
Sample records for aa household alkaline

  1. Alkaline phosphatases and aminopeptidases are altered in a Cry11Aa resistant strain of Aedes aegypti. (United States)

    Lee, Su-Bum; Aimanova, Karlygash G; Gill, Sarjeet S


    Bacillus thuringiensis subsp. israelensis (Bti) is widely used for the biological control of mosquito populations. However, the mechanism of Bti toxins is still not fully understood. To further elucidate the mechanism of Bti toxins, we developed an Aedes aegypti resistant strain that shows high-level resistance to Cry11Aa toxin. After 27 selections with Cry11Aa toxin, the larvae showed a 124-fold resistance ratio for Cry11Aa (strain G30). G30 larvae showed cross-resistance to Cry4Aa (66-fold resistance), less to Cry4Ba (13-fold), but not to Cry11Ba (2-fold). Midguts from these resistant larvae did not show detectable difference in the processing of the Cry11Aa toxin compared to that in susceptible larvae (WT). Brush border membrane vesicles (BBMV) from resistant larvae bound slightly less Cry11Aa compared to WT BBMV. To identify potential proteins associated with Cry11A resistance, not only transcript changes in the larval midgut were analyzed using Illumina sequencing and qPCR, but alterations of previously identified receptor proteins were investigated using immunoblots. The transcripts of 375 genes were significantly increased and those of 208 genes were down regulated in the resistant larvae midgut compared to the WT. None of the transcripts for previously identified receptors of Cry11Aa (Aedes cadherin, ALP1, APN1, and APN2) were altered in these analyses. The genes for the identified functional receptors in resistant larvae midgut did not contain any mutation in their sequences nor was there any change in their transcript expression levels compared to WT. However, ALP proteins were expressed at reduced levels (∼ 40%) in the resistant strain BBMV. APN proteins and their activity were also slightly reduced in resistance strain. The transcript levels of ALPs (AAEL013330 and AAEL015070) and APNs (AAEL008158, AAEL008162) were significantly reduced. These results strongly suggest that ALPs and APNs could be associated with Cry11Aa resistance in Ae. aegypti. PMID

  2. Influence of the degree of polishing of alloy AA 5083 on its behaviour against localised alkaline corrosion

    International Nuclear Information System (INIS)

    A study has been conducted of the influence of the surface finish on the behaviour against the corrosion of samples of alloy AA 5083 immersed in aerated solutions of NaCl at 3.5%. Samples polished from 80 to 1200 grit have been tested, utilising as experimental techniques, measurements of weight loss, optical and scanning electron microscopy, linear polarisations and electrochemical noise measurement (ENM). In the conditions studied, the principal corrosion process that takes place is localised alkaline corrosion (LAC). This type of corrosion occurs as a consequence of the alkalinisation of the area surrounding the Al(Mn,Fe,Cr) cathodic precipitates that exist in the alloy. The results obtained indicate that the samples polished to 1200 grit present a greater susceptibility to processes of localised alkaline corrosion than the samples polished to 80 grit. It has been found that the degree of polishing conditions the number of intermetallic particles exposed. Hence the differences of behaviour observed between the sets of results obtained have been interpreted as an effect function of the density of cathodic intermetallic particles exposed on the surface

  3. The effect of nickel on alloy microstructure and electrochemical behaviour of AA1050 aluminium alloy in acid and alkaline solutions

    International Nuclear Information System (INIS)

    The study investigates the influence of nickel and magnesium additions to AA1050 aluminium alloy on the alloy electrochemical behaviour in sodium hydroxide and hydrochloric solutions under conditions relevant to industries that use alkaline etching as a standard surface treatment procedure and to the lithographic and electronic industries where surface convolution is assisted by pitting in hydrochloric acid. Scanning and transmission electron microscopes were used to characterize the intermetallic particles, and scanning Kelvin probe microscopy was utilised in monitoring the surface potential. Nickel is shown to be incorporated into second phase particles, which mostly consisted of Al3Fe and α-(AlFeSi) phases, resulting in enhanced cathodic activity on the aluminium surface. Consequently, the dissolution rates of the superpure aluminium, alloys without nickel addition and alloy with nickel addition are increased respectively in sodium hydroxide, and increased pitting is respectively promoted in hydrochloric acid. In contrast, the addition of magnesium to the alloy had negligible influence on the etching and pitting behaviour.

  4. Evolution of the corrosion process of AA 2024-T3 in an alkaline NaCl solution with sodium dodecylbenzenesulfonate and lanthanum chloride inhibitors (United States)

    Zhou, Biner; Wang, Yishan; Zuo, Yu


    The evolution of the corrosion process of AA 2024-T3 in 0.58 g L-1 NaCl solution (pH 10) with sodium dodecylbenzenesulfonate (SDBS) and lanthanum chloride inhibitors was studied with electrochemical and surface analysis methods. With the addition of the compounded LaCl3 and SDBS inhibitors, in the early stage the polarization behavior of AA 2024-T3 changed from active corrosion to passivation, and both the general corrosion and pitting corrosion were inhibited. However, with the immersion time extended, the passive behavior gradually disappeared and pitting happened at the Cu-rich phases. After 24 h immersion, the compounded inhibitors still showed good inhibition for general corrosion, but the polarization curve again presented the characteristic similar to active polarization. The compounded inhibitors also inhibited the pitting corrosion to some extent. The acting mechanism of the inhibitors SDBS and La3Cl on the corrosion process of AA 2024-T3 in the test solution was discussed.

  5. Household Finance


    Campbell, John


    The welfare benefits of financial markets depend in large part on how effectively households use these markets. The study of household finance is challenging because household behavior is difficult to measure accurately, and because households face constraints that are not captured by textbook models, including fixed costs, uninsurable income risk, borrowing constraints, and contracts that are non-neutral with respect to inflation. Evidence on participation, diversification, and the exercise ...

  6. AA Index (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa index provides a long climatology of global geomagnetic activity using 2 antipodal observatories at Greenwich and Melbourne- IAGA Bulletin 37,...

  7. Household Products (United States)

    The products you use for cleaning, carpentry, auto repair, gardening, and many other household uses can contain ingredients that can harm you, your family, and the environment. These include Oven and ...

  8. Rating AAs. (United States)

    Carter, Susan J.


    Why alternative investments? In a word: performance. Many higher education endowment and foundation managers are making increasing commitments to alternative investments, or AAs, in order to obtain higher returns and broader diversification for their investment portfolios than public securities instruments can usually provide. Learn how to handle…

  9. Rural Households

    DEFF Research Database (Denmark)

    Bruun, Ole


    Based on a comprehensive survey and subsequent fieldwork, this chapter introduces the socio-economic characteristics and common livelihood strategies of rural households in Quang Nam, Central Vietnam. It demonstrates the basic premise of self-reliance in rural society and the decreasing economic ...... limitations of informal organization and community adaptive capacities, and finally, it discusses the issues of vulnerability and adaptation to climatic and environmental change from a household perspective.......Based on a comprehensive survey and subsequent fieldwork, this chapter introduces the socio-economic characteristics and common livelihood strategies of rural households in Quang Nam, Central Vietnam. It demonstrates the basic premise of self-reliance in rural society and the decreasing economic...

  10. Household Savings

    DEFF Research Database (Denmark)

    Browning, Martin; Lusardi, Annamaria

    suggested in the informal saving literature can be captured in the standard optimizing model. Particular attention is given to recent work on the precautionary motive and its implications for saving and consumption behavior. We also discuss the "behavioral" or "psychological" approach that eschews the use...... the recent empirical literature on the precautionary motive. We conclude that although some households do seem to have a significant precautionary motive at some points in their life cycle, this motive is not so strong empirically as some investigators suggest......In this survey, we review the recent theoretical and empirical literature on household saving and consumption. The discussion is structured around a list of motives for saving and how well the standard theory captures these motives. We show that almost all of the motives for saving that have been...

  11. Household Saving in Australia


    Richard Finlay; Fiona Price


    This paper investigates household saving behaviour in Australia, as well as the drivers behind the recent rise in the aggregate household saving ratio. Our results explaining differences in saving behaviour across households are consistent with theory and previous findings. As might be expected, households' saving ratios tend to increase with income, but decrease with wealth and gearing. Financially constrained and migrant households tend to save more than other households, all else equal. Wh...

  12. Antibacterials in Household Products (United States)

    ... products such as soaps, detergents, health and skincare products and household cleaners. How do antibacterials work? ♦ Antibacterials may be ... contain triclosan or other biocide agents? Antibacterials in household products Are there any risks associated with triclosan-containing ...

  13. Household Safety: Preventing Choking (United States)

    ... Tropical Delight: Melon Smoothie Pregnant? Your Baby's Growth Household Safety: Preventing Choking KidsHealth > For Parents > Household Safety: ... and often contain small parts. Make sure small refrigerator magnets are out of your child's reach. Check ...

  14. Culture and Household Saving


    Guin, Benjamin


    In this paper, I examine the role of culture for households' saving decisions. Exploiting historical language borders within Switzerland, I isolate the effect of culture from economic, institutional, demographic and geographic factors for a homogeneous and representative sample of households. The analysis is based on the Swiss Household Panel that I complement with geographic and socio-economic data. I show that households located in the Romanic-speaking part (Italian, French) are more than 1...

  15. Unemployment and Household formation


    Ebrahim, Amina; Woolard, Ingrid; Leibbrandt, Murray


    In comparison to other continents, Africa has received little scholarly attention with regard to household composition. Household composition is endogenous to a variety of welfare issues and little is understood about the determinants of this composition. Understanding the household composition and formation decision may improve our understanding of how the unemployed gain access to resources and how household composition could provide a safety net to the unemployed. However, increasingly, mo...

  16. ALP (Alkaline Phosphatase) Test (United States)

    ... Also known as: ALK PHOS; Alkp Formal name: Alkaline Phosphatase Related tests: AST ; ALT ; GGT ; Bilirubin ; Liver Panel ; Bone Markers ; Alkaline Phosphatase Isoenzymes; Bone Specific ALP All content on ...

  17. Antiproton Accumulator (AA)

    CERN Multimedia

    Photographic Service


    The AA in its final stage of construction, before it disappeared from view under concrete shielding. Antiprotons were first injected, stochastically cooled and accumulated in July 1980. From 1981 on, the AA provided antiprotons for collisions with protons, first in the ISR, then in the SPS Collider. From 1983 on, it also sent antiprotons, via the PS, to the Low-Energy Antiproton Ring (LEAR). The AA was dismantled in 1997 and shipped to Japan.

  18. Gambling households in Canada. (United States)

    MacDonald, Martha; McMullan, John L; Perrier, David C


    This paper examines the distribution of gambling dollars in Nova Scotia, Saskatchewan and Canada and studies the impact of this spending on households. We focus first on how gambling expenditures are related to the level and source of household income as well as to other demographic characteristics such as age, education, household composition, geographical area, and sources of income. Next we analyze how gambling expenditures are distributed among those households that gamble. We show how expenditure patterns differ in the intensity of gambling as measured by the proportion of household income or total amount of dollars spent on gambling. Then we study the affects that gambling has on spending on household necessities, changes in net worth, retirement savings and household debt. Finally we determine whether gambling expenditures act as a substitute or a complement to other recreational spending on entertainment products and services. Throughout the paper we offer a comparative analysis of provincial and national data. PMID:15353922

  19. AA magnet measurement team

    CERN Multimedia


    Quickly improvised measurement equipment for the AA (Antiproton Accumulator) was all the tight schedule permitted, but the high motivation of the team made up for the lack of convenience. From left to right: Roy Billinge (Joint AA Project Leader, the other one was Simon van der Meer); Bruno Autin, Brian Pincott, Colin Johnson.

  20. Consumer Behaviour of Households


    Netrdová, Blanka


    The thesis is focused on the consumer behavior of the households in the period from 2003 to 2013. The theoretical part is divided into two parts, household consumption from the perspective of marketing, and from the perspective of economics. In the marketing section explains the concepts of consumer, household, consumer credit, consumer behavior, consumer predisposition and the buying decision process. In the section dedicated to economics concepts are explained, the budget line consumption, ...

  1. Household hazardous waste

    DEFF Research Database (Denmark)

    Fjelsted, Lotte; Christensen, Thomas Højlund


    .) comprised 15-25% and foreign items comprised 10-20%. Water-based paint was the dominant part of the paint waste. The chemical composition of the paint waste and the paint-like waste was characterized by an analysis of 27 substances in seven waste fractions. The content of critical substances was tow and the...... incinerated. Allowing household paint waste to be collected with ordinary household waste is expected to reduce the cost of handling household hazardous waste, since paint waste in Denmark comprises the major fraction of household hazardous waste....

  2. AAS 228: Day 1 morning (United States)

    Kohler, Susanna


    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Come visit astrobites at the AAS booth we have swag!Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto hear from undergrads who already know and love the site, educators who want to use it in their classrooms, and students who had not yet been introduced to astrobites and were excited about a new resource!For the rest of the meeting we will be stationed at theAAS booth in the exhibit hall (booth #211-213), so drop by if you want to learn more (or pick up swag: weve got lots of stickers and sunglasses)!Mondaymorning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended this morning.Opening Address(by Susanna Kohler)AAS President Meg Urry kicked off the meeting this morning at 8am with an overview of some of the great endeavors AAS is supporting. We astrobiters had personal motivation to drag ourselves out of bed that early: during this session, Urryannounced the new partnership between AAS and astrobites!Urry touched on some difficult topics in her welcome, including yesterdays tragedy in Orlando. Shereiteratedthe AASs support fortheCommittee for Sexual-Orientation and Gender Minorities in Astronomy (SGMA). She also reminded meeting attendees about the importance ofkeeping conference interactions professional, and pointed to the meetings anti-harassment policy.Partnership Announcement (by Michael Zevin)This morning, the American Astronomical Society announced the new partnership that it will have with Astrobites! We are beyond excited to embark on this new partnership with the

  3. AAS 227: Welcome! (United States)

    Kohler, Susanna


    Greetings from the 227th American Astronomical Society meeting in Kissimmee, Florida! This week, along with several fellow authors from astrobites, Iwill bewritingupdates on selectedevents at themeeting and posting at the end of each day. You can follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.If youre an author or referee (or plan to be!) and youre here at the meeting, consider joining us at our Author and Referee Workshop on Wednesday in the Tallahassee room, where well be sharingsome of the exciting new features of the AAS journals. You can drop intoeither of the two-hour sessions(10 AM 12 PM or 1 PM 3 PM), and there will be afree buffet lunch at noon.Heres the agenda:Morning SessionTopic Speaker10:00 am 10:05 amIntroductionsJulie Steffen10:05 am 10:35 amChanges at AAS Journals; How to Be a Successful AAS AuthorEthan Vishniac10:35 am 11:00 amThe Peer Review ProcessButler Burton11:00 am 11:15 amAAS Nova: Sharing AAS Authors Research with the Broader CommunitySusanna Kohler11:15 am 11:30 amFixing Software and Instrumentation Publishing: New Paper Styles in AAS JournalsChris Lintott11:30 am 11:45 amMaking Article Writing Easier with the New AASTeX v6.0Greg Schwarz11:45 am 12:00 pmBringing JavaScript and Interactivity to Your AAS Journal FiguresGus MuenchLunch SessionTopic Speaker12:00 pm 12:15 pmUnified Astronomy ThesaurusKatie Frey12:15 pm 12:30 pmAAS/ADS ORCID Integration ToolAlberto Accomazzi12:30 pm 12:45 pmWorldWide Telescope and Video AbstractsJosh Peek12:45 pm 01:00 pmArizona Astronomical Data Hub (AADH)Bryan HeidornAfternoon SessionTopic Speaker01:00 pm 01:05 pmIntroductionsJulie Steffen01:05 pm 01:35 pmChanges at AAS Journals; How to Be a Successful AAS AuthorEthan Vishniac01:35 pm 02:00 pmThe Peer Review ProcessButler Burton02:00 pm 02:15 pmAAS Nova: Sharing AAS Authors Research with the Broader CommunitySusanna Kohler02:15 pm 02:30 pm

  4. Geomagnetic aa Indices (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa indices are the continuation of the series beginning in the year 1868. A full description of these indices is given in the International...

  5. Household electricity demand profiles

    DEFF Research Database (Denmark)

    Marszal, Anna Joanna; Heiselberg, Per Kvols; Larsen, Olena Kalyanova


    Highlights •A 1-min resolution household electricity load model is presented. •Model adapts a bottom-up approach with single appliance as the main building block. •Load profiles are used to analyse the flexibility potential of household appliances. •Load profiles can be applied in other domains, e...

  6. Promoting household energy conservation

    International Nuclear Information System (INIS)

    It is commonly assumed that households must change their behaviour to reduce the problems caused by increasing levels of fossil energy use. Strategies for behaviour change will be more effective if they target the most important causes of the behaviour in question. Therefore, this paper first discusses the factors influencing household energy use. Three barriers to fossil fuel energy conservation are discussed: insufficient knowledge of effective ways to reduce household energy use, the low priority and high costs of energy savings, and the lack of feasible alternatives. Next, the paper elaborates on the effectiveness and acceptability of strategies aimed to promote household energy savings. Informational strategies aimed at changing individuals' knowledge, perceptions, cognitions, motivations and norms, as well as structural strategies aimed at changing the context in which decisions are made, are discussed. This paper focuses on the psychological literature on household energy conservation, which mostly examined the effects of informational strategies. Finally, this paper lists important topics for future research

  7. Anodes for alkaline electrolysis (United States)

    Soloveichik, Grigorii Lev


    A method of making an anode for alkaline electrolysis cells includes adsorption of precursor material on a carbonaceous material, conversion of the precursor material to hydroxide form and conversion of precursor material from hydroxide form to oxy-hydroxide form within the alkaline electrolysis cell.

  8. Alkaline "Permanent" Paper. (United States)

    Pacey, Antony


    Discussion of paper manufacturing processes and their effects on library materials focuses on the promotion of alkaline "permanent" paper, with less acid, by Canadian library preservation specialists. Standards for paper acidity are explained; advantages of alkaline paper are described, including decreased manufacturing costs; and recyclability is…

  9. Ruthenium determination in synthetic Purex waste solutions by AAS

    International Nuclear Information System (INIS)

    A method for the determination of ruthenium in synthetic Purex waste solutions by flame AAS is described. With the usual flames and a lanthanum buffer, only cerium interference in the air-acetylene flame need be considered under the conditions applied. Ruthenium nitrosyl nitrate, ruthenium(IV) hydroxychloride and alkaline ruthenate samples gave identical results, showing that the extraordinarily stable Ru-NO bond does not hinder atomization. The preparation and standardization of the ruthenium nitrosyl solutions, and the alkaline fusion, are briefly described. (author)

  10. Alkaline battery operational methodology

    Energy Technology Data Exchange (ETDEWEB)

    Sholklapper, Tal; Gallaway, Joshua; Steingart, Daniel; Ingale, Nilesh; Nyce, Michael


    Methods of using specific operational charge and discharge parameters to extend the life of alkaline batteries are disclosed. The methods can be used with any commercial primary or secondary alkaline battery, as well as with newer alkaline battery designs, including batteries with flowing electrolyte. The methods include cycling batteries within a narrow operating voltage window, with minimum and maximum cut-off voltages that are set based on battery characteristics and environmental conditions. The narrow voltage window decreases available capacity but allows the batteries to be cycled for hundreds or thousands of times.

  11. Household Chemical Emergencies (United States)

    ... and disposing of the material according to the manufacturer’s directions. It is critical to store household chemicals in places where children cannot access them. Remember that products such as aerosol cans of hair spray and deodorant, nail polish ...

  12. Household hazardous waste

    DEFF Research Database (Denmark)

    Fjelsted, Lotte; Christensen, Thomas Højlund


    .) comprised 15-25% and foreign items comprised 10-20%. Water-based paint was the dominant part of the paint waste. The chemical composition of the paint waste and the paint-like waste was characterized by an analysis of 27 substances in seven waste fractions. The content of critical substances was tow and the......'Paint waste', a part of the 'household hazardous waste', amounting to approximately 5 tonnes was collected from recycling stations in two Danish cities. Sorting and analyses of the waste showed paint waste comprised approximately 65% of the mass, paint-like waste (cleaners, fillers, etc...... paint waste was less contaminated with heavy metals than was the ordinary household waste. This may suggest that households no longer need to source-segregate their paint if the household waste is incinerated, since the presence of a small quantity of solvent-based paint will not be harmful when...

  13. Household Hazards to Pets (United States)

    ... pennies (those minted after 1982 contain zinc) and alkaline batteries (like those in your remote controls) can ... artist’s or other specialty paints may contain heavy metals or volatile substances that could become harmful if ...

  14. Uranium in alkaline rocks

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, M.; Wollenberg, H.; Strisower, B.; Bowman, H.; Flexser, S.; Carmichael, I.


    Geologic and geochemical criteria were developed for the occurrence of economic uranium deposits in alkaline igneous rocks. A literature search, a limited chemical analytical program, and visits to three prominent alkaline-rock localities (Ilimaussaq, Greenland; Pocos de Caldas, Brazil; and Powderhorn, Colorado) were made to establish criteria to determine if a site had some uranium resource potential. From the literature, four alkaline-intrusive occurrences of differing character were identified as type-localities for uranium mineralization, and the important aspects of these localities were described. These characteristics were used to categorize and evaluate U.S. occurrences. The literature search disclosed 69 U.S. sites, encompassing nepheline syenite, alkaline granite, and carbonatite. It was possible to compare two-thirds of these sites to the type localities. A ranking system identified ten of the sites as most likely to have uranium resource potential.

  15. Uranium in alkaline rocks

    International Nuclear Information System (INIS)

    Geologic and geochemical criteria were developed for the occurrence of economic uranium deposits in alkaline igneous rocks. A literature search, a limited chemical analytical program, and visits to three prominent alkaline-rock localities (Ilimaussaq, Greenland; Pocos de Caldas, Brazil; and Powderhorn, Colorado) were made to establish criteria to determine if a site had some uranium resource potential. From the literature, four alkaline-intrusive occurrences of differing character were identified as type-localities for uranium mineralization, and the important aspects of these localities were described. These characteristics were used to categorize and evaluate U.S. occurrences. The literature search disclosed 69 U.S. sites, encompassing nepheline syenite, alkaline granite, and carbonatite. It was possible to compare two-thirds of these sites to the type localities. A ranking system identified ten of the sites as most likely to have uranium resource potential

  16. AAS Career Services (United States)

    Marvel, Kevin B.


    The American Astronomical Society provides substantial programs in the area of Career Services.Motivated by the Society's mission to enhance and share humanity's understanding of the Universe, the AAS provides a central resource for advertising positions, interviewing opportunities at its annual winter meeting and information, workshops and networks to enable astronomers to find employment.The programs of the Society in this area are overseen by an active committee on employment and the AAS Council itself.Additional resources that help characterize the field, its growth and facts about employment such as salaries and type of jobs available are regularly summarized and reported on by the American Institute of Physics.

  17. AAS Oral History Project (United States)

    Buxner, Sanlyn; Holbrook, Jarita; AAS Oral History Team


    Now in its fourth year, the AAS Oral History Project has interviewed over 80 astronomers from all over the world. Led by the AAS Historical Astronomy Division (HAD) and partially funded by the American Institute of Physics Niels Bohr Library and ongoing support from the AAS, volunteers have collected oral histories from astronomers at professional meetings starting in 2015, including AAS, DPS, and the IAU general assembly. Each interview lasts one and a half to two hours and focuses on interviewees’ personal and professional lives. Questions include those about one’s family, childhood, strong influences on one’s scientific career, career path, successes and challenges, perspectives on how astronomy is changing as a field, and advice to the next generation. Each interview is audio recorded and transcribed, the content of which is checked with each interviewee. Once complete, interview transcripts are posted online as part of a larger oral history library at Future analysis will reveal a rich story of astronomers and will help the community address issues of diversity, controversies, and the changing landscape of science. We are still recruiting individuals to be interviewed from all stages of career from undergraduate students to retired and emeritus astronomers. Contact Jarita Holbrook to schedule an interview or to find out more information about the project ( Also, contact Jarita Holbrook if you would like to become an interviewer for the project.

  18. Household Tax Compliance in Albania


    Edward Christie; Mario Holzner


    This paper applies a set of indicators of tax compliance to the household sector in Albania. These estimates are performed using available data for the years 1996 to 2003. Estimates of income declaration rates and of corresponding undeclared household income are computed using household final consumption data from national accounts and household survey data as well as detailed data on household taxation. Specific aspects such as remittances and the role of agriculture are explicitly taken int...

  19. Household skills and low wages


    Dale, Kristin


    Household skills provide job skills when tasks in jobs and household production are similar and jobs produce substitutes for home-made services. Opportunity costs of higher education are foregone earnings during schooling and foregone household production while studying and later in life. I show that individuals in jobs requiring household skills accept lower wage rates than traditional human capital theory predicts, and that individuals with low household skills tend to enter higher educatio...

  20. Use of Internet by households


    Humlová, Veronika


    This work is engaged in analysis of internet usage by the households by Czech households. The first part of work defines the basic concepts of Internet such as internet history, types of internet connection or the possibilities of its use. I tis followed by concrete analysis of trends in Internet usage by households in the Czech Republic, according to several aspects. The basic aspect is the share of households connected to the Internet to the total number of households. Next the work analyze...

  1. The Antiproton Accumulator (AA)

    CERN Multimedia


    Section 06 - 08*) of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A vacuum-tank, two bending magnets (BST06 and BST07 in blue) with a quadrupole (QDN07, in red) in between, another vacuum-tank, a wide quadrupole (QFW08) and a further tank . The tanks are covered with heating tape for bake-out. The tank left of BST06 contained the stack core pickup for stochastic cooling (see 7906193, 7906190, 8005051), the two other tanks served mainly as vacuum chambers in the region where the beam was large. Peter Zettwoch works on BST06. *) see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984)

  2. Lighting and social practices - what role does lighting play for low energy house (LEH) households and LED frontrunners?

    DEFF Research Database (Denmark)

    Jensen, Charlotte Louise

    dimensions influence how people use and relate to lighting. Assessing how very distinctive contexts of households (that diverge from an exemplary kind of household), such as low energy houses and LED frontrunner households, use and understand lighting, may give some insight into what may trigger or hamper a......As lighting in Danish households consume approximately 1.3 TWh every year, reducing electricity consumption from lighting is important. Studies have shown that a mere substitution of inefficient lighting technologies towards more efficient ones may not be possible, as many social and cultural...... transition towards less electricity-consuming lighting patterns....

  3. AA, bending magnet, BLG

    CERN Multimedia


    The very particular lattice of the AA required 2 types of dipole (bending magnets; BLG, long and narrow; BST, short and wide). The BLG had a steel length of 4.70 m, a good field width of 0.24 m, and a weight of about 70 t. Jean-Claude Brunet inspects the lower half of a BLG. For the BST magnets see 7811105 and 8006036.

  4. The Antiproton Accumulator (AA)

    CERN Multimedia


    A section of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A large vacuum-tank, a quadrupole (QDN09*), a bending magnet (BST08), another vacuum-tank, a wide quadrupole (QFW08) and (in the background) a further bending magnet (BST08). The tanks are covered with heating tape for bake-out. The tank left of QDN09 contained the kickers for stochastic pre-cooling (see 790621, 8002234, 8002637X), the other one served mainly as vacuum chamber in the region where the beam was large. Peter Zettwoch works on QFW08. * see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984) See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  5. Study of the alloying additives and alkaline zincate solution effects on the commercial aluminum as galvanic anode for use in alkaline batteries

    International Nuclear Information System (INIS)

    The corrosion behavior of different grades of commercial aluminum such as AA1040, AA5083, AA6060 and AA7075 in ZnO-containing 4 M NaOH has been determined by using open circuit potential-time measurements (OCP), galvanostatic and potentiodynamic polarization and electrochemical impedance spectroscopy (EIS). The results of scanning electron microscopy (SEM) and energy dispersive analysis of X-ray (EDAX) reveal that ZnO produces the inhibition effect by the formation of a zinc-containing deposit layer on the surface of aluminum electrodes. Although the influence of zincating on the performance of aluminum alloys and considering the amount of alloying elements such as zinc, magnesium and manganese in AA7075 and AA5083 alloys is much more than AA6060 one, the AA6060 aluminum exhibits negligible corrosion rate. Alloying aluminum with other elements and modifying the composition of the electrolyte is a necessary condition for reducing the self-corrosion of the aluminum anodes, whereas the proportion of the amount of additive elements is sufficient and important condition. As AA6060 with a low amount of Zn and Mg, but the high value of the ratio of (Mg/Zn) content (>400) can serve as a good galvanic anode in the alkaline media. - Highlights: • Decreasing the corrosion rate of tested alloys in 4 M NaOH solution specially AA6060. • Lowering the extent of anodic polarization at a current density of 50 mA cm−2. • High inhibitor efficiency about 97% for AA6060

  6. Study of the alloying additives and alkaline zincate solution effects on the commercial aluminum as galvanic anode for use in alkaline batteries

    Energy Technology Data Exchange (ETDEWEB)

    Rashvand avei, M. [Department of Chemistry, K.N. Toosi University of Technology, P.O. Box 15875-4416, Tehran (Iran, Islamic Republic of); Jafarian, M., E-mail: [Department of Chemistry, K.N. Toosi University of Technology, P.O. Box 15875-4416, Tehran (Iran, Islamic Republic of); Moghanni Bavil Olyaei, H. [Department of Chemistry, K.N. Toosi University of Technology, P.O. Box 15875-4416, Tehran (Iran, Islamic Republic of); Gobal, F. [Department of Chemistry, Sharif University of Technology, P.O. Box 11365-8516, Tehran (Iran, Islamic Republic of); Hosseini, S.M. [Jahad Organization – Science and Technology Center, Tehran (Iran, Islamic Republic of); Mahjani, M.G. [Department of Chemistry, K.N. Toosi University of Technology, P.O. Box 15875-4416, Tehran (Iran, Islamic Republic of)


    The corrosion behavior of different grades of commercial aluminum such as AA1040, AA5083, AA6060 and AA7075 in ZnO-containing 4 M NaOH has been determined by using open circuit potential-time measurements (OCP), galvanostatic and potentiodynamic polarization and electrochemical impedance spectroscopy (EIS). The results of scanning electron microscopy (SEM) and energy dispersive analysis of X-ray (EDAX) reveal that ZnO produces the inhibition effect by the formation of a zinc-containing deposit layer on the surface of aluminum electrodes. Although the influence of zincating on the performance of aluminum alloys and considering the amount of alloying elements such as zinc, magnesium and manganese in AA7075 and AA5083 alloys is much more than AA6060 one, the AA6060 aluminum exhibits negligible corrosion rate. Alloying aluminum with other elements and modifying the composition of the electrolyte is a necessary condition for reducing the self-corrosion of the aluminum anodes, whereas the proportion of the amount of additive elements is sufficient and important condition. As AA6060 with a low amount of Zn and Mg, but the high value of the ratio of (Mg/Zn) content (>400) can serve as a good galvanic anode in the alkaline media. - Highlights: • Decreasing the corrosion rate of tested alloys in 4 M NaOH solution specially AA6060. • Lowering the extent of anodic polarization at a current density of 50 mA cm{sup −2}. • High inhibitor efficiency about 97% for AA6060.

  7. AAS 228: Day 1 morning (United States)

    Kohler, Susanna


    extraterrestrial life. The jets are highly alkaline and may contain molecular hydrogen, which links the inorganic and living worlds as a reactant and energy source. Although Cassinis very fruitful mission will come to a close in 2017 with a death spiral into Saturn, the future is still bright for Enceladus. Glein closed with a preview of the next mission to this special moon: ELF, the Enceladus Life Finder, will fly through and analyze Enceladuss icy plume in unprecedented detail using state-of-the-art instruments and is predicted to fly in 2031. 102: The NASA K2 Mission (by Meredith Rawls)Everyones favorite planet finding telescope continues to impress. In this morning session, we heard highlights about how the repurposed Kepler mission (K2) is contributing to research in areas ranging from nearby brown dwarfs to extragalactic supernovae. The session kicked off with an overview by Knicole Colon, who happily reported extended funding for K2 through 2018, when its fuel is projected to run out. Colon: despite a glitch in the celebratory cake, #K2mission has been extended until the end of life! #aas228 Geert Barentsen (@GeertHub) June 13, 2016Bradley Tucker discussed recent extragalactic results from K2, and supernovae in particular. So far, the Kepler Extragalactic Survey has found 17 supernovae and they hope to find at least 20 more in the next three years. Because Kepler observations are so frequent, they reveal previously hidden subtleties in how supernovae fade over time..@btucker22: #K2mission is providing a statistical sample of high-precision supernova lightcurves! #aas228 Geert Barentsen (@GeertHub) June 13, 2016Of course, exoplanet science is still a primary goal for the K2 team. Matthew Penny updated us on the status of the in-progress microlensing campaign, which uses Kepler to search for one-off brightening events that indicate the presence of a planet due to gravitational microlensing. Work is also underway by

  8. The Rise in Household Saving


    Richard Finlay; Fiona Price


    This article investigates household saving behaviour in Australia and the drivers behind the sharp rise in saving that occurred in the late 2000s after an extended period of decline. Saving behaviour is important as, among other things, it influences household consumption, which accounts for a little over half of GDP. The rise in household saving appears to have been underpinned by precautionary motives, a reduction in expected future income gains for some types of households and an effort to...

  9. Efficient Intra-Household Allocations

    DEFF Research Database (Denmark)

    Browning, Martin

    households which have more than one member. We make minimal assumptions about how the individual members of the household resolve conflicts. All we assume is that however decisions are made, outcomes are efficient. We refer to this as the collective setting. We show that in the collective setting household...

  10. Is knowledge shared within households?


    Basu, Kaushik; Narayan, Ambar; Ravallion, Martin


    According to theory, a member of a collective-action household may or may not share knowledge with others in that household. Shared income gains from shared knowledge may well be offset by a shift in the balance of power within the family. But do literate members of the household share the benefits of literacy with other members of the household in practice? Using household survey data for Bangladesh, the authors find that education has strong external effects on individual earnings. When a r...

  11. Alkaline quinone flow battery. (United States)

    Lin, Kaixiang; Chen, Qing; Gerhardt, Michael R; Tong, Liuchuan; Kim, Sang Bok; Eisenach, Louise; Valle, Alvaro W; Hardee, David; Gordon, Roy G; Aziz, Michael J; Marshak, Michael P


    Storage of photovoltaic and wind electricity in batteries could solve the mismatch problem between the intermittent supply of these renewable resources and variable demand. Flow batteries permit more economical long-duration discharge than solid-electrode batteries by using liquid electrolytes stored outside of the battery. We report an alkaline flow battery based on redox-active organic molecules that are composed entirely of Earth-abundant elements and are nontoxic, nonflammable, and safe for use in residential and commercial environments. The battery operates efficiently with high power density near room temperature. These results demonstrate the stability and performance of redox-active organic molecules in alkaline flow batteries, potentially enabling cost-effective stationary storage of renewable energy. PMID:26404834

  12. Alkaline broadening in Stars

    CERN Document Server

    De Kertanguy, A


    Giving new insight for line broadening theory for atoms with more structure than hydrogen in most stars. Using symbolic software to build precise wave functions corrected for ds;dp quantum defects. The profiles obtained with that approach, have peculiar trends, narrower than hydrogen, all quantum defects used are taken from atomic database topbase. Illustration of stronger effects of ions and electrons on the alkaline profiles, than neutral-neutral collision mechanism. Keywords : Stars: fundamental parameters - Atomic processes - Line: profiles.

  13. Alkaline quinone flow battery


    Lin, Kaixiang; Chen, Qing; Gerhardt, Michael; Tong, Liuchuan; Kim, Sang Bok; Eisenach, Louise Ann; Valle, Alvaro West; Hardee, D.; Gordon, Roy Gerald; Aziz, Michael J.; Marshak, M


    Storage of photovoltaic and wind electricity in batteries could solve the mismatch problem between the intermittent supply of these renewable resources and variable demand. Flow batteries permit more economical long-duration discharge than solid-electrode batteries by using liquid electrolytes stored outside of the battery. We report an alkaline flow battery based on redox-active organic molecules that are composed entirely of Earth-abundant elements and are nontoxic, nonflammable, and safe f...

  14. AAS 227: Day 2 (United States)

    Kohler, Susanna


    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  15. AAS 227: Day 2 (United States)

    Kohler, Susanna


    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  16. AAS 227: Day 1 (United States)

    Kohler, Susanna


    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or at, or catch ourlive-tweeted updates from the @astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto have so many people tell us that they already know about and useastrobites, and we were excited to introduce a new cohort of students at AAS to astrobites for the first time.Tuesday morning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended today.Opening Address (by Becky Smethurst)The President of the AAS, aka our fearless leader Meg Urry kicked off the meeting this morning at the purely coffee powered hour of 8am this morning. She spoke about the importance of young astronomers at the meeting (heres looking at you reader!) and also the importance of the new Working Group for Accessibility and Disabilities (aka WGAD pronounced like wicked) at the AAS. The Society has made extra effort this year to make the conference accessible to all,a message which was very well received by everyone in attendance.Kavli Lecture: New Horizons Alan Stern (by Becky Smethurst)We were definitely spoilt with the first Plenary lecture at this years conference Alan Stern gave us a a review of the New Horizons mission of the Pluto Fly By (astrobites covered the mission back in July with this post). We were treated to beautiful images, wonderful results and a foray into geology.Before (Hubble) and after #NewHorizons. #thatisall #science #astro alanstern #aas227 Science News (@topsciencething) January 5, 2016Some awesome facts from the lecture that blew my mind:New Horizons is now 2AU (!) beyond Pluto

  17. The Household Registration System

    Directory of Open Access Journals (Sweden)


    Full Text Available Although longitudinal experimental community health research is crucial to testing hypotheses about the demographic impact of health technologies, longitudinal demographic research field stations are rare, owing to the complexity and high cost of developing requisite computer software systems. This paper describes the Household Registration System (HRS, a software package that has been used for the rapid development of eleven surveillance systems in sub-Saharan Africa and Asia. Features of the HRS automate software generation for a family of surveillance applications, obviating the need for new and complex computer software systems for each new longitudinal demographic study.

  18. Feedback on household electricity consumption

    DEFF Research Database (Denmark)

    Grønhøj, Alice; Thøgersen, John


    In this paper, we present results from a project aiming to develop a new feedback technology to support sustainable living in private households. Against the backdrop of a review of the relevant literature and based on qualitative family interviews and registration of the households' electricity...... consumption, we evaluate the effects of giving households detailed feedback about their electricity consumption on a small liquid crystal display (LCD) screen. Twenty Danish households participated in the study over a 5-month period. A new feedback system was developed in a user-involved innovation process....... The average electricity saving in participating households is estimated to 8.1%, compared with a 0.8% saving in the control group. The qualitative interviews revealed that the feedback made household electricity consumption more visible and salient, and empowered electricity consumers to take action...

  19. Survival strategies of Serbian households

    Directory of Open Access Journals (Sweden)

    Babović Marija


    Full Text Available Concept of household strategies was firstly used in poverty surveys in Africa and Latin America, and lately developed in economic changes surveys in Western developed societies. Connecting the structure and action, macro and micro level of analysis and focusing on households, rather than individual as basic unit of analysis, the concept opened possibilities for better understanding of household economic behavior during social and economic changes. New developments concept experienced in numerous surveys in post-socialist as well as 'post-fordists' societies. The economic household strategies surveys were conducted in Serbia in two waves - in summer of 2000. and autumn of 2002. Comparative analysis of results has not show significant changes in socio-economic position of households. However, changes were evident in the field of action (economic strategies of households and individuals. Decreasing of passive and defensive strategies and increasing of pro-active, particularly working strategies were significant trends from survey.

  20. The Multitasking of Household Production


    Kalenkoski, Charlene Marie; Foster, Gigi


    The standard household production model does not incorporate multitasking, although time-diary data reveal that individuals regularly multi-task. We formulate a model where time spent in child care can be sole-tasked or multitasked with other household production activities. This model implies associations between household productivity factors and both child outcomes and parental time use. We then use data from the Longitudinal Study of Australian Children and the Australian Time Use Surveys...

  1. Alkaline Phosphatase in Stem Cells

    Directory of Open Access Journals (Sweden)

    Kateřina Štefková


    Full Text Available Alkaline phosphatase is an enzyme commonly expressed in almost all living organisms. In humans and other mammals, determinations of the expression and activity of alkaline phosphatase have frequently been used for cell determination in developmental studies and/or within clinical trials. Alkaline phosphatase also seems to be one of the key markers in the identification of pluripotent embryonic stem as well as related cells. However, alkaline phosphatases exist in some isoenzymes and isoforms, which have tissue specific expressions and functions. Here, the role of alkaline phosphatase as a stem cell marker is discussed in detail. First, we briefly summarize contemporary knowledge of mammalian alkaline phosphatases in general. Second, we focus on the known facts of its role in and potential significance for the identification of stem cells.

  2. AAS 227: Day 3 (United States)

    Kohler, Susanna


    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 3 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Henry Norris Russell Lecture: Viewing the Universe with Infrared Eyes: The Spitzer Space Telescope (by Erika Nesvold)The Henry Norris Russell Award is the highest honor given by the AAS, for a lifetime of eminence in astronomy research. This years award went to Giovanni Fazio of the Harvard-Smithsonian Center for Astrophysics. Fazio became a leader in gamma ray astronomy before switching mid-career to the study of infrared astronomy, and he gave his award lecture on the latter subject, specifically on the Spitzer Space Telescope, one of the most successful infrared telescopes of all time.Artists rendering of the Spitzer space telescope. [NASA/JPL-Caltech]Spitzer has been operating for more than twelve years, and has resulted in over six thousand papers in refereed journals in that time. The telescope sits in an Earth-trailing orbit around the Sun, and is now farther from the Earth (1.4 AU) than the Earth is from the Sun. Fazio gave the audience a fascinating overview of the science done by Spitzer over more than a decade. One of the most productive areas of research for Spitzer is the study of exoplanets, which hadnt even been discovered when the Spitzer Telescope was first conceived. Spitzers high sensitivity and ability to observe exoplanets over

  3. Alkaline fuel cells applications (United States)

    Kordesch, Karl; Hacker, Viktor; Gsellmann, Josef; Cifrain, Martin; Faleschini, Gottfried; Enzinger, Peter; Fankhauser, Robert; Ortner, Markus; Muhr, Michael; Aronson, Robert R.

    On the world-wide automobile market technical developments are increasingly determined by the dramatic restriction on emissions as well as the regimentation of fuel consumption by legislation. Therefore there is an increasing chance of a completely new technology breakthrough if it offers new opportunities, meeting the requirements of resource preservation and emission restrictions. Fuel cell technology offers the possibility to excel in today's motive power techniques in terms of environmental compatibility, consumer's profit, costs of maintenance and efficiency. The key question is economy. This will be decided by the costs of fuel cell systems if they are to be used as power generators for future electric vehicles. The alkaline hydrogen-air fuel cell system with circulating KOH electrolyte and low-cost catalysed carbon electrodes could be a promising alternative. Based on the experiences of Kordesch [K. Kordesch, Brennstoffbatterien, Springer, Wien, 1984, ISBN 3-387-81819-7; K. Kordesch, City car with H 2-air fuel cell and lead-battery, SAE Paper No. 719015, 6th IECEC, 1971], who operated a city car hybrid vehicle on public roads for 3 years in the early 1970s, improved air electrodes plus new variations of the bipolar stack assembly developed in Graz are investigated. Primary fuel choice will be a major issue until such time as cost-effective, on-board hydrogen storage is developed. Ammonia is an interesting option. The whole system, ammonia dissociator plus alkaline fuel cell (AFC), is characterised by a simple design and high efficiency.

  4. AAS 228: Day 4 (United States)

    Kohler, Susanna


    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  5. Characterization and function analysis of a Halo-alkaline-adaptable Trk K~+ uptake system in Alkalimonas amylolytica strain N10

    Institute of Scientific and Technical Information of China (English)

    GUO YongHao; XUE YanFen; LIU Jun; WANG QuanHui; MA YanHe


    By functional complementation of Escherichia coli mutants defective in potassium (K~+) uptake, two genes that are required for K~+ uptake in halo-alkaliphilic Alkalimonas amylolytica strain N10 were cloned. These two genes, Aa-trkA (1337 bp) and Aa-trkH (1452 bp), were adjacent on the A. amylolytica N10 chromosome and transcribed in opposite directions. Complementation experiments revealed that Aa-TrkA and Aa-TrkH from A. amylolytica strain N10 restored the ability to grow at low K~+ concentration in E. coli △trkA and △trkG △trkH strains, respectively. In addition, Aa-TrkAH supported the growth of an E. coli △sapD strain, indicating that the ATP-binding protein TrkE was dispensable for the Trk system of A. amylolytica strain N10. The net K~+ uptake was detected at different pH levels and the critical NaCl concentration indicated that Aa-TrkAH is an alkaline-adaptable and partially halo-adaptable K~+ transporter. Kinetics determined by heterogeneous K~+ transport experiments with an E. coli △trkA strain revealed that Aa-TrkAH has an alkaline pH optimum close to 8.5 or higher. Site-directed mutagenesis of Aa-TrkH showed that Phe103 and Ser229 play certain key roles in K~+ selection and transportation. The molecular chaperones groES-groEL and tig promoted Aa-TrkH and Aa-TrkA overexpression in vitro.

  6. Characterization and function analysis of a Halo-alkaline-adaptable Trk K~+ uptake system in Alkalimonas amylolytica strain N10

    Institute of Scientific and Technical Information of China (English)


    By functional complementation of Escherichia coli mutants defective in potassium (K+) uptake, two genes that are required for K+ uptake in halo-alkaliphilic Alkalimonas amylolytica strain N10 were cloned. These two genes, Aa-trkA (1337 bp) and Aa-trkH (1452 bp), were adjacent on the A. amylolytica N10 chromosome and transcribed in opposite directions. Complementation experiments revealed that Aa-TrkA and Aa-TrkH from A. amylolytica strain N10 restored the ability to grow at low K+ concentration in E. coli △trkA and △trkG △trkH strains, respectively. In addition, Aa-TrkAH supported the growth of an E. coli △sapD strain, indicating that the ATP-binding protein TrkE was dispensable for the Trk system of A. amylolytica strain N10. The net K+ uptake was detected at different pH levels and the critical NaCl concentration indicated that Aa-TrkAH is an alkaline-adaptable and partially halo-adaptable K+ transporter. Kinetics determined by heterogeneous K+ transport experiments with an E. coli △trkA strain revealed that Aa-TrkAH has an alkaline pH optimum close to 8.5 or higher. Site-directed mutagenesis of Aa-TrkH showed that Phe103 and Ser229 play certain key roles in K+ selection and transportation. The molecular chaperones groES-groEL and tig promoted Aa-TrkH and Aa-TrkA overexpression in vitro.

  7. The Drentsche Aa valley system

    International Nuclear Information System (INIS)

    This thesis is composed of five papers concerned with Late Quaternary geology and geomorphology of the Aa valley system. The correlation and chronostratigraphic position of the layers have been established by radiocarbon dating. (Auth.)

  8. AAS 227: Day 4 (United States)

    Kohler, Susanna


    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  9. Bifunctional alkaline oxygen electrodes (United States)

    Swette, L.; Kackley, N.; Mccatty, S. A.


    The authors describe the identification and testing of electrocatalysts and supports for the positive electrode of moderate-temperature, single-unit, rechargeable alkaline fuel cells. Recent work on Na(x)Pt3O4, a potential bifunctional catalyst, is described, as well as the application of novel approaches to the development of more efficient bifunctional electrode structures. The three dual-character electrodes considered here showed similar superior performance; the Pt/RhO2 and Rh/RhO2 electrodes showed slightly better performance than the Pt/IrO2 electrode. It is concluded that Na(x)Pt3O4 continues to be a promising bifunctional oxygen electrode catalyst but requires further investigation and development.

  10. Silica in alkaline brines (United States)

    Jones, B.F.; Rettig, S.L.; Eugster, H.P.


    Analysis of sodium carbonate-bicarbonate brines from closed basins in volcanic terranes of Oregon and Kenya reveals silica contents of up to 2700 parts per million at pH's higher than 10. These high concentrations of SiO 2 can be attributed to reaction of waters with silicates, and subsequent evaporative concentration accompanied by a rise in pH. Supersaturation with respect to amorphous silica may occur and persist for brines that are out of contact with silicate muds and undersaturated with respect to trona; correlation of SiO2 with concentration of Na and total CO2 support this interpretation. Addition of moredilute waters to alkaline brines may lower the pH and cause inorganic precipitation of substantial amounts of silica.

  11. AAS 228: Day 4 (United States)

    Kohler, Susanna


    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  12. Changing Age and Household Patterns

    DEFF Research Database (Denmark)

    Højbjerg Jacobsen, Rasmus; Hougaard Jensen, Svend E.


    , lone parents and cohabiting couples. Focusing on components of welfare services with noticeable differences in unit costs across age and household status, we find that changes in age structures have improved public finances by 1.6% of GDP whereas changing household structures have worsened public......This paper studies the effects on tax revenues and welfare expenditures in Denmark caused by changes in age and household structures over the years 1982-2007. During that period, there has been a minor fall in the old-age dependency ratio, and a major increase in the number of people living alone...... finances by almost 1% of GDP on the yearly budget. While the net fiscal effect of changing household structures is minor, the gross effects are substantial. In a future characterized by population ageing, public finances may be adversely affected by changes in both age and household structures, thus...

  13. AAS 227: Day 4 (United States)

    Kohler, Susanna


    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  14. Food discard practices of householders. (United States)

    Van Garde, S J; Woodburn, M J


    Food discard patterns and reasons were determined for a sample of 243 households in Oregon. Personal interviews were conducted, and 7-day records of discards were collected. Discards over a 3-day period also were collected from a subsample of 50. The householder's estimate of amount, converted from measures to grams using food composition tables, was found to be 97% of the actual grams of food, as weighed in the laboratory. Households discarded an average of 1,587 gm ($2.88) food in a 7-day period on the basis of the 79% completed usable records. Major reasons were poor quality for fruits and vegetables; storage time for meat, fish, and poultry; non-use of leftovers for combination dishes; and plate waste for cereals and dairy products. Twenty-nine percent of the discarded food (by cost) was considered to be unsafe to eat by the householder. Aesthetic factors dominated decisions by the 18- to 25-year age group, but experiences related to food storage were the basis for decisions by half of the respondents more than 65 years old. Discards increased with number of members in the household and were influenced by age of children. Household income was not linearly related to amount of discard. As household refrigerator temperatures increased from 1.7 degrees C to 20 degrees C, the amount of discards also increased. Consumers generally lacked criteria for evaluating the safety of foods. PMID:3819252

  15. Household vehicles energy consumption 1994

    Energy Technology Data Exchange (ETDEWEB)



    Household Vehicles Energy Consumption 1994 reports on the results of the 1994 Residential Transportation Energy Consumption Survey (RTECS). The RTECS is a national sample survey that has been conducted every 3 years since 1985. For the 1994 survey, more than 3,000 households that own or use some 6,000 vehicles provided information to describe vehicle stock, vehicle-miles traveled, energy end-use consumption, and energy expenditures for personal vehicles. The survey results represent the characteristics of the 84.9 million households that used or had access to vehicles in 1994 nationwide. (An additional 12 million households neither owned or had access to vehicles during the survey year.) To be included in then RTECS survey, vehicles must be either owned or used by household members on a regular basis for personal transportation, or owned by a company rather than a household, but kept at home, regularly available for the use of household members. Most vehicles included in the RTECS are classified as {open_quotes}light-duty vehicles{close_quotes} (weighing less than 8,500 pounds). However, the RTECS also includes a very small number of {open_quotes}other{close_quotes} vehicles, such as motor homes and larger trucks that are available for personal use.

  16. Modulators of intestinal alkaline phosphatase. (United States)

    Bobkova, Ekaterina V; Kiffer-Moreira, Tina; Sergienko, Eduard A


    Small molecule modulators of phosphatases can lead to clinically useful drugs and serve as invaluable tools to study functional roles of various phosphatases in vivo. Here, we describe lead discovery strategies for identification of inhibitors and activators of intestinal alkaline phosphatases. To identify isozyme-selective inhibitors and activators of the human and mouse intestinal alkaline phosphatases, ultrahigh throughput chemiluminescent assays, utilizing CDP-Star as a substrate, were developed for murine intestinal alkaline phosphatase (mIAP), human intestinal alkaline phosphatase (hIAP), human placental alkaline phosphatase (PLAP), and human tissue-nonspecific alkaline phosphatase (TNAP) isozymes. Using these 1,536-well assays, concurrent HTS screens of the MLSMR library of 323,000 compounds were conducted for human and mouse IAP isozymes monitoring both inhibition and activation. This parallel screening approach led to identification of a novel inhibitory scaffold selective for murine intestinal alkaline phosphatase. SAR efforts based on parallel testing of analogs against different AP isozymes generated a potent inhibitor of the murine IAP with IC50 of 540 nM, at least 65-fold selectivity against human TNAP, and >185 selectivity against human PLAP. PMID:23860652

  17. Saving for Retirement: Household Bargaining and Household Net Worth


    Shelly J. Lundberg; Jennifer Ward-Batts


    Traditional economic models of savings treat the household as a single individual, and do not allow for the separate preferences of and possible conflicts of interest between husbands and wives. Since wives are typically younger than their husbands and life expectancy for women exceeds that for men, wives may prefer to save more for retirement than do their husbands. This suggests that households in which wives have greater relative bargaining power may accumulate greater net worth as they ap...

  18. Alkaline battery, separator therefore (United States)

    Schmidt, George F. (Inventor)


    An improved battery separator for alkaline battery cells has low resistance to electrolyte ion transfer and high resistance to electrode ion transfer. The separator is formed by applying an improved coating to an electrolyte absorber. The absorber, preferably, is a flexible, fibrous, and porous substrate that is resistant to strong alkali and oxidation. The coating composition includes an admixture of a polymeric binder, a hydrolyzable polymeric ester and inert fillers. The coating composition is substantially free of reactive fillers and plasticizers commonly employed as porosity promoting agents in separator coatings. When the separator is immersed in electrolyte, the polymeric ester of the film coating reacts with the electrolyte forming a salt and an alcohol. The alcohol goes into solution with the electrolyte while the salt imbibes electrolyte into the coating composition. When the salt is formed, it expands the polymeric chains of the binder to provide a film coating substantially permeable to electrolyte ion transfer but relatively impermeable to electrode ion transfer during use.

  19. Household vehicles energy consumption 1991

    Energy Technology Data Exchange (ETDEWEB)


    The purpose of this report is to provide information on the use of energy in residential vehicles in the 50 States and the District of Columbia. Included are data about: the number and type of vehicles in the residential sector, the characteristics of those vehicles, the total annual Vehicle Miles Traveled (VMT), the per household and per vehicle VMT, the vehicle fuel consumption and expenditures, and vehicle fuel efficiencies. The data for this report are based on the household telephone interviews from the 1991 RTECS, conducted during 1991 and early 1992. The 1991 RTECS represents 94.6 million households, of which 84.6 million own or have access to 151.2 million household motor vehicles in the 50 States and the District of Columbia.

  20. Car use within the household

    DEFF Research Database (Denmark)

    de Borger, Bruno; Mulalic, Ismir; Rouwendal, Jan


    In this paper we study the demand for car kilometres in two-car households, focusing on the substitution between cars in response to fuel price changes. We use a large sample of detailed Danish data on two-car households to estimate—for each car owned by the household—own and cross-price effects...... of increases in fuel costs per kilometre. The empirical results show that failure to capture substitution between cars within the household can result in substantial misspecification biases. Ignoring substitution, we estimate fuel price elasticities of –0.81 and -0.65 for the primary and secondary cars...... efficient car, finding partial support for the underlying hypothesis. More importantly, the results of this extended model emphasize the importance of behavioural differences related to the position of the most fuel efficient car in the household, suggesting that households’ fuel efficiency choices...

  1. Marriage in Rural Philippine Households


    Evenson, Robert E.


    Utilizing intergenerational data from a sample of rural households in Laguna Province, this article tests the proposition that rural families are responsive to economic conditions as choices are made regarding children’s educational needs, their location and occupation choices.

  2. Simulating Household Waste Management Behaviours


    Peter Tucker; Andrew Smith


    The paper reports the outcome of research to demonstrate the proof of concept for simulating individual, collective and interactive household waste management behaviours to provide a tool for efficient integrated waste management planning. The developed model simulates whole communities as distributions of individual households engaged in managing their own domestic waste, through home composting or recycling activities. The research addresses the personal hierarchical ordering of these activ...

  3. Sale of electricity to households

    International Nuclear Information System (INIS)

    The Company Slovenske elektrarne (SE) Predaj has after two years of presence in the market expanded their business activities to the households segment. The first customers can be particularly employees of Slovenske elektrarne. This chance will be provided to them starting from 1 October of this year. 'The electricity supplies for households will only be supplementary segment of sales at SE Predaj Company. We will still focus mainly at businesses with higher consumption,' says director of the Company Mr. Stanislav Reguli. (author)

  4. Education, Preferences, and Household Welfare


    Fafchamps, Marcel; Shilpi, Forhad


    Using census data from Nepal, we examine how the marginal effects of male and female education on various household welfare indicators vary with education levels. Parental education is associated with better household outcomes, but marginal effects vary with education level. Higher child survival for instace, is associated with higher primary education for mothers and higher secondary education for fathers. We calculate conditional marginal effects that correct for assortative matching of ...

  5. Household finances and social interaction


    Brown, S; Taylor, K.


    In this paper, we investigate the relationship between social interaction and household finances using data from the British Household Panel Survey. We explore how social interaction influences the probability of holding different types of unsecured debt and assets, as well as how social interaction influences the levels of unsecured debt, financial assets and net worth held. Our findings suggest that social interaction has a positive influence upon the types of financial assets held, which i...

  6. Households' Interest-bearing Assets


    Ellis Connolly; Fiona Fleming; Jarkko Jääskelä


    Households invest around two-fifths of their financial assets in interest-bearing assets. These assets are predominantly held directly in deposits and also via superannuation and other investment funds. Deposits have grown strongly in recent years, although there has been no growth in interest-bearing securities. Compared with other advanced economies, interest-bearing assets represent a relatively small share of financial assets. For the household sector as a whole, interest-bearing assets a...

  7. Household Consumption and Personal Bankruptcy


    Ning Zhu


    This paper utilizes the population of personal bankruptcy filers in the state of Delaware during 2003 and finds that household expenditures on durable consumption goods, such as houses and automobiles, contribute significantly to personal bankruptcy filings. Medical conditions also lead to personal bankruptcy filings, but other adverse events, such as divorce and unemployment, have marginal effects. My findings suggest that consumption patterns make households financially overstretched and mo...

  8. Effects of pH and chloride concentration on pitting corrosion of AA6061 aluminum alloy

    Energy Technology Data Exchange (ETDEWEB)

    Zaid, B. [Division de Technologie du Combustible, Departement de Metallurgie, Centre de Recherche Nucleaire de Draria, BP. 43 Seballa, Draria (Algeria)], E-mail:; Saidi, D. [Division de Technologie du Combustible, Departement de Metallurgie, Centre de Recherche Nucleaire de Draria, BP. 43 Seballa, Draria (Algeria); Benzaid, A. [Divisionde Physique et Application Nucleaires, Departement Application Nucleaires, Centre de Recherche Nucleaire de Draria, BP. 43 Seballa, Draria (Algeria); Hadji, S. [Division de Technologie du Combustible, Departement du combustible, Centre de Recherche Nucleaire de Draria, BP. 43 Seballa, Draria (Algeria)


    Effects of pH solution and chloride (Cl{sup -}) ion concentration on the corrosion behaviour of alloy AA6061 immersed in aqueous solutions of NaCl have been investigated using measurements of weight loss, potentiodynamic polarisation, linear polarisation, cyclic polarisation experiment combined with open circuit potential transient technique and optical or scanning electron microscopy. The corrosion behaviour of the AA6061 aluminum alloy was found to be dependant on the pH and chloride concentration [NaCl] of solution. In acidic or slightly neutral solutions, general and pitting corrosion occurred simultaneously. In contrast, exposure to alkaline solutions results in general corrosion. Experience revealed that the alloy AA6061 was susceptible to pitting corrosion in all chloride solution of concentration ranging between 0.003 wt% and 5.5 wt% NaCl and an increase in the chloride concentration slightly shifted both the pitting E{sub pit} and corrosion E{sub cor} potentials to more active values. In function of the conditions of treatment, the sheets of the alloy AA6061 undergo two types of localised corrosion process, leading to the formation of hemispherical and crystallographic pits. Polarisation resistance measurements in acidic (pH = 2) and alkaline chloride solutions (pH = 12) which are in good agreement with those of weight loss, show that the corrosion kinetic is minimised in slightly neutral solutions (pH = 6)

  9. The alkaline and alkaline-carbonatite magmatism from Southern Brazil (United States)

    Ruberti, E.; Gomes, C. D. B.; Comin-Chiaramonti, P.


    Early to Late Cretaceous lasting to Paleocene alkaline magmatism from southern Brazil is found associated with major extensional structural features in and around the Paraná Basin and grouped into various provinces on the basis of several data. Magmatism is variable in size, mode of occurrence and composition. The alkaline rocks are dominantly potassic, a few occurrences showing sodic affinity. The more abundant silicate rocks are evolved undersaturated to saturated in silica syenites, displaying large variation in igneous forms. Less evolved types are restricted to subvolcanic environments and outcrops of effusive suites occur rarely. Cumulatic mafic and ultramafic rock types are very common, particularly in the alkali-carbonatitic complexes. Carbonatite bodies are represented by Ca-carbonatites and Mg-carbonatites and more scarcely by Fe-carbonatites. Available radiometric ages for the alkaline rocks fit on three main chronological groups: around 130 Ma, subcoveal with the Early Cretaceous flood tholeiites of the Paraná Basin, 100-110 Ma and 80-90 Ma (Late Cretaceous). The alkaline magmatism also extends into Paleocene times, as indicated by ages from some volcanic lavas. Geochemically, alkaline potassic and sodic rock types are distinguished by their negative and positive Nb-Ta anomalies, respectively. Negative spikes in Nb-Ta are also a feature common to the associated tholeiitic rocks. Sr-Nd-Pb systematics confirm the contribution of both HIMU and EMI mantle components in the formation of the alkaline rocks. Notably, Early and Late Cretaceous carbonatites have the same isotopic Sr-Nd initial ratios of the associated alkaline rocks. C-O isotopic Sr-Nd isotopic ratios indicate typical mantle signature for some carbonatites and the influence of post-magmatic processes in others. Immiscibility of liquids of phonolitic composition, derived from mafic alkaline parental magmas, has been responsible for the origin of the carbonatites. Close association of alkaline

  10. Is amyloid A (AA) amyloidosis always secondary?


    Maury, C P; Törnroth, T; Wegelius, O


    The case is reported of a patient with systemic AA amyloidosis associated with non-specific mesenteric lymphadenitis and chronic sideropenia. Renal, small bowel, and rectal biopsies showed amyloid deposits containing AA protein, as defined by potassium permanganate sensitivity and by reactivity with AA antiserum. Reversal of the nephrotic syndrome occurred during steroid-azathioprine therapy.

  11. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor


    Pérez, Claudia; Fernandez, Luisa E.; Sun, Jianguang; Folch, Jorge Luis; Gill, Sarjeet S.; Soberón, Mario; Bravo, Alejandra


    Bacillus thuringiensis subsp. israelensis produces crystal proteins, Cry (4Aa, 4Ba, 10Aa, and 11Aa) and Cyt (1Aa and 2Ba) proteins, toxic to mosquito vectors of human diseases. Cyt1Aa overcomes insect resistance to Cry11Aa and Cry4 toxins and synergizes the toxicity of these toxins. However, the molecular mechanism of synergism remains unsolved. Here, we provide evidence that Cyt1Aa functions as a receptor of Cry11Aa. Sequential-binding analysis of Cyt1Aa and Cry11Aa revealed that Cyt1Aa bind...

  12. Alkaline protease from Thermoactinomyces sp. RS1 mitigates industrial pollution. (United States)

    Verma, Amit; Ansari, Mohammad W; Anwar, Mohmmad S; Agrawal, Ruchi; Agrawal, Sanjeev


    Proteases have found a wide application in the several industrial processes, such as laundry detergents, protein recovery or solubilization, prion degradation, meat tenderizations, and in bating of hides and skins in leather industries. But the main hurdle in industrial application of proteases is their economical production on a large scale. The present investigation aimed to exploit the locally available inexpensive agricultural and household wastes for alkaline protease production using Thermoactinomyces sp. RS1 via solid-state fermentation (SSF) technique. The alkaline enzyme is potentially useful as an additive in commercial detergents to mitigate pollution load due to extensive use of caustic soda-based detergents. Thermoactinomyces sp. RS1 showed good protease production under SSF conditions of 55 °C, pH 9, and 50 % moisture content with potato peels as solid substrate. The presented findings revealed that crude alkaline protease produced by Thermoactinomyces sp. RS1 via SSF is of potential application in silver recovery from used X-ray films. PMID:24122212

  13. Have Labour Market Outcomes Affected Household Structure in South Africa? A Descriptive Analysis of Households


    Farah Pirouz


    This paper seeks to investigate how the demography of households relates to individual labour market outcomes. We comprehensively examine household size and structures in the October Household Surveys 1995, 1997, 1999 and the Labour Force Surveys September 2001 and 2002. Over the 1995-2002 period, the number of households has increased in the face of rising unemployment and the average household size has decreased signifi cantly. A rising proportion of single households mostly drives this res...

  14. Determinants of Soviet Household Income

    Directory of Open Access Journals (Sweden)

    by Kenneth Smith


    Full Text Available World Values Survey data are used to examine household income in the Soviet Union. The data, gathered Summer/Fall 1990, provide a rare opportunity to empirically examine microeconomic factors influencing a Soviet household’s position in the regional/national income distribution. The survey contains data - collected regionally - from the three Baltic republics, Belarus, and the Moscow region. The data indicate certain patterns that existed and determined Soviet household income though there are often considerable regional variations. Further, there are marked differences between income distribution determinants in the Soviet Union and the U.S. and West Germany though similarities exist as well

  15. Burning Issue: Handling Household Burns (United States)

    ... take steps to avoid household burns. Never leave cooking food unattended on the stove. Set your water heater’s thermostat to 120 °F or lower to prevent scalding burns. And install smoke alarms on every floor of your home. Keep yourself and your family safe from unexpected ...

  16. Inflation differentials among Czech households

    Czech Academy of Sciences Publication Activity Database

    Janský, Petr; Hait, Pavel


    Roč. 25, č. 1 (2016), s. 71-84. ISSN 1210-0455 R&D Projects: GA TA ČR(CZ) TD020188 Institutional support: RVO:67985998 Keywords : households * inflation * inflation differentials Subject RIV: AH - Economics Impact factor: 0.500, year: 2014

  17. Households' recycling efforts

    Energy Technology Data Exchange (ETDEWEB)

    Bruvoll, Annegrete; Halvorsen, Bente [Research Department, Statistics Norway, 8131 Dep, N-0033 Oslo (Norway); Nyborg, Karine [The Ragnar Frisch Centre of Economic Research, Gaustadalleen 21, N-0349 Oslo (Norway)


    Households' recycling effort is often argued to be of an insignificant size. It is also frequently argued that this contribution, if significant, is not a cost to households, since it is voluntary. Thus households' use of time and energy are frequently disregarded in cost-benefit analyses of stricter recycling targets. In this survey, based on 1162 interviews, we find that sorting at source involves significant extra use of time and energy in the households. On average, each of those asked reported that they use close to half an hour a week for cleaning, sorting and transporting recyclable waste. On average, 185 h is used per tonne of waste. Four out of ten reported that they use warm or hot water to clean the materials. When investigating the motives for sorting waste, we find that many perceive sorting as mandatory, while some in fact find it a pleasant activity in itself. Moral motives for sorting at source are also widespread. A majority would prefer that a company took over the sorting if this were possible, and on average, the respondents are willing to pay US$ 20/year for this service.

  18. Households' Appetite for Financial Risk


    Susan Black; Lamorna Rogers; Albina Soultanaeva


    Australian households’ appetite for risk appears to have declined in recent years with households having actively shifted their portfolios away from riskier financial assets. The change in the composition of financial assets has been seen across most age and income groups. The shift in households’ actual risk exposures also accords with changes in self-reported preferences for risk.

  19. 2nd Generation Alkaline Electrolysis

    DEFF Research Database (Denmark)

    Yde, Lars; Kjartansdóttir, Cecilia Kristin; Allebrod, Frank; Mogensen, Mogens Bjerg; Møller, Per; Hilbert, Lisbeth R.; Nielsen, Peter Tommy; Mathiesen, Troels; Jensen, Jørgen; Andersen, Lars; Dierking, Alexander

    This report provides the results of the 2nd Generation Alkaline Electrolysis project which was initiated in 2008. The project has been conducted from 2009-2012 by a consortium comprising Århus University Business and Social Science – Centre for Energy Technologies (CET (former HIRC)), Technical...

  20. Laboratory Astrophysics Division of the AAS (LAD) (United States)

    Salama, Farid; Drake, R. P.; Federman, S. R.; Haxton, W. C.; Savin, D. W.


    The purpose of the Laboratory Astrophysics Division (LAD) is to advance our understanding of the Universe through the promotion of fundamental theoretical and experimental research into the underlying processes that drive the Cosmos. LAD represents all areas of astrophysics and planetary sciences. The first new AAS Division in more than 30 years, the LAD traces its history back to the recommendation from the scientific community via the White Paper from the 2006 NASA-sponsored Laboratory Astrophysics Workshop. This recommendation was endorsed by the Astronomy and Astrophysics Advisory Committee (AAAC), which advises the National Science Foundation (NSF), the National Aeronautics and Space Administration (NASA), and the U.S. Department of Energy (DOE) on selected issues within the fields of astronomy and astrophysics that are of mutual interest and concern to the agencies. In January 2007, at the 209th AAS meeting, the AAS Council set up a Steering Committee to formulate Bylaws for a Working Group on Laboratory Astrophysics (WGLA). The AAS Council formally established the WGLA with a five-year mandate in May 2007, at the 210th AAS meeting. From 2008 through 2012, the WGLA annually sponsored Meetings in-a-Meeting at the AAS Summer Meetings. In May 2011, at the 218th AAS meeting, the AAS Council voted to convert the WGLA, at the end of its mandate, into a Division of the AAS and requested draft Bylaws from the Steering Committee. In January 2012, at the 219th AAS Meeting, the AAS Council formally approved the Bylaws and the creation of the LAD. The inaugural gathering and the first business meeting of the LAD were held at the 220th AAS meeting in Anchorage in June 2012. You can learn more about LAD by visiting its website at and by subscribing to its mailing list.

  1. A Picture of Subsidized Households 2009 (United States)

    Department of Housing and Urban Development — Picture of Subsidized Households describes the nearly 5 million households living in HUD-subsidized housing in the United States for the year 2009. Picture 2009...

  2. Household Credit and Saving: Does Policy Matter?


    Peter Lawrence


    This paper surveys the existing literature on the determinants of household savings and credit in developing countries and examines the ways in which macro-level policies might impact on household financial behaviour.

  3. Household Safety: Preventing Poisoning (For Parents) (United States)

    ... spend a lot of time there). continue Cleaning Products and Other Household Chemicals Never put cleaning products in old soda ... poison on the floors of your home. Store household cleaning products and aerosol sprays in a high cabinet far ...

  4. Recent Refrigeration Cycle Technologies for Household Refrigerators (United States)

    Nagatomo, Shigemi

    The household refrigerator is one of the most important and the biggest energy-consuming home appliances. This paper summarize recent refrigeration cycle developments in the field of domestic household refrigerators based on a survey of publications.

  5. Household formation and the great recession


    Timothy Dunne


    During the Great Recession, the rate at which Americans formed households fell sharply. Though the rate has recently picked up, it isn’t fast enough to make up for the shortfall in household formation that occurred over the last several years. An analysis of recent household formation patterns shows that the greatest shortfall occurred among young adults and that it is related to weak economic conditions. Housing choices have shifted as well, with a greater proportion of young households livi...

  6. Intergenerational Developments in Household Saving Behaviour


    Mark Vink


    This paper examines the saving behaviour of different generations of households in New Zealand over the period 1984 to 2010 using data from the Household Economic Survey. The paper employs a life-cycle framework to estimate regression models that identify the influence of age and birth year on household saving rates. Consistent with the life-cycle hypothesis, the results show that household saving rates exhibit a hump shape over the life cycle. The results also indicate significant difference...

  7. Remittances, household expenditure and investment in Guatemala


    Adams, Richard H. Jr.


    The author uses a large household data set from Guatemala to analyze how the receipt of internal remittances (from Guatemala) and international remittances (from the United States) affects the marginal spending behavior of households on various consumption and investment goods. Contrary to other studies, the author finds that households receiving remittances actually spend less at the margin on consumption-food and consumer goods and durables-than do households receiving no remittances. Inste...

  8. Characterization of household food waste in Denmark

    DEFF Research Database (Denmark)

    Edjabou, Vincent Maklawe Essonanawe; Petersen, C.; Scheutz, Charlotte;

    This paper presents a methodology and the results of compositional analysis of food waste from Danish families living in single-family houses. Residual household waste was sampled and manually sorted from 211 single-family houses in the suburb of Copenhagen. The main fractions contributing to the...... household food waste were avoidable vegetable food waste and non-avoidable vegetable food waste. Statistical analysis found a positive linear relationship between household size and the amount of the household food waste....

  9. Household Behavior and the Marriage Market


    Del Boca, Daniela; Flinn, Christopher


    There is some controversy in the field of household economics regarding the efficiency of household decisions. We make the point that a flexible specification of spousal preferences and the household production technology precludes the possibility of using revealed preference data on household time allocations to determine the manner in which spouses interact: efficiently or inefficiently. Under strong, but standard, assumptions regarding marriage market equilibria, marital sorting patterns c...

  10. ICT and Household-Firm Relations


    Lindbeck, Assar; Wikström, Solveig


    This paper discusses how ICT and emerging electronic commerce in consumer products influence the relative efficiency in production of households and firms, resulting in changes in the division of tasks between these two types of agents. Increased information and competence of households, in combination with stiffer competition among firms, will also increase the power of households relative to firms, at least in a long-term perspective with free entry of firms. Households will also get more p...

  11. Households borrowing during a creditless recovery


    Jaanika Meriküll


    This paper investigates the contribution of households to the creditless recovery. We use Estonian cross-sectional microdata on households' assets, liabilities, income, expectations and intention to use credit in 2001-2010. The results indicate that (1) there was a large-scale drop in households demand for credit during the recession and sluggish recovery after the recession. (2) One third of the sluggish recovery in credit demand is explained by changed household endowments such as income re...

  12. Household Food Demand in Rural China


    Davis, John


    Abstract This paper explores rural household food consumption behaviour in China using a large household data set from Jilin Province. Data are classified into four main food groups?grain, vegetable products, animal products and other foods. A household food demand system, incorporating four household characteristics, is estimated using an LA-AIDS model, assuming a three-stage budgeting procedure. Expenditure elasticities for a range of food groups are estimated, with a particular...



    Masanet, Eric


    The term ?household carbon footprint? refers to the total annual carbon emissions associated with household consumption of energy, goods, and services. In this project, Lawrence Berkeley National Laboratory developed a carbon footprint modeling framework that characterizes the key underlying technologies and processes that contribute to household carbon footprints in California and the United States. The approach breaks down the carbon footprint by 35 different household fuel end uses and 3...

  14. Household Willingness to Pay for Organic Products


    Griffith, Rachel; Nesheim, Lars


    We use hedonic prices and purchase quantities to consider what can be learned about household willingness to pay for baskets of organic products and how this varies across households. We use rich scanner data on food purchases by a large number of households to compute household specific lower and upper bounds on willingness to pay for various baskets of organic products. These bounds provide information about willingness to pay for organic without imposing restrictive assumptions on preferen...

  15. Household energy and consumption and expenditures, 1990

    International Nuclear Information System (INIS)

    The purpose of this supplement to the Household Energy Consumption and Expenditures 1990 report is to provide information on the use of energy in residential housing units, specifically at the four Census regions and nine Census division levels. This report includes household energy consumption, expenditures, and prices for natural gas, electricity, fuel oil, liquefied petroleum gas (LPG), and kerosene as well as household wood consumption. For national-level data, see the main report, Household Energy Consumption and Expenditures 1990

  16. Does Reducing Malaria Improve Household Living Standards?


    Laxminarayan, Ramanan


    Living in malaria-endemic regions places an economic burden on households even if they do not actually suffer an episode of malaria. Households living with endemic malaria are less likely to have access to economic opportunities and may have to modify agricultural practices and other household behavior to adapt to their disease environment. Data from Vietnam demonstrate that reductions in malaria incidence through government-financed malaria control programs can contribute to higher household...



    Jakus, Paul M.; Tiller, Kelly; Park, William M., 1952-


    Rising landfill costs have forced solid waste managers to consider waste stream reduction alternatives such as household recycling. Explaining the factors which motivate households to recycle is important to regions where households must bear a large portion of the recycling cost because unit-based garbage disposal fees and curbside recycling are not feasible options. Empirical results indicate that residents are responsive to constraints introduced by the household production technology, suc...

  18. Financial fragility of euro area households


    Ampudia, Miguel; van Vlokhoven, Has; Żochowski, Dawid


    We propose a novel framework to identify distressed households by taking account of both the solvency and the liquidity situation of an individual household. Using the data from the Household Finance and Consumption Survey and the country-level data on non-performing loans we calibrate our metric of distress and estimate stress-test elasticities in response to an interest rate shock, an income shock and a house price shock. We find that, albeit euro area households are relatively resilient as...

  19. Spending time and money within the household

    DEFF Research Database (Denmark)

    Browning, Martin; Gørtz, Mette

    We consider theoretically and empirically the allocation of time and money within the household. The novelty of our empirical work is that we have a survey which provides information on both time use and the allocation of some goods within the household, for the same households. We can consider...

  20. Household Consumption, Investment and Life Insurance

    DEFF Research Database (Denmark)

    Bruhn, Kenneth; Steffensen, Mogens


    This paper develops a continuous-time Markov model for utility optimization of households. The household optimizes expected future utility from consumption by controlling consumption, investments and purchase of lifeinsurance for each person in the household. The optimal controls are investigated...

  1. Division of household tasks and financial management

    NARCIS (Netherlands)

    Antonides, G.


    Both the standard economic model and bargaining theory make predictions about financial management and the division of household labor between household partners. Using a large Internet survey, we have tested several predictions about task divisions reported by Dutch household partners. The division

  2. AA, closed orbit observation pickup

    CERN Multimedia


    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. Werner Sax contemplates his achievement. See also 8001383, 8010042, 8010045.

  3. AA, closed orbit observation pickup

    CERN Multimedia


    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles QFW, at maximum dispersion. See also 8001372, 8001383, 8010045

  4. AA, closed orbit observation pickup

    CERN Multimedia


    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. See also 8001372, 8010042, 8010045

  5. AA, closed orbit observation pickup

    CERN Multimedia


    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles, QFW, at maximum dispersion. See also 8001372,8001383, 8010042

  6. Smart Energy Management for Households


    Sonja van Dam


    The aim of the research presented in this thesis was to infer design-related insights and guidelines to improve the use and effectiveness of home energy management systems (HEMS). This was done through an empirical evaluation of the longitudinal effectiveness of these devices and an exploration of factors that influence their use and effectiveness. Three case studies executed with three different HEMS in households, a life cycle assessment (LCA) on those three HEMS, as well as a reflection on...

  7. Household Poverty Dynamics in Malawi


    Bokosi, Fanwell Kenala


    This paper’s goal is to identify the sources of expenditure and poverty dynamics among Malawian households between 1998 and 2002 and to model poverty transitions in Malawi using a bivariate probit model with endogenous selection to address the "initial conditions' problem. The exogeneity of the initial state is strongly rejected and could result in considerable overstatement of the effects of the explanatory factors. The results of the bivariate probit model do indicate that education of th...

  8. Regional gross disposable household income


    Eddie Holmes


    Presents estimates published in May 2008, an overview of methodology used and future plans for regional economic dataThis article looks at estimates for regional gross disposable household income (GDHI) at current basic prices, published in May 2008. These data are published using the European Union Nomenclature of Units for Territorial Statistics (NUTS) regions. Data are published for the NUTS1, NUTS2 and NUTS3 levels for the period 1995 to 2006. There is an overview of the methodology used ...

  9. Households credits and financial stability


    Cécile Bastidon


    This paper develops a theoretical model of financial intermediation with three original features: first, consideration of all sectors within total outstanding credits, including households; second, the possibility of a non monotic relationship between prices and funding supply volumes in periods of high financial strains; last, the link between interbank credit rationing and other sectors funding rationing. The central bank conducts an unconventional type monetary policy. We show that the int...

  10. Household income, poverty and wealth


    Hauser, Richard


    "This paper concentrates on official statistics on household income, poverty, and wealth. It characterizes the main research questions in this field, and it presents an overview of the available statistics and Scientific Use Files produced by the four Research Data Centers (RDC) in Germany. (RDC of the Federal Statistical Office; RDC of the Statistical Offices of the German states; RDC of the German Labor Office; RCD of the German Pension Insurance). We support the recommendations of a peer r...

  11. Householder triangularization of a quasimatrix


    Trefethen, Lloyd N.


    A standard algorithm for computing the QR factorization of a matrix A is Householder triangularization. Here this idea is generalized to the situation in which A is a quasimatrix, that is, a “matrix” whose “columns” are functions defined on an interval [a,b]. Applications are mentioned to quasimatrix leastsquares fitting, singular value decomposition, and determination of ranks, norms, and condition numbers, and numerical illustrations are presented using the chebfun system.

  12. Development of alkaline fuel cells.

    Energy Technology Data Exchange (ETDEWEB)

    Hibbs, Michael R.; Jenkins, Janelle E.; Alam, Todd Michael; Janarthanan, Rajeswari [Colorado School of Mines, Golden, CO; Horan, James L. [Colorado School of Mines, Golden, CO; Caire, Benjamin R. [Colorado School of Mines, Golden, CO; Ziegler, Zachary C. [Colorado School of Mines, Golden, CO; Herring, Andrew M. [Colorado School of Mines, Golden, CO; Yang, Yuan [Colorado School of Mines, Golden, CO; Zuo, Xiaobing [Argonne National Laboratory, Argonne, IL; Robson, Michael H. [University of New Mexico, Albuquerque, NM; Artyushkova, Kateryna [University of New Mexico, Albuquerque, NM; Patterson, Wendy [University of New Mexico, Albuquerque, NM; Atanassov, Plamen Borissov [University of New Mexico, Albuquerque, NM


    This project focuses on the development and demonstration of anion exchange membrane (AEM) fuel cells for portable power applications. Novel polymeric anion exchange membranes and ionomers with high chemical stabilities were prepared characterized by researchers at Sandia National Laboratories. Durable, non-precious metal catalysts were prepared by Dr. Plamen Atanassov's research group at the University of New Mexico by utilizing an aerosol-based process to prepare templated nano-structures. Dr. Andy Herring's group at the Colorado School of Mines combined all of these materials to fabricate and test membrane electrode assemblies for single cell testing in a methanol-fueled alkaline system. The highest power density achieved in this study was 54 mW/cm2 which was 90% of the project target and the highest reported power density for a direct methanol alkaline fuel cell.

  13. Inconsistent pathways of household waste

    International Nuclear Information System (INIS)

    The aim of this study was to provide policy-makers and waste management planners with information about how recycling programs affect the quantities of specific materials recycled and disposed of. Two questions were addressed: which factors influence household waste generation and pathways? and how reliable are official waste data? Household waste flows were studied in 35 Swedish municipalities, and a wide variation in the amount of waste per capita was observed. When evaluating the effect of different waste collection policies, it was found to be important to identify site-specific factors influencing waste generation. Eleven municipal variables were investigated in an attempt to explain the variation. The amount of household waste per resident was higher in populous municipalities and when net commuting was positive. Property-close collection of dry recyclables led to increased delivery of sorted metal, plastic and paper packaging. No difference was seen in the amount of separated recyclables per capita when weight-based billing for the collection of residual waste was applied, but the amount of residual waste was lower. Sixteen sources of error in official waste statistics were identified and the results of the study emphasize the importance of reliable waste generation and composition data to underpin waste management policies.

  14. Cloning of an alkaline lipase gene from Penicillium cyclopium and its expression in Escherichia coli. (United States)

    Wu, Minchen; Qian, Zhikang; Jiang, Peihong; Min, Taishan; Sun, Chongrong; Huang, Weida


    The gene encoding an alkaline lipase of Penicillium cyclopium PG37 was cloned with four steps of PCR amplification based on different principles. The cloned gene was 1,480 nucleotides in length, consisted of 94 bp of promoter region, and had 6 exons and 5 short introns ranging from 50 to 70 nucleotides. The open reading frame encoded a protein of 285 amino acid residues consisting of a 27-AA signal peptide and a 258-AA mature peptide, with a conserved motif of Gly-X-Ser-X-Gly shared by all types of alkaline lipases. However, this protein had a low homology with lipases of P. camembertii (22.9%), Humicola lanuginosa (25.6%), and Rhizomucor miehei (22.3%) at the amino acid level. The mature peptide-encoding cDNA was cloned and expressed in Escherichia coli on pET-30a for confirmation. A distinct band with a M.W. of 33 kDa was detected on SDS-PAGE. Results of a Western blot analysis and an enzyme activity assay verified the recombinant 33-kDa protein as an alkaline lipase. Its catalytic properties were not changed when compared with its natural counterpart. PMID:12784858

  15. AAS 228: Day 3 afternoon (United States)

    Kohler, Susanna


    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  16. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor. (United States)

    Pérez, Claudia; Fernandez, Luisa E; Sun, Jianguang; Folch, Jorge Luis; Gill, Sarjeet S; Soberón, Mario; Bravo, Alejandra


    Bacillus thuringiensis subsp. israelensis produces crystal proteins, Cry (4Aa, 4Ba, 10Aa, and 11Aa) and Cyt (1Aa and 2Ba) proteins, toxic to mosquito vectors of human diseases. Cyt1Aa overcomes insect resistance to Cry11Aa and Cry4 toxins and synergizes the toxicity of these toxins. However, the molecular mechanism of synergism remains unsolved. Here, we provide evidence that Cyt1Aa functions as a receptor of Cry11Aa. Sequential-binding analysis of Cyt1Aa and Cry11Aa revealed that Cyt1Aa binding to Aedes aegypti brush border membrane vesicles enhanced the binding of biotinylated-Cry11Aa. The Cyt1Aa- and Cry11Aa-binding epitopes were mapped by means of the yeast two-hybrid system, peptide arrays, and heterologous competition assays with synthetic peptides. Two exposed regions in Cyt1Aa, loop beta6-alphaE and part of beta7, bind Cry11Aa. On the other side, Cry11Aa binds Cyt1Aa proteins by means of domain II-loop alpha8 and beta-4, which are also involved in midgut receptor interaction. Characterization of single-point mutations in Cry11Aa and Cyt1Aa revealed key Cry11Aa (S259 and E266) and Cyt1Aa (K198, E204 and K225) residues involved in the interaction of both proteins and in synergism. Additionally, a Cyt1Aa loop beta6-alphaE mutant (K198A) with enhanced synergism to Cry11Aa was isolated. Data provided here strongly indicates that Cyt1Aa synergizes or suppresses resistance to Cry11Aa toxin by functioning as a membrane-bound receptor. Bacillus thuringiensis subsp. israelensis is a highly effective pathogenic bacterium because it produces a toxin and also its functional receptor, promoting toxin binding to the target membrane and causing toxicity. PMID:16339907

  17. AAS 228: Day 3 afternoon (United States)

    Kohler, Susanna


    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  18. Lamination sheet of AA BST magnet

    CERN Multimedia


    The AA had 2 types of bending magnets: BLG (window-frame, long and narrow)and BST (H-type, short and wide). The BST had a very wide aperture, 0.564 m of "good field". To demonstrate the size, the petite AA secretary, Val Mansfield, poses with a lamination sheet. See also 7811105, 7906163, 8006050.

  19. The householders' guide to radon

    International Nuclear Information System (INIS)

    This guide is a follow-up to the leaflet Radon in Houses which was issued previously by the Department of the Environment. It is intended for people who live in areas with high levels of radon. It is written particularly for householders whose homes have already been tested and found to have an appreciable level of radon. It explains what radon is, how it gets into houses and what the effects on health may be. It also outlines some of the ways of reducing the level of radon and gives guidance both on how to get the work done and likely costs. (author)

  20. Households in the smart grid

    DEFF Research Database (Denmark)

    Christensen, Toke Haunstrup; Friis, Freja; Gram-Hanssen, Kirsten

    It is a widespread assumption within the energy sector that the “smart grid” will be a crucial element of a future low-carbon energy system, and households are assigned an important role in this (particularly in relation to balancing consumption and production). However, this raises questions about...... the integration of consumers’ everyday life practices in this system. This paper introduces the ideas of the smart grid and review relevant demonstration projects. Special focus is on the role of consumers and electric vehicles. The paper ends with introducing major research questions and presents a new research...

  1. Financial planning for young households

    DEFF Research Database (Denmark)

    Pedersen, Anne Marie Boiden; Weissensteiner, Alex; Poulsen, Rolf


    uncertainty is described by a scenario tree generated from a vector auto-regressive process for equity returns and interest rate evolution. We find strong evidence of the importance of taking into account the multi-stage nature of the problem, as well as the need to consider the asset and liability sides......We analyze the financial planning problems of young households whose main decisions are how to finance the purchase of a house (liabilities) and how to allocate investments in pension savings schemes (assets). The problems are solved using a multi-stage stochastic programming model where the...

  2. Alkaline fuel cell performance investigation (United States)

    Martin, R. E.; Manzo, M. A.


    An exploratory experimental fuel cell test program was conducted to investigate the performance characteristics of alkaline laboratory research electrodes. The objective of this work was to establish the effect of temperature, pressure, and concentration upon performance and evaluate candidate cathode configurations having the potential for improved performance. The performance characterization tests provided data to empirically establish the effect of temperature, pressure, and concentration upon performance for cell temperatures up to 300 F and reactant pressures up to 200 psia. Evaluation of five gold alloy cathode catalysts revealed that three doped gold alloys had more that two times the surface areas of reference cathodes and therefore offered the best potential for improved performance.

  3. Carbon Dioxide, Energy Taxes and Household Income


    Cathal O'Donoghue


    This paper examines the impact of a carbon tax on the income distribution in Ireland using the 1987 Household Budget Survey. Previous studies have focused on the direct impact of the carbon tax on expenditures on domestic fuels. This study however, drawing on previous work expands the analysis to cover the indirect impact of carbon taxes on other household purchases> A direct and indirect tax would have a less regressive effect on the income distribution than a simple direct tax on household ...

  4. Impact of Weather Shocks on MENA Households


    Wodon, Quentin; Liverani, Andrea


    Do households living in climate affected areas in the MENA region believe that changes in climate patterns and their environment are taking place? Have households been affected by extreme weather events, and if so to what extent and which events have had the largest impact? What are the coping strategies that households declare having used, or could be using to cope with climate change and...

  5. Factor Shares from Household Survey Data


    Rodrigo García Verdú


    This paper proposes a method for estimating the factor shares of labor and capital using cross sectional household survey data containing detailed information on household income by source. It then applies the method to the case of Mexico, a country where factor shares are almost the opposite of those in the United States. The application of this method using data from every available household survey that is representative at the national level, corresponding to the years 1968, 1977, 1984, 1...



    Jakus, Paul M.; Tiller, Kelly; Park, William M.


    Rising landfill costs have forced solid waste managers to consider ways to reduce the waste stream. Using survey data, models explaining the weight of recyclables generated by households are estimated for paper and glass. Results indicate that households respond to the time cost of recycling paper but not glass. The waste generation models imply total monthly willingness to pay for recycling is $5.78 per household. Waste managers may increase the weight of recycled waste stream with programs ...

  7. The Impact of Superannuation on Household Saving


    Ellis Connolly; Marion Kohler


    Over the last 20 years superannuation has grown to be the second largest component of household wealth in Australia after ownership of dwellings. This paper analyses the impact on household saving behaviour of the substantial rise in compulsory contributions to superannuation funds. Our analysis takes account of other macroeconomic developments that are likely to have had a strong influence on the household saving rate over this period, especially the financial deregulation of the 1980s and t...

  8. Household Demand for Broadband Internet in 2010


    Rosston Gregory L.; Savage Scott J; Waldman Donald M.


    This paper uses data from a nationwide survey administered during late 2009 and early 2010 to estimate a random utility model of household preferences for broadband Internet service. Reliability and speed are important service characteristics: the representative household is willing to pay $20 per month for more reliable service; $45 for an improvement in speed from slow to fast; and $48 for an improvement in speed from slow to very fast. A representative household would be willing to pay $79...

  9. Education Financing of Rural Households in China


    Wang, Hua-shu; Moll, Henk


    The purpose of this paper was to examine children’s education financing alternatives among households in rural China. Data on education financing was from a household survey conducted in three poverty villages in Guizhou, China. The difference in financing education by households was verified through non-parametric testing. Findings show that private savings is dominant in financing education of children in school. Formal loans are almost absent even in the highest wealth group examined. The ...

  10. Spending time and money within the household


    Martin BROWNING; Gørtz, Metter


    We consider, both theoretically and empirically, the allocation of time and money within the household. The research question is whether a married person who enjoys more leisure than their partner also receives more consumption (which seems to indicate the outcome of power within the household) or receives less consumption (which seems to indicate differing intrahousehold preferences). We develop a simple parametric structural model with household production that is tested on survey data. We ...

  11. Demographics of South African Households - 1995


    Rantho, Lillian


    This paper provides an overview of the demographics of the South African population based on the October Household Survey (OHS) and the Income and Expenditure Survey (IES), both conducted by Statistics South Africa in 1995. Figures and tables are used throughout to paint a picture of the structure of the South African population, both at household level (IES data) and individual level (OHS data). Specific reference is made to the racial and spatial composition of households and individuals, t...

  12. Excessive household debt: causes, trends and consequences


    Péter Bauer; Mariann Endrész; Regina Kiss; Zsolt Kovalszky; Ádám Martonosi; Olivér Rácz; István Schindler


    The decade preceding the 2008 recession was marked by a rapid rise in household debt in several regions. Strong household lending prior to the recession boosted economic growth in the affected countries, but indebtedness then became one of the main sources of vulnerability of these countries with the onset of the economic crisis. Economies that saw a rapid rise in household debt were characterised by a stronger drop in domestic demand and a longer-than-average recovery time. This analysis foc...

  13. Demand for Nutrients: The Household Production Approach


    Chung, Rebecca H.; Lee, Jonq-Ying; Mark G. Brown


    This study uses the household production theory to study the demand for nutrients, i.e., households purchase a combination of food items from the market and produce the needed nutrients from these food items. By following the traditional household production approach, shadow prices for nutrients in food consumption are calculated. The cost function that generates the shadow prices appears plausible in terms of its elasticities of substitution and factor demand. After obtaining the calculated ...

  14. Financial Satisfaction from Intra-Household Perspectives


    Namkee Ahn; Victoria Ateca; Arantza Ugidos


    We address individuals’ financial satisfaction from the intra-household perspective. Our purpose is twofold. First, we want to contrast the hypothesis of relative income within the household. Does the income level of one individual relative to that of other members of the same household matter in his/her income satisfaction? Second, we want to test procedural utility hypothesis in that different sources of income may contribute differentially to individuals’ income satisfaction. In particular...

  15. Development of electrochemical biosensor based on the immobilisation of alkaline fosfatase for the determination of 2,4-dichlorophenoxyacetic acid

    International Nuclear Information System (INIS)

    An electrochemical biosensor based on the immobilisation of alkaline phosphatase was developed for the determination of 2,4-dichlorophenoxyacetic acid (2,4-D). The biosensor was constructed from the immobilization of alkaline phosphatase enzyme onto a screen-printed electrode (SPE). The ascorbic acid 2-phosphate (AA2P) was used as substrate for the enzymic reaction. The enzyme was entrapped in a hybrid sol-gel/ chitosan material with certain fixed composition. The determination of toxicity of 2,4-D pesticides quantitatively and qualitatively could be carried out by the inhibition of the alkaline phosphatase. A potential of +600 mV was suitable to be used for the oxidation of the products from the enzyme-substrate reaction, where the reaction pH was at 8.5. The linear response range of the biosensor to the AA2P substrates was 10 μM - 80 μM. The inhibition of the alkaline phosphatase enzyme of the 2,4-D biosensor was maximum at 80 ppm 2,4-D (50 % inhibition). (author)

  16. Household energy consumption and expenditures, 1990

    International Nuclear Information System (INIS)

    This report, Household Energy Consumption and Expenditures 1990, is based upon data from the 1990 Residential Energy Consumption Survey (RECS). Focusing on energy end-use consumption and expenditures of households, the 1990 RECS is the eighth in a series conducted since 1978 by the Energy Information Administration (EIA). Over 5,000 households were surveyed, providing information on their housing units, housing characteristics, energy consumption and expenditures, stock of energy-consuming appliances, and energy-related behavior. The information provided represents the characteristics and energy consumption of 94 million households nationwide

  17. Grace DAKASEP alkaline battery separator (United States)

    Giovannoni, R. T.; Lundquist, J. T.; Choi, W. M.


    The Grace DAKASEP separator was originally developed as a wicking layer for nickel-zinc alkaline batteries. The DAKASEP is a filled non-woven separator which is flexible and heat sealable. Through modification of formulation and processing variables, products with a variety of properties can be produced. Variations of DAKASEP were tested in Ni-H2, Ni-Zn, Ni-Cd, and primary alkaline batteries with good results. The properties of DAKASEP which are optimized for Hg-Zn primary batteries are shown in tabular form. This separator has high tensile strength, 12 micron average pore size, relatively low porosity at 46-48 percent, and consequently moderately high resistivity. Versions were produced with greater than 70 percent porosity and resistivities in 33 wt percent KOH as low as 3 ohm cm. Performance data for Hg-Zn E-1 size cells containing DAKASEP with the properties shown in tabular form, are more reproducible than data obtained with a competitive polypropylene non-woven separator. In addition, utilization of active material is in general considerably improved.

  18. Storage Stability Improvement of Copolymer Grafted Polypropylene-AcrylicAcid (PP-AA), by means of Various After Treatment Processes

    International Nuclear Information System (INIS)

    Polypropylene yams that have been subjected to irradiation induced graftco-polymerization with acrylic acid, have gained its moisture regain and dyeability, that fulfilled the requirement as textile material for garment.However, the copolymer grafted PP-AA has suffered from degradation in thestorage, which was indicated in the previous study that the strengthretention has dropped tremendously by photo-oxidation or photo-degradation.After treatments of PP-AA yams with chemical compound that was able toprevent further photo-oxidation, will be expected to improve the stability ofPP-AA in storage. In this research activity, the polypropylene (PP) yams weresubjected to irradiation induced graft co-polymerization by means ofγ-Ray Co-60 as irradiation source with acrylic acid (AA) as monomer.Various after treatments were subjected to the grafted PP-AA yams such asalkalisation process; dyeing (anionic dyes, cationic dyes and nonionic dyes);as well as processing with optical brightening agent and UV stabilizer,separately. The PP-AA yams (before and after treatment) were subjected tostorage from 1 month up to 42 months, and then being tested for theirmoisture regain, strength retention and elongation at breaks. The samplesbeing stored for 12 months were subjected to radical analysis. It isconcluded from the experiment that after treatment of grafted PP-AA by meansof those various processes were able to improve the stability of copolymergrafted PP-AA in storage. The presence of peroxide radical in the ESR(electron spin resonance) spectrum on PP-AA yams before treatment and theones after treated with alkaline and being stored for 12 months haveindicated the presence of photo oxidation or photo degradation, while thepresence of poly enyl radical in the ESR spectrum of after treated PP-AA withdyes having azo and azine compound as chromophore, as well as with UVstabilizer with carbonyl as chromophore and being stored for 12 months haveproved that its presence have protected such



    Bircan BODUR, Fatma; Mukiyyen AVCİ, Gizem


    Gender roles in household consumption patterns have been studied in the literature in relation to two models of household behavior; household production model and the unitary versus non-unitary models of the family decision making. The implications of the first model relate to the changes in household expenditure patterns as a result of the withdrawal of the wives from the traditional gender responsibilities at home due to their involvement in paid-labor activities. The studies testing the un...

  20. Personal Exposure to Household Particulate Matter, Household Activities and Heart Rate Variability among Housewives


    Huang, Ya-Li; Chen, Hua-Wei; Han, Bor-Cheng; Liu, Chien-Wei; Chuang, Hsiao-Chi; Lin, Lian-Yu; Chuang, Kai-Jen


    Background The association between indoor air pollution and heart rate variability (HRV) has been well-documented. Little is known about effects of household activities on indoor air quality and HRV alteration. To investigate changes in HRV associated with changes in personal exposure to household particulate matter (PM) and household activities. Methods We performed 24-h continuous monitoring of electrocardiography and measured household PM exposure among 50 housewives. The outcome variables...

  1. Financial behaviour of dutch households: analysis of the dnb household survey 2003


    P.J.A. van Els; W.A. van den End; M.C.J. van Rooij


    This paper presents an analysis of the financial behaviour of Dutch households on the basis of the DNB Household Survey. The results of this survey provide insight into the backgrounds and consequences of the persistent rise of household debt. The increase in mortgage debt is related to mortgage equity withdrawal. The financial vulnerability of households turns out to have increased, especially the sensitivity to interest rate movements. This contribution also looks into investors' response t...

  2. Households and food security: lessons from food secure households in East Africa.


    Silvestri, Silvia; Douxchamps, Sabine; Kristjanson, Patti; Förch, Wiebke; Radeny, Maren; Mutie, Lanetta; Quiros, F.C.; Herrero, M.; Ndungu, Anthony; Claessens, L.F.G.


    BackgroundWhat are the key factors that contribute to household-level food security? What lessons can we learn from food secure households? What agricultural options and management strategies are likely to benefit female-headed households in particular? This paper addresses these questions using a unique dataset of 600 households that allows us to explore a wide range of indicators capturing different aspects of performance and well-being for different types of households—female-headed, male-...



    Epp, Donald J.; Mauger, Paul C.


    A survey of household decision-makers and an analysis of their garbage was used to suggest factors affecting the weight of household contributions to municipal solid waste. Iterative regression was used to build a model from the data that is hypothesized to explain garbage weight. Food expenditure, environmental attitude, consumption of soft drinks in plastic bottles, and cats in the household were significant for all households. Self-sufficiency and energy-conscious behavioral scales also af...

  4. Alkaline and alkaline earth metal phosphate halides and phosphors (United States)

    Lyons, Robert Joseph; Setlur, Anant Achyut; Cleaver, Robert John


    Compounds, phosphor materials and apparatus related to nacaphite family of materials are presented. Potassium and rubidium based nacaphite family compounds and phosphors designed by doping divalent rare earth elements in the sites of alkaline earth metals in the nacaphite material families are descried. An apparatus comprising the phosphors based on the nacaphite family materials are presented herein. The compounds presented is of formula A.sub.2B.sub.1-yR.sub.yPO.sub.4X where the elements A, B, R, X and suffix y are defined such that A is potassium, rubidium, or a combination of potassium and rubidium and B is calcium, strontium, barium, or a combination of any of calcium, strontium and barium. X is fluorine, chlorine, or a combination of fluorine and chlorine, R is europium, samarium, ytterbium, or a combination of any of europium, samarium, and ytterbium, and y ranges from 0 to about 0.1.

  5. Progress of research on the influence of alkaline cation and alkaline solution on bentonite properties

    International Nuclear Information System (INIS)

    Based on the previous laboratory studies and numerical simulation on bentonite in alkaline environments, the effects of alkaline cation and alkaline solution on mineral composition, microstructure, swelling capacity and hydraulic properties of bentonite are emphasized in this paper, temperature, pH values and concentration are discussed as main affecting factors. When bentonite is exposed to alkaline cation or alkaline solution, microstructure of bentonite will be changed due to the dissolution of montmorillonite and the formation of secondary minerals, which results in the decrease of swelling pressure. The amount of the reduction of swelling pressure depends on the concentration of alkaline solution. Temperature, polyvalent cation, salinity and concentration are the main factors affecting hydraulic properties of bentonite under alkaline conditions. Therefore, future research should focus on the mechanism of coupling effects of weak alkaline solutions on the mineral composition, microstructure, swelling capacity and hydraulic properties of bentonite under different temperatures and different pH values. (authors)

  6. Smart Energy Management for Households

    Directory of Open Access Journals (Sweden)

    Sonja van Dam


    Full Text Available The aim of the research presented in this thesis was to infer design-related insights and guidelines to improve the use and effectiveness of home energy management systems (HEMS. This was done through an empirical evaluation of the longitudinal effectiveness of these devices and an exploration of factors that influence their use and effectiveness. Three case studies executed with three different HEMS in households, a life cycle assessment (LCA on those three HEMS, as well as a reflection on the challenges of both researching and implementing HEMS in existing housing gave a comprehensive picture of the opportunities and barriers for HEMS. The research revealed five typical use patterns that emerged amongst households. It also revealed average energy savings of 7.8%, which however decreased in the follow-up that was conducted, and factors that may influence the use and effectiveness of HEMS. Nonetheless, the LCA calculations divulged that the HEMS can achieve net energy savings when taking their embedded energy into account.Problem statementThe goal of reducing the energy consumption of existing housing formed the basis for this research. There are many facets to this energy consumption, including the characteristics of the house, its appliances, and the behaviours of its inhabitants. Because of this complexity, addressing only one of these facets is not effective in substantially reducing the overall energy consumption of households. This called for an interdisciplinary approach, merging the domains of design for sustainability, sustainable housing transformation and environmental psychology. In this thesis, HEMS were chosen as the intervention to address the various elements that contribute to household energy consumption, thereby functioning as a pivot. By giving feedback and/or helping manage consumption they can assist households in changing their behaviour and help save energy. However, in analysing literature on HEMS, four critique points

  7. Food Insecurity in Households with Children: Prevalence, Severity, and Household Characteristics. Economic Information Bulletin Number 56 (United States)

    Nord, Mark


    Eighty-four percent of U.S. households with children were food secure throughout 2007, meaning that they had consistent access to adequate food for active, healthy lives for all household members. Nearly 16 percent of households with children were food insecure sometime during the year, including 8.3 percent in which children were food insecure…

  8. The power of alternative assessments (AAs)

    Institute of Scientific and Technical Information of China (English)



    This article starts by discussing the potential disadvantages of traditional assessment towards young English as a Second Language (ESL) learners within the American public school education system. In response to such disadvantages, researchers ’call for the implementation of alternative assessments (AAs) is therefore introduced along with the various benefits of AAs. However, the current mainstream education policy in the US, namely No Child Left Behind (NCLB) Policy, is still largely based on the tra-ditional ways of testing, making policy-oriented implementation of AAs on large scales remarkably difficult. After careful analysis, the author points out several implications concerning how, under such an existing policy of NCLB, can practitioners effectively accommodate young ESL learners by applying the power of AAs.

  9. Alkaline azide mutagenicity in cowpea

    International Nuclear Information System (INIS)

    Sodium azide is known as a potent mutagen in cereals and legumes. It is very effective in acidic medium in barley. Here an attempt is made to measure the effectiveness of sodium azide in alkaline medium (pH 7.4) on cowpea (Vigna unguiculata (L.) Walp., variety FS-68). Seeds pre-soaked in distilled water for 5 hours were treated with different concentrations (10-6, 10-5, 10-4 and 10-3M) of sodium azide (NaN3) for 4 hours at 28± 2 deg. C. Bottles were intermittently shaken, then the seeds were thoroughly washed in running tap water and subsequently planted in pots. The treatment caused significant biological damage such as reduction in seed germination, length of root and shoot, number of nodules and pods per plant and morphological leaf variations. Morphological, as well as chlorophyll mutants, were detected in M2

  10. Spending Time and Money within the Household

    DEFF Research Database (Denmark)

    Browning, Martin; Gørtz, Mette


    We consider, both theoretically and empirically, the allocation of time and money within the household. The research question is whether a married person who enjoys more leisure than their partner also receives more consumption (which seems to indicate the outcome of power within the household) or...

  11. Household energy expenditures, 1982–2005


    David B. Cashin; Leslie McGranahan


    While energy's share of total expenditures has risen in recent years, it remains below the shares seen in the early and mid-1980s. Furthermore, the impact of the price increases on a household differs, based on the household's specific energy consumption patterns.

  12. Characterization of household waste in Greenland

    International Nuclear Information System (INIS)

    The composition of household waste in Greenland was investigated for the first time. About 2 tonnes of household waste was sampled as every 7th bag collected during 1 week along the scheduled collection routes in Sisimiut, the second largest town in Greenland with about 5400 inhabitants. The collection bags were sorted manually into 10 material fractions. The household waste composition consisted primarily of biowaste (43%) and the combustible fraction (30%), including anything combustible that did not belong to other clean fractions as paper, cardboard and plastic. Paper (8%) (dominated by magazine type paper) and glass (7%) were other important material fractions of the household waste. The remaining approximately 10% constituted of steel (1.5%), aluminum (0.5%), plastic (2.4%), wood (1.0%), non-combustible waste (1.8%) and household hazardous waste (1.2%). The high content of biowaste and the low content of paper make Greenlandic waste much different from Danish household waste. The moisture content, calorific value and chemical composition (55 elements, of which 22 were below detection limits) were determined for each material fraction. These characteristics were similar to what has been found for material fractions in Danish household waste. The chemical composition and the calorific value of the plastic fraction revealed that this fraction was not clean but contained a lot of biowaste. The established waste composition is useful in assessing alternative waste management schemes for household waste in Greenland.

  13. Poverty orderings and intra-household inequality


    Eugenio Peluso; Alain Trannoy


    We investigate under which conditions it is possible to infer the evolution of poverty at the individual level from the knowledge of poverty among households. The analysis is based on a reduced household model (Peluso and Trannoy 2007) and provides results in terms of preservation of poverty orderings...

  14. Passenger transport and household activity patterns

    DEFF Research Database (Denmark)

    Jørgensen, Kaj


    Review of Danish passenger transport patterns and analysis of energy consumption, emissions and safety impacts for selected typical households' travelling......Review of Danish passenger transport patterns and analysis of energy consumption, emissions and safety impacts for selected typical households' travelling...

  15. Household income distribution in the USA (United States)

    Efthimiou, Costas J.; Wearne, Adam


    In this article we present an alternative model for the distribution of household incomes in the United States. We provide arguments from two differing perspectives which both yield the proposed income distribution curve, and then fit this curve to empirical data on household income distribution obtained from the United States Census Bureau.

  16. Friction Stir Weldabilities of AA1050-H24 and AA6061-T6 Aluminum Alloys

    Institute of Scientific and Technical Information of China (English)

    Huijie LIU; Hidetoshi FUJIN; Masakatsu MAEDA; Kiyoshi NOGI


    The friction stir weldabilities of the strain-hardened AA1050-H24 and precipitate-hardened AA6061-T6 aluminum alloys were examined to reveal the effects of material properties on the friction stir welding behavior. The experimental results are obtlained. (1) For AA1050-H24, the weld can possess smoother surface ripples; there is no elliptical weld nugget in the weld; there is no discernible interface between the stir zone and the thermomechanically affected zone;and the internal defect of the weld looks like a long crack and is located in the lower part of the weld. (2) For AA6061-T6, the weld usually possesses slightly rougher surface ripples; an elliptical weld nugget clearly exists in the weld; there are discernible interfaces among the weld nugget, thermomechanically affected zone and heat affected zone; and the internal defect of the weld is similar to that of the AA1050-H24 weld. (3) The effective range of welding parameters for AA1050-H24 is narrow, while the one for AA6061-T6 is very wide. (4) The maximum tensile strength efficiency of the AA1050-H24 joints is similar to that of the AA6061-T6 joints, i.e. 79% and 77%, respectively.

  17. AAS 228: Day 3 morning (United States)

    Kohler, Susanna


    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session 2015 Newton Lacy Pierce Prize Lecture: The Elephant in the Room: Effects of Distant, Massive Companions on Planetary System Architectures (by Leonardo dos Santos)The first session on Wednesday at 228th AAS Meeting was the Newton Lacy Pierce Prize Lecture by Heather Knutson (California Institute of Technology). This talk featured a broad range of research efforts on exoplanets, with the main focus on how we study the composition of their atmospheres, and how multi-body interactions carve the structure of the planetary systems we observe.One of her first points is the well-known idea that the Solar System is an oddball, compared to the exoplanet systems we have found so far: most of these systems contain hot Jupiters and mini-Neptunes at very close-in orbits around their host stars. Moreover, even when studying their transmission spectra, it is difficult to know the exact composition of their atmospheres.Knutson: it is difficult to constrain atmospheric composition of exoplanets (H-poor or H-rich+clouds?) astrobites (@astrobites) June 15, 2016The main proposal on how these systems formed is the migration scenario. In order to validate this idea, Dr. Knutson and her group The Friends of Hot Jupiters study systems with close-in gas giants and their frequency of binary companions, which are supposed to be the main culprits causing gas-giant migration. They found that approximately half of the observed systems have long-distance companions, providing strong validation of the migration scenario. Moreover, Dr. Knutson speculates that wide binaries have more

  18. Magnetic horn of the Antiproton Accumulator (AA)

    CERN Multimedia

    Photographic Service


    In the 1960s, the invention of this "current sheet lens" has helped to greatly improve the flux of neutrino beams. It was used again at the AA, collecting antiprotons from the production target at angles too large to fit into the acceptance of the AA. It was machined from aluminium to a thickness of 1.4 mm and pulsed at 400 kA for 15 microseconds (half-sine).

  19. Household consumption and environment. 2011 edition

    International Nuclear Information System (INIS)

    This report presents and comments numerous data and indicators concerning the constraints and impacts on the environment related to household consumption and behaviour. After a presentation of context indicators (household number and size, household consumption expenses) and of some global indicators (water and carbon footprint of household consumption), several specific aspects are addressed: housing (electric and electronic equipment, water, space and energy consumption, renewable energies, CO2 emissions), transport (general statistics on travels, CO2 and pollutant emissions related to motor cars), food (water print and carbon print related to household food, consumption of bio-agriculture products and of conditioned beverages), and wastes (production and composition, electronic and electric equipment wastes, waste treatment)

  20. Characterization of household waste in Greenland

    DEFF Research Database (Denmark)

    Eisted, Rasmus; Christensen, Thomas Højlund


    The composition of household waste in Greenland was investigated for the first time. About 2tonnes of household waste was sampled as every 7th bag collected during 1week along the scheduled collection routes in Sisimiut, the second largest town in Greenland with about 5400 inhabitants. The...... collection bags were sorted manually into 10 material fractions. The household waste composition consisted primarily of biowaste (43%) and the combustible fraction (30%), including anything combustible that did not belong to other clean fractions as paper, cardboard and plastic. Paper (8%) (dominated by...... magazine type paper) and glass (7%) were other important material fractions of the household waste. The remaining approximately 10% constituted of steel (1.5%), aluminum (0.5%), plastic (2.4%), wood (1.0%), non-combustible waste (1.8%) and household hazardous waste (1.2%). The high content of biowaste and...

  1. Capitalization of Local Products through Agro- Household

    Directory of Open Access Journals (Sweden)

    Ramona Ciolac


    Full Text Available In every household there are many family activities that provide the necessary income or living foods. Some activities are related to cultivation of land, others for breeding other means services provided by the vilagers. The products of the own household must cover 40% of meals offered to tourists. These products are produced by the householder work in their household, the tourist having the opportunity to observe how the products are produced and participate effectively in this production. Specific rural household products can be recovered through tourism by both indirect and direct ways. Both variants can generate increased profitability and interest of the tourist business activity and impose a sense of satisfaction for quality benefit, issues that may be, in turn, assumptions favorable to the extension of this work.

  2. Household energy: Problems, policies and prospects

    Energy Technology Data Exchange (ETDEWEB)

    McGranahan, G.; Kaijser, A.


    This paper examines household energy problems in the Third World, focusing on past problems and future prospects for household energy policy. Whether or not there is a general household energy crisis, household energy problems can be severe, and are of particular importance to the poor. Most of these problems are largely independent of oil prices, and a poor household foraging for ever more scarce fuelwood is no better off because its fuel collection is not the cause of the declining supply. In the energy sector, as in virtually every other sector, the problems of the poor are the most intractable. Many of the difficulties encountered in attempts to deal with the household energy problems of the poor are analogous to those encountered in other poverty oriented programmes. It would indeed be unfortunate if, having recognized that many past efforts in the household energy sector were misconceived, household energy problems were to suffer from equally ill-conceived neglect. The memorandum attempts to draw some general conclusions about the form a more appropriate approach could take. Probably well over 90 % of public funds allocated to the household sector over the past two decades have been devoted to subsidizing commercial fuels such as electricity and kerosene, benefiting primarily the better-off households. This has helped to create energy problems, and done little to ease the problems of the poor. Most of the lessons to be drawn from experiences with such subsidies are negative. On the other hand, the relatively small proportion of funding devoted to activities such as stove programmes and biofuel supply enhancement should be viewed as exploratory in nature. (49 refs., 3 tabs.)

  3. Effect of supplementation of arachidonic acid (AA) or a combination of AA plus docosahexaenoic acid on breastmilk fatty acid composition

    NARCIS (Netherlands)

    Smit, EN; Koopmann, M; Boersma, ER; Muskiet, FAJ


    We investigated whether supplementation with arachidonic acid (20:4 omega 6; AA), ora combination of AA and docosahexaenoic acid (22:6 omega 3; DHA) would affect human milk polyunsaturated fatty acid (PUFA) composition. Ten women were daily supplemented with 300 mg AA, eight with 300 mg AA, 110 mg e

  4. Household Consumption Characteristics of Cookies: The Case of Uganda


    Fu, Shengfei; Florkowski, Wojciech J.; Nambiar, Padmanand Madhavan; Resurreccion, Anna V.A.; Chinnan, Manjeet S.


    The cookie consumption and purchase characteristics of households were investigated in six cities in Uganda using household survey data. Cookies can be fortified with vitamins to improve child nutrition. The application of a Logit model permitted the identification of factors significantly affecting household decision to eat cookies. They are household food buyer/preparer’s age, employment status, education level, household monthly income, household location, number of children from 4 to 18 y...

  5. AAS 228: Day 1 afternoon (United States)

    Kohler, Susanna


    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session: From Space Archeology to Serving the World Today: A 20-year Journey from the Jungles of Guatemala to a Network of Satellite Remote Sensing Facilities Around the World(by Michael Zevin)In the conferences second plenary session, NASAs Daniel Irwin turned the eyes of the conference back to Earth by highlighting the huge impact that NASA missions play in protecting and developing our own planet.Daniel Irwin: using satellite imagery to detect differences in vegetation and find ancient Mayan cities. #aas228 astrobites (@astrobites) June 13, 2016Irwin came to be involved in NASA through his work mapping Guatemalan jungles, where he would spend 22 days at a time exploring the treacherous jungles on foot armed with a 1st generation GPS, a compass, and a machete. A colleague introduced Irwin to the satellite imagery thathe was exploring, demonstratinghow these images are a strong complement to field work. The sharing of this satellite data with nearby villages helped to show the encroachment of agriculture and the necessity of connecting space to the village. Satellite imagery also played a role in archeological endeavors, uncovering dozens of Mayan cities that have been buried for over a millennia by vegetation, and it provided evidence that the fall of the Mayan civilization may have been due to massive deforestation that ledto drought.Glacial retreat in Chile imaged by ISERV.Irwin displayed the constellation of NASAs Earth-monitoring satellites that have played an integral role in conserving our planet and alerting the world of natural disasters. He also showed


    Energy Technology Data Exchange (ETDEWEB)

    Kramer, Klaas Jan; Homan, Greg; Brown, Rich; Worrell, Ernst; Masanet, Eric


    The term ?household carbon footprint? refers to the total annual carbon emissions associated with household consumption of energy, goods, and services. In this project, Lawrence Berkeley National Laboratory developed a carbon footprint modeling framework that characterizes the key underlying technologies and processes that contribute to household carbon footprints in California and the United States. The approach breaks down the carbon footprint by 35 different household fuel end uses and 32 different supply chain fuel end uses. This level of end use detail allows energy and policy analysts to better understand the underlying technologies and processes contributing to the carbon footprint of California households. The modeling framework was applied to estimate the annual home energy and supply chain carbon footprints of a prototypical California household. A preliminary assessment of parameter uncertainty associated with key model input data was also conducted. To illustrate the policy-relevance of this modeling framework, a case study was conducted that analyzed the achievable carbon footprint reductions associated with the adoption of energy efficient household and supply chain technologies.

  7. Sources of household salt in South Africa. (United States)

    Jooste, Pieter L


    Marketing of non-iodized salt through unconventional distribution channels is one of the factors weakening the national salt iodization program in South Africa. The aim of this study was therefore to quantify the various sources of household salt, and to relate this information to socio-economic status. Questionnaire information was collected by personal interview during home visits from a multistage, cluster, probability sample of 2164 adults representative of the adult population. Nationally 77.7% of households obtained their table salt from the typical food shops distributing iodized salt. However, in the nine different provinces between 8 and 37.3% of households used unconventional sources, distributing mainly non-iodized salt, to obtain their household salt. These alternative sources include distributors of agricultural salt, small general dealer shops called spaza shops, in peri-urban and rural townships, street vendors and salt saches placed in the packaging of maize meal bags. Country-wide around 30% of low socio-economic households obtained their salt from unconventional sources compared to less than 5% in high socio-economic households, emphasizing the vulnerability of low socio-economic groups to the use of non-iodized salt. Intervention strategies should mobilize all role players involved in unconventional marketing channels of household salt to provide only iodized salt to consumers, as required by law. PMID:15927933

  8. The Household Market for Electric Vehicles: Testing the Hybrid Household Hypothesis -- A Reflexively Designed Survey of New-Car-Buying Multi-Vehicle California Households


    Turrentine, Thomas; Kurani, Kenneth S


    We report the results of a survey of the potential demand for electric vehicles (EVs) among a subset of California households. We limit our analysis to one group of potential hybrid households. These households own two or more light duty vehicles and buy new vehicles of the body styles we expect will be offered as electric vehicles. These characteristics identify households who may be able to incorporate at least one limited range vehicle into their household vehicle holdings with no, or mini...

  9. Financial Assets of Private Households in Austria


    Peter Mooslechner


    The stock of financial assets owned by private households at the end of 1993 was estimated at almost Sch 2,100 billion. For the individual household this amounts to financial assets worth about Sch 660,000 on average, while indebtedness was slightly higher than Sch 260,000. These amounts may seem high but the financial wealth of Austrian households is low in an international comparison. While in the U.S., Japan, and the United Kingdom financial assets are more than twice as high as nominal gr...

  10. Substitution between cars within the household

    DEFF Research Database (Denmark)

    De Borger, Bruno; Mulalic, Ismir; Rouwendal, Jan

    The purpose of this paper is to study to what extent two-car households substitute the use of their less fuel efficient car by the use of their more fuel efficient car after an increase in fuel prices. Based on a simple theoretical framework we use a large sample of detailed Danish data on two-car...... households to estimate, for each car owned by the household, own and cross-price effects of increases in fuel costs per kilometer. The empirical results point at important substitution effects, so that models that estimate responses to fuel prices on the implicit or explicit assumption of one car per...

  11. Price elasticity of household fuel comsumption


    Clerc, M.; Marcus, V.


    The high levels reached by world oil prices and fuel prices in mid 2008 have raised notable concerns about the risk of future significant drops in household purchasing power. In the framework of a national strategy to reduce CO2 emissions, a tax reform on fossil fuels is also being studied. In this context, this paper aims to identify the categories of households that are most exposed to an energy-price increase and to assess the sensitivity of household consumption to changes in fuel prices ...

  12. Alkaline sorbent injection for mercury control (United States)

    Madden, Deborah A.; Holmes, Michael J.


    A mercury removal system for removing mercury from combustion flue gases is provided in which alkaline sorbents at generally extremely low stoichiometric molar ratios of alkaline earth or an alkali metal to sulfur of less than 1.0 are injected into a power plant system at one or more locations to remove at least between about 40% and 60% of the mercury content from combustion flue gases. Small amounts of alkaline sorbents are injected into the flue gas stream at a relatively low rate. A particulate filter is used to remove mercury-containing particles downstream of each injection point used in the power plant system.

  13. Alkaline rocks and the occurrence of uranium

    International Nuclear Information System (INIS)

    Many alkaline complexes contain uranium and other minerals in low concentrations and are regarded as constituting valuable potential reserves. Certain complex metallurgical problems, however, remain to be solved. Alkaline rocks occur in a number of forms and environments and it is noted that they are generated during periods of geological quiescence emplaced mainly in stable aseismic areas. Many occur along the extensions of oceanic transform faults beneath the continental crust and the application of this concept to areas not currently known to host alkaline complexes may prove useful in identifying potential target areas for prospecting operations

  14. Effects of applied potential on the stress corrosion cracking behavior of 7003 aluminum alloy in acid and alkaline chloride solutions (United States)

    Zhang, Xiao-yan; Song, Ren-guo; Sun, Bin; Lu, Hai; Wang, Chao


    Potentiodynamic polarization tests and slow strain rate test (SSRT) in combination with fracture morphology observations were conducted to investigate the stress corrosion cracking (SCC) behavior of 7003 aluminum alloy (AA7003) in acid and alkaline chloride solutions under various applied potentials ( E a). The results show that AA7003 is to a certain extent susceptible to SCC via anodic dissolution (AD) at open-circuit potential (OCP) and is highly susceptible to hydrogen embrittlement (HE) at high negative E a in the solutions with pH levels of 4 and 11. The susceptibility increases with negative shift in the potential when E a is less than -1000 mV vs. SCE. However, the susceptibility distinctly decreases because of the inhibition of AD when E a is equal to -1000 mV vs. SCE. In addition, the SCC susceptibility of AA7003 in the acid chloride solution is higher than that in the alkaline solution at each potential. Moreover, the effect of hydrogen on SCC increases with increasing hydrogen ion concentration.

  15. The AA disappearing under concrete shielding

    CERN Multimedia


    When the AA started up in July 1980, the machine stood freely in its hall, providing visitors with a view through the large window in the AA Control Room. The target area, in which the high-intensity 26 GeV/c proton beam from the PS hit the production target, was heavily shielded, not only towards the outside but also towards the AA-Hall. However, electrons and pions emanating from the target with the same momentum as the antiprotons, but much more numerous, accompanied these through the injection line into the AA ring. The pions decayed with a half-time corresponding to approximately a revolution period (540 ns), whereas the electrons lost energy through synchrotron radiation and ended up on the vacuum chamber wall. Electrons and pions produced the dominant component of the radiation level in the hall and the control room. With operation times far exceeding original expectations, the AA had to be buried under concrete shielding in order to reduce the radiation level by an order of magnitude.

  16. MDCT evaluation of acute aortic syndrome (AAS). (United States)

    Valente, Tullio; Rossi, Giovanni; Lassandro, Francesco; Rea, Gaetano; Marino, Maurizio; Muto, Maurizio; Molino, Antonio; Scaglione, Mariano


    Non-traumatic acute thoracic aortic syndromes (AAS) describe a spectrum of life-threatening aortic pathologies with significant implications on diagnosis, therapy and management. There is a common pathway for the various manifestations of AAS that eventually leads to a breakdown of the aortic intima and media. Improvements in biology and health policy and diffusion of technology into the community resulted in an associated decrease in mortality and morbidity related to aortic therapeutic interventions. Hybrid procedures, branched and fenestrated endografts, and percutaneous aortic valves have emerged as potent and viable alternatives to traditional surgeries. In this context, current state-of-the art multidetector CT (MDCT) is actually the gold standard in the emergency setting because of its intrinsic diagnostic value. Management of acute aortic disease has changed with the increasing realization that endovascular therapies may offer distinct advantages in these situations. This article provides a summary of AAS, focusing especially on the MDCT technique, typical and atypical findings and common pitfalls of AAS, as well as recent concepts regarding the subtypes of AAS, consisting of aortic dissection, intramural haematoma, penetrating atherosclerotic ulcer and unstable aortic aneurysm or contained aortic rupture. MDCT findings will be related to pathophysiology, timing and management options to achieve a definite and timely diagnostic and therapeutic definition. In the present article, we review the aetiology, pathophysiology, clinical presentation, outcomes and therapeutic approaches to acute aortic syndromes. PMID:27033344

  17. Cloning and sequence analysis of complete gene encoding an alkaline lipase from Penicillium cyclopium. (United States)

    Zhang, H M; Wu, M C; Guo, J; Li, J F


    The complete gene (PG37 lipI) encoding an alkaline lipase (PG37 LipI) was cloned from the genomic DNA of Penicillium cyclopium PG37. The cloned PG37 lipI is 2020 bp in length, consisting of 632 bp of the 5' flanking promoter region and 1388 bp of the downstream fragment that contains 6 exons and 5 short introns. The promoter region harbors putative TATA box, CAAT box and several transcription factor binding sites. The open reading frame (ORF) encodes a PG37 LipI of 285 amino acid residues, which was predicted to contain a 20-aa signal peptide, a 7-aa propeptide and a 258-aa mature peptide with a conserved motif Gly-X-Ser-X-Gly. However, PG37 LipI shows only 32%, 30%, 28% and 26% identity with lipases of Aspergillus parasiticus, Penicillium camembertii, Thermomyces lanuginosus and Rhizomucor miehei, respectively. It was predicted that the main secondary structures of PG37 LipI are alpha-helix and random coil. Three amino acid residues, Ser132-Asp188-His241, compose the enzymatic active center in the tertiary structure. PMID:22288192

  18. Dicty_cDB: FCL-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA03 (Link to dictyBase) - - - Contig-U15092-1 FCL-AA03E ...(Link to Original site) - - - - - - FCL-AA03E 627 Show FCL-AA03 Library FCL (Link to library) Clone ID FCL-AA... Representative seq. ID FCL-AA...03E (Link to Original site) Representative DNA sequence >FCL-AA03 (FCL-AA03Q) /CSM/FCL/FCL-AA/FCL-AA...03Q.Seq.d/ ACATAATGTTCCAAAAGAAAGCAATTGTTATTGATGGCAAAGGTCATTTGTTAGGTCGTT TAGCCTCCGTTGTTGCTAAATCCCTCCTCTCTGGTCAAAA

  19. Dicty_cDB: FCL-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA02 (Link to dictyBase) - - - Contig-U16560-1 FCL-AA02F ...(Link to Original site) FCL-AA02F 620 - - - - - - Show FCL-AA02 Library FCL (Link to library) Clone ID FCL-AA... Representative seq. ID FCL-AA...02F (Link to Original site) Representative DNA sequence >FCL-AA02 (FCL-AA02Q) /CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ ATTAA...ATACAAAATACAAATACAAATAACAAATACTTTACTATAGCTTTTTTTTCTTATT TATTTCTCCAAATAATTTTTTAATATGCAAATCTTTGTTAAAA

  20. Dicty_cDB: FCL-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA09 (Link to dictyBase) - - - Contig-U16453-1 FCL-AA09F ...(Link to Original site) FCL-AA09F 485 - - - - - - Show FCL-AA09 Library FCL (Link to library) Clone ID FCL-AA... Representative seq. ID FCL-AA...09F (Link to Original site) Representative DNA sequence >FCL-AA09 (FCL-AA09Q) /CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ GACAA...AAGTAAATAAAACATGTCCGCAAGTAATAAAGATGACCAACTCATGAAAAATGAG TTCGAAAGTACCTACGACAAAATTGTCGATTCATTCGACAA

  1. Dicty_cDB: FCL-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA08 (Link to dictyBase) - - - Contig-U16200-1 FCL-AA08Z ...(Link to Original site) - - FCL-AA08Z 574 - - - - Show FCL-AA08 Library FCL (Link to library) Clone ID FCL-AA... Representative seq. ID FCL-AA...08Z (Link to Original site) Representative DNA sequence >FCL-AA08 (FCL-AA08Q) /CSM/FCL/FCL-AA/FCL-AA...08Q.Seq.d/ XXXXXXXXXXTCGAAGCCAAAGGTCGTCTCGAAGAAGAATTCCATCGCTCGTACCAACTC TGATCGTTCAAGAAAGAGACTCGAAGCTGAAA

  2. Dicty_cDB: FC-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA09 (Link to dictyBase) - - - Contig-U15086-1 FC-AA09E (Li...nk to Original site) - - - - - - FC-AA09E 562 Show FC-AA09 Library FC (Link to library) Clone ID FC-AA09 (Li.../ Representative seq. ID FC-AA...09E (Link to Original site) Representative DNA sequence >FC-AA09 (FC-AA09Q) /CSM/FC/FC-AA/FC-AA09Q.Seq....d/ GATACATTATCACCATGGCAGGAAAAAAAGTCAAATCTAACACACCAAAACAAGACTTAT CTGTCTCTAAATCAAAGCTCACCAGCATTAAAGCCCCAGCTGCTGCCATCAAAGCTAAA

  3. Dicty_cDB: FC-AA14 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA14 (Link to dictyBase) - - - Contig-U15088-1 FC-AA14E (Li...nk to Original site) - - - - - - FC-AA14E 431 Show FC-AA14 Library FC (Link to library) Clone ID FC-AA14 (Li.../ Representative seq. ID FC-AA...14E (Link to Original site) Representative DNA sequence >FC-AA14 (FC-AA14Q) /CSM/FC/FC-AA/FC-AA14Q.Seq.d/ CTATGTCTGAAATCAAAA...CTGAAGAACTCGCTTGCATCTACTCCGGTCTTTTATTACAAG ATGACGGTATTGAAATCACCGCTGATAAAATCAAAACCTTATTAGAAGCTGCCAA

  4. Dicty_cDB: FCL-AA04 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA04 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA04Z ...(Link to Original site) - - FCL-AA04Z 530 - - - - Show FCL-AA04 Library FCL (Link to library) Clone ID FCL-AA... Representative seq. ID FCL-AA...04Z (Link to Original site) Representative DNA sequence >FCL-AA04 (FCL-AA04Q) /CSM/FCL/FCL-AA/FCL-AA...04Q.Seq.d/ XXXXXXXXXXCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTTCAGTCAAAGAAATT AAAAGAGGTATGGTCGCTGGTGACTCCAAAAACGATCCACCACAAGAAA

  5. Dicty_cDB: FC-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA20 (Link to dictyBase) - - - Contig-U16455-1 FC-AA20Z (Li...nk to Original site) - - FC-AA20Z 607 - - - - Show FC-AA20 Library FC (Link to library) Clone ID FC-AA20 (Li.../ Representative seq. ID FC-AA...20Z (Link to Original site) Representative DNA sequence >FC-AA20 (FC-AA20Q) /CSM/FC/FC-AA/FC-AA20Q.Seq....d/ XXXXXXXXXXCTTTGCCCCAGCTGGTCTCTCAACTGAAGTCAAATCAGTCGAAATGCATC ACGAACAACTCCCAGAAGCCCGTCCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTT CAGTCAA

  6. Dicty_cDB: FCL-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA15 (Link to dictyBase) - - - Contig-U16011-1 FCL-AA15Z ...(Link to Original site) - - FCL-AA15Z 442 - - - - Show FCL-AA15 Library FCL (Link to library) Clone ID FCL-AA... Representative seq. ID FCL-AA...15Z (Link to Original site) Representative DNA sequence >FCL-AA15 (FCL-AA15Q) /CSM/FCL/FCL-AA/FCL-AA...15Q.Seq.d/ XXXXXXXXXXCCATTCATCTGTCCAATCGATTGTCGTCGTGGTCTCTACAAGAATATCGT CTTATCTGGTGGTTCAACCATGTTTAAAGATTTTGGTAAACGTCTTCAA

  7. Dicty_cDB: FC-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA13 (Link to dictyBase) - - - Contig-U15674-1 FC-AA13Z (Li...nk to Original site) - - FC-AA13Z 528 - - - - Show FC-AA13 Library FC (Link to library) Clone ID FC-AA13 (Li.../ Representative seq. ID FC-AA...13Z (Link to Original site) Representative DNA sequence >FC-AA13 (FC-AA13Q) /CSM/FC/FC-AA/FC-AA13Q.Seq.d/ XXXXXXXXXXAAAGCAAA...CTCGTGCTGGTCAACGTACCCGTTTCAAGGCTTTCGTCGTTG TTGGTGATCACAACGGTCATGTAGGTCTCGGTGTTAAATGCGCTAAGGAA

  8. Dicty_cDB: FCL-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA20 (Link to dictyBase) - - - Contig-U15052-1 FCL-AA20E ...(Link to Original site) - - - - - - FCL-AA20E 1159 Show FCL-AA20 Library FCL (Link to library) Clone ID FCL-AA...L Representative seq. ID FCL-AA...20E (Link to Original site) Representative DNA sequence >FCL-AA20 (FCL-AA20Q) /CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ AAAA...CATTTACAAATGATGACCACAGAAGATGTACAACCAATTGAAACTACCAAAGATGG TGTAGTAGTATTAAATTATAGCGATTTAATTGCAGGTAAA

  9. Dicty_cDB: FC-AA23 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA23 (Link to dictyBase) - - - Contig-U16090-1 FC-AA23E (Li...nk to Original site) - - - - - - FC-AA23E 387 Show FC-AA23 Library FC (Link to library) Clone ID FC-AA23 (Li.../ Representative seq. ID FC-AA...23E (Link to Original site) Representative DNA sequence >FC-AA23 (FC-AA23Q) /CSM/FC/FC-AA/FC-AA23Q.Seq.d/ AAACTCGATTATATTCTTAA...TCTTAAAGTTCAAGATTTCATGGAAAGACGTCTCCAAACT TTAGTCTTCAAAAATGGTCTTGCCAAATCAATCCATCACGCTCGTGTTTTAATCAAA

  10. Dicty_cDB: FC-AA12 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA12 (Link to dictyBase) - - - Contig-U15087-1 FC-AA12E (Li...nk to Original site) - - - - - - FC-AA12E 454 Show FC-AA12 Library FC (Link to library) Clone ID FC-AA12 (Li.../ Representative seq. ID FC-AA...12E (Link to Original site) Representative DNA sequence >FC-AA12 (FC-AA12Q) /CSM/FC/FC-AA/FC-AA12Q.Seq.d/ AAATAATAATAATATAAAAA...TGGAAATTAAAGTTTTAGCTAAAAGAAAAGTATCAGCAAA ACGTGCAAATGAAATATTAGGAAAATTTATTTTAGAAAGAAAAGCAAATGAAGAAAA

  11. Dicty_cDB: FC-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA01 (Link to dictyBase) - - - Contig-U15084-1 FC-AA01E (Li...nk to Original site) - - - - - - FC-AA01E 701 Show FC-AA01 Library FC (Link to library) Clone ID FC-AA01 (Li.../ Representative seq. ID FC-AA...01E (Link to Original site) Representative DNA sequence >FC-AA01 (FC-AA01Q) /CSM/FC/FC-AA/FC-AA01Q.Seq.d/ GAGAAATATTTCTTATTAA...CAATTGCATGCGTTGTATTCAACCCAACATGGTGGAATATT ACAGCAAGAATGGAATATAATGCTAATAAATAACAACCATTTTCTTTACTTCCACAAA

  12. Dicty_cDB: FCL-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA10 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA10Z ...(Link to Original site) - - FCL-AA10Z 627 - - - - Show FCL-AA10 Library FCL (Link to library) Clone ID FCL-AA... Representative seq. ID FCL-AA...10Z (Link to Original site) Representative DNA sequence >FCL-AA10 (FCL-AA10Q) /CSM/FCL/FCL-AA/FCL-AA...10Q.Seq.d/ XXXXXXXXXXTAAACCAGGTATGGTCGTCACCTTTTGCCCCAGCTGGTCTCTCAACTGAA GTCAAATCAGTCGAAATGCATCACGAACAACTCCCAGAA

  13. Dicty_cDB: FC-AA19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA19 (Link to dictyBase) - - - Contig-U16072-1 FC-AA19F (Li...nk to Original site) FC-AA19F 539 - - - - - - Show FC-AA19 Library FC (Link to library) Clone ID FC-AA19 (Li.../ Representative seq. ID FC-AA...19F (Link to Original site) Representative DNA sequence >FC-AA19 (FC-AA19Q) /CSM/FC/FC-AA/FC-AA19Q.Seq.d/ CAGAAA...TCACTGGTTTTTCATTCCAATTATTTAATATTATCAGTATTTGGAATGTTGATC AAACATCATTCAATAGCTACAGTCTTCCAATTTGGTTACCAGCCATTCAA

  14. Dicty_cDB: FC-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA02 (Link to dictyBase) - - - Contig-U16527-1 FC-AA02Z (Li...nk to Original site) - - FC-AA02Z 458 - - - - Show FC-AA02 Library FC (Link to library) Clone ID FC-AA02 (Li.../ Representative seq. ID FC-AA...02Z (Link to Original site) Representative DNA sequence >FC-AA02 (FC-AA02Q) /CSM/FC/FC-AA/FC-AA02Q.Seq.d/ XXXXXXXXXXCAAAAA...GGCTCCTGGTCCGGAAGGATTGGGTAATCATTTGAATTTCCTAC GTAACTGGGCTTGATCTTTGTAATTATTGATCATAAACGAGGAATTCCTTGTAAGCGTAA

  15. Dicty_cDB: FCL-AA24 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA24 (Link to dictyBase) - - - Contig-U16467-1 FCL-AA24E ...(Link to Original site) - - - - - - FCL-AA24E 779 Show FCL-AA24 Library FCL (Link to library) Clone ID FCL-AA... Representative seq. ID FCL-AA...24E (Link to Original site) Representative DNA sequence >FCL-AA24 (FCL-AA24Q) /CSM/FCL/FCL-AA/FCL-AA...24Q.Seq.d/ CTAGAAATTTCTAAACAATTATTTATTTGAAGAGGTTTTTTAAAAAAAGAAAAAAATCAG AGCATCCAAATAATAACCGCAGTAAGGGGGGGATGGTTGTTAA

  16. Dicty_cDB: FCL-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA05 (Link to dictyBase) - - - Contig-U16473-1 FCL-AA05Z ...(Link to Original site) - - FCL-AA05Z 603 - - - - Show FCL-AA05 Library FCL (Link to library) Clone ID FCL-AA... Representative seq. ID FCL-AA...05Z (Link to Original site) Representative DNA sequence >FCL-AA05 (FCL-AA05Q) /CSM/FCL/FCL-AA/FCL-AA...05Q.Seq.d/ XXXXXXXXXXTGGCGCCATCATTACTGGTGGAGGTGGTGTTGCTATCACTCAAGCTCAAC CATCATACCAAGCTGATGCCGTTGCCACTTACATCAAAA

  17. AAS 228: Day 2 afternoon (United States)

    Kohler, Susanna


    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  18. AAS 228: Day 2 morning (United States)

    Kohler, Susanna


    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  19. AAS 228: Day 2 afternoon (United States)

    Kohler, Susanna


    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  20. Medical Expenditure Panel Survey Household Component (United States)

    U.S. Department of Health & Human Services — The Medical Expenditure Panel Survey (MEPS) Household Component (HC) collects data from a sample of families and individuals in selected communities across the...

  1. Household energy consumption and expenditures 1993

    Energy Technology Data Exchange (ETDEWEB)



    This presents information about household end-use consumption of energy and expenditures for that energy. These data were collected in the 1993 Residential Energy Consumption Survey; more than 7,000 households were surveyed for information on their housing units, energy consumption and expenditures, stock of energy-consuming appliances, and energy-related behavior. The information represents all households nationwide (97 million). Key findings: National residential energy consumption was 10.0 quadrillion Btu in 1993, a 9% increase over 1990. Weather has a significant effect on energy consumption. Consumption of electricity for appliances is increasing. Houses that use electricity for space heating have lower overall energy expenditures than households that heat with other fuels. RECS collected data for the 4 most populous states: CA, FL, NY, TX.

  2. Substitution between Cars within the Household

    DEFF Research Database (Denmark)

    de Borger, Bruno; Mulalic, Ismir; Rouwendal, Jan

    In this paper we study the demand for car kilometres in two-car households, focusing on the substitution between cars in response to fuel price changes. We use a large sample of detailed Danish data on two-car households to estimate—for each car owned by the household—own and cross-price effects of...... increases in fuel costs per kilometre. The empirical results show that failure to capture substitution between cars within the household can result in substantial misspecification biases. Ignoring substitution, we estimate fuel price elasticities of –0.81 and -0.65 for the primary and secondary cars...... efficient car, finding partial support for the underlying hypothesis. More importantly, the results of this extended model emphasize the importance of behavioural differences related to the position of the most fuel efficient car in the household, suggesting that households’ fuel efficiency choices are...

  3. Substitution between cars within the household

    DEFF Research Database (Denmark)

    De Borger, Bruno; Mulalic, Ismir; Rouwendal, Jan


    In this paper we study the demand for car kilometres in two-car households, focusing on the substitution between cars of different fuel efficiency in response to fuel price changes. We use a large sample of detailed Danish data on two-car households to estimate – for each car owned by the household...... – own and cross-price effects of increases in fuel costs per kilometre. The empirical results show that failure to capture substitution between cars within the household can result in substantial misspecification biases. Ignoring substitution, the basic model yielded fuel price elasticities of 0.98 and...... 1.41 for the primary and secondary cars, respectively. Accounting for substitution effects, these figures reduce to, respectively, 0.32 and 0.45. Consistent with substitution behaviour, we find that the fuel price elasticity of fuel demand exceeds the elasticity of kilometre demands with respect to...

  4. Households' ICT use in an energy perspective

    DEFF Research Database (Denmark)

    Røpke, Inge; Gram-Hanssen, Kirsten; Jensen, Jesper Ole


    considering ICT in an energy perspective. In particular, the paper focuses on the integration of ICT in households and the energy impacts related to changing everyday practices. As this has not received much attention in previous research, the paper has an explorative character. Firstly, the paper reviews...... some of the previous studies on ICT and energy and the consumption perspective is introduced. Secondly, the integration of ICT in everyday practices and the dynamics behind the changes are outlined, inspired by a historical perspective. Thirdly, a figure of the relationships between changing everyday...... practices and the related energy impacts is presented, followed by descriptions of direct energy consumption related to household ICT, indirect energy consumption outside households, and derived impacts both within and outside households. The paper concludes with some remarks on political implications and...

  5. Effects of household size and composition on consumption in rural households in Matabeleland South, Zimbabwe


    Young, Trevor; Hamdok, Abdalla A.


    This study, using a survey of rural households in Zimbabwe in 1990 j91, focuses on the effects of changing household composition on patterns of expenditure and provides estimates of the 'cost of a child' as well as of family members in other age groups. In addition to age differences in the size and direction of responses to changing family composition, the paper highlights significant differences across product groups. These effects are more muted in larger households.



    Fabiosa, Jacinto F.; Jensen, Helen H.


    The macroeconomic crisis in Indonesia in the late 1990s reduced real per capita income by 74 percent and increased prices of some food groups by 92-445 percent. Adjustments in the consumption decisions of households during this period was analyzed using SUSENAS data. The data showed a very strong pattern of adjustment in the consumption decisions of households. That is, households substituted away from more expensive food groups to cheaper alternatives. Of the nine food groups examined, per c...

  7. Household Formation, Poverty and Unemployment – The Case of Rural Households in South Africa


    Sonja Keller


    The paper examines household formation and composition decisions within the context of risk reduction and risk mitigation strategies of the poor in South Africa. A multi-level heckprobit estimator is employed in order to capture the influence of various factors at the individual, household and regional level, and we focus on the implications of the presence of pensioners and the unemployment on household composition and structure. Results are consistent with earlier findings that pensions are...

  8. Questions about Household Consumption in Surveys


    Savić Mirko


    Household total expenditure (consumption) is a very important phenomenon in many research areas. The problem is how to get precise information about the consumption from each household and at the same time not to make the questionnaire so long and involved that it becomes a burden to the respondent. In this paper is evidence from several sources on the usefulness of recall consumption questions. Valid information can be collected by adding specific recall questions to general purpose surveys....

  9. Preventing epidemics in a community of households.


    Hall, R; Becker, N G


    The occurrence of epidemics of vaccine-preventable diseases, and the immunization coverage required to prevent them, is affected by the presence of households and heterogeneity in the community. We consider a community where individuals live in households and are of different types, according to infectivity and/or susceptibility to infection. We describe a method for computing the critical immunization coverage to prevent epidemics in such communities and discuss the effectiveness of immuniza...

  10. Banded Householder representation of linear subspaces

    CERN Document Server

    Irving, Geoffrey


    We show how to compactly represent any $n$-dimensional subspace of $R^m$ as a banded product of Householder reflections using $n(m - n)$ floating point numbers. This is optimal since these subspaces form a Grassmannian space $Gr_n(m)$ of dimension $n(m - n)$. The representation is stable and easy to compute: any matrix can be factored into the product of a banded Householder matrix and a square matrix using two to three QR decompositions.

  11. Researches of odour emitted by household waste


    Eglė Marčiulaitienė; Tadas Lukauskas


    The article deals with odour emitted by household waste, the chemical composition of household waste. The experiment was made with food waste (1000 g) placed in 5 litter containers. Food waste was containing products of animal origin (meat, fish, dairy products) and plant origin (vegetables, fruit) waste. Time of the experiment was 14 days 19±3 °C at environment temperature. Odour concentration is determined by dynamic olfactometry method. Studies have shown that the strongest odour of all ho...

  12. Do disaster expectations explain household portfolios?


    Alan, Sule


    Quantitative Economics 3 (2012), 1–28 1759-7331/20120001 Do disaster expectations explain household portfolios? Sule Alan Faculty of Economics and CFAP, University of Cambridge and College of Administrative Sciences, Koc University It has been argued that rare economic disasters can explain most asset pricing puzzles. If this is the case, perceived risk associated with a disaster in stock mar-kets should be revealed in household portfolios. That is, the framework that sol...

  13. A Comparison of Farm and Nonfarm Households


    Katchova, Ani L.


    This study compares the economic well-being of farm and nonfarm households using data from the 2001 Agricultural Resource Management Survey and the 2001 Survey of Consumer Finances. Comparisons are made in terms of income and wealth using Tukey-Kramer mean separation tests, regression analysis, and Gini coefficients. The results show that income and wealth of rural residence and intermediate farms are comparable to those of nonfarm households without businesses, while the well-being of commer...

  14. Financial literacy, retirement planning, and household wealth


    Rooij, Maarten van; Lusardi, Annamaria; Alessie, Rob J. M.


    There is ample empirical evidence documenting widespread financial illiteracy and limited pension knowledge. At the same time, the distribution of wealth is widely dispersed and many workers arrive on the verge of retirement with few or no personal assets. In this paper, we investigate the relationship between financial literacy and household net worth, relying on comprehensive measures of financial knowledge designed for a special module of the DNB (De Nederlandsche Bank) Household Survey. O...

  15. Property Rights and Intra-Household Bargaining


    Shing-Yi Wang


    This paper examines whether an individual-level transfer of property rights increases the individual's bargaining power within the household. The question is analyzed in the context of a housing reform that occurred in China that gave existing tenants the opportunity to purchase the homes that they had been renting from their state employers. The rights to each housing unit were granted to a particular employee, so property rights were defined at the individual level rather than the household...

  16. Modeling Social Ties and Household Mobility


    Metcalf, Sara S.


    Underlying the aggregate phenomena of persistent problems such as urban sprawl and spatial socio-economic disparity is the individual choice of where to live. This study develops an agent-based model to simulate social and economic influences on neighborhood choice. With Danville, Illinois as an empirical context, a pattern-oriented approach is employed to examine the role of social ties in shaping intra-urban household mobility. In the model, household agents decide whether and where to relo...

  17. Rising Food Insecurity: Dimensions in Farm Households


    Okezie C. Austin; Aloysius C. Nwosu; Amir H. Baharuddin


    Problem statement: Nigeria runs the risk of slowing further progress toward the achievement of MDG-1 to eradicate extreme hunger and poverty; the fourth goal, to reduce child mortality since over 30% of child deaths are attributable to malnutrition and the fifth goal relating to reduction in maternal mortality. This study evaluated the manifestation of food insecurity in households in Abia State, Nigeria. Approach: Systematic sampling was adopted in selecting households from the three geopoli...

  18. Equity in dental care among Canadian households


    Grootendorst Paul; Quiñonez Carlos


    Abstract Background Changes in third party financing, whether public or private, are linked to a household's ability to access dental care. By removing costs at point of purchase, changes in financing influence the need to reach into one's pocket, thus facilitating or limiting access. This study asks: How have historical changes in dental care financing influenced household out-of-pocket expenditures for dental care in Canada? Methods This is a mixed methods study, comprised of an historical ...

  19. Sustainable reverse logistics for household plastic waste


    Bing, X.


    Summary of the thesis titled “Sustainable Reverse Logistics for Household Plastic Waste” PhD Candidate: Xiaoyun Bing Recycled plastic can be used in the manufacturing of plastic products to reduce the use of virgin plastics material. The cost of recycled plastics is usually lower than that of virgin plastics. Therefore, it is environmentally and economically beneficial to improve the plastic recycling system to ensure more plastic waste from households is properly collected and pr...

  20. Alkalinity in oil field waters - what alkalinity is and how it is measured

    International Nuclear Information System (INIS)

    The alkalinity is an important parameter in the description of pH-behaviour, buffer capacity and scaling potentials in oil field waters. Although the alkalinity is widely used, it seems to be considerable confusion in connection with the concept. It is often used incorrectly and different authors define the concept in different ways. Several different methods for the determination of alkalinity can be found in the literature. This paper discusses the definition of alkalinity and how to use alkalinity in oil field waters to obtain data of importance for scale and pH predictions. There is also shown how a simple titration of oil field waters can give both the alkalinity and the content of organic acids in these waters. It is obvious from these findings that most of the methods used to day may give considerable errors when applied to oil field waters with high contents of organic acids. 8 refs., 8 figs., 5 tabs

  1. Domestic energy use and householders' energy behaviour

    International Nuclear Information System (INIS)

    This paper discusses domestic energy use and energy behaviour. It shows some improvement in domestic energy consumption and adoption of good energy practice. The survey conducted indicated that 35% of homes could improve their energy efficiency by improved tank insulation. In the last 5 years condensing boilers have been installed only in 3% of homes, indicating that householders are unaware of their advantages. Although 88% of surveyed homes had purchased a major appliance in the last 2 years, only 16% had any idea of the energy rating of their new appliances. Use of energy saving light bulbs is predominant in kitchens compared to other rooms. 70–80% of householders undertook some kind of day-to-day energy efficiency measures. 20–35% of householders would like to invest in energy-saving measures but found cost to be a key barrier. Approximately 84% of those surveyed were unaware of the energy rating of their household appliances. Price and brand were the most important factors determining the purchase of a new appliance. Significant energy-saving could be achieved by providing appropriate information to the general public regarding temperature control, efficiency of appliances and energy-saving heating systems. - Highlights: ▶ Good practice in household energy use is being adopted but actual use is rising. ▶ Cost is dominant in energy related decisions purchasing of household appliances. ▶ Energy behaviour is improving but level of awareness needs more work.

  2. Household energy requirement and value patterns

    International Nuclear Information System (INIS)

    For an effective consumer energy policy, it is important to know why some households require more energy than others. The aim of the study described here was to examine whether there is a relationship between the total household energy requirement, on one hand, and value patterns, the motivation to save energy or the problem perception of climate change, on the other. To examine these relationships, we held a consumer survey among 2304 respondent households. We did not find significant differences in the energy requirement of groups of households with different value patterns, taking into account the differences in the socio-economic situation of households. Only for the 'motivation to save energy' we did find that the least motivated group requires 10 GJ more energy than the average and most motivated groups; this is about 4% of the total household energy requirement. This means that a self-regulating energy policy, solely based on the fact that a strategy of internalising environmental responsibility will not be effective in saving energy. There are indications that a social dilemma is one of the reasons why people's consumption patterns do not conform to their value patterns, problem perception or motivation to save energy

  3. AAS 228: Day 2 morning (United States)

    Kohler, Susanna


    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  4. Technetium recovery from high alkaline solution (United States)

    Nash, Charles A.


    Disclosed are methods for recovering technetium from a highly alkaline solution. The highly alkaline solution can be a liquid waste solution from a nuclear waste processing system. Methods can include combining the solution with a reductant capable of reducing technetium at the high pH of the solution and adding to or forming in the solution an adsorbent capable of adsorbing the precipitated technetium at the high pH of the solution.

  5. Alkaline tolerant dextranase from streptomyces anulatus (United States)

    Decker, Stephen R.; Adney, William S.; Vinzant, Todd B.; Himmel, Michael E.


    A process for production of an alkaline tolerant dextranase enzyme comprises culturing a dextran-producing microorganism Streptomyces anulatus having accession no. ATCC PTA-3866 to produce an alkaline tolerant dextranase, Dex 1 wherein the protein in said enzyme is characterized by a MW of 63.3 kDa and Dex 2 wherein its protein is characterized by a MW of 81.8 kDa.

  6. Chemical Associations of Lead, Cadmium, Chromium, Nickel and Zinc in Household Dust of Kathmandu Metropolitan Area

    International Nuclear Information System (INIS)

    Dust samples were collected from roadside houses of seven major locations in Kathmandu metropolitan area and trace element compositions was determined by atomic absorption spectrophotometer (AAS). Results show significant concentrations of Zn, Pb, Ni, Cr and Cd in the test household dusts as compared to the undisturbed (control) area. The mean concentrations of all the studied locations were found to be 76.2 mg/kg for Zn, 40.6 mg/kg for Pb, 29.9 mg/kg for Cr, 23.9 mg/kg for Ni and 8.2 mg/kg for Cd, respectively. Increase in these trace metals in the dust can most likely be attributed to rapid urbanization, increased vehicle emissions to the atmosphere and other anthropogenic sources. Elevated Zn abundance in household dust probably originates from traffic sources. Besides, enrichment factor reveals that the household dust was most severely affected by Cd in almost all the locations. Also, correlations between metal levels in dust samples for all the metals were investigated. (author)

  7. Alkaline Water and Longevity: A Murine Study (United States)

    Magro, Massimiliano; Corain, Livio; Ferro, Silvia; Baratella, Davide; Bonaiuto, Emanuela; Terzo, Milo; Corraducci, Vittorino; Salmaso, Luigi; Vianello, Fabio


    The biological effect of alkaline water consumption is object of controversy. The present paper presents a 3-year survival study on a population of 150 mice, and the data were analyzed with accelerated failure time (AFT) model. Starting from the second year of life, nonparametric survival plots suggest that mice watered with alkaline water showed a better survival than control mice. Interestingly, statistical analysis revealed that alkaline water provides higher longevity in terms of “deceleration aging factor” as it increases the survival functions when compared with control group; namely, animals belonging to the population treated with alkaline water resulted in a longer lifespan. Histological examination of mice kidneys, intestine, heart, liver, and brain revealed that no significant differences emerged among the three groups indicating that no specific pathology resulted correlated with the consumption of alkaline water. These results provide an informative and quantitative summary of survival data as a function of watering with alkaline water of long-lived mouse models. PMID:27340414

  8. Households Touched by Crime, 1987. Bureau of Justice Statistics Bulletin. (United States)

    Rand, Michael R.; And Others

    For the year 1987, 24.4 % of American households were touched by crime. A household is considered touched by crime if during the year it was affected by a burglarly, auto theft, or household theft or if a household member was raped, robbed, or assaulted or was a victim of personal theft, no matter where the crime occurred. These offenses, which…

  9. 21 CFR 864.7660 - Leukocyte alkaline phosphatase test. (United States)


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Leukocyte alkaline phosphatase test. 864.7660... Leukocyte alkaline phosphatase test. (a) Identification. A leukocyte alkaline phosphatase test is a device used to identify the enzyme leukocyte alkaline phosphatase in neutrophilic granulocytes...

  10. Households' characteristics and the modes of remittances in Bangladesh


    Chowdhury, Mehdi


    The modes of remittances of households in Bangladesh have been categorised as `No Remit- tances', `Internal Remittances' and `International Remittances'. This paper using a Multinomial Logit Model studies the associations between these modes and the households' basic character- istics. The study reveals that household level variables like rural-urban locations, age and sex of the households heads, religion, ratio of male, adult and young members etc. are potentially significant in households'...

  11. Integration into the South African Core Economy: Household Level Covariates


    Sten Dieden


    The aim of this paper is to further improve the understanding of income generation among the formerly underprivileged and often impoverished majority of households in South Africa. This study uses household survey data for the analysis of households' integration into the South African core economy. The emerging picture of household income generation is one that disputes common perceptions of the multitude of means by which African households are assumed to generate their income. The majority ...

  12. AA, vacuum tank for stochastic precooling

    CERN Multimedia


    The vaccum tank in which the fast stochastic precooling kicker was installed. It is clad with heating jackets for bake-out to 200 deg C, indispensable for reaching the operational vacuum of 7E-11 Torr. Alain Poncet, responsible for AA vacuum, is looking on. See also 7910268, 8002234.

  13. AA, mating of BST magnet halves

    CERN Multimedia


    The AA had 2 types of bending magnets: BLG (window-frame,long and narrow) and BST (H-type, short and wide). The BST had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the mating of two BST halves.

  14. Modification of magnetite coating formation in presence of alkaline acrylic acid

    International Nuclear Information System (INIS)

    In Indian PHWR's, the hot conditioning of primary heat transport system is carried out to form a protective magnetite coating on the inner surface of PHT system at the start up of the reactor and also after decontamination of PHT system to minimize the release of loose crud particulates and corrosion of the PHT system. An attempt has been made to modify the chemistry conditions for the formation of protective magnetite coating on CS coupons in a static autoclave at 523K to view its impact on the nature of the protectivity. In continuation of our efforts to modify the film with various organic additives like Glycerol, Ethylene glycol, PEG, in this paper the effect of acrylic acid on magnetite coating formation is discussed. The metal oxide powders synthesized by polymer combustion route in PVA, PEG and PAA resulted in nano crystallites. To see the effect of theses organics in reducing the crystallite sizes and improving the corrosion resistance behaviour in hydrothermal conditions the experiments are carried out. In presence of Acrylic acid (AA) at different concentrations (50, 100, 500ppm) at alkaline pH (LiOH -10.4 ) in static autoclave, magnetite coating is formed on CS coupons. The coupons were characterized by XRD, SEM, Raman and Electrochemical impedance and Potentiodynamic Anodic Polarization (PDAP) studies. The addition of acrylic acid results in smaller crystallite sizes and the crystallites look like thread bundles for 50ppm concentration of AA. PDAP studies indicate better film protectivity for magnetite coating formed in 50 ppm AA. Corrosion rate is observed to be less for CS coupons in presence of 50 and 100 ppm AA. The tendency for the film formed to dissolve is less for both 50 and 100 ppm AA developed coating in comparison to coating developed in LiOH alone. The impedance studies indicated the pore resistance of the film increased two fold and seven fold for 50 and 100 ppm acrylic acid case in comparison to simple LiOH case where as the charge

  15. 7 CFR 51.596 - U.S. Grade AA. (United States)


    ... 7 Agriculture 2 2010-01-01 2010-01-01 false U.S. Grade AA. 51.596 Section 51.596 Agriculture... Consumer Standards for Celery Stalks Grades § 51.596 U.S. Grade AA. U.S. Grade AA shall consist of stalks of celery of similar varietal characteristics, which are well developed, and have good...

  16. Household Transmission of Vibrio cholerae in Bangladesh.

    Directory of Open Access Journals (Sweden)

    Jonathan D Sugimoto


    Full Text Available Vibrio cholerae infections cluster in households. This study's objective was to quantify the relative contribution of direct, within-household exposure (for example, via contamination of household food, water, or surfaces to endemic cholera transmission. Quantifying the relative contribution of direct exposure is important for planning effective prevention and control measures.Symptom histories and multiple blood and fecal specimens were prospectively collected from household members of hospital-ascertained cholera cases in Bangladesh from 2001-2006. We estimated the probabilities of cholera transmission through 1 direct exposure within the household and 2 contact with community-based sources of infection. The natural history of cholera infection and covariate effects on transmission were considered. Significant direct transmission (p-value<0.0001 occurred among 1414 members of 364 households. Fecal shedding of O1 El Tor Ogawa was associated with a 4.9% (95% confidence interval: 0.9%-22.8% risk of infection among household contacts through direct exposure during an 11-day infectious period (mean length. The estimated 11-day risk of O1 El Tor Ogawa infection through exposure to community-based sources was 2.5% (0.8%-8.0%. The corresponding estimated risks for O1 El Tor Inaba and O139 infection were 3.7% (0.7%-16.6% and 8.2% (2.1%-27.1% through direct exposure, and 3.4% (1.7%-6.7% and 2.0% (0.5%-7.3% through community-based exposure. Children under 5 years-old were at elevated risk of infection. Limitations of the study may have led to an underestimation of the true risk of cholera infection. For instance, available covariate data may have incompletely characterized levels of pre-existing immunity to cholera infection. Transmission via direct exposure occurring outside of the household was not considered.Direct exposure contributes substantially to endemic transmission of symptomatic cholera in an urban setting. We provide the first estimate of

  17. Prophylactic treatment with alkaline phosphatase in cardiac surgery induces endogenous alkaline phosphatase release

    NARCIS (Netherlands)

    Kats, Suzanne; Brands, Ruud; Hamad, Mohamed A. Soliman; Seinen, Willem; Schamhorst, Volkher; Wulkan, Raymond W.; Schoenberger, Jacques P.; van Oeveren, Wim


    Introduction: Laboratory and clinical data have implicated endotoxin as an important factor in the inflammatory response to cardiopulmonary bypass. We assessed the effects of the administration of bovine intestinal alkaline phosphatase (bIAP), an endotoxin detoxifier, on alkaline phosphatase levels

  18. Energy requirements of households in Brazil

    International Nuclear Information System (INIS)

    In this study we determine the total (direct plus indirect) energy requirements of a given set of Brazilian households. We use a generalized input-output model in order to calculate the energy embodied in goods and services purchased by households of different income level in 11 capital cities of Brazil. Our results show that, on average, the total energy intensity of household expenditure increases with income level, although there is a considerable spread in energy intensities within income classes as well as disparities between regions of the country. The total yearly average energy requirement per household in Brazil in 1995-96 was 173.6 GJ (61% of which was indirect), with 32.8 GJ for the lower income level (66% of which was indirect), and 602.2 GJ for the higher income level (62% of which was indirect). Of this total average energy requirement, 76% was required for only three consumption categories: utilities (31%), mobility (28%) and shelter (17%). This analysis calls for the attention that has to be given not only to the direct energy consumption (as motor fuels and electricity, for example) but also to the consumption categories that encompass an important part of the indirect energy requirement of households in capital cities in Brazil

  19. Household epidemic models with varying infection response

    CERN Document Server

    Ball, Frank; Sirl, David


    This paper is concerned with SIR (susceptible $\\to$ infected $\\to$ removed) household epidemic models in which the infection response may be either mild or severe, with the type of response also affecting the infectiousness of an individual. Two different models are analysed. In the first model, the infection status of an individual is predetermined, perhaps due to partial immunity, and in the second, the infection status of an individual depends on the infection status of its infector and on whether the individual was infected by a within- or between-household contact. The first scenario may be modelled using a multitype household epidemic model, and the second scenario by a model we denote by the infector-dependent-severity household epidemic model. Large population results of the two models are derived, with the focus being on the distribution of the total numbers of mild and severe cases in a typical household, of any given size, in the event that the epidemic becomes established. The aim of the paper is ...

  20. Equity in dental care among Canadian households

    Directory of Open Access Journals (Sweden)

    Grootendorst Paul


    Full Text Available Abstract Background Changes in third party financing, whether public or private, are linked to a household's ability to access dental care. By removing costs at point of purchase, changes in financing influence the need to reach into one's pocket, thus facilitating or limiting access. This study asks: How have historical changes in dental care financing influenced household out-of-pocket expenditures for dental care in Canada? Methods This is a mixed methods study, comprised of an historical review of Canada's dental care market and an econometric analysis of household out-of-pocket expenditures for dental care. Results We demonstrate that changes in financing have important implications for out-of-pocket expenditures: with more financing come drops in the amount a household has to spend, and with less financing come increases. Low- and middle-income households appear to be most sensitive to changes in financing. Conclusions Alleviating the price barrier to care is a fundamental part of improving equity in dental care in Canada. How people have historically spent money on dental care highlights important gaps in Canadian dental care policy.

  1. Demographic and Expenditure Profiles of Zambian Households: Evidence from the June 1991 Zambian Household Expenditure and Income Survey


    Gary Stampley


    The HEIS's linkage of household-level demographic and expenditure data for Zambia provides the foundation for an analysis of household expenditure patterns. For this report, total household expenditure was composed of two broad expenditure classifications, food and nonfood. An analytical emphasis was placed on developing the food expenditure patterns of household groups identified by various socioeconomic characteristics. In general, within the various household classifications, there were th...

  2. EValuation of the thixoformability of AA7004 and AA7075 alloys

    Directory of Open Access Journals (Sweden)

    Eugenio José Zoqui


    Full Text Available This study involved a complete evaluation of the thixoformability of AA7004 and AA7075 alloys, from their microstructural characterization to their viscous behavior. The alloys were subjected to globularization heat treatments for 0, 30, 90 and 210 seconds in two conditions of solid fractions, 45 and 60%, and to viscosity assays under the same conditions. Heat treatments promote the globularization of primary phase particles; hence, the best viscosity results were achieved for alloys with low solid fractions heat-treated for 210 seconds. Alloys AA7004 and AA7075 showed an apparent viscosity of 10(4 to 10(5 (Pa.s. The behavior of materials in this range is similar to that of molten glass and they show high formability. However, the AA7075 alloy showed a better performance than the AA7004 due to the smaller size of its primary particles and original grains, their lower growth during reheating, and depending on the condition, their viscosity of 10(4 Pa.s, which is extremely low for thixoforming standards.

  3. Processing and Optimization of Dissimilar Friction Stir Welding of AA 2219 and AA 7039 Alloys (United States)

    Venkateswarlu, D.; Nageswara rao, P.; Mahapatra, M. M.; Harsha, S. P.; Mandal, N. R.


    The present paper discusses the optimization of dissimilar friction stir welding of AA 2219 and AA 7039 alloys with respect to tool design issues including microstructural study of weld. The optimized ultimate tensile strength was ~280 MPa, and % elongation was ~11.5. It was observed that the extent of tool shoulder flat surface and tool rotational speed influenced the weld quality significantly. A mathematical model was also developed using response surface regression analysis to predict the effects of tool geometry and process variables on dissimilar AA 2219 and AA 7039 alloys welds. The microstructure evolution and mechanical properties were investigated by employing electron backscatter diffraction technique, Vickers microhardness, and tensile testing, respectively. The microstructural observations indicated that the grain size obtained at advancing side (AA 2219 alloy side) was much finer compared to the retreating side (AA 7039 alloy side). Hardness distribution in the stir zone was inhomogeneous, which might be due to inadequate mixing of weld zone material. The hardness values observed at the weld zone were lower than that in the base materials.

  4. The Household Market for Electric Vehicles: Testing the Hybrid Household Hypothesis--A Reflively Designed Survey of New-car-buying, Multi-vehicle California Households


    Turrentine, Thomas; Kurani, Kenneth


    We report the results of a survey of the potential demand for electric vehicles (EVs) among a subset of California households. We limit our analysis to one group of potential hybrid households. These households own two or more light duty vehicles and buy new vehicles of the body styles we expect will be offered as electric vehicles. These characteristics identify households who may be able to incorporate at least one limited range vehicle into thei...

  5. Household food waste in Nordic countries

    DEFF Research Database (Denmark)

    Gjerris, Mickey; Gaiani, Silvia


    This study focuses on food waste generated by households in four Nordic countries: Finland, Denmark, Norway, and Sweden. Based on existing literature we present (A) comparable data on amounts and monetary value of food waste; (B) explanations for food waste at household level; (C) a number of...... public and private initiatives at national levels aiming to reduce food waste; and (D) a discussion of ethical issues related to food waste with a focus on possible contributions from ecocentric ethics. We argue that reduction of food waste at household level, which has an impact on issues such as...... climate change and unjust distribution of food resources, needs to be based on an appreciative and relational understanding of nature and food and not only on economic and moralizing arguments. This is done by drawing on an ecocentric perspective where food is seen as one of the areas where new narratives...

  6. Household batteries: Evaluation of collection methods

    Energy Technology Data Exchange (ETDEWEB)

    Seeberger, D.A.


    While it is difficult to prove that a specific material is causing contamination in a landfill, tests have been conducted at waste-to-energy facilities that indicate that household batteries contribute significant amounts of heavy metals to both air emissions and ash residue. Hennepin County, MN, used a dual approach for developing and implementing a special household battery collection. Alternative collection methods were examined; test collections were conducted. The second phase examined operating and disposal policy issues. This report describes the results of the grant project, moving from a broad examination of the construction and content of batteries, to a description of the pilot collection programs, and ending with a discussion of variables affecting the cost and operation of a comprehensive battery collection program. Three out-of-state companies (PA, NY) were found that accept spent batteries; difficulties in reclaiming household batteries are discussed.

  7. Household batteries: Evaluation of collection methods

    Energy Technology Data Exchange (ETDEWEB)

    Seeberger, D.A.


    While it is difficult to prove that a specific material is causing contamination in a landfill, tests have been conducted at waste-to-energy facilities that indicate that household batteries contribute significant amounts of heavy metals to both air emissions and ash residue. Hennepin County, MN, used a dual approach for developing and implementing a special household battery collection. Alternative collection methods were examined; test collections were conducted. The second phase examined operating and disposal policy issues. This report describes the results of the grant project, moving from a broad examination of the construction and content of batteries, to a description of the pilot collection programs, and ending with a discussion of variables affecting the cost and operation of a comprehensive battery collection program. Three out-of-state companies (PA, NY) were found that accept spent batteries; difficulties in reclaiming household batteries are discussed.

  8. Electricity savings in households with everyday IT

    DEFF Research Database (Denmark)

    Kibsgaard, Kaj; Larsen, Anders; leth, Søren;

    This paper analyzes the effect of supplying online feedback by SMS-text messages and email about electricity consumption on the level of total household electricity consumption. An experiment was conducted where 1,452 households were randomly allocated to three experimental groups and two control...... groups. Feedback was supplied throughout 2007 to members of the experiment groups who accepted the invitation, and data on consumption of electricity for 2006 and 2007 collected for all participants and control group members. 30% of the households invited to receive feedback accepted the invitation....... The estimated effects of the feedback on consumption of electricity are estimated to be in the range of 2-3%. The feedback technology is cheap to implement and therefore likely to be cost-effective...

  9. Evolution of geomagnetic aa index near sunspot minimum


    Kane, R. P.


    The smoothed values of the minima of sunspot number Rz and the geomagnetic index aa were compared for sunspot cycles 12–23. In one cycle, aa(min) occurred earlier than Rz(min), but remained at that low from a few months before Rz(min) to a few months after Rz(min). In two cycles, Rz(min) and aa(min) coincided within a month or two. In nine cycles, aa(min) occurred more than three months later than Rz(min). The aa(min) coincided with the minima of some solar radio e...

  10. Dicty_cDB: FC-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA03 (Link to dictyBase) - - - Contig-U15331-1 FC-AA03P (Li...nk to Original site) FC-AA03F 595 FC-AA03Z 546 FC-AA03P 1141 - - Show FC-AA03 Library FC (Link to library) Clone ID FC-AA...nal site URL Representative seq. ID FC-AA...03P (Link to Original site) Representative DNA sequence >FC-AA03 (FC-AA03Q) /CSM/FC/FC-AA/FC-AA03Q.Seq.d/ AA...AATGTCATCTTATTTATTCACTAGTGAATCCGTCACCGAAGTCATCCAGATAAAATCT GTGATCAAGTATCAGATGCTGTTCTCGATGCTTGTTTAGCTCAA

  11. Dicty_cDB: FC-AA04 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA04 (Link to dictyBase) - - - Contig-U15354-1 FC-AA04P (Li...nk to Original site) FC-AA04F 546 FC-AA04Z 484 FC-AA04P 1030 - - Show FC-AA04 Library FC (Link to library) Clone ID FC-AA...nal site URL Representative seq. ID FC-AA...04P (Link to Original site) Representative DNA sequence >FC-AA04 (FC-AA04Q) /CSM/FC/FC-AA/FC-AA04Q.Seq.d/ AA...TAATACACATAAAAAATTTATTAAATAAAAATGACTACAACAACAACAAATGAAGTTT ATATAGTTGATTGTATTCGTACACCAATTGGTAGAGGATATAGTAA

  12. Dicty_cDB: FC-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA10 (Link to dictyBase) - - - Contig-U16358-1 FC-AA10P (Li...nk to Original site) FC-AA10F 659 FC-AA10Z 544 FC-AA10P 1203 - - Show FC-AA10 Library FC (Link to library) Clone ID FC-AA...nal site URL Representative seq. ID FC-AA...10P (Link to Original site) Representative DNA sequence >FC-AA10 (FC-AA10Q) /CSM/FC/FC-AA/FC-AA10Q.Seq.d/ AA...ATGACTACCTTTAACGAATATCCATTCTTGGCTGAATTAGGCATTAAAGCTGAAAATA ATGATGGAGTCTTCAATGGAAAATGGGGAGGTGCTGGTGAAATCATCAA

  13. Targeting antibiotics to households for trachoma control.

    Directory of Open Access Journals (Sweden)

    Isobel M Blake

    Full Text Available BACKGROUND: Mass drug administration (MDA is part of the current trachoma control strategy, but it can be costly and results in many uninfected individuals receiving treatment. Here we explore whether alternative, targeted approaches are effective antibiotic-sparing strategies. METHODOLOGY/PRINCIPAL FINDINGS: We analysed data on the prevalence of ocular infection with Chlamydia trachomatis and of active trachoma disease among 4,436 individuals from two communities in The Gambia (West Africa and two communities in Tanzania (East Africa. An age- and household-structured mathematical model of transmission was fitted to these data using maximum likelihood. The presence of active inflammatory disease as a marker of infection in a household was, in general, significantly more sensitive (between 79% [95%CI: 60%-92%] and 86% [71%-95%] across the four communities than as a marker of infection in an individual (24% [16%-33%]-66% [56%-76%]. Model simulations, under the best fit models for each community, showed that targeting treatment to households has the potential to be as effective as and significantly more cost-effective than mass treatment when antibiotics are not donated. The cost (2007US$ per incident infection averted ranged from 1.5 to 3.1 for MDA, from 1.0 to 1.7 for household-targeted treatment assuming equivalent coverage, and from 0.4 to 1.7 if household visits increased treatment coverage to 100% in selected households. Assuming antibiotics were donated, MDA was predicted to be more cost-effective unless opportunity costs incurred by individuals collecting antibiotics were included or household visits improved treatment uptake. Limiting MDA to children was not as effective in reducing infection as the other aforementioned distribution strategies. CONCLUSIONS/SIGNIFICANCE: Our model suggests that targeting antibiotics to households with active trachoma has the potential to be a cost-effective trachoma control measure, but further work is

  14. Household and Small Business Across the Disciplines

    Directory of Open Access Journals (Sweden)

    Nicoletta Stame


    Full Text Available Households, which are seen as income pooling units (Wallerstein, Martin, Dickinson 1982, play a crucial role in the world-system analysis. Individuals enjoy income that accrues to their households, a unit embedded in a network of different social relationships among people, kin or not kin, living under the same roof or sharing some important living function. Thus, social relations are seen as ways of obtaining different types of income (wages, rent, pro?t, social exchange, gifts and ways of ensuring different welfare services.

  15. Future Changes in Age and Household Patterns

    DEFF Research Database (Denmark)

    Højbjerg Jacobsen, Rasmus; Hougaard Jensen, Svend E.


    Using stochastic forecasting techniques, this paper assesses the consequences for public finances of changes in age and household structures in Denmark over the period 2008–2037. Focusing on components of welfare provisions and tax payments with noticeable differences across age and household...... amount of uncertainty, the prospect of such a dramatic weakening of public finances is likely to trigger demands for welfare reforms characterized by a more individualized system of public transfer and tax payments, in addition to the measures that have already been taken to address the fiscal effects of...

  16. An inquiry into the household economy (United States)

    Samuelson, R. D.


    The value of the time which people devote to each activity of their lives is compared with the money they spend on the activity. After tax wage rates are used to value an individual's time. The enormous size of the household economy and the fact that for most activities the value of the consumer's time devoted to an activity exceeds the money expenditures on the activity, suggest that there are many opportunities for productivity improvements in the household economy which have been overlooked in most traditional thinking on productivity.

  17. Specific Examples of Hybrid Alkaline Cement


    Fernández-Jiménez Ana; García-Lodeiro Inés; Donatello Shane; Maltseva Olga; Palomo Ángel


    Hybrid alkaline cements are obtained by alkali-activating cementitious blends in the Na2O-CaO-SiO2-Al2O3-H2O system. The present paper discusses the results of activating different cementitious blends containing a low OPC clinker content ( 15MPa a 2 days) different alkaline activators were used (liquid and solid). The reaction products obtained were also characterised by XRD, SEM/EDX and 27Al and 29Si NMRMAS. The results showed that the main reaction product was a mix of cementitious gels C-A...

  18. Alkaline earth filled nickel skutterudite antimonide thermoelectrics (United States)

    Singh, David Joseph


    A thermoelectric material including a body centered cubic filled skutterudite having the formula A.sub.xFe.sub.yNi.sub.zSb.sub.12, where A is an alkaline earth element, x is no more than approximately 1.0, and the sum of y and z is approximately equal to 4.0. The alkaline earth element includes guest atoms selected from the group consisting of Be, Mb, Ca, Sr, Ba, Ra and combinations thereof. The filled skutterudite is shown to have properties suitable for a wide variety of thermoelectric applications.

  19. Alkaline Capacitors Based on Nitride Nanoparticles (United States)

    Aldissi, Matt


    High-energy-density alkaline electrochemical capacitors based on electrodes made of transition-metal nitride nanoparticles are undergoing development. Transition- metal nitrides (in particular, Fe3N and TiN) offer a desirable combination of high electrical conductivity and electrochemical stability in aqueous alkaline electrolytes like KOH. The high energy densities of these capacitors are attributable mainly to their high capacitance densities, which, in turn, are attributable mainly to the large specific surface areas of the electrode nanoparticles. Capacitors of this type could be useful as energy-storage components in such diverse equipment as digital communication systems, implanted medical devices, computers, portable consumer electronic devices, and electric vehicles.

  20. Electrochemical behaviour of alkaline copper complexes

    Indian Academy of Sciences (India)

    C L Aravinda; S M Mayanna; V R Muralidharan


    A search for non-cyanide plating baths for copper resulted in the development of alkaline copper complex baths containing trisodium citrate [TSC] and triethanolamine [TEA]. Voltammetric studies were carried out on platinum to understand the electrochemical behaviour of these complexes. In TSC solutions, the deposition of copper involves the slow formation of a monovalent species. Adsorption of this species obeys Langmuir isotherm. In TEA solutions the deposition involves the formation of monovalent ions obeying the non-activated Temkin isotherm. Conversion of divalent to monovalent copper is also slow. In TEA and TSC alkaline copper solutions, the predominant species that undergo stepwise reduction contain only TEA ligands

  1. Measures of Farm Household Well-Being Tell Different Stories


    Jones, Carol Adaire; Milkove, Daniel


    Traditionally, the economic well-being of households is gauged by indicators of the financial resources available–— household income and, when available, wealth. ERS publishes estimates of farm household income and wealth based on responses to USDA’s annual Agricultural Resource Management Survey (ARMS). Since 1998, average farm operator household income has exceeded that of the typical U.S. household by 3 to 21 percent, and median farm household wealth has been 4-5 times that of all U....





    This paper presents estimates for a thirty year period of Australia’s Gross Household Product (GHP), the economic value added by unpaid labour and the households own capital. In 2000 GHP was estimated to be worth $471 billion. Gross Market Product (GDP minus the imputed value of owner-occupied housing) was worth $604 billion in 2000. The household economy was nearly 80 per cent of the size of the market economy in 2000. More importantly, the GHP is nearly half (44%) of total economic activity...

  3. Food Insecurity in Households with Children: Prevalence, Severity, and Household Characteristics


    Nord, Mark


    Eighty-four percent of U.S. households with children were food secure throughout 2007, meaning that they had consistent access to adequate food for active, healthy lives for all household members. Nearly 16 percent of households with children were food insecure sometime during the year, including 8.3 percent in which children were food insecure and 0.8 percent in which one or more children experienced very low food security—the most severe food-insecure condition measured by the U.S. Departme...

  4. AA, inner conductor of a magnetic horn

    CERN Multimedia


    At the start-up of the AA and during its initial operation, magnetic horns focused the antiprotons emanating from the production target. These "current-sheet lenses" had a thin inner conductor (for minimum absorption of antiprotons), machined from aluminium to wall thicknesses of 0.7 or 1 mm. The half-sine pulses rose to 150 kA in 8 microsec. The angular acceptance was 50 mrad.

  5. AA Prototype-Quadrupole on Measurement Stand

    CERN Multimedia


    The very particular lattice of the AA required 2 types of quadrupoles: narrow ones (QFN, QDN) and wide ones (QFW, QDW). The wide ones, although not very long (steel length 0.54 m), had an unusually large aperture of 0.75 m in width, 0.68 m "good field". A prototype was built in 1978. Here we see it on its test stand, with Ray Brown positioning the measurement coil.

  6. AA Prototype-Quadrupole on Measurement Stand

    CERN Multimedia


    The very particular lattice of the AA required 2 types of quadrupoles: narrow ones (QFN, QDN) and wide ones (QFW, QDW). The wide ones, although rather short (steel length 0.54 m), had an unusually large aperture of 0.75 m in width, 0.68 m "good field". A prototype was built at CERN in 1978. Here we see it on its test stand, with a measurement coil inserted, Brian Pincott taking readings.

  7. Research in development: the approach of AAS


    Dugan, P.; Apgar, M.; Douthwaite, B.


    The CGIAR Research Program on Aquatic Agricultural Systems (AAS) is pursuing a Research in Development approach that emphasizes the importance of embedding research in the development context. Reflecting this emphasis the six elements of this approach are a commitment to people and place, participatory action research, gender transformative research, learning and networking, partnerships, and capacity building. It is through the careful pursuit of these six elements that we believe that the p...

  8. AA, assembly of wide bending magnet

    CERN Multimedia


    The very particular lattice of the AA required 2 types of dipoles (bending magnets; BST, short and wide; BLG, long and narrow). The wide ones had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the copper coils being hoisted onto the lower half of a BST. See also 7811105, 8006050. For a BLG, see 8001044.

  9. The Alkaline Diet: Is There Evidence That an Alkaline pH Diet Benefits Health?

    Directory of Open Access Journals (Sweden)

    Gerry K. Schwalfenberg


    Full Text Available This review looks at the role of an alkaline diet in health. Pubmed was searched looking for articles on pH, potential renal acid loads, bone health, muscle, growth hormone, back pain, vitamin D and chemotherapy. Many books written in the lay literature on the alkaline diet were also reviewed and evaluated in light of the published medical literature. There may be some value in considering an alkaline diet in reducing morbidity and mortality from chronic diseases and further studies are warranted in this area of medicine.

  10. The Alkaline Diet: Is There Evidence That an Alkaline ph Diet Benefits Health?

    International Nuclear Information System (INIS)

    This review looks at the role of an alkaline diet in health. Pub med was searched looking for articles on ph, potential renal acid loads, bone health, muscle, growth hormone, back pain, vitamin D and chemotherapy. Many books written in the lay literature on the alkaline diet were also reviewed and evaluated in light of the published medical literature. There may be some value in considering an alkaline diet in reducing morbidity and mortality from chronic diseases and further studies are warranted in this area of medicine

  11. The household energy transition in India and China

    International Nuclear Information System (INIS)

    Both India and China are countries in energy transition. This paper compares the household energy transitions in these nations through the analysis of both aggregate statistics and nationally representative household surveys. The two countries differ sharply in several respects. Residential energy consumption in China is twice that in India, in aggregate terms. In addition, Chinese households have almost universal access to electricity, while in India almost half of rural households and 10% of urban households still lack access. On aggregate, urban households in China also derive a larger share of their total energy from liquid fuels and grids (77%) as compared to urban Indian households (65%). Yet, at every income level, Indians derive a slightly larger fraction of their total household energy needs from liquid and grid sources of energy than Chinese with comparable incomes. Despite these differences, trends in energy use and the factors influencing a transition to modern energy in both nations are similar. Compared with rural households, urban households in both nations consume a disproportionately large share of commercial energy and are much further along in the transition to modern energy. However, total energy consumption in rural households exceeds that in urban households, because of a continued dependence on inefficient solid fuels, which contribute to over 85% of rural household energy needs in both countries. In addition to urbanisation, key drivers of the transition in both nations include income, energy prices, energy access and local fuel availability

  12. The household energy transition in India and China

    International Nuclear Information System (INIS)

    Both India and China are countries in energy transition. This paper compares the household energy transitions in these nations through the analysis of both aggregate statistics and nationally representative household surveys. The two countries differ sharply in several respects. Residential energy consumption in China is twice that in India, in aggregate terms. In addition, Chinese households have almost universal access to electricity, while in India almost half of rural households and 10% of urban households still lack access. On aggregate, urban households in China also derive a larger share of their total energy from liquid fuels and grids (77%) as compared to urban Indian households (65%). Yet, at every income level, Indians derive a slightly larger fraction of their total household energy needs from liquid and grid sources of energy than Chinese with comparable incomes. Despite these differences, trends in energy use and the factors influencing a transition to modern energy in both nations are similar. Compared with rural households, urban households in both nations consume a disproportionately large share of commercial energy and are much further along in the transition to modern energy. However, total energy consumption in rural households exceeds that in urban households, because of a continued dependence on inefficient solid fuels, which contribute to over 85% of rural household energy needs in both countries. In addition to urbanisation, key drivers of the transition in both nations include income, energy prices, energy access and local fuel availability. (author)

  13. AAS Publishing News: Astronomical Software Citation Workshop (United States)

    Kohler, Susanna


    Do you write code for your research? Use astronomical software? Do you wish there were a better way of citing, sharing, archiving, or discovering software for astronomy research? You're not alone! In April 2015, AAS's publishing team joined other leaders in the astronomical software community in a meeting funded by the Sloan Foundation, with the purpose of discussing these issues and potential solutions. In attendance were representatives from academic astronomy, publishing, libraries, for-profit software sharing platforms, telescope facilities, and grantmaking institutions. The goal of the group was to establish “protocols, policies, and platforms for astronomical software citation, sharing, and archiving,” in the hopes of encouraging a set of normalized standards across the field. The AAS is now collaborating with leaders at GitHub to write grant proposals for a project to develop strategies for software discoverability and citation, in astronomy and beyond. If this topic interests you, you can find more details in this document released by the group after the meeting: The group hopes to move this project forward with input and support from the broader community. Please share the above document, discuss it on social media using the hashtag #astroware (so that your conversations can be found!), or send private comments to

  14. Household Water Treatments in Developing Countries (United States)

    Smieja, Joanne A.


    Household water treatments (HWT) can help provide clean water to millions of people worldwide who do not have access to safe water. This article describes four common HWT used in developing countries and the pertinent chemistry involved. The intent of this article is to inform both high school and college chemical educators and chemistry students…

  15. Household energy isn't all stoves

    NARCIS (Netherlands)

    Clancy, J.S.


    When people talk about 'household energy', most people automatically think of stoves. A lot of attention has been paid to improving stoves to make them more energy efficient and to reduce their pollution. This is one side of the 'stoves' approach, whilst others look at the 'supply' side of the probl

  16. Distributed Coordination of Household Electricity Consumption

    DEFF Research Database (Denmark)

    Juelsgaard, Morten; Teixeira, Andre; Johansson, Mikael;


    This work presents a distributed framework for coordination of flexible electricity consumption for a number of households in the distribution grid. We conduct coordination with the purpose of minimizing a trade-off between individual concerns about discomfort and electricity cost, on the one hand...

  17. Household Food Security Study Summaries. 2001 Edition. (United States)

    Seavey, Dorie; Sullivan, Ashley F.

    This report provides the most recent data on the food security of United States households. Based on studies using the Food Security Core Module (FSCM), a tool facilitating direct documentation of the extent of food insecurity and hunger caused by income limitations, this report summarizes 35 studies representing 20 states and Canada. The report…

  18. IEC and China Household Electrical Appliance Standardization

    Institute of Scientific and Technical Information of China (English)

    Zhu Yan; Li Yi


    @@ Year 2006 is the year marking the 100th anniversary of the founding of International Electrotechnical Commission (IEC).IEC has kept close ties with international electrical and electronic products and their manufactures for nearly 100 years. As an integral part of electrical and electronic product portfolio, Household electrical product development has also been directly influenced by IEC.

  19. Independence, Individualism & Connection among Share Householders (United States)

    Natalier, Kristin


    How do young people who are financially dependent on their parents but living in share households conceive of the concept of independence? The meanings of independence are discussed in relation to a qualitative study of young people who described themselves as independent although they accepted money on a regular basis from their parents. Their…


    DEFF Research Database (Denmark)

    Nielsen, Joan Maj; Dahi, Elian


    Purification of fluoride contaminated magadi is studied using bone char sorption and calcium precipitation. The bone char treatment is found to be workable both in columns and in batches where the magadi is dissolved in water prior to treatment. The concentrations in the solutions were 89 g magadi...... treatment method. A procedure for purification of fluoride contaminated magadi at household level is described....

  1. Inattention and Inertia in Household Finance

    DEFF Research Database (Denmark)

    Andersen, Steffen; Campbell, John Y.; Meisner Nielsen, Kasper;

    This paper studies inattention to mortgage refinancing incentives among Danish households. Danish data are particularly suitable for this purpose because there are minimal barriers to refinancing, yet many borrowers fail to refinance optimally, and the characteristics of these borrowers can be ac...

  2. User Behavior Assessment of Household Electric Usage

    Directory of Open Access Journals (Sweden)

    Nur Budi Mulyono


    Full Text Available Abstract. Energy resilience is one of the famous issues among researchers and practitioners in energy sector. With enabling new technologies in power engineering for smart grid such as distributed generation, distributed storage, and intelligent information and management, each household community can establish a resilience energy production, distribution, and consumption. A household in smart grid system behaves as a customer and producer at the same time. This condition enabled them to reduce the power shortage in the peak hours, reduce CO2 pollution using renewable electricity, and minimizing electricity usage by changing life style. In developing countries, the amount of electricity supply is less than its demand. Most of the demand comes from the household that has peak load on nighttime. Keywords: User behavior, Game theory, Smart grid, Heating and cooling appliances, Energy resilientdoi:10.12695/ajtm.2013.6.2.1 How to cite this article:Mulyono, N. B. (2013. User Behavior Assessment of Household Electric Usage. The Asian Journal of Technology Management 6 (2: 65-71. Print ISSN: 1978-6956; Online ISSN: 2089-791X. doi:10.12695/ajtm.2013.6.2.1  


    The National Household Survey on Drug Abuse (NHSDA) is sponsored by the Substance Abuse and Mental Health Services Administration (SAMHSA). The survey has been conducted since 1971 and serves as the primary source of information on the prevalence and incidence of illicit drug, al...

  4. Modeling Social Ties and Household Mobility. (United States)

    Metcalf, Sara S


    Underlying the aggregate phenomena of persistent problems such as urban sprawl and spatial socio-economic disparity is the individual choice of where to live. This study develops an agent-based model to simulate social and economic influences on neighborhood choice. With Danville, Illinois as an empirical context, a pattern-oriented approach is employed to examine the role of social ties in shaping intra-urban household mobility. In the model, household agents decide whether and where to relocate within the community based upon factors such as neighborhood attractiveness, affordability, and the density of a household's social network in the prospective block group. Social network and neighborhood choices are encoded with logit utility functions. The relative influence of factors affecting the formation of social ties in the simulated social network, such as geographic proximity, similarity of income, race, and presence of children, are adjusted using parameter variation to create alternative model settings. Simulated migration patterns resulting from different network and neighborhood choice coefficients are compared with observed migration patterns over a two-year period. Based upon 1000 simulation experiments, a regression of homeowner migration error (the difference between simulated and observed migration) relative to the parameter settings revealed components of social network choice such as income, race, and probability of local ties to be significant in matching observed migration patterns. A non-linear effect of simulated social networks on household mobility and thus migration error was exhibited in this study. PMID:25035520

  5. Hazardous household waste management in Vinnytsia region


    Ishchenko, Vitalii; Petruk, Roman; Kozak, Yana


    The article analyzes hazardous household waste, including detergents, paints, adhesives, expired medicines, luminescent lamps, pesticides, fertilizers, batteries and accumulators, electrical and electronic waste, mercury-containing materials. Research shows that they contain a large quantity of dangerous and toxic substances (compounds of heavy metals, chlorinated polymers, aromatic hydrocarbons, surfactants, etc.), which pose a significant risk to the environment and ...



    Manrique, Justo; Jensen, Helen H.


    Consumption of seafood products in Spain has increased recently. Data from a nationally representative household budget survey are used. A double-hurdle model, applied to expenditures on fresh and processed seafood, shows the value of women's time, income and demographics to be determinants of participation and expenditure on seafood products.

  7. Sustainable reverse logistics for household plastic waste

    NARCIS (Netherlands)

    Bing, X.


    Summary of the thesis titled “Sustainable Reverse Logistics for Household Plastic Waste” PhD Candidate: Xiaoyun Bing Recycled plastic can be used in the manufacturing of plastic products to reduce the use of virgin plastics material. The cost of recycled plastics is usually lower than th

  8. A semiparametric model of household gasoline demand

    International Nuclear Information System (INIS)

    Gasoline demand studies typically generate a single price and income elasticity for a country. It is however possible that these elasticities may differ among various socio-economic groups. At the same time, parametric gasoline demand models may not be flexible enough to capture the changes in price elasticities with different levels of income. This paper models US gasoline demand using more flexible semiparametric techniques, accommodating the possibility of differences in responses among households. The econometric model employs a non-parametric bivariate smoothing for price and income and a parametric representation of other explanatory variables. Possible heterogeneity in price and income elasticities is modelled through interacting price and income with demographic variables. Results show that price responses do vary with demographic variables such as income, multiple vehicle holding, presence of multiple wage earners or rural or urban residential locations. Households' responses to a price change decrease with higher income. Multiple vehicle and multiple earner households also show higher sensitivity to a price change. Households located in urban areas reduce consumption more than those in rural areas in response to an increase in price. Comparison of the flexible semiparametric model with a parametric translog model, however, reveals no significant differences between results, and the parametric models have the advantage of lower computational requirements and better interpretability. (author)

  9. Potentiometric assay for acid and alkaline phosphatase

    International Nuclear Information System (INIS)

    Simple potentiometric kinetic assay for evaluation of acid and alkaline phosphatase activity has been developed. Enzymatically catalyzed hydrolysis of monofluorophosphate, the simplest inorganic compound containing P-F bond, has been investigated as the basis of the assays. Fluoride ions formed in the course of the hydrolysis of this specific substrate have been detected using conventional fluoride ion-selective electrode based on membrane made of lanthanum fluoride. The key analytical parameters necessary for sensitive and selective detection of both enzymes have been assessed. Maximal sensitivity of the assays was observed at monofluorophosphate concentration near 10-3 M. Maximal sensitivity of acid phosphatase assay was found at pH 6.0, but pH of 4.8 is recommended to eliminate effects from alkaline phosphatase. Optimal pH for alkaline phosphatase assay is 9.0. The utility of the developed substrate-sensor system for determination of acid and alkaline phosphatase activity in human serum has been demonstrated

  10. Persistently increased intestinal fraction of alkaline phosphatase

    DEFF Research Database (Denmark)

    Nathan, E; Baatrup, G; Berg, H;


    Persistent elevation of the intestinal fraction of the alkaline phosphatase (API) as an isolated finding has to our knowledge not been reported previously. It was found in a boy followed during a period of 5.5 years. The only symptom was transient periodic fatigue observed at home, but not apparent...

  11. Dicty_cDB: FC-AA11 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA11 (Link to dictyBase) - - - Contig-U16273-1 FC-AA11P (Li...nk to Original site) FC-AA11F 631 FC-AA11Z 502 FC-AA11P 1133 - - Show FC-AA11 Library FC (Link to library) Clone ID FC-AA...nal site URL Representative seq. ID FC-AA...11P (Link to Original site) Representative DNA sequence >FC-AA11 (FC-AA11Q) /CSM/FC/FC-AA/FC-AA...11Q.Seq.d/ GGTGAATTAATTGTTGAACCAGTTGATCAAAAATATATTTTCAAGACTGAACGTAAAGTT CCAAGAATGGGTGTTATGATTGTTGGTTTATGTGGTAACAATGGTACAA

  12. Dicty_cDB: FC-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA18 (Link to dictyBase) - - - Contig-U15943-1 FC-AA18P (Li...nk to Original site) FC-AA18F 506 FC-AA18Z 293 FC-AA18P 799 - - Show FC-AA18 Library FC (Link to library) Clone ID site URL Representative seq. ID FC-AA...18P (Link to Original site) Representative DNA sequence >FC-AA18 (FC-AA18Q) /CSM/FC/FC-AA/FC-AA18Q.Seq.d/ AAA...AGATAGAGAAGAAAGAAAACTTGAACGTGAGAAGGAACTTGAACGTGAACGTGAGAA AGAACTTGAGCGTGAGCGTGAACGTGAACAACGTCGTCTTGAAA

  13. Dicty_cDB: FCL-AA07 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA07 (Link to dictyBase) - - - Contig-U14973-1 FCL-AA07P ...(Link to Original site) FCL-AA07F 527 FCL-AA07Z 253 FCL-AA07P 780 - - Show FCL-AA07 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL Representative seq. ID FCL-AA07P (Link to Original site) Representative DNA sequence >FCL-AA07 (FCL-AA07Q) /CSM/FCL/FCL-AA.../FCL-AA07Q.Seq.d/ CAAAATAAAAAATGTTATCAAATTTTTTAAAAGTCAACAGTAAAGCACTAGGACATATAA GAACTTTTGCCTCAAAGAGTGGTGAAATTAAA

  14. Dicty_cDB: FCL-AA12 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA12 (Link to dictyBase) - - - Contig-U16034-1 FCL-AA12P ...(Link to Original site) FCL-AA12F 629 FCL-AA12Z 540 FCL-AA12P 1169 - - Show FCL-AA12 Library FCL (Link to library) Clone ID FCL-AA...4-1 Original site URL Representative seq. ID FCL-AA12P (Link to Original site) Representative DNA sequence >FCL-AA12 (FCL-AA12Q) /CSM/FCL/FCL-AA.../FCL-AA12Q.Seq.d/ ATCAAATGTTTATTCAACAACAACCATCAGATTCAATTGTTTGTAATCGTTATATTCATC CAGCCATTGTTGTTTTGGTTGACCAA

  15. Dicty_cDB: FCL-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA21 (Link to dictyBase) - - - Contig-U14936-1 FCL-AA21P ...(Link to Original site) FCL-AA21F 520 FCL-AA21Z 356 FCL-AA21P 876 - - Show FCL-AA21 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL Representative seq. ID FCL-AA21P (Link to Original site) Representative DNA sequence >FCL-AA21 (FCL-AA21Q) /CSM/FCL/FCL-AA.../FCL-AA21Q.Seq.d/ ATCATAATCATATATTTTTAATAGATATTGATATATATATTTAAAAAAATAAAATAAAAT AAAATAAAAAATGTCAACAGAGGAAACAAAAA

  16. Dicty_cDB: FCL-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA01 (Link to dictyBase) - - - Contig-U16033-1 FCL-AA01P ...(Link to Original site) FCL-AA01F 603 FCL-AA01Z 411 FCL-AA01P 1014 - - Show FCL-AA01 Library FCL (Link to library) Clone ID FCL-AA...3-1 Original site URL Representative seq. ID FCL-AA01P (Link to Original site) Representative DNA sequence >FCL-AA01 (FCL-AA01Q) /CSM/FCL/FCL-AA.../FCL-AA01Q.Seq.d/ GCAAATAATAATATTATGGGTATTGACTTTGGTACACATTTCGCATGTGTTGGTATTTTC AAGAATGAAAGAATTGAAATCTGTCCAAA

  17. Dicty_cDB: FCL-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA13 (Link to dictyBase) - - - - FCL-AA13P (Link to Original site) FCL-AA...13F 635 FCL-AA13Z 350 FCL-AA13P 985 - - Show FCL-AA13 Library FCL (Link to library) Clone ID Representative seq. ID FCL-AA...13P (Link to Original site) Representative DNA sequence >FCL-AA13 (FCL-AA13Q) /CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ CATATTTATAA...TTATATCTTTTTTGTTTAATAAAAAAGAAAGAATACCAACATGAGACTT TTATTGTGTTTAATTTTCTTAGTTTTTGTTTTCAATTTTGCATTATCAA

  18. Dicty_cDB: FC-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA06 (Link to dictyBase) - - - Contig-U15909-1 FC-AA06P (Li...nk to Original site) FC-AA06F 532 FC-AA06Z 501 FC-AA06P 1033 - - Show FC-AA06 Library FC (Link to library) Clone ID FC-AA...nal site URL Representative seq. ID FC-AA...06P (Link to Original site) Representative DNA sequence >FC-AA06 (FC-AA06Q) /CSM/FC/FC-AA/FC-AA...06Q.Seq.d/ GTGAATATAACGATTTAGATTTAGTGTATGATAAAGATGTTTATCAAAAATTAATAGAGA ATGGTGTAGATTCATTATTATCAAAA

  19. Dicty_cDB: FC-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA08 (Link to dictyBase) - - - Contig-U15942-1 FC-AA08P (Li...nk to Original site) FC-AA08F 620 FC-AA08Z 510 FC-AA08P 1130 - - Show FC-AA08 Library FC (Link to library) Clone ID FC-AA...nal site URL Representative seq. ID FC-AA...08P (Link to Original site) Representative DNA sequence >FC-AA08 (FC-AA08Q) /CSM/FC/FC-AA/FC-AA...08Q.Seq.d/ ATCAGTTACATGTACTGCACCAGTTAATATTGCAGTTATCAAATATTGGGGAAAGAGAGA TGAAAATATTATTTTACCATTAAATTCATCACTCAGTGGAA

  20. Household income and health care expenditures in Mexico. (United States)

    Parker, S W; Wong, R


    The purpose of this paper is to examine the determinants of household health expenditures in Mexico. Our analysis involves the estimation of household monetary health care expenditures, using the economic and demographic characteristics of the household as covariates. We pay particular attention to the impact of household income on health expenditures, estimating the elasticity of health care expenditures with respect to income for different income groups and according to health insurance status. For the empirical analysis, we use the Mexican National Survey of Income and Expenditures of 1989. Our principle findings show that monetary health expenditures by Mexican households are sensitive to changes in household income levels and that the group which is most responsive to changes in income levels in the lower-income uninsured group. This suggests that in times of economic crisis, these households reduce cash expenditures on health care by proportionately more than higher-income and insured households. PMID:10168755



    Tomasz Bergel; Tomasz Kotowski; Olga Woyciechowska


    The paper presents an analysis of daily water consumption for household purposes carried out within one year in a selected rural household. The study was undertaken because so far the guidelines for designing rural water supply systems have not been updated for a very long time and needed verification. It involved a comprehensive system for measuring water consumption equipped with automatic readers and data recorders. The research clearly showed that actual water consumption was much lower t...

  2. Household Factors Associated with Self-Harm in Johannesburg, South African Urban-Poor Households.

    Directory of Open Access Journals (Sweden)

    Nisha Naicker

    Full Text Available Low and middle income countries bear the majority burden of self-harm, yet there is a paucity of evidence detailing risk-factors for self-harm in these populations. This study aims to identify environmental, socio-economic and demographic household-level risk factors for self-harm in five impoverished urban communities in Johannesburg, South Africa.Annual serial cross-sectional surveys were undertaken in five impoverished urban communities in Johannesburg for the Health, Environment and Development (HEAD study. Logistic regression analysis using the HEAD study data (2006-2011 was conducted to identify household-level risk factors associated with self-harm (defined as a self-reported case of a fatal or non-fatal suicide attempt within the household during the preceding year. Stepwise multivariate logistic regression analysis was employed to identify factors associated with self-harm.A total of 2 795 household interviews were conducted from 2006 to 2011. There was no significant trend in self-harm over time. Results from the final model showed that self-harm was significantly associated with households exposed to a violent crime during the past year (Adjusted Odds Ratio (AOR 5.72; 95% CI 1.64-19.97; that have a member suffering from a chronic medical condition (AOR 8.95; 95% 2.39-33.56 and households exposed to indoor smoking (AOR 4.39; CI 95% 1.14-16.47.This study provides evidence on household risk factors of self-harm in settings of urban poverty and has highlighted the potential for a more cost-effective approach to identifying those at risk of self-harm based on household level factors.

  3. Time use within the household: Household production, work-life balance and racial discrimination


    Giménez Nadal, José Ignacio; Molina Chueca, José Alberto


    This doctoral dissertation uses microeconomic analysis to examine the behaviour of the members of the household, developing 3 lines of investigation that focus on time-allocation decisions. The first line of research analyzes how social norms can influence the time allocation decisions of individuals, which in turn may influence life decisions such as partnership formation, especially in countries with more traditional gender norms regarding the distribution of household chores. The second li...

  4. Family Size, Household Shocks and Chronic and Transient Poverty in the Philippine Households


    Bayudan-Dacuycuy, Connie; Lim, Joseph Anthony


    Using panel data, this paper attempts to analyze the chronic and transient poverty in the Philippines. Results indicate that chronic poverty is the more substantial portion of the Philippine poverty with rural households and households in the Mindanao region as the more afflicted areas. This paper finds that both chronic and transient poverty are affected by negative shocks but negative labor market shocks affect chronic poverty while natural disasters affect transient poverty. Results also ...

  5. Family Size, Household Shocks and Chronic and Transient Poverty in the Philippine Households


    Bayudan-Dacuycuy, Connie; Lim, Joseph Anthony


    Using panel data, this paper attempts to analyze the chronic and transient poverty in the Philippines. Results indicate that chronic poverty is the more substantial portion of the Philippine poverty with rural households and households in the Mindanao region as the more afflicted areas. This paper finds that both chronic and transient poverty are affected by negative shocks but negative labor market shocks affect chronic poverty while natural disasters affect transient poverty. Results also i...

  6. Household Life-Cycle Stages, Transitions, and Product Expenditures.


    Wilkes, Robert E


    Data from the U.S. Bureau of Labor Statistics' Consumer Expenditure Survey provide empirical verification of changes in household spending across a wide variety of products as households pass from one stage of the household life cycle to another. Three spending patterns emerged: (1) a generalized inverted U pattern, with spending rising sharply as households shift from young single to young married, then remaining relatively high, and falling sharply at the older married and/or older single s...

  7. Seasonal variation of household food waste in Denmark

    DEFF Research Database (Denmark)

    Edjabou, Vincent Maklawe Essonanawe; Petersen, Claus; Scheutz, Charlotte;

    This paper analysed the influence of seasonal variation in the generation of the Danish household food waste. Residual household waste was sampled and manually sorted into six food waste fractions. Vegetable food wastes were the main fraction contributing to the household food waste. Statistical...... analysis showed a significant relationship between avoidable food waste and household size. However, there were no significant seasonal differences in the amount of avoidable food waste....

  8. Identifying motivations and barriers to minimising household food waste


    Graham-Rowe, Ella; Jessop, Donna C; Sparks, Paul


    The amount of food discarded by UK households is substantial and, to a large extent, avoidable. Furthermore, such food waste has serious environmental consequences. If household food waste reduction initiatives are to be successful they will need to be informed by people's motivations and barriers to minimising household food waste. This paper reports a qualitative study of the thoughts, feelings and experiences of 15 UK household food purchasers, based on semi-structured interviews. Two core...

  9. Seasonal variation of household food waste in Denmark


    Edjabou, Vincent Maklawe Essonanawe; Petersen, Claus; Scheutz, Charlotte; Astrup, Thomas Fruergaard


    This paper analysed the influence of seasonal variation in the generation of the Danish household food waste. Residual household waste was sampled and manually sorted into six food waste fractions. Vegetable food wastes were the main fraction contributing to the household food waste. Statistical analysis showed a significant relationship between avoidable food waste and household size. However, there were no significant seasonal differences in the amount of avoidable food waste.

  10. Addressing household air pollution : a case study in rural Madagascar


    Dasgupta, Susmita; Martin, Paul; Samad, Hussain A.


    Household air pollution is the second leading cause of disease in Madagascar, where more than 99 percent of households rely on solid biomass, such as charcoal, wood, and crop waste, as the main cooking fuel. Only a limited number of studies have looked at the emissions and health consequences of cook stoves in Africa. This paper summarizes an initiative to monitor household air pollution in two towns in Madagascar, with a stratified sample of 154 and 184 households. Concentrations of fine par...

  11. International remittances, household saving and expenditure : evidence from Nepal


    Dhakal, Samir


    This thesis examines the general relationship between remittances and household expenditures and savings in Nepal by doing a cross sectional analysis of the household survey conducted in 2012 by the researcher. It provides a comprehensive overview of the effect of remittance on spending behavior by looking at common categories like food, non- food and education, and the saving behavior of the remittance receiving households against the nonremittance receiving households by usin...

  12. Testing the Unitary and Nash Bargaining Household Models in India


    T. Lakshmanasamy


    This paper tests the unitary or common preference approach versus the collective models of household behaviour in India. Using the independent female unearned income as an indicator of female’s control over resources within the household in the bargaining strategy, we study the effect of pooled unearned income versus independent unearned income of the spouses on five household decisions, viz., male and female labour supply, household expenditures on food, education and health. The OLS estimat...

  13. Natural Disasters, Household Welfare and Resilience: Evidence from Rural Vietnam


    Arouri, Mohamed; Ben Youssef, Adel; Nguyen-Viet, Cuong


    The study uses commune fixed-effect regressions to estimate the effect of natural disasters on welfare and poverty of rural households in Vietnam, and subsequently examines household and community characteristics that can strengthen resilience of households to natural disasters. We find that all the three disaster types considered in this study including storms, floods and droughts have negative effects on household income and expenditure. Access to micro-credit, internal remittances and soci...

  14. Microeconomic theory of the household and nutrition programs


    Chernichovsky, Dov; Zangwill, Linda


    Lack of food is no longer the major cause of malnutrition. Many households and individuals remain malnourished when income and supplies of food are adequate. Nutrition policy and programs must be based on a sound knowledge of household behaviour patterns. The microeconomic theory of the household focuses on the household's decisionmaking about scarce food resources based upon such considerations as: (i) the size of the family; (ii) the purchasing power of the family; (iii) the availability of...

  15. Food security experiences of displaced North Korean households


    Lee, Soo-Kyung; Nam, So-Young


    BACKGROUND/OBJECTIVES Food shortage situation in North Korea has gained much interest, however food insecurity caused by the food shortage in North Korean households has not been much investigated. This study examined food security experiences and food consumption pattern of displaced North Korean households currently living in South Korea. SUBJECTS/METHODS Food security experience among 51 North Korean households living in South Korea was examined using the Household Food Insecurity Access S...

  16. Household expenditure on food at home in Malaysia


    Tey, (John) Yeong-Sheng


    “Engel’s law” explains that the share of household expenditure on food typically falls as income and expenditure increase. The objectives of this study are to investigate the food expenditure patterns of different income groups and the relationships between household characteristics and expenditure patterns. Household Expenditure Survey 2004/2005 data from Department of Statistics was used to analyze the food expenditure pattern of households. An expenditure model was developed and the coeffi...

  17. The Demand and Supply of Credit for Households


    Bali Swain, Ranjula


    Abstract The demand and supply of credit in the rural credit markets is investigated in this paper using household data from India. The aim is to study the effects of household, farm productive characteristics and the policy variables on the demand and supply of credit. A type 3 Tobit model is estimated which corrects for sample selection and endogeniety bias. In addition, a generalised Double Hurdle model is estimated where the information on the household?s access to credit is in...

  18. The Analytical Returns to Measuring a Detailed Household Roster


    Akresh, Richard; Eric V. Edmonds


    Households are dynamic while most surveys only collect information on individuals who are present at a single point in time. We exploit a unique and thorough household membership enumeration in Burkina Faso to consider the analytical costs of the typical static household roster. We document that households are extremely fluid with 10 percent of individuals spending sometime away over a three year period, averaging 16 of the 36 months away. The residency status of persons age 16 to 24 is most ...

  19. WEEE and portable batteries in residual household waste: Quantification and characterisation of misplaced waste

    Energy Technology Data Exchange (ETDEWEB)

    Bigum, Marianne, E-mail: [Technical University of Denmark, Department of Environmental Engineering, Miljøvej 113, 2500 Kgs. Lyngby (Denmark); Petersen, Claus, E-mail: [Econet A/S, Strandboulevarden 122, 5, 2100 København Ø (Denmark); Christensen, Thomas H., E-mail: [Technical University of Denmark, Department of Environmental Engineering, Miljøvej 113, 2500 Kgs. Lyngby (Denmark); Scheutz, Charlotte, E-mail: [Technical University of Denmark, Department of Environmental Engineering, Miljøvej 113, 2500 Kgs. Lyngby (Denmark)


    Highlights: • We analyse 26.1 Mg of residual waste from 3129 Danish households. • We quantify and characterise misplaced WEEE and portable batteries. • We compare misplaced WEEE and batteries to collection through dedicated schemes. • Characterisation showed that primarily small WEEE and light sources are misplaced. • Significant amounts of misplaced batteries were discarded as built-in WEEE. - Abstract: A total of 26.1 Mg of residual waste from 3129 households in 12 Danish municipalities was analysed and revealed that 89.6 kg of Waste Electrical and Electronic Equipment (WEEE), 11 kg of batteries, 2.2 kg of toners and 16 kg of cables had been wrongfully discarded. This corresponds to a Danish household discarding 29 g of WEEE (7 items per year), 4 g of batteries (9 batteries per year), 1 g of toners and 7 g of unidentifiable cables on average per week, constituting 0.34% (w/w), 0.04% (w/w), 0.01% (w/w) and 0.09% (w/w), respectively, of residual waste. The study also found that misplaced WEEE and batteries in the residual waste constituted 16% and 39%, respectively, of what is being collected properly through the dedicated special waste collection schemes. This shows that a large amount of batteries are being discarded with the residual waste, whereas WEEE seems to be collected relatively successfully through the dedicated special waste collection schemes. Characterisation of the misplaced batteries showed that 20% (w/w) of the discarded batteries were discarded as part of WEEE (built-in). Primarily alkaline batteries, carbon zinc batteries and alkaline button cell batteries were found to be discarded with the residual household waste. Characterisation of WEEE showed that primarily small WEEE (WEEE directive categories 2, 5a, 6, 7 and 9) and light sources (WEEE directive category 5b) were misplaced. Electric tooth brushes, watches, clocks, headphones, flashlights, bicycle lights, and cables were items most frequently found. It is recommended that these

  20. Improved electrodes and gas impurity investigations on alkaline electrolysers

    DEFF Research Database (Denmark)

    Reissner, R.; Schiller, G.; Knoeri, T.;

    Alkaline water electrolysis for hydrogenproduction is a well-established techniquebut some technological issues regarding thecoupling of alkaline water electrolysis andRenewable Energy Sources (RES) remain tobe improved....

  1. Alkaline magmatism in the eastern of Paraguay.Generals characteristics

    International Nuclear Information System (INIS)

    This paper deals with the distribution of alkaline occurrences in Paraguayan territory and their assemblage into different provinces. Also draws the attention to the petrographic and geochemical characteristics showed by the alkaline rock-types. (author)

  2. Comparison between ARB and CARB processes on an AA5754/AA6061 composite (United States)

    Verstraete, K.; Helbert, A.-L.; Brisset, F.; Baudin, T.


    The present work aims to compare two processes: Accumulative Roll Bonding and Cross Accumulative Roll Bonding (CARB). Both processes consist in the repetition of rolling but the second technique adds a 90° rotation of the sheet around its normal direction between each rolling. Microstructure, mechanical properties and texture were compared for both processes on an AA5754/AA6061 composite. As a result a thinner and less elongated microstructure was obtained in the CARB process leading to an isotropy and an improvement of the mechanical properties. Besides, the texture was characterized by the rotated Cube component for both processes but for CARB it is of less strength.

  3. Food waste from Danish households: Generation and composition. (United States)

    Edjabou, Maklawe Essonanawe; Petersen, Claus; Scheutz, Charlotte; Astrup, Thomas Fruergaard


    Sustainable solutions for reducing food waste require a good understanding of food waste generation and composition, including avoidable and unavoidable food waste. We analysed 12tonnes of residual household waste collected from 1474 households, without source segregation of organic waste. Food waste was divided into six fractions according to avoidability, suitability for home-composting and whether or not it was cooked, prepared or had been served within the household. The results showed that the residual household waste generation rate was 434±18kg per household per year, of which 183±10kg per year was food waste. Unavoidable food waste amounted to 80±6kg per household per year, and avoidable food waste was 103±9kg per household per year. Food waste mass was influenced significantly by the number of occupants per household (household size) and the housing type. The results also indicated that avoidable food waste occurred in 97% of the households, suggesting that most Danish households could avoid or at least reduce how much they generate. Moreover, avoidable and unavoidable food waste was more likely to be found in houses containing more than one person than in households with only one occupant. PMID:27026492

  4. Household Chaos--Links with Parenting and Child Behaviour (United States)

    Coldwell, Joanne; Pike, Alison; Dunn, Judy


    Background: The study aimed to confirm previous findings showing links between household chaos and parenting in addition to examining whether household chaos was predictive of children's behaviour over and above parenting. In addition, we investigated whether household chaos acts as a moderator between parenting and children's behaviour. Method:…

  5. Utilization of Household Sewage Sludge in Brick making

    Institute of Scientific and Technical Information of China (English)



    Household sewage sludge is a kind of solid waste produced in sewage purifying at sewage farm. in procedure of water purifying, which can be used as raw material for producing fired brick. This article compares the chemical composition between household sewage sludge and clay, and explores two kinds of production process for making brick with Household sewage sludge.

  6. Cleaning sprays, household help and asthma among elderly women.

    NARCIS (Netherlands)

    Bédard, A.; Varraso, R.; Sanchez, M.; Clavel-Chapelon, F.; Zock, J.P.; Kauffmann, F.; Moual, N. le


    Objective: There is increasing evidence on the deleterious role in asthma of the use of household cleaning products in spray forms in adults. Household help might induce misclassification errors. The aim of the present analysis was to study associations between household exposure to cleaning sprays

  7. 7 CFR 2902.48 - General purpose household cleaners. (United States)


    ... 7 Agriculture 15 2010-01-01 2010-01-01 false General purpose household cleaners. 2902.48 Section... PROCUREMENT Designated Items § 2902.48 General purpose household cleaners. (a) Definition. Products designed to clean multiple common household surfaces. This designated item does not include products that...

  8. Taxation and the household saving rate: evidence from OECD countries

    Directory of Open Access Journals (Sweden)

    Vito Tanzi


    Full Text Available This paper analyzes anew the relationship between taxation and the household saving rate. On the basis of standard savings and tax revenue data from a sample of OECD countries, it provides compelling empirical evidence of a powerful impact of taxes on household savings. In particular, income taxes are shown to affect negatively the household saving rate much more than consumption taxes.

  9. Household Structure and Short-Run Economic Change in Nicaragua (United States)

    Winters, Paul; Stecklov, Guy; Todd, Jessica


    During the economic crises Nicaragua suffered between 2000 and 2002, a conditional cash transfer program targeting poor households began operating. Using panel data on 1,397 households from the program's experimentally designed evaluation, we examined the impact of the program on household structure. Our findings suggest that the program enabled…

  10. Dual Credit Markets and Household Access to Finance


    Cull, Robert; Gan, Li; Gao, Nan; Xu, Lixin Colin


    Using a new and representative data set of Chinese household finance, this paper documents household access to and costs of finance, along with their correlates. As in most developing countries, informal finance is a crucial element of household finance, and wealth tends to be associated with better access to formal and informal finance. Better financial knowledge shifts loan portfolios to...

  11. Role of forest income in rural household livelihoods

    DEFF Research Database (Denmark)

    Misbahuzzaman, Khaled; Smith-Hall, Carsten


    .02 %) in average total household income. However, VCFs provide bamboos, which are the largest source of household forest income. Moreover, they harbour rich native tree diversity which is vital for maintaining perennial water sources upon which most household livelihood activities depend. Therefore, it seems...

  12. Household Expenditures on Private Tutoring: Emerging Evidence from Malaysia (United States)

    Kenayathulla, Husaina Banu


    Private tutoring has been a burgeoning phenomenon in Malaysia for decades. This study examines the determinants of private tutoring expenditures in Malaysia using the 2004/2005 Household Expenditures Survey and applies hurdle regression models to the data. The results indicate that total household expenditures, household head's level of…

  13. Optimization of NaOH Molarity, LUSI Mud/Alkaline Activator, and Na2SiO3/NaOH Ratio to Produce Lightweight Aggregate-Based Geopolymer


    Rafiza Abdul Razak; Mohd Mustafa Al Bakri Abdullah; Kamarudin Hussin; Khairul Nizar Ismail; Djwantoro Hardjito; Zarina Yahya


    This paper presents the mechanical function and characterization of an artificial lightweight geopolymer aggregate (ALGA) using LUSI (Sidoarjo mud) and alkaline activator as source materials. LUSI stands for LU-Lumpur and SI-Sidoarjo, meaning mud from Sidoarjo which erupted near the Banjarpanji-1 exploration well in Sidoarjo, East Java, Indonesia on 27 May 2006. The effect of NaOH molarity, LUSI mud/Alkaline activator (LM/AA) ratio, and Na2SiO3/NaOH ratio to the ALGA are investigated at a sin...

  14. Anticipatory child fostering and household economic security in Malawi

    Directory of Open Access Journals (Sweden)

    Lauren Bachan


    Full Text Available Background: While there is a rich literature on the practice of child fostering in sub-Saharan Africa, little is known about how fostering impacts receiving households, as few studies consider household conditions both before and after fostering. Despite the fact that circumstancessurrounding fostering vary, the literature's key distinction of fostering is often drawn along the simple line of whether or not a household is fostering a child. This paper argues that anticipation of fostering responsibilities, in particular, is a useful dimension to distinguish fostering experiences for receiving households. Objective: This paper examines the relationship between receiving a foster child and subsequent changes in household wealth. Particular emphasis is placed on how these changes are conditioned by differing levels of anticipation of the fostering event. Methods: This study uses data from Tsogolo la Thanzi (TLT, a longitudinal survey in Balaka, Malawi. Using data from 1754 TLT respondents, fixed effects pooled time-series models are estimated to assess whether and how receiving a foster child changes household wealth. Results: This paper demonstrates the heterogeneity of fostering experiences for receiving households.The results show that households that anticipate fostering responsibilities experience a greater increase in household wealth than both households that do not foster and those that are surprised by fostering. Conclusions: Households that anticipate fostering responsibilities exhibit the greatest increase in householdwealth. While fostering households that do not anticipate fostering responsibilities may not experience these gains, there is no evidence to indicate that such households are negatively impacted relative to households that do not foster. This finding suggests that additional childcare responsibilities may not be as detrimental to African households as some researchers have feared.

  15. Drug Use and Spatial Dynamics of Household Allocation (United States)

    Dunlap, Eloise; Brown, Emma J


    Household space allocation by women who consume drugs in New York and North Florida is depicted to demonstrate the complex character of household space and social relations. Some parents attempt to hide their drug consumption through the allocation space in the household for drug use. Women allocation of space for drug use within their households and the impact of this on the household are relevant issues with implications for therapy and prevention. Objective The use of household space has not been a focus of social scientists. Middle class households have been used by decoration literature to specify space utilization. Modest literature pay attention to the utilization of household space among drug focused households. Analysis herein looks at the lived social relations of drug users to their children through controlling household space. Methods Data presented comes from two studies, New York and Florida. The studies involved a total of 158 participants in 72 families from New York and 26 participants in 23 families in North Florida. Both researches used an ethnographic methodology focusing on a variety of behavior patterns and conduct norms occurring within drug abusing households. Repeated interviews and observations took place in households which were visited at different times and days of the week. Florida study was conducted over a 2-year period; New York study took place over a 5-year period. Results Data suggest parents attempted to conceal their drug use from their offspring by using various strategies. Mental, social, and physical were tied together in space allocation. Household space acquired a different meaning and arose from use practice. Conclusion In urban and rural settings a pattern of household allocation space and drug consumption is emerging. Although drug consumption is still prominent, it is not all consuming or the primary focus in the lives of women who use drugs. These women may have learned to integrate their consumption into their daily

  16. Household Survival in the Face of Poverty in Salvador, Brazil: Towards an Integrated Model of Household Activities. (United States)

    Norris, William P.


    Compares the survival strategies of low-income urban households in a squatter settlement in Salvador, Bahia, Brazil with those of such households in other regions. Suggests, uses, and criticizes a simple additive model of survival household activities. Identifies important factors that emerge, and suggests issues for further research. (Author/BJV)

  17. Powder electrostatic enamelling of household appliances (United States)

    Bragina, L.; Shalygina, O.; Kuryakin, N.; Annenkov, V.; Guzenko, N.; Kupriyanenko, K.; Hudyakov, V.; Landik, A.


    Principles and practices of contemporary resource and energy saving technology of powder electrostatic application (POESTA)of vitreous enamel coatings are described. Its technological, economic and ecological advantages over slip enamelling in household appliances manufacture are discussed. We develop the principles of synthesis of special glass frits with high electric resistivity for POESTA and discuss the results of studies aimed at the development and industrial implementation of ground, direct-on and coloured cover enamels for household appliances and direct-on thermally resistant chemically durable coatings with antibacterial effect for protection of inner tanks of water heaters. Finally, we describe the development of compositions for easy-to-clean, catalytic and pyrolytic coatings.

  18. Determinants of household energy consumption in India

    International Nuclear Information System (INIS)

    Improving access to affordable modern energy is critical to improving living standards in the developing world. Rural households in India, in particular, are almost entirely reliant on traditional biomass for their basic cooking energy needs. This has adverse effects on their health and productivity, and also causes environmental degradation. This study presents a new generic modelling approach, with a focus on cooking fuel choices, and explores response strategies for energy poverty eradication in India. The modelling approach analyzes the determinants of fuel consumption choices for heterogeneous household groups, incorporating the effect of income distributions and traditionally more intangible factors such as preferences and private discount rates. The methodology is used to develop alternate future scenarios that explore how different policy mechanisms such as fuel subsidies and micro-financing can enhance the diffusion of modern, more efficient, energy sources in India.

  19. Experimentale Study of Alkaline Precipitation on Thermal Process SeaWater Desalination Condition

    International Nuclear Information System (INIS)

    The experiment of alkaline precipitation by separated method has beencarry out. Experiment took please by heating sea water simulation with eachother consist of a).142 ppm bicarbonate and 400 ppm calcium ion b). 142 ppmbicarbonate and magnesium ion at temperature 40,50,60,70,80,90,100,110 and120 oC respectively by using autoclave. Sampling has been done periodicalfor 30 minute in interval 300 minute for each temperature. The calculation ofalkaline precipitation on each step calculated through the decreasing ofcalcium and magnesium concentration with analysis by AAS. From experimentdata have the information that alkaline precipitation have been formed since40 oC. From time variable have been the information that the precipitationformed at 30th minute rapidly. Whether at further time the increasing ofprecipitation are not significant. This phenomena can explained that at eachheating step from 40 oC bicarbonate ion be come decomposition with theresult carbonate and hydroxide ion and react with calcium and magnesium formcalcium carbonate and magnesium hydroxide. From this information could beimplemented as base for avoiding using chemical material in desalinationthermal process. (author)

  20. AAS Special Session: Policy Making in Astronomy (United States)

    Cardelli, J. A.; Massa, D.


    The professional astronomical community today is more diverse than at any time in its history. Individuals participating in creative research programs can be found in a wide range of positions. This type of diversity, which mixes research, education, and service (e.g. contract) work, represents the strength of contemporary astronomy. While recognizing the unavoidable reductions in funding and restructuring of organizations like NASA, it is imperative that the significance of the current diversity be considered during these processes. Creative ideas are one of the cornerstones of quality research, and they can originate anywhere. Consequently, it is essential that adequate research resources remain available for free and open competition by all astronomers. Our goal in this session is to bring together officials from the AAS, NASA, and the NSF to discuss how the policy and decision making process operates and whether it should be changed to better serve the general needs of the professional astronomical community. Examples of the issues we believe are important include: In establishing new policy, how can the needs of the average research astronomer be better addressed? How could input from such astronomers be provided to those who craft NASA/NSF policy? How can/should the AAS serve as an interface between policy/decision making bodies and its membership? Should the AAS membership become more actively/effectively involved in the decision making process and, if so, how? More information on this session and related issues can be found at the Association of Research Astronomers Home Page:

  1. Simon van der Meer in the AA Control Room

    CERN Multimedia


    Simon van der Meer, spiritus rector of the Antiproton Accumulator, in the AA Control Room. Inventor of stochastic cooling, on which the AA was based, and of the magnetic horn, with which the antiprotons were focused, he also wrote most of the software with which the AA was controlled, and spent uncountable numbers of hours in this chair to tickle the AA to top performance. 8 months after this picture was taken, he received, in October 1984, the Nobel prize, together with Carlo Rubbia, the moving force behind the whole Proton-Antiproton Collider project that led to the discovery, in 1983, of the W and Z intermediate bosons.

  2. Flow Injection and Atomic Absorption Spectrometry (FI-AAS) -

    DEFF Research Database (Denmark)

    Hansen, Elo Harald


    absorption spectrometry (AAS). Initially with flame-AAS (fAAS) procedures, later for hydride generation (HG) techniques, and most recently in combination with electrothermal AAS (ETAAS). The common denominator for all these procedures is the inherently precise and strictly reproducible timing in FI from the......One of the advantages of the flow injection (FI) concept is that it is compatible with virtually all detection techniques. Being a versatile vehicle for enhancing the performance of the individual detection devices, the most spectacular results have possibly been obtained in conjunction with atomic...

  3. Food waste from Danish households: Generation and composition

    DEFF Research Database (Denmark)

    Edjabou, Maklawe Essonanawe; Petersen, Claus; Scheutz, Charlotte;


    Sustainable solutions for reducing food waste require a good understanding of food waste generation and composition, including avoidable and unavoidable food waste. We analysed 12 tonnes of residual household waste collected from 1474 households, without source segregation of organic waste. Food...... waste was divided into six fractions according to avoidability, suitability for home-composting and whether or not it was cooked, prepared or had been served within the household. The results showed that the residual household waste generation rate was 434 ± 18 kg per household per year, of which 183...

  4. Design and Research on Household Food Slicer


    Xiaowei Jiang


    The research purpose is to design a mini type household food slicer to slice the root vegetables. The study elaborates on the design of each part of the slicer, including selecting electric motor and V belt, the design of V belt pulley, shaft, elevating mechanism and blade, to introduce the main structure and operating principles of the slicer, based on which the conclusion has been reached.

  5. Synthesis of Ethyl Salicylate Using Household Chemicals (United States)

    Solomon, Sally; Hur, Chinhyu; Lee, Alan; Smith, Kurt


    Ethyl salicylate is synthesized, isolated, and characterized in a three-step process using simple equipment and household chemicals. First, acetylsalicylic acid is extracted from aspirin tablets with isopropyl alcohol, then hydrolyzed to salicylic acid with muriatic acid, and finally, the salicylic acid is esterified using ethanol and a boric acid catalyst. The experiment can be directed towards high school or university level students who have sufficient background in organic chemistry to recognize the structures and reactions that are involved.

  6. Intra-Household Allocation of Parental Leave


    Gobbi, Paula Eugenia; Parys, Juliane; Schwerhoff, Gregor


    We introduce childcare sharing in a collective model of household behavior to investigate which factors make spouses increase or decrease their share of parental leave. The concern about future consumption motivates parents to invest in their human capital and to limit their leave duration. Using relative income and the age difference between spouses as distribution factors, we cannot reject Pareto efficiency in childcare sharing. Higher relative incomes and larger age differences shift the c...

  7. The sequential propensity household projection model

    Directory of Open Access Journals (Sweden)

    Tom Wilson


    Full Text Available BACKGROUND The standard method of projecting living arrangements and households in Australia and New Zealand is the 'propensity model', a type of extended headship rate model. Unfortunately it possesses a number of serious shortcomings, including internal inconsistencies, difficulties in setting living arrangement assumptions, and very limited scenario creation capabilities. Data allowing the application of more sophisticated dynamic household projection models are unavailable in Australia. OBJECTIVE The aim was create a projection model to overcome these shortcomings whilst minimising input data requirements and costs, and retaining the projection outputs users are familiar with. METHODS The sequential propensity household projection model is proposed. Living arrangement projections take place in a sequence of calculations, with progressively more detailed living arrangement categories calculated in each step. In doing so the model largely overcomes the three serious deficiencies of the standard propensity model noted above. RESULTS The model is illustrated by three scenarios produced for one case study State, Queensland. They are: a baseline scenario in which all propensities are held constant to demonstrate the effects of population growth and ageing, a housing crisis scenario where housing affordability declines, and a prosperity scenario where families and individuals enjoy greater real incomes. A sensitivity analysis in which assumptions are varied one by one is also presented. CONCLUSIONS The sequential propensity model offers a more effective method of producing household and living arrangement projections than the standard propensity model, and is a practical alternative to dynamic projection models for countries and regions where the data and resources to apply such models are unavailable.

  8. Financial Literacy and Household Savings in Romania


    Elisabeth Beckmann


    We present new evidence from the Euro Survey of the Austrian Central Bank on the level of financial literacy in Romania and analyze how financial literacy is related to household savings. Less than 5% of respondents were able to correctly answer the three “core” financial literacy questions on interest compounding, inflation, and risk diversification, with the risk diversification question posing the greatest difficulties. Twenty percent of respondents are able to answer both the interest com...

  9. Psychological determinants of household saving behaviour


    Nyhus, Ellen Katrine


    This dissertation reports the results of a study that examined the impact of psychological variables on household saving and borrowing behaviour. Understanding saving behaviour is important for policy makers and financial institutions, but a comprehensive explanatory model that can explain individual differences in saving does not yet exist. The aim of this research has been to contribute towards the construction of such a model. The study was designed to answer four research q...

  10. Wages, Violence and Health in the Household


    Anna Aizer


    Three quarters of all violence against women is perpetrated by domestic partners. I study both the economic causes and consequences of domestic violence. I find that decreases in the male-female wage gap reduce violence against women, consistent with a household bargaining model. The relationship between the wage gap and violence suggests that reductions in violence may provide an alternative explanation for the well-established finding that child health improves when mothers control a greate...

  11. Labour Force Participation and Household Debt


    Rochelle Belkar; Lynne Cockerell; Rebecca Edwards


    In the past decade or so there has been a substantial rise in the indebtedness and debt-servicing obligations of Australian households. This has been accompanied by a trend increase in labour force participation (LFP) for women and more recently for men. Microeconomic data show a clear positive correlation between indebtedness and LFP. This paper models the LFP decision of prime-age Australian women and men accounting for the influence of debt and assets along with a range of other variables ...

  12. Household Assets and Rural Finance in Nigeria


    Onafowokan O. Oluyombo


    The study assesses the roles played by the loan service of cooperatives on household assets acquisition among cooperative members in rural communities of Ogun State where there is no bank.Independent student test and one way analysis of variance were used to analyze the data collected through questionnaire from 302 members. The study shows that the following assets – land, generator, television, radio and refrigerator – were more likely to be acquired by members than non-members. This is an i...

  13. Household Demand for Broadband Internet Service


    Gregory Rosston; Scott Savage; Donald Waldman


    As part of the Federal Communications Commission (“FCC”) National Broadband Report to Congress, we have been asked to conduct a survey to help determine consumer valuations of different aspects of broadband Internet service. Our empirical results show that reliability and speed are important characteristics of Internet service. The representative household is willing to pay about $20 per month for more reliable service and $45-48 for an increase in speed. Willingness-to-pay for speed increase...

  14. The relationship between advertising and household loans


    Sahlin, Daniel; Sjögren, Gustav


    Advertising expenditures are increasing on a yearly basis. An interesting question emerges from this: What are the macroeconomic effects of increasing advertising spending? Does the aggregate consumption increase or does it only rearrange consumption between different products and markets? The relationship between advertising and consumption was found in the literature, this relationship was further developed and the relationship between advertising and household loans emerged as an interesti...

  15. Households Credits, Financial Intermediation and Monetary Policies


    Cécile Bastidon


    This paper develops a theoretical model of financial intermediation with three original characteristics. Firstly, all sectors are taken into account within total outstanding credits, including households. Secondly, in periods of high financial strains, the relationship between prices and funding supply volumes may be non-monotonic. Finally, the occurrence of interbank credit rationing results in other sectors’ funding rationing in credit and securities markets. The central b...

  16. Human Capital Diversification within the Household

    DEFF Research Database (Denmark)

    Lilleør, Helene Bie

    Lack of primary schooling among rural children in developing countries is often attributed to credit constraints and household demand for child labour, implying that direct and indirect costs of schooling are high. Surprisingly few studies have considered the importance of parents' expected returns...... not for rural daughters. Exactly in line with what should be expected for a patrilineal society. This can potentially have far reaching policy implications....

  17. Stock Market Expectations of Dutch Households


    Hurd, Michael; Rooij, Maarten van; Winter, Joachim


    Despite its importance for the analysis of life-cycle behavior, stock ownership by households is poorly understood. Among other approaches to the investigation of this puzzle, recent research has elicited the expectations of stock market returns by individuals. This paper reports findings from a study that collected data over a two-year period both on stock market expectations (subjective probabilities of gains or losses) and on stock ownership. On average stock market expectations are much m...

  18. Financial Risk Aversion and Household Asset Diversification


    Barasinska, Nataliya; Schäfer, Dorothea; Stephan, Andreas


    This paper explores the relationship between risk attitude and asset diversification in household portfolios. We first examine the impact of manifested risk aversion on the total number of distinct assets held in a portfolio (naive diversification). The second part of the paper focuses on a more sophisticated strategy of diversification and asks whether financial theory is compatible with observed diversification patterns. Based on the German Socioeconomic Panel which provides unique measures...

  19. Internet and its use in households


    Dobešová, Zuzana


    The thesis deals with the internet and its use by households. First part describes the origins of the internet and its history, including description of what internet really is and which are its characteristics. Next part analyzes different types of internet connections and their features, advantages and disadvantages. This examination is followed by another chapter, which deals with the most widely used internet browsers in the Czech Republic. The thesis also shown and explained most comm...

  20. How Financial Literacy Affects Household Wealth Accumulation


    Behrman, Jere R.; Mitchell, Olivia S.; Soo, Cindy K.; David Bravo


    This study isolates the causal effects of financial literacy and schooling on wealth accumulation using a new household dataset and an instrumental variables (IV) approach. Financial literacy and schooling attainment are both strongly positively associated with wealth outcomes in linear regression models, whereas the IV estimates reveal even more potent effects of financial literacy. They also indicate that the schooling effect only becomes positive when interacted with financial literacy. Es...

  1. AA, Inner Conductor of Magnetic Horn

    CERN Multimedia


    Antiprotons emerging at large angles from the production target (hit by an intense 26 GeV proton beam from the PS), were focused into the acceptance of the injection line of the AA by means of a "magnetic horn" (current-sheet lens). Here we see an early protype of the horn's inner conductor, machined from solid aluminium to a thickness of less than 1 mm. The 1st version had to withstand pulses of 150 kA, 15 us long, every 2.4 s. See 8801040 for a later version.

  2. Wooden Model of Wide AA Bending Magnet

    CERN Multimedia


    The very particular lattice of the AA required 2 types of dipoles (bending magnets: BLG, long and narrow; BST, short and wide). A wide one had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. A wooden model was build in 1978, to gain dimensional experience. Here, Peter Zettwoch, one of the largest men at CERN at that time, is putting a hand in the mouth of the wooden BST monster.

  3. Atlas of Vega: 3850 -- 6860 \\AA

    CERN Document Server

    Kim, Hyun-Sook; Valyavin, G; Lee, Byeong-Cheol; Shimansky, V; Galazutdinov, G A


    We present a high resolving power ($\\lambda$ / $\\Delta\\lambda$ = 90,000) and high signal-to-noise ratio ($\\sim$700) spectral atlas of Vega covering the 3850 -- 6860 \\AA wavelength range. The atlas is a result of averaging of spectra recorded with the aid of the echelle spectrograph BOES fed by the 1.8-m telescope at Bohyunsan observatory (Korea). The atlas is provided only in machine-readable form (electronic data file) and will be available in the SIMBAD database upon publication.

  4. Specific Examples of Hybrid Alkaline Cement

    Directory of Open Access Journals (Sweden)

    Fernández-Jiménez Ana


    Full Text Available Hybrid alkaline cements are obtained by alkali-activating cementitious blends in the Na2O-CaO-SiO2-Al2O3-H2O system. The present paper discusses the results of activating different cementitious blends containing a low OPC clinker content ( 15MPa a 2 days different alkaline activators were used (liquid and solid. The reaction products obtained were also characterised by XRD, SEM/EDX and 27Al and 29Si NMRMAS. The results showed that the main reaction product was a mix of cementitious gels C-A-S-H and (N,C-A-S-H, and that their relative proportions were strongly influenced by the calcium content in the initial binder

  5. Study of niobium corrosion in alkaline medium

    International Nuclear Information System (INIS)

    A comparative study of niobium electrochemical behaviour in NaOH and KOH solution, with concentrations between 0,5 and 6,1M is presented. The studies were done through electrochemicals assays, consisting in the corrosion potential and anodic and cathodic polarization curves, complemented by loss of mass experiments. The niobium anodic behaviour in alkaline medium is characterized by passivation occurrence, with a stable film formation. The Na oH solution in alkaline medium are more corrosible to niobium than the KOH solution. The loss of mass assays showed that the corrosion velocit is more dependente of hydroxide concentration in KOH medium than the NaOH medium. (C.G.C.)

  6. High temperature and pressure alkaline electrolysis

    DEFF Research Database (Denmark)

    Allebrod, Frank; Chatzichristodoulou, Christodoulos; Mogensen, Mogens Bjerg


    Alkaline electrolyzers have proven to operate reliable for decades on a large scale, but in order to become commercially attractive and compete against conventional technologies for hydrogen production, the production and investment costs have to be reduced. This may occur by increasing the...... operational temperature and pressure to produce pressurized hydrogen at high rate (m3 H2·h-1·m-2 cell area) and high electrical efficiency. This work describes an exploratory technical study of the possibility to produce hydrogen and oxygen with a new type of alkaline electrolysis cell at high temperatures...... SrTiO3 was used for immobilization of aqueous KOH solutions. Electrolysis cells with this electrolyte and metal foam based gas diffusion electrodes were successfully demonstrated at temperatures up to 250 °C at 40 bar. Different electro-catalysts were tested in order to reduce the oxygen and hydrogen...

  7. High Temperature and Pressure Alkaline Electrolysis

    DEFF Research Database (Denmark)

    Allebrod, Frank

    radiation raises the necessity to store the produced energy. Hydrogen production by water electrolysis is one of the most promising ways to do so. Alkaline electrolyzers have proven to operate reliable for decades on a large scale (up to 160 MW), but in order to become commercially attractive and compete...... and oxygen with a new type of alkaline electrolysis cell at high temperatures and pressures. To perform measurements under high pressure and at elevated temperatures it was necessary to build a measurement system around an autoclave which could stand high temperatures up to 250 °C and pressures up to...... 200 bar as well as extremely caustic environments. Based on a literature study to identify resistant materials for these conditions, Inconel 600 was selected among the metals which are available for autoclave construction. An initial single atmosphere high temperature and pressure measurement setup...

  8. Experimental immunologically mediated aplastic anemia (AA) in mice: cyclosporin A fails to protect against AA

    International Nuclear Information System (INIS)

    Immunologically mediated aplastic anemia (AA) in mice was induced by the i.v. injection of 10(7) lymph node cells (LNC) from H-2k identical but Mls mismatched CBA/J donor mice into previously irradiated (600 rad total body gamma) C3H/HeJ mice. Cyclosporin A (CsA), 25 mg/kg, was administered subcutaneously from day -1 to day 30. Control mice included C3H/HeJ mice which received 600 rad alone, C3H/HeJ mice which received 600 rad plus CsA as above, and C3H/HeJ mice which received 600 rad total body irradiation followed by 10(7) LNC from CBA/J donors. CsA failed to prevent lethal AA. These results suggest that the pathogenetic mechanisms operating in immunologically mediated AA differ from the mechanisms operating in rodents transplanted with allogeneically mismatched marrow or spleen cells which develop graft-versus-host disease. The results are consistent with a non-T cell-dependent mechanism causing the AA

  9. Study on Fabrication of AA4032/AA6069 Cladding Billet Using Direct Chill Casting Process (United States)

    Han, Xing; Zhang, Haitao; Shao, Bo; Li, Lei; Liu, Xuan; Cui, Jianzhong


    AA4032/AA6069 cladding billet in size of φ130 mm/φ110 mm was prepared by the modified direct chill casting process, and the parametric effect on casting performance was investigated using numerical simulation. Microstructures, elements distribution, and mechanical properties of the bonding interface were examined. The results show that metallurgical bonding interface can be obtained with the optimal parameters: the casting speed of 130 to 140 mm/min, the internal liquid level height of 50 to 60 mm, and the contact height of 40 to 50 mm. The metallurgical bonding interface is free of any discontinuities due to the fact that the alloying elements diffused across the interface and formed Ni-containing phase. Tensile strength of the cladding billet reaches 225.3 MPa, and the fracture position was located in AA6069 side, suggesting that the interface bonding strength is higher than the strength of AA6069. The interfacial shearing strength is 159.3 MPa, indicating excellent metallurgical bonding.

  10. Researches of odour emitted by household waste

    Directory of Open Access Journals (Sweden)

    Eglė Marčiulaitienė


    Full Text Available The article deals with odour emitted by household waste, the chemical composition of household waste. The experiment was made with food waste (1000 g placed in 5 litter containers. Food waste was containing products of animal origin (meat, fish, dairy products and plant origin (vegetables, fruit waste. Time of the experiment was 14 days 19±3 °C at environment temperature. Odour concentration is determined by dynamic olfactometry method. Studies have shown that the strongest odour of all household waste used in this experiment was emitted by meat and fish waste (76 444 OUE/m3. Meat and fish waste emits the strongest odour as waste contains proteins, their decomposition releases into the environment a strong unpleasant odour, hydrogen sulphide and ammonia. Protein degradation releases into the environment are, characterized by a strong unpleasant smell of hydrogen sulphide and ammonia gas. During the anaerobic decomposition of organic matter a variety of other fragrant compounds: alcohols (e.g., ethanol and methanol, vinegar, formic acid, etc. is found.

  11. Ubiquitous Monitoring of Electrical Household Appliances (United States)

    Lloret, Jaime; Macías, Elsa; Suárez, Alvaro; Lacuesta, Raquel


    The number of appliances at home is increasing continuously, mainly because they make our lives easier. Currently, technology is integrated in all objects of our daily life. TCP/IP let us monitor our home in real time and check ubiquitously if something is happening at home. Bearing in mind this idea, we have developed a low-cost system, which can be used in any type of electrical household appliance that takes information from the appliance and posts the information to the Twitter Social network. Several sensors placed in the household appliances gather the sensed data and send them wired or wirelessly, depending on the case, using small and cheap devices to a gateway located in the home. This gateway takes decisions, based on the received data, and sends notifications to Twitter. We have developed a software application that takes the values and decides when to issue an alarm to the registered users (Twitter friends of our smart home). The performance of our system has been measured taking into account the home network (using IEEE 802.3u and IEEE 802.11g) and the data publishing in Twitter. As a result, we have generated an original product and service for any electrical household appliance, regardless of the model and manufacturer, that helps home users improve their quality of life. The paper also shows that there is no system with the same innovative features like the ones presented in this paper. PMID:23202205

  12. Radioactivity of household water in Finland

    International Nuclear Information System (INIS)

    A nationwide study on artificial and natural radioactivity in household water has been under way in Finland since the 1960s. The occurrence of artificial radionuclides in the surface water of drainage basins has been monitored extensively. The proportion of household water derived from surface waters in Finland is currently 48 %, but its usage is decreasing whereas that of groundwater is increasing at an annual rate of 1 - 2 %. The natural radioactivity of household water has been studied in almost all of the waters distributed by public waterworks and in 5400 private ground water wells. The downward trend in 90Sr, 137Cs and 3H concentrations in surface water continued from the middle 1960s until the Chernobyl accident. After the accident ten different radionuclides were detected in surface waters, but only 137Cs made a minor contribution the radiation dose. The maximum effective dose via ingestion of water was about 0.001 mSv in 1986, and considerably lower in the following years

  13. Household hazardous waste management: a review. (United States)

    Inglezakis, Vassilis J; Moustakas, Konstantinos


    This paper deals with the waste stream of household hazardous waste (HHW) presenting existing management systems, legislation overview and other relevant quantitative and qualitative information. European Union legislation and international management schemes are summarized and presented in a concise manner by the use of diagrams in order to provide crucial information on HHW. Furthermore, sources and types, numerical figures about generation, collection and relevant management costs are within the scope of the present paper. The review shows that the term used to refer to hazardous waste generated in households is not clearly defined in legislation, while there is absence of specific acts regulating the management of HHW. The lack of obligation to segregate HHW from the household waste and the different terminology used makes it difficult to determine the quantities and composition of this waste stream, while its generation amount is relatively small and, therefore, is commonly overlooked in waste statistics. The paper aims to cover the gap in the related literature on a subject that is included within the crucial waste management challenges at world level, considering that HHW can also have impact on other waste streams by altering the redox conditions or causing direct reactions with other non hazardous waste substances. PMID:25528172

  14. CARINA alkalinity data in the Atlantic Ocean

    Directory of Open Access Journals (Sweden)

    A. Velo


    Full Text Available Data on carbon and carbon-relevant hydrographic and hydrochemical parameters from previously non-publicly available cruise data sets in the Arctic, Atlantic and Southern Ocean have been retrieved and merged to a new database: CARINA (CARbon IN the Atlantic.

    These data have gone through rigorous quality control (QC procedures to assure the highest possible quality and consistency. The data for most of the measured parameters in the CARINA data base were objectively examined in order to quantify systematic differences in the reported values, i.e. secondary quality control. Systematic biases found in the data have been corrected in the data products, i.e. three merged data files with measured, calculated and interpolated data for each of the three CARINA regions; Arctic, Atlantic and Southern Ocean. Out of a total of 188 cruise entries in the CARINA database, 98 were conducted in the Atlantic Ocean and of these, 75 cruises report alkalinity values.

    Here we present details of the secondary QC on alkalinity for the Atlantic Ocean part of CARINA. Procedures of quality control, including crossover analysis between cruises and inversion analysis of all crossover data are briefly described. Adjustments were applied to the alkalinity values for 16 of the cruises in the Atlantic Ocean region. With these adjustments the CARINA database is consistent both internally as well as with GLODAP data, an oceanographic data set based on the World Hydrographic Program in the 1990s. Based on our analysis we estimate the internal accuracy of the CARINA-ATL alkalinity data to be 3.3 μmol kg−1. The CARINA data are now suitable for accurate assessments of, for example, oceanic carbon inventories and uptake rates and for model validation.

  15. Alkaline leaching of iron and steelmaking dust


    Stafanova, Anna; Aromaa, Jari


    Steel production generates significant quantities of dust and sludge in blast furnaces (BF),basic oxygen furnaces (BOF), and electric arc furnaces (EAF). These dusts contain toxicelements, such as heavy metals, and are thus classified as harmful waste making the disposalof them expensive. In addition, direct recycling of dust back to steel production is hindered dueto the presence of zinc. In this literature survey the alkaline leaching of zinc from iron and steelmaking dusts isreviewed. T...

  16. Alkaline earth cation extraction from acid solution (United States)

    Dietz, Mark; Horwitz, E. Philip


    An extractant medium for extracting alkaline earth cations from an aqueous acidic sample solution is described as are a method and apparatus for using the same. The separation medium is free of diluent, free-flowing and particulate, and comprises a Crown ether that is a 4,4'(5')[C.sub.4 -C.sub.8 -alkylcyclohexano]18-Crown-6 dispersed on an inert substrate material.

  17. Bifunctional Catalysts for Alkaline Fuel Cells

    Czech Academy of Sciences Publication Activity Database

    Klápště, Břetislav; Vondrák, Jiří; Velická, Jana

    Vol. 1. Brno : Akademické nakladatelství CERM, 2000 - (Vondrák, J.; Sedlaříková, M.), s. 24.1-24.4 ISBN 80-214-1614-9. [Advanced Batteries and Accumulators /1./. Brno (CZ), 28.08.2000-01.09.2000] R&D Projects: GA MŠk ME 216 Institutional research plan: CEZ:AV0Z4032918; CEZ:MSM 262200010 Keywords : alkaline * catalysts * electrochemistry Subject RIV: CG - Electrochemistry

  18. Heavy water production by alkaline water electrolysis

    International Nuclear Information System (INIS)

    Several heavy water isotope production processes are reported in literature. Water electrolysis in combination with catalytic exchange CECE process is considered as a futuristic process to increase the throughput and reduce the cryogenic distillation load but the application is limited due to the high cost of electricity. Any improvement in the efficiency of electrolyzers would make this process more attractive. The efficiency of alkaline water electrolysis is governed by various phenomena such as activation polarization, ohmic polarization and concentration polarization in the cell. A systematic study on the effect of these factors can lead to methods for improving the efficiency of the electrolyzer. A bipolar and compact type arrangement of the alkaline water electrolyzer leads to increased efficiency and reduced inventory in comparison to uni-polar tank type electrolyzers. The bipolar type arrangement is formed when a number of single cells are stacked together. Although a few experimental studies have been reported in the open literature, CFD simulation of a bipolar compact alkaline water electrolyzer with porous electrodes is not readily available.The principal aim of this study is to simulate the characteristics of a single cell compact electrolyzer unit. The simulation can be used to predict the Voltage-Current Density (V-I) characteristics, which is a measure of the efficiency of the process.The model equations were solved using COMSOL multi-physics software. The simulated V-I characteristic is compared with the experimental data

  19. The economic burden of cancers on Indian households.

    Directory of Open Access Journals (Sweden)

    Ajay Mahal

    Full Text Available We assessed the burden of cancer on households' out-of-pocket health spending, non-medical consumption, workforce participation, and debt and asset sales using data from a nationally representative health and morbidity survey in India for 2004 of nearly 74 thousand households. Propensity scores were used to match households containing a member diagnosed with cancer (i.e. cancer-affected households to households with similar socioeconomic and demographic characteristics (controls. Our estimates are based on data from 1,645 households chosen through matching. Cancer-affected households experienced higher levels of outpatient visits and hospital admissions and increased out-of-pocket health expenditures per member, relative to controls. Cancer-affected households spent between Indian Rupees (INR 66 and INR 85 more per member on healthcare over a 15-day reference period, than controls and additional expenditures (per member incurred on inpatient care by cancer-affected households annually is equivalent to 36% to 44% of annual household expenditures of matched controls. Members without cancer in cancer-affected households used less health-care and spent less on healthcare. Overall, adult workforce participation rates were lower by between 2.4 and 3.2 percentage points compared to controls; whereas workforce participation rates among adult members without cancer were higher than in control households. Cancer-affected households also had significantly higher rates of borrowing and asset sales for financing outpatient care that were 3.3% to 4.0% higher compared to control households; and even higher for inpatient care.

  20. The fate of added alkalinity in model scenarios of ocean alkalinization (United States)

    Ferrer González, Miriam; Ilyina, Tatiana


    The deliberate large-scale manipulation of the Earth's climate (geo-engineering) has been proposed to mitigate climate change and ocean acidification. Whilst the mitigation potential of these technologies could sound promising, they may also pose many environmental risks. Our research aims at exploring the ocean-based carbon dioxide removal method of alkalinity enhancement. Its mitigation potential to reduce atmospheric CO2 and counteract the consequences of ocean acidification, risks and unintended consequences are studied. In order to tackle these questions, different scenarios are implemented in the state-of-the-art Earth system model of the Max Planck Institute for Meteorology. The model configuration is based on the 5th phase of the coupled model intercomparison project following a high CO2 future climate change scenario RCP8.5 (in which radiative forcing rises to 8.5 W/m² in 2100). Two different scenarios are performed where the alkalinity is artificially added globally uniformly in the upper ocean. In the first scenario, alkalinity is increased as a pulse by doubling natural values of the first 12 meters. In the second scenario we add alkalinity into the same ocean layer such that the atmospheric CO2 concentration is reduced from RCP8.5 to RCP4.5 levels (with the radiative forcing of 4.5 W/m² in 2100). We investigate the fate of the added alkalinity in these two scenarios and compare the differences in alkalinity budgets. In order to increase oceanic CO2 uptake from the atmosphere, enhanced alkalinity has to stay in the upper ocean. Once the alkalinity is added, it will become part of the biogeochemical cycles and it will be distributed with the ocean currents. Therefore, we are particularly interested in the residence time of the added alkalinity at the surface. Variations in CO2 partial pressure, seawater pH and saturation state of carbonate minerals produced in the implemented scenarios will be presented. Collateral changes in ocean biogeochemistry and

  1. Estimating household food waste in Denmark:case study of single family households

    DEFF Research Database (Denmark)

    Edjabou, Vincent Maklawe Essonanawe; Petersen, C.; Scheutz, Charlotte;

    Food waste prevention remains the first priority in the European Waste Framework Directive, which aimed to halve the amount of food wasted within the EU Member States by 2025. Thus, reliable data on food waste composition and quantity are crucial for assessing the current food waste situation and...... determine potential improvements. In Denmark, although many sorting campaigns involving household waste has been conducted, little attention has been placed on food waste. Comparison of recent studies made for examples in Austria, and the UK suggests that quantity and material composition of food waste vary...... significantly among the studies and differ from one country to another. Here, we provide a consistent methodology for characterization of household food waste, so that data comparability and source information are ensured. In this study, residual household waste was sampled and manually sorted from more than...

  2. Hf-Nd isotopic and trace element constraints on the genesis of alkaline and calc-alkaline lamprophyres

    International Nuclear Information System (INIS)

    Major and trace element, Nd and for the first time Hf isotopic compositions of Central European Hercynian and Alpine alkaline (nephelinites) and calc-alkaline (minettes) lamprophyres are reported. The alkaline dikes have significantly higher initial εNd values (+3.9 to +5.2) than the calc-alkaline dikes (-1 to -7). Their initial εHf values range between +1.9 and +6.0. Both groups show the typical high level of incompatible-element enrichment. In addition the calc-alkaline lamprophyres are characterized by an overabundance of Cs relative to Rb, high Ba/La and Ba/Sr ratios as well as depletion in Nb, Ti and Ta. Covariations between initial εHf-εNd and trace elements suggest that crust-mantle mixing processes were involved in the formation of the calc-alkaline mafic magmas. These data give way to a general, refined model of lamprophyre genesis and provide information about enrichment processes in the subcontinental lithospheric mantle. It is suggested that alkaline and calc-alkaline lamprophyres originate from similar mantle segments. Alkaline lamprophyres can be generated by 10% partial melting of a metasomatically enriched garnet peridotite. Calc-alkaline lamprophyres, however, can be generated in subduction related environments by mixing of 5-15% sedimentary melts, strongly enriched in K, Rb, Zr, Hf, Y and REE, produced by partial melting of subducted oceanic sediments, with a metasomatically enriched mantle source similar to that suggested for the ultramafic alkaline dikes. (orig.)

  3. Dicty_cDB: FC-AA22 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA22 (Link to dictyBase) - - - Contig-U14948-1 FC-AA22E (Li...nk to Original site) - - - - - - FC-AA22E 576 Show FC-AA22 Library FC (Link to library) Clone ID FC-AA22 (Li.../ Representative seq. ID FC-AA...22E (Link to Original site) Representative DNA sequence >FC-AA22 (FC-AA22Q) /CSM/FC/FC-AA/FC-AA22Q.Seq.d/ ATGAA...TACGATGATAGTGATTCAGACTTTTGACCAATTGAAAAAACCAGCAACAGAAATG GTACTGGTTTGGTCTCCTCCACTTTTAAGGTTGCCCCTTCCTTCTCTACCATTCAAAAAC AACAA

  4. Dicty_cDB: FC-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA15 (Link to dictyBase) - G01144 DDB0204372 Contig-U15089-1 FC-AA...15E (Link to Original site) - - - - - - FC-AA15E 522 Show FC-AA15 Library FC (Link to library) Clone ID FC-AA...9-1 Original site URL Representative seq. ID FC-AA15E (Link to Original site) Representative DNA sequence >FC-AA15 (FC-AA15Q) /CSM/FC/FC-AA/FC-AA...15Q.Seq.d/ CAAATCACACATAAAAGTTTAATATAAAAATGGGTACACCAATTAAAAAGATTAGTACAG TAATTATTAAAATGGTTTCATCAGCCAA

  5. Dicty_cDB: FC-AA17 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA17 (Link to dictyBase) - - - Contig-U15091-1 FC-AA17E (Li...nk to Original site) - - - - - - FC-AA17E 347 Show FC-AA17 Library FC (Link to library) Clone ID FC-AA17 (Li.../ Representative seq. ID FC-AA...17E (Link to Original site) Representative DNA sequence >FC-AA17 (FC-AA17Q) /CSM/FC/FC-AA/FC-AA17Q.Seq.d/ CCCAAAAGCCCGTAA...GACTCACTGTGTCAAGTGCAACAAACACACCCCACACAAGGTTAC CCAATACAAAGCTGGTAAACCAAGTCTTTTCGCACAAGGTAAAAGACGTTACGATCGTAA ACAA

  6. Dicty_cDB: FC-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA05 (Link to dictyBase) - G01143 DDB0190243 Contig-U15085-1 FC-AA...05E (Link to Original site) - - - - - - FC-AA05E 675 Show FC-AA05 Library FC (Link to library) Clone ID FC-AA...5-1 Original site URL Representative seq. ID FC-AA05E (Link to Original site) Representative DNA sequence >FC-AA05 (FC-AA05Q) /CSM/FC/FC-AA/FC-AA...05Q.Seq.d/ AAACAAAAAAAAAAGGTATGGAAATTTTTGCATTTGTACCATTAGCAGTGTTAACAGCAT TATGTGTTGTTATTTCACTCTTTGTTAAAAGAGAGAAA

  7. Dicty_cDB: FCL-AA23 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA23 (Link to dictyBase) - G01759 DDB0201558 Contig-U15118-1 FCL-AA...23E (Link to Original site) - - - - - - FCL-AA23E 1045 Show FCL-AA23 Library FCL (Link to library) Clone ID FCL-AA...ig-U15118-1 Original site URL Representative seq. ID FCL-AA23E (Link to Original site) Representative DNA sequence >FCL-AA23 (FCL-AA...23Q) /CSM/FCL/FCL-AA/FCL-AA23Q.Seq.d/ ATAACTATATAACTATGTCTAACCAAAAGAAAAACGACGTATCTTCATTTGTTAAAGATT CTTTAA

  8. Dicty_cDB: FC-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA21 (Link to dictyBase) - - - Contig-U15450-1 FC-AA21E (Li...nk to Original site) - - - - - - FC-AA21E 839 Show FC-AA21 Library FC (Link to library) Clone ID FC-AA21 (Li.../ Representative seq. ID FC-AA...21E (Link to Original site) Representative DNA sequence >FC-AA21 (FC-AA21Q) /CSM/FC/FC-AA/FC-AA21Q.Seq.d/ AATTATTTTCATTAA...TTTTAGCTTTATTCCTTGTCAACTCCGCTGTTGTCTCTTCACTCG ACTCATGTAGTATTTGTGTTGATTTTGTTGGTAACTCACTCAATGATCTTTTAAATATTA TCCTTAA

  9. Dicty_cDB: FCL-AA22 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA22 (Link to dictyBase) - G01758 DDB0229949 Contig-U15119-1 FCL-AA...22E (Link to Original site) - - - - - - FCL-AA22E 840 Show FCL-AA22 Library FCL (Link to library) Clone ID FCL-AA...g-U15119-1 Original site URL Representative seq. ID FCL-AA22E (Link to Original site) Representative DNA sequence >FCL-AA22 (FCL-AA...22Q) /CSM/FCL/FCL-AA/FCL-AA22Q.Seq.d/ AAAATGAGCAAAATCTCAAGCGACCAAGTTAGATCAATCGTCTCCCAACTTTTCAAAGAA GCACAAGAATCCAAAA

  10. Dicty_cDB: FCL-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA06 (Link to dictyBase) - G24322 DDB0216974 Contig-U15228-1 FCL-AA...06E (Link to Original site) - - - - - - FCL-AA06E 791 Show FCL-AA06 Library FCL (Link to library) Clone ID FCL-AA...g-U15228-1 Original site URL Representative seq. ID FCL-AA06E (Link to Original site) Representative DNA sequence >FCL-AA06 (FCL-AA...06Q) /CSM/FCL/FCL-AA/FCL-AA06Q.Seq.d/ AAAATCCCAATTTCATTAGCAGTGGAAGTAACGGAATGAATTGGGGTGGTTCTTTGAACA CTTGTGACTCTGGAGGATTCAA

  11. Dicty_cDB: FCL-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA18 (Link to dictyBase) - G24323 DDB0191144 Contig-U15229-1 FCL-AA...18Z (Link to Original site) - - FCL-AA18Z 623 - - - - Show FCL-AA18 Library FCL (Link to library) Clone ID FCL-AA...g-U15229-1 Original site URL Representative seq. ID FCL-AA18Z (Link to Original site) Representative DNA sequence >FCL-AA18 (FCL-AA...18Q) /CSM/FCL/FCL-AA/FCL-AA18Q.Seq.d/ XXXXXXXXXXGTCAATGTCATTATTGGTGAACAATCTGATGGTTCGTTGGAACAAATCGC TAGAAATCCACAACCAA

  12. Dicty_cDB: FC-AA16 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA16 (Link to dictyBase) - G22556 DDB0204121 Contig-U15090-1 FC-AA...16E (Link to Original site) - - - - - - FC-AA16E 933 Show FC-AA16 Library FC (Link to library) Clone ID FC-AA...0-1 Original site URL Representative seq. ID FC-AA16E (Link to Original site) Representative DNA sequence >FC-AA16 (FC-AA16Q) /CSM/FC/FC-AA/FC-AA...16Q.Seq.d/ GGGCAGGATCATCATTTAATACTAAAGATTCAACAATAATTGCAAAAACTCAATTTTATC AAAAAAATATTCAAATTTATAAAGGTGATCAA

  13. Evolution of geomagnetic aa index near sunspot minimum

    Directory of Open Access Journals (Sweden)

    R. P. Kane

    Full Text Available The smoothed values of the minima of sunspot number Rz and the geomagnetic index aa were compared for sunspot cycles 12–23. In one cycle, aa(min occurred earlier than Rz(min, but remained at that low from a few months before Rz(min to a few months after Rz(min. In two cycles, Rz(min and aa(min coincided within a month or two. In nine cycles, aa(min occurred more than three months later than Rz(min. The aa(min coincided with the minima of some solar radio emission indices originating in the solar corona. For sunspot cycles 21, 22, 23, the minimum of solar wind velocity V occurred 0–9 months later than the aa(min. The minimum of solar wind total magnetic field B occurred near Rz(min. The solar wind ion density N had maxima (instead of minima near Rz(min, and again near Rz(max, indicating a  ~5-year periodicity, instead of an 11-year periodicity. The maxima of aa, V and B occurred near Rz(max and/or later in the declining phase of Rz. The aa index was very well correlated with the functions BV and BV 2.Key words. Geomagnetism and paleomagnetism (time variations, diurnal to secular – time variations, secular and long term Interplanetary physics (interplanetary magnetic field

  14. Household response to environmental incentives for rain garden adoption (United States)

    Newburn, David A.; Alberini, Anna


    A decentralized approach to encourage the voluntary adoption of household stormwater management practices is increasingly needed to mitigate urban runoff and to comply with more stringent water quality regulations. We analyze the household response to a hypothetical rebate program to incentivize rain garden adoption using household survey data from the Baltimore-Washington corridor. We asked respondents whether the household would adopt a rain garden without a rebate or when offered a randomly assigned rebate. An interval-data model is used to estimate household demand on the willingness to pay (WTP) for a rain garden as a function of demographic factors, gardening activities, environmental attitudes, and other household characteristics. Estimation results indicate that mean WTP for a rain garden in our sample population is approximately $6.72 per square foot, corresponding to almost three-fourths of the installation cost. The expected adoption rate more than tripled when comparing no rebate versus a government rebate set at one-third of the installation cost, indicating that economic incentives matter. There is substantial heterogeneity in the WTP among households. Higher levels of WTP are estimated for households with higher environmental concern for the Chesapeake Bay and local streams, garden experience, higher income, and non-senior citizen adults. We conclude that a cost-share rebate approach is likely to significantly affect household adoption decisions, and the partial contributions paid by households can assist with lowering the substantial compliance costs for local governments to meet water quality requirements.

  15. Electricity saving in households-A social cognitive approach

    International Nuclear Information System (INIS)

    We propose a conceptual framework for understanding the (lack of) energy saving efforts of private households based on Bandura's (1986) social cognitive theory. Results from applying this framework on a sample of Danish private electricity consumers are presented and it is concluded (a) that households' electricity consumption depends on both structural and motivational factors, (b) that their electricity saving effort depends on the strength of their internalized norms or self-expectations and on self-efficacy related factors, and (c) that there are predictable patterns of interaction among household members that influence their electricity consumption. The results suggest two approaches to promote electricity saving in households: (1) to change the socio-structural environment to be more facilitating for energy saving and empower householders to be more effective in their striving towards this goal through improved feedback about their household's electricity consumption and (2) social norms marketing, communicating social expectations and others' successful electricity saving achievements. - Research highlights: →A combination of survey and meter reading data is used to analyze energy saving in households. →Up to two adults from each household answered the questionnaire. →Dyadic data analysis is used to investigate interactions between household members. →Both structural and motivational factors account for households' electricity consumption. →Electricity saving efforts depends on internalized norms, self-efficacy and social interaction.

  16. Household transitions to energy efficient lighting

    International Nuclear Information System (INIS)

    New energy efficient lighting technologies can significantly reduce household electricity consumption, but adoption has been slow. A unique dataset of German households is used in this paper to examine the factors associated with the replacement of old incandescent lamps (ILs) with new energy efficient compact fluorescent lamps (CFLs) and light emitting diodes (LEDs). The ‘rebound’ effect of increased lamp luminosity in the transition to energy efficient bulbs is analyzed jointly with the replacement decision to account for household self-selection in bulb-type choice. Results indicate that the EU ban on ILs accelerated the pace of transition to CFLs and LEDs, while storage of bulbs significantly dampened the speed of the transition. Higher lighting needs and bulb attributes like energy efficiency, environmental friendliness, and durability spur IL replacement with CFLs or LEDs. Electricity gains from new energy efficient lighting are mitigated by 23% and 47% increases in luminosity for CFL and LED replacements, respectively. Model results suggest that taking the replacement bulb from storage and higher levels of education dampen the magnitude of these luminosity rebounds in IL to CFL transitions. - Highlights: • EU ban on ILs has fostered transitions to energy efficient lighting • Energy efficient, environmentally friendly, and durable lighting preferences make CFL and LED transitions more likely • Indicators of greater lighting needs are associated with higher propensities to replace ILs with CFLs and LEDs • For residential lighting, the rebound effect manifests itself through increases in luminosity • In IL to CLF transitions luminosity increases are lower with higher levels of education

  17. Investigating design issues in household environments

    DEFF Research Database (Denmark)

    Baillie, Lynne; Benyon, David; Macauley, Catriona;


    This paper argues that the current involvement of end users in the design of technological artefacts is too superficial. It is common to involve people in requirements generation, but rarely in product inception or design. A study is reported involving five households in central Scotland, who were...... each visited on three occasions, using a new investigative framework. Illustrative examples are provided of the strengths and weaknesses of the methods used. Despite the latter, it is demonstrated that the general public can both generate and critique design ideas and that valuable contributions to...... understanding people's relationships with technologies can be expected both from children and from the elderly....

  18. Household appliances using solar energy technology

    International Nuclear Information System (INIS)

    Many solar energy technologies are now sufficiently developed to make it possible to use these to replace some of our conventional energy sources, but still need improvement and reduction in cost. It is, therefore, necessary to focus attention on household uses of solar energy. This paper describes the recent developments and current position in respect of several such devices, which include; solar cooker, with curved concentrator, Panel Cooker, Solar Dryer, solar water heater, Solar Still, Solar Water Pump, Solar Water Disinfection, Solar space Heating and greenhouse solar Reflectors, Development and Extension activities on these should be taken up at various levels. (author)

  19. Dynamic Stock Market Participation of Households

    DEFF Research Database (Denmark)

    Khorunzhina, Natalia

    This paper develops and estimates a dynamic model of stock market participation, where consumers’ decisions regarding stock market participation are influenced by participation costs. The practical significance of the participation costs is considered as being a channel through which financial...... education programs can affect consumers’ investment decisions. Using household data from the Panel Study of Income Dynamics, I estimate the magnitude of the participation cost, allowing for individual heterogeneity in it. The results show the average stock market articipation cost is about 5% of labor...

  20. WEEE and portable batteries in residual household waste: quantification and characterisation of misplaced waste. (United States)

    Bigum, Marianne; Petersen, Claus; Christensen, Thomas H; Scheutz, Charlotte


    A total of 26.1Mg of residual waste from 3129 households in 12 Danish municipalities was analysed and revealed that 89.6kg of Waste Electrical and Electronic Equipment (WEEE), 11kg of batteries, 2.2kg of toners and 16kg of cables had been wrongfully discarded. This corresponds to a Danish household discarding 29g of WEEE (7 items per year), 4g of batteries (9 batteries per year), 1g of toners and 7g of unidentifiable cables on average per week, constituting 0.34% (w/w), 0.04% (w/w), 0.01% (w/w) and 0.09% (w/w), respectively, of residual waste. The study also found that misplaced WEEE and batteries in the residual waste constituted 16% and 39%, respectively, of what is being collected properly through the dedicated special waste collection schemes. This shows that a large amount of batteries are being discarded with the residual waste, whereas WEEE seems to be collected relatively successfully through the dedicated special waste collection schemes. Characterisation of the misplaced batteries showed that 20% (w/w) of the discarded batteries were discarded as part of WEEE (built-in). Primarily alkaline batteries, carbon zinc batteries and alkaline button cell batteries were found to be discarded with the residual household waste. Characterisation of WEEE showed that primarily small WEEE (WEEE directive categories 2, 5a, 6, 7 and 9) and light sources (WEEE directive category 5b) were misplaced. Electric tooth brushes, watches, clocks, headphones, flashlights, bicycle lights, and cables were items most frequently found. It is recommended that these findings are taken into account when designing new or improving existing special waste collection schemes. Improving the collection of WEEE is also recommended as one way to also improve the collection of batteries due to the large fraction of batteries found as built-in. The findings in this study were comparable to other western European studies, suggesting that the recommendations made in this study could apply to other

  1. Failure analysis of fusion clad alloy system AA3003/AA6xxx sheet under bending

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Y., E-mail: [Department of Mechanical Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada); Jin, H. [Novelis Global Technology Center, P.O. Box 8400, Kingston, Ontario, Canada K7L 5L9 (Canada); Wu, P.D. [Department of Mechanical Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada); Lloyd, D.J. [Aluminum Materials Consultants, 106 Nicholsons Point Road, Bath, Ontario, Canada K0H 1G0 (Canada); Embury, D. [Department of Mechanical Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada)


    An ingot of AA6xxx Al–Si–Mg–Cu alloy clad with AA3003 Al–Mn alloy was co-cast by Fusion technology. Bending tests and numerical modeling were performed to investigate the potential for sub-surface cracking for this laminate system. To simulate particle-induced crack initiation and growth, both random and stringer particles have been selected to mimic the particle distribution in the tested samples. The morphology of cracking in the model was similar to that observed in clad sheet tested in the Cantilever bend test. The crack initiated in the core close to the clad-core interface where the strain in the core is highest, between particles or near particles and propagates along local shear bands in the core, while the clad layer experiences extreme thinning before failure.

  2. RES Hydrogen: efficient pressurised alkaline electrolysers

    DEFF Research Database (Denmark)

    Bowen, Jacob R.; Bentzen, Janet Jonna; Jørgensen, Peter Stanley;

    The RESelyser project addresses issues associated with coupling alkaline electrolysis to renewable energy sources such as electrode stability and gas purity by implementing improved electrodes and a new separator membrane concept. The project aims to improve performance, operation pressure and...... reduce system cost. The project supports DTU Energy's activities on electrodes within the larger FCH-JU project. The overall project demonstrated: improved electrode efficiency also during cyclic operation, safe gas purity at a system pressure of 30 bar, 10 kW stack operation and estimated system costs...

  3. Alkaline carbonates in blast furnace process

    Directory of Open Access Journals (Sweden)

    P. Besta


    Full Text Available The production of iron in blast furnaces is a complex of physical, chemical and mechanical processes. The input raw materials contain not only metallic components, but also a number of negative elements. The most important negative elements include alkaline carbonates. They can significantly affect the course of the blast furnace process and thus the overall performance of the furnace. As a result of that, it is essential to accurately monitor the alkali content in the blast furnace raw materials. The article analyzes the alkali content in input and output raw materials and their impact on the blast furnace process.

  4. AA, shims and washers on quadrupole ends

    CERN Multimedia

    CERN PhotoLab


    Due to the fact that much of the field of the quadrupoles was outside the iron (in particular with the wide quadrupoles) and that thus the fields of quadrupoles and bending magnets interacted, the lattice properties of the AA could not be predicted with the required accuracy. After a first running period in 1980, during which detailed measurements were made with proton test beams, corrections to the quadrupoles were made in 1981, in the form of laminated shims at the ends of the poles, and with steel washers. With the latter ones, further refinements were made in an iterative procedure with measurements on the circulating beam. This eventually resulted, amongst other things, in a very low chromaticity, with the Q-values being constant to within +- 0.001 over the total momentum range of 6 %. Here we see the shims and washers on a narrow qudrupole (QFN, QDN). See also 8103203, 8103204, 8103205, 8103206.

  5. Household energy consumption and consumer electronics: The case of television

    International Nuclear Information System (INIS)

    In recent years, there has been a dramatic rise in the number of consumer electronics in households. These new technologies and the services that support them enable new highly energy intensive behaviours. Using in-depth interview data collected from 20 households in 2006, this paper explores these energy intensive behaviours, using the example of the use of televisions. In doing so, it illustrates how the design and marketing of consumer electronics, and the services which support them, actively encourage energy intensive behaviours and how householders are reconfiguring their homes and lifestyles to fit these behaviours. This latter point is significant because, as householders change their homes and daily lives to fit energy intensive consuming behaviours, it will become increasingly difficult to encourage people to reduce their household energy consumption. This paper concludes with the implications of the research findings for policies designed to reduce household energy consumption

  6. Definition of Household Membership in International Migration Surveys

    Directory of Open Access Journals (Sweden)

    Turgay Ünalan


    Full Text Available Using data from national surveys conducted within the scope of the Eurostat project titled “Push and Pull Factors of International Migration”, analyses are presented using different definitions (narrow versus wide of household membership in migrant-sending countries (Egypt, Ghana, Morocco, Senegal and Turkey to see if different definitions are helpful in identifying and increasing the number of migrants who are or was a part of those households. When broad definition was used, the increase in the international migrant members was especially considerable in recent and current migrant households. The findings demonstrated that it was possible to trace an important number of international migrants back in their country of origin and to collect data using proxy interviews. However, it was still impossible to survey emigrants who left the country as a household, those who were not expected to return to the household, those belonging to some dissolved households, or those who died.

  7. Standard of Electrical Washing Machine for Household and Similar Purposes

    Institute of Scientific and Technical Information of China (English)

    Lu Jianguo


    Background With further improvement of people's living,the household washing machine industry has entered a new stage of development.However,some indicators of GB/T 4288-2003 have become no longer suitable for the development of household washing machine products at present.Particularly,with an increasing number of basic functions and auxiliary functions,many aspects are not covered by the existing standard.In order to further improve the overall quality of China's household washing machines and enhance their competitiveness in the international market,guide manufacturers to produce household washing machines in line with the demands of consumers and instruct consumers to properly purchase and use household washing machines,it is imperative to revise the GB/T 4288-2003 Household Electric Washing Machine.

  8. Stochastic SIR epidemics in a population with households and schools

    CERN Document Server

    Ouboter, Tanneke; Trapman, Pieter


    We study the spread of stochastic SIR (Susceptible $\\to$ Infectious $\\to$ Recovered) epidemics in two types of structured populations, both consisting of schools and households. In each of the types, every individual is part of one school and one household. In the independent partition model, the partitions of the population into schools and households are independent of each other. This model corresponds to the well-studied household-workplace model. In the hierarchical model which we introduce here, members of the same household are also members of the same school. We introduce computable branching process approximations for both types of populations and use these to compare the probabilities of a large outbreak. The branching process approximation in the hierarchical model is novel and of independent interest. We prove by a coupling argument that if all households and schools have the same size, an epidemic spreads easier (in the sense that the number of individuals infected is stochastically larger) in th...

  9. Household health care facility utilization in the Philippines. (United States)

    Russo, G; Herrin, A N; Pons, M C

    This paper presents probit estimates of household utilization of health care facilities in the Philippines. Using household data from the 1987 National Health Survey and supply data from the Department of Health, separate probit equations are estimated for each of the four major types of facilities in the Philippines: Public hospitals, private hospitals, major rural health units and barangay (village) health stations. The probability that a household will utilize services from these facilities is estimated as a function of socioeconomic, demographic and supply variables. The results indicate substantial differences in utilization patterns by income class. Households in the highest income quartile are approximately twice as likely (0.451 versus 0.236) to utilize private hospital services vis-à-vis households in the lowest income quartile, ceteris paribus. The results also indicate substantial substitution between public and private services. An increase in the availability of private hospital beds significantly reduces the probability that a household will utilize government facilities. PMID:10050192

  10. Environmental income improves household-level poverty assessments and dynamics

    DEFF Research Database (Denmark)

    Walelign, Solomon Zena; Charlery, Lindy Callen; Smith-Hall, Carsten;


    Household-level poverty assessments and analyses of poverty dynamics in developing countries typically do not include environmental income. Using household (n = 427 in 2006, 2009 and 2012) total income panel data sets, with and without environmental income, from Nepal, we analysed the importance of...... environmental income in household-level poverty assessments (Foster-Greer-Thorbecke indices) and dynamics (movements in the Poverty Transition Matrix). Random effects logit and ordered logit models were applied to estimate variables covarying with poverty categories and compared for annual household incomes...... with and without environmental income. Using the without environmental income data set significantly changed the number of households classified as poor, as well as rates of movements in and out of poverty. Excluding household-level environmental income also distorted estimation of covariates of...

  11. Household time allocation – Theoretical and empirical results from Denmark

    Directory of Open Access Journals (Sweden)

    Jens Bonke


    Full Text Available Using data from a sample of households in 1994 we find that Danish household labour allocation choices are bestdescribed by a collective model in which decisions are made cooperatively. Individual preferences are similar butthere are important differences due to the differences in educational attainment. Households can be characterized as utilitarian with a sharing rule which depends on household income and is feminist rather than egalitarian. The allocation of tasks within the family depends on both the individuals’ comparative advantage in labour markets andindividual preferences for paid work as well as the intra-household distribution of income. These results do not require explicit assumptions about labour supply that are often employed in the household time allocation literature.

  12. Predicted intake of trace elements and minerals via household drinking water by 6-year-old children from Krakow (Poland). Part 3: Aluminum


    Barton, Henryk


    Abstract In order to evaluate aluminum intake via drinking water by children, ca. 400 households in urban, peripheral and rural areas were investigated. The study comprised ca. 200 of 5-7-year-old children in the period between 2000-2001. The samples of drinking water (DW) were collected by double sampling method (morning, evening). Aluminium (Al) was measured by the GF-AAS method. Geometric means (GM in ?g L-1, C.I.) were for evening samples: urban 72.5(13.2-398), peripheral 6.3(0...

  13. Electrochemical characterisation of aluminium AA7075-T6 and solution heat treated AA7075 using a micro-capillary cell

    International Nuclear Information System (INIS)

    Localised corrosion of 7xxx aluminium alloys initiates at cathodic intermetallics containing Cu and Fe due to a strong galvanic coupling with the matrix. In order to study this galvanic coupling, the electrochemical behaviour of AA7075-T6 and solution heat treated AA7075 has been investigated by means of complementary techniques: micro-capillary cell, scanning Kelvin probe force microscopy (SKPFM) and scanning electron microscopy (SEM). Characterisation with the micro-capillary cell showed that the intermetallics cause a more cathodic breakdown potential in the solution heat treated AA7075 compared with the AA7075-T6. This is associated with a higher Volta potential difference between the intermetallics and the matrix in the solution heat treated AA7075, indicating a stronger galvanic coupling for this temper. From these results, it is concluded that the breakdown potential of areas containing the intermetallics is related to the Volta potential difference between the intermetallics and the matrix

  14. Differences in Household Saving between Non-Hispanic White and Hispanic Households (United States)

    Fisher, Patti J.; Hsu, Chungwen


    This study uses the 2007 Survey of Consumer Finances to empirically explore differences in saving behavior between Hispanic (N = 533) and non-Hispanic White (N = 2,473) households. The results of the logistic regression model show that self-employed Hispanics were more likely to save, while self-employment was not significant for Whites. Being…

  15. Household and non-household activities of youths: issues of modelling, data and estimation strategies.


    Rosenzweig MR


    Working paper introducing an econometric model to test the labour economics of child labour in Indian rural areas. Analyses impact of wage rates, land ownership, labour supply, employment opportunities, parental employment (esp. women workers and married women) and children labour force participation, unpaid work in the household and school attendance, and derives conclusions on impact of family planning, educational policy and other programmes.

  16. Subsidized Housing and Household Hardship among Low-Income Single-Mother Households (United States)

    Berger, Lawrence M.; Heintze, Theresa; Naidich, Wendy B.; Meyers, Marcia K.


    We investigate associations of housing assistance with housing and food-related hardship among low-income single-mother households using data from the National Survey of America's Families (N = 5,396). Results from instrumental variables models suggest that receipt of unit-based assistance, such as traditional public housing, is associated with a…

  17. "Raising Him . . . to Pull His Own Weight": Boys' Household Work in Single-Mother Households (United States)

    Berridge, Clara W.; Romich, Jennifer L.


    In this study, the authors examine boys' household work in low- and moderate-income single-mother families. Through describing the work that boys do, why they do this work, and the meaning that they and their mothers give to this work, they add to the understanding of housework as an arena for gender role reproduction or interruption. Their data…

  18. Food Insecurity in Households with Children: Prevalence, Severity, and Household Characteristics. ERS Report Summary (United States)

    Nord, Mark


    Food security is especially important for children because their nutrition affects not only their current health, but also their future health and well-being. Previous studies that used various data sources suggest that children in food-insecure households face elevated risks of health and development problems, compared with children in otherwise…

  19. Household energy preferences for cooking in urban Ouagadougou, Burkina Faso

    International Nuclear Information System (INIS)

    An extensive survey on household expenditures in Ouagadougou, the capital of Burkina Faso, was used to analyze the factors determining urban household energy choices using a multinomial logit model. Wood-energy remains the preferred fuel of most urban households in the country; though rational, the choice is not sustainable as it portends a threat to the savanna woodlands and the economy. Many important policies have been adopted by public authorities to minimize household wood-energy consumption and to substitute it by alternative fuel. Despite the magnitude of all these policies, the depletion rate of the forest resource is increasing. A kind of inertia is thus observed for household preferences for cooking fuel. This model analyzes the sociological and economic variables of household energy preferences for cooking in Ouagadougou. The analyses show that the inertia of household cooking energy preferences are due to poverty factors such as low income, poor household access to electricity for primary and secondary energy, low house standard, household size, high frequency of cooking certain meals using woodfuel as cooking energy. The descriptive analyses show that the domestic demand for wood-energy is strongly related to household income. The firewood utilization rate decreases with increasing household income. In other words, this fuel appears as a 'transition good' for these households which aim for other sources of energy for cooking that are more adapted for urban consumption. This implies that a price subsidy policy for liquid petroleum gas (LPG) and its cook stoves could significantly decrease the utilization rate of wood-energy

  20. Electric household appliances lighting. Synthesis; Electromenager eclairage. Note de synthese

    Energy Technology Data Exchange (ETDEWEB)



    This study has been realized on 10000 families in order to know the French behavior concerning the electric household appliances and the lighting of their accommodation. The document presents statistically the answers to the questions on the electric household in the accommodation, the choice criteria, the use conditions, the washing temperatures, the nature of the electric household appliances, the microwave ovens, the influence of the energy-label on the appliances and the lighting. (A.L.B.)



    Puneeta Dandotiya; Praval Singh Chauhan; Hemant Samadhiya; O.P. Agrawal


    The household organic wastes commonly include dust, food and kitchen waste, garden waste, paper waste etc. that is generated everyday from every house. This highly nutritive organic waste is the house of infectious bacteria, vector and insect. A study was conducted to explore the possibility of vermicomposting of household organic waste at home level. For this study household waste (HW) and garden (leaves with soil-dust) waste (GW) were selected. They were mixed with dried dung powder (DDP) a...

  2. Beware of Workaholics : Household Preferences and Individual Equilibrium Utility


    Gersbach, Hans; Haller, Hans


    This paper analyzes the effects of sociological changes in the form of a shift of influence within two-member households participating in labor and product markets. The most striking effects occur when household members differ in individual preferences and enjoy positive leisure-dependent externalities. For instance, a global sociological change where the ?workaholic" member becomes more influential in each working class household can render the working class worse off. A binding restriction ...

  3. Socio-economic Determinants of Household Food Insecurity in Pakistan


    Asghar, Zahid; Muhammad, Ahmed


    This study investigates the determinants of food insecurity for both general and farmer households. It is based on Pakistan Social and Living standard Measurement (PSLM) 2007-08 survey conducted by the Federal Bureau of Statistics, Pakistan. After having descriptive analysis of the important determinants of food insecurity, we have used logit model to find the probability for being household secure or insecure. The model is initially fitted with 16 (for general) and 19 (for farmer households)...

  4. Household Income Determination and Regional Income Differential in Rural China


    Meng, Xin; Wu, Harry


    Regional income dispersion is a sensitive issue in China in terms of judging the impact of economic reform. This study looks closely at the issue as to what are the determinants of income variation among households in general, and which are the key determinants of income dispersion among different regions. The study uses the data from a sample survey on 1000 rural households in five Chinese provinces. Household income equations are estimated to assess the determinants of income variations am...

  5. Standby-consumption in households; Standby-Verbrauch im Haushalt

    Energy Technology Data Exchange (ETDEWEB)

    Zehnder, U.


    This final report for the Swiss Federal Office of Energy (SFOE) presents the results of a study made in five types of housing on the standby-consumption of various household appliances. 461 measurements were made in 37 households, whereby three modes - ready-for-use, standby and sleep - were examined. 71 different appliances were looked at in six consumer groups. These included entertainment, hygiene/health, kitchen/household, communication, office and garage. Data is presented in tabular form and commented on.

  6. Household saving behaviour and credit constraints in the euro area


    Porpiglia, Alessandro; Le Blanc, Julia; Teppa, Federica; Zhu, Junyi; Ziegelmeyer, Michael


    We study the role of household saving behaviour, of individual motives for saving and that of perceived liquidity constraints in 15 Euro Area countries. The empirical analysis is based on the Household Finance and Consumption Survey, a new harmonized data set collecting detailed information on wealth holdings, consumption and income at the household level. Since the data is from 2010-2011, strong conclusions as regards the present are difficult to draw. This is because the crisis may have aff...

  7. Determinants of household saving and portfolio choice behaviour in Turkey


    Halime Temel Nalın


    This study investigates the determinants of Turkish households’ saving and portfolio choice behaviour for the period of 2002–2006. The dataset includes 59,855 households, of whom only 10,829 report to have saved and invested. Hence, we first estimate a logit model to identify the characteristics of the households that have saved. Next, we estimate a multinomial logit model where the investment alternatives for the households are real estate, gold, foreign exchange, bank accounts, capital mark...

  8. A microeconometric analysis of households saving determinants in Morocco


    Arestoff, Florence; Mage-Bertomeu, Sabine; Touhami ABDELKHALEK; El Mekkaoui De Freitas, Najat


    Economic fluctuations, climate risk and a number of individual specific shocks leave households vulnerable to severe hardship in developing countries. Moreover, the credit and insurance markets are limited and the social coverage is weak. In this context, households saving is crucial to provide an insurance against the economic and social shocks. Additionally, a better knowledge of households saving behaviour could develop the potential to finance investments. This article provides an analysi...

  9. Household saving behaviour and credit constraints in the euro area



    We study the role of household saving behaviour, of individual motives for saving and that of perceived credit constraints in 15 Euro Area countries. The empirical analysis is based on the Household Finance and Consumption Survey, a new harmonized data set collecting detailed information on wealth holdings, consumption and income at the household level. Since the data is from 2008-2011, strong conclusions as regards the present are diffcult to draw. This is because the crisis may have affecte...

  10. Household saving behavior and credit constraints in the Euro area


    Le Blanc, Julia; Porpiglia, Alessandro; Teppa, Federica; Zhu, Junyi; Ziegelmeyer, Michael


    We study the role of household saving behaviour, of individual motives for saving and that of perceived liquidity constraints in 15 Euro Area countries. The empirical analysis is based on the Household Finance and Consumption Survey, a new harmonized data set collecting detailed information on wealth holdings, consumption and income at the household level. Since the data is from 2010-2011, strong conclusions as regards the present are difficult to draw. This is because the crisis may have aff...

  11. Spousal Employment and Intra-Household Bargaining Power




    This paper considers the relationship between work status and decision-making power of the head of household and his spouse. I use household fixed effects models to address the possibility that spousal work status may be correlated with unobserved factors that also affect bargaining power within the home. Consistent with the hypothesis that greater economic resources yield greater bargaining power, I find that the spouse of the head of household is more likely to be involved in decisions when...

  12. A note on households' choice of emergency finance


    Andrew Worthington


    This note examines demographic and socioeconomic characteristics as predictors of emergency finance in Australian households. The data is from the Household Expenditure Survey Confidentialised Unit Record Files and relates to 6,892 households. Emergency finance is defined as the ability to raise $2,000 within a week and its potential sources include own savings, loans from deposit-talking institutions, finance companies, credit cards, family and friends, welfare or community organisations and...

  13. Demand for Electric Vehicles in Hybrid Households: An Exploratory Analysis


    Kurani, Kenneth S; Turrentine, Tom; Sperling, Daniel


    Previous studies of the potential market for battery electric vehicles (BEVs) have reached contradictory conclusions. What they share are untested or implausible assumptions about consumer response to new transportation technology. We frame the BEV purchase decision in terms of a household's entire stock of vehicles, car purchase behavior and travel behavior. Within this framework, households which own both electric vehicles and gasoline vehicles are called "hybrid households". Because nearly...

  14. Poverty Transitions among Older Households in Brazil and South Africa


    Armando Barrientos; Julia Mase


    Using a panel data set of older people and their households in Brazil and South Africa, the article provides estimates of changes in the poverty status transitions of older people and their households over time, assessing the extent to which some panel households managed to escape from poverty, while others fell into poverty, and others remained persistently poor or persistently non-poor. It also provides an exploratory analysis of the factors associated with poverty transitions. The article ...

  15. Household Level Pollution in India: Patterns and Projections


    K.S. Kavi Kumar; Brinda Viswanatha


    Solid fuels are still a major source for cooking in many households in India causing significant disease and global warming burden. This study analyses the pollution-income relationship (for both local and global pollution), separately across rural and urban households in India based on unit record data on fuel consumption obtained through National Sample Survey data for 2004-05. Based on the estimated relationship, the study makes an attempt to project household level pollution for 2026. The...

  16. Crisis and shifting Households Menace below the poverty line


    Taliánová, Monika


    The main task of my bachor thesis: Crisis and shifting Households Menace below the poverty line is to analyse changes in households financial potential with a link to uneployment development, minimum salary rate, inflation increase in times of economic crises. I go into a detail in identification of risk of poverty rate and material deprivation of Czech hoseholds compared to member states of European Union in my analyses. Especialy for Czech Republic are made detailed analyses for households ...

  17. Household waste recycling: National survey evidence from Italy


    Fiorillo, Damiano


    The paper analyses the determinants of household recycling in Italy with particular emphasis on social behaviour. The econometric analysis is based on two waves - 1998 and 2000 - of the Multipurpose Household Survey conducted annually by the Italian Central Statistics Office. In Italy household recycling was substantially voluntary in the years from 1998 to 2000 with no monetary incentives or pecuniary sanctions. Five different materials are investigated: paper, glass, plastic, aluminium and ...

  18. Estimating the level and distribution of global household wealth


    DAVIES, JAMES B; Sandström, Susanna; Shorrocks, Anthony; Wolff, Edward N.


    We provide the first estimate of the level and distribution of global household wealth. Mean assets and debts within countries are measured, partly or wholly, for 38 countries using household balance sheet and survey data centred on the year 2000. Determinants of mean financial assets, non-financial assets, and liabilities are studied empirically, and the results are used to impute values to countries lacking wealth data. Household wealth per adult is US$43,494 in PPP terms, and ranges region...



    Doss, Cheryl R.


    In this paper, the percentage of assets held by women within the household is used as a measure of women's bargaining power. The assets used in this paper include land, savings, and business assets. Using detailed household survey data from Ghana, I demonstrate that the share of assets owned by women has a significant impact on household expenditure decisions. This provides additional support for the notion that women's bargaining power can be measured, at least in some dimensions, and that w...

  20. An Exploratory Study of Financial Management Practices Among Ghanaian Households


    Redeemer Yao Krah; Felix Kwame Aveh; Rebecca Addo


    This is an exploratory study that investigates the financial management practices of 286 selected households in Greater Accra Regions of Ghana. The main objectives of the study are to examine the budgeting and budgetary control practices of the households and to identify the relationships that exist between the budget culture of a household and their educational level, stage, income, and savings/investment stock. Questionnaire was used in data collection and descriptive statistics such as cro...

  1. Mental Accounting and Remittances: A Study of Malawian Households


    Davies, Simon; Easaw, Joshy; Ghoshray, Atanu


    In this paper we use a behavioural approach to studying household consumption behaviour in Malawi. In particular we are interested to know whether households use mental accounting when consuming different categories of good. It is useful for assessing the impact of remittances on household consumption behaviour. We use 1998 cross-sectional data to find the following key results: (i) mental accounting systems are in operation. Remittance income exhibits a higher marginal propensity to save th...

  2. How does household production affect measured income inequality?


    Frazis, Harley; Stewart, Jay


    Although income inequality has been studied extensively, relatively little attention has been paid to the role of household production. Economic theory predicts that households with less money income will produce more goods at home. Thus extended income, which includes the value of household production, should be more equally distributed than money income. Previous studies have found this to be the case and have speculated that the more-equal distribution of extended income is due to the weak...

  3. Are Children Decision-Makers Within the Household?


    Dauphin, Anyck; El Lahga,Abdelrahmen; Fortin, Bernard; Lacroix, Guy


    Children are seldom accounted for in household behavioural models. They are usually assumed to have neither the capacity nor the power to influence the household decision process. The literature on collective models has so far incorporated children through the "caring preferences" of their parents or has treated them as household public goods [Bourguignon (1999); Blundell et al. (2005)]. This paper seeks to determine whether children of a certain age are decision-makers. We focus on the decis...

  4. Household debt and saving during the 2007 recession


    Chakrabarti, Rajashri; Lee, Donghoon; van der Klaauw, Wilbert; Zafar, Basit


    Using administrative credit report records and data collected through several special household surveys we analyze changes in household debt and savings during the 2007 recession. We find that while different segments of the population were affected in distinct ways, depending on whether they owned a home, whether they owned stocks and whether they had secure jobs, the crisis' impact appears to have been widespread, affecting large shares of households across all age, income and education gro...

  5. Household food diversity and nutritional status among adults in Brazil


    Sichieri Rosely; Bezerra Ilana N


    Abstract Background The aims of this study were to evaluate whether a diversity of healthy foods in a household would decrease the availability of unhealthy foods and to evaluate the association between a healthy dietary diversity score (DDS) and nutritional status among adults. Methods Data from the 2002-2003 Brazilian Household Budget Survey were used. This nationwide survey used a two-stage sampling technique: households were selected after selection of primary sample units (PSUs). Analyse...

  6. An analysis of household's tobacco consumption decisions: Evidence from India


    Rijo John


    Tobacco products such as bidi and cigarette, both of which are smoked, cater to different kinds of households in India, and analyzing them separately may yield results that are useful for public policy. Hence, we analyze the consumption patterns, socio-economic distribution and the household choice of a variety of tobacco products across rural and urban India. Using a Multinomial Logit Model, we analyze the choice behavior of a household in deciding whether and which tobacco products to consu...

  7. Happiness, Leisure and Tourism vs Household Budget in Iran


    Dr. Mohammad Taghi Sheykhi


    The paper aims to explore how happiness, leisure and tourism play role in modern life, and how they are related to household budget. While in the past household budget was totally allotted to the necessities of food, clothing and shelter, nowadays, some portion of the household budget needs to be allotted to leisure and tourism activities ___ leading to happiness. While in the West it is done so, in the developing countries, there is still a long way to go, to achieve that goal. ...

  8. Incense and Joss Stick Making in Small Household Factories, Thailand


    S Siripanich; Siriwong, W.; P Keawrueang; M Borjan; Robson, M.


    Background: Incense and joss stick are generally used in the world. Most products were made in small household factories. There are many environmental and occupational hazards in these factories.Objective: To evaluate the workplace environmental and occupational hazards in small household incense and joss stick factories in Roi-Et, Thailand.Methods: Nine small household factories in rural areas of Roi-Et, Thailand, were studied. Dust concentration and small aerosol particles were counted thro...

  9. Household size and residential water demand: an empirical approach


    Arbues, Fernando; Villanu´a, Inmaculada; Barberán Ortí, Ramón


    The effectiveness of pricing policies depends on the price elasticity of consumption. It is well documented that residential demand for water is influenced by heterogeneity associated with differences in the size of the household and socioeconomic characteristics. In this paper, we focus on household size. Our initial hypothesis is that users’ sensitivity to changes in price is different depending on the number of household members. To this end, we carry out an empirical estimation of urban w...

  10. Alkaline chemistry of transuranium elements and technetium and the treatment of alkaline radioactive wastes

    International Nuclear Information System (INIS)

    Goal of this survey is to generalize the known data on fundamental physical-chemical properties of TRUs and Tc, methods for their isolation, and to provide recommendations that will be useful for partitioning them from alkaline high-level wastes

  11. Alkaline chemistry of transuranium elements and technetium and the treatment of alkaline radioactive wastes

    Energy Technology Data Exchange (ETDEWEB)

    Delegard, C.H. [Westinghouse Hanford Co., Richland, WA (United States); Peretrukhin, V.F.; Shilov, V.P.; Pikaev, A.K. [Russian Academy of Sciences (Russian Federation). Inst. of Physical Chemistry


    Goal of this survey is to generalize the known data on fundamental physical-chemical properties of TRUs and Tc, methods for their isolation, and to provide recommendations that will be useful for partitioning them from alkaline high-level wastes.

  12. Estimating energy conservation patterns of Greek households

    International Nuclear Information System (INIS)

    This paper develops an empirical model to investigate the main determinants of household energy conservation patterns in Greece employing cross-section data. In the empirical analysis, household energy-conserving choices models are employed, using a discrete and a latent trait variable respectively as a dependent variable. The results show that socio-economic variables such as consumers' income and family size are suitable to explain differences towards energy conservation preferences. In addition, the results suggest that electricity expenditures and age of the respondent are negatively associated with the number of energy-conserving actions that a consumer is willing to adopt. Finally, other variables such as environmental information feedback and consciousness of energy problems are characteristics of the energy-saver consumer. By evaluating consumer's decision-making process with regards to energy conservation measures, we are able to formulate and propose an effective energy conservation framework for Greece. An energy policy framework is among the main prerequisites not only to achieve sustainable development but also to maintain consumers' quality of life

  13. Correlation between cell survival and DNA single-strand break repair proficiency in the Chinese hamster ovary cell lines AA8 and EM9 irradiated with 365-nm ultraviolet-A radiation

    International Nuclear Information System (INIS)

    Cell survival parameters and the induction and repair of DNA single-strand breaks were measured in two Chinese hamster ovary cell lines after irradiation with monochromatic UVA radiation of wavelength 365 nm. The radiosensitive mutant cell line EM9 is known to repair ionizing-radiation-induced single-strand breaks (SSB) more slowly than the parent line AA8. EM9 was determined to be 1.7-fold more sensitive to killing by 365-nm radiation than AA8 at the 10% survival level, and EM9 had a smaller shoulder region on the survival curve (α = 1.76) than AA8 (α = 0.62). No significant differences were found between the cell lines in the initial yields of SSB induced either by γ-radiation (as determined by alkaline sucrose gradient sedimentation) or by 365-nm UVA (as determined by alkaline elution). For measurement of initial SSB, cells were irradiated at 0.5oC to minimize DNA repair processes. Rejoining of 365-nm induced SSB was measured by irradiating cells at 0.5oC, allowing them to repair at 37oC in full culture medium, and then quantitating the remaining SSB by alkaline elution. The repair of these breaks followed biphasic kinetics in both cell lines. EM9 repaired the breaks more slowly (T1/2 values of 1.3 and 61.3 min) than did AA8 (T1/2 values of 0.9 and 53.3 min), and EM9 also left more breaks unrepaired 90 min after irradiation (24% vs 8% for AA8). Thus, the sensitivity of EM9 to 365-nm radiation correlated with its deficiency in repairing DNA lesions revealed as SSB in alkaline elution. These results suggest that DNA may be a critical target in 365-nm induced cellular lethality and that the ability of AA8 and EM9 cells to repair DNA strand breaks may be related to their ability to survive 365-nm radiation. (author)

  14. Economic and demographic determinants of household energy use in Turkey

    International Nuclear Information System (INIS)

    This paper analyzes several economic and socio-demographic factors which affect households' energy choices in Turkey. The data is obtained from the Household Budget Surveys (HBS) conducted by the Turkish Statistics Institute (TÜİK). The multinomial logit model is used to identify households' energy choices. The most important finding of the study is that monthly income of households or household welfare in general has significant effect on energy choices. It is also important to note that ages of persons have influence on energy choices. Indeed, health concerns easiness in use was found as criteria referred to particularly by household heads at age 50 and over when making energy choices. As far as settlements are concerned, the most salient characteristic of urban dwellers vis á vis rural dwellers is their dominant preference for natural gas while rural dwellers have their choice for more conventional fuels. - Highlights: • We examine several factors affecting households' energy preferences in Turkey. • Monthly income of households has significant effect on energy choices. • Ages of persons have also influence on energy choices. • Health concerns easiness in use is important choice factor for old households. • Urban and rural dwellers choose natural gas and conventional fuels, respectively

  15. Barriers to household investment in residential energy conservation: preliminary assessment

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, W.L.


    A general assessment of the range of barriers which impede household investments in weatherization and other energy efficiency improvements for their homes is provided. The relationship of similar factors to households' interest in receiving a free energy audits examined. Rates of return that underly household investments in major conservation improvements are assessed. A special analysis of household knowledge of economically attractive investments is provided that compares high payback improvements specified by the energy audit with the list of needed or desirable conservation improvements identified by respondents. (LEW)

  16. A survey of household saving behavior in Japan


    Horioka, Charles Yuji


    This paper presents data on Japan's household saving rate, considers the reasons for Japan's high household saving rate in the past and the reasons for the recent decline therein, projects future trends in Japan's household saving rate, and consider the implications of my findings. It finds that Japan's high household saving rate was a temporary phenomenon and that it was high in both absolute and relative terms during the 1955-95 period (especially during the 1960s and 1970s) but that it was...

  17. Spousal Employment and Intra-Household Bargaining Power. (United States)

    Antman, Francisca M


    This paper considers the relationship between work status and decision-making power of the head of household and his spouse. I use household fixed effects models to address the possibility that spousal work status maybe correlated with unobserved factors that also affect bargaining power within the home. Consistent with the hypothesis that greater economic resources yield greater bargaining power, I find that the spouse of the head of household is more likely to be involved in decisions when she has been employed. Similarly, the head of household is less likely to be the sole decision-maker when his spouse works. PMID:25342928

  18. Spousal Employment and Intra-Household Bargaining Power* (United States)

    Antman, Francisca M.


    This paper considers the relationship between work status and decision-making power of the head of household and his spouse. I use household fixed effects models to address the possibility that spousal work status maybe correlated with unobserved factors that also affect bargaining power within the home. Consistent with the hypothesis that greater economic resources yield greater bargaining power, I find that the spouse of the head of household is more likely to be involved in decisions when she has been employed. Similarly, the head of household is less likely to be the sole decision-maker when his spouse works. PMID:25342928

  19. The Distribution of Household Income and Federal Taxes, 2011


    Congressional Budget Office


    Because higher-income households receive a much greater share of the nation’s before-tax income and pay higher average federal tax rates on that income, they pay much more in federal taxes than lower-income households do. In 2011, households in the top quintile received 52 percent of before-tax income and paid 69 percent of federal taxes; households in the bottom quintile received 5 percent of before tax-income and paid 1 percent of federal taxes.

  20. Household income differences in food sources and food items purchased

    Directory of Open Access Journals (Sweden)

    Wall Melanie


    Full Text Available Abstract Background The present study examined income-related household food purchases among a sample of 90 households from the community. Methods Annotated food purchase receipts were collected for a four-week period by the primary household shopper. Receipt food source and foods items were classified into specific categories, and food quantities in ounces were recorded by research staff. For home sources, a limited number of food/beverage categories were recorded. For eating out sources, all food/beverage items were recorded. Median monthly per person dollars spent and per person ounces purchased were computed. Food sources and food categories were examined by household income tertile. Subjects and Setting A community-based sample of 90 households. Results Higher income households spent significantly more dollars per person per month from both home and eating out sources compared with lower income households ($163 versus $100, p Conclusions Higher income households spent more money on both healthy and less healthy foods from a wide range of sources. Lower income households spent a larger proportion of their eating out dollars at carry out places, and a larger proportion of their home beverage purchases were sugar sweetened beverages.


    Energy Technology Data Exchange (ETDEWEB)



    Physical and chemical agents in the environment, those used in clinical applications, or encountered during recreational exposures to sunlight, induce damages in DNA. Understanding the biological impact of these agents requires quantitation of the levels of such damages in laboratory test systems as well as in field or clinical samples. Alkaline gel electrophoresis provides a sensitive (down to {approx} a few lesions/5Mb), rapid method of direct quantitation of a wide variety of DNA damages in nanogram quantities of non-radioactive DNAs from laboratory, field, or clinical specimens, including higher plants and animals. This method stems from velocity sedimentation studies of DNA populations, and from the simple methods of agarose gel electrophoresis. Our laboratories have developed quantitative agarose gel methods, analytical descriptions of DNA migration during electrophoresis on agarose gels (1-6), and electronic imaging for accurate determinations of DNA mass (7-9). Although all these components improve sensitivity and throughput of large numbers of samples (7,8,10), a simple version using only standard molecular biology equipment allows routine analysis of DNA damages at moderate frequencies. We present here a description of the methods, as well as a brief description of the underlying principles, required for a simplified approach to quantitation of DNA damages by alkaline gel electrophoresis.

  2. Dissolution kinetics of smectite under alkaline conditions

    International Nuclear Information System (INIS)

    Extensive use of cement for encapsulation, backfilling, and grouting purposes is envisaged in radioactive waste disposal. Degradation of cement materials through contact with groundwater can produce a high pH pore fluid initially ranging from pH 13.0 to 13.5. The pore fluid pH eventually decreases to moderately alkaline ranges due to formation and evolution of subsequent materials. The high pH pore fluids can migrate outwards where it will chemically react with the host rock, and the bentonite utilized to enhance the repository's integrity. These chemical reactions degrade the host rocks' and bentonite ability to absorb radionuclides. Smectites comprising the bulk of bentonite can lose some of their desirable properties during the early stages of bentonite-cement-pore fluid interaction. This has been a key research issue in the performance assessment of radioactive waste disposal system. Elucidating the effects of high pH pore fluid on the physical and chemical properties of smectites (i.e. especially dissolution behavior and rates) is of utmost importance. Stirred-flow-through dissolution experiments were utilized to derive reliable dissolution rates for smectites under neutral to highly alkaline conditions. The effects of pH and temperature on smectite dissolution rates were also investigated. (author)

  3. Biological alkalinity generation in acid mine drainage

    International Nuclear Information System (INIS)

    Ecological Engineering and Biological Polishing technologies are a decommissioning approach to inactive coal, uranium and base metal mining operations. To improve acid mine drainage water, some fundamental aspects of wetland ecology and sediment microbiology are combined. The combination provides conditions which allow biomineralization of the contaminants. The authors report here the first records of microbial alkalinity generation in acid mine drainage, through the utilization of the ARUM (Acid Reduction Using Microbiology) process. Increases in pH are brought about by alkalinity-generating microbes such as sulfate reducers, iron reducers, methanogens, or denitrifiers. The ARUM process has been successful in increasing pH from 2.5 to 7.0 in laboratory-scale flow-through reactors operated continuously for more than 120 days. Ni was also reduced from 13 mg/l to < 0.01 mg/l. Batch ARUMators in the field have also performed well. Design parameters are being developed for low flow rates of 5 l/min in a pilot-scale system receiving seepage from mine tailings

  4. Alkaline flocculation of Phaeodactylum tricornutum induced by brucite and calcite


    Vandamme, Dries; Pohl, Philip I.; Beuckels, Annelies; Foubert, Imogen; Brady, Patrick V.; Hewson, John C.; Muylaert, Koenraad


    Alkaline flocculation holds great potential as a low-cost harvesting method for marine microalgae biomass production. Alkaline flocculation is induced by an increase in pH and is related to precipitation of calcium and magnesium salts. In this study, we used the diatom Phaeodactylum tricornutum as model organism to study alkaline flocculation of marine microalgae cultured in seawater medium. Flocculation started when pH was increased to 10 and flocculation efficiency reached 90% when pH was 1...

  5. The effect of alkaline agents on retention of EOR chemicals

    Energy Technology Data Exchange (ETDEWEB)

    Lorenz, P.B.


    This report summarizes a literature survey on how alkaline agents reduce losses of surfactants and polymers in oil recovery by chemical injection. Data are reviewed for crude sulfonates, clean anionic surfactants, nonionic surfactants, and anionic and nonionic polymers. The role of mineral chemistry is briefly described. Specific effects of various alkaline anions are discussed. Investigations needed to improve the design of alkaline-surfactant-polymer floods are suggested. 62 refs., 28 figs., 6 tabs.

  6. Dicty_cDB: FCL-AA17 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA17 (Link to dictyBase) - G03264 DDB0191099 Contig-U15602-1 FCL-AA...17P (Link to Original site) FCL-AA17F 547 FCL-AA17Z 610 FCL-AA17P 1157 - - Show FCL-AA17 Library F...CL (Link to library) Clone ID FCL-AA17 (Link to dictyBase) Atlas ID - NBRP ID G03264 dictyBase ID DDB0191099... Link to Contig Contig-U15602-1 Original site URL Representative seq. ID FCL-AA17P (Link to Original site) Representative DNA sequence >FCL-AA

  7. Dicty_cDB: FCL-AA14 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA14 (Link to dictyBase) - G03263 DDB0218474 Contig-U16035-1 FCL-AA...14P (Link to Original site) FCL-AA14F 647 FCL-AA14Z 550 FCL-AA14P 1197 - - Show FCL-AA14 Library F...CL (Link to library) Clone ID FCL-AA14 (Link to dictyBase) Atlas ID - NBRP ID G03263 dictyBase ID DDB0218474... Link to Contig Contig-U16035-1 Original site URL Representative seq. ID FCL-AA14P (Link to Original site) Representative DNA sequence >FCL-AA

  8. Dicty_cDB: FCL-AA19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA19 (Link to dictyBase) - G01757 DDB0230128 Contig-U16036-1 FCL-AA...19P (Link to Original site) FCL-AA19F 246 FCL-AA19Z 568 FCL-AA19P 814 - - Show FCL-AA19 Library FC...L (Link to library) Clone ID FCL-AA19 (Link to dictyBase) Atlas ID - NBRP ID G01757 dictyBase ID DDB0230128 ...Link to Contig Contig-U16036-1 Original site URL Representative seq. ID FCL-AA19P (Link to Original site) Representative DNA sequence >FCL-AA

  9. Extraction of uranium from alkaline medium by certain amines

    International Nuclear Information System (INIS)

    A possible route for treatment of irradiated uranium from alkaline solution was recently addressed. This may have some advantages related to the isolation of many troublesome fission products upon alkaline dissolution of uranium oxides. In this work, the solubility of uranium oxides in alkaline medium of sodium carbonate and sodium hydroxide mixture was investigated. The different factors affecting the solubility were studied. From alkaline solutions, the extraction of uranium by different amines was carried out. The equilibrium encountered in this extraction systems was elaborated. Possible use of these systems for treatment of irradiated uranium was discussed

  10. Does Measurement Error Explain a Paradox About Household Size and Food Demand? Evidence from Variation in Household Survey Methods


    Gibson, John


    Several recent papers report a puzzling pattern of food demand falling as household size rises at constant per capita expenditure, especially in poorer countries. This pattern is contrary to a widely used model of scale economics. This paper exploits within-country differences in household survey methods and interviewer practices to provide a measurement error interpretation of this puzzle. A comparison of household surveys in Cambodia and Indonesia with the results from Monte Carlo experimen...

  11. The A&A Experience With Impact Factors

    CERN Document Server

    Sandqvist, A


    There is a widespread impression that the scientific journal "Astronomy & Astrophysics" (A&A) has a smaller impact, as measured by citations to articles, than some of the other major astronomy journals. This impression was apparently supported - and probably created - by the Journal Citation Report (JCR), which is prepared annually by the Institute of Scientific Information (ISI) Web of Knowledge. The published poor impact factor of A&A was in fact wrong and was due to a serious flaw in the method used by ISI Web of Knowledge to determine it. The resulting damage inflicted upon A&A by the JCR is incalculable.

  12. Corrosion issues of powder coated AA6060 aluminium profiles

    DEFF Research Database (Denmark)

    Din, Rameez Ud; Valgarðsson, Smári; Jellesen, Morten Stendahl;


    In this study detailed microstructural investigation of the reason for unexpected corrosion of powder coated aluminium alloy AA6060 windows profiles has been performed. The results from this study reveals that the failure of the window profiles was originated from the surface defects present...... on the extruded AA6060 aluminium profile after metallurgical process prior to powder coating. Surface defects are produced due to intermetallic particles in the alloy, which disturb the flow during the extrusion process. The corrosion mechanism leading to the failure of the powder coated AA6060 aluminium profiles...

  13. Poverty Analysis of Rice Farming Households: A Multidimensional Approach

    Directory of Open Access Journals (Sweden)

    Adenuga A. H


    Full Text Available The official measurement and analysis of poverty in Nigeria has historically relied upon the single dimension, consumption based monetary approach with little attention on multidimensional poverty assessment. This study was therefore carried out to assess the multidimensional poverty index of rice farming households in Nasarawa/Benue Rice Hub, Nigeria. The study employed stratified random sampling technique to select 149 rice farming households in the study area. Descriptive statistics, the Alkire and Foster Multidimensional Poverty Index Methodology using two different cut-off points and the Tobit regression model were the main analytical tools employed for the study. The results of the multidimensional poverty index analysis revealed that female headed households were poorer than the male headed households. On the overall, 66 percent of the rice farming households was multidimensionally poor. The study also showed that the rice farming households were deprived in 48 percent of the dimensions. A multidimensional poverty index of 0.32 was obtained for the rice farming households in the study area with varying values obtained for the male and female headed households. The result of the Tobit regression model showed that gender of the household head, health, marital status and membership of association were the major determinants of multidimensional poverty of the rice farming households in the study area. The study concluded that the rice farming households in the study area were multidimensionally poor. It was recommended that the government should give priorities to the development of the rural areas with special consideration for women through the provision of essential infrastructural facilities.

  14. Household Metabolism in the Five Cities. Swedish National Report - Stockholm

    Energy Technology Data Exchange (ETDEWEB)

    Carlsson-Kanyama, Annika; Karlsson, Rebecka [Stockholm Univ. and Swedish Defence Research Agency, Stockholm (Sweden). Environmental Strategies Research Group; Moll, Henri; Kok, Rixt [Univ. of Groningen (Netherlands). IVEM; Wadeskog, Anders [Statistics Sweden, Stockholm (Sweden)


    The study present results from a European project, ToolSust, in which direct and indirect energy use of household consumption is quantified. The focus is on households in Stockholm and how their spending contributes to energy use. A Dutch energy analyses programme, EAP, was modified to portray Swedish conditions, and analyses of more than 300 consumer goods were performed. These data were matched with information about family expenditure patterns from 1996. Six households were analysed, Swedish average, Stockholm City average and four households from Stockholm City. The results show that it is possible to portray households' total energy use, even the indirect one, with the help of the EAP programme and Swedish statistics. Further, indirect energy use may account for more than half of households total energy use and therefore it needs to be considered in policy making. The total primary energy use for the average households varied from 240 to 260 GJ during 1996. Heating, food and transportation were large contributors. The energy efficiency of total household spending varied from 8.8 MJ per Euro 13 MJ per Euro. Information about the energy efficiency on spending is valuable but cannot be presented and used without considering basic needs and quality of life. The total energy use per person varied from 50 to 350 GJ per year, a difference of factor seven. The analyses of energy efficiency of spending, MJ per SEK, indicate important opportunities for less energy demanding spending patterns, but those with low incomes have fewer opportunities than those with high incomes. The energy profiles for different households show that the individual ones may differ a lot from the average picture. There is a need for individual household advice about how to find more energy efficient spending patterns. Large cuts in household energy use means substantial changes in both energy intensity of goods and services and expenditure profiles. Expenditure levels should also be

  15. Household transmission of leptospira infection in urban slum communities.

    Directory of Open Access Journals (Sweden)

    Elves A P Maciel

    Full Text Available BACKGROUND: Leptospirosis, a spirochaetal zoonotic disease, is the cause of epidemics associated with high mortality in urban slum communities. Infection with pathogenic Leptospira occurs during environmental exposures and is traditionally associated with occupational risk activities. However, slum inhabitants reside in close proximity to environmental sources of contamination, suggesting that transmission during urban epidemics occurs in the household environment. METHODS AND FINDINGS: A survey was performed to determine whether Leptospira infection clustered within households located in slum communities in the city of Salvador, Brazil. Hospital-based surveillance identified 89 confirmed cases of leptospirosis during an outbreak. Serum samples were obtained from members of 22 households with index cases of leptospirosis and 52 control households located in the same slum communities. The presence of anti-Leptospira agglutinating antibodies was used as a marker for previous infection. In households with index cases, 22 (30% of 74 members had anti-Leptospira antibodies, whereas 16 (8% of 195 members from control households had anti-Leptospira antibodies. Highest titres were directed against L. interrogans serovars of the Icterohaemorrhagiae serogroup in 95% and 100% of the subjects with agglutinating antibodies from case and control households, respectively. Residence in a household with an index case of leptospirosis was associated with increased risk (OR 5.29, 95% CI 2.13-13.12 of having had a Leptospira infection. Increased infection risk was found for all age groups who resided in a household with an index case, including children <15 years of age (P = 0.008. CONCLUSIONS: This study identified significant household clustering of Leptospira infection in slum communities where recurrent epidemics of leptospirosis occur. The findings support the hypothesis that the household environment is an important transmission determinant in the urban slum

  16. Household Metabolism in the Five Cities. Swedish National Report - Stockholm

    International Nuclear Information System (INIS)

    The study present results from a European project, ToolSust, in which direct and indirect energy use of household consumption is quantified. The focus is on households in Stockholm and how their spending contributes to energy use. A Dutch energy analyses programme, EAP, was modified to portray Swedish conditions, and analyses of more than 300 consumer goods were performed. These data were matched with information about family expenditure patterns from 1996. Six households were analysed, Swedish average, Stockholm City average and four households from Stockholm City. The results show that it is possible to portray households' total energy use, even the indirect one, with the help of the EAP programme and Swedish statistics. Further, indirect energy use may account for more than half of households total energy use and therefore it needs to be considered in policy making. The total primary energy use for the average households varied from 240 to 260 GJ during 1996. Heating, food and transportation were large contributors. The energy efficiency of total household spending varied from 8.8 MJ per Euro 13 MJ per Euro. Information about the energy efficiency on spending is valuable but cannot be presented and used without considering basic needs and quality of life. The total energy use per person varied from 50 to 350 GJ per year, a difference of factor seven. The analyses of energy efficiency of spending, MJ per SEK, indicate important opportunities for less energy demanding spending patterns, but those with low incomes have fewer opportunities than those with high incomes. The energy profiles for different households show that the individual ones may differ a lot from the average picture. There is a need for individual household advice about how to find more energy efficient spending patterns. Large cuts in household energy use means substantial changes in both energy intensity of goods and services and expenditure profiles. Expenditure levels should also be questioned


    Annim, Samuel Kobina; Awusabo-Asare, Kofi; Amo-Adjei, Joshua


    This study uses three key anthropometric measures of nutritional status among children (stunting, wasting and underweight) to explore the dual effects of household composition and dependency on nutritional outcomes of under-five children in Ghana. The objective is to examine changes in household living arrangements of under-five children to explore the interaction of dependency and nucleation on child health outcomes. The concept of nucleation refers to the changing structure and composition of household living arrangements, from highly extended with its associated socioeconomic system of production and reproduction, social behaviour and values, towards single-family households - especially the nuclear family, containing a husband and wife and their children alone. A negative relationship between levels of dependency, as measured by the number of children in the household, and child health outcomes is premised on the grounds that high dependency depletes resources, both tangible and intangible, to the disadvantage of young children. Data were drawn from the last four rounds of the Ghana Demographic and Health Surveys (GDHSs), from 1993 to 2008, for the first objective - to explore changes in household composition. For the second objective, the study used data from the 2008 GDHS. The results show that, over time, households in Ghana have been changing towards nucleation. The main finding is that in households with the same number of dependent children, in nucleated households children under age 5 have better health outcomes compared with children under age 5 in non-nucleated households. The results also indicate that the effect of dependency on child health outcomes is mediated by household nucleation and wealth status and that, as such, high levels of dependency do not necessarily translate into negative health outcomes for children under age 5, based on anthropometric measures. PMID:25167165

  18. Dolomite Dissolution in Alkaline Cementious Media (United States)

    Mittermayr, Florian; Klammer, Dietmar; Köhler, Stephan; Dietzel, Martin


    Chemical alteration of concrete has gained much attention over the past years as many cases of deterioration due to sulphate attack, thaumasite formation (TSA) or alkali silica reactions (ASR) have been reported in various constructions (Schmidt et al, 2009). Much less is known about the so called alkali carbonate reaction (ACR). It is believed that dolomite aggregates can react with the alkalis from the cement, dissolve and form calcite and brucite (Katayama, 2004). Due to very low solubility of dolomite in alkaline solutions this reaction seems doubtful. In this study we are trying to gain new insides about the conditions that can lead to the dissolution of dolomite in concrete. Therefore we investigated concrete samples from Austrian tunnels that show partially dissolved dolomite aggregates. Petrological analysis such as microprobe, SEM and Raman spectroscopy as well as a hydrochemical analysis of interstitial solutions and ground water and modelling with PhreeqC (Parkhurst and Appelo, 1999) are carried out. In addition a series of batch experiments is set up. Modelling approaches by PhreeqC show a thermodynamically possibility in the alkaline range when additional Ca2+ in solution causes dolomite to become more and more undersaturated as calcite gets supersaturated. Interacting ground water is enriched in Ca2+and saturated with respect to gypsum as marine evaporites are found in situ rocks. Furthermore it is more likely that Portlandite (Ca(OH)2) plays a more important role than Na and K in the cement. Portlandite acts as an additional Ca2+ source and is much more abundant than the alkalies. Some interstitial solutions are dominated mainly by Na+ and SO42- and reach concentrations up to 30 g/l TDS. It is believed that solutions can even reach thenardite saturation as efflorescences are found on the tunnel walls. In consequence dolomite solubility increases with increasing ionic strength. pH > 11 further accelerate the process of dedolomitization by the removal

  19. Eat, Drink, Man, Woman: Gender, Income Share and Household Expenditure in South Africa (United States)

    Gummerson, Elizabeth; Schneider, Daniel


    This study examines how gendered household bargaining occurs in non-nuclear family households. We employ two South African data sets and use linear regression and household fixed effects to investigate the relationship between women's income shares and household expenditures. In married couple households, when women garner larger shares of income,…

  20. A cultural model of household energy consumption

    International Nuclear Information System (INIS)

    In this paper, we consider the development of demand-side research, from an early interest in conservation behavior to a later focus on physical, economic, psychological and social models of energy consumption. Unfortunately, none of these models account satisfactorily for measured energy consumption in the residential sector. Growing interest in the end-uses of energy (e.g. in support of load forecasting, demand-side management and least-cost utility planning), increasing international studies of energy use, and continuing work in the energy and lifestyles research tradition now support an emerging cultural perspective on household energy use. The ecological foundations of the cultural model and its applications in energy research are discussed, along with some of the analytic consequences of this approach. (author)