WorldWideScience

Sample records for aa linker mutant

  1. Evidence of the crucial role of the linker domain on the catalytic activity of human topoisomerase I by experimental and simulative characterization of the Lys681Ala mutant

    Science.gov (United States)

    Fiorani, Paola; Tesauro, Cinzia; Mancini, Giordano; Chillemi, Giovanni; D'A;nnessa, Ilda; Graziani, Grazia; Tentori, Lucio; Muzi, Alessia; Desideri, Alessandro

    2009-01-01

    The functional and structural-dynamical properties of the Lys681Ala mutation in the human topoisomerase IB linker domain have been investigated by catalytic assays and molecular dynamics simulation. The mutant is characterized by a comparable cleavage and a strongly reduced religation rate when compared to the wild type protein. The mutant also displays perturbed linker dynamics, as shown by analysis of the principal components of the motion, and a reduced electrostatic interaction with DNA. Inspection of the inter atomic distances in proximity of the active site shows that in the mutant the distance between the amino group of Lys532 side chain and the 5′ OH of the scissile phosphate is longer than the wild type enzyme, providing an atomic explanation for the reduced religation rate of the mutant. Taken together these results indicate the existence of a long range communication between the linker domain and the active site region and points out the crucial role of the linker in the modulation of the catalytic activity. PMID:19767617

  2. Backbone amide linker strategy

    DEFF Research Database (Denmark)

    Shelton, Anne Pernille Tofteng; Jensen, Knud Jørgen

    2013-01-01

    In the backbone amide linker (BAL) strategy, the peptide is anchored not at the C-terminus but through a backbone amide, which leaves the C-terminal available for various modifications. This is thus a very general strategy for the introduction of C-terminal modifications. The BAL strategy...... to assemble the final peptide. One useful application of this strategy is in the synthesis of C-terminal peptide aldehydes. The C-terminal aldehyde is masked as an acetal during synthesis and then conveniently demasked in the final cleavage step to generate the free aldehyde. Another application...

  3. Dominant negative phenotype of Bacillus thuringiensis Cry1Ab, Cry11Aa and Cry4Ba mutants suggest hetero-oligomer formation among different Cry toxins.

    NARCIS (Netherlands)

    Carmona, D.; Rodriguez-Almazan, C.; Munoz-Garay, C.; Portugal, L.; Perez, C.; Maagd, de R.A.; Bakker, P.; Soberon, M.; Bravo, A.

    2011-01-01

    Background - Bacillus thuringiensis Cry toxins are used worldwide in the control of different insect pests important in agriculture or in human health. The Cry proteins are pore-forming toxins that affect the midgut cell of target insects. It was shown that non-toxic Cry1Ab helix a-4 mutants had a

  4. The measles virus phosphoprotein interacts with the linker domain of STAT1

    Energy Technology Data Exchange (ETDEWEB)

    Devaux, Patricia, E-mail: devaux.patricia@mayo.edu; Priniski, Lauren; Cattaneo, Roberto

    2013-09-15

    The measles virus (MV) phosphoprotein (P) and V proteins block the interferon (IFN) response by impeding phosphorylation of the signal transducer and activator of transcription 1 (STAT1) by the Janus kinase 1 (JAK1). We characterized how STAT1 mutants interact with P and JAK1 phosphorylation. Certain mutants of the linker, the Src-homology 2 domain (SH2), or the transactivation domain had reduced or abolished phosphorylation through JAK1 after IFN treatment. Other mutants, mainly localized in the linker, failed to interact with P as documented by the lack of interference with nuclear translocation. Thus the functional footprint of P on STAT1 localizes mainly to the linker domain; there is also some overlap with the STAT1 phosphorylation functional footprint on the SH2 domain. Based on these observations, we discuss how the MV-P might operate to inhibit the JAK/STAT pathway. - Highlights: • Residue in the linker and SH2 domains of STAT1 are important for MV-P interaction. • Residue in the linker and SH2 domains of STAT1 are important for STAT1 phosphorylation. • Residues interferring with both functions have similar location on STAT1. • The viral P and V proteins may operate in concert to inhibit the JAK/STAT pathway.

  5. The measles virus phosphoprotein interacts with the linker domain of STAT1

    International Nuclear Information System (INIS)

    Devaux, Patricia; Priniski, Lauren; Cattaneo, Roberto

    2013-01-01

    The measles virus (MV) phosphoprotein (P) and V proteins block the interferon (IFN) response by impeding phosphorylation of the signal transducer and activator of transcription 1 (STAT1) by the Janus kinase 1 (JAK1). We characterized how STAT1 mutants interact with P and JAK1 phosphorylation. Certain mutants of the linker, the Src-homology 2 domain (SH2), or the transactivation domain had reduced or abolished phosphorylation through JAK1 after IFN treatment. Other mutants, mainly localized in the linker, failed to interact with P as documented by the lack of interference with nuclear translocation. Thus the functional footprint of P on STAT1 localizes mainly to the linker domain; there is also some overlap with the STAT1 phosphorylation functional footprint on the SH2 domain. Based on these observations, we discuss how the MV-P might operate to inhibit the JAK/STAT pathway. - Highlights: • Residue in the linker and SH2 domains of STAT1 are important for MV-P interaction. • Residue in the linker and SH2 domains of STAT1 are important for STAT1 phosphorylation. • Residues interferring with both functions have similar location on STAT1. • The viral P and V proteins may operate in concert to inhibit the JAK/STAT pathway

  6. AA Index

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa index provides a long climatology of global geomagnetic activity using 2 antipodal observatories at Greenwich and Melbourne- IAGA Bulletin 37,...

  7. The neck linker of kinesin 1 seems optimally designed to approach the largest stepping velocity: a simulation study of an ideal model

    Science.gov (United States)

    Shu, Yao-Gen; Zhang, Xiao-Hu; Ou-Yang, Zhong-Can; Li, Ming

    2012-01-01

    The neck linker is widely believed to play a critical role in the hand-over-hand walking of conventional kinesin 1. Experiments have shown that change of the neck linker length will significantly change the stepping velocity of the motor. In this paper, we studied this length effect based on a highly simplified chemically powered ratchet model. In this model, we assume that the chemical steps (ATP hydrolysis, ADP and Pi release, ATP binding, neck linker docking) are fast enough under conditions far from equilibrium and the mechanical steps (detachment, diffusional search and re-attachment of the free head) are rate-limiting in kinesin walking. According to this model, and regarding the neck linker as a worm-like-chain polypeptide, we can calculate the steady state stepping velocity of the motor for different neck linker lengths. Our results show, under the actual values of binding energy between kinesin head and microtubule (˜15kBT) and the persistence length of neck linker (˜0.5 nm), that there is an optimal neck linker length (˜14-16 a.a.) corresponding to the maximal velocity, which implies that the length of the wild-type neck linker (˜15 a.a.) might be optimally designed for kinesin 1 to approach the largest stepping velocity.

  8. Monte Carlo analysis of neck linker extension in kinesin molecular motors.

    Directory of Open Access Journals (Sweden)

    Matthew L Kutys

    2010-11-01

    Full Text Available Kinesin stepping is thought to involve both concerted conformational changes and diffusive movement, but the relative roles played by these two processes are not clear. The neck linker docking model is widely accepted in the field, but the remainder of the step--diffusion of the tethered head to the next binding site--is often assumed to occur rapidly with little mechanical resistance. Here, we investigate the effect of tethering by the neck linker on the diffusive movement of the kinesin head, and focus on the predicted behavior of motors with naturally or artificially extended neck linker domains. The kinesin chemomechanical cycle was modeled using a discrete-state Markov chain to describe chemical transitions. Brownian dynamics were used to model the tethered diffusion of the free head, incorporating resistive forces from the neck linker and a position-dependent microtubule binding rate. The Brownian dynamics and chemomechanical cycle were coupled to model processive runs consisting of many 8 nm steps. Three mechanical models of the neck linker were investigated: Constant Stiffness (a simple spring, Increasing Stiffness (analogous to a Worm-Like Chain, and Reflecting (negligible stiffness up to a limiting contour length. Motor velocities and run lengths from simulated paths were compared to experimental results from Kinesin-1 and a mutant containing an extended neck linker domain. When tethered by an increasingly stiff spring, the head is predicted to spend an unrealistically short amount of time within the binding zone, and extending the neck is predicted to increase both the velocity and processivity, contrary to experiments. These results suggest that the Worm-Like Chain is not an adequate model for the flexible neck linker domain. The model can be reconciled with experimental data if the neck linker is either much more compliant or much stiffer than generally assumed, or if weak kinesin-microtubule interactions stabilize the diffusing

  9. Abia, AA

    African Journals Online (AJOL)

    Abia, AA. Vol 4, No 6 (2010) - Articles Studies on the kinetics and intraparticle diffusivities of BOD, colour and TSS reduction from palm oil mill effluent (POME) using boiler fly ash. Abstract PDF. ISSN: 1996-0786. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More ...

  10. Adejumo, AA

    African Journals Online (AJOL)

    Adejumo, AA. Vol 6, No 2 (2014) - Articles Assessment of Tourists Flow and Revenue Generation in Kainji Lake National Park, Nigeria Abstract PDF. ISSN: 2141-1778. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and ...

  11. Adepeju, AA

    African Journals Online (AJOL)

    Adepeju, AA. Vol 19, No 2 (2010) - Articles Assessment of Ethical and Other Professional Standards in Private Medical Laboratories; Osun State Experience. Abstract. ISSN: 1116-1043. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's ...

  12. Wornyo, AA

    African Journals Online (AJOL)

    Wornyo, AA. Vol 2, No 1 (2012) - Articles Addressing the Difficulties of Learners in the Reading Class Abstract. ISSN: 2026-6081. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and Conditions of Use · Contact AJOL ...

  13. Structure and Functions of Linker Histones.

    Science.gov (United States)

    Lyubitelev, A V; Nikitin, D V; Shaytan, A K; Studitsky, V M; Kirpichnikov, M P

    2016-03-01

    Linker histones such as variants H1, H5, and other similar proteins play an important role in regulation of chromatin structure and dynamics. However, interactions of linker histones with DNA and proteins, as well as specific functions of their different variants, are poorly studied. This is because they acquire tertiary structure only when interacting with a nucleosome, and because of limitations of currently available methods. However, deeper investigation of linker histones and their interactions with other proteins will address a number of important questions - from structure of compacted chromatin to regulation of early embryogenesis. In this review, structures of histone H1 variants and its interaction with chromatin DNA are considered. A possible functional significance of different H1 variants, a role of these proteins in maintaining interphase chromatin structure, and interactions of linker histones with other cellular proteins are also discussed.

  14. Hydroquinone–pyrrole dyads with varied linkers

    Directory of Open Access Journals (Sweden)

    Hao Huang

    2016-01-01

    Full Text Available A series of pyrroles functionalized in the 3-position with p-dimethoxybenzene via various linkers (CH2, CH2CH2, CH=CH, C≡C has been synthesized. Their electronic properties have been deduced from 1H NMR, 13C NMR, and UV–vis spectra to detect possible interactions between the two aromatic subunits. The extent of conjugation between the subunits is largely controlled by the nature of the linker, with the largest conjugation found with the trans-ethene linker and the weakest with the aliphatic linkers. DFT calculations revealed substantial changes in the HOMO–LUMO gap that correlated with the extent of conjugation found experimentally. The results of this work are expected to open up for use of the investigated compounds as components of redox-active materials in sustainable, organic electrical energy storage devices.

  15. Cross-linking of Poly(sodium acrylate-Based Hydrogels by a Non-vinyl Cross-linker

    Directory of Open Access Journals (Sweden)

    Solmaz Mojarad Jabali

    2016-05-01

    Full Text Available Polyvinyl-based cross-linkers are most frequently used for internal cross-linking of hydrogels, while non-vinyl cross-linkers are used for surface cross-linking of hydrogels by reactions between the pendant groups of hydrogel and functional groups of cross-linkers. The type of internal or external cross-linking of hydrogels strongly affects their final properties. The type of internal or external cross-linking of hydrogels strongly affects the final properties of the products. In this research, the superabsorbent polymers (SAPs based on partially neutralized acrylic acid (AA-NaAA were synthesized by solution polymerization, using a series of new multifunctional cross-linkers such as polyethylene glycol diglycidyl ether (PEGDGE-300, ethylene glycol diglycidyl ether (EGDGE, 1,4-butane diol (BDO and [3-(2,3-epoxypropoxy-propyl]-trimethoxysilane (GPS in the presence of ammonium persulfate-tetramethyl ethylene diamine (APS/TMEDA as initiator. The molecular structures of PEGDGE and GPS hydrogels were detected by FTIR and EDX analyses. The type and concentration of cross-linkers were studied in relation to hydrogels’ free swelling capacity in distilled water and 0.9 wt% NaCl solution and their absorbency under load (AUL and resulting rheological behavior. The result showed that the order of free swelling capacity in the hydrogels synthesized by these four cross-linkers was GPS PEGDGE EGDGE BDO. In a constant free absorbency capacity (about 200 g/g, the cross-linked PEGDGE showed the highest amount of AUL. Furthermore, the rheological results showed the higher swollen gel strength in this hydrogel and confirmed the AUL result. The swelling properties of non-vinyl cross-linkers strongly depended on drying temperature, and hydrogels cured at different temperatures exhibited different rheological properties achieved by a constant amount of cross-linker. The use of non-vinyl cross-linker is a new approach to synthesize hydrogels without any polyvinyl

  16. Water-soluble heterobifunctional fluorescent linkers

    Czech Academy of Sciences Publication Activity Database

    Bartoň, Jan; Cígler, Petr

    2017-01-01

    Roč. 15, č. 1 (2017), s. 4 ISSN 2336-7202. [Mezioborové setkání mladých biologů, biochemiků a chemiků /17./. 30.05.2017-01.06.2017, Milovy] Institutional support: RVO:61388963 Keywords : fluorescent probes * heterobifunctional linkers Subject RIV: CA - Inorganic Chemistry

  17. Roles of the linker region of RNA helicase A in HIV-1 RNA metabolism.

    Directory of Open Access Journals (Sweden)

    Li Xing

    Full Text Available RNA helicase A (RHA promotes multiple steps in HIV-1 production including transcription and translation of viral RNA, annealing of primer tRNA(Lys3 to viral RNA, and elevating the ratio of unspliced to spliced viral RNA. At its amino terminus are two double-stranded RNA binding domains (dsRBDs that are essential for RHA-viral RNA interaction. Linking the dsRBDs to the core helicase domain is a linker region containing 6 predicted helices. Working in vitro with purified mutant RHAs containing deletions of individual helices reveals that this region may regulate the enzyme's helicase activity, since deletion of helix 2 or 3 reduces the rate of unwinding RNA by RHA. The biological significance of this finding was then examined during HIV-1 production. Deletions in the linker region do not significantly affect either RHA-HIV-1 RNA interaction in vivo or the incorporation of mutant RHAs into progeny virions. While the partial reduction in helicase activity of mutant RHA containing a deletion of helices 2 or 3 does not reduce the ability of RHA to stimulate viral RNA synthesis, the promotion of tRNA(Lys3 annealing to viral RNA is blocked. In contrast, deletion of helices 4 or 5 does not affect the ability of RHA to promote tRNA(Lys3 annealing, but reduces its ability to stimulate viral RNA synthesis. Additionally, RHA stimulation of viral RNA synthesis results in an increased ratio of unspliced to spliced viral RNA, and this increase is not inhibited by deletions in the linker region, nor is the pattern of splicing changed within the ∼ 4.0 kb or ∼ 1.8 kb HIV-1 RNA classes, suggesting that RHA's effect on suppressing splicing is confined mainly to the first 5'-splice donor site. Overall, the differential responses to the mutations in the linker region of RHA reveal that RHA participates in HIV-1 RNA metabolism by multiple distinct mechanisms.

  18. [Construction of cTnC-linker-TnI (P) Genes, Expression of Fusion Protein and Preparation of Lyophilized Protein].

    Science.gov (United States)

    Song, Xiaoli; Liu, Xiaoyun; Cai, Lei; Wu, Jianwei; Wang, Jihua

    2015-12-01

    In order to construct and express human cardiac troponin C-linker-troponin I(P) [ cTnC-linker-TnI(P)] fusion protein, detect its activity and prepare lyophilized protein, we searched the CDs of human cTnC and cTnI from GenBank, synthesized cTnC and cTnI(30-110aa) into cloning vector by a short DNA sequence coding for 15 neutral amino acid residues. pCold I-cTnC-linker-TnI(P) was constructed and transformed into E. coli BL21(DE3). Then, cTnC-linker-TnI(P) fusion protein was induced by isopropyl-β-D-thiogalactopyranoside (IPTG). Soluable expression of cTnC-linker-TnI(P) in prokaryotic system was successfully obtained. The fusion protein was purified by Ni²⁺ Sepharose 6 Fast Flow affinity chromatography with over 95% purity and prepared into lyophilized protein. The activity of purified cTnC-linker-TnI(P) and its lyophilized protein were detected by Wondfo Finecare™ cTnI Test. Lyophilized protein of cTnC-linker-TnI(P) was stable for 10 or more days at 37 °C and 4 or more months at 25 °C and 4 °C. The expression system established in this research is feasible and efficient. Lyophilized protein is stable enough to be provided as biological raw materials for further research.

  19. ATM mutants

    Indian Academy of Sciences (India)

    First page Back Continue Last page Graphics. ATM mutants. ATM (Ataxia Telangiectasia Mutated). AT2BE and AT5B1 cells – fibroblast cell lines from Ataxia telangiectasia patients. Deletion mutants expressing truncated ATM protein which is inactive. Have been used in studies looking at the role of ATM in DNA damage ...

  20. Syntabulin, a motor protein linker, controls dorsal determination.

    Science.gov (United States)

    Nojima, Hideaki; Rothhämel, Sophie; Shimizu, Takashi; Kim, Cheol-Hee; Yonemura, Shigenobu; Marlow, Florence L; Hibi, Masahiko

    2010-03-01

    In amphibian and teleost embryos, the dorsal determinants (DDs) are believed to be initially localized to the vegetal pole and then transported to the prospective dorsal side of the embryo along a microtubule array. The DDs are known to activate the canonical Wnt pathway and thereby promote the expression of genes that induce the dorsal organizer. Here, by identifying the locus of the maternal-effect ventralized mutant tokkaebi, we show that Syntabulin, a linker of the kinesin I motor protein, is essential for dorsal determination in zebrafish. We found that syntabulin mRNA is transported to the vegetal pole during oogenesis through the Bucky ball (Buc)-mediated Balbiani body-dependent pathway, which is necessary for establishment of animal-vegetal (AV) oocyte polarity. We demonstrate that Syntabulin is translocated from the vegetal pole in a microtubule-dependent manner. Our findings suggest that Syntabulin regulates the microtubule-dependent transport of the DDs, and provide evidence for the link between AV and dorsoventral axis formation.

  1. Desmosine-Inspired Cross-Linkers for Hyaluronan Hydrogels

    Science.gov (United States)

    Hagel, Valentin; Mateescu, Markus; Southan, Alexander; Wegner, Seraphine V.; Nuss, Isabell; Haraszti, Tamás; Kleinhans, Claudia; Schuh, Christian; Spatz, Joachim P.; Kluger, Petra J.; Bach, Monika; Tussetschläger, Stefan; Tovar, Günter E. M.; Laschat, Sabine; Boehm, Heike

    2013-06-01

    We designed bioinspired cross-linkers based on desmosine, the cross-linker in natural elastin, to prepare hydrogels with thiolated hyaluronic acid. These short, rigid cross-linkers are based on pyridinium salts (as in desmosine) and can connect two polymer backbones. Generally, the obtained semi-synthetic hydrogels are form-stable, can withstand repeated stress, have a large linear-elastic range, and show strain stiffening behavior typical for biopolymer networks. In addition, it is possible to introduce a positive charge to the core of the cross-linker without affecting the gelation efficiency, or consequently the network connectivity. However, the mechanical properties strongly depend on the charge of the cross-linker. The properties of the presented hydrogels can thus be tuned in a range important for engineering of soft tissues by controlling the cross-linking density and the charge of the cross-linker.

  2. Aa Ah Nak

    Science.gov (United States)

    Tha, Na Gya; Wus, Thay

    2017-01-01

    In this article, Aa Ah Nak, the authors' methodology presents not only various reflections but also diverse contradictions about the Aa Nii language as well as language revitalization. This article explores language foundation and how the Aa Nii language revitalization is inextricably linked to the genocide and resulting historic trauma pervasive…

  3. Conformational rearrangements in the S6 domain and C-linker during gating in CNGA1 channels.

    Science.gov (United States)

    Nair, Anil V; Nguyen, Chuong H H; Mazzolini, Monica

    2009-09-01

    This work completes previous findings and, using cysteine scanning mutagenesis (CSM) and biochemical methods, provides detailed analysis of conformational changes of the S6 domain and C-linker during gating of CNGA1 channels. Specific residues between Phe375 and Val424 were mutated to a cysteine in the CNGA1 and CNGA1(cys-free) background and the effect of intracellular Cd(2+) or cross-linkers of different length in the open and closed state was studied. In the closed state, Cd(2+) ions inhibited mutant channels A406C and Q409C and the longer cross-linker reagent M-4-M inhibited mutant channels A406C(cys-free) and Q409C(cys-free). Cd(2+) ions inhibited mutant channels D413C and Y418C in the open state, both constructed in a CNGA1 and CNGA1(cys-free) background. Our results suggest that, in the closed state, residues from Phe375 to approximately Ala406 form a helical bundle with a three-dimensional (3D) structure similar to those of the KcsA; furthermore, in the open state, residues from Ser399 to Gln409 in homologous subunits move far apart, as expected from the gating in K(+) channels; in contrast, residues from Asp413 to Tyr418 in homologous subunits become closer in the open state.

  4. Linker insertion mutations in the adenovirus preterminal protein that affect DNA replication activity in vivo and in vitro.

    OpenAIRE

    Fredman, J N; Pettit, S C; Horwitz, M S; Engler, J A

    1991-01-01

    Eighteen linker insertion mutants with mutations in the adenovirus precursor to terminal protein (pTP), which were originally constructed and tested in virions by Freimuth and Ginsberg (Proc. Natl. Acad. Sci. USA 83:7816-7820, 1986), were transferred to expression plasmids for assay of the various functions of the isolated pTP. Function was measured by the ability of individual pTP mutant proteins to participate in the initiation of replication from an adenovirus DNA end, by their activity in...

  5. Linker-scanning mutational analysis of the transcriptional activity of the human immunodeficiency virus type 1 long terminal repeat.

    OpenAIRE

    Zeichner, S L; Kim, J Y; Alwine, J C

    1991-01-01

    We have compared the relative importance of transcription regulatory regions in the U3 and R regions of the human immunodeficiency virus type 1 long terminal repeat (LTR) by using linker-scanning mutational analysis. Twenty-six mutant LTR-chloramphenicol acetyltransferase (CAT) transient expression plasmids were prepared in which consecutive 18-bp regions of wild-type LTR were replaced with an NdeI-XhoI-SalI (NXS) polylinker. The mutant LTR-CAT plasmids were transfected into unstimulated Jurk...

  6. Structural Mechanisms of Nucleosome Recognition by Linker Histones.

    Science.gov (United States)

    Zhou, Bing-Rui; Jiang, Jiansheng; Feng, Hanqiao; Ghirlando, Rodolfo; Xiao, T Sam; Bai, Yawen

    2015-08-20

    Linker histones bind to the nucleosome and regulate the structure of chromatin and gene expression. Despite more than three decades of effort, the structural basis of nucleosome recognition by linker histones remains elusive. Here, we report the crystal structure of the globular domain of chicken linker histone H5 in complex with the nucleosome at 3.5 Å resolution, which is validated using nuclear magnetic resonance spectroscopy. The globular domain sits on the dyad of the nucleosome and interacts with both DNA linkers. Our structure integrates results from mutation analyses and previous cross-linking and fluorescence recovery after photobleach experiments, and it helps resolve the long debate on structural mechanisms of nucleosome recognition by linker histones. The on-dyad binding mode of the H5 globular domain is different from the recently reported off-dyad binding mode of Drosophila linker histone H1. We demonstrate that linker histones with different binding modes could fold chromatin to form distinct higher-order structures. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Nanohashtag structures based on carbon nanotubes and molecular linkers

    Science.gov (United States)

    Frye, Connor W.; Rybolt, Thomas R.

    2018-03-01

    Molecular mechanics was used to study the noncovalent interactions between single-walled carbon nanotubes and molecular linkers. Groups of nanotubes have the tendency to form tight, parallel bundles (||||). Molecular linkers were introduced into our models to stabilize nanostructures with carbon nanotubes held in perpendicular orientations. Molecular mechanics makes it possible to estimate the strength of noncovalent interactions holding these structures together and to calculate the overall binding energy of the structures. A set of linkers were designed and built around a 1,3,5,7-cyclooctatetraene tether with two corannulene containing pincers that extend in opposite directions from the central cyclooctatetraene portion. Each pincer consists of a pairs of "arms." These molecular linkers were modified so that the "hand" portions of each pair of "arms" could close together to grab and hold two carbon nanotubes in a perpendicular arrangement. To illustrate the possibility of more complicated and open perpendicular CNTs structures, our primary goal was to create a model of a nanohashtag (#) CNT conformation that is more stable than any parallel CNT arrangements with bound linker molecules forming clumps of CNTs and linkers in non-hashtag arrangements. This goal was achieved using a molecular linker (C280H96) that utilizes van der Waals interactions to two perpendicular oriented CNTs. Hydrogen bonding was then added between linker molecules to augment the stability of the hashtag structure. In the hashtag structure with hydrogen bonding, four (5,5) CNTs of length 4.46 nm (18 rings) and four linkers (C276H92N8O8) stabilized the hashtag so that the average binding energy per pincer was 118 kcal/mol.

  8. Photolabile linker for the synthesis of hydroxamic acids

    DEFF Research Database (Denmark)

    2013-01-01

    The present invention relates to a photolabile hydroxamate linker based on the o - nitroveratryl group and its application for multistep solid-phase synthesis and controlled photolytic release of hydroxamic acids. The invention provides a method for producing a solid support comprising...... a hydroxylamine - functionalized photolabile linker, and the so produced hydroxylamine - functionalized photolabile solid support. The invention further provides a method for synthesizing a one-bead-one compound library of hydroxamic acid derivatives on a photolabile linker, as well as a method for screening...... a library of hydroxamic acid derivatives....

  9. Crystallization of Galectin-8 Linker Reveals Intricate Relationship between the N-terminal Tail and the Linker

    Directory of Open Access Journals (Sweden)

    Yunlong Si

    2016-12-01

    Full Text Available Galectin-8 (Gal-8 plays a significant role in normal immunological function as well as in cancer. This lectin contains two carbohydrate recognition domains (CRD connected by a peptide linker. The N-terminal CRD determines ligand binding specificity, whereas the linker has been proposed to regulate overall Gal-8 function, including multimerization and biological activity. Here, we crystallized the Gal-8 N-terminal CRD with the peptide linker using a crystallization condition that contains Ni2+. The Ni2+ ion was found to be complexed between two CRDs via crystal packing contacts. The coordination between Ni2+ and Asp25 plays an indirect role in determining the structure of β-strand F0 and in influencing the linker conformation which could not be defined due to its dynamic nature. The linker was also shortened in situ and crystallized under a different condition, leading to a higher resolution structure refined to 1.08 Å. This crystal structure allowed definition of a short portion of the linker interacting with the Gal-8 N-terminal tail via ionic interactions and hydrogen bonds. Observation of two Gal-8 N-terminal CRD structures implies that the N-terminal tail and the linker may influence each other’s conformation. In addition, under specific crystallization conditions, glycerol could replace lactose and was observed at the carbohydrate binding site. However, glycerol did not show inhibition activity in hemagglutination assay.

  10. AA under construction

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    The AA at an early stage of construction, in the newly built AA-Hall. Cable-trays already outline the shape of the accumulator ring. To the right are huge cable-drums for the pulse-forming-network (PFN) of the injection kicker. Seeing this picture, can one imagine that only 8 months later beams were circulating in the completed accumulator ring ?

  11. A Small Number of Residues Can Determine if Linker Histones Are Bound On or Off Dyad in the Chromatosome.

    Science.gov (United States)

    Zhou, Bing-Rui; Feng, Hanqiao; Ghirlando, Rodolfo; Li, Shipeng; Schwieters, Charles D; Bai, Yawen

    2016-10-09

    Linker histones bind to the nucleosome and regulate the structure and function of chromatin. We have previously shown that the globular domains of chicken H5 and Drosophila H1 linker histones bind to the nucleosome with on- or off-dyad modes, respectively. To explore the determinant for the distinct binding modes, we investigated the binding of a mutant globular domain of H5 to the nucleosome. This mutant, termed GH5_pMut, includes substitutions of five globular domain residues of H5 with the corresponding residues in the globular domain of Drosophila H1. The residues at these five positions play important roles in nucleosome binding by either H5 or Drosophila H1. NMR and spin-labeling experiments showed that GH5_pMut bound to the nucleosome off the dyad. We further found that the nucleosome array condensed by either the GH5_pMut or the globular domain of Drosophila H1 displayed a similar sedimentation coefficient, whereas the same nucleosome array condensed by the wild-type globular domain of H5 showed a much larger sedimentation coefficient. Moreover, NMR and spin-labeling results from the study of the nucleosome in complex with the full-length human linker histone H1.0, whose globular domain shares high sequence conservation with the corresponding globular domain of H5, are consistent with an on-dyad binding mode. Taken together, our results suggest that a small number of residues in the globular domain of a linker histone can control its binding location on the nucleosome and higher-order chromatin structure. Copyright © 2016. Published by Elsevier Ltd.

  12. A Covalent Linker Allows for Membrane Targeting of An Oxylipin Biosynthetic Complex

    Energy Technology Data Exchange (ETDEWEB)

    Gilbert, N.C.; Niebuhr, M.; Tsuruta, H.; Bordelon, T.; Ridderbusch, O.; Dassey, A.; Brash, A.R.; Bartlett, S.G.; Newcomer, M.E.

    2009-05-18

    A naturally occurring bifunctional protein from Plexaura homomalla links sequential catalytic activities in an oxylipin biosynthetic pathway. The C-terminal lipoxygenase (LOX) portion of the molecule catalyzes the transformation of arachidonic acid (AA) to the corresponding 8R-hydroperoxide, and the N-terminal allene oxide synthase (AOS) domain promotes the conversion of the hydroperoxide intermediate to the product allene oxide (AO). Small-angle X-ray scattering data indicate that in the absence of a covalent linkage the two catalytic domains that transform AA to AO associate to form a complex that recapitulates the structure of the bifunctional protein. The SAXS data also support a model for LOX and AOS domain orientation in the fusion protein inferred from a low-resolution crystal structure. However, results of membrane binding experiments indicate that covalent linkage of the domains is required for Ca2+-dependent membrane targeting of the sequential activities, despite the noncovalent domain association. Furthermore, membrane targeting is accompanied by a conformational change as monitored by specific proteolysis of the linker that joins the AOS and LOX domains. Our data are consistent with a model in which Ca2+-dependent membrane binding relieves the noncovalent interactions between the AOS and LOX domains and suggests that the C2-like domain of LOX mediates both protein-protein and protein-membrane interactions.

  13. Geomagnetic aa Indices

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa indices are the continuation of the series beginning in the year 1868. A full description of these indices is given in the International...

  14. A study on the effects of linker flexibility on acid phosphatase PhoC-GFP fusion protein using a novel linker library.

    Science.gov (United States)

    Huang, Ziliang; Li, Gang; Zhang, Chong; Xing, Xin-Hui

    2016-02-01

    Fusion strategy has been widely used to construct artificial multifunction proteins. The flexibility or rigidity of linkers between two fused partners is an important parameter that affects the function of fusion proteins. By combining the flexible unit GGGGS (F) and rigid unit EAAAK (R), ten linkers consisting of five elementary units that cover the fully rigid RRRRR linker to the fully flexible FFFFF linker were used to construct acid phosphatase-green fluorescence protein fusion protein (PhoC-GFP). By varying the linker flexibility in PhoC-GFPs, the relative specific activity of phosphotransferase and phosphatase varied from ∼19.0% to 100% and ∼9.35% to 100%, respectively. There exists an optimal linker capable of achieving the highest phosphotransferase/phosphatase activity and GFP fluorescence intensity. We found that the highest activities were achieved neither with the rigid RRRRR linker nor with the flexible FFFFF linker, but with the FFFRR linker. Linker flexibility could adjust the activity ratio between phosphotransferase and phosphatase and varied between ∼30% to 100%. PhoC-GFP with FRRRR linker achieved the highest relative specific phosphotransferase activity/relative specific phosphatase activity (T/P) value. Our results show that applying a linker library with controllable flexibility to the fusion proteins will be an efficient way to adjust the function of fusion enzymes. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Inter-domain linker prediction using amino acid compositional index.

    Science.gov (United States)

    Shatnawi, Maad; Zaki, Nazar

    2015-04-01

    Protein chains are generally long and consist of multiple domains. Domains are distinct structural units of a protein that can evolve and function independently. The accurate and reliable prediction of protein domain linkers and boundaries is often considered to be the initial step of protein tertiary structure and function predictions. In this paper, we introduce CISA as a method for predicting inter-domain linker regions solely from the amino acid sequence information. The method first computes the amino acid compositional index from the protein sequence dataset of domain-linker segments and the amino acid composition. A preference profile is then generated by calculating the average compositional index values along the amino acid sequence using a sliding window. Finally, the protein sequence is segmented into intervals and a simulated annealing algorithm is employed to enhance the prediction by finding the optimal threshold value for each segment that separates domains from inter-domain linkers. The method was tested on two standard protein datasets and showed considerable improvement over the state-of-the-art domain linker prediction methods. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Initial conformation of kinesin's neck linker

    International Nuclear Information System (INIS)

    Geng Yi-Zhao; Yan Shi-Wei; Ji Qing; Liu Shu-Xia

    2014-01-01

    How ATP binding initiates the docking process of kinesin's neck linker is a key question in understanding kinesin mechanisms. By exploiting a molecular dynamics method, we investigate the initial conformation of kinesin's neck linker in its docking process. We find that, in the initial conformation, the neck linker has interactions with β0 and forms a ‘cover-neck bundle’ structure with β0. From this initial structure, the formation of extra turns and the docking of the cover-neck bundle structure can be achieved. The motor head provides a forward force on the initial cover-neck bundle structure through ATP-induced rotation. This force, together with the hydrophobic interaction of ILE327 with the hydrophobic pocket on the motor head, drives the formation of the extra turn and initiates the neck linker docking process. Based on these findings, a pathway from ATP binding-induced motor head rotation to neck linker docking is proposed. (interdisciplinary physics and related areas of science and technology)

  17. Identification of Epithelial-Mesenchymal Transition-related Target Genes Induced by the Mutation of Smad3 Linker Phosphorylation

    Science.gov (United States)

    Park, Sujin; Yang, Kyung-Min; Park, Yuna; Hong, Eunji; Hong, Chang Pyo; Park, Jinah; Pang, Kyoungwha; Lee, Jihee; Park, Bora; Lee, Siyoung; An, Haein; Kwak, Mi-Kyung; Kim, Junil; Kang, Jin Muk; Kim, Pyunggang; Xiao, Yang; Nie, Guangjun; Ooshima, Akira

    2018-01-01

    Background Smad3 linker phosphorylation plays essential roles in tumor progression and metastasis. We have previously reported that the mutation of Smad3 linker phosphorylation sites (Smad3-Erk/Pro-directed kinase site mutant constructs [EPSM]) markedly reduced the tumor progression while increasing the lung metastasis in breast cancer. Methods We performed high-throughput RNA-Sequencing of the human prostate cancer cell lines infected with adenoviral Smad3-EPSM to identify the genes regulated by Smad3-EPSM. Results In this study, we identified genes which are differentially regulated in the presence of Smad3-EPSM. We first confirmed that Smad3-EPSM strongly enhanced a capability of cell motility and invasiveness as well as the expression of epithelial-mesenchymal transition marker genes, CDH2, SNAI1, and ZEB1 in response to TGF-β1 in human pancreatic and prostate cancer cell lines. We identified GADD45B, CTGF, and JUNB genes in the expression profiles associated with cell motility and invasiveness induced by the Smad3-EPSM. Conclusions These results suggested that inhibition of Smad3 linker phosphorylation may enhance cell motility and invasiveness by inducing expression of GADD45B, CTGF, and JUNB genes in various cancers. PMID:29629343

  18. An Externally Accessible Linker Region in the Sodium-Coupled Phosphate Transporter PiT-1 (SLC20A1 is Important for Transport Function

    Directory of Open Access Journals (Sweden)

    Silvia Ravera

    2013-07-01

    Full Text Available Background/Aims: Members of the SLC20 cotransporter family (PiT-1, PiT-2 are ubiquitously expressed in mammalian tissue and are thought to perform housekeeping functions for intracellular Pi homeostasis as well as being implicated in vascular calcification and renal Pi reabsorption. The aims of this study were to investigate the topology of a linker region in PiT-1 between the predicted 2nd and 3rd transmembrane domains and to investigate the functional consequences of cysteine substitutions in this region. Methods: Cysteines were substituted at 18 sites in the Xenopus PiT-1 isoform and the mutants were expressed in Xenopus laevis oocytes. Transport function of the mutants was investigated by 32P tracer or two electrode voltage clamp before and after thiol modification of the novel Cys. Results: Exposure to the thiol reactive reagent resulted in diminished transport function for 7 mutants. The apparent accessibility of 5 of the mutated sites, estimated from the rate of functional thiol modification, was site-dependent. Cysteine substitution at some sites also altered the apparent affinity for Pi and cation (Na+/Li+ and substrate (phosphate/arsenate selectivity, further underscoring the importance of this linker in defining PiT-1 transport characteristics. Conclusions: The external accessibility of a linker in PiT-1 was confirmed and sites were identified that determine substrate selectivity and transport function.

  19. A comparison of Aggregatibacter actinomycetemcomitans (Aa virulence traits in a rat model for periodontal disease.

    Directory of Open Access Journals (Sweden)

    Helen Schreiner

    Full Text Available Our aim was to explore the effects of Cytolethal Distending toxin (Cdt in a well established rat model of periodontal disease where leukotoxin (LtxA was thought to have no known effect. In vitro studies, were used to assess CdtB activity using Aa Leukotoxin as a negative control. These studies showed that both CdtB and LtxA (unexpectedly exerted significant effects on CD4(+ T cells. As a result we decided to compare the effects of these two prominent Aa virulence factors on bone loss using our rat model of Aa-induced periodontitis. In this model, Aa strains, mutant in cdtB and ltxA, were compared to their parent non-mutant strains and evaluated for colonization, antibody response to Aa, bone loss and disease. We found that bone loss/disease caused by the ltxA mutant strain, in which cdtB was expressed, was significantly less (p<0.05 than that due to the wild type strain. On the other hand, the disease caused by cdtB mutant strain, in which ltxA was expressed, was not significantly different from the wild type strain. This data indicates that Aa LtxA exerts a greater effect on bone loss than Cdt in this rat model of periodontal disease and supports the utility of this model to dissect specific virulence factors as they relate to immunopathology in studies of Aa-induced disease.

  20. Novel mixing method for cross linker introduction into droplet emulsions

    CSIR Research Space (South Africa)

    Land, KJ

    2013-10-01

    Full Text Available TAS 2013, Freiburg, Germany, 27-31 October 2013 NOVEL MIXING METHOD FOR CROSS LINKER INTRODUCTION INTO DROPLET EMULSIONS K.J. Land1, 2*, M.M. Mbanjwa1 and J.G. Korvink2 1CSIR, SOUTH AFRICA and 2IMTEK and FRIAS, GERMANY ABSTRACT Microfluidic...

  1. Dynamic alterations of linker histone variants during development.

    Science.gov (United States)

    Godde, James S; Ura, Kiyoe

    2009-01-01

    The process of development can be viewed as a series of linker histone replacements which take place throughout spermatogenesis and oogenesis, as well as following fertilization or somatic nuclear transfer (SNT). Although few of the histone H1 variants in question have been shown to be essential for viability, the timing of their appearance as well as the affinity with which they are able to bind to chromatin seem to be important factors in their developmental role. A looser binding of linker histones to chromatin seems to correlate with the meiotic phases of gametogenesis and the establishment of a totipotent, as well as the maintenance of a pluripotent, state in early embryos, while tighter binding of linker histones to chromatin appears to be associated with the mitotic phases, as well as the increased levels of condensation that are required for the packaging of DNA into sperm. This latter process also involves the binding of certain basic non-histone proteins to DNA. While all proteins involved in chromatin compaction during development are highly basic in nature, in general they can be seen to change from lysine-rich variants to arginine-rich ones, and back again. The fact that linker histone transitions are conserved across diverse metazoan species speaks of their importance in packaging DNA in a variety of ways during this crucial period.

  2. Fred-Jaiyesimi, AA

    African Journals Online (AJOL)

    Fred-Jaiyesimi, AA. Vol 12 (2008) - Articles Hypoglycaemic And Alpha-Amylase Inhibitory Activities Of Fermented Seeds Of Parkia Biglobosa (Jacq) Benth Abstract. ISSN: 1118-6267. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's ...

  3. Isolation and characterization of respiration-deficient mutants from the pathogenic yeast Candida albicans.

    Science.gov (United States)

    Hatab, M A; Whittaker, P A

    1992-04-01

    The isolation of several respiration deficient mutants of the pathogenic yeast Candida albicans is described. These show greatly reduced respiration rates, loss of cytochromes aa3 and b, and reduced growth rates. All of the mutants had lost the ability to assimilate a wide range of carbon sources. Ultrastructural studies showed reduced development of mitochondrial cristae in the mutants. The mutants can be divided into three classes depending on their respiration responses to the addition of cyanide.

  4. AL SAHLI, AA; OKOLI, JU

    African Journals Online (AJOL)

    ADOWIE PERE

    bioline.org.br/ja. The Use of Soil Palynomorphs in Forensics. *. 1. ABDULRAHAMAN, AA;. 2. AL SAHLI, AA;. 1. OKOLI, JU. 1Applied Plant Anatomy and Wood Technology Laboratory, Department of Plant Biology, University of Ilorin, Ilorin, Nigeria.

  5. Open and Closed: The Roles of Linker Histones in Plants and Animals

    OpenAIRE

    Over, Ryan S.; Michaels, Scott D.

    2014-01-01

    Linker histones play key roles alongside core histones in the regulation and maintenance of chromatin. Here, we illustrate our current understanding of the contributions of linker histones to the cell cycle, development, and chromatin structure in plants and animals.

  6. The Antiproton Accumulator (AA)

    CERN Multimedia

    1980-01-01

    Section 06 - 08*) of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A vacuum-tank, two bending magnets (BST06 and BST07 in blue) with a quadrupole (QDN07, in red) in between, another vacuum-tank, a wide quadrupole (QFW08) and a further tank . The tanks are covered with heating tape for bake-out. The tank left of BST06 contained the stack core pickup for stochastic cooling (see 7906193, 7906190, 8005051), the two other tanks served mainly as vacuum chambers in the region where the beam was large. Peter Zettwoch works on BST06. *) see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984)

  7. AA, bending magnet, BLG

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    The very particular lattice of the AA required 2 types of dipole (bending magnets; BLG, long and narrow; BST, short and wide). The BLG had a steel length of 4.70 m, a good field width of 0.24 m, and a weight of about 70 t. Jean-Claude Brunet inspects the lower half of a BLG. For the BST magnets see 7811105 and 8006036.

  8. The Antiproton Accumulator (AA)

    CERN Multimedia

    1980-01-01

    A section of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A large vacuum-tank, a quadrupole (QDN09*), a bending magnet (BST08), another vacuum-tank, a wide quadrupole (QFW08) and (in the background) a further bending magnet (BST08). The tanks are covered with heating tape for bake-out. The tank left of QDN09 contained the kickers for stochastic pre-cooling (see 790621, 8002234, 8002637X), the other one served mainly as vacuum chamber in the region where the beam was large. Peter Zettwoch works on QFW08. * see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984) See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  9. Rheology of semiflexible bundle networks with transient linkers.

    Science.gov (United States)

    Müller, Kei W; Bruinsma, Robijn F; Lieleg, Oliver; Bausch, Andreas R; Wall, Wolfgang A; Levine, Alex J

    2014-06-13

    We present a theoretical and computational analysis of the rheology of networks made up of bundles of semiflexible filaments bound by transient cross-linkers. Such systems are ubiquitous in the cytoskeleton and can be formed in vitro using filamentous actin and various cross-linkers. We find that their high-frequency rheology is characterized by a scaling behavior that is quite distinct from that of networks of the well-studied single semiflexible filaments. This regime can be understood theoretically in terms of a length-scale-dependent bending modulus for bundles. Next, we observe new dissipative dynamics associated with the shear-induced disruption of the network at intermediate frequencies. Finally, at low frequencies, we encounter a region of non-Newtonian rheology characterized by power-law scaling. This regime is dominated by bundle dissolution and large-scale rearrangements of the network driven by equilibrium thermal fluctuations.

  10. Tryptophan provision by dietary supplementation of a Bacillus subtilis mutant strain in piglets

    DEFF Research Database (Denmark)

    Torres-Pitarch, A; Nielsen, B.; Canibe, Nuria

    2015-01-01

    Supplementing Bacillus (B.) subtilis mutants selected to overproduce a specific amino acid (AA) may be an alternative method to provide essential AA in pig diets. Two experiments on a B. subtilis strain selected to overproduce Trp were conducted using 8-kg pigs fed Trp-deficient diets for 20 d. B...... to counterbalance the Trp deficiency in any of the two experiments. No effect of B. subtilis supplementation to piglet diets was observed on the plasma AA profile. In conclusion, this mutant strain of B. subtilis was not able to compensate a Trp deficiency in the tested doses....

  11. Construction of a linker library with widely controllable flexibility for fusion protein design.

    Science.gov (United States)

    Li, Gang; Huang, Ziliang; Zhang, Chong; Dong, Bo-Jun; Guo, Ruo-Hai; Yue, Hong-Wei; Yan, Li-Tang; Xing, Xin-Hui

    2016-01-01

    Flexibility or rigidity of the linker between two fused proteins is an important parameter that affects the function of fusion proteins. In this study, we constructed a linker library with five elementary units based on the combination of the flexible (GGGGS) and the rigid (EAAAK) units. Molecular dynamics (MD) simulation showed that more rigid units in the linkers lead to more helical conformation and hydrogen bonds, and less distance fluctuation between the N- and C-termini of the linker. The diversity of linker flexibility of the linker library was then studied by fluorescence resonance energy transfer (FRET) of cyan fluorescent protein (CFP)-yellow fluorescent protein (YFP) fusion proteins, which showed that there is a wide range of distribution of the FRET efficiency. Dissipative particle dynamics (DPD) simulation of CFP-YFP with different linkers also gave identical results with that of FRET efficiency analysis, and we further found that the combination manner of the linker peptide had a remarkable effect on the orientation of CFP and YFP domains. Our studies demonstrated that the construction of the linker library with the widely controllable flexibility could provide appropriate linkers with the desirable characteristics to engineer the fusion proteins with the expected functions.

  12. AAS 227: Day 1

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or at astrobites.com, or catch ourlive-tweeted updates from the @astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto have so many people tell us that they already know about and useastrobites, and we were excited to introduce a new cohort of students at AAS to astrobites for the first time.Tuesday morning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended today.Opening Address (by Becky Smethurst)The President of the AAS, aka our fearless leader Meg Urry kicked off the meeting this morning at the purely coffee powered hour of 8am this morning. She spoke about the importance of young astronomers at the meeting (heres looking at you reader!) and also the importance of the new Working Group for Accessibility and Disabilities (aka WGAD pronounced like wicked) at the AAS. The Society has made extra effort this year to make the conference accessible to all,a message which was very well received by everyone in attendance.Kavli Lecture: New Horizons Alan Stern (by Becky Smethurst)We were definitely spoilt with the first Plenary lecture at this years conference Alan Stern gave us a a review of the New Horizons mission of the Pluto Fly By (astrobites covered the mission back in July with this post). We were treated to beautiful images, wonderful results and a foray into geology.Before (Hubble) and after #NewHorizons. #thatisall #science #astro alanstern #aas227 pic.twitter.com/kkMt6RsSIR Science News (@topsciencething) January 5, 2016Some awesome facts from the lecture that blew my mind:New Horizons is now 2AU (!) beyond Pluto

  13. AAS 227: Day 2

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  14. An A-T linker adapter polymerase chain reaction method for chromosome walking without restriction site cloning bias.

    Science.gov (United States)

    Trinh, Quoclinh; Xu, Wentao; Shi, Hui; Luo, Yunbo; Huang, Kunlun

    2012-06-01

    A-T linker adapter polymerase chain reaction (PCR) was modified and employed for the isolation of genomic fragments adjacent to a known DNA sequence. The improvements in the method focus on two points. The first is the modification of the PO(4) and NH(2) groups in the adapter to inhibit the self-ligation of the adapter or the generation of nonspecific products. The second improvement is the use of the capacity of rTaq DNA polymerase to add an adenosine overhang at the 3' ends of digested DNA to suppress self-ligation in the digested DNA and simultaneously resolve restriction site clone bias. The combination of modifications in the adapter and in the digested DNA leads to T/A-specific ligation, which enhances the flexibility of this method and makes it feasible to use many different restriction enzymes with a single adapter. This novel A-T linker adapter PCR overcomes the inherent limitations of the original ligation-mediated PCR method such as low specificity and a lack of restriction enzyme choice. Moreover, this method also offers higher amplification efficiency, greater flexibility, and easier manipulation compared with other PCR methods for chromosome walking. Experimental results from 143 Arabidopsis mutants illustrate that this method is reliable and efficient in high-throughput experiments. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Mutation of Gly717Phe in human topoisomerase 1B has an effect on enzymatic function, reactivity to the camptothecin anticancer drug and on the linker domain orientation.

    Science.gov (United States)

    Wang, Zhenxing; D'Annessa, Ilda; Tesauro, Cinzia; Croce, Stefano; Ottaviani, Alessio; Fiorani, Paola; Desideri, Alessandro

    2015-08-01

    Human topoisomerase 1B controls the topological state of supercoiled DNA allowing the progression of fundamental cellular processes. The enzyme, which is the unique molecular target of the natural anticancer compound camptothecin, acts by cleaving one DNA strand and forming a transient protein-DNA covalent adduct. In this work the role of the Gly717 residue, located in a α-helix structure bridging the active site and the linker domain, has been investigated mutating it in Phe. The mutation gives rise to drug resistance in vivo as observed through a viability assay of yeast cells. In vitro activity assays show that the mutant is characterized by a fast religation rate, only partially reduced by the presence of the drug. Comparative molecular dynamics simulations of the native and mutant proteins indicate that the mutation of Gly717 affects the motion orientation of the linker domain, changing its interaction with the DNA substrate, likely affecting the strand rotation and religation rate. The mutation also causes a slight rearrangement of the active site and of the drug binding site, providing an additional explanation for the lowered effect of camptothecin toward the mutant. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Influencing Antibody-Mediated Attenuation of Methamphetamine CNS Distribution through Vaccine Linker Design.

    Science.gov (United States)

    Gooyit, Major; Miranda, Pedro O; Wenthur, Cody J; Ducime, Alex; Janda, Kim D

    2017-03-15

    Active vaccination examining a single hapten engendered with a series of peptidic linkers has resulted in the production of antimethamphetamine antibodies. Given the limited chemical complexity of methamphetamine, the structure of the linker species embedded within the hapten could have a substantial effect on the ultimate efficacy of the resulting vaccines. Herein, we investigate linker effects by generating a series of methamphetamine haptens that harbor a linker with varying amino acid identity, peptide length, and associated carrier protein. Independent changes in each of these parameters were found to result in alterations in both the quantity and quality of the antibodies induced by vaccination. Although it was found that the consequence of the linker design was also dependent on the identity of the carrier protein, we demonstrate overall that the inclusion of a short, structurally simple, amino acid linker benefits the efficacy of a methamphetamine vaccine in limiting brain penetration of the free drug.

  17. Open and closed: the roles of linker histones in plants and animals.

    Science.gov (United States)

    Over, Ryan S; Michaels, Scott D

    2014-03-01

    Histones package DNA in all eukaryotes and play key roles in regulating gene expression. Approximately 150 base pairs of DNA wraps around an octamer of core histones to form the nucleosome, the basic unit of chromatin. Linker histones compact chromatin further by binding to and neutralizing the charge of the DNA between nucleosomes. It is well established that chromatin packing is regulated by a complex pattern of posttranslational modifications (PTMs) to core histones, but linker histone function is less well understood. In this review, we describe the current understanding of the many roles that linker histones play in cellular processes, including gene regulation, cell division, and development, while putting the linker histone in the context of other nuclear proteins. Although intriguing roles for plant linker histones are beginning to emerge, much of our current understanding comes from work in animal systems. Many unanswered questions remain and additional work is required to fully elucidate the complex processes mediated by linker histones in plants.

  18. Investigation of the Linker Swing Motion in the Zeolitic Imidazolate Framework ZIF-90

    KAUST Repository

    Zheng, Bin

    2018-03-13

    The linker swing motion in the zeolitic imidazolate framework ZIF-90 is investigated by density functional theory (DFT) calculation, molecular dynamics (MD) and grand-canonical Monte Carlo (GCMC) simulations. The relation between the terminal aldehyde group rotation and the linker swing motion is revealed. The extremely high activation energy of the linker swing motion in ZIF-90 can be attributed to the asymmetric geometry and electron distribution of aldehyde groups. The change in the gate structure resulting from the linker rotation is used to understand the guest adsorption in ZIF-90. This study shows that it is possible to tune the linker swing motion and then the properties of ZIF-90 by manipulating the terminal group rotation. The results highlight the importance of considering the internal freedom effects to correctly describe the linker swing motion and the flexibility of metal-organic frameworks (MOFs).

  19. P-Link: A method for generating multicomponent cytochrome P450 fusions with variable linker length

    DEFF Research Database (Denmark)

    Belsare, Ketaki D.; Ruff, Anna Joelle; Martinez, Ronny

    2014-01-01

    Fusion protein construction is a widely employed biochemical technique, especially when it comes to multi-component enzymes such as cytochrome P450s. Here we describe a novel method for generating fusion proteins with variable linker lengths, protein fusion with variable linker insertion (P-LinK)...... but also requires only a single cloning and transformation step in order to generate multiple linker variants (1 to 16 amino acids long), making the approach technically simple and robust....

  20. Identification of a minimal functional linker in human topoisomerase I by domain swapping with Cre recombinase

    DEFF Research Database (Denmark)

    Hougaard, Rikke Frøhlich; Juul, Sissel; Vinther, Maria

    2008-01-01

    . In this study we replace 86 amino acids including the linker domain of the cellular type IB topoisomerase, human topoisomerase I, with four, six, or eight amino acids from the corresponding short loop region in Cre recombinase. In vitro characterization of the resulting chimeras, denoted Cropos, reveals...... that six amino acids from the Cre linker loop constitute the minimal length of a functional linker in human topoisomerase I....

  1. AAS 227: Day 3

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 3 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Henry Norris Russell Lecture: Viewing the Universe with Infrared Eyes: The Spitzer Space Telescope (by Erika Nesvold)The Henry Norris Russell Award is the highest honor given by the AAS, for a lifetime of eminence in astronomy research. This years award went to Giovanni Fazio of the Harvard-Smithsonian Center for Astrophysics. Fazio became a leader in gamma ray astronomy before switching mid-career to the study of infrared astronomy, and he gave his award lecture on the latter subject, specifically on the Spitzer Space Telescope, one of the most successful infrared telescopes of all time.Artists rendering of the Spitzer space telescope. [NASA/JPL-Caltech]Spitzer has been operating for more than twelve years, and has resulted in over six thousand papers in refereed journals in that time. The telescope sits in an Earth-trailing orbit around the Sun, and is now farther from the Earth (1.4 AU) than the Earth is from the Sun. Fazio gave the audience a fascinating overview of the science done by Spitzer over more than a decade. One of the most productive areas of research for Spitzer is the study of exoplanets, which hadnt even been discovered when the Spitzer Telescope was first conceived. Spitzers high sensitivity and ability to observe exoplanets over

  2. Tunable CO 2 Adsorbents by Mixed-Linker Synthesis and Postsynthetic Modification of Zeolitic Imidazolate Frameworks

    KAUST Repository

    Thompson, Joshua A.

    2013-04-25

    The incorporation of accessible amine functionality in zeolitic imidazolate frameworks (ZIFs) is used to improve the adsorption selectivity for CO 2/CH4 gas separation applications. Two synthetic approaches are described in this work to introduce functionality into the ZIF: (i) mixed-linker ZIF synthesis with 2-aminobenzimidazole as a substitution linker and (ii) postsynthetic modification of a mixed-linker ZIF with ethylenediamine. Using 2-aminobenzimidazole, a linker with a primary amine functional group, substitution of the ZIF-8 linker during synthesis allows for control over the adsorption properties while maintaining the ZIF-8 structure with up to nearly 50% substitution in the mixed-linker ZIF framework, producing a material with tunable pore size and amine functionality. Alternatively, postsynthetic modification of a mixed-linker ZIF containing an aldehyde functional group produces a ZIF material with a primary amine without detrimental loss of micropore volume by controlling the amount of functional group sites for modification. Both approaches using mixed-linker ZIFs yield new materials that show improvement in adsorption selectivity for the CO 2/CH4 gas pair over ZIF-8 and commercially available adsorbents as well as an increase in the heat of adsorption for CO2 without significant changes to the crystal structure. These results indicate that tuning the surface properties of ZIFs by either mixed-linker synthesis and/or postsynthetic modification may generate new materials with improved gas separation properties, thereby providing a new method for tailoring metal-organic frameworks. © 2013 American Chemical Society.

  3. Discovery of Peptidomimetic Antibody-Drug Conjugate Linkers with Enhanced Protease Specificity.

    Science.gov (United States)

    Wei, BinQing; Gunzner-Toste, Janet; Yao, Hui; Wang, Tao; Wang, Jing; Xu, Zijin; Chen, Jinhua; Wai, John; Nonomiya, Jim; Tsai, Siao Ping; Chuh, Josefa; Kozak, Katherine R; Liu, Yichin; Yu, Shang-Fan; Lau, Jeff; Li, Guangmin; Phillips, Gail D; Leipold, Doug; Kamath, Amrita; Su, Dian; Xu, Keyang; Eigenbrot, Charles; Steinbacher, Stefan; Ohri, Rachana; Raab, Helga; Staben, Leanna R; Zhao, Guiling; Flygare, John A; Pillow, Thomas H; Verma, Vishal; Masterson, Luke A; Howard, Philip W; Safina, Brian

    2018-02-08

    Antibody-drug conjugates (ADCs) have become an important therapeutic modality for oncology, with three approved by the FDA and over 60 others in clinical trials. Despite the progress, improvements in ADC therapeutic index are desired. Peptide-based ADC linkers that are cleaved by lysosomal proteases have shown sufficient stability in serum and effective payload-release in targeted cells. If the linker can be preferentially hydrolyzed by tumor-specific proteases, safety margin may improve. However, the use of peptide-based linkers limits our ability to modulate protease specificity. Here we report the structure-guided discovery of novel, nonpeptidic ADC linkers. We show that a cyclobutane-1,1-dicarboxamide-containing linker is hydrolyzed predominantly by cathepsin B while the valine-citrulline dipeptide linker is not. ADCs bearing the nonpeptidic linker are as efficacious and stable in vivo as those with the dipeptide linker. Our results strongly support the application of the peptidomimetic linker and present new opportunities for improving the selectivity of ADCs.

  4. AAS 228: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors fromastrobites.com, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  5. X-ray crystallographic analysis and DFT calculations of three 'propylene linker' dimers linked by one polystep reaction

    Science.gov (United States)

    Shi, Yan; Tan, Xue-Jie; Xing, Dian-Xiang; Sui, Qi-Cheng; Liu, Bin; Feng, Wen-Quan; Liu, Yun

    2017-06-01

    In this manuscript, we report the synthesis, NMR and single-crystal structures of three propylene linking dimers related with the hydrolytic degradation of one 5,6-dehydronorcantharimide dimer. Special attention was paid to the conformation of propylene linkers in order to understand their changes in the reaction. Statistical analysis of CSD database revealed that a-a, g-a and g-g conformations may have similar stability in most cases and various complicated unpredictable non-covalent interactions may play important role in the formation of final rotamers. In order to reproduce all stable conformations and the energy barriers separating them, full range two-dimensional fully relaxed potential-energy surfaces (PES) scans of six 'propylene linker' dimers were calculated starting from the most stable crystal structures. The PES were scanned along both bridge Csbnd C single bond torsional angles (denoted as θ1 and θ2), while all other internal coordinates were optimized at the DFT/B3LYP/3-21G* level in gas phase. Then all energy minima were re-optimized again at the DFT/B3LYP/6-311 + G(d,p) level both in gas and ethanol solutions in order to evaluate the really stable rotamers. At last, 1D or 2D relaxed PES scans were performed between local stable rotamers to get reliable energy barriers. This method represents a less time-consuming and more reliable approach to the determination of conformational stability of propanediyl bridging chains. The combination of experimental, statistical and theoretical results shows that the observed conformation is jointly determined by the energy levels of the minima, energy barriers separating them, non-covalent interactions and somewhat randomness.

  6. Mutations at opposite ends of the DIII/S4-S5 linker of sodium channel NaV1.7 produce distinct pain disorders

    Directory of Open Access Journals (Sweden)

    Tyrrell Lynda

    2010-04-01

    Full Text Available Abstract Background Two groups of gain-of-function mutations in sodium channel NaV1.7, which are expressed in dorsal root ganglion (DRG neurons, produce two clinically-distinct pain syndromes - inherited erythromelalgia (IEM and paroxysmal extreme pain disorder (PEPD. IEM is characterized by intermittent burning pain and skin redness in the feet or hands, triggered by warmth or mild exercise, while PEPD is characterized by episodes of rectal, ocular and mandibular pain accompanied with skin flushing, triggered by bowel movement and perianal stimulation. Most of the IEM mutations are located within channel domains I and II, while most of the PEPD mutations are located within domains III and IV. The structural dichotomy parallels the biophysical effects of the two types of mutations, with IEM mutations shifting voltage-dependence of NaV1.7 activation in a hyperpolarized direction, and PEPD mutations shifting fast-inactivation of NaV1.7 in a depolarized direction. While four IEM and four PEPD mutations are located within cytoplasmic linkers joining segments 4 and 5 (S4-S5 linkers in the different domains (IEM: domains I and II; PEPD: domains III and IV, no S4-S5 linker has been reported to house both IEM and PEPD mutations thus far. Results We have identified a new IEM mutation P1308L within the C-terminus of the DIII/S4-S5 linker of NaV1.7, ten amino acids from a known PEPD mutation V1298F which is located within the N-terminus of this linker. We used voltage-clamp to compare the biophysical properties of the two mutant channels and current-clamp to study their effects on DRG neuron excitability. We confirm that P1308L and V1298F behave as prototypical IEM and PEPD mutations, respectively. We also show that DRG neurons expressing either P1308L or V1298F become hyperexcitable, compared to DRG neurons expressing wild-type channels. Conclusions Our results provide evidence for differential roles of the DIII/S4-S5 linker N- and C-termini in channel

  7. The Drentsche Aa valley system

    International Nuclear Information System (INIS)

    Gans, W. de.

    1981-01-01

    This thesis is composed of five papers concerned with Late Quaternary geology and geomorphology of the Aa valley system. The correlation and chronostratigraphic position of the layers have been established by radiocarbon dating. (Auth.)

  8. Linkers, resins, and general procedures for solid-phase peptide synthesis

    DEFF Research Database (Denmark)

    Shelton, Anne Pernille Tofteng; Jensen, Knud Jørgen

    2013-01-01

    and linkers for solid-phase synthesis is a key parameter for successful peptide synthesis. This chapter provides an overview of the most common and useful resins and linkers for the synthesis of peptides with C-terminal amides, carboxylic acids, and more. The chapter finishes with robust protocols for general...

  9. Hemidesmosomal linker proteins regulate cell motility, invasion and tumorigenicity in oral squamous cell carcinoma derived cells.

    Science.gov (United States)

    Chaudhari, Pratik Rajeev; Charles, Silvania Emlit; D'Souza, Zinia Charlotte; Vaidya, Milind Murlidhar

    2017-11-15

    BPAG1e and Plectin are hemidesmosomal linker proteins which anchor intermediate filament proteins to the cell surface through β4 integrin. Recent reports indicate that these proteins play a role in various cellular processes apart from their known anchoring function. However, the available literature is inconsistent. Further, the previous study from our laboratory suggested that Keratin8/18 pair promotes cell motility and tumor progression by deregulating β4 integrin signaling in oral squamous cell carcinoma (OSCC) derived cells. Based on these findings, we hypothesized that linker proteins may have a role in neoplastic progression of OSCC. Downregulation of hemidesmosomal linker proteins in OSCC derived cells resulted in reduced cell migration accompanied by alterations in actin organization. Further, decreased MMP9 activity led to reduced cell invasion in linker proteins knockdown cells. Moreover, loss of these proteins resulted in reduced tumorigenic potential. SWATH analysis demonstrated upregulation of N-Myc downstream regulated gene 1 (NDRG1) in linker proteins downregulated cells as compared to vector control cells. Further, the defects in phenotype upon linker proteins ablation were rescued upon loss of NDRG1 in linker proteins knockdown background. These data together indicate that hemidesmosomal linker proteins regulate cell motility, invasion and tumorigenicity possibly through NDRG1 in OSCC derived cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. frameworks bearing1,3-bis(4-pyridyl)propane and inorganic linkers

    Indian Academy of Sciences (India)

    aState Key Laboratory for the Chemistry and Molecular Engineering of Medicinal Resources,. School of Chemistry and Pharmaceutical ... ever, the uses of inorganic linkers or a combination of organic and inorganic linkers to ... necessary to carry out a systematic investigation on this kind of MOF materials. Based on the ...

  11. Mixed-linker strategy for the construction of multifunctional metal–organic frameworks

    Energy Technology Data Exchange (ETDEWEB)

    Qin, Jun-Sheng [Department of Chemistry; Texas A& M University; College Station; USA; Yuan, Shuai [Department of Chemistry; Texas A& M University; College Station; USA; Wang, Qi [Department of Chemistry; Texas A& M University; College Station; USA; Alsalme, Ali [Chemistry Department; College of Science; King Saud University; Riyadh 11451; Saudi Arabia; Zhou, Hong-Cai [Chemistry Department; College of Science; King Saud University; Riyadh 11451; Saudi Arabia

    2017-01-01

    Mixed-linker strategy is a promising way to construct multifunctional metal–organic frameworks (MOFs). In this review, we demonstrate the recent developments, discussions and challenges related to the preparation and applications of four types of mixed-linker MOF materials.

  12. AAS 227: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from http://web.physics.ucsb.edu/ ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  13. Construction of hierarchically porous metal-organic frameworks through linker labilization

    Science.gov (United States)

    Yuan, Shuai; Zou, Lanfang; Qin, Jun-Sheng; Li, Jialuo; Huang, Lan; Feng, Liang; Wang, Xuan; Bosch, Mathieu; Alsalme, Ali; Cagin, Tahir; Zhou, Hong-Cai

    2017-05-01

    A major goal of metal-organic framework (MOF) research is the expansion of pore size and volume. Although many approaches have been attempted to increase the pore size of MOF materials, it is still a challenge to construct MOFs with precisely customized pore apertures for specific applications. Herein, we present a new method, namely linker labilization, to increase the MOF porosity and pore size, giving rise to hierarchical-pore architectures. Microporous MOFs with robust metal nodes and pro-labile linkers were initially synthesized. The mesopores were subsequently created as crystal defects through the splitting of a pro-labile-linker and the removal of the linker fragments by acid treatment. We demonstrate that linker labilization method can create controllable hierarchical porous structures in stable MOFs, which facilitates the diffusion and adsorption process of guest molecules to improve the performances of MOFs in adsorption and catalysis.

  14. An alanine residue in the M3-M4 linker lines the glycine binding pocket of the N-methyl-D-aspartate receptor.

    Science.gov (United States)

    Wood, M W; VanDongen, H M; VanDongen, A M

    1997-02-07

    While attempting to map a central region in the M3-M4 linker of the N-methyl-D-aspartate receptor NR1 subunit, we found that mutation of a single position, Ala-714, greatly reduced the apparent affinity for glycine. Proximal N-glycosylation localized this region to the extracellular space. Glycine affinities of additional Ala-714 mutations correlated with side chain volume. Substitution of alanine 714 with cysteine did not alter glycine sensitivity, although this mutant was rapidly inhibited by dithionitrobenzoate. Glycine protected the A714C mutant from modification by dithionitrobenzoate, whereas the co-agonist L-glutamate was ineffective. These experiments place Ala-714 in the glycine binding pocket of the N-methyl-D-aspartate receptor, a determination not predicted by previous structural models based on bacterial periplasmic binding protein homology.

  15. Promising rice mutants

    International Nuclear Information System (INIS)

    Hakim, L.; Azam, M.A.; Miah, A.J.; Mansur, M.A.; Akanda, H.R.

    1988-01-01

    Two induced mutants namely, Mut NS 1 (tall) and Mut NS 5 (semi-dwarf) derived from rice variety Nizersail were evaluated for various agronomic characters at four locations in Bangladesh. Both the mutants matured about three weeks earlier and yielded significantly higher than the parent variety Nizersail. (author). 3 tabs., 9 refs

  16. Mutant heterosis in rice

    International Nuclear Information System (INIS)

    1987-01-01

    In the variety TKM6 a high yielding semidwarf mutant has been induced. This TKM6 mutant was used in test crosses with a number of other varieties and mutants to examine the extent of heterosis of dwarfs in rice and to select superior crosses. An excerpt of the published data is given. It appears from the backcross of the mutant with its original variety, that an increase in number of productive tillers occurs in the hybrid, leading to a striking grain yield increase, while the semi-dwarf culm length (the main mutant character) reverts to the normal phenotype. In the cross with IR8 on the other hand, there is only a minimal increase in tiller number but a substantial increase in TGW leading to more than 30% yield increase over the better parent

  17. Influences of Various Peptide Linkers on the Thermotoga maritima MSB8 Nitrilase Displayed on the Spore Surface of Bacillus subtilis.

    Science.gov (United States)

    Chen, Huayou; Chen, Zhi; Wu, Bangguo; Ullah, Jawad; Zhang, Tianxi; Jia, Jinru; Wang, Hongcheng; Tan, Tianwei

    2017-01-01

    In the present study, fusion genes composed of Thermotoga maritima MSB8 nitrilase and Bacillus subtilis 168 outer coat protein CotG were constructed with various peptide linkers and displayed on B. subtilis DB 403 spores. The successful display of CotG-nit fusion proteins on the spore surface of B. subtilis was verified by Western blot analysis and activity measurement. It was demonstrated that the fusion with linker GGGGSEAAAKGGGGS presented the highest thermal and pH stability, which is 2.67- and 1.9-fold of the fusion without linker. In addition, fusion with flexible linker (GGGGS)3 demonstrated better thermal and pH stability than fusions with linkers GGGGS and (GGGGS)2. Fusion with rigid linker (EAAAK) demonstrated better thermal stability than fusions with linkers (EAAAK)2 and (EAAAK)3. Fusions with linker (EAAAK)2 demonstrated better pH stability than fusions with linkers (EAAAK) and (EAAAK)3. In the presence of 1 mM dithiothreitol, 1% (v/v) sodium dodecyl sulfate, and 20% (v/v) ethanol, the optimal linkers of the fusions were MGSSSN, GGGGSEAAAKGGGGS, and (GGGGS)3, respectively. In summary, our results showed that optimizing the peptide linkers with different type, length, and amino acid composition of the fusion proteins would be an efficient way to maintain the stability of fusion proteins and thus improve the nitrilase display efficiency, which could provide an effective method for rational design peptide linkers of displayed nitrilase on B. subtilis. © 2017 S. Karger AG, Basel.

  18. Effect of the linkers between the zinc fingers in zinc finger protein 809 on gene silencing and nuclear localization

    Energy Technology Data Exchange (ETDEWEB)

    Ichida, Yu, E-mail: ichida-y@ncchd.go.jp; Utsunomiya, Yuko; Onodera, Masafumi

    2016-03-18

    Zinc finger protein 809 (ZFP809) belongs to the Kruppel-associated box-containing zinc finger protein (KRAB-ZFP) family and functions in repressing the expression of Moloney murine leukemia virus (MoMLV). ZFP809 binds to the primer-binding site (PBS)located downstream of the MoMLV-long terminal repeat (LTR) and induces epigenetic modifications at integration sites, such as repressive histone modifications and de novo DNA methylation. KRAB-ZFPs contain consensus TGEKP linkers between C2H2 zinc fingers. The phosphorylation of threonine residues within linkers leads to the inactivation of zinc finger binding to target sequences. ZFP809 also contains consensus linkers between zinc fingers. However, the function of ZFP809 linkers remains unknown. In the present study, we constructed ZFP809 proteins containing mutated linkers and examined their ability to silence transgene expression driven by MLV, binding ability to MLV PBS, and cellular localization. The results of the present study revealed that the linkers affected the ability of ZFP809 to silence transgene expression. Furthermore, this effect could be partly attributed to changes in the localization of ZFP809 proteins containing mutated linkers. Further characterization of ZFP809 linkers is required for understanding the functions and features of KRAB-ZFP-containing linkers. - Highlights: • ZFP809 has three consensus linkers between the zinc fingers. • Linkers are required for ZFP809 to silence transgene expression driven by MLV-LTR. • Linkers affect the precise nuclear localization of ZFP809.

  19. Chemical shift assignments for the apo-form of the catalytic domain, the linker region, and the carbohydrate-binding domain of the cellulose-active lytic polysaccharide monooxygenase ScLPMO10C.

    Science.gov (United States)

    Courtade, Gaston; Forsberg, Zarah; Vaaje-Kolstad, Gustav; Eijsink, Vincent G H; Aachmann, Finn L

    2017-10-01

    The apo-form of the 21.4 kDa catalytic domain and the 10.7 kDa carbohydrate binding domain of the AA10 family lytic polysaccharide monooxygenase ScLPMO10C from Streptomyces coelicolor have been isotopically labeled and recombinantly expressed in Escherichia coli. In this paper, we report the 1 H, 13 C, and 15 N chemical shift assignments of each individual domain as well as an ensemble of the assignment for the full-length protein, including its approximately 30-amino acid long linker.

  20. Linker histone partial phosphorylation: effects on secondary structure and chromatin condensation

    Science.gov (United States)

    Lopez, Rita; Sarg, Bettina; Lindner, Herbert; Bartolomé, Salvador; Ponte, Inma; Suau, Pedro; Roque, Alicia

    2015-01-01

    Linker histones are involved in chromatin higher-order structure and gene regulation. We have successfully achieved partial phosphorylation of linker histones in chicken erythrocyte soluble chromatin with CDK2, as indicated by HPCE, MALDI-TOF and Tandem MS. We have studied the effects of linker histone partial phosphorylation on secondary structure and chromatin condensation. Infrared spectroscopy analysis showed a gradual increase of β-structure in the phosphorylated samples, concomitant to a decrease in α-helix/turns, with increasing linker histone phosphorylation. This conformational change could act as the first step in the phosphorylation-induced effects on chromatin condensation. A decrease of the sedimentation rate through sucrose gradients of the phosphorylated samples was observed, indicating a global relaxation of the 30-nm fiber following linker histone phosphorylation. Analysis of specific genes, combining nuclease digestion and qPCR, showed that phosphorylated samples were more accessible than unphosphorylated samples, suggesting local chromatin relaxation. Chromatin aggregation was induced by MgCl2 and analyzed by dynamic light scattering (DLS). Phosphorylated chromatin had lower percentages in volume of aggregated molecules and the aggregates had smaller hydrodynamic diameter than unphosphorylated chromatin, indicating that linker histone phosphorylation impaired chromatin aggregation. These findings provide new insights into the effects of linker histone phosphorylation in chromatin condensation. PMID:25870416

  1. Protein inter-domain linker prediction using Random Forest and amino acid physiochemical properties

    Science.gov (United States)

    2014-01-01

    Background Protein chains are generally long and consist of multiple domains. Domains are distinct structural units of a protein that can evolve and function independently. The accurate prediction of protein domain linkers and boundaries is often regarded as the initial step of protein tertiary structure and function predictions. Such information not only enhances protein-targeted drug development but also reduces the experimental cost of protein analysis by allowing researchers to work on a set of smaller and independent units. In this study, we propose a novel and accurate domain-linker prediction approach based on protein primary structure information only. We utilize a nature-inspired machine-learning model called Random Forest along with a novel domain-linker profile that contains physiochemical and domain-linker information of amino acid sequences. Results The proposed approach was tested on two well-known benchmark protein datasets and achieved 68% sensitivity and 99% precision, which is better than any existing protein domain-linker predictor. Without applying any data balancing technique such as class weighting and data re-sampling, the proposed approach is able to accurately classify inter-domain linkers from highly imbalanced datasets. Conclusion Our experimental results prove that the proposed approach is useful for domain-linker identification in highly imbalanced single- and multi-domain proteins. PMID:25521329

  2. Creating Hierarchical Pores by Controlled Linker Thermolysis in Multivariate Metal-Organic Frameworks

    KAUST Repository

    Feng, Liang

    2018-01-18

    Sufficient pore size, appropriate stability and hierarchical porosity are three prerequisites for open frameworks designed for drug delivery, enzyme immobilization and catalysis involving large molecules. Herein, we report a powerful and general strate-gy, linker thermolysis, to construct ultra-stable hierarchically porous metal−organic frameworks (HP-MOFs) with tunable pore size distribution. Linker instability, usually an undesirable trait of MOFs, was exploited to create mesopores by generating crystal defects throughout a microporous MOF crystal via thermolysis. The crystallinity and stability of HP-MOFs remain after thermolabile linkers are selectively removed from multivariate metal-organic frameworks (MTV-MOFs) through a decarboxyla-tion process. A domain-based linker spatial distribution was found to be critical for creating hierarchical pores inside MTV-MOFs. Furthermore, linker thermolysis promotes the formation of ultra-small metal oxide (MO) nanoparticles immobilized in an open framework that exhibits high catalytic activity for Lewis acid catalyzed reactions. Most importantly, this work pro-vides fresh insights into the connection between linker apportionment and vacancy distribution, which may shed light on prob-ing the disordered linker apportionment in multivariate systems, a long-standing challenge in the study of MTV-MOFs.

  3. Lecithin-Linker Microemulsion Gelatin Gels for Extended Drug Delivery

    Directory of Open Access Journals (Sweden)

    Yu-Ling Cheng

    2012-01-01

    Full Text Available This article introduces the formulation of alcohol-free, lecithin microemulsion-based gels (MBGs prepared with gelatin as gelling agent. The influence of oil, water, lecithin and hydrophilic and lipophilic additives (linkers on the rheological properties and appearance of these gels was systematically explored using ternary phase diagrams. Clear MBGs were obtained in regions of single phase microemulsions (μEs at room temperature. Increasing the water content in the formulation increased the elastic modulus of the gels, while increasing the oil content had the opposite effect. The hydrophilic additive (PEG-6-caprylic/capric glycerides was shown to reduce the elastic modulus of gelatin gels, particularly at high temperatures. In contrast to anionic (AOT μEs, the results suggest that in lecithin (nonionic μEs, the introduction of gelatin “dehydrates” the μE. Finally, when the transdermal transport of lidocaine formulated in the parent μE and the resulting MBG were compared, only a minor retardation in the loading and release of lidocaine was observed.

  4. Library of biphenyl privileged substructures using a safety-catch linker approach

    DEFF Research Database (Denmark)

    Severinsen, Rune; Bourne, Gregory T; Tran, Tran T

    2008-01-01

    A biphenyl privileged structure library containing three attachment points were synthesized using a catechol-based safety-catch linker strategy. The method requires the attachment of a bromo-acid to the linker, followed by a Pd-catalyzed Suzuki cross-coupling reaction. Further derivatization......, activation of the linker with strong acid and aminolysis afforded the respective products in high purity and good overall yield. To show the versatility of the synthesis, a 199-member library was generated. The library samples both conformational and chemical diversity about a well-known privileged...

  5. A Traceless Aryl-Triazene Linker for DNA-Directed Chemistry

    DEFF Research Database (Denmark)

    Hejesen, Christian; Pedersen, Lars Kolster; Gothelf, Kurt Vesterager

    2013-01-01

    DNA-directed synthesis of encoded combinatorial libraries of small organic compounds most often involves transfer of organic building blocks from one DNA strand to another. This requires cleavable linkers to enable cleavage of the link to the original DNA strand from which the building block...... is transferred. Relatively few cleavable linkers are available for DNA-directed synthesis and most often they leave an amino group at the organic molecule. Here we have extended the application of 10 aryltriazenes as traceless linkers for DNA-directed synthesis. After reaction of one building block...

  6. Replacement of the human topoisomerase linker domain with the plasmodial counterpart renders the enzyme camptothecin resistant

    DEFF Research Database (Denmark)

    Arnò, Barbara; D'Annessa, Ilda; Tesauro, Cinzia

    2013-01-01

    , but it is characterized by a much faster religation rate. The hybrid enzyme is also camptothecin resistant. A 3D structure of the hybrid enzyme has been built and its structural-dynamical properties have been analyzed by molecular dynamics simulation. The analysis indicates that the swapped plasmodial linker samples...... a conformational space much larger than the corresponding domain in the human enzyme. The large linker conformational variability is then linked to important functional properties such as an increased religation rate and a low drug reactivity, demonstrating that the linker domain has a crucial role...

  7. First principle investigation of the linker length effects on the thermodynamics of divalent pseudorotaxanes.

    Science.gov (United States)

    Achazi, Andreas J; Mollenhauer, Doreen; Paulus, Beate

    2015-01-01

    The Gibbs energies of association (Gibbs free (binding) energies) for divalent crown-8/ammonium pseudorotaxanes are determined by investigating the influence of different linkers onto the binding. Calculations are performed with density functional theory including dispersion corrections. The translational, rotational and vibrational contributions are taken into account and solvation effects including counter ions are investigated by applying the COSMO-RS method, which is based on a continuum solvation model. The calculated energies agree well with the experimentally determined ones. The shortest investigated linker shows an enhanced binding strength due to electronic effects, namely the dispersion interaction between the linkers from the guest and the host. For the longer linkers this ideal packing is not possible due to steric hindrance.

  8. LRRC45 Is a Centrosome Linker Component Required for Centrosome Cohesion

    Directory of Open Access Journals (Sweden)

    Runsheng He

    2013-09-01

    Full Text Available During interphase, centrosomes are connected by a proteinaceous linker between the proximal ends of the centrioles, which is important for the centrosomes to function as a single microtubule-organizing center. However, the composition and regulation of centrosomal linker remain largely unknown. Here, we show that LRRC45 is a centrosome linker that localizes at the proximal ends of the centrioles and forms fiber-like structures between them. Depletion of LRRC45 results in centrosome splitting during interphase. Moreover, LRRC45 interacts with both C-Nap1 and rootletin and is phosphorylated by Nek2A at S661 during mitosis. After phosphorylation, both LRRC45 centrosomal localization and fiber-like structures are significantly reduced, which subsequently leads to centrosome separation. Thus, LRRC45 is a critical component of the proteinaceous linker between two centrioles and is required for centrosome cohesion.

  9. Replacement of the human topoisomerase linker domain with the plasmodial counterpart renders the enzyme camptothecin resistant.

    Directory of Open Access Journals (Sweden)

    Barbara Arnò

    Full Text Available A human/plasmodial hybrid enzyme, generated by swapping the human topoisomerase IB linker domain with the corresponding domain of the Plasmodium falciparum enzyme, has been produced and characterized. The hybrid enzyme displays a relaxation activity comparable to the human enzyme, but it is characterized by a much faster religation rate. The hybrid enzyme is also camptothecin resistant. A 3D structure of the hybrid enzyme has been built and its structural-dynamical properties have been analyzed by molecular dynamics simulation. The analysis indicates that the swapped plasmodial linker samples a conformational space much larger than the corresponding domain in the human enzyme. The large linker conformational variability is then linked to important functional properties such as an increased religation rate and a low drug reactivity, demonstrating that the linker domain has a crucial role in the modulation of the topoisomerase IB activity.

  10. Replacement of the human topoisomerase linker domain with the plasmodial counterpart renders the enzyme camptothecin resistant.

    Science.gov (United States)

    Arnò, Barbara; D'Annessa, Ilda; Tesauro, Cinzia; Zuccaro, Laura; Ottaviani, Alessio; Knudsen, Birgitta; Fiorani, Paola; Desideri, Alessandro

    2013-01-01

    A human/plasmodial hybrid enzyme, generated by swapping the human topoisomerase IB linker domain with the corresponding domain of the Plasmodium falciparum enzyme, has been produced and characterized. The hybrid enzyme displays a relaxation activity comparable to the human enzyme, but it is characterized by a much faster religation rate. The hybrid enzyme is also camptothecin resistant. A 3D structure of the hybrid enzyme has been built and its structural-dynamical properties have been analyzed by molecular dynamics simulation. The analysis indicates that the swapped plasmodial linker samples a conformational space much larger than the corresponding domain in the human enzyme. The large linker conformational variability is then linked to important functional properties such as an increased religation rate and a low drug reactivity, demonstrating that the linker domain has a crucial role in the modulation of the topoisomerase IB activity.

  11. Sequential Linker Installation: Precise Placement of Functional Groups in Multivariate Metal-Organic Frameworks

    Energy Technology Data Exchange (ETDEWEB)

    Yuan, S; Lu, WG; Chen, YP; Zhang, Q; Liu, TF; Feng, DW; Wang, X; Qin, JS; Zhou, HC

    2015-03-11

    A unique strategy, sequential linker installation (SLI), has been developed to construct multivariate MOFs with functional groups precisely positioned. PCN-700, a Zr-MOF with eight-connected Zr6O4(OH)(8)(H2O)(4) clusters, has been judiciously designed; the Zr-6 clusters in this MOF are arranged in such a fashion that, by replacement of terminal OH-/H2O ligands, subsequent insertion of linear dicarboxylate linkers is achieved. We demonstrate that linkers with distinct lengths and functionalities can be sequentially installed into PCN-700. Single-crystal to single-crystal transformation is realized so that the positions of the subsequently installed linkers are pinpointed via single-crystal X-ray diffraction analyses. This methodology provides a powerful tool to construct multivariate MOFs with precisely positioned functionalities in the desired proximity, which would otherwise be difficult to achieve.

  12. High-Flux Zeolitic Imidazolate Framework Membranes for Propylene/Propane Separation by Postsynthetic Linker Exchange.

    Science.gov (United States)

    Lee, Moon Joo; Kwon, Hyuk Taek; Jeong, Hae-Kwon

    2018-01-02

    While zeolitic imidazolate framework, ZIF-8, membranes show impressive propylene/propane separation, their throughput needs to be greatly improved for practical applications. A method is described that drastically reduces the effective thickness of ZIF-8 membranes, thereby substantially improving their propylene permeance (that is, flux). The new strategy is based on a controlled single-crystal to single-crystal linker exchange of 2-methylimidazole in ZIF-8 membrane grains with 2-imidazolecarboxaldehyde (ZIF-90 linker), thereby enlarging the effective aperture size of ZIF-8. The linker-exchanged ZIF-8 membranes showed a drastic increase in propylene permeance by about four times, with a negligible loss in propylene/propane separation factor when compared to as-prepared membranes. The linker-exchange effect depends on the membrane synthesis method. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Structural analysis of the S4-S5 linker of the human KCNQ1 potassium channel.

    Science.gov (United States)

    Gayen, Shovanlal; Li, Qingxin; Kang, CongBao

    2015-01-02

    KCNQ1 plays important roles in the cardiac action potential and consists of an N-terminal domain, a voltage-sensor domain, a pore domain and a C-terminal domain. KCNQ1 is a voltage-gated potassium channel and its channel activity is regulated by membrane potentials. The linker between transmembrane helices 4 and 5 (S4-S5 linker) is important for transferring the conformational changes from the voltage-sensor domain to the pore domain. In this study, the structure of the S4-S5 linker of KCNQ1 was investigated by solution NMR, circular dichroism and fluorescence spectroscopic studies. The S4-S5 linker adopted a helical structure in detergent micelles. The W248 may interact with the cell membrane. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Tethering metal ions to photocatalyst particulate surfaces by bifunctional molecular linkers for efficient hydrogen evolution

    KAUST Repository

    Yu, Weili

    2014-08-19

    A simple and versatile method for the preparation of photocatalyst particulates modified with effective cocatalysts is presented; the method involves the sequential soaking of photocatalyst particulates in solutions containing bifunctional organic linkers and metal ions. The modification of the particulate surfaces is a universal and reproducible method because the molecular linkers utilize strong covalent bonds, which in turn result in modified monolayer with a small but controlled quantity of metals. The photocatalysis results indicated that the CdS with likely photochemically reduced Pd and Ni, which were initially immobilized via ethanedithiol (EDT) as a linker, were highly efficient for photocatalytic hydrogen evolution from Na2S-Na2SO3-containing aqueous solutions. The method developed in this study opens a new synthesis route for the preparation of effective photocatalysts with various combinations of bifunctional linkers, metals, and photocatalyst particulate materials. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Composite materials with metal oxide attached to lead chalcogenide nanocrystal quantum dots with linkers

    Science.gov (United States)

    Fuke, Nobuhiro; Koposov, Alexey Y; Sykora, Milan; Hoch, Laura

    2014-12-16

    Composite materials useful for devices such as photoelectrochemical solar cells include a substrate, a metal oxide film on the substrate, nanocrystalline quantum dots (NQDs) of lead sulfide, lead selenide, and lead telluride, and linkers that attach the NQDs to the metal oxide film. Suitable linkers preserve the 1s absorption peak of the NQDs. A suitable linker has a general structure A-B-C where A is a chemical group adapted for binding to a MO.sub.x and C is a chemical group adapted for binding to a NQD and B is a divalent, rigid, or semi-rigid organic spacer moiety. Other linkers that preserve the 1s absorption peak may also be used.

  16. Identification of novel post-translational modifications in linker histones from chicken erythrocytes.

    Science.gov (United States)

    Sarg, Bettina; Lopez, Rita; Lindner, Herbert; Ponte, Inma; Suau, Pedro; Roque, Alicia

    2015-01-15

    Chicken erythrocyte nuclei were digested with micrococcal nuclease and fractionated by centrifugation in low-salt buffer into soluble and insoluble fractions. Post-translational modifications of the purified linker histones of both fractions were analyzed by LC-ESI-MS/MS. All six histone H1 subtypes (H1.01, H1.02, H1.03, H1.10, H1.1L and H1.1R) and histone H5 were identified. Mass spectrometry analysis enabled the identification of a wide range of PTMs, including N(α)-terminal acetylation, acetylation, formylation, phosphorylation and oxidation. A total of nine new modifications in chicken linker histones were mapped, most of them located in the N-terminal and globular domains. Relative quantification of the modified peptides showed that linker histone PTMs were differentially distributed among both chromatin fractions, suggesting their relevance in the regulation of chromatin structure. The analysis of our results combined with previously reported data for chicken and some mammalian species showed that most of the modified positions were conserved throughout evolution, highlighting their importance in specific linker histone functions and epigenetics. Post-translational modifications of linker histones could have a role in the regulation of gene expression through the modulation of chromatin higher-order structure and chromatin remodeling. Finding new PTMs in linker histones is the first step to elucidate their role in the histone code. In this manuscript we report nine new post-translational modifications of the linker histones from chicken erythrocytes, one in H5 and eight in the H1 subtypes. Chromatin fractionated by centrifugation in low-salt buffer resulted in two fractions with different contents and compositions of linker histones and enriched in specific core histone PTMs. Of particular interest is the fact that linker histone PTMs were differentially distributed in both chromatin fractions, suggesting specific functions. Future studies are needed to

  17. Effective generation of transgenic pigs and mice by linker based sperm-mediated gene transfer.

    OpenAIRE

    Chang, Keejong; Qian, Jin; Jiang, MeiSheng; Liu, Yi-Hsin; Wu, Ming-Che; Chen, Chi-Dar; Lai, Chao-Kuen; Lo, Hsin-Lung; Hsiao, Chin-Ton; Brown, Lucy; Bolen, James; Huang, Hsiao-I; Ho, Pei-Yu; Shih, Ping Yao; Yao, Chen-Wen

    2002-01-01

    Abstract Background Transgenic animals have become valuable tools for both research and applied purposes. The current method of gene transfer, microinjection, which is widely used in transgenic mouse production, has only had limited success in producing transgenic animals of larger or higher species. Here, we report a linker based sperm-mediated gene transfer method (LB-SMGT) that greatly improves the production efficiency of large transgenic animals. Results The linker protein, a monoclonal ...

  18. Lipid membrane editing with peptide cargo linkers in cells and synthetic nanostructures

    OpenAIRE

    Pan, Hua; Myerson, Jacob W.; Ivashyna, Olena; Soman, Neelesh R.; Marsh, Jon N.; Hood, Joshua L.; Lanza, Gregory M.; Schlesinger, Paul H.; Wickline, Samuel A.

    2010-01-01

    Current strategies for deploying synthetic nanocarriers involve the creation of agents that incorporate targeting ligands, imaging agents, and/or therapeutic drugs into particles as an integral part of the formulation process. Here we report the development of an amphipathic peptide linker that enables postformulation editing of payloads without the need for reformulation to achieve multiplexing capability for lipidic nanocarriers. To exemplify the flexibility of this peptide linker strategy,...

  19. Novel Concepts of MS-Cleavable Cross-linkers for Improved Peptide Structure Analysis

    Science.gov (United States)

    Hage, Christoph; Falvo, Francesco; Schäfer, Mathias; Sinz, Andrea

    2017-10-01

    The chemical cross-linking/mass spectrometry (MS) approach is gaining increasing importance as an alternative method for studying protein conformation and for deciphering protein interaction networks. This study is part of our ongoing efforts to develop innovative cross-linking principles for a facile and efficient assignment of cross-linked products. We evaluate two homobifunctional, amine-reactive, and MS-cleavable cross-linkers regarding their potential for automated analysis of cross-linked products. We introduce the bromine phenylurea (BrPU) linker that possesses a unique structure yielding a distinctive fragmentation pattern on collisional activation. Moreover, BrPU delivers the characteristic bromine isotope pattern and mass defect for all cross-linker-decorated fragments. We compare the fragmentation behavior of the BrPU linker with that of our previously described MS-cleavable TEMPO-Bz linker (which consists of a 2,2,6,6-tetramethylpiperidine-1-oxy moiety connected to a benzyl group) that was developed to perform free-radical-initiated peptide sequencing. Comparative collisional activation experiments (collision-induced dissociation and higher-energy collision-induced dissociation) with both cross-linkers were conducted in negative electrospray ionization mode with an Orbitrap Fusion mass spectrometer using five model peptides. As hypothesized in a previous study, the presence of a cross-linked N-terminal aspartic acid residue seems to be the prerequisite for the loss of an intact peptide from the cross-linked products. As the BrPU linker combines a characteristic mass shift with an isotope signature, it presents a more favorable combination for automated assignment of cross-linked products compared with the TEMPO-Bz linker. [Figure not available: see fulltext.

  20. A highly conserved glycine within linker I and the extreme C terminus of G protein alpha subunits interact cooperatively in switching G protein-coupled receptor-to-effector specificity

    DEFF Research Database (Denmark)

    Kostenis, Evi; Martini, Lene; Ellis, James

    2004-01-01

    Numerous studies have attested to the importance of the extreme C terminus of G protein alpha subunits in determining their selectivity of receptor recognition. We have previously reported that a highly conserved glycine residue within linker I is important for constraining the fidelity of receptor...... recognition by Galpha(q) proteins. Herein, we explored whether both modules (linker I and extreme C terminus) interact cooperatively in switching G protein-coupled receptor (GPCR)-to-effector specificity and created as models mutant Galpha(q) proteins in which glycine was replaced with various amino acids...... and the C-terminal five Galpha(q) residues with the corresponding Galpha(i) or Galpha(s) sequence. Coupling properties of the mutated Galpha(q) proteins were determined after coexpression with a panel of 13 G(i)-and G(s) -selective receptors and compared with those of Galpha proteins modified in only one...

  1. Insertion of inter-domain linkers improves expression and bioactivity of Zygote arrest (Zar) fusion proteins.

    Science.gov (United States)

    Cook, Jonathan M; Charlesworth, Amanda

    2017-04-01

    Developmentally important proteins that are crucial for fertilization and embryogenesis are synthesized through highly regulated translation of maternal mRNA. The Zygote arrest proteins, Zar1 and Zar2, are crucial for embryogenesis and have been implicated in binding mRNA and repressing mRNA translation. To investigate Zar1 and Zar2, the full-length proteins had been fused to glutathione-S-transferase (GST) or MS2 protein tags with minimal inter-domain linkers derived from multiple cloning sites; however, these fusion proteins expressed poorly and/or lacked robust function. Here, we tested the effect of inserting additional linkers between the fusion domains. Three linkers were tested, each 17 amino acids long with different physical and chemical properties: flexible hydrophilic, rigid extended or rigid helical. In the presence of any of the three linkers, GST-Zar1 and GST-Zar2 had fewer breakdown products. Moreover, in the presence of any of the linkers, MS2-Zar1 was expressed to higher levels, and in dual luciferase tethered assays, both MS2-Zar1 and MS2-Zar2 repressed luciferase translation to a greater extent. These data suggest that for Zar fusion proteins, increasing the length of linkers, regardless of their physical or chemical properties, improves stability, expression and bioactivity. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Productive mutants of niger

    International Nuclear Information System (INIS)

    Misra, R.C.

    2001-01-01

    Seeds of six niger (Guizotia abyssinica Cass.) varieties ('GA-10', 'ONS-8', 'IGP-72', 'N-71', 'NB-9' and 'UN-4') were treated with 0.5, 0.75 and 1% ethyl methanesulphonate. After four generations of selection, 29 mutant lines were developed and those were evaluated from 1990-92 during Kharif (July to October) and Rabi (December to March) seasons. Average plant characteristics and yield data of four high yielding mutants along with 'IGP-76' (National Check), GA-10 (Zonal Check) and 'Semiliguda Local' (Local Check) are presented

  3. A.A., constructivism, and reflecting teams.

    Science.gov (United States)

    Nevels, B

    1997-12-01

    Numerous studies and clinical anecdotes reveal a relationship between attendance at A.A. meetings and/or degree of involvement in A.A. and maintenance of sobriety. Hypotheses as to how A.A. and/or the A.A. meeting is helpful to its members have ranged from a focus on factors common to all therapy groups, to aspects of A.A. "treatment" which are behavioral in nature. Presented here is another way of understanding A.A.'s effectiveness within the frame of more recent, constructivistic approaches to family therapy. In particular, the A.A. topic meeting is compared to the reflecting team concept of Tom Anderson.

  4. Engineering of a novel Ca{sup 2+}-regulated kinesin molecular motor using a calmodulin dimer linker

    Energy Technology Data Exchange (ETDEWEB)

    Shishido, Hideki [Department of Bioinformatics, Faculty of Engineering, Soka University, Hachioji, Tokyo 192-8577 (Japan); Maruta, Shinsaku, E-mail: maruta@soka.ac.jp [Department of Bioinformatics, Faculty of Engineering, Soka University, Hachioji, Tokyo 192-8577 (Japan)

    2012-06-29

    Highlights: Black-Right-Pointing-Pointer Engineered kinesin-M13 and calmodulin involving single cysteine were prepared. Black-Right-Pointing-Pointer CaM mutant was cross-linked to dimer by bifunctional thiol reactive reagent. Black-Right-Pointing-Pointer Kinesin-M13 was dimerized via CaM dimer in the presence of calcium. Black-Right-Pointing-Pointer Function of the engineered kinesin was regulated by a Ca{sup 2+}-calmodulin dimer linker. -- Abstract: The kinesin-microtubule system holds great promise as a molecular shuttle device within biochips. However, one current barrier is that such shuttles do not have 'on-off' control of their movement. Here we report the development of a novel molecular motor powered by an accelerator and brake system, using a kinesin monomer and a calmodulin (CaM) dimer. The kinesin monomer, K355, was fused with a CaM target peptide (M13 peptide) at the C-terminal part of the neck region (K355-M13). We also prepared CaM dimers using CaM mutants (Q3C), (R86C), or (A147C) and crosslinkers that react with cysteine residues. Following induction of K355-M13 dimerization with CaM dimers, we measured K355-M13 motility and found that it can be reversibly regulated in a Ca{sup 2+}-dependent manner. We also found that velocities of K355-M13 varied depending on the type and crosslink position of the CaM dimer used; crosslink length also had a moderate effect on motility. These results suggest Ca{sup 2+}-dependent dimerization of K355-M13 could be used as a novel molecular shuttle, equipped with an accelerator and brake system, for biochip applications.

  5. Spectroscopic study of the light-harvesting protein C-phycocyanin associated with colorless linker peptides

    Energy Technology Data Exchange (ETDEWEB)

    Pizarro, Shelly Ann [Univ. of California, Berkeley, CA (United States)

    2000-05-01

    The phycobilisome (PBS) light-harvesting antenna is composed of chromophore-containing biliproteins and 'colorless' linker peptides and is structurally designed to support unidirectional transfer of excitation energy from the periphery of the PBS to its core. The linker peptides have a unique role in this transfer process by modulating the spectral properties of the associated biliprotein. There is only one three-dimensional structure of a biliprotein/linker complex available to date (APC/LC7.8) and the mechanism of interaction between these two proteins remains unknown. This study brings together a detailed spectroscopic characterization of C-Phycocyanin (PC)-linker complexes (isolated from Synechococcus sp. PCC 7002) with proteomic analysis of the linker amino acid sequences to produce a model for biliprotein/linker interaction. The amino acid sequences of the rod linkers [LR8.9, LR32.3 and LRC28.5] were examined to identify evolutionarily conserved regions important to either the structure or function of this protein family. Although there is not one common homologous site among all the linkers, there are strong trends across each separate subset (LC, LR and LRC) and the N-terminal segments of both LR32.3 and LRC28.5 display multiple regions of similarity with other linkers. Predictions of the secondary structure of LR32.3 and LRC28.5, and comparison to the crystal structure of LC7.8, further narrowed the candidates for interaction sites with the PC chromophores. Measurements of the absorption, fluorescence, CD and excitation anisotropy of PC trimer, PC/LR32.3, and PC/LRC28.5, document the spectroscopic effect of each linker peptide on the PC chromophores at a series of temperatures (298 to 77 K

  6. Chemical and enzymatic stability of amino acid prodrugs containing methoxy, ethoxy and propylene glycol linkers.

    Science.gov (United States)

    Gupta, Deepak; Gupta, Sheeba Varghese; Lee, Kyung-Dall; Amidon, Gordon L

    2009-01-01

    We evaluated the chemical and enzymatic stabilities of prodrugs containing methoxy, ethoxy and propylene glycol linkers in order to find a suitable linker for prodrugs of carboxylic acids with amino acids. l-Valine and l-phenylalanine prodrugs of model compounds (benzoic acid and phenyl acetic acid) containing methoxy, ethoxy and propylene glycol linkers were synthesized. The hydrolysis rate profile of each compound was studied at physiologically relevant pHs (1.2, 4, 6 and 7.4). Enzymatic hydrolysis of propylene glycol containing compounds was studied using Caco-2 homogenate as well as purified enzyme valacyclovirase. It was observed that the stability of the prodrugs increases with the linker length (propyl > ethyl > methyl). The model prodrugs were stable at acidic pH as compared to basic pH. It was observed that the prodrug with the aliphatic amino acid promoiety was more stable compared to its aromatic counterpart. The comparison between benzyl and the phenyl model compounds revealed that the amino acid side chain is significant in determining the stability of the prodrug whereas the benzyl or phenyl carboxylic acid had little or no effect on the stability. The enzymatic activation studies of propylene glycol linker prodrug in the presence of valacyclovirase and cell homogenate showed faster generation of the parent drug at pH 7.4. The half-life of prodrugs at pH 7.4 was more than 12 h, whereas in the presence of cell homogenate the half-lives were less than 1 h. Hydrolysis by Caco-2 homogenate generated the parent compound in two steps, where the prodrug was first converted to the intermediate, propylene glycol benzoate, which was then converted to the parent compound (benzoic acid). Enzymatic hydrolysis of propylene glycol containing prodrugs by valacyclovirase showed hydrolysis of the amino acid ester part to generate the propylene glycol ester of model compound (propylene glycol benzoate) as the major product. The amino acid prodrugs containing methoxy

  7. Use of cysteine-reactive cross-linkers to probe conformational flexibility of human DJ-1 demonstrates that Glu18 mutations are dimers.

    Science.gov (United States)

    Prahlad, Janani; Hauser, David N; Milkovic, Nicole M; Cookson, Mark R; Wilson, Mark A

    2014-09-01

    The oxidation of a key cysteine residue (Cys106) in the parkinsonism-associated protein DJ-1 regulates its ability to protect against oxidative stress and mitochondrial damage. Cys106 interacts with a neighboring protonated Glu18 residue, stabilizing the Cys106-SO2 (-) (sulfinic acid) form of DJ-1. To study this important post-translational modification, we previously designed several Glu18 mutations (E18N, E18D, E18Q) that alter the oxidative propensity of Cys106. However, recent results suggest these Glu18 mutations cause loss of DJ-1 dimerization, which would severely compromise the protein's function. The purpose of this study was to conclusively determine the oligomerization state of these mutants using X-ray crystallography, NMR spectroscopy, thermal stability analysis, circular dichroism spectroscopy, sedimentation equilibrium ultracentrifugation, and cross-linking. We found that all of the Glu18 DJ-1 mutants were dimeric. Thiol cross-linking indicates that these mutant dimers are more flexible than the wild-type protein and can form multiple cross-linked dimeric species due to the transient exposure of cysteine residues that are inaccessible in the wild-type protein. The enhanced flexibility of Glu18 DJ-1 mutants provides a parsimonious explanation for their lower observed cross-linking efficiency in cells. In addition, thiol cross-linkers may have an underappreciated value as qualitative probes of protein conformational flexibility. DJ-1 is a homodimeric protein that protects cells against oxidative stress. Designed mutations that influence the regulatory oxidation of a key cysteine residue have recently been proposed to disrupt DJ-1 dimerization. We use cysteine cross-linking and various biophysical techniques to show that these DJ-1 mutants form dimers with increased conformational flexibility. © 2014 International Society for Neurochemistry.

  8. Enhanced Symbiotic Performance by Rhizobium tropici Glycogen Synthase Mutants

    Science.gov (United States)

    Marroquí, Silvia; Zorreguieta, Angeles; Santamaría, Carmen; Temprano, Francisco; Soberón, Mario; Megías, Manuel; Downie, J. Allan

    2001-01-01

    We isolated a Tn5-induced Rhizobium tropici mutant that has enhanced capacity to oxidize N,N-dimethyl-p-phenylendiamine (DMPD) and therefore has enhanced respiration via cytochrome oxidase. The mutant had increased levels of the cytochromes c1 and CycM and a small increase in the amount of cytochrome aa3. In plant tests, the mutant increased the dry weight of Phaseolus vulgaris plants by 20 to 38% compared with the control strain, thus showing significantly enhanced symbiotic performance. The predicted product of the mutated gene is homologous to glycogen synthases from several bacteria, and the mutant lacked glycogen. The DNA sequence of the adjacent gene region revealed six genes predicted to encode products homologous to the following gene products from Escherichia coli: glycogen phosphorylase (glgP), glycogen branching enzyme (glgB), ADP glucose pyrophosphorylase (glgC), glycogen synthase (glgA), phosphoglucomutase (pgm), and glycogen debranching enzyme (glgX). All six genes are transcribed in the same direction, and analysis with lacZ gene fusions suggests that the first five genes are organized in one operon, although pgm appears to have an additional promoter; glgX is transcribed independently. Surprisingly, the glgA mutant had decreased levels of high-molecular-weight exopolysaccharide after growth on glucose, but levels were normal after growth on galactose. A deletion mutant was constructed in order to generate a nonpolar mutation in glgA. This mutant had a phenotype similar to that of the Tn5 mutant, indicating that the enhanced respiration and symbiotic nitrogen fixation and decreased exopolysaccharide were due to mutation of glgA and not to a polar effect on a downstream gene. PMID:11208782

  9. Laboratory Astrophysics Division of the AAS (LAD)

    Science.gov (United States)

    Salama, Farid; Drake, R. P.; Federman, S. R.; Haxton, W. C.; Savin, D. W.

    2012-01-01

    The purpose of the Laboratory Astrophysics Division (LAD) is to advance our understanding of the Universe through the promotion of fundamental theoretical and experimental research into the underlying processes that drive the Cosmos. LAD represents all areas of astrophysics and planetary sciences. The first new AAS Division in more than 30 years, the LAD traces its history back to the recommendation from the scientific community via the White Paper from the 2006 NASA-sponsored Laboratory Astrophysics Workshop. This recommendation was endorsed by the Astronomy and Astrophysics Advisory Committee (AAAC), which advises the National Science Foundation (NSF), the National Aeronautics and Space Administration (NASA), and the U.S. Department of Energy (DOE) on selected issues within the fields of astronomy and astrophysics that are of mutual interest and concern to the agencies. In January 2007, at the 209th AAS meeting, the AAS Council set up a Steering Committee to formulate Bylaws for a Working Group on Laboratory Astrophysics (WGLA). The AAS Council formally established the WGLA with a five-year mandate in May 2007, at the 210th AAS meeting. From 2008 through 2012, the WGLA annually sponsored Meetings in-a-Meeting at the AAS Summer Meetings. In May 2011, at the 218th AAS meeting, the AAS Council voted to convert the WGLA, at the end of its mandate, into a Division of the AAS and requested draft Bylaws from the Steering Committee. In January 2012, at the 219th AAS Meeting, the AAS Council formally approved the Bylaws and the creation of the LAD. The inaugural gathering and the first business meeting of the LAD were held at the 220th AAS meeting in Anchorage in June 2012. You can learn more about LAD by visiting its website at http://lad.aas.org/ and by subscribing to its mailing list.

  10. Laboratory Astrophysics Division of The AAS (LAD)

    Science.gov (United States)

    Salama, Farid; Drake, R. P.; Federman, S. R.; Haxton, W. C.; Savin, D. W.

    2012-10-01

    The purpose of the Laboratory Astrophysics Division (LAD) is to advance our understanding of the Universe through the promotion of fundamental theoretical and experimental research into the underlying processes that drive the Cosmos. LAD represents all areas of astrophysics and planetary sciences. The first new AAS Division in more than 30 years, the LAD traces its history back to the recommendation from the scientific community via the White Paper from the 2006 NASA-sponsored Laboratory Astrophysics Workshop. This recommendation was endorsed by the Astronomy and Astrophysics Advisory Committee (AAAC), which advises the National Science Foundation (NSF), the National Aeronautics and Space Administration (NASA), and the U.S. Department of Energy (DOE) on selected issues within the fields of astronomy and astrophysics that are of mutual interest and concern to the agencies. In January 2007, at the 209th AAS meeting, the AAS Council set up a Steering Committee to formulate Bylaws for a Working Group on Laboratory Astrophysics (WGLA). The AAS Council formally established the WGLA with a five-year mandate in May 2007, at the 210th AAS meeting. From 2008 through 2012, the WGLA annually sponsored Meetings in-a-Meeting at the AAS Summer Meetings. In May 2011, at the 218th AAS meeting, the AAS Council voted to convert the WGLA, at the end of its mandate, into a Division of the AAS and requested draft Bylaws from the Steering Committee. In January 2012, at the 219th AAS Meeting, the AAS Council formally approved the Bylaws and the creation of the LAD. The inaugural gathering and the first business meeting of the LAD were held at the 220th AAS meeting in Anchorage in June 2012. You can learn more about LAD by visiting its website at http://lad.aas.org/ and by subscribing to its mailing list.

  11. Elongated and substituted triazine-based tricarboxylic acid linkers for MOFs

    Directory of Open Access Journals (Sweden)

    Arne Klinkebiel

    2016-10-01

    Full Text Available New triazine-based tricarboxylic acid linkers were prepared as elongated relatives of triazinetribenzoic acid (TATB. Additionally, functional groups (NO2, NH2, OMe, OH were introduced for potential post-synthetic modification (PSM of MOFs. Functionalized tris(4-bromoaryltriazine “cores” (3a,3b were obtained by unsymmetric trimerization mixing one equivalent of an acid chloride (OMe or NO2 substituted with two equivalents of an unsubstituted nitrile. Triple Suzuki coupling of the cores 3 with suitable phenyl- and biphenylboronic acid derivatives provided elongated tricarboxylic acid linkers as carboxylic acids 17 and 20 or their esters 16 and 19. Reduction of the nitro group and cleavage of the methoxy group gave the respective amino and hydroxy-substituted triazine linkers.

  12. AA, closed orbit observation pickup

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles QFW, at maximum dispersion. See also 8001372, 8001383, 8010045

  13. AA, closed orbit observation pickup

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles, QFW, at maximum dispersion. See also 8001372,8001383, 8010042

  14. AA, closed orbit observation pickup

    CERN Multimedia

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. See also 8001372, 8010042, 8010045

  15. AA, closed orbit observation pickup

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. Werner Sax contemplates his achievement. See also 8001383, 8010042, 8010045.

  16. The centrosomal linker and microtubules provide dual levels of spatial coordination of centrosomes.

    Directory of Open Access Journals (Sweden)

    Marko Panic

    2015-05-01

    Full Text Available The centrosome is the principal microtubule organizing center in most animal cells. It consists of a pair of centrioles surrounded by pericentriolar material. The centrosome, like DNA, duplicates exactly once per cell cycle. During interphase duplicated centrosomes remain closely linked by a proteinaceous linker. This centrosomal linker is composed of rootletin filaments that are anchored to the centrioles via the protein C-Nap1. At the onset of mitosis the linker is dissolved by Nek2A kinase to support the formation of the bipolar mitotic spindle. The importance of the centrosomal linker for cell function during interphase awaits characterization. Here we assessed the phenotype of human RPE1 C-Nap1 knockout (KO cells. The absence of the linker led to a modest increase in the average centrosome separation from 1 to 2.5 μm. This small impact on the degree of separation is indicative of a second level of spatial organization of centrosomes. Microtubule depolymerisation or stabilization in C-Nap1 KO cells dramatically increased the inter-centrosomal separation (> 8 μm. Thus, microtubules position centrosomes relatively close to one another in the absence of linker function. C-Nap1 KO cells had a Golgi organization defect with a two-fold expansion of the area occupied by the Golgi. When the centrosomes of C-Nap1 KO cells showed considerable separation, two spatially distinct Golgi stacks could be observed. Furthermore, migration of C-Nap1 KO cells was slower than their wild type RPE1 counterparts. These data show that the spatial organization of centrosomes is modulated by a combination of centrosomal cohesion and microtubule forces. Furthermore a modest increase in centrosome separation has major impact on Golgi organization and cell migration.

  17. Novel silicone compatible cross-linkers for controlled functionalization of PDMS networks

    DEFF Research Database (Denmark)

    Madsen, Frederikke Bahrt; Daugaard, Anders Egede; Hvilsted, Søren

    2013-01-01

    Polydimethylsiloxane (PDMS) elastomers are excellent materials for dielectric electroactive polymers (DEAPs) due to their high efficiency and fast response. PDMS suffers, however, from low dielectric permittivity and high voltages are therefore required when the material is used for DEAP actuators...... functional cross-linker and fluorescence microscopy. The thermal, mechanical and electro-mechanical properties of PDMS elastomers of 0 wt% to 3.6 wt% of push-pull dipole cross-linker are investigated. An increase in the dielectric permittivity of 19 % at only 0.46 wt% of pure push-pull dipole is observed...

  18. Dipolar cross-linkers for PDMS networks with enhanced dielectric permittivity and low dielectric loss

    DEFF Research Database (Denmark)

    Bahrt, Frederikke; Daugaard, Anders Egede; Hvilsted, Søren

    2013-01-01

    -(4-((4-nitrophenyl)diazenyl)phenoxy)-prop-1-yn-1-ylium, with a synthesized silicone compatible azide-functional cross-linker by click chemistry. The thermal, mechanical and electromechanical properties were investigated for PDMS films with 0 to 3.6 wt% of dipole-cross-linker. The relative dielectric permittivity...... was found to increase by ∼20% at only 0.46 wt% of incorporated dipole without significant changes in the mechanical properties. Furthermore, the dielectric losses were proved to be remarkably low while the electrical breakdown strengths were high....

  19. AAS 228: Day 3 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  20. Regulation of Cellular Dynamics and Chromosomal Binding Site Preference of Linker Histones H1.0 and H1.X.

    Science.gov (United States)

    Okuwaki, Mitsuru; Abe, Mayumi; Hisaoka, Miharu; Nagata, Kyosuke

    2016-11-01

    Linker histones play important roles in the genomic organization of mammalian cells. Of the linker histone variants, H1.X shows the most dynamic behavior in the nucleus. Recent research has suggested that the linker histone variants H1.X and H1.0 have different chromosomal binding site preferences. However, it remains unclear how the dynamics and binding site preferences of linker histones are determined. Here, we biochemically demonstrated that the DNA/nucleosome and histone chaperone binding activities of H1.X are significantly lower than those of other linker histones. This explains why H1.X moves more rapidly than other linker histones in vivo Domain swapping between H1.0 and H1.X suggests that the globular domain (GD) and C-terminal domain (CTD) of H1.X independently contribute to the dynamic behavior of H1.X. Our results also suggest that the N-terminal domain (NTD), GD, and CTD cooperatively determine the preferential binding sites, and the contribution of each domain for this determination is different depending on the target genes. We also found that linker histones accumulate in the nucleoli when the nucleosome binding activities of the GDs are weak. Our results contribute to understanding the molecular mechanisms of dynamic behaviors, binding site selection, and localization of linker histones. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  1. A photolabile linker for the solid-phase synthesis of 4-substituted NH-1,2,3-triazoles

    DEFF Research Database (Denmark)

    Qvortrup, Katrine; Nielsen, Thomas Eiland

    2011-01-01

    A novel photolabile linker for solid-phase synthesis is presented. The linker displays an azido handle for copper-catalyzed azide–alkyne cycloaddition reactions with a variety of alkynes, remains intact under typical solid-phase reaction conditions, and enables a mild photolytic release of 4...

  2. AAS 228: Day 1 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Come visit astrobites at the AAS booth we have swag!Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto hear from undergrads who already know and love the site, educators who want to use it in their classrooms, and students who had not yet been introduced to astrobites and were excited about a new resource!For the rest of the meeting we will be stationed at theAAS booth in the exhibit hall (booth #211-213), so drop by if you want to learn more (or pick up swag: weve got lots of stickers and sunglasses)!Mondaymorning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended this morning.Opening Address(by Susanna Kohler)AAS President Meg Urry kicked off the meeting this morning at 8am with an overview of some of the great endeavors AAS is supporting. We astrobiters had personal motivation to drag ourselves out of bed that early: during this session, Urryannounced the new partnership between AAS and astrobites!Urry touched on some difficult topics in her welcome, including yesterdays tragedy in Orlando. Shereiteratedthe AASs support fortheCommittee for Sexual-Orientation and Gender Minorities in Astronomy (SGMA). She also reminded meeting attendees about the importance ofkeeping conference interactions professional, and pointed to the meetings anti-harassment policy.Partnership Announcement (by Michael Zevin)This morning, the American Astronomical Society announced the new partnership that it will have with Astrobites! We are beyond excited to embark on this new partnership with the

  3. Photorepair mutants of Arabidopsis

    International Nuclear Information System (INIS)

    Jiang, C.Z.; Yee, J.; Mitchell, D.L.; Britt, A.B.

    1997-01-01

    UV radiation induces two major DNA damage products, the cyclobutane pyrimidine dimer (CPD) and, at a lower frequency, the pyrimidine (6-4) pyrimidinone dimer (6-4 product). Although Escherichia coli and Saccharomyces cerevisiae produce a CPD-specific photolyase that eliminates only this class of dimer, Arabidopsis thaliana, Drosophila melanogaster, Crotalus atrox, and Xenopus laevis have recently been shown to photoreactivate both CPDs and 6-4 products. We describe the isolation and characterization of two new classes of mutants of Arabidopsis, termed uvr2 and uvr3, that are defective in the photoreactivation of CPDs and 6-4 products, respectively. We demonstrate that the CPD photolyase mutation is genetically linked to a DNA sequence encoding a type II (metazoan) CPD photolyase. In addition, we are able to generate plants in which only CPDs or 6-4 products are photoreactivated in the nuclear genome by exposing these mutants to UV light and then allowing them to repair one or the other class of dimers. This provides us with a unique opportunity to study the biological consequences of each of these two major UV-induced photoproducts in an intact living system

  4. The linker pivot in Ci-VSP: the key to unlock catalysis.

    Directory of Open Access Journals (Sweden)

    Kirstin Hobiger

    Full Text Available In the voltage-sensitive phosphatase Ci-VSP, conformational changes in the transmembrane voltage sensor domain (VSD are transduced to the intracellular catalytic domain (CD leading to its dephosphorylation activity against membrane-embedded phosphoinositides. The linker between both domains is proposed to be crucial for the VSD-CD coupling. With a combined approach of electrophysiological measurements on Xenopus oocytes and molecular dynamics simulations of a Ci-VSP model embedded in a lipid bilayer, we analyzed how conformational changes in the linker mediate the interaction between the CD and the activated VSD. In this way, we identified specific residues in the linker that interact with well-defined amino acids in one of the three loops forming the active site of the protein, named TI loop. With our results, we shed light into the early steps of the coupling process between the VSD and the CD, which are based on fine-tuned electrostatic and hydrophobic interactions between the linker, the membrane and the CD.

  5. A New Achiral Linker Reagent for the Incorporation of Multiple Amino Groups Into Oligonucleotides

    DEFF Research Database (Denmark)

    1997-01-01

    with the linker in conventional phosphoamidite or H-phosphonate DNA syntheses. Directly, or via a post modification step, an oligonucleotide is labelled with one or more reporter moieties, e.g. dansyl (5-dimethylamino)-1-naphthalenesulfonyl), biotin, digoxigenin, DOXYL (N-oxyl-4,4-dimethyloxazolidine), PROXYL (N...

  6. Data from computational analysis of the peptide linkers in the MocR bacterial transcriptional regulators

    Directory of Open Access Journals (Sweden)

    Sebastiana Angelaccio

    2016-12-01

    Interpretation and discussion of reported data refer to the article “Structural properties of the linkers connecting the N- and C- terminal domains in the MocR bacterial transcriptional regulators” (T. Milano, S. Angelaccio, A. Tramonti, M. L. Di Salvo, R. Contestabile, S. Pascarella, 2016 [1].

  7. Novel pH-Sensitive Cationic Lipids with Linear Ortho Ester Linkers for Gene Delivery

    Science.gov (United States)

    Chen, Haigang; Zhang, Huizhen; Thor, Der; Rahimian, Roshanak; Guo, Xin

    2012-01-01

    In an effort to develop pH-sensitive lipoplexes for efficient gene delivery, we report three novel cationic lipids containing a linear ortho ester linker that conjugates either the headgroup (Type I) or one hydrocarbon chain (Type II) with the rest of the lipid molecule. The cationic lipids carry either an iodide or a chloride counterion. Compared to our previously reported cyclic ortho ester linker, the linear ortho ester linker facilitated the construction of cationic liposomes and lipoplexes with different helper lipids. The chloride counterion not only facilitated the hydration of the lipid films during liposome construction, but also enhanced the hydrolysis of the ortho ester linker in the lipoplexes. After incubation at endosomal pH 5.5, the Type I lipoplexes aggregated and destabilized the endosome-mimicking model liposomes, but not the Type II lipoplexes. The helper lipids (DOPE or cholesterol) of the lipoplexes enhanced the pH-sensitivity of the Type I lipoplexes. In CV-1 cells (monkey kidney fibroblast), the Type I ortho ester-based lipoplexes, especially those with the chloride counterion, significantly improved the gene transfection efficiency, in some cases by more than 100 fold, compared to their pH-insensitive counterparts consisting of DOTAP. The gene transfection efficiency of the ortho ester-based lipoplexes was well correlated with their rate of aggregation and membrane destabilization in response to the endosomal pH 5.5. PMID:22480493

  8. Release of 3-methyladenine from linker and core DNA of chromatin by a purified DNA glycosylase

    International Nuclear Information System (INIS)

    Heller, E.P.; Goldthwait, D.A.

    1983-01-01

    Oligonucleosomes were isolated from [ 14 C]thymidine-labeled HeLa cells by digestion of the nuclei with micrococcal nuclease and were then alkylated with [ 3 H]methylnitrosourea. Nucleosome core particles were also prepared by further digestion of the oligonucleosomes. The distribution of 3 H-labeled methyl groups in the linker versus the core DNA was established by a determination of 3 H: 14 C ratios in oligonucleosome and core DNA. The ratios in the core DNA of 145 and 165 base pair DNA fragments were 5.2 and 5.4, respectively, while the ratio in the oligonucleosomal DNA was 8.2. Assuming an equal mixture (as determined) of 145 and 165 base pair fragments of DNA in the 185 base pair repeat, the relative concentration of 3 H methyl groups in the linker versus the core DNA was 4.2. Thus, 45% of the 3 H methyl groups were in the linker DNA, and 55% were in the core DNA. Some shielding of the DNA was evident during alkylation. The concentrations of alkyl groups on the linker and core DNA were 67 and 12% of that found on free DNA alkylated under comparable conditions. No evidence for preferential shielding of the major or minor groove was observed. The purified 3-methyladenine DNA glycosylase I of Escherichia coli released approximately 37% of the 3-methyladenine from the linker DNA and 13% from the core DNA. The limited enzymatic removal of 3-methyladenine in vitro compared to the efficient removal in vivo suggests that conformational changes of the oligonucleosome and core structure must occur for total repair

  9. Localized buckling of a microtubule surrounded by randomly distributed cross linkers.

    Science.gov (United States)

    Jin, M Z; Ru, C Q

    2013-07-01

    Microtubules supported by surrounding cross linkers in eukaryotic cells can bear a much higher compressive force than free-standing microtubules. Different from some previous studies, which treated the surroundings as a continuum elastic foundation or elastic medium, the present paper develops a micromechanics numerical model to examine the role of randomly distributed discrete cross linkers in the buckling of compressed microtubules. First, the proposed numerical approach is validated by reproducing the uniform multiwave buckling mode predicted by the existing elastic-foundation model. For more realistic buckling of microtubules surrounded by randomly distributed cross linkers, the present numerical model predicts that the buckling mode is localized at one end in agreement with some known experimental observations. In particular, the critical force for localized buckling, predicted by the present model, is insensitive to microtubule length and can be about 1 order of magnitude lower than those given by the elastic-foundation model, which suggests that the elastic-foundation model may have overestimated the critical force for buckling of microtubules in vivo. In addition, unlike the elastic-foundation model, the present model can capture the effect of end conditions on the critical force and wavelength of localized buckling. Based on the known data of spacing and elastic constants of cross linkers available in literature, the critical force and wavelength of the localized buckling mode, predicted by the present model, are compared to some experimental data with reasonable agreement. Finally, two empirical formulas are proposed for the critical force and wavelength of the localized buckling of microtubules surrounded by cross linkers.

  10. (PCL/AA) hydrogel for controlled drug delivery

    Indian Academy of Sciences (India)

    Administrator

    PCL-g-AA) on the .... Solvent replacement method was used for porosity meas- urement. Weighed dried discs were immersed in .... Regression coefficient (r) values obtained from PCL/AA hydrogels at varying contents of AA and EGDMA are.

  11. AaMYB1 and its orthologue AtMYB61 affect terpene metabolism and trichome development in Artemisia annua and Arabidopsis thaliana.

    Science.gov (United States)

    Matías-Hernández, Luis; Jiang, Weimin; Yang, Ke; Tang, Kexuan; Brodelius, Peter E; Pelaz, Soraya

    2017-05-01

    The effective anti-malarial drug artemisinin (AN) isolated from Artemisia annua is relatively expensive due to the low AN content in the plant as AN is only synthesized within the glandular trichomes. Therefore, genetic engineering of A. annua is one of the most promising approaches for improving the yield of AN. In this work, the AaMYB1 transcription factor has been identified and characterized. When AaMYB1 is overexpressed in A. annua, either exclusively in trichomes or in the whole plant, essential AN biosynthetic genes are also overexpressed and consequently the amount of AN is significantly increased. Artemisia AaMYB1 constitutively overexpressing plants displayed a greater number of trichomes. In order to study the role of AaMYB1 on trichome development and other possibly connected biological processes, AaMYB1 was overexpressed in Arabidopsis thaliana. To support our findings in Arabidopsis thaliana, an AaMYB1 orthologue from this model plant, AtMYB61, was identified and atmyb61 mutants characterized. Both AaMYB1 and AtMYB61 affected trichome initiation, root development and stomatal aperture in A. thaliana. Molecular analyses indicated that two crucial trichome activator genes are misexpressed in atmyb61 mutant plants and in plants overexpressing AaMYB1. Furthermore, AaMYB1 and AtMYB61 are also essential for gibberellin (GA) biosynthesis and degradation in both species by positively affecting the expression of the enzymes that convert GA 9 into the bioactive GA 4 as well as the enzymes involved in the degradation of GA 4 . Overall, these results identify AaMYB1/AtMYB61 as a key component of the molecular network that connects important biosynthetic processes, and reveal its potential value for AN production through genetic engineering. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  12. Water-deficit tolerant classification in mutant lines of indica rice

    Directory of Open Access Journals (Sweden)

    Suriyan Cha-um

    2012-04-01

    Full Text Available Water shortage is a major abiotic stress for crop production worldwide, limiting the productivity of crop species, especially in dry-land agricultural areas. This investigation aimed to classify the water-deficit tolerance in mutant rice (Oryza sativa L. spp. indica genotypes during the reproductive stage. Proline content in the flag leaf of mutant lines increased when plants were subjected to water deficit. Relative water content (RWC in the flag leaf of different mutant lines dropped in relation to water deficit stress. A decrease RWC was positively related to chlorophyll a degradation. Chlorophyll a , chlorophyll b , total chlorophyll , total carotenoids , maximum quantum yield of PSII , stomatal conductance , transpiration rate and water use efficiency in mutant lines grown under water deficit conditions declined in comparison to the well-watered, leading to a reduction in net-photosynthetic rate. In addition, when exposed to water deficit, panicle traits, including panicle length and fertile grains were dropped. The biochemical and physiological data were subjected to classify the water deficit tolerance. NSG19 (positive control and DD14 were identified as water deficit tolerant, and AA11, AA12, AA16, BB13, BB16, CC12, CC15, EE12, FF15, FF17, G11 and IR20 (negative control as water deficit sensitive, using Ward's method.

  13. Biodistribution of the chimeric monoclonal antibody U36 radioiodinated with a closo-dodecaborate-containing linker. Comparison with other radioiodination methods.

    NARCIS (Netherlands)

    Nestor, M; Persson, M; Cheng, J.; Tolmachev, V; Dongen, van G.A.M.S.; Anniko, M; Kairemo, K

    2003-01-01

    We have evaluated the applicability of the [(4-isothiocyanatobenzylammonio)undecahydro-closo-dodecaborate (1-)] (DABI) linker molecule for antibody radiohalogenation and compared it to radiohalogenation using the linker N-succinimidyl 4-iodobenzoate (PIB) and to direct radiohalogenation using

  14. Isozyme differences in barley mutants

    International Nuclear Information System (INIS)

    AI-Jibouri, A.A.M.; Dham, K.M.

    1990-01-01

    Full text: Thirty mutants (M 11 ) of barley (Hordeum vulgare L.) induced by physical and chemical mutagens were analysed for isozyme composition using polyacrylamide gel electrophoresis. Results show that these mutants were different in the isozymes leucine aminopeptidase, esterase and peroxidase. The differences included the number of forms of each enzyme, relative mobility value and their intensity on the gel. Glutamate oxaloacetate transaminase isozyme was found in six molecular forms and these forms were similar in all mutants. (author)

  15. A Stretch of Negatively Charged Amino Acids of Linker for Activation of T-Cell Adaptor Has a Dual Role in T-Cell Antigen Receptor Intracellular Signaling

    Directory of Open Access Journals (Sweden)

    Mikel M. Arbulo-Echevarria

    2018-02-01

    Full Text Available The adaptor protein linker for activation of T cells (LAT has an essential role transducing activatory intracellular signals coming from the TCR/CD3 complex. Previous reports have shown that upon T-cell activation, LAT interacts with the tyrosine kinase Lck, leading to the inhibition of its kinase activity. LAT–Lck interaction seemed to depend on a stretch of negatively charged amino acids in LAT. Here, we have substituted this segment of LAT between amino acids 113 and 126 with a non-charged segment and expressed the mutant LAT (LAT-NIL in J.CaM2 cells in order to analyze TCR signaling. Substitution of this segment in LAT prevented the activation-induced interaction with Lck. Moreover, cells expressing this mutant form of LAT showed a statistically significant increase of proximal intracellular signals such as phosphorylation of LAT in tyrosine residues 171 and 191, and also enhanced ZAP70 phosphorylation approaching borderline statistical significance (p = 0.051. Nevertheless, downstream signals such as Ca2+ influx or MAPK pathways were partially inhibited. Overall, our data reveal that LAT–Lck interaction constitutes a key element regulating proximal intracellular signals coming from the TCR/CD3 complex.

  16. Linker insertion analysis of the FimH adhesin of type 1 fimbriae in an Escherichia coli fimH-null background

    DEFF Research Database (Denmark)

    Schembri, Mark; Pallesen, Lars; Connell, Hugh

    1996-01-01

    on the ability of bacteria to express a D-mannose binding phenotype was assessed in a fimH null mutant (MS4) constructed by allelic exchange in the E. coli K-12 strain PC31. Mutations mapping at amino acid residues 36, 58, and 279 of the mature FimH protein were shown to completely abolish binding to D......The gene encoding the Escherichia coli FimH adhesin has been subjected to linker insertion mutagenesis. Amino acid changes were introduced in a number of positions spanning the entire sequence in order to probe the structure-function relationship of the FimH protein. The effect of these mutations......-mannose receptors. Differences in the level of fimbriation were also observed as a result of some of the mutations in the fimH gene. These mutants may prove useful in dissecting receptor-ligand interactions by defining regions of the FimH protein that are important in erythrocyte binding....

  17. Abnormal grooming activity in Dab1(scm) (scrambler) mutant mice.

    Science.gov (United States)

    Strazielle, C; Lefevre, A; Jacquelin, C; Lalonde, R

    2012-07-15

    Dab1(scm) mutant mice, characterized by cell ectopias and degeneration in cerebellum, hippocampus, and neocortex, were compared to non-ataxic controls for different facets of grooming caused by brief water immersions, as well as some non-grooming behaviors. Dab1(scm) mutants were strongly affected in their quantitative functional parameters, exhibiting higher starting latencies before grooming relative to non-ataxic littermates of the A/A strain, fewer grooming bouts, and grooming components of shorter duration, with an unequal regional distribution targeting almost totally the rostral part (head washing and forelimb licking) of the animal. Only bouts of a single grooming element were preserved. The cephalocaudal order of grooming elements appeared less disorganized, mutant and control mice initiating the grooming with head washing and forelimb licking prior to licking posterior parts. However, mutants differed from controls in that all their bouts were incomplete but uninterrupted, although intergroup difference for percentage of the incorrect transitions was not significant. In contrast to grooming, Dab1(scm) mice ambulated for a longer time. During walking episodes, they exhibited more body scratching than controls, possibly to compensate for the lack of licking different body parts. In conjunction with studies with other ataxic mice, these results indicate that the cerebellar cortex affects grooming activity and is consequently involved in executing various components, but not in its sequential organization, which requires other brain regions such as cerebral cortices or basal ganglia. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Isolation of a Defective Prion Mutant from Natural Scrapie.

    Directory of Open Access Journals (Sweden)

    Ilaria Vanni

    2016-11-01

    Full Text Available It is widely known that prion strains can mutate in response to modification of the replication environment and we have recently reported that prion mutations can occur in vitro during amplification of vole-adapted prions by Protein Misfolding Cyclic Amplification on bank vole substrate (bvPMCA. Here we exploited the high efficiency of prion replication by bvPMCA to study the in vitro propagation of natural scrapie isolates. Although in vitro vole-adapted PrPSc conformers were usually similar to the sheep counterpart, we repeatedly isolated a PrPSc mutant exclusively when starting from extremely diluted seeds of a single sheep isolate. The mutant and faithful PrPSc conformers showed to be efficiently autocatalytic in vitro and were characterized by different PrP protease resistant cores, spanning aa ∼155-231 and ∼80-231 respectively, and by different conformational stabilities. The two conformers could thus be seen as different bona fide PrPSc types, putatively accounting for prion populations with different biological properties. Indeed, once inoculated in bank vole the faithful conformer was competent for in vivo replication while the mutant was unable to infect voles, de facto behaving like a defective prion mutant. Overall, our findings confirm that prions can adapt and evolve in the new replication environments and that the starting population size can affect their evolutionary landscape, at least in vitro. Furthermore, we report the first example of "authentic" defective prion mutant, composed of brain-derived PrPC and originating from a natural scrapie isolate. Our results clearly indicate that the defective mutant lacks of some structural characteristics, that presumably involve the central region ∼90-155, critical for infectivity but not for in vitro replication. Finally, we propose a molecular mechanism able to account for the discordant in vitro and in vivo behavior, suggesting possible new paths for investigating the molecular

  19. Structure and Dynamics of a 197 bp Nucleosome in Complex with Linker Histone H1.

    Science.gov (United States)

    Bednar, Jan; Garcia-Saez, Isabel; Boopathi, Ramachandran; Cutter, Amber R; Papai, Gabor; Reymer, Anna; Syed, Sajad H; Lone, Imtiaz Nisar; Tonchev, Ognyan; Crucifix, Corinne; Menoni, Hervé; Papin, Christophe; Skoufias, Dimitrios A; Kurumizaka, Hitoshi; Lavery, Richard; Hamiche, Ali; Hayes, Jeffrey J; Schultz, Patrick; Angelov, Dimitar; Petosa, Carlo; Dimitrov, Stefan

    2017-05-04

    Linker histones associate with nucleosomes to promote the formation of higher-order chromatin structure, but the underlying molecular details are unclear. We investigated the structure of a 197 bp nucleosome bearing symmetric 25 bp linker DNA arms in complex with vertebrate linker histone H1. We determined electron cryo-microscopy (cryo-EM) and crystal structures of unbound and H1-bound nucleosomes and validated these structures by site-directed protein cross-linking and hydroxyl radical footprinting experiments. Histone H1 shifts the conformational landscape of the nucleosome by drawing the two linkers together and reducing their flexibility. The H1 C-terminal domain (CTD) localizes primarily to a single linker, while the H1 globular domain contacts the nucleosome dyad and both linkers, associating more closely with the CTD-distal linker. These findings reveal that H1 imparts a strong degree of asymmetry to the nucleosome, which is likely to influence the assembly and architecture of higher-order structures. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. First circulating beam in the AA

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.56 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are too numerous to name them all, but the 3 most prominent ones are at the centre (left to right): Roy Billinge (Joint AA Project Leader, with his hand on the control box), Eifionydd Jones (white shirt), Simon van der Meer (spiritus rector and Joint AA Project Leader). The first antiprotons were injected, made to circulate and cooled soon after, on 14 July 1980.

  1. Development of a UiO-Type Thin Film Electrocatalysis Platform with Redox-Active Linkers.

    Science.gov (United States)

    Johnson, Ben A; Bhunia, Asamanjoy; Fei, Honghan; Cohen, Seth M; Ott, Sascha

    2018-02-28

    Metal-organic frameworks (MOFs) as electrocatalysis scaffolds are appealing due to the large concentration of catalytic units that can be assembled in three dimensions. To harness the full potential of these materials, charge transport to the redox catalysts within the MOF has to be ensured. Herein, we report the first electroactive MOF with the UiO/PIZOF topology (Zr(dcphOH-NDI)), i.e., one of the most widely used MOFs for catalyst incorporation, by using redox-active naphthalene diimide-based linkers (dcphOH-NDI). Hydroxyl groups were included on the dcphOH-NDI linker to facilitate proton transport through the material. Potentiometric titrations of Zr(dcphOH-NDI) show the proton-responsive behavior via the -OH groups on the linkers and the bridging Zr-μ 3 -OH of the secondary building units with pK a values of 6.10 and 3.45, respectively. When grown directly onto transparent conductive fluorine-doped tin oxide (FTO), 1 μm thin films of Zr(dcphOH-NDI)@FTO could be achieved. Zr(dcphOH-NDI)@FTO displays reversible electrochromic behavior as a result of the sequential one-electron reductions of the redox-active NDI linkers. Importantly, 97% of the NDI sites are electrochemically active at applied potentials. Charge propagation through the thin film proceeds through a linker-to-linker hopping mechanism that is charge-balanced by electrolyte transport, giving rise to cyclic voltammograms of the thin films that show characteristics of a diffusion-controlled process. The equivalent diffusion coefficient, D e , that contains contributions from both phenomena was measured directly by UV/vis spectroelectrochemistry. Using KPF 6 as electrolyte, D e was determined to be D e (KPF 6 ) = (5.4 ± 1.1) × 10 -11 cm 2 s -1 , while an increase in countercation size to n-Bu 4 N + led to a significant decrease of D e by about 1 order of magnitude (D e (n-Bu 4 NPF 6 ) = (4.0 ± 2.5) × 10 -12 cm 2 s -1 ).

  2. AAS 228: Day 3 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session 2015 Newton Lacy Pierce Prize Lecture: The Elephant in the Room: Effects of Distant, Massive Companions on Planetary System Architectures (by Leonardo dos Santos)The first session on Wednesday at 228th AAS Meeting was the Newton Lacy Pierce Prize Lecture by Heather Knutson (California Institute of Technology). This talk featured a broad range of research efforts on exoplanets, with the main focus on how we study the composition of their atmospheres, and how multi-body interactions carve the structure of the planetary systems we observe.One of her first points is the well-known idea that the Solar System is an oddball, compared to the exoplanet systems we have found so far: most of these systems contain hot Jupiters and mini-Neptunes at very close-in orbits around their host stars. Moreover, even when studying their transmission spectra, it is difficult to know the exact composition of their atmospheres.Knutson: it is difficult to constrain atmospheric composition of exoplanets (H-poor or H-rich+clouds?) #aas228pic.twitter.com/LdyN4o9RC7 astrobites (@astrobites) June 15, 2016The main proposal on how these systems formed is the migration scenario. In order to validate this idea, Dr. Knutson and her group The Friends of Hot Jupiters study systems with close-in gas giants and their frequency of binary companions, which are supposed to be the main culprits causing gas-giant migration. They found that approximately half of the observed systems have long-distance companions, providing strong validation of the migration scenario. Moreover, Dr. Knutson speculates that wide binaries have more

  3. Evaluation of tall rice mutant

    International Nuclear Information System (INIS)

    Hakim, L.; Azam, M.A.; Miah, A.J.; Mansur, M.A.; Akanda, H.R.

    1989-01-01

    One tall mutant (Mut NS1) of rice variety Nizersail was put to multilocation on-farm trial. It showed improvement over the parent in respect of by earlier maturity and higher grain yield at all locations and thus it appears as an improved mutant of Nizersail. (author). 6 refs

  4. cis-Apa: a practical linker for the microwave-assisted preparation of cyclic pseudopeptides via RCM cyclative cleavage.

    Science.gov (United States)

    Baron, Alice; Verdié, Pascal; Martinez, Jean; Lamaty, Frédéric

    2011-02-04

    A new linker cis-5-aminopent-3-enoic acid (cis-Apa) was prepared for the synthesis of cyclic pseudopeptides by cyclization-cleavage by using ring-closing methatesis (RCM). We developed a new synthetic pathway for the preparation of the cis-Apa linker that was tested in the cyclization-cleavage process of different RGD peptide sequences. Different macrocyclic peptidomimetics were prepared by using this integrated microwave-assisted method, showing that the readily available cis-Apa amino acid is well adapted as a linker in the cyclization-cleavage process.

  5. Linker-mediated recombinational subcloning of large DNA fragments using yeast.

    Science.gov (United States)

    Raymond, Christopher K; Sims, Elizabeth H; Olson, Maynard V

    2002-01-01

    The homologous recombination pathway in yeast is an ideal tool for the sequence-specific assembly of plasmids. Complementary 80-nucleotide oligonucleotides that overlap a vector and a target fragment were found to serve as efficient recombination linkers for fragment subcloning. Using electroporation, single-stranded 80-mers were adequate for routine plasmid construction. A cycloheximide-based counterselection was introduced to increase the specificity of cloning by homologous recombination relative to nonspecific vector background. Reconstruction experiments suggest this counterselection increased cloning specificity by 100-fold. Cycloheximide counterselection was used in conjunction with 80-bp linkers to subclone targeted regions from bacterial artificial chromosomes. This technology may find broad application in the final stages of completing the Human Genome Sequencing Project and in applications of BAC clones to the functional analysis of complex genomes.

  6. Connecting two proteins using a fusion alpha helix stabilized by a chemical cross linker

    Science.gov (United States)

    Jeong, Woo Hyeon; Lee, Haerim; Song, Dong Hyun; Eom, Jae-Hoon; Kim, Sun Chang; Lee, Hee-Seung; Lee, Hayyoung; Lee, Jie-Oh

    2016-03-01

    Building a sophisticated protein nano-assembly requires a method for linking protein components in a predictable and stable structure. Most of the cross linkers available have flexible spacers. Because of this, the linked hybrids have significant structural flexibility and the relative structure between their two components is largely unpredictable. Here we describe a method of connecting two proteins via a `fusion α helix' formed by joining two pre-existing helices into a single extended helix. Because simple ligation of two helices does not guarantee the formation of a continuous helix, we used EY-CBS, a synthetic cross linker that has been shown to react selectively with cysteines in α-helices, to stabilize the connecting helix. Formation and stabilization of the fusion helix was confirmed by determining the crystal structures of the fusion proteins with and without bound EY-CBS. Our method should be widely applicable for linking protein building blocks to generate predictable structures.

  7. Effect of substitution of photo-cross-linker in photochemical cytosine to uracil transition in DNA.

    Science.gov (United States)

    Sethi, Siddhant; Takashima, Yasuharu; Nakamura, Shigetaka; Fujimoto, Kenzo

    2017-08-15

    Genome editing is an important technique for protein engineering, treatment of genetic disorders, and production of non-native proteins. A shortcoming of current enzymatic and chemical methods for genome editing is their limited applicability for in vivo studies. In addition, non-enzymatic methods, such as photochemical DNA editing using 3-cyanovinylcarbazole ( CNV K), require high temperatures to affect cytosine to uracil transformations. To overcome this limitation, we developed new photo-cross-linkers based on CNV K, 3-methoxycarbonlycarbazole, 3-carboxyvinylcarbazole, and 3-carbonylamidevinylcarbazole. The use of 3-carboxyvinylcarbazole resulted in greater acceleration of the deamination reaction than that achieved with CNV K. The most likely factors affecting the ability of ultrafast photo-responsive nucleosides to accelerate the deamination reaction are polarity and hydrophilicity of the oligodeoxyribonucleotides that contain photo-cross-linker. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. The H1 linker histones: multifunctional proteins beyond the nucleosomal core particle.

    Science.gov (United States)

    Hergeth, Sonja P; Schneider, Robert

    2015-11-01

    The linker histone H1 family members are a key component of chromatin and bind to the nucleosomal core particle around the DNA entry and exit sites. H1 can stabilize both nucleosome structure and higher-order chromatin architecture. In general, H1 molecules consist of a central globular domain with more flexible tail regions at both their N- and C-terminal ends. The existence of multiple H1 subtypes and a large variety of posttranslational modifications brings about a considerable degree of complexity and makes studying this protein family challenging. Here, we review recent progress in understanding the function of linker histones and their subtypes beyond their role as merely structural chromatin components. We summarize current findings on the role of H1 in heterochromatin formation, transcriptional regulation and embryogenesis with a focus on H1 subtypes and their specific modifications. © 2015 The Authors.

  9. Destabilization of the Outer and Inner Mitochondrial Membranes by Core and Linker Histones

    Science.gov (United States)

    Cascone, Annunziata; Bruelle, Celine; Lindholm, Dan; Bernardi, Paolo; Eriksson, Ove

    2012-01-01

    Background Extensive DNA damage leads to apoptosis. Histones play a central role in DNA damage sensing and may mediate signals of genotoxic damage to cytosolic effectors including mitochondria. Methodology/Principal Findings We have investigated the effects of histones on mitochondrial function and membrane integrity. We demonstrate that both linker histone H1 and core histones H2A, H2B, H3, and H4 bind strongly to isolated mitochondria. All histones caused a rapid and massive release of the pro-apoptotic intermembrane space proteins cytochrome c and Smac/Diablo, indicating that they permeabilize the outer mitochondrial membrane. In addition, linker histone H1, but not core histones, permeabilized the inner membrane with a collapse of the membrane potential, release of pyridine nucleotides, and mitochondrial fragmentation. Conclusions We conclude that histones destabilize the mitochondrial membranes, a mechanism that may convey genotoxic signals to mitochondria and promote apoptosis following DNA damage. PMID:22523586

  10. Linker histones: novel insights into structure-specific recognition of the nucleosome.

    Science.gov (United States)

    Cutter, Amber R; Hayes, Jeffrey J

    2017-04-01

    Linker histones (H1s) are a primary component of metazoan chromatin, fulfilling numerous functions, both in vitro and in vivo, including stabilizing the wrapping of DNA around the nucleosome, promoting folding and assembly of higher order chromatin structures, influencing nucleosome spacing on DNA, and regulating specific gene expression. However, many molecular details of how H1 binds to nucleosomes and recognizes unique structural features on the nucleosome surface remain undefined. Numerous, confounding studies are complicated not only by experimental limitations, but the use of different linker histone isoforms and nucleosome constructions. This review summarizes the decades of research that has resulted in several models of H1 association with nucleosomes, with a focus on recent advances that suggest multiple modes of H1 interaction in chromatin, while highlighting the remaining questions.

  11. AAS 228: Day 1 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session: From Space Archeology to Serving the World Today: A 20-year Journey from the Jungles of Guatemala to a Network of Satellite Remote Sensing Facilities Around the World(by Michael Zevin)In the conferences second plenary session, NASAs Daniel Irwin turned the eyes of the conference back to Earth by highlighting the huge impact that NASA missions play in protecting and developing our own planet.Daniel Irwin: using satellite imagery to detect differences in vegetation and find ancient Mayan cities. #aas228 pic.twitter.com/9LFPQdCHTM astrobites (@astrobites) June 13, 2016Irwin came to be involved in NASA through his work mapping Guatemalan jungles, where he would spend 22 days at a time exploring the treacherous jungles on foot armed with a 1st generation GPS, a compass, and a machete. A colleague introduced Irwin to the satellite imagery thathe was exploring, demonstratinghow these images are a strong complement to field work. The sharing of this satellite data with nearby villages helped to show the encroachment of agriculture and the necessity of connecting space to the village. Satellite imagery also played a role in archeological endeavors, uncovering dozens of Mayan cities that have been buried for over a millennia by vegetation, and it provided evidence that the fall of the Mayan civilization may have been due to massive deforestation that ledto drought.Glacial retreat in Chile imaged by ISERV.Irwin displayed the constellation of NASAs Earth-monitoring satellites that have played an integral role in conserving our planet and alerting the world of natural disasters. He also showed

  12. Magnetic horn of the Antiproton Accumulator (AA)

    CERN Multimedia

    Photographic Service

    1988-01-01

    In the 1960s, the invention of this "current sheet lens" has helped to greatly improve the flux of neutrino beams. It was used again at the AA, collecting antiprotons from the production target at angles too large to fit into the acceptance of the AA. It was machined from aluminium to a thickness of 1.4 mm and pulsed at 400 kA for 15 microseconds (half-sine).

  13. Construction of Multivalent Homo- and Heterofunctional ABO Blood Group Glycoconjugates Using a Trifunctional Linker Strategy.

    Science.gov (United States)

    Daskhan, Gour Chand; Tran, Hanh-Thuc Ton; Meloncelli, Peter J; Lowary, Todd L; West, Lori J; Cairo, Christopher W

    2018-02-21

    The design and synthesis of multivalent ligands displaying complex oligosaccharides is necessary for the development of therapeutics, diagnostics, and research tools. Here, we report an efficient conjugation strategy to prepare complex glycoconjugates with 4 copies of 1 or 2 separate glycan epitopes, providing 4-8 carbohydrate residues on a tetravalent poly(ethylene glycol) scaffold. This strategy provides complex glycoconjugates that approach the size of glycoproteins (15-18 kDa) while remaining well-defined. The synthetic strategy makes use of three orthogonal functional groups, including a reactive N-hydroxysuccinimide (NHS)-ester moiety on the linker to install the first carbohydrate epitope via reaction with an amine. A masked amine functionality on the linker is revealed after the removal of a fluorenylmethyloxycarbonyl (Fmoc)-protecting group, allowing the attachment to the NHS-activated poly(ethylene glycol) (PEG) scaffold. An azide group in the linker was then used to incorporate the second carbohydrate epitope via catalyzed alkyne-azide cycloaddition. Using a known tetravalent PEG scaffold (PDI, 1.025), we prepared homofunctional glycoconjugates that display four copies of lactose and the A-type II or the B-type II human blood group antigens. Using our trifunctional linker, we expanded this strategy to produce heterofunctional conjugates with four copies of two separate glycan epitopes. These heterofunctional conjugates included Neu5Ac, 3'-sialyllactose, or 6'-sialyllactose as a second antigen. Using an alternative strategy, we generated heterofunctional conjugates with three copies of the glycan epitope and one fluorescent group (on average) using a sequential dual-amine coupling strategy. These conjugation strategies should be easily generalized for conjugation of other complex glycans. We demonstrate that the glycan epitopes of heterofunctional conjugates engage and cluster target B-cell receptors and CD22 receptors on B cells, supporting the

  14. Expression of a linker histone-like gene in the primordial germ cells in zebrafish

    OpenAIRE

    Müller, Katja; Thisse, Christine; Thisse, Bernard; Raz, Erez

    2002-01-01

    Similar to many other organisms, specification of primordial germ cells (PGCs) in zebraftsh occurs during early development and depends on inheritance of 'germ plasm' determinants. Following their specification, the PGCs exhibit characteristic transcriptional profile and cell behaviour. Here we describe the cloning, expression pattern and sub-cellular localization of the zebrafish H I type linker histone, HIM, which is specifically expressed in the PGCs in the second phase of their developmen...

  15. Lipid membrane editing with peptide cargo linkers in cells and synthetic nanostructures

    Science.gov (United States)

    Pan, Hua; Myerson, Jacob W.; Ivashyna, Olena; Soman, Neelesh R.; Marsh, Jon N.; Hood, Joshua L.; Lanza, Gregory M.; Schlesinger, Paul H.; Wickline, Samuel A.

    2010-01-01

    Current strategies for deploying synthetic nanocarriers involve the creation of agents that incorporate targeting ligands, imaging agents, and/or therapeutic drugs into particles as an integral part of the formulation process. Here we report the development of an amphipathic peptide linker that enables postformulation editing of payloads without the need for reformulation to achieve multiplexing capability for lipidic nanocarriers. To exemplify the flexibility of this peptide linker strategy, 3 applications were demonstrated: converting nontargeted nanoparticles into targeting vehicles; adding cargo to preformulated targeted nanoparticles for in vivo site-specific delivery; and labeling living cells for in vivo tracking. This strategy is expected to enhance the clinical application of molecular imaging and/or targeted therapeutic agents by offering extended flexibility for multiplexing targeting ligands and/or drug payloads that can be selected after base nanocarrier formulation.—Pan, H., Myerson, J. W., Ivashyna, O., Soman, N. R., Marsh, J. N., Hood, J. L., Lanza, G. M., Schlesinger, P. H., Wickline, S. A.. Lipid membrane editing with peptide cargo linkers in cells and synthetic nanostructures. PMID:20335225

  16. Bifunctional bridging linker-assisted synthesis and characterization of TiO{sub 2}/Au nanocomposites

    Energy Technology Data Exchange (ETDEWEB)

    Žunič, Vojka, E-mail: vojka.zunic@ijs.si, E-mail: vojka13@gmail.com; Kurtjak, Mario; Suvorov, Danilo [Jožef Stefan Institute, Advanced Materials Department (Slovenia)

    2016-11-15

    Using a simple organic bifunctional bridging linker, titanium dioxide (TiO{sub 2}) nanoparticles were coupled with the Au nanoparticles to form TiO{sub 2}/Au nanocomposites with a variety of Au loadings. This organic bifunctional linker, meso-2,3-dimercaptosuccinic acid, contains two types of functional groups: (i) the carboxyl group, which enables binding to the TiO{sub 2}, and (ii) the thiol group, which enables binding to the Au. In addition, the organic bifunctional linker acts as a stabilizing agent to prevent the agglomeration and growth of the Au particles, resulting in the formation of highly dispersed Au nanoparticles. To form the TiO{sub 2}/Au nanocomposites in a simple way, we deliberately applied a synthetic method that simultaneously ensures: (i) the capping of the Au nanoparticles and (ii) the binding of different amounts of Au to the TiO{sub 2}. The TiO{sub 2}/Au nanocomposites formed with this method show enhanced UV and Vis photocatalytic activities when compared to the pure TiO{sub 2} nanopowders.Graphical Abstract.

  17. Linker proteins enable ultrafast excitation energy transfer in the phycobilisome antenna system of Thermosynechococcus vulcanus.

    Science.gov (United States)

    Nganou, C; David, L; Adir, N; Mkandawire, M

    2016-01-01

    We applied a femtosecond flash method, using induced transient absorption changes, to obtain a time-resolved view of excitation energy transfer in intact phycobilisomes of Thermosynechococcus vulcanus at room temperature. Our measurement of an excitation energy transfer rate of 888 fs in phycobilisomes shows the existence of ultrafast kinetics along the phycocyanin rod subcomplex to the allophycocyanin core that is faster than expected for previous excitation energy transfer based on Förster theory in phycobilisomes. Allophycocyanin in the core further transfers energy to the terminal emitter(s) in 17 ps. In the phycobilisome, rod doublets composed of hexameric phycocyanin discs and internal linker proteins are arranged in a parallel fashion, facilitating direct rod-rod interactions. Excitonic splitting likely drives rod absorption at 635 nm as a result of strong coupling between β84 chromophores (20 ± 1 Å) in adjacent hexamers. In comparison to the absorbance of the phycobilisome antenna system of the cyanobacterium Acaryochloris marina, which possesses a single rod structure, the linkers in T. vulcanus rods induce a 17 nm red shift in the absorbance spectrum. Furthermore, the kinetics of 888 fs indicates that the presence of the linker protein induces ultrafast excitation energy transfer between phycocyanin and allophycocyanin inside the phycobilisome, which is faster than all previous excitation energy transfer in phycobilisome subunits or sub-complexes reported to date.

  18. Efficient Naphthalenediimide-Based Hole Semiconducting Polymer with Vinylene Linkers between Donor and Acceptor Units

    KAUST Repository

    Zhang, Lei

    2016-11-04

    We demonstrate a new method to reverse the polarity and charge transport behavior of naphthalenediimide (NDI)-based copolymers by inserting a vinylene linker between the donor and acceptor units. The vinylene linkers minimize the intrinsic steric congestion between the NDI and thiophene moieties to prompt backbone planarity. The polymers with vinylene linkers exhibit electron n-channel transport characteristics under vacuum, similar to the benchmark polymer, P(NDI2OD-T2). To our surprise, when the polymers are measured in air, the dominant carrier type switches from n- to p-type and yield hole mobilities up to 0.45 cm(2) s(-1) with hole to electron mobility ratio of three (mu(h)/mu(e), similar to 3), which indicates that the hole density in the active layer can be significantly increased by exposure to air. This increase is consistent with the intrinsic more delocalized nature of the highest occupied molecular orbital of the charged vinylene polymer, as estimated by density functional theory (DFT) calculations, which facilitates hole transport within the polymer chains. This is the first demonstration of an efficient NDI-based hole semiconducting polymer, which will enable new developments in all-polymer solar cells, complementary circuits, and dopable polymers for use in thermoelectrics.

  19. SEVA Linkers: A Versatile and Automatable DNA Backbone Exchange Standard for Synthetic Biology.

    Science.gov (United States)

    Kim, Se Hyeuk; Cavaleiro, Ana Mafalda; Rennig, Maja; Nørholm, Morten H H

    2016-10-21

    DNA vectors serve to maintain and select recombinant DNA in cell factories, and as design complexity increases, there is a greater need for well-characterized parts and methods for their assembly. Standards in synthetic biology are top priority, but standardizing molecular cloning contrasts flexibility, and different researchers prefer and master different molecular technologies. Here, we describe a new, highly versatile and automatable standard "SEVA linkers" for vector exchange. SEVA linkers enable backbone swapping with 20 combinations of classical enzymatic restriction/ligation, Gibson isothermal assembly, uracil excision cloning, and a nicking enzyme-based methodology we term SEVA cloning. SEVA cloning is a simplistic one-tube protocol for backbone swapping directly from plasmid stock solutions. We demonstrate the different performance of 30 plasmid backbones for small molecule and protein production and obtain more than 10-fold improvement from a four-gene biosynthetic pathway and 430-fold improvement with a difficult-to-express membrane protein. The standardized linkers and protocols add to the Standard European Vectors Architecture (SEVA) resource and are freely available to the synthetic biology community.

  20. The Swedish mutant barley collection

    International Nuclear Information System (INIS)

    1989-01-01

    Full text: The Swedish mutation research programme in barley began about 50 years ago and has mainly been carried out at Svaloev in co-operation with the institute of Genetics at the University of Lund. The collection has been produced from different Swedish high-yielding spring barley varieties, using the following mutagens: X-rays, neutrons, several organic chemical compounds such as ethyleneimine, several sulfonate derivatives and the inorganic chemical mutagen sodium azide. Nearly 10,000 barley mutants are stored in the Nordic Gene Bank and documented in databases developed by Udda Lundquist, Svaloev AB. The collection consists of the following nine categories with 94 different types of mutants: 1. Mutants with changes in the spike and spikelets; 2. Changes in culm length and culm composition; 3. Changes in growth types; 4. Physiological mutants; 5. Changes in awns; 6. Changes in seed size and shape; 7. Changes in leaf blades; 8. Changes in anthocyanin and colour; 9. Resistance to barley powdery mildew. Barley is one of the most thoroughly investigated crops in terms of induction of mutations and mutation genetics. So far, about half of the mutants stored at the Nordic Gene Bank, have been analysed genetically; They constitute, however, only a minority of the 94 different mutant types. The genetic analyses have given valuable insights into the mutation process but also into the genetic architecture of various characters. A number of mutants of two-row barley have been registered and commercially released. One of the earliest released, Mari, an early maturing, daylength neutral, straw stiff mutant, is still grown in Iceland. The Swedish mutation material has been used in Sweden, but also in other countries, such as Denmark, Germany, and USA, for various studies providing a better understanding of the barley genome. The collection will be immensely valuable for future molecular genetical analyses of clone mutant genes. (author)

  1. Onset of grain filling is associated with a change in properties of linker histone variants in maize kernels

    DEFF Research Database (Denmark)

    Kalamajka, R.; Finnie, Christine; Grasser, K.D.

    2010-01-01

    ) initiation of storage synthesis. Six linker histone gene products were identified by MALDI-TOF mass spectrometry. A marked shift of around 4 pH units was observed for the linker histone spot pattern after 2D-gel electrophoresis when comparing the proteins of 11 and 16 dap kernels. The shift from acidic......, the linker histones isolated from 16 dap kernels consistently displayed a lower affinity for DNA than the proteins isolated from 11 dap kernels. These findings suggest that the affinity for DNA of the linker histones may be regulated by post-translational modification and that the reduction in DNA affinity...... could be involved in a more open chromatin during storage synthesis....

  2. Effects of Site-Mutations Within the 22 kDa No-Core Fragment of the Vip3Aa11 Insecticidal Toxin of Bacillus thuringiensis.

    Science.gov (United States)

    Liu, Ming; Liu, Rongmei; Luo, Guoxing; Li, Haitao; Gao, Jiguo

    2017-05-01

    Bacillus thuringiensis vegetative insecticidal proteins (VIPs) are not homologous to other known Cry proteins, and they act against lepidopteran larvae via a unique process. All reported studies on the mode of action of Vip3 proteins have been performed on the Vip3A family, mostly on the Vip3Aa subfamily. Vip3Aa proteins are activated by midgut proteases, and they cross the peritrophic membrane and bind specific proteins in apical membrane epithelial midgut cells, which results in pore formation and, eventually, death to the insects. Some studies of trypsin-activated protein (core fragment) and the full-length protein show differences in mortality on the same insect species. The N-terminus of Vip3A proteins is responsible for the translocation of the protein across the cell membrane. To determine whether the N-terminus of Vip3Aa11 proteins contribute to insecticidal activity, we exchanged Vip3Aa11 residues with Vip3Aa39 no-core fragment residues using site-directed mutagenesis. Bioassays showed that the toxicity of S9N, S193T, and S194L mutants displayed approximately one- and twofold increases in toxicity against Helicoverpa armigera. Mutant protein R115H demonstrated a threefold decrease in toxicity. This work serves as a guideline for the study of the Vip3Aa11 no-core fragment protein insecticidal mechanism.

  3. Synthesis and characterization of a linker for primary amines used in the solid phase organic synthesis of spermidine

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Emerson T. da; San Gil, Rosane A.S.; Lima, Edson L.S. [Universidade Federal do Rio de Janeiro (IQ/UFRJ), RJ (Brazil). Inst. de Quimica; Caldarelli, Stefano [Aix-Marseille Univ., Marseille (France). Campus de Saint Jerome; Ziarelli, Fabio [Aix-Marseille Universite Spectropole - Federation de Sciences Chimiques de Marseille, Campus de Saint Jerome (France)

    2011-07-01

    A linker resin for the synthesis of functionalized spermidine in good yield is described, along with its characterization by infrared (IR), {sup 13}C solid-state nuclear magnetic resonance with cross polarization and magic angle spinning ({sup 13}C CPMAS NMR) and {sup 1}H high resolution magic angle spinning nuclear magnetic resonance ({sup 1}H HRMAS NMR). This linker has been regenerated after cleavage of spermidine and re-used without loss of efficiency. (author)

  4. Mixed-linker zeolitic imidazolate framework mixed-matrix membranes for aggressive CO2 separation from natural gas

    KAUST Repository

    Thompson, Joshua A.

    2014-07-01

    Zeolitic imidazolate framework (ZIF) materials are a promising subclass of metal-organic frameworks (MOF) for gas separations. However, due to the deleterious effects of gate-opening phenomena associated with organic linker rotation near the limiting pore apertures of ZIFs, there have been few demonstrations of improved gas separation properties over pure polymer membranes when utilizing ZIF materials in composite membranes for CO2-based gas separations. Here, we report a study of composite ZIF/polymer membranes, containing mixed-linker ZIF materials with ZIF-8 crystal topologies but composed of different organic linker compositions. Characterization of the mixed-linker ZIFs shows that the mixed linker approach offers control over the porosity and pore size distribution of the materials, as determined from nitrogen physisorption and Horváth-Kawazoe analysis. Single gas permeation measurements on mixed-matrix membranes reveal that inclusion of mixed-linker ZIFs yields membranes with better ideal CO2/CH4 selectivity than membranes containing ZIF-8. This improvement is shown to likely occur from enhancement in the diffusion selectivity of the membranes associated with controlling the pore size distribution of the ZIF filler. Mixed-gas permeation experiments show that membranes with mixed-linker ZIFs display an effective plasticization resistance that is not typical of the pure polymeric matrix. Overall, we demonstrate that mixed-linker ZIFs can improve the gas separation properties in composite membranes and may be applicable to aggressive CO2 concentrations in natural gas feeds. © 2013 Elsevier Inc. All rights reserved.

  5. Effect of supplementation of arachidonic acid (AA) or a combination of AA plus docosahexaenoic acid on breastmilk fatty acid composition

    NARCIS (Netherlands)

    Smit, EN; Koopmann, M; Boersma, ER; Muskiet, FAJ

    We investigated whether supplementation with arachidonic acid (20:4 omega 6; AA), ora combination of AA and docosahexaenoic acid (22:6 omega 3; DHA) would affect human milk polyunsaturated fatty acid (PUFA) composition. Ten women were daily supplemented with 300 mg AA, eight with 300 mg AA, 110 mg

  6. Rapid One-Pot Microwave Synthesis of Mixed-Linker Hybrid Zeolitic-Imidazolate Framework Membranes for Tunable Gas Separations.

    Science.gov (United States)

    Hillman, Febrian; Brito, Jordan; Jeong, Hae-Kwon

    2018-02-14

    The relatively slow and complex fabrication processes of polycrystalline metal-organic framework (MOF) membranes often times restrict their way to commercialization, despite their potential for molecular separation applications. Herein, we report a rapid one-pot microwave synthesis of mixed-linker hybrid zeolitic-imidazolate framework (ZIF) membranes consisting of 2-methylimidazolate (ZIF-8 linker) and benzimidazolate (ZIF-7 linker) linkers, termed ZIF-7-8 membranes. The fast-volumetric microwave heating in conjunction with a unique counter diffusion of metal and linker solutions enabled unprecedented rapid synthesis of well-intergrown ZIF-7-8 membranes in ∼90 s, the fastest MOF membrane preparation up to date. Furthermore, we were able to tune the molecular sieving properties of the ZIF-7-8 membranes by varying the benzimidazole-to-2-methylimidazole (bIm-to-mIm) linker ratio in the hybrid frameworks. The tuning of their molecular sieving properties led to the systematic change in the permeance and selectivity of various small gases. The unprecedented rapid synthesis of well-intergrown ZIF-7-8 membranes with tunable molecular sieving properties is an important step forward for the commercial gas separation applications of ZIF membranes.

  7. Obesity is a significant susceptibility factor for idiopathic AA amyloidosis.

    Science.gov (United States)

    Blank, Norbert; Hegenbart, Ute; Dietrich, Sascha; Brune, Maik; Beimler, Jörg; Röcken, Christoph; Müller-Tidow, Carsten; Lorenz, Hanns-Martin; Schönland, Stefan O

    2018-01-24

    To investigate obesity as susceptibility factor in patients with idiopathic AA amyloidosis. Clinical, biochemical and genetic data were obtained from 146 patients with AA amyloidosis. Control groups comprised 40 patients with long-standing inflammatory diseases without AA amyloidosis and 56 controls without any inflammatory disease. Patients with AA amyloidosis had either familial Mediterranean fever (FMF) or long-standing rheumatic diseases as underlying inflammatory disease (n = 111, median age 46 years). However, in a significant proportion of patients with AA amyloidosis no primary disease was identified (idiopathic AA; n = 37, median age 60 years). Patients with idiopathic AA amyloidosis were more obese and older than patients with AA amyloidosis secondary to FMF or rheumatic diseases. Serum leptin levels correlated with the body mass index (BMI) in all types of AA amyloidosis. Elevated leptin levels of more than 30 µg/l were detected in 18% of FMF/rheumatic + AA amyloidosis and in 40% of patients with idiopathic AA amyloidosis (p = .018). Finally, the SAA1 polymorphism was confirmed as a susceptibility factor for AA amyloidosis irrespective of the type of the disease. Obesity, age and the SAA1 polymorphism are susceptibility factors for idiopathic AA amyloidosis. Recent advances in treatment of FMF and rheumatic disorders will decrease the incidence of AA amyloidosis due to these diseases. Idiopathic AA, however, might be an emerging problem in the ageing and increasingly obese population.

  8. Loss of the chromatin modifier Kdm2aa causes BrafV600E-independent spontaneous melanoma in zebrafish.

    Directory of Open Access Journals (Sweden)

    Catherine M Scahill

    2017-08-01

    Full Text Available KDM2A is a histone demethylase associated with transcriptional silencing, however very little is known about its in vivo role in development and disease. Here we demonstrate that loss of the orthologue kdm2aa in zebrafish causes widespread transcriptional disruption and leads to spontaneous melanomas at a high frequency. Fish homozygous for two independent premature stop codon alleles show reduced growth and survival, a strong male sex bias, and homozygous females exhibit a progressive oogenesis defect. kdm2aa mutant fish also develop melanomas from early adulthood onwards which are independent from mutations in braf and other common oncogenes and tumour suppressors as revealed by deep whole exome sequencing. In addition to effects on translation and DNA replication gene expression, high-replicate RNA-seq in morphologically normal individuals demonstrates a stable regulatory response of epigenetic modifiers and the specific de-repression of a group of zinc finger genes residing in constitutive heterochromatin. Together our data reveal a complex role for Kdm2aa in regulating normal mRNA levels and carcinogenesis. These findings establish kdm2aa mutants as the first single gene knockout model of melanoma biology.

  9. AAS 228: Day 2 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  10. Mutants of alfalfa mosaic virus

    International Nuclear Information System (INIS)

    Roosien, J.

    1983-01-01

    In this thesis the isolation and characterization of a number of mutants of alfalfa mosaic virus, a plant virus with a coat protein dependent genome, is described. Thermo-sensitive (ts) mutants were selected since, at least theoretically, ts mutations can be present in all virus coded functions. It was found that a high percentage of spontaneous mutants, isolated because of their aberrant symptoms, were ts. The majority of these isolates could grow at the non-permissive temperature in the presence of a single wild type (wt) component. To increase the mutation rate virus preparations were treated with several mutagens. After nitrous acid treatment or irradiation with ultraviolet light, an increase in the level of mutations was observed. UV irradiation was preferred since it did not require large amounts of purified viral components. During the preliminary characterization of potential ts mutants the author also obtained one structural and several symptom mutants which were analysed further (chapter 7, 8 and 9). The properties of the ts mutants are described in chapter 3-7. (Auth.)

  11. The AA disappearing under concrete shielding

    CERN Multimedia

    CERN PhotoLab

    1982-01-01

    When the AA started up in July 1980, the machine stood freely in its hall, providing visitors with a view through the large window in the AA Control Room. The target area, in which the high-intensity 26 GeV/c proton beam from the PS hit the production target, was heavily shielded, not only towards the outside but also towards the AA-Hall. However, electrons and pions emanating from the target with the same momentum as the antiprotons, but much more numerous, accompanied these through the injection line into the AA ring. The pions decayed with a half-time corresponding to approximately a revolution period (540 ns), whereas the electrons lost energy through synchrotron radiation and ended up on the vacuum chamber wall. Electrons and pions produced the dominant component of the radiation level in the hall and the control room. With operation times far exceeding original expectations, the AA had to be buried under concrete shielding in order to reduce the radiation level by an order of magnitude.

  12. AAS 228: Day 2 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  13. Detection of AA76, a Common Form of Amyloid A Protein, as a Way of Diagnosing AA Amyloidosis.

    Science.gov (United States)

    Sato, Junji; Okuda, Yasuaki; Kuroda, Takeshi; Yamada, Toshiyuki

    2016-01-01

    Reactive amyloid deposits consist of amyloid A (AA) proteins, the degradation products of serum amyloid A (SAA). Since the most common species of AA is the amino terminal portion produced by cleavage between residues 76 and 77 of SAA (AA76), the presence of AA76 in tissues could be a consequence of AA amyloid deposition. This study assessed the diagnostic significance of the detection of AA76 for AA amyloidosis using two different approaches. Biopsy specimens (n=130 from 54 subjects) from gastroduodenal mucosa or abdominal fat (n=9 from 9 subjects) of patients who had already been diagnosed with or were suspected of having AA amyloidosis were used. Fixed mucosal sections were subjected to immunohistochemistry using a newly developed antibody recognizing the carboxyl terminal end of AA76 (anti-AA76). The non-fixed materials from gastroduodenal mucosa or abdominal fat were subjected to immunoblotting for detection of the size of AA76. Among the gastroduodenal specimens (n=115) from already diagnosed patients, the positive rates of Congo red staining, immunohistochemistry using anti-AA76, and immunoblotting were 68.4%, 73.0%, and 92.2%, respectively. The anti-AA76 did not stain the supposed SAA in the blood or leakage, which was stained by anti-SAA antibody. AA76 was not detected either by immunohistochemistry or by immunoblot in the materials from patients in whom AA amyloidosis had been ruled out. In the abdominal fat, the immunoblot detected AA76 in 8 materials from 8 already diagnosed patients and did not in 1 patient whose gastroduodenal mucosa was negative. In conclusion, the detection of AA76 may alter the ability to diagnose AA amyloidosis. In immunohistochemistry for fixed specimens, the new anti-AA76 antibody can improve the specificity. Immunoblot for non-fixed materials, which can considerably improve the sensitivity, should be beneficial for small materials like abdominal fat. © 2016 by the Association of Clinical Scientists, Inc.

  14. A Novel MS-Cleavable Azo Cross-Linker for Peptide Structure Analysis by Free Radical Initiated Peptide Sequencing (FRIPS)

    Science.gov (United States)

    Iacobucci, Claudio; Hage, Christoph; Schäfer, Mathias; Sinz, Andrea

    2017-10-01

    The chemical cross-linking/mass spectrometry (MS) approach is a growing research field in structural proteomics that allows gaining insights into protein conformations. It relies on creating distance constraints between cross-linked amino acid side chains that can further be used to derive protein structures. Currently, the most urgent task for designing novel cross-linking principles is an unambiguous and automated assignment of the created cross-linked products. Here, we introduce the homobifunctional, amine-reactive, and water soluble cross-linker azobisimidoester (ABI) as a prototype of a novel class of cross-linkers. The ABI-linker possesses an innovative modular scaffold combining the benefits of collisional activation lability with open shell chemistry. This MS-cleavable cross-linker can be efficiently operated via free radical initiated peptide sequencing (FRIPS) in positive ionization mode. Our proof-of-principle study challenges the gas phase behavior of the ABI-linker for the three amino acids, lysine, leucine, and isoleucine, as well as the model peptide thymopentin. The isomeric amino acids leucine and isoleucine could be discriminated by their characteristic side chain fragments. Collisional activation experiments were conducted via positive electrospray ionization (ESI) on two Orbitrap mass spectrometers. The ABI-mediated formation of odd electron product ions in MS/MS and MS3 experiments was evaluated and compared with a previously described azo-based cross-linker. All cross-linked products were amenable to automated analysis by the MeroX software, underlining the future potential of the ABI-linker for structural proteomics studies. [Figure not available: see fulltext.

  15. Molecular mechanism of the camptothecin resistance of Glu710Gly topoisomerase IB mutant analyzed in vitro and in silico.

    Science.gov (United States)

    Tesauro, Cinzia; Morozzo della Rocca, Blasco; Ottaviani, Alessio; Coletta, Andrea; Zuccaro, Laura; Arnò, Barbara; D'Annessa, Ilda; Fiorani, Paola; Desideri, Alessandro

    2013-09-03

    DNA topoisomerases are key enzymes that modulate the topological state of DNA through the breaking and rejoining of DNA strands. Human topoisomerase IB can be inhibited by several compounds that act through different mechanisms, including clinically used drugs, such as the derivatives of the natural compound camptothecin that reversibly bind the covalent topoisomerase-DNA complex, slowing down the religation of the cleaved DNA strand, thus inducing cell death. Three enzyme mutations, which confer resistance to irinotecan in an adenocarcinoma cell line, were recently identified but the molecular mechanism of resistance was unclear. The three resistant mutants have been investigated in S. cerevisiae model system following their viability in presence of increasing amounts of camptothecin. A systematical analysis of the different catalytic steps has been made for one of these mutants (Glu710Gly) and has been correlated with its structural-dynamical properties studied by classical molecular dynamics simulation. The three mutants display a different degree of camptothecin resistance in a yeast cell viability assay. Characterization of the different steps of the catalytic cycle of the Glu710Gly mutant indicated that its resistance is related to a high religation rate that is hardly affected by the presence of the drug. Analysis of the dynamic properties through simulation indicate that the mutant displays a much lower degree of correlation in the motion between the different protein domains and that the linker almost completely loses its correlation with the C-terminal domain, containing the active site tyrosine. These results indicate that a fully functional linker is required to confer camptothecin sensitivity to topoisomerase I since the destabilization of its structural-dynamical properties is correlated to an increase of religation rate and drug resistance.

  16. Cellular delivery and antisense effects of peptide nucleic acid conjugated to polyethyleneimine via disulfide linkers

    DEFF Research Database (Denmark)

    Berthold, Peter R; Shiraishi, Takehiko; Nielsen, Peter E

    2010-01-01

    Peptide nucleic acid (PNA) is potentially an attractive antisense and antigene agent for which more efficient cellular delivery systems are still warranted. The cationic polymer polyethylenimine (PEI) is commonly used for cellular transfection of DNA and RNA complexes, but is not readily applicable...... for PNA due to the (inherent) charge neutrality of PNA. However, PEI could function as an efficient scaffold for PNA via chemical conjugation. Accordingly, we modified PEI with the amine-reactive heterobifunctional linker agent N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP) (with and without a PEG...

  17. SEVA Linkers: A Versatile and Automatable DNA Backbone Exchange Standard for Synthetic Biology

    DEFF Research Database (Denmark)

    Kim, Se Hyeuk; Cavaleiro, Mafalda; Rennig, Maja

    2016-01-01

    DNA vectors serve to maintain and select recombinant DNA in cell factories, and as design complexity increases, there is a greater need for well-characterized parts and methods for their assembly. Standards in synthetic biology are top priority, but standardizing molecular cloning contrasts...... flexibility, and different researchers prefer and master different molecular technologies. Here, we describe a new, highly versatile and automatable standard “SEVA linkers” for vector exchange. SEVA linkers enable backbone swapping with 20 combinations of classical enzymatic restriction/ligation, Gibson...

  18. Dicty_cDB: FC-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA02 (Link to dictyBase) - - - Contig-U16527-1 FC-AA02Z (Li...nk to Original site) - - FC-AA02Z 458 - - - - Show FC-AA02 Library FC (Link to library) Clone ID FC-AA02 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA02Q.Seq.d/ Representative seq. ID FC-AA...02Z (Link to Original site) Representative DNA sequence >FC-AA02 (FC-AA02Q) /CSM/FC/FC-AA/FC-AA02Q.Seq.d/ XXXXXXXXXXCAAAAA...GGCTCCTGGTCCGGAAGGATTGGGTAATCATTTGAATTTCCTAC GTAACTGGGCTTGATCTTTGTAATTATTGATCATAAACGAGGAATTCCTTGTAAGCGTAA

  19. Dicty_cDB: FCL-AA04 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA04 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA04Z ...(Link to Original site) - - FCL-AA04Z 530 - - - - Show FCL-AA04 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA04Q.Seq.d/ Representative seq. ID FCL-AA...04Z (Link to Original site) Representative DNA sequence >FCL-AA04 (FCL-AA04Q) /CSM/FCL/FCL-AA/FCL-AA...04Q.Seq.d/ XXXXXXXXXXCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTTCAGTCAAAGAAATT AAAAGAGGTATGGTCGCTGGTGACTCCAAAAACGATCCACCACAAGAAA

  20. Dicty_cDB: FCL-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA03 (Link to dictyBase) - - - Contig-U15092-1 FCL-AA03E ...(Link to Original site) - - - - - - FCL-AA03E 627 Show FCL-AA03 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA03Q.Seq.d/ Representative seq. ID FCL-AA...03E (Link to Original site) Representative DNA sequence >FCL-AA03 (FCL-AA03Q) /CSM/FCL/FCL-AA/FCL-AA...03Q.Seq.d/ ACATAATGTTCCAAAAGAAAGCAATTGTTATTGATGGCAAAGGTCATTTGTTAGGTCGTT TAGCCTCCGTTGTTGCTAAATCCCTCCTCTCTGGTCAAAA

  1. Dicty_cDB: FCL-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA09 (Link to dictyBase) - - - Contig-U16453-1 FCL-AA09F ...(Link to Original site) FCL-AA09F 485 - - - - - - Show FCL-AA09 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ Representative seq. ID FCL-AA...09F (Link to Original site) Representative DNA sequence >FCL-AA09 (FCL-AA09Q) /CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ GACAA...AAGTAAATAAAACATGTCCGCAAGTAATAAAGATGACCAACTCATGAAAAATGAG TTCGAAAGTACCTACGACAAAATTGTCGATTCATTCGACAA

  2. Dicty_cDB: FCL-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA08 (Link to dictyBase) - - - Contig-U16200-1 FCL-AA08Z ...(Link to Original site) - - FCL-AA08Z 574 - - - - Show FCL-AA08 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA08Q.Seq.d/ Representative seq. ID FCL-AA...08Z (Link to Original site) Representative DNA sequence >FCL-AA08 (FCL-AA08Q) /CSM/FCL/FCL-AA/FCL-AA...08Q.Seq.d/ XXXXXXXXXXTCGAAGCCAAAGGTCGTCTCGAAGAAGAATTCCATCGCTCGTACCAACTC TGATCGTTCAAGAAAGAGACTCGAAGCTGAAA

  3. Dicty_cDB: FCL-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA10 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA10Z ...(Link to Original site) - - FCL-AA10Z 627 - - - - Show FCL-AA10 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA10Q.Seq.d/ Representative seq. ID FCL-AA...10Z (Link to Original site) Representative DNA sequence >FCL-AA10 (FCL-AA10Q) /CSM/FCL/FCL-AA/FCL-AA...10Q.Seq.d/ XXXXXXXXXXTAAACCAGGTATGGTCGTCACCTTTTGCCCCAGCTGGTCTCTCAACTGAA GTCAAATCAGTCGAAATGCATCACGAACAACTCCCAGAA

  4. Dicty_cDB: FC-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA01 (Link to dictyBase) - - - Contig-U15084-1 FC-AA01E (Li...nk to Original site) - - - - - - FC-AA01E 701 Show FC-AA01 Library FC (Link to library) Clone ID FC-AA01 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA01Q.Seq.d/ Representative seq. ID FC-AA...01E (Link to Original site) Representative DNA sequence >FC-AA01 (FC-AA01Q) /CSM/FC/FC-AA/FC-AA01Q.Seq.d/ GAGAAATATTTCTTATTAA...CAATTGCATGCGTTGTATTCAACCCAACATGGTGGAATATT ACAGCAAGAATGGAATATAATGCTAATAAATAACAACCATTTTCTTTACTTCCACAAA

  5. Dicty_cDB: FC-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA20 (Link to dictyBase) - - - Contig-U16455-1 FC-AA20Z (Li...nk to Original site) - - FC-AA20Z 607 - - - - Show FC-AA20 Library FC (Link to library) Clone ID FC-AA20 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA20Q.Seq.d/ Representative seq. ID FC-AA...20Z (Link to Original site) Representative DNA sequence >FC-AA20 (FC-AA20Q) /CSM/FC/FC-AA/FC-AA20Q.Seq....d/ XXXXXXXXXXCTTTGCCCCAGCTGGTCTCTCAACTGAAGTCAAATCAGTCGAAATGCATC ACGAACAACTCCCAGAAGCCCGTCCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTT CAGTCAA

  6. Dicty_cDB: FC-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA13 (Link to dictyBase) - - - Contig-U15674-1 FC-AA13Z (Li...nk to Original site) - - FC-AA13Z 528 - - - - Show FC-AA13 Library FC (Link to library) Clone ID FC-AA13 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA13Q.Seq.d/ Representative seq. ID FC-AA...13Z (Link to Original site) Representative DNA sequence >FC-AA13 (FC-AA13Q) /CSM/FC/FC-AA/FC-AA13Q.Seq.d/ XXXXXXXXXXAAAGCAAA...CTCGTGCTGGTCAACGTACCCGTTTCAAGGCTTTCGTCGTTG TTGGTGATCACAACGGTCATGTAGGTCTCGGTGTTAAATGCGCTAAGGAA

  7. Dicty_cDB: FCL-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA02 (Link to dictyBase) - - - Contig-U16560-1 FCL-AA02F ...(Link to Original site) FCL-AA02F 620 - - - - - - Show FCL-AA02 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ Representative seq. ID FCL-AA...02F (Link to Original site) Representative DNA sequence >FCL-AA02 (FCL-AA02Q) /CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ ATTAA...ATACAAAATACAAATACAAATAACAAATACTTTACTATAGCTTTTTTTTCTTATT TATTTCTCCAAATAATTTTTTAATATGCAAATCTTTGTTAAAA

  8. Dicty_cDB: FCL-AA24 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA24 (Link to dictyBase) - - - Contig-U16467-1 FCL-AA24E ...(Link to Original site) - - - - - - FCL-AA24E 779 Show FCL-AA24 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA24Q.Seq.d/ Representative seq. ID FCL-AA...24E (Link to Original site) Representative DNA sequence >FCL-AA24 (FCL-AA24Q) /CSM/FCL/FCL-AA/FCL-AA...24Q.Seq.d/ CTAGAAATTTCTAAACAATTATTTATTTGAAGAGGTTTTTTAAAAAAAGAAAAAAATCAG AGCATCCAAATAATAACCGCAGTAAGGGGGGGATGGTTGTTAA

  9. Dicty_cDB: FCL-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA20 (Link to dictyBase) - - - Contig-U15052-1 FCL-AA20E ...(Link to Original site) - - - - - - FCL-AA20E 1159 Show FCL-AA20 Library FCL (Link to library) Clone ID FCL-AA...L http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ Representative seq. ID FCL-AA...20E (Link to Original site) Representative DNA sequence >FCL-AA20 (FCL-AA20Q) /CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ AAAA...CATTTACAAATGATGACCACAGAAGATGTACAACCAATTGAAACTACCAAAGATGG TGTAGTAGTATTAAATTATAGCGATTTAATTGCAGGTAAA

  10. Dicty_cDB: FCL-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA15 (Link to dictyBase) - - - Contig-U16011-1 FCL-AA15Z ...(Link to Original site) - - FCL-AA15Z 442 - - - - Show FCL-AA15 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA15Q.Seq.d/ Representative seq. ID FCL-AA...15Z (Link to Original site) Representative DNA sequence >FCL-AA15 (FCL-AA15Q) /CSM/FCL/FCL-AA/FCL-AA...15Q.Seq.d/ XXXXXXXXXXCCATTCATCTGTCCAATCGATTGTCGTCGTGGTCTCTACAAGAATATCGT CTTATCTGGTGGTTCAACCATGTTTAAAGATTTTGGTAAACGTCTTCAA

  11. Dicty_cDB: FC-AA14 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA14 (Link to dictyBase) - - - Contig-U15088-1 FC-AA14E (Li...nk to Original site) - - - - - - FC-AA14E 431 Show FC-AA14 Library FC (Link to library) Clone ID FC-AA14 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA14Q.Seq.d/ Representative seq. ID FC-AA...14E (Link to Original site) Representative DNA sequence >FC-AA14 (FC-AA14Q) /CSM/FC/FC-AA/FC-AA14Q.Seq.d/ CTATGTCTGAAATCAAAA...CTGAAGAACTCGCTTGCATCTACTCCGGTCTTTTATTACAAG ATGACGGTATTGAAATCACCGCTGATAAAATCAAAACCTTATTAGAAGCTGCCAA

  12. Dicty_cDB: FC-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA09 (Link to dictyBase) - - - Contig-U15086-1 FC-AA09E (Li...nk to Original site) - - - - - - FC-AA09E 562 Show FC-AA09 Library FC (Link to library) Clone ID FC-AA09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA09Q.Seq.d/ Representative seq. ID FC-AA...09E (Link to Original site) Representative DNA sequence >FC-AA09 (FC-AA09Q) /CSM/FC/FC-AA/FC-AA09Q.Seq....d/ GATACATTATCACCATGGCAGGAAAAAAAGTCAAATCTAACACACCAAAACAAGACTTAT CTGTCTCTAAATCAAAGCTCACCAGCATTAAAGCCCCAGCTGCTGCCATCAAAGCTAAA

  13. Dicty_cDB: FCL-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA05 (Link to dictyBase) - - - Contig-U16473-1 FCL-AA05Z ...(Link to Original site) - - FCL-AA05Z 603 - - - - Show FCL-AA05 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA05Q.Seq.d/ Representative seq. ID FCL-AA...05Z (Link to Original site) Representative DNA sequence >FCL-AA05 (FCL-AA05Q) /CSM/FCL/FCL-AA/FCL-AA...05Q.Seq.d/ XXXXXXXXXXTGGCGCCATCATTACTGGTGGAGGTGGTGTTGCTATCACTCAAGCTCAAC CATCATACCAAGCTGATGCCGTTGCCACTTACATCAAAA

  14. Dicty_cDB: FC-AA19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA19 (Link to dictyBase) - - - Contig-U16072-1 FC-AA19F (Li...nk to Original site) FC-AA19F 539 - - - - - - Show FC-AA19 Library FC (Link to library) Clone ID FC-AA19 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA19Q.Seq.d/ Representative seq. ID FC-AA...19F (Link to Original site) Representative DNA sequence >FC-AA19 (FC-AA19Q) /CSM/FC/FC-AA/FC-AA19Q.Seq.d/ CAGAAA...TCACTGGTTTTTCATTCCAATTATTTAATATTATCAGTATTTGGAATGTTGATC AAACATCATTCAATAGCTACAGTCTTCCAATTTGGTTACCAGCCATTCAA

  15. Accurate distance determination of nucleic acids via Förster resonance energy transfer: implications of dye linker length and rigidity.

    Science.gov (United States)

    Sindbert, Simon; Kalinin, Stanislav; Nguyen, Hien; Kienzler, Andrea; Clima, Lilia; Bannwarth, Willi; Appel, Bettina; Müller, Sabine; Seidel, Claus A M

    2011-03-02

    In Förster resonance energy transfer (FRET) experiments, the donor (D) and acceptor (A) fluorophores are usually attached to the macromolecule of interest via long flexible linkers of up to 15 Å in length. This causes significant uncertainties in quantitative distance measurements and prevents experiments with short distances between the attachment points of the dyes due to possible dye-dye interactions. We present two approaches to overcome the above problems as demonstrated by FRET measurements for a series of dsDNA and dsRNA internally labeled with Alexa488 and Cy5 as D and A dye, respectively. First, we characterize the influence of linker length and flexibility on FRET for different dye linker types (long, intermediate, short) by analyzing fluorescence lifetime and anisotropy decays. For long linkers, we describe a straightforward procedure that allows for very high accuracy of FRET-based structure determination through proper consideration of the position distribution of the dye and of linker dynamics. The position distribution can be quickly calculated with geometric accessible volume (AV) simulations, provided that the local structure of RNA or DNA in the proximity of the dye is known and that the dye diffuses freely in the sterically allowed space. The AV approach provides results similar to molecular dynamics simulations (MD) and is fully consistent with experimental FRET data. In a benchmark study for ds A-RNA, an rmsd value of 1.3 Å is achieved. Considering the case of undefined dye environments or very short DA distances, we introduce short linkers with a propargyl or alkenyl unit for internal labeling of nucleic acids to minimize position uncertainties. Studies by ensemble time correlated single photon counting and single-molecule detection show that the nature of the linker strongly affects the radius of the dye's accessible volume (6-16 Å). For short propargyl linkers, heterogeneous dye environments are observed on the millisecond time scale. A

  16. Targeting ESR1-Mutant Breast Cancer

    Science.gov (United States)

    2015-09-01

    we have developed models of mutant ER driven cancer in which to characterize gene expression. Specifically, tetracycline inducible MCF7 cells that...expression profiling. Figure 1: Degradation of WT and mutant ER with ARN810. MCF7 cells stably transfected with tet-inducible WT and mutant...mutant ER. MCF7 cells stably transfected with tet- inducible WT and mutant ER are treated for 24 hours with estradiol and gene expression profiling

  17. AA, sandwich line with magnetic horn

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Continuation from 8010293: Finally, the sandwich line with the horn is placed on the ground, for the horn to be inspected and, if needed, exchanged for a new one. The whole procedure was trained with several members of the AA team, for quick and safe handling, and to share the radiation dose amongst them.

  18. Overall view of AA (Bld 193)

    CERN Multimedia

    1980-01-01

    See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  19. Overview of the Antiproton Accumulator (AA)

    CERN Multimedia

    1982-01-01

    See photo 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  20. Overall view of AA in Bld. 193

    CERN Multimedia

    1980-01-01

    See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  1. AA, mating of BST magnet halves

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    The AA had 2 types of bending magnets: BLG (window-frame,long and narrow) and BST (H-type, short and wide). The BST had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the mating of two BST halves.

  2. AA, vacuum tank for stochastic precooling

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    The vaccum tank in which the fast stochastic precooling kicker was installed. It is clad with heating jackets for bake-out to 200 deg C, indispensable for reaching the operational vacuum of 7E-11 Torr. Alain Poncet, responsible for AA vacuum, is looking on. See also 7910268, 8002234.

  3. Effective generation of transgenic pigs and mice by linker based sperm-mediated gene transfer.

    Directory of Open Access Journals (Sweden)

    Shih Ping Yao

    2002-04-01

    Full Text Available Abstract Background Transgenic animals have become valuable tools for both research and applied purposes. The current method of gene transfer, microinjection, which is widely used in transgenic mouse production, has only had limited success in producing transgenic animals of larger or higher species. Here, we report a linker based sperm-mediated gene transfer method (LB-SMGT that greatly improves the production efficiency of large transgenic animals. Results The linker protein, a monoclonal antibody (mAb C, is reactive to a surface antigen on sperm of all tested species including pig, mouse, chicken, cow, goat, sheep, and human. mAb C is a basic protein that binds to DNA through ionic interaction allowing exogenous DNA to be linked specifically to sperm. After fertilization of the egg, the DNA is shown to be successfully integrated into the genome of viable pig and mouse offspring with germ-line transfer to the F1 generation at a highly efficient rate: 37.5% of pigs and 33% of mice. The integration is demonstrated again by FISH analysis and F2 transmission in pigs. Furthermore, expression of the transgene is demonstrated in 61% (35/57 of transgenic pigs (F0 generation. Conclusions Our data suggests that LB-SMGT could be used to generate transgenic animals efficiently in many different species.

  4. Non-equilibrium fluctuations of a semi-flexible filament driven by active cross-linkers

    Science.gov (United States)

    Weber, I.; Appert-Rolland, C.; Schehr, G.; Santen, L.

    2017-11-01

    The cytoskeleton is an inhomogeneous network of semi-flexible filaments, which are involved in a wide variety of active biological processes. Although the cytoskeletal filaments can be very stiff and embedded in a dense and cross-linked network, it has been shown that, in cells, they typically exhibit significant bending on all length scales. In this work we propose a model of a semi-flexible filament deformed by different types of cross-linkers for which one can compute and investigate the bending spectrum. Our model allows to couple the evolution of the deformation of the semi-flexible polymer with the stochastic dynamics of linkers which exert transversal forces onto the filament. We observe a q-2 dependence of the bending spectrum for some biologically relevant parameters and in a certain range of wave numbers q, as observed in some experiments. However, generically, the spatially localized forcing and the non-thermal dynamics both introduce deviations from the thermal-like q-2 spectrum.

  5. Hybrid Zeolitic Imidazolate Frameworks: Controlling Framework Porosity and Functionality by Mixed-Linker Synthesis

    KAUST Repository

    Thompson, Joshua A.

    2012-05-22

    Zeolitic imidazolate frameworks (ZIFs) are a subclass of nanoporous metal-organic frameworks (MOFs) that exhibit zeolite-like structural topologies and have interesting molecular recognition properties, such as molecular sieving and gate-opening effects associated with their pore apertures. The synthesis and characterization of hybrid ZIFs with mixed linkers in the framework are described in this work, producing materials with properties distinctly different from the parent frameworks (ZIF-8, ZIF-90, and ZIF-7). NMR spectroscopy is used to assess the relative amounts of the different linkers included in the frameworks, whereas nitrogen physisorption shows the evolution of the effective pore size distribution in materials resulting from the framework hybridization. X-ray diffraction shows these hybrid materials to be crystalline. In the case of ZIF-8-90 hybrids, the cubic space group of the parent frameworks is continuously maintained, whereas in the case of the ZIF-7-8 hybrids there is a transition from a cubic to a rhombohedral space group. Nitrogen physisorption data reveal that the hybrid materials exhibit substantial changes in gate-opening phenomena, either occurring at continuously tunable partial pressures of nitrogen (ZIF-8-90 hybrids) or loss of gate-opening effects to yield more rigid frameworks (ZIF-7-8 hybrids). With this synthetic approach, significant alterations in MOF properties may be realized to suit a desired separation or catalytic process. © 2012 American Chemical Society.

  6. A Switchable Linker-Based Immunoassay for Ultrasensitive Visible Detection of Salmonella in Tomatoes.

    Science.gov (United States)

    Hahn, Jungwoo; Kim, Eunghee; You, Young Sang; Gunasekaran, Sundaram; Lim, Seokwon; Choi, Young Jin

    2017-10-01

    On-site detection for sensitive identification of foodborne pathogens on fresh produce with minimal use of specialized instrumentation is crucial to the food industry. A switchable linker (SL)-based immunoassay was designed for ultrasensitive on-site detection of Salmonella in tomato samples. The assay is based on large-scale aggregation of gold nanoparticles (GNPs), induced by a quantitative relationship among the biotinylated Salmonella polyclonal antibody (b-Ab) used as the SL, the functionalized GNPs, and Salmonella. Important factors such as the concentration of SLs, time required for large-scale aggregation, and selectivity of b-Ab were optimized to minimize the detection time (within 45 min with gentle agitation) and achieve the lowest limit of detection (LOD; 10 CFU/g in tomato samples) possible. This SL-based immunoassay with its relatively low LOD and short detection time may meet the need for rapid, simple, on-site analysis of pathogens in fresh produce. The novel switchable linker-based immunoassay is a rapid, specific, and sensitive method that has potential applications for routine diagnostics of Salmonella in tomato products. These advantages make it a practical approach for general use in the processing industry to detect Salmonella rapidly and to implement appropriate regulatory procedures. Furthermore, it could be applied to other fresh products including cantaloupe, strawberry, and cucumbers. © 2017 Institute of Food Technologists®.

  7. Longitudinal study of experimental induction of AA amyloidosis in mice seeded with homologous and heterologous AA fibrils.

    Science.gov (United States)

    Muhammad, Naeem; Murakami, Tomoaki; Inoshima, Yasuo; Ishiguro, Naotaka

    2016-09-01

    To investigate pathogenesis and kinetics of experimentally induced murine AA amyloidosis seeded with homologous (murine) and heterologous (bovine) AA fibrils. Experimental AA amyloidosis was induced by administration of inflammatory stimulus and preformed AA fibrils to a total of 111 female C57/Black mice. In this longitudinal study, heterologous (bovine) as well as homologous (murine) AA fibrils were injected intraperitoneally to mice in various combinations. Re-stimulation was done at 120 or 300 days post first inoculation. To analyze the intensity of amyloid depositions in mice organs, immunohistochemical techniques and image J software were used. Assessment of cytokines level in sera was done using a Mouse Th1/Th2/Th17 Cytokine CBA Kit. Incidence and severity of AA amyloidosis were quite low in mice inoculated with heterologous bovine AA fibrils than homologous murine one. Homologous AA fibrils administration at first and second inoculation caused maximum amount of amyloid depositions and severe systemic form of amyloidosis. Increase in the level of pro-inflammatory cytokine IL-6 was observed after first inoculation, while second inoculation caused a further increase in the level of anti-inflammatory cytokine IL-10. AA amyloidosis can be induced by heterologous as well as homologous AA fibrils. Severity of AA amyloidosis induced with homologous AA fibrils is higher compared to heterologous AA fibrils.

  8. [Risk control of traditional Chinese medicines containing aristolochis acids (AAs) based on influencing factors of content of AAs].

    Science.gov (United States)

    Tian, Jing-Zhuo; Liang, Ai-Hua; Liu, Jing; Zhang, Bo-Li

    2017-12-01

    Aristolochic acids (AAs) widely exist in such plants as Aristolochia and Asarum. The renal toxicity of AAs as well as its carcinogenicity to urinary system have been widely known. In 2003 and 2004, China prohibited the use of Aristolochiae Radix, Aristolochiae Manshuriensis Caulis and Aristolochiae Fangchi Radix, and required administering other AAs-containing medicines in accordance with the regulations for prescription drugs. In this paper, we retrieved literatures on the content determination of AAs in recent 10 years in China. It suggested that the AAs content is lower in Asarum herb, especially in its roots and rhizomes, and most of which do not show detectable amount of AA-I. Some of traditional Chinese medicines show fairly small amount of detectable AA-I. The AAs content in Aristolochia herb (including Fructus Aristolochiae, kaempfer dutchmanspipe root) is relatively high; however, there are fewer literatures for studying the content determination of AAs in Chinese patent medicines. There were many factors affecting AAs content, including the parts used, origins, processing methods, extraction process. It suggested that we should pay attention to the toxicity of Chinese medicines containing AAs and use these decoction pieces and traditional Chinese medicines cautiously. In addition, basic studies for the origins, processing methods and extraction process of Chinese patent medicines containing AAs, as well as supervision and detection of AAs content in traditional Chinese medicinal materials, decoction pieces and Chinese patent medicines shall be strengthened for reducing medication risk and guaranteeing clinical medication safety. Copyright© by the Chinese Pharmaceutical Association.

  9. Systemic AA amyloidosis: epidemiology, diagnosis, and management.

    Science.gov (United States)

    Real de Asúa, Diego; Costa, Ramón; Galván, Jose María; Filigheddu, María Teresa; Trujillo, Davinia; Cadiñanos, Julen

    2014-01-01

    The term "amyloidosis" encompasses the heterogeneous group of diseases caused by the extracellular deposition of autologous fibrillar proteins. The global incidence of amyloidosis is estimated at five to nine cases per million patient-years. While amyloid light-chain (AL) amyloidosis is more frequent in developed countries, amyloid A (AA) amyloidosis is more common in some European regions and in developing countries. The spectrum of AA amyloidosis has changed in recent decades owing to: an increase in the median age at diagnosis; a percent increase in the frequency of primary AL amyloidosis with respect to the AA type; and a substantial change in the epidemiology of the underlying diseases. Diagnosis of amyloidosis is based on clinical organ involvement and histological evidence of amyloid deposits. Among the many tinctorial characteristics of amyloid deposits, avidity for Congo red and metachromatic birefringence under unidirectional polarized light remain the gold standard. Once the initial diagnosis has been made, the amyloid subtype must be identified and systemic organ involvement evaluated. In this sense, the (123)I-labeled serum amyloid P component scintigraphy is a safe and noninvasive technique that has revolutionized the diagnosis and monitoring of treatment in systemic amyloidosis. It can successfully identify anatomical patterns of amyloid deposition throughout the body and enables not only an initial estimation of prognosis, but also the monitoring of the course of the disease and the response to treatment. Given the etiologic diversity of AA amyloidosis, common therapeutic strategies are scarce. All treatment options should be based upon a greater control of the underlying disease, adequate organ support, and treatment of symptoms. Nevertheless, novel therapeutic strategies targeting the formation of amyloid fibrils and amyloid deposition may generate new expectations for patients with AA amyloidosis.

  10. Iminodiacetic acid as bifunctional linker for dimerization of cyclic RGD peptides

    International Nuclear Information System (INIS)

    Xu, Dong; Zhao, Zuo-Quan; Chen, Shu-Ting; Yang, Yong; Fang, Wei; Liu, Shuang

    2017-01-01

    Introduction: In this study, I2P-RGD 2 was used as the example to illustrate a novel approach for dimerization of cyclic RGD peptides. The main objective of this study was to explore the impact of bifunctional linkers (glutamic acid vs. iminodiacetic acid) on tumor-targeting capability and excretion kinetics of the 99m Tc-labeled dimeric cyclic RGD peptides. Methods: HYNIC-I2P-RGD 2 was prepared by reacting I2P-RGD 2 with HYNIC-OSu in the presence of diisopropylethylamine, and was evaluated for its α v β 3 binding affinity against 125 I-echistatin bound to U87MG glioma cells. 99m Tc-I2P-RGD 2 was prepared with high specific activity (~185 GBq/μmol). The athymic nude mice bearing U87MG glioma xenografts were used to evaluate its biodistribution properties and image quality in comparison with those of 99m Tc-3P-RGD 2 . Results: The IC 50 value for HYNIC-I2P-RGD 2 was determined to be 39 ± 6 nM, which was very close to that (IC 50 = 33 ± 5 nM) of HYNIC-3P-RGD 2 . Replacing glutamic acid with iminodiacetic acid had little impact on α v β 3 binding affinity of cyclic RGD peptides. 99m Tc-I2P-RGD 2 and 99m Tc-3P-RGD 2 shared similar tumor uptake values over the 2 h period, and its α v β 3 -specificity was demonstrated by a blocking experiment. The uptake of 99m Tc-I2P-RGD 2 was significantly lower than 99m Tc-3P-RGD 2 in the liver and kidneys. The U87MG glioma tumors were visualized by SPECT with excellent contrast using both 99m Tc-I2P-RGD 2 and 99m Tc-3P-RGD 2 . Conclusion: Iminodiacetic acid is an excellent bifunctional linker for dimerization of cyclic RGD peptides. Bifunctional linkers have significant impact on the excretion kinetics of 99m Tc radiotracers. Because of its lower liver uptake and better tumor/liver ratios, 99m Tc-I2P-RGD 2 may have advantages over 99m Tc-3P-RGD 2 for diagnosis of tumors in chest region. -- Graphical abstract: This report presents novel approach for dimerization of cyclic RGD peptides using iminodiacetic acid as a

  11. Wild Accessions and Mutant Resources

    DEFF Research Database (Denmark)

    Kawaguchi, Masayoshi; Sandal, Niels Nørgaard

    2014-01-01

    Lotus japonicus, Lotus burttii, and Lotus filicaulis are species of Lotus genus that are utilized for molecular genetic analysis such as the construction of a linkage map and QTL analysis. Among them, a number of mutants have been isolated from two wild accessions: L. japonicus Gifu B-129...

  12. components in induced sorghum mutants

    African Journals Online (AJOL)

    (1984) evaluated induced mutation and hybridisation methods for producing genetic variability in 15 quantitative characters of sorghum. Their results showed large variability in grain yield, plant maturity, plant height and panicles length. Selected mutants with favorable properties can be directly combined in varietal hybrids.

  13. Comparative Enactment of Formaldehyde-free and Formaldehyde-based Cross-linkers on Cotton Woven Fabrics

    Directory of Open Access Journals (Sweden)

    Nawshin Farzana

    2017-04-01

    Full Text Available The performances of formaldehyde-based and non-formaldehyde cross-linkers on pretreated cotton woven fabric were assessed and compared in this research. Fixapret CL was considered as the formaldehyde-based resin and Fixapret NF as the formaldehyde-free resin. Dry cross-linking method was adopted for the application of cross-linkers. Different properties of resin treated fabrics investigated and compared were as follows: DP (durable press rating, wrinkle recovery, stiff ness, tensile strength, tear strength, shrinkage, skewness, hydrophobicity, whiteness and yellowness index. Marginally low performances in smoothness appearance and dimensional stability on fabric were exhibited with formaldehyde-free cross-linkers although indicating lower amount of the strength loss percentage. The formaldehyde-based compounds imparted more yellowing tendency to the treated fabric. The formaldehyde-free resins may be a good choice of replacements considering the overall eff ectiveness on fabric

  14. Mutations in Biosynthetic Enzymes for the Protein Linker Region of Chondroitin/Dermatan/Heparan Sulfate Cause Skeletal and Skin Dysplasias

    Directory of Open Access Journals (Sweden)

    Shuji Mizumoto

    2015-01-01

    Full Text Available Glycosaminoglycans, including chondroitin, dermatan, and heparan sulfate, have various roles in a wide range of biological events such as cell signaling, cell proliferation, tissue morphogenesis, and interactions with various growth factors. Their polysaccharides covalently attach to the serine residues on specific core proteins through the common linker region tetrasaccharide, -xylose-galactose-galactose-glucuronic acid, which is produced through the stepwise addition of respective monosaccharides by four distinct glycosyltransferases. Mutations in the human genes encoding the glycosyltransferases responsible for the biosynthesis of the linker region tetrasaccharide cause a number of genetic disorders, called glycosaminoglycan linkeropathies, including Desbuquois dysplasia type 2, spondyloepimetaphyseal dysplasia, Ehlers-Danlos syndrome, and Larsen syndrome. This review focused on recent studies on genetic diseases caused by defects in the biosynthesis of the common linker region tetrasaccharide.

  15. A Linker for the Solid-Phase Synthesis of Hydroxamic Acids and Identification of HDAC6 Inhibitors

    DEFF Research Database (Denmark)

    Bang, Claus Gunnar; Jensen, Jakob Feldthusen; Cohrt, Anders Emil O'Hanlon

    2017-01-01

    We herein present broadly useful, readily available and nonintegral hydroxylamine linkers for the routine solid-phase synthesis of hydroxamic acids. The developed protocols enable the efficient synthesis and release of a wide range of hydroxamic acids from various resins, relying on high control...... and flexibility with respect to reagents and synthetic processes. A trityl-based hydroxylamine linker was used to synthesize a library of peptide hydroxamic acids. The inhibitory effects of the compounds were examined for seven HDAC enzyme subtypes using a chemiluminescence-based assay....

  16. Enhanced Adsorption and Recovery of Uranyl Ions by NikR Mutant-Displaying Yeast

    Directory of Open Access Journals (Sweden)

    Kouichi Kuroda

    2014-04-01

    Full Text Available Uranium is one of the most important metal resources, and the technology for the recovery of uranyl ions (UO22+ from aqueous solutions is required to ensure a semi-permanent supply of uranium. The NikR protein is a Ni2+-dependent transcriptional repressor of the nickel-ion uptake system in Escherichia coli, but its mutant protein (NikRm is able to selectively bind uranyl ions in the interface of the two monomers. In this study, NikRm protein with ability to adsorb uranyl ions was displayed on the cell surface of Saccharomyces cerevisiae. To perform the binding of metal ions in the interface of the two monomers, two metal-binding domains (MBDs of NikRm were tandemly fused via linker peptides and displayed on the yeast cell surface by fusion with the cell wall-anchoring domain of yeast α-agglutinin. The NikRm-MBD-displaying yeast cells with particular linker lengths showed the enhanced adsorption of uranyl ions in comparison to the control strain. By treating cells with citrate buffer (pH 4.3, the uranyl ions adsorbed on the cell surface were recovered. Our results indicate that the adsorption system by yeast cells displaying tandemly fused MBDs of NikRm is effective for simple and concentrated recovery of uranyl ions, as well as adsorption of uranyl ions.

  17. Induced High Lysine Mutants in Barley

    DEFF Research Database (Denmark)

    Doll, Hans; Køie, B.; Eggum, B. O.

    1974-01-01

    variety. Comparisons of six high lysine mutants with the parent variety showed that grain yield and seed size of the mutants are reduced between 10 and 30 per cent. However, the most promising mutant had the lowest reduction in grain yield, and the absolute lysine yield of this mutant was some 30 per cent...... above that of the parent variety. Feeding tests with rats revealed substantial increases in the biological value of the high lysine mutant protein. Also the net protein utilization was improved but less so because of a somewhat reduced digestibility of the mutant protein....

  18. Role of Flexibility in Protein-DNA-Drug Recognition: The Case of Asp677Gly-Val703Ile Topoisomerase Mutant Hypersensitive to Camptothecin

    Science.gov (United States)

    D'Annessa, Ilda; Tesauro, Cinzia; Fiorani, Paola; Chillemi, Giovanni; Castelli, Silvia; Vassallo, Oscar; Capranico, Giovanni; Desideri, Alessandro

    2012-01-01

    Topoisomerases I are ubiquitous enzymes that control DNA topology within the cell. They are the unique target of the antitumor drug camptothecin that selectively recognizes the DNA-topoisomerase covalent complex and reversibly stabilizes it. The biochemical and structural-dynamical properties of the Asp677Gly-Val703Ile double mutant with enhanced CPT sensitivity have been investigated. The mutant displays a lower religation rate of the DNA substrate when compared to the wild-type protein. Analyses of the structural dynamical properties by molecular dynamics simulation show that the mutant has reduced flexibility and an active site partially destructured at the level of the Lys532 residue. These results demonstrate long-range communication mechanism where reduction of the linker flexibility alters the active site geometry with the consequent lowering of the religation rate and increase in drug sensitivity. PMID:22315664

  19. Role of Flexibility in Protein-DNA-Drug Recognition: The Case of Asp677Gly-Val703Ile Topoisomerase Mutant Hypersensitive to Camptothecin

    Directory of Open Access Journals (Sweden)

    Ilda D'Annessa

    2012-01-01

    Full Text Available Topoisomerases I are ubiquitous enzymes that control DNA topology within the cell. They are the unique target of the antitumor drug camptothecin that selectively recognizes the DNA-topoisomerase covalent complex and reversibly stabilizes it. The biochemical and structural-dynamical properties of the Asp677Gly-Val703Ile double mutant with enhanced CPT sensitivity have been investigated. The mutant displays a lower religation rate of the DNA substrate when compared to the wild-type protein. Analyses of the structural dynamical properties by molecular dynamics simulation show that the mutant has reduced flexibility and an active site partially destructured at the level of the Lys532 residue. These results demonstrate long-range communication mechanism where reduction of the linker flexibility alters the active site geometry with the consequent lowering of the religation rate and increase in drug sensitivity.

  20. Removal of some most hazardous cationic dyes using novel poly (NIPAAm/AA/N-allylisatin nanohydrogel

    Directory of Open Access Journals (Sweden)

    Viran P. Mahida

    2016-05-01

    Full Text Available Synthesis of nanoparticles by microemulsion method is an interesting research area of current years. By accepting this opinion, N-isopropylacrylamide was polymerized with different amounts of acrylic acid (AA and N-allylisatin using aerosol (AOT as a surfactant, ethylene glycol dimethacrylate (EGDMA as a cross linker and 2,2′-azobisisobuteronitrile (AIBN as a surface active initiator. The chemical structure of nanohydrogel was characterized by FT-IR, DSC and TGA analysis. SEM photographs demonstrate the surface morphology of nanohydrogel before and after the dye adsorption. TEM micrographs confirm the particle size distribution in the range between 5 and 10 nm. Specific surface area and pore volume of the synthesized nanohydrogel were determined by BET and BJH analysis. The nanohydrogels were used in experiments on swelling behavior and adsorption of some water-soluble cationic dyes such as Methylene Blue (BB-9, Auramine O (BY-2 and Chrysoidine G (BO-2. Furthermore, the Langmuir and Freundlich adsorption isotherm models were applied which showed a favorable adsorption. From the results, removal of dyes within the nanohydrogel increased in the following order: BB-9 > BY-2 > BO-2.

  1. Absorption spectra of AA-stacked graphite

    International Nuclear Information System (INIS)

    Chiu, C W; Lee, S H; Chen, S C; Lin, M F; Shyu, F L

    2010-01-01

    AA-stacked graphite shows strong anisotropy in geometric structures and velocity matrix elements. However, the absorption spectra are isotropic for the polarization vector on the graphene plane. The spectra exhibit one prominent plateau at middle energy and one shoulder structure at lower energy. These structures directly reflect the unique geometric and band structures and provide sufficient information for experimental fitting of the intralayer and interlayer atomic interactions. On the other hand, monolayer graphene shows a sharp absorption peak but no shoulder structure; AA-stacked bilayer graphene has two absorption peaks at middle energy and abruptly vanishes at lower energy. Furthermore, the isotropic features are expected to exist in other graphene-related systems. The calculated results and the predicted atomic interactions could be verified by optical measurements.

  2. First circulating beam in the AA

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.5 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are to numerous to name them all. Heribert Koziol, apparently asleep, is answering the call from an impatient director. See also 8007094.

  3. AA, assembly of wide bending magnet

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    The very particular lattice of the AA required 2 types of dipoles (bending magnets; BST, short and wide; BLG, long and narrow). The wide ones had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the copper coils being hoisted onto the lower half of a BST. See also 7811105, 8006050. For a BLG, see 8001044.

  4. AA, inner conductor of a magnetic horn

    CERN Multimedia

    CERN PhotoLab

    1981-01-01

    At the start-up of the AA and during its initial operation, magnetic horns focused the antiprotons emanating from the production target. These "current-sheet lenses" had a thin inner conductor (for minimum absorption of antiprotons), machined from aluminium to wall thicknesses of 0.7 or 1 mm. The half-sine pulses rose to 150 kA in 8 microsec. The angular acceptance was 50 mrad.

  5. Identification of Bacillus thuringiensis Cry3Aa toxin domain II loop 1 as the binding site of Tenebrio molitor cadherin repeat CR12.

    Science.gov (United States)

    Zúñiga-Navarrete, Fernando; Gómez, Isabel; Peña, Guadalupe; Amaro, Itzel; Ortíz, Ernesto; Becerril, Baltazar; Ibarra, Jorge E; Bravo, Alejandra; Soberón, Mario

    2015-04-01

    Bacillus thuringiensis Cry toxins exert their toxic effect by specific recognition of larval midgut proteins leading to oligomerization of the toxin, membrane insertion and pore formation. The exposed domain II loop regions of Cry toxins have been shown to be involved in receptor binding. Insect cadherins have shown to be functionally involved in toxin binding facilitating toxin oligomerization. Here, we isolated a VHH (VHHA5) antibody by phage display that binds Cry3Aa loop 1 and competed with the binding of Cry3Aa to Tenebrio molitor brush border membranes. VHHA5 also competed with the binding of Cry3Aa to a cadherin fragment (CR12) that was previously shown to be involved in binding and toxicity of Cry3Aa, indicating that Cry3Aa binds CR12 through domain II loop 1. Moreover, we show that a loop 1 mutant, previously characterized to have increased toxicity to T. molitor, displayed a correlative enhanced binding affinity to T. molitor CR12 and to VHHA5. These results show that Cry3Aa domain II loop 1 is a binding site of CR12 T. molitor cadherin. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Head-to-tail macrocyclization of cysteine-free peptides using an o-aminoanilide linker.

    Science.gov (United States)

    Ohara, Takumi; Kaneda, Masato; Saito, Tomo; Fujii, Nobutaka; Ohno, Hiroaki; Oishi, Shinya

    2018-05-01

    A head-to-tail macrocyclization protocol for the preparation of cysteine-free cyclic peptides was investigated. The o-aminoanilide linker constructed in the peptide sequence by a standard Fmoc-based peptide synthesis procedure was subjected to nitrite-mediated activation under acidic conditions toward N-acyl benzotriazole as the active ester species. The subsequent cyclization smoothly proceeded by neutralization in the presence of additives such as 1-hydroxybenzotriazole (HOBt) and 1-hydroxy-7-azabenzotriazole (HOAt) to afford the expected cyclic pentapeptide, a CXCR4 antagonist. The cyclization efficiencies were dependent on the precursor open-chain sequence. The application of this step-wise activation-cyclization protocol to microflow reaction systems is also described. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. Speaking tasks for the assessment of English: the use of linkers

    Directory of Open Access Journals (Sweden)

    Marcos Peñate Cabrera

    2015-07-01

    Full Text Available Although assessment experts have been researching the relationship between the different types of tasks and their level of difficulty, this process of analysis should be pursued further in order to acquire a more accurate vision of the variables involved. In this article we study the three types of tasks most frequently used in the different models of oral exams (one-to-one interview based on a photo, one-to-one interview based on a comic strip and a dialogue in pairs. In order to carry out this study we assessed 244 pupils from the second year of Bachillerato belonging to nine different schools and having an A2 level of English. When contrasting the 3 types of tasks, our aim was to analyse the amount and complexity of the oral production, namely the use of linkers, by means of statistical tests of homogeneity and specificity.

  8. A novel bipartite nuclear localization signal with an atypically long linker in DOF transcription factors.

    Science.gov (United States)

    Krebs, Jonas; Mueller-Roeber, Bernd; Ruzicic, Slobodan

    2010-05-01

    Large molecules require a nuclear localization signal (NLS) for translocation into the nucleus. Classical NLSs are rich in basic amino acids and they represent three groups, based on their structural features: SV40 T-antigen-type, yeast mating factor Matalpha-2-type, and bipartite NLSs. DNA-binding-with-one-finger (DOF) transcription factors play important roles in plants, and although their nuclear localization has been demonstrated in several cases, public protein localization prediction tools fail to detect NLS motifs in these proteins. Here, we demonstrate that an atypical bipartite NLS with a 17 amino acid long linker between its flanking basic regions directs Arabidopsis thaliana DOF proteins to the cell nucleus. The novel bipartite NLS is highly conserved in plant DOF transcription factors, including the single DOF protein in the green alga Chlamydomonas reinhardtii. Copyright 2010 Elsevier GmbH. All rights reserved.

  9. Efficient loading of primary alcohols onto a solid phase using a trityl bromide linker

    DEFF Research Database (Denmark)

    Crestey, François; Ottesen, Lars Korsgaard; Jaroszewski, Jerzy Witold

    2008-01-01

    expensive or non-commercial resin types. Secondary alcohols were only attached in moderate to low yields, while attempts to load a tertiary alcohol expectedly failed. Importantly, selective attachment of diols via a primary alcohol group in the presence of more hindered alcohol groups proved possible......The Letter describes an improved, rapid and mild strategy for the loading of primary alcohols onto a polystyrene trityl resin via a highly reactive trityl bromide linker. This protocol facilitates an efficient resin loading even of acid-sensitive or heat-labile alcohols, which otherwise require....... The effects of activation time and reagent excess as well as alcohol structure were investigated. This improved method provides a convenient access to O-linked resin-bound N-Fmoc-protected amino alcohols that may be employed in SPS of peptides with C-terminal alcohol functionalities. In the case...

  10. Cytoskeletal Linker Protein Dystonin Is Not Critical to Terminal Oligodendrocyte Differentiation or CNS Myelination.

    Science.gov (United States)

    Kornfeld, Samantha F; Lynch-Godrei, Anisha; Bonin, Sawyer R; Gibeault, Sabrina; De Repentigny, Yves; Kothary, Rashmi

    2016-01-01

    Oligodendrocyte differentiation and central nervous system myelination require massive reorganization of the oligodendrocyte cytoskeleton. Loss of specific actin- and tubulin-organizing factors can lead to impaired morphological and/or molecular differentiation of oligodendrocytes, resulting in a subsequent loss of myelination. Dystonin is a cytoskeletal linker protein with both actin- and tubulin-binding domains. Loss of function of this protein results in a sensory neuropathy called Hereditary Sensory Autonomic Neuropathy VI in humans and dystonia musculorum in mice. This disease presents with severe ataxia, dystonic muscle and is ultimately fatal early in life. While loss of the neuronal isoforms of dystonin primarily leads to sensory neuron degeneration, it has also been shown that peripheral myelination is compromised due to intrinsic Schwann cell differentiation abnormalities. The role of this cytoskeletal linker in oligodendrocytes, however, remains unclear. We sought to determine the effects of the loss of neuronal dystonin on oligodendrocyte differentiation and central myelination. To address this, primary oligodendrocytes were isolated from a severe model of dystonia musculorum, Dstdt-27J, and assessed for morphological and molecular differentiation capacity. No defects could be discerned in the differentiation of Dstdt-27J oligodendrocytes relative to oligodendrocytes from wild-type littermates. Survival was also compared between Dstdt-27J and wild-type oligodendrocytes, revealing no significant difference. Using a recently developed migration assay, we further analysed the ability of primary oligodendrocyte progenitor cell motility, and found that Dstdt-27J oligodendrocyte progenitor cells were able to migrate normally. Finally, in vivo analysis of oligodendrocyte myelination was done in phenotype-stage optic nerve, cerebral cortex and spinal cord. The density of myelinated axons and g-ratios of Dstdt-27J optic nerves was normal, as was myelin basic

  11. Cytoskeletal Linker Protein Dystonin Is Not Critical to Terminal Oligodendrocyte Differentiation or CNS Myelination.

    Directory of Open Access Journals (Sweden)

    Samantha F Kornfeld

    Full Text Available Oligodendrocyte differentiation and central nervous system myelination require massive reorganization of the oligodendrocyte cytoskeleton. Loss of specific actin- and tubulin-organizing factors can lead to impaired morphological and/or molecular differentiation of oligodendrocytes, resulting in a subsequent loss of myelination. Dystonin is a cytoskeletal linker protein with both actin- and tubulin-binding domains. Loss of function of this protein results in a sensory neuropathy called Hereditary Sensory Autonomic Neuropathy VI in humans and dystonia musculorum in mice. This disease presents with severe ataxia, dystonic muscle and is ultimately fatal early in life. While loss of the neuronal isoforms of dystonin primarily leads to sensory neuron degeneration, it has also been shown that peripheral myelination is compromised due to intrinsic Schwann cell differentiation abnormalities. The role of this cytoskeletal linker in oligodendrocytes, however, remains unclear. We sought to determine the effects of the loss of neuronal dystonin on oligodendrocyte differentiation and central myelination. To address this, primary oligodendrocytes were isolated from a severe model of dystonia musculorum, Dstdt-27J, and assessed for morphological and molecular differentiation capacity. No defects could be discerned in the differentiation of Dstdt-27J oligodendrocytes relative to oligodendrocytes from wild-type littermates. Survival was also compared between Dstdt-27J and wild-type oligodendrocytes, revealing no significant difference. Using a recently developed migration assay, we further analysed the ability of primary oligodendrocyte progenitor cell motility, and found that Dstdt-27J oligodendrocyte progenitor cells were able to migrate normally. Finally, in vivo analysis of oligodendrocyte myelination was done in phenotype-stage optic nerve, cerebral cortex and spinal cord. The density of myelinated axons and g-ratios of Dstdt-27J optic nerves was normal, as

  12. Nile tilapia skin collagen sponge modified with chemical cross-linkers as a biomedical hemostatic material.

    Science.gov (United States)

    Sun, Leilei; Li, Bafang; Jiang, Dandan; Hou, Hu

    2017-11-01

    Nile tilapia skin collagen sponges were fabricated by freeze-drying technology and modified with 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide in the presence of N-hydroxysuccinimide (EDC/NHS), genipin+PBS, genipin+ethanol, tea polyphenol (TP), nordihydroguaiaretic acid (NDGA) and diphenyl phosphoryl azide (DPPA). Physicochemical and biological properties, micromorphology and compatibility before and after modification were investigated to evaluate collagen sponge as a hemostatic biomedical material. The mechanical property of collagen sponges strengthened after cross-linking. The elongation at break of cross-linked collagen sponges decreased except for EDC/NHS, which was close to that of non-crosslinked. The collagen sponge cross-linked with EDC/NHS exhibited the highest hygroscopicity in comparison with other cross-linkers. The resistance to collagenase biodegradation of collagen sponges after cross-linking strengthened significantly except for NDGA. Collagen sponges cross-linked with EDC/NHS, TP and NDGA maintained high porosity (97-98%), similar to non-crosslinked (98.42%). Collagen sponges could shorten the blood coagulation time. From the variations of the FTIR spectrum pattern and SEM, DPPA could change the secondary structure of collagen and destroy the spongy structure of collagen sponge, which was not suitable for the cross-linking of collagen sponge. Whereas, EDC/NHS was recognized as a perfect cross-linker owing to its excellent properties and porous microstructure. All fabricated collagen sponges were recognized to be biocompatible by the hemolysis assay in vitro. Therefore, collagen sponge modified with EDC/NHS could be used as a perfect biomedical hemostatic material. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Mutant genes in pea breeding

    International Nuclear Information System (INIS)

    Swiecicki, W.K.

    1990-01-01

    Full text: Mutations of genes Dpo (dehiscing pods) and A (anthocyanin synthesis) played a role in pea domestication. A number of other genes were important in cultivar development for 3 types of usage (dry seeds, green vegetable types, fodder), e.g. fn, fna, le, p, v, fas and af. New genes (induced and spontaneous), are important for present ideotypes and are registered by the Pisum Genetics Association (PGA). Comparison of a pea variety ideotype with the variation available in gene banks shows that breeders need 'new' features. In mutation induction experiments, genotype, mutagen and method of treatment (e.g. combined or fractionated doses) are varied for broadening the mutation spectrum and selecting more genes of agronomic value. New genes are genetically analysed. In Poland, some mutant varieties with the gene afila were registered, controlling lodging by a shorter stem and a higher number of internodes. Really non-lodging pea varieties could strongly increase seed yield. But the probability of detecting a major gene for lodging resistance is low. Therefore, mutant genes with smaller influence on plant architecture are sought, to combine their effect by crossing. Promising seem to be the genes rogue, reductus and arthritic as well as a number of mutant genes not yet genetically identified. The gene det for terminal inflorescence - similarly to Vicia faba - changes plant development. Utilisation of assimilates and ripening should be better. Improvement of harvest index should give higher seed yield. A number of genes controlling disease resistance are well known (eg. Fw, Fnw, En, mo and sbm). Important in mass screening of resistance are closely linked gene markers. Pea gene banks collect respective lines, but mutants induced in highly productive cultivars would be better. Inducing gene markers sometimes seems to be easier than transfer by crossing. Mutation induction in pea breeding is probably more important because a high number of monogenic features are

  14. 40 CFR Appendix A to Subpart Aa of... - Applicability of General Provisions (40 CFR Part 63, Subpart A) to Subpart AA

    Science.gov (United States)

    2010-07-01

    ... (40 CFR Part 63, Subpart A) to Subpart AA A Appendix A to Subpart AA of Part 63 Protection of... Hazardous Air Pollutants From Phosphoric Acid Manufacturing Plants Pt. 63, Subpt. AA, App. A Appendix A to Subpart AA of Part 63—Applicability of General Provisions (40 CFR Part 63, Subpart A) to Subpart AA 40 CFR...

  15. Dicty_cDB: FC-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA10 (Link to dictyBase) - - - Contig-U16358-1 FC-AA10P (Li...nk to Original site) FC-AA10F 659 FC-AA10Z 544 FC-AA10P 1203 - - Show FC-AA10 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA10Q.Seq.d/ Representative seq. ID FC-AA...10P (Link to Original site) Representative DNA sequence >FC-AA10 (FC-AA10Q) /CSM/FC/FC-AA/FC-AA10Q.Seq.d/ AA...ATGACTACCTTTAACGAATATCCATTCTTGGCTGAATTAGGCATTAAAGCTGAAAATA ATGATGGAGTCTTCAATGGAAAATGGGGAGGTGCTGGTGAAATCATCAA

  16. Dicty_cDB: FC-AA04 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA04 (Link to dictyBase) - - - Contig-U15354-1 FC-AA04P (Li...nk to Original site) FC-AA04F 546 FC-AA04Z 484 FC-AA04P 1030 - - Show FC-AA04 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA04Q.Seq.d/ Representative seq. ID FC-AA...04P (Link to Original site) Representative DNA sequence >FC-AA04 (FC-AA04Q) /CSM/FC/FC-AA/FC-AA04Q.Seq.d/ AA...TAATACACATAAAAAATTTATTAAATAAAAATGACTACAACAACAACAAATGAAGTTT ATATAGTTGATTGTATTCGTACACCAATTGGTAGAGGATATAGTAA

  17. Dicty_cDB: FC-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA03 (Link to dictyBase) - - - Contig-U15331-1 FC-AA03P (Li...nk to Original site) FC-AA03F 595 FC-AA03Z 546 FC-AA03P 1141 - - Show FC-AA03 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA03Q.Seq.d/ Representative seq. ID FC-AA...03P (Link to Original site) Representative DNA sequence >FC-AA03 (FC-AA03Q) /CSM/FC/FC-AA/FC-AA03Q.Seq.d/ AA...AATGTCATCTTATTTATTCACTAGTGAATCCGTCACCGAAGTCATCCAGATAAAATCT GTGATCAAGTATCAGATGCTGTTCTCGATGCTTGTTTAGCTCAA

  18. Synthesis of Selective Butyrylcholinesterase Inhibitors Coupled between α-Lipoic Acid and Polyphenols by Using 2-(Piperazin-1-yl)ethanol Linker

    Energy Technology Data Exchange (ETDEWEB)

    Yeun, Go Heun; Lee, Seung Hwan; LIm, Yong Bae; Lee, Hye Sook; Lee, Bong Ho; Park, Jeong Ho [Hanbat National Univ., Daejeon (Korea, Republic of); Won, Mooho [Kangwon National Univ., Chuncheon (Korea, Republic of)

    2013-04-15

    In the previous paper (Bull. Korean Chem. Soc., 2011, 32, 2997), the hybrid molecules between α-lipoic acid (ALA) and polyphenols (PPs) connected with neutral 2-(2-aminoethoxy)ethanol linker (linker-1) showed new biological activity such as butyrylcholinesterase (BuChE) inhibition. In order to increase the binding affinity of the hybrid compounds to cholinesterase (ChE), the neutral 2-(2-aminoethoxy)ethanol (linker 1) was switched to the cationic 2-(piperazin-1-yl)ethanol linker (linker 2). The IC{sub 50} values of the linker-2 hybrid molecules for BuChE inhibition were lower than those of linker-1 hybrid molecules (except 9-2) and they also had the same great selectivity for BuChE over AChE (> 800 fold) as linker-1 hybrid molecules. ALA-acetyl caffeic acid (10-2, ALA-AcCA) was shown as an effective inhibitor of BuChE (IC{sub 50} = 0.44 ± 0.24 μM). A kinetic study using 7-2 showed that it is the same mixed type inhibition as 7-1. Its inhibition constant (Ki) to BuChE is 4.3 ± 0.09 μM.

  19. Modulations of DNA Contacts by Linker Histones and Post-translational Modifications Determine the Mobility and Modifiability of Nucleosomal H3 Tails.

    Science.gov (United States)

    Stützer, Alexandra; Liokatis, Stamatios; Kiesel, Anja; Schwarzer, Dirk; Sprangers, Remco; Söding, Johannes; Selenko, Philipp; Fischle, Wolfgang

    2016-01-21

    Post-translational histone modifications and linker histone incorporation regulate chromatin structure and genome activity. How these systems interface on a molecular level is unclear. Using biochemistry and NMR spectroscopy, we deduced mechanistic insights into the modification behavior of N-terminal histone H3 tails in different nucleosomal contexts. We find that linker histones generally inhibit modifications of different H3 sites and reduce H3 tail dynamics in nucleosomes. These effects are caused by modulations of electrostatic interactions of H3 tails with linker DNA and largely depend on the C-terminal domains of linker histones. In agreement, linker histone occupancy and H3 tail modifications segregate on a genome-wide level. Charge-modulating modifications such as phosphorylation and acetylation weaken transient H3 tail-linker DNA interactions, increase H3 tail dynamics, and, concomitantly, enhance general modifiability. We propose that alterations of H3 tail-linker DNA interactions by linker histones and charge-modulating modifications execute basal control mechanisms of chromatin function. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Temperature-triggered release of a liquid cross-linker micro-encapsulated in a glassy polymer for low temperature curing

    NARCIS (Netherlands)

    Senatore, D.; Cate, A.T. ten; Laven, J.; Benthem, R.A.T.M. van; With, G. de

    2013-01-01

    In order to prevent a liquid epoxy cross-linker from premature, Arrhenius-law predicted, reaction with an acid-functional polyester resin, the liquid cross-linker has been physically separated from the resin by encapsulation while release is only possible by a temperature-controlled trigger. The

  1. Saint Louis Encephalitis Temperature-Sensitive Mutants.

    Science.gov (United States)

    1981-01-01

    group II contains two mutants and group III contains three mutants. Examination of the ability of mutants to grow at 300C, 40 C or 37 C indicates that...importance. Information from studies with Poliovirus has shown that the use of live attenuated virus vaccines result in longer lasting, more effec- tive...sensitive mutant to grow at internal body temperature may have a significant effect on the ability of the virus to induce a protective immune response or

  2. _. AA~ AA, _ _

    Indian Academy of Sciences (India)

    It is probably very difficult to find a person who has not been charmed by the exquisite beauty of soap bubbles. Invariably, our appre- ciation of soap bubbles ends with an admira- tion of their shapes and colours. We do not realise that there is a profound science behind their beauty. The best book to start learning.

  3. Structure Elucidation of Mixed-Linker Zeolitic Imidazolate Frameworks by Solid-State (1)H CRAMPS NMR Spectroscopy and Computational Modeling.

    Science.gov (United States)

    Jayachandrababu, Krishna C; Verploegh, Ross J; Leisen, Johannes; Nieuwendaal, Ryan C; Sholl, David S; Nair, Sankar

    2016-06-15

    Mixed-linker zeolitic imidazolate frameworks (ZIFs) are nanoporous materials that exhibit continuous and controllable tunability of properties like effective pore size, hydrophobicity, and organophilicity. The structure of mixed-linker ZIFs has been studied on macroscopic scales using gravimetric and spectroscopic techniques. However, it has so far not been possible to obtain information on unit-cell-level linker distribution, an understanding of which is key to predicting and controlling their adsorption and diffusion properties. We demonstrate the use of (1)H combined rotation and multiple pulse spectroscopy (CRAMPS) NMR spin exchange measurements in combination with computational modeling to elucidate potential structures of mixed-linker ZIFs, particularly the ZIF 8-90 series. All of the compositions studied have structures that have linkers mixed at a unit-cell-level as opposed to separated or highly clustered phases within the same crystal. Direct experimental observations of linker mixing were accomplished by measuring the proton spin exchange behavior between functional groups on the linkers. The data were then fitted to a kinetic spin exchange model using proton positions from candidate mixed-linker ZIF structures that were generated computationally using the short-range order (SRO) parameter as a measure of the ordering, clustering, or randomization of the linkers. The present method offers the advantages of sensitivity without requiring isotope enrichment, a straightforward NMR pulse sequence, and an analysis framework that allows one to relate spin diffusion behavior to proposed atomic positions. We find that structures close to equimolar composition of the two linkers show a greater tendency for linker clustering than what would be predicted based on random models. Using computational modeling we have also shown how the window-type distribution in experimentally synthesized mixed-linker ZIF-8-90 materials varies as a function of their composition. The

  4. Mechanistic Evaluation of Motion in Redox-Driven Rotaxanes Reveals Longer Linkers Hasten Forward Escape's and Hinder Backward Translations

    DEFF Research Database (Denmark)

    Andersen, S. S.; Share, A. I.; Poulsen, B. L.

    2014-01-01

    temperatures to provide activation enthalpies (Delta H-double dagger) and entropies (Delta S-double dagger). Longer glycol linkers led to modest increases in the forward escape (t(1/2) = 60 to 69 s); though not because of a diffusive walk. The reduced rate of motion backward depended on folded structures...

  5. Synthesis and catalytic evaluation in the Heck reaction of deposited palladium catalysts immobilized via amide linkers and their molecular analogues

    Czech Academy of Sciences Publication Activity Database

    Semler, M.; Čejka, Jiří; Štěpnička, P.

    2014-01-01

    Roč. 227, MAY 2014 (2014), s. 207-214 ISSN 0920-5861 R&D Projects: GA ČR GA104/09/0561; GA ČR(CZ) GA13-08944S Institutional support: RVO:61388955 Keywords : deposited catalysts * palladium * amide linkers Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.893, year: 2014

  6. The interdomain flexible linker of the polypeptide GalNAc transferases dictates their long-range glycosylation preferences

    DEFF Research Database (Denmark)

    Rivas, Matilde De Las; Lira-Navarrete, Erandi; Daniel, Earnest James Paul

    2017-01-01

    The polypeptide GalNAc-transferases (GalNAc-Ts), that initiate mucin-type O-glycosylation, consist of a catalytic and a lectin domain connected by a flexible linker. In addition to recognizing polypeptide sequence, the GalNAc-Ts exhibit unique long-range N- A nd/or C-terminal prior glycosylation ...

  7. Novel cross-linkers for PDMS networks for controlled and well distributed grafting of functionalities by click chemistry

    DEFF Research Database (Denmark)

    Bahrt, Frederikke; Dimitrov, Ivaylo; Daugaard, Anders Egede

    2013-01-01

    -methyl-umbelliferone containing cross-linker. TGA showed that a ferrocene functionality increased the thermal degradation temperature of PDMS. It was furthermore shown that the incorporation of only 0.25 wt% of the push-pull dipole, ethynyl-4-nitrobenzene, increased the dielectric permittivity of PDMS...

  8. Linker dependent intercalation of bisbenzimidazole-aminosugars in an RNA duplex; selectivity in RNA vs. DNA binding.

    Science.gov (United States)

    Ranjan, Nihar; Arya, Dev P

    2016-12-15

    Neomycin and Hoechst 33258 are two well-known nucleic acid binders that interact with RNA and DNA duplexes with high affinities respectively. In this manuscript, we report that covalent attachment of bisbenzimidazole unit derived from Hoechst 33258 to neomycin leads to intercalative binding of the bisbenzimidazole unit (oriented at 64-74° with respected to the RNA helical axis) in a linker length dependent manner. The dual binding and intercalation of conjugates were supported by thermal denaturation, CD, LD and UV-Vis absorption experiments. These studies highlight the importance of linker length in dual recognition by conjugates, for effective RNA recognition, which can lead to novel ways of recognizing RNA structures. Additionally, the ligand library screens also identify DNA and RNA selective compounds, with compound 9, containing a long linker, showing a 20.3°C change in RNA duplex T m with only a 13.0°C change in T m for the corresponding DNA duplex. Significantly, the shorter linker in compound 3 shows almost the reverse trend, a 23.8°C change in DNA T m , with only a 9.1°C change in T m for the corresponding RNA duplex. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Conformational rearrangements in the S6 domain and C-linker during gating in CNGA1 channels.

    NARCIS (Netherlands)

    Nair, A.V.; Nguyen, C.H.; Mazzolini, M.

    2009-01-01

    This work completes previous findings and, using cysteine scanning mutagenesis (CSM) and biochemical methods, provides detailed analysis of conformational changes of the S6 domain and C-linker during gating of CNGA1 channels. Specific residues between Phe375 and Val424 were mutated to a cysteine in

  10. Photochemical Reactions of the LOV and LOV-Linker Domains of the Blue Light Sensor Protein YtvA

    NARCIS (Netherlands)

    Choi, S.; Nakasone, Y.; Hellingwerf, K.J.; Terazima, M.

    2016-01-01

    YtvA is a blue light sensor protein composed of an N-terminal LOV (light-oxygen-voltage) domain, a linker helix, and the C-terminal sulfate transporter and anti-sigma factor antagonist domain. YtvA is believed to act as a positive regulator for light and salt stress responses by regulating the

  11. An extra early mutant of pigeonpea

    International Nuclear Information System (INIS)

    Ravikesavan, R.; Kalaimagal, T.; Rathnaswamy, R.

    2001-01-01

    The redgram (Cajanus cajan (L.) Huth) variety 'Prabhat DT' was gamma irradiated with 100, 200, 300 and 400 Gy doses. Several mutants have been identified viz., extra early mutants, monostem mutants, obcordifoliate mutants and bi-stigmatic mutants. The extra early mutant was obtained when treated with 100 Gy dose. The mutant was selfed and forwarded from M 2 to M 4 generation. In the M 4 generation the mutant line was raised along with the parental variety. Normal cultural practices were followed and the biometrical observations were recorded. It was observed that for the characters viz., total number of branches per plant, number of pods per plants, seeds per pod, 100 seed weight and seed yield per plant there was no difference between the mutant and parent variety. Whereas, regarding the days to flowering and maturity the mutants were earlier than the parents. The observation was recorded from two hundred plants each. The mutant gives the same yield in 90 days as that of the parent variety in 107 days, which make it an economic mutant

  12. Problem-Solving Test: Tryptophan Operon Mutants

    Science.gov (United States)

    Szeberenyi, Jozsef

    2010-01-01

    This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

  13. High-resolution two-dimensional liquid chromatography analysis of key linker drug intermediate used in antibody drug conjugates.

    Science.gov (United States)

    Venkatramani, C J; Huang, Shu Rong; Al-Sayah, Mohammad; Patel, Ila; Wigman, Larry

    2017-10-27

    In this manuscript, the application of high-resolution sampling (HRS) two-dimensional liquid chromatography (2D-LC) in the detailed analysis of key linker drug intermediate is presented. Using HRS, selected regions of the primary column eluent were transferred to a secondary column with fidelity enabling qualitative and quantitative analysis of linker drugs. The primary column purity of linker drug intermediate ranged from 88.9% to 94.5% and the secondary column purity ranged from 99.6% to 99.9%, showing lot-to-lot variability, significant differences between the three lots, and substantiating the synthetic and analytical challenges of ADCs. Over 15 impurities co-eluting with the linker drug intermediate in the primary dimension were resolved in the secondary dimension. The concentrations of most of these impurities were over three orders of magnitude lower than the linker drug. Effective peak focusing and high-speed secondary column analysis resulted in sharp peaks in the secondary dimension, improving the signal-to-noise ratios. The sensitivity of 2D-LC separation was over five fold better than conventional HPLC separation. The limit of quantitation (LOQ) was less than 0.01%. Many peaks originating from primary dimension were resolved into multiple components in the complementary secondary dimension, demonstrating the complexity of these samples. The 2D-LC was highly reproducible, showing good precision between runs with%RSD of peak areas less than 0.1 for the main component. The absolute difference in the peak areas of impurities less than 0.1% were within ±0.01% and for impurities in the range of 0.1%-0.3%, the absolute difference were ±0.02%, which are comparable to 1D-LC. The overall purity of the linker drug intermediate was determined from the product of primary and secondary column purity (HPLC Purity=%peak area of main component in the primary dimension×%peak area of main component in the secondary dimension). Additionally, the 2D-LC separation enables

  14. Prescreening of Nicotine Hapten Linkers in Vitro To Select Hapten-Conjugate Vaccine Candidates for Pharmacokinetic Evaluation in Vivo.

    Science.gov (United States)

    Arutla, Viswanath; Leal, Joseph; Liu, Xiaowei; Sokalingam, Sriram; Raleigh, Michael; Adaralegbe, Adejimi; Liu, Li; Pentel, Paul R; Hecht, Sidney M; Chang, Yung

    2017-05-08

    Since the demonstration of nicotine vaccines as a possible therapeutic intervention for the effects of tobacco smoke, extensive effort has been made to enhance nicotine specific immunity. Linker modifications of nicotine haptens have been a focal point for improving the immunogenicity of nicotine, in which the evaluation of these modifications usually relies on in vivo animal models, such as mice, rats or nonhuman primates. Here, we present two in vitro screening strategies to estimate and predict the immunogenic potential of our newly designed nicotine haptens. One utilizes a competition enzyme-linked immunoabsorbent assay (ELISA) to profile the interactions of nicotine haptens or hapten-protein conjugates with nicotine specific antibodies, both polyclonal and monoclonal. Another relies on computational modeling of the interactions between haptens and amino acid residues near the conjugation site of the carrier protein to infer linker-carrier protein conjugation effect on antinicotine antibody response. Using these two in vitro methods, we ranked the haptens with different linkers for their potential as viable vaccine candidates. The ELISA-based hapten ranking was in an agreement with the results obtained by in vivo nicotine pharmacokinetic analysis. A correlation was found between the average binding affinity (IC 50 ) of the haptens to an anti-Nic monoclonal antibody and the average brain nicotine concentration in the immunized mice. The computational modeling of hapten and carrier protein interactions helps exclude conjugates with strong linker-carrier conjugation effects and low in vivo efficacy. The simplicity of these in vitro screening strategies should facilitate the selection and development of more effective nicotine conjugate vaccines. In addition, these data highlight a previously under-appreciated contribution of linkers and hapten-protein conjugations to conjugate vaccine immunogenicity by virtue of their inclusion in the epitope that binds and

  15. Family-specific Kinesin Structures Reveal Neck-linker Length Based on Initiation of the Coiled-coil.

    Science.gov (United States)

    Phillips, Rebecca K; Peter, Logan G; Gilbert, Susan P; Rayment, Ivan

    2016-09-23

    Kinesin-1, -2, -5, and -7 generate processive hand-over-hand 8-nm steps to transport intracellular cargoes toward the microtubule plus end. This processive motility requires gating mechanisms to coordinate the mechanochemical cycles of the two motor heads to sustain the processive run. A key structural element believed to regulate the degree of processivity is the neck-linker, a short peptide of 12-18 residues, which connects the motor domain to its coiled-coil stalk. Although a shorter neck-linker has been correlated with longer run lengths, the structural data to support this hypothesis have been lacking. To test this hypothesis, seven kinesin structures were determined by x-ray crystallography. Each included the neck-linker motif, followed by helix α7 that constitutes the start of the coiled-coil stalk. In the majority of the structures, the neck-linker length differed from predictions because helix α7, which initiates the coiled-coil, started earlier in the sequence than predicted. A further examination of structures in the Protein Data Bank reveals that there is a great disparity between the predicted and observed starting residues. This suggests that an accurate prediction of the start of a coiled-coil is currently difficult to achieve. These results are significant because they now exclude simple comparisons between members of the kinesin superfamily and add a further layer of complexity when interpreting the results of mutagenesis or protein fusion. They also re-emphasize the need to consider factors beyond the kinesin neck-linker motif when attempting to understand how inter-head communication is tuned to achieve the degree of processivity required for cellular function. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Family-specific Kinesin Structures Reveal Neck-linker Length Based on Initiation of the Coiled-coil*

    Science.gov (United States)

    Phillips, Rebecca K.; Peter, Logan G.; Gilbert, Susan P.

    2016-01-01

    Kinesin-1, -2, -5, and -7 generate processive hand-over-hand 8-nm steps to transport intracellular cargoes toward the microtubule plus end. This processive motility requires gating mechanisms to coordinate the mechanochemical cycles of the two motor heads to sustain the processive run. A key structural element believed to regulate the degree of processivity is the neck-linker, a short peptide of 12–18 residues, which connects the motor domain to its coiled-coil stalk. Although a shorter neck-linker has been correlated with longer run lengths, the structural data to support this hypothesis have been lacking. To test this hypothesis, seven kinesin structures were determined by x-ray crystallography. Each included the neck-linker motif, followed by helix α7 that constitutes the start of the coiled-coil stalk. In the majority of the structures, the neck-linker length differed from predictions because helix α7, which initiates the coiled-coil, started earlier in the sequence than predicted. A further examination of structures in the Protein Data Bank reveals that there is a great disparity between the predicted and observed starting residues. This suggests that an accurate prediction of the start of a coiled-coil is currently difficult to achieve. These results are significant because they now exclude simple comparisons between members of the kinesin superfamily and add a further layer of complexity when interpreting the results of mutagenesis or protein fusion. They also re-emphasize the need to consider factors beyond the kinesin neck-linker motif when attempting to understand how inter-head communication is tuned to achieve the degree of processivity required for cellular function. PMID:27462072

  17. Evaluation of ¹¹¹in-labelled exendin-4 derivatives containing different meprin β-specific cleavable linkers.

    Directory of Open Access Journals (Sweden)

    Andreas Jodal

    Full Text Available Cleavable linkers, which are specifically cleaved by defined conditions or enzymes, are powerful tools that can be used for various purposes. Amongst other things, they have been successfully used to deliver toxic payloads as prodrugs into target tissues. In this work novel linker sequences targeting meprin β, a metalloprotease expressed in the kidney brush-border membrane, were designed and included in the sequence of three radiolabelled exendin-4 derivatives. As radiolabelled exendin-4 derivatives strongly accumulate in the kidneys, we hypothesised that specific cleavage of the radiolabelled moiety at the kidney brush-border membrane would allow easier excretion of the activity into the urine and therefore improve the pharmacological properties of the peptide.The insertion of a cleavable linker did not negatively influence the in vitro properties of the peptides. They showed a good affinity to the GLP-1 receptor expressed in CHL cells, a high internalisation and sufficiently high stability in fresh human blood plasma. In vitro digestion with recombinant meprin β rapidly metabolised the corresponding linker sequences. After 60 min the majority of the corresponding peptides were digested and at the same time the anticipated fragments were formed. The peptides were also quickly metabolised in CD1 nu/nu mouse kidney homogenates. Immunofluorescence staining of meprin β in kidney sections confirmed the expression of the protease in the kidney brush-border membrane. Biodistribution in GLP-1 receptor positive tumour-xenograft bearing mice revealed high specific uptake of the 111In-labelled tracers in receptor positive tissue. Accumulation in the kidneys, however, was still high and comparable to the lead compound 111In-Ex4NOD40.In conclusion, we show that the concept of cleavable linkers specific for meprin β is feasible, as the peptides are rapidly cleaved by the enzyme while retaining their biological properties.

  18. Time-resolved fluctuation during the photochemical reaction of a photoreceptor protein: phototropin1LOV2-linker.

    Science.gov (United States)

    Kuroi, Kunisato; Sato, Francielle; Nakasone, Yusuke; Zikihara, Kazunori; Tokutomi, Satoru; Terazima, Masahide

    2016-02-17

    Although the relationship between structural fluctuations and reactions is important for elucidating reaction mechanisms, experimental data describing such fluctuations of reaction intermediates are sparse. In order to investigate structural fluctuations during a protein reaction, the compressibilities of intermediate species after photoexcitation of a phot1LOV2-linker, which is a typical LOV domain protein with the C-terminal linker including the J-α helix and used recently for optogenetics, were measured in the time-domain by the transient grating and transient lens methods with a high pressure optical cell. The yield of covalent bond formation between the chromophore and a Cys residue (S state formation) relative to that at 0.1 MPa decreased very slightly with increasing pressure. The fraction of the reactive species that yields the T state (linker-unfolded state) decreased almost proportionally with pressure (0.1-200 MPa) to about 65%. Interestingly, the volume change associated with the reaction was much more pressure sensitive. By combining these data, the compressibility changes for the short lived intermediate (S state) and the final product (T state) formation were determined. The compressibility of the S state was found to increase compared with the dark (D) state, and the compressibility decreased during the transition from the S state to the T state. The compressibility change is discussed in terms of cavities inside the protein. By comparing the crystal structures of the phot1LOV2-linker at dark and light states, we concluded that the cavity volumes between the LOV domain and the linker domain increase in the S state, which explains the enhanced compressibility.

  19. Enhancers of Conidiation Mutants in Aspergillus Nidulans

    OpenAIRE

    Gems, D. H.; Clutterbuck, A. J.

    1994-01-01

    Mutants at a number of loci, designated sthenyo, have been isolated as enhancers of the oligoconidial mutations at the medA locus. Two loci have been mapped: sthA on linkage group I, and sthB on linkage group V. Two probable alleles have been identified at each locus but two further mutants were unlinked to either sthA or sthB. Neither sthA nor sthB mutants have conspicuous effects on morphology on their own, nor could the sthA1 sthB2 double mutant be distinguished from wild type. Mutants at ...

  20. Dwarf mutant of rice variety Seratus Malam

    International Nuclear Information System (INIS)

    Mugiono, P. S.; Soemanggono, A.M.R.

    1989-01-01

    Full text: Seeds of 'Seratus Malam', a local tall upland variety with long panicles and high yield potential were irradiated with 10-50 krad gamma rays in 1983. From 50,000 M 2 plants, 130 semidwarf mutants and 1 dwarf mutant were selected. The dwarf mutant M-362 was obtained from the 10 krad treatment. The mutant shows about 50% reduction in plant height, but also in number of productive tillers. Thus the yield per plant is also significantly less. However, the mutant gene is not allelic to DGWG and therefore may be useful in cross breeding. (author)

  1. Dicty_cDB: FC-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA18 (Link to dictyBase) - - - Contig-U15943-1 FC-AA18P (Li...nk to Original site) FC-AA18F 506 FC-AA18Z 293 FC-AA18P 799 - - Show FC-AA18 Library FC (Link to library) Clone ID FC-AA...al site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA18Q.Seq.d/ Representative seq. ID FC-AA...18P (Link to Original site) Representative DNA sequence >FC-AA18 (FC-AA18Q) /CSM/FC/FC-AA/FC-AA18Q.Seq.d/ AAA...AGATAGAGAAGAAAGAAAACTTGAACGTGAGAAGGAACTTGAACGTGAACGTGAGAA AGAACTTGAGCGTGAGCGTGAACGTGAACAACGTCGTCTTGAAA

  2. Dicty_cDB: FCL-AA12 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA12 (Link to dictyBase) - - - Contig-U16034-1 FCL-AA12P ...(Link to Original site) FCL-AA12F 629 FCL-AA12Z 540 FCL-AA12P 1169 - - Show FCL-AA12 Library FCL (Link to library) Clone ID FCL-AA...4-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA12Q....Seq.d/ Representative seq. ID FCL-AA12P (Link to Original site) Representative DNA sequence >FCL-AA12 (FCL-AA12Q) /CSM/FCL/FCL-AA.../FCL-AA12Q.Seq.d/ ATCAAATGTTTATTCAACAACAACCATCAGATTCAATTGTTTGTAATCGTTATATTCATC CAGCCATTGTTGTTTTGGTTGACCAA

  3. Dicty_cDB: FCL-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA01 (Link to dictyBase) - - - Contig-U16033-1 FCL-AA01P ...(Link to Original site) FCL-AA01F 603 FCL-AA01Z 411 FCL-AA01P 1014 - - Show FCL-AA01 Library FCL (Link to library) Clone ID FCL-AA...3-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA01Q....Seq.d/ Representative seq. ID FCL-AA01P (Link to Original site) Representative DNA sequence >FCL-AA01 (FCL-AA01Q) /CSM/FCL/FCL-AA.../FCL-AA01Q.Seq.d/ GCAAATAATAATATTATGGGTATTGACTTTGGTACACATTTCGCATGTGTTGGTATTTTC AAGAATGAAAGAATTGAAATCTGTCCAAA

  4. Dicty_cDB: FCL-AA07 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA07 (Link to dictyBase) - - - Contig-U14973-1 FCL-AA07P ...(Link to Original site) FCL-AA07F 527 FCL-AA07Z 253 FCL-AA07P 780 - - Show FCL-AA07 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA07Q....Seq.d/ Representative seq. ID FCL-AA07P (Link to Original site) Representative DNA sequence >FCL-AA07 (FCL-AA07Q) /CSM/FCL/FCL-AA.../FCL-AA07Q.Seq.d/ CAAAATAAAAAATGTTATCAAATTTTTTAAAAGTCAACAGTAAAGCACTAGGACATATAA GAACTTTTGCCTCAAAGAGTGGTGAAATTAAA

  5. Dicty_cDB: FCL-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA21 (Link to dictyBase) - - - Contig-U14936-1 FCL-AA21P ...(Link to Original site) FCL-AA21F 520 FCL-AA21Z 356 FCL-AA21P 876 - - Show FCL-AA21 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA21Q....Seq.d/ Representative seq. ID FCL-AA21P (Link to Original site) Representative DNA sequence >FCL-AA21 (FCL-AA21Q) /CSM/FCL/FCL-AA.../FCL-AA21Q.Seq.d/ ATCATAATCATATATTTTTAATAGATATTGATATATATATTTAAAAAAATAAAATAAAAT AAAATAAAAAATGTCAACAGAGGAAACAAAAA

  6. Dicty_cDB: FC-AA11 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA11 (Link to dictyBase) - - - Contig-U16273-1 FC-AA11P (Li...nk to Original site) FC-AA11F 631 FC-AA11Z 502 FC-AA11P 1133 - - Show FC-AA11 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA11Q.Seq.d/ Representative seq. ID FC-AA...11P (Link to Original site) Representative DNA sequence >FC-AA11 (FC-AA11Q) /CSM/FC/FC-AA/FC-AA...11Q.Seq.d/ GGTGAATTAATTGTTGAACCAGTTGATCAAAAATATATTTTCAAGACTGAACGTAAAGTT CCAAGAATGGGTGTTATGATTGTTGGTTTATGTGGTAACAATGGTACAA

  7. Dicty_cDB: FC-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA08 (Link to dictyBase) - - - Contig-U15942-1 FC-AA08P (Li...nk to Original site) FC-AA08F 620 FC-AA08Z 510 FC-AA08P 1130 - - Show FC-AA08 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA08Q.Seq.d/ Representative seq. ID FC-AA...08P (Link to Original site) Representative DNA sequence >FC-AA08 (FC-AA08Q) /CSM/FC/FC-AA/FC-AA...08Q.Seq.d/ ATCAGTTACATGTACTGCACCAGTTAATATTGCAGTTATCAAATATTGGGGAAAGAGAGA TGAAAATATTATTTTACCATTAAATTCATCACTCAGTGGAA

  8. Dicty_cDB: FC-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA06 (Link to dictyBase) - - - Contig-U15909-1 FC-AA06P (Li...nk to Original site) FC-AA06F 532 FC-AA06Z 501 FC-AA06P 1033 - - Show FC-AA06 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA06Q.Seq.d/ Representative seq. ID FC-AA...06P (Link to Original site) Representative DNA sequence >FC-AA06 (FC-AA06Q) /CSM/FC/FC-AA/FC-AA...06Q.Seq.d/ GTGAATATAACGATTTAGATTTAGTGTATGATAAAGATGTTTATCAAAAATTAATAGAGA ATGGTGTAGATTCATTATTATCAAAA

  9. Dicty_cDB: FCL-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA13 (Link to dictyBase) - - - - FCL-AA13P (Link to Original site) FCL-AA...13F 635 FCL-AA13Z 350 FCL-AA13P 985 - - Show FCL-AA13 Library FCL (Link to library) Clone ID FCL-AA...dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ Representative seq. ID FCL-AA...13P (Link to Original site) Representative DNA sequence >FCL-AA13 (FCL-AA13Q) /CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ CATATTTATAA...TTATATCTTTTTTGTTTAATAAAAAAGAAAGAATACCAACATGAGACTT TTATTGTGTTTAATTTTCTTAGTTTTTGTTTTCAATTTTGCATTATCAA

  10. AA, Inner Conductor of Magnetic Horn

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    Antiprotons emerging at large angles from the production target (hit by an intense 26 GeV proton beam from the PS), were focused into the acceptance of the injection line of the AA by means of a "magnetic horn" (current-sheet lens). Here we see an early protype of the horn's inner conductor, machined from solid aluminium to a thickness of less than 1 mm. The 1st version had to withstand pulses of 150 kA, 15 us long, every 2.4 s. See 8801040 for a later version.

  11. Alanine to valine substitutions in the pore helix IIIP1 and linker-helix IIIL45 confer cockroach sodium channel resistance to DDT and pyrethroids.

    Science.gov (United States)

    Chen, Mengli; Du, Yuzhe; Nomura, Yoshiko; Zhu, Guonian; Zhorov, Boris S; Dong, Ke

    2017-05-01

    Pyrethroid insecticides exert toxic effects by prolonging the opening of voltage-gated sodium channels. More than 20 sodium channel mutations from arthropod pests and disease vectors have been confirmed to confer pyrethroid resistance. These mutations have been valuable in elucidating the molecular interaction between pyrethroids and sodium channels, including identification of two pyrethroid receptor sites. Previously, two alanine to valine substitutions, one in the pore helix IIIP1 and the other in the linker-helix connecting S4 and S5 in domain III (IIIL45), were found in Drosophila melanogaster mutants that are resistant to DDT and deltamethrin (a type II pyrethroid with an α-cyano group at the phenylbenzyl alcohol position, which is lacking in type I pyrethroids), but their role in target-site-mediated insecticide resistance has not been functionally confirmed. In this study, we functionally examined the two mutations in cockroach sodium channels expressed in Xenopus laevis oocytes. Both mutations caused depolarizing shifts in the voltage dependence of activation, conferred DDT resistance and also resistance to two Type I pyrethroids by almost abolishing the tail currents induced by Type I pyrethroids. In contrast, neither mutation reduced the amplitude of tail currents induced by the Type II pyrethroids, deltamethrin or cypermethrin. However, both mutations accelerated the decay of Type II pyrethroid-induced tail currents, which normally decay extremely slowly. These results provided new insight into the molecular basis of different actions of Type I and Type II pyrethroids on sodium channels. Computer modeling predicts that both mutations may allosterically affect pyrethroid binding. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Experimental immunologically mediated aplastic anemia (AA) in mice: cyclosporin A fails to protect against AA

    International Nuclear Information System (INIS)

    Knospe, W.H.; Steinberg, D.; Gratwohl, A.; Speck, B.

    1984-01-01

    Immunologically mediated aplastic anemia (AA) in mice was induced by the i.v. injection of 10(7) lymph node cells (LNC) from H-2k identical but Mls mismatched CBA/J donor mice into previously irradiated (600 rad total body gamma) C3H/HeJ mice. Cyclosporin A (CsA), 25 mg/kg, was administered subcutaneously from day -1 to day 30. Control mice included C3H/HeJ mice which received 600 rad alone, C3H/HeJ mice which received 600 rad plus CsA as above, and C3H/HeJ mice which received 600 rad total body irradiation followed by 10(7) LNC from CBA/J donors. CsA failed to prevent lethal AA. These results suggest that the pathogenetic mechanisms operating in immunologically mediated AA differ from the mechanisms operating in rodents transplanted with allogeneically mismatched marrow or spleen cells which develop graft-versus-host disease. The results are consistent with a non-T cell-dependent mechanism causing the AA

  13. PNRI mutant variety: Cordyline 'Afable'

    International Nuclear Information System (INIS)

    Aurigue, Fernando B.

    2012-01-01

    Cordyline 'Afable', registered by the Philippine Nuclear Research Institute as NSIC 2009 Or-83, is an induced mutant developed from Cordyline 'Kiwi' by treating stem cuttings with acute gamma radiation from a Cobalt-60 source. The new mutant is identical to Cordyline 'Kiwi' in growth habit but differs in foliage color, and exhibits field resistance to Phytophthora sp., a fungus that causes leaf blight and rot in Ti plants. Results of this mutation breeding experiment showed that leaf color was altered by gamma irradiation and resistance to fungal diseases was improved. It also demonstrated how mutations that occur in nature may be generated artificially. Propagation of cordyline 'Afable' is true-to-type by vegetative propagation methods, such as separation of suckers and offshoots, shoot tip cutting, and top cutting. Aside from landscaping material, terrarium or dish-garden plant, it is ideal as containerized plant for indoor and outdoor use. The leaves or shoots may be harvested as cut foliage for flower arrangements. (author)

  14. Simon van der Meer in the AA Control Room

    CERN Multimedia

    CERN PhotoLab

    1984-01-01

    Simon van der Meer, spiritus rector of the Antiproton Accumulator, in the AA Control Room. Inventor of stochastic cooling, on which the AA was based, and of the magnetic horn, with which the antiprotons were focused, he also wrote most of the software with which the AA was controlled, and spent uncountable numbers of hours in this chair to tickle the AA to top performance. 8 months after this picture was taken, he received, in October 1984, the Nobel prize, together with Carlo Rubbia, the moving force behind the whole Proton-Antiproton Collider project that led to the discovery, in 1983, of the W and Z intermediate bosons.

  15. Flow Injection and Atomic Absorption Spectrometry (FI-AAS) -

    DEFF Research Database (Denmark)

    Hansen, Elo Harald

    1996-01-01

    One of the advantages of the flow injection (FI) concept is that it is compatible with virtually all detection techniques. Being a versatile vehicle for enhancing the performance of the individual detection devices, the most spectacular results have possibly been obtained in conjunction with atomic...... absorption spectrometry (AAS). Initially with flame-AAS (fAAS) procedures, later for hydride generation (HG) techniques, and most recently in combination with electrothermal AAS (ETAAS). The common denominator for all these procedures is the inherently precise and strictly reproducible timing in FI from...

  16. Gamma ray induced mutants in Coleus

    International Nuclear Information System (INIS)

    Vasudevan, K.; Jos, J.S.

    1988-01-01

    The germplasm collection of Chinese potato (Coleus parviflorus Benth) contains almost no variation for yield contributing traits. The crop does not produce seeds. Treatment of underground tubers with 1 kR, 2 kR, 3 kR and 4 kR gamma rays resulted in 50 morphologically different mutants which are maintained as mutant clones. In the M 1 V 1 generation, suspected mutant sprouts, were carefully removed and grown separately. The most interesting mutant types are the following: (i) erect mutant with spoon shaped light green leaves, 30 cm long inflorescences against 20 cm in the control, cylindrical tubers measuring ca. 7.0 cm long and 3 cm girth against 4 cm and 2.5 cm in the control (ii) early mutants 1 and 2, one having less leaf serration, the other having light green small leaves and dwarf type (iii) fleshy leaf mutant, dark green, thick and smooth leaves. Control plants spread almost in 1 m 2 area and bear tubers from the nodes of branches. In the early mutants tuber formation is mainly restricted to the base of the plant, which makes harvest easier. The crop usually matures within 150 - 160 days, the early mutants are ready for harvest 100 days after planting. As the mutants are less spreading, the yield could be increased by closer spacing

  17. Moessbauer spectrometer MsAa-3

    International Nuclear Information System (INIS)

    Gornicki, R.; Blachowski, A.; Ruebenbauer, K.

    2007-01-01

    The paper is aimed at the description of the newly developed Moessbauer spectrometer MsAa-3. The spectrometer MsAa-3 consists of a high quality γ--ray spectrometer including either a proportional gas detector head or a scintillation detector head, a transducer driving system including the transducer, data storage system, and data communication system based on the TCP/IP protocol. Additionally, the Michelson-Morley interferometer is provided for precise calibration of the transducer velocity. The spectrometer is equipped with an integrated simple temperature controller. All the essential functions are remotely controlled over the TCP/IP link allowing for the spectrometer set-up as the stand-alone unit in the computer network, e.g. on the Internet. External γ-ray detectors or external complete nuclear blocks could be used as well. The spectrometer is equipped with software allowing for setting all the functions, to perform on-line control, and retrieve data. The Moessbauer data processing software MOSGRAF is enclosed as well. The latter software allows for the calculation of the variety of velocity reference functions. (authors)

  18. Sharing mutants and experimental information prepublication using FgMutantDb (https://scabusa.org/FgMutantDb).

    Science.gov (United States)

    Baldwin, Thomas T; Basenko, Evelina; Harb, Omar; Brown, Neil A; Urban, Martin; Hammond-Kosack, Kim E; Bregitzer, Phil P

    2018-02-02

    There is no comprehensive storage for generated mutants of Fusarium graminearum or data associated with these mutants. Instead, researchers relied on several independent and non-integrated databases. FgMutantDb was designed as a simple spreadsheet that is accessible globally on the web that will function as a centralized source of information on F. graminearum mutants. FgMutantDb aids in the maintenance and sharing of mutants within a research community. It will serve also as a platform for disseminating prepublication results as well as negative results that often go unreported. Additionally, the highly curated information on mutants in FgMutantDb will be shared with other databases (FungiDB, Ensembl, PhytoPath, and PHI-base) through updating reports. Here we describe the creation and potential usefulness of FgMutantDb to the F. graminearum research community, and provide a tutorial on its use. This type of database could be easily emulated for other fungal species. Published by Elsevier Inc.

  19. Bis-isatin hydrazones with novel linkers: Synthesis and biological evaluation as cytotoxic agents.

    Science.gov (United States)

    Ibrahim, Hany S; Abou-Seri, Sahar M; Ismail, Nasser S M; Elaasser, Mahmoud M; Aly, Mohamed H; Abdel-Aziz, Hatem A

    2016-01-27

    Many bis-isatins and isatins with hydrazide extension were reported to have a potential anti-proliferative effects against different cancer cell lines and cancer targets. In this study, four series of bis-isatins with hydrazide linkers were synthesized. These compounds were investigated for their antitumor activity by assessing their cytotoxic potency against HepG2, MCF-7 and HCT-116 cancer cell lines. Compound 21c possessed significant cytotoxic activity against MCF-7 (IC50 = 1.84 μM) and HCT-116 (IC50 = 3.31 μM) that surpasses the activity of doxorubicin against both cell lines (MCF-7; IC50 = 2.57 μM and HCT-116; IC50 = 3.70 μM). Cell cycle analysis and annexin V-FITC staining of MCF-7 cells treated with 21c suggested that the cytotoxic effect of the compound could be attributed to its pro-apoptotic activity. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  20. Gold nanoparticles deposited on linker-free silicon substrate and embedded in aluminum Schottky contact.

    Science.gov (United States)

    Gorji, Mohammad Saleh; Razak, Khairunisak Abdul; Cheong, Kuan Yew

    2013-10-15

    Given the enormous importance of Au nanoparticles (NPs) deposition on Si substrates as the precursor for various applications, we present an alternative approach to deposit Au NPs on linker-free n- and p-type Si substrates. It is demonstrated that, all conditions being similar, there is a significant difference between densities of the deposited NPs on both substrates. The Zeta-potential and polarity of charges surrounding the hydroxylamine reduced seeded growth Au NPs, are determined by a Zetasizer. To investigate the surface properties of Si substrates, contact angle measurement is performed. Field-emission scanning electron microscope is then utilized to distinguish the NPs density on the substrates. Finally, Al/Si Schottky barrier diodes with embedded Au NPs are fabricated, and their structural and electrical characteristics are further evaluated using an energy-filtered transmission electron microscope and current-voltage measurements, respectively. The results reveal that the density of NPs is significantly higher on n-type Si substrate and consequently has more pronounced effects on the electrical characteristics of the diode. It is concluded that protonation of Si-OH group on Si surface in low pH is responsible for the immobilization of Au NPs, which eventually contributes to the lowering of barrier height and enhances the electrical characteristics. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Regulation of ABCB1/PGP1-catalysed auxin transport by linker phosphorylation

    DEFF Research Database (Denmark)

    Henrichs, Sina; Wang, Bangjun; Fukao, Yoichiro

    2012-01-01

    Polar transport of the plant hormone auxin is controlled by PIN-and ABCB/PGP-efflux catalysts. PIN polarity is regulated by the AGC protein kinase, PINOID (PID), while ABCB activity was shown to be dependent on interaction with the FKBP42, TWISTED DWARF1 (TWD1). Using co-immunoprecipitation (co......-IP) and shotgun LC-MS/MS analysis, we identified PID as a valid partner in the interaction with TWD1. In-vitro and yeast expression analyses indicated that PID specifically modulates ABCB1-mediated auxin efflux in an action that is dependent on its kinase activity and that is reverted by quercetin binding...... and thus inhibition of PID autophosphorylation. Triple ABCB1/PID/TWD1 co-transfection in tobacco revealed that PID enhances ABCB1-mediated auxin efflux but blocks ABCB1 in the presence of TWD1. Phospho-proteomic analyses identified S634 as a key residue of the regulatory ABCB1 linker and a very likely...

  2. Nucleosome–nucleosome interactions via histone tails and linker DNA regulate nuclear rigidity

    Science.gov (United States)

    Shimamoto, Yuta; Tamura, Sachiko; Masumoto, Hiroshi; Maeshima, Kazuhiro

    2017-01-01

    Cells, as well as the nuclei inside them, experience significant mechanical stress in diverse biological processes, including contraction, migration, and adhesion. The structural stability of nuclei must therefore be maintained in order to protect genome integrity. Despite extensive knowledge on nuclear architecture and components, however, the underlying physical and molecular mechanisms remain largely unknown. We address this by subjecting isolated human cell nuclei to microneedle-based quantitative micromanipulation with a series of biochemical perturbations of the chromatin. We find that the mechanical rigidity of nuclei depends on the continuity of the nucleosomal fiber and interactions between nucleosomes. Disrupting these chromatin features by varying cation concentration, acetylating histone tails, or digesting linker DNA results in loss of nuclear rigidity. In contrast, the levels of key chromatin assembly factors, including cohesin, condensin II, and CTCF, and a major nuclear envelope protein, lamin, are unaffected. Together with in situ evidence using living cells and a simple mechanical model, our findings reveal a chromatin-based regulation of the nuclear mechanical response and provide insight into the significance of local and global chromatin structures, such as those associated with interdigitated or melted nucleosomal fibers. PMID:28428255

  3. Molecular motor-induced instabilities and cross linkers determine biopolymer organization.

    Energy Technology Data Exchange (ETDEWEB)

    Smith, D.; Ziebert, F.; Humphrey, D.; Duggan, C.; Steinbeck, M.; Zimmermann, W.; Kas, J.; Materials Science Division; Univ. of Leipzig; Univ. of Texas at Austin; Univ. Bayreuth

    2007-01-01

    All eukaryotic cells rely on the active self-organization of protein filaments to form a responsive intracellular cytoskeleton. The necessity of motility and reaction to stimuli additionally requires pathways that quickly and reversibly change cytoskeletal organization. While thermally driven order-disorder transitions are, from the viewpoint of physics, the most obvious method for controlling states of organization, the timescales necessary for effective cellular dynamics would require temperatures exceeding the physiologically viable temperature range. We report a mechanism whereby the molecular motor myosin II can cause near-instantaneous order-disorder transitions in reconstituted cytoskeletal actin solutions. When motor-induced filament sliding diminishes, the actin network structure rapidly and reversibly self-organizes into various assemblies. Addition of stable cross linkers was found to alter the architectures of ordered assemblies. These isothermal transitions between dynamic disorder and self-assembled ordered states illustrate that the interplay between passive crosslinking and molecular motor activity plays a substantial role in dynamic cellular organization.

  4. Role of H1 linker histones in mammalian development and stem cell differentiation.

    Science.gov (United States)

    Pan, Chenyi; Fan, Yuhong

    2016-03-01

    H1 linker histones are key chromatin architectural proteins facilitating the formation of higher order chromatin structures. The H1 family constitutes the most heterogeneous group of histone proteins, with eleven non-allelic H1 variants in mammals. H1 variants differ in their biochemical properties and exhibit significant sequence divergence from one another, yet most of them are highly conserved during evolution from mouse to human. H1 variants are differentially regulated during development and their cellular compositions undergo dramatic changes in embryogenesis, gametogenesis, tissue maturation and cellular differentiation. As a group, H1 histones are essential for mouse development and proper stem cell differentiation. Here we summarize our current knowledge on the expression and functions of H1 variants in mammalian development and stem cell differentiation. Their diversity, sequence conservation, complex expression and distinct functions suggest that H1s mediate chromatin reprogramming and contribute to the large variations and complexity of chromatin structure and gene expression in the mammalian genome. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. A new polysiloxane based cross-linker for solid polymer electrolyte

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Yongku; Lee, Junkyoung; Lee, Changjin [Advanced Materials Division, Korea Research Institute of Chemical Technology, P.O. Box 107 Yuseong, Daejeon 305-600 (Korea, Republic of); Suh, Dong Hack [Department of Engineering Chemistry, Hanyang University, Seoul 133-791 (Korea, Republic of)

    2005-08-26

    A new cross-linker, poly[siloxane-(g-oligo(ethylene oxide)-co-acrylate)], was synthesized and used to prepare the solid polymer electrolytes (SPE) by in situ thermal curing method with the addition of the ion-conducting plasticizers such as low molecular weight poly(ethylene oxide)dimethyl ether (PEGDME) and poly(siloxane-g-ethylene oxide) (PSi-PEG). Increase of conductivity and decrease of T{sub g} were observed as increasing the content of plasticizer. The ionic conductivity was measured to be 7.13x10{sup -4}Scm{sup -1} with 70wt.% PEGDME and 4.18x10{sup -5}Scm{sup -1} with 70wt.% of PSi-PEG at 30{sup o}C. The electrochemical stability window of the resulting solid polymer electrolyte could be extended to up to 4.5V and 5.2V for PEGDME and PSi-PEG, respectively. Thermal stability of polymer electrolyte was greatly enhanced with siloxane based plasticizer. The degradation of SPE with PSi-PEG started at ca. 350{sup o}C. The SPE plasticized with PSi-PEG, which has good electrochemical stability and thermal stability, could be a promising solid polymer electrolyte for lithium polymer batteries. (author)

  6. Mutants for plant height in hexaploid triticale

    International Nuclear Information System (INIS)

    Reddy, V.R.K.; Gupta, P.K.

    1988-01-01

    Full text: Four hexaploid triticale varieties namely Beagle, Coorong, TL 419 and Welsh were subjected to gamma rays (100 Gy, 200 Gy, 300 Gy) and to aqueous solution of EMS (0.5%, (8h, 12h, 16h). In all four varieties, three types of mutants for plant height were observed: Semidwarf - the mutant plants are 20-25 cm shorter than the shortest plant in the control. Dwarf - mutant plants grow up to 40-60 cm. Stunted - mutant plants grow up to 10-20 cm. The segregation pattern suggests that semidwarf mutants are quantitatively inherited, showing continuous segregation in M 3 , M 4 and M 5 , whereas dwarf and stunted are monogenic recessive. They showed true breeding in M 3 and later generations. The semi-dwarf, dwarf and stunted mutants can be used as initial material for development of new varieties with short straw and resistance to lodging. (author)

  7. De novo transcriptome analysis of the red seaweed Gracilaria chilensis and identification of linkers associated with phycobilisomes.

    Science.gov (United States)

    Vorphal, María Alejandra; Gallardo-Escárate, Cristian; Valenzuela-Muñoz, Valentina; Dagnino-Leone, Jorge; Vásquez, José Aleikar; Martínez-Oyanedel, José; Bunster, Marta

    2017-02-01

    This work reports the results of the Illumina RNA-Seq of a wild population of female haploid plants of Gracilaria chilensis (Bird et al., 1986) (Rhodophyta, Gigartinalis). Most transcripts were de novo assembled in 12,331 contigs with an average length of 1756bp, showing that 96.64% of the sequences were annotated with known proteins. In particular, the identification of linker proteins of phycobilisomes (PBS) is reported. Linker proteins have primary been identified in cyanobacteria but the information available about them in eukaryotic red alga is not complete, and this is the first report in G. chilensis. This resource will also provide the basis for the study of metabolic pathways related to polysaccharide production. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Role of linker groups between hydrophilic and hydrophobic moieties of cationic surfactants on oligonucleotide-surfactant interactions.

    Science.gov (United States)

    Santhiya, Deenan; Dias, Rita S; Shome, Anshupriya; Das, Prasanta Kumar; Miguel, Maria G; Lindman, Björn; Maiti, Souvik

    2009-12-15

    The interaction between DNA and amino-acid-based surfactants with different linker groups was investigated by gel electrophoresis, ethidium bromide exclusion assays, circular dichroism, and melting temperature determinations. The studies showed that the strength of the interaction between the oligonucleotides and the surfactants is highly dependent on the linker of the surfactant. For ester surfactants, no significant interaction was observed for surfactant-to-DNA charge ratios up to 12. On the other hand, amide surfactants were shown to interact strongly with the oligonucleotides; these surfactants could displace up to 75% of the ethidium bromide molecules bound to the DNA and induced significant changes in the circular dichroism spectra. When comparing the headgroups of the surfactants, it was observed that surfactants with more hydrophobic headgroups (proline vs alanine) interacted more strongly with the DNA, in good agreement with previous studies.

  9. Photochemical Proteolysis of an Unstructured Linker of the GABAAR Extracellular Domain Prevents GABA but Not Pentobarbital Activation

    Science.gov (United States)

    Hanek, Ariele P.; Lester, Henry A.

    2010-01-01

    The GABA type A receptor (GABAAR) is the major inhibitory receptor in the mammalian central nervous system and the target of numerous pharmaceuticals. The α-subunit of these pentameric Cys-loop neurotransmitter-gated ion channels contributes to the binding of both GABA and allosteric modulators such as the benzodiazepines, suggesting a role for this subunit in the conformational changes associated with activation of the receptor. Herein we use the nonsense suppression methodology to incorporate a photoactivatable unnatural amino acid and photochemically cleave the backbone of the α subunit of the α1β2 GABAAR in a linker region that is believed to span the subunit. Proteolytic cleavage impairs GABA but not pentobarbital activation, strongly suggesting that conformational changes involving this linker region are critical to the GABA activation pathway. PMID:20363860

  10. Gamma ray induced mutants in Colocasia

    International Nuclear Information System (INIS)

    Vasudevan, K.; Jos, J.S.

    1988-01-01

    Presented are selected treatments with 250 r, 500 r and 1000 r gamma rays Colocasia mutants with changes in morphological and yield characters. Results from a preliminary yield trial of four mutants with its control variety C 9 are presented. The mutant's characteristics are (i) erect and narrow leaf (ii) cup shaped leaf, dwarf, matures within 120 days against 180 days in control (iii) narrow and thicker leaves, colour of lamina chalky and pale green (iv) vigorous

  11. Effect of linker length and residues on the structure and stability of a fusion protein with malaria vaccine application.

    Science.gov (United States)

    Shamriz, Shabnam; Ofoghi, Hamideh; Moazami, Nasrin

    2016-09-01

    Recombinant protein technology has revolutionized the world of biology and medicine. Following this progress, fusion protein technology, as a novel innovation, has opened new horizons for the development of proteins that do not naturally exist. Fusion proteins are generated via genetically fusing two or more genes coding for separate proteins, thus the product is a single protein having functional properties of both proteins. As an indispensable element in fusion protein construction, linkers are used to separate the functional domains in order to improve their expression, folding and stability. We computationally fused an antigen and an adjuvant together using different linkers to obtain a two-domain fusion construct which can potentially act as an oral vaccine candidate against malaria. We then predicted the structures computationally to find out the probable folding of each domain in the designed construct. One of the fusion constructs was selected based on the highest value for C-score. Ramchandran Plot analysis represented that most residues were fallen in favorable regions. Our in silico analysis showed that (GGGGS)3 linker confers the best structure and stability for our target fusion protein. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Nuclear mobility and mitotic chromosome binding: similarities between pioneer transcription factor FoxA and linker histone H1.

    Science.gov (United States)

    Zaret, K S; Caravaca, J M; Tulin, A; Sekiya, T

    2010-01-01

    There exists a hierarchy by which transcription factors can engage their target sites in chromatin, in that a subset of factors can bind transcriptionally silent, nucleosomal DNA, whereas most factors cannot, and this hierarchy is reflected, at least in part, in the developmental function of the factors. For example, transcription factors possessing the Forkhead box (Fox) DNA-binding domain contain an overall fold resembling that of linker histone and thus are structured to bind DNA, site specifically, in a nucleosomal context. Where tested, Fox factors bind early in the developmental or physiological activation of target genes, thereby enabling the binding of other factors that cannot engage chromatin on their own. To investigate the basis for early chromatin binding, we have used fluorescence recovery after photobleaching (FRAP) to analyze the mobility, in the live cell nucleus, of FoxA factors in comparison to linker histone and other transcription factors. We have further analyzed the factors for their ability to bind to chromatin in mitosis and thereby serve as epigenetic marks. The results indicate that the "pioneer" features of FoxA factors involve various chromatin-binding parameters seen in linker histones and that distinguish the factors with respect to their regulatory and mechanistic functions.

  13. SNaPe: a versatile method to generate multiplexed protein fusions using synthetic linker peptides for in vitro applications.

    Science.gov (United States)

    Ulrich, Veronika; Cryle, Max J

    2017-01-01

    Understanding the structure and function of protein complexes and multi-domain proteins is highly important in biology, although the in vitro characterization of these systems is often complicated by their size or the transient nature of protein/protein interactions. To assist in the characterization of such protein complexes, we have developed a modular approach to fusion protein generation that relies upon Sortase-mediated and Native chemical ligation using synthetic Peptide linkers (SNaPe) to link two separately expressed proteins. In this approach, we utilize two separate linking steps - sortase-mediated and native chemical ligation - together with a library of peptide linkers to generate libraries of fusion proteins. We have demonstrated the viability of SNaPe to generate libraries from fusion protein constructs taken from the biosynthetic enzymes responsible for late stage aglycone assembly during glycopeptide antibiotic biosynthesis. Crucially, SNaPe was able to generate fusion proteins that are inaccessible via direct expression of the fusion construct itself. This highlights the advantages of SNaPe to not only access fusion proteins that have been previously unavailable for biochemical and structural characterization but also to do so in a manner that enables the linker itself to be controlled as an experimental parameter of fusion protein generation. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd.

  14. Idiopathic systemic AA-amyloidosis in a skunk (Mephitis mephitis).

    Science.gov (United States)

    Elhensheri, Mohamed; Linke, Reinhold P; Blankenburg, Anja; Beineke, Andreas

    2012-03-01

    This report describes a case of systemic amyloidosis in a captive striped skunk. At necropsy, bilateral alopecia, as well as reno-, hepato-, and splenomegaly were present. Congo red staining and immunohistochemistry revealed depositions of AA-amyloid in different organs. The lack of a predisposing disease is suggestive of idiopathic systemic AA-amyloidosis.

  15. Partially melted zone cracking in AA6061 welds

    International Nuclear Information System (INIS)

    Prasad Rao, K.; Ramanaiah, N.; Viswanathan, N.

    2008-01-01

    Partially melted zone (PMZ) cracking susceptibility in AA6061 alloy was studied. Role of prior thermal history, gas tungsten arc welding techniques such as continuous current (CC) and pulsed current (PC) and use of different fillers (AA4043 and AA5356) were studied. Role of different grain refiners such as scandium, zirconium and Tibor in the above fillers was studied. Varestraint test was used to study the PMZ cracking susceptibility. Metallurgical analysis was done to corroborate the results. PMZ cracking was severe in T6 temper than in T4 irrespective of filler material. PMZ cracking susceptibility was more with AA5356 than in AA4043. It was less with pulsed current GTAW. PMZ cracking susceptibility was reduced with addition of grain refiners. Out of all, lowest PMZ cracking susceptibility was observed with 0.5%Sc addition to fusion zone through AA4043 filler and PC technique. The concentrations of magnesium and silicon were reduced at the PMZ grain boundaries with grain refiner additions to fusion zone through AA5356 or AA4043

  16. Partially melted zone cracking in AA6061 welds

    Energy Technology Data Exchange (ETDEWEB)

    Prasad Rao, K. [Department of Metallurgical and Materials Engineering, Indian Institute of Technology Madras, Chennai (India)], E-mail: kpr@iitm.ac.in; Ramanaiah, N. [Sri Kalahasteeswara Institute of Technology, Srikalahasti (India); Viswanathan, N. [Defence Research and Development Laboratory, Hyderabad (India)

    2008-07-01

    Partially melted zone (PMZ) cracking susceptibility in AA6061 alloy was studied. Role of prior thermal history, gas tungsten arc welding techniques such as continuous current (CC) and pulsed current (PC) and use of different fillers (AA4043 and AA5356) were studied. Role of different grain refiners such as scandium, zirconium and Tibor in the above fillers was studied. Varestraint test was used to study the PMZ cracking susceptibility. Metallurgical analysis was done to corroborate the results. PMZ cracking was severe in T6 temper than in T4 irrespective of filler material. PMZ cracking susceptibility was more with AA5356 than in AA4043. It was less with pulsed current GTAW. PMZ cracking susceptibility was reduced with addition of grain refiners. Out of all, lowest PMZ cracking susceptibility was observed with 0.5%Sc addition to fusion zone through AA4043 filler and PC technique. The concentrations of magnesium and silicon were reduced at the PMZ grain boundaries with grain refiner additions to fusion zone through AA5356 or AA4043.

  17. The Use of Soil Palynomorphs in Forensics * ABDULRAHAMAN, AA ...

    African Journals Online (AJOL)

    ADOWIE PERE

    The Use of Soil Palynomorphs in Forensics. *. 1. ABDULRAHAMAN, AA;. 2. AL SAHLI, AA;. 1. OKOLI, JU. 1Applied Plant Anatomy and Wood Technology Laboratory, Department of Plant Biology, University of Ilorin, Ilorin, Nigeria. 2Department of Botany and Microbiology, College of Science, King Saud University, Riyadh, ...

  18. Evolution of geomagnetic aa index near sunspot minimum

    Directory of Open Access Journals (Sweden)

    R. P. Kane

    2002-10-01

    Full Text Available The smoothed values of the minima of sunspot number Rz and the geomagnetic index aa were compared for sunspot cycles 12–23. In one cycle, aa(min occurred earlier than Rz(min, but remained at that low from a few months before Rz(min to a few months after Rz(min. In two cycles, Rz(min and aa(min coincided within a month or two. In nine cycles, aa(min occurred more than three months later than Rz(min. The aa(min coincided with the minima of some solar radio emission indices originating in the solar corona. For sunspot cycles 21, 22, 23, the minimum of solar wind velocity V occurred 0–9 months later than the aa(min. The minimum of solar wind total magnetic field B occurred near Rz(min. The solar wind ion density N had maxima (instead of minima near Rz(min, and again near Rz(max, indicating a  ~5-year periodicity, instead of an 11-year periodicity. The maxima of aa, V and B occurred near Rz(max and/or later in the declining phase of Rz. The aa index was very well correlated with the functions BV and BV 2.Key words. Geomagnetism and paleomagnetism (time variations, diurnal to secular – time variations, secular and long term Interplanetary physics (interplanetary magnetic field

  19. AA, shims and washers on quadrupole ends

    CERN Multimedia

    CERN PhotoLab

    1981-01-01

    Due to the fact that much of the field of the quadrupoles was outside the iron (in particular with the wide quadrupoles) and that thus the fields of quadrupoles and bending magnets interacted, the lattice properties of the AA could not be predicted with the required accuracy. After a first running period in 1980, during which detailed measurements were made with proton test beams, corrections to the quadrupoles were made in 1981, in the form of laminated shims at the ends of the poles, and with steel washers. With the latter ones, further refinements were made in an iterative procedure with measurements on the circulating beam. This eventually resulted, amongst other things, in a very low chromaticity, with the Q-values being constant to within +- 0.001 over the total momentum range of 6 %. Here we see the shims and washers on a narrow qudrupole (QFN, QDN). See also 8103203, 8103204, 8103205, 8103206.

  20. Hot stamping of AA7075 aluminum sheets

    Science.gov (United States)

    Mendiguren, J.; Saenz de Argandona, E.; Galdos, L.

    2016-11-01

    In this work the formability of a high strength aluminium alloy (AA7075-T6) for the stamping of an automotive component has been studied. Due to the low formability of the selected alloy, two different heat assisted forming strategies have been analysed. On the one hand, the W-temper process, where the thermal process is carried out prior to the forming operation. On the other hand, the hot stamping process, where the thermal process is carried out at the same time as the forming. The results showed that both technology were able to form the component avoiding any failure of the material. On the contrary, both processes reduced the final mechanical properties of the material compared to the as received material condition. However, the obtained mechanical properties doubled the strength of commonly used 5xxx and 6xxx aluminium alloys.

  1. The PathLinker app: Connect the dots in protein interaction networks [version 1; referees: 1 approved, 2 approved with reservations

    Directory of Open Access Journals (Sweden)

    Daniel P. Gil

    2017-01-01

    Full Text Available PathLinker is a graph-theoretic algorithm for reconstructing the interactions in a signaling pathway of interest. It efficiently computes multiple short paths within a background protein interaction network from the receptors to transcription factors (TFs in a pathway. We originally developed PathLinker to complement manual curation of signaling pathways, which is slow and painstaking. The method can be used in general to connect any set of sources to any set of targets in an interaction network. The app presented here makes the PathLinker functionality available to Cytoscape users. We present an example where we used PathLinker to compute and analyze the network of interactions connecting proteins that are perturbed by the drug lovastatin.

  2. X-ray-enhanced cancer cell migration requires the linker of nucleoskeleton and cytoskeleton complex.

    Science.gov (United States)

    Imaizumi, Hiromasa; Sato, Katsutoshi; Nishihara, Asuka; Minami, Kazumasa; Koizumi, Masahiko; Matsuura, Nariaki; Hieda, Miki

    2018-04-01

    The linker of nucleoskeleton and cytoskeleton (LINC) complex is a multifunctional protein complex that is involved in various processes at the nuclear envelope, including nuclear migration, mechanotransduction, chromatin tethering and DNA damage response. We recently showed that a nuclear envelope protein, Sad1 and UNC84 domain protein 1 (SUN1), a component of the LINC complex, has a critical function in cell migration. Although ionizing radiation activates cell migration and invasion in vivo and in vitro, the underlying molecular mechanism remains unknown. Here, we examined the involvement of the LINC complex in radiation-enhanced cell migration and invasion. A sublethal dose of X-ray radiation promoted human breast cancer MDA-MB-231 cell migration and invasion, whereas carbon ion beam radiation suppressed these processes in a dose-dependent manner. Depletion of SUN1 and SUN2 significantly suppressed X-ray-enhanced cell migration and invasion. Moreover, depletion or overexpression of each SUN1 splicing variant revealed that SUN1_888 containing 888 amino acids of SUN1 but not SUN1_916 was required for X-ray-enhanced migration and invasion. In addition, the results suggested that X-ray irradiation affected the expression level of SUN1 splicing variants and a SUN protein binding partner, nesprins. Taken together, our findings supported that the LINC complex contributed to photon-enhanced cell migration and invasion. © 2018 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  3. Dicty_cDB: FC-AA17 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA17 (Link to dictyBase) - - - Contig-U15091-1 FC-AA17E (Li...nk to Original site) - - - - - - FC-AA17E 347 Show FC-AA17 Library FC (Link to library) Clone ID FC-AA17 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA17Q.Seq.d/ Representative seq. ID FC-AA...17E (Link to Original site) Representative DNA sequence >FC-AA17 (FC-AA17Q) /CSM/FC/FC-AA/FC-AA17Q.Seq.d/ CCCAAAAGCCCGTAA...GACTCACTGTGTCAAGTGCAACAAACACACCCCACACAAGGTTAC CCAATACAAAGCTGGTAAACCAAGTCTTTTCGCACAAGGTAAAAGACGTTACGATCGTAA ACAA

  4. Dicty_cDB: FCL-AA22 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA22 (Link to dictyBase) - G01758 DDB0229949 Contig-U15119-1 FCL-AA...22E (Link to Original site) - - - - - - FCL-AA22E 840 Show FCL-AA22 Library FCL (Link to library) Clone ID FCL-AA...g-U15119-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...22Q.Seq.d/ Representative seq. ID FCL-AA22E (Link to Original site) Representative DNA sequence >FCL-AA22 (FCL-AA...22Q) /CSM/FCL/FCL-AA/FCL-AA22Q.Seq.d/ AAAATGAGCAAAATCTCAAGCGACCAAGTTAGATCAATCGTCTCCCAACTTTTCAAAGAA GCACAAGAATCCAAAA

  5. Dicty_cDB: FC-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA05 (Link to dictyBase) - G01143 DDB0190243 Contig-U15085-1 FC-AA...05E (Link to Original site) - - - - - - FC-AA05E 675 Show FC-AA05 Library FC (Link to library) Clone ID FC-AA...5-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA05Q.Se...q.d/ Representative seq. ID FC-AA05E (Link to Original site) Representative DNA sequence >FC-AA05 (FC-AA05Q) /CSM/FC/FC-AA/FC-AA...05Q.Seq.d/ AAACAAAAAAAAAAGGTATGGAAATTTTTGCATTTGTACCATTAGCAGTGTTAACAGCAT TATGTGTTGTTATTTCACTCTTTGTTAAAAGAGAGAAA

  6. Dicty_cDB: FC-AA16 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA16 (Link to dictyBase) - G22556 DDB0204121 Contig-U15090-1 FC-AA...16E (Link to Original site) - - - - - - FC-AA16E 933 Show FC-AA16 Library FC (Link to library) Clone ID FC-AA...0-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA16Q.Se...q.d/ Representative seq. ID FC-AA16E (Link to Original site) Representative DNA sequence >FC-AA16 (FC-AA16Q) /CSM/FC/FC-AA/FC-AA...16Q.Seq.d/ GGGCAGGATCATCATTTAATACTAAAGATTCAACAATAATTGCAAAAACTCAATTTTATC AAAAAAATATTCAAATTTATAAAGGTGATCAA

  7. Dicty_cDB: FCL-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA06 (Link to dictyBase) - G24322 DDB0216974 Contig-U15228-1 FCL-AA...06E (Link to Original site) - - - - - - FCL-AA06E 791 Show FCL-AA06 Library FCL (Link to library) Clone ID FCL-AA...g-U15228-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...06Q.Seq.d/ Representative seq. ID FCL-AA06E (Link to Original site) Representative DNA sequence >FCL-AA06 (FCL-AA...06Q) /CSM/FCL/FCL-AA/FCL-AA06Q.Seq.d/ AAAATCCCAATTTCATTAGCAGTGGAAGTAACGGAATGAATTGGGGTGGTTCTTTGAACA CTTGTGACTCTGGAGGATTCAA

  8. Dicty_cDB: FC-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA15 (Link to dictyBase) - G01144 DDB0204372 Contig-U15089-1 FC-AA...15E (Link to Original site) - - - - - - FC-AA15E 522 Show FC-AA15 Library FC (Link to library) Clone ID FC-AA...9-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA15Q.Se...q.d/ Representative seq. ID FC-AA15E (Link to Original site) Representative DNA sequence >FC-AA15 (FC-AA15Q) /CSM/FC/FC-AA/FC-AA...15Q.Seq.d/ CAAATCACACATAAAAGTTTAATATAAAAATGGGTACACCAATTAAAAAGATTAGTACAG TAATTATTAAAATGGTTTCATCAGCCAA

  9. Dicty_cDB: FC-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA21 (Link to dictyBase) - - - Contig-U15450-1 FC-AA21E (Li...nk to Original site) - - - - - - FC-AA21E 839 Show FC-AA21 Library FC (Link to library) Clone ID FC-AA21 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA21Q.Seq.d/ Representative seq. ID FC-AA...21E (Link to Original site) Representative DNA sequence >FC-AA21 (FC-AA21Q) /CSM/FC/FC-AA/FC-AA21Q.Seq.d/ AATTATTTTCATTAA...TTTTAGCTTTATTCCTTGTCAACTCCGCTGTTGTCTCTTCACTCG ACTCATGTAGTATTTGTGTTGATTTTGTTGGTAACTCACTCAATGATCTTTTAAATATTA TCCTTAA

  10. Dicty_cDB: FCL-AA23 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA23 (Link to dictyBase) - G01759 DDB0201558 Contig-U15118-1 FCL-AA...23E (Link to Original site) - - - - - - FCL-AA23E 1045 Show FCL-AA23 Library FCL (Link to library) Clone ID FCL-AA...ig-U15118-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...23Q.Seq.d/ Representative seq. ID FCL-AA23E (Link to Original site) Representative DNA sequence >FCL-AA23 (FCL-AA...23Q) /CSM/FCL/FCL-AA/FCL-AA23Q.Seq.d/ ATAACTATATAACTATGTCTAACCAAAAGAAAAACGACGTATCTTCATTTGTTAAAGATT CTTTAA

  11. Dicty_cDB: FCL-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA18 (Link to dictyBase) - G24323 DDB0191144 Contig-U15229-1 FCL-AA...18Z (Link to Original site) - - FCL-AA18Z 623 - - - - Show FCL-AA18 Library FCL (Link to library) Clone ID FCL-AA...g-U15229-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...18Q.Seq.d/ Representative seq. ID FCL-AA18Z (Link to Original site) Representative DNA sequence >FCL-AA18 (FCL-AA...18Q) /CSM/FCL/FCL-AA/FCL-AA18Q.Seq.d/ XXXXXXXXXXGTCAATGTCATTATTGGTGAACAATCTGATGGTTCGTTGGAACAAATCGC TAGAAATCCACAACCAA

  12. Dicty_cDB: FC-AA22 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA22 (Link to dictyBase) - - - Contig-U14948-1 FC-AA22E (Li...nk to Original site) - - - - - - FC-AA22E 576 Show FC-AA22 Library FC (Link to library) Clone ID FC-AA22 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA22Q.Seq.d/ Representative seq. ID FC-AA...22E (Link to Original site) Representative DNA sequence >FC-AA22 (FC-AA22Q) /CSM/FC/FC-AA/FC-AA22Q.Seq.d/ ATGAA...TACGATGATAGTGATTCAGACTTTTGACCAATTGAAAAAACCAGCAACAGAAATG GTACTGGTTTGGTCTCCTCCACTTTTAAGGTTGCCCCTTCCTTCTCTACCATTCAAAAAC AACAA

  13. Reassembly and co-crystallization of a family 9 processive endoglucanase from its component parts: structural and functional significance of the intermodular linker

    Directory of Open Access Journals (Sweden)

    Svetlana Petkun

    2015-09-01

    Full Text Available Non-cellulosomal processive endoglucanase 9I (Cel9I from Clostridium thermocellum is a modular protein, consisting of a family-9 glycoside hydrolase (GH9 catalytic module and two family-3 carbohydrate-binding modules (CBM3c and CBM3b, separated by linker regions. GH9 does not show cellulase activity when expressed without CBM3c and CBM3b and the presence of the CBM3c was previously shown to be essential for endoglucanase activity. Physical reassociation of independently expressed GH9 and CBM3c modules (containing linker sequences restored 60–70% of the intact Cel9I endocellulase activity. However, the mechanism responsible for recovery of activity remained unclear. In this work we independently expressed recombinant GH9 and CBM3c with and without their interconnecting linker in Escherichia coli. We crystallized and determined the molecular structure of the GH9/linker-CBM3c heterodimer at a resolution of 1.68 Å to understand the functional and structural importance of the mutual spatial orientation of the modules and the role of the interconnecting linker during their re-association. Enzyme activity assays and isothermal titration calorimetry were performed to study and compare the effect of the linker on the re-association. The results indicated that reassembly of the modules could also occur without the linker, albeit with only very low recovery of endoglucanase activity. We propose that the linker regions in the GH9/CBM3c endoglucanases are important for spatial organization and fixation of the modules into functional enzymes.

  14. States' Flexibility Waiver Plans for Alternate Assessments Based on Alternate Achievement Standards (AA-AAS). Synthesis Report 96

    Science.gov (United States)

    Lazarus, Sheryl S.; Edwards, Lynn M.; Thurlow, Martha L.; Hodgson, Jennifer R.

    2014-01-01

    All states have alternate assessments based on alternate achievement standards (AA-AAS) for students with the most significant cognitive disabilities. For accountability purposes, the Elementary and Secondary Education Act (ESEA) allows up to 1% of students to be counted as proficient with this assessment option. In 2011 the U.S. Department of…

  15. Flocculation phenomenon of a mutant flocculent Saccharomyces ...

    African Journals Online (AJOL)

    The flocculation mechanism of a stable mutant flocculent yeast strain Saccharomyces cerevisiae KRM-1 was quantitatively investigated for potential industrial interest. It was found that the mutant flocculent strain was NewFlo phenotype by means of sugar inhibition test. The flocculation was completely inhibited by treatment ...

  16. Generation and characterization of pigment mutants of ...

    African Journals Online (AJOL)

    Compared to the wild CC-124, these mutants are characterized by a decrease in chlorophyll a & b content and an increase in carotenoids. The lowest decrease in chlorophyll a was 3 to 4 folds, while the highest increase in carotenoids was 2 to 4 folds. The result of bio-test, using the resulting pigment mutant of C. reinhardtii ...

  17. Site-saturation engineering of lysine 47 in cyclodextrin glycosyltransferase from Paenibacillus macerans to enhance substrate specificity towards maltodextrin for enzymatic synthesis of 2-O-D-glucopyranosyl-L-ascorbic acid (AA-2G).

    Science.gov (United States)

    Han, Ruizhi; Liu, Long; Shin, Hyun-dong; Chen, Rachel R; Du, Guocheng; Chen, Jian

    2013-07-01

    In this work, the site-saturation engineering of lysine 47 in cyclodextrin glycosyltransferase (CGTase) from Paenibacillus macerans was conducted to improve the specificity of CGTase towards maltodextrin, which can be used as a cheap and easily soluble glycosyl donor for the enzymatic synthesis of 2-O-D-glucopyranosyl-L-ascorbic acid (AA-2G) by CGTase. When using maltodextrin as glycosyl donor, four mutants K47F (lysine→ phenylalanine), K47L (lysine→ leucine), K47V (lysine→ valine) and K47W (lysine→ tryptophan) showed higher AA-2G yield as compared with that produced by the wild-type CGTase. The transformation conditions (temperature, pH and the mass ratio of L-ascorbic acid to maltodextrin) were optimized and the highest titer of AA-2G produced by the mutant K47L could reach 1.97 g/l, which was 64.2% higher than that (1.20 g/l) produced by the wild-type CGTase. The reaction kinetics analysis confirmed the enhanced maltodextrin specificity, and it was also found that compared with the wild-type CGTase, the four mutants had relatively lower cyclization activities and higher disproportionation activities, which was favorable for AA-2G synthesis. The mechanism responsible for the enhanced substrate specificity was further explored by structure modeling and it was indicated that the enhancement of maltodextrin specificity may be due to the short residue chain and the removal of hydrogen bonding interactions between the side chain of residue 47 and the sugar at -3 subsite. Here the obtained mutant CGTases, especially the K47L, has a great potential in the production of AA-2G with maltodextrin as a cheap and easily soluble substrate.

  18. Los mutantes de la escuela

    Directory of Open Access Journals (Sweden)

    Diego Armando Jaramillo-Ocampo

    2013-01-01

    Full Text Available El presente artículo muestra los resultados parciales del estudio “Juegos en el recreo escolar: un escenario para la formación ciudadana”, cuya pretensión fue comprender los imaginarios sociales de juego en el recreo escolar y su relación con la convivencia social desde la proximidad del enfoque de complementariedad y el diseño de investigación emergente, planteado por Murcia y Jaramillo (2008. Se presentan los desarrollos logrados en dos categorías centrales del estudio: el patio y el cuerpo; dos categorías que mutan constantemente como entidades vivas en la escuela, hacia la configuración de sujetos que reconocen en el otro y lo otro su posibilidad. La escuela viva, donde es posible “ser en relación con”… se reduce a un espacio temporal y físico, limitado por la campana, “el recreo”. El texto muestra, desde la voz de los actores, esa vida que se da y se quita en la escuela y que se posiciona como una más de las imposiciones normalizadas para controlar. Reconoce, finalmente, una propuesta desde la posibilidad que estos dos mutantes propician para una escuela libre y dinámica.

  19. Effect of Amino Acid Substitutions in the GerAA Protein on the Function of the Alanine-Responsive Germinant Receptor of Bacillus subtilis Spores▿

    Science.gov (United States)

    Mongkolthanaruk, Wiyada; Cooper, Gareth R.; Mawer, Julia S. P.; Allan, Raymond N.; Moir, Anne

    2011-01-01

    Spores of Bacillus subtilis require the GerAA, GerAB, and GerAC receptor proteins for l-alanine-induced germination. Mutations in gerAA, both random and site directed, result in phenotypes that identify amino acid residues important for receptor function in broad terms. They highlight the functional importance of two regions in the central, integral membrane domain of GerAA. A P324S substitution in the first residue of a conserved PFPP motif results in a 10-fold increase in a spore's sensitivity to alanine; a P326S change results in the release of phase-dark spores, in which the receptor may be in an “activated” or “quasigerminated” state. Substitutions in residues 398 to 400, in a short loop between the last two likely membrane-spanning helices of this central domain, all affect the germination response, with the G398S substitution causing a temperature-sensitive defect. In others, there are wider effects on the receptor: if alanine is substituted for conserved residue N146, H304, or E330, a severe defect in l-alanine germination results. This correlates with the absence of GerAC, suggesting that the assembly or stability of the entire receptor complex has been compromised by the defect in GerAA. In contrast, severely germination-defective mutants such as E129K, L373F, S400F, and M409N mutants retain GerAC at normal levels, suggesting more local and specific effects on the function of GerAA itself. Further interpretation will depend on progress in structural analysis of the receptor proteins. PMID:21378197

  20. The cytochrome P450 2AA gene cluster in zebrafish (Danio rerio): Expression of CYP2AA1 and CYP2AA2 and response to phenobarbital-type inducers

    Energy Technology Data Exchange (ETDEWEB)

    Kubota, Akira [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Bainy, Afonso C.D. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Departamento de Bioquímica, CCB, Universidade Federal de Santa Catarina, Florianopolis, SC 88040-900 (Brazil); Woodin, Bruce R.; Goldstone, Jared V. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Stegeman, John J., E-mail: jstegeman@whoi.edu [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States)

    2013-10-01

    The cytochrome P450 (CYP) 2 gene family is the largest and most diverse CYP gene family in vertebrates. In zebrafish, we have identified 10 genes in a new subfamily, CYP2AA, which does not show orthology to any human or other mammalian CYP genes. Here we report evolutionary and structural relationships of the 10 CYP2AA genes and expression of the first two genes, CYP2AA1 and CYP2AA2. Parsimony reconstruction of the tandem duplication pattern for the CYP2AA cluster suggests that CYP2AA1, CYP2AA2 and CYP2AA3 likely arose in the earlier duplication events and thus are most diverged in function from the other CYP2AAs. On the other hand, CYP2AA8 and CYP2AA9 are genes that arose in the latest duplication event, implying functional similarity between these two CYPs. A molecular model of CYP2AA1 showing the sequence conservation across the CYP2AA cluster reveals that the regions with the highest variability within the cluster map onto CYP2AA1 near the substrate access channels, suggesting differing substrate specificities. Zebrafish CYP2AA1 transcript was expressed predominantly in the intestine, while CYP2AA2 was most highly expressed in the kidney, suggesting differing roles in physiology. In the liver CYP2AA2 expression but not that of CYP2AA1, was increased by 1,4-bis [2-(3,5-dichloropyridyloxy)] benzene (TCPOBOP) and, to a lesser extent, by phenobarbital (PB). In contrast, pregnenolone 16α-carbonitrile (PCN) increased CYP2AA1 expression, but not CYP2AA2 in the liver. The results identify a CYP2 subfamily in zebrafish that includes genes apparently induced by PB-type chemicals and PXR agonists, the first concrete in vivo evidence for a PB-type response in fish. - Highlights: • A tandemly duplicated cluster of ten CYP2AA genes was described in zebrafish. • Parsimony and duplication analyses suggest pathways to CYP2AA diversity. • Homology models reveal amino acid positions possibly related to functional diversity. • The CYP2AA locus does not share synteny with

  1. Elucidation of Kinetic Mechanisms of Human Translesion DNA Polymerase κ Using Tryptophan Mutants

    Science.gov (United States)

    Zhao, Linlin; Pence, Matthew G.; Eoff, Robert L.; Yuan, Shuai; Fercu, Catinca A.; Guengerich, F. Peter

    2014-01-01

    In order to investigate the conformational dynamics of human DNA polymerase κ (hpol κ), we generated two mutants, Y50W (N-clasp region) and Y408W (linker between the thumb and little finger domains), using a Trp-null mutant (W214Y/W392H) of the hpol κ catalytic core enzyme. These mutants retained catalytic activity and similar patterns of selectivity for bypassing the DNA adduct 7,8-dihydro-8-oxo-2′-deoxyguanosine (8-oxoG), as judged by the results of steady-state and pre-steady-state kinetic experiments. Stopped-flow kinetic assays with hpol κ Y50W and T408W revealed a decrease in Trp fluorescence with the template G:dCTP pair but not for any mispairs. This decrease in fluorescence was not rate-limiting and is considered to be related to a conformational change necessary for correct nucleotidyl transfer. When a free 3′-hydroxyl was present on the primer, the Trp fluorescence returned to the baseline level at a rate similar to the observed kcat, suggesting that this change occurs during or after nucleotidyl transfer. However, polymerization rates (kpol) of extended-product formation were fast, indicating that the slow fluorescence step follows phosphodiester bond formation and is rate-limiting. Pyrophosphate formation and release were fast and are likely to precede the slower relaxation step. The available kinetic data were used to fit a simplified minimal model. The extracted rate constants confirmed that the conformational change after phosphodiester formation was rate-limiting for hpol κ catalysis with the template G:dCTP pair. PMID:25065501

  2. Corrosion issues of powder coated AA6060 aluminium profiles

    DEFF Research Database (Denmark)

    Din, Rameez Ud; Valgarðsson, Smári; Jellesen, Morten Stendahl

    2015-01-01

    In this study detailed microstructural investigation of the reason for unexpected corrosion of powder coated aluminium alloy AA6060 windows profiles has been performed. The results from this study reveals that the failure of the window profiles was originated from the surface defects present...... on the extruded AA6060 aluminium profile after metallurgical process prior to powder coating. Surface defects are produced due to intermetallic particles in the alloy, which disturb the flow during the extrusion process. The corrosion mechanism leading to the failure of the powder coated AA6060 aluminium profiles...

  3. Software papers and citation in the AAS Journals

    Science.gov (United States)

    Robitaille, Thomas; Lintott, Chris

    2018-01-01

    At the start of 2016, AAS Publishing released a policy statement that officially opened the door for papers describing novel software to be published in the AAS Journals without a requirement for novel results to also be included. This statement also describes how the use of software should be cited in articles. In this talk, I will give an overview of this policy and will give an overview of the growth of software papers and software citation in AAS Journals over the last two years.

  4. Effect of pressurized steam on AA1050 aluminium

    DEFF Research Database (Denmark)

    Jariyaboon, Manthana; Møller, Per; Ambat, Rajan

    2012-01-01

    Purpose - The purpose of this paper is to understand the effect of pressurized steam on surface changes, structures of intermetallic particles and corrosion behavior of AA1050 aluminium. Design/methodology/approach - Industrially pure aluminium (AA1050, 99.5 per cent) surfaces were exposed...... reactivities was observed due to the formation of the compact oxide layer. Originality/value - This paper reveals a detailed investigation of how pressurized steam can affect the corrosion behaviour of AA1050 aluminium and the structure of Fe-containing intermetallic particles....

  5. Integrity of the Linker of Nucleoskeleton and Cytoskeleton Is Required for Efficient Herpesvirus Nuclear Egress.

    Science.gov (United States)

    Klupp, Barbara G; Hellberg, Teresa; Granzow, Harald; Franzke, Kati; Dominguez Gonzalez, Beatriz; Goodchild, Rose E; Mettenleiter, Thomas C

    2017-10-01

    Herpesvirus capsids assemble in the nucleus, while final virion maturation proceeds in the cytoplasm. This requires that newly formed nucleocapsids cross the nuclear envelope (NE), which occurs by budding at the inner nuclear membrane (INM), release of the primary enveloped virion into the perinuclear space (PNS), and subsequent rapid fusion with the outer nuclear membrane (ONM). During this process, the NE remains intact, even at late stages of infection. In addition, the spacing between the INM and ONM is maintained, as is that between the primary virion envelope and nuclear membranes. The linker of nucleoskeleton and cytoskeleton (LINC) complex consists of INM proteins with a luminal SUN (Sad1/UNC-84 homology) domain connected to ONM proteins with a KASH (Klarsicht, ANC-1, SYNE homology) domain and is thought to be responsible for spacing the nuclear membranes. To investigate the role of the LINC complex during herpesvirus infection, we generated cell lines constitutively expressing dominant negative (dn) forms of SUN1 and SUN2. Ultrastructural analyses revealed a significant expansion of the PNS and the contiguous intracytoplasmic lumen, most likely representing endoplasmic reticulum (ER), especially in cells expressing dn-SUN2. After infection, primary virions accumulated in these expanded luminal regions, also very distant from the nucleus. The importance of the LINC complex was also confirmed by reduced progeny virus titers in cells expressing dn-SUN2. These data show that the intact LINC complex is required for efficient nuclear egress of herpesviruses, likely acting to promote fusion of primary enveloped virions with the ONM. IMPORTANCE While the viral factors for primary envelopment of nucleocapsids at the inner nuclear membrane are known to the point of high-resolution structures, the roles of cellular components and regulators remain enigmatic. Furthermore, the machinery responsible for fusion with the outer nuclear membrane is unsolved. We show here

  6. Dicty_cDB: FCL-AA14 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA14 (Link to dictyBase) - G03263 DDB0218474 Contig-U16035-1 FCL-AA...14P (Link to Original site) FCL-AA14F 647 FCL-AA14Z 550 FCL-AA14P 1197 - - Show FCL-AA14 Library F...CL (Link to library) Clone ID FCL-AA14 (Link to dictyBase) Atlas ID - NBRP ID G03263 dictyBase ID DDB0218474... Link to Contig Contig-U16035-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA.../FCL-AA14Q.Seq.d/ Representative seq. ID FCL-AA14P (Link to Original site) Representative DNA sequence >FCL-AA

  7. Dicty_cDB: FCL-AA19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA19 (Link to dictyBase) - G01757 DDB0230128 Contig-U16036-1 FCL-AA...19P (Link to Original site) FCL-AA19F 246 FCL-AA19Z 568 FCL-AA19P 814 - - Show FCL-AA19 Library FC...L (Link to library) Clone ID FCL-AA19 (Link to dictyBase) Atlas ID - NBRP ID G01757 dictyBase ID DDB0230128 ...Link to Contig Contig-U16036-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...19Q.Seq.d/ Representative seq. ID FCL-AA19P (Link to Original site) Representative DNA sequence >FCL-AA

  8. Dicty_cDB: FCL-AA17 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA17 (Link to dictyBase) - G03264 DDB0191099 Contig-U15602-1 FCL-AA...17P (Link to Original site) FCL-AA17F 547 FCL-AA17Z 610 FCL-AA17P 1157 - - Show FCL-AA17 Library F...CL (Link to library) Clone ID FCL-AA17 (Link to dictyBase) Atlas ID - NBRP ID G03264 dictyBase ID DDB0191099... Link to Contig Contig-U15602-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA.../FCL-AA17Q.Seq.d/ Representative seq. ID FCL-AA17P (Link to Original site) Representative DNA sequence >FCL-AA

  9. Simulation de la formabilite des alliages d'aluminium AA5754 et AA6063

    Science.gov (United States)

    Eljaafari, Samira

    Les besoins de reduction du poids se sont concretement traduits par l'introduction de nouvelles nuances plus legeres dans les structures automobiles. Ainsi, des alliages d'aluminium ont commence a etre integres dans les pieces de structure de plusieurs vehicules. La faible masse volumique des alliages d'aluminium (2,7g/cm3) permet d'alleger le poids du vehicule qui entraine une diminution de la consommation de carburant et, donc, des emissions de gaz a effet de serre. La striction et la rupture sont les principaux modes de defaillance qui entrainent le rebut systematique des pieces. C'est pourquoi, ameliorer la prediction d'apparition de ces defauts lors de la simulation va dans le sens d'une meilleure maitrise du procede. Dans le cadre de ce travail doctoral, deux modeles sont developpes pour simuler le comportement a grandes deformations d'alliages d'aluminium: un modele polycristallin de type Taylor et un modele a un ou plusieurs elements finis par grain. Les diagrammes limites de formage (DLF) pour les deux alliages d'aluminium AA5754 et AA6063 ont ete simules numeriquement en utilisant une formulation par elements finis pour les polycristaux basee sur l'hypothese de Taylor. Les DLF conventionnels et de l'hydroformage ont ete traces. L'effet des chemins de deformation sur la formabilite des alliages d'aluminium a aussi ete etudie. Finalement, des simulations numeriques avec les donnees de diffraction des electrons retrodiffuses (EBSD) pour 1'alliage d'aluminium AA5754 ont ete effectuees en utilisant le modele a un ou plusieurs elements par grain. Ces simulations sont executees avec differents modeles du durcissement (Asaro, Bassani et puissance). Mots-cles: Formabilite; Alliage d'aluminium; Hydroformage; Glissement cristallographique; Durcissement; Calcul parallele; Diagramme limite de formage (DLF); Diffraction electron.

  10. Development of a 3D printable maxillofacial silicone: Part I. Optimization of polydimethylsiloxane chains and cross-linker concentration.

    Science.gov (United States)

    Jindal, Swati K; Sherriff, Martyn; Waters, Mark G; Coward, Trevor J

    2016-10-01

    Conventionally, maxillofacial prostheses are fabricated by hand carving the missing anatomic defect in wax and creating a mold into which pigmented silicone elastomer is placed. Digital technologies such as computer numerical control (CNC) milling and 3-dimensional (3D) printing have been used to prepare molds directly or indirectly into which a biocompatible pigmented silicone elastomer is placed. The purpose of this in vitro study was to develop a silicone elastomer by varying composition that could eventually be 3D printed directly without a mold to create facial/body prostheses. The silicone was composed of polydimethylsiloxane (PDMS), filler, catalyst, and cross-linker. Four types of base silicone polymers were prepared with different PDMS molecular weight combinations with long, medium, and short chain length PDMS. The effect of the cross-linker (2.5% to 12.5%) content in these bases was assessed for the effect upon the mechanical properties of the elastomer. Ten readings were made for each formulation, and differences in the means were evaluated with a 2-way ANOVA (α=.05). Variations in silicone composition resulted in hardness from 6.8 to 28.5 durometer, tensile strength from 0.720 to 3.524 kNm -1 and tear strength from 0.954 to 8.484 MPa. Significant differences were observed among all formulations (P<.05). These formulations have mechanical properties comparable with the commercial silicones currently used for the fabrication of facial prostheses. The formulation with 5% cross-linker content and high content of long-chain PDMS chains with optimum mechanical properties was chosen for further development. The optimum combination of mechanical properties implies the use of one of these formulations for further evaluation in a 3D printer capable of actively mixing and extruding 2-component, room temperature vulcanization silicone. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

  11. Stability, Intracellular Delivery, and Release of siRNA from Chitosan Nanoparticles Using Different Cross-Linkers.

    Directory of Open Access Journals (Sweden)

    Maria Abdul Ghafoor Raja

    Full Text Available Chitosan (CS nanoparticles have been extensively studied for siRNA delivery; however, their stability and efficacy are highly dependent on the types of cross-linker used. To address this issue, three common cross-linkers; tripolyphosphate (TPP, dextran sulphate (DS and poly-D-glutamic acid (PGA were used to prepare siRNA loaded CS-TPP/DS/PGA nanoparticles by ionic gelation method. The resulting nanoparticles were compared with regard to their physicochemical properties including particle size, zeta potential, morphology, binding and encapsulation efficiencies. Among all the formulations prepared with different cross linkers, CS-TPP-siRNA had the smallest particle size (ranged from 127 ± 9.7 to 455 ± 12.9 nm with zeta potential ranged from +25.1 ± 1.5 to +39.4 ± 0.5 mV, and high entrapment (>95% and binding efficiencies. Similarly, CS-TPP nanoparticles showed better siRNA protection during storage at 4˚C and as determined by serum protection assay. TEM micrographs revealed the assorted morphology of CS-TPP-siRNA nanoparticles in contrast to irregular morphology displayed by CS-DS-siRNA and CS-PGA-siRNA nanoparticles. All siRNA loaded CS-TPP/DS/PGA nanoparticles showed initial burst release followed by sustained release of siRNA. Moreover, all the formulations showed low and concentration-dependent cytotoxicity with human colorectal cancer cells (DLD-1, in vitro. The cellular uptake studies with CS-TPP-siRNA nanoparticles showed successful delivery of siRNA within cytoplasm of DLD-1 cells. The results demonstrate that ionically cross-linked CS-TPP nanoparticles are biocompatible non-viral gene delivery system and generate a solid ground for further optimization studies, for example with regard to steric stabilization and targeting.

  12. Direct demonstration of the flexibility of the glycosylated proline-threonine linker in the Cellulomonas fimi Xylanase Cex through NMR spectroscopic analysis.

    Science.gov (United States)

    Poon, David K Y; Withers, Stephen G; McIntosh, Lawrence P

    2007-01-19

    The modular xylanase Cex (or CfXyn10A) from Cellulomonas fimi consists of an N-terminal catalytic domain and a C-terminal cellulose-binding domain, joined by a glycosylated proline-threonine (PT) linker. To characterize the conformation and dynamics of the Cex linker and the consequences of its modification, we have used NMR spectroscopy to study full-length Cex in its nonglycosylated ( approximately 47 kDa) and glycosylated ( approximately 51 kDa) forms. The PT linker lacks any predominant structure in either form as indicated by random coil amide chemical shifts. Furthermore, heteronuclear (1)H-(15)N nuclear Overhauser effect relaxation measurements demonstrate that the linker is flexible on the ns-to-ps time scale and that glycosylation partially dampens this flexibility. The catalytic and cellulose-binding domains also exhibit identical amide chemical shifts whether in isolation or in the context of either unmodified or glycosylated full-length Cex. Therefore, there are no noncovalent interactions between the two domains of Cex or between either domain and the linker. This conclusion is supported by the distinct (15)N relaxation properties of the two domains, as well as their differential alignment within a magnetic field by Pf1 phage particles. These data demonstrate that the PT linker is a flexible tether, joining the structurally independent catalytic and cellulose-binding domains of Cex in an ensemble of conformations; however, more extended forms may predominate because of restrictions imparted by the alternating proline residues. This supports the postulate that the binding-domain anchors Cex to the surface of cellulose, whereas the linker provides flexibility for the catalytic domain to hydrolyze nearby hemicellulose (xylan) chains.

  13. Interdomain Linker Determines Primarily the Structural Stability of Dystrophin and Utrophin Tandem Calponin-Homology Domains Rather than Their Actin-Binding Affinity.

    Science.gov (United States)

    Bandi, Swati; Singh, Surinder M; Mallela, Krishna M G

    2015-09-08

    Tandem calponin-homology (CH) domains are the most common actin-binding domains in proteins. However, structural principles underlying their function are poorly understood. These tandem domains exist in multiple conformations with varying degrees of inter-CH-domain interactions. Dystrophin and utrophin tandem CH domains share high sequence similarity (∼82%), yet differ in their structural stability and actin-binding affinity. We examined whether the conformational differences between the two tandem CH domains can explain differences in their stability and actin binding. Dystrophin tandem CH domain is more stable by ∼4 kcal/mol than that of utrophin. Individual CH domains of dystrophin and utrophin have identical structures but differ in their relative orientation around the interdomain linker. We swapped the linkers between dystrophin and utrophin tandem CH domains. Dystrophin tandem CH domain with utrophin linker (DUL) has similar stability as that of utrophin tandem CH domain. Utrophin tandem CH domain with dystrophin linker (UDL) has similar stability as that of dystrophin tandem CH domain. Dystrophin tandem CH domain binds to F-actin ∼30 times weaker than that of utrophin. After linker swapping, DUL has twice the binding affinity as that of dystrophin tandem CH domain. Similarly, UDL has half the binding affinity as that of utrophin tandem CH domain. However, changes in binding free energies due to linker swapping are much lower by an order of magnitude compared to the corresponding changes in unfolding free energies. These results indicate that the linker region determines primarily the structural stability of tandem CH domains rather than their actin-binding affinity.

  14. The First Extracellular Linker Is Important for Several Aspects of the Gating Mechanism of Human TRPA1 Channel

    Czech Academy of Sciences Publication Activity Database

    Maršáková, Lenka; Barvík, I.; Zíma, V.; Zímová, Lucie; Vlachová, Viktorie

    2017-01-01

    Roč. 10, Jan 31 (2017), č. článku 16. ISSN 1662-5099 R&D Projects: GA ČR(CZ) GA15-15839S; GA ČR(CZ) GBP304/12/G069; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : TRP channel * S1-S2 linker * allyl isothiocynate * sensor module Subject RIV: FH - Neurology OBOR OECD: Neuroscience s (including psychophysiology Impact factor: 5.076, year: 2016

  15. A&A Painting and Restoration Co., Inc. Information Sheet

    Science.gov (United States)

    A&A Painting and Restoration Co., Inc. (the Company) is located in Great Mills, Maryland. The settlement involves renovation activities conducted at properties constructed prior to 1978, located in Drayden, Maryland.

  16. Transcriptional cellular responses in midgut tissue of Aedes aegypti larvae following intoxication with Cry11Aa toxin from Bacillus thuringiensis.

    Science.gov (United States)

    Canton, Pablo Emiliano; Cancino-Rodezno, Angeles; Gill, Sarjeet S; Soberón, Mario; Bravo, Alejandra

    2015-12-09

    Although much is known about the mechanism of action of Bacillus thuringiensis Cry toxins, the target tissue cellular responses to toxin activity is less understood. Previous transcriptomic studies indicated that significant changes in gene expression occurred during intoxication. However, most of these studies were done in organisms without a sequenced and annotated reference genome. A reference genome and transcriptome is available for the mosquito Aedes aegypti, and its importance as a disease vector has positioned its biological control as a primary health concern. Through RNA sequencing we sought to determine the transcriptional changes observed during intoxication by Cry11Aa in A. aegypti and to analyze possible defense and recovery mechanisms engaged after toxin ingestion. In this work the changes in the transcriptome of 4(th) instar A. aegypti larvae exposed to Cry11Aa toxin for 0, 3, 6, 9, and 12 h were analyzed. A total of 1060 differentially expressed genes after toxin ingestion were identified with two bioconductoR packages: DESeq2 and EdgeR. The most important transcriptional changes were observed after 9 or 12 h of toxin exposure. GO enrichment analysis of molecular function and biological process were performed as well as Interpro protein functional domains and pBLAST analyses. Up regulated processes include vesicular trafficking, small GTPase signaling, MAPK pathways, and lipid metabolism. In contrast, down regulated functions are related to transmembrane transport, detoxification mechanisms, cell proliferation and metabolism enzymes. Validation with RT-qPCR showed large agreement with Cry11Aa intoxication since these changes were not observed with untreated larvae or larvae treated with non-toxic Cry11Aa mutants, indicating that a fully functional pore forming Cry toxin is required for the observed transcriptional responses. This study presents the first transcriptome of Cry intoxication response in a fully sequenced insect, and reveals possible

  17. X-rays sensitive mammalian cell mutant

    International Nuclear Information System (INIS)

    Utsumi, Hiroshi

    1982-01-01

    A phenomenon that in x-ray-sensitive mammalian-cell mutants, cellular death due to x-ray radiation was not increased by caffeine, but on the contrary, the dead cells were resuscitated by it was discussed. The survival rate of mutant cells increased by caffein in a low concentration. This suggested that caffeine may have induced some mechanism to produce x-ray resistant mutant cells. Postirradiation treatment with caffeine increased considerably the survival rate of the mutant cells, and this suggested the existence of latent caffeine-sensitive potentially lethal damage repair system. This system, after a few hours, is thought to be substituted by caffeine-resistant repair system which is induced by caffeine, and this may be further substituted by x-ray-resistant repair system. The repair system was also induced by adenine. (Ueda, J.)

  18. Semi-dwarf mutants for rice improvement

    International Nuclear Information System (INIS)

    Othman, Ramli; Osman, Mohammad; Ibrahim, Rusli

    1990-01-01

    Full text: MARDI and the National University of Malaysia embarked on a programme to induce resistance against blast in rice in 1978. MARDI also obtained semi dwarf mutants of cvs 'Mahsuri', 'Muda', 'Pongsu seribu' and 'Jarum Mas', which are under evaluation. The popular local rice variety 'Manik' was subjected to gamma irradiation (15-40 krad) and 101 promising semidwarf mutants have been obtained following selection in M 2 -M 6 . 29 of them show grain yields of 6.0-7.3 t/ha, compared with 5.7t for 'Manik'. Other valuable mutants were found showing long grain, less shattering, earlier maturity, and glutinous endosperm. One mutant, resistant to brown plant hopper yields 6.3t/ha. (author)

  19. Robust mutant strain design by pessimistic optimization.

    Science.gov (United States)

    Apaydin, Meltem; Xu, Liang; Zeng, Bo; Qian, Xiaoning

    2017-10-03

    Flux Balance Analysis (FBA) based mathematical modeling enables in silico prediction of systems behavior for genome-scale metabolic networks. Computational methods have been derived in the FBA framework to solve bi-level optimization for deriving "optimal" mutant microbial strains with targeted biochemical overproduction. The common inherent assumption of these methods is that the surviving mutants will always cooperate with the engineering objective by overproducing the maximum desired biochemicals. However, it has been shown that this optimistic assumption may not be valid in practice. We study the validity and robustness of existing bi-level methods for strain optimization under uncertainty and non-cooperative environment. More importantly, we propose new pessimistic optimization formulations: P-ROOM and P-OptKnock, aiming to derive robust mutants with the desired overproduction under two different mutant cell survival models: (1) ROOM assuming mutants have the minimum changes in reaction fluxes from wild-type flux values, and (2) the one considered by OptKnock maximizing the biomass production yield. When optimizing for desired overproduction, our pessimistic formulations derive more robust mutant strains by considering the uncertainty of the cell survival models at the inner level and the cooperation between the outer- and inner-level decision makers. For both P-ROOM and P-OptKnock, by converting multi-level formulations into single-level Mixed Integer Programming (MIP) problems based on the strong duality theorem, we can derive exact optimal solutions that are highly scalable with large networks. Our robust formulations P-ROOM and P-OptKnock are tested with a small E. coli core metabolic network and a large-scale E. coli iAF1260 network. We demonstrate that the original bi-level formulations (ROOM and OptKnock) derive mutants that may not achieve the predicted overproduction under uncertainty and non-cooperative environment. The knockouts obtained by the

  20. Characteristics of AA amyloidosis patients in San Francisco.

    Science.gov (United States)

    Lejmi, Hiba; Jen, Kuang-Yu; Olson, Jean L; James, Sam H; Sam, Ramin

    2016-04-01

    AA amyloidosis due to subcutaneous injection of drugs of abuse has been described in the USA, but all the existing literature is from more than 20 years ago. There is more recent literature from Europe. We have observed a high incidence of AA amyloidosis in the county hospital in San Francisco. Here, we describe 24 patients who had kidney biopsy-proven AA amyloidosis from our hospital from 1998 to 2013. All the patients were thought to have AA amyloidosis from skin popping of illicit drugs after having exhausted the intravenous route. These patients with biopsy-proven AA amyloidosis were analysed further. All patients were found to have hepatitis C infection, hypertension was not common, most had advanced kidney failure, and acidosis was common as was tubulointerstitial involvement on the kidney biopsy. Other organ involvement included hepatomegaly and splenomegaly in a number of patients; direct myocardial involvement was not seen, but pulmonary hypertension, history of deep vein thrombosis and pulmonary embolism were common. The prognosis of these patients was poor. The mortality rate approached 50% 1 year after biopsy, and most of the patient needed dialysis shortly after diagnosis. Cessation of drug use seemed beneficial but rarely achievable. AA amyloidosis from skin popping is common in San Francisco. Most patients with renal involvement end up on dialysis, and mortality rates are exceedingly high. © 2015 Asian Pacific Society of Nephrology.

  1. Bake hardening of nanograin AA7075 aluminum alloy

    International Nuclear Information System (INIS)

    Dehghani, Kamran

    2011-01-01

    Highlights: ► The bake hardening behavior of AA7075 was studied and compared with its coarse-grain counterpart. ► Nanograin AA7075 exhibited 88–100% increase in bake hardenability. ► Nanograin AA7075 exhibited 36–38% increase in final yield strength after baking. ► Maximum bake hardenability and final yield stress were about 185 MPa and 719 MPa. - Abstract: In the present work, the bake hardening of nanostructured AA7075 aluminum alloy was compared with that of its coarse-grain counterpart. Surface severe plastic deformation (SSPD) was used to produce nanograin layers on both surfaces of workpieces. The nanostructured layers were characterized using scanning electron microscopy (SEM) and atomic force microscopy (AFM) techniques. The thickness of nanostructured layer, having the grains of 50–110 nm, was about 75 μm on each side of workpiece. The bake hardenability of nanograin and coarse-grain AA7075 was then compared by pre-straining to 2, 4 and 6% followed by baking at 100 °C and 200 °C for 20 min. Comparing to coarse-grain case, there was about 88–100% increase in bake hardenability and about 36–38% increase in yield strength after the bake hardening of present nanograin AA7075. Such an increase in bake hardenability and strength was achieved when the thickness of two nanograin layers was about only one-tenth of the whole thickness.

  2. Mutant ribosomes can generate dominant kirromycin resistance.

    Science.gov (United States)

    Tubulekas, I; Buckingham, R H; Hughes, D

    1991-01-01

    Mutations in the two genes for EF-Tu in Salmonella typhimurium and Escherichia coli, tufA and tufB, can confer resistance to the antibiotic kirromycin. Kirromycin resistance is a recessive phenotype expressed when both tuf genes are mutant. We describe a new kirromycin-resistant phenotype dominant to the effect of wild-type EF-Tu. Strains carrying a single kirromycin-resistant tuf mutation and an error-restrictive, streptomycin-resistant rpsL mutation are resistant to high levels of kirromycin, even when the other tuf gene is wild type. This phenotype is dependent on error-restrictive mutations and is not expressed with nonrestrictive streptomycin-resistant mutations. Kirromycin resistance is also expressed at a low level in the absence of any mutant EF-Tu. These novel phenotypes exist as a result of differences in the interactions of mutant and wild-type EF-Tu with the mutant ribosomes. The restrictive ribosomes have a relatively poor interaction with wild-type EF-Tu and are thus more easily saturated with mutant kirromycin-resistant EF-Tu. In addition, the mutant ribosomes are inherently kirromycin resistant and support a significantly faster EF-Tu cycle time in the presence of the antibiotic than do wild-type ribosomes. A second phenotype associated with combinations of rpsL and error-prone tuf mutations is a reduction in the level of resistance to streptomycin. PMID:2050625

  3. Commercialization Of Orchid Mutants For Floriculture Industry

    International Nuclear Information System (INIS)

    Sakinah Ariffin; Zaiton Ahmad

    2014-01-01

    Orchids are the main contributors to cut flower industry in Malaysia with an existing good market and a huge business potential. Orchid industry has been established in Malaysia since 1960s but only started to develop and expand since 1980s. Continuous development of new orchid varieties is essential to meet customers' demands. Orchid mutagenesis research using gamma irradiation at Malaysian Nuclear Agency has successfully generated a number of new orchid varieties with commercial potentials. Therefore, Nuclear Malaysia has collaborated with an industrial partner, Hexagon Green Sdn Bhd (HGSB), to carry out commercialization research on these mutants under a Technofund project entitled 'Pre-Commercialization of Mutant Orchids for Cut Flowers Industry' from July 2011 to July 2014. Through this collaboration, Dendrobium orchid mutant plants developed by Nuclear Malaysia were transferred to HGSB's commercial orchid nursery at Bukit Changgang Agrotechnology Park, Banting, Selangor, for mass-propagation. The activities include evaluations on plant growth performance, flower quality, post harvest and market potential of these mutants. Mutants with good field performance have been identified and filed for Plant Variety Protection (PVP) with Department of Agriculture Malaysia. This paper describes outputs from this collaboration and activities undertaken in commercializing these mutants. (author)

  4. A novel Cry9Aa with increased toxicity for Spodoptera exigua (Hübner)

    NARCIS (Netherlands)

    Naimov, S.; Nedyalkova, R.; Staykov, N.; Weemen-Hendriks, M.; Minkov, I.; Maagd, de R.A.

    2014-01-01

    Cry9Aa, produced by Bacillus thuringiensis is reported to be not active against Spodoptera exigua (beet armyworm). In this study we have cloned a new cry9Aa5 gene encoding a protoxin with increased activity against S. exigua as compared to Cry9Aa1. When aligned to Cry9Aa1, four amino acid

  5. Cytopathological effects of Bacillus sphaericus Cry48Aa/Cry49Aa toxin on binary toxin-susceptible and -resistant Culex quinquefasciatus larvae.

    Science.gov (United States)

    de Melo, Janaina Viana; Jones, Gareth Wyn; Berry, Colin; Vasconcelos, Romero Henrique Teixeira; de Oliveira, Cláudia Maria Fontes; Furtado, André Freire; Peixoto, Christina Alves; Silva-Filha, Maria Helena Neves Lobo

    2009-07-01

    The Cry48Aa/Cry49Aa mosquitocidal two-component toxin was recently characterized from Bacillus sphaericus strain IAB59 and is uniquely composed of a three-domain Cry protein toxin (Cry48Aa) and a binary (Bin) toxin-like protein (Cry49Aa). Its mode of action has not been elucidated, but a remarkable feature of this protein is the high toxicity against species from the Culex complex, besides its capacity to overcome Culex resistance to the Bin toxin, the major insecticidal factor in B. sphaericus-based larvicides. The goal of this work was to investigate the ultrastructural effects of Cry48Aa/Cry49Aa on midgut cells of Bin-toxin-susceptible and -resistant Culex quinquefasciatus larvae. The major cytopathological effects observed after Cry48Aa/Cry49Aa treatment were intense mitochondrial vacuolation, breakdown of endoplasmic reticulum, production of cytoplasmic vacuoles, and microvillus disruption. These effects were similar in Bin-toxin-susceptible and -resistant larvae and demonstrated that Cry48Aa/Cry49Aa toxin interacts with and displays toxic effects on cells lacking receptors for the Bin toxin, while B. sphaericus IAB59-resistant larvae did not show mortality after treatment with Cry48Aa/Cry49Aa toxin. The cytopathological alterations in Bin-toxin-resistant larvae provoked by Cry48Aa/Cry49Aa treatment were similar to those observed when larvae were exposed to a synergistic mixture of Bin/Cry11Aa toxins. Such effects seemed to result from a combined action of Cry-like and Bin-like toxins. The complex effects caused by Cry48Aa/Cry49Aa provide evidence for the potential of these toxins as active ingredients of a new generation of biolarvicides that conjugate insecticidal factors with distinct sites of action, in order to manage mosquito resistance.

  6. Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast.

    Science.gov (United States)

    Miki, Risa; Saiki, Ryoichi; Ozoe, Yoshihisa; Kawamukai, Makoto

    2008-11-01

    Among the steps in ubiquinone biosynthesis, that catalyzed by the product of the clk-1/coq7 gene has received considerable attention because of its relevance to life span in Caenorhabditis elegans. We analyzed the coq7 ortholog (denoted coq7) in Schizosaccharomyces pombe, to determine whether coq7 has specific roles that differ from those of other coq genes. We first confirmed that coq7 is necessary for the penultimate step in ubiquinone biosynthesis, from the observation that the deletion mutant accumulated the ubiquinone precursor demethoxyubiquinone-10 instead of ubiquinone-10. The coq7 mutant displayed phenotypes characteristic of other ubiquinone-deficient Sc. pombe mutants, namely, hypersensitivity to hydrogen peroxide, a requirement for antioxidants for growth on minimal medium, and an elevated production of sulfide. To compare these phenotypes with those of other respiration-deficient mutants, we constructed cytochrome c (cyc1) and coq3 deletion mutants. We also assessed accumulation of oxidative stress in various ubiquinone-deficient strains and in the cyc1 mutant by measuring mRNA levels of stress-inducible genes and the phosphorylation level of the Spc1 MAP kinase. Induction of ctt1, encoding catalase, and apt1, encoding a 25 kDa protein, but not that of gpx1, encoding glutathione peroxidase, was indistinguishable in four ubiquinone-deficient mutants, indicating that the oxidative stress response operates at similar levels in the tested strains. One new phenotype was observed, namely, loss of viability in stationary phase (chronological life span) in both the ubiquinone-deficient mutant and in the cyc1 mutant. Finally, Coq7 was found to localize in mitochondria, consistent with the possibility that ubiquinone biosynthesis occurs in mitochondria in yeasts. In summary, our results indicate that coq7 is required for ubiquinone biosynthesis and the coq7 mutant is not distinguishable from other ubiquinone-deficient mutants, except that its phenotypes are more

  7. Influence of Process Parameters in the Friction Surfacing of AA 6082-T6 over AA 2024-T3

    OpenAIRE

    Gandra, J.; Pereira, D.; Miranda, R.M.; Vilaça, P.

    2013-01-01

    VK: T20309 Friction Surfacing is a solid state coating technique with applications in hardfacing, corrosion protection and repair. Since it doesn’t require the fusion of the materials involved, it is suitable to join aluminium alloys while avoiding several of their processing difficulties. The present study addresses the deposition of AA 6082-T6 coatings on AA 2024-T3 substrates, while focusing on the effect of process parameters, such as, axial force, rotation and travel speed. Sound alum...

  8. Parsing the roles of neck-linker docking and tethered head diffusion in the stepping dynamics of kinesin.

    Science.gov (United States)

    Zhang, Zhechun; Goldtzvik, Yonathan; Thirumalai, D

    2017-11-14

    Kinesin walks processively on microtubules (MTs) in an asymmetric hand-over-hand manner consuming one ATP molecule per 16-nm step. The individual contributions due to docking of the approximately 13-residue neck linker to the leading head (deemed to be the power stroke) and diffusion of the trailing head (TH) that contributes in propelling the motor by 16 nm have not been quantified. We use molecular simulations by creating a coarse-grained model of the MT-kinesin complex, which reproduces the measured stall force as well as the force required to dislodge the motor head from the MT, to show that nearly three-quarters of the step occurs by bidirectional stochastic motion of the TH. However, docking of the neck linker to the leading head constrains the extent of diffusion and minimizes the probability that kinesin takes side steps, implying that both the events are necessary in the motility of kinesin and for the maintenance of processivity. Surprisingly, we find that during a single step, the TH stochastically hops multiple times between the geometrically accessible neighboring sites on the MT before forming a stable interaction with the target binding site with correct orientation between the motor head and the [Formula: see text] tubulin dimer.

  9. Coupled regulation by the juxtamembrane and sterile α motif (SAM) linker is a hallmark of Ephrin tyrosine kinase evolution.

    Science.gov (United States)

    Kwon, Annie; John, Mihir; Ruan, Zheng; Kannan, Natarajan

    2018-02-12

    Ephrin (Eph) receptor tyrosine kinases have evolutionarily diverged from other tyrosine kinases to respond to specific activation and regulatory signals that requires close coupling of kinase catalytic and regulatory functions. However, the evolutionary basis for such functional coupling is not fully understood. We employed an evolutionary systems approach involving statistical mining of large sequence and structural datasets to define the hallmarks of Eph kinase evolution and functional specialization. We find that some of the most distinguishing Eph- specific residues structurally tether the flanking juxtamembrane and sterile α motif (SAM) linker regions to the kinase domain, and substitutions of these residues in EphA3 result in faster kinase activation. We report for the first time that the SAM domain linker is functionally coupled to the juxtamembrane through co-conserved residues in the kinase domain, and that together these residues provide a structural framework for coupling catalytic and regulatory functions. The unique organization of Eph-specific tethering networks and the identification of other Eph-specific sequence features of unknown functions provide new hypotheses for future functional studies and new clues to disease mutations altering Eph kinase-specific functions. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  10. The effect of varying the peptide linker length in a single chain variable fragment antibody against wogonin glucuronide.

    Science.gov (United States)

    Paudel, Madan Kumar; Sakamoto, Seiichi; Van Huy, Le; Tanaka, Hiroyuki; Miyamoto, Tomofumi; Morimoto, Satoshi

    2017-06-10

    Peptide linkers of three different lengths were constructed to join the variable regions of the heavy chain (VH) and the light chain (VL) in a single-chain variable fragment antibody (scFv) specific for wogonin glucuronide (Wgn) that has the structure VH-(GGGGS) n -VL (n=3, 5, or 7). The scFv antibodies, which were expressed in Escherichia coli, were derived from an anti-Wgn monoclonal antibody (315A). An indirect competitive enzyme-linked immunosorbent assay (icELISA) was used to evaluate their reactivity and sensitivity, which is also used for quantitative analysis of Wgn. Our results, showed that the reactivity and specificity of the three different scFvs were, in fact, similar. Subsequently, the scFv having a VH-(GGGGS) 3 -VL linker which was slightly better that other two scFvs against Wgn, was applied to indirect competitive ELISA (icELISA) to analyze Scutellariae Radix (S. Radix). The utility of the icELISA was demonstrated for quality control and analysis of S. Radix in this report. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Wall to membrane linkers, stretch activated channels, and the detection of tension, voltage, temperature, auxin, and pH

    Science.gov (United States)

    Pickard, B. G.

    1992-01-01

    Introduction. The higher plant is a heterogeneous, mechanically prestressed structure continually subject to shifting forces. When a cell grows in a plant at gravitropic equilibrium, it must create localized maxima of shear in walls of neighboring cells. Such mechanical stress and strain are likely detected in a variety of ways. However, tension-sensitive ion channels are of particular interest because it appears that they are elaborately evolved for sensory function. We hypothesize that 1) the patchy patterns of high shear are focused via wall-to-membrane linkers onto the plasma membrane, where 2) they are translated by mechanosensory cation channels into corresponding patterns of high cytosolic Ca2+, which 3) initiate local enhancement of wall expansion. Further, we hypothesize that the local promotion of enhancement is achieved at least in part by local intensification of auxin transport across the plasma membrane. By implication, when an organ is asymmetrically pressed, rubbed, or bent or when it is displaced in the gravitational field, the net asymmetry of shear stress occurring across the organ would lead to asymmetric redistribution of auxin and corrective asymmetric growth. We shall describe a representative mechanosensitive Ca(2+) -selective cation channel (MCaC) with susceptibilities to xenobiotics implicating it as a force transducer in thigmo- and gravitropism. Then, we shall consider whether a putative wall-to-membrane linker (WML) could be a key feature of the molecular architecture permitting the stress distributed in the wall system to be focused on the channels.

  12. One-pot DNA construction for synthetic biology: the Modular Overlap-Directed Assembly with Linkers (MODAL) strategy

    Science.gov (United States)

    Casini, Arturo; MacDonald, James T.; Jonghe, Joachim De; Christodoulou, Georgia; Freemont, Paul S.; Baldwin, Geoff S.; Ellis, Tom

    2014-01-01

    Overlap-directed DNA assembly methods allow multiple DNA parts to be assembled together in one reaction. These methods, which rely on sequence homology between the ends of DNA parts, have become widely adopted in synthetic biology, despite being incompatible with a key principle of engineering: modularity. To answer this, we present MODAL: a Modular Overlap-Directed Assembly with Linkers strategy that brings modularity to overlap-directed methods, allowing assembly of an initial set of DNA parts into a variety of arrangements in one-pot reactions. MODAL is accompanied by a custom software tool that designs overlap linkers to guide assembly, allowing parts to be assembled in any specified order and orientation. The in silico design of synthetic orthogonal overlapping junctions allows for much greater efficiency in DNA assembly for a variety of different methods compared with using non-designed sequence. In tests with three different assembly technologies, the MODAL strategy gives assembly of both yeast and bacterial plasmids, composed of up to five DNA parts in the kilobase range with efficiencies of between 75 and 100%. It also seamlessly allows mutagenesis to be performed on any specified DNA parts during the process, allowing the one-step creation of construct libraries valuable for synthetic biology applications. PMID:24153110

  13. Probing the Influence of Linker Length and Flexibility in the Design and Synthesis of New Trehalase Inhibitors

    Directory of Open Access Journals (Sweden)

    Giampiero D’Adamio

    2018-02-01

    Full Text Available This work aims to synthesize new trehalase inhibitors selective towards the insect trehalase versus the porcine trehalase, in view of their application as potentially non-toxic insecticides and fungicides. The synthesis of a new pseudodisaccharide mimetic 8, by means of a stereoselective α-glucosylation of the key pyrrolizidine intermediate 13, was accomplished. The activity of compound 8 as trehalase inhibitor towards C. riparius trehalase was evaluated and the results showed that 8 was active in the μM range and showed a good selectivity towards the insect trehalase. To reduce the overall number of synthetic steps, simpler and more flexible disaccharide mimetics 9–11 bearing a pyrrolidine nucleus instead of the pyrrolizidine core were synthesized. The biological data showed the key role of the linker chain’s length in inducing inhibitory properties, since only compounds 9 (α,β-mixture, bearing a two-carbon atom linker chain, maintained activity as trehalase inhibitors. A proper change in the glucosyl donor-protecting groups allowed the stereoselective synthesis of the β-glucoside 9β, which was active in the low micromolar range (IC50 = 0.78 μM and 12-fold more potent (and more selective than 9α towards the insect trehalase.

  14. Development of high yielding mutants in lentil

    International Nuclear Information System (INIS)

    Rajput, M.A.; Sarwar, G.; Siddiqui, K.A.

    2001-01-01

    Full text: Lentil (Lens culinaris Medik.) locally known as Masoor, is the second most important rabi pulse crop, after chickpea, in Pakistan. It is cultivated on an area of over 63,400 ha, which constitutes about 4.83% of the total area under pulses. The annual production of the crop is 28,200 tones with an average yield of 445 kg/ha. Yield at the national level is very low, about one-half of the world's yield, which is mainly due to non-availability of high yield potential genotypes. Keeping in view the importance of mutants in developing a large number of new varieties, an induced mutations programme was initiated at AEARC, Tandojam during 1987-88, to develop high yielding varieties in lentil. For this, seeds of two lentil varieties, 'Masoor-85' and 'ICARDA-8' had been irradiated with gamma-rays ranging from 100-600 Gy in NIAB, Faisalabad during 1990. Selections were made in M2 on the basis of earliness, plant height, branches/plant and 100 grain weight. After confirming these mutants in M3 they were promoted in station yield trials and studied continuously for three consecutive years (1993- 1995). Overall results revealed that these mutants have consistent improvement of earliness in flowering and maturity. Plant height also increased in all mutant lines except AEL 23/40/91 where reduction in this attribute was observed as compared to parent variety. Mutant lines AEL 49/20/91 and AEL 13/30/91 showed improvement in 100 grain weight. The improvement of some agronomic characters enhanced the yield of mutant lines in comparison to parent varieties (Masoor-85 and ICARDA-8). The diversity in yield over the respective parents was computed from 6.94 to 60.12%. From these encouraging results it is hoped that mutant lines like AEL 12/30/91 and AEL 49/20/91 may serve as potential lentil genotypes in future. (author)

  15. Officially released mutant varieties in China

    International Nuclear Information System (INIS)

    Liu, L.; Van Zanten, L.; Shu, Q.Y.; Maluszynski, M.

    2004-01-01

    The use of mutation techniques for crop improvement in China has a long and well-established tradition of more than 50 years. As the result of intensive research in many institutes dealing with application of nuclear technologies more than 620 cultivars of 44 crop species have been released. Numerous mutant varieties have been grown on a large scale bringing significant economic impact, sustaining crop production and greatly contributing to increase of food production also in stress prone areas of the country. However, there is still missing information not only on the number of mutant varieties released in particular crop species but also on mutagens applied, selection approaches and on the use of mutants in cross breeding. Numerous Chinese scientists collected and systematized this information. Results of their work were often published in local scientific journals in the Chinese language and as such were unavailable to breeders from other countries. Having this in mind, we requested Dr. Liu Luxiang, the Director of the Department of Plant Mutation Breeding and Genetics, Institute for Application of Atomic Energy, Chinese Academy of Agricultural Sciences in Beijing to help us in finding as much information as possible on mutant varieties officially released in China. The data has been collected in close collaboration with his colleagues from various institutions all over the country and then evaluated, edited and prepared for publication by our team responsible for the FAO/IAEA Database of Officially Released Mutant Varieties. We would like to thank all Chinese colleagues who contributed to this list of Chinese mutant varieties. We hope that this publication will stimulate plant breeders in China to collect more information on released mutant varieties and especially on the use of mutated genes in cross breeding. (author)

  16. Effect of heating on the stability of amyloid A (AA) fibrils and the intra- and cross-species transmission of AA amyloidosis.

    Science.gov (United States)

    Ogawa, Saki; Murakami, Tomoaki; Inoshima, Yasuo; Ishiguro, Naotaka

    2015-01-01

    Amyloid A (AA) amyloidosis is a protein misfolding disease characterized by extracellular deposition of AA fibrils. AA fibrils are found in several tissues from food animals with AA amyloidosis. For hygienic purposes, heating is widely used to inactivate microbes in food, but it is uncertain whether heating is sufficient to inactivate AA fibrils and prevent intra- or cross-species transmission. We examined the effect of heating (at 60 °C or 100 °C) and autoclaving (at 121 °C or 135 °C) on murine and bovine AA fibrils using Western blot analysis, transmission electron microscopy (TEM), and mouse model transmission experiments. TEM revealed that a mixture of AA fibrils and amorphous aggregates appeared after heating at 100 °C, whereas autoclaving at 135 °C produced large amorphous aggregates. AA fibrils retained antigen specificity in Western blot analysis when heated at 100 °C or autoclaved at 121 °C, but not when autoclaved at 135 °C. Transmissible pathogenicity of murine and bovine AA fibrils subjected to heating (at 60 °C or 100 °C) was significantly stimulated and resulted in amyloid deposition in mice. Autoclaving of murine AA fibrils at 121 °C or 135 °C significantly decreased amyloid deposition. Moreover, amyloid deposition in mice injected with murine AA fibrils was more severe than that in mice injected with bovine AA fibrils. Bovine AA fibrils autoclaved at 121 °C or 135 °C did not induce amyloid deposition in mice. These results suggest that AA fibrils are relatively heat stable and that similar to prions, autoclaving at 135 °C is required to destroy the pathogenicity of AA fibrils. These findings may contribute to the prevention of AA fibril transmission through food materials to different animals and especially to humans.

  17. An all-atom model of the chromatin fiber containing linker histones reveals a versatile structure tuned by the nucleosomal repeat length.

    Directory of Open Access Journals (Sweden)

    Hua Wong

    Full Text Available In the nucleus of eukaryotic cells, histone proteins organize the linear genome into a functional and hierarchical architecture. In this paper, we use the crystal structures of the nucleosome core particle, B-DNA and the globular domain of H5 linker histone to build the first all-atom model of compact chromatin fibers. In this 3D jigsaw puzzle, DNA bending is achieved by solving an inverse kinematics problem. Our model is based on recent electron microscopy measurements of reconstituted fiber dimensions. Strikingly, we find that the chromatin fiber containing linker histones is a polymorphic structure. We show that different fiber conformations are obtained by tuning the linker histone orientation at the nucleosomes entry/exit according to the nucleosomal repeat length. We propose that the observed in vivo quantization of nucleosomal repeat length could reflect nature's ability to use the DNA molecule's helical geometry in order to give chromatin versatile topological and mechanical properties.

  18. Outcomes From AAS Hack Day at the 227th AAS Meeting

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This is a final post from the 227th AAS Meeting in Kissimmee, FL. This special summary of AAS Hack Day, a meeting of AAS members to collaboratively work on various small projects, was written by Meredith Rawls (@Merrdiff) and was originally posted on astrobites.com.As the 227thAmerican Astronomical Society meeting drew to a close (see highlights from Day 1, Day 2, Day 3, and Day 4), a group of at least 50 attendees spent Day 4working on small projects fondly called hacks. Thanks to sponsorship from LSST and Northrup Grumman, the industrious hackers werewell-caffeinated and fed so we could devote time and energy toworking in groups on one-day projects.TheHack Day beganat 10am with pitches. Anybody with a project idea was welcome to briefly speak and try to convince others to work with them. Only someideas panned out, but the enthusiasm was palpable. Its not every day you get a full room of astronomers and affiliates eager to spend hours working on fun and useful projects to benefit the community.#hackAAS is getting underway! #aas227 pic.twitter.com/yX7jlOnSCK James R A Davenport (@jradavenport) January 8, 2016Here is a rundown of what we accomplished. Pretty impressive for a single day! Many thanks to fellow astrobiter Erika Nesvold (now at Carnegie DTM; @erikanesvold) whose hack was live-documenting all the other hacks. Her tweets as @astrobites appeared with the #hackaas hashtag, and her notes made this recap post infinitely easier to write.Interested in joining the fun? Sign up for Hack Day at the 2017 JanuaryAAS meeting (its free with meeting registration), and consider applying for the .Astronomy conference this summer.Towards Optimal Session Scheduling:Adrian Price-Whelan (Columbia), David Hogg (NYU), and Scott Idem (AAS) began writing a program to take all submitted abstracts to a conference like AAS and sort them using keywords to avoid scheduling similar talks in parallel sessions. Its impossible to make everyone happy, but minimizing conflicts

  19. Interaction of Lysinibacillus sphaericus Cry48Aa/Cry49Aa toxin with midgut brush-border membrane fractions from Culex quinquefasciatus larvae.

    Science.gov (United States)

    Guo, Q-Y; Hu, X-M; Cai, Q-X; Yan, J-P; Yuan, Z-M

    2016-04-01

    The Cry48Aa/Cry49Aa mosquitocidal toxin from Lysinibacillus sphaericus was uniquely composed of a three-domain (Cry) toxin and binary (Bin) toxin-like protein, with high toxicity against Culex spp. However, its mode of action against the target mosquitoes is still unknown. In this study, Cry48Aa, Cry49Aa and its N- and C-terminal truncated proteins were expressed and purified, and the binding affinities of the purified proteins with midgut brush-border membrane fractions (BBMFs) from Culex quin-quefasciatus larvae were performed. The results showed that both Cry48Aa and Cry49Aa have specific and high binding affinity to BBMFs, with dissociation constants of 9.5 ± 1.8 and 25.4 ± 3.8 nM, respectively. Competition assays demonstrated that Cry49Aa C-terminal derivatives were able to bind to the BBMFs, whereas Far-Western dot blot analysis revealed that its N-terminal constructs interacted with Cry48Aa. Nevertheless, larvicidal activity was almost lost when Cry49Aa truncated proteins, either individually or in pairs, combined with Cry48Aa. It is concluded that Cry49Aa is responsible for receptor binding and interaction with Cry48Aa and plays an important role in the mechanism of action of these two-component toxins. © 2016 The Royal Entomological Society.

  20. Delineation of the functional properties and the mechanism of action of AA29504, an allosteric agonist and positive allosteric modulator of GABAAreceptors.

    Science.gov (United States)

    Olander, Emma Rie; Madjroh, Nawid; Bunch, Lennart; Söderhielm, Pella Cecilia; Jensen, Anders A

    2018-04-01

    The retigabine analog 2-amino-4-[(2,4,6-trimethylbenzylamino)-phenyl]-carbamic acid ethyl ester (AA29504) is a positive allosteric modulator (PAM) of γ-aminobutyric acid A receptors (GABA A Rs), and the modulator has been used in ex vivo/in vivo studies to probe the physiological roles of native δ-containing GABA A Rs. In this study, the functional properties and mode of action of AA29504 were investigated at human GABA A Rs expressed in Xenopus oocytes by two-electrode voltage clamp electrophysiology. AA29504 was found to be an allosteric GABA A R agonist displaying low intrinsic activities at 3-30 μM. AA29504 was essentially equipotent as a PAM at the 13 GABA A R subtypes tested (EC 50 : 0.45-5.2 μM), however GABA EC 5 -evoked currents through αβδ subtypes were modulated to substantially higher levels than those through αβγ 2S subtypes (relative to GABA I max ). While the δ/γ 2S -difference clearly was key for this differential GABA efficacy modulation, studies of the AA29504-mediated modulation of different α 4,5,6 -containing αβ, αβγ 2S and αβδ GABA A Rs revealed the α-subunit identity to be another important determinant. Based on its functional properties at numerous mutant GABA A Rs and on in silico analysis of its low-energy conformations, AA29504 is proposed to act through an allosteric site in the transmembrane β (+) /α (-) interface in the GABA A R also targeted by etomidate and several other modulators. In contrast to these modulators, however, AA29504 did not display substantial β 2 /β 3 -over-β 1 GABA A R preference, which challenges the notion of ligands targeting this site always possessing this subtype-selectivity profile. Hence, the detailed pharmacological profiling of AA29504 both highlights the complexity of allosteric GABA A R modulation and provides valuable information about this modulator as a pharmacological tool. Copyright © 2018 Elsevier Inc. All rights reserved.

  1. Agronomically valuable mutant lines of castor

    International Nuclear Information System (INIS)

    Bokhan, I.K.

    1990-01-01

    Dry seeds of four castor varieties (VNIIMK 165-improved, VNIIMK 18, Chervonnaya and Antika) were treated with six chemical mutagens, N-nitroso-N-methyl urea (NMU), N-nitroso-N-ethyl urea (NEU), dimethyl sulphate (DMS), diethyl sulphate (DES), ethylenimine (EI) and 1,4-bis-diazoacetyl-butane (DAB) in various doses during 18 hours. About 40,000 plants were studied in M 2 and 80 types of mutations were found, including a number of valuable mutants: short-stemmed, semi-dwarf, dwarf, early maturing, with female and interspersed types of racemes, highly productive etc. Based on trials in M 3 -M 4 , on small plots with two or three replications, the superior mutant lines were identified. The best mutants are presented in the table. Early maturation is very important for growing castor in the USSR, as it is the predecessor of winter wheat in crop rotation. The mutants M2-323 and Ml-83 are of great value as they show early maturation and high yield. Their productivity is mainly conditioned by a high percentage of interspersed plants. The reduction of plant height is of great importance for the successful combine harvesting of castor. Mutant lines M2-119 and Ml-284 characterised by low plant height and high yield are very interesting in this respect. The obtained initial material will be used in further breeding work

  2. Plasmodium berghei: in vivo generation and selection of karyotype mutants and non-gametocyte producer mutants

    NARCIS (Netherlands)

    Janse, C. J.; Ramesar, J.; van den Berg, F. M.; Mons, B.

    1992-01-01

    We previously reported that karyotype and gametocyte-producer mutants spontaneously arose during in vivo asexual multiplication of Plasmodium berghei. Here we studied the rate of selection of these mutants in vivo. Gametocyte production and karyotype pattern were established at regular intervals

  3. The research progress on plant mutant germplasm resources in China

    International Nuclear Information System (INIS)

    He Cexi; Ji Linzhen; Zhao Shirong

    1991-07-01

    Mutants induced by nuclear radiation or other mutagens are new artificial germplasm resources. Some mutants have been applied in plant breeding and great achievements have been reached. The status and progress on the collection, identification and utilization of mutants in China are introduced. A proposal for developing mutant germplasm resources with good agronomic characters is suggested

  4. The influence of different linker modifications on the catalytic activity and cellulose affinity of cellobiohydrolase Cel7A from Hypocrea jecorina

    DEFF Research Database (Denmark)

    Badino, Silke Flindt; Bathke, Jenny Kim; Sørensen, Trine Holst

    2017-01-01

    , of the linker and its glycans, have been widely discussed, but experimental evidence remains sparse. One of the most studied cellulose degrading enzymes is the multi-domain cellobiohydrolase Cel7A from Hypocrea jecorina. Here, we designed variants of Cel7A with mutations in the linker region to elucidate...... interactions. However, a variant with several inserted glycosylation sites near the CBM also showed lower affinity for the substrate compared to the wild-type, and we suggest that substrate interactions of the glycans depend on their exact location as well as other factors such as changes in structure...

  5. Ester-free cross-linker molecules for ultraviolet-light-cured polysilsesquioxane gate dielectric layers of organic thin-film transistors

    Science.gov (United States)

    Okada, Shuichi; Nakahara, Yoshio; Uno, Kazuyuki; Tanaka, Ichiro

    2018-04-01

    Pentacene thin-film transistors (TFTs) were fabricated with ultraviolet-light (UV)-cured polysilsesquioxane (PSQ) gate dielectric layers using cross-linker molecules with or without ester groups. To polymerize PSQ without ester groups, thiol-ene reaction was adopted. The TFTs fabricated with PSQ layers comprising ester-free cross-linkers showed a higher carrier mobility than the TFTs with PSQ layers cross-linked with ester groups, which had large electric dipole moments that limited the carrier mobility. It was demonstrated that the thiol-ene reaction is more suitable than the conventional radical reaction for UV-cured PSQ with small dielectric constant.

  6. Essential Role of the CBD1-CBD2 Linker in Slow Dissociation of Ca2+ from the Regulatory Two-domain Tandem of NCX1*

    OpenAIRE

    Giladi, Moshe; Boyman, Liron; Mikhasenko, Helen; Hiller, Reuben; Khananshvili, Daniel

    2010-01-01

    In NCX proteins CBD1 and CBD2 domains are connected through a short linker (3 or 4 amino acids) forming a regulatory tandem (CBD12). Only three of the six CBD12 Ca2+-binding sites contribute to NCX regulation. Two of them are located on CBD1 (Kd = ∼0.2 μm), and one is on CBD2 (Kd = ∼5 μm). Here we analyze how the intrinsic properties of individual regulatory sites are affected by linker-dependent interactions in CBD12 (AD splice variant). The three sites of CBD12 and CBD1 + CBD2 have comparab...

  7. Effects of linker variation on the in vitro and in vivo characteristics of an 111In-labeled RGD peptide

    International Nuclear Information System (INIS)

    Dijkgraaf, Ingrid; Liu, Shuang; Kruijtzer, John A.W.; Soede, Annemieke C.; Oyen, Wim J.G.; Liskamp, Rob M.J.; Corstens, Frans H.M.; Boerman, Otto C.

    2007-01-01

    Introduction: Due to the selective expression of the α v β 3 integrin in tumors, radiolabeled arginine-glycine-aspartic acid (RGD) peptides are attractive candidates for tumor targeting. Minor modifications of these peptides could have a major impact on in vivo characteristics. In this study, we systematically investigated the effects of linker modification between two cyclic RGD sequences and DOTA (1,4,7,10-tetraazadodecane-N,N',N ' ,N'''-tetraacetic acid) on the in vitro and in vivo characteristics of the tracer. Methods: A dimeric RGD peptide was synthesized and conjugated either directly with DOTA or via different linkers: PEG 4 (polyethylene glycol), glutamic acid or lysine. The RGD peptides were radiolabeled with 111 In, and their in vitro and in vivo α v β 3 -binding characteristics were determined. Results: LogP values varied between -2.82±0.06 and -3.95±0.33. The IC 50 values for DOTA-E-[c(RGDfK)] 2 , DOTA-PEG 4 -E-[c(RGDfK)] 2 , DOTA-E-E-[c(RGDfK)] 2 and DOTA-K-E-[c(RGDfK)] 2 were comparable. Two hours after injection, the tumor uptakes of the 111 In-labeled compounds were not significantly different. The kidney accumulation of [ 111 In]-DOTA-K-E-[c(RGDfK)] 2 [4.05±0.20% of the injected dose per gram (ID/g)] was significantly higher as compared with that of [ 111 In]-DOTA-E-[c(RGDfK)] 2 (2.63±0.19% ID/g; P 111 In]-DOTA-E-E-[c(RGDfK)] 2 (2.16±0.21% ID/g; P 111 In]-DOTA-E-E-[c(RGDfK)] 2 (2.12±0.09% ID/g) was significantly higher as compared with that of [ 111 In]-DOTA-E-[c(RGDfK)] 2 (1.64±0.1% ID/g; P 111 In]-DOTA-K-E-[c(RGDfK)] 2 (1.52±0.04% ID/g; P v β 3 and tumor uptake. Insertion of lysine caused enhanced kidney retention; that of glutamic acid also resulted in enhanced retention in the kidneys. PEG 4 appeared to be the most suitable linker as compared with glutamic acid and lysine because it has the highest tumor-to-blood ratio and the lowest uptake in the kidney and liver

  8. High Persister Mutants in Mycobacterium tuberculosis.

    Directory of Open Access Journals (Sweden)

    Heather L Torrey

    Full Text Available Mycobacterium tuberculosis forms drug-tolerant persister cells that are the probable cause of its recalcitrance to antibiotic therapy. While genetically identical to the rest of the population, persisters are dormant, which protects them from killing by bactericidal antibiotics. The mechanism of persister formation in M. tuberculosis is not well understood. In this study, we selected for high persister (hip mutants and characterized them by whole genome sequencing and transcriptome analysis. In parallel, we identified and characterized clinical isolates that naturally produce high levels of persisters. We compared the hip mutants obtained in vitro with clinical isolates to identify candidate persister genes. Genes involved in lipid biosynthesis, carbon metabolism, toxin-antitoxin systems, and transcriptional regulators were among those identified. We also found that clinical hip isolates exhibited greater ex vivo survival than the low persister isolates. Our data suggest that M. tuberculosis persister formation involves multiple pathways, and hip mutants may contribute to the recalcitrance of the infection.

  9. Native Mutant Huntingtin in Human Brain

    Science.gov (United States)

    Sapp, Ellen; Valencia, Antonio; Li, Xueyi; Aronin, Neil; Kegel, Kimberly B.; Vonsattel, Jean-Paul; Young, Anne B.; Wexler, Nancy; DiFiglia, Marian

    2012-01-01

    Huntington disease (HD) is caused by polyglutamine expansion in the N terminus of huntingtin (htt). Analysis of human postmortem brain lysates by SDS-PAGE and Western blot reveals htt as full-length and fragmented. Here we used Blue Native PAGE (BNP) and Western blots to study native htt in human postmortem brain. Antisera against htt detected a single band broadly migrating at 575–850 kDa in control brain and at 650–885 kDa in heterozygous and Venezuelan homozygous HD brains. Anti-polyglutamine antisera detected full-length mutant htt in HD brain. There was little htt cleavage even if lysates were pretreated with trypsin, indicating a property of native htt to resist protease cleavage. A soluble mutant htt fragment of about 180 kDa was detected with anti-htt antibody Ab1 (htt-(1–17)) and increased when lysates were treated with denaturants (SDS, 8 m urea, DTT, or trypsin) before BNP. Wild-type htt was more resistant to denaturants. Based on migration of in vitro translated htt fragments, the 180-kDa segment terminated ≈htt 670–880 amino acids. If second dimension SDS-PAGE followed BNP, the 180-kDa mutant htt was absent, and 43–50 kDa htt fragments appeared. Brain lysates from two HD mouse models expressed native full-length htt; a mutant fragment formed if lysates were pretreated with 8 m urea + DTT. Native full-length mutant htt in embryonic HD140Q/140Q mouse primary neurons was intact during cell death and when cell lysates were exposed to denaturants before BNP. Thus, native mutant htt occurs in brain and primary neurons as a soluble full-length monomer. PMID:22375012

  10. Identification of Eps15 as antigen recognized by the monoclonal antibodies aa2 and ab52 of the Wuerzburg Hybridoma Library against Drosophila brain.

    Directory of Open Access Journals (Sweden)

    Partho Halder

    Full Text Available The Wuerzburg Hybridoma Library against the Drosophila brain represents a collection of around 200 monoclonal antibodies that bind to specific structures in the Drosophila brain. Here we describe the immunohistochemical staining patterns, the Western blot signals of one- and two-dimensional electrophoretic separation, and the mass spectrometric characterization of the target protein candidates recognized by the monoclonal antibodies aa2 and ab52 from the library. Analysis of a mutant of a candidate gene identified the Drosophila homolog of the Epidermal growth factor receptor Pathway Substrate clone 15 (Eps15 as the antigen for these two antibodies.

  11. Fecal transmission of AA amyloidosis in the cheetah contributes to high incidence of disease

    Science.gov (United States)

    Zhang, Beiru; Une, Yumi; Fu, Xiaoying; Yan, Jingmin; Ge, FengXia; Yao, Junjie; Sawashita, Jinko; Mori, Masayuki; Tomozawa, Hiroshi; Kametani, Fuyuki; Higuchi, Keiichi

    2008-01-01

    AA amyloidosis is one of the principal causes of morbidity and mortality in captive cheetahs (Acinonyx jubatus), which are in danger of extinction, but little is known about the underlying mechanisms. Given the transmissible characteristics of AA amyloidosis, transmission between captive cheetahs may be a possible mechanism involved in the high incidence of AA amyloidosis. In this study of animals with AA amyloidosis, we found that cheetah feces contained AA amyloid fibrils that were different from those of the liver with regard to molecular weight and shape and had greater transmissibility. The infectious activity of fecal AA amyloid fibrils was reduced or abolished by the protein denaturants 6 M guanidine·HCl and formic acid or by AA immunodepletion. Thus, we propose that feces are a vehicle of transmission that may accelerate AA amyloidosis in captive cheetah populations. These results provide a pathogenesis for AA amyloidosis and suggest possible measures for rescuing cheetahs from extinction. PMID:18474855

  12. Yield and flow properties of aluminum alloy AA 8001

    International Nuclear Information System (INIS)

    Lyons, J.S.; Johnson, H.W.; Han, E.G.

    1995-01-01

    Aluminum alloy AA 8001 is being used at the Westinghouse Savannah River Company (WSRC) for nuclear reactor fuel and target components. The objective of this research was to determine parameters for predictive models of the compressive flow properties of AA 8001. Seventy-five true strain-rate, hot compression tests were performed. New, quantitative information about the yield and flow behavior of aluminum alloy AA 8001 was determined. Parameters were determined to use in a hyperbolic sine constitutive law so that the yield stress, the peak stress, and the peak strain can be predicted from the temperature-compensated strain-rate, Z. It was found that the onset of strain softening was more strongly dependent on Z than the onset of yielding was

  13. Occupational asthma and contact dermatitis in a spray painter after introduction of an aziridine cross-linker.

    Science.gov (United States)

    Leffler, C T; Milton, D K

    1999-07-01

    A 23-year-old spray painter developed contact dermatitis and respiratory difficulty characterized by small airways obstruction shortly after the polyfunctional aziridine cross-linker CX-100 began to be used in his workplace as a paint activator. The symptoms resolved after he was removed from the workplace and was treated with inhaled and topical steroids. Painters may have an increased risk of asthma due to exposure to a variety of agents, such as isocyanates, alkyd resins, and chromates. This case illustrates the importance of using appropriate work practices and personal protective equipment to minimize exposure. Occupational asthma is diagnosed by a history of work-related symptoms and exposure to known causative agents. The diagnosis is confirmed by serial pulmonary function testing or inhalational challenge testing. The risk of asthma attributable to occupational exposures is probably underappreciated due to underreporting and to inappropriate use of narrow definitions of exposure in epidemiologic studies of attributable risk.

  14. Highly Polarizable Triiodide Anions (I3(-)) as Cross-Linkers for Coordination Polymers: Closing the Semiconductive Band Gap.

    Science.gov (United States)

    He, Jun; Cao, Peng; Wu, Chao; Huang, Jiahong; Huang, Jian; He, Yonghe; Yu, Lin; Zeller, Matthias; Hunter, Allen D; Xu, Zhengtao

    2015-07-06

    From a hydrothermal reaction using CuI, KI, and 3,3'5,5'-tetramethyl-4,4'-bipyrazole (TMBP), the triiodide anion I3(-) has been integrated into the water-stable 2D coordination polymer Cu(TMBP)I3 (1). In contrast with other metal triiodide complexes, 1 features remarkably small distortions in the bond distances associated with the I3(-) units (i.e., the Cu-I and I-I bonds), which effectively link up the copper(I) centers into infinite CuI3 chains. The electronic band gaps and electrical conductivity data are also found to be consistent with the I3(-) ion acting as an effective linker across the copper(I) centers.

  15. Fatigue behaviour of GMAW welded aluminium alloy AA7020

    OpenAIRE

    Bloem, Carlos; Salvador Moya, Mª Dolores; Amigó, Vicente; Vicente-Escuder, Ángel

    2009-01-01

    [EN] The aim of this investigation is to evaluate the influence on fatigue behaviour of the finishing of the bulge in a welded aluminium zinc magnesium alloy AA7020. It was determined that total or partial elimination of the bulge has very little influence on its behaviour, giving a very similar result on both cases, where one is better than the other by only 3%. Bloem, C.; Salvador Moya, MD.; Amigó, V.; Vicente-Escuder, Á. (2009). Fatigue behaviour of GMAW welded aluminium alloy AA7020. W...

  16. Experimental transmission of AA amyloidosis by injecting the AA amyloid protein into interleukin-1 receptor antagonist knockout (IL-1raKO) mice.

    Science.gov (United States)

    Watanabe, K; Uchida, K; Chambers, J K; Tei, M; Shoji, A; Ushio, N; Nakayama, H

    2015-05-01

    The incidence of AA amyloidosis is high in humans with rheumatoid arthritis and several animal species, including cats and cattle with prolonged inflammation. AA amyloidosis can be experimentally induced in mice using severe inflammatory stimuli and a coinjection of AA amyloid; however, difficulties have been associated with transmitting AA amyloidosis to a different animal species, and this has been attributed to the "species barrier." The interleukin-1 receptor antagonist knockout (IL-1raKO) mouse, a rodent model of human rheumatoid arthritis, has been used in the transmission of AA amyloid. When IL-1raKO and BALB/c mice were intraperitoneally injected with mouse AA amyloid together with a subcutaneous pretreatment of 2% AgNO3, all mice from both strains that were injected with crude or purified murine AA amyloid developed AA amyloidosis. However, the amyloid index, which was determined by the intensity of AA amyloid deposition, was significantly higher in IL-1raKO mice than in BALB/c mice. When IL-1raKO and BALB/c mice were injected with crude or purified bovine AA amyloid together with the pretreatment, 83% (5/6 cases) and 38% (3/8 cases) of IL-1raKO mice and 17% (1/6 cases) and 0% (0/6 cases) of BALB/c mice, respectively, developed AA amyloidosis. Similarly, when IL-1raKO and BALB/c mice were injected with crude or purified feline AA amyloid, 33% (2/6 cases) and 88% (7/8 cases) of IL-1raKO mice and 0% (0/6 cases) and 29% (2/6 cases) of BALB/c mice, respectively, developed AA amyloidosis. These results indicated that IL-1raKO mice are a useful animal model for investigating AA amyloidogenesis. © The Author(s) 2014.

  17. Nicotinamide ribosyl uptake mutants in Haemophilus influenzae.

    Science.gov (United States)

    Herbert, Mark; Sauer, Elizabeta; Smethurst, Graeme; Kraiss, Anita; Hilpert, Anna-Karina; Reidl, Joachim

    2003-09-01

    The gene for the nicotinamide riboside (NR) transporter (pnuC) was identified in Haemophilus influenzae. A pnuC mutant had only residual NR uptake and could survive in vitro with high concentrations of NR, but could not survive in vivo. PnuC may represent a target for the development of inhibitors for preventing H. influenzae disease.

  18. Ethanol production using engineered mutant E. coli

    Science.gov (United States)

    Ingram, Lonnie O.; Clark, David P.

    1991-01-01

    The subject invention concerns novel means and materials for producing ethanol as a fermentation product. Mutant E. coli are transformed with a gene coding for pyruvate decarboxylase activity. The resulting system is capable of producing relatively large amounts of ethanol from a variety of biomass sources.

  19. Avirulent mutants of Macrophomina phaseolina and Aspergillus ...

    Indian Academy of Sciences (India)

    albino colonies out of the above ten were moderately viru- lent compared to wild type strain. They were sclerotia forming and produced phaseolinone in culture. A brown variant, designated Muv 21, and two other albino mutants, designated Muv 19 and Muv 20, were avirulent and pro- duced no phaseolinone in culture.

  20. Induced mutants for cereal grain protein improvement

    International Nuclear Information System (INIS)

    1982-01-01

    Out of 17 papers and one summary presented, six dealing with the genetic improvement of seed protein using ionizing radiations fall within the INIS subject scope. Other topics discussed were non-radiation induced mutants used for cereal grain protein improvement

  1. Mutant PTEN in Cancer : Worse Than Nothing

    NARCIS (Netherlands)

    Leslie, Nick R; den Hertog, Jeroen

    2014-01-01

    Tumor suppressors block the development of cancer and are often lost during tumor development. Papa et al. show that partial loss of normal PTEN tumor suppressor function can be compounded by additional disruption caused by the expression of inactive mutant PTEN protein. This has significant

  2. Generation and characterization of pigment mutants of ...

    African Journals Online (AJOL)

    The result of bio-test, using the resulting pigment mutant of C. reinhardtii 124y-1 showed that mutagenic activity was observed significantly in both Tekeli River and Pavlodar Oil Refinery in Kazakhstan; the waste water of the Pavlodar Oil Refinery had high-toxicity while the water of the Tekeli River had medium-toxicity.

  3. Radioiodination of protein using 2,3,5,6-tetrafluorophenyl 3-(nido-carboranyl) propionate (TCP) as a potential bi-functional linker: Synthesis and biodistribution in mice

    International Nuclear Information System (INIS)

    Lin Rushan; Liu Ning; Yang Yuanyou; Li Bing; Liao Jiali; Jin Jiannan

    2009-01-01

    2,3,5,6-Tetrafluorophenyl 3-(nido-carboranyl) propionate (TCP), as a new potential bi-functional linker for radiohalogenation of proteins or peptides, was synthesized. With this bi-functional linker, the first attempt to conjugate bovine serum albumin (BSA) with 125 I was made and the biodistribution of the conjugated BSA ( 125 I-TCP-BSA) was investigated in NIH strain mice. By the use of TCP as the linker, BSA was conjugated with 125 I in a labeling yield of 58-75% and with radiochemical purity of 99.8% after purification by Sephadex TM G-50. Even after being kept at room temperature for 72 h, the radiochemical purity of 125 I-TCP-BSA was still more than 98%, much higher than that of the directly 125 I-labeled BSA ( 125 I-BSA). Meanwhile, biodistribution experiments in mice indicated that the uptake of 125 I with 125 I-TCP-BSA into thyroid was obviously less than that with 125 I-BSA post-injection. All the results implied that the 125 I-conjugated BSA ( 125 I-TCP-BSA) was considerably stable in vivo as well as in vitro, and TCP was regarded as a promising bi-functional linker for radiohalogenation of proteins

  4. Micromachined silicon acoustic delay line with 3D-printed micro linkers and tapered input for improved structural stability and acoustic directivity

    International Nuclear Information System (INIS)

    Cho, Y; Kumar, A; Xu, S; Zou, J

    2016-01-01

    Recent studies have shown that micromachined silicon acoustic delay lines can provide a promising solution to achieve real-time photoacoustic tomography without the need for complex transducer arrays and data acquisition electronics. To achieve deeper imaging depth and wider field of view, a longer delay time and therefore delay length are required. However, as the length of the delay line increases, it becomes more vulnerable to structural instability due to reduced mechanical stiffness. In this paper, we report the design, fabrication, and testing of a new silicon acoustic delay line enhanced with 3D printed polymer micro linker structures. First, mechanical deformation of the silicon acoustic delay line (with and without linker structures) under gravity was simulated by using finite element method. Second, the acoustic crosstalk and acoustic attenuation caused by the polymer micro linker structures were evaluated with both numerical simulation and ultrasound transmission testing. The result shows that the use of the polymer micro linker structures significantly improves the structural stability of the silicon acoustic delay lines without creating additional acoustic attenuation and crosstalk. In addition, the improvement of the acoustic acceptance angle of the silicon acoustic delay lines was also investigated to better suppress the reception of unwanted ultrasound signals outside of the imaging plane. These two improvements are expected to provide an effective solution to eliminate current limitations on the achievable acoustic delay time and out-of-plane imaging resolution of micromachined silicon acoustic delay line arrays. (paper)

  5. RENAL SPECIFIC DELIVERY OF SULFAMETHOXAZOLE IN THE RAT BY COUPLING TO THE LOW-MOLECULAR-WEIGHT PROTEIN LYSOZYME VIA AN ACID-SENSITIVE LINKER

    NARCIS (Netherlands)

    FRANSSEN, EJF; MOOLENAAR, F; DEZEEUW, D; MEIJER, DKF

    1992-01-01

    Sulfamethoxazole (SM) was converted to a renal specific drug targeting preparation by coupling the drug to egg-white lysozyme via an acid-sensitive cis-aconityl linker (1:1). Due to this chemical manipulation SM was rapidly distributed to the kidney. Both in vitro and in vivo data indicate that SM

  6. Traceless Azido Linker for the Solid-Phase Synthesis of NH-1,2,3-Triazoles via Cu-Catalyzed Azide-Alkyne Cycloaddition Reactions

    DEFF Research Database (Denmark)

    Cohrt, Anders Emil; Jensen, Jakob Feldthusen; Nielsen, Thomas Eiland

    2010-01-01

    A broadly useful acid-labile traceless azido linker for the solid-phase synthesis of NH-1,2,3-triazoles is presented. A variety of alkynes were efficiently immobilized on a range of polymeric supports by Cu(I)-mediated azide-alkyne cycloadditions. Supported triazoles showed excellent compatibility...

  7. Phanerochaete mutants with enhanced ligninolytic activity

    International Nuclear Information System (INIS)

    Kakar, S.N.; Perez, A.; Gonzales, J.

    1994-01-01

    In addition to lignin, the white rot fungus Phanerochaete chrysosporium has the ability to degrade a wide spectrum of recalcitrant organo pollutants in soils and aqueous media. Most of the organic compounds are degraded under ligninolytic conditions with the involvement of the extracellular enzymes, lignin peroxidases, and manganese-dependent peroxidases, which are produced as secondary metabolites triggered by conditions of nutrient starvation (e.g., nitrogen limitation). The fungus and its enzymes can thus provide alternative technologies for bioremediation, bio pulping, bio bleaching, and other industrial applications. The efficiency and effectiveness of the fungus can be enhanced by increasing production and secretion of the important enzymes in large quantities and as primary metabolites under enriched conditions. One way this can be achieved is through isolation of mutants that are deregulated, or are hyper producers or super secretors of key enzymes under enriched conditions. Through UV-light and γ-ray mutagenesis, we have isolated a variety of mutants, some of which produce key enzymes of the ligninolytic system under high-nitrogen growth conditions. One of the mutants, 76UV, produced 272 U of lignin peroxidases enzyme activity/L after 9 d under high nitrogen (although the parent strain does not produce this enzyme under these conditions). The mutant and the parent strains produced up to 54 and 62 U/L, respectively, of the enzyme activity under low nitrogen growth conditions during this period. In some experiments, the mutant showed 281 U/L of enzyme activity under high nitrogen after 17 d

  8. Processing and targeting of proteins derived from polyprotein with 2A and LP4/2A as peptide linkers in a maize expression system.

    Science.gov (United States)

    Sun, He; Zhou, Ni; Wang, Hai; Huang, Dafang; Lang, Zhihong

    2017-01-01

    In the transformation of multiple genes, gene fusion is an attractive alternative to other methods, including sexual crossing, re-transformation, and co-transformation, among others. The 2A peptide from the foot-and-mouth disease virus (FMDV) causes the co-translational "cleavage" of polyprotein and operates in a wide variety of eukaryotic cells. LP4, a linker peptide that originates from a natural polyprotein occurring in the seed of Impatiens balsamina, can be split between the first and second amino acids in post-translational processing. LP4/2A is a hybrid linker peptide that contains the first nine amino acids of LP4 and 20 amino acids of 2A. The three linkers have been used as a suitable technique to link the expression of genes in some transgenic plants, but to date the cleavage efficiency of three linkers have not been comprehensively demonstrated in the same transformation system, especially in the staple crop. To verify the functions of 2A, LP4, and LP4/2A linker peptides in transgenic maize, six fusion protein vectors that each encoded a single open reading frame (ORF) incorporating two report genes, Green Fluorescent Protein (GFP) and β-glucuronidase (GUS), separated by 2A (or modified 2A), LP4 or LP4/2A were assembled to compare the cleavage efficiency of the three linkers in a maize transient expression system. The results demonstrated the more protein production and higher cleavage splicing efficiency with the polyprotein construct linked by the LP4/2A peptide than those of the polyprotein constructs linked by 2A or LP4 alone. Seven other fusion proteins that each encoded a single ORF incorporating two different genes GFP and Red Fluorecent Protein (RFP) with different signal peptides were assembled to study the subcellular localization of genes linked by LP4/2A. The subcellular localization experiments suggested that both types of signal peptide, co-translational and post-translational, could lead their proteins to the target localization in maize

  9. Processing and targeting of proteins derived from polyprotein with 2A and LP4/2A as peptide linkers in a maize expression system.

    Directory of Open Access Journals (Sweden)

    He Sun

    Full Text Available In the transformation of multiple genes, gene fusion is an attractive alternative to other methods, including sexual crossing, re-transformation, and co-transformation, among others. The 2A peptide from the foot-and-mouth disease virus (FMDV causes the co-translational "cleavage" of polyprotein and operates in a wide variety of eukaryotic cells. LP4, a linker peptide that originates from a natural polyprotein occurring in the seed of Impatiens balsamina, can be split between the first and second amino acids in post-translational processing. LP4/2A is a hybrid linker peptide that contains the first nine amino acids of LP4 and 20 amino acids of 2A. The three linkers have been used as a suitable technique to link the expression of genes in some transgenic plants, but to date the cleavage efficiency of three linkers have not been comprehensively demonstrated in the same transformation system, especially in the staple crop. To verify the functions of 2A, LP4, and LP4/2A linker peptides in transgenic maize, six fusion protein vectors that each encoded a single open reading frame (ORF incorporating two report genes, Green Fluorescent Protein (GFP and β-glucuronidase (GUS, separated by 2A (or modified 2A, LP4 or LP4/2A were assembled to compare the cleavage efficiency of the three linkers in a maize transient expression system. The results demonstrated the more protein production and higher cleavage splicing efficiency with the polyprotein construct linked by the LP4/2A peptide than those of the polyprotein constructs linked by 2A or LP4 alone. Seven other fusion proteins that each encoded a single ORF incorporating two different genes GFP and Red Fluorecent Protein (RFP with different signal peptides were assembled to study the subcellular localization of genes linked by LP4/2A. The subcellular localization experiments suggested that both types of signal peptide, co-translational and post-translational, could lead their proteins to the target

  10. Systemic AA amyloidosis in the red fox (Vulpes vulpes).

    Science.gov (United States)

    Rising, Anna; Cederlund, Ella; Palmberg, Carina; Uhlhorn, Henrik; Gaunitz, Stefan; Nordling, Kerstin; Ågren, Erik; Ihse, Elisabet; Westermark, Gunilla T; Tjernberg, Lars; Jörnvall, Hans; Johansson, Jan; Westermark, Per

    2017-11-01

    Amyloid A (AA) amyloidosis occurs spontaneously in many mammals and birds, but the prevalence varies considerably among different species, and even among subgroups of the same species. The Blue fox and the Gray fox seem to be resistant to the development of AA amyloidosis, while Island foxes have a high prevalence of the disease. Herein, we report on the identification of AA amyloidosis in the Red fox (Vulpes vulpes). Edman degradation and tandem MS analysis of proteolyzed amyloid protein revealed that the amyloid partly was composed of full-length SAA. Its amino acid sequence was determined and found to consist of 111 amino acid residues. Based on inter-species sequence comparisons we found four residue exchanges (Ser31, Lys63, Leu71, Lys72) between the Red and Blue fox SAAs. Lys63 seems unique to the Red fox SAA. We found no obvious explanation to how these exchanges might correlate with the reported differences in SAA amyloidogenicity. Furthermore, in contrast to fibrils from many other mammalian species, the isolated amyloid fibrils from Red fox did not seed AA amyloidosis in a mouse model. © 2017 The Protein Society.

  11. Contribution to comprehensive study of aluminium alloy Aa 5083 ...

    African Journals Online (AJOL)

    Corrosion induced by elemental mercury in aqueous media of industrial Aluminium alloys AA5083 used in heat exchanger industries of natural gas liquefaction has been studied by linear sweep voltammétry on rotating amalgamated disk electrode. Corrosion process depends on: • Chemical processes of amalgamation of ...

  12. Churg-Strauss syndrome associated with AA amyloidosis: a case ...

    African Journals Online (AJOL)

    Churg Strauss syndrome is a rare systemic and pulmonary vasculitis exceptionally associated with AA amyloidosis. We report the case of a 65-year old woman with past medical history of asthma. She developed polyarthralgia, headache and purpura. A laboratory workout found hypereosinophilia (1150/μL), positive ...

  13. Backend solutions for AA in the MUSE network supporting FMC

    NARCIS (Netherlands)

    Neerbos, A.N.R. van; Prins, M.; Melander, B.; Pimilla Larrucea, I.; Thakur, M.J.; Fredricx, F.

    2007-01-01

    The European MUSE project investigated fixed-mobile convergence from the perspective of an unbundled fixed network. A major part of the work consisted of finding solutions for the authentication and authorisation of users who roam from their home network to a visited network. This paper shows how AA

  14. Three body abrasion of laser surface alloyed aluminium AA1200

    CSIR Research Space (South Africa)

    Mabhali, Luyolo AB

    2012-06-01

    Full Text Available Laser surface alloying of aluminium AA1200 was performed with a 4 kW Nd:YAG laser to improve the abrasion wear resistance. Aluminium surfaces reinforced with metal matrix composites and intermetallic phases were achieved. The phases present depended...

  15. Recovery and recrystallization in the superplastic deformation of AA5182

    NARCIS (Netherlands)

    Chen, Z.; Kazantzis, A. V.; De Hosson, J. Th. M.

    The coarse-grained Al alloy AA5182 exhibits poor superplasticity with a maximum elongation to failure not exceeding 220% at 450 degrees C and at 10(-2) s(-1). The low values of the strain rate sensitivity indicate that the dislocation velocity is quite high and necking is developed quite soon during

  16. Impact toughness of laser alloyed aluminium AA1200 alloys

    CSIR Research Space (South Africa)

    Mabhali, Luyolo AB

    2013-08-01

    Full Text Available Laser surface alloying of aluminium AA1200 was performed with a 4kW Nd:YAG laser and impact resistance of the alloys was investigated. The alloying powders were a mixture of Ni, Ti and SiC in different proportions. Surfaces reinforced...

  17. Pollution assessment and heavy metal determination by AAS in ...

    African Journals Online (AJOL)

    Foisal

    below detective level. This study points out the health risk status of waste water for residents and aquatic living being, an ultimate concern for their survival in the region. Key words: Waste water, pollution assessment, physico-chemical parameters, atomic absorption spectrophotometer (AAS), heavy metal contamination.

  18. Making ET AAS Determination Less Dependent on Vapourization ...

    African Journals Online (AJOL)

    NICO

    The quantification of the analytes in ET AAS is normally attained by the measurement and integration of transient absorbance. High degree of atomization and constant vapour transportation rate for the analyte atoms in the absorption volume are considered to be crucial to grant correctness of the measurements. However ...

  19. A Status Report on the AAS Astronomy Ambassadors Program

    Science.gov (United States)

    Fienberg, Richard Tresch; Fraknoi, Andrew; Gurton, Suzanne; Hurst, Anna; Schatz, Dennis L.

    2014-06-01

    The American Astronomical Society, in partnership with the Astronomical Society of the Pacific (ASP), has launched a series of professional-development workshops and a community of practice designed to improve early-career astronomers’ ability to communicate effectively with students and the public. Called AAS Astronomy Ambassadors, the program provides training and mentoring for young astronomers, from advanced undergraduates to beginning faculty; it also provides them access to resources and a network of contacts within the astronomy education and public outreach (EPO) community. Ambassadors are provided with a library of outreach activities and resource materials suitable for a range of venues and audiences. For much of this library we are using resources developed by organizations such as the ASP, the Pacific Science Center, and the Center for Astronomy Education for other outreach programs, though some resources have been created by one of us (AF) specifically for this program. After a period of evaluation and revision, the program’s “Menu of Outreach Opportunities for Science Education” (MOOSE) is now posted on the AAS website at http://aas.org/outreach/moose-menu-outreach-opportunities-science-education.The first two Astronomy Ambassadors workshops were held at AAS meetings in January 2013 and January 2014; each served 30 young astronomers chosen from about twice that many applicants. Web-based follow-up activities are being provided through a website at the ASP designed to keep cohorts of educators trained in their programs in touch with one another. The AAS is exploring ways to fund additional workshops at future winter meetings; suggestions are most welcome. Meanwhile, the Astronomy Ambassadors trained to date have logged more than 150 outreach events, reaching many thousands of children and adults across the U.S. and Canada.

  20. A trimeric structural fusion of an antagonistic tumor necrosis factor-α mutant enhances molecular stability and enables facile modification.

    Science.gov (United States)

    Inoue, Masaki; Ando, Daisuke; Kamada, Haruhiko; Taki, Shintaro; Niiyama, Mayumi; Mukai, Yohei; Tadokoro, Takashi; Maenaka, Katsumi; Nakayama, Taisuke; Kado, Yuji; Inoue, Tsuyoshi; Tsutsumi, Yasuo; Tsunoda, Shin-Ichi

    2017-04-21

    Tumor necrosis factor-α (TNF) exerts its biological effect through two types of receptors, p55 TNF receptor (TNFR1) and p75 TNF receptor (TNFR2). An inflammatory response is known to be induced mainly by TNFR1, whereas an anti-inflammatory reaction is thought to be mediated by TNFR2 in some autoimmune diseases. We have been investigating the use of an antagonistic TNF mutant (TNFR1-selective antagonistic TNF mutant (R1antTNF)) to reveal the pharmacological effect of TNFR1-selective inhibition as a new therapeutic modality. Here, we aimed to further improve and optimize the activity and behavior of this mutant protein both in vitro and in vivo Specifically, we examined a trimeric structural fusion of R1antTNF, formed via the introduction of short peptide linkers, as a strategy to enhance bioactivity and molecular stability. By comparative analysis with R1antTNF, the trimeric fusion, referred to as single-chain R1antTNF (scR1antTNF), was found to retain in vitro molecular properties of receptor selectivity and antagonistic activity but displayed a marked increase in thermal stability. The residence time of scR1antTNF in vivo was also significantly prolonged. Furthermore, molecular modification using polyethylene glycol (PEG) was easily controlled by limiting the number of reactive sites. Taken together, our findings show that scR1antTNF displays enhanced molecular stability while maintaining biological activity compared with R1antTNF. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Microstructure and Mechanical Properties of Accumulative Roll-Bonded AA1050A/AA5005 Laminated Metal Composites

    Directory of Open Access Journals (Sweden)

    Frank Kümmel

    2016-03-01

    Full Text Available Laminated metal composites (LMCs with alternating layers of commercial pure aluminum AA1050A and aluminum alloy AA5005 were produced by accumulative roll-bonding (ARB. In order to vary the layer thickness and the number of layer interfaces, different numbers of ARB cycles (4, 8, 10, 12, 14 and 16 were performed. The microstructure and mechanical properties were characterized in detail. Up to 8 ARB cycles, the ultrafine-grained (UFG microstructure of the layers in the LMC evolves almost equally to those in AA1050A and AA5005 mono-material sheets. However, the grain size in the composites tends to have smaller values. Nevertheless, the local mechanical properties of the individual layers in the LMCs are very similar to those of the mono-material sheets, and the macroscopic static mechanical properties of the LMCs can be calculated as the mean value of the mono-material sheets applying a linear rule of mixture. In contrast, for more than 12 ARB cycles, a homogenous microstructure was obtained where the individual layers within the composite cannot be visually separated any longer; thus, the hardness is at one constant and a high level across the whole sheet thickness. This results also in a significant higher strength in tensile testing. It was revealed that, with decreasing layer thickness, the layer interfaces become more and more dominating.

  2. Dynamic Response and Microstructure Evolution of AA2219-T4 and AA2219-T6 Aluminum Alloys

    Science.gov (United States)

    Olasumboye, A.; Owolabi, G.; Odeshi, A.; Zeytinci, A.; Yilmaz, N.

    2018-02-01

    In this study, the dynamic deformation behavior of AA2219 aluminum alloy was investigated in two different temper conditions: T4 and T6, with a view to determining the effect of heat treatment on the microstructure and flow behavior of the material under high strain rates. Split Hopkinson pressure bar experiment was used in determining the dynamic response of the alloy while a digital image correlation system was employed in visualizing and tracking the surface deformation of the specimens. Optical microscopy and scanning electron microscopy were used to assess the microstructure of the material after following standard metallographic specimen preparation techniques. The results obtained showed heterogeneous deformation of the alloy in the two temper conditions. It was observed that the dynamic mechanical behavior of each sample preparation was dependent on its strength properties due to aging type, which in turn controls the metamorphosis of the strengthening precipitates and the initial microstructure. At the maximum strain rate of 3500 s-1, transformed bands leading to crack nucleation was observed in the AA2219-T4 aluminum alloy while AA2219-T6 had fractured at the same strain rate. The modes of crack formation and growth in the two alloys were found to be similar: nucleation, growth and coalescence of voids. However, shear band bifurcation phenomenon was observed only in the AA2219-T6 alloy.

  3. Ultrastructure of a hexagonal array in exosporium of a highly sporogenic mutant of Clostridium botulinum type A revealed by electron microscopy using optical diffraction and filtration.

    Science.gov (United States)

    Masuda, K; Kawata, T; Takumi, K; Kinouchi, T

    1980-01-01

    The ultrastructure of a hexagonal array in the exosporium from spores of a highly sporogenic mutant of Clostridium botulinum type A strain 190L was studied by electron microscopy of negatively stained exosporium fragments using optical diffraction and filtration. The exosporium was composed of three or more lamellae showing and equilateral, hexagonal periodicity. Images of the single exosporium layer from which the noise had been filtered optically revealed that the hexagonally arranged, morphological unit of the exosporium was composed of three globular subunits about 2.1 nm in diameter which were arranged at the vertices of an equilateral triangle with sides of about 2.4 nm. The morphological units were arranged with a spacing of about 4.5 nm. the adjacent globular subunits appeared to be interconnected by delicate linkers.

  4. Hair defects in Hoxc13 mutant mice.

    Science.gov (United States)

    Godwin, A R; Capecchi, M R

    1999-12-01

    Hox genes encode transcription factors that are important during normal embryonic development of diverse organisms including vertebrates. In mammals, Hox genes are responsible for conferring regional identity in embryonic tissues, including the limb bud, the neural tube, the presomitic mesoderm and the intestinal tract. Recent studies have demonstrated expression of Hox genes in skin and hair follicles, suggesting potential functions for these genes in epidermal appendages. These studies are reviewed here with emphasis on Hoxc13, as Hoxc13 mutants are the first Hox mutants to demonstrate overt hair defects. In addition, because Hoxc13 does not show regionally restricted expression in the skin, as demonstrated for other Hox genes, the potentially different roles of Hoxc13 versus other Hox genes in the skin are discussed.

  5. PNRI mutant variety: sansevieria 'Sword of Ibe'

    International Nuclear Information System (INIS)

    Aurigue, Fernando B.

    2011-01-01

    Sansevieria 'Sword of Ibe,' registered by the Philippine Nuclear Research Institute as NSIC 2008 Or-66, is a chlorophyll mutant of Sansevieria trifasciata 'Moonshine' developed by treating its suckers or shoots arising from a rhizome with acute gamma radiation from a Cobalt-60 source. The new mutant is identical in growth habit and vigor to Sansevieria 'Moonshine,' also known as Moonglow. Results of this mutation breeding experiment showed that leaf color and flowering were altered by gamma irradiation without changing the other characteristics of the plant. Propagation is true-to-type by separation of sucker and top cutting. The plant is recommended for use as landscaping material and as pot plant for indoor and outdoor use. The leaves may be harvested as cut foliage for Japanese flower arrangements. (author)

  6. The roles of the RIIβ linker and N-terminal cyclic nucleotide-binding domain in determining the unique structures of the type IIβ protein kinase A: a small angle x-ray and neutron scattering study.

    Science.gov (United States)

    Blumenthal, Donald K; Copps, Jeffrey; Smith-Nguyen, Eric V; Zhang, Ping; Heller, William T; Taylor, Susan S

    2014-10-10

    Protein kinase A (PKA) is ubiquitously expressed and is responsible for regulating many important cellular functions in response to changes in intracellular cAMP concentrations. The PKA holoenzyme is a tetramer (R2:C2), with a regulatory subunit homodimer (R2) that binds and inhibits two catalytic (C) subunits; binding of cAMP to the regulatory subunit homodimer causes activation of the catalytic subunits. Four different R subunit isoforms exist in mammalian cells, and these confer different structural features, subcellular localization, and biochemical properties upon the PKA holoenzymes they form. The holoenzyme containing RIIβ is structurally unique in that the type IIβ holoenzyme is much more compact than the free RIIβ homodimer. We have used small angle x-ray scattering and small angle neutron scattering to study the solution structure and subunit organization of a holoenzyme containing an RIIβ C-terminal deletion mutant (RIIβ(1-280)), which is missing the C-terminal cAMP-binding domain to better understand the structural organization of the type IIβ holoenzyme and the RIIβ domains that contribute to stabilizing the holoenzyme conformation. Our results demonstrate that compaction of the type IIβ holoenzyme does not require the C-terminal cAMP-binding domain but rather involves large structural rearrangements within the linker and N-terminal cyclic nucleotide-binding domain of the RIIβ homodimer. The structural rearrangements are significantly greater than seen previously with RIIα and are likely to be important in mediating short range and long range interdomain and intersubunit interactions that uniquely regulate the activity of the type IIβ isoform of PKA. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Activation of moesin, a protein that links actin cytoskeleton to the plasma membrane, occurs by phosphatidylinositol 4,5-bisphosphate (PIP2) binding sequentially to two sites and releasing an autoinhibitory linker.

    Science.gov (United States)

    Ben-Aissa, Khadija; Patino-Lopez, Genaro; Belkina, Natalya V; Maniti, Ofelia; Rosales, Tilman; Hao, Jian-Jiang; Kruhlak, Michael J; Knutson, Jay R; Picart, Catherine; Shaw, Stephen

    2012-05-11

    Many cellular processes depend on ERM (ezrin, moesin, and radixin) proteins mediating regulated linkage between plasma membrane and actin cytoskeleton. Although conformational activation of the ERM protein is mediated by the membrane PIP2, the known properties of the two described PIP2-binding sites do not explain activation. To elucidate the structural basis of possible mechanisms, we generated informative moesin mutations and tested three attributes: membrane localization of the expressed moesin, moesin binding to PIP2, and PIP2-induced release of moesin autoinhibition. The results demonstrate for the first time that the POCKET containing inositol 1,4,5-trisphosphate on crystal structure (the "POCKET" Lys-63, Lys-278 residues) mediates all three functions. Furthermore the second described PIP2-binding site (the "PATCH," Lys-253/Lys-254, Lys-262/Lys-263) is also essential for all three functions. In native autoinhibited ERM proteins, the POCKET is a cavity masked by an acidic linker, which we designate the "FLAP." Analysis of three mutant moesin constructs predicted to influence FLAP function demonstrated that the FLAP is a functional autoinhibitory region. Moreover, analysis of the cooperativity and stoichiometry demonstrate that the PATCH and POCKET do not bind PIP2 simultaneously. Based on our data and supporting published data, we propose a model of progressive activation of autoinhibited moesin by a single PIP2 molecule in the membrane. Initial transient binding of PIP2 to the PATCH initiates release of the FLAP, which enables transition of the same PIP2 molecule into the newly exposed POCKET where it binds stably and completes the conformational activation.

  8. Diagnostic performance of amyloid A protein quantification in fat tissue of patients with clinical AA amyloidosis

    NARCIS (Netherlands)

    Hazenberg, Bouke P. C.; Bijzet, Johannes; Limburg, Pieter C.; Skinner, Martha; Hawkins, Philip N.; Butrimiene, Irena; Livneh, Avi; Lesnyak, Olga; Nasonov, Evgeney L.; Filipowicz-Sosnowska, Anna; Guel, Ahmet; Merlini, Giampaolo; Wiland, Piotr; Oezdogan, Huri; Gorevic, Peter D.; Ben Maiz, Hedi; Benson, Merrill D.; Direskeneli, Haner; Kaarela, Kalevi; Garceau, Denis; Hauck, Wendy; van Rijswijk, Martin

    Objective. Amyloid A protein quantification in fat tissue is a new immunochemical method for detecting AA amyloidosis, a rare but serious disease. The objective was to assess diagnostic performance in clinical AA amyloidosis. Methods. Abdominal subcutaneous fat tissue of patients with AA amyloidosis

  9. Displaying Now-Understanding: The Finnish Change-of-State Token "aa"

    Science.gov (United States)

    Koivisto, Aino

    2015-01-01

    This article discusses the use of the Finnish change-of-state token "aa" that has previously not been identified. The central claim is that even though "aa" indicates a cognitive shift experienced by the speaker, it does not function as a receipt of new information. Instead, the token "aa" indicates that the speaker…

  10. An Analysis of the Rise and Fall of the AA-MAS Policy

    Science.gov (United States)

    Lazarus, Sheryl S.; Thurlow, Martha L.; Ysseldyke, James E.; Edwards, Lynn M.

    2015-01-01

    In 2005, to address concerns about students who might fall in the "gap" between the regular assessment and the alternate assessment based on alternate achievement standards (AA-AAS), the U.S. Department of Education announced that states could develop alternate assessments based on modified achievement standards (AA-MAS). This article…

  11. Isoleucine at position 150 of Cyt2Aa toxin from Bacillus thuringiensis plays an important role during membrane binding and oligomerization

    Directory of Open Access Journals (Sweden)

    Wanwarang Pathaichindachote

    2013-03-01

    Full Text Available Cyt2Aa2 is a mosquito larvicidal and cytolytic toxin producedby Bacillus thuringiensis subsp. darmstadiensis. The toxin becomesinactive when isoleucine at position 150 was replacedby alanine. To investigate the functional role of this position,Ile150 was substituted with Leu, Phe, Glu and Lys. All mutantproteins were produced at high level, solubilized in carbonatebuffer and yielded protease activated product similar to thoseof the wild type. Intrinsic fluorescence spectra analysis suggestedthat these mutants retain similar folding to the wildtype. However, mosquito larvicidal and hemolytic activitiesdramatically decreased for the I150K and were completelyabolished for I150A and I150F mutants. Membrane bindingand oligomerization assays demonstrated that only I150E andI150L could bind and form oligomers on lipid membrane similarto that of the wild type. Our results suggest that amino acidat position 150 plays an important role during membranebinding and oligomerization of Cyt2Aa2 toxin. [BMB Reports2013; 46(3: 175-180

  12. Recombination-deficient mutant of Streptococcus faecalis

    International Nuclear Information System (INIS)

    Yagi, Y.; Clewell, D.B.

    1980-01-01

    An ultraviolet radiation-sensitive derivative of Streptococcus faecalis strain JH2-2 was isolated and found to be deficient in recombination, using a plasmid-plasmid recombination system. The strain was sensitive to chemical agents which interact with deoxyribonucleic acid and also underwent deoxyribonucleic acid degradation after ultraviolet irradiation. Thus, the mutant has properties similar to those of recA strains of Escherichia coli

  13. Characterization of a Legionella micdadei mip mutant

    DEFF Research Database (Denmark)

    O'Connell, W A; Bangsborg, Jette Marie; Cianciotto, N P

    1995-01-01

    The pathogenesis of Legionella micdadei is dependent upon its ability to infect alveolar phagocytes. To better understand the basis of intracellular infection by this organism, we examined the importance of its Mip surface protein. In Legionella pneumophila, Mip promotes infection of both human m...... into the phagocyte. Similarly, the mutant was less able to parasitize Hartmannella amoebae. Taken together, these data argue that Mip specifically potentiates intracellular growth by L. micdadei....

  14. Radiation induced early maturing mutants in barley

    International Nuclear Information System (INIS)

    Kumar, R.; Chauhan, S.V.S.; Sharma, R.P.

    1978-01-01

    In M 2 generation, two early maturing plants were screened from a single spike progeny of a plant obtained from 20 kR of gamma-ray irradiation of a six-rowed barley (Hordeum vulgare L. var. Jyoti). Their true breeding nature was confirmed in M 3 generation. These mutants flower and mature 38 and 22 days earlier than those of control. (auth.)

  15. Selection of hyperadherent mutants in Pseudomonas putida biofilms

    DEFF Research Database (Denmark)

    Yousef-Coronado, Fatima; Soriano, María Isabel; Yang, Liang

    2011-01-01

    transposon Pseudomonas putida KT2440 mutants showing increased biofilm formation, and the detailed characterization of one of them. This mutant exhibits a complex phenotype, including altered colony morphology, increased production of extracellular polymeric substances and enhanced swarming motility, along...

  16. Multivariate analysis for selecting apple mutants

    International Nuclear Information System (INIS)

    Faedi, W.; Bagnara, G.L.; Rosati, P.; Cecchini, M.

    1992-01-01

    The mutlivariate analysis of four year records on several vegetative and productive traits of twenty-one apple mutants (3 of 'Jonathan', 3 of 'Ozark Gold', 14 of 'Mollie's Delicious', 1 of 'Neipling's Early Stayman)' induced by gamma radiations showed that observation of some traits of one-year-old shoots is the most efficient way to reveal compact growing apple mutants. In particular, basal cross-section area, total length and leaf area resulted the most appropriate parameters, while internode length together with conopy height and width are less appropriate. The most interesting mutants we found are: one of 'Mollie's Delicious for the best balance among tree and fruit traits and for high skin color; one of 'Neipling's Early Stayman' with an earlier and more extensively red colored apple than the original clone. (author)

  17. Probiotic features of Lactobacillus plantarum mutant strains.

    Science.gov (United States)

    Bove, Pasquale; Gallone, Anna; Russo, Pasquale; Capozzi, Vittorio; Albenzio, Marzia; Spano, Giuseppe; Fiocco, Daniela

    2012-10-01

    In this study, the probiotic potential of Lactobacillus plantarum wild-type and derivative mutant strains was investigated. Bacterial survival was evaluated in an in vitro system, simulating the transit along the human oro-gastro-intestinal tract. Interaction with human gut epithelial cells was studied by assessing bacterial adhesive ability to Caco-2 cells and induction of genes involved in innate immunity. L. plantarum strains were resistant to the combined stress at the various steps of the simulated gastrointestinal tract. Major decreases in the viability of L. plantarum cells were observed mainly under drastic acidic conditions (pH ≤ 2.0) of the gastric compartment. Abiotic stresses associated to small intestine poorly affected bacterial viability. All the bacterial strains significantly adhered to Caco-2 cells, with the ΔctsR mutant strain exhibiting the highest adhesion. Induction of immune-related genes resulted higher upon incubation with heat-inactivated bacteria rather than with live ones. For specific genes, a differential transcriptional pattern was observed upon stimulation with different L. plantarum strains, evidencing a possible role of the knocked out bacterial genes in the modulation of host cell response. In particular, cells from Δhsp18.55 and ΔftsH mutants strongly triggered immune defence genes. Our study highlights the relevance of microbial genetic background in host-probiotic interaction and might contribute to identify candidate bacterial genes and molecules involved in probiosis.

  18. Grain product of 34 soya mutant lines

    International Nuclear Information System (INIS)

    Salmeron E, J.; Mastache L, A. A.; Valencia E, F.; Diaz V, G. E.; Cervantes S, T.; De la Cruz T, E.; Garcia A, J. M.; Falcon B, T.; Gatica T, M. A.

    2009-01-01

    This work was development with the objective of obtaining information of the agronomic behavior of 34 soya mutant lines (R 4 M 18 ) for human consumption and this way to select the 2 better lines. The genetic materials were obtained starting from the variety ISAAEG-B M2 by means of the application of recurrent radiation with Co 60 gammas, to a dose of 350 Gray for the first two generations and both later to 200 Gray and selection during 17 cycles, being obtained the 34 better lines mutants with agronomic characteristic wanted and good flavor. The obtained results were that the mutant lines L 25 and L 32 produced the major quantity in branches/plant number with 7.5 and 7.25, pods/plant number with 171.25 and 167, grains/plant number with 350.89 and 333.07 and grain product (ton/ha) to 15% of humidity 5.15 and 4.68 ton/ha, respectively. (Author)

  19. Agrobacterium rhizogenes mutants that fail to bind to plant cells.

    OpenAIRE

    Crews, J L; Colby, S; Matthysse, A G

    1990-01-01

    Transposon insertion mutants of Agrobacterium rhizogenes were screened to obtain mutant bacteria that failed to bind to carrot suspension culture cells. A light microscope binding assay was used. The bacterial isolates that were reduced in binding to carrot cells were all avirulent on Bryophyllum diagremontiana leaves and on carrot root disks. The mutants did not appear to be altered in cellulose production. The composition of the medium affected the ability of the parent and mutant bacteria ...

  20. Differential disease resistance response in the barley necrotic mutant nec1

    Directory of Open Access Journals (Sweden)

    Kunga Laura

    2011-04-01

    Full Text Available Abstract Background Although ion fluxes are considered to be an integral part of signal transduction during responses to pathogens, only a few ion channels are known to participate in the plant response to infection. CNGC4 is a disease resistance-related cyclic nucleotide-gated ion channel. Arabidopsis thaliana CNGC4 mutants hlm1 and dnd2 display an impaired hypersensitive response (HR, retarded growth, a constitutively active salicylic acid (SA-mediated pathogenesis-related response and elevated resistance against bacterial pathogens. Barley CNGC4 shares 67% aa identity with AtCNGC4. The barley mutant nec1 comprising of a frame-shift mutation of CNGC4 displays a necrotic phenotype and constitutively over-expresses PR-1, yet it is not known what effect the nec1 mutation has on barley resistance against different types of pathogens. Results nec1 mutant accumulated high amount of SA and hydrogen peroxide compared to parental cv. Parkland. Experiments investigating nec1 disease resistance demonstrated positive effect of nec1 mutation on non-host resistance against Pseudomonas syringae pv. tomato (Pst at high inoculum density, whereas at normal Pst inoculum concentration nec1 resistance did not differ from wt. In contrast to augmented P. syringae resistance, penetration resistance against biotrophic fungus Blumeria graminis f. sp. hordei (Bgh, the causal agent of powdery mildew, was not altered in nec1. The nec1 mutant significantly over-expressed race non-specific Bgh resistance-related genes BI-1 and MLO. Induction of BI-1 and MLO suggested putative involvement of nec1 in race non-specific Bgh resistance, therefore the effect of nec1on mlo-5-mediated Bgh resistance was assessed. The nec1/mlo-5 double mutant was as resistant to Bgh as Nec1/mlo-5 plants, suggesting that nec1 did not impair mlo-5 race non-specific Bgh resistance. Conclusions Together, the results suggest that nec1 mutation alters activation of systemic acquired resistance

  1. Differential disease resistance response in the barley necrotic mutant nec1

    Science.gov (United States)

    2011-01-01

    Background Although ion fluxes are considered to be an integral part of signal transduction during responses to pathogens, only a few ion channels are known to participate in the plant response to infection. CNGC4 is a disease resistance-related cyclic nucleotide-gated ion channel. Arabidopsis thaliana CNGC4 mutants hlm1 and dnd2 display an impaired hypersensitive response (HR), retarded growth, a constitutively active salicylic acid (SA)-mediated pathogenesis-related response and elevated resistance against bacterial pathogens. Barley CNGC4 shares 67% aa identity with AtCNGC4. The barley mutant nec1 comprising of a frame-shift mutation of CNGC4 displays a necrotic phenotype and constitutively over-expresses PR-1, yet it is not known what effect the nec1 mutation has on barley resistance against different types of pathogens. Results nec1 mutant accumulated high amount of SA and hydrogen peroxide compared to parental cv. Parkland. Experiments investigating nec1 disease resistance demonstrated positive effect of nec1 mutation on non-host resistance against Pseudomonas syringae pv. tomato (Pst) at high inoculum density, whereas at normal Pst inoculum concentration nec1 resistance did not differ from wt. In contrast to augmented P. syringae resistance, penetration resistance against biotrophic fungus Blumeria graminis f. sp. hordei (Bgh), the causal agent of powdery mildew, was not altered in nec1. The nec1 mutant significantly over-expressed race non-specific Bgh resistance-related genes BI-1 and MLO. Induction of BI-1 and MLO suggested putative involvement of nec1 in race non-specific Bgh resistance, therefore the effect of nec1on mlo-5-mediated Bgh resistance was assessed. The nec1/mlo-5 double mutant was as resistant to Bgh as Nec1/mlo-5 plants, suggesting that nec1 did not impair mlo-5 race non-specific Bgh resistance. Conclusions Together, the results suggest that nec1 mutation alters activation of systemic acquired resistance-related physiological markers and

  2. Localization of aristolochic acid in mouse kidney tissues by immunohistochemistry using an anti-AA-I and AA-II monoclonal antibody.

    Science.gov (United States)

    Li, Xiao-Wei; Yokota, Sadaki; Wang, Dan; Wang, Xuan; Shoyama, Yukihiro; Cai, Shao-Qing

    2014-01-01

    Aristolochic acids (AAs) are found in herbal medicines of Aristolochiaceae plants, including Aristolochia and Asarum species. AAs are associated with a rapidly progressive interstitial nephritis, which is called aristolochic acid nephropathy (AAN). However, the in-situ localization of AAs in the target organ, the kidney, has not been investigated yet. In the present study, the accumulation of aristolochic acid I (AA-I) in mouse kidney was revealed by immunoperoxidase light microscopy as well as colloidal gold immunoelectron microscopy (IEM) based on an anti-AA-I and AA-II monoclonal antibody (mAb). Male BALB/c mice were treated with 1.25 or 2.50 mg kg(-1) of AA-I per day for 5 days. Paraffin sections and ultra-thin sections of kidney tissue were respectively prepared. Under light microscopy, the apical surface of proximal tubules was strongly stained for AA-I, whereas no obvious immunostaining was found in the distal tubules and glomerulus, which remained relatively intact. Under electron microscopy, epithelial cells of the proximal tubules, distal tubules and collecting tubules were broken to various degrees. Gold labeling in the proximal and distal tubules was stronger than that in the collecting tubules. In renal tubules, immunogold signals of AA-I tended to accumulate in the mitochondria and peroxisomes, though the signals could be observed all over the cell. Gold signals were also found in the erythrocytes of glomeruli. The MAb against AA-I and AA-II provides a clue for the identification of proteins or factors which might interact with AA-I and thus induce targeted damage of kidney.

  3. Evaluation of soybean mutants evolved from gamma irradiation

    International Nuclear Information System (INIS)

    Naseri Tafti, M.; Yousefi, F.; Rezazadeh, M.; Sabzi, H.; Ojani, R.

    2003-01-01

    Pure early soybean mutants evolved through mutagenesis (Co-60) from cultivar Clark irradiated with doses 100 Gy, 150 Gy and 250 Gy (absorbed dose) were evaluated for agronomic al traits and compared with two commercial cultivars; Clark and Williams in two regions, Karaj and Alishtar. Experimental design was conducted in a simple lattice (7 m x 7 m) with two replications. A significant statistical difference in yield existed at 1 and 5 percent level among mutants lines and between mutants - Williams and mutants - Clark, respectively in Karaj. The mutant line number 47 placed itself at the top of the list with yield of 4782 Kg/hect., followed by mutant line number 38 with 4722 Kg/hect. A number of mutant lines matured between 10 to 12 days earlier than the commercial soybean cultivars used as checks in the experiment. In Alishtar seed yield of mutant lines compared to the cultivar Williams showed a significant difference at 5% level. The highest seed yield of 3147 Kg/hect. belonged to the mutant line 47 which also matured two weeks earlier compared to the cultivar Clark. The compound analysis of seed yield in Karaj and Alishtar showed superiority of 15 mutant lines over the cultivar Clark and 36 mutant lines over the cultivar Williams. The mutant line number 18 producing seed yield of 3643 Kg/hect. ranks first in the list while, it matured earlier than both check cultivars, Clark and Williams

  4. Isolation and characterization of gallium resistant Pseudomonas aeruginosa mutants

    NARCIS (Netherlands)

    García-Contreras, R; Lira-Silva, E; Jasso-Chávez, R; Hernández-González, I.L.; Maeda, T.; Hashimoto, T.; Boogerd, F.C.; Sheng, L; Wood, TK; Moreno-Sánchez, R

    2013-01-01

    Pseudomonas aeruginosa PA14 cells resistant to the novel antimicrobial gallium nitrate (Ga) were developed using transposon mutagenesis and by selecting spontaneous mutants. The mutants showing the highest growth in the presence of Ga were selected for further characterization. These mutants showed

  5. Biological changes in Barley mutants resistant to powdery mildew disease

    International Nuclear Information System (INIS)

    Amer, I. M.; Fahim, M. M.; Moustafa, N. A.

    2012-12-01

    physiological studies showed that all kinds of chlorophyll (a), (b) and (a + b) content in infected plant were decreased while, the carotenes pigment were increased. Infection generally reduced total sugars content of all resistant mutants. Infected resistant mutant showed more phenols content and peroxidase, polyphenoloxidase activities than healthy ones of the mutants. (Author)

  6. Human GLTP and mutant forms of ACD11 suppress cell death in the Arabidopsis acd11 mutant

    DEFF Research Database (Denmark)

    Petersen, Nikolaj H T; McKinney, Lea V; Pike, Helen

    2008-01-01

    The Arabidopsis acd11 mutant exhibits runaway, programmed cell death due to the loss of a putative sphingosine transfer protein (ACD11) with homology to mammalian GLTP. We demonstrate that transgenic expression in Arabidopsis thaliana of human GLTP partially suppressed the phenotype of the acd11...... null mutant, resulting in delayed programmed cell death development and plant survival. Surprisingly, a GLTP mutant form impaired in glycolipid transfer activity also complemented the acd11 mutants. To understand the relationship between functional complementarity and transfer activity, we generated...... site-specific mutants in ACD11 based on homologous GLTP residues required for glycolipid transfer. We show that these ACD11 mutant forms are impaired in their in vitro transfer activity of sphingolipids. However, transgenic expression of these mutant forms fully complemented acd11 mutant cell death...

  7. Phosphonate self-assembled monolayers as organic linkers in solid-state quantum dot sensetized solar cells

    KAUST Repository

    Ardalan, Pendar

    2010-06-01

    We have employed X-ray photoelectron spectroscopy (XPS), ultraviolet-visible (UV-vis) spectroscopy, infrared (IR) spectroscopy, water contact angle (WCA) measurements, ellipsometry, and electrical measurements to study the effects of self-assembled monolayers (SAMs) with phosphonic acid headgroups on the bonding and performance of cadmium sulfide (CdS) solid-state quantum dot sensitized solar cells (QDSSCs). ∼2 to ∼6 nm size CdS quantum dots (QDs) were grown on the SAM-passivated TiO2 surfaces by successive ionic layer adsorption and reaction (SILAR). Our results show differences in the bonding of the CdS QDs at the TiO2 surfaces with a SAM linker. Moreover, our data indicate that presence of a SAM increases the CdS uptake on TiO2 as well as the performance of the resulting devices. Importantly, we observe ∼2 times higher power conversion efficiencies in the devices with a SAM compared to those that lack a SAM. © 2010 IEEE.

  8. Characterization of Two Monoclonal Antibodies That Recognize Linker Region and Carboxyl Terminal Domain of Coronavirus Nucleocapsid Protein.

    Science.gov (United States)

    Zhang, Xin; Zhao, Xin; Dong, Hui; Zhu, Yunnuan; Shi, Hongyan; Chen, Jianfei; Shi, Da; Feng, Li

    The transmissible gastroenteritis virus (TGEV) nucleocapsid (N) protein plays important roles in the replication and translation of viral RNA. The present study provides the first description of two monoclonal antibodies (mAbs) (5E8 and 3D7) directed against the TGEV N protein linker region (LKR) and carboxyl terminal domain (CTD). The mAbs 5E8 and 3D7 reacted with native N protein in western blotting and immunofluorescence assay (IFA). Two linear epitopes, 189SVEQAVLAALKKLG202 and 246VTRFYGARSSSA257, located in the LKR and CTD of TGEV N protein, respectively, were identified after truncating the protein and applying a peptide scanning technique. Using mAb 5E8, we observed that the N protein was expressed in the cytoplasm during TGEV replication and that the protein could be immunoprecipitated from TGEV-infected PK-15 cells. The mAb 5E8 can be applied for different approaches to diagnosis of TGEV infection. In addition, the antibodies represent useful tools for investigating the antigenic properties of the N protein.

  9. Characterization of Two Monoclonal Antibodies That Recognize Linker Region and Carboxyl Terminal Domain of Coronavirus Nucleocapsid Protein.

    Directory of Open Access Journals (Sweden)

    Xin Zhang

    Full Text Available The transmissible gastroenteritis virus (TGEV nucleocapsid (N protein plays important roles in the replication and translation of viral RNA. The present study provides the first description of two monoclonal antibodies (mAbs (5E8 and 3D7 directed against the TGEV N protein linker region (LKR and carboxyl terminal domain (CTD. The mAbs 5E8 and 3D7 reacted with native N protein in western blotting and immunofluorescence assay (IFA. Two linear epitopes, 189SVEQAVLAALKKLG202 and 246VTRFYGARSSSA257, located in the LKR and CTD of TGEV N protein, respectively, were identified after truncating the protein and applying a peptide scanning technique. Using mAb 5E8, we observed that the N protein was expressed in the cytoplasm during TGEV replication and that the protein could be immunoprecipitated from TGEV-infected PK-15 cells. The mAb 5E8 can be applied for different approaches to diagnosis of TGEV infection. In addition, the antibodies represent useful tools for investigating the antigenic properties of the N protein.

  10. Potent Bivalent Smac Mimetics: Effect of the Linker on Binding to Inhibitor of Apoptosis Proteins (IAPs) and Anticancer Activity

    Science.gov (United States)

    Sun, Haiying; Liu, Liu; Lu, Jianfeng; Bai, Longchuan; Li, Xiaoqin; Nikolovska-Coleska, Zaneta; McEachern, Donna; Yang, Chao-Yie; Qiu, Su; Yi, Han; Sun, Duxin; Wang, Shaomeng

    2011-01-01

    We have synthesized and evaluated a series of non-peptidic, bivalent Smac mimetics as antagonists of the inhibitor of apoptosis proteins and new anticancer agents. All these bivalent Smac mimetics bind to full-length XIAP with low nanomolar affinities and function as ultra-potent antagonists of XIAP. While these Smac mimetics bind to cIAP1/2 with similar low nanomolar affinities, their potencies to induce degradation of cIAP1/2 proteins in cells differ by more than 100-fold. The most potent bivalent Smac mimetics inhibit cell growth with IC50 values from 1–3 nM in the MDA-MB-231 breast cancer cell line and are 100-times more potent than the least potent compounds. Determination of intracellular concentrations for several representative compounds showed that the linkers in these bivalent Smac mimetics significantly affect their intracellular concentrations, hence the overall cellular activity. Compound 27 completely inhibits tumor growth in the MDA-MB-231 xenografts, while causing no signs of toxicity in the animals. PMID:21462933

  11. Biocompatible Porous Polyester-Ether Hydrogel Scaffolds with Cross-Linker Mediated Biodegradation and Mechanical Properties for Tissue Augmentation

    Directory of Open Access Journals (Sweden)

    Berkay Ozcelik

    2018-02-01

    Full Text Available Porous polyester-ether hydrogel scaffolds (PEHs were fabricated using acid chloride/alcohol chemistry and a salt templating approach. The PEHs were produced from readily available and cheap commercial reagents via the reaction of hydroxyl terminated poly(ethylene glycol (PEG derivatives with sebacoyl, succinyl, or trimesoyl chloride to afford ester cross-links between the PEG chains. Through variation of the acid chloride cross-linkers used in the synthesis and the incorporation of a hydrophobic modifier (poly(caprolactone (PCL, it was possible to tune the degradation rates and mechanical properties of the resulting hydrogels. Several of the hydrogel formulations displayed exceptional mechanical properties, remaining elastic without fracture at compressive strains of up to 80%, whilst still displaying degradation over a period of weeks to months. A subcutaneous rat model was used to study the scaffolds in vivo and revealed that the PEHs were infiltrated with well vascularised tissue within two weeks and had undergone significant degradation in 16 weeks without any signs of toxicity. Histological evaluation for immune responses revealed that the PEHs incite only a minor inflammatory response that is reduced over 16 weeks with no evidence of adverse effects.

  12. Mutations in linker for activation of T cells (LAT) lead to a novel form of severe combined immunodeficiency.

    Science.gov (United States)

    Bacchelli, Chiara; Moretti, Federico A; Carmo, Marlene; Adams, Stuart; Stanescu, Horia C; Pearce, Kerra; Madkaikar, Manisha; Gilmour, Kimberly C; Nicholas, Adeline K; Woods, C Geoffrey; Kleta, Robert; Beales, Phil L; Qasim, Waseem; Gaspar, H Bobby

    2017-02-01

    Signaling through the T-cell receptor (TCR) is critical for T-cell development and function. Linker for activation of T cells (LAT) is a transmembrane adaptor signaling molecule that is part of the TCR complex and essential for T-cell development, as demonstrated by LAT-deficient mice, which show a complete lack of peripheral T cells. We describe a pedigree affected by a severe combined immunodeficiency phenotype with absent T cells and normal B-cell and natural killer cell numbers. A novel homozygous frameshift mutation in the gene encoding for LAT was identified in this kindred. Genetic, molecular, and functional analyses were used to identify and characterize the LAT defect. Clinical and immunologic analysis of patients was also performed and reported. Homozygosity mapping was used to identify potential defective genes. Sanger sequencing of the LAT gene showed a mutation that resulted in a premature stop codon and protein truncation leading to complete loss of function and loss of expression of LAT in the affected family members. We also demonstrate loss of LAT expression and lack of TCR signaling restoration in LAT-deficient cell lines reconstituted with a synthetic LAT gene bearing this severe combined immunodeficiency mutation. For the first time, the results of this study show that inherited LAT deficiency should be considered in patients with combined immunodeficiency with T-cell abnormalities. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  13. The bacterial tubulin FtsZ requires its intrinsically disordered linker to direct robust cell wall construction.

    Science.gov (United States)

    Sundararajan, Kousik; Miguel, Amanda; Desmarais, Samantha M; Meier, Elizabeth L; Casey Huang, Kerwyn; Goley, Erin D

    2015-06-23

    The bacterial GTPase FtsZ forms a cytokinetic ring at midcell, recruits the division machinery and orchestrates membrane and peptidoglycan cell wall invagination. However, the mechanism for FtsZ regulation of peptidoglycan metabolism is unknown. The FtsZ GTPase domain is separated from its membrane-anchoring C-terminal conserved (CTC) peptide by a disordered C-terminal linker (CTL). Here we investigate CTL function in Caulobacter crescentus. Strikingly, production of FtsZ lacking the CTL (ΔCTL) is lethal: cells become filamentous, form envelope bulges and lyse, resembling treatment with β-lactam antibiotics. This phenotype is produced by FtsZ polymers bearing the CTC and a CTL shorter than 14 residues. Peptidoglycan synthesis still occurs downstream of ΔCTL; however, cells expressing ΔCTL exhibit reduced peptidoglycan crosslinking and longer glycan strands than wild type. Importantly, midcell proteins are still recruited to sites of ΔCTL assembly. We propose that FtsZ regulates peptidoglycan metabolism through a CTL-dependent mechanism that extends beyond simple protein recruitment.

  14. Structure and properties of Al-MIL-53-ADP, a breathing MOF based on the aliphatic linker molecule adipic acid.

    Science.gov (United States)

    Reinsch, Helge; Pillai, Renjith S; Siegel, Renée; Senker, Jürgen; Lieb, Alexandra; Maurin, Guillaume; Stock, Norbert

    2016-03-14

    The new aluminium based metal-organic framework [Al(OH)(O2C-C4H8-CO2)]·H2O denoted as Al-MIL-53-ADP-lp (lp stands for large pore) was synthesised under solvothermal conditions. This solid is an analogue of the archetypical aluminium terephthalate Al-MIL-53 based on the aliphatic single-chain linker molecule adipic acid (H2ADP, hexanedioic acid). In contrast to its aromatic counterparts, Al-MIL-53-ADP exhibits a structural breathing behaviour solely upon dehydration/rehydration. The crystal structure of the anhydrous compound denoted as Al-MIL-53-ADP-np (np stands for narrow pore) was determined by a combination of forcefield-based computations and Rietveld refinement of the powder X-ray diffraction data while the structure of the hydrated form Al-MIL-53-ADP-lp was derived computationally by a combination of force field based methods and Density Functional Theory calculations. Both structures were further supported by (1)H, (13)C and (27)Al high-resolution NMR MAS 1D data coupled again with simulations. Al-MIL-53-ADP was further characterised by means of vibrational spectroscopy, elemental analysis, thermogravimetry and water vapour sorption.

  15. Hsp70 oligomerization is mediated by an interaction between the interdomain linker and the substrate-binding domain.

    Directory of Open Access Journals (Sweden)

    Francesco A Aprile

    Full Text Available Oligomerization in the heat shock protein (Hsp 70 family has been extensively documented both in vitro and in vivo, although the mechanism, the identity of the specific protein regions involved and the physiological relevance of this process are still unclear. We have studied the oligomeric properties of a series of human Hsp70 variants by means of nanoelectrospray ionization mass spectrometry, optical spectroscopy and quantitative size exclusion chromatography. Our results show that Hsp70 oligomerization takes place through a specific interaction between the interdomain linker of one molecule and the substrate-binding domain of a different molecule, generating dimers and higher-order oligomers. We have found that substrate binding shifts the oligomerization equilibrium towards the accumulation of functional monomeric protein, probably by sequestering the helical lid sub-domain needed to stabilize the chaperone: substrate complex. Taken together, these findings suggest a possible role of chaperone oligomerization as a mechanism for regulating the availability of the active monomeric form of the chaperone and for the control of substrate binding and release.

  16. Demonstration of Improved Charge Transfer in Graphene/Au Nanorods Plasmonic Hybrids Stabilized by Benzyl Thiol Linkers

    Directory of Open Access Journals (Sweden)

    Giuseppe Valerio Bianco

    2016-01-01

    Full Text Available Hybrids based on graphene decorated with plasmonic gold (Au nanostructures are being investigated as possible materials combination to add to graphene functionalities of tunable plasmon resonance and enhanced absorption at selected wavelength in the visible-near-infrared region of the spectrum. Here, we report a solution drop-casting approach for fabricating stable hybrids based on chemical vapor deposition (CVD graphene and Au nanorods, which are able to activate effective charge transfer from graphene. We demonstrate that CVD graphene functionalization by benzyl thiol (BZT provides the linker to strong anchoring, via S-Au bonds, Au nanorods to graphene. Optical measurements by spectroscopic ellipsometry give evidence of the introduction of plasmon resonances at 1.85 and 2.25 eV in the Au nanorods/BZT/graphene hybrids, which enable surface enhanced Raman scattering (SERS detection. Furthermore, an effective electron transfer from graphene to Au nanorods, resulting in an enhancement of p-type doping of graphene with a consequent decrease of its sheet resistance, is probed by Raman spectroscopy and corroborated by electrical measurements.

  17. Synthesis of Cassava Waste Pulp-Acrylamide Super Absorbent: Effect of Initiator and Cross-Linker Concentration

    Directory of Open Access Journals (Sweden)

    Zainal Alim Mas’ud

    2013-05-01

    Full Text Available Cassava waste pulp (CWP contains high carbohydrates that can be modified into super absorbent polymer (SAP through grafting and cross-linking copolymerization. Acrylamide (AM was grafted onto CWP with ammonium persulfate (APS as the initiator and N,N'-methylene-bis-acrylamide (MBA as the cross-linker under atmospheric nitrogen. The effect of APS and MBA concentrations on water absorption capacity of saponified SAP was studied, while the evaluation of grafting ratio (GR and grafting efficiency (GRE was conducted on unsaponified SAP. The grafting success was indicated by the occurrence of IR peaks at wave numbers of 573, 765, 858, and 1667 cm-1. In the saponified SAP, the very intense characteristic band at 1562 cm-1 is due to C=O asymmetric stretching in the carboxylate anion. Saponification increases significantly water absorption capacity compared to that of unsaponified SAP (from 39.79 g/g to 578.23 g/g. The highest water absorption capacity is reached at 0.74% APS and 0.09% MBA. The percentage of GRE and GR tends to increase with increasing APS concentration until reaching the highest value and then decreases. Effect of MBA concentration on water absorption capacity, GR, and on GRE is similar to the effect of initiator concentration on GR and GRE.

  18. Optimization and characterization of biomolecule immobilization on silicon substrates using (3-aminopropyl)triethoxysilane (APTES) and glutaraldehyde linker

    Energy Technology Data Exchange (ETDEWEB)

    Gunda, Naga Siva Kumar [Department of Mechanical Engineering, University of Alberta, Edmonton, Canada T6G 2G8 (Canada); Singh, Minashree [Department of Pharmacy and Pharmaceutical Sciences, University of Alberta, Edmonton, Canada T6G 1C9 (Canada); Norman, Lana [Department of Chemical and Materials Engineering, University of Alberta, Edmonton, AB, Canada T6G 2V4 (Canada); Kaur, Kamaljit [Department of Pharmacy and Pharmaceutical Sciences, University of Alberta, Edmonton, Canada T6G 1C9 (Canada); Mitra, Sushanta K., E-mail: sushanta.mitra@ualberta.ca [Department of Mechanical Engineering, University of Alberta, Edmonton, Canada T6G 2G8 (Canada)

    2014-06-01

    In the present work, we developed and optimized a technique to produce a thin, stable silane layer on silicon substrate in a controlled environment using (3-aminopropyl)triethoxysilane (APTES). The effect of APTES concentration and silanization time on the formation of silane layer is studied using spectroscopic ellipsometry and Fourier transform infrared spectroscopy (FTIR). Biomolecules of interest are immobilized on optimized silane layer formed silicon substrates using glutaraldehyde linker. Surface analytical techniques such as ellipsometry, FTIR, contact angle measurement system, and atomic force microscopy are employed to characterize the bio-chemically modified silicon surfaces at each step of the biomolecule immobilization process. It is observed that a uniform, homogenous and highly dense layer of biomolecules are immobilized with optimized silane layer on the silicon substrate. The developed immobilization method is successfully implemented on different silicon substrates (flat and pillar). Also, different types of biomolecules such as anti-human IgG (rabbit monoclonal to human IgG), Listeria monocytogenes, myoglobin and dengue capture antibodies were successfully immobilized. Further, standard sandwich immunoassay (antibody–antigen–antibody) is employed on respective capture antibody coated silicon substrates. Fluorescence microscopy is used to detect the respective FITC tagged detection antibodies bound to the surface after immunoassay.

  19. Linker-free 3D assembly of nanocrystals with tunable unit size for reversible lithium ion storage

    Energy Technology Data Exchange (ETDEWEB)

    Deng, Da; Lee, Jim Yang, E-mail: cheleejy@nus.edu.sg [Department of Chemical and Biomolecular Engineering, Faculty of Engineering, National University of Singapore, 10 Kent Ridge Crescent, 119260 (Singapore)

    2011-09-02

    A simple and scalable procedure combining hydrothermal synthesis with post-synthesis calcination was developed to produce a linker-free, thermally stable, mesoscale 3D ordered assembly of spinel-type ZnCo{sub 2}O{sub 4} nanocrystals. The mesoscale assembly with distinctively sharp edges was formed by close-packing the ZnCo{sub 2}O{sub 4} nanocrystal building blocks with a unit size changeable by the synthesis temperature. A self-templating mechanism based on the topotactic transformation of an oxalato-bridged precursor coordination compound was proposed for the assembly. The packaging of crystalline ZnCo{sub 2}O{sub 4} nanoparticles, an active lithium ion storage compound, into a dense organized structure is an effective way to increase the volumetric capacity of ZnCo{sub 2}O{sub 4} nanoparticles for reversible lithium ion storage. The highly ordered 3D assembly of ZnCo{sub 2}O{sub 4} demonstrated excellent reversible lithium ion storage properties and a specific capacity ({approx}800 mAh g{sup -1}) much higher than that of carbon (typically {approx} 350 mAh g{sup -1}).

  20. NIR-Cyanine Dye Linker: a Promising Candidate for Isochronic Fluorescence Imaging in Molecular Cancer Diagnostics and Therapy Monitoring.

    Science.gov (United States)

    Komljenovic, Dorde; Wiessler, Manfred; Waldeck, Waldemar; Ehemann, Volker; Pipkorn, Ruediger; Schrenk, Hans-Hermann; Debus, Jürgen; Braun, Klaus

    2016-01-01

    Personalized anti-cancer medicine is boosted by the recent development of molecular diagnostics and molecularly targeted drugs requiring rapid and efficient ligation routes. Here, we present a novel approach to synthetize a conjugate able to act simultaneously as an imaging and as a chemotherapeutic agent by coupling functional peptides employing solid phase peptide synthesis technologies. Development and the first synthesis of a fluorescent dye with similarity in the polymethine part of the Cy7 molecule whose indolenine-N residues were substituted with a propylene linker are described. Methylating agent temozolomide is functionalized with a tetrazine as a diene component whereas Cy7-cell penetrating peptide conjugate acts as a dienophilic reaction partner for the inverse Diels-Alder click chemistry-mediated ligation route yielding a theranostic conjugate, 3-mercapto-propionic-cyclohexenyl-Cy7-bis-temozolomide-bromide-cell penetrating peptide. Synthesis route described here may facilitate targeted delivery of the therapeutic compound to achieve sufficient local concentrations at the target site or tissue. Its versatility allows a choice of adequate imaging tags applicable in e.g. PET, SPECT, CT, near-infrared imaging, and therapeutic substances including cytotoxic agents. Imaging tags and therapeutics may be simultaneously bound to the conjugate applying click chemistry. Theranostic compound presented here offers a solid basis for a further improvement of cancer management in a precise, patient-specific manner.

  1. Production of Chymotrypsin-Resistant Bacillus thuringiensis Cry2Aa1 δ-Endotoxin by Protein Engineering

    Science.gov (United States)

    Audtho, Mongkon; Valaitis, Algimantas P.; Alzate, Oscar; Dean, Donald H.

    1999-01-01

    Cleavage of the Cry2Aa1 protoxin (molecular mass, 63 kDa) from Bacillus thuringiensis by midgut juice of gypsy moth (Lymantria dispar) larvae resulted in two major protein fragments: a 58-kDa fragment which was highly toxic to the insect and a 49-kDa fragment which was not toxic. In the midgut juice, the protoxin was processed into a 58-kDa toxin within 1 min, but after digestion for 1 h, the 58-kDa fragment was further cleaved within domain I, resulting in the protease-resistant 49-kDa fragment. Both the 58-kDa and nontoxic 49-kDa fragments were also found in vivo when 125I-labeled toxin was fed to the insects. N-terminal sequencing revealed that the protease cleavage sites are at the C termini of Tyr49 and Leu144 for the active fragment and the smaller fragment, respectively. To prevent the production of the nontoxic fragment during midgut processing, five mutant proteins were constructed by replacing Leu144 of the toxin with Asp (L144D), Ala (L144A), Gly (L144G), His (L144H), or Val (L144V) by using a pair of complementary mutagenic oligonucleotides in PCR. All of the mutant proteins were highly resistant to the midgut proteases and chymotrypsin. Digestion of the mutant proteins by insect midgut extract and chymotrypsin produced only the active 58-kDa fragment, except that L144H was partially cleaved at residue 144. PMID:10508095

  2. Production of chymotrypsin-resistant Bacillus thuringiensis Cry2Aa1 delta-endotoxin by protein engineering.

    Science.gov (United States)

    Audtho, M; Valaitis, A P; Alzate, O; Dean, D H

    1999-10-01

    Cleavage of the Cry2Aa1 protoxin (molecular mass, 63 kDa) from Bacillus thuringiensis by midgut juice of gypsy moth (Lymantria dispar) larvae resulted in two major protein fragments: a 58-kDa fragment which was highly toxic to the insect and a 49-kDa fragment which was not toxic. In the midgut juice, the protoxin was processed into a 58-kDa toxin within 1 min, but after digestion for 1 h, the 58-kDa fragment was further cleaved within domain I, resulting in the protease-resistant 49-kDa fragment. Both the 58-kDa and nontoxic 49-kDa fragments were also found in vivo when (125)I-labeled toxin was fed to the insects. N-terminal sequencing revealed that the protease cleavage sites are at the C termini of Tyr49 and Leu144 for the active fragment and the smaller fragment, respectively. To prevent the production of the nontoxic fragment during midgut processing, five mutant proteins were constructed by replacing Leu144 of the toxin with Asp (L144D), Ala (L144A), Gly (L144G), His (L144H), or Val (L144V) by using a pair of complementary mutagenic oligonucleotides in PCR. All of the mutant proteins were highly resistant to the midgut proteases and chymotrypsin. Digestion of the mutant proteins by insect midgut extract and chymotrypsin produced only the active 58-kDa fragment, except that L144H was partially cleaved at residue 144.

  3. Natural Aging Behaviour Of AA6111 Aluminium | Quainoo | Ghana ...

    African Journals Online (AJOL)

    Natural aging is observed to affect the kinetic reaction of AA6111. Dans la campagne continue pour la réduction en poids dans le nouveau modèle d\\' automobile, les séries 6000 d\\' aluminium en alliage ont émergé comme le matériau de feuille de carrosserie la plus prometteuse endurcirable avec l\\'âge dans l\\'industrie de ...

  4. Evolutionary status of AA Doradus: still an enigma?

    International Nuclear Information System (INIS)

    Sarna, M.J.

    1985-01-01

    The evolutionary scenarios for AA Dor are reconsidered using new contraction times for degenerate red dwarfs. It is found that both types of models considered by Paczynski (1980) with the primary being either an hydrogen shell burning helium white dwarf or a double shell burning carbon-oxygen white dwarf are consistent with the available data. The second model requires a very narrow range of the initial parameters of the binary system. 26 refs. (author)

  5. Mexican obsidian samples analysed by PIXE and AAS

    Energy Technology Data Exchange (ETDEWEB)

    Tenorio, D.; Jimenez-Reyes, M. [Inst. Nacional de Investigaciones Nucleares, Mexico (Mexico); Lagarde, G.

    1997-12-31

    Proton induced X-ray emission analysis results are reported for obsidian artifacts from different sites of the State of Mexico: Teotenango, Calixtlahuaca, La Marqueza, Malinalco and Tonatico. Twenty elements were analysed by PIXE and some of them were verified by AAS. The results show that the samples came from three different sources: Teotenango and Calixtlahuaca samples from the first, La Marqueza and Malinalco samples from the second and Tonatico samples from the third. (author)

  6. Wooden models of an AA quadrupole between bending magnets

    CERN Multimedia

    CERN PhotoLab

    1978-01-01

    At two points in the AA lattice, a quadrupole (QDN, defocusing, narrow) was tightly wedged between two bending magnets (BST, short, wide). This picture of wooden models lets one imagine the strong interaction between their magnetic fields. There was no way one could calculate with the necessary accuracy the magnetic effects and their consequences for the machine optics. The necessary corrections were made after measurements with a circulating beam, in a tedious iterative procedure, with corrrection coils and shims.

  7. Core-corona PSt/P(BA-AA) composite particles by two-stage emulsion polymerization

    Science.gov (United States)

    Xie, Delong; Ren, Xiaolin; Zhang, Xinya; Liao, Shijun

    2016-03-01

    Raspberry-shaped composite particles with polystyrene (PSt) as core and poly(n-butyl acrylate-co-acrylic acid) (P(BA-AA)) as corona were synthesized via emulsion polymerization. The random copolymer, P(BA-AA), was pre-prepared and used as a polymeric surfactant, its emulsifying properties adjusted by changing the mass ratio of BA and AA. The morphology of the resulting core-corona composite particles, P(St/P(BA-AA)), could be regulated and controlled by varying the concentrations of P(BA-AA) or the mass ratio of BA:AA in P(BA-AA). The experimental results indicate that 3.0-6.0 wt% of P(BA-AA) is required to obtain stable composite emulsions, and P(BA-AA) with a mass ratio of BA:AA = 1:2 is able to generate distinct core-corona structures. A mechanism of composite particle formation is proposed based on the high affinity between the PSt core and the hydrophobic segments of P(BA-A). The regular morphology of the colloidal film is expected to facilitate potential application of core-corona particles in the field of light scattering. Furthermore, the diversity of core-corona particles can be expanded by replacing P(BA-AA) corona particles with other amphiphilic particles.

  8. New perspectives on contributing factors to the monthly behavior of the aa geomagnetic index

    Science.gov (United States)

    Mendoza, Blanca; Pazos, Marni; González, Luis Xavier

    2016-12-01

    We studied the Aa geomagnetic index ( aa index daily average) behavior on a monthly timescale using data from 1868 to 2015 for cycles 11-24. We identified solar- and lunar-associated periodicities in the Aa time series and found statistically significant Aa minima values a few days before the full Moon and high Aa values during the new Moon. When considering all the cycles, it was clear that the deepest Aa minima occurred during the Aa descending activity phase. However, when the cycles were separated according to the direction of the interplanetary magnetic field (IMF), the Aa minima came from the contribution of cycles with the IMF pointing toward the Sun (Type 1). Furthermore, during the descending phase of cycles with the IMF pointing away from the Sun (Type 2), the smallest Aa index values were found along with smaller changes compared to Type 1 cases. This behavior implies that during Type 1 cycles there are larger Aa perturbations than during Type 2 cycles. It is very likely that the mechanisms responsible for the Aa monthly behavior are a combination of solar and lunar effects that depend on several factors: (a) the Moon phases (new and full Moon), (b) the phase of the solar cycle (ascending or descending), and (c) the direction of the interplanetary magnetic field (away or toward the Sun).

  9. High yielding mutants of blackgram variety 'PH-25'

    International Nuclear Information System (INIS)

    Misra, R.C.; Mohapatra, B.D.; Panda, B.S.

    2001-01-01

    Seeds of blackgram (Vigna mungo L.) variety 'PH-5' were treated with chemical mutagens ethyl methanesulfonate (EMS), nitrosoguanidine (NG), maleic hydrazide (MH) and sodium azide (NaN 3 ), each at 3 different concentrations. Thirty six mutant lines developed from mutagenic treatments along with parent varieties were tested in M 4 generation. The mutants showed wide variation in most of the traits and multivariante D 2 analysis showed genetic divergence among themselves. Twenty of the thirty mutants showed genetic divergence from parent. Ten selected high yielding mutants were tested in M 5 . Yield and other productive traits of five high yielding mutants in M 4 and M 5 are presented

  10. Corrosion of AA2024-T3 Part III: Propagation

    International Nuclear Information System (INIS)

    Glenn, A.M.; Muster, T.H.; Luo, C.; Zhou, X.; Thompson, G.E.; Boag, A.; Hughes, A.E.

    2011-01-01

    Research highlights: → Corrosion of AA2024 in 0.1 M NaCl was examined for immersion times up to 120 min. → Rings of corrosion product with H 2 evolution developed after 5 min immersion. → Intergranular attack penetrated up to 60 μm below the rings within 120 min. → After 240 min mixed intergranular attack and grain etchout were observed. - Abstract: Optical and electron microscopies and EBSD were used to study the early stages of corrosion propagation during stable pit formation on AA2024-T3. Polished AA2024-T3 developed large scale rings of corrosion product, typically a few hundred microns in diameter, within 2 h of exposure to 0.1 M NaCl at room temperature. These features were sectioned using diamond ultramicrotomy and substantial subsurface attack, in the form of intergranular corrosion was observed beneath these sites with virtually no grain etchout. A model is proposed for the mechanism of stable pit progression which involves extensive grain boundary attack, followed by grain etchout leading to open pit formation.

  11. Renal Involvement in AA Amyloidosis: Clinical Outcomes and Survival

    Directory of Open Access Journals (Sweden)

    Murvet Yilmaz

    2013-03-01

    Full Text Available Background: The natural history of AA amyloidosis is typically progressive, leading to multiple organ failure and death. We analyzed the etiology as well as clinical and laboratory features of patients with biopsy-proven AA amyloidosis and evaluated the ultimate outcome. Methods: Seventy-three patients (24 female; mean age 41.85±15.89 years were analyzed retrospectively. Demographic, clinical and laboratory features were studied and the outcome was assessed. Results: Familial Mediterranean Fever and tuberculosis were the most frequent causes of amyloidosis. Mean serum creatinine and proteinuria at diagnosis were 4.65±4.89 mg/dl and 8.04±6.09 g/day, respectively; and stage I, II, III, IV and V renal disease were present in 19.2%, 13.7%, 16.4%, 11%, and 39.7% of the patients, respectively. ESRD developed in 16 patients during the follow-up period. All of the ESRD patients started a dialysis programme. Thirty patients (41% died during the follow-up period; median patient survival was 35.9±6.12 months. Old age, tuberculosis etiology, advanced renal disease and low serum albumin levels were associated with a worse prognosis. Serum albumin was a predictor of mortality in logistic regression analysis. Conclusion: The ultimate outcome of the patients with AA amyloidosis is poor, possibly due to the late referral to the nephrology clinics. Early referral may be helpful to improve prognosis.

  12. Characterizing the Constitutive Properties of AA7075 for Hot Forming

    Science.gov (United States)

    Omer, K.; Kim, S.; Butcher, C.; Worswick, M.

    2017-09-01

    The work presented herein investigates the constitutive properties of AA7075 as it undergoes a hot stamping/die quenching process. Tensile specimens were solutionized inside a heated furnace set to 470°C. Once solutionized, the samples were quenched to an intermediate temperature using a vortex air chiller at a minimum rate of 52°C/s. Tensile tests were conducted at steady state temperatures of 470, 400, 300, 200, 115 and 25°C. This solutionizing and subsequent quenching process replicated the temperature cycle and quench rates representative of a die quenching operation. The results of the tensile test were analyzed with digital imaging correlation using an area reduction approach. The area reduction approach approximated the cross-sectional area of the tensile specimen as it necked. The approach allowed for the true stress-strain response to be calculated well past the initial necking point. The resulting true stress-strain curves showed that the AA7075 samples experienced almost no hardening at 470°C. As steady state temperature decreased, the rate of hardening as well as overall material strength increased. The true stress strain curves were fit to a modified version of the extended Voce constitutive model. The resulting fits can be used in a finite element model to predict the behaviour of an AA7075 blank during a die quenching operation.

  13. Long-term biases in geomagnetic K and aa indices

    Science.gov (United States)

    Love, J.J.

    2011-01-01

    Analysis is made of the geomagnetic-activity aa index and its source K-index data from groups of ground-based observatories in Britain, and Australia, 1868.0-2009.0, solar cycles 11-23. The K data show persistent biases, especially for high (low) K-activity levels at British (Australian) observatories. From examination of multiple subsets of the K data we infer that the biases are not predominantly the result of changes in observatory location, localized induced magnetotelluric currents, changes in magnetometer technology, or the modernization of K-value estimation methods. Instead, the biases appear to be artifacts of the latitude-dependent scaling used to assign K values to particular local levels of geomagnetic activity. The biases are not effectively removed by weighting factors used to estimate aa. We show that long-term averages of the aa index, such as annual averages, are dominated by medium-level geomagnetic activity levels having K values of 3 and 4. ?? 2011 Author(s).

  14. Effects of Friction Stir Welding Speed on AA2195 alloy

    Directory of Open Access Journals (Sweden)

    Lee Ho-Sung

    2016-01-01

    Full Text Available The application of friction stir welding (FSW to aerospace has grown rapidly due to the high efficiency and environmental friendly nature of the process. FSW is achieved by plastic flow of frictionally heated material in solid state and offers many advantages of avoiding hot cracking and limiting component distortion. Recently low density, high modulus and high strength AA2195 are used as substitute for conventional aluminum alloys since the weight saving is critical in aerospace applications. One of the problems for this alloy is weld metal porosity formation leading to hot cracking. Combination of FSW and AA2195 provides synergy effect to improve mechanical properties and weight saving of aerospace structure such as cryogenic fuel tanks for launch systems. The objective of this paper is to investigate the effect of friction stir welding speed on mechanical and microstructural properties of AA2195. The friction stir welded materials were joined with four different tool rotation speeds (350~800 rpm and five welding speeds (120~360 mm/min, which are the two prime welding parameters in this process.

  15. Cell volume regulation in hemoglobin CC and AA erythrocytes

    International Nuclear Information System (INIS)

    Berkowitz, L.R.; Orringer, E.P.

    1987-01-01

    Swelling hemoglobin CC erythrocytes stimulates a ouabain-insensitive K flux that restores original cell volume. Studies were performed with the K analog, 86 Rb. This volume regulatory pathway was characterized for its anion dependence, sensitivity to loop diuretics, and requirement for Na. The swelling-induced K flux was eliminated if intracellular chloride was replaced by nitrate and both swelling-activated K influx and efflux were partially inhibited by 1 mM furosemide or bumetanide. K influx in swollen hemoglobin CC cells was not diminished when Na in the incubation medium was replaced with choline, indicating Na independence of the swelling-induced flux. Identical experiments with hemoglobin AA cells also demonstrated a swelling-induced increase in K flux, but the magnitude and duration of this increase were considerably less than that seen with hemoglobin CC cells. The increased K flux in hemoglobin AA cells was likewise sensitive to anion replacement and to loop diuretics and did not require the presence of Na. These data indicate that a volume-activated K pathway with similar transport characteristics exists in both hemoglobin CC and AA red cells

  16. Calculated photo-isomerization efficiencies of functionalized azobenzene derivatives in solar energy materials: azo-functional organic linkers for porous coordinated polymers

    Science.gov (United States)

    Neukirch, Amanda J.; Park, Jinhee; Zobac, Vladmir; Wang, Hong; Jelinek, Pavel; Prezhdo, Oleg V.; Zhou, Hong-Cai; Lewis, James P.

    2015-04-01

    Recently, we used a local orbital density functional theory code called FIREBALL, to study the photoisomerization process in azobenzene derivatives for solar energy materials. Azobenzene functional groups undergo photoisomerization upon light irradiation or application of heat. Zhou et al (2012 J. Am. Chem. Soc. 134 99-102) showed that these azobenzenes can then be introduced into metal-organic frameworks via an organic linker in order to create a reversible switch for CO2 adsorption. In this manuscript, we examined how the addition of organic linkers (isophthalic acid) changes the relaxation times, isomerization mechanism, and quantum yield for both the cis↔trans pathways. We then tuned these properties by substituting functional groups, finding an increase in quantum yield as well as improved optical properties.

  17. Tuning the Hydrolytic Stability of Next Generation Maleimide Cross-Linkers Enables Access to Albumin-Antibody Fragment Conjugates and tri-scFvs.

    Science.gov (United States)

    Forte, Nafsika; Livanos, Maria; Miranda, Enrique; Morais, Maurício; Yang, Xiaoping; Rajkumar, Vineeth S; Chester, Kerry A; Chudasama, Vijay; Baker, James R

    2018-02-21

    We describe investigations to expand the scope of next generation maleimide cross-linkers for the construction of homogeneous protein-protein conjugates. Diiodomaleimides are shown to offer the ideal properties of rapid bioconjugation with reduced hydrolysis, allowing the cross-linking of even sterically hindered systems. The optimized linkers are exploited to link human serum albumin to antibody fragments (Fab or scFv) as a prospective half-life extension platform, with retention of antigen binding and robust serum stability. Finally, a triprotein conjugate is formed, by linking scFv antibody fragments targeting carcinoembryonic antigen. This tri-scFv is shown to infer a combination of greater antigen avidity and increased in vivo half-life, representing a promising platform for antibody therapeutic development.

  18. Modulation of domain-domain interaction and protein function by a charged linker: a case study of mycobacteriophage D29 endolysin.

    Science.gov (United States)

    Pohane, Amol Arunrao; Patidar, Neelam Devidas; Jain, Vikas

    2015-03-12

    Phage-encoded cell wall peptidoglycan hydrolyzing enzymes, called endolysins, are essential for efficient release of virions from bacteria, and show species-specific killing of the host. We have demonstrated previously that the interaction between N-terminal catalytic and C-terminal cell wall binding domains of mycobacteriophage D29 endolysin makes the enzyme inactive in Escherichiacoli. Here, we demonstrate that such interaction occurs intramolecularly and is facilitated by a charged linker that connects the two domains. We also show that linker composition is crucial for the inactivation of PG hydrolase in E. coli. Such knowledge will immensely help in bioengineering of endolysins with narrow or broad spectrum antimicrobial activity. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  19. The Influence of the Linker Geometry in Bis(3-hydroxy-N-methyl-pyridin-2-one) Ligands on Solution-Phase Uranyl Affinity

    Energy Technology Data Exchange (ETDEWEB)

    Szigethy, Geza; Raymond, Kenneth

    2010-08-12

    Seven water-soluble, tetradentate bis(3-hydroxy-N-methyl-pyridin-2-one) (bis-Me-3,2-HOPO) ligands were synthesized that vary only in linker geometry and rigidity. Solution phase thermodynamic measurements were conducted between pH 1.6 and pH 9.0 to determine the effects of these variations on proton and uranyl cation affinity. Proton affinity decreases by introduction of the solubilizing triethylene glycol group as compared to un-substituted reference ligands. Uranyl affinity was found to follow no discernable trends with incremental geometric modification. The butyl-linked 4Li-Me-3,2-HOPO ligand exhibited the highest uranyl affinity, consistent with prior in vivo decorporation results. Of the rigidly-linked ligands, the o-phenylene linker imparted the best uranyl affinity to the bis-Me-3,2-HOPO ligand platform.

  20. Influence of the single-strand linker composition on the structural/dynamical properties of a truncated octahedral DNA nano-cage family.

    Science.gov (United States)

    Iacovelli, Federico; Alves, Cassio; Falconi, Mattia; Oteri, Francesco; de Oliveira, Cristiano L P; Desideri, Alessandro

    2014-10-01

    The structural/dynamical properties of three truncated octahedral DNA nano-cages composed by identical double helices but single strand linkers with different composition, namely 7 thymidines, 7 adenines, and 7 alternated thymidines and adenines, have been investigated through classical molecular dynamics simulations. Trajectories have been analyzed to investigate the role of the linkers in defining nano-cages stability and flexibility, including possible influence on the internal cages motions. The data indicate that the cages behavior is almost identical and that the structural/dynamical parameters measured along the trajectories are not particularly affected by the presence of different bases. These results demonstrate that the constraints imposed by the nano-structure geometry are the main factor in modulating these properties

  1. Effect of Redox “Non-Innocent” Linker on the Catalytic Activity of Copper-Catecholate-Decorated Metal–Organic Frameworks

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xuan [Department of Chemistry, Northwestern University, 2145 Sheridan Road, Evanston, Illinois 60208, United States; Vermeulen, Nicolaas A. [Department of Chemistry, Northwestern University, 2145 Sheridan Road, Evanston, Illinois 60208, United States; Huang, Zhiyuan [Chemical Sciences & amp, Engineering Division, Argonne National Laboratory, Argonne, Illinois 60439, United States; Cui, Yuexing [Department of Chemistry, Northwestern University, 2145 Sheridan Road, Evanston, Illinois 60208, United States; Liu, Jian [Department of Chemistry, Northwestern University, 2145 Sheridan Road, Evanston, Illinois 60208, United States; Krzyaniak, Matthew D. [Department of Chemistry, Northwestern University, 2145 Sheridan Road, Evanston, Illinois 60208, United States; Li, Zhanyong [Department of Chemistry, Northwestern University, 2145 Sheridan Road, Evanston, Illinois 60208, United States; Noh, Hyunho [Department of Chemistry, Northwestern University, 2145 Sheridan Road, Evanston, Illinois 60208, United States; Wasielewski, Michael R. [Department of Chemistry, Northwestern University, 2145 Sheridan Road, Evanston, Illinois 60208, United States; Delferro, Massimiliano [Chemical Sciences & amp, Engineering Division, Argonne National Laboratory, Argonne, Illinois 60439, United States; Farha, Omar K. [Department of Chemistry, Northwestern University, 2145 Sheridan Road, Evanston, Illinois 60208, United States; Department of Chemical and Biological Engineering, Northwestern University, 2145 Sheridan Road, Evanston, Illinois 60208, United States; Department of Chemistry, Faculty of Science, King Abdulaziz University, Jeddah 21589, Saudi Arabia

    2017-12-19

    Two new UiO-68 type of Zr-MOFs featuring redox non-innocent catechol-based linkers of different redox activities have been synthesized through a de novo mixed-linker strategy. Metalation of the MOFs with Cu(II) precursors triggers the reduction of Cu(II) by the phenyl-catechol groups to Cu(I) with the concomitant formation of semiquinone radicals as evidenced by EPR and XPS characterization. The MOF-supported catalysts are selective toward the allylic oxidation of cyclohexene and it is found that the presence of in situ-generated Cu(I) species exhibits enhanced catalytic activity as compared to a similar MOF with Cu(II) metalated naphthalenyl-dihydroxy groups. This work unveils the importance of metal-support redox interactions in the catalytic activity of MOF-supported catalysts which are not easily accessible in traditional metal oxide supports.

  2. Using of AFLP to evaluate gamma-irradiated amaranth mutants

    Directory of Open Access Journals (Sweden)

    Labajová Mária

    2013-01-01

    Full Text Available To determine which of several gamma-irradiated mutants of amaranth Ficha cultivar and K-433 hybrid are most genetically similar to their non-irradiated control genotypes, we performed amplified fragment length polymorphism (AFLP based analysis. A total of 40 selective primer combinations were used in reported analyses. First analyses of gamma-irradiated amaranth mutant lines were done used the AFLP. In the study, primers with the differentiation ability for all analysed mutant lines are reported. The very specific changes in the mutant lines´ non-coding regions based on AFLP length polymorphism were analysed. Mutant lines of the Ficha cultivar (C15, C26, C27, C82, C236 shared a genetic dissimilarity of 0,11 and their ISSR profiles are more similar to the Ficha than those of K-433 hybrid mutant lines. The K-433 mutant lines (D54, D279, D282 shared genetic dissimilarity of 0,534 but are more distinct to their control plant as a whole, as those of the Ficha mutant lines. Different AFLP fingerprints patters of the mutant lines when compared to the Ficha cultivar and K-433 hybrid AFLP profiles may be a consequence of the complex response of the intergenic space of mutant lines to the gamma-radiance. Although a genetic polymorphism was detected within accessions, the AFLP markers successfully identified all the accessions. The AFLP results are discussed by a combination of biochemical characteristics of mutant lines and their control genotypes.

  3. Distribution of soluble amino acids in maize endosperm mutants

    Directory of Open Access Journals (Sweden)

    Toro Alejandro Alberto

    2003-01-01

    Full Text Available For human nutrition the main source of vegetable proteins are cereal and legume seeds. The content of total soluble amino acids in mature endosperm of wild-type, opaque and floury maize (Zea mays L. mutants were determined by HPLC. The total absolute concentration of soluble amino acids among the mutants varied depending on the mutant. The o11 and o13 mutants exhibited the highest average content, whereas o10, fl3 and fl1 exhibited the lowest average content. In general, the mutants exhibited similar concentrations of total soluble amino acids when compared to the wild-type lines, with the clear exception of mutants o11 and fl1, with the o11 mutant exhibiting a higher concentration of total soluble amino acids when compared to its wild-type counterpart W22 and the fl1 mutant a lower concentration when compared to its wild-type counterpart Oh43. For methionine, the mutants o2 and o11 and wild-type Oh43 exhibited the highest concentrations of this amino acid. Significant differences were not observed between mutants for other amino acids such as lysine and threonine. The high lysine concentrations obtained originally for these mutants may be due to the amino acids incorporated into storage proteins, but not those present in the soluble form.

  4. Influence of Tuned Linker Functionality on Modulation of Magnetic Properties and Relaxation Dynamics in a Family of Six Isotypic Ln2(Ln = Dy and Gd) Complexes.

    Science.gov (United States)

    Mukherjee, Soumya; Lu, Jingjing; Velmurugan, Gunasekaran; Singh, Shweta; Rajaraman, Gopalan; Tang, Jinkui; Ghosh, Sujit K

    2016-11-07

    A coordination complex family comprising of six new dinuclear symmetric lanthanide complexes, namely, [Ln 2 (L x ) 2 (L') 2 (CH 3 OH) 2 ]·yG (H 2 L x : three related yet distinct Schiff-base linkers; x = 1-3, according to the nomenclature of the Schiff-base linker employed herein. HL': 2,6-dimethoxyphenol. yG refers to crystallographically assigned guest solvent species in the respective complexes; y = number of solvent molecules; Ln III = Dy/Gd) were isolated employing a mixed-ligand strategy stemming out of a strategic variation of the functionalities introduced among the constituent Schiff-base linkers. The purposeful introduction of three diverse auxiliary groups with delicate differences in their electrostatic natures affects the local anisotropy and magnetic coupling of Ln III ion-environment in the ensuing Ln 2 dinuclear complexes, consequentially resulting into distinctly dynamical magnetic behaviors among the investigated new-fangled family of isotypic Ln 2 complexes. Among the entire family, subtle alterations in the chemical moieties render two of the Dy 2 analogues to behave as single molecule magnets, while the other Dy 2 congener merely exhibits slow relaxation of the magnetization. The current observation marks one of the rare paradigms, wherein magnetic behavior modulation was achieved by virtue of the omnipresent influence of subtly tuned linker functionalities among the constituent motifs of the lanthanide nanomagnets. To rationalize the observed difference in the magnetic coupling, density functional theory and ab initio calculations (CASSCF/RASSI-SO/POLY_ANISO) were performed on all six complexes. Subtle difference in the bond angles leads to difference in the J values observed for Gd 2 complexes, while difference in the tunnel splitting associated with the structural alterations lead to variation in the magnetization blockade in the Dy 2 complexes.

  5. Epigenetics and autism spectrum disorder: A report of an autism case with mutation in H1 linker histone HIST1H1e and literature review.

    Science.gov (United States)

    Duffney, Lara J; Valdez, Purnima; Tremblay, Martine W; Cao, Xinyu; Montgomery, Sarah; McConkie-Rosell, Allyn; Jiang, Yong-Hui

    2018-04-27

    Genetic mutations in genes encoding proteins involved in epigenetic machinery have been reported in individuals with autism spectrum disorder (ASD), intellectual disability, congenital heart disease, and other disorders. H1 histone linker protein, the basic component in nucleosome packaging and chromatin organization, has not been implicated in human disease until recently. We report a de novo deleterious mutation of histone cluster 1 H1 family member e (HIST1H1E; c.435dupC; p.Thr146Hisfs*50), encoding H1 histone linker protein H1.4, in a 10-year-old boy with autism and intellectual disability diagnosed through clinical whole exome sequencing. The c.435dupC at the 3' end of the mRNA leads to a frameshift and truncation of the positive charge in the carboxy-terminus of the protein. An expression study demonstrates the mutation leads to reduced protein expression, supporting haploinsufficiency of HIST1H1E protein and loss of function as an underlying mechanism of dysfunction in the brain. Taken together with other recent cases with mutations of HIST1H1E in intellectual disability, the evidence supporting the link to causality in disease is strong. Our finding implicates the deficiency of H1 linker histone protein in autism. The systematic review of candidate genes implicated in ASD revealed that 42 of 215 (19.5%) genes are directly involved in epigenetic regulations and the majority of these genes belong to histone writers, readers, and erasers. While the mechanism of how haploinsufficiency of HIST1H1E causes autism is entirely unknown, our report underscores the importance of further study of the function of this protein and other histone linker proteins in brain development. © 2018 Wiley Periodicals, Inc.

  6. Radioiodinating of protein using 2, 3, 5, 6-tetrafluorophenyl 3-(nodo-carboranyl) propionate (TCP) as a new bi-functional linker: synthesis and biodistribution in mice

    International Nuclear Information System (INIS)

    Lin Rushan; Liu Ning; Yang Yuanyou; Liao Jiali; Jin Jiannan

    2008-01-01

    An active ester, 2, 3, 5, 6-tetrafluorophenyl 3-(nodo-carboranyl) propionate (TCP), was proposed as a pendant group for labeling proteins with suitable radionuclide for radionuclide therapy. In this paper, TCP, a new potential bi-functional linker for radioiodination of proteins or peptides, was synthesized. Then, the first attempt to conjugate bovine serum albumin (BSA) with 125 I via this bi-functional linker was made. The results showed that BSA could be conjugated with 125 I using TCP as the linker in a labeling yield of 58.3-65.8%%, and with radiochemical purity nearly of 100% after purification by Sephadex TM G-50. Even kept at room temperature for 72 hours, the radiochemical purity of 125 I-TCP-BSA was still more than 98%, much higher than that with the direct labeled BSA ( 125 I-BSA, 81.1%), implying that the conjugated BSA was fairly stable in vitro. Biodistribution of 125 I-TCP-BSA in mice suggested that 125 I accumulated mainly in liver post injection, with the maximum uptake of 11.42%I.D./g at 8 h, and mainly excreted by kidney. However, the uptake of 125 I in mice for 125 I-TCP-BSA in some key organs, especially in thyroid, stomach, lung and spleen were much less than that with the direct labeled BSA ( 125 I-BSA) and that of free iodine-125( 125 I - ). Additionally, it was noted that 125 I-TCP-BSA has much better in vivo stability than 125 I-BSA. This result indicated that 125 I-TCP-BSA has considerable stability in vivo as well as in vitro, and thus TCP could be used as a bi-functional linker for labeling proteins. (authors)

  7. Mutant ribosomes can generate dominant kirromycin resistance.

    OpenAIRE

    Tubulekas, I; Buckingham, R H; Hughes, D

    1991-01-01

    Mutations in the two genes for EF-Tu in Salmonella typhimurium and Escherichia coli, tufA and tufB, can confer resistance to the antibiotic kirromycin. Kirromycin resistance is a recessive phenotype expressed when both tuf genes are mutant. We describe a new kirromycin-resistant phenotype dominant to the effect of wild-type EF-Tu. Strains carrying a single kirromycin-resistant tuf mutation and an error-restrictive, streptomycin-resistant rpsL mutation are resistant to high levels of kirromyci...

  8. Effect of gaussian beam on microstructural and mechanical properties of dissimilarlaser welding ofAA5083 and AA6061 alloys

    Science.gov (United States)

    Srinivas, B.; Cheepu, Muralimohan; Sivaprasad, K.; Muthupandi, V.

    2018-03-01

    The present study focuses on a sheet thickness of 4 mm using different laser power and welding rate by the laser beam welding (LBW) at a beam size180 μm. The observations on the weldments are showing that thermal conductivity of the materials plays a major role on microstructural changes. The as-welded mechanical properties were studied by correlation with its microstructures. Due to the steeper temperature gradient during the laser beam welding AA6061 was showing the greater variation compares with AA5083 side in the micro hardness studies.Also, the tensile strength of 241 MPa has been reported as highest with the welds made of laser powerat 3.5 kW and welding rate at 3.5 mmin-1.

  9. Prediction of shear and tensile strength of the diffusion bonded AA5083 and AA7075 aluminium alloy using ANN

    International Nuclear Information System (INIS)

    Sagai Francis Britto, A.; Raj, R. Edwin; Mabel, M. Carolin

    2017-01-01

    Diffusion bonding is a pressure welding technique to establish bonds by inter diffusion of atoms. Bonding characteristics were generated by varying the significant process conditions such as the bonding temperature, the pressing load and the duration of pressure while bonding the aluminium alloys AA5083 and AA7075. Deriving analytical correlation with the process variables to weld strength is quite involved due to the non-linear dependency of the process variables with the mechanical strength of the joints. An arbitrary function approximation mechanism, the artificial neural network (ANN) is therefore employed to develop the models for predicting the mechanical properties of the bonded joints. Back propagation technique, which alters the network weights to minimize the mean square error was used to develop the ANN models. The models were tested, validated and found to be satisfactory with good prediction accuracy.

  10. Dynamic covalent side-chain cross-links via intermolecular oxime or hydrazone formation from bifunctional peptides and simple organic linkers.

    Science.gov (United States)

    Haney, Conor M; Horne, W Seth

    2014-02-01

    Peptide cyclization via chemoselective reactions between side chains has proven a useful strategy to control folded structure. We report here a method for the synthesis of side-chain to side-chain cyclic peptides based on the intermolecular reaction between a linear peptide functionalized with two aminooxy or hydrazide side chains and an organic dialdehyde linker. A family of oxime-based and hydrazone-based cyclic products is prepared in a modular and convergent fashion by combination of unprotected linear peptide precursors and various small molecule linkers in neutral aqueous buffer. The side-chain to side-chain linkages that result can alter peptide folding behavior. The dynamic covalent nature of the Schiff bases in the cyclic products can be utilized to create mixtures where product composition changes in response to experimental conditions. Thus, a linear peptide precursor can select one organic linker from a mixture, and a cyclic product can dynamically exchange the small molecule component of the macrocycle. Copyright © 2014 European Peptide Society and John Wiley & Sons, Ltd.

  11. Fusing two cytochromes b of Rhodobacter capsulatus cytochrome bc1 using various linkers defines a set of protein templates for asymmetric mutagenesis.

    Science.gov (United States)

    Czapla, Monika; Borek, Arkadiusz; Sarewicz, Marcin; Osyczka, Artur

    2012-01-01

    Cytochrome bc(1) (mitochondrial complex III), one of the key enzymes of biological energy conversion, is a functional homodimer in which each monomer contains three catalytic subunits: cytochrome c(1), the iron-sulfur subunit and cytochrome b. The latter is composed of eight transmembrane α-helices which, in duplicate, form a hydrophobic core of a dimer. We show that two cytochromes b can be fused into one 16-helical subunit using a number of different peptide linkers that vary in length but all connect the C-terminus of one cytochrome with the N-terminus of the other. The fusion proteins replace two cytochromes b in the dimer defining a set of available protein templates for introducing mutations that allow breaking symmetry of a dimer. A more detailed comparison of the form with the shortest, 3 amino acid, linker to the form with 12 amino acid linker established that both forms display similar level of structural plasticity to accommodate several, but not all, asymmetric patterns of mutations that knock out individual segments of cofactor chains. While the system based on a fused gene does not allow for the assessments of the functionality of electron-transfer paths in vivo, the family of proteins with fused cytochrome b offers attractive model for detailed investigations of molecular mechanism of catalysis at in vitro/reconstitution level.

  12. Optimization of the Alkyl Linker of TO Base Surrogate in Triplex-Forming PNA for Enhanced Binding to Double-Stranded RNA.

    Science.gov (United States)

    Sato, Takaya; Sato, Yusuke; Nishizawa, Seiichi

    2017-03-23

    A series of triplex-forming peptide nucleic acid (TFP) probes carrying a thiazole orange (TO) base surrogate through an alkyl linker was synthesized, and the interactions between these so-called tFIT probes and purine-rich sequences within double-stranded RNA (dsRNA) were examined. We found that the TO base surrogate linker significantly affected both the binding affinity and the fluorescence response upon triplex formation with the target dsRNA. Among the probes examined, the TO base surrogate connected through the propyl linker in the tFIT probes increased the binding affinity by a factor of ten while maintaining its function as the fluorescent universal base. Isothermal titration calorimetry experiments revealed that the increased binding affinity resulted from the gain in the binding enthalpy, which could be explained by the enhanced π-stacking interaction between the TO base surrogate and the dsRNA part of the triplex. We expect that these results will provide a molecular basis for designing strong binding tFIT probes for fluorescence sensing of various kinds of purine-rich dsRNAs sequences including those carrying a pyrimidine-purine inversion. The obtained data also offers a new insight into further development of the universal bases incorporated in TFP. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. The role of H1 linker histone subtypes in preserving the fidelity of elaboration of mesendodermal and neuroectodermal lineages during embryonic development.

    Directory of Open Access Journals (Sweden)

    Giang D Nguyen

    Full Text Available H1 linker histone proteins are essential for the structural and functional integrity of chromatin and for the fidelity of additional epigenetic modifications. Deletion of H1c, H1d and H1e in mice leads to embryonic lethality by mid-gestation with a broad spectrum of developmental alterations. To elucidate the cellular and molecular mechanisms underlying H1 linker histone developmental functions, we analyzed embryonic stem cells (ESCs depleted of H1c, H1d and H1e subtypes (H1-KO ESCs by utilizing established ESC differentiation paradigms. Our study revealed that although H1-KO ESCs continued to express core pluripotency genes and the embryonic stem cell markers, alkaline phosphatase and SSEA1, they exhibited enhanced cell death during embryoid body formation and during specification of mesendoderm and neuroectoderm. In addition, we demonstrated deregulation in the developmental programs of cardiomyocyte, hepatic and pancreatic lineage elaboration. Moreover, ectopic neurogenesis and cardiomyogenesis occurred during endoderm-derived pancreatic but not hepatic differentiation. Furthermore, neural differentiation paradigms revealed selective impairments in the specification and maturation of glutamatergic and dopaminergic neurons with accelerated maturation of glial lineages. These impairments were associated with deregulation in the expression profiles of pro-neural genes in dorsal and ventral forebrain-derived neural stem cell species. Taken together, these experimental observations suggest that H1 linker histone proteins are critical for the specification, maturation and fidelity of organ-specific cellular lineages derived from the three cardinal germ layers.

  14. Combining reactive triblock copolymers with functional cross-linkers: A versatile pathway to disulfide stabilized-polyplex libraries and their application as pDNA vaccines.

    Science.gov (United States)

    Heller, Philipp; Hobernik, Dominika; Lächelt, Ulrich; Schinnerer, Meike; Weber, Benjamin; Schmidt, Manfred; Wagner, Ernst; Bros, Matthias; Barz, Matthias

    2017-07-28

    Therapeutic nucleic acids such as pDNA hold great promise for the treatment of multiple diseases. These therapeutic interventions are, however, compromised by the lack of efficient and safe non-viral delivery systems, which guarantee stability during blood circulation together with high transfection efficiency. To provide these desired properties within one system, we propose the use of reactive triblock copolypept(o)ides, which include a stealth-like block for efficient shielding, a hydrophobic block based on reactive disulfides for cross-linking and a cationic block for complexation of pDNA. After the complexation step, bifunctional cross-linkers can be employed to bio-reversibly stabilize derived polyplexes by disulfide bond formation and to introduce endosomolytic moieties at the same time. Cross-linked polyplexes show no aggregation in human blood serum. Upon cellular uptake and cleavage of disulfide bonds, the cross-linkers can interact with the endosomal membrane, leading to lysis and efficient endosomal translocation. In principal, the approach allows for the combination of one polymer with various different cross-linkers and thus enables the fast forward creation of a polyplex library. Here, we provide a first insight into the potential of this concept and use a screening strategy to identify a lead candidate, which is able to transfect dendritic cells with a model DNA vaccine. Copyright © 2017. Published by Elsevier B.V.

  15. Surface expression and subunit specific control of steady protein levels by the Kv7.2 helix A-B linker.

    Directory of Open Access Journals (Sweden)

    Paloma Aivar

    Full Text Available Kv7.2 and Kv7.3 are the main components of the neuronal voltage-dependent M-current, which is a subthreshold potassium conductance that exerts an important control on neuronal excitability. Despite their predominantly intracellular distribution, these channels must reach the plasma membrane in order to control neuronal activity. Thus, we analyzed the amino acid sequence of Kv7.2 to identify intrinsic signals that may control its surface expression. Removal of the interlinker connecting helix A and helix B of the intracellular C-terminus produces a large increase in the number of functional channels at the plasma membrane. Moreover, elimination of this linker increased the steady-state amount of protein, which was not associated with a decrease of protein degradation. The magnitude of this increase was inversely correlated with the number of helix A - helix B linkers present in the tetrameric channel assemblies. In contrast to the remarkable effect on the amount of Kv7.2 protein, removal of the Kv7.2 linker had no detectable impact on the steady-state levels of Kv7.3 protein.

  16. Single particle electron microscopy analysis of the bovine anion exchanger 1 reveals a flexible linker connecting the cytoplasmic and membrane domains.

    Directory of Open Access Journals (Sweden)

    Jiansen Jiang

    Full Text Available Anion exchanger 1 (AE1 is the major erythrocyte membrane protein that mediates chloride/bicarbonate exchange across the erythrocyte membrane facilitating CO₂ transport by the blood, and anchors the plasma membrane to the spectrin-based cytoskeleton. This multi-protein cytoskeletal complex plays an important role in erythrocyte elasticity and membrane stability. An in-frame AE1 deletion of nine amino acids in the cytoplasmic domain in a proximity to the membrane domain results in a marked increase in membrane rigidity and ovalocytic red cells in the disease Southeast Asian Ovalocytosis (SAO. We hypothesized that AE1 has a flexible region connecting the cytoplasmic and membrane domains, which is partially deleted in SAO, thus causing the loss of erythrocyte elasticity. To explore this hypothesis, we developed a new non-denaturing method of AE1 purification from bovine erythrocyte membranes. A three-dimensional (3D structure of bovine AE1 at 2.4 nm resolution was obtained by negative staining electron microscopy, orthogonal tilt reconstruction and single particle analysis. The cytoplasmic and membrane domains are connected by two parallel linkers. Image classification demonstrated substantial flexibility in the linker region. We propose a mechanism whereby flexibility of the linker region plays a critical role in regulating red cell elasticity.

  17. [A review for recent advances in AA amyloid research and therapeutic approach to AA amyloidosis complicating rheumatoid arthritis].

    Science.gov (United States)

    Tamura, Hiroaki; Hasegawa, Kiminori

    2009-02-01

    AA amyloidosis is a life threatening clinical complication of chronic inflammatory diseases such as rheumatoid arthritis. It has been demonstrated biochemically that amyloidosis resulted from abnormal folding of proteins, which are deposited as insoluble fibrils in extracellular tissue, leading to the disruption of their normal function. In this regard, amyloidosis has been recognized as a conformation disorder. Interestingly, genetic polymorphisms of amyloid precursor protein (SAA) have been reported to associate with increased risk for AA amyloidosis. Also recent biochemical research revealed that SAA is synthesized under the influence of the proinflammatory cytokines, such as IL-6, TNF-alpha, IL-1. Additionally, it was suggested that amyloid deposits in extracellular tissue could reflect to the serum level of SAA in the reversible fashion, leading to the hypothesis that the control of the SAA synthesis could be beneficial to the treatment of amyloidosis. In this context, anti-cytokine therapies may be most effective. Especially the inhibition of IL-6 is critical to suppression of SAA production, so treatment with a humanized monoclonal antibody against human IL-6 receptor may not only ameliorate RA disease activity but also pave the way for the treatment of AA amyloidosis.

  18. Deletions of the hypervariable region (HVR) in open reading frame 1 of hepatitis E virus do not abolish virus infectivity: evidence for attenuation of HVR deletion mutants in vivo.

    Science.gov (United States)

    Pudupakam, R S; Huang, Y W; Opriessnig, T; Halbur, P G; Pierson, F W; Meng, X J

    2009-01-01

    Hepatitis E virus (HEV) is an important human pathogen, although little is known about its biology and replication. Comparative sequence analysis revealed a hypervariable region (HVR) with extensive sequence variations in open reading frame 1 of HEV. To elucidate the role of the HVR in HEV replication, we first constructed two HVR deletion mutants, hHVRd1 and hHVRd2, with in-frame deletion of amino acids (aa) 711 to 777 and 747 to 761 in the HVR of a genotype 1 human HEV replicon. Evidence of HEV replication was detected in Huh7 cells transfected with RNA transcripts from mutant hHVRd2, as evidenced by expression of enhanced green fluorescent protein. To confirm the in vitro results, we constructed three avian HEV mutants with various HVR deletions: mutants aHVRd1, with deletion of aa 557 to 585 (Delta557-585); aHVRd2 (Delta612-641); and aHVRd3 (Delta557-641). Chickens intrahepatically inoculated with capped RNA transcripts from mutants aHVRd1 and aHVRd2 developed active viral infection, as evidenced by seroconversion, viremia, and fecal virus shedding, although mutant aHVRd3, with complete HVR deletion, was apparently attenuated in chickens. To further verify the results, we constructed four additional HVR deletion mutants using the genotype 3 swine HEV as the backbone. Mutants sHVRd2 (Delta722-781), sHVRd3 (Delta735-765), and sHVRd4 (Delta712-765) were shown to tolerate deletions and were infectious in pigs intrahepatically inoculated with capped RNA transcripts from the mutants, whereas mutant sHVRd1 (Delta712-790), with a nearly complete HVR deletion, exhibited an attenuation phenotype in infected pigs. The data from these studies indicate that deletions in HVR do not abolish HEV infectivity in vitro or in vivo, although evidence for attenuation was observed for HEV mutants with a larger or nearly complete HVR deletion.

  19. The domain II loops of Bacillus thuringiensis Cry1Aa form an overlapping interaction site for two Bombyx mori larvae functional receptors, ABC transporter C2 and cadherin-like receptor.

    Science.gov (United States)

    Adegawa, Satomi; Nakama, Yui; Endo, Haruka; Shinkawa, Naoki; Kikuta, Shingo; Sato, Ryoichi

    2017-02-01

    Information about the receptor-interaction region of Cry toxins, insecticidal proteins produced by Bacillus thuringiensis, is needed to elucidate the mode of action of Cry toxins and improve their toxicity through protein engineering. We analyzed the interaction sites on Cry1Aa with ABC transporter C2 (ABCC2), one of the most important Cry1A toxin receptors. A competitive binding assay revealed that the Bombyx mori ABCC2 (BmABCC2) Cry1A binding site was the same as the BtR175 binding site, suggesting that the loop region of Cry1Aa domain II is a binding site. Next, we constructed several domain II loop mutant toxins and tested their binding affinity in an SPR analysis, and also performed a cell swelling assay to evaluate receptor-mediated cytotoxicity. Our results indicate that the loop regions required for BtR175 and BmABCC2 binding and the regions important for cytotoxicity partially overlap. Our results also suggest that receptor binding is necessary but not sufficient for cytotoxicity. This is the first report showing the region of interaction between ABCC2 and Cry1Aa and the cytotoxicity-relevant properties of the Cry1Aa domain II loop region. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Single-reversal charge in the β10-β11 receptor-binding loop of Bacillus thuringiensis Cry4Aa and Cry4Ba toxins reflects their different toxicity against Culex spp. larvae.

    Science.gov (United States)

    Visitsattapongse, Sarinporn; Sakdee, Somsri; Leetacheewa, Somphob; Angsuthanasombat, Chanan

    2014-07-25

    Bacillus thuringiensis Cry4Aa toxin was previously shown to be much more toxic to Culex mosquito-larvae than its closely related toxin - Cry4Ba, conceivably due to their sequence differences within the β10-β11 receptor-binding loop. Here, single-Ala substitutions of five residues (Pro(510), Thr(512), Tyr(513), Lys(514) and Thr(515)) within the Cry4Aa β10-β11 loop revealed that only Lys(514) corresponding to the relative position of Cry4Ba-Asp(454) is crucial for toxicity against Culex quinquefasciatus larvae. Interestingly, charge-reversal mutations at Cry4Ba-Asp(454) (D454R and D454K) revealed a marked increase in toxicity against such less-susceptible larvae. In situ binding analyses revealed that both Cry4Ba-D454R and D454K mutants exhibited a significant increase in binding to apical microvilli of Culex larval midguts, albeit at lower-binding activity when compared with Cry4Aa. Altogether, our present data suggest that a positively charged side-chain near the tip of the β10-β11 loop plays a critical role in determining target specificity of Cry4Aa against Culex spp., and hence a great increase in the Culex larval toxicity of Cry4Ba was obtained toward an opposite-charge conversion of the corresponding Asp(454). Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Induction of drought tolerant mutants of rice

    International Nuclear Information System (INIS)

    El-Hissewy, A.A.; Abd Allah, A.

    2001-01-01

    The ultimate goal of crop breeding is to develop varieties with a high yield potential and desirable agronomic characteristics. In Egypt, the most important qualities sought by breeders have been high yield potential, resistance to major diseases and insects, and improved grain and eating quality. However, breeding efforts should concentrate on varieties with the potential to minimize yield losses under unfavorable conditions such as drought, and to maximize yields when conditions are favorable. Rice (Oryza sativa L.) in Egypt is completely irrigated and a significant portion of the rice cultivated area is subject to water deficit resulting from an inadequate or insufficient irrigation supply. Drought tolerance is a complex trait in that it results from the interaction of histological and physiological characters of plant with environmental factors, both above-ground and under-ground. Accordingly, root characters are closely related to drought tolerance. Little attention has been paid in Egyptian breeding programs to root characters and their relation to shoot characters. Furthermore, induced mutations are considered as one of the most important methods to induce useful mutants, especially with improved root characters, to overcome the drought problem. The present investigation aimed to study the effect of different doses of gamma rays on several characters of three Egyptian rice varieties, i.e. 'Giza 171', 'Giza 175' and 'Giza 176' and to induce one or more mutants possessing drought tolerance

  2. Flower morphology of Dendrobium Sonia mutants

    International Nuclear Information System (INIS)

    Sakinah Ariffin; Azhar Mohamad; Affrida Abu Hassan; Zaiton Ahmad; Mohd Nazir Basiran

    2010-01-01

    Dendrobium Sonia is a commercial hybrid which is popular as cut flower and potted plant in Malaysia. Variability in flower is important for new variety to generate more demands and choices in selection. Mutation induction is a tool in creating variability for new flower color and shape. In vitro cultures of protocorm-like bodies (PLBs) were exposed to gamma ray at dose 35 Gy. Phenotypic characteristics of the flower were observed at fully bloomed flower with emphasis on shape and color. Approximately 2000 regenerated irradiated plants were observed and after subsequent flowering, 100 plants were finally selected for further evaluation. Most of the color and shape changes are expressed in different combinations of petal, sepal and lip of the flower. In this work, 11 stable mutants were found different at flower phenotype as compared to control. Amongst these, four mutant varieties with commercial potential has been named as Dendrobium 'SoniaKeenaOval', Dendrobium 'SoniaKeenaRadiant', Dendrobium 'SoniaKeenaHiengDing' and Dendrobium 'Sonia KeenaAhmadSobri'. In this paper, variations in flower morphology and flower color were discussed, giving emphasis on variations in flower petal shape. (author)

  3. Indy mutants: live long and prosper

    Directory of Open Access Journals (Sweden)

    Stewart eFrankel

    2012-02-01

    Full Text Available Indy encodes the fly homologue of a mammalian transporter of di and tricarboxylatecomponents of the Krebs cycle. Reduced expression of fly Indy or two of the C. elegansIndy homologs leads to an increase in life span. Fly and worm tissues that play key roles inintermediary metabolism are also the places where Indy genes are expressed. One of themouse homologs of Indy (mIndy is mainly expressed in the liver. It has been hypothesizedthat decreased INDY activity creates a state similar to caloric restriction (CR. Thishypothesis is supported by the physiological similarities between Indy mutant flies on highcalorie food and control flies on CR, such as increased physical activity and decreases inweight, egg production, triglyceride levels, starvation resistance, and insulin signaling. Inaddition, Indy mutant flies undergo changes in mitochondrial biogenesis also observed inCR animals. Recent findings with mIndy knockout mice support and extend the findingsfrom flies. mIndy-/- mice display an increase in hepatic mitochondrial biogenesis, lipidoxidation and decreased hepatic lipogenesis. When mIndy-/- mice are fed high calorie foodthey are protected from adiposity and insulin resistance. These findings point to INDY as apotential drug target for the treatment of metabolic syndrome, type 2 diabetes and obesity.

  4. Allosteric Mutant IDH1 Inhibitors Reveal Mechanisms for IDH1 Mutant and Isoform Selectivity

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Xiaoling; Baird, Daniel; Bowen, Kimberly; Capka, Vladimir; Chen, Jinyun; Chenail, Gregg; Cho, YoungShin; Dooley, Julia; Farsidjani, Ali; Fortin, Pascal; Kohls, Darcy; Kulathila, Raviraj; Lin, Fallon; McKay, Daniel; Rodrigues, Lindsey; Sage, David; Touré, B. Barry; van der Plas, Simon; Wright, Kirk; Xu, Ming; Yin, Hong; Levell, Julian; Pagliarini, Raymond A. (Novartis)

    2017-03-01

    Oncogenic IDH1 and IDH2 mutations contribute to cancer via production of R-2-hydroxyglutarate (2-HG). Here, we characterize two structurally distinct mutant- and isoform-selective IDH1 inhibitors that inhibit 2-HG production. Both bind to an allosteric pocket on IDH1, yet shape it differently, highlighting the plasticity of this site. Oncogenic IDH1R132H mutation destabilizes an IDH1 “regulatory segment,” which otherwise restricts compound access to the allosteric pocket. Regulatory segment destabilization in wild-type IDH1 promotes inhibitor binding, suggesting that destabilization is critical for mutant selectivity. We also report crystal structures of oncogenic IDH2 mutant isoforms, highlighting the fact that the analogous segment of IDH2 is not similarly destabilized. This intrinsic stability of IDH2 may contribute to observed inhibitor IDH1 isoform selectivity. Moreover, discrete residues in the IDH1 allosteric pocket that differ from IDH2 may also guide IDH1 isoform selectivity. These data provide a deeper understanding of how IDH1 inhibitors achieve mutant and isoform selectivity.

  5. Stomach Chitinase from Japanese Sardine Sardinops melanostictus: Purification, Characterization, and Molecular Cloning of Chitinase Isozymes with a Long Linker.

    Science.gov (United States)

    Kawashima, Satoshi; Ikehata, Hiroki; Tada, Chihiro; Ogino, Tomohiro; Kakizaki, Hiromi; Ikeda, Mana; Fukushima, Hideto; Matsumiya, Masahiro

    2016-01-20

    Fish express two different chitinases, acidic fish chitinase-1 (AFCase-1) and acidic fish chitinase-2 (AFCase-2), in the stomach. AFCase-1 and AFCase-2 have different degradation patterns, as fish efficiently degrade chitin ingested as food. For a comparison with the enzymatic properties and the primary structures of chitinase isozymes obtained previously from the stomach of demersal fish, in this study, we purified chitinase isozymes from the stomach of Japanese sardine Sardinops melanostictus, a surface fish that feeds on plankton, characterized the properties of these isozymes, and cloned the cDNAs encoding chitinases. We also predicted 3D structure models using the primary structures of S. melanostictus stomach chitinases. Two chitinase isozymes, SmeChiA (45 kDa) and SmeChiB (56 kDa), were purified from the stomach of S. melanostictus. Moreover, two cDNAs, SmeChi-1 encoding SmeChiA, and SmeChi-2 encoding SmeChiB were cloned. The linker regions of the deduced amino acid sequences of SmeChi-1 and SmeChi-2 (SmeChi-1 and SmeChi-2) are the longest among the fish stomach chitinases. In the cleavage pattern groups toward short substrates and the phylogenetic tree analysis, SmeChi-1 and SmeChi-2 were classified into AFCase-1 and AFCase-2, respectively. SmeChi-1 and SmeChi-2 had catalytic domains that consisted of a TIM-barrel (β/α)₈-fold structure and a deep substrate-binding cleft. This is the first study showing the 3D structure models of fish stomach chitinases.

  6. Development and characterization of polyclonal antibodies against the linker region of the telomere-binding protein TRF2

    Directory of Open Access Journals (Sweden)

    Nadya V. Ilicheva

    2018-03-01

    Full Text Available Background: TRF2 (telomeric repeat binding factor 2 is an essential component of the telomere-binding protein complex shelterin. TRF2 induces the formation of a special structure of telomeric DNA and counteracts activation of DNA damage-response pathways telomeres. TRF2 has a poorly characterized linker region (udTRF2 between its homodimerization and DNA-binding domains. Some lines of evidence have shown that this region could be involved in TRF2 interaction with nuclear lamina. Results: In this study, the fragment of the TERF2 gene encoding udTRF2 domain of telomere-binding protein TRF2 was produced by PCR and cloned into the pET32a vector. The resulting plasmid pET32a-udTRF2 was used for the expression of the recombinant udTRF2 in E. coli RosettaBlue (DE3. The protein was isolated and purified using ammonium sulfate precipitation followed by ion-exchange chromatography. The purified recombinant protein udTRF2 was injected into guinea pigs to generate polyclonal antibodies. The ability of anti-udTRF2 antibodies to bind endogenous TRF2 in human skin fibroblasts was tested by western blotting and immunofluorescent staining. Conclusions: In this study, the recombinant protein udTRF2 and antibodies to it were generated. Both protein and antibodies will provide a useful tool for investigation of the functions of the udTRF2 domain and its role in the interaction between TRF2 and nuclear lamina. Keywords: Chromosomes, Molecular cloning, Nuclear lamina, Nucleoprotein complexes, Polyclonal antibodies, Recombinant polypeptide, Shelterin, Telomere-binding protein TRF2, Telomeres, Telomeric DNA, TTAGGG repeats

  7. Synthesis of zincphthalocyanine-based conjugated microporous polymers with rigid-linker as novel and green heterogeneous photocatalysts.

    Science.gov (United States)

    Cai, Lijun; Li, Yanwei; Li, Yanhui; Wang, Hengguo; Yu, Yang; Liu, Ying; Duan, Qian

    2018-04-15

    The novel zincphthalocyanine-based conjugated microporous polymers with rigid-linker (α-ZnPc-CMP and β-ZnPc-CMP) were synthesized by copolymerization of zinc phthalocyanine (ZnPc) and 4, 6-diaminoresorcinol dihydrochloride (DADHC). The α-ZnPc-CMP and β-ZnPc-CMP were utilized as heterogeneous photocatalysts to degrade Rhodamine B (RhB) in aqueous solution. It is the first time for MPc-based CMPs used as heterogeneous photocatalysts for photodegradation of RhB to date. The highly ordered skeletal alignment and two-dimensional open-channel structure of α-ZnPc-CMP and β-ZnPc-CMP not only solve the aggregation of ZnPc and enhance its photocatalytic activity, but also facilitate the recycling and avoid the secondary pollution. The chemical structures and morphologies of α-ZnPc-CMP and β-ZnPc-CMP were well characterized by Fourier transform infrared spectra (FT-IR), solid-state 13 C nuclear magnetic resonance ( 13 C NMR), scanning electron microscopy (SEM), N 2 -sorption/ desorption and X-ray diffraction (XRD). The solubility experiments and thermogravimetric analysis (TGA) showed they have good chemical stability and recyclability. Furthermore, the photocatalytic tests indicated α-ZnPc-CMP and β-ZnPc-CMP have excellent photocatalytic performances for degradation of RhB (3 h, degraded 98 and 97.47%) in the presence of H 2 O 2 under visible-light irradiation. All results reveal that α-ZnPc-CMP and β-ZnPc-CMP have great potential as photocatalysts on the degradation of organic dye contaminants. Moreover, the possible reaction mechanism of α-ZnPc-CMP and β-ZnPc-CMP as photocatalysts for the degradation of RhB is proposed. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. [AA amyloidosis: a little-known complication of chronic leg ulcer].

    Science.gov (United States)

    Waton, J; Fays-Michel, S; Chandeclerc, M L; Corby, S; Cuny, J F; Barbaud, A; Schmutz, J-L

    2008-02-01

    AA amyloidosis, secondary to inflammatory chronic diseases like rheumatoid arthritis, is often complicated by renal failure. Chronic inflammatory dermatoses constitute rare causes of AA amyloidosis. We describe two cases of AA amyloidosis discovered after renal failure in patients presenting leg ulcers for several years. AL amyloidosis was suspected in both cases because of a history of monoclonal gammopathy in one patient and of plasmocytoma in the other. The diagnosis of AA amyloidosis was confirmed on renal histology through the detection of AA antibodies in amyloid deposits. No extrarenal amyloidosis was seen in either patient and there were no inflammatory diseases other than chronic leg ulcers. AA amyloidosis is caused by serum amyloid protein A (SAA), a reactive inflammatory protein. AA amyloidosis is thus caused by chronic inflammatory diseases, but only rarely by cutaneous inflammatory diseases. To our knowledge, the literature contains only seven other published cases of AA amyloidosis secondary to chronic leg ulcers. A review of the literature does not indicate whether cure of ulcers has any effect on the accompanying renal failure. We imagine that AA amyloidosis secondary to leg ulcer is in fact under-diagnosed. However, since the first specific treatment for AA amyloidosis is currently being evaluated by the Food and Drug Administration, it is essential that this serious complication of chronic leg ulcers be widely recognised.

  9. Role and mechanism of AT1-AA in the pathogenesis of HELLP syndrome.

    Science.gov (United States)

    Bu, Shurui; Wang, Yuxian; Sun, Shuqing; Zheng, Yanqian; Jin, Zhu; Zhi, Jianming

    2018-01-10

    HELLP syndrome remains a leading cause of maternal and neonatal mortality and morbidity worldwide, which symptoms include hemolysis, elevated liver enzymes and low platelet count. The objective of this study was to determine whether HELLP is associated with AT1-AA. The positive rate and titer of AT1-AA in plasma from pregnant women were determined, and the correlation of AT1-AA titer with the grade of HELLP was analyzed. A HELLP rat model established by intravenous injection of AT1-AA. Our experimental results show the AT1-AA titer and positive rate were significantly higher in HELLP group, and AT1-AA titer were positively correlated with the level of TNF-α and ET-1 in plasma and the grade of HELLP syndrome. The results of animal experiments showed that the typical features of HELLP in the pregnant rats after AT1-AA injection. The levels of TNF-α and ET-1 in plasma and liver tissue were significantly increased in AT1-AA-treated rats compared with control rats. The HELLP syndrome induced by AT1-AA was attenuated markedly after administration of losartan. These data support the hypothesis that one the potential pathway that AT1-AA induce damage to capillary endothelial cells and liver during pregnancy is through activation of TNF-α and ET-1.

  10. Adverse effects of doping with anabolic androgenic steroids (AAS) in competitive athletics, recreational sports and bodybuilding.

    Science.gov (United States)

    Vorona, Elena; Nieschlag, Eberhard

    2018-02-19

    Despite the fact that sports organizations and legislators have introduced various mechanisms to discourage athletes from using performance and appearance enhancing substances a high percentage of athletes admits to their unabated application. In competitive athletics, bodybuilding and in recreational sports anabolic androgenic steroids (AAS) continue to be the substances most abused. This review summarizes the side effects of AAS abuse on organs and system functions in both sexes. High doses of AAS cause a significant increase of erythrocytes und haemoglobin concentration, which may lead to thromboembolism, intracardiac thrombosis and stroke. Long-term AAS abusers have a higher incidence of arrhythmias, atherosclerosis, concentric left-ventricular myocardial hypertrophy with impaired diastolic function and also sudden cardiac death. Changes of liver function and structure, up to hepatocellular carcinoma, have been described, mainly in cases of chronic misuse of 17α-alkylated AAS. Sleeplessness, increased irritability, depressive mood status are often observed in AAS abuse. In former AAS abusers depression, anxiety and melancholy may persist for many years. Due to negative feedback in the regulation of the hypothalamic-pituitary-gonadal axis AAS can cause reversible suppression of spermatogenesis up to azoospermia. In women the changes most often caused by AAS abuse are hirsutism, irreversible deepening of voice, dysmenorrhoea, secondary amenorrhoea with anovulation and infertility. AAS abuse notwithstanding, under clinical conditions testosterone remains the most important hormone for substitution therapy of male hypogonadism.

  11. Core–corona PSt/P(BA–AA) composite particles by two-stage emulsion polymerization

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Delong; Ren, Xiaolin; Zhang, Xinya, E-mail: cexyzh@scut.edu.cn; Liao, Shijun [South China University of Technology, School of Chemistry and Chemical Engineering (China)

    2016-03-15

    Raspberry-shaped composite particles with polystyrene (PSt) as core and poly(n-butyl acrylate-co-acrylic acid) (P(BA–AA)) as corona were synthesized via emulsion polymerization. The random copolymer, P(BA–AA), was pre-prepared and used as a polymeric surfactant, its emulsifying properties adjusted by changing the mass ratio of BA and AA. The morphology of the resulting core–corona composite particles, P(St/P(BA–AA)), could be regulated and controlled by varying the concentrations of P(BA–AA) or the mass ratio of BA:AA in P(BA–AA). The experimental results indicate that 3.0–6.0 wt% of P(BA–AA) is required to obtain stable composite emulsions, and P(BA–AA) with a mass ratio of BA:AA = 1:2 is able to generate distinct core–corona structures. A mechanism of composite particle formation is proposed based on the high affinity between the PSt core and the hydrophobic segments of P(BA–A). The regular morphology of the colloidal film is expected to facilitate potential application of core–corona particles in the field of light scattering. Furthermore, the diversity of core–corona particles can be expanded by replacing P(BA–AA) corona particles with other amphiphilic particles.

  12. Core–corona PSt/P(BA–AA) composite particles by two-stage emulsion polymerization

    International Nuclear Information System (INIS)

    Xie, Delong; Ren, Xiaolin; Zhang, Xinya; Liao, Shijun

    2016-01-01

    Raspberry-shaped composite particles with polystyrene (PSt) as core and poly(n-butyl acrylate-co-acrylic acid) (P(BA–AA)) as corona were synthesized via emulsion polymerization. The random copolymer, P(BA–AA), was pre-prepared and used as a polymeric surfactant, its emulsifying properties adjusted by changing the mass ratio of BA and AA. The morphology of the resulting core–corona composite particles, P(St/P(BA–AA)), could be regulated and controlled by varying the concentrations of P(BA–AA) or the mass ratio of BA:AA in P(BA–AA). The experimental results indicate that 3.0–6.0 wt% of P(BA–AA) is required to obtain stable composite emulsions, and P(BA–AA) with a mass ratio of BA:AA = 1:2 is able to generate distinct core–corona structures. A mechanism of composite particle formation is proposed based on the high affinity between the PSt core and the hydrophobic segments of P(BA–A). The regular morphology of the colloidal film is expected to facilitate potential application of core–corona particles in the field of light scattering. Furthermore, the diversity of core–corona particles can be expanded by replacing P(BA–AA) corona particles with other amphiphilic particles.

  13. Serrated leaf mutant in mungbean (Vigna radiata (L) Wilczek)

    International Nuclear Information System (INIS)

    Malik, I.A.; Ghulam, Sarwar; Yousaf, Ali; Saleem, M.

    1988-01-01

    Dry dormant seeds of mungbean (Vigna radiata (L) Wilczek) were treated with gamma rays (15, 30 and 60 kR). The serrated leaf mutation was noticed in M 2 of cultivar Pak 32 treated with 60 kR. Cf 14 plants, 3 showed the altered leaf structure and the others were normal. The feature of this mutant was the deep serration of leaflet margins. The mutant had large thick leaflets with prominent venation. The mutant bred true in the M 3 and successive generation. Details of the morphological characteristics of the mutant are presented. The mutant exhibited slower growth particularly during the early stages of development, flowered later and attained shorter height. There was an increase in the number of pods, in seed weight and in seed protein content, but number of seed per pod was considerably reduced. The seed coat colour showed a change from green to yellowish green. In the mutant's flowers the stamina were placed much below the stigma level and the stigma sometimes protruded the corolla. Outcrossing of 4% recorded in some of the mutant lines revealed a reduced cleistogamy. The low number of seeds per pod in the mutant could be due to reduced pollen fertility. The mutant behaved as monogenic recessive. The symbols SL/sl are proposed for this allelic pair. The mutant may have use as a green manure crop because of its large foliage and for the breeders as a genetic marker

  14. Forward genetic screen for auxin-deficient mutants by cytokinin.

    Science.gov (United States)

    Wu, Lei; Luo, Pan; Di, Dong-Wei; Wang, Li; Wang, Ming; Lu, Cheng-Kai; Wei, Shao-Dong; Zhang, Li; Zhang, Tian-Zi; Amakorová, Petra; Strnad, Miroslav; Novák, Ondřej; Guo, Guang-Qin

    2015-07-06

    Identification of mutants with impairments in auxin biosynthesis and dynamics by forward genetic screening is hindered by the complexity, redundancy and necessity of the pathways involved. Furthermore, although a few auxin-deficient mutants have been recently identified by screening for altered responses to shade, ethylene, N-1-naphthylphthalamic acid (NPA) or cytokinin (CK), there is still a lack of robust markers for systematically isolating such mutants. We hypothesized that a potentially suitable phenotypic marker is root curling induced by CK, as observed in the auxin biosynthesis mutant CK-induced root curling 1 / tryptophan aminotransferase of Arabidopsis 1 (ckrc1/taa1). Phenotypic observations, genetic analyses and biochemical complementation tests of Arabidopsis seedlings displaying the trait in large-scale genetic screens showed that it can facilitate isolation of mutants with perturbations in auxin biosynthesis, transport and signaling. However, unlike transport/signaling mutants, the curled (or wavy) root phenotypes of auxin-deficient mutants were significantly induced by CKs and could be rescued by exogenous auxins. Mutants allelic to several known auxin biosynthesis mutants were re-isolated, but several new classes of auxin-deficient mutants were also isolated. The findings show that CK-induced root curling provides an effective marker for discovering genes involved in auxin biosynthesis or homeostasis.

  15. Neurobehavioral Mutants Identified in an ENU Mutagenesis Project

    Energy Technology Data Exchange (ETDEWEB)

    Cook, Melloni N. [University of Memphis; Dunning, Jonathan P [University of Memphis; Wiley, Ronald G [Vanderbilt University and Veterans Administration, Nashville, TN; Chesler, Elissa J [ORNL; Johnson, Dabney K [ORNL; Goldowitz, Daniel [University of Tennessee Health Science Center, Memphis

    2007-01-01

    We report on a behavioral screening test battery that successfully identified several neurobehavioral mutants among a large-scale ENU-mutagenized mouse population. Large numbers of ENU mutagenized mice were screened for abnormalities in central nervous system function based on abnormal performance in a series of behavior tasks. We developed and employed a high-throughput screen of behavioral tasks to detect behavioral outliers. Twelve mutant pedigrees, representing a broad range of behavioral phenotypes, have been identified. Specifically, we have identified two open field mutants (one displaying hyper-locomotion, the other hypo-locomotion), four tail suspension mutants (all displaying increased immobility), one nociception mutant (displaying abnormal responsiveness to thermal pain), two prepulse inhibition mutants (displaying poor inhibition of the startle response), one anxiety-related mutant (displaying decreased anxiety in the light/dark test), and one learning and memory mutant (displaying reduced response to the conditioned stimulus) These findings highlight the utility of a set of behavioral tasks used in a high throughput screen to identify neurobehavioral mutants. Further analysis (i.e., behavioral and genetic mapping studies) of mutants is in progress with the ultimate goal of identification of novel genes and mouse models relevant to human disorders as well as the identification of novel therapeutic targets.

  16. Antiangiogenic effects of AA-PMe on HUVECs in vitro and zebrafish in vivo

    Directory of Open Access Journals (Sweden)

    Jing Y

    2018-04-01

    Full Text Available Yue Jing,1,2,* Gang Wang,1,* Qi Xiao,1 Yachun Zhou,1 Yingjie Wei,3 Zhunan Gong1 1Center for New Drug Research and Development, College of Life Science, Nanjing Normal University, Nanjing, China; 2Central Laboratory of Stomatology, Nanjing Stomatological Hospital, Medical School of Nanjing University, Nanjing, China; 3Key Laboratory of Oral Drug Delivery System of Chinese Materia Medica of State Administration of Traditional Chinese Medicine, Jiangsu Branch of China Academy of Chinese Medical Science, Nanjing, China *These authors contributed equally to this work Abstract: Angiogenesis plays a vital role in many physiological and pathological processes and several diseases are connected with its dysregulation. Asiatic acid (AA has demonstrated anticancer properties and we suspect this might be attributable to an effect on angiogenesis. A modified derivative of AA, N-(2α,3β,23-acetoxyurs-12-en-28-oyl-L-proline methyl ester (AA-PMe, has improved efficacy over its parent compound, but its effect on blood vessel development remains unclear. Methods: In this study, we investigated the antiangiogenic activity of AA and AA-PMe in zebrafish embryos and human umbilical vein endothelial cells (HUVECs. First of all, we treated HUVECs with increasing concentrations of AA-PMe or AA, with or without vascular endothelial growth factor (VEGF present, and assessed cell viability, tube formation, and cell migration and invasion. Quantitative real-time polymerase chain reaction and Western blot analysis were later used to determine the role of vascular endothelial growth factor receptor 2 (VEGFR2-mediated signaling in AA-PMe inhibition of angiogenesis. We extended these studies to follow angiogenesis using Tg(fli:EGFP transgenic zebrafish embryos. For these experiments, embryos were treated with varying concentrations of AA-PMe or AA from 24 to 72 hours postfertilization prior to morphological observation, angiogenesis assessment, and endogenous alkaline

  17. Introducing the AAS Working Group on Astroinformatics and Astrostatistics

    Science.gov (United States)

    Ivezic, Zeljko

    2014-01-01

    In response to two White Papers submitted to the Astro2010 Decadal Survey (1,2), a new AAS Working Group on Astroinformatics and Astrostatistics (WGAA) has been approved by the AAS Council at the 220th Meeting, June 2012, in Anchorage. The motivation for this WG is the growing importance of the interface between astronomy and various branches of applied mathematics, computer science and the emerging field of data science. With the new data-intensive projects envisioned for the coming decade, the need for advice derived from the focused attention of a group of AAS members who work in these areas is bound to increase. The Working Group is charged with spreading awareness of rapidly advancing computational techniques, sophsticated statistical methods, and highly capble software to further the goals of astronomical and astrophysical research. The three main strategic goals adopted by the WGAA Steering Committee for the next few years are to: (i) develop, organize and maintain methodological resources (such as software tools, papers, books, and lectures); (ii) enhance human resources (such as foster the creation of career paths, establish a Speakers' Bureau, establish and maintain an archived discussion forum, enable periodic news distribution); and (iii) organize topical meetings. The WGAA Steering Committee at this time includes twelve members: Kirk Borne, George Djorgovski, Eric Feigelson, Eric Ford, Alyssa Goodman, Joe Hilbe, Zeljko Ivezic (chair), Ashish Mahabal, Aneta Siemiginowska, Alex Szalay, Rick White, and Padma Yanamandra-Fisher. I will summarize our accomplishments since July 2012. (1) Astroinformatics: A 21st Century Approach to Astronomy (Borne & 90 coauthors), (2) The Astronomical Information Sciences: A Keystone for 21st-Century Astronomy (Loredo & 72 coauthors)

  18. Effect of precipitates on mechanical properties of AA2195

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jae-Hee [Launcher Structure and Materials Team, Korea Aerospace Research Institute, Daejeon (Korea, Republic of); Jeun, Jeong-Hoon [Department of Materials Science and Engineering, Seoul National University, Seoul (Korea, Republic of); Chun, Hyun-Jin [Southeast University, Nanjing (China); Lee, Ye Rim [Department of Aerospace System Engineering, University of Science & Technology, Daejeon (Korea, Republic of); Yoo, Joon-Tae [Launcher Structure and Materials Team, Korea Aerospace Research Institute, Daejeon (Korea, Republic of); Yoon, Jong-Hoon [Launcher Structure and Materials Team, Korea Aerospace Research Institute, Daejeon (Korea, Republic of); Department of Aerospace System Engineering, University of Science & Technology, Daejeon (Korea, Republic of); Lee, Ho-Sung, E-mail: hslee@kari.re.kr [Launcher Structure and Materials Team, Korea Aerospace Research Institute, Daejeon (Korea, Republic of); Department of Aerospace System Engineering, University of Science & Technology, Daejeon (Korea, Republic of)

    2016-06-05

    Addition of 1–4 wt.% lithium into a conventional Al–Cu–Mg alloy allows lower density and higher mechanical properties, which are attractive for aerospace applications. In this study, fundamental investigations including phase and microstructure evolution, resulting in strengthening, of the AA2195 are conducted to observe a possibility of production with commercial level. Precipitation sequence and kinetics during post-annealing were evaluated with variations of temperature and holding time. Microstructures revealed formation and evolution in representative precipitates including θ (Al{sub 2}Cu), ß′ (Al{sub 3}Zr), and T (Al{sub x}Li{sub y}Cu) series. Aluminum alloys have low hardness, modulus, and strength before aging, but precipitates such as θ′ (Al{sub 2}Cu), ß′ (Al{sub 3}Zr), and T{sub 1} (Al{sub 2}LiCu) show enhanced mechanical properties of AA2195 tempered because of their interaction with dislocation. However, longer holding time and higher annealing temperature result in significant decreases in mechanical properties due to the presence of incoherent precipitates (θ phase) and coarsening of the precipitates via grain-boundary diffusion. In the current study, the tensile strength of 560 MPa was obtained with post-heat treatment without work hardening. This value has never been achieved in other studies. The maximum strength was reported as 500 MPa without a work hardening process. - Highlights: • A relationship between microstructure and mechanical properties to post annealing AA2195. • A formation and dissolution of the precipitates were observed for various treatment. • An optimum post-annealing condition was obtained.

  19. Temperature sensitive riboflavin mutants of Penicillium vermiculatum Dangeard

    International Nuclear Information System (INIS)

    Mitra, J.; Chaudhari, K.L.

    1974-01-01

    Two temperature sensitive UV induced riboflavin mutants rib 1 and rib 6 have been physiologically and genetically characterized. The two mutants behave differently with regard to their temperature sensitivity. The rib 1 mutant exhibits a leaky growth in minimal medium between 15 0 C and 30 0 C but grows well when the medium is supplemented with riboflavin. At 35 0 C the growth response of the mutant is at its max. and at 40 0 C and below 15 0 C it ceases to grow. The rib 6 mutant which is red brown in colour shows wild type character at temp. below 25 0 C in minimal medium but requires riboflavin at 30 0 C and above. Heterokaryotic analysis revealed the nonallelic nature of the two temperature mutants. Genetic tests of allelic relationship between riboflavin markers by crossing were also done. (author)

  20. Mutants of Cercospora kikuchii altered in cercosporin synthesis and pathogenicity

    Energy Technology Data Exchange (ETDEWEB)

    Upchurch, R.G.; Walker, D.C.; Rollins, J.A.; Ehrenshaft, M.; Daub, M.E. (North Carolina State Univ., Raleigh (United States))

    1991-10-01

    The authors have obtained spontaneous and UV-induced stable mutants, altered in the synthesis of cercosporin, of the fungal soybean pathogen Cercospora kikuchii. The mutants were isolated on the basis of colony color on minimal medium. The UV-induced mutants accumulated, at most, 2% of wild-type cercosporin levels on all media tested. In contrast, cercosporin accumulation by the spontaneous mutants was strongly medium regulated, occurring only on potato dextrose medium but at concentrations comparable to those produced by the wild-type strain. UV-induced mutants unable to synthesize cercosporin on any medium were unable to incite lesions when inoculated onto the soybean host. Cercosporin was reproducibly isolated from all inoculated leaves showing lesions. Although cercosporin involvement in disease has been indirectly suggested by many previous studies, this is the first report in which mutants blocked in cercosporin synthesis have been used to demonstrate that cercosporin is a crucial pathogenicity factor for this fungal genus.