protection against A. baumannii ATCC 19606 and MDR AB-44 strains. We found that the two combination vaccine candidates were protective and induced both Th1 and Th2 responses.

  6. Evaluation of 7Be fallout spatial variability

    International Nuclear Information System (INIS)

    The cosmogenic radionuclide beryllium-7 (Be) is produced in the atmosphere by cosmic particle reactions and is being used as a tracer for soil erosion and climatic processes research. After the production, 7Be bonds to aerosol particles in the atmosphere and is deposited on the soil surface with other radionuclide species by rainfall. Because of the high adsorption on soil particles and its short half-life of 53.2 days, this radionuclide follows of the erosion process and can be used as a tracer to evaluate the sediment transport that occurs during a single rain event or short period of rain events. A key assumption for the erosion evaluation through this radiotracer is the uniformity of the spatial distribution of the 7Be fallout. The 7Be method was elaborated recently and due to its few applications, some assumptions related to the method were not yet properly investigated yet, and the hypothesis of 7Be fallout uniformity needs to be evaluated. The aim of this study was to evaluate the 7Be fallout spatial distribution through the rain water 7Be activity analysis of the first five millimeters of single rain events. The rain water was sampled using twelve collectors distributed on an experimental area of about 300 m2 , located in the campus of Sao Paulo University, Piracicaba. The 7Be activities were measured using a 53% efficiency gamma-ray spectrometer from the Radioisotope laboratory of CENA. The 7Be activities in rain water varied from 0.26 to 1.81 Sq.L-1, with the highest values in summer and lowest in spring. In each one of the 5 single events, the spatial variability of 7Se activity in rain water was high, showing the high randomness of the fallout spatial distribution. A simulation using the 7Be spatial variability values obtained here and 7Se average reference inventories taken from the literature was performed determining the lowest detectable erosion rate estimated by 7Be model. The importance of taking a representative number of samples to determine the

  7. Ultrasonic evaluation of friction stud welded AA 6063/AISI 1030 steel joints

    International Nuclear Information System (INIS)

    Highlights: • Friction stud welding of AA 6063 and AISI 1030 was done successfully. • Ultrasonic evaluation of interfacial properties. • EDX analysis confirms intermetallic compound (FeAl) in the interfacial region. - Abstract: Friction stud welding is a promising technique in many applications related to oil and gas industries. It is used to attach grating to offshore oil platforms in areas where arc welding is not permitted because of the risk of causing a fire or explosion. Attachment of anodes inside seawater discharge pipelines in a gas processing plant is performed by this process. This solid state joining process permits metal combinations such as welding of aluminum studs to steel which would be problematic with arc welding because of the formation of thick and brittle inter-metallic compounds. In the present work, AA 6063 is joined to AISI 1030 steel using friction stud welding machine. Properties that are of interest to manufacturing applications such as Young’s modulus, longitudinal velocity, bulk modulus and shear modulus are evaluated by means of an ultrasonic flaw detector. At the interface of the joint, there is an increase of 4.4%, 1.8%, 1.15% and 4.42% is observed for the properties Young’s modulus, longitudinal velocity, bulk modulus and shear modulus respectively. This is due to the formation of intermetallic compound and increase in hardness at the interfacial region. Energy Dispersive X-ray analysis confirms the presence of FeAl as the intermetallic compound. Scanning Electron Microscope evaluation shows the presence of an unbound zone at the center of the inner region which is due to the minimum rotational speed and low axial load experienced at that point. In the unbound zone, there is an incomplete bond between dissimilar metals and it is detrimental to joint strength. Optimum value of friction time and usage of pure aluminum interlayer during the friction stud welding process hinders the formation of unbound zone and enhances the

  8. Covert Auditory Spatial Orienting: An Evaluation of the Spatial Relevance Hypothesis

    Science.gov (United States)

    Roberts, Katherine L.; Summerfield, A. Quentin; Hall, Deborah A.

    2009-01-01

    The spatial relevance hypothesis (J. J. McDonald & L. M. Ward, 1999) proposes that covert auditory spatial orienting can only be beneficial to auditory processing when task stimuli are encoded spatially. We present a series of experiments that evaluate 2 key aspects of the hypothesis: (a) that "reflexive activation of location-sensitive neurons is…

  9. Effect of Initial Crack Location on Spatial Randomness of Fatigue Crack Growth Resistance in Friction Stir Welded AA7075-T651 Plates

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seon Jin [Pukyong National University, Busan (Korea, Republic of)

    2014-09-15

    In the present paper, the effects of initial crack location on spatial randomness of fatigue crack growth resistance (FCGR) in friction stir welded (FSWed) AA7075-T651 plates were studied. The objective of this study is to characterize the statistical properties of FCGR for three different types of initial crack location (ICL) specimens. In this work, the FCGR coefficients were treated as a spatial random process. It was found that the FCGR coefficients for all initial crack location specimens closely followed a two parameter Weibull distribution. The shape parameter of the Weibull distribution for BM-ICL specimens showed the largest value of 7.50, and that for the WM-ICL specimens showed the smallest value of 2.61. In addition, the autocorrelation functions for all the ICL specimens followed the exponential function.

  10. Spatial Evaluation and Verification of Earthquake Simulators

    Science.gov (United States)

    Wilson, John Max; Yoder, Mark R.; Rundle, John B.; Turcotte, Donald L.; Schultz, Kasey W.

    2016-09-01

    In this paper, we address the problem of verifying earthquake simulators with observed data. Earthquake simulators are a class of computational simulations which attempt to mirror the topological complexity of fault systems on which earthquakes occur. In addition, the physics of friction and elastic interactions between fault elements are included in these simulations. Simulation parameters are adjusted so that natural earthquake sequences are matched in their scaling properties. Physically based earthquake simulators can generate many thousands of years of simulated seismicity, allowing for a robust capture of the statistical properties of large, damaging earthquakes that have long recurrence time scales. Verification of simulations against current observed earthquake seismicity is necessary, and following past simulator and forecast model verification methods, we approach the challenges in spatial forecast verification to simulators; namely, that simulator outputs are confined to the modeled faults, while observed earthquake epicenters often occur off of known faults. We present two methods for addressing this discrepancy: a simplistic approach whereby observed earthquakes are shifted to the nearest fault element and a smoothing method based on the power laws of the epidemic-type aftershock (ETAS) model, which distributes the seismicity of each simulated earthquake over the entire test region at a decaying rate with epicentral distance. To test these methods, a receiver operating characteristic plot was produced by comparing the rate maps to observed m>6.0 earthquakes in California since 1980. We found that the nearest-neighbor mapping produced poor forecasts, while the ETAS power-law method produced rate maps that agreed reasonably well with observations.

  11. Seasonal trend of AOD and \\AA ngstr\\"om exponent($\\alpha)$ over Indian megacities in varying spatial resolution

    CERN Document Server

    Banerjee, Subhasis

    2014-01-01

    Aerosol optical characteristics AOD and \\AA ngstr\\"om exponent is often used to asses environmental aerosol loading. AOD or Aerosol Optical Depth is an indirect measure of atmospheric aerosol loading by means of total extinction of incoming solar radiation due to scattering and absorption whereas \\AA ngstr\\"om exponent($\\alpha)$ is used to get qualitative understanding of aerosol particle size. Analysis of long term time series AOD data reveals how AOD vis-\\`a-vis aerosol on a particular place changes over time. Similar study with \\AA ngstr\\"om exponent($\\alpha)$ gives an idea how particle size distribution is changing over some area. Such studies cannot be conducted by data measured by ground based stations alone because they are inadequate in numbers on earth moreover such data for considerably long period are not available for most places. To overcome this, radiance data sensed by MODIS instruments on board Aqua and Terra satellite have been used by many authors. In this study 13 years of MODIS level 2 dat...

  12. EVALUATION OF PARAMETERS OF FRICTION STIR WELDING FOR ALUMINIUM AA6351 ALLOY

    Directory of Open Access Journals (Sweden)

    AHMED KHALID HUSSAIN

    2010-10-01

    Full Text Available Friction Stir Welding (FSW is a solid state welding process in which the relative motion between the tool and the work piece produces heat which makes the material of two edges being joined by plastic atomicdiffusion. This method relies on the direct conversion of mechanical energy to thermal energy to form the weld without the application of heat from conventional source. The rotational speed of the tools, the axial pressure and welding speed and the (weld time are the principal variables that are controlled in order to provide the necessary combination of heat and pressure to form the weld. These parameters are adjusted so that the interface is heated into the plastic temperature range (plastic state where welding can take place. During the last stage of welding process, atomic diffusion occurs while the interfaces are in contact, allowing metallurgical bond to form between the two materials. The functional behaviour of the weldments is substantially determined by the nature of the weld strength characterized by the tensile strength, metallurgical behavior, surface roughness, weld hardness and micro hardness. In this project an attempt is made to determine and evaluate the influence of the process parameters of FSW on the weldments. The Vickers hardness, tensile strength and radiography are considered for investigation by varying tool speed, tool feed and maintaining onstant depth of penetration of weld. Experiments were conducted on AA6351 Aluminium alloy in a CNC Vertical Machining Centre. Theoutput factors are measured in UTM, Vickers hardness tester and Radiography equipment. Results show strong relation and robust comparison between the weldment strength and process parameters. Hence FSW process variable data base is to be developed for wide variety of metals and alloys for selection of optimum process parameters for efficient weld.

  13. High and low spatial frequencies in website evaluations.

    Science.gov (United States)

    Thielsch, Meinald T; Hirschfeld, Gerrit

    2010-08-01

    Which features of websites are important for users' perceptions regarding aesthetics or usability? This study investigates how evaluations of aesthetic appeal and usability depend on high vs. low spatial frequencies. High spatial frequencies convey information on fine details, whereas low spatial frequencies convey information about the global layout. Participants rated aesthetic appeal and usability of 50 website screenshots from different domains. Screenshots were presented unfiltered, low-pass filtered with blurred targets or high-pass filtered with high-pass filtered targets. The main result is that low spatial frequencies can be seen to have a unique contribution in perceived website aesthetics, thus confirming a central prediction from processing fluency theory. There was no connection between low spatial frequencies and usability evaluations, whereas strong correlations were found between ratings of high-pass filtered websites and those of unfiltered websites in aesthetics and usability. This study thus offers a new perspective on the biological basis of users' website perceptions. This research links ergonomics to neurocognitive models of visual processing. This paper investigates how high and low spatial frequencies, which are neurologically processed in different visual pathways, independently contribute to users' perceptions of websites. This is very relevant for theories of website perceptions and for practitioners of web design. PMID:20658391

  14. The spatial evaluation of neighborhood clusters of birth defects

    Energy Technology Data Exchange (ETDEWEB)

    Frisch, J.D.

    1990-04-16

    Spatial statistics have recently been applied in epidemiology to evaluate clusters of cancer and birth defects. Their use requires a comparison population, drawn from the population at risk for disease, that may not always be readily available. In this dissertation the plausibility of using data on all birth defects, available from birth defects registries, as a surrogate for the spatial distribution of all live births in the analysis of clusters is assessed. Three spatial statistics that have been applied in epidemiologic investigations of clusters, nearest neighbor distance, average interpoint distance, and average distance to a fixed point, were evaluated by computer simulation for their properties in a unit square, and in a zip code region. Comparison of spatial distributions of live births and birth defects was performed by drawing samples of live births and birth defects from Santa Clara County, determining the street address at birth, geocoding this address and evaluating the resultant maps using various statistical techniques. The proposed method was then demonstrated on a previously confirmed cluster of oral cleft cases. All live births for the neighborhood were geocoded, as were all birth defects. Evaluation of this cluster using the nearest neighbor and average interpoint distance statistics was performed using randomization techniques with both the live births population and the birth defect population as comparison groups. 113 refs., 36 figs., 16 tabs.

  15. Evaluation of AMOEBA: a spectral-spatial classification method

    Science.gov (United States)

    Jenson, Susan K.; Loveland, Thomas R.; Bryant, J.

    1982-01-01

    Muitispectral remotely sensed images have been treated as arbitrary multivariate spectral data for purposes of clustering and classifying. However, the spatial properties of image data can also be exploited. AMOEBA is a clustering and classification method that is based on a spatially derived model for image data. In an evaluation test, Landsat data were classified with both AMOEBA and a widely used spectral classifier. The test showed that irrigated crop types can be classified as accurately with the AMOEBA method as with the generally used spectral method ISOCLS; the AMOEBA method, however, requires less computer time.

  16. Comparative evaluation of tungsten inert gas and laser beam welding of AA5083-H321

    Indian Academy of Sciences (India)

    K Subbaiah; M Geetha; B Shanmugarajan; S R Koteswara Rao

    2012-10-01

    In this study, the bead-on-plate welds were made on AA5083-H321 alloy plates using both tungsten inert gas (TIG) welding and laser beam (LB) welding processes to study the enhancement of mechanical properties such as weld yield strength and hardness. The low heat input of laser beam welding effectively reduced the size of the fusion zone and heat affected zone compared to tungsten inert gas welding process. High speed LB welding and fast heating and cooling of LB welding process hinders grain growth compared to TIG welding process. The effect of vapourization of volatile alloying elements is also considered. It seems that magnesium evaporation is relatively less in LB welding compared to TIG welding. Tensile testing of the welded joints revealed that LB welding results in superior mechanical properties. It is concluded that LB welding process is more suitable to join AA5083-H321.

  17. EVALUATING THREE INTERFACE TECHNOLOGIES IN ASSISTING PEDESTRIANS' SPATIAL KNOWLEDGE ACQUISITION

    Directory of Open Access Journals (Sweden)

    H. Huang

    2012-07-01

    Full Text Available Recent years have seen raising interests in mobile pedestrian navigation systems. Different interface technologies can be used to communicate/convey route directions to pedestrians, such as mobile maps, voices, and augmented reality (AR. Many field experiments have been conducted to study the effectiveness of different interface technologies in guiding pedestrians to their destinations. In contrast to other field studies, this article aims at investigating the influence of different interface technologies on spatial knowledge acquisition (spatial learning. With sufficient spatial knowledge about an environment, people can still find their way when navigation systems fail (e.g. out of battery. The goal of this article is to empirically evaluate three GPS-based navigation prototypes (implementing mobile map-based, AR-based, and voice-based guidance respectively in supporting spatial knowledge acquisition. The field test showed that in terms of spatial knowledge acquisition, the three interface technologies led to comparable poor results, which were also not significantly different from each other. This article concludes with some implications for designing mobile pedestrian navigation systems.

  18. Hematotoxicity and genotoxicity evaluations in Swiss mice intraperitoneally exposed to Bacillus thuringiensis (var kurstaki) spore crystals genetically modified to express individually Cry1Aa, Cry1Ab, Cry1Ac, or Cry2Aa.

    Science.gov (United States)

    Mezzomo, Bélin Poletto; Miranda-Vilela, Ana Luisa; Barbosa, Lilian Carla Pereira; Albernaz, Vanessa Lima; Grisolia, Cesar Koppe

    2016-08-01

    Bacillus thuringiensis (Bt) has been widely used in foliar sprays as part of integrated pest management strategies against insect pests of agricultural crops. Since the advent of genetically modified plants expressing Bt δ-endotoxins, the bioavailability of Cry proteins has increased, and therefore for biosafety reasons their adverse effects should be studied, mainly for nontarget organisms. We evaluated, in Swiss mice, the hematotoxicity and genotoxicity of the genetically modified strains of Bt spore crystals Cry1Aa, 1Ab, 1Ac, or 2Aa at 27 mg/kg, and Cry1Aa, 1Ab and 2Aa also at 136 and 270 mg/kg, administered with a single intraperitoneal injection 24 h before euthanasia. Controls received filtered water or cyclophosphamide. Blood samples collected by cardiac puncture were used to perform hemogram, and bone marrow was extracted for the micronucleus test. Bt spore crystals presented toxicity for lymphocytes when in higher doses, which varied according to the type of spore crystal studied, besides promoting cytotoxic and genotoxic effects for the erythroid lineage of bone marrow, mainly at highest doses. Although the profile of such adverse side effects can be related to their high level of exposure, which is not commonly found in the environment, results indicated that these Bt spore crystals were not harmless to mice. This suggests that a more specific approach should be taken to increase knowledge about their toxicological properties and to establish the toxicological risks to nontarget organisms. © 2015 Wiley Periodicals, Inc. Environ Toxicol 31: 970-978, 2016.

  19. Evaluation of the Mechanical Properties of AA 6063 Processed by Severe Plastic Deformation

    Science.gov (United States)

    Jafarlou, Davoud Mashhadi; Zalnezhad, Erfan; Hamouda, Abdelmagid Salem; Faraji, Ghader; Mardi, Noor Azizi Bin; Hassan Mohamed, Mohsen Abdelnaeim

    2015-05-01

    In this study, the mechanical properties, including surface hardness, tensile strength, fatigue, and fretting fatigue behavior of AA 6063 processed by equal channel angular pressing as the most efficient severe shear plastic deformation (SPD) technique, were investigated. Following the SPD process, samples were subjected to heat treatment (HT), hard anodizing (HA), and a combination of HT and HA. Rotating-bending fretting fatigue tests were performed to explore the samples' response to the fretting condition. From the experimental fatigue and fretting fatigue tests, it was apparent that the SPD treatment had a positive effect on enhancing the fatigue and fretting fatigue lives of the samples at low and high-cyclic loads compared with the HT technique by 78 and 67 pct, and 131 and 154 pct respectively. The results also indicate that the SPD + HT technique significantly increased the fatigue and fretting fatigue lives of the samples at high and low cycles by 15.56 and 8.33 pct, and 14.4 and 5.1 pct respectively, compared with the SPD method. HA of AA6063 increased the fatigue and fretting fatigue lives of SPD + HT-processed samples at low cycle by 15.5 and 18.4 pct respectively; however, at high cycle, HA had reverse effects, whereby the fatigue and fretting fatigue lives of SPD + HT-processed samples decreased by 16.7 and 30 pct, respectively.

  20. Genetic algorithm-based evaluation of spatial straightness error

    Institute of Scientific and Technical Information of China (English)

    崔长彩; 车仁生; 黄庆成; 叶东; 陈刚

    2003-01-01

    A genetic algorithm ( GA ) -based approach is proposed to evaluate the straightness error of spatial lines. According to the mathematical definition of spatial straightness, a verification model is established for straightness error, and the fitness function of GA is then given and the implementation techniques of the proposed algorithm is discussed in detail. The implementation techniques include real number encoding, adaptive variable range choosing, roulette wheel and elitist combination selection strategies, heuristic crossover and single point mutation schemes etc. An application example is quoted to validate the proposed algorithm. The computation result shows that the GA-based approach is a superior nonlinear parallel optimization method. The performance of the evolution population can be improved through genetic operations such as reproduction, crossover and mutation until the optimum goal of the minimum zone solution is obtained. The quality of the solution is better and the efficiency of computation is higher than other methods.

  1. Spatial evaluation of volcanic ash forecasts using satellite observations

    Directory of Open Access Journals (Sweden)

    N. J. Harvey

    2015-09-01

    Full Text Available The decision to close airspace in the event of a volcanic eruption is based on hazard maps of predicted ash extent. These are produced using output from volcanic ash transport and dispersion (VATD models. In this paper an objective metric to evaluate the spatial accuracy of VATD simulations relative to satellite retrievals of volcanic ash is presented. The metric is based on the fractions skill score (FSS. This measure of skill provides more information than traditional point-by-point metrics, such as success index and Pearson correlation coefficient, as it takes into the account spatial scale over which skill is being assessed. The FSS determines the scale over which a simulation has skill and can differentiate between a "near miss" and a forecast that is badly misplaced. The idealised scenarios presented show that even simulations with considerable displacement errors have useful skill when evaluated over neighbourhood scales of 200–700 km2. This method could be used to compare forecasts produced by different VATDs or using different model parameters, assess the impact of assimilating satellite retrieved ash data and evaluate VATD forecasts over a long time period.

  2. Spatial evaluation of volcanic ash forecasts using satellite observations

    Science.gov (United States)

    Harvey, N. J.; Dacre, H. F.

    2016-01-01

    The decision to close airspace in the event of a volcanic eruption is based on hazard maps of predicted ash extent. These are produced using output from volcanic ash transport and dispersion (VATD) models. In this paper the fractions skill score has been used for the first time to evaluate the spatial accuracy of VATD simulations relative to satellite retrievals of volcanic ash. This objective measure of skill provides more information than traditional point-by-point metrics, such as success index and Pearson correlation coefficient, as it takes into the account spatial scale over which skill is being assessed. The FSS determines the scale over which a simulation has skill and can differentiate between a "near miss" and a forecast that is badly misplaced. The idealized scenarios presented show that even simulations with considerable displacement errors have useful skill when evaluated over neighbourhood scales of 200-700 (km)2. This method could be used to compare forecasts produced by different VATDs or using different model parameters, assess the impact of assimilating satellite-retrieved ash data and evaluate VATD forecasts over a long time period.

  3. Smart tools of urban climate evaluation for smart spatial planning

    Directory of Open Access Journals (Sweden)

    Středová Hana

    2015-09-01

    Full Text Available Air temperature and humidity conditions were monitored in Hradec Králové, Czech Republic, by a network of meteorological stations. Meteorological sensors were placed across a representative variety of urban and suburban environments. The data collected over the 2011–2014 period are analysed in this paper. The data from reference standard meteorological stations were used for comparison and modelling purposes. Air temperatures at the points of interest were successfully modelled using regression relationships. The spatial expression of point measurements of air temperatures was provided by GIS methods in combination with CORINE land cover layer, and satellite thermal images were used to evaluate the significance of these methods. The use of standard climate information has low priority for urban planners. The impact of the urban heat island on city residents and visitors was evaluated using the HUMIDEX index, as it is more understandable for urban planners than temperature conditions as such. The aim of this paper is the modification, description and presentation of urban climate evaluation methods that are easily useable for spatial planning purposes. These methods are based on comprehensible, easily available but quality data and results. This unified methodology forms a theoretical basis for better urban planning policies to mitigate the urban heat island effects.

  4. Spatial augmented reality for product appearance design evaluation

    Directory of Open Access Journals (Sweden)

    Min Ki Park

    2015-01-01

    Full Text Available Augmented reality based on projection, called “Spatial Augmented Reality (SAR”, is a new technology that can produce immersive contents by overlapping virtuality and real-world environment. It has been paid attention as the next generation digital contents in media art and human–computer interaction (HCI. In this paper, we present a new methodology to evaluate the product appearance design more intuitively by means of SAR technique. The proposed method first projects the high-quality rendered image considering the optical property of materials onto the mock-up of a product. We also conduct a projector-camera calibration to compensate a color distortion according to a projector, a projection surface and environment lighting. The design evaluation methodology we propose offers more flexible and intuitive evaluation environment to a designer and user (evaluator than previous methods that are performed via a digital display. At the end of this research, we have conducted a case study for designing and evaluating appearance design of an automobile.

  5. Evaluation of Spatial Agreement of Distinct Landslide Prediction Models

    Science.gov (United States)

    Sterlacchini, Simone; Bordogna, Gloria; Frigerio, Ivan

    2013-04-01

    derived to test agreement among the maps. Nevertheless, no information was made available about the location where the prediction of two or more maps agreed and where they did not. Thus we wanted to study if also the spatial agreements of the models predicted the same or similar values. To this end we adopted a soft image fusion approach proposed in. It is defined as a group decision making model for ranking spatial alternatives based on a soft fusion of coherent evaluations. In order to apply this approach, the prediction maps were categorized into 10 distinct classes by using an equal-area criterion to compare the predicted results. Thus we applied soft fusion of the prediction maps regarded as evaluations of distinct human experts. The fusion process needs the definition of the concept of "fuzzy majority", provided by a linguistic quantifier, in order to determine the coherence of a majority of maps in each pixel of the territory. Based on this, the overall spatial coherence among the majority of the prediction maps was evaluated. The spatial coherence among a fuzzy majority is defined based on the Minkowski OWA operators. The result made it possible to spatially identify sectors of the study area in which the predictions were in agreement for the same or for close classes of susceptibility, or discordant, or even distant classes. We studied the spatial agreement among a "fuzzy majority" defined as "80% of the 13 coherent maps", thus requiring that at least 11 out of 13 agree, since from previous results we knew that two maps were in disagreement. So the fuzzy majority AtLeast80% was defined by a quantifier with linear increasing membership function (0.8, 1). The coherence metric used was the Euclidean distance. We thus computed the soft fusion of AtLeast80% coherent maps for homogeneous groups of classes. We considered as homogeneous classes the highest two classes (9 and 10), the lowest two classes, and the central classes (4, 5 and 6). We then fused the maps

  6. Hematotoxicity and genotoxicity evaluations in Swiss mice intraperitoneally exposed to Bacillus thuringiensis (var kurstaki) spore crystals genetically modified to express individually Cry1Aa, Cry1Ab, Cry1Ac, or Cry2Aa.

    Science.gov (United States)

    Mezzomo, Bélin Poletto; Miranda-Vilela, Ana Luisa; Barbosa, Lilian Carla Pereira; Albernaz, Vanessa Lima; Grisolia, Cesar Koppe

    2016-08-01

    Bacillus thuringiensis (Bt) has been widely used in foliar sprays as part of integrated pest management strategies against insect pests of agricultural crops. Since the advent of genetically modified plants expressing Bt δ-endotoxins, the bioavailability of Cry proteins has increased, and therefore for biosafety reasons their adverse effects should be studied, mainly for nontarget organisms. We evaluated, in Swiss mice, the hematotoxicity and genotoxicity of the genetically modified strains of Bt spore crystals Cry1Aa, 1Ab, 1Ac, or 2Aa at 27 mg/kg, and Cry1Aa, 1Ab and 2Aa also at 136 and 270 mg/kg, administered with a single intraperitoneal injection 24 h before euthanasia. Controls received filtered water or cyclophosphamide. Blood samples collected by cardiac puncture were used to perform hemogram, and bone marrow was extracted for the micronucleus test. Bt spore crystals presented toxicity for lymphocytes when in higher doses, which varied according to the type of spore crystal studied, besides promoting cytotoxic and genotoxic effects for the erythroid lineage of bone marrow, mainly at highest doses. Although the profile of such adverse side effects can be related to their high level of exposure, which is not commonly found in the environment, results indicated that these Bt spore crystals were not harmless to mice. This suggests that a more specific approach should be taken to increase knowledge about their toxicological properties and to establish the toxicological risks to nontarget organisms. © 2015 Wiley Periodicals, Inc. Environ Toxicol 31: 970-978, 2016. PMID:25899034

  7. Evaluating Michigan's community hospital access: spatial methods for decision support

    Directory of Open Access Journals (Sweden)

    Varnakovida Pariwate

    2006-09-01

    Full Text Available Abstract Background Community hospital placement is dictated by a diverse set of geographical factors and historical contingency. In the summer of 2004, a multi-organizational committee headed by the State of Michigan's Department of Community Health approached the authors of this paper with questions about how spatial analyses might be employed to develop a revised community hospital approval procedure. Three objectives were set. First, the committee needed visualizations of both the spatial pattern of Michigan's population and its 139 community hospitals. Second, the committee required a clear, defensible assessment methodology to quantify access to existing hospitals statewide, taking into account factors such as distance to nearest hospital and road network density to estimate travel time. Third, the committee wanted to contrast the spatial distribution of existing community hospitals with a theoretical configuration that best met statewide demand. This paper presents our efforts to first describe the distribution of Michigan's current community hospital pattern and its people, and second, develop two models, access-based and demand-based, to identify areas with inadequate access to existing hospitals. Results Using the product from the access-based model and contiguity and population criteria, two areas were identified as being "under-served." The lower area, located north/northeast of Detroit, contained the greater total land area and population of the two areas. The upper area was centered north of Grand Rapids. A demand-based model was applied to evaluate the existing facility arrangement by allocating daily bed demand in each ZIP code to the closest facility. We found 1,887 beds per day were demanded by ZIP centroids more than 16.1 kilometers from the nearest existing hospital. This represented 12.7% of the average statewide daily bed demand. If a 32.3 kilometer radius was employed, unmet demand dropped to 160 beds per day (1

  8. Numerical Weather Predictions Evaluation Using Spatial Verification Methods

    Science.gov (United States)

    Tegoulias, I.; Pytharoulis, I.; Kotsopoulos, S.; Kartsios, S.; Bampzelis, D.; Karacostas, T.

    2014-12-01

    During the last years high-resolution numerical weather prediction simulations have been used to examine meteorological events with increased convective activity. Traditional verification methods do not provide the desired level of information to evaluate those high-resolution simulations. To assess those limitations new spatial verification methods have been proposed. In the present study an attempt is made to estimate the ability of the WRF model (WRF -ARW ver3.5.1) to reproduce selected days with high convective activity during the year 2010 using those feature-based verification methods. Three model domains, covering Europe, the Mediterranean Sea and northern Africa (d01), the wider area of Greece (d02) and central Greece - Thessaly region (d03) are used at horizontal grid-spacings of 15km, 5km and 1km respectively. By alternating microphysics (Ferrier, WSM6, Goddard), boundary layer (YSU, MYJ) and cumulus convection (Kain-­-Fritsch, BMJ) schemes, a set of twelve model setups is obtained. The results of those simulations are evaluated against data obtained using a C-Band (5cm) radar located at the centre of the innermost domain. Spatial characteristics are well captured but with a variable time lag between simulation results and radar data. Acknowledgements: This research is co­financed by the European Union (European Regional Development Fund) and Greek national funds, through the action "COOPERATION 2011: Partnerships of Production and Research Institutions in Focused Research and Technology Sectors" (contract number 11SYN_8_1088 - DAPHNE) in the framework of the operational programme "Competitiveness and Entrepreneurship" and Regions in Transition (OPC II, NSRF 2007-­-2013).

  9. AA Index

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa index provides a long climatology of global geomagnetic activity using 2 antipodal observatories at Greenwich and Melbourne- IAGA Bulletin 37,...

  10. IMGT/StatClonotype for Pairwise Evaluation and Visualization of NGS IG and TR IMGT Clonotype (AA) Diversity or Expression from IMGT/HighV-QUEST.

    Science.gov (United States)

    Aouinti, Safa; Giudicelli, Véronique; Duroux, Patrice; Malouche, Dhafer; Kossida, Sofia; Lefranc, Marie-Paule

    2016-01-01

    There is a huge need for standardized analysis and statistical procedures in order to compare the complex immune repertoires of antigen receptors immunoglobulins (IG) and T cell receptors (TR) obtained by next generation sequencing (NGS). NGS technologies generate millions of nucleotide sequences and have led to the development of new tools. The IMGT/HighV-QUEST, available since 2010, is the first global web portal for the analysis of IG and TR high throughput sequences. IMGT/HighV-QUEST provides standardized outputs for the characterization of the "IMGT clonotype (AA)" (AA for amino acids) and their comparison in up to one million sequences. Standardized statistical procedures for "IMGT clonotype (AA)" diversity or expression comparisons have recently been described, however, no tool was yet available. IMGT/StatClonotype, a new IMGT(®) tool, evaluates and visualizes statistical significance of pairwise comparisons of IMGT clonotype (AA) diversity or expression, per V (variable), D (diversity), and J (joining) gene of a given IG or TR group, from NGS IMGT/HighV-QUEST statistical output. IMGT/StatClonotype tool is incorporated in the R package "IMGTStatClonotype," with a user-friendly interface. IMGT/StatClonotype is downloadable at IMGT(®) for users to evaluate pairwise comparison of IG and TR NGS statistical output from IMGT/HighV-QUEST and to visualize, on their web browser, the statistical significance of IMGT clonotype (AA) diversity or expression, per gene, the comparative analysis of CDR-IMGT and the V-D-J associations, in immunoprofiles from normal or pathological immune responses.

  11. IMGT/StatClonotype for Pairwise Evaluation and Visualization of NGS IG and TR IMGT Clonotype (AA) Diversity or Expression from IMGT/HighV-QUEST

    Science.gov (United States)

    Aouinti, Safa; Giudicelli, Véronique; Duroux, Patrice; Malouche, Dhafer; Kossida, Sofia; Lefranc, Marie-Paule

    2016-01-01

    There is a huge need for standardized analysis and statistical procedures in order to compare the complex immune repertoires of antigen receptors immunoglobulins (IG) and T cell receptors (TR) obtained by next generation sequencing (NGS). NGS technologies generate millions of nucleotide sequences and have led to the development of new tools. The IMGT/HighV-QUEST, available since 2010, is the first global web portal for the analysis of IG and TR high throughput sequences. IMGT/HighV-QUEST provides standardized outputs for the characterization of the “IMGT clonotype (AA)” (AA for amino acids) and their comparison in up to one million sequences. Standardized statistical procedures for “IMGT clonotype (AA)” diversity or expression comparisons have recently been described, however, no tool was yet available. IMGT/StatClonotype, a new IMGT® tool, evaluates and visualizes statistical significance of pairwise comparisons of IMGT clonotype (AA) diversity or expression, per V (variable), D (diversity), and J (joining) gene of a given IG or TR group, from NGS IMGT/HighV-QUEST statistical output. IMGT/StatClonotype tool is incorporated in the R package “IMGTStatClonotype,” with a user-friendly interface. IMGT/StatClonotype is downloadable at IMGT®1 for users to evaluate pairwise comparison of IG and TR NGS statistical output from IMGT/HighV-QUEST and to visualize, on their web browser, the statistical significance of IMGT clonotype (AA) diversity or expression, per gene, the comparative analysis of CDR-IMGT and the V–D–J associations, in immunoprofiles from normal or pathological immune responses. PMID:27667992

  12. IMGT/StatClonotype for Pairwise Evaluation and Visualization of NGS IG and TR IMGT Clonotype (AA) Diversity or Expression from IMGT/HighV-QUEST.

    Science.gov (United States)

    Aouinti, Safa; Giudicelli, Véronique; Duroux, Patrice; Malouche, Dhafer; Kossida, Sofia; Lefranc, Marie-Paule

    2016-01-01

    There is a huge need for standardized analysis and statistical procedures in order to compare the complex immune repertoires of antigen receptors immunoglobulins (IG) and T cell receptors (TR) obtained by next generation sequencing (NGS). NGS technologies generate millions of nucleotide sequences and have led to the development of new tools. The IMGT/HighV-QUEST, available since 2010, is the first global web portal for the analysis of IG and TR high throughput sequences. IMGT/HighV-QUEST provides standardized outputs for the characterization of the "IMGT clonotype (AA)" (AA for amino acids) and their comparison in up to one million sequences. Standardized statistical procedures for "IMGT clonotype (AA)" diversity or expression comparisons have recently been described, however, no tool was yet available. IMGT/StatClonotype, a new IMGT(®) tool, evaluates and visualizes statistical significance of pairwise comparisons of IMGT clonotype (AA) diversity or expression, per V (variable), D (diversity), and J (joining) gene of a given IG or TR group, from NGS IMGT/HighV-QUEST statistical output. IMGT/StatClonotype tool is incorporated in the R package "IMGTStatClonotype," with a user-friendly interface. IMGT/StatClonotype is downloadable at IMGT(®) for users to evaluate pairwise comparison of IG and TR NGS statistical output from IMGT/HighV-QUEST and to visualize, on their web browser, the statistical significance of IMGT clonotype (AA) diversity or expression, per gene, the comparative analysis of CDR-IMGT and the V-D-J associations, in immunoprofiles from normal or pathological immune responses. PMID:27667992

  13. IMGT/StatClonotype for Pairwise Evaluation and Visualization of NGS IG and TR IMGT Clonotype (AA) Diversity or Expression from IMGT/HighV-QUEST

    Science.gov (United States)

    Aouinti, Safa; Giudicelli, Véronique; Duroux, Patrice; Malouche, Dhafer; Kossida, Sofia; Lefranc, Marie-Paule

    2016-01-01

    There is a huge need for standardized analysis and statistical procedures in order to compare the complex immune repertoires of antigen receptors immunoglobulins (IG) and T cell receptors (TR) obtained by next generation sequencing (NGS). NGS technologies generate millions of nucleotide sequences and have led to the development of new tools. The IMGT/HighV-QUEST, available since 2010, is the first global web portal for the analysis of IG and TR high throughput sequences. IMGT/HighV-QUEST provides standardized outputs for the characterization of the “IMGT clonotype (AA)” (AA for amino acids) and their comparison in up to one million sequences. Standardized statistical procedures for “IMGT clonotype (AA)” diversity or expression comparisons have recently been described, however, no tool was yet available. IMGT/StatClonotype, a new IMGT® tool, evaluates and visualizes statistical significance of pairwise comparisons of IMGT clonotype (AA) diversity or expression, per V (variable), D (diversity), and J (joining) gene of a given IG or TR group, from NGS IMGT/HighV-QUEST statistical output. IMGT/StatClonotype tool is incorporated in the R package “IMGTStatClonotype,” with a user-friendly interface. IMGT/StatClonotype is downloadable at IMGT®1 for users to evaluate pairwise comparison of IG and TR NGS statistical output from IMGT/HighV-QUEST and to visualize, on their web browser, the statistical significance of IMGT clonotype (AA) diversity or expression, per gene, the comparative analysis of CDR-IMGT and the V–D–J associations, in immunoprofiles from normal or pathological immune responses.

  14. Evaluation of two commercially-available lubricants by means of ring test to AA 6061 F aluminum alloys

    Directory of Open Access Journals (Sweden)

    Rogério Alves Oliveira

    2003-12-01

    Full Text Available This paper shows friction results obtained through compression ring tests for two commercially-available lubricants (i.e., Oildag and Deltaforge applied in the hot forging of aluminum alloys. The experiments were performed with AA 6061 F aluminum alloy samples with the goal of observing the behavior of each lubricant in several conditions of temperature (200, 300, and 450 °C, strain rates (1, 10 and 50 s-1, and strain (25, 50 and 75%. The friction coefficients for each lubrication condition were established by means of calibration curves determined from finite element calculations with the use of the PEP/Larstran software package. An Analysis-of-Variance approach for the ring's internal diameter was followed in order to evaluate the performance of the lubricants. The results indicated that the Oildag lubricant presents a better stability as well as lower friction coefficients than the Deltaforge lubricant for the range of conditions tested, which translates into a better friction condition at die-part interface.

  15. (Un)awareness of unilateral spatial neglect: a quantitative evaluation of performance in visuo-spatial tasks.

    Science.gov (United States)

    Ronchi, Roberta; Bolognini, Nadia; Gallucci, Marcello; Chiapella, Laura; Algeri, Lorella; Spada, Maria Simonetta; Vallar, Giuseppe

    2014-12-01

    Right-brain-damaged patients with unilateral spatial neglect are usually unaware (anosognosic) about their spatial deficits. However, in the scientific literature there is a lack of systematic and quantitative evaluation of this kind of unawareness, despite the negative impact of anosognosia on rehabilitation programs. This study investigated anosognosia for neglect-related impairments at different clinical tasks, by means of a quantitative assessment. Patients were tested in two different conditions (before and after execution of each task), in order to evaluate changes in the level of awareness of neglect-related behaviours triggered by task execution. Twenty-nine right-brain-damaged patients (17 with left spatial neglect) and 27 neurologically unimpaired controls entered the study. Anosognosia for spatial deficits is not pervasive, with different tasks evoking different degrees of awareness about neglect symptoms. Indeed, patients showed a largely preserved awareness about their performance in complex visuo-motor spatial and reading tasks; conversely, they were impaired in evaluating their spatial difficulties in line bisection and drawing from memory, showing over-estimation of their performance. The selectivity of the patients' unawareness of specific manifestations of spatial neglect is further supported by their preserved awareness of performance at a linguistic task, and by the absence of anosognosia for hemiplegia. This evidence indicates that discrete processes are involved in the aware monitoring of cognitive and motor performance, which can be selectively compromised by brain damage. Awareness of spatial difficulties is supported by a number of distinct components, and influenced by the specific skills required to perform a given task.

  16. An Evaluation of University World Geography Textbook Questions for Components of Spatial Thinking

    Science.gov (United States)

    Scholz, Michael A.; Huynh, Niem Tu; Brysch, Carmen P.; Scholz, Ruojing Wang

    2014-01-01

    Geography textbooks contain chapter or review questions that may engage students in spatial thinking. This research used Jo and Bednarz's (2009) "Taxonomy of Spatial Thinking" to evaluate the percentage of spatial thinking questions in four university-level world geography course textbooks. The results from this study were then…

  17. Rating AAs.

    Science.gov (United States)

    Carter, Susan J.

    2001-01-01

    Why alternative investments? In a word: performance. Many higher education endowment and foundation managers are making increasing commitments to alternative investments, or AAs, in order to obtain higher returns and broader diversification for their investment portfolios than public securities instruments can usually provide. Learn how to handle…

  18. Evaluating Motion. Spatial User Behavior in Virtual Environments

    DEFF Research Database (Denmark)

    Drachen, Anders; Canossa, Alessandro

    2011-01-01

    User-behaviour analysis has only recently been adapted to the context of the virtual world domain and remains limited in its application. Behaviour analysis is based on instrumentation data, automated, detailed, quantitative information about user behaviour within the virtual environment (VE...... which they experience the games. Therefore, spatial behaviour analyses are useful to game research and design. In this paper, spatial analysis methods are introduced and arguments posed for their use in user-behaviour analysis. Case studies involving data from thousands of players are used to exemplify...... the application of instrumentation data to the analysis of spatial patterns of user behaviour....

  19. Coefficient shifts in geographical ecology: an empirical evaluation of spatial and non-spatial regression

    DEFF Research Database (Denmark)

    Bini, L. M.; Diniz-Filho, J. A. F.; Rangel, T. F. L. V. B.;

    2009-01-01

    richness, body size, range size and abundance in 97 multi-factorial data sets. Our goal was to compare standardized partial regression coefficients of non-spatial ordinary least squares regressions (i.e. models fitted using ordinary least squares without taking autocorrelation into account; "OLS models......A major focus of geographical ecology and macroecology is to understand the causes of spatially structured ecological patterns. However, achieving this understanding can be complicated when using multiple regression, because the relative importance of explanatory variables, as measured...

  20. National indicators for evaluating the outcome of reinventing spatial planning in Serbia

    Directory of Open Access Journals (Sweden)

    Dželebdžić Omiljena

    2011-01-01

    Full Text Available This paper is a follow-up to a research in the domain of theorizing planning practice and practising spatial planning theoretical approaches in the context of information-isation, globalisation and EU-isation. The theoretical framework contemplates the meaning of the spatial concept that is grounded in the duality of the information phenomenon and contemporary expression of the space notion, as a way of reinventing spatial planning. The operational framework discuses the spatial planning practice in Serbia through a brief explanation of applied methodology for identifying a suitable indicator set proposed for the implementation monitoring of the Spatial Plan of the Republic of Serbia 2010-2020. The national indicators set represents a theoretical model of knowledge for evaluating relational outcomes of spatial development complexity, and its spatial-temporal character represents a way of practising theoretical approaches as monitoring tools for spatial planning within the limits of the present regulatory system in Serbia.

  1. Numerical modeling of AA2024-T3 friction stir welding process for residual stress evaluation, including softening effects

    DEFF Research Database (Denmark)

    Sonne, Mads Rostgaard; Carlone, Pierpaolo; Palazzo, Gaetano S.;

    2014-01-01

    In the present paper, a numerical finite element model of the precipitation hardenable AA2024-T3 aluminum alloy, consisting of a heat transfer analysis based on the Thermal Pseudo Mechanical model for heat generation, and a sequentially coupled quasi-static stress analysis is proposed. Metallurgi...

  2. Developing Bilateral and Spatial Concepts in Primary School-aged Children: An Empirical Evaluation of the Anker Bilateral Spatial System

    Directory of Open Access Journals (Sweden)

    Janet E. Richmond PhD

    2014-07-01

    Full Text Available Background: Visual-spatial and visual-motor perceptual difficulties contribute to school-aged learning problems. Hence, a need exists to address children’s visual-spatial and visual-motor perceptual difficulties as early as possible in the child’s school career. Thus, this study reports on the evaluation of the Anker Bilateral Spatial System’s (ABSS effectiveness in remediating primary school children’s perceptual difficulties. Method: Thirty-one children (17 boys and 14 girls aged 6 to 12 years who had been identified by their classroom teacher as having observable visual-spatial and visual-motor perceptual difficulties participated in a 10-week pre/posttest intervention study. The study’s pre/posttest assessments included the Developmental Test of Visual-Motor Integration (VMI, the Spatial Awareness Skills Program Test (SASP, and two subscales of the School Function Assessment (SFA. Results: Paired t-test statistics were calculated on the pre/post intervention scores. Paired t-test statistics calculated (p = .05 that significant change had occurred in the writing speed (t = -3.978, p < .001. Conclusion: Given that the study’s Year 1 students made progress in more areas of remediation than did any other year level, it is evident that the ABSS is particularly effective with this year group.

  3. Evaluating stream health based environmental justice model performance at different spatial scales

    Science.gov (United States)

    Daneshvar, Fariborz; Nejadhashemi, A. Pouyan; Zhang, Zhen; Herman, Matthew R.; Shortridge, Ashton; Marquart-Pyatt, Sandra

    2016-07-01

    This study evaluated the effects of spatial resolution on environmental justice analysis concerning stream health. The Saginaw River Basin in Michigan was selected since it is an area of concern in the Great Lakes basin. Three Bayesian Conditional Autoregressive (CAR) models (ordinary regression, weighted regression and spatial) were developed for each stream health measure based on 17 socioeconomic and physiographical variables at three census levels. For all stream health measures, spatial models had better performance compared to the two non-spatial ones at the census tract and block group levels. Meanwhile no spatial dependency was found at the county level. Multilevel Bayesian CAR models were also developed to understand the spatial dependency at the three levels. Results showed that considering level interactions improved models' prediction. Residual plots also showed that models developed at the block group and census tract (in contrary to county level models) are able to capture spatial variations.

  4. Evaluation of trace elements in chewing tobacco and snuff using instrumental neutron activation analysis (INAA) and atomic absorption spectroscopy (AAS)

    Energy Technology Data Exchange (ETDEWEB)

    Waheed, S.; Siddique, N.; Rahman, S. [Chemistry Div., Directorate of Science, Pakistan Inst. of Nuclear Science and Tech., Islamabad (Pakistan)

    2009-07-01

    Nine samples of chewing tobacco, snuff, tobacco leaf and ash were analyzed using Instrumental Neutron Activation Analysis (INAA) and Atomic Absorption Spectroscopy (AAS). Almost all samples of chewing tobacco and snuff studied in this work contain substantial amounts of Mg, Mn, Na, K. V. Sc, Rb and Fe. Furthermore, varying amounts of Al, Ba, Ca, Ce, Co and Zn were also detected in all tobacco samples. Of the toxic elements which were determined using INAA. As, Sb and Hg were quantified in only few tobacco samples. However, other toxic elements, which were determined using AAS, such as Cu, Pb and Cd were detected in almost all samples of chewing tobacco and snuff. The concentration of majority of the detected elements is high in ash samples which imply that most elements in chewing tobacco and snuff may originate from the addition of ash. (orig.)

  5. Microstructural Characterization and Hardness Evaluation of Friction Stir Welded Composite AA6061-4.5Cu-5SiC (Wt.%

    Directory of Open Access Journals (Sweden)

    A.K. Shettigar

    2013-07-01

    Full Text Available Recent developments in advanced materials research have led to the emergence of new materials having features like low density, high strength to weight ratio, excellent mechanical properties, heat and corrosion resistance. In friction stir welding (FSW, a non-consumable rotating welding tool is used to generate the frictional heat and plastic deformation of the material in the welding zone, which is in the solid state. The advantages of FSW as compared to the fusion welding are high joint strength, less defect weld, uniform distribution of grain structure in the weld zone and low power consumption. AA6061with 4.5 % weight of copper and 5 % weight of SiC composite material has been prepared to conduct experiment and carry out characterization, evaluation of the mechanical properties. Micro-structural characterization of the weld zone is carried out by scanning electron microscope (SEM. Evaluation of hardness was also carried out across the weld zone. A successful method for FSW of AA6061-4.5(wt.% Cu-5(wt.% SiC has been developed.Defence Science Journal, 2013, 63(4, pp.429-434, DOI:http://dx.doi.org/10.14429/dsj.63.4869

  6. Microstructural Characterization and Hardness Evaluation of Friction Stir Welded Composite AA6061-4.5Cu-5SiC (Wt.%

    Directory of Open Access Journals (Sweden)

    A.K. Shettigar

    2013-07-01

    Full Text Available Recent developments in advanced materials research have led to the emergence of new materials having features like low density, high strength to weight ratio, excellent mechanical properties, heat and corrosion resistance. In friction stir welding (FSW, a non-consumable rotating welding tool is used to generate the frictional heat and plastic deformation of the material in the welding zone, which is in the solid state. The advantages of FSW as compared to the fusion welding are high joint strength, less defect weld, uniform distribution of grain structure in the weld zone and low power consumption. AA6061with 4.5 % weight of copper and 5 % weight of SiC composite material has been prepared to conduct experiment and carry out characterization, evaluation of the mechanical properties. Micro-structural characterization of the weld zone is carried out by scanning electron microscope (SEM. Evaluation of hardness was also carried out across the weld zone. A successful method for FSW of AA6061-4.5(wt.% Cu-5(wt.% SiC has been developed.

  7. Sediment spatial distribution evaluated by three methods and its relation to some soil properties

    Energy Technology Data Exchange (ETDEWEB)

    Bacchi, O.O.S. [Centro de Energia Nuclear na Agricultura-CENA/USP, Laboratorio de Fisica do Solo, Piracicaba, SP (Brazil)]. E-mail: osny@ccna.usp.br; Reichardt, K. [Centro de Energia Nuclear na Agricultura-CENA/USP, Laboratorio de Fisica do Solo, Piracicaba, SP (Brazil); Departamento de Ciencias Exatas, Escola Superior de Agricultura ' Luiz de Queiroz' ESALQ/USP, Piracicaba, SP (Brazil); Sparovek, G. [Departamento de Solos e Nutricao de Plantas, Escola Superior de Agricultura ' Luiz de Queiroz' ESALQ/USP, Piracicaba, SP (Brazil)

    2003-02-15

    An investigation of rates and spatial distribution of sediments on an agricultural field cultivated with sugarcane was undertaken using the {sup 137}Cs technique, USLE and WEPP models. The study was carried out on the Ceveiro watershed of the Piracicaba river basin, state of Sao Paulo, Brazil, experiencing severe soil degradation due to soil erosion. The objectives of the study were to compare the spatial distribution of sediments evaluated by the three methods and its relation to some soil properties. Erosion and sedimentation rates and their spatial distribution estimated by the three methods were completely different. Although not able to show sediment deposition, the spatial distribution of erosion rates evaluated by USLE presented the best correlation with other studied soil properties. (author)

  8. A high-performance spatial database based approach for pathology imaging algorithm evaluation

    Directory of Open Access Journals (Sweden)

    Fusheng Wang

    2013-01-01

    Full Text Available Background: Algorithm evaluation provides a means to characterize variability across image analysis algorithms, validate algorithms by comparison with human annotations, combine results from multiple algorithms for performance improvement, and facilitate algorithm sensitivity studies. The sizes of images and image analysis results in pathology image analysis pose significant challenges in algorithm evaluation. We present an efficient parallel spatial database approach to model, normalize, manage, and query large volumes of analytical image result data. This provides an efficient platform for algorithm evaluation. Our experiments with a set of brain tumor images demonstrate the application, scalability, and effectiveness of the platform. Context: The paper describes an approach and platform for evaluation of pathology image analysis algorithms. The platform facilitates algorithm evaluation through a high-performance database built on the Pathology Analytic Imaging Standards (PAIS data model. Aims: (1 Develop a framework to support algorithm evaluation by modeling and managing analytical results and human annotations from pathology images; (2 Create a robust data normalization tool for converting, validating, and fixing spatial data from algorithm or human annotations; (3 Develop a set of queries to support data sampling and result comparisons; (4 Achieve high performance computation capacity via a parallel data management infrastructure, parallel data loading and spatial indexing optimizations in this infrastructure. Materials and Methods: We have considered two scenarios for algorithm evaluation: (1 algorithm comparison where multiple result sets from different methods are compared and consolidated; and (2 algorithm validation where algorithm results are compared with human annotations. We have developed a spatial normalization toolkit to validate and normalize spatial boundaries produced by image analysis algorithms or human annotations. The

  9. A Framework for Evaluation of Marine Spatial Data Geoportals Using Case Studies

    Directory of Open Access Journals (Sweden)

    Tavra Marina

    2014-12-01

    Full Text Available Need for a Marine Spatial Data Infrastructure (MSDI as a component of a National Spatial Data Infrastructure (NSDI is widely recognized. An MSDI is relevant not only for hydrographers and government planners, but also for many other sectors which takes interest in marine spatial data, whether they are data users, data providers, or data managers [9]. An MSDI encompasses marine and coastal geographic and business information. For efficient use of Marine Spatial Data, it is necessary to ensure its valid and accessible distribution. A geoportal is a specialized web portal for sharing spatial information at different levels over the Internet. This paper re-examines the implementation of an MSDI and what it means for data custodians and end users. Several geoportals are reviewed (German and Australian to determine their web services functionality, capabilities and the scope to which they support the sharing and reuse of Marine Spatial Data to assist the development of the Croatian MSDI Geoportal. This framework provides a context for better understanding the information bases on spatial data standards and a tool for evaluation of MSDI dissemination - Geoportal.

  10. Standard Reticle Slide To Objectively Evaluate Spatial Resolution and Instrument Performance in Imaging Mass Spectrometry.

    Science.gov (United States)

    Zubair, Faizan; Prentice, Boone M; Norris, Jeremy L; Laibinis, Paul E; Caprioli, Richard M

    2016-07-19

    Spatial resolution is a key parameter in imaging mass spectrometry (IMS). Aside from being a primary determinant in overall image quality, spatial resolution has important consequences on the acquisition time of the IMS experiment and the resulting file size. Hardware and software modifications during instrumentation development can dramatically affect the spatial resolution achievable using a given imaging mass spectrometer. As such, an accurate and objective method to determine the working spatial resolution is needed to guide instrument development and ensure quality IMS results. We have used lithographic and self-assembly techniques to fabricate a pattern of crystal violet as a standard reticle slide for assessing spatial resolution in matrix-assisted laser desorption/ionization (MALDI) IMS experiments. The reticle is used to evaluate spatial resolution under user-defined instrumental conditions. Edgespread analysis measures the beam diameter for a Gaussian profile and line scans measure an "effective" spatial resolution that is a convolution of beam optics and sampling frequency. The patterned crystal violet reticle was also used to diagnose issues with IMS instrumentation such as intermittent losses of pixel data. PMID:27299987

  11. Evaluation of the MIND Research Institute's Spatial-Temporal Math (ST Math) Program in California

    Science.gov (United States)

    Wendt, Staci; Rice, John; Nakamoto, Jonathan

    2014-01-01

    The MIND Research Institute contracted with the Evaluation Research Program at WestEd to conduct an independent assessment of mathematics outcomes in elementary school grades across California that were provided with the ST Math program. Spatial-Temporal (ST) Math is a game-based instructional software designed to boost K-5 and secondary-level…

  12. Evaluating the Value of High Spatial Resolution in National Capacity Expansion Models using ReEDS

    Energy Technology Data Exchange (ETDEWEB)

    Krishnan, Venkat; Cole, Wesley

    2016-07-18

    This poster is based on the paper of the same name, presented at the IEEE Power & Energy Society General Meeting, July18, 2016. Power sector capacity expansion models (CEMs) have a broad range of spatial resolutions. This paper uses the Regional Energy Deployment System (ReEDS) model, a long-term national scale electric sector CEM, to evaluate the value of high spatial resolution for CEMs. ReEDS models the United States with 134 load balancing areas (BAs) and captures the variability in existing generation parameters, future technology costs, performance, and resource availability using very high spatial resolution data, especially for wind and solar modeled at 356 resource regions. In this paper we perform planning studies at three different spatial resolutions - native resolution (134 BAs), state-level, and NERC region level - and evaluate how results change under different levels of spatial aggregation in terms of renewable capacity deployment and location, associated transmission builds, and system costs. The results are used to ascertain the value of high geographically resolved models in terms of their impact on relative competitiveness among renewable energy resources.

  13. Evaluation of the performance of tests for spatial randomness on prostate cancer data

    Directory of Open Access Journals (Sweden)

    Song Changhong

    2009-07-01

    Full Text Available Abstract Background Spatial global clustering tests can be used to evaluate the geographical distribution of health outcomes. The power of several of these tests has been evaluated and compared using simulated data, but their performance using real unadjusted data and data adjusted for individual- and area-level covariates has not been reported previously. We evaluated data on prostate cancer histologic tumor grade and stage of disease at diagnosis for incident cases of prostate cancer reported to the Maryland Cancer Registry during 1992–1997. We analyzed unadjusted data as well as expected counts from models that were adjusted for individual-level covariates (race, age and year of diagnosis and area-level covariates (census block group median household income and a county-level socioeconomic index. We chose 3 spatial clustering tests that are commonly used to evaluate the geographic distribution of disease: Cuzick-Edwards' k-NN (k-Nearest Neighbors test, Moran's I and Tango's MEET (Maximized Excess Events Test. Results For both grade and stage at diagnosis, we found that Cuzick-Edwards' k-NN and Moran's I were very sensitive to the percent of population parameter selected. For stage at diagnosis, all three tests showed that the models with individual- and area-level adjustments reduced clustering the most, but did not reduce it entirely. Conclusion Based on this specific example, results suggest that these tests provide useful tools for evaluating spatial clustering of disease characteristics, both before and after consideration of covariates.

  14. Shapes on a plane: Evaluating the impact of projection distortion on spatial binning

    Science.gov (United States)

    Battersby, Sarah E.; Strebe, Daniel “daan”; Finn, Michael P.

    2016-01-01

    One method for working with large, dense sets of spatial point data is to aggregate the measure of the data into polygonal containers, such as political boundaries, or into regular spatial bins such as triangles, squares, or hexagons. When mapping these aggregations, the map projection must inevitably distort relationships. This distortion can impact the reader’s ability to compare count and density measures across the map. Spatial binning, particularly via hexagons, is becoming a popular technique for displaying aggregate measures of point data sets. Increasingly, we see questionable use of the technique without attendant discussion of its hazards. In this work, we discuss when and why spatial binning works and how mapmakers can better understand the limitations caused by distortion from projecting to the plane. We introduce equations for evaluating distortion’s impact on one common projection (Web Mercator) and discuss how the methods used generalize to other projections. While we focus on hexagonal binning, these same considerations affect spatial bins of any shape, and more generally, any analysis of geographic data performed in planar space.

  15. A new measure for evaluating spatially related properties of traffic information credibility

    Institute of Scientific and Technical Information of China (English)

    李海舰; 董宏辉; 贾利民; 仁墨羽; 秦勇

    2014-01-01

    With the wide applications of sensor network technology in traffic information acquisition systems, a new measure will be quite necessary to evaluate spatially related properties of traffic information credibility. The heterogeneity of spatial distribution of information credibility from sensor networks is analyzed and a new measure, information credibility function (ICF), is proposed to describe this heterogeneity. Three possible functional forms of sensor ICF and their corresponding expressions are presented. Then, two feasible operations of spatial superposition of sensor ICFs are discussed. Finally, a numerical example is introduced to show the calibration method of sensor ICF and obtain the spatially related properties of expressway in Beijing. The results show that the sensor ICF of expressway in Beijing possesses a negative exponent property. The traffic information is more abundant at or near the locations of sensor, while with the distance away from the sensor increasing, the traffic information credibility will be declined by an exponential trend. The new measure provides theoretical bases for the optimal locations of traffic sensor networks and the mechanism research of spatial distribution of traffic information credibility.

  16. Infrared chemical imaging: Spatial resolution evaluation and super-resolution concept

    Energy Technology Data Exchange (ETDEWEB)

    Offroy, Marc [Laboratoire de Spectrochimie Infrarouge et Raman, LASIR, CNRS UMR 8516, Bat. C5, Universite des Sciences et Technologies de Lille, 59655 Villeneuve d' Ascq Cedex (France); Roggo, Yves [F. Hoffmann-La Roche A.G., Basel (Switzerland); Milanfar, Peyman [Multi-Dimensional Signal Processing Laboratory, Electrical Engineering Department, Baskin School of Engineering, University of California, 1156 High Street, Mailcode SOE2, Santa Cruz, CA 95064 (United States); Duponchel, Ludovic, E-mail: ludovic.duponchel@univ-lille1.fr [Laboratoire de Spectrochimie Infrarouge et Raman, LASIR, CNRS UMR 8516, Bat. C5, Universite des Sciences et Technologies de Lille, 59655 Villeneuve d' Ascq Cedex (France)

    2010-08-03

    Chemical imaging systems help to solve many challenges in various scientific fields. Able to deliver rapid spatial and chemical information, modern infrared spectrometers using Focal Plane Array detectors (FPA) are of great interest. Considering conventional infrared spectrometers with a single element detector, we can consider that the diffraction-limited spatial resolution is more or less equal to the wavelength of the light (i.e. 2.5-25 {mu}m). Unfortunately, the spatial resolution of FPA spectroscopic setup is even lower due to the detector pixel size. This becomes a real constraint when micron-sized samples are analysed. New chemometrics methods are thus of great interest to overcome such resolution drawback, while keeping our far-field infrared imaging spectrometers. The aim of the present work is to evaluate the super-resolution concept in order to increase the spatial resolution of infrared imaging spectrometers using FPA detectors. The main idea of super-resolution is the fusion of several low-resolution images of the same sample to obtain a higher-resolution image. Applying the super-resolution concept on a relatively low number of FPA acquisitions, it was possible to observe a 30% decrease in spatial resolution.

  17. Wavelet-based spatial comparison technique for analysing and evaluating two-dimensional geophysical model fields

    Directory of Open Access Journals (Sweden)

    S. Saux Picart

    2011-11-01

    Full Text Available Complex numerical models of the Earth's environment, based around 3-D or 4-D time and space domains are routinely used for applications including climate predictions, weather forecasts, fishery management and environmental impact assessments. Quantitatively assessing the ability of these models to accurately reproduce geographical patterns at a range of spatial and temporal scales has always been a difficult problem to address. However, this is crucial if we are to rely on these models for decision making. Satellite data are potentially the only observational dataset able to cover the large spatial domains analysed by many types of geophysical models. Consequently optical wavelength satellite data is beginning to be used to evaluate model hindcast fields of terrestrial and marine environments. However, these satellite data invariably contain regions of occluded or missing data due to clouds, further complicating or impacting on any comparisons with the model. A methodology has recently been developed to evaluate precipitation forecasts using radar observations. It allows model skill to be evaluated at a range of spatial scales and rain intensities. Here we extend the original method to allow its generic application to a range of continuous and discontinuous geophysical data fields, and therefore allowing its use with optical satellite data. This is achieved through two major improvements to the original method: (i all thresholds are determined based on the statistical distribution of the input data, so no a priori knowledge about the model fields being analysed is required and (ii occluded data can be analysed without impacting on the metric results. The method can be used to assess a model's ability to simulate geographical patterns over a range of spatial scales. We illustrate how the method provides a compact and concise way of visualising the degree of agreement between spatial features in two datasets. The application of the new method, its

  18. An evaluation of potential sampling locations in a reservoir with emphasis on conserved spatial correlation structure.

    Science.gov (United States)

    Yenilmez, Firdes; Düzgün, Sebnem; Aksoy, Aysegül

    2015-01-01

    In this study, kernel density estimation (KDE) was coupled with ordinary two-dimensional kriging (OK) to reduce the number of sampling locations in measurement and kriging of dissolved oxygen (DO) concentrations in Porsuk Dam Reservoir (PDR). Conservation of the spatial correlation structure in the DO distribution was a target. KDE was used as a tool to aid in identification of the sampling locations that would be removed from the sampling network in order to decrease the total number of samples. Accordingly, several networks were generated in which sampling locations were reduced from 65 to 10 in increments of 4 or 5 points at a time based on kernel density maps. DO variograms were constructed, and DO values in PDR were kriged. Performance of the networks in DO estimations were evaluated through various error metrics, standard error maps (SEM), and whether the spatial correlation structure was conserved or not. Results indicated that smaller number of sampling points resulted in loss of information in regard to spatial correlation structure in DO. The minimum representative sampling points for PDR was 35. Efficacy of the sampling location selection method was tested against the networks generated by experts. It was shown that the evaluation approach proposed in this study provided a better sampling network design in which the spatial correlation structure of DO was sustained for kriging. PMID:25527435

  19. Fundamental study on an evaluation method for the geological environment with spatially heterogeneous characteristics

    International Nuclear Information System (INIS)

    In order to count the spatially heterogeneous environment itself as one of components of the engineering system, the following procedures must be considered: recognition of the importance to the engineering system of evaluations of the geological environment with spatially heterogeneous characteristics; designing a strategy for the investigation in the light of the above; and development of an uncertainty analysis methodology as a quality control on the evaluation method of the spatially heterogeneous environment. Focusing on a firm scientific and technological basis for the research and development of the high-level radioactive waste geological disposal, a study of these procedure is reported in this paper. Consequently an 'uncertainty analysis methodology associated with the characterization of the geological environment' was developed for the spatially heterogeneous characteristics of a geological environment. The developed uncertainty analysis methodology adopts a new approach, where all the possible options in models and datasets that cannot be excluded in the light of evidence available, are identified. This approach enables uncertainties associated with the understanding at a given stage of the site characterization to be made explicit, based on the classification of uncertainties into variability and ignorance. The uncertainties could be reduced by screening to exclude models and data-sets that can be denied in the light of additional evidences obtained in subsequent stages. (author)

  20. Evaluation of AA5052 alloy anode in alkaline electrolyte with organic rare-earth complex additives for aluminium-air batteries

    Science.gov (United States)

    Wang, Dapeng; Li, Heshun; Liu, Jie; Zhang, Daquan; Gao, Lixin; Tong, Lin

    2015-10-01

    Behaviours of the AA5052 aluminium alloy anode of the alkaline aluminium-air battery are studied by the hydrogen evolution test, the electrochemical measurements and the surface analysis method. The combination of amino-acid and rare earth as electrolyte additives effectively retards the self-corrosion of AA5052 aluminium alloy in 4 M NaOH solution. It shows that the combination of L-cysteine and cerium nitrate has a synergistic effect owing to the formation of a complex film on AA5052 alloy surface. The organic rare-earth complex can decrease the anodic polarisation, suppress the hydrogen evolution and increase the anodic utilization rate.

  1. AgesGalore-A software program for evaluating spatially resolved luminescence data

    International Nuclear Information System (INIS)

    Low-light luminescence is usually recorded by photomultiplier tubes (PMTs) yielding integrated photon-number data. Highly sensitive CCD (charged coupled device) detectors allow for the spatially resolved recording of luminescence. The resulting two-dimensional images require suitable software for data processing. We present a recently developed software program specially designed for equivalent-dose evaluation in the framework of optically stimulated luminescence (OSL) dating. The software is capable of appropriate CCD data handling, parameter estimation using a Bayesian approach, and the pixel-wise fitting of functions for time and dose dependencies to the luminescence signal. The results of the fitting procedure and the equivalent-dose evaluation can be presented and analyzed both as spatial and as frequency distributions

  2. Spatial decentralization and program evaluation: Theory and an example from Indonesia

    OpenAIRE

    Pitt, Mark M.; Menon, Nidhiya

    2010-01-01

    This paper proposes a novel instrumental variable method for program evaluation that only requires a single cross-section of data on the spatial intensity of programs and outcomes. The instruments are derived from a simple theoretical model of government decision-making in which governments are responsive to the attributes of places and their populations, rather than to the attributes of individuals, in making allocation decisions across space, and have a social welfare function that is spati...

  3. Evaluation and Comparision of Common Spatial Patterns (CSP) and Intelligent Segmentation in P300 Detection

    OpenAIRE

    Zahra Amini1; Vahid Abootalebi; Mohammad Taghi Sadeghi

    2011-01-01

    In This Paper, two different feature extraction methods were studied and their performances in pattern recognition based- P300 detection were compared. These two methods were Common Spatial Pattern (CSP) and intelligent segmentation. Data set II (P300 speller) from the BCI competition 2005 was used. After pre-processing and feature extraction, these features were compared. For this purpose, first, a statistical analysis had been applied for evaluating the fitness of each feature in discrimina...

  4. A reference dataset for deformable image registration spatial accuracy evaluation using the COPDgene study archive

    Science.gov (United States)

    Castillo, Richard; Castillo, Edward; Fuentes, David; Ahmad, Moiz; Wood, Abbie M.; Ludwig, Michelle S.; Guerrero, Thomas

    2013-05-01

    Landmark point-pairs provide a strategy to assess deformable image registration (DIR) accuracy in terms of the spatial registration of the underlying anatomy depicted in medical images. In this study, we propose to augment a publicly available database (www.dir-lab.com) of medical images with large sets of manually identified anatomic feature pairs between breath-hold computed tomography (BH-CT) images for DIR spatial accuracy evaluation. Ten BH-CT image pairs were randomly selected from the COPDgene study cases. Each patient had received CT imaging of the entire thorax in the supine position at one-fourth dose normal expiration and maximum effort full dose inspiration. Using dedicated in-house software, an imaging expert manually identified large sets of anatomic feature pairs between images. Estimates of inter- and intra-observer spatial variation in feature localization were determined by repeat measurements of multiple observers over subsets of randomly selected features. 7298 anatomic landmark features were manually paired between the 10 sets of images. Quantity of feature pairs per case ranged from 447 to 1172. Average 3D Euclidean landmark displacements varied substantially among cases, ranging from 12.29 (SD: 6.39) to 30.90 (SD: 14.05) mm. Repeat registration of uniformly sampled subsets of 150 landmarks for each case yielded estimates of observer localization error, which ranged in average from 0.58 (SD: 0.87) to 1.06 (SD: 2.38) mm for each case. The additions to the online web database (www.dir-lab.com) described in this work will broaden the applicability of the reference data, providing a freely available common dataset for targeted critical evaluation of DIR spatial accuracy performance in multiple clinical settings. Estimates of observer variance in feature localization suggest consistent spatial accuracy for all observers across both four-dimensional CT and COPDgene patient cohorts.

  5. A spatial assessment framework for evaluating flood risk under extreme climates.

    Science.gov (United States)

    Chen, Yun; Liu, Rui; Barrett, Damian; Gao, Lei; Zhou, Mingwei; Renzullo, Luigi; Emelyanova, Irina

    2015-12-15

    Australian coal mines have been facing a major challenge of increasing risk of flooding caused by intensive rainfall events in recent years. In light of growing climate change concerns and the predicted escalation of flooding, estimating flood inundation risk becomes essential for understanding sustainable mine water management in the Australian mining sector. This research develops a spatial multi-criteria decision making prototype for the evaluation of flooding risk at a regional scale using the Bowen Basin and its surroundings in Queensland as a case study. Spatial gridded data, including climate, hydrology, topography, vegetation and soils, were collected and processed in ArcGIS. Several indices were derived based on time series of observations and spatial modeling taking account of extreme rainfall, evapotranspiration, stream flow, potential soil water retention, elevation and slope generated from a digital elevation model (DEM), as well as drainage density and proximity extracted from a river network. These spatial indices were weighted using the analytical hierarchy process (AHP) and integrated in an AHP-based suitability assessment (AHP-SA) model under the spatial risk evaluation framework. A regional flooding risk map was delineated to represent likely impacts of criterion indices at different risk levels, which was verified using the maximum inundation extent detectable by a time series of remote sensing imagery. The result provides baseline information to help Bowen Basin coal mines identify and assess flooding risk when making adaptation strategies and implementing mitigation measures in future. The framework and methodology developed in this research offers the Australian mining industry, and social and environmental studies around the world, an effective way to produce reliable assessment on flood risk for managing uncertainty in water availability under climate change.

  6. A spatial assessment framework for evaluating flood risk under extreme climates.

    Science.gov (United States)

    Chen, Yun; Liu, Rui; Barrett, Damian; Gao, Lei; Zhou, Mingwei; Renzullo, Luigi; Emelyanova, Irina

    2015-12-15

    Australian coal mines have been facing a major challenge of increasing risk of flooding caused by intensive rainfall events in recent years. In light of growing climate change concerns and the predicted escalation of flooding, estimating flood inundation risk becomes essential for understanding sustainable mine water management in the Australian mining sector. This research develops a spatial multi-criteria decision making prototype for the evaluation of flooding risk at a regional scale using the Bowen Basin and its surroundings in Queensland as a case study. Spatial gridded data, including climate, hydrology, topography, vegetation and soils, were collected and processed in ArcGIS. Several indices were derived based on time series of observations and spatial modeling taking account of extreme rainfall, evapotranspiration, stream flow, potential soil water retention, elevation and slope generated from a digital elevation model (DEM), as well as drainage density and proximity extracted from a river network. These spatial indices were weighted using the analytical hierarchy process (AHP) and integrated in an AHP-based suitability assessment (AHP-SA) model under the spatial risk evaluation framework. A regional flooding risk map was delineated to represent likely impacts of criterion indices at different risk levels, which was verified using the maximum inundation extent detectable by a time series of remote sensing imagery. The result provides baseline information to help Bowen Basin coal mines identify and assess flooding risk when making adaptation strategies and implementing mitigation measures in future. The framework and methodology developed in this research offers the Australian mining industry, and social and environmental studies around the world, an effective way to produce reliable assessment on flood risk for managing uncertainty in water availability under climate change. PMID:26318687

  7. Spatial visualization ability and laparoscopic skills in novice learners: evaluating stereoscopic versus monoscopic visualizations.

    Science.gov (United States)

    Roach, Victoria A; Mistry, Manisha R; Wilson, Timothy D

    2014-01-01

    Elevated spatial visualization ability (Vz) is thought to influence surgical skill acquisition and performance. Current research suggests that stereo visualization technology and its association with skill performance may confer perceptual advantages. This is of particular interest in laparoscopic skill training, where stereo visualization may confer learning advantages to novices of variant Vz. This study explored laparoscopic skill performance scores in novices with variable spatial ability utilizing stereoscopic and traditional monoscopic visualization paradigms. Utilizing the McGill Inanimate System for Teaching and Evaluating Laparoscopic Skills (MISTELS) scoring protocol it was hypothesized that individuals with high spatial visualization ability (HVz) would achieve higher overall and individual MISTELS task scores as compared to low spatial visualization ability (LVz) counterparts. Further, we also hypothesized that a difference would exist between HVz and LVz individual scores based on the viewing modality employed. No significant difference was observed between HVz and LVz individuals for MISTELS tasks scores, overall or individually under both viewing modalities, despite higher average MISTELS scores for HVz individuals. The lack of difference between scores obtained under the stereo modality suggested that the additional depth that is conferred by the stereoscopic visualization may act to enhance performance for individuals with LVz, potentially equilibrating their performance with their HVz peers. Further experimentation is required to better ascertain the effects of stereo visualization in individuals of high and low Vz, though it appears stereoscopic visualizations could serve as a prosthetic to enhance skill performance.

  8. Application of spatial frequency response as a criterion for evaluating thermal imaging camera performance

    Science.gov (United States)

    Lock, Andrew; Amon, Francine

    2008-04-01

    Police, firefighters, and emergency medical personnel are examples of first responders that are utilizing thermal imaging cameras in a very practical way every day. However, few performance metrics have been developed to assist first responders in evaluating the performance of thermal imaging technology. This paper describes one possible metric for evaluating spatial resolution using an application of Spatial Frequency Response (SFR) calculations for thermal imaging. According to ISO 12233, the SFR is defined as the integrated area below the Modulation Transfer Function (MTF) curve derived from the discrete Fourier transform of a camera image representing a knife-edge target. This concept is modified slightly for use as a quantitative analysis of the camera's performance by integrating the area between the MTF curve and the camera's characteristic nonuniformity, or noise floor, determined at room temperature. The resulting value, which is termed the Effective SFR, can then be compared with a spatial resolution value obtained from human perception testing of task specific situations to determine the acceptability of the performance of thermal imaging cameras. The testing procedures described herein are being developed as part of a suite of tests for possible inclusion into a performance standard on thermal imaging cameras for first responders.

  9. Integrated planning and spatial evaluation of megasite remediation and reuse options

    Science.gov (United States)

    Schädler, Sebastian; Morio, Maximilian; Bartke, Stephan; Finkel, Michael

    2012-01-01

    Redevelopment of large contaminated brownfields (megasites) is often hampered by a lack of communication and harmonization among diverse stakeholders with potentially conflicting interests. Decision support is required to provide integrative yet transparent evaluation of often complex spatial information to stakeholders with different areas of expertise. It is considered crucial for successful redevelopment to identify a shared vision of how the respective contaminated site could be remediated and redeveloped. We describe a framework of assessment methods and models that analyzes and visualizes site- and land use-specific spatial information at the screening level, with the aim to support the derivation of recommendable land use layouts and to initiate further and more detailed planning. The framework integrates a GIS-based identification of areas to be remediated, an estimation of associated clean-up costs, a spatially explicit market value appraisal, and an assessment of the planned future land use's contribution to sustainable urban and regional development. Case study results show that derived options are potentially favorable in both a sustainability and an economic sense and that iterative re-planning is facilitated by the evaluation and visualization of economic, ecological and socio-economic aspects. The framework supports an efficient early judgment about whether and how abandoned land may be assigned a sustainable and marketable land use.

  10. Enhancement of Spatial Resolution Using a Metamaterial Sensor in Nondestructive Evaluation

    Directory of Open Access Journals (Sweden)

    Adriana Savin

    2015-11-01

    Full Text Available The current stage of non-destructive evaluation techniques imposes the development of new electromagnetic methods that are based on high spatial resolution and increased sensitivity. Printed circuit boards, integrated circuit boards, composite materials with polymeric matrix containing conductive fibers, as well as some types of biosensors are devices of interest in using such evaluation methods. In order to achieve high performance, the work frequencies must be either radiofrequencies or microwaves. At these frequencies, at the dielectric/conductor interface, plasmon polaritons can appear, propagating between conductive regions as evanescent waves. Detection of these waves, containing required information, can be done using sensors with metamaterial lenses. We propose in this paper the enhancement of the spatial resolution using electromagnetic methods, which can be accomplished in this case using evanescent waves that appear in the current study in slits of materials such as the spaces between carbon fibers in Carbon Fibers Reinforced Plastics or in materials of interest in the nondestructive evaluation field with industrial applications, where microscopic cracks are present. We propose herein a unique design of the metamaterials for use in nondestructive evaluation based on Conical Swiss Rolls configurations, which assure the robust concentration/focusing of the incident electromagnetic waves (practically impossible to be focused using classical materials, as well as the robust manipulation of evanescent waves. Applying this testing method, spatial resolution of approximately λ/2000 can be achieved. This testing method can be successfully applied in a variety of applications of paramount importance such as defect/damage detection in materials used in a variety of industrial applications, such as automotive and aviation technologies.

  11. Basic evaluation of sampling step angle and spatial resolution in continuous rotating acquisition with SPECT

    International Nuclear Information System (INIS)

    In the data sampling in single photon emission computed tomography (SPECT), the continuous rotating acquisition method has high clinical utility. There have been various reports about the optimum sampling step angle for continuous rotating acquisition. Objective evaluation was performed visually and by measuring spatial resolution with a column phantom to find the optimum sampling step angle for continuous rotating acquisition. In locations far from the rotation center, a large sampling step angle produced artificial images with tangential elongation. The spatial resolution was 11.58±0.19 mm full width half maximum (FWHM) as measured at a sampling step angle of 3 degrees and at 10 cm away from the rotation center. Increasing the sampling step angle to more than 3 degrees resulted in an increase of FWHM in the tangential direction. The optimum sampling step angle for continuous rotating acquisition in SPECT needs to be below that calculated from the sampling theorem. (author)

  12. AA magnet measurement team

    CERN Multimedia

    1978-01-01

    Quickly improvised measurement equipment for the AA (Antiproton Accumulator) was all the tight schedule permitted, but the high motivation of the team made up for the lack of convenience. From left to right: Roy Billinge (Joint AA Project Leader, the other one was Simon van der Meer); Bruno Autin, Brian Pincott, Colin Johnson.

  13. Counterstatement to Article Entitled "A Framework for Evaluation of Marine Spatial Data Geoportals Using Case Studies"

    Directory of Open Access Journals (Sweden)

    Seip Christian

    2015-12-01

    Full Text Available In December 2014 in volume 60 issue 4 a paper was published entitled “A Framework for Evaluation of Marine Spatial Data Geoportals Using Case Studies” by Marina Tavra, Vlado Cetl and Tea Duplancic Leder which is suspected to constitute academic misconduct. This comment reasons that the core of the paper was taken from another source and thus does not offer new and original scientific work and therefore does not add knowledge to the body of science. Furthermore it argues that apart from the plagiarism the paper shows major weaknesses and thus should have not been published even it was not plagiarized.

  14. A spatial point pattern analysis in Drosophila blastoderm embryos evaluating the potential inheritance of transcriptional states.

    Directory of Open Access Journals (Sweden)

    Feng He

    Full Text Available The Drosophila blastoderm embryo undergoes rapid cycles of nuclear division. This poses a challenge to genes that need to reliably sense the concentrations of morphogen molecules to form desired expression patterns. Here we investigate whether the transcriptional state of hunchback (hb, a target gene directly activated by the morphogenetic protein Bicoid (Bcd, exhibits properties indicative of inheritance between mitotic cycles. To achieve this, we build a dataset of hb transcriptional states at the resolution of individual nuclei in embryos at early cycle 14. We perform a spatial point pattern (SPP analysis to evaluate the spatial relationships among the nuclei that have distinct numbers of hb gene copies undergoing active transcription in snapshots of embryos. Our statistical tests and simulation studies reveal properties of dispersed clustering for nuclei with both or neither copies of hb undergoing active transcription. Modeling of nuclear lineages from cycle 11 to cycle 14 suggests that these two types of nuclei can achieve spatial clustering when, and only when, the transcriptional states are allowed to propagate between mitotic cycles. Our results are consistent with the possibility where the positional information encoded by the Bcd morphogen gradient may not need to be decoded de novo at all mitotic cycles in the Drosophila blastoderm embryo.

  15. Spatial Quality Evaluation of Resampled Unmanned Aerial Vehicle-Imagery for Weed Mapping

    Directory of Open Access Journals (Sweden)

    Irene Borra-Serrano

    2015-08-01

    Full Text Available Unmanned aerial vehicles (UAVs combined with different spectral range sensors are an emerging technology for providing early weed maps for optimizing herbicide applications. Considering that weeds, at very early phenological stages, are similar spectrally and in appearance, three major components are relevant: spatial resolution, type of sensor and classification algorithm. Resampling is a technique to create a new version of an image with a different width and/or height in pixels, and it has been used in satellite imagery with different spatial and temporal resolutions. In this paper, the efficiency of resampled-images (RS-images created from real UAV-images (UAV-images; the UAVs were equipped with two types of sensors, i.e., visible and visible plus near-infrared spectra captured at different altitudes is examined to test the quality of the RS-image output. The performance of the object-based-image-analysis (OBIA implemented for the early weed mapping using different weed thresholds was also evaluated. Our results showed that resampling accurately extracted the spectral values from high spatial resolution UAV-images at an altitude of 30 m and the RS-image data at altitudes of 60 and 100 m, was able to provide accurate weed cover and herbicide application maps compared with UAV-images from real flights.

  16. Spatial Quality Evaluation of Resampled Unmanned Aerial Vehicle-Imagery for Weed Mapping.

    Science.gov (United States)

    Borra-Serrano, Irene; Peña, José Manuel; Torres-Sánchez, Jorge; Mesas-Carrascosa, Francisco Javier; López-Granados, Francisca

    2015-01-01

    Unmanned aerial vehicles (UAVs) combined with different spectral range sensors are an emerging technology for providing early weed maps for optimizing herbicide applications. Considering that weeds, at very early phenological stages, are similar spectrally and in appearance, three major components are relevant: spatial resolution, type of sensor and classification algorithm. Resampling is a technique to create a new version of an image with a different width and/or height in pixels, and it has been used in satellite imagery with different spatial and temporal resolutions. In this paper, the efficiency of resampled-images (RS-images) created from real UAV-images (UAV-images; the UAVs were equipped with two types of sensors, i.e., visible and visible plus near-infrared spectra) captured at different altitudes is examined to test the quality of the RS-image output. The performance of the object-based-image-analysis (OBIA) implemented for the early weed mapping using different weed thresholds was also evaluated. Our results showed that resampling accurately extracted the spectral values from high spatial resolution UAV-images at an altitude of 30 m and the RS-image data at altitudes of 60 and 100 m, was able to provide accurate weed cover and herbicide application maps compared with UAV-images from real flights. PMID:26274960

  17. Spatially Varying Coefficient Inequalities: Evaluating How the Impact of Patient Characteristics on Breast Cancer Survival Varies by Location

    Science.gov (United States)

    Hsieh, Jeff Ching-Fu; Cramb, Susanna M.; McGree, James M.; Dunn, Nathan A. M.; Baade, Peter D.; Mengersen, Kerrie L.

    2016-01-01

    An increasing number of studies have identified spatial differences in breast cancer survival. However little is known about whether the structure and dynamics of this spatial inequality are consistent across a region. This study aims to evaluate the spatially varying nature of predictors of spatial inequality in relative survival for women diagnosed with breast cancer across Queensland, Australia. All Queensland women aged less than 90 years diagnosed with invasive breast cancer from 1997 to 2007 and followed up to the end of 2008 were extracted from linked Queensland Cancer Registry and BreastScreen Queensland data. Bayesian relative survival models were fitted using various model structures (a spatial regression model, a varying coefficient model and a finite mixture of regressions model) to evaluate the relative excess risk of breast cancer, with the use of Markov chain Monte Carlo computation. The spatially varying coefficient models revealed that some covariate effects may not be constant across the geographic regions of the study. The overall spatial patterns showed lower survival among women living in more remote areas, and higher survival among the urbanised south-east corner. Notwithstanding this, the spatial survival pattern for younger women contrasted with that for older women as well as single women. This complex spatial interplay may be indicative of different factors impacting on survival patterns for these women. PMID:27149274

  18. From site measurements to spatial modelling - multi-criteria model evaluation

    Science.gov (United States)

    Gottschalk, Pia; Roers, Michael; Wechsung, Frank

    2015-04-01

    Hydrological models are traditionally evaluated at gauge stations for river runoff which is assumed to be the valid and global test for model performance. One model output is assumed to reflect the performance of all implemented processes and parameters. It neglects the complex interactions of landscape processes which are actually simulated by the model but not tested. The application of a spatial hydrological model however offers a vast potential of evaluation aspects which shall be presented here with the example of the eco-hydrological model SWIM. We present current activities to evaluate SWIM at the lysimeter site Brandis, the eddy-co-variance site Gebesee and with spatial crop yields of Germany to constrain model performance additionally to river runoff. The lysimeter site is used to evaluate actuall evapotranspiration, total runoff below the soil profile and crop yields. The eddy-covariance site Gebesee offers data to study crop growth via net-ecosystem carbon exchange and actuall evapotranspiration. The performance of the vegetation module is tested via spatial crop yields at county level of Germany. Crop yields are an indirect measure of crop growth which is an important driver of the landscape water balance and therefore eventually determines river runoff as well. First results at the lysimeter site show that simulated soil water dynamics are less sensitive to soil type than measured soil water dynamics. First results from the simulation of actuall evapotranspiration and carbon exchange at Gebesee show a satisfactorily model performance with however difficulties to capture initial vegetation growth in spring. The latter is a hint at problems capturing winter growth conditions and subsequent impacts on crop growth. This is also reflected in the performance of simulated crop yields for Germany where the model reflects crop yields of silage maize much better than of winter wheat. With the given approach we would like to highlight the advantages and

  19. Spatial Data Envelopment Analysis Method for the Evaluation of Regional Infrastructure Disparities

    Directory of Open Access Journals (Sweden)

    Birutė Galinienė

    2012-12-01

    Full Text Available Purpose—to achieve a more detailed assessment of regional differences, exploring regional infrastructure and human capital usage efficiency and to display analysis capabilities of spatial data efficient frontier method.Design/methodology/approach—the data envelopment analysis (DEA is applied to find the efficient frontier, which extends the application of production function of the regions. This method of mathematical programming optimization allows assessing the effectiveness of the regional spatial aspects presented. In recent studies this method is applied for evaluating the European Union regional policy issues.Findings—the application of DEA reveals its feasibility for regional input and output studies to evaluate more detailed and more reasonable fund allocation between Lithuanian regions. This analysis shows that in the comparatively efficient Lithuanian regions, such as Vilnius and Klaipėda, “the bottleneck” of usage of transport infrastructure and regional specific human capital is reached. It is stated that decision-making units could enhance region attractiveness for private investors by improving indirect factors in these regions. For practical significance of the study the results are compared with German regional analysis, conducted by Schaffer and other researchers (2011.Practical implications—the practical value of this work is based on giving more accurate planning tools for fund allocation decisions in Lithuanian regions while planning infrastructure and human capital development. The regional indicators were analyzed for 2010.Research type—case study.

  20. Spatial Data Envelopment Analysis Method for the Evaluation of Regional Infrastructure Disparities

    Directory of Open Access Journals (Sweden)

    Birutė Galinienė

    2013-02-01

    Full Text Available Purpose—to achieve a more detailed assessment of regional differences, exploring regional infrastructure and human capital usage efficiency and to display analysis capabilities of spatial data efficient frontier method. Design/methodology/approach—the data envelopment analysis (DEA is applied to find the efficient frontier, which extends the application of production function of the regions. This method of mathematical programming optimization allows assessing the effectiveness of the regional spatial aspects presented. In recent studies this method is applied for evaluating the European Union regional policy issues. Findings—the application of DEA reveals its feasibility for regional input and output studies to evaluate more detailed and more reasonable fund allocation between Lithuanian regions. This analysis shows that in the comparatively efficient Lithuanian regions, such as Vilnius and Klaipėda, “the bottleneck” of usage of transport infrastructure and regional specific human capital is reached. It is stated that decision-making units could enhance region attractiveness for private investors by improving indirect factors in these regions. For practical significance of the study the results are compared with German regional analysis, conducted by Schaffer and other researchers (2011. Practical implications—the practical value of this work is based on giving more accurate planning tools for fund allocation decisions in Lithuanian regions while planning infrastructure and human capital development. The regional indicators were analyzed for 2010. Research type—case study.

  1. Evaluating the Value of High Spatial Resolution in National Capacity Expansion Models using ReEDS: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Krishnan, Venkat; Cole, Wesley

    2016-07-01

    Power sector capacity expansion models (CEMs) have a broad range of spatial resolutions. This paper uses the Regional Energy Deployment System (ReEDS) model, a long-term national scale electric sector CEM, to evaluate the value of high spatial resolution for CEMs. ReEDS models the United States with 134 load balancing areas (BAs) and captures the variability in existing generation parameters, future technology costs, performance, and resource availability using very high spatial resolution data, especially for wind and solar modeled at 356 resource regions. In this paper we perform planning studies at three different spatial resolutions--native resolution (134 BAs), state-level, and NERC region level--and evaluate how results change under different levels of spatial aggregation in terms of renewable capacity deployment and location, associated transmission builds, and system costs. The results are used to ascertain the value of high geographically resolved models in terms of their impact on relative competitiveness among renewable energy resources.

  2. AAS 227: Day 3

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 3 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Henry Norris Russell Lecture: Viewing the Universe with Infrared Eyes: The Spitzer Space Telescope (by Erika Nesvold)The Henry Norris Russell Award is the highest honor given by the AAS, for a lifetime of eminence in astronomy research. This years award went to Giovanni Fazio of the Harvard-Smithsonian Center for Astrophysics. Fazio became a leader in gamma ray astronomy before switching mid-career to the study of infrared astronomy, and he gave his award lecture on the latter subject, specifically on the Spitzer Space Telescope, one of the most successful infrared telescopes of all time.Artists rendering of the Spitzer space telescope. [NASA/JPL-Caltech]Spitzer has been operating for more than twelve years, and has resulted in over six thousand papers in refereed journals in that time. The telescope sits in an Earth-trailing orbit around the Sun, and is now farther from the Earth (1.4 AU) than the Earth is from the Sun. Fazio gave the audience a fascinating overview of the science done by Spitzer over more than a decade. One of the most productive areas of research for Spitzer is the study of exoplanets, which hadnt even been discovered when the Spitzer Telescope was first conceived. Spitzers high sensitivity and ability to observe exoplanets over

  3. EVALUATION OF SPATIAL AND TEMPORAL DISTRIBUTION CHANGES OF LST USING LANDSAT IMAGES (CASE STUDY:TEHRAN

    Directory of Open Access Journals (Sweden)

    H. Kachar

    2015-12-01

    Full Text Available In traditional approach, the land surface temperature (LST is estimated by the permanent or portable ground-based weather stations. Due to the lack of adequate distribution of weather stations, a uniform LST could not be achieved. Todays, With the development of remote sensing from space, satellite data offer the only possibility for measuring LST over the entire globe with sufficiently high temporal resolution and with complete spatially averaged rather than point values. the remote sensing imageries with relatively high spatial and temporal resolution are used as suitable tools to uniformly LST estimation. Time series, generated by remote sensed LST, provide a rich spatial-temporal infrastructure for heat island’s analysis. in this paper, a time series was generated by Landsat8 and Landsat7 satellite images to analysis the changes in the spatial and temporal distribution of the Tehran’s LST. In this process, The Normalized Difference Vegetation Index (NDVI threshold method was applied to extract the LST; then the changes in spatial and temporal distribution of LST over the period 1999 to 2014 were evaluated by the statistical analysis. Finally, the achieved results show the very low temperature regions and the middle temperature regions were reduced by the rate of 0.54% and 5.67% respectively. On the other hand, the high temperature and the very high temperature regions were increased by 3.68% and 0.38% respectively. These results indicate an incremental procedure on the distribution of the hot regions in Tehran in this period. To quantitatively compare urban heat islands (UHI, an index called Urban Heat Island Ratio Index(URI was calculated. It can reveal the intensity of the UHI within the urban area. The calculation of the index was based on the ratio of UHI area to urban area. The greater the index, the more intense the UHI was. Eventually, Considering URI between 1999 and 2014, an increasing about 0.03 was shown. The reasons

  4. AAS 228: Welcome!

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Greetings from the 228th American Astronomical Society meeting in San Diego, California! This week, along with a team of fellow authorsfrom astrobites, Iwill bewritingupdates on selectedevents at themeeting and posting twiceeach day. You can follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.If youre at the meeting, come stop by the AAS booth (Booth #211-213) to learn about the newly-announced partnership between AAS and astrobites and pick up some swag.And dont forget to visit the IOP booth in the Exhibit Hall (Booth #223) to learn more about the new corridors for AAS Journals and to pick up a badge pin to representyour corridor!

  5. AA Narrow Quadrupole

    CERN Multimedia

    1979-01-01

    The very particular lattice of the AA required 2 types of quadrupoles: narrow ones (QFN, QDN) and wide ones (QFW, QDW). This is the first one of the narrow quadrupoles, delivered by industry early in 1979.

  6. AAS 227: Welcome!

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Greetings from the 227th American Astronomical Society meeting in Kissimmee, Florida! This week, along with several fellow authors from astrobites, Iwill bewritingupdates on selectedevents at themeeting and posting at the end of each day. You can follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.If youre an author or referee (or plan to be!) and youre here at the meeting, consider joining us at our Author and Referee Workshop on Wednesday in the Tallahassee room, where well be sharingsome of the exciting new features of the AAS journals. You can drop intoeither of the two-hour sessions(10 AM 12 PM or 1 PM 3 PM), and there will be afree buffet lunch at noon.Heres the agenda:Morning SessionTopic Speaker10:00 am 10:05 amIntroductionsJulie Steffen10:05 am 10:35 amChanges at AAS Journals; How to Be a Successful AAS AuthorEthan Vishniac10:35 am 11:00 amThe Peer Review ProcessButler Burton11:00 am 11:15 amAAS Nova: Sharing AAS Authors Research with the Broader CommunitySusanna Kohler11:15 am 11:30 amFixing Software and Instrumentation Publishing: New Paper Styles in AAS JournalsChris Lintott11:30 am 11:45 amMaking Article Writing Easier with the New AASTeX v6.0Greg Schwarz11:45 am 12:00 pmBringing JavaScript and Interactivity to Your AAS Journal FiguresGus MuenchLunch SessionTopic Speaker12:00 pm 12:15 pmUnified Astronomy ThesaurusKatie Frey12:15 pm 12:30 pmAAS/ADS ORCID Integration ToolAlberto Accomazzi12:30 pm 12:45 pmWorldWide Telescope and Video AbstractsJosh Peek12:45 pm 01:00 pmArizona Astronomical Data Hub (AADH)Bryan HeidornAfternoon SessionTopic Speaker01:00 pm 01:05 pmIntroductionsJulie Steffen01:05 pm 01:35 pmChanges at AAS Journals; How to Be a Successful AAS AuthorEthan Vishniac01:35 pm 02:00 pmThe Peer Review ProcessButler Burton02:00 pm 02:15 pmAAS Nova: Sharing AAS Authors Research with the Broader CommunitySusanna Kohler02:15 pm 02:30 pm

  7. Geomagnetic aa Indices

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa indices are the continuation of the series beginning in the year 1868. A full description of these indices is given in the International...

  8. Mapping the spatial dimensions of participatory practice: A discussion of context in evaluation.

    Science.gov (United States)

    Chouinard, Jill Anne; Milley, Peter

    2016-02-01

    In participatory or collaborative evaluation practice, context is considered a complex, relational and social phenomenon that frames the parameters of the inquiry process in profound ways. To help us expand upon our understanding of context, we borrow the concept of "space" from the critical geographers, as it provides a bridge between the social and geographic complexities of context, enabling us to more fully capture the social and relational dynamic that fundamentally defines participatory evaluation. Our focus is on understanding context and relationships as two interconnected, dynamic and constituent parts of evaluation practices that feature participatory spaces. We then turn to a comparative analysis of participatory practice across two published reviews of distinct sets of empirical studies as a way to extend our understanding of participatory evaluation in relation to its practical, and frequently complex, contextual expressions in the field. This comparative analysis enables us to develop a set of five dimensions (epistemic, temporal/historical, cultural, economic/organizational, political) that we believe captures the spatial and contextual characteristics and contours of participatory practice. PMID:26476858

  9. Cloven-hoofed animals spatial activity evaluation methods in Doupov Mountains in the Czech Republic

    Directory of Open Access Journals (Sweden)

    J. Jarolímek, J. Masner, M. Ulman, S. Dvořák

    2012-09-01

    Full Text Available The focus of the project „Collection and interpretation of positional data“ is placed on the use of positional data (or the information about a moving object in the scientific research and educational activities in various fields such as environmental science, logistics, spatial data infrastructure, information management, and others. The objective of this effort is to create an universal model for collection and presentation of moving objects data retrieved through GPS (Global Positioning System, and to verify the model in practice.Several different approaches to process and visualize data about sika deer (Cervus nippon spatial movements in Doupov Mountains are described in the paper. The data base is represented with large data files created through the cooperation of the Faculty of Forestry and Wood Sciences at the Czech University of Life Sciences in Prague and the Military Forests and Estates of the Czech Republic, a state-owned enterprise.Pieces of knowledge introduced in this paper resulted from solution of an institutional research intention. Internal grant agency of the Faculty of Economics and Management, Czech University of Life Sciences in Prague, grant no. 20121043, „Sběr a interpretace pozičních dat“.The results of the cloven-hoofed animals spatial activity evaluation methods will be available for Research Program titled “Economy of the Czech Agriculture Resources and Their Efficient Use within the Framework of the Multifunctional Agri-food Systems” of the Czech Ministry of Education, Youth and Sports number VZ MSM 6046070906.

  10. Stochastic simulation for imaging spatial uncertainty: Comparison and evaluation of available algorithms

    Energy Technology Data Exchange (ETDEWEB)

    Gotway, C.A. [Nebraska Univ., Lincoln, NE (United States). Dept. of Biometry; Rutherford, B.M. [Sandia National Labs., Albuquerque, NM (United States)

    1993-09-01

    Stochastic simulation has been suggested as a viable method for characterizing the uncertainty associated with the prediction of a nonlinear function of a spatially-varying parameter. Geostatistical simulation algorithms generate realizations of a random field with specified statistical and geostatistical properties. A nonlinear function is evaluated over each realization to obtain an uncertainty distribution of a system response that reflects the spatial variability and uncertainty in the parameter. Crucial management decisions, such as potential regulatory compliance of proposed nuclear waste facilities and optimal allocation of resources in environmental remediation, are based on the resulting system response uncertainty distribution. Many geostatistical simulation algorithms have been developed to generate the random fields, and each algorithm will produce fields with different statistical properties. These different properties will result in different distributions for system response, and potentially, different managerial decisions. The statistical properties of the resulting system response distributions are not completely understood, nor is the ability of the various algorithms to generate response distributions that adequately reflect the associated uncertainty. This paper reviews several of the algorithms available for generating random fields. Algorithms are compared in a designed experiment using seven exhaustive data sets with different statistical and geostatistical properties. For each exhaustive data set, a number of realizations are generated using each simulation algorithm. The realizations are used with each of several deterministic transfer functions to produce a cumulative uncertainty distribution function of a system response. The uncertainty distributions are then compared to the single value obtained from the corresponding exhaustive data set.

  11. Application of Spatial and Network Analysis to Evaluate Shelter Plan for Tsunami Evacuation

    Directory of Open Access Journals (Sweden)

    Sutikno S.

    2015-09-01

    Full Text Available This study proposes a method for evaluating shelter plan for emergency evacuation prior to a tsunami based on service area analysis. The evacuation service areas are generated using both spatial and network analysis based on Geographic Information System (GIS. A case study in Pacitan city, East Java Province, Indonesia which is located in the South coastal area of Java Island, is picked as study area. The field has a possibility of suffering tsunami disaster because of the movement of Indo-Australian plate and Eurasian plate. The simulation result shows that the current evacuation shelters arranged by local government are not easy to access if tsunami occurs. About 50% of the residents do not have enough time to evacuate to the shelters because many shelters are located far from residential area. Utilizing public buildings around residential area for temporary shelters proposed in this study, about 96% residents in inundation area have sufficient time to evacuate to the shelters.

  12. Integrating neighborhoods in the evaluation of fitness promotes cooperation in the spatial prisoner's dilemma game

    CERN Document Server

    Wang, Zhen; Cao, Xian-Bin; Zhang, Lian-Zhong

    2010-01-01

    A fundamental question of human society is the evolution of cooperation. Many previous studies explored this question via setting spatial background, where players obtain their payoffs by playing game with their nearest neighbors. Another undoubted fact is that environment plays an important role in the individual development. Inspired by these phenomena, we reconsider the definition of individual fitness which integrates the environment, denoted by the average payoff of all individual neighbors, with the traditional individual payoffs by introducing a selection parameter $u$. Tuning $u$ equal to zero returns the traditional version, while increasing $u$ bears the influence of environment. We find that considering the environment, i.e. integrating neighborhoods in the evaluation of fitness, promotes cooperation. If we enhance the value of $u$, the invasion of defection could be resisted better. We also provide quantitative explanations and complete phase diagrams presenting the influence of environment on the...

  13. Evaluating spatial patterns of dioxins in sediments to aid determination of potential implications for marine reptiles

    Energy Technology Data Exchange (ETDEWEB)

    Hermanussen, S.; Gaus, C. [National Research Centre for Environmental Toxicology, Brisbane (Australia); Limpus, C.J. [Queensland Environmental Protection Agency, Brisbane (Australia); Paepke, O. [ERGO Forschungsgesellschaft mbH, Hamburg (Germany); Blanshard, W. [Sea World, Gold Coast (Australia); Connell, D. [School of Public Health, Griffith Univ., Brisbane (Australia)

    2004-09-15

    Recent investigations have identified elevated concentrations of polychlorinated dibenzo-p-dioxins (dioxins) in marine sediments and wildlife of Queensland, Australia. While it has been demonstrated that the contamination is widespread and predominantly land-based, limited information exists on the pathways and fate of these compounds within the near-shore marine system. This environment supports unique and threatened species including green sea turtles (Chelonia mydas). Adult green turtles are predominantly herbivorous, feeding on seagrass and algae. Apart from initial migration to feeding grounds (at {proportional_to}10 years of age) and intermittent migrations to breeding grounds (at {proportional_to}30-50 years and thereafter), green turtles remain and feed within relatively small home ranges. Long life-span (50 years or more), near-shore feeding grounds and highly specialized food requirements render green turtles potentially vulnerable to contaminant exposure. Recent studies have shown a relationship between PCDD/F concentrations found in herbivorous marine wildlife and concentrations in sediments of their habitats. Hence, the spatial evaluation of sediment PCDD/F distribution may assist the assessment of green turtle exposure and its potential implications. The present study provides baseline information on green turtle PCDD/F concentrations in Queensland, Australia and investigates exposure pathways. In addition, spatial distribution of PCDD/Fs in sediments from known green turtle feeding regions is assessed using geographic information systems. This represents the first stage of a large scale investigation into the exposure and sensitivity of marine reptiles to dioxins and dioxin-like compounds and to evaluate whether poor health status observed in some populations may be related to contaminant exposure.

  14. Evaluation of spatial resolution in image acquisition by optical flatbed scanners for radiochromic film dosimetry

    Science.gov (United States)

    Asero, G.; Greco, C.; Gueli, A. M.; Raffaele, L.; Spampinato, S.

    2016-03-01

    Introduction: Radiochromic films are two-dimensional dosimeters that do not require developing and give values of absorbed dose with accuracy and precision. Since this dosimeter colours directly after irradiation, it can be digitized with commercial optical flatbed scanners to obtain a calibration curve that links blackening of the film with dose. Although the film has an intrinsic high spatial resolution, the scanner determines the actual resolution of this dosimeter, in particular the "dot per inch" (dpi) parameter. The present study investigates the effective spatial resolution of a scanner used for Gafchromic® XR-QA2 film (designed for radiology Quality Assurance) analysis. Material and methods: The quantitative evaluation of the resolution was performed with the Modulation Transfer Function (MTF) method, comparing the nominal resolution with the experimental one. The analysis was performed with two procedures. First, the 1951 USAF resolution test chart, a tool that tests the performance of optical devices, was used. Secondly, a combined system of mammography X-ray tube, XR-QA2 film and a bar pattern object was used. In both cases the MTF method has been applied and the results were compared. Results: The USAF and the film images have been acquired with increasing dpi and a standard protocol for radiochromic analysis, to evaluate horizontal and vertical and resolution. The effective resolution corresponds to the value of the MTF at 50%. In both cases and for both procedures, it was verified that, starting from a dpi value, the effective resolution saturates. Conclusion: The study found that, for dosimetric applications, the dpi of the scanner have to be adjusted to a reasonable value because, if too high, it requires high scanning and computational time without providing additional information.

  15. A Rapid Monitoring and Evaluation Method of Schistosomiasis Based on Spatial Information Technology.

    Science.gov (United States)

    Wang, Yong; Zhuang, Dafang

    2015-12-12

    Thanks to Spatial Information Technologies (SITs) such as Remote Sensing (RS) and Geographical Information System (GIS) that are being quickly developed and updated, SITs are being used more widely in the public health field. The use of SITs to study the characteristics of the temporal and spatial distribution of Schistosoma japonicum and to assess the risk of infection provides methods for the control and prevention of schistosomiasis japonica has gradually become a hot topic in the field. The purpose of the present paper was to use RS and GIS technology to develop an efficient method of prediction and assessment of the risk of schistosomiasis japonica. We choose the Yueyang region, close to the east DongTing Lake (Hunan Province, China), as the study area, where a recent serious outbreak of schistosomiasis japonica took place. We monitored and evaluated the transmission risk of schistosomiasis japonica in the region using SITs. Water distribution data were extracted from RS images. The ground temperature, ground humidity and vegetation index were calculated based on RS images. Additionally, the density of oncomelania snails, which are the Schistosoma japonicum intermediate host, was calculated on the base of RS data and field measurements. The spatial distribution of oncomelania snails was explored using SITs in order to estimate the area surrounding the residents with transmission risk of schistosomiasis japonica. Our research result demonstrated: (1) the risk factors for the transmission of schistosomiasis japonica were closely related to the living environment of oncomelania snails. Key factors such as water distribution, ground temperature, ground humidity and vegetation index can be quickly obtained and calculated from RS images; (2) using GIS technology and a RS deduction technique along with statistical regression models, the density distribution model of oncomelania snails could be quickly built; (3) using SITs and analysis with overlaying population

  16. Corrosion evaluation of friction stir welded lap joints of AA6061-T6 aluminum alloy%AA6061-T6合金搅拌摩擦焊搭接接头的腐蚀性能评价

    Institute of Scientific and Technical Information of China (English)

    Farhad GHARAVI; Khamirul A. MATORI; Robiah YUNUS; Norinsan K. OTHMAN; Firouz FADAEIFARD

    2016-01-01

    采用氯化钠+过氧化氢溶液浸泡试验研究AA6061-T6铝合金搅拌摩擦焊搭接接头的腐蚀行为。采用循环动电位极化测试、扫描电子显微镜和能谱仪表征腐蚀形貌,揭示焊接区与基体合金的腐蚀机理。研究了焊接接头的显微组织和剪切强度。结果表明,与基体合金相比,焊接区在腐蚀溶液中会发生晶间腐蚀和点蚀。搭接剪切测试结果表明,所得焊接接头的拉伸剪切强度为128 MPa,超过基体合金强度的60%。电化学测试结果表明,焊核区和热影响区的保护电位比点蚀电位更负,说明焊核区与热影响区点蚀的趋势不强。基体合金抗腐蚀性比焊缝区的强,而热影响区的抗腐蚀性最差。点蚀主要源于金属间化合物边缘,因为与铝基体相比,金属间化合物的自腐蚀电位更高而成为阴极。由于焊缝区的金属间化合物增加,腐蚀电偶增加,焊缝的抗腐蚀性降低。%Corrosion behavior of friction stir lap welded AA6061-T6 aluminum alloy was investigated by immersion tests in sodium chloride + hydrogen peroxide solution. Electrochemical measurement by cyclic potentiodynamic polarization, scanning electron microscopy, and energy dispersive spectroscopy were employed to characterize corrosion morphology and to realize corrosion mechanism of weld regions as opposed to the parent alloy. The microstructure and shear strength of welded joint were fully investigated. The results indicate that, compared with the parent alloy, the weld regions are susceptible to intergranular and pitting attacks in the test solution during immersion time. The obtained results of lap shear testing disclose that tensile shear strength of the welds is 128 MPa which is more than 60% of the strength of parent alloy in lap shear testing. Electrochemical results show that the protection potentials of the WNZ and HAZ regions are more negative than the pitting potential. This means that the WNZ and

  17. A Framework for Evaluation of Marine Spatial Data Geoportals Using Case Studies

    OpenAIRE

    Tavra Marina; Cetl Vlado; Duplančić Leder Tea

    2014-01-01

    Need for a Marine Spatial Data Infrastructure (MSDI) as a component of a National Spatial Data Infrastructure (NSDI) is widely recognized. An MSDI is relevant not only for hydrographers and government planners, but also for many other sectors which takes interest in marine spatial data, whether they are data users, data providers, or data managers [9]. An MSDI encompasses marine and coastal geographic and business information. For efficient use of Marine Spatial Data, it is necessary to ensur...

  18. Spatial Analysis of Pollution-free Land for Tea Plantation and Comprehensive Evaluation of Soil Suitability

    Institute of Scientific and Technical Information of China (English)

    Ximei; WEN; Yang; LU; Anjun; LAN; Hong; TAN

    2013-01-01

    To survey the tea resource advantages in Guizhou’s mountainous areas and complete rational layout of pollution-free tea planting areas, we take the case of Guiding County in Guizhou Province to establish the comprehensive evaluation indicator system of pollution-free land for tea plantation and comprehensive evaluation model of soil suitability of land for tea plantation according to the Environmental Conditions Standard for Pollution-free Food-Tea Producing Areas by the Ministry of Agriculture (NY 5020-2001), using land use data, remote sensing data, soil data, temperature, precipitation, light, DEM and other critical basic data, combined with the spatial analysis statistical method. The results show that the area of land suitable for planting tea is 1265 km2, accounting for 77.57% of the entire study area; the area of land with soil quality, climatic conditions and terrain conditions to meet the planting standard of pollution-free tea is 1232.51 km2, accounting for 75.57% of the total land area; the area of land most suitable for the planting of pollution-free tea is 128.71 km2, accounting for 7.89% of the total land area. The above studies can provide scientific basis and decision support for the implementation of tea planting industry standards in the specific areas, and provide reference for the comprehensive assessment of tea planting in other areas.

  19. Evaluation of a semi-distributed model through an assessment of the spatial coherence of Intercatchment Groundwater Flows

    Science.gov (United States)

    de Lavenne, Alban; Thirel, Guillaume; Andréassian, Vazken; Perrin, Charles; Ramos, Maria-Helena

    2016-04-01

    Semi-distributed hydrological models aim to provide useful information to understand and manage the spatial distribution of water resources. However, their evaluation is often limited to independent and single evaluations at each sub-catchment within larger catchments. This enables to qualify model performance at different points, but does not provide a coherent assessment of the overall spatial consistency of the model. To cope with these methodological deficiencies, we propose a two-step strategy. First, we apply a sequential spatial calibration procedure to define spatially consistent model parameters. Secondly, we evaluate the hydrological simulations using variables that involve some dependency between sub-catchments to evaluate the overall coherence of model outputs. In this study, we particularly choose to look at the simulated Intercatchment Groundwater Flows (IGF). The idea is that the water that is lost in one place should be recovered somewhere else within the catchment to guarantee a spatially coherent water balance in time. The model used is a recently developed daily semi-distributed model, which is based on a spatial distribution of the lumped GR5J model. The model has five parameters for each sub-catchments and a streamflow velocity parameter for flow routing between them. It implements two reservoirs, one for production and one for routing, and estimates IGF according to the level of the second in a way that catchment can release water to IGF during high flows and receive water through IGF during low flows. The calibration of the model is performed from upstream to downstream, making an efficient use of spatially distributed streamflow measurements. To take model uncertainty into account, we implemented three variants of the original model structure, each one computing in a different way the IGF in each sub-catchment. The study is applied on over 1000 catchments in France. By exploring a wide area and a variability of hydrometeorological conditions

  20. AAS Career Services

    Science.gov (United States)

    Marvel, Kevin B.

    2012-08-01

    The American Astronomical Society provides substantial programs in the area of Career Services.Motivated by the Society's mission to enhance and share humanity's understanding of the Universe, the AAS provides a central resource for advertising positions, interviewing opportunities at its annual winter meeting and information, workshops and networks to enable astronomers to find employment.The programs of the Society in this area are overseen by an active committee on employment and the AAS Council itself.Additional resources that help characterize the field, its growth and facts about employment such as salaries and type of jobs available are regularly summarized and reported on by the American Institute of Physics.

  1. Development of a high spatial resolution neutron imaging system and performance evaluation

    Science.gov (United States)

    Cao, Lei

    The combination of a scintillation screen and a charged coupled device (CCD) camera is a digitized neutron imaging technology that has been widely employed for research and industry application. The maximum of spatial resolution of scintillation screens is in the range of 100 mum and creates a bottleneck for the further improvement of the overall system resolution. In this investigation, a neutron sensitive micro-channel plate (MCP) detector with pore pitch of 11.4 mum is combined with a cooled CCD camera with a pixel size of 6.8 mum to provide a high spatial resolution neutron imaging system. The optical path includes a high reflection front surface mirror for keeping the camera out of neutron beam and a macro lens for achieving the maximum magnification that could be achieved. All components are assembled into an aluminum light tight box with heavy radiation shielding to protect the camera as well as to provide a dark working condition. Particularly, a remote controlled stepper motor is also integrated into the system to provide on-line focusing ability. The best focus is guaranteed through use of an algorithm instead of perceptual observation. An evaluation routine not previously utilized in the field of neutron radiography is developed in this study. Routines like this were never previously required due to the lower resolution of other systems. Use of the augulation technique to obtain presampled MTF addresses the problem of aliasing associated with digital sampling. The determined MTF agrees well with the visual inspection of imaging a testing target. Other detector/camera combinations may be integrated into the system and their performances are also compared. The best resolution achieved by the system at the TRIGA Mark II reactor at the University of Texas at Austin is 16.2 lp/mm, which is equivalent to a minimum resolvable spacing of 30 mum. The noise performance of the device is evaluated in terms of the noise power spectrum (NPS) and the detective quantum

  2. Influence of 4,4’-azobis (4-cyanopentanoic acid in Transmission and Reflection Gratings Stored in a PVA/AA Photopolymer

    Directory of Open Access Journals (Sweden)

    Elena Fernandez

    2016-03-01

    Full Text Available Holographic transmission gratings with a spatial frequency of 2658 lines/mm and reflection gratings with a spatial frequency of 4553 lines/mm were stored in a polyvinyl alcohol (PVA/acrylamide (AA based photopolymer. This material can reach diffraction efficiencies close to 100% for spatial frequencies about 1000 lines/mm. However, for higher spatial frequencies, the diffraction efficiency decreases considerably as the spatial frequency increases. To enhance the material response at high spatial frequencies, a chain transfer agent, the 4,4’-azobis (4-cyanopentanoic acid, ACPA, is added to the composition of the material. Different concentrations of ACPA are incorporated into the main composition of the photopolymer to find the concentration value that provides the highest diffraction efficiency. Moreover, the refractive index modulation and the optical thickness of the transmission and reflection gratings were obtained, evaluated and compared to procure more information about the influence of the ACPA on them.

  3. GIS-based evaluation and spatial distribution characteristics of land degradation in Bijiang watershed.

    Science.gov (United States)

    Zhao, Xiaoqing; Dai, Jinhua; Wang, Jianping

    2013-01-01

    Land degradation is one of the significant issues the human beings are confronted with, which has become a bottleneck of restricting the sustainable development of the regional society and economy. In order to ascertain the root causes contributed to the land degradation and characteristics of land degradation, Bijiang watershed, the most important Lead-Zinc mine area of Lanping county of Yunnan Province, was selected as the study area. One evaluation index system for land degradation that consists of 5 single factors(water-soil erosion intensity, geological disaster risk, cultivation intensity of arable land, pollution of heavy metals in soil and biodiversity deterioration) was established and 13 indicators were chosen, and the entropy method was adopted to assign weights to each single factor. By using the tools of Geographic Information System (GIS), the land degradation degree was evaluated and one spatial distribution map for land degradation was accomplished. In this study, the land of the whole watershed was divided into 4 types, including extremely-severe degradation area, severely-degraded area, moderately-degraded area and slightly-degraded area, and some solutions for ecological restoration and rehabilitation were also put forward in this study. The study results indicated that: (1) Water-soil erosion intension and pollution of heavy metals in soil have made greater contribution to the comprehensive land degradation in Bijiang watershed; (2) There is an apparent difference regarding land degradation degree in Bijiang watershed. The moderately-degraded area accounts for the most part in the region, which covers 79.66% of the whole watershed. The severely-degraded area accounts for 15.98% and the slightly-degraded regions and extremely severe degradation area accounts for 1.08% and 3.28% respectively; (3) There is an evident regularity of spatial distribution in land degradation in Bijiang watershed. The moderately-degraded areas mainly distribute in the

  4. An Improved Fitness Evaluation Mechanism with Memory in Spatial Prisoner's Dilemma Game on Regular Lattices

    Institute of Scientific and Technical Information of China (English)

    WANG Juan; LIU Li-Na; DONG En-Zeng; WANG Li

    2013-01-01

    To deeply understand the emergence of cooperation in natural,social and economical systems,we present an improved fitness evaluation mechanism with memory in spatial prisoner's dilemma game on regular lattices.In our model,the individual fitness is not only determined by the payoff in the current game round,but also by the payoffs in previous round bins.A tunable parameter,termed as the memory strength (μ),which lies between 0 and 1,is introduced into the model to regulate the ratio of payoffs of current and previous game rounds in the individual fitness calculation.When μ =0,our model is reduced to the standard prisoner's dilemma game; while μ =1 represents the case in which the payoff is totally determined by the initial strategies and thus it is far from the realistic ones.Extensive numerical simulations indicate that the memory effect can substantially promote the evolution of cooperation.For μ < 1,the stronger the memory effect,the higher the cooperation level,but μ = 1 leads to a pathological state of cooperation,but can partially enhance the cooperation in the very large temptation parameter.The current results are of great significance for us to account for the role of memory effect during the evolution of cooperation among selfish players.

  5. Using geographical information system for spatial evaluation of canine extruded disc herniation.

    Science.gov (United States)

    Daraban, Constantin; Murino, Carla; Marzatico, Giuseppe; Mennonna, Giuseppina; Fatone, Gerardo; Auletta, Luigi; Miceli, Fabiana; Vulpe, Vasile; Meomartino, Leonardo

    2014-11-01

    Disc herniation is one of the most common pathologies of the vertebral column in dogs. The aim of this study was to develop a geographical information system (GIS)-based vertebral canal (VC) map useful for spatial evaluation of extruded disc herniation (EDH) in dogs. ArcGIS® was used to create two-dimensional and three-dimensional maps, in which the VC surface is divided into polygons by lines representing latitude and longitude. Actual locations and directions of the herniated disc material were assessed by a series of 142 computer tomographies of dogs collected between 2005 and 2013. Most EDHs were located on the cervical and transitional regions (thoraco-lumbar and lumbo-sacral) and shown at the level of the ventro- cranial and ventro-central polygons created. Choropleth maps, highlighting the distribution and the location/direction patterns of the EDHs throughout the VC, were produced based on the frequency of the ailment. GIS proved to be a valuable tool in analysing EDH in dogs. Further studies are required for biomechanical analysis of EDH patterns.

  6. Using geographical information system for spatial evaluation of canine extruded disc herniation

    Directory of Open Access Journals (Sweden)

    Constantin Daraban

    2014-11-01

    Full Text Available Disc herniation is one of the most common pathologies of the vertebral column in dogs. The aim of this study was to develop a geographical information system (GIS-based vertebral canal (VC map useful for spatial evaluation of extruded disc herniation (EDH in dogs. ArcGIS® was used to create two-dimensional and three-dimensional maps, in which the VC surface is divided into polygons by lines representing latitude and longitude. Actual locations and directions of the herniated disc material were assessed by a series of 142 computer tomographies of dogs collected between 2005 and 2013. Most EDHs were located on the cervical and transitional regions (thoraco-lumbar and lumbo-sacral and shown at the level of the ven- tro-cranial and ventro-central polygons created. Choropleth maps, highlighting the distribution and the location/direction patterns of the EDHs throughout the VC, were produced based on the frequency of the ailment. GIS proved to be a valuable tool in analysing EDH in dogs. Further studies are required for biomechanical analysis of EDH patterns.

  7. Evaluation des politiques de transports et équité spatiale

    OpenAIRE

    Bonnafous, Alain; Masson, Sophie

    2003-01-01

    JEL classification: D61, D63, R40, R53 International audience Assessment of transport policy and spatial equity. - The set up of a transport system in a place generates inequalities in accessibility at the local, national or international level. This raises the problem of the unequal access to transport and local public goods, hereafter designated as the spatial inequity. In the assessment of transport policies, dealing with spatial equity leads to several problems mainly because of the...

  8. AAS Oral History Project

    Science.gov (United States)

    Buxner, Sanlyn; Holbrook, Jarita; AAS Oral History Team

    2016-06-01

    Now in its fourth year, the AAS Oral History Project has interviewed over 80 astronomers from all over the world. Led by the AAS Historical Astronomy Division (HAD) and partially funded by the American Institute of Physics Niels Bohr Library and ongoing support from the AAS, volunteers have collected oral histories from astronomers at professional meetings starting in 2015, including AAS, DPS, and the IAU general assembly. Each interview lasts one and a half to two hours and focuses on interviewees’ personal and professional lives. Questions include those about one’s family, childhood, strong influences on one’s scientific career, career path, successes and challenges, perspectives on how astronomy is changing as a field, and advice to the next generation. Each interview is audio recorded and transcribed, the content of which is checked with each interviewee. Once complete, interview transcripts are posted online as part of a larger oral history library at https://www.aip.org/history-programs/niels-bohr-library/oral-histories. Future analysis will reveal a rich story of astronomers and will help the community address issues of diversity, controversies, and the changing landscape of science. We are still recruiting individuals to be interviewed from all stages of career from undergraduate students to retired and emeritus astronomers. Contact Jarita Holbrook to schedule an interview or to find out more information about the project (astroholbrook@gmail.com). Also, contact Jarita Holbrook if you would like to become an interviewer for the project.

  9. Spatial Evaluation of Heavy Metals Concentrations in the Surface Sediment of Taihu Lake.

    Science.gov (United States)

    Niu, Yong; Jiao, Wei; Yu, Hui; Niu, Yuan; Pang, Yong; Xu, Xiangyang; Guo, Xiaochun

    2015-11-27

    With regard to the size of China's freshwater lakes, Taihu Lake ranks third and it plays an important role in the supply of drinking water, flood prevention, farming and navigation, as well as in the travelling industry. The problem of environmental pollution has attracted widespread attention in recent years. In order to understand the levels, distribution and sources of heavy metals in sediments of Taihu Lake, random selection was carried out to obtain 59 samples of surface sediment from the entire lake and study the concentrations of Pb, Cd, Cu, Zn, Cr and Ni. Toxic units were also calculated to normalize the toxicities caused by various heavy metals. As a result, Cd and Cu in sediment were considered lower than the effect range low (ERL) at all regions where samples were gathered, while Pb and Ni were categorized into ERL-effect range median (ERM) at over 22% of the regions where samples were obtained. Nevertheless, all average concentrations of the samples were below the level of potential effect. According to the findings of this research, significant spatial heterogeneity existed in the above heavy metals. In conclusion, the distribution areas of heavy metals with higher concentrations were mainly the north bays, namely Zhushan Bay, Meiliang Bay as well as Gonghu Bay. The distribution areas of Cu, Zn, Cr and Ni with higher concentration also included the lake's central region, whereas the uniform distribution areas of those with lower concentrations were the lake's southeast region. In addition, it was most probable that the spatial distribution of heavy metals was determined by river inputs, whereas atmospheric precipitation caused by urban and traffic contamination also exerted considerable effects on the higher concentrations of Pb and Cd. Through evaluating the total amount of toxic units (ΣTU), it was found that higher toxicity existed primarily in the north bays and central region of the lake. If the heavy metals were sorted by the reduction of mean

  10. Evaluation of Cytotoxicity, Genotoxicity and Hematotoxicity of the Recombinant Spore-Crystal Complexes Cry1Ia, Cry10Aa and Cry1Ba6 from Bacillus thuringiensis in Swiss Mice

    Science.gov (United States)

    de Souza Freire, Ingrid; Miranda-Vilela, Ana Luisa; Barbosa, Lilian Carla Pereira; Martins, Erica Soares; Monnerat, Rose Gomes; Grisolia, Cesar Koppe

    2014-01-01

    The insecticidal properties of Cry-endotoxins from Bacillus thuringiensis (Bt) have long been used as spore-crystals in commercial spray formulations for insect control. Recently, some Bt-endotoxin genes have been cloned in many different plants. Toxicological evaluations of three spore-crystal endotoxins, BtCry1Ia, BtCry10Aa and BtCry1Ba6 from B. thuringiensis, were carried out on mice to understand their adverse effects on hematological systems and on genetic material. These three spore-crystals have shown toxic activity to the boll weevil, which is one of the most aggressive pests of the cotton crop. Cry1Ia, Cry10Aa and Cry1Ba6 did not increase the micronucleus frequency in the peripheral erythrocytes of mice and did not cause changes in the frequency of polychromatic erythrocytes. However, some hematologic disburbances were observed, specifically related to Cry1Ia and Cry1Ba6, respectively, for the erythroid and lymphoid lineage. Thus, although the profile of such adverse side effects can be related to their high level of exposure, which is not commonly found in the environment, results showed that these Bt spore-crystals were not harmless to mice, indicating that each spore-crystal endotoxin presents a characteristic profile of toxicity and might be investigated individually. PMID:25268978

  11. Evaluation of spatial variability of metal bioavailability in soils using geostatistics

    DEFF Research Database (Denmark)

    Owsianiak, Mikolaj; Hauschild, Michael Zwicky; Rosenbaum, Ralph K.

    2012-01-01

    is performed using ArcGIS Geostatistical Analyst. Results show that BFs of copper span a range of 6 orders of magnitude, and have signifficant spatial variability at local and continental scales. The model nugget variance is signifficantly higher than zero, suggesting the presence of spatial variability...

  12. Evaluating the spatial and temporal solar energy potential in South Korea

    Science.gov (United States)

    Oh, Si-Young; Park, Jin-Ki; Park, Jong-Hwa

    2012-11-01

    Recent issues of climate changes and natural disasters have brought many changes in world energy utilization. Especially due to the Japan's earthquake and tsunami, potential of nuclear power have made negative. And thus many countries are looking for a new renewable energy that can replace. Of which solar energy has emerged as a useful alternative. Under these circumstances, it is highly desirable that detailed information about the availability of solar radiation on the surface is essential for the optimum design and study of solar energy systems. And its components at a given location are very essential. Hence the solar radiation data is one of the key parameters required to be monitored at any meteorological station. But solar radiation measurements are not easily available due to the cost and maintenance requirements of the measuring equipment. Therefore, solar resource modeling or mapping is one of the essential tools for proper design, planning, maintenance and pricing of solar energy system. In this study, the feasibility of a regression model using image fusion for the prediction of solar energy potential in Republic of Korea was investigated. Meteorological and geographical data of 22 cities in South Korea for period of 10 years (2001-2011) were used. Meteorological and geographical data (latitude, longitude, altitude, month, sunshine duration, temperature, and relative humidity) were used as inputs to the model, while the regional solar radiation was used as the output of the model. The model for evaluating the spatial and temporal solar radiation was executed for South Korea. The annual mean solar radiation estimates in South Korea vary from a minimum of 5.48 MJ/m2/day to a maximum of 19.51 MJ/m2/day. Our proposed annual mean solar radiation is 13.5 MJ/m2/day. These compare favorably with the observed data as expected. This study has shown that a simple method can accurately predict solar radiation potential in South Korea.

  13. The Antiproton Accumulator (AA)

    CERN Multimedia

    1980-01-01

    Section 06 - 08*) of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A vacuum-tank, two bending magnets (BST06 and BST07 in blue) with a quadrupole (QDN07, in red) in between, another vacuum-tank, a wide quadrupole (QFW08) and a further tank . The tanks are covered with heating tape for bake-out. The tank left of BST06 contained the stack core pickup for stochastic cooling (see 7906193, 7906190, 8005051), the two other tanks served mainly as vacuum chambers in the region where the beam was large. Peter Zettwoch works on BST06. *) see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984)

  14. Evaluating agri-environmental schemes using a spatially explicit agent-based modelling approach

    OpenAIRE

    Schouten, M.A.H.; Polman, N.B.P.; Westerhof, E.J.G.M.; Opdam, P.F.M.

    2012-01-01

    Networks of nature reserves are being proposed as a solution when the degree of fragmentation is considered to endanger the long-term persistence of species diversity. Agri-environmental schemes are supposed to make a positive contribution to these networks. The spatially explicit agent-based model presented in this chapter combines spatial dynamics in land ownership, land use and the importance of agri-environmental schemes in conserving biodiversity by capturing the heterogeneity of individ...

  15. Methodology of AA CRASH: a prospective observational study evaluating the incidence and pathogenesis of adverse post-traumatic sequelae in African-Americans experiencing motor vehicle collision

    Science.gov (United States)

    Linnstaedt, Sarah D; Hu, JunMei; Liu, Andrea Y; Soward, April C; Bollen, Kenneth A; Wang, Henry E; Hendry, Phyllis L; Zimny, Erin; Lewandowski, Christopher; Velilla, Marc-Anthony; Damiron, Kathia; Pearson, Claire; Domeier, Robert; Kaushik, Sangeeta; Feldman, James; Rosenberg, Mark; Jones, Jeffrey; Swor, Robert; Rathlev, Niels; McLean, Samuel A

    2016-01-01

    Introduction A motor vehicle collision (MVC) is one of the most common life-threatening events experienced by individuals living in the USA. While most individuals recover following MVC, a significant proportion of individuals develop adverse post-traumatic sequelae such as post-traumatic stress disorder or persistent musculoskeletal pain. Adverse post-traumatic sequelae are common, morbid and costly public health problems in the USA and other industrialised countries. The pathogenesis of these disorders following MVC remains poorly understood. In the USA, available data suggest that African-Americans experience an increased burden of adverse post-traumatic sequelae after MVC compared to European Americans, but to date no studies examining the pathogenesis of these disorders among African-Americans experiencing MVC have been performed. Methods and analysis The African-American CRASH (AA CRASH) study is an NIH-funded, multicentre, prospective study that enrols African-Americans (n=900) who present to the emergency department (ED) within 24 hours of MVC. Participants are enrolled at 13 ED sites in the USA. Individuals who are admitted to the hospital or who report a fracture or tissue injury are excluded. Participants complete a detailed ED interview that includes an assessment of crash history, current post-traumatic symptoms and health status prior to the MVC. Blood samples are also collected in the ED using PAXgene DNA and PAXgene RNA tubes. Serial mixed-mode assessments 6 weeks, 6 months and 1 year after MVC include an assessment of adverse sequelae, general health status and health service utilisation. The results from this study will provide insights into the incidence and pathogenesis of persistent pain and other post-traumatic sequelae in African-Americans experiencing MVC. Ethics and dissemination AA CRASH has ethics approval in the USA, and the results will be published in a peer-reviewed journal. PMID:27601501

  16. The Antiproton Accumulator (AA)

    CERN Multimedia

    1980-01-01

    A section of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A large vacuum-tank, a quadrupole (QDN09*), a bending magnet (BST08), another vacuum-tank, a wide quadrupole (QFW08) and (in the background) a further bending magnet (BST08). The tanks are covered with heating tape for bake-out. The tank left of QDN09 contained the kickers for stochastic pre-cooling (see 790621, 8002234, 8002637X), the other one served mainly as vacuum chamber in the region where the beam was large. Peter Zettwoch works on QFW08. * see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984) See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  17. Evaluation of Spatial Pattern of Altered Flow Regimes on a River Network Using a Distributed Hydrological Model.

    Science.gov (United States)

    Ryo, Masahiro; Iwasaki, Yuichi; Yoshimura, Chihiro; Saavedra V, Oliver C

    2015-01-01

    Alteration of the spatial variability of natural flow regimes has been less studied than that of the temporal variability, despite its ecological importance for river ecosystems. Here, we aimed to quantify the spatial patterns of flow regime alterations along a river network in the Sagami River, Japan, by estimating river discharge under natural and altered flow conditions. We used a distributed hydrological model, which simulates hydrological processes spatiotemporally, to estimate 20-year daily river discharge along the river network. Then, 33 hydrologic indices (i.e., Indicators of Hydrologic Alteration) were calculated from the simulated discharge to estimate the spatial patterns of their alterations. Some hydrologic indices were relatively well estimated such as the magnitude and timing of maximum flows, monthly median flows, and the frequency of low and high flow pulses. The accuracy was evaluated with correlation analysis (r > 0.4) and the Kolmogorov-Smirnov test (α = 0.05) by comparing these indices calculated from both observed and simulated discharge. The spatial patterns of the flow regime alterations varied depending on the hydrologic indices. For example, both the median flow in August and the frequency of high flow pulses were reduced by the maximum of approximately 70%, but these strongest alterations were detected at different locations (i.e., on the mainstream and the tributary, respectively). These results are likely caused by different operational purposes of multiple water control facilities. The results imply that the evaluation only at discharge gauges is insufficient to capture the alteration of the flow regime. Our findings clearly emphasize the importance of evaluating the spatial pattern of flow regime alteration on a river network where its discharge is affected by multiple water control facilities.

  18. Ensembles of adaptive spatial filters increase BCI performance: an online evaluation

    Science.gov (United States)

    Sannelli, Claudia; Vidaurre, Carmen; Müller, Klaus-Robert; Blankertz, Benjamin

    2016-08-01

    Objective: In electroencephalographic (EEG) data, signals from distinct sources within the brain are widely spread by volume conduction and superimposed such that sensors receive mixtures of a multitude of signals. This reduction of spatial information strongly hampers single-trial analysis of EEG data as, for example, required for brain–computer interfacing (BCI) when using features from spontaneous brain rhythms. Spatial filtering techniques are therefore greatly needed to extract meaningful information from EEG. Our goal is to show, in online operation, that common spatial pattern patches (CSPP) are valuable to counteract this problem. Approach: Even though the effect of spatial mixing can be encountered by spatial filters, there is a trade-off between performance and the requirement of calibration data. Laplacian derivations do not require calibration data at all, but their performance for single-trial classification is limited. Conversely, data-driven spatial filters, such as common spatial patterns (CSP), can lead to highly distinctive features; however they require a considerable amount of training data. Recently, we showed in an offline analysis that CSPP can establish a valuable compromise. In this paper, we confirm these results in an online BCI study. In order to demonstrate the paramount feature that CSPP requires little training data, we used them in an adaptive setting with 20 participants and focused on users who did not have success with previous BCI approaches. Main results: The results of the study show that CSPP adapts faster and thereby allows users to achieve better feedback within a shorter time than previous approaches performed with Laplacian derivations and CSP filters. The success of the experiment highlights that CSPP has the potential to further reduce BCI inefficiency. Significance: CSPP are a valuable compromise between CSP and Laplacian filters. They allow users to attain better feedback within a shorter time and thus reduce BCI

  19. Empirical evaluation of confidence and prediction intervals for spatial models of forest structure in Jalisco, Mexico

    Institute of Scientific and Technical Information of China (English)

    Robin M. Reich; C. Aguirre-Bravo; Vanessa A. Bravo; Martin Mendoza Brise(n)o

    2011-01-01

    In recent years there has been an increasing interest in developing spatial statistical models for data sets that are seemingly spatially independent.This lack of spatial structure makes it difficult, if not impossible to use optimal predictors such as ordinary kriging for modeling the spatial variability in the data.In many instances, the data still contain a wealth of information that could be used to gain flexibility and precision in estimation.In this paper we propose using a combination of regression analysis to describe the large-scale spatial variability in a set of survey data and a tree-based stratification design to enhance the estimation process of the small-scale spatial variability.With this approach,sample units (i.e., pixel of a satellite image) are classified with respect to predictions of error attributes into homogeneous classes, and the classes are then used as strata in the stratified analysis.Independent variables used as a basis of stratification included terrain data and satellite imagery.A decision rule was used to identify a tree size that minimized the error in estimating the variance of the mean response and prediction uncertainties at new spatial locations.This approach was applied to a set of n=937 forested plots from a state-wide inventory conducted in 2006 in the Mexican State of Jalisco.The final models accounted for 62% to 82% of the variability observed in canopy closure (%), basal area (m2·ha-l), cubic volumes (m3·ha-1) and biomass (t·ha-1) on the sample plots.The spatial models provided unbiased estimates and when averaged over all sample units in the population, estimates of forest structure were very close to those obtained using classical estimates based on the sampling strategy used in the state-wide inventory.The spatial models also provided unbiased estimates of model variances leading to confidence and prediction coverage rates close to the 0.95 nominal rate.

  20. Evaluating the effect of corridors and landscape heterogeneity on dispersal probability: a comparison of three spatially explicit modelling approaches

    DEFF Research Database (Denmark)

    Jepsen, J. U.; Baveco, J. M.; Topping, C. J.;

    2004-01-01

    Spatially explicit simulation models of varying degree of complexity are increasingly used in landscape and species management and conservation. The choice as to which type of model to employ in a particular situation, is however, far too often governed by logistic constraints and the personal...... preferences of the modeller, rather than by a critical evaluation of model performance. We present a comparison of three common spatial simulation approaches (patch-based incidence-function model (IFM), individual-based movement model (IBMM), individual-based population model including detailed behaviour...... or populations in space given a specific configuration of habitat patches. We evaluated how the choice of model influenced predictions regarding the effect of patch- and corridor configuration on dispersal probabilities and the number of successful immigrants of a simulated small mammal. Model results were...

  1. Monitoring and evaluation of spatially managed areas: A generic framework for implementation of ecosystem based marine management and its application

    DEFF Research Database (Denmark)

    Stelzenmüller, Vanessa; Breen, Patricia; Stamford, Tammy;

    2013-01-01

    This study introduces a framework for the monitoring and evaluation of spatially managed areas (SMAs), which is currently being tested by nine European case studies. The framework provides guidance on the selection, mapping, and assessment of ecosystem components and human pressures, the evaluation...... of management effectiveness and potential adaptations to management. Moreover, it provides a structured approach with advice on spatially explicit tools for practical tasks like the assessment of cumulative impacts of human pressures or pressure-state relationships. The case studies revealed emerging challenges......, such as the lack of operational objectives within SMAs, particularly for transnational cases, data access, and stakeholder involvement. Furthermore, the emerging challenges of integrating the framework assessment using scientific information with a structured governance research analysis based mainly...

  2. Geographical information system (GIS) as a new tool to evaluate epidemiology based on spatial analysis and clinical outcomes in acromegaly

    OpenAIRE

    Naves, Luciana Ansaneli; Porto, Lara Benigno; Rosa, João Willy Corrêa; Casulari, Luiz Augusto; Rosa, José Wilson Corrêa

    2013-01-01

    Geographical information systems (GIS) have emerged as a group of innovative software components useful for projects in epidemiology and planning in Health Care System. This is an original study to investigate environmental and geographical influences on epidemiology of acromegaly in Brazil. We aimed to validate a method to link an acromegaly registry with a GIS mapping program, to describe the spatial distribution of patients, to identify disease clusters and to evaluate if the access to Hea...

  3. [Application of spatial relative risk estimation in communicable disease risk evaluation].

    Science.gov (United States)

    Zhang, Yewu; Guo, Qing; Wang, Xiaofeng; Yu, Meng; Su, Xuemei; Dong, Yan; Zhang, Chunxi

    2015-05-01

    This paper summaries the application of adaptive kernel density algorithm in the spatial relative risk estimation of communicable diseases by using the reported data of infectious diarrhea (other than cholera, dysentery, typhoid and paratyphoid) in Ludian county and surrounding area in Yunnan province in 2013. Statistically significant fluctuations in an estimated risk function were identified through the use of asymptotic tolerance contours, and finally these data were visualized though disease mapping. The results of spatial relative risk estimation and disease mapping showed that high risk areas were in southeastern Shaoyang next to Ludian. Therefore, the spatial relative risk estimation of disease by using adaptive kernel density algorithm and disease mapping technique is a powerful method in identifying high risk population and areas. PMID:26080648

  4. Impact of spatially constrained sampling of temporal contact networks on the evaluation of the epidemic risk

    CERN Document Server

    Vestergaard, Christian L; Génois, Mathieu; Poletto, Chiara; Colizza, Vittoria; Barrat, Alain

    2016-01-01

    The ability to directly record human face-to-face interactions increasingly enables the development of detailed data-driven models for the spread of directly transmitted infectious diseases at the scale of individuals. Complete coverage of the contacts occurring in a population is however generally unattainable, due for instance to limited participation rates or experimental constraints in spatial coverage. Here, we study the impact of spatially constrained sampling on our ability to estimate the epidemic risk in a population using such detailed data-driven models. The epidemic risk is quantified by the epidemic threshold of the susceptible-infectious-recovered-susceptible model for the propagation of communicable diseases, i.e. the critical value of disease transmissibility above which the disease turns endemic. We verify for both synthetic and empirical data of human interactions that the use of incomplete data sets due to spatial sampling leads to the underestimation of the epidemic risk. The bias is howev...

  5. Evaluation of spatial models to predict vulnerability of forest birds to brood parasitism by cowbirds

    Science.gov (United States)

    Gustafson, E.J.; Knutson, M.G.; Niemi, G.J.; Friberg, M.

    2002-01-01

    We constructed alternative spatial models at two scales to predict Brown-headed Cowbird (Molothrus ater) parasitism rates from land cover maps. The local-scale models tested competing hypotheses about the relationship between cowbird parasitism and distance of host nests from a forest edge (forest-nonforest boundary). The landscape models tested competing hypotheses about how landscape features (e.g., forests, agricultural fields) interact to determine rates of cowbird parasitism. The models incorporate spatial neighborhoods with a radius of 2.5 km in their formulation, reflecting the scale of the majority of cowbird commuting activity. Field data on parasitism by cowbirds (parasitism rate and number of cowbird eggs per nest) were collected at 28 sites in the Driftless Area Ecoregion of Wisconsin, Minnesota, and Iowa and were compared to the predictions of the alternative models. At the local scale, there was a significant positive relationship between cowbird parasitism and mean distance of nest sites from the forest edge. At the landscape scale, the best fitting models were the forest-dependent and forest-fragmentation-dependent models, in which more heavily forested and less fragmented landscapes had higher parasitism rates. However, much of the explanatory power of these models results from the inclusion of the local-scale relationship in these models. We found lower rates of cowbird parasitism than did most Midwestern studies, and we identified landscape patterns of cowbird parasitism that are opposite to those reported in several other studies of Midwestern songbirds. We caution that cowbird parasitism patterns can be unpredictable, depending upon ecoregional location and the spatial extent, and that our models should be tested in other ecoregions before they are applied there. Our study confirms that cowbird biology has a strong spatial component, and that improved spatial models applied at multiple spatial scales will be required to predict the effects of

  6. Comparison of recrystallization and recrystallization textures in cold-rolled DC and CC AA 5182 aluminum alloys

    International Nuclear Information System (INIS)

    The recrystallization and recrystallization textures in cold-rolled direct chill cast (DC) and continuous cast (CC) AA 5182 aluminum alloys were investigated. The recrystallization behavior of cold-rolled DC and CC AA 5182 aluminum alloys was evaluated by tensile properties. The evolution of recrystallization textures in cold-rolled DC and CC AA 5182 aluminum alloys was determined by X-ray diffraction. The results showed that the recrystallization temperature of cold-rolled DC AA 5182 aluminum alloy was somewhat lower than that of cold-rolled CC AA 5182 aluminum alloy. The resulting recrystallization textures of cold-rolled AA 5182 aluminum alloy were characterized by the strong R orientation and the cube orientation with strong scattering about the rolling direction towards the Goss orientation. CC AA 5182 aluminum alloy showed slightly weaker recrystallization textures than DC AA 5182 aluminum alloy

  7. Field evaluation of four spatial repellent devices against Arkansas rice-land mosquitoes

    Science.gov (United States)

    Four commercially available spatial repellent devices were tested in a rice land habitat near Stuttgart, Arkansas after semi-field level assessments had been made at the Center for Medical, Agricultural, and Veterinary Entomology, ARS, USDA in Gainesville, FL. OFF! Clip-On® (a.i. metofluthrin, S.C....

  8. Spatial Visualization Ability and Laparoscopic Skills in Novice Learners: Evaluating Stereoscopic versus Monoscopic Visualizations

    Science.gov (United States)

    Roach, Victoria A.; Mistry, Manisha R.; Wilson, Timothy D.

    2014-01-01

    Elevated spatial visualization ability (Vz) is thought to influence surgical skill acquisition and performance. Current research suggests that stereo visualization technology and its association with skill performance may confer perceptual advantages. This is of particular interest in laparoscopic skill training, where stereo visualization may…

  9. Evaluation of spatial correlations of dynamically downscaled rainfall data for eastern Australia

    Science.gov (United States)

    Parana Manage, Nadeeka; Lockart, Natalie; Willgoose, Garry; Kuczera, George; Kiem, Anthony; Kamal Chowdhury, A. F. M.

    2016-04-01

    As part of the Eastern Seaboard Climate Change Initiative (ESCCI) - East Coast Low project, we assess three high resolution dynamically downscaled regional climate model datasets simulated by the Weather Research Forecasting (WRF) model over the east coast of Australia. The datasets have been produced by the NARCliM (NSW/ACT Regional Climate Modelling) project at 10km resolution spanning a 60-year period (1950-2010) and driven by the NCEP/NCAR reanalysis. In the analysis, the RCM simulated data was first examined considering the possible spatial reduction of the point rainfall intensity occurs when transforming point rainfall to areal average rainfall at the pixel level. The ability of RCM simulated data to reproduce the observed spatial correlations was assessed using two data sets: 1) point rainfall data for selected Bureau of Meteorology daily rainfall stations within the study area and 2) the Australian Water Availability Project (AWAP) gridded (0.05° ×0.05°, 5km x 5km) daily rainfall dataset. The standard deviation of the RCM time series is less than the standard deviation of the observed rainfall even when allowing for the differences between point scale observed data and pixel averaged RCM data. The spatial pattern of the RCM correlations was qualitatively similar to that of the observed data. A topographic influence in the spatial correlations was also found. We studied the spatial correlation structure of both the RCM data and the observed raingauge data. The RCM correlation function was about 15-20% higher than the observed data for all separations from 10km to 200km.

  10. Evaluation of sliding baseline methods for spatial estimation for cluster detection in the biosurveillance system

    Directory of Open Access Journals (Sweden)

    Leuze Michael

    2009-07-01

    Full Text Available Abstract Background The Centers for Disease Control and Prevention's (CDC's BioSense system provides near-real time situational awareness for public health monitoring through analysis of electronic health data. Determination of anomalous spatial and temporal disease clusters is a crucial part of the daily disease monitoring task. Our study focused on finding useful anomalies at manageable alert rates according to available BioSense data history. Methods The study dataset included more than 3 years of daily counts of military outpatient clinic visits for respiratory and rash syndrome groupings. We applied four spatial estimation methods in implementations of space-time scan statistics cross-checked in Matlab and C. We compared the utility of these methods according to the resultant background cluster rate (a false alarm surrogate and sensitivity to injected cluster signals. The comparison runs used a spatial resolution based on the facility zip code in the patient record and a finer resolution based on the residence zip code. Results Simple estimation methods that account for day-of-week (DOW data patterns yielded a clear advantage both in background cluster rate and in signal sensitivity. A 28-day baseline gave the most robust results for this estimation; the preferred baseline is long enough to remove daily fluctuations but short enough to reflect recent disease trends and data representation. Background cluster rates were lower for the rash syndrome counts than for the respiratory counts, likely because of seasonality and the large scale of the respiratory counts. Conclusion The spatial estimation method should be chosen according to characteristics of the selected data streams. In this dataset with strong day-of-week effects, the overall best detection performance was achieved using subregion averages over a 28-day baseline stratified by weekday or weekend/holiday behavior. Changing the estimation method for particular scenarios involving

  11. Spatial shrinkage/expansion patterns between breast density measured in two MRI scans evaluated by non-rigid registration

    Energy Technology Data Exchange (ETDEWEB)

    Lin Muqing; Chen, Jeon-Hor; Bahri, Shadfar; Nalcioglu, Orhan; Su Minying [Tu and Yuen Center for Functional Onco-Imaging, Department of Radiological Sciences, University of California, Irvine, CA (United States); Mehta, Rita S [Department of Medicine, University of California, Irvine, CA (United States); Chan Siwa, E-mail: msu@uci.edu [Department of Radiology, Taichung Veterans General Hospital, Taichung, Taiwan (China)

    2011-09-21

    Breast MRI acquires many images from the breast, and computer-aided algorithms and display tools are often used to assist the radiologist's interpretation. Women with lifetime risk greater than 20% of developing breast cancer are recommended to receive annual screening MRI, but the current breast MRI computer-aided-diagnosis systems do not provide the necessary function for comparison of images acquired at different times. The purpose of this work was to develop registration methods for evaluating the spatial change pattern of fibroglandular tissue between two breast MRI scans of the same woman taken at different times. The registration method is based on rigid alignment followed by a non-rigid Demons algorithm. The method was tested on three different subjects who had different degrees of changes in the fibroglandular tissue, including two patients who showed different spatial shrinkage patterns after receiving neoadjuvant chemotherapy before surgery, and one control case from a normal volunteer. Based on the transformation matrix, the collapse of multiple voxels on the baseline images to one voxel on the follow-up images is used to calculate the shrinkage factor. Conversely, based on the reverse transformation matrix the expansion factor can be calculated. The shrinkage/expansion factor, the deformation magnitude and direction, as well as the Jacobian determinate at each location can be displayed in a 3D rendering view to show the spatial changes between two MRI scans. These different parameters show consistent results and can be used for quantitative evaluation of the spatial change patterns. The presented registration method can be further developed into a clinical tool for evaluating therapy-induced changes and for early diagnosis of breast cancer in screening MRI.

  12. AAS 228: Day 1 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Come visit astrobites at the AAS booth we have swag!Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto hear from undergrads who already know and love the site, educators who want to use it in their classrooms, and students who had not yet been introduced to astrobites and were excited about a new resource!For the rest of the meeting we will be stationed at theAAS booth in the exhibit hall (booth #211-213), so drop by if you want to learn more (or pick up swag: weve got lots of stickers and sunglasses)!Mondaymorning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended this morning.Opening Address(by Susanna Kohler)AAS President Meg Urry kicked off the meeting this morning at 8am with an overview of some of the great endeavors AAS is supporting. We astrobiters had personal motivation to drag ourselves out of bed that early: during this session, Urryannounced the new partnership between AAS and astrobites!Urry touched on some difficult topics in her welcome, including yesterdays tragedy in Orlando. Shereiteratedthe AASs support fortheCommittee for Sexual-Orientation and Gender Minorities in Astronomy (SGMA). She also reminded meeting attendees about the importance ofkeeping conference interactions professional, and pointed to the meetings anti-harassment policy.Partnership Announcement (by Michael Zevin)This morning, the American Astronomical Society announced the new partnership that it will have with Astrobites! We are beyond excited to embark on this new partnership with the

  13. Spatial evaluation and modeling of Dengue seroprevalence and vector density in Rio de Janeiro, Brazil.

    Directory of Open Access Journals (Sweden)

    Nildimar Alves Honório

    Full Text Available BACKGROUND: Rio de Janeiro, Brazil, experienced a severe dengue fever epidemic in 2008. This was the worst epidemic ever, characterized by a sharp increase in case-fatality rate, mainly among younger individuals. A combination of factors, such as climate, mosquito abundance, buildup of the susceptible population, or viral evolution, could explain the severity of this epidemic. The main objective of this study is to model the spatial patterns of dengue seroprevalence in three neighborhoods with different socioeconomic profiles in Rio de Janeiro. As blood sampling coincided with the peak of dengue transmission, we were also able to identify recent dengue infections and visually relate them to Aedes aegypti spatial distribution abundance. We analyzed individual and spatial factors associated with seroprevalence using Generalized Additive Model (GAM. METHODOLOGY/PRINCIPAL FINDINGS: Three neighborhoods were investigated: a central urban neighborhood, and two isolated areas characterized as a slum and a suburban area. Weekly mosquito collections started in September 2006 and continued until March 2008. In each study area, 40 adult traps and 40 egg traps were installed in a random sample of premises, and two infestation indexes calculated: mean adult density and mean egg density. Sera from individuals living in the three neighborhoods were collected before the 2008 epidemic (July through November 2007 and during the epidemic (February through April 2008. Sera were tested for DENV-reactive IgM, IgG, Nested RT-PCR, and Real Time RT-PCR. From the before-after epidemics paired data, we described seroprevalence, recent dengue infections (asymptomatic or not, and seroconversion. Recent dengue infection varied from 1.3% to 14.1% among study areas. The highest IgM seropositivity occurred in the slum, where mosquito abundance was the lowest, but household conditions were the best for promoting contact between hosts and vectors. By fitting spatial GAM we found

  14. Evaluation of spatially targeted strategies to control non-domiciliated Triatoma dimidiata vector of Chagas disease.

    Directory of Open Access Journals (Sweden)

    Corentin Barbu

    2011-05-01

    Full Text Available BACKGROUND: Chagas disease is a major neglected tropical disease with deep socio-economical effects throughout Central and South America. Vector control programs have consistently reduced domestic populations of triatomine vectors, but non-domiciliated vectors still have to be controlled efficiently. Designing control strategies targeting these vectors is challenging, as it requires a quantitative description of the spatio-temporal dynamics of village infestation, which can only be gained from combinations of extensive field studies and spatial population dynamic modelling. METHODOLOGY/PRINCIPAL FINDINGS: A spatially explicit population dynamic model was combined with a two-year field study of T. dimidiata infestation dynamics in the village of Teya, Mexico. The parameterized model fitted and predicted accurately both intra-annual variation and the spatial gradient in vector abundance. Five different control strategies were then applied in concentric rings to mimic spatial design targeting the periphery of the village, where vectors were most abundant. Indoor insecticide spraying and insect screens reduced vector abundance by up to 80% (when applied to the whole village, and half of this effect was obtained when control was applied only to the 33% of households closest to the village periphery. Peri-domicile cleaning was able to eliminate up to 60% of the vectors, but at the periphery of the village it has a low effect, as it is ineffective against sylvatic insects. The use of lethal traps and the management of house attractiveness provided similar levels of control. However this required either house attractiveness to be null, or ≥ 5 lethal traps, at least as attractive as houses, to be installed in each household. CONCLUSION/SIGNIFICANCE: Insecticide and insect screens used in houses at the periphery of the village can contribute to reduce house infestation in more central untreated zones. However, this beneficial effect remains insufficient

  15. Evaluation of {sup 7}Be fallout spatial variability; Avaliacao da variabilidade espacial do fallout do {sup 7}Be

    Energy Technology Data Exchange (ETDEWEB)

    Pinto, Victor Meriguetti

    2011-07-01

    The cosmogenic radionuclide beryllium-7 (Be) is produced in the atmosphere by cosmic particle reactions and is being used as a tracer for soil erosion and climatic processes research. After the production, {sup 7}Be bonds to aerosol particles in the atmosphere and is deposited on the soil surface with other radionuclide species by rainfall. Because of the high adsorption on soil particles and its short half-life of 53.2 days, this radionuclide follows of the erosion process and can be used as a tracer to evaluate the sediment transport that occurs during a single rain event or short period of rain events. A key assumption for the erosion evaluation through this radiotracer is the uniformity of the spatial distribution of the {sup 7}Be fallout. The {sup 7}Be method was elaborated recently and due to its few applications, some assumptions related to the method were not yet properly investigated yet, and the hypothesis of {sup 7}Be fallout uniformity needs to be evaluated. The aim of this study was to evaluate the {sup 7}Be fallout spatial distribution through the rain water {sup 7}Be activity analysis of the first five millimeters of single rain events. The rain water was sampled using twelve collectors distributed on an experimental area of about 300 m2 , located in the campus of Sao Paulo University, Piracicaba. The {sup 7}Be activities were measured using a 53% efficiency gamma-ray spectrometer from the Radioisotope laboratory of CENA. The {sup 7}Be activities in rain water varied from 0.26 to 1.81 Sq.L{sup -}1, with the highest values in summer and lowest in spring. In each one of the 5 single events, the spatial variability of {sup 7}Se activity in rain water was high, showing the high randomness of the fallout spatial distribution. A simulation using the {sup 7}Be spatial variability values obtained here and {sup 7}Se average reference inventories taken from the literature was performed determining the lowest detectable erosion rate estimated by {sup 7}Be model

  16. Keeping one's distance: the influence of spatial distance cues on affect and evaluation.

    Science.gov (United States)

    Williams, Lawrence E; Bargh, John A

    2008-03-01

    Current conceptualizations of psychological distance (e.g., construal-level theory) refer to the degree of overlap between the self and some other person, place, or point in time. We propose a complementary view in which perceptual and motor representations of physical distance influence people's thoughts and feelings without reference to the self, extending research and theory on the effects of distance into domains where construal-level theory is silent. Across four experiments, participants were primed with either spatial closeness or spatial distance by plotting an assigned set of points on a Cartesian coordinate plane. Compared with the closeness prime, the distance prime produced greater enjoyment of media depicting embarrassment (Study 1), less emotional distress from violent media (Study 2), lower estimates of the number of calories in unhealthy food (Study 3), and weaker reports of emotional attachments to family members and hometowns (Study 4). These results support a broader conceptualization of distance-mediated effects on judgment and affect.

  17. A spatially-evaluated methodology for assessing risk to a population from contaminated land

    Energy Technology Data Exchange (ETDEWEB)

    Gay, J. Rebecca [Environmental Processes and Systems Research Group, Department of Earth Science and Engineering, Imperial College London, Royal School of Mines Building, Prince Consort Road, London SW7 2AZ (United Kingdom)]. E-mail: jrebeccagay@yahoo.co.uk; Korre, Anna [Environmental Processes and Systems Research Group, Department of Earth Science and Engineering, Imperial College London, Royal School of Mines Building, Prince Consort Road, London SW7 2AZ (United Kingdom)]. E-mail: a.korre@imperial.ac.uk

    2006-07-15

    A methodology is proposed which combines quantitative probabilistic human health risk assessment and spatial statistical methods (geostatistics) to produce an assessment of risks to human health from exposure to contaminated land, in a manner which preserves the spatial distribution of risks and provides a measure of uncertainty in the assessment. Maps of soil contaminant levels, which incorporate uncertainty, are produced from sparse sample data using sequential indicator simulation. A real, age-stratified population is mapped across the contaminated area, and intake of soil contaminants by individuals is calculated probabilistically using an adaptation of the Contaminated Land Exposure Assessment (CLEA) model. An abundance of information is contained in results which can be interrogated at the population and individual level, and mapped to provide a powerful visual tool for risk managers, enabling efficient targeting of risk reduction measures to different locations. - A methodology for calculating and mapping risks to a population from intake of soil contaminants.

  18. A spatially-evaluated methodology for assessing risk to a population from contaminated land.

    Science.gov (United States)

    Gay, J Rebecca; Korre, Anna

    2006-07-01

    A methodology is proposed which combines quantitative probabilistic human health risk assessment and spatial statistical methods (geostatistics) to produce an assessment of risks to human health from exposure to contaminated land, in a manner which preserves the spatial distribution of risks and provides a measure of uncertainty in the assessment. Maps of soil contaminant levels, which incorporate uncertainty, are produced from sparse sample data using sequential indicator simulation. A real, age-stratified population is mapped across the contaminated area, and intake of soil contaminants by individuals is calculated probabilistically using an adaptation of the Contaminated Land Exposure Assessment (CLEA) model. An abundance of information is contained in results which can be interrogated at the population and individual level, and mapped to provide a powerful visual tool for risk managers, enabling efficient targeting of risk reduction measures to different locations.

  19. Spatial Differentiation and Evaluation of Tourism Performance of Slovakia and Its Specificities

    Directory of Open Access Journals (Sweden)

    Kasagranda Anton

    2015-12-01

    Full Text Available The aim of this paper is to quantify tourists (both domestic and international of Slovakia and their chronology throughout the years. Firstly, a brief development of them is introduced (absolute number and proportion of the total traffic from 1985 to 2013. Subsequently, the structure of their nationality, spatial differentiation (at municipal level and seasonality is discussed (respective distribution during the year. The aim of this study is to discover a spatial context in space and time. To quantify the number of tourists, the data from the Statistical Office of the Slovak Republic and also from the Ministry of Transport, Construction and Regional Development, are used. These data are interpreted in analyses and confirmed by tables, graphs and pictures.

  20. Evaluation of charge-sharing effects on the spatial resolution of the PICASSO detector

    Energy Technology Data Exchange (ETDEWEB)

    Rigon, L., E-mail: luigi.rigon@ts.infn.i [Istituto Nazionale di Fisica Nucleare (INFN), Sezione di Trieste, Via Valerio 2, 34127 Trieste (Italy); Arfelli, F. [Istituto Nazionale di Fisica Nucleare (INFN), Sezione di Trieste, Via Valerio 2, 34127 Trieste (Italy); Dipartimento di Fisica, Universita di Trieste, Via Valerio 2, 34127 Trieste (Italy); Bergamaschi, A. [Paul Scherrer Institut (PSI), CH-5232 Villigen (Switzerland); Chen, R.C. [Istituto Nazionale di Fisica Nucleare (INFN), Sezione di Trieste, Via Valerio 2, 34127 Trieste (Italy); Shanghai Institute of Applied Physics, CAS, Shanghai 201800 (China); Dreossi, D. [Istituto Nazionale di Fisica Nucleare (INFN), Sezione di Trieste, Via Valerio 2, 34127 Trieste (Italy); Sincrotrone Trieste SCpA, S.S. 14 km 163.5, 34012 Basovizza (Italy); Longo, R. [Istituto Nazionale di Fisica Nucleare (INFN), Sezione di Trieste, Via Valerio 2, 34127 Trieste (Italy); Dipartimento di Fisica, Universita di Trieste, Via Valerio 2, 34127 Trieste (Italy); Menk, R.-H. [Sincrotrone Trieste SCpA, S.S. 14 km 163.5, 34012 Basovizza (TS) (Italy); Schmitt, B. [Paul Scherrer Institut (PSI), CH-5232 Villigen (Switzerland); Vallazza, E. [Istituto Nazionale di Fisica Nucleare (INFN), Sezione di Trieste, Via Valerio 2, 34127 Trieste (Italy); Castelli, E. [Istituto Nazionale di Fisica Nucleare (INFN), Sezione di Trieste, Via Valerio 2, 34127 Trieste (Italy); Dipartimento di Fisica, Universita di Trieste, Via Valerio 2, 34127 Trieste (Italy)

    2010-05-21

    A double -layer 'edge-on' silicon microstrip detector has been designed and realized in the frame of the PICASSO (Phase Imaging for Clinical Application with Silicon detector and Synchrotron radiatiOn) project at the SYRMEP (SYnchrotron Radiation for MEdical Physics) beamline of Elettra (Trieste, Italy). The detector meets the requirements for synchrotron radiation mammography with patients inregarding: (a) size, since it covers the full beam width (210 mm); (b) spatial resolution, determined by the 0.05 mm strip pitch; (c) single-photon counting capabilities, because it is able to handle more than 10{sup 6} photons/(pixelxs); (d) contrast resolution, thanks to a threshold trim DAC that equalizes the channel sensitivity; (e) efficiency, due to the high absorption in the 15-20 mm sensor depth. Experimental measurements evidence charge sharing, though not compromising the spatial resolution.

  1. Silicon microstrip detectors for digital mammography - evaluation and spatial resolution study

    CERN Document Server

    Mali, T; Mikuz, M

    2001-01-01

    Silicon microstrip detectors were used to build an experimental X-ray imaging setup. The detectors were used in an 'edge-on' geometry, with the photons hitting the detector from the side. Efficiencies up to 90% at 20 keV photon energy could be achieved. The system was tested using a standard mammographic phantom. Images of modeled microcalcifications with various diameters down to 200 mu m and images of modeled tumors were made. Spatial resolution of the system was studied on an X-ray test pattern with frequency of line-pairs between 1 and 10l p/mm. An appropriate scanning step combined with knowledge of the system's line spread function was used to deconvolve the measured image and increase the spatial resolution. In this way the effective pixel size was reduced as much as for a factor of approx 3.

  2. Evaluating the use of local ecological knowledge to monitor hunted tropicalforest wildlife over large spatial scales

    OpenAIRE

    Luke Parry; Peres, Carlos A.

    2015-01-01

    Monitoring the distribution and abundance of hunted wildlife is critical to achieving sustainable resource use, yet adequate data are sparse for most tropical regions. Conventional methods for monitoring hunted forest-vertebrate species require intensive in situ survey effort, which severely constrains spatial and temporal replication. Integrating local ecological knowledge (LEK) into monitoring and management is appealing because it can be cost-effective, enhance community participation, and...

  3. Nondestructive quality evaluation and monitoring of Braeburn apples by Spatially Resolved Spectroscopy.

    OpenAIRE

    Do Trong, Nghia Nguyen; Tsuta, Mizuki; Erkinbaev, Chyngyz; Mathijs, Frank; Moreda Cantero, Guillermo P.; Barreiro Elorza, Pilar; Verboven, Pieter; Nicolai, Bart; Saeys, Wouter

    2013-01-01

    Contact Spatially Resolved Spectroscopy (SRS) measurements by means of a fiber-optics probe were employed for nondestructive assessment and monitoring of Braeburn apples during shelflife storage. SRS measurements and estimation of optical properties were calibrated and validated by means of liquid optical phantoms with known optical properties and a metamodeling method. The acquired optical properties (absorption and reduced scattering coefficients) for the apples during shelf-life storage we...

  4. Spatial distribution and pollution evaluation of heavy metals in Yangtze estuary sediment.

    Science.gov (United States)

    Liu, Ruimin; Men, Cong; Liu, Yongyan; Yu, Wenwen; Xu, Fei; Shen, Zhenyao

    2016-09-15

    To analyze the spatial distribution patterns and ecological risks of heavy metals, 30 sediment samples were taken in the Yangtze River Estuary (YRE) in May 2011. The content of Al, As, Cr, Cu, Fe, Mn, Ni and Pb increased as follows: inner-regionCARB) and As was related to organic-associated (OM) which is more stable than CARB. The fractions played an important role in the contamination assessment of heavy metals. PMID:27267116

  5. A human spatial-chromatic vision model for evaluating electronic displays

    OpenAIRE

    Lloyd, Charles J. C.

    1990-01-01

    This dissertation examines those attributes of full-color display systems (particularly color matrix displays) which degrade image quality. Based on this analysis, it is suggested that a comprehensive metric should measure image quality in terms of transmitted signal and noise modulation, both achromatic and chromatic. Moreover, it is suggested that these signal and noise measurements be weighted in terms of human spatial-chromatic visual characteristics. A review of extant...

  6. Evaluating Spatial Interaction Models for Regional Mobility in Sub-Saharan Africa.

    Science.gov (United States)

    Wesolowski, Amy; O'Meara, Wendy Prudhomme; Eagle, Nathan; Tatem, Andrew J; Buckee, Caroline O

    2015-07-01

    Simple spatial interaction models of human mobility based on physical laws have been used extensively in the social, biological, and physical sciences, and in the study of the human dynamics underlying the spread of disease. Recent analyses of commuting patterns and travel behavior in high-income countries have led to the suggestion that these models are highly generalizable, and as a result, gravity and radiation models have become standard tools for describing population mobility dynamics for infectious disease epidemiology. Communities in Sub-Saharan Africa may not conform to these models, however; physical accessibility, availability of transport, and cost of travel between locations may be variable and severely constrained compared to high-income settings, informal labor movements rather than regular commuting patterns are often the norm, and the rise of mega-cities across the continent has important implications for travel between rural and urban areas. Here, we first review how infectious disease frameworks incorporate human mobility on different spatial scales and use anonymous mobile phone data from nearly 15 million individuals to analyze the spatiotemporal dynamics of the Kenyan population. We find that gravity and radiation models fail in systematic ways to capture human mobility measured by mobile phones; both severely overestimate the spatial spread of travel and perform poorly in rural areas, but each exhibits different characteristic patterns of failure with respect to routes and volumes of travel. Thus, infectious disease frameworks that rely on spatial interaction models are likely to misrepresent population dynamics important for the spread of disease in many African populations. PMID:26158274

  7. Evaluating Spatial Interaction Models for Regional Mobility in Sub-Saharan Africa.

    Directory of Open Access Journals (Sweden)

    Amy Wesolowski

    2015-07-01

    Full Text Available Simple spatial interaction models of human mobility based on physical laws have been used extensively in the social, biological, and physical sciences, and in the study of the human dynamics underlying the spread of disease. Recent analyses of commuting patterns and travel behavior in high-income countries have led to the suggestion that these models are highly generalizable, and as a result, gravity and radiation models have become standard tools for describing population mobility dynamics for infectious disease epidemiology. Communities in Sub-Saharan Africa may not conform to these models, however; physical accessibility, availability of transport, and cost of travel between locations may be variable and severely constrained compared to high-income settings, informal labor movements rather than regular commuting patterns are often the norm, and the rise of mega-cities across the continent has important implications for travel between rural and urban areas. Here, we first review how infectious disease frameworks incorporate human mobility on different spatial scales and use anonymous mobile phone data from nearly 15 million individuals to analyze the spatiotemporal dynamics of the Kenyan population. We find that gravity and radiation models fail in systematic ways to capture human mobility measured by mobile phones; both severely overestimate the spatial spread of travel and perform poorly in rural areas, but each exhibits different characteristic patterns of failure with respect to routes and volumes of travel. Thus, infectious disease frameworks that rely on spatial interaction models are likely to misrepresent population dynamics important for the spread of disease in many African populations.

  8. Evaluation of a Computer-Based Training Program for Enhancing Arithmetic Skills and Spatial Number Representation in Primary School Children

    Science.gov (United States)

    Rauscher, Larissa; Kohn, Juliane; Käser, Tanja; Mayer, Verena; Kucian, Karin; McCaskey, Ursina; Esser, Günter; von Aster, Michael

    2016-01-01

    Calcularis is a computer-based training program which focuses on basic numerical skills, spatial representation of numbers and arithmetic operations. The program includes a user model allowing flexible adaptation to the child's individual knowledge and learning profile. The study design to evaluate the training comprises three conditions (Calcularis group, waiting control group, spelling training group). One hundred and thirty-eight children from second to fifth grade participated in the study. Training duration comprised a minimum of 24 training sessions of 20 min within a time period of 6–8 weeks. Compared to the group without training (waiting control group) and the group with an alternative training (spelling training group), the children of the Calcularis group demonstrated a higher benefit in subtraction and number line estimation with medium to large effect sizes. Therefore, Calcularis can be used effectively to support children in arithmetic performance and spatial number representation. PMID:27445889

  9. Evaluation of a Computer-Based Training Program for Enhancing Arithmetic Skills and Spatial Number Representation in Primary School Children.

    Science.gov (United States)

    Rauscher, Larissa; Kohn, Juliane; Käser, Tanja; Mayer, Verena; Kucian, Karin; McCaskey, Ursina; Esser, Günter; von Aster, Michael

    2016-01-01

    Calcularis is a computer-based training program which focuses on basic numerical skills, spatial representation of numbers and arithmetic operations. The program includes a user model allowing flexible adaptation to the child's individual knowledge and learning profile. The study design to evaluate the training comprises three conditions (Calcularis group, waiting control group, spelling training group). One hundred and thirty-eight children from second to fifth grade participated in the study. Training duration comprised a minimum of 24 training sessions of 20 min within a time period of 6-8 weeks. Compared to the group without training (waiting control group) and the group with an alternative training (spelling training group), the children of the Calcularis group demonstrated a higher benefit in subtraction and number line estimation with medium to large effect sizes. Therefore, Calcularis can be used effectively to support children in arithmetic performance and spatial number representation. PMID:27445889

  10. Evaluating the Spatial Distribution of Toxic Air Contaminants in Multiple Ecosystem Indicators in the Sierra Nevada-Southern Cascades

    Science.gov (United States)

    Nanus, L.; Simonich, S. L.; Rocchio, J.; Flanagan, C.

    2013-12-01

    Toxic air contaminants originating from agricultural areas of the Central Valley in California threaten vulnerable sensitive receptors including surface water, vegetation, snow, sediments, fish, and amphibians in the Sierra Nevada-Southern Cascades region. The spatial distribution of toxic air contaminants in different ecosystem indicators depends on variation in atmospheric concentrations and deposition, and variation in air toxics accumulation in ecosystems. The spatial distribution of organic air toxics and mercury at over 330 unique sampling locations and sample types over two decades (1990-2009) in the Sierra Nevada-Southern Cascades region were compiled and maps were developed to further understand spatial patterns and linkages between air toxics deposition and ecological effects. Potential ecosystem impacts in the Sierra Nevada-Southern Cascades region include bioaccumulation of air toxics in both aquatic and terrestrial ecosystems, reproductive disruption, and immune suppression. The most sensitive ecological end points in the region that are affected by bioaccumulation of toxic air contaminants are fish. Mercury was detected in all fish and approximately 6% exceeded human consumption thresholds. Organic air toxics were also detected in fish yielding variable spatial patterns. For amphibians, which are sensitive to pesticide exposure and potential immune suppression, increasing trends in current and historic use pesticides are observed from north to south across the region. In other indicators, such as vegetation, pesticide concentrations in lichen increase with increasing elevation. Current and historic use pesticides and mercury were also observed in snowpack at high elevations in the study area. This study shows spatial patterns in toxic air contaminants, evaluates associated risks to sensitive receptors, and identifies data gaps. Future research on atmospheric modeling and information on sources is needed in order to predict which ecosystems are the

  11. AAS 227: Day 2

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  12. Performance evaluation of spatial vector routing protocol for wireless sensor networks

    International Nuclear Information System (INIS)

    WSNs (Wireless Sensor Networks) is an emerging area of research. Researchers worldwide are working on the issues faced by sensor nodes. Communication has been a major issue in wireless networks and the problem is manifolds in WSN s because of the limited resources. The routing protocol in such networks plays a pivotal role, as an effective routing protocol could significantly reduce the energy consumed in transmitting and receiving data packets throughout a network. In this paper the performance of SVR (Spatial Vector Routing) an energy efficient, location aware routing protocol is compared with the existing location aware protocols. The results from the simulation trials show the performance of SVR. (author)

  13. AAS 227: Day 1

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or at astrobites.com, or catch ourlive-tweeted updates from the @astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto have so many people tell us that they already know about and useastrobites, and we were excited to introduce a new cohort of students at AAS to astrobites for the first time.Tuesday morning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended today.Opening Address (by Becky Smethurst)The President of the AAS, aka our fearless leader Meg Urry kicked off the meeting this morning at the purely coffee powered hour of 8am this morning. She spoke about the importance of young astronomers at the meeting (heres looking at you reader!) and also the importance of the new Working Group for Accessibility and Disabilities (aka WGAD pronounced like wicked) at the AAS. The Society has made extra effort this year to make the conference accessible to all,a message which was very well received by everyone in attendance.Kavli Lecture: New Horizons Alan Stern (by Becky Smethurst)We were definitely spoilt with the first Plenary lecture at this years conference Alan Stern gave us a a review of the New Horizons mission of the Pluto Fly By (astrobites covered the mission back in July with this post). We were treated to beautiful images, wonderful results and a foray into geology.Before (Hubble) and after #NewHorizons. #thatisall #science #astro alanstern #aas227 pic.twitter.com/kkMt6RsSIR Science News (@topsciencething) January 5, 2016Some awesome facts from the lecture that blew my mind:New Horizons is now 2AU (!) beyond Pluto

  14. AAS 227: Day 2

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  15. Development and evaluation of spatial point process models for epidermal nerve fibers.

    Science.gov (United States)

    Olsbo, Viktor; Myllymäki, Mari; Waller, Lance A; Särkkä, Aila

    2013-06-01

    We propose two spatial point process models for the spatial structure of epidermal nerve fibers (ENFs) across human skin. The models derive from two point processes, Φb and Φe, describing the locations of the base and end points of the fibers. Each point of Φe (the end point process) is connected to a unique point in Φb (the base point process). In the first model, both Φe and Φb are Poisson processes, yielding a null model of uniform coverage of the skin by end points and general baseline results and reference values for moments of key physiologic indicators. The second model provides a mechanistic model to generate end points for each base, and we model the branching structure more directly by defining Φe as a cluster process conditioned on the realization of Φb as its parent points. In both cases, we derive distributional properties for observable quantities of direct interest to neurologists such as the number of fibers per base, and the direction and range of fibers on the skin. We contrast both models by fitting them to data from skin blister biopsy images of ENFs and provide inference regarding physiological properties of ENFs.

  16. Keeping one's distance: the influence of spatial distance cues on affect and evaluation.

    Science.gov (United States)

    Williams, Lawrence E; Bargh, John A

    2008-03-01

    Current conceptualizations of psychological distance (e.g., construal-level theory) refer to the degree of overlap between the self and some other person, place, or point in time. We propose a complementary view in which perceptual and motor representations of physical distance influence people's thoughts and feelings without reference to the self, extending research and theory on the effects of distance into domains where construal-level theory is silent. Across four experiments, participants were primed with either spatial closeness or spatial distance by plotting an assigned set of points on a Cartesian coordinate plane. Compared with the closeness prime, the distance prime produced greater enjoyment of media depicting embarrassment (Study 1), less emotional distress from violent media (Study 2), lower estimates of the number of calories in unhealthy food (Study 3), and weaker reports of emotional attachments to family members and hometowns (Study 4). These results support a broader conceptualization of distance-mediated effects on judgment and affect. PMID:18315805

  17. Evaluating Methods of Estimation and Modelling Spatial Distribution of Evapotranspiration in the Middle Heihe River Basin, China

    Directory of Open Access Journals (Sweden)

    Chuanyan Zhao

    2005-01-01

    Full Text Available Seven models commonly used to estimate the daily reference evapotranspiration (ET0 were evaluated in the middle Heihe River Basin of the arid northwestern part of China. The objectives of the study are to choose the appropriate model for estimating the areal distribution of ET0 and to explain the spatial-temporal distribution of the same through GIS in the study area. The results indicated that the FAO-Penman model is the best way to estimate ET0; its RMSE ranged from 1.11 to 1.70 mm, and r2 from 0.59 to 0.93. The spatial variations of ET0 are higher in the western part than in the middle-eastern part of the study area. The temporal variations of daily differences in ET0 rates are mainly due to the differences in irradiance (Rn and to daily differences in the vapor pressure deficit (D. The spatially modeled ET0 results (r2 = 0.88 are in agreement with the corresponding data in situ on the 15th of each month.

  18. AAS 227: Day 3

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 3 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Henry Norris Russell Lecture: Viewing the Universe with Infrared Eyes: The Spitzer Space Telescope (by Erika Nesvold)The Henry Norris Russell Award is the highest honor given by the AAS, for a lifetime of eminence in astronomy research. This years award went to Giovanni Fazio of the Harvard-Smithsonian Center for Astrophysics. Fazio became a leader in gamma ray astronomy before switching mid-career to the study of infrared astronomy, and he gave his award lecture on the latter subject, specifically on the Spitzer Space Telescope, one of the most successful infrared telescopes of all time.Artists rendering of the Spitzer space telescope. [NASA/JPL-Caltech]Spitzer has been operating for more than twelve years, and has resulted in over six thousand papers in refereed journals in that time. The telescope sits in an Earth-trailing orbit around the Sun, and is now farther from the Earth (1.4 AU) than the Earth is from the Sun. Fazio gave the audience a fascinating overview of the science done by Spitzer over more than a decade. One of the most productive areas of research for Spitzer is the study of exoplanets, which hadnt even been discovered when the Spitzer Telescope was first conceived. Spitzers high sensitivity and ability to observe exoplanets over

  19. 丙烯酰胺共聚物AM/AA/NCD-离子液[equin]BF4复合粘土稳定剂的合成及性能研究%Synthesis and evaluation of clay stabilizer based on copolymer AM/AA/NCD and ionic liquid[equin]BF4

    Institute of Scientific and Technical Information of China (English)

    蒋文超; 苟绍华; 胡海; 刘帅; 杨上艺; 罗源皓

    2014-01-01

    采用丙烯酰胺(AM)、丙烯酸(AA)以及单六位取代烯丙胺基β-环糊精(NCD)为原料,合成出了一种水溶性聚合物 AM/ AA/ NCD。采用喹啉、溴乙烷、氟硼酸钠在温和条件下合成了离子液体四氟硼酸1-乙基-喹啉盐([equin]BF4)。AM/ AA/ NCD 溶液与[ equin]BF4在50℃下回流,发生复合反应,生成 AM/ AA/ NCD-离子液[equin]BF4复合粘土稳定剂。考察了反应条件对聚合反应的影响,确立了最佳合成工艺。通过膨润土线性膨胀实验,确定了复合粘土稳定剂最佳加量为0.6%,防膨率达到81%。采用 X-射线衍射(XRD)考察了复合粘土稳定剂对钠蒙脱土晶层间距的抑制效果,晶层间距从1.89 nm 降低到1.66 nm。压入硬度实验表明,AM/ AA/ NCD-[equin]BF4能有效保持泥页岩岩石强度。%A novel copolymer AM/ AA/ NCD was prepared by acrylamide(AM),acrylic acid(AA)and mono-6-(allyl amino)-β-cyclodextrin(NCD). Ionic liquid[equin]BF4 was synthesized using quinolin, bromoethane and sodium fluoroborate(NaBF4 )as starting materials. AM/ AA/ NCD Solution and[equin] BF4 were mixed and refluxed at 50 ℃ for incorporation reaction yielding AM/ AA/ NCD-[ equin]BF4 as clay stabilizer. The structures of AM/ AA/ NCD and[ equin]BF4 were confirmed by Infrared( IR) spectroscopy. The anti-swelling ratio could be 81% when the concentration of clay stabilizer was 0. 6% . The result of X-ray diffractometry(XRD)test showed that the solutions of obtained copolymers could re-markably reduce the interlayer spacing of sodium montmorillonite(from 1. 89 nm to 1. 66 nm)and im-prove the indentation hardness of shale.

  20. Spatial Analysis of Pollution-free Land for Tea Plantation and Comprehensive Evaluation of Soil Suitability

    OpenAIRE

    Wen, Ximei; Lu, Yang; Lan, Anjun; Tan, Hong

    2013-01-01

    To survey the tea resource advantages in Guizhou's mountainous areas and complete rational layout of pollution-free tea planting areas, we take the case of Guiding County in Guizhou Province to establish the comprehensive evaluation indicator system of pollution-free land for tea plantation and comprehensive evaluation model of soil suitability of land for tea plantation according to the Environmental Conditions Standard for Pollution-free Food-Tea Producing Areas by the Ministry of Agricultu...

  1. Evaluating influence of active tectonics on spatial distribution pattern of floods along eastern Tamil Nadu, India

    Science.gov (United States)

    Selvakumar, R.; Ramasamy, SM.

    2014-12-01

    Flooding is a naturally recurrent phenomenon that causes severe damage to lives and property. Predictions on flood-prone zones are made based on intensity-duration of rainfall, carrying capacity of drainage, and natural or man-made obstructions. Particularly, the lower part of the drainage system and its adjacent geomorphic landforms like floodplains and deltaic plains are considered for analysis, but stagnation in parts of basins that are far away from major riverine systems is less unveiled. Similarly, uncharacteristic flooding in the upper and middle parts of drainage, especially in zones of an anomalous drainage pattern, is also least understood. Even though topographic differences are attributed for such anomalous spatial occurrence of floods, its genetic cause has to be identified for effective management practice. Added to structural and lithological variations, tectonic movements too impart micro-scale terrain undulations. Because active tectonic movements are slow-occurring, long-term geological processes, its resultant topographical variations and drainage anomalies are least correlated with floods. The recent floods of Tamil Nadu also exhibit a unique distribution pattern emphasizing the role of tectonics over it. Hence a detailed geoinformatics-based analysis was carried out to envisage the relationship between spatial distribution of flood and active tectonic elements such as regional arches and deeps, block faults, and graben and drainage anomalies such as deflected drainage, compressed meander, and eyed drainages. The analysis reveals that micro-scale topographic highs and lows imparted by active tectonic movements and its further induced drainage anomalies have substantially controlled the distribution pattern of flood.

  2. Evaluation of MRI and cannabinoid type 1 receptor PET templates constructed using DARTEL for spatial normalization of rat brains

    Energy Technology Data Exchange (ETDEWEB)

    Kronfeld, Andrea; Müller-Forell, Wibke [Institute of Neuroradiology, University Medical Center of the Johannes Gutenberg University Mainz, Langenbeckstraße 1, Mainz 55131 (Germany); Buchholz, Hans-Georg; Maus, Stephan; Reuss, Stefan; Schreckenberger, Mathias; Miederer, Isabelle, E-mail: isabelle.miederer@unimedizin-mainz.de [Department of Nuclear Medicine, University Medical Center of the Johannes Gutenberg University Mainz, Langenbeckstraße 1, Mainz 55131 (Germany); Lutz, Beat [Institute of Physiological Chemistry, University Medical Center of the Johannes Gutenberg University Mainz, Duesbergweg 6, Mainz 55128 (Germany)

    2015-12-15

    Purpose: Image registration is one prerequisite for the analysis of brain regions in magnetic-resonance-imaging (MRI) or positron-emission-tomography (PET) studies. Diffeomorphic anatomical registration through exponentiated Lie algebra (DARTEL) is a nonlinear, diffeomorphic algorithm for image registration and construction of image templates. The goal of this small animal study was (1) the evaluation of a MRI and calculation of several cannabinoid type 1 (CB1) receptor PET templates constructed using DARTEL and (2) the analysis of the image registration accuracy of MR and PET images to their DARTEL templates with reference to analytical and iterative PET reconstruction algorithms. Methods: Five male Sprague Dawley rats were investigated for template construction using MRI and [{sup 18}F]MK-9470 PET for CB1 receptor representation. PET images were reconstructed using the algorithms filtered back-projection, ordered subset expectation maximization in 2D, and maximum a posteriori in 3D. Landmarks were defined on each MR image, and templates were constructed under different settings, i.e., based on different tissue class images [gray matter (GM), white matter (WM), and GM + WM] and regularization forms (“linear elastic energy,” “membrane energy,” and “bending energy”). Registration accuracy for MRI and PET templates was evaluated by means of the distance between landmark coordinates. Results: The best MRI template was constructed based on gray and white matter images and the regularization form linear elastic energy. In this case, most distances between landmark coordinates were <1 mm. Accordingly, MRI-based spatial normalization was most accurate, but results of the PET-based spatial normalization were quite comparable. Conclusions: Image registration using DARTEL provides a standardized and automatic framework for small animal brain data analysis. The authors were able to show that this method works with high reliability and validity. Using DARTEL

  3. Evaluation of MRI and cannabinoid type 1 receptor PET templates constructed using DARTEL for spatial normalization of rat brains

    International Nuclear Information System (INIS)

    Purpose: Image registration is one prerequisite for the analysis of brain regions in magnetic-resonance-imaging (MRI) or positron-emission-tomography (PET) studies. Diffeomorphic anatomical registration through exponentiated Lie algebra (DARTEL) is a nonlinear, diffeomorphic algorithm for image registration and construction of image templates. The goal of this small animal study was (1) the evaluation of a MRI and calculation of several cannabinoid type 1 (CB1) receptor PET templates constructed using DARTEL and (2) the analysis of the image registration accuracy of MR and PET images to their DARTEL templates with reference to analytical and iterative PET reconstruction algorithms. Methods: Five male Sprague Dawley rats were investigated for template construction using MRI and [18F]MK-9470 PET for CB1 receptor representation. PET images were reconstructed using the algorithms filtered back-projection, ordered subset expectation maximization in 2D, and maximum a posteriori in 3D. Landmarks were defined on each MR image, and templates were constructed under different settings, i.e., based on different tissue class images [gray matter (GM), white matter (WM), and GM + WM] and regularization forms (“linear elastic energy,” “membrane energy,” and “bending energy”). Registration accuracy for MRI and PET templates was evaluated by means of the distance between landmark coordinates. Results: The best MRI template was constructed based on gray and white matter images and the regularization form linear elastic energy. In this case, most distances between landmark coordinates were <1 mm. Accordingly, MRI-based spatial normalization was most accurate, but results of the PET-based spatial normalization were quite comparable. Conclusions: Image registration using DARTEL provides a standardized and automatic framework for small animal brain data analysis. The authors were able to show that this method works with high reliability and validity. Using DARTEL templates

  4. The Drentsche Aa valley system

    International Nuclear Information System (INIS)

    This thesis is composed of five papers concerned with Late Quaternary geology and geomorphology of the Aa valley system. The correlation and chronostratigraphic position of the layers have been established by radiocarbon dating. (Auth.)

  5. AAS 228: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors fromastrobites.com, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  6. EVALUATING THE EULER-POINCARÉ CHARACTERISTIC OF A SET USING A SPATIAL TESSELLATION

    Directory of Open Access Journals (Sweden)

    Jean-Paul Jernot

    2011-05-01

    Full Text Available A new formula is established to evaluate the Euler-Poincaré characteristic of a polyconvex subset X in Rd starting only from measurements of X in the cells of a tessellation. Simplifications occur when X is a union of cells of the tessellation, leading to another formula that unifies and extends several classical digitization results.

  7. Objective evaluation of the sweet spot size in spatial sound reproduction using elevated loudspeakers

    DEFF Research Database (Denmark)

    Lacouture Parodi, Yesenia; Rubak, Per

    2010-01-01

    , the least-squares methods outperformed the method based on the minimum-phase decomposition. However, the evaluation was only done for the best-case scenario, where the transfer functions used to design the filters correspond to the listener's transfer functions and his/her location and orientation...

  8. Evaluation of corrosion of steel embedded in concrete exposed to carbonation AAS using a factorial experiment with repeated measures. Evaluación de la corrosión del acero embebido en concreto AAS, expuesto a carbonatación mediante un experimento factorial con medidas repetidas.

    Directory of Open Access Journals (Sweden)

    W Aperador Chaparro

    2013-03-01

    Full Text Available This article presents various techniques for assessing corrosion, the linear polarization resistance and galvanostatic pulse, the analysis was performed using analysis of variance models using a factorial experiment with three factors, one repeated measure, because on the same experimental unit (reinforced concrete, it experienced several samples to be measured in time (0 h=1, 350 h=2, 700 h=3, 1050 h=4, 1700 h=5 y 2600 h=6. This makes the observations are not independent, the other two factors relate to, the binder (ce: 1 = activatedslag [AAS] and 2 = ordinary Portland concrete [OPC] and the exposure condition (ca: 1 = y 2 = environmental exposure accelerated carbonation. These factors were discussed according to the results of the electrochemical properties. Initially performed the statistical processing of each of the variables in relation to the properties and analyzed the interaction between them. Where they established the differences in materials used as coating steel, concrete, OPC and AAS. OPC concrete specimens, exhibited a resting potential, polarization resistance and ohmic (CO2 condition than those obtained for reinforced concrete in AAS.En este artículo se presentan las técnicas de evaluación de la corrosión, tales como potencial de corrosión, resistencia lineal a la polarización y pulso galvanostático a los concretos de activación alcalina (AAS y Portland tipo I (OPC. El estudio se realizó por medio de modelos de análisis de varianza, aplicando un experimento factorial con tres factores, uno de ellos medida repetida, debido a que sobre la misma unidad experimental (concreto armado AAS y OPC se ensayaron varias muestras para medirlas en el tiempo (0 h=1, 350 h=2, 700 h=3, 1050 h=4, 1700 h=5 y 2600 h=6, lo que hace que las observaciones no sean independientes; los otros dos factores corresponden al cementante (ce: 1=escoria activada alcalinamente [AAS] y 2=concreto Portland ordinario [OPC] y la condición de exposici

  9. Evaluating public health responses to reintroduced smallpox via dynamic, socially structured, and spatially distributed metapopulation models.

    Science.gov (United States)

    Glasser, John W; Foster, Stanley O; Millar, J Donald; Lane, J Michael

    2008-03-15

    The risk of smallpox reintroduction has motivated preparations in potential target countries. After reproducing the spatiotemporal pattern after the 1972 importation into Yugoslavia via coupled, biologically realistic systems of ordinary differential equations, we developed dynamic population models with current US age distributions and typical spatially distributed social structures. Surveillance and containment (S&C) coupled with vaccination of 95% of hospital-based health care workers (HCWs) within 2 days after the first diagnosis (estimated to be 18 days after aerosol release) were modeled after simulated exposure of 10, 50, or 10,000 people in various settings. If 90% of patients were isolated within days after symptom onset and 75% of contacts were vaccinated and monitored, S&C would reduce cases by 82%-99%. Preemptive immunization of HCWs, closing of schools, and even vaccination of as many as 80% within 1 week would have small marginal benefits. Preparations should emphasize stockpiling vaccine, training HCWs, improving laboratory capacity, and fostering an understanding of S&C. PMID:18284358

  10. Correlations of trace elements in breast human tissues: Evaluation of spatial distribution using {mu}-XRF

    Energy Technology Data Exchange (ETDEWEB)

    Piacenti da Silva, Marina; Silva, Deisy Mara da; Ribeiro-Silva, Alfredo; Poletti, Martin Eduardo [Departamento de Fisica, FFCLRP/USP, Av. dos Bandeirantes n. 3900, 14040-901 Ribeirao Preto - SP (Brazil); Departamento de Patologia, HCFM/USP, Av. dos Bandeirantes n. 3900, 14040-901 Ribeirao Preto - SP (Brazil); Departamento de Fisica, FFCLRP/USP, Av. dos Bandeirantes n. 3900, 14040-901 Ribeirao Preto - SP (Brazil)

    2012-05-17

    The aim of this work is to investigate microscopic correlations between trace elements in breast human tissues. A synchrotron X-ray fluorescence microprobe system ({mu}-XRF) was used to obtain two-dimensional distribution of trace element Ca, Fe, Cu and Zn in normal (6 samples) and malignant (14 samples) breast tissues. The experiment was performed in X-ray Fluorescence beam line at Laboratorio Nacional de Luz Sincrotron (LNLS), Campinas, Brazil. The white microbeam was generated with a fine conical capillary with a 20 {mu}m output diameter. The samples were supported on a XYZ table. An optical microscope with motorized zoom was used for sample positioning and choice the area to be scanned. Automatic two-dimensional scans were programmed and performed with steps of 30 {mu}m in each direction (x, y) on the selected area. The fluorescence signals were recorded using a Si(Li) detector, positioned at 90 degrees with respect to the incident beam, with a collection time of 10 s per point. The elemental maps obtained from each sample were overlap to observe correlation between trace elements. Qualitative results showed that the pairs of elements Ca-Zn and Fe-Cu could to be correlated in malignant breast tissues. Quantitative results, achieved by Spearman correlation tests, indicate that there is a spatial correlation between these pairs of elements (p < 0.001) suggesting the importance of these elements in metabolic processes associated with the development of the tumor.

  11. The two-layer geochemical structure of modern biogeochemical provinces and its significance for spatially adequate ecological evaluations and decisions

    Science.gov (United States)

    Korobova, Elena; Romanov, Sergey

    2014-05-01

    Contamination of the environment has reached such a scale that ecogeochemical situation in any area can be interpreted now as a result of the combined effect of natural and anthropogenic factors. The areas that appear uncomfortable for a long stay can have natural and anthropogenic genesis, but the spatial structure of such biogeochemical provinces is in any case formed of a combination of natural and technogenic fields of chemical elements. Features of structural organization and the difference in factors and specific time of their formation allow their separation on one hand and help in identification of areas with different ecological risks due to overlay of the two structures on the other. Geochemistry of soil cover reflects the long-term result of the naturally balanced biogeochemical cycles, therefore the soil geochemical maps of the undisturbed areas may serve the basis for evaluation of the natural geochemical background with due regard to the main factors of geochemical differentiation in biosphere. Purposeful and incidental technogenic concentrations and dispersions of chemical elements of specific (mainly mono- or polycentric) structure are also fixed in soils that serve as secondary sources of contamination of the vegetation cover and local food chains. Overlay of the two structures forms specific heterogeneity of modern biogeochemical provinces with different risk for particular groups of people, animals and plants adapted to specific natural geochemical background within particular concentration interval. The developed approach is believed to be helpful for biogeochemical regionalizing of modern biosphere (noosphere) and for spatially adequate ecogeochemical evaluation of the environment and landuse decisions. It allows production of a set of applied geochemical maps such as: 1) health risk due to chemical elements deficiency and technogenic contamination accounting of possible additive effects; 2) adequate soil fertilization and melioration with due

  12. Spatial-temporal distribution and fuzzy comprehensive evaluation of total phosphorus and total nitrogen in the Yangtze River Estuary.

    Science.gov (United States)

    Liu, Ruimin; Chen, Yaxin; Yu, Wenwen; Xu, Fei; Shen, Zhenyao

    2016-01-01

    Based on water sample data collected from the Yangtze River Estuary (YRE) during four sampling periods in 2010 and 2011, the total nitrogen (TN) and total phosphorus (TP) content were evaluated using the traditional single-factor evaluation (TSE) and the fuzzy comprehensive evaluation (FCE). Statistical analyses showed that the average TN and TP for the four periods were 2.60 mg/L and 0.11 mg/L, respectively. August 2010 showed the lowest TN (1.57 mg/L), and February 2011 showed the highest TP (0.15 mg/L). The annual spatial distribution results indicated that an area of high TN concentration (TN ≥ 3.0 mg/L) occurred in the adjacent sea and increased on an eastward gradient. An area of high TP concentration (TP ≥0.10 mg/L) occurred in the inner YRE and decreased on an eastward gradient. There were significant differences in the results of TSE and FCE. The TSE results only reflected the TN evaluation results for certain locations of the YRE. The FCE method combined the effects of the TN and TP factors, and the results indicate that the Chinese water quality classification of Class 5 was dominant in the YRE. PMID:26901737

  13. CCTV Coverage Index Based on Surveillance Resolution and Its Evaluation Using 3D Spatial Analysis

    Directory of Open Access Journals (Sweden)

    Kyoungah Choi

    2015-09-01

    Full Text Available We propose a novel approach to evaluating how effectively a closed circuit television (CCTV system can monitor a targeted area. With 3D models of the target area and the camera parameters of the CCTV system, the approach produces surveillance coverage index, which is newly defined in this study as a quantitative measure for surveillance performance. This index indicates the proportion of the space being monitored with a sufficient resolution to the entire space of the target area. It is determined by computing surveillance resolution at every position and orientation, which indicates how closely a specific object can be monitored with a CCTV system. We present full mathematical derivation for the resolution, which depends on the location and orientation of the object as well as the geometric model of a camera. With the proposed approach, we quantitatively evaluated the surveillance coverage of a CCTV system in an underground parking area. Our evaluation process provided various quantitative-analysis results, compelling us to examine the design of the CCTV system prior to its installation and understand the surveillance capability of an existing CCTV system.

  14. Clinical utility of spatially normalized PET and SPECT to evaluate patients with memory and cognitive impairments

    International Nuclear Information System (INIS)

    We assessed cerebral metabolism and blood flow in patients with memory and other cognitive impairment using the easy Z score imaging system (eZIS) and statistical parametric mapping (SPM) of FDG-PET and SPECT scans. Twenty patients with dementia (12 Alzheimer's disease (AD), 3 diffuse Lewy body disease (DLB), and 2 frontotemporal dementia (FTD)) and twenty with diffuse axonal injury (DAI) and cognitive impairments were studied with FDG-PET and ECD-SPECT. All images were analyzed using eZIS with the same processing procedures, including smoothing, normalization, and z-transformation, and compared to a database of normals. Z score maps were super-imposed on 3D MRI brain images. Group analyses were performed using SPM. Age-related declines in cerebral metabolism and blood flow were observed in the anterior cingulate association area. In contrast, reductions in these cerebral functions correlated best with severity of AD in the posterior cingulate association areas. In DLB and FTD, eZIS analysis of PET and SPECT revealed reductions of cerebral functions in specific areas. DAI showed low metabolism and blood flow in mesiofrontal cortex including the anterior cingulate association area. Dysfunction of the anterior cingulate association area in DAI, which resembled age-related cognitive decline, may be responsible for cognitive impairments. Overall, PET and SPECT scans showed significant correlations according to the type of dementia. Spatially normalized maps contributed to PET and SPECT image interpretation for patients with memory and cognitive impairments because better 3D visualization allowed more objective and systematic investigations. (author)

  15. AAS 227: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from http://web.physics.ucsb.edu/ ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  16. Spatial and temporal evaluation of erosion with RUSLE: a case study in an olive orchard microcatchment in Spain

    Directory of Open Access Journals (Sweden)

    E. V. Taguas

    2010-09-01

    Full Text Available Soil loss is commonly estimated using the Revised Universal Soil Loss Equation (RUSLE. Since RUSLE is an empirically based soil-loss model derived from surveys on plots, the high spatial and temporal variability of erosion in Mediterranean environments and scale effects mean that it is necessary to evaluate the model in other spatial units such as the microcatchment. In this study, a series of topographic and soil surveys was carried out on a microcatchment of 6.7 ha in a mountainous area under no-tillage farming with bare soil in order to examine spatial and temporal results produced by RUSLE. GPS measurements of the microrelief height differences were used in a control area in the microcatchment to compare observed erosion and deposition with RUSLE predictions. Erosion points located in certain areas correlate very closely with RUSLE predictions, while the distribution of deposition points showed no correlations with RUSLE predictions. Secondly, a time series of daily rainfall data was used to calculate annual erosivity values, which were fitted to an appropriate distribution function. It was determined that the rainfall distribution best fitted the Pearson type III distribution function. Next, efforts were made to quantify the long term erosion and to check the suitability of the land-use and management under different thresholds of tolerance. It was found that values of erosivity in the study area with a return period of 10 years generate a mean annual erosion of 5 t ha−1 yr−1. On the study scale, RUSLE allowed us to locate the most erosive areas and to combine the suitability of the soil land-use and the management with the frequency of the annual erosivity. In addition, an annual sediment delivery ratio of approximately 47% was estimated for the period 2005–2006.

  17. Geographical information system (GIS) as a new tool to evaluate epidemiology based on spatial analysis and clinical outcomes in acromegaly.

    Science.gov (United States)

    Naves, Luciana Ansaneli; Porto, Lara Benigno; Rosa, João Willy Corrêa; Casulari, Luiz Augusto; Rosa, José Wilson Corrêa

    2015-02-01

    Geographical information systems (GIS) have emerged as a group of innovative software components useful for projects in epidemiology and planning in Health Care System. This is an original study to investigate environmental and geographical influences on epidemiology of acromegaly in Brazil. We aimed to validate a method to link an acromegaly registry with a GIS mapping program, to describe the spatial distribution of patients, to identify disease clusters and to evaluate if the access to Health Care could influence the outcome of the disease. Clinical data from 112 consecutive patients were collected and home addresses were plotted in the GIS software for spatial analysis. The buffer spatial distribution of patients living in Brasilia showed that 38.1% lived from 0.33 to 8.66 km, 17.7% from 8.67 to 18.06 km, 22.2% from 18.07 to 25.67 km and 22% from 25.68 to 36.70 km distant to the Reference Medical Center (RMC), and no unexpected clusters were identified. Migration of 26 patients from 11 others cities in different regions of the country was observed. Most of patients (64%) with adenomas bigger than 25 mm lived more than 20 km away from RMC, but no significant correlation between the distance from patient's home to the RMC and tumor diameter (r = 0.45 p = 0.20) nor for delay in diagnosis (r = 0.43 p = 0.30) was found. The geographical distribution of diagnosed cases did not impact in the latency of diagnosis or tumor size but the recognition of significant migration denotes that improvements in the medical assistance network are needed.

  18. AAS 228: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors fromastrobites.com, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  19. Rain gauge network evaluation and optimal design using spatial correlation approach in arid and semi-arid regions of Iran

    Science.gov (United States)

    Nazaripour, Hamid; Mansouri Daneshvar, Mohammad Reza

    2016-06-01

    The present study is aimed at evaluation of a rain gauge network in order to optimize a network design. In this regard, point rainfall estimations were assessed using a spatial correlation approach in the Kerman region, Iran. This approach was implemented based on monthly rainfall data for existing 117 rain gauge stations in the study area. The results revealed that the regular arrangement of rain gauges could provide the reliable values for accurate rainfall estimation. Low density of rain gauge combined with the low rainfall values may result in strong increase of the interpolation errors. Based on the existing rain gauge network, the relative mean error of observed rainfalls (E a ) is less than 5 % over the study area. The spatial interpolation errors (E i ) were considered to optimize the design of rain gauge network at the confidence level of 85 %, where the mean errors were exhibited from 8.5 to 14 % in districts A and B, respectively. On this basis, about 46 locations were proposed for allocation of new stations. Therefore, it was suggested to relocate about 20 existing stations in order to achieve an accurate design.

  20. Visual and quantitative evaluation of selected image combination schemes in ultrasound spatial compound scanning

    DEFF Research Database (Denmark)

    Wilhjelm, Jens E.; Jensen, M.S.; Jespersen, S.K.;

    2004-01-01

    the lowest SNRs is obtained for the maximum operator. When comparing SNRs for adipose and fibrous tissue, the level is close to 1.91 for adipose tissue but only 1.7 for fibrous tissue which contain relatively few organized scattering structures....... tissue containing adipose, connective and muscular tissue. Image quality increased with number of angles up to +/-14degrees after which the improvements became debatable. The mem and median operators, which try to render the images more quantitatively correct by suppressing strong echoes from specular......, mean-excluding-maximum (mem), root-mean-square (rms), geometric mean and maximum) on image quality (tissue delineation and artifacts), speckle signal-to-noise ratio (SNRs) and contrast. The evaluation is based on in vitro SAI (+/-21degrees in steps of Deltatheta = 7degrees) of formalin fixed porcine...

  1. Evaluation of spatial pressure distribution during ice-structure interaction using pressure indicating film

    Directory of Open Access Journals (Sweden)

    Kim Hyunwook

    2014-09-01

    Full Text Available Understanding of ‘spatial’ pressure distribution is required to determine design loads on local structures, such as plating and framing. However, obtaining a practical ‘spatial’ pressure distribution is a hard task due to the sensitivity of the data acquisition frequency and resolution. High-resolution Pessure-Idicating Flm (PIF was applied to obtain pressure distribution and pressure magnitude using stepped crushing method. Different types of PIF were stacked at each test to creating a pressure distribution plot at specific time steps. Two different concepts of plotting ‘spatial’ pressure-area curve was introduced and evaluated. Diverse unit pixel size was chosen to investigate the effect of the resolution in data analysis. Activated area was not significantly affected by unit pixel size; however, total force was highly sensitive

  2. Precipitation hardening and hydrogen embrittlement of aluminum alloy AA7020

    Indian Academy of Sciences (India)

    Santosh Kumar; T K G Namboodhiri

    2011-04-01

    AA7020 Al–Mg–Zn, a medium strength aluminium alloy, is used in welded structures in military and aerospace applications. As it may be subjected to extremes of environmental exposures, including high pressure liquid hydrogen, it could suffer hydrogen embrittlement. Hydrogen susceptibility of alloy AA7020 was evaluated by slow strain-rate tensile testing, and delayed failure testing of hydrogen-charged specimens of air-cooled, duplexaged, and water-quenched duplex agedmaterials. The resistance to hydrogen embrittlement of the alloy was found to be in the order of air-cooled duplex aged alloy > as-received (T6 condition) > water quenched duplex aged material.

  3. AAS 227: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from http://web.physics.ucsb.edu/ ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  4. Evaluation of a low-dose digital X-ray system with improved spatial resolution

    International Nuclear Information System (INIS)

    We present results from an evaluation of a significantly improved version of the Siberian Digital Radiographic Device (SDRD). The SDRD is already in clinical use in Novosibirsk and Moscow where it produces images of high diagnostic value at considerably lower doses than conventional film-screen combinations. It uses a fast multiwire proportional chamber with highly parallel readout as a detector. Improvements in the readout system have given a reduction by a factor of two in the pixel size. We have used well established methods to compare imaging performance of the new SDRD with the old version as well as with a film-screen combination used in routine clinical practice in the UK. At the same level of exposure the threshold contrast for objects of the order of the pixel size is two times better for the new SDRD than for the old one, and the minimum size of objects visible in the image is two times smaller (0.25 mm) for the new system than for the old SDRD (0.5 mm). ((orig.))

  5. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor

    OpenAIRE

    Pérez, Claudia; Fernandez, Luisa E.; Sun, Jianguang; Folch, Jorge Luis; Gill, Sarjeet S.; Soberón, Mario; Bravo, Alejandra

    2005-01-01

    Bacillus thuringiensis subsp. israelensis produces crystal proteins, Cry (4Aa, 4Ba, 10Aa, and 11Aa) and Cyt (1Aa and 2Ba) proteins, toxic to mosquito vectors of human diseases. Cyt1Aa overcomes insect resistance to Cry11Aa and Cry4 toxins and synergizes the toxicity of these toxins. However, the molecular mechanism of synergism remains unsolved. Here, we provide evidence that Cyt1Aa functions as a receptor of Cry11Aa. Sequential-binding analysis of Cyt1Aa and Cry11Aa revealed that Cyt1Aa bind...

  6. Is amyloid A (AA) amyloidosis always secondary?

    OpenAIRE

    Maury, C P; Törnroth, T; Wegelius, O

    1985-01-01

    The case is reported of a patient with systemic AA amyloidosis associated with non-specific mesenteric lymphadenitis and chronic sideropenia. Renal, small bowel, and rectal biopsies showed amyloid deposits containing AA protein, as defined by potassium permanganate sensitivity and by reactivity with AA antiserum. Reversal of the nephrotic syndrome occurred during steroid-azathioprine therapy.

  7. Avaliação da geometria de ferramenta e parâmetros do processo FSW na soldagem da liga de alumínio AA 5052 Process parameters and tool geometry evaluation in the FSW of AA 5052 aluminum alloy

    Directory of Open Access Journals (Sweden)

    Tiago Valdameri Capelari

    2009-09-01

    presença de uma descontinuidade longitudinal no cordão de solda. O perfil de microdureza das amostras soldadas pelo processo FSW demonstrou homogeneidade entre as diferentes zonas microestruturais existentes ao longo da seção transversal, ao passo que as amostras soldadas através do processo MIG apresentaram variação característica dos processos ao arco elétrico.Welding of aluminum alloys with no considerable degradation of the properties of the base metal is a problem to be overcomed by industry manufacturing processes. In the aeronautical industry, no-melt joining processes such as adhesive bonding or riveting are often considered when designing aluminum connections. Alternatively, a welding process named Friction Stir Welding (FSW is receiving crescent attention for its potential applications where heat input shall be minimized or when dissimilar metals must be joined. In this process a high strength rotating tool with a special profile is introduced at the interface of the materials to be joined and translated along the joint at controlled speeds. Heat generated softens the material and allows the tool to stir while traveling along the joint. This work aimed to product welds on AA 5052-H34 plates, 6.35mm (0,25 inches thickness, using a conventional milling machine. In order to do that, three tool geometries were designed, manufactured and tested so as to define which welding parameters could generate the best results. Once these parameters were chosen, each tool produced three welds and their performance was evaluated. Transversal bending, tensile tests, micro-hardness measurements along the weld cross-section and macrographical analysis were carried out in order to assess weld properties. In addition, MIG welds were produced and subjected to the same test conditions. Considering yield stress as an efficiency parameter, all the tested tools presented similar results (around 80% of the base metal yield stress. However one of these tools showed inferior

  8. An expert-based approach to forest road network planning by combining Delphi and spatial multi-criteria evaluation.

    Science.gov (United States)

    Hayati, Elyas; Majnounian, Baris; Abdi, Ehsan; Sessions, John; Makhdoum, Majid

    2013-02-01

    Changes in forest landscapes resulting from road construction have increased remarkably in the last few years. On the other hand, the sustainable management of forest resources can only be achieved through a well-organized road network. In order to minimize the environmental impacts of forest roads, forest road managers must design the road network efficiently and environmentally as well. Efficient planning methodologies can assist forest road managers in considering the technical, economic, and environmental factors that affect forest road planning. This paper describes a three-stage methodology using the Delphi method for selecting the important criteria, the Analytic Hierarchy Process for obtaining the relative importance of the criteria, and finally, a spatial multi-criteria evaluation in a geographic information system (GIS) environment for identifying the lowest-impact road network alternative. Results of the Delphi method revealed that ground slope, lithology, distance from stream network, distance from faults, landslide susceptibility, erosion susceptibility, geology, and soil texture are the most important criteria for forest road planning in the study area. The suitability map for road planning was then obtained by combining the fuzzy map layers of these criteria with respect to their weights. Nine road network alternatives were designed using PEGGER, an ArcView GIS extension, and finally, their values were extracted from the suitability map. Results showed that the methodology was useful for identifying road that met environmental and cost considerations. Based on this work, we suggest future work in forest road planning using multi-criteria evaluation and decision making be considered in other regions and that the road planning criteria identified in this study may be useful.

  9. Spatial variability of POPs in European background air

    Directory of Open Access Journals (Sweden)

    A. K. Halse

    2010-10-01

    Full Text Available Persistent organic pollutants (POPs are recognized for their potential to create harmful effects in remote areas and several monitoring programs have been established which measure POPs in air. Active air sampling (AAS has so far been the recommended method used under the EMEP (co-operative programme for monitoring and evaluation of the long-range transmissions of air pollutants in Europe measurement program. The number of EMEP AAS stations is still limited and mainly located in the north western part of Europe. Passive air sampling (PAS methods, which have become increasingly popular in recent years, offer an opportunity as a complementary sampling strategy which could improve sampling coverage under EMEP. To gain further insight into spatial patterns of POPs in European background air and to evaluate PAS as an alternative sampling technique under EMEP, PAS were deployed at 86 European background sites during summer 2006. Duplicate PAS samplers were also deployed at EMEP AAS sites to allow for a comparison of results obtained using both methods. The PAS were analyzed for selected PCBs, HCHs, DDTs, PAHs, chlordanes and HCB, and air concentrations were calculated on the basis of losses of performance reference compounds. Air concentrations of PCBs were generally lowest in more remote areas of Northern Europe with elevated levels in more densely populated areas. γ-HCH was found at elevated levels in more central parts of Europe, whereas α-HCH, β-HCH and DDTs showed higher concentrations in the southeastern part. There was no clear spatial pattern in the concentrations for PAHs, indicative of influence by local sources, rather than long range atmospheric transport (LRAT. HCB was evenly distributed across Europe, while the concentrations of chlordanes were typically low or non-detectable. Co-deployed PAS samples showed a fair agreement between the duplicates, typically within 30%. Larger differences were seen when comparing results obtained on

  10. Using multiple natural and injected tracers to evaluate spatial and temporal patterns of hyporheic flux and biogeochemistry

    Science.gov (United States)

    Briggs, M. A.; Lautz, L. K.; Gordon, R. P.; McKenzie, J. M.; Gonzalez Pinzon, R. A.; Hare, D. K.

    2011-12-01

    Punctuated head differentials along stream water surface profiles, in conjunction with heterogeneous sediment and complex bedforms, enhance hyporheic exchange, although the magnitude of this exchange is not uniform across the streambed. Patchy biogeochemical micro-environments develop within these complex systems, and are strongly controlled by residence time along hyporheic flowpaths. We used multiple tracer techniques, natural and injected, to evaluate the physical hyporheic flow dynamics and associated biogeochemical cycling and microbial reactivity around two beaver dams in Wyoming, USA as stream discharge dropped by 45% over five weeks. High spatial-resolution fiber-optic distributed temperature sensing (DTS) was used to collect heat data over nine vertical profiles to 0.8 m depth in varied streambed morphologies (pools, glides and bars). This data was interpreted with a one-dimensional flux model (VFLUX) to quantitatively determine how vertical hyporheic flux patterns arrange spatially and evolve over time. Coincident with these locations, vertical profiles of pore water to the 0.55 m depth were collected every week and analyzed for dissolved oxygen, pH and redox sensitive solutes. Additionally, the stream was brought to a plateau for 9 hrs with paired chloride and resazurin tracers, a technique which can be used to measure the aerobic microbial reactivity of specific flowpaths in the subsurface. During this injection, shallow profiles of pore water were collected three times at all nine locations. The combined results revealed a complicated system where vertical hyporheic flux patterns were organized by morphologic unit and dictated the redox condition of the subsurface. Generally, glides had strong, deep and consistent downward hyporheic flux (1.6 md-1), with oxic conditions persisting to depth along the profiles. Sediment bars close to the dam had shallower strong downward flux that diminished over the study period, while bars set farther back from the dam

  11. Stochastic spatial disaggregation of extreme precipitation to validate a Regional Climate Model and to evaluate climate change impacts over a small watershed

    Directory of Open Access Journals (Sweden)

    P. Gagnon

    2013-06-01

    Full Text Available Regional Climate Models (RCMs are valuable tools to evaluate impacts of climate change (CC at regional scale. However, as the size of the area of interest decreases, the ability of a RCM to simulate extreme precipitation events decreases due to the spatial resolution. Thus, it is difficult to evaluate whether a RCM bias on localized extreme precipitation is caused by the spatial resolution or by a misrepresentation of the physical processes in the model. Thereby, it is difficult to trust the CC impact projections for localized extreme precipitation. Stochastic spatial disaggregation models can bring the RCM precipitation data at a finer scale and reduce the bias caused by spatial resolution. In addition, disaggregation models can generate an ensemble of outputs, producing an interval of possible values instead of a unique discrete value. The objective of this work is to evaluate whether a stochastic spatial disaggregation model applied on annual maximum daily precipitation: (i enables the validation of a RCM for a period of reference, and (ii modifies the evaluation of CC impacts over a small area. Three simulations of the Canadian RCM (CRCM covering the period 1961–2099 are used over a small watershed (130 km2 located in southern Québec, Canada. The disaggregation model applied is based on Gibbs sampling and accounts for physical properties of the event (wind speed, wind direction, and convective available potential energy (CAPE, leading to realistic spatial distributions of precipitation. The results indicate that disaggregation has a significant impact on the validation. However it does not provide a precise estimate of the simulation bias because of the difference in resolution between disaggregated values (4 km and observations, and because of the underestimation of the spatial variability by the disaggregation model for the most convective events. Nevertheless, disaggregation permits to determine that the simulations used mostly

  12. Are Gender Differences in Spatial Ability Real or an Artifact? Evaluation of Measurement Invariance on the Revised PSVT:R

    Science.gov (United States)

    Maeda, Yukiko; Yoon, So Yoon

    2016-01-01

    We investigated the extent to which the observed gender differences in mental rotation ability among the 2,468 freshmen studying engineering at a Midwest public university attributed to the gender bias of a test. The Revised Purdue Spatial Visualization Tests: Visualization of Rotations (Revised PSVT:R) is a spatial test frequently used to measure…

  13. Spatial resolution evaluation with a pair of two four-layer DOI detectors for small animal PET scanner: jPET-RD

    Energy Technology Data Exchange (ETDEWEB)

    Nishikido, Fumihiko [National Institute of Radiological Sciences, Anagawa 4-9-1 Inage-ku, Chiba-shi, Chiba 263-8555 (Japan)], E-mail: funis@nirs.go.jp; Tsuda, Tomoaki [Shimadzu Corporation, Nishinokyo Kuwabaracho 1 Nakagyo-ku, Kyoto-shi, Kyoto 604-8511 (Japan); Yoshida, Eiji; Inadama, Naoko; Shibuya, Kengo; Yamaya, Taiga [National Institute of Radiological Sciences, Anagawa 4-9-1 Inage-ku, Chiba-shi, Chiba 263-8555 (Japan); Kitamura, Keishi [Shimadzu Corporation, Nishinokyo Kuwabaracho 1 Nakagyo-ku, Kyoto-shi, Kyoto 604-8511 (Japan); Takahashi, Kei [National Institute of Radiological Sciences, Anagawa 4-9-1 Inage-ku, Chiba-shi, Chiba 263-8555 (Japan); Graduate School of Science and Technology, Chiba University, Yayoi-cho 1-33, Inage-ku, Chiba-shi, Chiba 263-8522 (Japan); Ohmura, Atsushi [National Institute of Radiological Sciences, Anagawa 4-9-1 Inage-ku, Chiba-shi, Chiba 263-8555 (Japan); Graduate School of Advanced Science and Engineering, Waseda University, Okubo 3-4-1, Shinjuku-ku, Tokyo 169-8555 (Japan); Murayama, Hideo [National Institute of Radiological Sciences, Anagawa 4-9-1 Inage-ku, Chiba-shi, Chiba 263-8555 (Japan)

    2008-01-01

    We are developing a small animal PET scanner, 'jPET-RD' to achieve high sensitivity as well as high spatial resolution by using four-layer depth-of-interaction (DOI) detectors. The jPET-RD is designed with two detector rings. Each detector ring is composed of six DOI detectors arranged hexagonally. The diameter of the field-of-view (FOV) is 8.8 cm, which is smaller than typical small animal PET scanners on the market now. Each detector module consists of a crystal block and a 256-channel flat panel position-sensitive photomultiplier tube. The crystal block, consisting of 32x32x4 crystal (4096 crystals, each 1.46 mmx1.46 mmx4.5 mm) and a reflector, is mounted on the 256ch FP-PMT. In this study, we evaluated the spatial resolution of reconstructed images with the evaluation system of two four-layer DOI detectors which consist of 32x32x4 LYSO (Lu: 98%, Y: 2%) crystals coupled on the 256ch FP-PMT by using RTV rubber. The spatial resolution of 1.5 mm was obtained at the center of the FOV by the filtered back projection. The spatial resolution, better than 2 mm in the whole FOV, was also achieved with DOI while the spatial resolution without DOI was degraded to 3.3 mm.

  14. Spatial Analysis of the National Evaluation of Scholastic Achievement (ENLACE in Schools of the Municipality of Juarez, Chihuahua

    Directory of Open Access Journals (Sweden)

    Luis Ernesto Cervera Gómez

    2008-05-01

    Full Text Available This research was focused on analyzing the results of the first National Assessment of Academic Achievement for Scholar Centers (ENLACE; acronym in Spanish applied during the year 2006 in the Municipality of Juarez (State of Chihuahua, Mexico. In order to conduct the spatial analysis a geographical information system (GIS was used to make a georeferenced database were all variables were connected to a point representing a school. Results of the examinations expressed as deficient, elemental, good en excellent were spatially distributed over the urban area of Ciudad Juárez. Apparently there is a high spatial correlation between ENLACE’s results with the socioeconomic level of people. In this way results going from good to excellent were spatially located over the sectors more developed of the city. Poor results going from Insufficient to Elemental were spatially located at places with higher deficits of infrastructure and low socioeconomic levels.

  15. Laboratory Astrophysics Division of the AAS (LAD)

    Science.gov (United States)

    Salama, Farid; Drake, R. P.; Federman, S. R.; Haxton, W. C.; Savin, D. W.

    2012-01-01

    The purpose of the Laboratory Astrophysics Division (LAD) is to advance our understanding of the Universe through the promotion of fundamental theoretical and experimental research into the underlying processes that drive the Cosmos. LAD represents all areas of astrophysics and planetary sciences. The first new AAS Division in more than 30 years, the LAD traces its history back to the recommendation from the scientific community via the White Paper from the 2006 NASA-sponsored Laboratory Astrophysics Workshop. This recommendation was endorsed by the Astronomy and Astrophysics Advisory Committee (AAAC), which advises the National Science Foundation (NSF), the National Aeronautics and Space Administration (NASA), and the U.S. Department of Energy (DOE) on selected issues within the fields of astronomy and astrophysics that are of mutual interest and concern to the agencies. In January 2007, at the 209th AAS meeting, the AAS Council set up a Steering Committee to formulate Bylaws for a Working Group on Laboratory Astrophysics (WGLA). The AAS Council formally established the WGLA with a five-year mandate in May 2007, at the 210th AAS meeting. From 2008 through 2012, the WGLA annually sponsored Meetings in-a-Meeting at the AAS Summer Meetings. In May 2011, at the 218th AAS meeting, the AAS Council voted to convert the WGLA, at the end of its mandate, into a Division of the AAS and requested draft Bylaws from the Steering Committee. In January 2012, at the 219th AAS Meeting, the AAS Council formally approved the Bylaws and the creation of the LAD. The inaugural gathering and the first business meeting of the LAD were held at the 220th AAS meeting in Anchorage in June 2012. You can learn more about LAD by visiting its website at http://lad.aas.org/ and by subscribing to its mailing list.

  16. The thioacetate-ω(γ-lactam carboxamide) HDAC inhibitor ST7612AA1 as HIV-1 latency reactivation agent.

    Science.gov (United States)

    Badia, Roger; Grau, Judith; Riveira-Muñoz, Eva; Ballana, Ester; Giannini, Giuseppe; Esté, José A

    2015-11-01

    Antiretroviral therapy (ART) is unable to cure HIV infection. The ability of HIV to establish a subset of latent infected CD4(+) T cells, which remain undetectable to the immune system, becomes a major roadblock to achieve viral eradication. Histone deacetylase inhibitors (HDACi) have been shown to potently induce the reactivation of latent HIV. Here, we show that a new thiol-based HDACi, the thioacetate-ω(γ-lactam carboxamide) derivative ST7612AA1, is a potent inducer of HIV reactivation. We evaluated HIV reactivation activity of ST7612AA1 compared to panobinostat (PNB), romidepsin (RMD) and vorinostat (VOR) in cell culture models of HIV-1 latency, in latently infected primary CD4(+) T lymphocytes and in PBMCs from HIV(+) patients. ST7612AA1 potently induced HIV-1 reactivation at submicromolar concentrations with comparable potency to panobinostat or superior to vorinostat. The presence of known antiretrovirals did not affect ST7612AA1-induced reactivation and their activity was not affected by ST7612AA1. Cell proliferation and cell activation were not affected by ST7612AA1, or any other HDACi used. In conclusion, our results indicate that ST7612AA1 is a potent activator of latent HIV and that reactivation activity of ST7612AA1 is exerted without activation or proliferation of CD4(+) T cells. ST7612AA1 is a suitable candidate for further studies of HIV reactivation strategies and potential new therapies to eradicate the viral reservoirs. PMID:26348004

  17. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor.

    Science.gov (United States)

    Pérez, Claudia; Fernandez, Luisa E; Sun, Jianguang; Folch, Jorge Luis; Gill, Sarjeet S; Soberón, Mario; Bravo, Alejandra

    2005-12-20

    Bacillus thuringiensis subsp. israelensis produces crystal proteins, Cry (4Aa, 4Ba, 10Aa, and 11Aa) and Cyt (1Aa and 2Ba) proteins, toxic to mosquito vectors of human diseases. Cyt1Aa overcomes insect resistance to Cry11Aa and Cry4 toxins and synergizes the toxicity of these toxins. However, the molecular mechanism of synergism remains unsolved. Here, we provide evidence that Cyt1Aa functions as a receptor of Cry11Aa. Sequential-binding analysis of Cyt1Aa and Cry11Aa revealed that Cyt1Aa binding to Aedes aegypti brush border membrane vesicles enhanced the binding of biotinylated-Cry11Aa. The Cyt1Aa- and Cry11Aa-binding epitopes were mapped by means of the yeast two-hybrid system, peptide arrays, and heterologous competition assays with synthetic peptides. Two exposed regions in Cyt1Aa, loop beta6-alphaE and part of beta7, bind Cry11Aa. On the other side, Cry11Aa binds Cyt1Aa proteins by means of domain II-loop alpha8 and beta-4, which are also involved in midgut receptor interaction. Characterization of single-point mutations in Cry11Aa and Cyt1Aa revealed key Cry11Aa (S259 and E266) and Cyt1Aa (K198, E204 and K225) residues involved in the interaction of both proteins and in synergism. Additionally, a Cyt1Aa loop beta6-alphaE mutant (K198A) with enhanced synergism to Cry11Aa was isolated. Data provided here strongly indicates that Cyt1Aa synergizes or suppresses resistance to Cry11Aa toxin by functioning as a membrane-bound receptor. Bacillus thuringiensis subsp. israelensis is a highly effective pathogenic bacterium because it produces a toxin and also its functional receptor, promoting toxin binding to the target membrane and causing toxicity. PMID:16339907

  18. A Status Report on the AAS Astronomy Ambassadors Program

    Science.gov (United States)

    Fienberg, Richard Tresch; Fraknoi, Andrew; Gurton, Suzanne; Hurst, Anna; Schatz, Dennis L.

    2014-06-01

    The American Astronomical Society, in partnership with the Astronomical Society of the Pacific (ASP), has launched a series of professional-development workshops and a community of practice designed to improve early-career astronomers’ ability to communicate effectively with students and the public. Called AAS Astronomy Ambassadors, the program provides training and mentoring for young astronomers, from advanced undergraduates to beginning faculty; it also provides them access to resources and a network of contacts within the astronomy education and public outreach (EPO) community. Ambassadors are provided with a library of outreach activities and resource materials suitable for a range of venues and audiences. For much of this library we are using resources developed by organizations such as the ASP, the Pacific Science Center, and the Center for Astronomy Education for other outreach programs, though some resources have been created by one of us (AF) specifically for this program. After a period of evaluation and revision, the program’s “Menu of Outreach Opportunities for Science Education” (MOOSE) is now posted on the AAS website at http://aas.org/outreach/moose-menu-outreach-opportunities-science-education.The first two Astronomy Ambassadors workshops were held at AAS meetings in January 2013 and January 2014; each served 30 young astronomers chosen from about twice that many applicants. Web-based follow-up activities are being provided through a website at the ASP designed to keep cohorts of educators trained in their programs in touch with one another. The AAS is exploring ways to fund additional workshops at future winter meetings; suggestions are most welcome. Meanwhile, the Astronomy Ambassadors trained to date have logged more than 150 outreach events, reaching many thousands of children and adults across the U.S. and Canada.

  19. [Evaluating the performance of the UCLA method for spatially downscaling soil moisture products using three Ts/VI indices].

    Science.gov (United States)

    Ling, Zi-Wei; He, Long-Bin; Zeng, Hui

    2014-02-01

    Soil moisture products derived from microwave remote sensing data are commonly used in the studies of large-scale water resources or climate change. However, the spatial resolutions of these products are usually too coarse to be used in regional- or watershed-scale studies. Therefore, it is necessary to spatially downscale the coarse-resolution soil moisture products for use in regional- or watershed-scale studies. The UCLA method is one of the methods for spatially downscaling soil moisture products. In this method, the spatial indices (Ts/VI indices) calculated from land surface temperature and vegetation index are used as auxiliary variables for spatial downscaling. In this paper, we compared the performance of the UCLA method for spatially downscaling the coarse-resolution AMSR-E soil moisture products, using three Ts/VI indices as auxiliary variables, i. e., the soil wetness index (SW), temperature vegetation dryness index (TVDI), and vegetation temperature condition index (VTCI). These auxiliary variables were calculated from the products of MODIS land surface temperature (MYD11A1) and MODIS vegetation index (MYD13A2). The downscaled results using the three Ts/VI indices were all reasonable. However, the downscaled results using TVDI and VTCI were better than using SW. Therefore, we concluded that TVDI and VTCI are more suitable than SW to be used as the auxiliary variable when applying the UCLA method for downscaling soil moisture products. Finally, we discussed the error sources of applying the UCLA method, such as measurement errors of coarse resolution soil products, calculation errors from spatial indices, and errors from the UCLA method itself, and we also discussed the potential improvements of future research. PMID:24830256

  20. Spatial planning

    OpenAIRE

    Dimitrov, Nikola; Koteski, Cane

    2016-01-01

    The professional book ,, Space planning "processed chapters on: space, concept and definition of space, space as a system, spatial economics, economic essence of space, space planning, social determinants of spatial planning, spatial planning as a process, factors development and elements in spatial planning, methodology, components and content of spatial planning stages and types of preparation of spatial planning, spatial planning and industrialization, industrialization, urbanization and s...

  1. AAS 228: Day 1 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Come visit astrobites at the AAS booth we have swag!Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto hear from undergrads who already know and love the site, educators who want to use it in their classrooms, and students who had not yet been introduced to astrobites and were excited about a new resource!For the rest of the meeting we will be stationed at theAAS booth in the exhibit hall (booth #211-213), so drop by if you want to learn more (or pick up swag: weve got lots of stickers and sunglasses)!Mondaymorning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended this morning.Opening Address(by Susanna Kohler)AAS President Meg Urry kicked off the meeting this morning at 8am with an overview of some of the great endeavors AAS is supporting. We astrobiters had personal motivation to drag ourselves out of bed that early: during this session, Urryannounced the new partnership between AAS and astrobites!Urry touched on some difficult topics in her welcome, including yesterdays tragedy in Orlando. Shereiteratedthe AASs support fortheCommittee for Sexual-Orientation and Gender Minorities in Astronomy (SGMA). She also reminded meeting attendees about the importance ofkeeping conference interactions professional, and pointed to the meetings anti-harassment policy.Partnership Announcement (by Michael Zevin)This morning, the American Astronomical Society announced the new partnership that it will have with Astrobites! We are beyond excited to embark on this new partnership with the

  2. Evaluation of a Global Soil Moisture Product from Finer Spatial Resolution SAR Data and Ground Measurements at Irish Sites

    Directory of Open Access Journals (Sweden)

    Chiara Pratola

    2014-08-01

    Full Text Available In the framework of the European Space Agency Climate Change Initiative, a global, almost daily, soil moisture (SM product is being developed from passive and active satellite microwave sensors, at a coarse spatial resolution. This study contributes to its validation by using finer spatial resolution ASAR Wide Swath and in situ soil moisture data taken over three sites in Ireland, from 2007 to 2009. This is the first time a comparison has been carried out between three sets of independent observations from different sensors at very different spatial resolutions for such a long time series. Furthermore, the SM spatial distribution has been investigated at the ASAR scale within each Essential Climate Variable (ECV pixel, without adopting any particular model or using a densely distributed network of in situ stations. This approach facilitated an understanding of the extent to which geophysical factors, such as soil texture, terrain composition and altitude, affect the retrieved ECV SM product values in temperate grasslands. Temporal and spatial variability analysis provided high levels of correlation (p < 0.025 and low errors between the three datasets, leading to confidence in the new ECV SM global product, despite limitations in its ability to track the driest and wettest conditions.

  3. Evaluation of structure specification in linear mixed models for modeling the spatial effects in tree height-diamater relationships

    Directory of Open Access Journals (Sweden)

    Junfeng Lu

    2013-07-01

    Full Text Available In recent years, linear mixed models (LMM have become more popular to deal with spatial effects in forestry and ecological data. In this study, different structure specifications of linear mixed model were applied to model tree height-diameter relationships, including LMM with random blocks only (LMM-block, LMM with spatial covariance only (LMM-covariance, and the combination of the last two (LMM-block-covariance. Further, the between-group heterogeneous variances were incorporated into LMM-covariance and LMM-block-covariance. The results indicated that, in general, LMM-covariance significantly reduced spatial autocorrelation in model residuals, while LMM-block was effective in dealing with spatial heterogeneity. LMM-block treated the blocks as random effects and avoided the estimation of parameters of the variogram model. Thus, it produced better model predictions than LMM-covariance. LMM-block-covariance took both block effects and spatial covariance into account, and significantly improve model fitting. However, it did not produce better model predictions due to the increase of model complexity and estimation of the local variogram within each block. 

  4. 景观空间感知评价的GIS方法应用研究%Landscape Spatial Perception Evaluation Method and Application Research Based on GIS

    Institute of Scientific and Technical Information of China (English)

    刘增贤; 高峻

    2012-01-01

    Landscape spatial perception is the result of interaction between human and landscape in the range of space, and the process of observer obtaining landscape environment spatial information and the scope of perception. Landscape spatial perception e-valuation emphasizes the unity of landscape aesthetic value and spatial perception; it is of very realistic significance in designing landscape space and select sightseeing positions. However, the current researches of Landscape spatial perception in China are still at the starting stage, which only have few scattered theoretical framework rather than complete set of scientific system. This paper summarizes the development of the landscape spatial perception theories, expounds the theory of the formation factor, and using GIS technology with mathematical methods to quantitatively analyze the impact of spatial perception, puts forward combined system of the geographic information system technology and virtual reality, simulate and quantitatively analyses landscape space perception environment using Virtual Reality Geography Information System, provide technical support for the next step to establish a complete spatial perception of evaluation system.%景观空间感知是在空间范畴内人与景观相互作用的结果,研究观察者对于景观环境空间信息的获取过程与感知阈值.强调景观美学价值与空间感知度的统一,对景观空间设计与观景位置的选择具有现实指导意义.然而,目前对与景观空间感知的研究还处于刚刚起步阶段,并未形成一套完整的科学体系.笔者在景观空间感知理论发展进程的基础上,总结景观空间感知理论的研究内容与研究方法,基于GIS 3维空间分析进行了景观空间感知评价的方法研究,提出将地理信息系统技术与虚拟现实相结合,利用VRGIS对景观空间感知环境进行模拟与定量化分析,为建立完整空间感知评价体系提供方法理论支撑.

  5. Experimental hut evaluation of linalool spatial repellent agar gel against Anopheles gambiae sensu stricto mosquitoes in a semi-field system in Bagamoyo, Tanzania

    OpenAIRE

    Tambwe, Mgeni; Mbeyela, Edgar; Massinda, Brian; Moore, Sarah; Maia, Marta

    2014-01-01

    Background Malaria vector control is in need of new tools to face its current challenges such as the spread of pyrethroid-resistance and the increase of outdoor feeding mosquitoes. New strategies such as spatial repellents need to be evaluated as supplemental tools to existing control measures such as insecticide treated bed nets and indoor residual spraying. Linalool is a naturally occurring terpene alcohol commonly found in flowers and spices with reportedly repellent properties. Methods Fo...

  6. AA, closed orbit observation pickup

    CERN Multimedia

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. Werner Sax contemplates his achievement. See also 8001383, 8010042, 8010045.

  7. AA, closed orbit observation pickup

    CERN Multimedia

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles QFW, at maximum dispersion. See also 8001372, 8001383, 8010045

  8. AA, closed orbit observation pickup

    CERN Multimedia

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. See also 8001372, 8010042, 8010045

  9. AA, closed orbit observation pickup

    CERN Multimedia

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles, QFW, at maximum dispersion. See also 8001372,8001383, 8010042

  10. Ecosystem Services Evaluation and Its Spatial Characteristics in Central Asia’s Arid Regions: A Case Study in Altay Prefecture, China

    Directory of Open Access Journals (Sweden)

    Qi Fu

    2015-06-01

    Full Text Available Ecosystem services are important foundations to realize the sustainable development of economy and society. The question of how to quantitatively evaluate ecosystem services in a scientific way is a hot topic among international researchers. Studying the spatial characteristics of ecosystem services in arid regions can provide the theoretical and practical basis for coordinating a sustainable man-land relationship. Altay Prefecture of China, a typical arid region in Central Asia, was taken as the study area. It is on the Silk Road economic belt, which is a key region in the program of developing Western China. Three ecosystem services: water yield, soil conservation, and net primary productivity were quantitatively evaluated. The results show that (1 the spatial distribution pattern has a distinct characteristic of zonality; (2 mountain zone and mountain-oasis ecotone are the hotspots of ecosystem services; and (3 the correlation between water yield and net primary productivity shows a gradual increasing trend as altitude decreases. Objective analysis from the aspect of mechanism is given by discussing the causes of this particular pattern. It is found that altitude and slope have great influence on spatial distributions of ecosystem services, zones with the most amount of services are distributed in 1.5–2 km-altitude and 15–25°-slope. Different human activities in different regions and spatial distance decay of ecosystem services also contribute to the formation of spatial pattern. Thus, overgrazing, logging and mining are prohibited in mountain zones and mountain-oasis ecotones. Scholars are encouraged to focus on desert-ecosystem services in the future.

  11. A full Bayes before-after study accounting for temporal and spatial effects: Evaluating the safety impact of new signal installations.

    Science.gov (United States)

    Sacchi, Emanuele; Sayed, Tarek; El-Basyouny, Karim

    2016-09-01

    Recently, important advances in road safety statistics have been brought about by methods able to address issues other than the choice of the best error structure for modeling crash data. In particular, accounting for spatial and temporal interdependence, i.e., the notion that the collision occurrence of a site or unit times depend on those of others, has become an important issue that needs further research. Overall, autoregressive models can be used for this purpose as they can specify that the output variable depends on its own previous values and on a stochastic term. Spatial effects have been investigated and applied mostly in the context of developing safety performance functions (SPFs) to relate crash occurrence to highway characteristics. Hence, there is a need for studies that attempt to estimate the effectiveness of safety countermeasures by including the spatial interdependence of road sites within the context of an observational before-after (BA) study. Moreover, the combination of temporal dynamics and spatial effects on crash frequency has not been explored in depth for SPF development. Therefore, the main goal of this research was to carry out a BA study accounting for spatial effects and temporal dynamics in evaluating the effectiveness of a road safety treatment. The countermeasure analyzed was the installation of traffic signals at unsignalized urban/suburban intersections in British Columbia (Canada). The full Bayes approach was selected as the statistical framework to develop the models. The results demonstrated that zone variation was a major component of total crash variability and that spatial effects were alleviated by clustering intersections together. Finally, the methodology used also allowed estimation of the treatment's effectiveness in the form of crash modification factors and functions with time trends.

  12. A full Bayes before-after study accounting for temporal and spatial effects: Evaluating the safety impact of new signal installations.

    Science.gov (United States)

    Sacchi, Emanuele; Sayed, Tarek; El-Basyouny, Karim

    2016-09-01

    Recently, important advances in road safety statistics have been brought about by methods able to address issues other than the choice of the best error structure for modeling crash data. In particular, accounting for spatial and temporal interdependence, i.e., the notion that the collision occurrence of a site or unit times depend on those of others, has become an important issue that needs further research. Overall, autoregressive models can be used for this purpose as they can specify that the output variable depends on its own previous values and on a stochastic term. Spatial effects have been investigated and applied mostly in the context of developing safety performance functions (SPFs) to relate crash occurrence to highway characteristics. Hence, there is a need for studies that attempt to estimate the effectiveness of safety countermeasures by including the spatial interdependence of road sites within the context of an observational before-after (BA) study. Moreover, the combination of temporal dynamics and spatial effects on crash frequency has not been explored in depth for SPF development. Therefore, the main goal of this research was to carry out a BA study accounting for spatial effects and temporal dynamics in evaluating the effectiveness of a road safety treatment. The countermeasure analyzed was the installation of traffic signals at unsignalized urban/suburban intersections in British Columbia (Canada). The full Bayes approach was selected as the statistical framework to develop the models. The results demonstrated that zone variation was a major component of total crash variability and that spatial effects were alleviated by clustering intersections together. Finally, the methodology used also allowed estimation of the treatment's effectiveness in the form of crash modification factors and functions with time trends. PMID:27249403

  13. A size-structured simulation model for evaluating management strategies in gillnet fisheries exploiting spatially differentiated populations.

    NARCIS (Netherlands)

    Pet, J.S.; Machiels, M.A.M.; Densen, van W.L.T.

    1996-01-01

    A length-structured simulation model is presented as a tool in decision making for gillnet fisheries management. The analytical model simulates the fish population dynamics and impact of the fisheries, taking into account size-dependent spatial distribution patterns and migration of the fish. The da

  14. Spatial response surface modelling in the presence of data paucity for the evaluation of potential human health risk due to the contamination of potable water resources.

    Science.gov (United States)

    Liu, Shen; McGree, James; Hayes, John F; Goonetilleke, Ashantha

    2016-10-01

    Potential human health risk from waterborne diseases arising from unsatisfactory performance of on-site wastewater treatment systems is driven by landscape factors such as topography, soil characteristics, depth to water table, drainage characteristics and the presence of surface water bodies. These factors are present as random variables which are spatially distributed across a region. A methodological framework is presented that can be applied to model and evaluate the influence of various factors on waterborne disease potential. This framework is informed by spatial data and expert knowledge. For prediction at unsampled sites, interpolation methods were used to derive a spatially smoothed surface of disease potential which takes into account the uncertainty due to spatial variation at any pre-determined level of significance. This surface was constructed by accounting for the influence of multiple variables which appear to contribute to disease potential. The framework developed in this work strengthens the understanding of the characteristics of disease potential and provides predictions of this potential across a region. The study outcomes presented constitutes an innovative approach to environmental monitoring and management in the face of data paucity. PMID:27277208

  15. Optimization-Based Design of a Small Pneumatic-Actuator-Driven Parallel Mechanism for a Shoulder Prosthetic Arm with Statics and Spatial Accessibility Evaluation

    Directory of Open Access Journals (Sweden)

    Masashi Sekine

    2013-07-01

    Full Text Available Human arms undertake most tasks in the activities of daily living (ADLs. When designing shoulder prostheses for high‐level upper‐limb amputees, we should consider not only how to realize high degrees of freedom under weight and shape constraints but also the user’s individual task space in daily life. An appropriate mechanical structure that can make full use of state‐of‐the‐art actuators and a scheme to optimize the structure’s configuration to match users’ spatial access and manipulability requirements are essential. In our previous research, a small pneumatic‐actuator‐driven parallel mechanism was studied as a shoulder prosthetic arm. In this paper, a systematic procedure is proposed to design the mechanism for a shoulder prosthesis considering force and spatial accessibility. This procedure includes ADL measurements to obtain the task spaces for individual subjects, indexes to evaluate the force and spatial accessibility and an optimization process based on kinematic and statics models. With this approach, the parallel mechanism was optimized for one important ADL task group, considering the trade‐off between its required force and working space. Moreover, it was confirmed that the proposed design procedure could find solutions for various spatial specifications. That is, the approach could be used for individualized shoulder prosthesis design.

  16. Using scaling factors for evaluating spatial and temporal variability of soil hydraulic properties within one elevation transect

    Science.gov (United States)

    Nikodem, Antonín; Kodešová, Radka; Jakšík, Ondřej; Fér, Miroslav; Klement, Aleš

    2016-04-01

    This study was carried out in Southern Moravia, in the Czech Republic. The original soil unit in the wider area is a Haplic Chernozem developed on loess. The intensive agricultural exploitation in combination with terrain morphology has resulted in a highly diversified soil spatial pattern. Nowadays the original soil unit is preserved only on top of relatively flat parts, and is gradually transformed by water erosion up to Regosols on the steepest slopes, while colluvial soils are formed in terrain depressions and at toe slopes due to sedimentation of previously eroded material. Soils within this area has been intensively investigated during the last several years (e.g. Jakšík et al., 2015; Vašát et al., 2014, 2015a,b). Soil sampling (disturbed and undisturbed 100-cm3 soil samples) was performed at 5 points of one elevation transect in November 2010 (after wheat sowing) and August 2011 (after wheat harvest). Disturbed soil samples were used to determine basic soil properties (grain size distribution and organic carbon content etc.). Undisturbed soil samples were used to determine the soil water retention curves and the hydraulic conductivity functions using the multiple outflow tests in Tempe cells and a numerical inversion with HYDRUS 1-D. Scaling factors (alpha-h for pressure head, alpha-theta for soil water contents and alpha-k for hydraulic conductivities) were used here to express soil hydraulic properties variability. Evaluated scaling factors reflected position within the elevation transect as well as time of soil sampling. In general large values of alpha-h, lower values of alpha-k and similar values of alpha-theta were obtained in 2010 in comparison to values obtained in 2011, which indicates development of soil structure during the vegetation season. Jakšík, O., Kodešová, R., Kubiš, A., Stehlíková, I., Drábek, O., Kapička, A. (2015): Soil aggregate stability within morphologically diverse areas. Catena, 127, 287-299. Vašát, R., Kode

  17. AAS 228: Day 3 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  18. AAS 228: Day 3 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  19. Preliminary evaluation of a monolithic detector module for integrated PET/MRI scanner with high spatial resolution

    International Nuclear Information System (INIS)

    The proposal of Mindview European Project concerns with the development of a very high resolution and high efficiency brain dedicated PET scanner simultaneously working with a Magnetic Resonance scanner, that expects to visualize neurotransmitter pathways and their disruptions in the quest to better diagnose schizophrenia. On behalf of this project, we propose a low cost PET module for the first prototype, based on monolithic crystals, suitable to be integrated with a head Radio Frequency (RF) coil. The aim of the suggested module is to achieve high performances in terms of efficiency, planar spatial resolution (expected about 1 mm) and discrimination of gamma Depth Of Interaction (DOI) in order to reduce the parallax error. Our preliminary results are very promising: a DOI resolution of about 3 mm, a spatial resolution ranging from about 1 to 1.5 mm and a good position linearity

  20. Permafrost temperature and active-layer thickness of Yakutia with 0.5 degree spatial resolution for model evaluation

    Directory of Open Access Journals (Sweden)

    C. Beer

    2013-05-01

    Full Text Available Based on the map of landscapes and permafrost conditions in Yakutia (Merzlotno-landshaftnaya karta Yakutskoi0 ASSR, Gosgeodeziya SSSR, 1991, rasterized maps of permafrost temperature and active-layer thickness of Yakutia, East Siberia were derived. The mean and standard deviation at 0.5 degree grid cell size are estimated by assigning a probability density function at 0.001 degree spatial resolution. The gridded datasets can be accessed at the PANGAEA repository (doi:10.1594/PANGAEA.808240. Spatial pattern of both variables are dominated by a climatic gradient from north to south, and by mountains and the soil type distribution. Uncertainties are highest in mountains and in the isolated permafrost zone in the south. The maps are best suited as a benchmark for land surface models which include a permafrost module.

  1. Evaluating the roles of biotransformation, spatial concentration differences, organism home range, and field sampling design on trophic magnification factors.

    Science.gov (United States)

    Kim, Jaeshin; Gobas, Frank A P C; Arnot, Jon A; Powell, David E; Seston, Rita M; Woodburn, Kent B

    2016-05-01

    Trophic magnification factors (TMFs) are field-based measurements of the bioaccumulation behavior of chemicals in food-webs. TMFs can provide valuable insights into the bioaccumulation behavior of chemicals. However, bioaccumulation metrics such as TMF may be subject to considerable uncertainty as a consequence of systematic bias and the influence of confounding variables. This study seeks to investigate the role of systematic bias resulting from spatially-variable concentrations in water and sediments and biotransformation rates on the determination of TMF. For this purpose, a multibox food-web bioaccumulation model was developed to account for spatial concentration differences and movement of organisms on chemical concentrations in aquatic biota and TMFs. Model calculated and reported field TMFs showed good agreement for persistent polychlorinated biphenyl (PCB) congeners and biotransformable phthalate esters (PEs) in a marine aquatic food-web. Model testing showed no systematic bias and good precision in the estimation of the TMF for PCB congeners but an apparent underestimation of model calculated TMFs, relative to reported field TMFs, for PEs. A model sensitivity analysis showed that sampling designs that ignore the presence of concentration gradients may cause systematically biased and misleading TMF values. The model demonstrates that field TMFs are most sensitive to concentration gradients and species migration patterns for substances that are subject to a low degree of biomagnification or trophic dilution. The model is useful in anticipating the effect of spatial concentration gradients on the determination of the TMF; guiding species collection strategies in TMF studies; and interpretation of the results of field bioaccumulation studies in study locations where spatial differences in chemical concentration exist.

  2. A Flare Observed in Coronal, Transition Region and Helium I 10830 \\AA\\ Emissions

    CERN Document Server

    Zeng, Zhicheng; Cao, Wenda; Judge, Philip G

    2014-01-01

    On June 17, 2012, we observed the evolution of a C-class flare associated with the eruption of a filament near a large sunspot in the active region NOAA 11504. We obtained high spatial resolution filtergrams using the 1.6 m New Solar Telescope at the Big Bear Solar Observatory in broad-band TiO at 706 nm (bandpass:10 \\AA) and He I 10830 \\AA\\ narrow-band (bandpass: 0.5 \\AA, centered 0.25 \\AA\\ to the blue). We analyze the spatio-temporal behavior of the He I 10830 \\AA\\ data, which were obtained over a 90" X 90" field of view with a cadence of 10 sec. We also analyze simultaneous data from the Atmospheric Imaging Assembly and Extreme Ultraviolet Variability Experiment instruments on board the Solar Dynamics Observatory spacecraft, and data from Reuven Ramaty High Energy Solar Spectroscopic Imager and GOES spacecrafts. Non-thermal effects are ignored in this analysis. Several quantitative aspects of the data, as well as models derived using the "0D" Enthalpy-Based Thermal Evolution of Loops model (EBTEL: Klimchuk...

  3. Evaluation of Spatial Resolution and Noise Sensitivity of sLORETA Method for EEG Source Localization Using Low-Density Headsets

    CERN Document Server

    Saha, Sajib; Tahtali, Murat; Gureyev, Timur E

    2014-01-01

    Electroencephalography (EEG) has enjoyed considerable attention over the past century and has been applied for diagnosis of epilepsy, stroke, traumatic brain injury and other disorders where 3D localization of electrical activity in the brain is potentially of great diagnostic value. In this study we evaluate the precision and accuracy of spatial localization of electrical activity in the brain delivered by a popular reconstruction technique sLORETA applied to EEG data collected by two commonly used low-density headsets with 14 and 19 measurement channels, respectively. Numerical experiments were performed for a realistic head model obtained by segmentation of MRI images. The EEG source localization study was conducted with a simulated single active dipole, as well as with two spatially separated simultaneously active dipoles, as a function of dipole positions across the neocortex, with several different noise levels in the EEG signals registered on the scalp. The results indicate that while the reconstructio...

  4. The presence of cadmium in the intertidal environments of a moderately impacted coastal lagoon in western Portugal (Óbidos Lagoon)--spatial and seasonal evaluations.

    Science.gov (United States)

    Pedro, Carmen A; Santos, Márcia S S; Ferreira, Susana M F; Gonçalves, Sílvia C

    2016-01-01

    A seasonal environmental monitoring program was carried out (winter 2009 to summer 2010) to evaluate the spatial and seasonal cadmium concentrations in the intertidal environments of the Óbidos Lagoon (Portugal). Also, some environmental parameters were monitored at each sampling station. Both the water and the sediment samples were contaminated, although to different degrees. In general, cadmium contamination appears to be mostly focused on the inner areas of the lagoon, namely, in Barrosa's arm, which receives a small tributary contaminated by agro-industrial activities. Only cadmium concentration in sediment showed to be significantly influenced by seasons. Some environmental parameters presented spatial and temporal heterogeneity which influenced, to some extent, cadmium bioavailability. The results of this study allow a better understanding of the environmental quality of this ecosystem regarding cadmium contamination and may assist in the definition of future coastal management measures specifically targeted to trace metal contamination and pollution monitoring.

  5. SPATIAL STABILITY

    OpenAIRE

    Pascal Mossay

    2004-01-01

    We consider a continuous spatial economy consisting of pure exchange local economies. Agents are allowed to change their location over time as a response to spatial utility differentials. These spatial adjustments toward higher utility neighborhoods lead the spatial economy to converge to a spatially uniform allocation of resources, provided that the matrix of price effects is quasi-negative definite. Furthermore our model provides a real time interpretation of the tâtonnement story. Also, sp...

  6. First circulating beam in the AA

    CERN Multimedia

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.56 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are too numerous to name them all, but the 3 most prominent ones are at the centre (left to right): Roy Billinge (Joint AA Project Leader, with his hand on the control box), Eifionydd Jones (white shirt), Simon van der Meer (spiritus rector and Joint AA Project Leader). The first antiprotons were injected, made to circulate and cooled soon after, on 14 July 1980.

  7. Evaluating and Mapping of Spatial Air Ion Quality Patterns in a Residential Garden Using a Geostatistic Method

    Directory of Open Access Journals (Sweden)

    Wen-Huang Lin

    2011-06-01

    Full Text Available Negative air ions (NAI produce biochemical reactions that increase the levels of the mood chemical serotonin in the environment. Moreover, they benefit both the psychological well being and the human body’s physiological condition. The aim of this research was to estimate and measure the spatial distributions of negative and positive air ions in a residential garden in central Taiwan. Negative and positive air ions were measured at thirty monitoring locations in the study garden from July 2009 to June 2010. Moreover, Kriging was applied to estimate the spatial distribution of negative and positive air ions, as well as the air ion index in the study area. The measurement results showed that the numbers of NAI and PAI differed greatly during the four seasons, the highest and the lowest negative and positive air ion concentrations were found in the summer and winter, respectively. Moreover, temperature was positively affected negative air ions concentration. No matter what temperature is, the ranges of variogram in NAI/PAI were similar during four seasons. It indicated that spatial patterns of NAI/PAI were independent of the seasons and depended on garden elements and configuration, thus the NAP/PAI was a good estimate of the air quality regarding air ions. Kriging maps depicted that the highest negative and positive air ion concentration was next to the waterfall, whereas the lowest air ions areas were next to the exits of the garden. The results reveal that waterscapes are a source of negative and positive air ions, and that plants and green space are a minor source of negative air ions in the study garden. Moreover, temperature and humidity are positively and negatively affected negative air ions concentration, respectively. The proposed monitoring and mapping approach provides a way to effectively assess the patterns of negative and positive air ions in future landscape design projects.

  8. Effect of supplementation of arachidonic acid (AA) or a combination of AA plus docosahexaenoic acid on breastmilk fatty acid composition

    NARCIS (Netherlands)

    Smit, EN; Koopmann, M; Boersma, ER; Muskiet, FAJ

    2000-01-01

    We investigated whether supplementation with arachidonic acid (20:4 omega 6; AA), ora combination of AA and docosahexaenoic acid (22:6 omega 3; DHA) would affect human milk polyunsaturated fatty acid (PUFA) composition. Ten women were daily supplemented with 300 mg AA, eight with 300 mg AA, 110 mg e

  9. Optimization of process parameters for friction Stir welding of dissimilar Aluminum alloys (AA2024 -T6 and AA6351-T6 by using Taguchi method

    Directory of Open Access Journals (Sweden)

    N. Ramanaiah

    2013-01-01

    Full Text Available The present study focused on the Taguchi experimental design technique of Friction Stir Welds of dissimilar aluminum alloys (AA2024-T6 and AA6351-T6 for tensile properties. Effect of process parameters, rotational speed, Traverse speed and axial force, on tensile strength was evaluated. Optimized welding conditions for maximize tensile strength were estimated in order to improve the productivity, weld quality. Non-linear regression mathematical model was developed to correlate the process parameters to tensile strength. The results were verified by conducting the confirmation tests at identified optimum conditions.

  10. Bt rice expressing Cry2Aa does not harm Cyrtorhinus lividipennis, a main predator of the nontarget herbivore Nilapavarta lugens.

    Directory of Open Access Journals (Sweden)

    Yu Han

    Full Text Available T2A-1 is a newly developed transgenic rice that expresses a synthesized cry2Aa gene driven by the maize ubiquitin promoter. T2A-1 exhibits high resistance against lepidopteran pests of rice. The brown planthopper, Nilapavarta lugens (Stål, is a main nontarget sap-sucking insect pest of rice, and Cyrtorhinus lividipennis (Reuter is the major predator of the eggs and young nymphs of planthoppers. As C. lividipennis may expose to the Cry2Aa protein via N. lugens, it is therefore essential to assess the potential effects of transgenic cry2Aa rice on this predator. In the present study, three experiments were conducted to evaluate the ecological risk of transgenic cry2Aa rice to C. lividipennis: (1 a direct feeding experiment in which C. lividipennis was fed an artificial diet containing Cry2Aa at the dose of 10-time higher than that it may encounter in the realistic field condition; (2 a tritrophic experiment in which the Cry2Aa protein was delivered to C. lividipennis indirectly through prey eggs or nymphs; (3 a realistic field experiment in which the population dynamics of C. lividipennis were investigated using vacuum-suction. Both direct exposure to elevated doses of the Cry2Aa protein and prey-mediated exposure to realistic doses of the protein did not result in significant detrimental effects on the development, survival, female ratio and body weight of C. lividipennis. No significant differences in population density and population dynamics were observed between C. lividipennis in transgenic cry2Aa and nontransgenic rice fields. It may be concluded that transgenic cry2Aa rice had no detrimental effects on C. lividipennis. This study represents the first report of an assessment continuum for the effects of transgenic cry2Aa rice on C. lividipennis.

  11. Evaluation of socio-spatial vulnerability of citydwellers and analysis of risk perception: industrial and seismic risks in Mulhouse

    Science.gov (United States)

    Glatron, S.; Beck, E.

    2008-10-01

    Social vulnerability has been studied for years with sociological, psychological and economical approaches. Our proposition focuses on perception and cognitive representations of risks by city dwellers living in a medium size urban area, namely Mulhouse (France). Perception, being part of the social vulnerability and resilience of the society to disasters, influences the potential damage; for example it leads to adequate or inadequate behaviour in the case of an emergency. As geographers, we assume that the spatial relationship to danger or hazard can be an important factor of vulnerability and we feel that the spatial dimension is a challenging question either for better knowledge or for operational reasons (e.g. management of preventive information). We interviewed 491 people, inhabitants and workers, regularly distributed within the urban area to get to know their opinion on hazards and security measures better. We designed and mapped a vulnerability index on the basis of their answers. The results show that the social vulnerability depends on the type of hazard, and that the distance to the source of danger influences the vulnerability, especially for hazards with a precise location (industrial for example). Moreover, the effectiveness of the information campaigns is doubtful, as the people living close to hazardous industries (target of specific preventive information) are surprisingly more vulnerable and less aware of industrial risk.

  12. Evaluating spatial overlap and relatedness of white-tailed deer in a chronic wasting disease management zone.

    Science.gov (United States)

    Magle, Seth B; Samuel, Michael D; Van Deelen, Timothy R; Robinson, Stacie J; Mathews, Nancy E

    2013-01-01

    Wildlife disease transmission, at a local scale, can occur from interactions between infected and susceptible conspecifics or from a contaminated environment. Thus, the degree of spatial overlap and rate of contact among deer is likely to impact both direct and indirect transmission of infectious diseases such chronic wasting disease (CWD) or bovine tuberculosis. We identified a strong relationship between degree of spatial overlap (volume of intersection) and genetic relatedness for female white-tailed deer in Wisconsin's area of highest CWD prevalence. We used volume of intersection as a surrogate for contact rates between deer and concluded that related deer are more likely to have contact, which may drive disease transmission dynamics. In addition, we found that age of deer influences overlap, with fawns exhibiting the highest degree of overlap with other deer. Our results further support the finding that female social groups have higher contact among related deer which can result in transmission of infectious diseases. We suggest that control of large social groups comprised of closely related deer may be an effective strategy in slowing the transmission of infectious pathogens, and CWD in particular.

  13. Evaluating spatial overlap and relatedness of white-tailed deer in a chronic wasting disease management zone.

    Directory of Open Access Journals (Sweden)

    Seth B Magle

    Full Text Available Wildlife disease transmission, at a local scale, can occur from interactions between infected and susceptible conspecifics or from a contaminated environment. Thus, the degree of spatial overlap and rate of contact among deer is likely to impact both direct and indirect transmission of infectious diseases such chronic wasting disease (CWD or bovine tuberculosis. We identified a strong relationship between degree of spatial overlap (volume of intersection and genetic relatedness for female white-tailed deer in Wisconsin's area of highest CWD prevalence. We used volume of intersection as a surrogate for contact rates between deer and concluded that related deer are more likely to have contact, which may drive disease transmission dynamics. In addition, we found that age of deer influences overlap, with fawns exhibiting the highest degree of overlap with other deer. Our results further support the finding that female social groups have higher contact among related deer which can result in transmission of infectious diseases. We suggest that control of large social groups comprised of closely related deer may be an effective strategy in slowing the transmission of infectious pathogens, and CWD in particular.

  14. Evaluating spatial overlap and relatedness of white-tailed deer in a chronic wasting disease management zone

    Science.gov (United States)

    Samuel, Michael D.; Magle, Seth B.; Van Deelen, Timothy R.; Robinson, Stacie J.; Mathews, Nancy E.

    2013-01-01

    Wildlife disease transmission, at a local scale, can occur from interactions between infected and susceptible conspecifics or from a contaminated environment. Thus, the degree of spatial overlap and rate of contact among deer is likely to impact both direct and indirect transmission of infectious diseases such chronic wasting disease (CWD) or bovine tuberculosis. We identified a strong relationship between degree of spatial overlap (volume of intersection) and genetic relatedness for female white-tailed deer in Wisconsin’s area of highest CWD prevalence. We used volume of intersection as a surrogate for contact rates between deer and concluded that related deer are more likely to have contact, which may drive disease transmission dynamics. In addition, we found that age of deer influences overlap, with fawns exhibiting the highest degree of overlap with other deer. Our results further support the finding that female social groups have higher contact among related deer which can result in transmission of infectious diseases. We suggest that control of large social groups comprised of closely related deer may be an effective strategy in slowing the transmission of infectious pathogens, and CWD in particular.

  15. Laboratory Studies for Planetary Sciences. A Planetary Decadal Survey White Paper Prepared by the American Astronomical Society (AAS) Working Group on Laboratory Astrophysics (WGLA)

    CERN Document Server

    Gudipati, The AAS WGLA: Murthy; Brickhouse, Nancy; Cowan, John; Drake, Paul; Federman, Steven; Ferland, Gary; Frank, Adam; Haxton, Wick; Herbst, Eric; Mumma, Michael; Salama, Farid; Savin, Daniel Wolf; Ziurys, Lucy

    2009-01-01

    The WGLA of the AAS (http://www.aas.org/labastro/) promotes collaboration and exchange of knowledge between astronomy and planetary sciences and the laboratory sciences (physics, chemistry, and biology). Laboratory data needs of ongoing and next generation planetary science missions are carefully evaluated and recommended in this white paper submitted by the WGLA to Planetary Decadal Survey.

  16. Friction Stir Weldabilities of AA1050-H24 and AA6061-T6 Aluminum Alloys

    Institute of Scientific and Technical Information of China (English)

    Huijie LIU; Hidetoshi FUJIN; Masakatsu MAEDA; Kiyoshi NOGI

    2005-01-01

    The friction stir weldabilities of the strain-hardened AA1050-H24 and precipitate-hardened AA6061-T6 aluminum alloys were examined to reveal the effects of material properties on the friction stir welding behavior. The experimental results are obtlained. (1) For AA1050-H24, the weld can possess smoother surface ripples; there is no elliptical weld nugget in the weld; there is no discernible interface between the stir zone and the thermomechanically affected zone;and the internal defect of the weld looks like a long crack and is located in the lower part of the weld. (2) For AA6061-T6, the weld usually possesses slightly rougher surface ripples; an elliptical weld nugget clearly exists in the weld; there are discernible interfaces among the weld nugget, thermomechanically affected zone and heat affected zone; and the internal defect of the weld is similar to that of the AA1050-H24 weld. (3) The effective range of welding parameters for AA1050-H24 is narrow, while the one for AA6061-T6 is very wide. (4) The maximum tensile strength efficiency of the AA1050-H24 joints is similar to that of the AA6061-T6 joints, i.e. 79% and 77%, respectively.

  17. Evaluation of Different Change Detection Techniques in Forestry for Improvement of Spatial Objects Extraction Algorithms by Very High Resolution Remote Sensing Digital Imagery

    Science.gov (United States)

    Amiri, N.

    2013-09-01

    Earth observations which are being useable by spatial analysis ability play an important role in detecting, management and solving environmental problems such as climate changes, deforestation, disasters, land use, water resource and carbon cycle. Remote sensing technology in combination with geospatial information system (GIS) can render reliable information on vegetation cover. Satellite Remote sensed data and GIS for land cover/use with its changes is a key to many diverse applications such as Forestry. Change detection can be defined as the process of identifying differences in the state of an object or phenomenon by observing it at different times. The analysis of the spatial extent and temporal change of vegetation cover (Forest) by using remotely sensed data is critically importance to natural resource management sciences. The main aim of this review paper is to go through the different change detection methods and algorithms based on very high resolution remote sensing imagery data, evaluate the quality of the spatial individual crown cover extraction in forests with high density, analyse, compare the results by optimized performance of control data for the same objects to provide the improvement in technique for detection and improve the mathematical sides of the change detection algorithms for high dense forests regions with different boundaries.

  18. The power of alternative assessments (AAs)

    Institute of Scientific and Technical Information of China (English)

    张千茜

    2013-01-01

    This article starts by discussing the potential disadvantages of traditional assessment towards young English as a Second Language (ESL) learners within the American public school education system. In response to such disadvantages, researchers ’call for the implementation of alternative assessments (AAs) is therefore introduced along with the various benefits of AAs. However, the current mainstream education policy in the US, namely No Child Left Behind (NCLB) Policy, is still largely based on the tra-ditional ways of testing, making policy-oriented implementation of AAs on large scales remarkably difficult. After careful analysis, the author points out several implications concerning how, under such an existing policy of NCLB, can practitioners effectively accommodate young ESL learners by applying the power of AAs.

  19. Determination and correlation of spatial distribution of trace elements in normal and neoplastic breast tissues evaluated by {mu}-XRF

    Energy Technology Data Exchange (ETDEWEB)

    Silva, M.P.; Oliveira, M.A.; Poletti, M.E. [Universidade de Sao Paulo (USP),Ribeirao Preto, SP (Brazil)

    2012-07-01

    Full text: Some trace elements, naturally present in breast tissues, participate in a large number of biological processes, which include among others, activation or inhibition of enzymatic reactions and changes on cell membranes permeability, suggesting that these elements may influence carcinogenic processes. Thus, knowledge of the amounts of these elements and their spatial distribution in normal and neoplastic tissues may help in understanding the role of these elements in the carcinogenic process and tumor progression of breast cancers. Concentrations of trace elements like Ca, Fe, Cu and Zn, previously studied at LNLS using TXRF and conventional XRF, were elevated in neoplastic breast tissues compared to normal tissues. In this study we determined the spatial distribution of these elements in normal and neoplastic breast tissues using {mu}-XRF technique. We analyzed 22 samples of normal and neoplastic breast tissues (malignant and benign) obtained from paraffin blocks available for study at the Department of Pathology HC-FMRP/USP. From the blocks, a small fraction of material was removed and subjected to histological sections of 60 {mu}m thick made with a microtome. The slices where placed in holder samples and covered with ultralen film. Tissue samples were irradiated with a white beam of synchrotron radiation. The samples were positioned at 45 degrees with respect to the incident beam on a table with 3 freedom degrees (x, y and z), allowing independent positioning of the sample in these directions. The white beam was collimated by a 20 {mu}m microcapillary and samples were fully scanned. At each step, a spectrum was detected for 10 s. The fluorescence emitted by elements present in the sample was detected by a Si (Li) detector with 165 eV at 5.9 keV energy resolution, placed at 90 deg with respect to the incident beam. Results reveal that trace elements Ca-Zn and Fe-Cu could to be correlated in malignant breast tissues. Quantitative results, achieved by

  20. Evaluation of a spatial rainfall generator and an interpolation methods for the creation of future gridded data sets over complex terrains

    Science.gov (United States)

    Camera, Corrado; Bruggeman, Adriana; Hadjinicolaou, Panos; Michaelides, Silas; Lange, Manfred A.

    2015-04-01

    Space-time variability of precipitation plays a key role as a driver of many processes in different environmental fields like hydrology, ecology, biology, agriculture, and natural hazards. The objective of this study was to compare two approaches for statistical downscaling of precipitation from climate models. The study was applied to the island of Cyprus, an orographically complex terrain. The first approach makes use of a spatial temporal Neyman-Scott Rectangular Pulses (NSRP) model and a previously tested interpolation scheme (Camera et al., 2014). The second approach is based on the use of the single site NSRP model and a simplified gridded scheme based on scaling coefficients obtained from past observations. The rainfall generators were evaluated on the period 1980-2010. Both approaches were subsequently used to downscale three RCMs from the EU ENSEMBLE project to calculate climate projections (2020-2050). The main advantage of the spatial-temporal approach is that it allows creating spatially consistent daily maps of precipitation. On the other hand, due to the assumptions made using a stochastic generator based on homogeneous Poisson processes, it shows a smoothing out of all the rainfall statistics (except mean and variance) all over the study area. This leads to high errors when analyzing indices related to extremes. Examples are the number of days with rainfall over 50 mm (R50 - mean error 65%), the 95th percentile value of rainy days (RT95 - mean error 19%), and the mean annual rainfall recorded on days with rainfall above the 95th percentile (RA95 - mean error 22%). The single site approach excludes the possibility of using the created gridded data sets for case studies involving spatial connection between grid cells (e.g. hydrologic modelling), but it leads to a better reproduction of rainfall statistics and properties. The errors for the extreme indices are in fact much lower: 17% for R50, 4% for RT95, and 2% for RA95. Future projections show a

  1. Dicty_cDB: FCL-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA03 (Link to dictyBase) - - - Contig-U15092-1 FCL-AA03E ...(Link to Original site) - - - - - - FCL-AA03E 627 Show FCL-AA03 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA03Q.Seq.d/ Representative seq. ID FCL-AA...03E (Link to Original site) Representative DNA sequence >FCL-AA03 (FCL-AA03Q) /CSM/FCL/FCL-AA/FCL-AA...03Q.Seq.d/ ACATAATGTTCCAAAAGAAAGCAATTGTTATTGATGGCAAAGGTCATTTGTTAGGTCGTT TAGCCTCCGTTGTTGCTAAATCCCTCCTCTCTGGTCAAAA

  2. Dicty_cDB: FCL-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA02 (Link to dictyBase) - - - Contig-U16560-1 FCL-AA02F ...(Link to Original site) FCL-AA02F 620 - - - - - - Show FCL-AA02 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ Representative seq. ID FCL-AA...02F (Link to Original site) Representative DNA sequence >FCL-AA02 (FCL-AA02Q) /CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ ATTAA...ATACAAAATACAAATACAAATAACAAATACTTTACTATAGCTTTTTTTTCTTATT TATTTCTCCAAATAATTTTTTAATATGCAAATCTTTGTTAAAA

  3. Dicty_cDB: FCL-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA09 (Link to dictyBase) - - - Contig-U16453-1 FCL-AA09F ...(Link to Original site) FCL-AA09F 485 - - - - - - Show FCL-AA09 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ Representative seq. ID FCL-AA...09F (Link to Original site) Representative DNA sequence >FCL-AA09 (FCL-AA09Q) /CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ GACAA...AAGTAAATAAAACATGTCCGCAAGTAATAAAGATGACCAACTCATGAAAAATGAG TTCGAAAGTACCTACGACAAAATTGTCGATTCATTCGACAA

  4. Dicty_cDB: FCL-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA08 (Link to dictyBase) - - - Contig-U16200-1 FCL-AA08Z ...(Link to Original site) - - FCL-AA08Z 574 - - - - Show FCL-AA08 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA08Q.Seq.d/ Representative seq. ID FCL-AA...08Z (Link to Original site) Representative DNA sequence >FCL-AA08 (FCL-AA08Q) /CSM/FCL/FCL-AA/FCL-AA...08Q.Seq.d/ XXXXXXXXXXTCGAAGCCAAAGGTCGTCTCGAAGAAGAATTCCATCGCTCGTACCAACTC TGATCGTTCAAGAAAGAGACTCGAAGCTGAAA

  5. Dicty_cDB: FC-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA09 (Link to dictyBase) - - - Contig-U15086-1 FC-AA09E (Li...nk to Original site) - - - - - - FC-AA09E 562 Show FC-AA09 Library FC (Link to library) Clone ID FC-AA09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA09Q.Seq.d/ Representative seq. ID FC-AA...09E (Link to Original site) Representative DNA sequence >FC-AA09 (FC-AA09Q) /CSM/FC/FC-AA/FC-AA09Q.Seq....d/ GATACATTATCACCATGGCAGGAAAAAAAGTCAAATCTAACACACCAAAACAAGACTTAT CTGTCTCTAAATCAAAGCTCACCAGCATTAAAGCCCCAGCTGCTGCCATCAAAGCTAAA

  6. Dicty_cDB: FC-AA14 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA14 (Link to dictyBase) - - - Contig-U15088-1 FC-AA14E (Li...nk to Original site) - - - - - - FC-AA14E 431 Show FC-AA14 Library FC (Link to library) Clone ID FC-AA14 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA14Q.Seq.d/ Representative seq. ID FC-AA...14E (Link to Original site) Representative DNA sequence >FC-AA14 (FC-AA14Q) /CSM/FC/FC-AA/FC-AA14Q.Seq.d/ CTATGTCTGAAATCAAAA...CTGAAGAACTCGCTTGCATCTACTCCGGTCTTTTATTACAAG ATGACGGTATTGAAATCACCGCTGATAAAATCAAAACCTTATTAGAAGCTGCCAA

  7. Dicty_cDB: FCL-AA04 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA04 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA04Z ...(Link to Original site) - - FCL-AA04Z 530 - - - - Show FCL-AA04 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA04Q.Seq.d/ Representative seq. ID FCL-AA...04Z (Link to Original site) Representative DNA sequence >FCL-AA04 (FCL-AA04Q) /CSM/FCL/FCL-AA/FCL-AA...04Q.Seq.d/ XXXXXXXXXXCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTTCAGTCAAAGAAATT AAAAGAGGTATGGTCGCTGGTGACTCCAAAAACGATCCACCACAAGAAA

  8. Dicty_cDB: FC-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA20 (Link to dictyBase) - - - Contig-U16455-1 FC-AA20Z (Li...nk to Original site) - - FC-AA20Z 607 - - - - Show FC-AA20 Library FC (Link to library) Clone ID FC-AA20 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA20Q.Seq.d/ Representative seq. ID FC-AA...20Z (Link to Original site) Representative DNA sequence >FC-AA20 (FC-AA20Q) /CSM/FC/FC-AA/FC-AA20Q.Seq....d/ XXXXXXXXXXCTTTGCCCCAGCTGGTCTCTCAACTGAAGTCAAATCAGTCGAAATGCATC ACGAACAACTCCCAGAAGCCCGTCCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTT CAGTCAA

  9. Dicty_cDB: FCL-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA15 (Link to dictyBase) - - - Contig-U16011-1 FCL-AA15Z ...(Link to Original site) - - FCL-AA15Z 442 - - - - Show FCL-AA15 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA15Q.Seq.d/ Representative seq. ID FCL-AA...15Z (Link to Original site) Representative DNA sequence >FCL-AA15 (FCL-AA15Q) /CSM/FCL/FCL-AA/FCL-AA...15Q.Seq.d/ XXXXXXXXXXCCATTCATCTGTCCAATCGATTGTCGTCGTGGTCTCTACAAGAATATCGT CTTATCTGGTGGTTCAACCATGTTTAAAGATTTTGGTAAACGTCTTCAA

  10. Dicty_cDB: FC-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA13 (Link to dictyBase) - - - Contig-U15674-1 FC-AA13Z (Li...nk to Original site) - - FC-AA13Z 528 - - - - Show FC-AA13 Library FC (Link to library) Clone ID FC-AA13 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA13Q.Seq.d/ Representative seq. ID FC-AA...13Z (Link to Original site) Representative DNA sequence >FC-AA13 (FC-AA13Q) /CSM/FC/FC-AA/FC-AA13Q.Seq.d/ XXXXXXXXXXAAAGCAAA...CTCGTGCTGGTCAACGTACCCGTTTCAAGGCTTTCGTCGTTG TTGGTGATCACAACGGTCATGTAGGTCTCGGTGTTAAATGCGCTAAGGAA

  11. Dicty_cDB: FCL-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA20 (Link to dictyBase) - - - Contig-U15052-1 FCL-AA20E ...(Link to Original site) - - - - - - FCL-AA20E 1159 Show FCL-AA20 Library FCL (Link to library) Clone ID FCL-AA...L http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ Representative seq. ID FCL-AA...20E (Link to Original site) Representative DNA sequence >FCL-AA20 (FCL-AA20Q) /CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ AAAA...CATTTACAAATGATGACCACAGAAGATGTACAACCAATTGAAACTACCAAAGATGG TGTAGTAGTATTAAATTATAGCGATTTAATTGCAGGTAAA

  12. Dicty_cDB: FC-AA23 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA23 (Link to dictyBase) - - - Contig-U16090-1 FC-AA23E (Li...nk to Original site) - - - - - - FC-AA23E 387 Show FC-AA23 Library FC (Link to library) Clone ID FC-AA23 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA23Q.Seq.d/ Representative seq. ID FC-AA...23E (Link to Original site) Representative DNA sequence >FC-AA23 (FC-AA23Q) /CSM/FC/FC-AA/FC-AA23Q.Seq.d/ AAACTCGATTATATTCTTAA...TCTTAAAGTTCAAGATTTCATGGAAAGACGTCTCCAAACT TTAGTCTTCAAAAATGGTCTTGCCAAATCAATCCATCACGCTCGTGTTTTAATCAAA

  13. Dicty_cDB: FC-AA12 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA12 (Link to dictyBase) - - - Contig-U15087-1 FC-AA12E (Li...nk to Original site) - - - - - - FC-AA12E 454 Show FC-AA12 Library FC (Link to library) Clone ID FC-AA12 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA12Q.Seq.d/ Representative seq. ID FC-AA...12E (Link to Original site) Representative DNA sequence >FC-AA12 (FC-AA12Q) /CSM/FC/FC-AA/FC-AA12Q.Seq.d/ AAATAATAATAATATAAAAA...TGGAAATTAAAGTTTTAGCTAAAAGAAAAGTATCAGCAAA ACGTGCAAATGAAATATTAGGAAAATTTATTTTAGAAAGAAAAGCAAATGAAGAAAA

  14. Dicty_cDB: FC-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA01 (Link to dictyBase) - - - Contig-U15084-1 FC-AA01E (Li...nk to Original site) - - - - - - FC-AA01E 701 Show FC-AA01 Library FC (Link to library) Clone ID FC-AA01 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA01Q.Seq.d/ Representative seq. ID FC-AA...01E (Link to Original site) Representative DNA sequence >FC-AA01 (FC-AA01Q) /CSM/FC/FC-AA/FC-AA01Q.Seq.d/ GAGAAATATTTCTTATTAA...CAATTGCATGCGTTGTATTCAACCCAACATGGTGGAATATT ACAGCAAGAATGGAATATAATGCTAATAAATAACAACCATTTTCTTTACTTCCACAAA

  15. Dicty_cDB: FCL-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA10 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA10Z ...(Link to Original site) - - FCL-AA10Z 627 - - - - Show FCL-AA10 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA10Q.Seq.d/ Representative seq. ID FCL-AA...10Z (Link to Original site) Representative DNA sequence >FCL-AA10 (FCL-AA10Q) /CSM/FCL/FCL-AA/FCL-AA...10Q.Seq.d/ XXXXXXXXXXTAAACCAGGTATGGTCGTCACCTTTTGCCCCAGCTGGTCTCTCAACTGAA GTCAAATCAGTCGAAATGCATCACGAACAACTCCCAGAA

  16. Dicty_cDB: FC-AA19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA19 (Link to dictyBase) - - - Contig-U16072-1 FC-AA19F (Li...nk to Original site) FC-AA19F 539 - - - - - - Show FC-AA19 Library FC (Link to library) Clone ID FC-AA19 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA19Q.Seq.d/ Representative seq. ID FC-AA...19F (Link to Original site) Representative DNA sequence >FC-AA19 (FC-AA19Q) /CSM/FC/FC-AA/FC-AA19Q.Seq.d/ CAGAAA...TCACTGGTTTTTCATTCCAATTATTTAATATTATCAGTATTTGGAATGTTGATC AAACATCATTCAATAGCTACAGTCTTCCAATTTGGTTACCAGCCATTCAA

  17. Dicty_cDB: FC-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA02 (Link to dictyBase) - - - Contig-U16527-1 FC-AA02Z (Li...nk to Original site) - - FC-AA02Z 458 - - - - Show FC-AA02 Library FC (Link to library) Clone ID FC-AA02 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA02Q.Seq.d/ Representative seq. ID FC-AA...02Z (Link to Original site) Representative DNA sequence >FC-AA02 (FC-AA02Q) /CSM/FC/FC-AA/FC-AA02Q.Seq.d/ XXXXXXXXXXCAAAAA...GGCTCCTGGTCCGGAAGGATTGGGTAATCATTTGAATTTCCTAC GTAACTGGGCTTGATCTTTGTAATTATTGATCATAAACGAGGAATTCCTTGTAAGCGTAA

  18. Dicty_cDB: FCL-AA24 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA24 (Link to dictyBase) - - - Contig-U16467-1 FCL-AA24E ...(Link to Original site) - - - - - - FCL-AA24E 779 Show FCL-AA24 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA24Q.Seq.d/ Representative seq. ID FCL-AA...24E (Link to Original site) Representative DNA sequence >FCL-AA24 (FCL-AA24Q) /CSM/FCL/FCL-AA/FCL-AA...24Q.Seq.d/ CTAGAAATTTCTAAACAATTATTTATTTGAAGAGGTTTTTTAAAAAAAGAAAAAAATCAG AGCATCCAAATAATAACCGCAGTAAGGGGGGGATGGTTGTTAA

  19. Dicty_cDB: FCL-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA05 (Link to dictyBase) - - - Contig-U16473-1 FCL-AA05Z ...(Link to Original site) - - FCL-AA05Z 603 - - - - Show FCL-AA05 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA05Q.Seq.d/ Representative seq. ID FCL-AA...05Z (Link to Original site) Representative DNA sequence >FCL-AA05 (FCL-AA05Q) /CSM/FCL/FCL-AA/FCL-AA...05Q.Seq.d/ XXXXXXXXXXTGGCGCCATCATTACTGGTGGAGGTGGTGTTGCTATCACTCAAGCTCAAC CATCATACCAAGCTGATGCCGTTGCCACTTACATCAAAA

  20. Magnetic horn of the Antiproton Accumulator (AA)

    CERN Multimedia

    Photographic Service

    1988-01-01

    In the 1960s, the invention of this "current sheet lens" has helped to greatly improve the flux of neutrino beams. It was used again at the AA, collecting antiprotons from the production target at angles too large to fit into the acceptance of the AA. It was machined from aluminium to a thickness of 1.4 mm and pulsed at 400 kA for 15 microseconds (half-sine).

  1. Evaluating spatial-temporal dynamics of net primary productivity of different forest types in northeastern China based on improved FORCCHN.

    Directory of Open Access Journals (Sweden)

    Junfang Zhao

    Full Text Available An improved individual-based forest ecosystem carbon budget model for China (FORCCHN was applied to investigate the spatial-temporal dynamics of net primary productivity of different forest types in northeastern China. In this study, the forests of northeastern China were categorized into four ecological types according to their habitats and generic characteristics (evergreen broadleaf forest, deciduous broadleaf forest, evergreen needleleaf forest and deciduous needleleaf forest. The results showed that distribution and change of forest NPP in northeastern China were related to the different forest types. From 1981 to 2002, among the forest types in northeastern China, per unit area NPP and total NPP of deciduous broadleaf forest were the highest, with the values of 729.4 gC/(m(2•yr and 106.0 TgC/yr, respectively, followed by mixed broadleaf- needleleaf forest, deciduous needleleaf forest and evergreen needleleaf forest. From 1981 to 2002, per unit area NPP and total NPP of different forest types in northeastern China exhibited significant trends of interannual increase, and rapid increase was found between the 1980s and 1990s. The contribution of the different forest type's NPP to total NPP in northeastern China was clearly different. The greatest was deciduous broadleaf forest, followed by mixed broadleaf- needleleaf forest and deciduous needleleaf forest. The smallest was evergreen needleleaf forest. Spatial difference in NPP between different forest types was remarkable. High NPP values of deciduous needleleaf forest, mixed broadleaf- needleleaf forest and deciduous broadleaf forest were found in the Daxing'anling region, the southeastern of Xiaoxing'anling and Jilin province, and the Changbai Mountain, respectively. However, no regional differences were found for evergreen needleleaf NPP. This study provided not only an estimation NPP of different forest types in northeastern China but also a useful methodology for estimating forest

  2. A spatial entropy reflecting distribution of spatial objects

    Institute of Scientific and Technical Information of China (English)

    Youn-Kyung Jang; Byeong-Seob You; Ho-Seok Kim; Kyoung-Bae Kim; Hae-Young Bae

    2007-01-01

    Decision trees are mainly used to classify data and predict data classes. A spatial decision tree has been designed using Euclidean distance between objects for reflecting spatial data characteristic. Even though this method explains the distance of objects in spatial dimension, it fails to represent distributions of spatial data and their relationships. But distributions of spatial data and relationships with their neighborhoods are very important in real world. This paper proposes decision tree based on spatial entropy that represents distributions of spatial data with dispersion and dissimilarity. The rate of dispersion by dissimilarity presents how related distribution of spatial data and non-spatial attributes. The experiment evaluates the accuracy and building time of decision tree as compared to previous methods and it shows that the proposed method makes efficient and scalable classification for spatial decision support.

  3. Spatial Sense.

    Science.gov (United States)

    Del Grande, John

    1990-01-01

    Describes seven spatial abilities related to mathematics including eye-motor coordination, figure-ground perception, perceptual constancy, position-in-space perception, perception of spatial relationships, visual discrimination, and visual memory. Discusses the relationship of the spatial abilities to the study of geometry. Lists 19 references.…

  4. Quantitative evaluation of the lactate signal loss and its spatial dependence in press localized (1)H NMR spectroscopy.

    Science.gov (United States)

    Jung, W I; Bunse, M; Lutz, O

    2001-10-01

    Localized (1)H NMR spectroscopy using the 90 degrees -t(1)-180 degrees -t(1)+t(2)-180 degrees -t(2)-Acq. PRESS sequence can lead to a signal loss for the lactate doublet compared with signals from uncoupled nuclei which is dependent on the choice of t(1) and t(2). The most striking signal loss of up to 78% of the total signal occurs with the symmetrical PRESS sequence (t(1)=t(2)) at an echo time of 2/J (approximately 290 ms). Calculations have shown that this signal loss is related to the pulse angle distributions produced by the two refocusing pulses which leads to the creation of single quantum polarization transfer (PT) as well as to not directly observable states (NDOS) of the lactate AX(3) spin system: zero- and multiple-quantum coherences, and longitudinal spin orders. In addition, the chemical shift dependent voxel displacement (VOD) leads to further signal loss. By calculating the density operator for various of the echo times TE=n/J, n=1, 2, 3,..., we calculated quantitatively the contributions of these effects to the signal loss as well as their spatial distribution. A maximum signal loss of 75% can be expected from theory for the symmetrical PRESS sequence and TE=2/J for Hamming filtered sinc pulses, whereby 47% are due to the creation of NDOS and up to 28% arise from PT. Taking also the VOD effect into account (2 mT/m slice selection gradients, 20-mm slices) leads to 54% signal loss from NDOS and up to 24% from PT, leading to a maximum signal loss of 78%. Using RE-BURP pulses with their more rectangular pulse angle distributions reduces the maximum signal loss to 44%. Experiments at 1.5 T using a lactate solution demonstrated a maximum lactate signal loss for sinc pulses of 82% (52% NDOS, 30% PT) at TE=290 ms using the symmetrical PRESS sequence. The great signal loss and its spatial distribution is of importance for investigations using a symmetrical PRESS sequence at TE=2/J. PMID:11567573

  5. Quantitative Evaluation of the Lactate Signal Loss and Its Spatial Dependence in PRESS Localized 1H NMR Spectroscopy

    Science.gov (United States)

    Jung, Wulf-Ingo; Bunse, Michael; Lutz, Otto

    2001-10-01

    Localized 1H NMR spectroscopy using the 90°-t1-180°-t1+t2-180°-t2-Acq. PRESS sequence can lead to a signal loss for the lactate doublet compared with signals from uncoupled nuclei which is dependent on the choice of t1 and t2. The most striking signal loss of up to 78% of the total signal occurs with the symmetrical PRESS sequence (t1=t2) at an echo time of 2/J (≃290 ms). Calculations have shown that this signal loss is related to the pulse angle distributions produced by the two refocusing pulses which leads to the creation of single quantum polarization transfer (PT) as well as to not directly observable states (NDOS) of the lactate AX3 spin system: zero- and multiple-quantum coherences, and longitudinal spin orders. In addition, the chemical shift dependent voxel displacement (VOD) leads to further signal loss. By calculating the density operator for various of the echo times TE=n/J, n=1, 2, 3, …, we calculated quantitatively the contributions of these effects to the signal loss as well as their spatial distribution. A maximum signal loss of 75% can be expected from theory for the symmetrical PRESS sequence and TE=2/J for Hamming filtered sinc pulses, whereby 47% are due to the creation of NDOS and up to 28% arise from PT. Taking also the VOD effect into account (2 mT/m slice selection gradients, 20-mm slices) leads to 54% signal loss from NDOS and up to 24% from PT, leading to a maximum signal loss of 78%. Using RE-BURP pulses with their more rectangular pulse angle distributions reduces the maximum signal loss to 44%. Experiments at 1.5 T using a lactate solution demonstrated a maximum lactate signal loss for sinc pulses of 82% (52% NDOS, 30% PT) at TE=290 ms using the symmetrical PRESS sequence. The great signal loss and its spatial distribution is of importance for investigations using a symmetrical PRESS sequence at TE=2/J.

  6. Investigation and Evaluation of the open source ETL tools GeoKettle and Talend Open Studio in terms of their ability to process spatial data

    Science.gov (United States)

    Kuhnert, Kristin; Quedenau, Jörn

    2016-04-01

    Integration and harmonization of large spatial data sets is not only since the introduction of the spatial data infrastructure INSPIRE a big issue. The process of extracting and combining spatial data from heterogeneous source formats, transforming that data to obtain the required quality for particular purposes and loading it into a data store, are common tasks. The procedure of Extraction, Transformation and Loading of data is called ETL process. Geographic Information Systems (GIS) can take over many of these tasks but often they are not suitable for processing large datasets. ETL tools can make the implementation and execution of ETL processes convenient and efficient. One reason for choosing ETL tools for data integration is that they ease maintenance because of a clear (graphical) presentation of the transformation steps. Developers and administrators are provided with tools for identification of errors, analyzing processing performance and managing the execution of ETL processes. Another benefit of ETL tools is that for most tasks no or only little scripting skills are required so that also researchers without programming background can easily work with it. Investigations on ETL tools for business approaches are available for a long time. However, little work has been published on the capabilities of those tools to handle spatial data. In this work, we review and compare the open source ETL tools GeoKettle and Talend Open Studio in terms of processing spatial data sets of different formats. For evaluation, ETL processes are performed with both software packages based on air quality data measured during the BÄRLIN2014 Campaign initiated by the Institute for Advanced Sustainability Studies (IASS). The aim of the BÄRLIN2014 Campaign is to better understand the sources and distribution of particulate matter in Berlin. The air quality data are available in heterogeneous formats because they were measured with different instruments. For further data analysis

  7. Analysis of Resource and Emission Impacts: An Emergy-Based Multiple Spatial Scale Framework for Urban Ecological and Economic Evaluation

    Directory of Open Access Journals (Sweden)

    Lixiao Zhang

    2011-03-01

    Full Text Available The development of the complex and multi-dimensional urban socio-economic system creates impacts on natural capital and human capital, which range from a local to a global scale. An emergy-based multiple spatial scale analysis framework and a rigorous accounting method that can quantify the values of human-made and natural capital losses were proposed in this study. With the intent of comparing the trajectory of Beijing over time, the characteristics of the interface between different scales are considered to explain the resource trade and the impacts of emissions. In addition, our improved determination of emergy analysis and acceptable management options that are in agreement with Beijing’s overall sustainability strategy were examined. The results showed that Beijing’s economy was closely correlated with the consumption of nonrenewable resources and exerted rising pressure on the environment. Of the total emergy use by the economic system, the imported nonrenewable resources from other provinces contribute the most, and the multi‑scale environmental impacts of waterborne and airborne pollution continued to increase from 1999 to 2006. Given the inputs structure, Beijing was chiefly making greater profits by shifting resources from other provinces in China and transferring the emissions outside. The results of our study should enable urban policy planners to better understand the multi-scale policy planning and development design of an urban ecological economic system.

  8. AAS 228: Day 3 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session 2015 Newton Lacy Pierce Prize Lecture: The Elephant in the Room: Effects of Distant, Massive Companions on Planetary System Architectures (by Leonardo dos Santos)The first session on Wednesday at 228th AAS Meeting was the Newton Lacy Pierce Prize Lecture by Heather Knutson (California Institute of Technology). This talk featured a broad range of research efforts on exoplanets, with the main focus on how we study the composition of their atmospheres, and how multi-body interactions carve the structure of the planetary systems we observe.One of her first points is the well-known idea that the Solar System is an oddball, compared to the exoplanet systems we have found so far: most of these systems contain hot Jupiters and mini-Neptunes at very close-in orbits around their host stars. Moreover, even when studying their transmission spectra, it is difficult to know the exact composition of their atmospheres.Knutson: it is difficult to constrain atmospheric composition of exoplanets (H-poor or H-rich+clouds?) #aas228pic.twitter.com/LdyN4o9RC7 astrobites (@astrobites) June 15, 2016The main proposal on how these systems formed is the migration scenario. In order to validate this idea, Dr. Knutson and her group The Friends of Hot Jupiters study systems with close-in gas giants and their frequency of binary companions, which are supposed to be the main culprits causing gas-giant migration. They found that approximately half of the observed systems have long-distance companions, providing strong validation of the migration scenario. Moreover, Dr. Knutson speculates that wide binaries have more

  9. Multicomponent He I 10830 {\\AA} profiles in an active filament

    CERN Document Server

    Sasso, C; Solanki, S K

    2011-01-01

    We present new spectropolarimetric observations of the chromospheric He I 10830 {\\AA} multiplet observed in a filament during its phase of activity. The data were recorded with the new Tenerife Infrared Polarimeter (TIP-II) at the German Vacuum Tower Telescope (VTT) on 2005 May 18. We inverted the He Stokes profiles using multiple atmospheric components. The observed He Stokes profiles display a remarkably wide variety of shapes. Most of the profiles show very broad Stokes I absorptions and complex and spatially variable Stokes V signatures. The inversion of the profiles shows evidence of different atmospheric blue- and redshifted components of the He I lines within the resolution element (1 arcsec), with supersonic velocities of up to 100 km/s. Up to five different atmospheric components are found in the same profile. We show that even these complex profiles can be reliably inverted.

  10. AAS 228: Day 1 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session: From Space Archeology to Serving the World Today: A 20-year Journey from the Jungles of Guatemala to a Network of Satellite Remote Sensing Facilities Around the World(by Michael Zevin)In the conferences second plenary session, NASAs Daniel Irwin turned the eyes of the conference back to Earth by highlighting the huge impact that NASA missions play in protecting and developing our own planet.Daniel Irwin: using satellite imagery to detect differences in vegetation and find ancient Mayan cities. #aas228 pic.twitter.com/9LFPQdCHTM astrobites (@astrobites) June 13, 2016Irwin came to be involved in NASA through his work mapping Guatemalan jungles, where he would spend 22 days at a time exploring the treacherous jungles on foot armed with a 1st generation GPS, a compass, and a machete. A colleague introduced Irwin to the satellite imagery thathe was exploring, demonstratinghow these images are a strong complement to field work. The sharing of this satellite data with nearby villages helped to show the encroachment of agriculture and the necessity of connecting space to the village. Satellite imagery also played a role in archeological endeavors, uncovering dozens of Mayan cities that have been buried for over a millennia by vegetation, and it provided evidence that the fall of the Mayan civilization may have been due to massive deforestation that ledto drought.Glacial retreat in Chile imaged by ISERV.Irwin displayed the constellation of NASAs Earth-monitoring satellites that have played an integral role in conserving our planet and alerting the world of natural disasters. He also showed

  11. Assessing regional environmental quality by integrated use of remote sensing, GIS, and spatial multi-criteria evaluation for prioritization of environmental restoration.

    Science.gov (United States)

    Rahman, Md Rejaur; Shi, Z H; Chongfa, Cai

    2014-11-01

    This study was an attempt to analyse the regional environmental quality with the application of remote sensing, geographical information system, and spatial multiple criteria decision analysis and, to project a quantitative method applicable to identify the status of the regional environment of the study area. Using spatial multi-criteria evaluation (SMCE) approach with expert knowledge in this study, an integrated regional environmental quality index (REQI) was computed and classified into five levels of regional environment quality viz. worse, poor, moderate, good, and very good. During the process, a set of spatial criteria were selected (here, 15 criterions) together with the degree of importance of criteria in sustainability of the regional environment. Integrated remote sensing and GIS technique and models were applied to generate the necessary factors (criterions) maps for the SMCE approach. The ranking, along with expected value method, was used to standardize the factors and on the other hand, an analytical hierarchy process (AHP) was applied for calculating factor weights. The entire process was executed in the integrated land and water information system (ILWIS) software tool that supports SMCE. The analysis showed that the overall regional environmental quality of the area was at moderate level and was partly determined by elevation. Areas under worse and poor quality of environment indicated that the regional environmental status showed decline in these parts of the county. The study also revealed that the human activities, vegetation condition, soil erosion, topography, climate, and soil conditions have serious influence on the regional environment condition of the area. Considering the regional characteristics of environmental quality, priority, and practical needs for environmental restoration, the study area was further regionalized into four priority areas which may serve as base areas of decision making for the recovery, rebuilding, and

  12. Assessing regional environmental quality by integrated use of remote sensing, GIS, and spatial multi-criteria evaluation for prioritization of environmental restoration.

    Science.gov (United States)

    Rahman, Md Rejaur; Shi, Z H; Chongfa, Cai

    2014-11-01

    This study was an attempt to analyse the regional environmental quality with the application of remote sensing, geographical information system, and spatial multiple criteria decision analysis and, to project a quantitative method applicable to identify the status of the regional environment of the study area. Using spatial multi-criteria evaluation (SMCE) approach with expert knowledge in this study, an integrated regional environmental quality index (REQI) was computed and classified into five levels of regional environment quality viz. worse, poor, moderate, good, and very good. During the process, a set of spatial criteria were selected (here, 15 criterions) together with the degree of importance of criteria in sustainability of the regional environment. Integrated remote sensing and GIS technique and models were applied to generate the necessary factors (criterions) maps for the SMCE approach. The ranking, along with expected value method, was used to standardize the factors and on the other hand, an analytical hierarchy process (AHP) was applied for calculating factor weights. The entire process was executed in the integrated land and water information system (ILWIS) software tool that supports SMCE. The analysis showed that the overall regional environmental quality of the area was at moderate level and was partly determined by elevation. Areas under worse and poor quality of environment indicated that the regional environmental status showed decline in these parts of the county. The study also revealed that the human activities, vegetation condition, soil erosion, topography, climate, and soil conditions have serious influence on the regional environment condition of the area. Considering the regional characteristics of environmental quality, priority, and practical needs for environmental restoration, the study area was further regionalized into four priority areas which may serve as base areas of decision making for the recovery, rebuilding, and

  13. A Framework for the Evaluation of Marine Spatial Data Infrastructures – Accompanied by International Case-Studies

    Directory of Open Access Journals (Sweden)

    Seip Christian

    2016-06-01

    Full Text Available Germany is currently developing a marine data infrastructure addressing different topics such as coastal engineering, hydrography and surveying, protection of the marine environment, maritime conservation, regional planning, and coastal research. This undertaking is embedded in a series of regulations and developments at many administrative levels, from which specifications and courses of action are derived. To set up a conceptual framework for the marine data infrastructure of Germany (MDI-DE, scientists at the Chair for Geodesy and Geoinformatics at the Rostock University are building a reference model, evaluating meta-information systems and developing models to support common workflows in marine applications.

  14. Modeling Spatial Sustainability: Spatial Welfare Economics versus Ecological Footprint

    OpenAIRE

    Grazi, Fabio; Van Den Bergh, Jeroen C.J.M.; Rietveld, Piet

    2006-01-01

    A spatial welfare framework for the analysis of the spatial dimensions of sustainability is developed. It incorporates agglomeration effects, interregional trade, negative environmental externalities and various land use categories. The model is used to compare rankings of spatial configurations according to evaluations based on social welfare and ecological footprint indicators. Five spatial configurations are considered for this purpose. The exercise is operationalized with the help of a tw...

  15. A web-based multicriteria evaluation of spatial trade-offs between environmental and economic implications from hydraulic fracturing in a shale gas region in Ohio.

    Science.gov (United States)

    Liu, X; Gorsevski, P V; Yacobucci, M M; Onasch, C M

    2016-06-01

    Planning of shale gas infrastructure and drilling sites for hydraulic fracturing has important spatial implications. The evaluation of conflicting and competing objectives requires an explicit consideration of multiple criteria as they have important environmental and economic implications. This study presents a web-based multicriteria spatial decision support system (SDSS) prototype with a flexible and user-friendly interface that could provide educational or decision-making capabilities with respect to hydraulic fracturing site selection in eastern Ohio. One of the main features of this SDSS is to emphasize potential trade-offs between important factors of environmental and economic ramifications from hydraulic fracturing activities using a weighted linear combination (WLC) method. In the prototype, the GIS-enabled analytical components allow spontaneous visualization of available alternatives on maps which provide value-added features for decision support processes and derivation of final decision maps. The SDSS prototype also facilitates nonexpert participation capabilities using a mapping module, decision-making tool, group decision module, and social media sharing tools. The logical flow of successively presented forms and standardized criteria maps is used to generate visualization of trade-off scenarios and alternative solutions tailored to individual user's preferences that are graphed for subsequent decision-making.

  16. Evaluation of the spatial patterns and risk factors, including backyard pigs, for classical swine fever occurrence in Bulgaria using a Bayesian model

    Directory of Open Access Journals (Sweden)

    Beatriz Martínez-López

    2014-05-01

    Full Text Available The spatial pattern and epidemiology of backyard pig farming and other low bio-security pig production systems and their role in the occurrence of classical swine fever (CSF is described and evaluated. A spatial Bayesian model was used to explore the risk factors, including human demographics, socioeconomic and environmental factors. The analyses were performed for Bulgaria, which has a large number of backyard farms (96% of all pig farms in the country are classified as backyard farms, and it is one of the countries for which both backyard pig and farm counts were available. Results reveal that the high-risk areas are typically concentrated in areas with small family farms, high numbers of outgoing pig shipments and low levels of personal consumption (i.e. economically deprived areas. Identification of risk factors and high-risk areas for CSF will allow to targeting risk-based surveillance strategies leading to prevention, control and, ultimately, elimination of the disease in Bulgaria and other countries with similar socio-epidemiological conditions.

  17. A web-based multicriteria evaluation of spatial trade-offs between environmental and economic implications from hydraulic fracturing in a shale gas region in Ohio.

    Science.gov (United States)

    Liu, X; Gorsevski, P V; Yacobucci, M M; Onasch, C M

    2016-06-01

    Planning of shale gas infrastructure and drilling sites for hydraulic fracturing has important spatial implications. The evaluation of conflicting and competing objectives requires an explicit consideration of multiple criteria as they have important environmental and economic implications. This study presents a web-based multicriteria spatial decision support system (SDSS) prototype with a flexible and user-friendly interface that could provide educational or decision-making capabilities with respect to hydraulic fracturing site selection in eastern Ohio. One of the main features of this SDSS is to emphasize potential trade-offs between important factors of environmental and economic ramifications from hydraulic fracturing activities using a weighted linear combination (WLC) method. In the prototype, the GIS-enabled analytical components allow spontaneous visualization of available alternatives on maps which provide value-added features for decision support processes and derivation of final decision maps. The SDSS prototype also facilitates nonexpert participation capabilities using a mapping module, decision-making tool, group decision module, and social media sharing tools. The logical flow of successively presented forms and standardized criteria maps is used to generate visualization of trade-off scenarios and alternative solutions tailored to individual user's preferences that are graphed for subsequent decision-making. PMID:27230428

  18. The AA disappearing under concrete shielding

    CERN Multimedia

    1982-01-01

    When the AA started up in July 1980, the machine stood freely in its hall, providing visitors with a view through the large window in the AA Control Room. The target area, in which the high-intensity 26 GeV/c proton beam from the PS hit the production target, was heavily shielded, not only towards the outside but also towards the AA-Hall. However, electrons and pions emanating from the target with the same momentum as the antiprotons, but much more numerous, accompanied these through the injection line into the AA ring. The pions decayed with a half-time corresponding to approximately a revolution period (540 ns), whereas the electrons lost energy through synchrotron radiation and ended up on the vacuum chamber wall. Electrons and pions produced the dominant component of the radiation level in the hall and the control room. With operation times far exceeding original expectations, the AA had to be buried under concrete shielding in order to reduce the radiation level by an order of magnitude.

  19. Toward a simultaneous description of $R_{AA}$ and $v_2$ for heavy quarks

    CERN Document Server

    Das, Santosh K; Plumari, Salvatore; Greco, Vincenzo

    2016-01-01

    The two key observables related to heavy quarks that have been measured in RHIC and LHC energies are the nuclear suppression factor $R_{AA}$ and the elliptic flow $v_2$. Simultaneous description of these two observables is a top challenge for all the existing models. We have highlighted how a consistent combination of four ingredients i.e the temperature dependence of the energy loss, full solution of the Boltzmann collision integral for the momentum evolution of heavy quark, hadronization by coalescence, then the hadronic rescattering, responsible to address a large part of such a puzzle. We have considered four different models to evaluate the temperature dependence of drag coefficients of the heavy quark in QGP. All these four different models are set to reproduce the same $R_{AA}$ as of the experiments. We have shown that for the same $R_{AA}$, the $v_2$ could be quite different depending on the interaction dynamics as well as other ingredients.

  20. Design and technical evaluation of an enhanced location-awareness service enabler for spatial disorientation management of elderly with mild cognitive impairment.

    Science.gov (United States)

    Moreno, Pedro A; Hernando, M Elena; Gómez, Enrique J

    2015-01-01

    The progressive ageing of population has turned the mild cognitive impairment (MCI) into a prevalent disease suffered by elderly. Consequently, the spatial disorientation has become a significant problem for older people and their caregivers. The ambient-assisted living applications are offering location-based services for empowering elderly to go outside and encouraging a greater independence. Therefore, this paper describes the design and technical evaluation of a location-awareness service enabler aimed at supporting and managing probable wandering situations of a person with MCI. Through the presence capabilities of the IP multimedia subsystem (IMS) architecture, the service will alert patient's contacts if a hazardous situation is detected depending on his location. Furthermore, information about the older person's security areas has been included in the user profile managed by IMS. In doing so, the service enabler introduced contribute to "context-awareness" paradigm allowing the adaptation and personalization of services depending on user's context and specific conditions or preferences.

  1. Application of water quality index to evaluate groundwater quality (temporal and spatial variation) of an intensively exploited aquifer (Puebla valley, Mexico).

    Science.gov (United States)

    Salcedo-Sánchez, Edith R; Garrido Hoyos, Sofía E; Esteller Alberich, Ma Vicenta; Martínez Morales, Manuel

    2016-10-01

    The spatial and temporal variation of water quality in the urban area of the Puebla Valley aquifer was evaluated using historical and present data obtained during this investigation. The current study assessed water quality based on the Water Quality Index developed by the Canadian Council of Ministers of the Environment (CCME-WQI), which provides a mathematical framework to evaluate the quality of water in combination with a set of conditions representing quality criteria, or limits. This index is flexible regarding the type and number of variables used by the evaluation given that the variables of interest are selected according to the characteristics and objectives of development, conservation and compliance with regulations. The CCME-WQI was calculated using several variables that assess the main use of the wells in the urban area that is public supply, according to criteria for human use and consumption established by Mexican law and international standards proposed by the World Health Organization. The assessment of the index shows a gradual deterioration in the quality of the aquifer over time, as the amount of wells with excellent quality have decreased and those with lower index values (poor quality) have increased throughout the urban area of the Puebla Valley aquifer. The parameters affecting groundwater quality are: total dissolved solids, sulfate, calcium, magnesium and total hardness. PMID:27645142

  2. Application of water quality index to evaluate groundwater quality (temporal and spatial variation) of an intensively exploited aquifer (Puebla valley, Mexico).

    Science.gov (United States)

    Salcedo-Sánchez, Edith R; Garrido Hoyos, Sofía E; Esteller Alberich, Ma Vicenta; Martínez Morales, Manuel

    2016-10-01

    The spatial and temporal variation of water quality in the urban area of the Puebla Valley aquifer was evaluated using historical and present data obtained during this investigation. The current study assessed water quality based on the Water Quality Index developed by the Canadian Council of Ministers of the Environment (CCME-WQI), which provides a mathematical framework to evaluate the quality of water in combination with a set of conditions representing quality criteria, or limits. This index is flexible regarding the type and number of variables used by the evaluation given that the variables of interest are selected according to the characteristics and objectives of development, conservation and compliance with regulations. The CCME-WQI was calculated using several variables that assess the main use of the wells in the urban area that is public supply, according to criteria for human use and consumption established by Mexican law and international standards proposed by the World Health Organization. The assessment of the index shows a gradual deterioration in the quality of the aquifer over time, as the amount of wells with excellent quality have decreased and those with lower index values (poor quality) have increased throughout the urban area of the Puebla Valley aquifer. The parameters affecting groundwater quality are: total dissolved solids, sulfate, calcium, magnesium and total hardness.

  3. A GIS TOOL TO EVALUATE THE SPATIAL EVOLUTION OF HYDRO-THERMIC FEATURES DURING GROWING SEASON OF VEGETABLE CROPS IN ELBE RIVER LOWLAND (POLABI

    Directory of Open Access Journals (Sweden)

    VERA POTOP

    2012-11-01

    Full Text Available A GIS tool to evaluate the spatial evolution of hydro-thermic features during growing season of vegetable crops in Elbe River lowland (Polabi. This article presents the results of the first study on combined mezoclimatological, microclimatological and topographical tools for evaluating precision farming in the growth of vegetable crops in the Elbe River lowland (Polabi region from the Czech Republic. We assess the variability of basically climatological characteristics in relation to topographic characteristics at the regional (Polabi and local (agricultural farm scales. At regional scale, interpolation approach is based on local linear regression and universal kriging interpolation. At local scale, two conventional interpolation methods, spline and local ordinary kriging with a Gaussian model variance across the fields, were applied. The local spline interpolators have been used in developing digital elevation models (DEMs and to determine the slope angle inclination of vegetable fields. The DEMs of the vegetable crops fields was developed at a 10 m x 10 m resolution based on elevation data collected in the field by a hand-held RTK- Global Positioning System receiver. This tool allowed the distinction of microclimatic conditions that produce altitude-slope-related patterns of the spatial-temporal distribution of the basic meteorological elements during growing season of vegetable crops. The effect of slope on diurnal extreme temperatures in the vegetable cropped field conditions was more pronounced than that of elevation. Accordingly to developed maps, the warmest and longest duration of sunshine, and the least precipitation totals during growing season occurred in the middle part of Polabi.

  4. Clinical Evaluation of Spatial Accuracy of a Fusion Imaging Technique Combining Previously Acquired Computed Tomography and Real-Time Ultrasound for Imaging of Liver Metastases

    International Nuclear Information System (INIS)

    Purpose: This study was designed to evaluate the spatial accuracy of matching volumetric computed tomography (CT) data of hepatic metastases with real-time ultrasound (US) using a fusion imaging system (VNav) according to different clinical settings. Methods: Twenty-four patients with one hepatic tumor identified on enhanced CT and US were prospectively enrolled. A set of three landmarks markers was chosen on CT and US for image registration. US and CT images were then superimposed using the fusion imaging display mode. The difference in spatial location between the tumor visible on the CT and the US on the overlay images (reviewer no. 1, comment no. 2) was measured in the lateral, anterior–posterior, and vertical axis. The maximum difference (Dmax) was evaluated for different predictive factors.CT performed 1–30 days before registration versus immediately before. Use of general anesthesia for CT and US versus no anesthesia.Anatomic landmarks versus landmarks that include at least one nonanatomic structure, such as a cyst or a calcificationResultsOverall, Dmax was 11.53 ± 8.38 mm. Dmax was 6.55 ± 7.31 mm with CT performed immediately before VNav versus 17.4 ± 5.18 with CT performed 1–30 days before (p < 0.0001). Dmax was 7.05 ± 6.95 under general anesthesia and 16.81 ± 6.77 without anesthesia (p < 0.0015). Landmarks including at least one nonanatomic structure increase Dmax of 5.2 mm (p < 0.0001). The lowest Dmax (1.9 ± 1.4 mm) was obtained when CT and VNav were performed under general anesthesia, one immediately after the other. Conclusions: VNav is accurate when adequate clinical setup is carefully selected. Only under these conditions (reviewer no. 2), liver tumors not identified on US can be accurately targeted for biopsy or radiofrequency ablation using fusion imaging.

  5. Land drainage system detection using IR and visual imagery taken from autonomous mapping airship and evaluation of physical and spatial parameters of suggested method

    Science.gov (United States)

    Koska, Bronislav; Křemen, Tomáš; Štroner, Martin; Pospíšil, Jiří; Jirka, Vladimír.

    2014-10-01

    An experimental approach to the land drainage system detection and its physical and spatial parameters evaluation by the form of pilot project is presented in this paper. The novelty of the approach is partly based on using of unique unmanned aerial vehicle - airship with some specific properties. The most important parameters are carrying capacity (15 kg) and long flight time (3 hours). A special instrumentation was installed for physical characteristic testing in the locality too. The most important is 30 meter high mast with 3 meter length bracket at the top with sensors recording absolute and comparative temperature, humidity and wind speed and direction in several heights of the mast. There were also installed several measuring units recording local condition in the area. Recorded data were compared with IR images taken from airship platform. The locality is situated around village Domanín in the Czech Republic and has size about 1.8 x 1.5 km. There was build a land drainage system during the 70-ties of the last century which is made from burnt ceramic blocks placed about 70 cm below surface. The project documentation of the land drainage system exists but real state surveying haveńt been never realized. The aim of the project was land surveying of land drainage system based on infrared, visual and its combination high resolution orthophotos (10 cm for VIS and 30 cm for IR) and spatial and physical parameters evaluation of the presented procedure. The orthophoto in VIS and IR spectrum and its combination seems to be suitable for the task.

  6. AAS Nova and Astrobites: Making current astronomy research accessible

    Science.gov (United States)

    Kohler, Susanna; Astrobites Team

    2016-10-01

    AAS Nova and Astrobites are two resources available for astronomers, astronomy students, and astronomy enthusiasts to keep up with some of the most recent research published across the field of astronomy. Both supported by the AAS, these two daily astrophysical literature blogs provide accessible summaries of recent publications on the arXiv and in AAS journals. We present the goals, content, and readership of AAS Nova and Astrobites, and discuss how they might be used as tools in the undergraduate classroom.

  7. Spatial variability of POPs in European background air

    Directory of Open Access Journals (Sweden)

    A. K. Halse

    2011-02-01

    Full Text Available Passive air samplers (PAS were deployed at 86 European background sites during summer 2006 in order (i to gain further insight into spatial patterns of persistent organic pollutants (POPs in European background air and, (ii to evaluate PAS as an alternative sampling technique under EMEP (Co-operative programme for monitoring and evaluation of the long-range transmissions of air pollutants in Europe. The samples were analyzed for selected PCBs, HCHs, DDTs, HCB, PAHs and chlordanes, and air concentrations were calculated on the basis of losses of performance reference compounds. Air concentrations of PCBs were generally lowest in more remote areas of northern Europe with elevated levels in more densely populated areas. γ-HCH was found at elevated levels in more central parts of Europe, whereas α-HCH, β-HCH and DDTs showed higher concentrations in the south-eastern part. There was no clear spatial pattern in the concentrations for PAHs, indicative of influence by local sources, rather than long range atmospheric transport (LRAT. HCB was evenly distributed across Europe, while the concentrations of chlordanes were typically low or non-detectable. A comparison of results obtained on the basis of PAS and active air sampling (AAS illustrated that coordinated PAS campaigns have the potential serve as useful inter-comparison exercises within and across existing monitoring networks. The results also highlighted limitations of the current EMEP measurement network with respect to spatial coverage. We finally adopted an existing Lagrangian transport model (FLEXPART as recently modified to incorporate key processes relevant for POPs to evaluate potential source regions affecting observed concentrations at selected sites. Using PCB-28 as an example, the model predicted concentrations which agreed within a factor of 3 with PAS measurements for all except 1 out of the 17 sites selected for this analysis.

  8. Spatial-temporal water quality parameters evaluation of the Santa Rita river (BA with respect to the release of manipueira

    Directory of Open Access Journals (Sweden)

    Franklin Delano Porto Júnior

    2012-12-01

    Full Text Available The watershed of the river Santa Rita includes the towns of Simão and Campinhos, where exists about 150 flour houses. Campinhos is among the largest cassava processing facilities in the region, generating many direct and indirect jobs. Manipueira is a liquid residue originating from the cassava pressing and presents high pollutant potential due to its high amount of glucose and fructose, this potential is 25 times greater than the one from domestic sewer. This work had as objective the evaluation of possible impacts of manipueira release in the water quality of Santa Rita river. For this, the land use map was elaborated and the physiographic characterization developed, besides being performed six campaigns for water samples collection in four sampling points along the river. The obtained results indicated that the watershed is elongated, with low drainage efficiency and it is not prone to flooding. Estimated water quality parameters indicated that organic effluents from Campinhos and Simão impact the values of dissolved oxygen, electrical conductivity, salinity, ammonia, nitrite, nitrate and zinc, suggesting that the water quality of the river Santa Rita is affected by manipueira release. The concentrations of total phosphorus, iron and cooper were superior downstream of the Sewer Treatment Station. The river water was saline in the three sampling points most affected by the release of manipueira.

  9. Dicty_cDB: FC-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA03 (Link to dictyBase) - - - Contig-U15331-1 FC-AA03P (Li...nk to Original site) FC-AA03F 595 FC-AA03Z 546 FC-AA03P 1141 - - Show FC-AA03 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA03Q.Seq.d/ Representative seq. ID FC-AA...03P (Link to Original site) Representative DNA sequence >FC-AA03 (FC-AA03Q) /CSM/FC/FC-AA/FC-AA03Q.Seq.d/ AA...AATGTCATCTTATTTATTCACTAGTGAATCCGTCACCGAAGTCATCCAGATAAAATCT GTGATCAAGTATCAGATGCTGTTCTCGATGCTTGTTTAGCTCAA

  10. Dicty_cDB: FC-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA10 (Link to dictyBase) - - - Contig-U16358-1 FC-AA10P (Li...nk to Original site) FC-AA10F 659 FC-AA10Z 544 FC-AA10P 1203 - - Show FC-AA10 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA10Q.Seq.d/ Representative seq. ID FC-AA...10P (Link to Original site) Representative DNA sequence >FC-AA10 (FC-AA10Q) /CSM/FC/FC-AA/FC-AA10Q.Seq.d/ AA...ATGACTACCTTTAACGAATATCCATTCTTGGCTGAATTAGGCATTAAAGCTGAAAATA ATGATGGAGTCTTCAATGGAAAATGGGGAGGTGCTGGTGAAATCATCAA

  11. Spatial Operations

    Directory of Open Access Journals (Sweden)

    Anda VELICANU

    2010-09-01

    Full Text Available This paper contains a brief description of the most important operations that can be performed on spatial data such as spatial queries, create, update, insert, delete operations, conversions, operations on the map or analysis on grid cells. Each operation has a graphical example and some of them have code examples in Oracle and PostgreSQL.

  12. Spatializing Time

    DEFF Research Database (Denmark)

    Thomsen, Bodil Marie Stavning

    2011-01-01

    The article analyses some of artist Søren Lose's photographic installations in which time, history and narration is reflected in the creation of allegoric, spatial relations.......The article analyses some of artist Søren Lose's photographic installations in which time, history and narration is reflected in the creation of allegoric, spatial relations....

  13. Flow Injection and Atomic Absorption Spectrometry (FI-AAS) -

    DEFF Research Database (Denmark)

    Hansen, Elo Harald

    1996-01-01

    of (especially HG- forming) elements. In the words of the one of the authorities of AAS and foremost pioneers of FI-AAS - Professor Z. L. Fang, who is the author on two recently published monographs on this hyphenated technique - the impact of FI on AAS is "so dramatic" that it has brought "new vitality...

  14. Design and evaluation of an innovative MRI-compatible Braille stimulator with high spatial and temporal resolution.

    Science.gov (United States)

    Debowska, Weronika; Wolak, Tomasz; Soluch, Pawel; Orzechowski, Mateusz; Kossut, Malgorzata

    2013-02-15

    Neural correlates of Braille reading have been widely studied with different neuroimaging techniques. Nevertheless, the exact brain processes underlying this unique activity are still unknown, due to suboptimal accuracy of imaging and/or stimuli delivery methods. To study somatosensory perception effectively, the stimulation must reflect parameters of the natural stimulus and must be applied with precise timing. In functional magnetic resonance imaging (fMRI) providing these characteristics requires technologically advanced solutions and there have been several successful direct tactile stimulation devices designed that allow investigation of somatotopic organization of brain sensory areas. They may, however, be of limited applicability in studying brain mechanisms related to such distinctive tactile activity as Braille reading. In this paper we describe the design and experimental evaluation of an innovative MRI-compatible Braille Character Stimulator (BCS) enabling precise and stable delivery of standardized Braille characters with high temporal resolution. Our device is fully programmable, flexible in stimuli delivery and can be easily implemented in any research unit. The Braille Character Stimulator was tested with a same-different discrimination task on Braille characters during an event-related fMRI experiment in eleven right-handed sighted adult subjects. The results show significant activations in several cortical areas, including bilateral primary (SI) and secondary somatosensory (SII) cortices, bilateral premotor and supplementary motor areas, inferior frontal gyri, inferior temporal gyri and precuneus, as well as contralateral (to the stimulated hand) thalamus. The results validate the use of the BCS as a method of effective stimuli application in fMRI studies, in both sighted and visually impaired subjects.

  15. First evaluation of drug-resistant Mycobacterium tuberculosis clinical isolates from Congo revealed misdetection of fluoroquinolone resistance by line probe assay due to a double substitution T80A-A90G in GyrA.

    Directory of Open Access Journals (Sweden)

    Alexandra Aubry

    Full Text Available BACKGROUND: Tuberculosis (TB is one of the major public health problems in Congo. However, data concerning Mycobacterium tuberculosis drug resistance are lacking because of the insufficient processing capacity. So, the aim of this study was to investigate for the first time the resistance patterns and the strain lineages of a sample of M. tuberculosis complex (MTBC isolates collected in the two main cities of Congo. METHODS: Over a 9-day period, 114 smear-positive sputa isolated from 114 patients attending centers for the diagnosis and treatment of TB in Brazzaville and Pointe Noire were collected for culture and drug susceptibility testing (DST. Detection of mutations conferring drug resistance was performed by using line probe assays (GenoType MTBDRplus and MTBDRsl and DNA sequencing. Strain lineages were determined by MIRU-VNTR genotyping. RESULTS: Of the 114 sputa, 46 were culture positive for MTBC. Twenty-one (46% were resistant to one or more first-line antiTB drugs. Of these, 15 (71% were multidrug resistant (MDR. The most prevalent mutations involved in rifampin and isoniazid resistance, D516V (60% in rpoB and S315T (87% in katG respectively, were well detected by MTBDRplus assay. All the 15 MDR strains were susceptible to fluoroquinolone and injectable second-line drug. No mutation was detected in the rrs locus involved in resistance to amikacin and capreomycin by both the MTBDRsl assay and DNA sequencing. By contrast, 9 MDR strains belonging to the same cluster related to T-family were identified as being falsely resistant to fluoroquinolone by the MTBDRsl assay due to the presence of a double substitution T80A-A90G in GyrA. CONCLUSIONS: Taken together, these data revealed a possible spread of a particular MDR clone in Congo, misidentified as fluoroquinolone resistant by MTBDRsl assay. Thus, this test cannot replace gold-standard culture method and should be interpreted carefully in view of the patient's native land.

  16. AAS 228: Day 2 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  17. AAS 228: Day 2 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  18. AAS 228: Day 2 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  19. Evaluation to Obtain the Image According to the Spatial Domain Filtering of Various Convolution Kernels in the Multi-Detector Row Computed Tomography

    International Nuclear Information System (INIS)

    Our objective was to evaluate the image of spatial domain filtering as an alternative to additional image reconstruction using different kernels in MDCT. Derived from thin collimated source images were generated using water phantom and abdomen B10(very smooth), B20(smooth), B30(medium smooth), B40 (medium), B50(medium sharp), B60(sharp), B70(very sharp) and B80(ultra sharp) kernels. MTF and spatial resolution measured with various convolution kernels. Quantitative CT attenuation coefficient and noise measurements provided comparable HU(Hounsfield) units in this respect. CT attenuation coefficient(mean HU) values in the water were values in the water were 1.1∼1.8 HU, air(-998∼-1000 HU) and noise in the water(5.4∼44.8 HU), air(3.6∼31.4 HU). In the abdominal fat a CT attenuation coefficient(-2.2∼0.8 HU) and noise(10.1∼82.4 HU) was measured. In the abdominal was CT attenuation coefficient(53.3∼54.3 HU) and noise(10.4∼70.7 HU) in the muscle and in the liver parenchyma of CT attenuation coefficient(60.4∼62.2 HU) and noise (7.6∼63.8 HU) in the liver parenchyma. Image reconstructed with a convolution kernel led to an increase in noise, whereas the results for CT attenuation coefficient were comparable. Image scanned with a high convolution kernel(B80) led to an increase in noise, whereas the results for CT attenuation coefficient were comparable. Image medications of image sharpness and noise eliminate the need for reconstruction using different kernels in the future. Adjusting CT various kernels, which should be adjusted to take into account the kernels of the CT undergoing the examination, may control CT images increase the diagnostic accuracy.

  20. Evaluating habitat associations of a fish assemblage at multiple spatial scales in a minimally disturbed stream using low-cost remote sensing

    Science.gov (United States)

    Cheek, Brandon D.; Grabowski, Timothy B.; Bean, Preston T.; Groeschel, Jillian R.; Magnelia, Stephan J.

    2016-01-01

    Habitat heterogeneity at multiple scales is a major factor affecting fish assemblage structure. However, assessments that examine these relationships at multiple scales concurrently are lacking. The lack of assessments at these scales is a critical gap in understanding as conservation and restoration efforts typically work at these levels.A combination of low-cost side-scan sonar surveys, aerial imagery using an unmanned aerial vehicle, and fish collections were used to evaluate the relationship between physicochemical and landscape variables at various spatial scales (e.g. micro-mesohabitat, mesohabitat, channel unit, stream reach) and stream–fish assemblage structure and habitat associations in the South Llano River, a spring-fed second-order stream on the Edwards Plateau in central Texas during 2012–2013.Low-cost side-scan sonar surveys have not typically been used to generate data for riverscape assessments of assemblage structure, thus the secondary objective was to assess the efficacy of this approach.The finest spatial scale (micro-mesohabitat) and the intermediate scale (channel unit) had the greatest explanatory power for variation in fish assemblage structure.Many of the fish endemic to the Edwards Plateau showed similar associations with physicochemical and landscape variables suggesting that conservation and restoration actions targeting a single endemic species may provide benefits to a large proportion of the endemic species in this system.Low-cost side-scan sonar proved to be a cost-effective means of acquiring information on the habitat availability of the entire river length and allowed the assessment of how a full suite of riverscape-level variables influenced local fish assemblage structure.

  1. Evaluation of TRMM Multi-satellite Precipitation Analysis (TMPA performance in the Central Andes region and its dependency on spatial and temporal resolution

    Directory of Open Access Journals (Sweden)

    M. L. M. Scheel

    2011-08-01

    Full Text Available Climate time series are of major importance for base line studies for climate change impact and adaptation projects. However, for instance, in mountain regions and in developing countries there exist significant gaps in ground based climate records in space and time. Specifically, in the Peruvian Andes spatially and temporally coherent precipitation information is a prerequisite for ongoing climate change adaptation projects in the fields of water resources, disasters and food security. The present work aims at evaluating the ability of Tropical Rainfall Measurement Mission (TRMM Multi-satellite Precipitation Analysis (TMPA to estimate precipitation rates at daily 0.25° × 0.25° scale in the Central Andes and the dependency of the estimate performance on changing spatial and temporal resolution. Comparison of the TMPA product with gauge measurements in the regions of Cuzco, Peru and La Paz, Bolivia were carried out and analysed statistically. Large biases are identified in both investigation areas in the estimation of daily precipitation amounts. The occurrence of strong precipitation events was well assessed, but their intensities were underestimated. TMPA estimates for La Paz show high false alarm ratio.

    The dependency of the TMPA estimate quality with changing resolution was analysed by comparisons of 1-, 7-, 15- and 30-day sums for Cuzco, Peru. The correlation of TMPA estimates with ground data increases strongly and almost linearly with temporal aggregation. The spatial aggregation to 0.5°, 0.75° and 1° grid box averaged precipitation and its comparison to gauge data of the same areas revealed no significant change in correlation coefficients and estimate performance.

    In order to profit from the TMPA combination product on a daily basis, a procedure to blend it with daily precipitation gauge measurements is proposed.

    Different sources of errors and uncertainties introduced by the sensors, sensor

  2. Evaluation of TRMM Multi-satellite Precipitation Analysis (TMPA performance in the Central Andes region and its dependency on spatial and temporal resolution

    Directory of Open Access Journals (Sweden)

    M. L. M. Scheel

    2010-10-01

    Full Text Available Climate time series are of major importance for base line studies for climate change impact and adaptation projects. However, in mountain regions and in developing countries there exist significant gaps in ground based climate records in space and time. Specifically, in the Peruvian Andes spatially and temporally coherent precipitation information is a prerequisite for ongoing climate change adaptation projects in the fields of water resources, disasters and food security. The present work aims at evaluating the ability of Tropical Rainfall Measurement Mission (TRMM Multi-satellite Precipitation Analysis (TMPA to estimate precipitation rates at daily 0.25° × 0.25° scale in the Central Andes and the dependency of the estimate performance on changing spatial and temporal resolution. Comparison of the TMPA product with gauge measurements in the regions of Cuzco, Peru and La Paz, Bolivia were carried out and analysed statistically. Large biases are identified in both investigation areas in the estimation of daily precipitation amounts. The occurrence of strong precipitation events was well assessed, but their intensities were underestimated. TMPA estimates for La Paz show high false alarm ratio.

    The dependency of the TMPA estimate quality with changing resolution was analysed by comparisons of 1-, 7-, 15- and 30-day sums for Cuzco, Peru. The correlation of TMPA estimates with ground data increases strongly and almost linearly with temporal aggregation. The spatial aggregation to 0.5°, 0.75° and 1° grid box averaged precipitation and its comparison to gauge data of the same areas revealed no significant change in correlation coefficients and estimate performance.

    In order to profit from the TMPA combination product on a daily basis, a procedure to blend it with daily precipitation gauge measurements is proposed.

    Different sources of errors and uncertainties introduced by the sensors, sensor-specific algorithm aspects

  3. AAS 228: Day 2 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  4. AA, vacuum tank for stochastic precooling

    CERN Multimedia

    1979-01-01

    The vaccum tank in which the fast stochastic precooling kicker was installed. It is clad with heating jackets for bake-out to 200 deg C, indispensable for reaching the operational vacuum of 7E-11 Torr. Alain Poncet, responsible for AA vacuum, is looking on. See also 7910268, 8002234.

  5. AA, mating of BST magnet halves

    CERN Multimedia

    1980-01-01

    The AA had 2 types of bending magnets: BLG (window-frame,long and narrow) and BST (H-type, short and wide). The BST had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the mating of two BST halves.

  6. Relative accuracy of spatial predictive models for lynx Lynx canadensis derived using logistic regression-AIC, multiple criteria evaluation and Bayesian approaches

    Institute of Scientific and Technical Information of China (English)

    Hejun KANG; Shelley M.ALEXANDER

    2009-01-01

    We compared probability surfaces derived using one set of environmental variables in three Geographic Information Systems (GIS) -based approaches: logistic regression and Akaike's Information Criterion (AIC),Multiple Criteria Evaluation (MCE),and Bayesian Analysis (specifically Dempster-Shafer theory). We used lynx Lynx canadensis as our focal species,and developed our environment relationship model using track data collected in Banff National Park,Alberta,Canada,during winters from 1997 to 2000. The accuracy of the three spatial models were compared using a contingency table method. We determined the percentage of cases in which both presence and absence points were correctly classified (overall accuracy),the failure to predict a species where it occurred (omission error) and the prediction of presence where there was absence (commission error). Our overall accuracy showed the logistic regression approach was the most accurate (74.51% ). The multiple criteria evaluation was intermediate (39.22%),while the Dempster-Shafer (D-S) theory model was the poorest (29.90%). However,omission and commission error tell us a different story: logistic regression had the lowest commission error,while D-S theory produced the lowest omission error. Our results provide evidence that habitat modellers should evaluate all three error measures when ascribing confidence in their model. We suggest that for our study area at least,the logistic regression model is optimal. However,where sample size is small or the species is very rare,it may also be useful to explore and/or use a more ecologically cautious modelling approach (e.g. Dempster-Shafer) that would over-predict,protect more sites,and thereby minimize the risk of missing critical habitat in conservation plans.

  7. Processing and Optimization of Dissimilar Friction Stir Welding of AA 2219 and AA 7039 Alloys

    Science.gov (United States)

    Venkateswarlu, D.; Nageswara rao, P.; Mahapatra, M. M.; Harsha, S. P.; Mandal, N. R.

    2015-12-01

    The present paper discusses the optimization of dissimilar friction stir welding of AA 2219 and AA 7039 alloys with respect to tool design issues including microstructural study of weld. The optimized ultimate tensile strength was ~280 MPa, and % elongation was ~11.5. It was observed that the extent of tool shoulder flat surface and tool rotational speed influenced the weld quality significantly. A mathematical model was also developed using response surface regression analysis to predict the effects of tool geometry and process variables on dissimilar AA 2219 and AA 7039 alloys welds. The microstructure evolution and mechanical properties were investigated by employing electron backscatter diffraction technique, Vickers microhardness, and tensile testing, respectively. The microstructural observations indicated that the grain size obtained at advancing side (AA 2219 alloy side) was much finer compared to the retreating side (AA 7039 alloy side). Hardness distribution in the stir zone was inhomogeneous, which might be due to inadequate mixing of weld zone material. The hardness values observed at the weld zone were lower than that in the base materials.

  8. Dicty_cDB: FC-AA11 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA11 (Link to dictyBase) - - - Contig-U16273-1 FC-AA11P (Li...nk to Original site) FC-AA11F 631 FC-AA11Z 502 FC-AA11P 1133 - - Show FC-AA11 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA11Q.Seq.d/ Representative seq. ID FC-AA...11P (Link to Original site) Representative DNA sequence >FC-AA11 (FC-AA11Q) /CSM/FC/FC-AA/FC-AA...11Q.Seq.d/ GGTGAATTAATTGTTGAACCAGTTGATCAAAAATATATTTTCAAGACTGAACGTAAAGTT CCAAGAATGGGTGTTATGATTGTTGGTTTATGTGGTAACAATGGTACAA

  9. Dicty_cDB: FC-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA18 (Link to dictyBase) - - - Contig-U15943-1 FC-AA18P (Li...nk to Original site) FC-AA18F 506 FC-AA18Z 293 FC-AA18P 799 - - Show FC-AA18 Library FC (Link to library) Clone ID FC-AA...al site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA18Q.Seq.d/ Representative seq. ID FC-AA...18P (Link to Original site) Representative DNA sequence >FC-AA18 (FC-AA18Q) /CSM/FC/FC-AA/FC-AA18Q.Seq.d/ AAA...AGATAGAGAAGAAAGAAAACTTGAACGTGAGAAGGAACTTGAACGTGAACGTGAGAA AGAACTTGAGCGTGAGCGTGAACGTGAACAACGTCGTCTTGAAA

  10. Dicty_cDB: FCL-AA07 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA07 (Link to dictyBase) - - - Contig-U14973-1 FCL-AA07P ...(Link to Original site) FCL-AA07F 527 FCL-AA07Z 253 FCL-AA07P 780 - - Show FCL-AA07 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA07Q....Seq.d/ Representative seq. ID FCL-AA07P (Link to Original site) Representative DNA sequence >FCL-AA07 (FCL-AA07Q) /CSM/FCL/FCL-AA.../FCL-AA07Q.Seq.d/ CAAAATAAAAAATGTTATCAAATTTTTTAAAAGTCAACAGTAAAGCACTAGGACATATAA GAACTTTTGCCTCAAAGAGTGGTGAAATTAAA

  11. Dicty_cDB: FCL-AA12 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA12 (Link to dictyBase) - - - Contig-U16034-1 FCL-AA12P ...(Link to Original site) FCL-AA12F 629 FCL-AA12Z 540 FCL-AA12P 1169 - - Show FCL-AA12 Library FCL (Link to library) Clone ID FCL-AA...4-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA12Q....Seq.d/ Representative seq. ID FCL-AA12P (Link to Original site) Representative DNA sequence >FCL-AA12 (FCL-AA12Q) /CSM/FCL/FCL-AA.../FCL-AA12Q.Seq.d/ ATCAAATGTTTATTCAACAACAACCATCAGATTCAATTGTTTGTAATCGTTATATTCATC CAGCCATTGTTGTTTTGGTTGACCAA

  12. Dicty_cDB: FCL-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA21 (Link to dictyBase) - - - Contig-U14936-1 FCL-AA21P ...(Link to Original site) FCL-AA21F 520 FCL-AA21Z 356 FCL-AA21P 876 - - Show FCL-AA21 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA21Q....Seq.d/ Representative seq. ID FCL-AA21P (Link to Original site) Representative DNA sequence >FCL-AA21 (FCL-AA21Q) /CSM/FCL/FCL-AA.../FCL-AA21Q.Seq.d/ ATCATAATCATATATTTTTAATAGATATTGATATATATATTTAAAAAAATAAAATAAAAT AAAATAAAAAATGTCAACAGAGGAAACAAAAA

  13. Dicty_cDB: FCL-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA01 (Link to dictyBase) - - - Contig-U16033-1 FCL-AA01P ...(Link to Original site) FCL-AA01F 603 FCL-AA01Z 411 FCL-AA01P 1014 - - Show FCL-AA01 Library FCL (Link to library) Clone ID FCL-AA...3-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA01Q....Seq.d/ Representative seq. ID FCL-AA01P (Link to Original site) Representative DNA sequence >FCL-AA01 (FCL-AA01Q) /CSM/FCL/FCL-AA.../FCL-AA01Q.Seq.d/ GCAAATAATAATATTATGGGTATTGACTTTGGTACACATTTCGCATGTGTTGGTATTTTC AAGAATGAAAGAATTGAAATCTGTCCAAA

  14. Dicty_cDB: FCL-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA13 (Link to dictyBase) - - - - FCL-AA13P (Link to Original site) FCL-AA...13F 635 FCL-AA13Z 350 FCL-AA13P 985 - - Show FCL-AA13 Library FCL (Link to library) Clone ID FCL-AA...dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ Representative seq. ID FCL-AA...13P (Link to Original site) Representative DNA sequence >FCL-AA13 (FCL-AA13Q) /CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ CATATTTATAA...TTATATCTTTTTTGTTTAATAAAAAAGAAAGAATACCAACATGAGACTT TTATTGTGTTTAATTTTCTTAGTTTTTGTTTTCAATTTTGCATTATCAA

  15. Dicty_cDB: FC-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA06 (Link to dictyBase) - - - Contig-U15909-1 FC-AA06P (Li...nk to Original site) FC-AA06F 532 FC-AA06Z 501 FC-AA06P 1033 - - Show FC-AA06 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA06Q.Seq.d/ Representative seq. ID FC-AA...06P (Link to Original site) Representative DNA sequence >FC-AA06 (FC-AA06Q) /CSM/FC/FC-AA/FC-AA...06Q.Seq.d/ GTGAATATAACGATTTAGATTTAGTGTATGATAAAGATGTTTATCAAAAATTAATAGAGA ATGGTGTAGATTCATTATTATCAAAA

  16. Dicty_cDB: FC-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA08 (Link to dictyBase) - - - Contig-U15942-1 FC-AA08P (Li...nk to Original site) FC-AA08F 620 FC-AA08Z 510 FC-AA08P 1130 - - Show FC-AA08 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA08Q.Seq.d/ Representative seq. ID FC-AA...08P (Link to Original site) Representative DNA sequence >FC-AA08 (FC-AA08Q) /CSM/FC/FC-AA/FC-AA...08Q.Seq.d/ ATCAGTTACATGTACTGCACCAGTTAATATTGCAGTTATCAAATATTGGGGAAAGAGAGA TGAAAATATTATTTTACCATTAAATTCATCACTCAGTGGAA

  17. Justice… spatiale !

    OpenAIRE

    Gervais-Lambony, Philippe; Dufaux, Frédéric

    2009-01-01

    International audience The notion of spatial justice was developed by Anglo-Saxon radical geographyin the 1970’s. Today it is often used in different contexts, mostly within thefield of urban studies. The central idea in this paper is to demonstrate thata revisited form of the concept of « spatial justice » may be used to promoteinteraction between the very diverse contemporary approaches of geography atevery scale. The theoretical background of political philosophy is presented first,we t...

  18. Mechanical properties of aluminium–copper–lithium alloy AA2195 at cryogenic temperatures

    International Nuclear Information System (INIS)

    Highlights: • 4 mm thick sheet of AA2195 was imparted T87 temper. • 7% cold work to impart T87 was given by combination of cold rolling and stretching. • Mechanical properties were evaluated at RT and cryogenic temperatures. • Strength of AA2195 are superior to the conventional aluminum alloy 2219 at all temperatures. • Strength decreases with decrease in temperature whereas ductility remains unchanged. - Abstract: Tensile testing was performed on a 4 mm thick sheet of the aluminum–lithium alloy AA2195 in T87 (solution treatment + water quenching + 7% cold work + peak aging) temper which was subjected to 7% cold working by combination of cold rolling and stretching, over a temperature range from ambient to liquid hydrogen (20 K) conditions. Properties were evaluated in longitudinal as well as transverse directions to characterize anisotropy with respect to strength and ductility. Strength and ductility were compared to the conventional aluminum alloy AA2219-T87, developed for similar cryogenic applications. Decreases in test temperature led to higher strengths with little or no change in ductility. As the temperature decreases, the differences between ultimate tensile strength as well as yield strength for two different combinations of cold roll and stretch studied in the present work, narrows down and become equal at 20 K

  19. Fatigue behavior of GMAW welded Aluminium alloy AA7020; Comportamiento a fatiga de uniones soldadas GMAW de la aleacion de aluminio AA 7020

    Energy Technology Data Exchange (ETDEWEB)

    Bloem, C. A.; Salvador, M. D.; Amigo, V.; Vicente, A.

    2007-07-01

    The aim of this investigation is to evaluate the influence on the fatigue behavior by the finishing of the bulge in a welded aluminium-zinc-magnesium alloy AA7020. It was determined that total or partial elimination of the bulge has very little influence on its behavior, giving a very similar result on both cases, where one is better than the other by only 3%. (Author) 20 refs.

  20. Microstructure evolution and mechanical properties of dissimilar friction stir welded joints between AA1100-B{sub 4}C MMC and AA6063 alloy

    Energy Technology Data Exchange (ETDEWEB)

    Guo, J. [Department of Applied Science, University of Quebec at Chicoutimi, Saguenay (QC) G7H 2B1 (Canada); Aluminium Technology Centre, National Research Council Canada, Saguenay (QC) G7H 8C3 (Canada); Gougeon, P. [Aluminium Technology Centre, National Research Council Canada, Saguenay (QC) G7H 8C3 (Canada); Chen, X.-G., E-mail: xgrant_chen@uqac.ca [Department of Applied Science, University of Quebec at Chicoutimi, Saguenay (QC) G7H 2B1 (Canada)

    2012-09-15

    Highlights: Black-Right-Pointing-Pointer Microstructures and mechanical properties of dissimilar FSW between AA1100-B{sub 4}C and AA6063 alloy. Black-Right-Pointing-Pointer Effect of the welding parameters on the interface bonding, joint microstructure and mechanical properties. Black-Right-Pointing-Pointer Microstructural evolution of dissimilar joints revealed by the electron backscatter diffraction analysis. Black-Right-Pointing-Pointer Good material mixing and seamless bonding around the interfaces between Al-B{sub 4}C and the AA6063 alloy. Black-Right-Pointing-Pointer 100% joint efficiencies (UTS) achieved by all dissimilar joints. - Abstract: The feasibility of dissimilar friction stir welding (FSW) between the AA1100-16 vol.% B{sub 4}C metal matrix composite and the AA6063 alloy has been evaluated. The effect of the welding parameters on the interface bonding, joint microstructure and mechanical properties was investigated. The results revealed that all dissimilar joints produced under welding conditions investigated were stronger than the base materials of the Al-B{sub 4}C composite. Analysis of the Mg concentration and the B{sub 4}C particle distribution indicates that good material mixing and seamless bonding was achieved around the interface between the Al-B{sub 4}C composite and the Al 6063 alloy during FSW. The electron backscatter diffraction analysis (EBSD) shows that during dissimilar FSW, there was a gradual microstructural evolution on both material sides, resulting in a variety of grain structures in the different weld zones. In the weld zones of FSW joints, the materials underwent dynamic recovery and recrystallization to different extents depending on their thermal mechanical history. The grain refinement of both materials in the nugget zone was observed. It is recommended that the 6063 aluminum alloy should be fixed on the advancing side and the use of an appropriate offset to the 6063 aluminum side is preferred.

  1. Influencia de los parámetros de la soldadura metálica fría en las aleaciones AA5083 y AA6061//Influence of the colt metal welding parameters on the AA5083 and AA6061 aluminum

    Directory of Open Access Journals (Sweden)

    René Eduardo de‐Luna‐Alanís

    2015-01-01

    Full Text Available El trabajo tuvo como objetivo evaluar la influencia de la velocidad de la soldadura y de las correcciones del arco y pulso en el proceso de Transferencia Metálica Fría sobre las propiedades mecánicas de las aleaciones AA5083 y AA6061. Se desarrolló un diseño experimental de tipo factorial multinivel, con 4 factores independientes (Corrección de Arco, Pulso, Velocidad de Soldadura y Aleación. Los parámetros fundamentales fueron: Corriente de base 250 A; Voltaje de arco 21 V y Polaridad (Direct current electrode positive, DCEP. La evaluación se realizó a través de un ensayo de tracción transversal sobre probetas planas obtenidas de los cupones soldados. Se demuestra que el modelo aplicado es adecuado, revelándose en los experimentos diferencias sustanciales en las propiedades Tensión de fluencia 29,56 %, Módulo de elasticidad 51,16 % y Trabajo específico de deformación elástica 42,30 %, el cual no posee una dependencia lineal con elresto de las propiedades anteriores.Palabras claves: transferencia metálica fría, aleación AA5083, aleación AA6061, propiedades mecánicas._______________________________________________________________________________AbstractThe work objective was to evaluatethe influence of Cold Metal Transfer process arc and pulse corrections and welding speed on the mechanical properties of AA5083 and AA6061 aluminum alloys. For it, a Factorial Multilevel experimental design whit 4 independent factor (arc correction, pulse correction, welding speed and alloy was developed. The essential welding parameters employed were: base current 250 A; arc voltage 21 V and polarity (DCEP. The evaluation was made whit a transverse traction test of plate welded coupons. The experimental model applied wasadequate and substantial differences was showed between yield tensile strength 29,56 %, elasticity module (51,16 % and specific work of elastic deformation 42,30 %, which it does not possess a lineal dependence whit the rest

  2. Spatial and temporal evaluation of metal concentrations in soils and sediments from New Orleans, Louisiana, USA, following hurricanes Katrina and Rita.

    Science.gov (United States)

    Abel, Michael T; Presley, Steven M; Rainwater, Thomas R; Austin, Galen P; Cox, Stephen B; McDaniel, Les N; Marsland, Eric J; Leftwich, Blair D; Anderson, Todd A; Kendall, Ronald J; Cobb, George P

    2007-10-01

    During January 2006, soil and sediment samples from 75 sites in the New Orleans (LA, USA) area were collected and tested for 26 inorganic elements. The study design was intended to provide a spatial pattern of metal concentrations within the city following hurricanes Katrina and Rita. The sampling design included four transects that traversed the city in a north-south direction and three transects that traversed the city in an east-west direction. Contaminant concentrations were determined at multiple sites within each transect and compared to U.S. Environmental Protection Agency soil screening criteria pertaining to human health. Concentrations of Pb and As exceeded the criteria indiscriminately throughout the city. Of the 75 sites, 14 (19%) exceeded the soil screening criteria for Pb, and 73 (97%) exceeded the criteria for As. Forty-three of the 75 sites coincided with a previous sampling event in October 2005. Metal concentrations were evaluated for temporal comparisons using a pair sampled t test. Arsenic concentrations differed significantly over time, but Pb concentrations did not.

  3. Spatial Culture

    DEFF Research Database (Denmark)

    Reeh, Henrik

    2012-01-01

    of Humani-ties, University of Copenhagen, have been exploring urbanity and aesthetics from the viewpoint of their own generation. Some twenty graduates contribute to the present volume which has been entitled Spatial Culture in order to indicate a common denominator of their MA theses from the years 2002......Spatial Culture – A Humanities Perspective Abstract of introductory essay by Henrik Reeh Secured by alliances between socio-political development and cultural practices, a new field of humanistic studies in spatial culture has developed since the 1990s. To focus on links between urban culture...... and modern society is, however, an intellectual practice which has a much longer history. Already in the 1980s, the debate on the modern and the postmodern cited Paris and Los Angeles as spatio-cultural illustrations of these major philosophical concepts. Earlier, in the history of critical studies, the work...

  4. Microstructure analysis of aluminum extrusion: grain size distribution in AA6060, AA6082 and AA7075 alloys

    Energy Technology Data Exchange (ETDEWEB)

    Schikorra, M.; Tekkaya, A. E. [Institute of Forming Technology and Lightweight Construction, Dortmund (Germany); Donate, L.; Iomesani, L. [University of Bologna, Bologna (Italy)

    2007-10-15

    Microstructure and material flow of aluminum alloys have a significant influence on the mechanical properties and surface quality. In extrusion of aluminum billets at high temperatures the microstructure is dependent on the alloy and the forming and temperature history. A prediction of grain size and precipitation is of increasing importance in order to design the process by adjustment of parameters such as punch speed, temperatures, and quenching. To give references for microstructure prediction based on material flow, and with it strain and strain rate history, this paper deals with the microstructure during the extrusion process of AA6060, AA6082, and AA7075 alloys. Billets have been partly extruded to axisymmetric round profiles and the microstructure of the press rests consisting of the billet rests in container and die has been considered. Furthermore, these rests have been analyzed to show the material flow, dynamic and static recrystallization based on macro etchings and visible microstructure under different conditions, e.g. as in the area of high strain rate near the container wall, or in dead zones. To allow an accurate simulation of the extrusion process, punch force and temperature conditions during the tests have been measured and are presented in this paper, too.

  5. Absorption spectra of AA-stacked graphite

    Energy Technology Data Exchange (ETDEWEB)

    Chiu, C W; Lee, S H; Chen, S C; Lin, M F [Department of Physics, National Cheng Kung University, Taiwan (China); Shyu, F L, E-mail: fl.shyu@msa.hinet.ne, E-mail: mflin@mail.ncku.edu.t [Department of Physics, ROC Military Academy, 830 Kaohsiung, Taiwan (China)

    2010-08-15

    AA-stacked graphite shows strong anisotropy in geometric structures and velocity matrix elements. However, the absorption spectra are isotropic for the polarization vector on the graphene plane. The spectra exhibit one prominent plateau at middle energy and one shoulder structure at lower energy. These structures directly reflect the unique geometric and band structures and provide sufficient information for experimental fitting of the intralayer and interlayer atomic interactions. On the other hand, monolayer graphene shows a sharp absorption peak but no shoulder structure; AA-stacked bilayer graphene has two absorption peaks at middle energy and abruptly vanishes at lower energy. Furthermore, the isotropic features are expected to exist in other graphene-related systems. The calculated results and the predicted atomic interactions could be verified by optical measurements.

  6. Development and Evaluation of a Web Map Mind Tool Environment with the Theory of Spatial Thinking and Project-Based Learning Strategy

    Science.gov (United States)

    Hou, Huei-Tse; Yu, Tsai-Fang; Wu, Yi-Xuan; Sung, Yao-Ting; Chang, Kuo-En

    2016-01-01

    The theory of spatial thinking is relevant to the learning and teaching of many academic domains. One promising method to facilitate learners' higher-order thinking is to utilize a web map mind tool to assist learners in applying spatial thinking to cooperative problem solving. In this study, an environment is designed based on the theory of…

  7. Comparative Study for determination of iron content in soils by AAS and calorimetry. Estudio comparativo de la determinacion por AAS y colorimetria del contenido de hierro en suelos

    Energy Technology Data Exchange (ETDEWEB)

    Manuel-Vez, M.P.; Garcia-Vargas, M. (Universidad de Cadiz. Departamento de Qumica Analitica. Cadiz (Spain))

    1992-12-01

    In order to evaluate the accuracy and reliability of a new calorimetric method for the determination of iron in soils, a comparative study with atomic absorption spectrometry (AAS) was conducted. the first method results very selective and is based in the formation of a complex between the reactant picolinoilhidrazone of 2.2 dipiridilketone and Fe (II), of green color and stechiometry 2:1 (nm, and ''alpha''=7.0 x 10''3 1 mol''-4 cm''-1 in water ethanol solution). Soil samples were analysed by means of a AAS standard method. after data processing of the results obtained it could be concluded that both method led to results statistically equivalent. (Author).

  8. AA, inner conductor of a magnetic horn

    CERN Multimedia

    CERN PhotoLab

    1981-01-01

    At the start-up of the AA and during its initial operation, magnetic horns focused the antiprotons emanating from the production target. These "current-sheet lenses" had a thin inner conductor (for minimum absorption of antiprotons), machined from aluminium to wall thicknesses of 0.7 or 1 mm. The half-sine pulses rose to 150 kA in 8 microsec. The angular acceptance was 50 mrad.

  9. Research in development: the approach of AAS

    OpenAIRE

    Dugan, P.; Apgar, M.; Douthwaite, B.

    2013-01-01

    The CGIAR Research Program on Aquatic Agricultural Systems (AAS) is pursuing a Research in Development approach that emphasizes the importance of embedding research in the development context. Reflecting this emphasis the six elements of this approach are a commitment to people and place, participatory action research, gender transformative research, learning and networking, partnerships, and capacity building. It is through the careful pursuit of these six elements that we believe that the p...

  10. First circulating beam in the AA

    CERN Multimedia

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.5 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are to numerous to name them all. Heribert Koziol, apparently asleep, is answering the call from an impatient director. See also 8007094.

  11. AA Prototype-Quadrupole on Measurement Stand

    CERN Multimedia

    1979-01-01

    The very particular lattice of the AA required 2 types of quadrupoles: narrow ones (QFN, QDN) and wide ones (QFW, QDW). The wide ones, although rather short (steel length 0.54 m), had an unusually large aperture of 0.75 m in width, 0.68 m "good field". A prototype was built at CERN in 1978. Here we see it on its test stand, with a measurement coil inserted, Brian Pincott taking readings.

  12. AA, assembly of wide bending magnet

    CERN Multimedia

    1980-01-01

    The very particular lattice of the AA required 2 types of dipoles (bending magnets; BST, short and wide; BLG, long and narrow). The wide ones had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the copper coils being hoisted onto the lower half of a BST. See also 7811105, 8006050. For a BLG, see 8001044.

  13. AA Prototype-Quadrupole on Measurement Stand

    CERN Multimedia

    1978-01-01

    The very particular lattice of the AA required 2 types of quadrupoles: narrow ones (QFN, QDN) and wide ones (QFW, QDW). The wide ones, although not very long (steel length 0.54 m), had an unusually large aperture of 0.75 m in width, 0.68 m "good field". A prototype was built in 1978. Here we see it on its test stand, with Ray Brown positioning the measurement coil.

  14. Spatial distribution

    DEFF Research Database (Denmark)

    Borregaard, Michael Krabbe; Hendrichsen, Ditte Katrine; Nachman, Gøsta Støger

    2008-01-01

    , depending on the nature of intraspecific interactions between them: while the individuals of some species repel each other and partition the available area, others form groups of varying size, determined by the fitness of each group member. The spatial distribution pattern of individuals again strongly...

  15. Spatially explicit non-Mendelian diploid model

    CERN Document Server

    Lanchier, N; 10.1214/09-AAP598

    2009-01-01

    We introduce a spatially explicit model for the competition between type $a$ and type $b$ alleles. Each vertex of the $d$-dimensional integer lattice is occupied by a diploid individual, which is in one of three possible states or genotypes: $aa$, $ab$ or $bb$. We are interested in the long-term behavior of the gene frequencies when Mendel's law of segregation does not hold. This results in a voter type model depending on four parameters; each of these parameters measures the strength of competition between genes during meiosis. We prove that with or without a spatial structure, type $a$ and type $b$ alleles coexist at equilibrium when homozygotes are poor competitors. The inclusion of a spatial structure, however, reduces the parameter region where coexistence occurs.

  16. Introducing the AAS Astronomy Ambassadors Program

    Science.gov (United States)

    Gurton, S.; Fienberg, R. T.; Fraknoi, A.; Prather, E. E.

    2013-04-01

    Newly established by the American Astronomical Society (AAS), the Astronomy Ambassadors program is designed to support early-career AAS members with training in resources and techniques for effective outreach to students and/or the public. A pilot Astronomy Ambassadors workshop will be held at the January 2013 AAS meeting. Workshop participants will learn to communicate effectively with public and school audiences; find outreach opportunities and establish ongoing partnerships with local schools, science centers, museums, parks, and/or community centers; reach audiences with personal stories, hands-on activities, and jargon-free language; identify strategies and techniques to improve their presentation skills; gain access to a menu of outreach resources that work in a variety of settings; and become part of an active community of astronomers who do outreach. Applications are welcome from advanced undergraduates (those doing research and committed to continuing in astronomy), graduate students, and postdocs and new faculty in their first two years after receipt of the PhD. We especially encourage applications from members of groups that are presently underrepresented in science.

  17. AAS Publishing News: Astronomical Software Citation Workshop

    Science.gov (United States)

    Kohler, Susanna

    2015-07-01

    Do you write code for your research? Use astronomical software? Do you wish there were a better way of citing, sharing, archiving, or discovering software for astronomy research? You're not alone! In April 2015, AAS's publishing team joined other leaders in the astronomical software community in a meeting funded by the Sloan Foundation, with the purpose of discussing these issues and potential solutions. In attendance were representatives from academic astronomy, publishing, libraries, for-profit software sharing platforms, telescope facilities, and grantmaking institutions. The goal of the group was to establish “protocols, policies, and platforms for astronomical software citation, sharing, and archiving,” in the hopes of encouraging a set of normalized standards across the field. The AAS is now collaborating with leaders at GitHub to write grant proposals for a project to develop strategies for software discoverability and citation, in astronomy and beyond. If this topic interests you, you can find more details in this document released by the group after the meeting: http://astronomy-software-index.github.io/2015-workshop/ The group hopes to move this project forward with input and support from the broader community. Please share the above document, discuss it on social media using the hashtag #astroware (so that your conversations can be found!), or send private comments to julie.steffen@aas.org.

  18. HCI-Evaluation of the GeoCitizen-reporting App for citizen participation in spatial planning and community management among members of marginalized communities in Cali, Colombia . GI_Forum|GI_Forum 2016, Volume 1 – open:spatial:interfaces|

    OpenAIRE

    Parra Arteaga, Andres; Eitzinger, Anton; Marin, Beatriz Eugenia; Gonzalez Quintero, Bryan; Atzmanstorfer, Karl; Resl, Richard

    2016-01-01

    Increasingly, geospatial web applications such as www.fixmystreet.com or www.seeclickfix.com are being integrated within citizen participation processes in spatial planning and the provision of communal services. Recently, several of these platforms have been launched in Latin America and other countries of the Global South. This development raises the questions of whether citizens with low ICT-skills can fully access and use these tools, and hence whether they are empowered to participate in...

  19. Evaluating Spatial Heterogeneity and Environmental Variability Inferred from Branched Glycerol Dialkyl Glycerol Tetraethers (GDGTs) Distribution in Soils from Valles Caldera, New Mexic

    Science.gov (United States)

    Contreras Quintana, S. H.; Werne, J. P.; Brown, E. T.; Halbur, J.; Sinninghe Damsté, , J.; Schouten, S.; Correa-Metrio, A.; Fawcett, P. J.

    2014-12-01

    Branched glycerol dialkyl glycerol tetraethers (GDGTs) are recently discovered bacterial membrane lipids, ubiquitously present in peat bogs and soils, as well as in rivers, lakes and lake sediments. Their distribution appears to be controlled mainly by soil pH and annual mean air temperature (MAT) and they have been increasingly used as paleoclimate proxies in sedimentary records. In order to validate their application as paleoclimate proxies, it is essential evaluate the influence of small scale environmental variability on their distribution. Initial application of the original soil-based branched GDGT distribution proxy to lacustrine sediments from Valles Caldera, New Mexico (NM) was promising, producing a viable temperature record spanning two glacial/interglacial cycles. In this study, we assess the influence of analytical and spatial soil heterogeneity on the concentration and distribution of 9 branched GDGTs in soils from Valles Caldera, and show how this variability is propagated to MAT and pH estimates using multiple soil-based branched GDGT transfer functions. Our results show that significant differences in the abundance and distribution of branched GDGTs in soil can be observed even within a small area such as Valles Caldera. Although the original MBT-CBT calibration appears to give robust MAT estimates and the newest calibration provides pH estimates in better agreement with modern local soils in Valles Caldera, the environmental heterogeneity (e.g. vegetation type and soil moisture) appears to affect the precision of MAT and pH estimates. Furthermore, the heterogeneity of soils leads to significant variability among samples taken even from within a square meter. While such soil heterogeneity is not unknown (and is typically controlled for by combining multiple samples), this study quantifies heterogeneity relative to branched GDGT-based proxies for the first time, indicating that care must be taken with samples from heterogeneous soils in MAT and p

  20. The Importance of Southern Hemisphere CZOs for Evaluating Spatial Patterns of Chemical Structure in the Critical Zone and Assisting Human Development

    Science.gov (United States)

    Chadwick, O.

    2014-12-01

    The US Critical Zone Exploration Network (CZEN) is a network of sites designed to provide a better understanding of the integrated Earth surface system. The capacity of the critical zone to withstand perturbations, whether driven by climate, land use change, or spread of invasive species, depends on its chemical composition and physical state, which in turn depends on the time evolution of the critical zone. Many temperate and/or tectonically active critical zones contain a relatively short history due to rapid erosion but tectonically quiescent, tropical regions of the planet contain much longer records that need to be understood to cover the full suite of critical zone processes. Southern Hemisphere Critical Zone Observatories such as those proposed for Kruger National Park (KNP) in South Africa and for portions of the Yilgarn Craton in Western Australa will allow us to extend our temporal understanding of development of spatial heterogeneity in the chemical and physical structure of the critical zone. In addition to considering Earth and climate boundary conditions, these sites incorporate the roles that humans play in driving critical zone processes. For instance along the edges of KNP there is strong evidence of soil erosions due to periurbanization and small-scale agriculture. The existence of KNP provides an important contrast between a "natural" and "human-dominated" landscape that can be exploited to evaluate human impacts on critical zone resources and to develop targeted mitigation strategies. Western Australia has an exploitive economy that relies on large-scale agriculture and mineral extraction, both are intensive users of water which is scarce. The proposed CZO there will be partly focused on managing water under intense economic pressures. It is evident that if funding can be found for these sites they will enhance both critical zone science and practical applied science.

  1. Evaluation of an index of biotic integrity approach used to assess biological condition in western U.S. streams and rivers at varying spatial scales

    Science.gov (United States)

    Meador, M.R.; Whittier, T.R.; Goldstein, R.M.; Hughes, R.M.; Peck, D.V.

    2008-01-01

    Consistent assessments of biological condition are needed across multiple ecoregions to provide a greater understanding of the spatial extent of environmental degradation. However, consistent assessments at large geographic scales are often hampered by lack of uniformity in data collection, analyses, and interpretation. The index of biotic integrity (IBI) has been widely used in eastern and central North America, where fish assemblages are complex and largely composed of native species, but IBI development has been hindered in the western United States because of relatively low fish species richness and greater relative abundance of alien fishes. Approaches to developing IBIs rarely provide a consistent means of assessing biological condition across multiple ecoregions. We conducted an evaluation of IBIs recently proposed for three ecoregions of the western United States using an independent data set covering a large geographic scale. We standardized the regional IBIs and developed biological condition criteria, assessed the responsiveness of IBIs to basin-level land uses, and assessed their precision and concordance with basin-scale IBIs. Standardized IBI scores from 318 sites in the western United States comprising mountain, plains, and xeric ecoregions were significantly related to combined urban and agricultural land uses. Standard deviations and coefficients of variation revealed relatively low variation in IBI scores based on multiple sampling reaches at sites. A relatively high degree of corroboration with independent, locally developed IBIs indicates that the regional IBIs are robust across large geographic scales, providing precise and accurate assessments of biological condition for western U.S. streams. ?? Copyright by the American Fisheries Society 2008.

  2. Regional left ventricular myocardial contraction abnormalities and asynchrony in patients with hypertrophic cardiomyopathy evaluated by magnetic resonance spatial modulation of magnetization myocardial tagging

    Energy Technology Data Exchange (ETDEWEB)

    Mishiro, Yuichiro; Oki, Takashi [Tokushima Univ. (Japan). School of Medicine; Iuchi, Arata [and others

    1999-06-01

    Global left ventricular (LV) pump function is generally preserved in patients with hypertrophic cardiomyopathy (HCM). However, it is unknown whether regional myocardial contractility is impaired, especially in nonhypertrophied regions. The purpose of this study was to evaluate regional LV myocardial contraction in patients with HCM using magnetic resonance (MR) spatial modulation of magnetization (SPAMM) myocardial tagging. The study group comprised 20 patients with asymmetric septal hypertrophy (HCM group) and 16 age-matched normal patients (control group), and data were collected using transthoracic M-mode and 2-dimensional echocardiography, and MR SPAMM myocardial tagging. The systolic strain ratio, maximum systolic strain velocity, and time from end-diastole to maximum systolic strain ({Delta}T) in the anterior, ventricular septal, inferior and lateral regions for 2 LV short-axis sections at the levels of the chordae tendineae and papillary muscles were measured at 50-ms intervals by MR myocardial tagging. The end-diastolic anterior and ventricular septal wall thicknesses and LV mass index were significantly different between the HCM and control groups. The systolic strain ratio for all 4 walls, particularly the anterior and ventricular septal regions, was significantly lower in the HCM group. In the HCM group, the maximum systolic strain velocity was significantly lower and {Delta}T was significantly shorter for all 4 walls, particularly the anterior and ventricular septal regions. The standard deviation for the {Delta}T, calculated from the {Delta}T for the 8 regions of the 2 LV short-axis sections, was significantly greater in the HCM group. In conclusion, regional LV myocardial contraction is impaired in both hypertrophied and nonhypertrophied regions, and systolic LV wall asynchrony occurs in patients with HCM. (author)

  3. 基于空间信息技术的地震灾害监测评估%Earthquake disaster monitoring and evaluation based on spatial information technology

    Institute of Scientific and Technical Information of China (English)

    毕晓佳; 汪宝存; 徐华全; 张宁

    2012-01-01

    空间信息技术即包括地理信息系统GIS、遥感RS、全球导航卫星系统GNSS以及数字地球在内的地球空间信息科学。随着计算机和空间对地观测技术的发展,空间信息技术已逐渐应用于防震减灾领域。本文通过实际震例分别对目前基于GIS、RS技术的地震灾害监测评估方法进行了分析研究,总结了其优越性以及存在的问题,并结合数字地球平台可视化展示了综合多源数据空间信息技术方法进行的震害评估效果。%Space information technology which includes the geographic information system GIS, remote sensing RS, global navigation satellite system GNSS and digital earth platform, it is an earth space information science. With the development of computer and space on earth observation technology, the space information technology has been applied gradually in earthquake resistance and disaster mitigation fields. This article through the actual examples respectively analyzed the current earthquake disaster monitoring and evaluation method which is based on GIS and RS technology. Sums up the advantages and the existing problems, and with digital earth platform visually shows the effect of comprehensive multi-source data spatial information technology used in earthquake damage assessment.

  4. Characterization of AA7050 aluminium alloy processed by ECAP; Caracterizacao da liga de aluminio AA7050 processada por ECAP

    Energy Technology Data Exchange (ETDEWEB)

    Cardoso, K.R.; Guido, V. [Universidade do Vale do Paraiba (UNIVAP), Sao Jose dos Campos, SP (Brazil). Inst. de Pesquisa e Desenvolvimento; Travessa, D.N. [Empresa Brasileira de Aeronautica (EMBRAER), Sao Jose dos Campos, SP (Brazil); Jorge Junior, A.M. [Universidade Federal de Sao Carlos (DEMa/UFSCar), SP (Brazil). Dept. de Engenharia de Materiais

    2010-07-01

    The commercial AA7050 aluminium alloy in the solution heat treated condition (W) was processed by ECAP through route A. Two pressing temperatures (room and 150 deg C and velocities (5 and 30mm/min) were used, as well as different number of passes. The effect of such variables on the microstructure evolution was evaluated using optical and transmission electron microscopy with EDX microanalysis, and xray diffraction. It was found that the microstructure has been refined by ECAP, as a result of subgrains formed within deformation bands. ECAP at 150 deg C resulted in intense precipitation of plate like {eta} phase, which evolves to equiaxial morphology as the number of passes increases. (author)

  5. The Spatial Turn in Literary Historiography

    OpenAIRE

    Cabo Aseguinolaza, Fernando

    2011-01-01

    In his article "The Spatial Turn in Literary Historiography," Fernando Cabo Aseguinolaza examines the spatialization of literary history in recent years. He evaluates the resurgence of interest in literary geography and argues that the geographic dimension is not the only aspect of the predominant spatiality in new literary histories. Further, Cabo Aseguinolaza postulates that although the emphasis on spatiality marks many current literary histories, all literary histories imply spatial eleme...

  6. Comparison between ARB and CARB processes on an AA5754/AA6061 composite

    Science.gov (United States)

    Verstraete, K.; Helbert, A.-L.; Brisset, F.; Baudin, T.

    2014-08-01

    The present work aims to compare two processes: Accumulative Roll Bonding and Cross Accumulative Roll Bonding (CARB). Both processes consist in the repetition of rolling but the second technique adds a 90° rotation of the sheet around its normal direction between each rolling. Microstructure, mechanical properties and texture were compared for both processes on an AA5754/AA6061 composite. As a result a thinner and less elongated microstructure was obtained in the CARB process leading to an isotropy and an improvement of the mechanical properties. Besides, the texture was characterized by the rotated Cube component for both processes but for CARB it is of less strength.

  7. Simon van der Meer in the AA Control Room

    CERN Multimedia

    1984-01-01

    Simon van der Meer, spiritus rector of the Antiproton Accumulator, in the AA Control Room. Inventor of stochastic cooling, on which the AA was based, and of the magnetic horn, with which the antiprotons were focused, he also wrote most of the software with which the AA was controlled, and spent uncountable numbers of hours in this chair to tickle the AA to top performance. 8 months after this picture was taken, he received, in October 1984, the Nobel prize, together with Carlo Rubbia, the moving force behind the whole Proton-Antiproton Collider project that led to the discovery, in 1983, of the W and Z intermediate bosons.

  8. Spatial alexia.

    Science.gov (United States)

    Ardila, A; Rosselli, M

    1994-05-01

    Twenty-one patients with right hemisphere damage were studied (11 men, 10 women; average age = 41.33; range = 19-65). Patients were divided in two groups: pre-Rolandic (six patients) and retro-Rolandic (15 patients) right hemisphere damage. A special reading test was given to each patient. The observed errors included: literal errors (substitutions, additions, and omissions of letters), substitutions of syllables and pseudowords for meaningful words, left hemispatial neglect, confabulation, splitting of words, verbal errors (substitutions, additions, and omission of words), grouping of letters belonging to two different words, misuse of punctuation marks, and errors in following lines. It was proposed that spatial alexia is characterized by: (1) some difficulties in the recognition of the spatial orientation in letters; (2) left hemispatial neglect; (3) tendency to "complete" the sense of words and sentences; (4) inability to follow lines when reading texts, and sequentially explore the spatial distribution of the written material; and (5) grouping and fragmentation of words, most likely as a consequence of the inability to interpret the relative value of spaces between letters correctly. PMID:7960468

  9. Dicty_cDB: FC-AA22 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA22 (Link to dictyBase) - - - Contig-U14948-1 FC-AA22E (Li...nk to Original site) - - - - - - FC-AA22E 576 Show FC-AA22 Library FC (Link to library) Clone ID FC-AA22 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA22Q.Seq.d/ Representative seq. ID FC-AA...22E (Link to Original site) Representative DNA sequence >FC-AA22 (FC-AA22Q) /CSM/FC/FC-AA/FC-AA22Q.Seq.d/ ATGAA...TACGATGATAGTGATTCAGACTTTTGACCAATTGAAAAAACCAGCAACAGAAATG GTACTGGTTTGGTCTCCTCCACTTTTAAGGTTGCCCCTTCCTTCTCTACCATTCAAAAAC AACAA

  10. Dicty_cDB: FC-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA15 (Link to dictyBase) - G01144 DDB0204372 Contig-U15089-1 FC-AA...15E (Link to Original site) - - - - - - FC-AA15E 522 Show FC-AA15 Library FC (Link to library) Clone ID FC-AA...9-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA15Q.Se...q.d/ Representative seq. ID FC-AA15E (Link to Original site) Representative DNA sequence >FC-AA15 (FC-AA15Q) /CSM/FC/FC-AA/FC-AA...15Q.Seq.d/ CAAATCACACATAAAAGTTTAATATAAAAATGGGTACACCAATTAAAAAGATTAGTACAG TAATTATTAAAATGGTTTCATCAGCCAA

  11. Dicty_cDB: FC-AA17 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA17 (Link to dictyBase) - - - Contig-U15091-1 FC-AA17E (Li...nk to Original site) - - - - - - FC-AA17E 347 Show FC-AA17 Library FC (Link to library) Clone ID FC-AA17 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA17Q.Seq.d/ Representative seq. ID FC-AA...17E (Link to Original site) Representative DNA sequence >FC-AA17 (FC-AA17Q) /CSM/FC/FC-AA/FC-AA17Q.Seq.d/ CCCAAAAGCCCGTAA...GACTCACTGTGTCAAGTGCAACAAACACACCCCACACAAGGTTAC CCAATACAAAGCTGGTAAACCAAGTCTTTTCGCACAAGGTAAAAGACGTTACGATCGTAA ACAA

  12. Dicty_cDB: FC-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA05 (Link to dictyBase) - G01143 DDB0190243 Contig-U15085-1 FC-AA...05E (Link to Original site) - - - - - - FC-AA05E 675 Show FC-AA05 Library FC (Link to library) Clone ID FC-AA...5-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA05Q.Se...q.d/ Representative seq. ID FC-AA05E (Link to Original site) Representative DNA sequence >FC-AA05 (FC-AA05Q) /CSM/FC/FC-AA/FC-AA...05Q.Seq.d/ AAACAAAAAAAAAAGGTATGGAAATTTTTGCATTTGTACCATTAGCAGTGTTAACAGCAT TATGTGTTGTTATTTCACTCTTTGTTAAAAGAGAGAAA

  13. Dicty_cDB: FCL-AA23 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA23 (Link to dictyBase) - G01759 DDB0201558 Contig-U15118-1 FCL-AA...23E (Link to Original site) - - - - - - FCL-AA23E 1045 Show FCL-AA23 Library FCL (Link to library) Clone ID FCL-AA...ig-U15118-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...23Q.Seq.d/ Representative seq. ID FCL-AA23E (Link to Original site) Representative DNA sequence >FCL-AA23 (FCL-AA...23Q) /CSM/FCL/FCL-AA/FCL-AA23Q.Seq.d/ ATAACTATATAACTATGTCTAACCAAAAGAAAAACGACGTATCTTCATTTGTTAAAGATT CTTTAA

  14. Dicty_cDB: FC-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA21 (Link to dictyBase) - - - Contig-U15450-1 FC-AA21E (Li...nk to Original site) - - - - - - FC-AA21E 839 Show FC-AA21 Library FC (Link to library) Clone ID FC-AA21 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA21Q.Seq.d/ Representative seq. ID FC-AA...21E (Link to Original site) Representative DNA sequence >FC-AA21 (FC-AA21Q) /CSM/FC/FC-AA/FC-AA21Q.Seq.d/ AATTATTTTCATTAA...TTTTAGCTTTATTCCTTGTCAACTCCGCTGTTGTCTCTTCACTCG ACTCATGTAGTATTTGTGTTGATTTTGTTGGTAACTCACTCAATGATCTTTTAAATATTA TCCTTAA

  15. Dicty_cDB: FCL-AA22 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA22 (Link to dictyBase) - G01758 DDB0229949 Contig-U15119-1 FCL-AA...22E (Link to Original site) - - - - - - FCL-AA22E 840 Show FCL-AA22 Library FCL (Link to library) Clone ID FCL-AA...g-U15119-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...22Q.Seq.d/ Representative seq. ID FCL-AA22E (Link to Original site) Representative DNA sequence >FCL-AA22 (FCL-AA...22Q) /CSM/FCL/FCL-AA/FCL-AA22Q.Seq.d/ AAAATGAGCAAAATCTCAAGCGACCAAGTTAGATCAATCGTCTCCCAACTTTTCAAAGAA GCACAAGAATCCAAAA

  16. Dicty_cDB: FCL-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA06 (Link to dictyBase) - G24322 DDB0216974 Contig-U15228-1 FCL-AA...06E (Link to Original site) - - - - - - FCL-AA06E 791 Show FCL-AA06 Library FCL (Link to library) Clone ID FCL-AA...g-U15228-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...06Q.Seq.d/ Representative seq. ID FCL-AA06E (Link to Original site) Representative DNA sequence >FCL-AA06 (FCL-AA...06Q) /CSM/FCL/FCL-AA/FCL-AA06Q.Seq.d/ AAAATCCCAATTTCATTAGCAGTGGAAGTAACGGAATGAATTGGGGTGGTTCTTTGAACA CTTGTGACTCTGGAGGATTCAA

  17. Dicty_cDB: FCL-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA18 (Link to dictyBase) - G24323 DDB0191144 Contig-U15229-1 FCL-AA...18Z (Link to Original site) - - FCL-AA18Z 623 - - - - Show FCL-AA18 Library FCL (Link to library) Clone ID FCL-AA...g-U15229-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...18Q.Seq.d/ Representative seq. ID FCL-AA18Z (Link to Original site) Representative DNA sequence >FCL-AA18 (FCL-AA...18Q) /CSM/FCL/FCL-AA/FCL-AA18Q.Seq.d/ XXXXXXXXXXGTCAATGTCATTATTGGTGAACAATCTGATGGTTCGTTGGAACAAATCGC TAGAAATCCACAACCAA

  18. Dicty_cDB: FC-AA16 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA16 (Link to dictyBase) - G22556 DDB0204121 Contig-U15090-1 FC-AA...16E (Link to Original site) - - - - - - FC-AA16E 933 Show FC-AA16 Library FC (Link to library) Clone ID FC-AA...0-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA16Q.Se...q.d/ Representative seq. ID FC-AA16E (Link to Original site) Representative DNA sequence >FC-AA16 (FC-AA16Q) /CSM/FC/FC-AA/FC-AA...16Q.Seq.d/ GGGCAGGATCATCATTTAATACTAAAGATTCAACAATAATTGCAAAAACTCAATTTTATC AAAAAAATATTCAAATTTATAAAGGTGATCAA

  19. Comparison of direct mercury analyzer and FIA-CV-AAS in determination of methylmercury in fish

    Science.gov (United States)

    Ulrich, J. C.; Hortellani, M. A.; Sarkis, J. E. S.; Nakatsubo, M. A.

    2016-07-01

    Methylmercury (MeHg) has been determined in fish reference materials by direct mercury analyzer (DMA 80) and FIA-CV-AAS. In order to evaluate accuracy, certified reference materials (Fish protein, NRCC - Dorm 4 and fish material, Ipen - Dourada 1) were analyzed after extraction and separation of mercury species. Good agreement of the results have been obtained (relative error of the determination between the methods varied from 1.5% to 39%). The repeatability of the results varied from 4% to 26%.

  20. Laboratory study on the behaviour of spent AA household alkaline batteries in incineration

    OpenAIRE

    Almeida, Manuel F.; Xará, Susana M.; Delgado, Julanda; Costa, Carlos A.

    2009-01-01

    The quantitative evaluation of emissions from incineration is essential when Life Cycle Assessment (LCA) studies consider this process as an end-of-life solution for some wastes. Thus, the objective of this work is to quantify the main gaseous emissions produced when spent AA alkaline batteries are incinerated. With this aim, batteries were kept for 1 h at 1273 K in a refractory steel tube hold in a horizontal electric furnace with temperature control. At one end of the refractory...

  1. Microstructural features, texture and strengthening mechanisms of nanostructured AA6063 alloy processed by powder metallurgy

    International Nuclear Information System (INIS)

    Research highlights: → Nanostructured AA6063 (NS-Al) alloy contains Cu and P texture components. → The microstructure consists of nano-size grains and ultrafine grains (200-400 nm). → NS-Al exhibits a lower work hardening compared to coarse-grained Al alloy. → Grain boundary strengthening mechanism plays an important role for NS-Al. - Abstract: Nanostructured AA6063 (NS-Al) powder with an average grain size of ∼100 nm was synthesized by high-energy attrition milling of gas-atomized AA6063 powder followed by hot extrusion. The microstructural features of the consolidated specimen were studied by transmission electron microscopy (TEM) and electron backscatter diffraction (EBSD) techniques and compared with those of coarse-grained AA6063 (CG-Al) produced by hot powder extrusion of gas-atomized powder (without using mechanical milling). The consolidated NS-Al alloy consisted of elongated ultrafine grains (aspect ratio of ∼2.9) and equiaxed nanostructured grains. A high fraction (∼78%) of high-angle grain boundaries with average misorientation angle of 33o was noticed. Microtexture evaluation by plotting pole-figures and orientation distribution function (ODF) analysis showed Copper and P texture components for both the consolidated Al alloys. Tensile test at room temperature and microhardness measurement revealed that a significant improvement in the strength of AA6063 alloy is obtained through refinement of the grain structure. The strengthening mechanisms are discussed based on the dislocation-based models. The role of high-angle and low-angle grain boundaries on the strengthening mechanisms is discussed.

  2. Bardoxolone methyl (BARD) ameliorates aristolochic acid (AA)-induced acute kidney injury through Nrf2 pathway

    International Nuclear Information System (INIS)

    Bardoxolone methyl (BARD) is an antioxidant modulator that acts through induction of the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway. This study aimed to investigate the role of BARD in protecting kidneys from aristolochic acid (AA)-induced acute kidney injury (AKI). Male C57BL/6 mice received intraperitoneal (i.p.) injections of aristolochic acid I (AAI) (5 mg/kg/day) for 5 days to produce acute AA nephropathy (AAN) model. BARD (10 mg/kg/day, i.p.) was applied for 7 consecutive days, starting 2 days prior to AAI administration. The mice in the AA group showed AKI as evidenced by worsening kidney function evaluated by blood urea nitrogen (BUN) and serum creatinine (SCr) levels, and severe tubulointerstitial injury marked by massive tubule necrosis in kidney tissues. BARD significantly reduced BUN and SCr levels which were elevated by AAI. Additionally, AAI-induced histopathological renal damage was ameliorated by BARD. Furthermore, the expression of Nrf2 was reduced, and its repressor Kelch-like ECH-associated protein 1 (Keap1) was increased significantly, whereas heme oxygenase-1 (HO-1) was upregulated and NAD(P)H quinone oxidoreductase-1 (NQO1) was barely increased in the cytoplasm of tubules in kidneys after treatment with AAI. BARD significantly upregulated renal Nrf2, NQO1 and HO-1 expression and downregulated Keap1 expression compared with those in the AA group. Moreover, it was found that Nrf2 was expressed both in the cytoplasm and nuclear of glomeruli and tubules, whereas NQO1 and HO-1 were localized in the cytoplasm of tubules only. In conclusion, AA-induced acute renal injury was associated with impaired Nrf2 activation and expression of its downstream target genes in renal tissues. BARD prevented renal damage induced by AAI, and this renoprotective effect may be exerted by activating the Nrf2 signaling pathway and increasing expression of the downstream target genes

  3. Evaluation of the impact of information and communication technologies (ICTs on spatial change in terms of urban and regional planning discipline

    Directory of Open Access Journals (Sweden)

    Havva Filiz Alkan Meşhur

    2012-07-01

    Full Text Available Information and communication technologies (ICTs have progressed rapidly during the last twenty years and the spatial effects of these technologies have been debated since 1980’s. Although there is no absolute consensus of opinion what the spatial impact will be on, all authorities and academics have agreed in respect of ICTs have important role on spatial structure. These improvements will impact both spatial development and spatial planning. In this context, in order to debate about the spatial effects of ICTs, basic factors this behind spatial change should be defined. The studies done upon the meaning of space, distance and time have showed that these factors are no longer a negative component by means of information networks and communication. In the literature there are a number of studies which deal with the development of the information society and the important role of ICTs in this process. On the other hand, the urban and spatial effects of these developments has been dealt with mostly only by researchers and this discussion has been highly modest among urban planners. This article explicates the need and possibilities to develop urban and regional planning discipline due to the impact of ICTs on urban and spatial change. The findings are based on the views represented in literature and on the opinions of Turkish urban planners. The objective of the field survey is to search for opinions of Turkish urban planners about the effects of the ICTs and its implications on the spatial developments of urban and rural areas and also urban planning. In the fieldwork, the opinions of Turkish planners were surveyed in a questionnaire for this article. The questionnaire contained different statements about the effects of ICTs on spatial development and the development of planning practices. Surveys were conducted to urban planners working in public and private institutions in Turkey. The likert scale was used to measure respondents’ attitudes

  4. Psychometric properties of two physical activity questionnaires, the AQuAA and the PASE, in cancer patients

    NARCIS (Netherlands)

    R.D.K. Liu; L.M. Buffart; M.J. Kersten; M. Spiering; J. Brug; W. van Mechelen; M.J.M. Chinapaw

    2011-01-01

    Background: This study aimed to evaluate the reliability and validity of two self-report physical activity (PA) questionnaires - the AQuAA (Activity Questionnaire for Adults and Adolescents) and PASE (Physical Activity Scale for the Elderly) - in cancer patients. Methods: Test-retest reliability was

  5. The adhesion performance of epoxy coating on AA6063 treated in Ti/Zr/V based solution

    Science.gov (United States)

    Zhu, Wen; Li, Wenfang; Mu, Songlin; Yang, Yunyu; Zuo, Xi

    2016-10-01

    An environment-friendly titanium/zirconium/vanadium-based (Ti/Zr/V) conversion coating was prepared on aluminum alloy 6063 (AA6063). The epoxy powder coatings were applied on the AA6063 samples with/without Ti/Zr/V conversion coatings via electrostatic spraying. The morphology and composition of the conversion coating were studied by scanning electron microscope (SEM) and X-ray photoelectron spectroscopy (XPS), respectively. The surface free energy components of AA6063 samples were measured by a static contact angle measuring device with Owens method. The adhesion properties of the epoxy coating on AA6063 treated with different conversion times were evaluated using a pull-off tester. The Ti/Zr/V conversion coating was mainly composed of metal oxide (TiO2, ZrO2, V2O5, Al2O3, etc.), metal fluoride (ZrF4, AlF3, etc.) and metal organic complex. The formation time of this conversion coating was reduced to 50 s. After such surface treatment, the samples' surface roughness was increased and the contact angle with water was decreased. Both the surface free energy and the work of adhesion were increased. The adhesion strength between the epoxy coating and AA6063 was enhanced significantly.

  6. Cylindrical diffractive lenses recorded on PVA/AA photopolymers

    Science.gov (United States)

    Fernández, R.; Gallego, S.; Márquez, A.; Navarro-Fuster, V.; Francés, J.; Neipp, C.; Beléndez, A.; Pascual, I.

    2016-04-01

    Photopolymers are optical recording materials appealing for many different applications such as holography, data storage, interconnectors, solar concentrations, or wave-guides fabrication. Recently the capacity of photopolymers to record diffractive optical elements (DOE's) has been investigated. Different authors have reported proposes to record DOE like fork gratings, photonics structures, lenses, sinusoidal, blazed or fork gratings. In these experiments there are different experimental set-ups and different photopolymers. In this work due to the improvement in the spatial light modulation technology together with the photopolymer science we propose a recording experimental system of DOE using a Liquid Cristal based on Silicon (LCoS) display as a master to store complex DOE like cylindrical lenses. This technology permits us an accurate control of the phase and the amplitude of the recording beam, with a very small pixel size. The main advantage of this display is that permit us to modify the DOE automatically, we use the software of the LCoS to send the voltage to each pixel In this work we use a photopolymer composed by acrylamide (AA) as polymerizable monomer and polyvinyl alcohol (PVA). We use a coverplated and index matched photopolymer to avoid the influence of the thickness variation on the transmitted light. In order to reproduce the material behaviour during polymerization, we have designed our model to simulate cylindrical lenses and used Fresnel propagation to simulate the light propagation through the DOE and analyze the focal plane and the properties of the recorded lenses.

  7. Study on Fabrication of AA4032/AA6069 Cladding Billet Using Direct Chill Casting Process

    Science.gov (United States)

    Han, Xing; Zhang, Haitao; Shao, Bo; Li, Lei; Liu, Xuan; Cui, Jianzhong

    2016-04-01

    AA4032/AA6069 cladding billet in size of φ130 mm/φ110 mm was prepared by the modified direct chill casting process, and the parametric effect on casting performance was investigated using numerical simulation. Microstructures, elements distribution, and mechanical properties of the bonding interface were examined. The results show that metallurgical bonding interface can be obtained with the optimal parameters: the casting speed of 130 to 140 mm/min, the internal liquid level height of 50 to 60 mm, and the contact height of 40 to 50 mm. The metallurgical bonding interface is free of any discontinuities due to the fact that the alloying elements diffused across the interface and formed Ni-containing phase. Tensile strength of the cladding billet reaches 225.3 MPa, and the fracture position was located in AA6069 side, suggesting that the interface bonding strength is higher than the strength of AA6069. The interfacial shearing strength is 159.3 MPa, indicating excellent metallurgical bonding.

  8. The Spatial Politics of Spatial Representation

    DEFF Research Database (Denmark)

    Olesen, Kristian; Richardson, Tim

    2011-01-01

    spatial planning in Denmark reveals how fuzzy spatial representations and relational spatial concepts are being used to depoliticise strategic spatial planning processes and to camouflage spatial politics. The paper concludes that, while relational geography might play an important role in building...

  9. Evaluation.

    Science.gov (United States)

    McAnany, Emile G.; And Others

    1980-01-01

    Two lead articles set the theme for this issue devoted to evaluation as Emile G. McAnany examines the usefulness of evaluation and Robert C. Hornik addresses four widely accepted myths about evaluation. Additional articles include a report of a field evaluation done by the Accion Cultural Popular (ACPO); a study of the impact of that evaluation by…

  10. AAS Special Session: Policy Making in Astronomy

    Science.gov (United States)

    Cardelli, J. A.; Massa, D.

    1995-12-01

    The professional astronomical community today is more diverse than at any time in its history. Individuals participating in creative research programs can be found in a wide range of positions. This type of diversity, which mixes research, education, and service (e.g. contract) work, represents the strength of contemporary astronomy. While recognizing the unavoidable reductions in funding and restructuring of organizations like NASA, it is imperative that the significance of the current diversity be considered during these processes. Creative ideas are one of the cornerstones of quality research, and they can originate anywhere. Consequently, it is essential that adequate research resources remain available for free and open competition by all astronomers. Our goal in this session is to bring together officials from the AAS, NASA, and the NSF to discuss how the policy and decision making process operates and whether it should be changed to better serve the general needs of the professional astronomical community. Examples of the issues we believe are important include: In establishing new policy, how can the needs of the average research astronomer be better addressed? How could input from such astronomers be provided to those who craft NASA/NSF policy? How can/should the AAS serve as an interface between policy/decision making bodies and its membership? Should the AAS membership become more actively/effectively involved in the decision making process and, if so, how? More information on this session and related issues can be found at the Association of Research Astronomers Home Page: http://www.phy.vill.edu/astro/faculty/ara/ara_home.htm

  11. AA, Inner Conductor of Magnetic Horn

    CERN Multimedia

    1979-01-01

    Antiprotons emerging at large angles from the production target (hit by an intense 26 GeV proton beam from the PS), were focused into the acceptance of the injection line of the AA by means of a "magnetic horn" (current-sheet lens). Here we see an early protype of the horn's inner conductor, machined from solid aluminium to a thickness of less than 1 mm. The 1st version had to withstand pulses of 150 kA, 15 us long, every 2.4 s. See 8801040 for a later version.

  12. Wooden Model of Wide AA Bending Magnet

    CERN Multimedia

    1978-01-01

    The very particular lattice of the AA required 2 types of dipoles (bending magnets: BLG, long and narrow; BST, short and wide). A wide one had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. A wooden model was build in 1978, to gain dimensional experience. Here, Peter Zettwoch, one of the largest men at CERN at that time, is putting a hand in the mouth of the wooden BST monster.

  13. Atlas of Vega: 3850 -- 6860 \\AA

    CERN Document Server

    Kim, Hyun-Sook; Valyavin, G; Lee, Byeong-Cheol; Shimansky, V; Galazutdinov, G A

    2009-01-01

    We present a high resolving power ($\\lambda$ / $\\Delta\\lambda$ = 90,000) and high signal-to-noise ratio ($\\sim$700) spectral atlas of Vega covering the 3850 -- 6860 \\AA wavelength range. The atlas is a result of averaging of spectra recorded with the aid of the echelle spectrograph BOES fed by the 1.8-m telescope at Bohyunsan observatory (Korea). The atlas is provided only in machine-readable form (electronic data file) and will be available in the SIMBAD database upon publication.

  14. The cytochrome P450 2AA gene cluster in zebrafish (Danio rerio): Expression of CYP2AA1 and CYP2AA2 and response to phenobarbital-type inducers

    Energy Technology Data Exchange (ETDEWEB)

    Kubota, Akira [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Bainy, Afonso C.D. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Departamento de Bioquímica, CCB, Universidade Federal de Santa Catarina, Florianopolis, SC 88040-900 (Brazil); Woodin, Bruce R.; Goldstone, Jared V. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Stegeman, John J., E-mail: jstegeman@whoi.edu [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States)

    2013-10-01

    The cytochrome P450 (CYP) 2 gene family is the largest and most diverse CYP gene family in vertebrates. In zebrafish, we have identified 10 genes in a new subfamily, CYP2AA, which does not show orthology to any human or other mammalian CYP genes. Here we report evolutionary and structural relationships of the 10 CYP2AA genes and expression of the first two genes, CYP2AA1 and CYP2AA2. Parsimony reconstruction of the tandem duplication pattern for the CYP2AA cluster suggests that CYP2AA1, CYP2AA2 and CYP2AA3 likely arose in the earlier duplication events and thus are most diverged in function from the other CYP2AAs. On the other hand, CYP2AA8 and CYP2AA9 are genes that arose in the latest duplication event, implying functional similarity between these two CYPs. A molecular model of CYP2AA1 showing the sequence conservation across the CYP2AA cluster reveals that the regions with the highest variability within the cluster map onto CYP2AA1 near the substrate access channels, suggesting differing substrate specificities. Zebrafish CYP2AA1 transcript was expressed predominantly in the intestine, while CYP2AA2 was most highly expressed in the kidney, suggesting differing roles in physiology. In the liver CYP2AA2 expression but not that of CYP2AA1, was increased by 1,4-bis [2-(3,5-dichloropyridyloxy)] benzene (TCPOBOP) and, to a lesser extent, by phenobarbital (PB). In contrast, pregnenolone 16α-carbonitrile (PCN) increased CYP2AA1 expression, but not CYP2AA2 in the liver. The results identify a CYP2 subfamily in zebrafish that includes genes apparently induced by PB-type chemicals and PXR agonists, the first concrete in vivo evidence for a PB-type response in fish. - Highlights: • A tandemly duplicated cluster of ten CYP2AA genes was described in zebrafish. • Parsimony and duplication analyses suggest pathways to CYP2AA diversity. • Homology models reveal amino acid positions possibly related to functional diversity. • The CYP2AA locus does not share synteny with

  15. Partially melted zone cracking in AA6061 welds

    Energy Technology Data Exchange (ETDEWEB)

    Prasad Rao, K. [Department of Metallurgical and Materials Engineering, Indian Institute of Technology Madras, Chennai (India)], E-mail: kpr@iitm.ac.in; Ramanaiah, N. [Sri Kalahasteeswara Institute of Technology, Srikalahasti (India); Viswanathan, N. [Defence Research and Development Laboratory, Hyderabad (India)

    2008-07-01

    Partially melted zone (PMZ) cracking susceptibility in AA6061 alloy was studied. Role of prior thermal history, gas tungsten arc welding techniques such as continuous current (CC) and pulsed current (PC) and use of different fillers (AA4043 and AA5356) were studied. Role of different grain refiners such as scandium, zirconium and Tibor in the above fillers was studied. Varestraint test was used to study the PMZ cracking susceptibility. Metallurgical analysis was done to corroborate the results. PMZ cracking was severe in T6 temper than in T4 irrespective of filler material. PMZ cracking susceptibility was more with AA5356 than in AA4043. It was less with pulsed current GTAW. PMZ cracking susceptibility was reduced with addition of grain refiners. Out of all, lowest PMZ cracking susceptibility was observed with 0.5%Sc addition to fusion zone through AA4043 filler and PC technique. The concentrations of magnesium and silicon were reduced at the PMZ grain boundaries with grain refiner additions to fusion zone through AA5356 or AA4043.

  16. Transcriptome profiling of the intoxication response of Tenebrio molitor larvae to Bacillus thuringiensis Cry3Aa protoxin.

    Directory of Open Access Journals (Sweden)

    Brenda Oppert

    Full Text Available Bacillus thuringiensis (Bt crystal (Cry proteins are effective against a select number of insect pests, but improvements are needed to increase efficacy and decrease time to mortality for coleopteran pests. To gain insight into the Bt intoxication process in Coleoptera, we performed RNA-Seq on cDNA generated from the guts of Tenebrio molitor larvae that consumed either a control diet or a diet containing Cry3Aa protoxin. Approximately 134,090 and 124,287 sequence reads from the control and Cry3Aa-treated groups were assembled into 1,318 and 1,140 contigs, respectively. Enrichment analyses indicated that functions associated with mitochondrial respiration, signalling, maintenance of cell structure, membrane integrity, protein recycling/synthesis, and glycosyl hydrolases were significantly increased in Cry3Aa-treated larvae, whereas functions associated with many metabolic processes were reduced, especially glycolysis, tricarboxylic acid cycle, and fatty acid synthesis. Microarray analysis was used to evaluate temporal changes in gene expression after 6, 12 or 24 h of Cry3Aa exposure. Overall, microarray analysis indicated that transcripts related to allergens, chitin-binding proteins, glycosyl hydrolases, and tubulins were induced, and those related to immunity and metabolism were repressed in Cry3Aa-intoxicated larvae. The 24 h microarray data validated most of the RNA-Seq data. Of the three intoxication intervals, larvae demonstrated more differential expression of transcripts after 12 h exposure to Cry3Aa. Gene expression examined by three different methods in control vs. Cry3Aa-treated larvae at the 24 h time point indicated that transcripts encoding proteins with chitin-binding domain 3 were the most differentially expressed in Cry3Aa-intoxicated larvae. Overall, the data suggest that T. molitor larvae mount a complex response to Cry3Aa during the initial 24 h of intoxication. Data from this study represent the largest genetic sequence

  17. Evaluation of dual energy quantitative CT for determining the spatial distributions of red marrow and bone for dosimetry in internal emitter radiation therapy

    International Nuclear Information System (INIS)

    Purpose: To evaluate a three-equation three-unknown dual-energy quantitative CT (DEQCT) technique for determining region specific variations in bone spongiosa composition for improved red marrow dose estimation in radionuclide therapy. Methods: The DEQCT method was applied to 80/140 kVp images of patient-simulating lumbar sectional body phantoms of three sizes (small, medium, and large). External calibration rods of bone, red marrow, and fat-simulating materials were placed beneath the body phantoms. Similar internal calibration inserts were placed at vertebral locations within the body phantoms. Six test inserts of known volume fractions of bone, fat, and red marrow were also scanned. External-to-internal calibration correction factors were derived. The effects of body phantom size, radiation dose, spongiosa region segmentation granularity [single (∼17 × 17 mm) region of interest (ROI), 2 × 2, and 3 × 3 segmentation of that single ROI], and calibration method on the accuracy of the calculated volume fractions of red marrow (cellularity) and trabecular bone were evaluated. Results: For standard low dose DEQCT x-ray technique factors and the internal calibration method, the RMS errors of the estimated volume fractions of red marrow of the test inserts were 1.2–1.3 times greater in the medium body than in the small body phantom and 1.3–1.5 times greater in the large body than in the small body phantom. RMS errors of the calculated volume fractions of red marrow within 2 × 2 segmented subregions of the ROIs were 1.6–1.9 times greater than for no segmentation, and RMS errors for 3 × 3 segmented subregions were 2.3–2.7 times greater than those for no segmentation. Increasing the dose by a factor of 2 reduced the RMS errors of all constituent volume fractions by an average factor of 1.40 ± 0.29 for all segmentation schemes and body phantom sizes; increasing the dose by a factor of 4 reduced those RMS errors by an average factor of 1.71 ± 0.25. Results

  18. Evaluation of dual energy quantitative CT for determining the spatial distributions of red marrow and bone for dosimetry in internal emitter radiation therapy

    Energy Technology Data Exchange (ETDEWEB)

    Goodsitt, Mitchell M., E-mail: goodsitt@umich.edu; Shenoy, Apeksha; Howard, David; Christodoulou, Emmanuel; Dewaraja, Yuni K. [Department of Radiology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States); Shen, Jincheng [Department of Biostatistics, University of Michigan, 1415 Washington Heights, Ann Arbor, Michigan 48109 (United States); Schipper, Matthew J. [Department of Radiation Oncology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States); Wilderman, Scott [Department of Nuclear Engineering, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States); Chun, Se Young [Ulsan National Institute of Science and Technology (UNIST), School of Electrical and Computer Engineering, Ulsan 689-798 (Korea, Republic of)

    2014-05-15

    Purpose: To evaluate a three-equation three-unknown dual-energy quantitative CT (DEQCT) technique for determining region specific variations in bone spongiosa composition for improved red marrow dose estimation in radionuclide therapy. Methods: The DEQCT method was applied to 80/140 kVp images of patient-simulating lumbar sectional body phantoms of three sizes (small, medium, and large). External calibration rods of bone, red marrow, and fat-simulating materials were placed beneath the body phantoms. Similar internal calibration inserts were placed at vertebral locations within the body phantoms. Six test inserts of known volume fractions of bone, fat, and red marrow were also scanned. External-to-internal calibration correction factors were derived. The effects of body phantom size, radiation dose, spongiosa region segmentation granularity [single (∼17 × 17 mm) region of interest (ROI), 2 × 2, and 3 × 3 segmentation of that single ROI], and calibration method on the accuracy of the calculated volume fractions of red marrow (cellularity) and trabecular bone were evaluated. Results: For standard low dose DEQCT x-ray technique factors and the internal calibration method, the RMS errors of the estimated volume fractions of red marrow of the test inserts were 1.2–1.3 times greater in the medium body than in the small body phantom and 1.3–1.5 times greater in the large body than in the small body phantom. RMS errors of the calculated volume fractions of red marrow within 2 × 2 segmented subregions of the ROIs were 1.6–1.9 times greater than for no segmentation, and RMS errors for 3 × 3 segmented subregions were 2.3–2.7 times greater than those for no segmentation. Increasing the dose by a factor of 2 reduced the RMS errors of all constituent volume fractions by an average factor of 1.40 ± 0.29 for all segmentation schemes and body phantom sizes; increasing the dose by a factor of 4 reduced those RMS errors by an average factor of 1.71 ± 0.25. Results

  19. Dicty_cDB: FCL-AA17 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA17 (Link to dictyBase) - G03264 DDB0191099 Contig-U15602-1 FCL-AA...17P (Link to Original site) FCL-AA17F 547 FCL-AA17Z 610 FCL-AA17P 1157 - - Show FCL-AA17 Library F...CL (Link to library) Clone ID FCL-AA17 (Link to dictyBase) Atlas ID - NBRP ID G03264 dictyBase ID DDB0191099... Link to Contig Contig-U15602-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA.../FCL-AA17Q.Seq.d/ Representative seq. ID FCL-AA17P (Link to Original site) Representative DNA sequence >FCL-AA

  20. Dicty_cDB: FCL-AA14 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA14 (Link to dictyBase) - G03263 DDB0218474 Contig-U16035-1 FCL-AA...14P (Link to Original site) FCL-AA14F 647 FCL-AA14Z 550 FCL-AA14P 1197 - - Show FCL-AA14 Library F...CL (Link to library) Clone ID FCL-AA14 (Link to dictyBase) Atlas ID - NBRP ID G03263 dictyBase ID DDB0218474... Link to Contig Contig-U16035-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA.../FCL-AA14Q.Seq.d/ Representative seq. ID FCL-AA14P (Link to Original site) Representative DNA sequence >FCL-AA

  1. Dicty_cDB: FCL-AA19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA19 (Link to dictyBase) - G01757 DDB0230128 Contig-U16036-1 FCL-AA...19P (Link to Original site) FCL-AA19F 246 FCL-AA19Z 568 FCL-AA19P 814 - - Show FCL-AA19 Library FC...L (Link to library) Clone ID FCL-AA19 (Link to dictyBase) Atlas ID - NBRP ID G01757 dictyBase ID DDB0230128 ...Link to Contig Contig-U16036-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...19Q.Seq.d/ Representative seq. ID FCL-AA19P (Link to Original site) Representative DNA sequence >FCL-AA

  2. DEFORMATION BEHAVIOR OF AA6063 ALUMINIUM ALLOY AFTER REMOVING FRICTION EFFECT UNDER HOT WORKING CONDITIONS

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The hot deformation behavior of AA6063 aluminium alloy has been investigated by means of compression tests at temperatures between 400 and 520℃, and strain ratesranging from 2.5 to 10 s-1. Owing to the barreling, the theoretical model on the basis of Hill's general method is used to calculate the flow stress of a cylindrical spec-imen under uniaxial simple compression so as to consider the friction effect at the die-specimen interface. A method of evaluating the friction coefficient by combining compression tests with the finite element method is presented. The real flow behavior of AA6063 aluminium alloy can be described with sinh-Arrhenius equation. The hot deformation activation energy Q derived from the corrected stress and strain data is 232.350 k.J/mol.

  3. Experimental investigation of hardness of FSW and TIG joints of Aluminium alloys of AA7075 and AA6061

    Directory of Open Access Journals (Sweden)

    Chetan Patil

    2016-07-01

    Full Text Available This paper reports hardness testing conducted on welded butt joints by FSW and TIG welding process on similar and dissimilar aluminium alloys. FSW joints were produced for similar alloys of AA7075T651 and dissimilar alloys of AA7075T651- AA6061T6. The Friction stir welds of AA7075 & AA6061 aluminium alloy were produced at different tool rotational speeds of 650,700, 800, 900, 1000 and transverse speed of 30, 35, 40 mm/min. TIG welding was conducted along the rolling direction of similar and dissimilar aluminium plates. The Brinell hardness testing techniques were employed to conduct the tests; these tests were conducted on the welds to ascertain the joint integrity before characterization to have an idea of the quality of the welds

  4. Failure analysis of fusion clad alloy system AA3003/AA6xxx sheet under bending

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Y., E-mail: shiyh@mcmaster.ca [Department of Mechanical Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada); Jin, H. [Novelis Global Technology Center, P.O. Box 8400, Kingston, Ontario, Canada K7L 5L9 (Canada); Wu, P.D. [Department of Mechanical Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada); Lloyd, D.J. [Aluminum Materials Consultants, 106 Nicholsons Point Road, Bath, Ontario, Canada K0H 1G0 (Canada); Embury, D. [Department of Mechanical Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada)

    2014-07-29

    An ingot of AA6xxx Al–Si–Mg–Cu alloy clad with AA3003 Al–Mn alloy was co-cast by Fusion technology. Bending tests and numerical modeling were performed to investigate the potential for sub-surface cracking for this laminate system. To simulate particle-induced crack initiation and growth, both random and stringer particles have been selected to mimic the particle distribution in the tested samples. The morphology of cracking in the model was similar to that observed in clad sheet tested in the Cantilever bend test. The crack initiated in the core close to the clad-core interface where the strain in the core is highest, between particles or near particles and propagates along local shear bands in the core, while the clad layer experiences extreme thinning before failure.

  5. Ultra-narrow Negative Flare Front Observed in Helium-10830~\\AA\\ using the 1.6 m New Solar Telescope

    CERN Document Server

    Xu, Yan; Ding, Mingde; Kleint, Lucia; Su, Jiangtao; Liu, Chang; Ji, Haisheng; Chae, Jongchul; Jing, Ju; Cho, Kyuhyoun; Cho, Kyungsuk; Gary, Dale; Wang, Haimin

    2016-01-01

    Solar flares are sudden flashes of brightness on the Sun and are often associated with coronal mass ejections and solar energetic particles which have adverse effects in the near Earth environment. By definition, flares are usually referred to bright features resulting from excess emission. Using the newly commissioned 1.6~m New Solar Telescope at Big Bear Solar Observatory, here we show a striking "negative" flare with a narrow, but unambiguous "dark" moving front observed in He I 10830 \\AA, which is as narrow as 340 km and is associated with distinct spectral characteristics in H-alpha and Mg II lines. Theoretically, such negative contrast in He I 10830 \\AA\\ can be produced under special circumstances, by nonthermal-electron collisions, or photoionization followed by recombination. Our discovery, made possible due to unprecedented spatial resolution, confirms the presence of the required plasma conditions and provides unique information in understanding the energy release and radiative transfer in astronomi...

  6. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis

    Science.gov (United States)

    Gueutin, Victor; Langlois, Anne-Lyse; Shehwaro, Nathalie; Elharraqui, Ryme; Rouvier, Philippe; Izzedine, Hassane

    2013-01-01

    Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported. PMID:24558629

  7. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis

    OpenAIRE

    Victor Gueutin; Anne-Lyse Langlois; Nathalie Shehwaro; Ryme Elharraqui; Philippe Rouvier; Hassane Izzedine

    2013-01-01

    Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported.

  8. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis

    Directory of Open Access Journals (Sweden)

    Victor Gueutin

    2013-01-01

    Full Text Available Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported.

  9. NCBI nr-aa BLAST: CBRC-PTRO-27-0055 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PTRO-27-0055 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus... influenzae PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 8e-09 53% ...

  10. NCBI nr-aa BLAST: CBRC-HSAP-02-0029 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-HSAP-02-0029 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus... influenzae PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 5e-11 48% ...

  11. NCBI nr-aa BLAST: CBRC-PTRO-02-0026 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PTRO-02-0026 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus... influenzae PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 8e-09 50% ...

  12. NCBI nr-aa BLAST: CBRC-GGAL-35-0091 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0091 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus... influenzae PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 2e-08 34% ...

  13. NCBI nr-aa BLAST: CBRC-OLAT-13-0071 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OLAT-13-0071 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus... influenzae PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 0.14 37% ...

  14. NCBI nr-aa BLAST: CBRC-ACAR-01-0367 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0367 ref|ZP_01790024.1| hypothetical protein CGSHiAA_05974 [Haemophilus... influenzae PittAA] gb|EDK08288.1| hypothetical protein CGSHiAA_05974 [Haemophilus influenzae PittAA] ZP_01790024.1 4.0 29% ...

  15. NCBI nr-aa BLAST: CBRC-HSAP-02-0031 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-HSAP-02-0031 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus... influenzae PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 6e-09 52% ...

  16. NCBI nr-aa BLAST: CBRC-RNOR-08-0315 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RNOR-08-0315 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus... influenzae PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 8e-25 73% ...

  17. NCBI nr-aa BLAST: CBRC-RNOR-15-0027 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RNOR-15-0027 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus... influenzae PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 2e-30 98% ...

  18. NCBI nr-aa BLAST: CBRC-AGAM-07-0022 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0022 ref|ZP_01789747.1| hypothetical protein CGSHiAA_08330 [Haemophilus... influenzae PittAA] gb|EDK08473.1| hypothetical protein CGSHiAA_08330 [Haemophilus influenzae PittAA] ZP_01789747.1 2e-14 23% ...

  19. 汶川地震灾后人口与居民点空间配置的适宜性评价%Suitability evaluation of population and settlements spatial layout after Wenchuan Earthquake

    Institute of Scientific and Technical Information of China (English)

    方创琳; 吴丰林; 李茂勋

    2011-01-01

    The suitability evaluation of population and settlements spatial layout in the mountainous areas is an important basis on which the scale of population and settlement after Wenchuan Earthquake is determined. Based on the statistical data of field reseamh, this paper chooses 1264 towns in 51 counties as the scope of evaluation, selects eight indices in the evaluation index system which includes post-disaster population scale, population density,urbanization rate, the percentage of migrant workers, death rate by earthquake, the percentage of minorities, elevation-slope integrated terrain and comprehensive geological condition. Besides, this paper uses AHP supported by entropy technique and fuzzy membership function model to calculate the suitability evaluation index and then divides the disaster areas into five types: highly suitable area (area accounted for 11.03%), relatively highly suitable area (15.29%), moderately suitable area (29%), less suitable area (30.08%) and unsuitable area (14.6%). According to the result of suitability evaluation, this paper puts forward several suggestions for the reconstruction as follows: the urban system and the building of new countryside should be guided by the suitability evaluation subareas; post-earthquake reconstruction avoids zones near Longmenshan fracture and high-mountain gorge areas as far as possible; the scale of population and settlement should not exceed the capacity of resources and environment; population should be resettled as close as possible by considering adequately the heterogenicity and homogeneity of regional nationality culture characteristics;densely resettle the people at plains and hilly areas; encourage the migrant workers settle in the working place with their families voluntarily; and urban system reconstruction such as industry layout and important projects of lifeline should be guided by the spatial layout suitability evaluation.

  20. Evaluation of the Audio Bracelet for Blind Interaction for improving mobility and spatial cognition in early blind children - A pilot study.

    Science.gov (United States)

    Finocchietti, Sara; Cappagli, Giulia; Ben Porquis, Lope; Baud-Bovy, Gabriel; Cocchi, Elena; Gori, Monica

    2015-08-01

    This study was designed to assess the effectiveness of the Audio Bracelet for Blind Interaction (ABBI) system for improving mobility and spatial cognition in visually impaired children. The bracelet is worn on the wrist and the key feature is to provide an audio feedback about body movements to help visually impaired children to build a sense of space. Nine early blind children took part at this study. The study lasted 12 weeks. Once per week each child participated in a 45-minutes ABBI rehabilitation with trained professionals. He also had to use it one hour per day at home alone or with one relative. The mobility and spatial cognition abilities were measured before and after a 12-weeks rehabilitation program with three different tests. Results showed that the use of the Audio Bracelet for Blind Interaction allowed the early blind children to significantly improve their mobility and spatial abilities. Although an extended study including a larger number of participants is needed to confirm these data, the present results are encouraging. They do suggest that ABBI could be used for rehabilitate the sense of space in visually impaired children. PMID:26738148

  1. Evaluating effects of Everglades restoration on American crocodile populations in south Florida using a spatially-explicit, stage-based population model

    Science.gov (United States)

    Green, Timothy W.; Slone, Daniel H.; Swain, Eric D.; Cherkiss, Michael S.; Lohmann, Melinda; Mazzotti, Frank J.; Rice, Kenneth G.

    2014-01-01

    The distribution and abundance of the American crocodile (Crocodylus acutus) in the Florida Everglades is dependent on the timing, amount, and location of freshwater flow. One of the goals of the Comprehensive Everglades Restoration Plan (CERP) is to restore historic freshwater flows to American crocodile habitat throughout the Everglades. To predict the impacts on the crocodile population from planned restoration activities, we created a stage-based spatially explicit crocodile population model that incorporated regional hydrology models and American crocodile research and monitoring data. Growth and survival were influenced by salinity, water depth, and density-dependent interactions. A stage-structured spatial model was used with discrete spatial convolution to direct crocodiles toward attractive sources where conditions were favorable. The model predicted that CERP would have both positive and negative impacts on American crocodile growth, survival, and distribution. Overall, crocodile populations across south Florida were predicted to decrease approximately 3 % with the implementation of CERP compared to future conditions without restoration, but local increases up to 30 % occurred in the Joe Bay area near Taylor Slough, and local decreases up to 30 % occurred in the vicinity of Buttonwood Canal due to changes in salinity and freshwater flows.

  2. A new spatial orientation memory test: Evaluation in patients with mild Alzheimer's disease and in patients with operated and unoperated mesial temporal lobe epilepsy

    Directory of Open Access Journals (Sweden)

    Lisiane Tuon

    2007-06-01

    Full Text Available Background and objectives: Spatial orientation and spatial learning depend on the medial temporal lobe. A new test of spatial memory in humans is described, and applied to patients with Alzheimer's disease (AD, with presumable damage of that region, and to patients with unilateral mesial temporal sclerosis (MTS submitted or not to treatment by selective surgical amygdala-hippocampectomy (SAH. Methods: Subjects were asked to go to each of four objects hanging from the wall of a room: a cylinder, a square, a ball and a triangle (trial 1. In trial 2 they repeated this blindfolded; all figures except the cylinder were removed; once the subjects reached the cylinder they had to say what figures should be at the left, right and back. In trial 3, all figures were withdrawn and the subjects, again blindfolded, were instructed first to go to the front, right, left and back, and then to go to the former positions occupied by the cylinder, the ball, the square and the triangle. Results: Experiment 1 studied 10 patients with mild AD and 10 controls matched by age, gender and schooling. Performance was 46% lower in AD patients relative to controls (p < 0.001. Experiment 2 studied 23 patients with MTS, 20 patients submitted to SAH, and 23 healthy volunteers with similar levels of age, gender and schooling. No differences in performance among these three groups were observed. Conclusions: The test distinguished performance deficits of AD patients relative to controls, but not among MTS and STH patients and controls.

  3. Histamine ameliorates spatial memory deficits induced by MK-801 infusion into ventral hippocampus as evaluated by radial maze task in rats

    Institute of Scientific and Technical Information of China (English)

    Li-sha XU; Li-xia YANG; Wei-wei HU; Xiao YU; Li MA; Lu-ying LIU; Er-qing WEI; Zhong CHEN

    2005-01-01

    Aim: To investigate the role of histamine in memory deficits induced by MK-801 infusion into the ventral hippocampus in rats. Methods: An 8-arm radial maze (4arms baited) was used to assess spatial memory. Results: Bilateral ventral intrahippocampal (ih) infusion of MK-801 (0.3 μg/site), an N-methyl-D-aspartate (NMDA) antagonist, impaired the retrieval process in both working memory and reference memory. Intrahippocampal injection of histamine (25 or 50 ng/site) or intraperitoneal (ip) injection of histidine (25, 50 or 100 mg/kg) markedly ameliorated the spatial memory deficits induced by MK-801. Both the histamine H1 antagonist pyrilamine (0.5 or 1.0 μg/site, ih) and the H2 antagonist cimetidine (2.5 μg/site,ih) abolished the ameliorating effect of histidine (100 mg/kg, ip) on reference memory deficits, but not that on working memory deficits induced by MK-801. Conclusion:The results indicate that histamine in the ventral hippocampus can ameliorate MK-801-induced spatial memory deficits, and that histamine's effect on reference memory is mediated by postsynaptic histamine H1 and H2 receptors.

  4. AA, shims and washers on quadrupole ends

    CERN Multimedia

    CERN PhotoLab

    1981-01-01

    Due to the fact that much of the field of the quadrupoles was outside the iron (in particular with the wide quadrupoles) and that thus the fields of quadrupoles and bending magnets interacted, the lattice properties of the AA could not be predicted with the required accuracy. After a first running period in 1980, during which detailed measurements were made with proton test beams, corrections to the quadrupoles were made in 1981, in the form of laminated shims at the ends of the poles, and with steel washers. With the latter ones, further refinements were made in an iterative procedure with measurements on the circulating beam. This eventually resulted, amongst other things, in a very low chromaticity, with the Q-values being constant to within +- 0.001 over the total momentum range of 6 %. Here we see the shims and washers on a narrow qudrupole (QFN, QDN). See also 8103203, 8103204, 8103205, 8103206.

  5. Effect of pressurized steam on AA1050 aluminium

    DEFF Research Database (Denmark)

    Jariyaboon, Manthana; Møller, Per; Ambat, Rajan

    2012-01-01

    Purpose - The purpose of this paper is to understand the effect of pressurized steam on surface changes, structures of intermetallic particles and corrosion behavior of AA1050 aluminium. Design/methodology/approach - Industrially pure aluminium (AA1050, 99.5 per cent) surfaces were exposed...... reactivities was observed due to the formation of the compact oxide layer. Originality/value - This paper reveals a detailed investigation of how pressurized steam can affect the corrosion behaviour of AA1050 aluminium and the structure of Fe-containing intermetallic particles....

  6. Corrosion issues of powder coated AA6060 aluminium profiles

    DEFF Research Database (Denmark)

    Din, Rameez Ud; Valgarðsson, Smári; Jellesen, Morten Stendahl;

    2015-01-01

    In this study detailed microstructural investigation of the reason for unexpected corrosion of powder coated aluminium alloy AA6060 windows profiles has been performed. The results from this study reveals that the failure of the window profiles was originated from the surface defects present...... on the extruded AA6060 aluminium profile after metallurgical process prior to powder coating. Surface defects are produced due to intermetallic particles in the alloy, which disturb the flow during the extrusion process. The corrosion mechanism leading to the failure of the powder coated AA6060 aluminium profiles...

  7. The A&A Experience With Impact Factors

    CERN Document Server

    Sandqvist, A

    2004-01-01

    There is a widespread impression that the scientific journal "Astronomy & Astrophysics" (A&A) has a smaller impact, as measured by citations to articles, than some of the other major astronomy journals. This impression was apparently supported - and probably created - by the Journal Citation Report (JCR), which is prepared annually by the Institute of Scientific Information (ISI) Web of Knowledge. The published poor impact factor of A&A was in fact wrong and was due to a serious flaw in the method used by ISI Web of Knowledge to determine it. The resulting damage inflicted upon A&A by the JCR is incalculable.

  8. Expression of Cry1Aa in cassava improves its insect resistance against Helicoverpa armigera.

    Science.gov (United States)

    Duan, Xiaoguang; Xu, Jia; Ling, Erjun; Zhang, Peng

    2013-09-01

    Lepidopteran insects affect cassava production globally, especially in intercropping system. The expression of Cry toxins in transgenic crops has contributed to an efficient control of insect pests, leading to a significant reduction in chemical insecticide usage. Helicoverpa armigera is a Lepidopteran pest that feeds on a wide range of plants like cotton and cassava. In the present study, transgenic cassava plants over-expressing Cry1Aa, which we named as Bt cassava, were developed and used to evaluate its efficacy against H. armigera as a model. Insect feeding assays were carried out to test the effects of Bt cassava leaves on the development and survival of H. armigera. Significant reduction (P cassava leaves in comparison with those fed with wild-type cassava leaves. The higher expression of Cry1Aa in transgenic cassava caused the lethal effect in larvae, in contrast to the normal growth and development of adults and pupation observed when fed with wild-type leaves. Morphological observation on the larval midguts showed that the consumption of Bt cassava affected the gut integrity of H. armigera. The columnar cells of the midgut epithelium were dramatically damaged and showed loose or disordered structure. Their cytoplasms become highly vacuolated and contained disorganized microvilli. Our study demonstrated that the transgenic cassava expressing the Cry1Aa is effective in controlling H. armigera. Our Bt transgenic cassava plant would provide a long-term beneficial effect on all crops in intercropping system, which in-turn, will be profitable to the farmers.

  9. Mechanical and microstructural characterization of single and double pass Aluminum AA6061 friction stir weld joints

    Science.gov (United States)

    Othman, N. H.; Shah, L. H.; Ishak, M.

    2015-12-01

    This study focuses on the effect of single pass (SP), double sided pass (DSP) and normal double pass (NDP) method on friction stir welding of aluminum AA6061. Two pieces of AA6061 alloy with thickness of 6 mm were friction stir welded by using conventional milling machine. The rotational speeds that were used in this study were 800 rpm, 1000 rpm and 1200 rpm, respectively. The welding speed is fixed to 100 mm/min. Microstructure observation of welded area was studied by using optical microscope. Tensile test and Vickers hardness test were used to evaluate the mechanical properties of this specimen. Mechanical property analysis results indicate that at low rotational speeds, defects such as surface lack of fill and tunneling in the welded area can be observed. Vickers hardness of specimens however did not vary much when rotational speed is varied. Welded specimens using single pass method shows higher tensile strength and hardness value compared to both double pass methods up to 180.61 MPa. Moreover, DSP showed better tensile test and hardness test compared to NDP method. The optimum parameters were found to be single pass method with 1200 rpm of rotational speed. Therefore economically sound to only perform SP method to obtain maximum tensile strength for AA6061 FSW with thickness of 6 mm.

  10. Spatially resolved energy dispersive x-ray spectroscopic method for in-situ evaluation of mechanical properties during the growth of a C - Pt composite nanowire

    OpenAIRE

    Amit Banerjee; Banerjee, S S

    2014-01-01

    A core-shell type C-Pt composite nanowire is fabricated using focused ion and electron beam induced chemical vapor deposition techniques. Using information from spatially resolved energy dispersive x-ray spectra, we detect the resonance vibration in the C-Pt composite nanowire. We use this method to measure the Young's moduli of the constituents (C, Pt) of the composite nanowire and also estimate the density of the FEB CVD grown Pt shell surrounding the C core. By measuring the resonance char...

  11. [Secondary amyloidosis (AA-type) due to localized cutaneous vasculitis].

    Science.gov (United States)

    Esteve, V; Ribera, L; Ponz, E; Almirall, J; López, T; Martínez Ocaña, J C; Ibeas, J; Rodríguez Jornet, A; Andreu, X; García, M

    2007-01-01

    We report a case of a 49 year old man, diagnosed soon after the outcome of casual proteinuria, of AA-type amyloidosis in relation to small and medium vessel cutaneous vasculitis without systemic involvement. This combination is a rare entity and only two cases of cutaneous hypersensibility vasculitis complicated with AA-type amyloidosis had been reported. We describe the results of the use of several immunosuppressive drugs during four years follow up with temporally total remission of the disease. PMID:18045042

  12. Systemic AA amyloidosis induced by liver cell adenoma.

    OpenAIRE

    Fievet, P; Sevestre, H; Boudjelal, M; Noel, L H; Kemeny, F; D. Franco; Delamarre, J; Capron, J.P.

    1990-01-01

    Systemic AA amyloidosis is a rare complication of benign tumours. This report describes a patient with hepatocellular adenoma associated with reactive AA amyloidosis. He had a nephrotic syndrome with deteriorating renal function and an increase of serum concentrations of acute phase proteins, mainly C-reactive protein. Resection of the tumour was followed by improvement in renal function and a marked decrease of the serum concentrations of acute phase proteins.

  13. AA amyloidosis as a complication of primary lymphedema.

    Science.gov (United States)

    Beloncle, François; Sayegh, Johnny; Eymerit-Morin, Caroline; Duveau, Agnès; Augusto, Jean-François

    2014-03-01

    Primary lymphedema is a rare disease caused by a disorder of lymphangiogenesis. Clinical presentation and age at onset are variable. AA amyloidosis is usually due to chronic inflammatory diseases, malignant tumors or less frequently chronic infectious diseases. We report here the first two cases of AA amyloidosis present with renal failure and nephrotic syndrome in patients with primary lymphedema-induced chronic leg ulcers. The first patient was a 62-year-old female who presented with chronic untreated leg ulcers for 8 years secondary to primary lymphedema. A kidney biopsy done for nephrotic syndrome allowed the diagnosis of AA amyloidosis. The second patient was a 54-year-old male who presented with hereditary lymphedema and elephantiasis since the age of 12. A salivary gland biopsy allowed the diagnosis of AA amyloidosis. Renal function deteriorated progressively needing chronic haemodialysis. Chronic leg ulcers have been rarely reported to induce AA amyloidosis. Only five other cases have been reported in the literature, but none of them with chronic lymphedema. We believe that the relation between lymphedema, chronic leg ulcers and AA amyloidosis is underestimated. PMID:23964754

  14. Six Myths About Spatial Thinking

    Science.gov (United States)

    Newcombe, Nora S.; Stieff, Mike

    2012-04-01

    Visualizations are an increasingly important part of scientific education and discovery. However, users often do not gain knowledge from them in a complete or efficient way. This article aims to direct research on visualizations in science education in productive directions by reviewing the evidence for widespread assumptions that learning styles, sex differences, developmental stages, and spatial language determine the impact of visualizations on science learning. First, we examine the assumption that people differ in their verbal versus visual learning style. Due to the lack of rigorous evaluation, there is no current support for this distinction. Future research should distinguish between two different kinds of visual learning style. Second, we consider the belief that there are large and intractable sex differences in spatial ability resultant from immutable biological reasons. Although there are some spatial sex differences (in some types of spatial tests although not all), there is actually only very mixed support for biological causation. Most important, there is conclusive evidence that spatial skills can be improved through training and education. Third, we explore educators' use of Piaget's ideas about spatial development to draw conclusions about 'developmental appropriateness'. However, recent research on spatial development has focused on identifying sequences that begin with early starting points of skill, and spatial education is possible in some form at all ages. Fourth, although spatial language does not determine spatial thought, it does frame attention in a way that can have impact on learning and understanding. We examine the empirical support for each assumption and its relevance to future research on visualizations in science education.

  15. Handbook of Spatial Statistics

    CERN Document Server

    Gelfand, Alan E

    2010-01-01

    Offers an introduction detailing the evolution of the field of spatial statistics. This title focuses on the three main branches of spatial statistics: continuous spatial variation (point referenced data); discrete spatial variation, including lattice and areal unit data; and, spatial point patterns.

  16. Interaction of Lysinibacillus sphaericus Cry48Aa/Cry49Aa toxin with midgut brush-border membrane fractions from Culex quinquefasciatus larvae.

    Science.gov (United States)

    Guo, Q-Y; Hu, X-M; Cai, Q-X; Yan, J-P; Yuan, Z-M

    2016-04-01

    The Cry48Aa/Cry49Aa mosquitocidal toxin from Lysinibacillus sphaericus was uniquely composed of a three-domain (Cry) toxin and binary (Bin) toxin-like protein, with high toxicity against Culex spp. However, its mode of action against the target mosquitoes is still unknown. In this study, Cry48Aa, Cry49Aa and its N- and C-terminal truncated proteins were expressed and purified, and the binding affinities of the purified proteins with midgut brush-border membrane fractions (BBMFs) from Culex quin-quefasciatus larvae were performed. The results showed that both Cry48Aa and Cry49Aa have specific and high binding affinity to BBMFs, with dissociation constants of 9.5 ± 1.8 and 25.4 ± 3.8 nM, respectively. Competition assays demonstrated that Cry49Aa C-terminal derivatives were able to bind to the BBMFs, whereas Far-Western dot blot analysis revealed that its N-terminal constructs interacted with Cry48Aa. Nevertheless, larvicidal activity was almost lost when Cry49Aa truncated proteins, either individually or in pairs, combined with Cry48Aa. It is concluded that Cry49Aa is responsible for receptor binding and interaction with Cry48Aa and plays an important role in the mechanism of action of these two-component toxins. PMID:26748768

  17. The OIV 1407.3\\AA /1401.1\\AA\\ emission-line ratio in a plasma

    CERN Document Server

    Nessib, Nabil Ben; Qindeel, Rabia; Sahal-Bréchot, Sylvie; Dimitrijević, Milan S

    2013-01-01

    Line ratio of O IV 1407.3 \\AA/1401.1 \\AA\\- is calculated using mostly our own atomic and collisional data. Energy levels and oscillator strengths needed for this calculation have been calculated using a Hartree-Fock relativistic (HFR) approach. The electron collision strengths introduced in the statistic equilibrium equations are fitted by Line ratio of O IV 1407.3 \\AA/1401.1 \\AA\\- is calculated using mostly our own atomic and collisional data. Energy levels and oscillator strengths needed for this calculation have been calculated using a Hartree-Fock relativistic (HFR) approach. The electron collision strengths introduced in the statistic equilibrium equations are fitted by polynomials for different energies. Comparison has also been made with available theoretical results. The provided line ratio has been obtained for a set of electron densities from $10^{8}$ cm$^{-3}$ to $10^{13}$ cm$^{-3}$ and for a fixed temperature of 50 000 K.

  18. Spatially varying coefficient models in real estate: Eigenvector spatial filtering and alternative approaches

    NARCIS (Netherlands)

    Helbich, M; Griffith, D

    2016-01-01

    Real estate policies in urban areas require the recognition of spatial heterogeneity in housing prices to account for local settings. In response to the growing number of spatially varying coefficient models in housing applications, this study evaluated four models in terms of their spatial patterns

  19. Spatial comparison of areas at risk for schistosomiasis in the hilly and mountainous regions in the People’s Republic of China: evaluation of the long-term effect of the 10-year World Bank Loan Project

    Directory of Open Access Journals (Sweden)

    Zhi-Jie Zhang

    2012-05-01

    Full Text Available The long-term effectiveness of the mainly chemotherapy-based control strategy of the World Bank Loan Project (WBLP for schistosomiasis control in Chinese hilly and mountainous regions was evaluated with a view to determine the best road forward. Based on the national database of schistosomiasis prevalence for the periods of 1999-2001 and 2007- 2008 in the People’s Republic of China, a Bayesian regression model was used for spatial comparison of schistosomiasis risk distribution between two periods taking account of all the potential risk factors simultaneously through two latent components of random effects: spatially correlated heterogeneities (CH and spatially uncorrelated heterogeneities (UH. Four different types of endemic areas were investigated: those that remained endemic despite control efforts (17 or 37.8%, those that became non-endemic (9 or 20.0%, those that reverted back to endemicity (7 or 15.6%, and those with fluctuating endemicity (12 or 26.7%. The overall prevalence of schistosomiasis was lower in 2007-2008 compared with that in 1999- 2001, but the spatial distribution of risk remained similar. Compared to 1999-2001, the magnitude and range of risk even tended to be greater in 2007-2008. UH showed a fluctuating pattern, while CH increased gradually doubling over the two periods. There was no evidence for long-term effectiveness of the WBLP chemotherapy-based control strategy in this region. Controlling the effect of UH is still the main aspect of current schistosomiasis control strategy for the hilly and mountainous regions, but innovative methods are urgently needed for effectively controlling UH.

  20. Spatial comparison of areas at risk for schistosomiasis in the hilly and mountainous regions in the People's Republic of China: evaluation of the long-term effect of the 10-year World Bank Loan Project.

    Science.gov (United States)

    Zhang, Zhi-Jie; Zhu, Rong; Bergquist, Robert; Chen, Dong-Mei; Chen, Yue; Zhang, Li-Juan; Guo, Jia-Gang; Zhao, Fei; Jiang, Qing-Wu

    2012-05-01

    The long-term effectiveness of the mainly chemotherapy-based control strategy of the World Bank Loan Project (WBLP) for schistosomiasis control in Chinese hilly and mountainous regions was evaluated with a view to determine the best road forward. Based on the national database of schistosomiasis prevalence for the periods of 1999-2001 and 2007-2008 in the People's Republic of China, a Bayesian regression model was used for spatial comparison of schistosomiasis risk distribution between two periods taking account of all the potential risk factors simultaneously through two latent components of random effects: spatially correlated heterogeneities (CH) and spatially uncorrelated heterogeneities (UH). Four different types of endemic areas were investigated: those that remained endemic despite control efforts (17 or 37.8%), those that became non-endemic (9 or 20.0%), those that reverted back to endemicity (7 or 15.6%), and those with fluctuating endemicity (12 or 26.7%). The overall prevalence of schistosomiasis was lower in 2007-2008 compared with that in 1999-2001, but the spatial distribution of risk remained similar. Compared to 1999-2001, the magnitude and range of risk even tended to be greater in 2007-2008. UH showed a fluctuating pattern, while CH increased gradually doubling over the two periods. There was no evidence for long-term effectiveness of the WBLP chemotherapy-based control strategy in this region. Controlling the effect of UH is still the main aspect of current schistosomiasis control strategy for the hilly and mountainous regions, but innovative methods are urgently needed for effectively controlling UH.

  1. Evaluation

    Institute of Scientific and Technical Information of China (English)

    Fred Genesee

    2005-01-01

    @@ Introduction Evaluation in TESOL settings is a process of collecting,analysing and interpreting information about teaching and learning in order to make informed decisions that enhance student achievement and the success of educational programmes (Rea-Dickins and Germaine 1993; Genesee and Upshur 1996;O'Malley and Valdez-Pierce 1996).Three simple examples help explicate the varied forms evaluation can take in TESOL settings:

  2. Spatially resolved energy dispersive x-ray spectroscopic method for in-situ evaluation of mechanical properties during the growth of a C - Pt composite nanowire

    Energy Technology Data Exchange (ETDEWEB)

    Banerjee, Amit; Banerjee, S. S., E-mail: satyajit@iitk.ac.in [Department of Physics, Indian Institute of Technology Kanpur, Kanpur, 208016 (India)

    2014-05-15

    A core-shell type C-Pt composite nanowire is fabricated using focused ion and electron beam induced chemical vapor deposition techniques. Using information from spatially resolved energy dispersive x-ray spectra, we detect the resonance vibration in the C-Pt composite nanowire. We use this method to measure the Young's moduli of the constituents (C, Pt) of the composite nanowire and also estimate the density of the FEB CVD grown Pt shell surrounding the C core. By measuring the resonance characteristics of the composite nanowire we estimate a Pt shell growth rate of ∼0.9 nms{sup −1}. The study is analyzed to suggest that the Pt shell growth mechanism is primarily governed by the sticking coefficient of the organometallic vapor on the C nanowire core.

  3. Evaluation of potential human health effects associated with the agricultural uses of 1,3-D: Spatial and temporal stochastic risk analysis.

    Science.gov (United States)

    Driver, Jeffrey H; Price, Paul S; Van Wesenbeeck, Ian; Ross, John H; Gehen, Sean; Holden, Larry R; Landenberger, Bryce; Hastings, Kerry; Yan, Zhongyu June; Rasoulpour, Reza

    2016-11-15

    Dow AgroSciences (DAS) markets and sells 1,3-Dichloropropene (1,3-D), the active ingredient in Telone®, which is used as a pre-plant soil fumigant nematicide in economically important crops in California. 1,3-D has been regulated as a "probable human carcinogen" and the California Department of Pesticide Regulation limits use of 1,3-D based on human health risk assessments for bystanders. This paper presents a risk characterization for bystanders based on advances in the assessment of both exposure and hazard. The revised bystander risk assessment incorporates significant advances: 1) new data on residency duration and mobility in communities where 1,3-D is in high demand; 2) new information on spatial and temporal concentrations of 1,3-D in air based on multi-year modeling using a validated model; and 3) a new stochastic spatial and temporal model of long-term exposures. Predicted distributions of long-term, chronic exposures indicate that current, and anticipated uses of 1,3-D would result in lifetime average daily doses lower than 0.002mg/kg/d, a dose associated with theoretical lifetime excess cancer risk of 95% of the local population based on a non-threshold risk assessment approach. Additionally, examination of 1,3-D toxicity studies including new chronic toxicity data and mechanism of action supports the use of a non-linear, threshold based risk assessment approach. The estimated maximum annual average daily dose of 1000-fold, a clear indication of acceptable risk for human health. In summary, the best available science supports 1,3-D's threshold nature of hazard and the revised exposure assessment supports that current agricultural uses of 1,3-D are associated with reasonable certainty of no harm, i.e., estimated long-term exposures pose insignificant health risks to bystanders even when the non-threshold approach is assumed.

  4. Mathematical Modeling of spatial disease variables by Spatial Fuzzy Logic for Spatial Decision Support Systems

    Science.gov (United States)

    Platz, M.; Rapp, J.; Groessler, M.; Niehaus, E.; Babu, A.; Soman, B.

    2014-11-01

    A Spatial Decision Support System (SDSS) provides support for decision makers and should not be viewed as replacing human intelligence with machines. Therefore it is reasonable that decision makers are able to use a feature to analyze the provided spatial decision support in detail to crosscheck the digital support of the SDSS with their own expertise. Spatial decision support is based on risk and resource maps in a Geographic Information System (GIS) with relevant layers e.g. environmental, health and socio-economic data. Spatial fuzzy logic allows the representation of spatial properties with a value of truth in the range between 0 and 1. Decision makers can refer to the visualization of the spatial truth of single risk variables of a disease. Spatial fuzzy logic rules that support the allocation of limited resources according to risk can be evaluated with measure theory on topological spaces, which allows to visualize the applicability of this rules as well in a map. Our paper is based on the concept of a spatial fuzzy logic on topological spaces that contributes to the development of an adaptive Early Warning And Response System (EWARS) providing decision support for the current or future spatial distribution of a disease. It supports the decision maker in testing interventions based on available resources and apply risk mitigation strategies and provide guidance tailored to the geo-location of the user via mobile devices. The software component of the system would be based on open source software and the software developed during this project will also be in the open source domain, so that an open community can build on the results and tailor further work to regional or international requirements and constraints. A freely available EWARS Spatial Fuzzy Logic Demo was developed wich enables a user to visualize risk and resource maps based on individual data in several data formats.

  5. Rupture locations of friction stir welded joints of AA2017-T351 and AA6061-T6 aluminum alloys

    Institute of Scientific and Technical Information of China (English)

    LIU Hui-jie; FENG Ji-cai; H. Fujii; M. Maeda; K. Nogi

    2005-01-01

    The tensile rupture locations of friction stir welded joints of AA2017-T351 and AA6061-T6 aluminum alloys were examined. The experiments show that the rupture locations of the joints are different for the two aluminum alloys, which are influenced by the welding parameters. When the joints are free of welding defects, the AA2017-T351 joints are ruptured in the weld nugget adjacent to the thermo-mechanically affected zone on the advancing side and the rupture surfaces appear as oval contours of the weld nugget, while the AA6061-T6 joints are ruptured in the heat affected zone on the retreating side and the rupture surfaces are inclined at a certain degree to the bottom surfaces of the joints. When welding defects are present in the joints, the AA2017-T351 joints are ruptured in the weld center, while the AA6061-T6 joints are ruptured on the retreating side near the weld center. The rupture locations of the joints are dependent on the internal structures of the joints and can be explained through them.

  6. Thermodynamic Model of Spatial Memory

    Science.gov (United States)

    Kaufman, Miron; Allen, P.

    1998-03-01

    We develop and test a thermodynamic model of spatial memory. Our model is an application of statistical thermodynamics to cognitive science. It is related to applications of the statistical mechanics framework in parallel distributed processes research. Our macroscopic model allows us to evaluate an entropy associated with spatial memory tasks. We find that older adults exhibit higher levels of entropy than younger adults. Thurstone's Law of Categorical Judgment, according to which the discriminal processes along the psychological continuum produced by presentations of a single stimulus are normally distributed, is explained by using a Hooke spring model of spatial memory. We have also analyzed a nonlinear modification of the ideal spring model of spatial memory. This work is supported by NIH/NIA grant AG09282-06.

  7. Spatial Management Areas

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Spatial management files combine all related and relevant spatial management files into an integrated fisheries management file. Overlaps of the redundant spatial...

  8. Effect of Weld Tool Geometry on Friction Stir Welded AA2219-T87 Properties

    Science.gov (United States)

    Querin, Joseph A.; Schneider, Judy A.

    2008-01-01

    In this study, flat panels of AA2219-T87 were friction stir welded (FSWed) using weld tools with tapered pins The three pin geometries of the weld tools included: 0 (straight cylinder), 30 , and 60 angles on the frustum. For each weld tool geometry, the FSW process parameters were optimized to eliminate defects. A constant heat input was maintained while varying the process parameters of spindle rpm and travel speed. This provided a constant heat input for each FSW weld panel while altering the hot working conditions imparted to the workpiece. The resulting mechanical properties were evaluated from tensile test results of the FSW joint.

  9. Rare earth conversion coatings grown on AA6061 aluminum alloys. Corrosion studies

    Energy Technology Data Exchange (ETDEWEB)

    Brachetti S, S. B. [Instituto Tecnologico de Ciudad Madero, Av. 1o. de Mayo y Sor Juana I. de la Cruz, Col. Los Mangos, 89440 Ciudad Madero, Tanaulipas (Mexico); Dominguez C, M. A.; Torres H, A. M.; Onofre B, E. [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada - Altamira, Carretera Tampico-Puerto Industrial Altamira Km. 14.5, 89600 Altamira, Tamaulipas (Mexico); De la Cruz H, W., E-mail: mdominguezc@ipn.mx [UNAM, Centro de Nanociencias y Nanotecnologia, Apdo. Postal 2681, 22800 Ensenada, Baja California (Mexico)

    2014-07-01

    The present work is aimed to investigate the corrosion resistance of rare earth protective coatings deposited by spontaneous deposition on AA6061 aluminum alloy substrates. Coatings were deposited from water-based Ce(NO{sub 3}){sub 3} and La(NO{sub 3}){sub 3} solutions by varing parameters such as rare earth solution concentration, bath temperature and immersion time. The values of the Tafel slopes indicate that the cathodic process is favored by concentration polarization rather than activation polarization. Chemical and morphological characterizations of the surface before and after electrochemical evaluations were performed by X-ray photoelectron spectroscopy and scanning electron microscopy. (Author)

  10. Symbiotic seed germination and protocorm development of Aa achalensis Schltr., a terrestrial orchid endemic from Argentina.

    Science.gov (United States)

    Sebastián, Fracchia; Vanesa, Silvani; Eduardo, Flachsland; Graciela, Terada; Silvana, Sede

    2014-01-01

    Aa achalensis is an endangered terrestrial orchid endemic from Argentina. In vitro symbiotic seed germination was evaluated for its propagation. Five different fungal strains were isolated from this species: two Rhizoctonia-like related to Thanatephorus cucumeris and three ascomicetaceous fungi belonging to Phialophora graminicola and one to an uncultured Pezizaceae. All five isolates promoted seed germination being one T. cucumeris strain the most effective. After 16 weeks of growth, 30% of A. achalensis protocorms developed until seedlings with two/four leaves in this treatment. These findings open an opportunity to the knowledge and preservation of this species.

  11. Effect of cooling rate on microstructure of friction-stir welded AA1100 aluminum alloy

    Science.gov (United States)

    Yi, D.; Mironov, S.; Sato, Y. S.; Kokawa, H.

    2016-06-01

    In this work, the microstructural changes occurring during cooling of friction-stir welded aluminum alloy AA1100 were evaluated. To this end, friction-stir welding (FSW) was performed in a wide range of cooling rates of 20-62 K/s and the evolved microstructures were studied by using electron backscatter diffraction. Below 0.6 Tm (Tm being the melting point), the stir zone material was found to experience no significant changes during cooling. At higher FSW temperatures, however, notable changes occurred in the welded material, including grain growth, sharpening of texture, reduction of the fraction of high-angle boundaries and material softening.

  12. Rare earth conversion coatings grown on AA6061 aluminum alloys. Corrosion studies

    International Nuclear Information System (INIS)

    The present work is aimed to investigate the corrosion resistance of rare earth protective coatings deposited by spontaneous deposition on AA6061 aluminum alloy substrates. Coatings were deposited from water-based Ce(NO3)3 and La(NO3)3 solutions by varing parameters such as rare earth solution concentration, bath temperature and immersion time. The values of the Tafel slopes indicate that the cathodic process is favored by concentration polarization rather than activation polarization. Chemical and morphological characterizations of the surface before and after electrochemical evaluations were performed by X-ray photoelectron spectroscopy and scanning electron microscopy. (Author)

  13. AAS Committee on Employment Panel Introduction

    Science.gov (United States)

    Borne, Kirk; Fanelli, M. N.; Storrie-Lombardi, L. J.; Krishnamurthi, A.

    2006-12-01

    Many younger astronomers are unaware of the dangers and pitfalls that await them in the job market. Issues related to fringe benefits (if any), moving expenses, medical coverage for family members, teaching versus research expectations, etc. can lead to misunderstandings and to serious difficulties if these are not addressed early in the job interview process. The AAS Committee on Employment has often received letters from concerned junior members of the society, who feel that they needed more guidance and assistance in entering the job market for the first time. The major areas of concern have included those just listed, but there may be others. The session is structured as a panel presentation, whose members are asked to prepare in advance their top 10 questions that job applicants should ask, and we will instruct our panel members not to discuss their list at all with the other panel members prior to their presentations. This will ensure independent viewpoints and novel responses. The panel will consist of astronomers who have different perspectives on this issue, including old and young, postdoc and beyond, academic and non-academic. To kick off the session, we will invite a brief humorous presentation of the Top Ten List, in the style of The Night Show host David Letterman.

  14. Regional evaluation of particulate matter composition in an Atlantic coastal area (Cantabria region, northern Spain): Spatial variations in different urban and rural environments

    Science.gov (United States)

    Arruti, A.; Fernández-Olmo, I.; Irabien, A.

    2011-07-01

    The aim of this study was to determine the major components (Na, Ca, K, Mg, Fe, Al, NH 4+, SO 42-, NO 3-, Cl - and TC) and trace-metal levels (As, Ni, Cd, Pb, Ti, V, Cr, Mn, Cu, Mo, Rh and Hg) in PM 10 and PM 2.5 at an Atlantic coastal city (Santander, Cantabria region, Northern Spain). Additional samples were collected in other urban sites of the Cantabria region to assess the metal content found in different urban environments within the region. To control for the mass attributed to inland regional background particulate matter, samples were also collected in Los Tojos village. The spatial variability of the major PM components shows that PM origins are different at inland and coastal sites. In the coastal city of Santander, the most important contributors are (i) the marine aerosol and (ii) the secondary inorganic aerosol (SIA) and the total carbon (TC) in PM 10 and PM 2.5, respectively. Additionally, the influence of the coastal location on the ionic balance of PM is also studied. The trace metal spatial variability is studied using the coefficient of divergence (COD), which shows that the levels of trace metals at the three studied urban sites are mainly influenced by local emission sources. The main local tracers are identified as follows: Mn in the Santander area; Mo, Cr and Pb at Reinosa; and Ni and V at Castro Urdiales. A more detailed source apportionment study of the local trace metals at Santander is conducted by Principal Component Analysis (PCA) and Positive Matrix Factorisation (PMF); these two receptor models report complementary information. From these statistical analyses, the identified sources of trace metals in PM 10 are urban background sources, industrial sources and traffic. The industrial factor was dominated by Mn, Cu and Pb, which are trace metals used in steel production and manganese-ferroalloy production plant. With respect to PM 2.5, the identified emission sources of trace metals are combustion processes as well as traffic and

  15. Interactions between soil consumption and archaeological heritage: spatial analysis for hydrogeological risk evaluation and urban sprawl in the Tavoliere di Puglia (southern Italy)

    Science.gov (United States)

    Danese, Maria; Gioia, Dario; Masini, Nicola

    2015-04-01

    The soil consumption is a complex phenomenon because it is due to different causes and it also produces many consequences on landscape and related human activities. In low-relief areas of the Mediterranean regions such as the foredeep of the southern Italian chain, alluvional processes and flooding can play an important role on the amount of available soil, especially if one consider the recent climate changes and the recurrence of extreme events. Moreover the uncontrolled growth of the cities is a cause of soil consumption too. Consequently occurrence of flood events in low-relief areas, erosion processes and urban sprawl have a strong impact on agricultural activities and real estate market, but also in research activities about archaeological heritage, with the risk to loose signs of the past. To consider this phenomenon from a spatial point of view is essential to determine protection policies, but it is nowadays still a problem. In this contribution, we performed a detailed study of the geological and geomorphological features of the drainage network of the Tavoliere di Puglia plain in order to investigate erosional and depositional processes. GIS-supported statistical analysis of the drainage network features allow us to compile a map of the hydrogeological hazard [1]. The map has been used as a basic tool useful to consider areal distribution in soil consumption coming from alluvional processes, erosional phenomena and the urban sprawl of the Tavoliere di Puglia plain (Southern Italy). Moreover, we investigated the relationships between sectors of the Tavoliere di Puglia plain featured by higher hydrogeological risk and archaeological sensibility areas, such as places with existing or with not yet discovered archaeological sites or areas characterized by crop marks [2]. [1] Danese M., Gioia D., Biscione M., Masini N. 2014. Spatial Methods for Archaeological Flood Risk: The Case Study of the Neolithic Sites in the Apulia Region (Southern Italy). Computational

  16. Evaluation on the methods for collecting saliva before and after acid stimulation by salivary flow rate and sAA activity in rats%流率及唾液淀粉酶活性用于评价大鼠酸刺激前后唾液样本采集方法的探讨

    Institute of Scientific and Technical Information of China (English)

    林静; 杨泽民; 卢群

    2014-01-01

    目的:了解柠檬酸刺激对大鼠唾液淀粉酶( sAA)活性和唾液流率的影响,探讨味觉刺激下的唾液标本采集方法。方法随机选取正常雌性SD大鼠30只,先用微量取样器抽取刺激前的全唾液,然后用0.4 mol/L 0.50 cm×0.50 cm的柠檬酸滤纸每隔2.5 min刺激大鼠舌尖30 s,5 min采集的唾液混合为一管,连续采集15 min,共3管唾液样本,记录每管唾液采集量,用Bernfeld法测定sAA活性,计算唾液流率、酸刺激前后流率和sAA活性比值,检测流率和sAA活性的相关性。结果大鼠酸刺激后0~5 min、6~10 min、11~15 min 3个时间段的sAA活性和唾液流率以及其比值都显著增加(P0.05)。刺激前唾液流率与sAA呈显著正相关(P0.05) . A significant positive correlation was observed between sAA activity and salivary flow rate in unstimulated situation ( P<0. 05 ) , but a negative correlation was noted under stimulation( P<0.05) . Conclusion Citric acid stimulation may increase the sAA activity and salivary flow rate in rats. This convenient method is suitable for saliva collection.

  17. Evaluation of a novel noncontact spectrally and spatially resolved reflectance setup with continuously variable source-detector separation using silicone phantoms.

    Science.gov (United States)

    Andree, Stefan; Reble, Carina; Helfmann, Jurgen; Gersonde, Ingo; Illing, Gerd

    2010-01-01

    We present a new variant of a noncontact, oblique incidence spatially resolved reflectance setup. The continuously variable source detector separation enables adaptation to high and low albedo samples. Absorption (μ(a)) and reduced scattering coefficients (μ(') (s)) are determined in the wavelength range of 400-1000 nm using a lookup table, calculated by a Monte Carlo simulation of the light transport. The method is characterized by an silicone phantom study covering a wide parameter range 0.01 mm(-1) ≤ μ(a) ≤ 2.5 mm(-1) and 0.2 mm(-1) ≤ μ(') (s) ≤ 10 mm(-1), which includes the optical parameters of tissue in the visible and near infrared. The influence of the incident angle and the detection aperture on the simulated remission was examined. Using perpendicular incidence and 90-deg detection aperture in the Monte Carlo simulation in contrast to the experimental situation with 30-deg incidence and 4.6-deg detection aperture is shown to be valid for the parameter range μ(') (s) > 1 mm(-1) and μ(a) coefficient for increasing absorption can be the consequence of real physics instead of cross talk. PMID:21198213

  18. Using PET/CT Bone Scan Dynamic Data to Evaluate Tibia Remodeling When a Taylor Spatial Frame Is Used: Short and Longer Term Differences

    Science.gov (United States)

    Lundblad, Henrik; Maguire, Gerald Q.; Karlsson-Thur, Charlotte; Jonsson, Cathrine; Noz, Marilyn E.; Zeleznik, Michael P.; Jacobsson, Hans; Weidenhielm, Lars

    2015-01-01

    Eighteen consecutive patients, treated with a Taylor Spatial Frame for complex tibia conditions, gave their informed consent to undergo Na18F− PET/CT bone scans. We present a Patlak-like analysis utilizing an approximated blood time-activity curve eliminating the need for blood aliquots. Additionally, standardized uptake values (SUV) derived from dynamic acquisitions were compared to this Patlak-like approach. Spherical volumes of interest (VOIs) were drawn to include broken bone, other (normal) bone, and muscle. The SUVm(t) (m = max, mean) and a series of slopes were computed as (SUVm(ti) − SUVm(tj))/(ti − tj), for pairs of time values ti and tj. A Patlak-like analysis was performed for the same time values by computing ((VOIp(ti)/VOIe(ti))−(VOIp(tj)/VOIe(tj)))/(ti − tj), where p = broken bone, other bone, and muscle and e = expected activity in a VOI. Paired comparisons between Patlak-like and SUVm slopes showed good agreement by both linear regression and correlation coefficient analysis (r = 84%, rs = 78%-SUVmax, r = 92%, and rs = 91%-SUVmean), suggesting static scans could substitute for dynamic studies. Patlak-like slope differences of 0.1 min−1 or greater between examinations and SUVmax differences of ~5 usually indicated good remodeling progress, while negative Patlak-like slope differences of −0.06 min−1 usually indicated poor remodeling progress in this cohort. PMID:26436093

  19. Using PET/CT Bone Scan Dynamic Data to Evaluate Tibia Remodeling When a Taylor Spatial Frame Is Used: Short and Longer Term Differences

    Directory of Open Access Journals (Sweden)

    Henrik Lundblad

    2015-01-01

    Full Text Available Eighteen consecutive patients, treated with a Taylor Spatial Frame for complex tibia conditions, gave their informed consent to undergo Na18F− PET/CT bone scans. We present a Patlak-like analysis utilizing an approximated blood time-activity curve eliminating the need for blood aliquots. Additionally, standardized uptake values (SUV derived from dynamic acquisitions were compared to this Patlak-like approach. Spherical volumes of interest (VOIs were drawn to include broken bone, other (normal bone, and muscle. The SUVm(t (m=max, mean and a series of slopes were computed as (SUVm(ti-SUVm(tj/(ti-tj, for pairs of time values ti and tj. A Patlak-like analysis was performed for the same time values by computing ((VOIp(ti/VOIe(ti-(VOIp(tj/VOIe(tj/(ti-tj, where p = broken bone, other bone, and muscle and e = expected activity in a VOI. Paired comparisons between Patlak-like and SUVm slopes showed good agreement by both linear regression and correlation coefficient analysis (r=84%,rs=78%-SUVmax,r=92%, and rs=91%-SUVmean, suggesting static scans could substitute for dynamic studies. Patlak-like slope differences of 0.1 min−1 or greater between examinations and SUVmax differences of ~5 usually indicated good remodeling progress, while negative Patlak-like slope differences of −0.06 min−1 usually indicated poor remodeling progress in this cohort.

  20. The clinical utility of MR diffusion tensor imaging and spatially normalized PET to evaluate traumatic brain injury patients with memory and cognitive impairments

    International Nuclear Information System (INIS)

    We detected and compared abnormal brain areas using both MR diffusion tensor imaging (DTI) and easy Z score imaging system (eZIS) of fluorodeoxyglucose (FDG)-PET for traumatic brain injury patients with memory and cognitive impairments. Twenty normal subjects and eighteen diffuse axonal injury patients with memory and cognitive impairments were studied with DTI and eZIS of 18F-FDG-PET. DTI contained fractional anisotorophy (FA) analysis and the tractography for the corpus callosum. After PET imaging was performed, statistical analysis using eZIS was undergone with followed processing steps, including smoothing, normalization and z transformation with respect to normal database. Z score map was superimposed on 3D MRI brain. Group analysis was performed using statistical parametric mapping (SPM). In diffuse axonal injury patients, the decline of FA was observed around the corpus callosum in comparison with normal subjects and the reduction of glucose metabolism was shown in the cingulated association. These results suggest that the reduction of metabolism within the cingulated cortex indicated deprived neuronal activation caused by the impaired neuronal connectivity that was revealed with DTI. Furthermore, the metabolic abnormalities within the cingulated cortex may be responsible for memory and cognitive impairments. DTI and spatially normalized PET have a role in neuroimaging interpretation for patients with memory and cognition impairments be cause its 3D better visualization allows objective and systematic investigation. (author)

  1. Effect of weld parameter on mechanical and metallurgical properties of dissimilar joints AA6082–AA6061 in T6 condition produced by FSW

    Directory of Open Access Journals (Sweden)

    H. S. Patil

    2013-04-01

    Full Text Available The effect of processing parameters on the mechanical and metallurgical properties of dissimilar joints of AA6082–AA6061 produced by friction stir welding was analysed in this study. Different FSW samples were produced by varying the welding speeds of the tool as 50 and 62 mm/min and by varying the alloy positioned on the advancing side of the tool. In all the experiments the rotating speed is fixed at 1600rpm. All the welds were produced perpendicularly to the rolling direction for both the alloys. Microhardness (HV and tensile tests performed at room temperature were used to evaluate the mechanical properties of the joints. In order to analyse the microstructural evolution of the material, the weld’s cross-sections were observed optically and SEM observations were made of the fracture surfaces. The corrosion tests of base alloy and welded joints were carried out in 3.5%NaCl solution at a room temperature. Corrosion current and potential were determined using potentiostatic polarization measurements. It was found that the corrosion rates of welded joints were higher than that of base alloy.

  2. Effect of post weld heat treatment on tensile properties and microstructure characteristics of friction stir welded armour grade AA7075-T651 aluminium alloy

    Institute of Scientific and Technical Information of China (English)

    P. SIVARAJ; D. KANAGARAJAN; V. BALASUBRAMANIAN

    2014-01-01

    This paper reports the effects of post weld heat treatments, namely artificial ageing and solution treatment followed by artificial ageing, on microstructure and mechanical properties of 12 mm thick friction stir welded joints of precipitation hardenable high strength armour grade AA7075-T651 aluminium alloy. The tensile properties, such as yield strength, tensile strength, elongation and notch tensile strength, are evaluated and correlated with the microhardness and microstructural features. The scanning electron microscope is used to characterie the fracture surfaces. The solution treatment followed by ageing heat treatment cycle is found to be marginally beneficial in improving the tensile properties of friction stir welds of AA7075-T651 aluminium alloy.

  3. Influence of climate variables on the concentration of Escherichia coli in the Rhine, Meuse, and Drentse Aa during 1985–2010

    NARCIS (Netherlands)

    Vermeulen, L.C.; Hofstra, N.

    2014-01-01

    This study evaluates the relationship between the climate variables temperature and precipitation and the concentration of Escherichia coli bacteria in the Rhine, Meuse, and Drentse Aa for the period 1985–2010. Data from 4,679 E. coli concentration measurements spread over a total of 13 locations in

  4. Effect of inclusion of SiC particulates on the mechanical resistance behaviour of stir-cast AA6063/SiC composites

    International Nuclear Information System (INIS)

    Highlights: • AA6063/SiC composites with different weight percent are stir cast. • Resistance properties against indentation, stretching force and sliding force are studied. • Increase in initiation of cleavage facets and reduces the tensile strength for 15% SiC. • Transition from micro ploughing to micro cutting wear mechanism is less due to SiC inclusion. - Abstract: This study investigates the mechanical resistance behaviour of AA6063 particulate composites with the inclusion of micron-sized silicon carbide (SiC) particles with different weight percentages in an AA6063 aluminium matrix. AA6063/SiC particulate composites containing 0, 5, 10, and 15 weight percent of SiC particles were produced by stir casting. Standard mechanical tests were conducted on the composite plates, and the mechanical resistance to indentation, tensile force and sliding force are evaluated. It has been observed that upon addition of SiC particles, the resistance against indentation is increased and the resistance against tensile force is initially increased and then decreased. Furthermore, using scanning electron microscopy (SEM), the fracture appearance of the broken specimen subjected to tensile force and morphological changes in the surface subjected to sliding force are analysed. The SEM images reveal that the addition of SiC particles in the AA6063 aluminium matrix initiates more cleavage facets. This leads to brittle fracture in the specimen subjected to tensile forces and less transition from material displacement to material removal in the specimen subjected to sliding forces

  5. Evaluation of the oxidative potential of urban Pm and its relation to in vitro induced DNA damage: a spatial and temporal comparison

    Energy Technology Data Exchange (ETDEWEB)

    Quintana B, R. O.; Alfaro M, E.; Garcia C, C. M.; Vazquez L, I. [Instituto Nacional de Cancerologia, Laboratorio de Toxicologia Ambiental, Av. San Fernando No. 22, Col. Seccion 16, 14080 Mexico D. F. (Mexico); Rosas P, I. [UNAM, Centro de Ciencias de la Atmosfera, Ciudad Universitaria, 04510 Mexico D. F. (Mexico); Gomez V, V.; Salmon S, M. de J. [UNAM, Instituto de Quimica, Ciudad Universitaria, 04510 Mexico D. F. (Mexico); Osornio V, A. R., E-mail: qbro@hotmail.com [University of Alberta, Edmonton Clinic Health Academy, 11405 87 Avenue, Edmonton, Alberta T6G 1C9 (Canada)

    2015-07-01

    Some toxic effects of particulate matter (Pm) are related to the oxidative potential (Op) of the particles. The electron paramagnetic resonance (EPR) technique was used to evaluate the intensity of paramagnetic species (Ps) and EPR plus spin trapping, to evaluate the Op of Pm. We evaluated, in parallel, the DNA degradation potential of PM{sub 10} and PM{sub 2.5} collected from three regions of Mexico City in 1991 and 2003. Each region had different sources of pollution; industrial, commercial or residential. Both techniques evaluated Fenton-type reactions in the presence and absence of deferoxamine. PM{sub 10} samples from the industrial region presented similar high Op, independently of sampling year. PM{sub 10} and PM{sub 2.5} collected in the commercial and residential regions in 2003 had similarly low Op. The Op induced by PM{sub 10} from the industrial region was completely inhibited by Dfo, and Dfo partially inhibited the Op induced by PM{sub 10} from other regions. PM{sub 2.5} Op was not inhibited by Dfo. Pm from the industrial region was the most potent inductor of DNA degradation, while Pm from residential region was the least potent, correlating with the Op. Dfo inhibited the degradation of DNA induced by Pm. The Op of Pm collected in the industrial and residential region correlated with the DNA degradation. The region, size and year of Pm collection are linked to observed Op variations and DNA degradation induced by Pm. (Author)

  6. Spatial, Temporal and Forecast Evaluation of Rivers’ Streamflow of the Drainage Basin of the Upper Tisa under the Conditions of Climate Change

    OpenAIRE

    Olga Lukianets; Iurii Obodovskyi

    2015-01-01

    The drainage basin of the Upper Tisa is considered to be one of the most flood hazardous areas of the Ukrainian Carpathians. Climate changes in the past decade made a significant impact on the course of hydrological processes, including streamflow. The studies of the processes at global and regional levels are of great importance for grounding of flood protection operations as well as arrangement of measures for adaptation to climate change. The study considers approaches to evaluation of cha...

  7. The Pasadena Recommendations: Five Years After AAS Endorsement

    Science.gov (United States)

    Knezek, Patricia; Frattare, L.; Ulvestad, J.

    2010-01-01

    It has been five years since the AAS Council unanimously endorsed the document, known as "Equity Now: The Pasadena Recommendations for Gender Equality in Astronomy," in January 2005. This document was the main product of the conference entitled "Women in Astronomy II: Ten Years After” (WIA II), held in June 2003 in Pasadena, CA. Participants of that 2003 meeting assessed the progress for women in science, offering insights into causes of the slower advancement of women, and discussed strategies to accelerate the achievement of equality. These insights and strategies were then incorporated into the "Pasadena Recommendations" by the CSWA. It was subsequently released to the entire AAS community for review and comments prior to its endorsement by the AAS. We will discuss the Recommendations and their impact since the endorsement by the AAS, including the process that is in place for organizations and departments to formally endorse the Pasadena Recommendations, thus making an organizational commitment to their implementation (see http://www.aas.org/cswa/pasadena_endorse.html).

  8. Retrospective Evaluation of Alopecia Areata Patients

    OpenAIRE

    Müzeyyen Gönül; Ülker Gül,; Emine Pişkin; Seray Külcü Çakmak; Seçil Soylu; Arzu Kılıç; Zeynep Bıyıklı

    2011-01-01

    Objective: We aimed to evaluate the clinical, demographic and laboratory features of alopecia areata (AA) patients who attended our policlinic in the last year.Material and Methods: The study was performed retrospectively and age, gender, family history of patients, onset age, duration and localization area of AA, number of recurrences, associated findings and laboratory findings were obtained from records. Results: The study included 132 patients. Median duration of disease was 4 months. 15....

  9. Publication Characteristics of Members of the AAS

    Science.gov (United States)

    Abt, Helmut A.

    1990-10-01

    For each of the 4995 persons listed in the 1989 American Astronomical Society Membership Directory, we noted their total 1984-88 publications as listed in the Author Index of Astronomy and Astrophysics Abstracts. The members are subdivided as retired (mean of 0.61 paper/yr), foreign (3.89), Full (3.34), Division Affiliates (1.76), Associate (1.48), and Junior (0.79) members. For Full members the frequencies of various publication rates are listed; the median is 2.28 papers/yr. The Full members are subdivided by affiliations, namely private institutions (mean of 4.71 papers/yr), university (3.89), government-funded (3.46), commercial company (1.81), and unknown affiliations (0.84). We looked up the listed publications for four high producers who each average 25.7 papers/yr. We found that 55% of those are preprints, abstracts, conference papers, and other secondary material. Furthermore, they average 4.2 authors per original research paper. If we divide each original research paper by the number of authors, these four average only the equivalent of 4.0 single-author research papers/yr. A sample of moderate producers also have 53% of their publications as abstracts, conference papers, etc., and they average 4.2 authors per original research paper. We conclude that the average Full AAS member produces the equivalent of 1/2 single-author original-research paper/yr and 23% of them produce more than 1 such paper/yr.

  10. Spatial evaluation of Ar-systematics in rocks from the British Channel Islands: a UV laserprobe Ar/Ar study of excess 40Ar

    Science.gov (United States)

    Schwenzer, S. P.; Sherlock, S.; Kelley, S. P.

    2010-12-01

    includes sericitization of the feldspars and chloritization of biotite. Ar-Ar investigations were carried out using high spatial resolution UV laser ablation gas release in combination with a NU instruments Noblesse gas mass spectrometer. This sensitive instrumentation allows for a spatial resolution of 80 to 140 µm spot size. Detailed Ar-Ar analysis shows large variability of ages and also correlation with K and Ca content of the spot (measureable as 37Ar, and 39Ar after irradiation). In quartz in some of the samples there is large amounts of excess 40Ar accompanied by high 38Ar/39Ar and low to non-measurable 37Ar concentrations. This indicates the presence of chlorine and excess 40Ar; and thus fluid inclusions in those quartz crystals may be the host for excess 40Ar. Our preliminary results give insights into the behaviour of the Ar system during and after emplacement of igneous rocks from the Cadomian Belt, and the interaction of different reservoirs within the rocks.

  11. Spatial Process Generation

    OpenAIRE

    Kroese, Dirk P.; Botev, Zdravko I.

    2013-01-01

    The generation of random spatial data on a computer is an important tool for understanding the behavior of spatial processes. In this paper we describe how to generate realizations from the main types of spatial processes, including Gaussian and Markov random fields, point processes, spatial Wiener processes, and Levy fields. Concrete MATLAB code is provided.

  12. Evaluating the utility of the medium-spatial resolution Landsat 8 multispectral sensor in quantifying aboveground biomass in uMgeni catchment, South Africa

    Science.gov (United States)

    Dube, Timothy; Mutanga, Onisimo

    2015-03-01

    Aboveground biomass estimation is critical in understanding forest contribution to regional carbon cycles. Despite the successful application of high spatial and spectral resolution sensors in aboveground biomass (AGB) estimation, there are challenges related to high acquisition costs, small area coverage, multicollinearity and limited availability. These challenges hamper the successful regional scale AGB quantification. The aim of this study was to assess the utility of the newly-launched medium-resolution multispectral Landsat 8 Operational Land Imager (OLI) dataset with a large swath width, in quantifying AGB in a forest plantation. We applied different sets of spectral analysis (test I: spectral bands; test II: spectral vegetation indices and test III: spectral bands + spectral vegetation indices) in testing the utility of Landsat 8 OLI using two non-parametric algorithms: stochastic gradient boosting and the random forest ensembles. The results of the study show that the medium-resolution multispectral Landsat 8 OLI dataset provides better AGB estimates for Eucalyptus dunii, Eucalyptus grandis and Pinus taeda especially when using the extracted spectral information together with the derived spectral vegetation indices. We also noted that incorporating the optimal subset of the most important selected medium-resolution multispectral Landsat 8 OLI bands improved AGB accuracies. We compared medium-resolution multispectral Landsat 8 OLI AGB estimates with Landsat 7 ETM + estimates and the latter yielded lower estimation accuracies. Overall, this study demonstrates the invaluable potential and strength of applying the relatively affordable and readily available newly-launched medium-resolution Landsat 8 OLI dataset, with a large swath width (185-km) in precisely estimating AGB. This strength of the Landsat OLI dataset is crucial especially in sub-Saharan Africa where high-resolution remote sensing data availability remains a challenge.

  13. State-space approach to evaluate spatial variability of field measured soil water status along a line transect in a volcanic-vesuvian soil

    Directory of Open Access Journals (Sweden)

    A. Comegna

    2010-12-01

    Full Text Available Unsaturated hydraulic properties and their spatial variability today are analyzed in order to use properly mathematical models developed to simulate flow of the water and solute movement at the field-scale soils. Many studies have shown that observations of soil hydraulic properties should not be considered purely random, given that they possess a structure which may be described by means of stochastic processes. The techniques used for analyzing such a structure have essentially been based either on the theory of regionalized variables or to a lesser extent, on the analysis of time series. This work attempts to use the time-series approach mentioned above by means of a study of pressure head h and water content θ which characterize soil water status, in the space-time domain. The data of the analyses were recorded in the open field during a controlled drainage process, evaporation being prevented, along a 50 m transect in a volcanic Vesuvian soil. The isotropic hypothesis is empirical proved and then the autocorrelation ACF and the partial autocorrelation functions PACF were used to identify and estimate the ARMA(1,1 statistical model for the analyzed series and the AR(1 for the extracted signal. Relations with a state-space model are investigated, and a bivariate AR(1 model fitted. The simultaneous relations between θ and h are considered and estimated. The results are of value for sampling strategies and they should incite to a larger use of time and space series analysis.

  14. Spatial econometrics using microdata

    CERN Document Server

    Dubé, Jean

    2014-01-01

    This book provides an introduction to spatial analyses concerning disaggregated (or micro) spatial data.Particular emphasis is put on spatial data compilation and the structuring of the connections between the observations. Descriptive analysis methods of spatial data are presented in order to identify and measure the spatial, global and local dependency.The authors then focus on autoregressive spatial models, to control the problem of spatial dependency between the residues of a basic linear statistical model, thereby contravening one of the basic hypotheses of the ordinary least squares appr

  15. Visual Spatial Cognition in Neurodegenerative Disease

    OpenAIRE

    Possin, Katherine L.

    2010-01-01

    Visual spatial impairment is often an early symptom of neurodegenerative disease; however, this multi-faceted domain of cognition is not well-assessed by most typical dementia evaluations. Neurodegenerative diseases cause circumscribed atrophy in distinct neural networks, and accordingly, they impact visual spatial cognition in different and characteristic ways. Anatomically-focused visual spatial assessment can assist the clinician in making an early and accurate diagnosis. This article will...

  16. Spatial Relation Resolution and Spatial Relation Abstraction

    Institute of Scientific and Technical Information of China (English)

    AI Tinghua; LIU Yaolin

    2003-01-01

    This paper attempts toregard spatial relation transformationas an important process in map gener-alization. The spatial relation generali-zation can be divided into the compo-nents of abstraction: topology, dis-tance and orientation. The concept‘ spatial relation resolution' is intro-duced to describe the constraints ofrelative spatial relation. On the basisof nine intersection models, the cardi-nal direction models and the iso-dis-tance-relation models, this paper givesthree sorts of relation resolution repre-sentations for topological, distance andorientation relation, respectively. Twomapping implementations in map gen-eralization is discussed.

  17. NCBI nr-aa BLAST: CBRC-PTRO-07-0067 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  18. NCBI nr-aa BLAST: CBRC-TBEL-01-1883 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  19. NCBI nr-aa BLAST: CBRC-TNIG-14-0023 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  20. NCBI nr-aa BLAST: CBRC-FRUB-02-0074 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  1. NCBI nr-aa BLAST: CBRC-LAFR-01-1734 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  2. NCBI nr-aa BLAST: CBRC-OLAT-24-0009 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  3. NCBI nr-aa BLAST: CBRC-TNIG-10-0006 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  4. NCBI nr-aa BLAST: CBRC-ACAR-01-0845 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  5. NCBI nr-aa BLAST: CBRC-RNOR-05-0081 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  6. NCBI nr-aa BLAST: CBRC-SARA-01-0195 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  7. NCBI nr-aa BLAST: CBRC-ETEL-01-1516 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  8. NCBI nr-aa BLAST: CBRC-RMAC-04-0050 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  9. NCBI nr-aa BLAST: CBRC-PABE-07-0058 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  10. The 9aaTAD Transactivation Domains: From Gal4 to p53.

    Science.gov (United States)

    Piskacek, Martin; Havelka, Marek; Rezacova, Martina; Knight, Andrea

    2016-01-01

    The family of the Nine amino acid Transactivation Domain, 9aaTAD family, comprises currently over 40 members. The 9aaTAD domains are universally recognized by the transcriptional machinery from yeast to man. We had identified the 9aaTAD domains in the p53, Msn2, Pdr1 and B42 activators by our prediction algorithm. In this study, their competence to activate transcription as small peptides was proven. Not surprisingly, we elicited immense 9aaTAD divergence in hundreds of identified orthologs and numerous examples of the 9aaTAD species' convergence. We found unforeseen similarity of the mammalian p53 with yeast Gal4 9aaTAD domains. Furthermore, we identified artificial 9aaTAD domains generated accidentally by others. From an evolutionary perspective, the observed easiness to generate 9aaTAD transactivation domains indicates the natural advantage for spontaneous generation of transcription factors from DNA binding precursors. PMID:27618436

  11. Modelling the spatial distribution of endemic Caesalpinioideae in Central Africa, a contribution to the evaluation of actual protected areas in the region

    DEFF Research Database (Denmark)

    Ndayishimiye, Joël; Greve, Michelle; Stoffelen, P.;

    2012-01-01

    conservation status of each species and to evaluate how well the species are protected by the protected areas in the region. Distributions were analyzed and potential distributions predicted using the Maxent species distribution algorithm with climatic (precipitation and temperature) and non-climatic predictor...... of concentration of endemic species which should be given particular conservation attention. Comparing the potential distributions to the current Central African protected areas showed that the endemic species are not well protected, as 97% of their potential habitat is localized outside protected areas. Hence...

  12. Spatial, Temporal and Forecast Evaluation of Rivers’ Streamflow of the Drainage Basin of the Upper Tisa under the Conditions of Climate Change

    Directory of Open Access Journals (Sweden)

    Olga Lukianets

    2015-05-01

    Full Text Available The drainage basin of the Upper Tisa is considered to be one of the most flood hazardous areas of the Ukrainian Carpathians. Climate changes in the past decade made a significant impact on the course of hydrological processes, including streamflow. The studies of the processes at global and regional levels are of great importance for grounding of flood protection operations as well as arrangement of measures for adaptation to climate change. The study considers approaches to evaluation of changes of hydrologic balance elements of the investigated drainage basin in the period of the 20th century. A retrospective analysis of the changes is provided in order to find out relationship between the streamflow and the climate aspects which influence it. A statistical analysis of a series of long-term observations was performed in order to test their steadiness and homogeneity. Inter-row connections were determined between changes in precipitation regime, air temperature of the surface and streamflow in the modern period (1991–2012 compared to the period of the climatic norm (1961–1990. The closest interconnection between mentioned variables is observed for the warm period. For the cold period such dependencies are satisfactory. Consequently, an equation was derived for conversion of the expected influence of climate change on the streamflow. Results of the regional model REMO-ESNAM5 were used to perform forecast evaluation of hydrological consequences of climate change. The projection of changes of climatic aspects for the drainage basin of the Upper Tisa for the time period 2021–2050 as well as А1B sustainable development scenario was created. The evaluation of possible changes of average, seasonal and annual streamflow in the basin is presented up to the middle of the 21st century. Annual redistribution is clearly registered. Forecast evaluations were performed of the maximum streamflow changes, floods frequency and their recurrence throughout

  13. 三峡库区农村发展系统评价与空间格局分析%Evaluation and spatial pattern analysis of rural development system in Three Gorges Reservoir Area

    Institute of Scientific and Technical Information of China (English)

    彭立; 刘邵权

    2013-01-01

    The systemic characteristic and spatial pattern of rural development are important basis for establishing mode of regional sustainable development. The evaluation system composed of 16 indicators which belong to social system, economic system and resource-environmental system is established to evaluate rural development status. At present, the study on regional rural development mainly focuses on spatial pattern, but the study on spatial correlation is seldom. The systemic characteristic and spatial pattern of rural development on regional scale (counties) in Three Gorges Reservoir Area were investigated using mean-squared deviation weight method, system coupling theory, exploratory spatial data analysis method (ESDA), variogram model and so on, and discipline of rural development via the master systemic status, the relationships of subsystems and spatial correlation of system were explored. Conclusions are drawn as follows:1) The rural development level in Three Gorges Reservoir Area is quite unbalanced, and the high-level counties in regional scale mainly locate in the area around Chongqing’s main urban area, the correspondingly low-level counties mainly locate in eastern Chongqing. The disparity of economic system among subsystems is the highest, followed by social system and resource-environmental system. 2) The overall level of coordination degree between subsystems is still low in Three Gorges Reservoir Area. Coordination degrees of 19 counties mainly are divided into four kinds, the moderate coordination, the mild coordination, the mild incoordination and the moderate incoordination, and there are no obvious differences among these counties. On regional scale, the counties with high-level coordination degree mainly locate in the north of Three Gorges Reservoir Area, and the correspondingly low-level counties mainly locate in the south. 3) The overall of rural development system and its subsystems (e.g. social system, economic system and resource

  14. Flexibility Analysis of Bacillus thuringiensis Cry1Aa

    Institute of Scientific and Technical Information of China (English)

    ZHAO Xin Min; XIA Li Qiu; YANG Xiao Ping; PENG Xiao Yun

    2015-01-01

    Objective To investigate the flexibility and mobility of the Bacillus thuringiensis toxin Cry1Aa. Methods The graph theory-based program Constraint Network Analysis and normal mode-based program NMsim were used to analyze the global and local flexibility indices as well as the fluctuation of individual residues in detail. Results The decrease in Cry1Aa network rigidity with the increase of temperature was evident. Two phase transition points in which the Cry1Aa structure lost rigidity during the thermal simulation were identified. Two rigid clusters were found in domains I and II. Weak spots were found in C-terminal domain III. Several flexible regions were found in all three domains;the largest residue fluctuation was present in the apical loop2 of domain II. Conclusion Although several flexible regions could be found in all the three domains, the most flexible regions were in the apical loops of domain II.

  15. 基于新一代GPS的空间直线度误差快速几何逼近算法%GPS-based Spatial Straightness Error Evaluation with Fast Geometric Approximation Algorithm

    Institute of Scientific and Technical Information of China (English)

    徐辉; 李济顺; 雷贤卿

    2011-01-01

    According to operation and operator technology in new generation GPS (Geometrical Product Specification and Verification), fast geometric approximation algorithm is introduced to evaluate the spatial straightness error as a new method. Under the principle of minimum zone, the mathematical model of spatial straightness error and the optimal objective function are given. The method is simple, no complicated math, easy to program on computer and can obtain precise ideal centerline which meet the definition of GPS.%基于新一代产品几何技术规范(Geometrical Product Specification and Verification,GPS)的操作及操作算子技术提出了一种新的空间直线度评定方法--快速几何逼近算法.按照最小区域的原则,给出了空间直线度快速几何逼近算法的数学模型及优化目标.该算法原理简单,没有复杂的数学运算,易于计算机编程实现,可精确求解符合GPS定义的理想中心线位置.

  16. Implications of Spatial Variability in Heat Flow for Geothermal Resource Evaluation in Large Foreland Basins: The Case of the Western Canada Sedimentary Basin

    Directory of Open Access Journals (Sweden)

    Simon Weides

    2014-04-01

    Full Text Available Heat flow and geothermal gradient of the sedimentary succession of the Western Canada Sedimentary Basin (WCSB are mapped based on a large thermal database. Heat flow in the deep part of the basin varies from 30 mW/m2 in the south to high 100 mW/m2 in the north. As permeable strata are required for a successful geothermal application, the most important aquifers are discussed and evaluated. Regional temperature distribution within different aquifers is mapped for the first time, enabling a delineation of the most promising areas based on thermal field and aquifer properties. Results of previous regional studies on the geothermal potential of the WCSB are newly evaluated and discussed. In parts of the WCSB temperatures as high as 100–210 °C exist at depths of 3–5 km. Fluids from deep aquifers in these “hot” regions of the WCSB could be used in geothermal power plants to produce electricity. The geothermal resources of the shallower parts of the WCSB (>2 km could be used for warm water provision (>50 °C or district heating (>70 °C in urban areas.

  17. Water quality spatial and temporal evaluation and auto-purification simulation from the São Simão stream watershed, SP

    Directory of Open Access Journals (Sweden)

    Letícia Hirata Godoy

    2012-12-01

    Full Text Available This study evaluated the water of São Simão stream watershed. For this, six sampling points were established and twelve samples of water were collected during the months of March, May, June, July, August, September, October, November, and December of 2005 and January, February, and March of 2006. The following variables were analyzed: discharge, temperature, turbidity, pH, electrical conductivity (EC, dissolved oxygen (DO, alkalinity, chloride and TSS (total suspended solids. The Streter & Phelps model which correlates the variation of the deficit oxygen with the distance was applied to evaluate the São Simão stream auto-purification. The characteristics of the São Simão stream near its spring until it reaches São Simão city allowed concluding that there is low interference in its quality. However, the absence of treatment of domestic wastewater at São Simão city reduced the water quality and increased the degradation process of São Simão stream after passing through the city. The Streeter & Phelps model allowed identifying the auto-purification zones in this stream and indicated the need for primary wastewater treatment, with an efficiency of 30%.

  18. Dynamical freeze-out criterion in hydrodynamical description of $Au+Au$ collisions at $\\sqrt{s_\\mathrm{AA}}=200$ GeV and $Pb+Pb$ collisions at $\\sqrt{s_\\mathrm{AA}}=2760$ GeV

    CERN Document Server

    Ahmad, Saeed; Huovinen, Pasi

    2016-01-01

    In hydrodynamical modeling of ultrarelativistic heavy-ion collisions, the freeze-out is typically assumed to take place at a surface of constant temperature or energy density. A more physical approach is to assume that freeze-out takes place at a surface of constant Knudsen number. We evaluate the Knudsen number as a ratio of the expansion rate of the system to the pion scattering rate, and apply the constant Knudsen number freeze-out criterion to ideal hydrodynamical description of heavy-ion collisions at RHIC ($\\sqrt{s_\\mathrm{AA}}=200$ GeV) and the LHC ($\\sqrt{s_\\mathrm{AA}}=2760$ GeV) energies. We see that once the numerical values of freeze-out temperature and freeze-out Knudsen number are chosen to produce similar $p_T$ distributions, the elliptic and triangular anisotropies are similar too, in both event-by-event and averaged initial state calculations.

  19. Outcomes From AAS Hack Day at the 227th AAS Meeting

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This is a final post from the 227th AAS Meeting in Kissimmee, FL. This special summary of AAS Hack Day, a meeting of AAS members to collaboratively work on various small projects, was written by Meredith Rawls (@Merrdiff) and was originally posted on astrobites.com.As the 227thAmerican Astronomical Society meeting drew to a close (see highlights from Day 1, Day 2, Day 3, and Day 4), a group of at least 50 attendees spent Day 4working on small projects fondly called hacks. Thanks to sponsorship from LSST and Northrup Grumman, the industrious hackers werewell-caffeinated and fed so we could devote time and energy toworking in groups on one-day projects.TheHack Day beganat 10am with pitches. Anybody with a project idea was welcome to briefly speak and try to convince others to work with them. Only someideas panned out, but the enthusiasm was palpable. Its not every day you get a full room of astronomers and affiliates eager to spend hours working on fun and useful projects to benefit the community.#hackAAS is getting underway! #aas227 pic.twitter.com/yX7jlOnSCK James R A Davenport (@jradavenport) January 8, 2016Here is a rundown of what we accomplished. Pretty impressive for a single day! Many thanks to fellow astrobiter Erika Nesvold (now at Carnegie DTM; @erikanesvold) whose hack was live-documenting all the other hacks. Her tweets as @astrobites appeared with the #hackaas hashtag, and her notes made this recap post infinitely easier to write.Interested in joining the fun? Sign up for Hack Day at the 2017 JanuaryAAS meeting (its free with meeting registration), and consider applying for the .Astronomy conference this summer.Towards Optimal Session Scheduling:Adrian Price-Whelan (Columbia), David Hogg (NYU), and Scott Idem (AAS) began writing a program to take all submitted abstracts to a conference like AAS and sort them using keywords to avoid scheduling similar talks in parallel sessions. Its impossible to make everyone happy, but minimizing conflicts

  20. Injektointimassan kehittäminen AA-tiiviysluokan tunnelialueille

    OpenAIRE

    Parkkonen, Ilari

    2012-01-01

    Tutkimuksen tarkoituksena oli kehittää uusi kallioinjektointimassa AA-luokan tiiviysalueille, koska ennen käytetty injektointimassa sitoutui sekä kovettui liian hitaasti, mikä puolestaan hidasti louhintaa merkittävästi. Tutkimuksessa keskityttiin uuden injektointireseptin kehittämiseen uudella sementtivalmisteella. Kehittämisellä pyrittiin korvaamaan BB-sementti AA-sementillä, koska uusi sementti sitoutuu nopeammin kuin ennestään käytetty. Tutkimusmenetelmänä käytettiin Kalliotilojen inje...

  1. Numerical semigroups II: pseudo-symmetric AA-Semigroups

    OpenAIRE

    García-Marco, Ignacio; Ramirez Alfonsin, Jorge; Rodseth, Oystein J.

    2016-01-01

    This paper is a continuation of the paper " Numerical Semigroups: Apéry Sets and Hilbert Series". We consider the general numerical AA-semigroup, i.e., semigroups consisting of all non-negative integer linear combinations of relatively prime positive integers of the form $a, a+d, a+2d,. .. , a+kd, c$. We first prove that, in contrast to arbitrary numerical semigroups, there exists an upper bound for the type of AA-semigroups that only depends on the number of generators of the semigroup. We t...

  2. On the operationalization of a spatially explicit evaluation of the complexity of land use trajectories in semi-arid Mediterranean agro-ecosystems

    DEFF Research Database (Denmark)

    Nainggolan, Doan

    of the interacting effects of various types of drivers. The thesis highlights conceptual and practical challenges in undertaking an integrated evaluation of land use change complexity. Future policy making should consider the various factors that are jointly shaping agricultural land use trajectories.......This thesis aims to unpack the complexity of trajectories of land use change in semi-arid Mediterranean agro-ecosystems – illustrated using findings from the Torrealvilla catchment in south-eastern Spain. The research looks at multiple dimensions of land use change and addresses the past, present...... for further expansion of irrigated farming, the agent-based scenario analysis indicates the opposite. Overall the thesis confirms that land use changes in Mediterranean agro-ecosystems are indeed complex entailing multiple, contrasting, and perhaps competing trajectories and are the manifestation...

  3. Evaluation of image quality and spatial resolution of low-dose high-pitch multidetector-row helical high-resolution CT in 11 autopsy lungs and a wire phantom

    International Nuclear Information System (INIS)

    The aim of this study was to evaluate whether low-dose high-pitch (6:1) multidetector-row helical high-resolution CT is appropriate for the evaluation of various pulmonary abnormalities, including faint opacities. Eleven autopsy lungs were scanned with a multidetector-row CT scanner using 2.5 mm x 4 beam collimation, effective slice thickness 3 mm, 6:1 pitch, 0.8 second gantry rotation speed, 20 cm Display Fov, high spatial frequency (bone) algorithm, and various radiation doses (120 kVp; 160, 80, 40, 24, and 8 mAs). The image quality of each CT set was assessed as adequate or inadequate for diagnosis by two independent observers. In addition, a wire phantom was scanned with the same parameters in order to describe the modular transfer function (MTF) curves. There was excellent agreement between the observers for the evaluation of image quality (kappa statistic, 0.84). The ratio of images evaluated as inadequate for 8 mAs and 24 mAs was significantly higher than that for 160, 80, and 40 mAs (p<0.01: chi-square test). MTF curves of both 8 and 24 mAs were significantly inferior to those of 40, 80, and 160 mAs (p<0.01, Friedman test), while the MTF curve of 40 mAs was relatively inferior to that of 160 mAs (p<0.05, Friedman test). More than 40 mAs in combination with 120 kVp is preferable for the evaluation of details of lung parenchyma by high-pitch. multidetector-row helical high-resolution CT. (author)

  4. Evaluation of image quality and spatial resolution of low-dose high-pitch multidetector-row helical high-resolution CT in 11 autopsy lungs and a wire phantom

    Energy Technology Data Exchange (ETDEWEB)

    Johkoh, Takeshi; Honda, Osamu; Yamamoto, Shuji [Osaka Univ., Suita (Japan). Medical School] (and others)

    2001-12-01

    The aim of this study was to evaluate whether low-dose high-pitch (6:1) multidetector-row helical high-resolution CT is appropriate for the evaluation of various pulmonary abnormalities, including faint opacities. Eleven autopsy lungs were scanned with a multidetector-row CT scanner using 2.5 mm x 4 beam collimation, effective slice thickness 3 mm, 6:1 pitch, 0.8 second gantry rotation speed, 20 cm Display Fov, high spatial frequency (bone) algorithm, and various radiation doses (120 kVp; 160, 80, 40, 24, and 8 mAs). The image quality of each CT set was assessed as adequate or inadequate for diagnosis by two independent observers. In addition, a wire phantom was scanned with the same parameters in order to describe the modular transfer function (MTF) curves. There was excellent agreement between the observers for the evaluation of image quality (kappa statistic, 0.84). The ratio of images evaluated as inadequate for 8 mAs and 24 mAs was significantly higher than that for 160, 80, and 40 mAs (p<0.01: chi-square test). MTF curves of both 8 and 24 mAs were significantly inferior to those of 40, 80, and 160 mAs (p<0.01, Friedman test), while the MTF curve of 40 mAs was relatively inferior to that of 160 mAs (p<0.05, Friedman test). More than 40 mAs in combination with 120 kVp is preferable for the evaluation of details of lung parenchyma by high-pitch. multidetector-row helical high-resolution CT. (author)

  5. Diagnostic performance of amyloid A protein quantification in fat tissue of patients with clinical AA amyloidosis

    NARCIS (Netherlands)

    Hazenberg, Bouke P. C.; Bijzet, Johannes; Limburg, Pieter C.; Skinner, Martha; Hawkins, Philip N.; Butrimiene, Irena; Livneh, Avi; Lesnyak, Olga; Nasonov, Evgeney L.; Filipowicz-Sosnowska, Anna; Guel, Ahmet; Merlini, Giampaolo; Wiland, Piotr; Oezdogan, Huri; Gorevic, Peter D.; Ben Maiz, Hedi; Benson, Merrill D.; Direskeneli, Haner; Kaarela, Kalevi; Garceau, Denis; Hauck, Wendy; van Rijswijk, Martin

    2007-01-01

    Objective. Amyloid A protein quantification in fat tissue is a new immunochemical method for detecting AA amyloidosis, a rare but serious disease. The objective was to assess diagnostic performance in clinical AA amyloidosis. Methods. Abdominal subcutaneous fat tissue of patients with AA amyloidosis

  6. Comportamiento a fatiga de uniones soldadas GMAW de la aleación de aluminio AA 7020

    Directory of Open Access Journals (Sweden)

    Bloem, C. A.

    2007-04-01

    Full Text Available The aim of this investigation is to evaluate the influence on the fatigue behavior by the finishing of the bulge in a welded aluminium-zinc-magnesium alloy AA7020. It was determined
    that total or partial elimination of the bulge has very little influence on its behavior, giving a very similar result on both cases, where one is better than the other by only 3%.

    El objetivo de la presente investigación es evaluar la influencia del acabado del sobrecordón en la respuesta a fatiga de las uniones soldadas realizadas sobre una aleación Al-ZnMg AA7020. Se determinó que la eliminación total o parcial del sobrecordón ejerce poca influencia en su comportamiento, obteniéndose en ambos casos una respuesta similar, donde la mejora de uno respecto del otro no es superior al 3%.

  7. An Evaluation of Potential Occupational Exposure to Asbestiform Amphiboles near a Former Vermiculite Mine

    Directory of Open Access Journals (Sweden)

    Julie F. Hart

    2009-01-01

    Full Text Available Amphibole asbestos (AA has been detected on the surface of tree bark in forests neighboring an abandoned vermiculite mine near Libby, Montana. In the present study, simulations were performed to assess potential AA exposure associated with United States Department of Agriculture Forest Service (FS occupational activities. Bark samples were collected prior, and personal breathing zone (PBZ and Tyvek clothing wipe samples were collected during and immediately after trials that simulated FS activities. Transmission electron microscopy (TEM analyses revealed AA bark concentrations up to 15 million structures per square centimeter (s/cm2. AA was detected in 25% of the PBZ TEM samples. AA was detected on wipe samples collected from all activities evaluated. This research demonstrates the potential for airborne exposure and transport of AA in the Kootenai National Forest. These findings are especially relevant to those that work in the area and to the general public who may conduct recreational activities.

  8. Spatial Data Management

    CERN Document Server

    Mamoulis, Nikos

    2011-01-01

    Spatial database management deals with the storage, indexing, and querying of data with spatial features, such as location and geometric extent. Many applications require the efficient management of spatial data, including Geographic Information Systems, Computer Aided Design, and Location Based Services. The goal of this book is to provide the reader with an overview of spatial data management technology, with an emphasis on indexing and search techniques. It first introduces spatial data models and queries and discusses the main issues of extending a database system to support spatial data.

  9. Evaluation of an operational ocean model configuration at 1/12° spatial resolution for the Indonesian seas - Part 1: Ocean physics

    Science.gov (United States)

    Tranchant, B.; Reffray, G.; Greiner, E.; Nugroho, D.; Koch-Larrouy, A.; Gaspar, P.

    2015-08-01

    INDO12, a 1/12° regional version of the NEMO physical ocean model covering the whole Indonesian EEZ has been developed and is now running every week in the framework of the INDESO project (Infrastructure Development of Space Oceanography) implemented by the Indonesian Ministry of Marine Affairs and Fisheries. The initial hydrographic conditions as well as open boundary conditions are derived from the operational global ocean forecasting system at 1/4° operated by Mercator Ocean. Atmospheric forcing fields (3 hourly ECMWF analyses) are used to force the regional model. INDO12 is also forced by tidal currents and elevations, and by the inverse barometer effect. The turbulent mixing induced by internal tides is taken into account through a specific parameterization. In this study we evaluate the model skill through comparisons with various datasets including outputs of the parent model, climatologies, in situ temperature and salinity measurements, and satellite data. The simulated and altimeter-derived Eddy Kinetic Energy fields display similar patterns and confirm that tides are a dominant forcing in the area. The volume transport of the Indonesian ThroughFlow is in good agreement with the INSTANT current meter estimates while the transport through Luzon Strait is, on average, westward but probably too weak. Significant water mass transformation occurs along the main routes of the Indonesian Throughflow (ITF) and compares well with observations. Vertical mixing is able to erode the South and North Pacific subtropical waters salinity maximum as seen in TS diagrams. Compared to satellite data, surface salinity and temperature fields display marked biases in the South China Sea. Altogether, INDO12 proves to be able to provide a very realistic simulation of the ocean circulation and water mass transformation through the Indonesian Archipelago. A few weaknesses are also detected. Work is on-going to reduce or eliminate these problems in the second INDO12 version.

  10. Evaluating the Spatial Distribution of Quantitative Risk and Hazard Level of Arsenic Exposure in Groundwater, case Study of Qorveh County, Kurdistan Iran

    Directory of Open Access Journals (Sweden)

    Touraj Nasrabadi

    2013-04-01

    Full Text Available Regional distribution of quantitative risk and hazard levels due to arsenic poisoning in some parts of Iran’s Kurdistan province is considered. To investigate the potential risk and hazard level regarding arsenic-contaminated drinking water and further carcinogenic and non-carcinogenic effects on villagers, thirteen wells in rural areas of Qorveh County were considered for evaluation of arsenic concentration in water. Sampling campaign was performed in August 2010 and arsenic concentration was measured via the Silver Diethyldithiocarbamate method. The highest and lowest arsenic concentration are reported in Guilaklu and Qezeljakand villages with 420 and 67 μg/L, respectively. None of thirteen water samples met the maximum contaminant level issued by USEPA and Institute of Standards and Industrial Research of Iran (10 ppb. The highest arsenic concentration and consequently risk and hazard levels belong to villages situated alongside the eastern frontiers of the county. Existence of volcanic activities within the upper Miocene and Pleistocene in this part of the study area may be addressed as the main geopogenic source of arsenic pollution. Quantitative risk values are varying from 1.49E-03 in Qezeljakand to 8.92E-03 in Guilaklu and may be interpreted as very high when compared by similar studies in Iran. Regarding non-carcinogenic effects, all thirteen water samples are considered hazardous while all calculated chronic daily intakes are greater than arsenic reference dose. Such drinking water source has the potential to impose adverse carcinogenic and non-carcinogenic effects on villagers. Accordingly, an urgent decision must be made to substitute the current drinking water source with a safer one.

  11. Fundamental spatial data quality check and evaluation technique in weatern China%西部基础空间数据质量检查与评价技术研究

    Institute of Scientific and Technical Information of China (English)

    宋伟东; 曹阳; 雷兵

    2009-01-01

    Evaluation of map quality for national western surveying and mapping project based on cloud model and rough set was conducted using entity-based quality inspection method. At first, digital linear graphics quality model was constructed by analyzing western area characteristic, the quality element and sub-element were summarized. Then, spatial operator was summarized to form inspection rule. Finally, the weight of each index was calculated according to importance of attribute in rough set. Cloud decision generator transformed indexes value into qualitative evaluation. Software for quality inspection and evaluation was developed. Test indicated that the inspection and evaluation method is feasible and software has higher automation and interaction.%针对西部测图工程,采用基于地理实体的质量检查方法,并利用云模型和粗集理论进行地图质量评价.首先分析西部测区特征,在此基础上建立数字线划图质量模型,进而总结质量元素及其相应的质量子元素.其次,归纳总结基本空间算子,形成具体检查规则.然后,根据粗集的属性依赖度计算各个质量元素和质量子元素的权重,接着对评语进行云模型化,根据X-条件云发生器和最大隶属原则判断地图等级.最后研制开发了质量检查、评价软件.实验证明,检查、评价方法可行,软件自动化程度高,并具有良好的交互性.

  12. Lead induced intergranular fracture in aluminum alloy AA6262

    NARCIS (Netherlands)

    De Hosson, JTM

    2003-01-01

    The influence of lead on the fracture behavior of aluminum alloy AA6262 is investigated. Under certain conditions, the mode of fracture changes from transgranular microvoid coalescence to an intergranular mechanism. Three different intergranular fracture mechanisms are observed: liquid metal embritt

  13. Backend solutions for AA in the MUSE network supporting FMC

    NARCIS (Netherlands)

    Neerbos, A.N.R. van; Prins, M.; Melander, B.; Pimilla Larrucea, I.; Thakur, M.J.; Fredricx, F.

    2007-01-01

    The European MUSE project investigated fixed-mobile convergence from the perspective of an unbundled fixed network. A major part of the work consisted of finding solutions for the authentication and authorisation of users who roam from their home network to a visited network. This paper shows how AA

  14. Evaluation of an operational ocean model configuration at 1/12° spatial resolution for the Indonesian seas (NEMO2.3/INDO12) - Part 1: Ocean physics

    Science.gov (United States)

    Tranchant, Benoît; Reffray, Guillaume; Greiner, Eric; Nugroho, Dwiyoga; Koch-Larrouy, Ariane; Gaspar, Philippe

    2016-03-01

    INDO12 is a 1/12° regional version of the NEMO physical ocean model covering the whole Indonesian EEZ (Exclusive Economic Zone). It has been developed and is now running every week in the framework of the INDESO (Infrastructure Development of Space Oceanography) project implemented by the Indonesian Ministry of Marine Affairs and Fisheries. The initial hydrographic conditions as well as open-boundary conditions are derived from the operational global ocean forecasting system at 1/4° operated by Mercator Océan. Atmospheric forcing fields (3-hourly ECMWF (European Centre for Medium-Range Weather Forecast) analyses) are used to force the regional model. INDO12 is also forced by tidal currents and elevations, and by the inverse barometer effect. The turbulent mixing induced by internal tides is taken into account through a specific parameterisation. In this study we evaluate the model skill through comparisons with various data sets including outputs of the parent model, climatologies, in situ temperature and salinity measurements, and satellite data. The biogeochemical model results assessment is presented in a companion paper (Gutknecht et al., 2015). The simulated and altimeter-derived Eddy Kinetic Energy fields display similar patterns and confirm that tides are a dominant forcing in the area. The volume transport of the Indonesian throughflow (ITF) is in good agreement with the INSTANT estimates while the transport through Luzon Strait is, on average, westward but probably too weak. Compared to satellite data, surface salinity and temperature fields display marked biases in the South China Sea. Significant water mass transformation occurs along the main routes of the ITF and compares well with observations. Vertical mixing is able to modify the South and North Pacific subtropical water-salinity maximum as seen in T-S diagrams. In spite of a few weaknesses, INDO12 proves to be able to provide a very realistic simulation of the ocean circulation and water mass

  15. Deformation character of the aluminum alloy AA 6063 depending on the homogenization state

    Energy Technology Data Exchange (ETDEWEB)

    Kelesoglu, Erguen [Yildiz Technical Univ. (Turkey). Research and Development Centre for Industrial Cooperation; Erarslan, Yaman [Metallurgical and Materials Engineering, Yildiz Technical Univ. (Turkey); Oezer, Goekhan [Metallurgical and Materials Engineering, Yildiz Technical Univ. (Turkey); Yildiz Technical Univ. (TR). Balkan Centre of Advanced Casting Technologies (BCACT)

    2009-07-01

    In the work for this contribution, homogenization heat treatment was evaluated with respect to its effect on deformation ability of AA6063 aluminum alloy which is a widely used extrusion alloy. The samples machined from extrusion billets were homogenized at 540 C, 560 C and 580 C for a time period of 2, 4, 6, 8 and 10 h. The homogenization state of the samples was assessed via microstructure examination. The hardness of the samples was determined using Brinell hardness method. Tensile test was carried out in order to evaluate the deformation ability. Tensile strength and elongation at rupture were compared depending on the homogenization state of the alloy. Depending on the homogenization grade, the elongation at rupture was increased, and samples showed a gradual shift from brittle fracture to ductile fracture. (orig.)

  16. Spatially-Resolved Medium Resolution Spectroscopy of an Interacting E+A (post-starburst) System with the Subaru telescope

    OpenAIRE

    Goto, Tomotsugu; Yagi, Masafumi; Yamauchi, Chisato

    2008-01-01

    We have performed a spatially-resolved medium resolution long-slit spectroscopy of a nearby E+A (post-starburst) galaxy system, SDSSJ161330.18+510335.5. This E+A galaxy has an obvious companion galaxy 14kpc in front with the velocity difference of 61.8 km/s. Both galaxies have obviously disturbed morphology We have found that H$\\delta$ equivalent width (EW) of the E+A galaxy is greater than 7\\AA galaxy wide (8.5 kpc). The E+A galaxy have a weak [OIII] emission (EW$\\sim$1\\AA) by $\\sim$2.6 kpc ...

  17. Spatial Language Learning

    Science.gov (United States)

    Fu, Zhengling

    2016-01-01

    Spatial language constitutes part of the basic fabric of language. Although languages may have the same number of terms to cover a set of spatial relations, they do not always do so in the same way. Spatial languages differ across languages quite radically, thus providing a real semantic challenge for second language learners. The essay first…

  18. Memoz - Spatial Weblogging

    Science.gov (United States)

    Hoem, Jon

    The article argues that spatial webpublishing has influence on weblogging, and calls for a revision of the current weblog definition. The weblog genre should be able to incorporate spatial representation, not only the sequential ordering of articles. The article show examples of different spatial forms, including material produced in Memoz (MEMory OrganiZer).

  19. 广东省市际金融排斥度综合评价及空间格局演变%A Comprehensive Evaluation of the Intercity Financial Exclusion in Guangdong with an Exploration of Its Spatial Pattern

    Institute of Scientific and Technical Information of China (English)

    张国俊; 周春山; 许学强

    2014-01-01

    Regarding the three dimensions of penetration, usage and effectiveness of financial services, we con-structed a comprehensive evaluation index system of financial exclusion and measured the intercity financial exclusion in Guangdong Province of China in 2002, 2007 and 2012 respectively by using Human Develop-ment Index, and then analyzed the spatial pattern of its evolution by integrating the ArcGIS spatial analysis mode. The research showed that: 1) While the disparity of intercity financial exclusion in Guangdong was large, and relatively stable, the financial exclusion was far lower in the Zhujiang River Delta than the surround-ing areas;2) The intercity financial exclusion showed significant spatial correlation and spatial gathering char-acteristics, with obvious spatial disparity between the Zhujiang River Delta and the surrounding areas and basi-cally stable evolutionary pattern. 3) The evolution pattern of financial exclusion disparity in Guangdong was affected by many interacting factors such as the strategy of the financial provider, the objective demand of the real economy development, the guidance of government economic behavior, social culture and institutions etc. This article argues, to reduce the financial exclusion, what is important is to speed up the regional economic de-velopment, reinforce governmental regulation, to develop micro-finance, and to cultivate good institutional and cultural environment.%从金融服务的渗透度、使用度、效用度3个维度构建了省域尺度金融排斥的综合评价指标体系,借鉴人类发展指数的计算方法,对广东省2002年、2007年和2012年市际单元的金融排斥度进行综合评价;并结合ArcGIS的空间分析模块,对广东省市际金融排斥度的空间格局演化进行探讨。研究表明:①广东省金融排斥度的市际差异大且相对稳定,珠三角的金融排斥度远远低于外围区;②市际金融排斥度呈现显著的空间相关性和空

  20. Serum amyloid A and protein AA: molecular mechanisms of a transmissible amyloidosis.

    Science.gov (United States)

    Westermark, Gunilla T; Westermark, Per

    2009-08-20

    Systemic AA-amyloidosis is a complication of chronic inflammatory diseases and the fibril protein AA derives from the acute phase reactant serum AA. AA-amyloidosis can be induced in mice by an inflammatory challenge. The lag phase before amyloid develops can be dramatically shortened by administration of a small amount of amyloid fibrils. Systemic AA-amyloidosis is transmissible in mice and may be so in humans. Since transmission can cross species barriers it is possible that AA-amyloidosis can be induced by amyloid in food, e.g. foie gras. In mice, development of AA-amyloidosis can also be accelerated by other components with amyloid-like properties. A new possible risk factor may appear with synthetically made fibrils from short peptides, constructed for tissue repair.