WorldWideScience

Sample records for aa household alkaline

  1. Laboratory study on the behaviour of spent AA household alkaline batteries in incineration

    OpenAIRE

    Almeida, Manuel F.; Xará, Susana M.; Delgado, Julanda; Costa, Carlos A.

    2009-01-01

    The quantitative evaluation of emissions from incineration is essential when Life Cycle Assessment (LCA) studies consider this process as an end-of-life solution for some wastes. Thus, the objective of this work is to quantify the main gaseous emissions produced when spent AA alkaline batteries are incinerated. With this aim, batteries were kept for 1 h at 1273 K in a refractory steel tube hold in a horizontal electric furnace with temperature control. At one end of the refractory...

  2. Crystal structure determination of alkaline haemorrhagin AaHⅢ from snake venom of Agkistrodon acutus

    Institute of Scientific and Technical Information of China (English)

    龚为民; 滕脉坤; 牛立文

    1997-01-01

    The haemorrhagin AaH Ⅲ isolated from the snake venom of Agkistrodon acutus is one of the few al-kaline ones in snake venoms. Its crystals belong to space group P212121 with a = 9. 573 4 nm, b = 4. 996 7 nm and c = 4. 728 8 nm. Its crystal structure was determined by the molecular replacement method according to the model of metalloproteinase Adamalysin n from eastern rattlesnake venom. The AaHⅢ structure has been refined by PROLSQ. The final R factor was 0.254 and the RMS deviations of bond lengths and angles were 0. 001 8 nm and 1.5°. The structure comparison suggested that AaHⅢ has a similar structure to other snake venom zinc-metalloproteinases. They all belong to matrix metalloproteinases super-family.

  3. Performance of AA5052 alloy anode in alkaline ethylene glycol electrolyte with dicarboxylic acids additives for aluminium-air batteries

    Science.gov (United States)

    Wang, DaPeng; Zhang, DaQuan; Lee, KangYong; Gao, LiXin

    2015-11-01

    Dicarboxylic acid compounds, i.e. succinic acid (SUA), adipic acid (ADA) and sebacic acid (SEA), are used as electrolyte additives in the alkaline ethylene glycol solution for AA5052 aluminium-air batteries. It shows that the addition of dicarboxylic acids lowers the hydrogen gas evolution rate of commercial AA5052 aluminium alloy anode. AA5052 aluminium alloy has wide potential window for electrochemical activity and better discharge performance in alkaline ethylene glycol solution containing dicarboxylic acid additives. ADA has the best inhibition effect for the self-corrosion of AA5052 anode among the three dicarboxylic acid additives. Fourier transform infrared spectroscopy (FT-IR) reveals that dicarboxylic acids and aluminium ions can form coordination complexes. Quantum chemical calculations shows that ADA has a smaller energy gap (ΔE, the energy difference between the lowest unoccupied orbital and the highest occupied orbital), indicating that ADA has the strongest interaction with aluminium ions.

  4. A GPI-anchored alkaline phosphatase is a functional midgut receptor of Cry11Aa toxin in Aedes aegypti larvae.

    Science.gov (United States)

    Fernandez, Luisa E; Aimanova, Karlygash G; Gill, Sarjeet S; Bravo, Alejandra; Soberón, Mario

    2006-02-15

    A 65 kDa GPI (glycosylphosphatidyl-inositol)-anchored ALP (alkaline phosphatase) was characterized as a functional receptor of the Bacillus thuringiensis subsp. israelensis Cry11Aa toxin in Aedes aegypti midgut cells. Two (a 100 kDa and a 65 kDa) GPI-anchored proteins that bound Cry11Aa toxin were preferentially extracted after treatment of BBMV (brush boder membrane vesicles) from Ae. aegypti midgut epithelia with phospholipase C. The 65 kDa protein was further purified by toxin affinity chromatography. The 65 kDa protein showed ALP activity. The peptide-displaying phages (P1.BBMV and P8.BBMV) that bound to the 65 kDa GPI-ALP (GPI-anchored ALP) and competed with the Cry11Aa toxin to bind to BBMV were isolated by selecting BBMV-binding peptide-phages by biopanning. GPI-ALP was shown to be preferentially distributed in Ae. aegypti in the posterior part of the midgut and in the caeca, by using P1.BBMV binding to fixed midgut tissue sections to determine the location of GPI-ALP. Cry11Aa binds to the same regions of the midgut and competed with P1.BBMV and P8.BBMV to bind to BBMV. The importance of this interaction was demonstrated by the in vivo attenuation of Cry11Aa toxicity in the presence of these phages. Our results shows that GPI-ALP is an important receptor molecule involved in Cry11Aa interaction with midgut cells and toxicity to Ae. aegypti larvae.

  5. Evaluation of AA5052 alloy anode in alkaline electrolyte with organic rare-earth complex additives for aluminium-air batteries

    Science.gov (United States)

    Wang, Dapeng; Li, Heshun; Liu, Jie; Zhang, Daquan; Gao, Lixin; Tong, Lin

    2015-10-01

    Behaviours of the AA5052 aluminium alloy anode of the alkaline aluminium-air battery are studied by the hydrogen evolution test, the electrochemical measurements and the surface analysis method. The combination of amino-acid and rare earth as electrolyte additives effectively retards the self-corrosion of AA5052 aluminium alloy in 4 M NaOH solution. It shows that the combination of L-cysteine and cerium nitrate has a synergistic effect owing to the formation of a complex film on AA5052 alloy surface. The organic rare-earth complex can decrease the anodic polarisation, suppress the hydrogen evolution and increase the anodic utilization rate.

  6. Alkaline phosphatases and aminopeptidases are altered in a Cry11Aa resistant strain of Aedes aegypti.

    Science.gov (United States)

    Lee, Su-Bum; Aimanova, Karlygash G; Gill, Sarjeet S

    2014-11-01

    Bacillus thuringiensis subsp. israelensis (Bti) is widely used for the biological control of mosquito populations. However, the mechanism of Bti toxins is still not fully understood. To further elucidate the mechanism of Bti toxins, we developed an Aedes aegypti resistant strain that shows high-level resistance to Cry11Aa toxin. After 27 selections with Cry11Aa toxin, the larvae showed a 124-fold resistance ratio for Cry11Aa (strain G30). G30 larvae showed cross-resistance to Cry4Aa (66-fold resistance), less to Cry4Ba (13-fold), but not to Cry11Ba (2-fold). Midguts from these resistant larvae did not show detectable difference in the processing of the Cry11Aa toxin compared to that in susceptible larvae (WT). Brush border membrane vesicles (BBMV) from resistant larvae bound slightly less Cry11Aa compared to WT BBMV. To identify potential proteins associated with Cry11A resistance, not only transcript changes in the larval midgut were analyzed using Illumina sequencing and qPCR, but alterations of previously identified receptor proteins were investigated using immunoblots. The transcripts of 375 genes were significantly increased and those of 208 genes were down regulated in the resistant larvae midgut compared to the WT. None of the transcripts for previously identified receptors of Cry11Aa (Aedes cadherin, ALP1, APN1, and APN2) were altered in these analyses. The genes for the identified functional receptors in resistant larvae midgut did not contain any mutation in their sequences nor was there any change in their transcript expression levels compared to WT. However, ALP proteins were expressed at reduced levels (∼ 40%) in the resistant strain BBMV. APN proteins and their activity were also slightly reduced in resistance strain. The transcript levels of ALPs (AAEL013330 and AAEL015070) and APNs (AAEL008158, AAEL008162) were significantly reduced. These results strongly suggest that ALPs and APNs could be associated with Cry11Aa resistance in Ae. aegypti. PMID

  7. Influence of the degree of polishing of alloy AA 5083 on its behaviour against localised alkaline corrosion

    International Nuclear Information System (INIS)

    A study has been conducted of the influence of the surface finish on the behaviour against the corrosion of samples of alloy AA 5083 immersed in aerated solutions of NaCl at 3.5%. Samples polished from 80 to 1200 grit have been tested, utilising as experimental techniques, measurements of weight loss, optical and scanning electron microscopy, linear polarisations and electrochemical noise measurement (ENM). In the conditions studied, the principal corrosion process that takes place is localised alkaline corrosion (LAC). This type of corrosion occurs as a consequence of the alkalinisation of the area surrounding the Al(Mn,Fe,Cr) cathodic precipitates that exist in the alloy. The results obtained indicate that the samples polished to 1200 grit present a greater susceptibility to processes of localised alkaline corrosion than the samples polished to 80 grit. It has been found that the degree of polishing conditions the number of intermetallic particles exposed. Hence the differences of behaviour observed between the sets of results obtained have been interpreted as an effect function of the density of cathodic intermetallic particles exposed on the surface

  8. The effect of nickel on alloy microstructure and electrochemical behaviour of AA1050 aluminium alloy in acid and alkaline solutions

    International Nuclear Information System (INIS)

    The study investigates the influence of nickel and magnesium additions to AA1050 aluminium alloy on the alloy electrochemical behaviour in sodium hydroxide and hydrochloric solutions under conditions relevant to industries that use alkaline etching as a standard surface treatment procedure and to the lithographic and electronic industries where surface convolution is assisted by pitting in hydrochloric acid. Scanning and transmission electron microscopes were used to characterize the intermetallic particles, and scanning Kelvin probe microscopy was utilised in monitoring the surface potential. Nickel is shown to be incorporated into second phase particles, which mostly consisted of Al3Fe and α-(AlFeSi) phases, resulting in enhanced cathodic activity on the aluminium surface. Consequently, the dissolution rates of the superpure aluminium, alloys without nickel addition and alloy with nickel addition are increased respectively in sodium hydroxide, and increased pitting is respectively promoted in hydrochloric acid. In contrast, the addition of magnesium to the alloy had negligible influence on the etching and pitting behaviour.

  9. Household Products

    Science.gov (United States)

    The products you use for cleaning, carpentry, auto repair, gardening, and many other household uses can contain ingredients that can harm you, your family, and the environment. These include Oven and ...

  10. Household Savings

    DEFF Research Database (Denmark)

    Browning, Martin; Lusardi, Annamaria

    of standard optimization techniques and focuses instead on direct consideration on saving. We provide a section on facts: who save and how much. We then discuss informally the recent decline in the U.S. saving rate and whether the theory is of much use in understanding this and other changes in aggregate...... saving rates over time. We do not find any convincing explanation for the change in saving rates. We also discuss some analyses of saving behavior over the life-cycle, addressing such questions as whether households save "enough" for retirement and whether the consumption patterns of older households can......In this survey, we review the recent theoretical and empirical literature on household saving and consumption. The discussion is structured around a list of motives for saving and how well the standard theory captures these motives. We show that almost all of the motives for saving that have been...

  11. Rural Households

    DEFF Research Database (Denmark)

    Bruun, Ole

    2013-01-01

    Based on a comprehensive survey and subsequent fieldwork, this chapter introduces the socio-economic characteristics and common livelihood strategies of rural households in Quang Nam, Central Vietnam. It demonstrates the basic premise of self-reliance in rural society and the decreasing economic...

  12. AA Index

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa index provides a long climatology of global geomagnetic activity using 2 antipodal observatories at Greenwich and Melbourne- IAGA Bulletin 37,...

  13. Rating AAs.

    Science.gov (United States)

    Carter, Susan J.

    2001-01-01

    Why alternative investments? In a word: performance. Many higher education endowment and foundation managers are making increasing commitments to alternative investments, or AAs, in order to obtain higher returns and broader diversification for their investment portfolios than public securities instruments can usually provide. Learn how to handle…

  14. Antibacterials in Household Products

    Science.gov (United States)

    ... products such as soaps, detergents, health and skincare products and household cleaners. How do antibacterials work? ♦ Antibacterials may be ... contain triclosan or other biocide agents? Antibacterials in household products Are there any risks associated with triclosan-containing ...

  15. Household Safety: Preventing Choking

    Science.gov (United States)

    ... Tropical Delight: Melon Smoothie Pregnant? Your Baby's Growth Household Safety: Preventing Choking KidsHealth > For Parents > Household Safety: ... and often contain small parts. Make sure small refrigerator magnets are out of your child's reach. Check ...

  16. ALP (Alkaline Phosphatase) Test

    Science.gov (United States)

    ... Also known as: ALK PHOS; Alkp Formal name: Alkaline Phosphatase Related tests: AST ; ALT ; GGT ; Bilirubin ; Liver Panel ; Bone Markers ; Alkaline Phosphatase Isoenzymes; Bone Specific ALP All content on ...

  17. Unemployment and Household formation

    OpenAIRE

    Ebrahim, Amina; Woolard, Ingrid; Leibbrandt, Murray

    2013-01-01

    In comparison to other continents, Africa has received little scholarly attention with regard to household composition. Household composition is endogenous to a variety of welfare issues and little is understood about the determinants of this composition. Understanding the household composition and formation decision may improve our understanding of how the unemployed gain access to resources and how household composition could provide a safety net to the unemployed. However, increasingly, mo...

  18. Gambling households in Canada.

    Science.gov (United States)

    MacDonald, Martha; McMullan, John L; Perrier, David C

    2004-01-01

    This paper examines the distribution of gambling dollars in Nova Scotia, Saskatchewan and Canada and studies the impact of this spending on households. We focus first on how gambling expenditures are related to the level and source of household income as well as to other demographic characteristics such as age, education, household composition, geographical area, and sources of income. Next we analyze how gambling expenditures are distributed among those households that gamble. We show how expenditure patterns differ in the intensity of gambling as measured by the proportion of household income or total amount of dollars spent on gambling. Then we study the affects that gambling has on spending on household necessities, changes in net worth, retirement savings and household debt. Finally we determine whether gambling expenditures act as a substitute or a complement to other recreational spending on entertainment products and services. Throughout the paper we offer a comparative analysis of provincial and national data. PMID:15353922

  19. Consumer Behaviour of Households

    OpenAIRE

    Netrdová, Blanka

    2013-01-01

    The thesis is focused on the consumer behavior of the households in the period from 2003 to 2013. The theoretical part is divided into two parts, household consumption from the perspective of marketing, and from the perspective of economics. In the marketing section explains the concepts of consumer, household, consumer credit, consumer behavior, consumer predisposition and the buying decision process. In the section dedicated to economics concepts are explained, the budget line consumption, ...

  20. Household electricity demand profiles

    DEFF Research Database (Denmark)

    Marszal, Anna Joanna; Heiselberg, Per Kvols; Larsen, Olena Kalyanova

    2016-01-01

    Highlights •A 1-min resolution household electricity load model is presented. •Model adapts a bottom-up approach with single appliance as the main building block. •Load profiles are used to analyse the flexibility potential of household appliances. •Load profiles can be applied in other domains, e...

  1. Essays in household finance

    NARCIS (Netherlands)

    Djordjevic, Ljubica

    2015-01-01

    Household finance is a young and vibrant research field that continuously attracts public attention. There may be very few matters that people care so much about as their personal finance. Recent rise of academic interest in household finance is to a great extent due to households’ more active role

  2. Anodes for alkaline electrolysis

    Science.gov (United States)

    Soloveichik, Grigorii Lev

    2011-02-01

    A method of making an anode for alkaline electrolysis cells includes adsorption of precursor material on a carbonaceous material, conversion of the precursor material to hydroxide form and conversion of precursor material from hydroxide form to oxy-hydroxide form within the alkaline electrolysis cell.

  3. Alkaline "Permanent" Paper.

    Science.gov (United States)

    Pacey, Antony

    1991-01-01

    Discussion of paper manufacturing processes and their effects on library materials focuses on the promotion of alkaline "permanent" paper, with less acid, by Canadian library preservation specialists. Standards for paper acidity are explained; advantages of alkaline paper are described, including decreased manufacturing costs; and recyclability is…

  4. Promoting household energy conservation

    International Nuclear Information System (INIS)

    It is commonly assumed that households must change their behaviour to reduce the problems caused by increasing levels of fossil energy use. Strategies for behaviour change will be more effective if they target the most important causes of the behaviour in question. Therefore, this paper first discusses the factors influencing household energy use. Three barriers to fossil fuel energy conservation are discussed: insufficient knowledge of effective ways to reduce household energy use, the low priority and high costs of energy savings, and the lack of feasible alternatives. Next, the paper elaborates on the effectiveness and acceptability of strategies aimed to promote household energy savings. Informational strategies aimed at changing individuals' knowledge, perceptions, cognitions, motivations and norms, as well as structural strategies aimed at changing the context in which decisions are made, are discussed. This paper focuses on the psychological literature on household energy conservation, which mostly examined the effects of informational strategies. Finally, this paper lists important topics for future research

  5. Alkaline battery operational methodology

    Energy Technology Data Exchange (ETDEWEB)

    Sholklapper, Tal; Gallaway, Joshua; Steingart, Daniel; Ingale, Nilesh; Nyce, Michael

    2016-08-16

    Methods of using specific operational charge and discharge parameters to extend the life of alkaline batteries are disclosed. The methods can be used with any commercial primary or secondary alkaline battery, as well as with newer alkaline battery designs, including batteries with flowing electrolyte. The methods include cycling batteries within a narrow operating voltage window, with minimum and maximum cut-off voltages that are set based on battery characteristics and environmental conditions. The narrow voltage window decreases available capacity but allows the batteries to be cycled for hundreds or thousands of times.

  6. Household hazardous waste

    DEFF Research Database (Denmark)

    Fjelsted, Lotte; Christensen, Thomas Højlund

    2007-01-01

    .) comprised 15-25% and foreign items comprised 10-20%. Water-based paint was the dominant part of the paint waste. The chemical composition of the paint waste and the paint-like waste was characterized by an analysis of 27 substances in seven waste fractions. The content of critical substances was tow......'Paint waste', a part of the 'household hazardous waste', amounting to approximately 5 tonnes was collected from recycling stations in two Danish cities. Sorting and analyses of the waste showed paint waste comprised approximately 65% of the mass, paint-like waste (cleaners, fillers, etc...... and the paint waste was less contaminated with heavy metals than was the ordinary household waste. This may suggest that households no longer need to source-segregate their paint if the household waste is incinerated, since the presence of a small quantity of solvent-based paint will not be harmful when...

  7. Household Chemical Emergencies

    Science.gov (United States)

    ... and disposing of the material according to the manufacturer’s directions. It is critical to store household chemicals in places where children cannot access them. Remember that products such as aerosol cans of hair spray and deodorant, nail polish ...

  8. Uranium in alkaline rocks

    International Nuclear Information System (INIS)

    Geologic and geochemical criteria were developed for the occurrence of economic uranium deposits in alkaline igneous rocks. A literature search, a limited chemical analytical program, and visits to three prominent alkaline-rock localities (Ilimaussaq, Greenland; Pocos de Caldas, Brazil; and Powderhorn, Colorado) were made to establish criteria to determine if a site had some uranium resource potential. From the literature, four alkaline-intrusive occurrences of differing character were identified as type-localities for uranium mineralization, and the important aspects of these localities were described. These characteristics were used to categorize and evaluate U.S. occurrences. The literature search disclosed 69 U.S. sites, encompassing nepheline syenite, alkaline granite, and carbonatite. It was possible to compare two-thirds of these sites to the type localities. A ranking system identified ten of the sites as most likely to have uranium resource potential

  9. Uranium in alkaline rocks

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, M.; Wollenberg, H.; Strisower, B.; Bowman, H.; Flexser, S.; Carmichael, I.

    1978-04-01

    Geologic and geochemical criteria were developed for the occurrence of economic uranium deposits in alkaline igneous rocks. A literature search, a limited chemical analytical program, and visits to three prominent alkaline-rock localities (Ilimaussaq, Greenland; Pocos de Caldas, Brazil; and Powderhorn, Colorado) were made to establish criteria to determine if a site had some uranium resource potential. From the literature, four alkaline-intrusive occurrences of differing character were identified as type-localities for uranium mineralization, and the important aspects of these localities were described. These characteristics were used to categorize and evaluate U.S. occurrences. The literature search disclosed 69 U.S. sites, encompassing nepheline syenite, alkaline granite, and carbonatite. It was possible to compare two-thirds of these sites to the type localities. A ranking system identified ten of the sites as most likely to have uranium resource potential.

  10. Household Hazards to Pets

    Science.gov (United States)

    ... pennies (those minted after 1982 contain zinc) and alkaline batteries (like those in your remote controls) can ... artist’s or other specialty paints may contain heavy metals or volatile substances that could become harmful if ...

  11. Use of Internet by households

    OpenAIRE

    Humlová, Veronika

    2011-01-01

    This work is engaged in analysis of internet usage by the households by Czech households. The first part of work defines the basic concepts of Internet such as internet history, types of internet connection or the possibilities of its use. I tis followed by concrete analysis of trends in Internet usage by households in the Czech Republic, according to several aspects. The basic aspect is the share of households connected to the Internet to the total number of households. Next the work analyze...

  12. Household skills and low wages

    OpenAIRE

    Dale, Kristin

    2008-01-01

    Household skills provide job skills when tasks in jobs and household production are similar and jobs produce substitutes for home-made services. Opportunity costs of higher education are foregone earnings during schooling and foregone household production while studying and later in life. I show that individuals in jobs requiring household skills accept lower wage rates than traditional human capital theory predicts, and that individuals with low household skills tend to enter higher educatio...

  13. AA magnet measurement team

    CERN Multimedia

    1978-01-01

    Quickly improvised measurement equipment for the AA (Antiproton Accumulator) was all the tight schedule permitted, but the high motivation of the team made up for the lack of convenience. From left to right: Roy Billinge (Joint AA Project Leader, the other one was Simon van der Meer); Bruno Autin, Brian Pincott, Colin Johnson.

  14. Study of the alloying additives and alkaline zincate solution effects on the commercial aluminum as galvanic anode for use in alkaline batteries

    Energy Technology Data Exchange (ETDEWEB)

    Rashvand avei, M. [Department of Chemistry, K.N. Toosi University of Technology, P.O. Box 15875-4416, Tehran (Iran, Islamic Republic of); Jafarian, M., E-mail: mjafarian@kntu.ac.ir [Department of Chemistry, K.N. Toosi University of Technology, P.O. Box 15875-4416, Tehran (Iran, Islamic Republic of); Moghanni Bavil Olyaei, H. [Department of Chemistry, K.N. Toosi University of Technology, P.O. Box 15875-4416, Tehran (Iran, Islamic Republic of); Gobal, F. [Department of Chemistry, Sharif University of Technology, P.O. Box 11365-8516, Tehran (Iran, Islamic Republic of); Hosseini, S.M. [Jahad Organization – Science and Technology Center, Tehran (Iran, Islamic Republic of); Mahjani, M.G. [Department of Chemistry, K.N. Toosi University of Technology, P.O. Box 15875-4416, Tehran (Iran, Islamic Republic of)

    2013-12-16

    The corrosion behavior of different grades of commercial aluminum such as AA1040, AA5083, AA6060 and AA7075 in ZnO-containing 4 M NaOH has been determined by using open circuit potential-time measurements (OCP), galvanostatic and potentiodynamic polarization and electrochemical impedance spectroscopy (EIS). The results of scanning electron microscopy (SEM) and energy dispersive analysis of X-ray (EDAX) reveal that ZnO produces the inhibition effect by the formation of a zinc-containing deposit layer on the surface of aluminum electrodes. Although the influence of zincating on the performance of aluminum alloys and considering the amount of alloying elements such as zinc, magnesium and manganese in AA7075 and AA5083 alloys is much more than AA6060 one, the AA6060 aluminum exhibits negligible corrosion rate. Alloying aluminum with other elements and modifying the composition of the electrolyte is a necessary condition for reducing the self-corrosion of the aluminum anodes, whereas the proportion of the amount of additive elements is sufficient and important condition. As AA6060 with a low amount of Zn and Mg, but the high value of the ratio of (Mg/Zn) content (>400) can serve as a good galvanic anode in the alkaline media. - Highlights: • Decreasing the corrosion rate of tested alloys in 4 M NaOH solution specially AA6060. • Lowering the extent of anodic polarization at a current density of 50 mA cm{sup −2}. • High inhibitor efficiency about 97% for AA6060.

  15. AAS 228: Day 1 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Come visit astrobites at the AAS booth we have swag!Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto hear from undergrads who already know and love the site, educators who want to use it in their classrooms, and students who had not yet been introduced to astrobites and were excited about a new resource!For the rest of the meeting we will be stationed at theAAS booth in the exhibit hall (booth #211-213), so drop by if you want to learn more (or pick up swag: weve got lots of stickers and sunglasses)!Mondaymorning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended this morning.Opening Address(by Susanna Kohler)AAS President Meg Urry kicked off the meeting this morning at 8am with an overview of some of the great endeavors AAS is supporting. We astrobiters had personal motivation to drag ourselves out of bed that early: during this session, Urryannounced the new partnership between AAS and astrobites!Urry touched on some difficult topics in her welcome, including yesterdays tragedy in Orlando. Shereiteratedthe AASs support fortheCommittee for Sexual-Orientation and Gender Minorities in Astronomy (SGMA). She also reminded meeting attendees about the importance ofkeeping conference interactions professional, and pointed to the meetings anti-harassment policy.Partnership Announcement (by Michael Zevin)This morning, the American Astronomical Society announced the new partnership that it will have with Astrobites! We are beyond excited to embark on this new partnership with the

  16. Household metabolism in Groningen

    NARCIS (Netherlands)

    Falkena, Henk-Jan; Moll, Henri C.; Noorman, Klaas Jan; Kok, Rixt; Benders, René

    2003-01-01

    This report is the Dutch national report of the second work package of the ToolSust project. ToolSust, the involvement of stakeholders to develop and implement Tools for Sustainable households in the city of tomorrow, has been developed within the fifth framework program of the EU, as a part of Ener

  17. AAS 228: Welcome!

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Greetings from the 228th American Astronomical Society meeting in San Diego, California! This week, along with a team of fellow authorsfrom astrobites, Iwill bewritingupdates on selectedevents at themeeting and posting twiceeach day. You can follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.If youre at the meeting, come stop by the AAS booth (Booth #211-213) to learn about the newly-announced partnership between AAS and astrobites and pick up some swag.And dont forget to visit the IOP booth in the Exhibit Hall (Booth #223) to learn more about the new corridors for AAS Journals and to pick up a badge pin to representyour corridor!

  18. AA Narrow Quadrupole

    CERN Multimedia

    1979-01-01

    The very particular lattice of the AA required 2 types of quadrupoles: narrow ones (QFN, QDN) and wide ones (QFW, QDW). This is the first one of the narrow quadrupoles, delivered by industry early in 1979.

  19. AAS 227: Welcome!

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Greetings from the 227th American Astronomical Society meeting in Kissimmee, Florida! This week, along with several fellow authors from astrobites, Iwill bewritingupdates on selectedevents at themeeting and posting at the end of each day. You can follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.If youre an author or referee (or plan to be!) and youre here at the meeting, consider joining us at our Author and Referee Workshop on Wednesday in the Tallahassee room, where well be sharingsome of the exciting new features of the AAS journals. You can drop intoeither of the two-hour sessions(10 AM 12 PM or 1 PM 3 PM), and there will be afree buffet lunch at noon.Heres the agenda:Morning SessionTopic Speaker10:00 am 10:05 amIntroductionsJulie Steffen10:05 am 10:35 amChanges at AAS Journals; How to Be a Successful AAS AuthorEthan Vishniac10:35 am 11:00 amThe Peer Review ProcessButler Burton11:00 am 11:15 amAAS Nova: Sharing AAS Authors Research with the Broader CommunitySusanna Kohler11:15 am 11:30 amFixing Software and Instrumentation Publishing: New Paper Styles in AAS JournalsChris Lintott11:30 am 11:45 amMaking Article Writing Easier with the New AASTeX v6.0Greg Schwarz11:45 am 12:00 pmBringing JavaScript and Interactivity to Your AAS Journal FiguresGus MuenchLunch SessionTopic Speaker12:00 pm 12:15 pmUnified Astronomy ThesaurusKatie Frey12:15 pm 12:30 pmAAS/ADS ORCID Integration ToolAlberto Accomazzi12:30 pm 12:45 pmWorldWide Telescope and Video AbstractsJosh Peek12:45 pm 01:00 pmArizona Astronomical Data Hub (AADH)Bryan HeidornAfternoon SessionTopic Speaker01:00 pm 01:05 pmIntroductionsJulie Steffen01:05 pm 01:35 pmChanges at AAS Journals; How to Be a Successful AAS AuthorEthan Vishniac01:35 pm 02:00 pmThe Peer Review ProcessButler Burton02:00 pm 02:15 pmAAS Nova: Sharing AAS Authors Research with the Broader CommunitySusanna Kohler02:15 pm 02:30 pm

  20. Geomagnetic aa Indices

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa indices are the continuation of the series beginning in the year 1868. A full description of these indices is given in the International...

  1. Lumped Thermal Household Model

    DEFF Research Database (Denmark)

    Biegel, Benjamin; Andersen, Palle; Stoustrup, Jakob;

    2013-01-01

    In this paper we discuss two different approaches to model the flexible power consumption of heat pump heated households: individual household modeling and lumped modeling. We illustrate that a benefit of individual modeling is that we can overview and optimize the complete flexibility of a heat...... pump portfolio. Following, we illustrate two disadvantages of individual models, namely that it requires much computational effort to optimize over a large portfolio, and second that it is difficult to accurately model the houses in certain time periods due to local disturbances. Finally, we propose...... a lumped model approach as an alternative to the individual models. In the lumped model, the portfolio is seen as baseline consumption superimposed with an ideal storage of limited power and energy capacity. The benefit of such a lumped model is that the computational effort of flexibility optimization...

  2. Alkaline quinone flow battery.

    Science.gov (United States)

    Lin, Kaixiang; Chen, Qing; Gerhardt, Michael R; Tong, Liuchuan; Kim, Sang Bok; Eisenach, Louise; Valle, Alvaro W; Hardee, David; Gordon, Roy G; Aziz, Michael J; Marshak, Michael P

    2015-09-25

    Storage of photovoltaic and wind electricity in batteries could solve the mismatch problem between the intermittent supply of these renewable resources and variable demand. Flow batteries permit more economical long-duration discharge than solid-electrode batteries by using liquid electrolytes stored outside of the battery. We report an alkaline flow battery based on redox-active organic molecules that are composed entirely of Earth-abundant elements and are nontoxic, nonflammable, and safe for use in residential and commercial environments. The battery operates efficiently with high power density near room temperature. These results demonstrate the stability and performance of redox-active organic molecules in alkaline flow batteries, potentially enabling cost-effective stationary storage of renewable energy. PMID:26404834

  3. Is knowledge shared within households?

    OpenAIRE

    Basu, Kaushik; Narayan, Ambar; Ravallion, Martin

    1999-01-01

    According to theory, a member of a collective-action household may or may not share knowledge with others in that household. Shared income gains from shared knowledge may well be offset by a shift in the balance of power within the family. But do literate members of the household share the benefits of literacy with other members of the household in practice? Using household survey data for Bangladesh, the authors find that education has strong external effects on individual earnings. When a r...

  4. Alkaline broadening in Stars

    CERN Document Server

    De Kertanguy, A

    2015-01-01

    Giving new insight for line broadening theory for atoms with more structure than hydrogen in most stars. Using symbolic software to build precise wave functions corrected for ds;dp quantum defects. The profiles obtained with that approach, have peculiar trends, narrower than hydrogen, all quantum defects used are taken from atomic database topbase. Illustration of stronger effects of ions and electrons on the alkaline profiles, than neutral-neutral collision mechanism. Keywords : Stars: fundamental parameters - Atomic processes - Line: profiles.

  5. Promising practices in food security and nutrition assistance to vulnerable households in the Tonle Sap Region, Cambodia

    OpenAIRE

    2015-01-01

    The CGIAR Research Program on Aquatic Agricultural Systems (AAS) seeks to reduce poverty and improve food security for many small-scale fishers and farmers who are dependent on aquatic agriculture systems by partnering with local, national and international partners to achieve large-scale development impact. This study on promising practices in food security and nutrition assistance to vulnerable households in the Tonle Sap region forms part of the preliminary research that informs AAS work i...

  6. Efficient Intra-Household Allocations

    DEFF Research Database (Denmark)

    Browning, Martin

    for households which have more than one member. We make minimal assumptions about how the individual members of the household resolve conflicts. All we assume is that however decisions are made, outcomes are efficient. We refer to this as the collective setting. We show that in the collective setting household...... demands must satisfy a symmetry and rank condition on the Slutsky matrix. We also present some further results on the effects on demands of variables that do nor modify preferences but that do affect how decisions are made. We apply our theory to a series of surveys of household expendityres from Canada....... The tests of the usual symmetry conditions are rejected for two person households but not for one person households. We also show that income pooling is rejected for two person households. We then test for our collective setting conditions on the couples data. None of the collective setting restrictions...

  7. The Household Registration System

    Directory of Open Access Journals (Sweden)

    2000-06-01

    Full Text Available Although longitudinal experimental community health research is crucial to testing hypotheses about the demographic impact of health technologies, longitudinal demographic research field stations are rare, owing to the complexity and high cost of developing requisite computer software systems. This paper describes the Household Registration System (HRS, a software package that has been used for the rapid development of eleven surveillance systems in sub-Saharan Africa and Asia. Features of the HRS automate software generation for a family of surveillance applications, obviating the need for new and complex computer software systems for each new longitudinal demographic study.

  8. Alkaline Phosphatase in Stem Cells

    Directory of Open Access Journals (Sweden)

    Kateřina Štefková

    2015-01-01

    Full Text Available Alkaline phosphatase is an enzyme commonly expressed in almost all living organisms. In humans and other mammals, determinations of the expression and activity of alkaline phosphatase have frequently been used for cell determination in developmental studies and/or within clinical trials. Alkaline phosphatase also seems to be one of the key markers in the identification of pluripotent embryonic stem as well as related cells. However, alkaline phosphatases exist in some isoenzymes and isoforms, which have tissue specific expressions and functions. Here, the role of alkaline phosphatase as a stem cell marker is discussed in detail. First, we briefly summarize contemporary knowledge of mammalian alkaline phosphatases in general. Second, we focus on the known facts of its role in and potential significance for the identification of stem cells.

  9. Alkaline fuel cells applications

    Science.gov (United States)

    Kordesch, Karl; Hacker, Viktor; Gsellmann, Josef; Cifrain, Martin; Faleschini, Gottfried; Enzinger, Peter; Fankhauser, Robert; Ortner, Markus; Muhr, Michael; Aronson, Robert R.

    On the world-wide automobile market technical developments are increasingly determined by the dramatic restriction on emissions as well as the regimentation of fuel consumption by legislation. Therefore there is an increasing chance of a completely new technology breakthrough if it offers new opportunities, meeting the requirements of resource preservation and emission restrictions. Fuel cell technology offers the possibility to excel in today's motive power techniques in terms of environmental compatibility, consumer's profit, costs of maintenance and efficiency. The key question is economy. This will be decided by the costs of fuel cell systems if they are to be used as power generators for future electric vehicles. The alkaline hydrogen-air fuel cell system with circulating KOH electrolyte and low-cost catalysed carbon electrodes could be a promising alternative. Based on the experiences of Kordesch [K. Kordesch, Brennstoffbatterien, Springer, Wien, 1984, ISBN 3-387-81819-7; K. Kordesch, City car with H 2-air fuel cell and lead-battery, SAE Paper No. 719015, 6th IECEC, 1971], who operated a city car hybrid vehicle on public roads for 3 years in the early 1970s, improved air electrodes plus new variations of the bipolar stack assembly developed in Graz are investigated. Primary fuel choice will be a major issue until such time as cost-effective, on-board hydrogen storage is developed. Ammonia is an interesting option. The whole system, ammonia dissociator plus alkaline fuel cell (AFC), is characterised by a simple design and high efficiency.

  10. AAS Career Services

    Science.gov (United States)

    Marvel, Kevin B.

    2012-08-01

    The American Astronomical Society provides substantial programs in the area of Career Services.Motivated by the Society's mission to enhance and share humanity's understanding of the Universe, the AAS provides a central resource for advertising positions, interviewing opportunities at its annual winter meeting and information, workshops and networks to enable astronomers to find employment.The programs of the Society in this area are overseen by an active committee on employment and the AAS Council itself.Additional resources that help characterize the field, its growth and facts about employment such as salaries and type of jobs available are regularly summarized and reported on by the American Institute of Physics.

  11. Characterization and function analysis of a Halo-alkaline-adaptable Trk K~+ uptake system in Alkalimonas amylolytica strain N10

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    By functional complementation of Escherichia coli mutants defective in potassium (K+) uptake, two genes that are required for K+ uptake in halo-alkaliphilic Alkalimonas amylolytica strain N10 were cloned. These two genes, Aa-trkA (1337 bp) and Aa-trkH (1452 bp), were adjacent on the A. amylolytica N10 chromosome and transcribed in opposite directions. Complementation experiments revealed that Aa-TrkA and Aa-TrkH from A. amylolytica strain N10 restored the ability to grow at low K+ concentration in E. coli △trkA and △trkG △trkH strains, respectively. In addition, Aa-TrkAH supported the growth of an E. coli △sapD strain, indicating that the ATP-binding protein TrkE was dispensable for the Trk system of A. amylolytica strain N10. The net K+ uptake was detected at different pH levels and the critical NaCl concentration indicated that Aa-TrkAH is an alkaline-adaptable and partially halo-adaptable K+ transporter. Kinetics determined by heterogeneous K+ transport experiments with an E. coli △trkA strain revealed that Aa-TrkAH has an alkaline pH optimum close to 8.5 or higher. Site-directed mutagenesis of Aa-TrkH showed that Phe103 and Ser229 play certain key roles in K+ selection and transportation. The molecular chaperones groES-groEL and tig promoted Aa-TrkH and Aa-TrkA overexpression in vitro.

  12. Characterization and function analysis of a Halo-alkaline-adaptable Trk K~+ uptake system in Alkalimonas amylolytica strain N10

    Institute of Scientific and Technical Information of China (English)

    GUO YongHao; XUE YanFen; LIU Jun; WANG QuanHui; MA YanHe

    2009-01-01

    By functional complementation of Escherichia coli mutants defective in potassium (K~+) uptake, two genes that are required for K~+ uptake in halo-alkaliphilic Alkalimonas amylolytica strain N10 were cloned. These two genes, Aa-trkA (1337 bp) and Aa-trkH (1452 bp), were adjacent on the A. amylolytica N10 chromosome and transcribed in opposite directions. Complementation experiments revealed that Aa-TrkA and Aa-TrkH from A. amylolytica strain N10 restored the ability to grow at low K~+ concentration in E. coli △trkA and △trkG △trkH strains, respectively. In addition, Aa-TrkAH supported the growth of an E. coli △sapD strain, indicating that the ATP-binding protein TrkE was dispensable for the Trk system of A. amylolytica strain N10. The net K~+ uptake was detected at different pH levels and the critical NaCl concentration indicated that Aa-TrkAH is an alkaline-adaptable and partially halo-adaptable K~+ transporter. Kinetics determined by heterogeneous K~+ transport experiments with an E. coli △trkA strain revealed that Aa-TrkAH has an alkaline pH optimum close to 8.5 or higher. Site-directed mutagenesis of Aa-TrkH showed that Phe103 and Ser229 play certain key roles in K~+ selection and transportation. The molecular chaperones groES-groEL and tig promoted Aa-TrkH and Aa-TrkA overexpression in vitro.

  13. AAS Oral History Project

    Science.gov (United States)

    Buxner, Sanlyn; Holbrook, Jarita; AAS Oral History Team

    2016-06-01

    Now in its fourth year, the AAS Oral History Project has interviewed over 80 astronomers from all over the world. Led by the AAS Historical Astronomy Division (HAD) and partially funded by the American Institute of Physics Niels Bohr Library and ongoing support from the AAS, volunteers have collected oral histories from astronomers at professional meetings starting in 2015, including AAS, DPS, and the IAU general assembly. Each interview lasts one and a half to two hours and focuses on interviewees’ personal and professional lives. Questions include those about one’s family, childhood, strong influences on one’s scientific career, career path, successes and challenges, perspectives on how astronomy is changing as a field, and advice to the next generation. Each interview is audio recorded and transcribed, the content of which is checked with each interviewee. Once complete, interview transcripts are posted online as part of a larger oral history library at https://www.aip.org/history-programs/niels-bohr-library/oral-histories. Future analysis will reveal a rich story of astronomers and will help the community address issues of diversity, controversies, and the changing landscape of science. We are still recruiting individuals to be interviewed from all stages of career from undergraduate students to retired and emeritus astronomers. Contact Jarita Holbrook to schedule an interview or to find out more information about the project (astroholbrook@gmail.com). Also, contact Jarita Holbrook if you would like to become an interviewer for the project.

  14. Bifunctional alkaline oxygen electrodes

    Science.gov (United States)

    Swette, L.; Kackley, N.; Mccatty, S. A.

    1991-01-01

    The authors describe the identification and testing of electrocatalysts and supports for the positive electrode of moderate-temperature, single-unit, rechargeable alkaline fuel cells. Recent work on Na(x)Pt3O4, a potential bifunctional catalyst, is described, as well as the application of novel approaches to the development of more efficient bifunctional electrode structures. The three dual-character electrodes considered here showed similar superior performance; the Pt/RhO2 and Rh/RhO2 electrodes showed slightly better performance than the Pt/IrO2 electrode. It is concluded that Na(x)Pt3O4 continues to be a promising bifunctional oxygen electrode catalyst but requires further investigation and development.

  15. Silica in alkaline brines

    Science.gov (United States)

    Jones, B.F.; Rettig, S.L.; Eugster, H.P.

    1967-01-01

    Analysis of sodium carbonate-bicarbonate brines from closed basins in volcanic terranes of Oregon and Kenya reveals silica contents of up to 2700 parts per million at pH's higher than 10. These high concentrations of SiO 2 can be attributed to reaction of waters with silicates, and subsequent evaporative concentration accompanied by a rise in pH. Supersaturation with respect to amorphous silica may occur and persist for brines that are out of contact with silicate muds and undersaturated with respect to trona; correlation of SiO2 with concentration of Na and total CO2 support this interpretation. Addition of moredilute waters to alkaline brines may lower the pH and cause inorganic precipitation of substantial amounts of silica.

  16. An alkaline element

    Energy Technology Data Exchange (ETDEWEB)

    Arita, T.; Murakami, K.; Okha, K.

    1983-04-28

    A cathode with a dual layer active mass is installed in the disk shaped alkaline silver and zinc element. The first layer, which is turned towards the anode, contains 85 parts Ag2O, 5 parts electrolytic MnO2 and 10 parts graphite. The second layer, which contacts the bottom of the element, contains 35 parts Ag2O, 60 parts electrolytic MnO2 and 5 parts graphite. The electrical capacity of the first and second layers is 60 and 40, respectively. The first layer may be discharged with a high current density and the second layer with less current density. The element has high characteristics with comparatively low cost.

  17. Feedback on household electricity consumption

    DEFF Research Database (Denmark)

    Grønhøj, Alice; Thøgersen, John

    2011-01-01

    consumption, we evaluate the effects of giving households detailed feedback about their electricity consumption on a small liquid crystal display (LCD) screen. Twenty Danish households participated in the study over a 5-month period. A new feedback system was developed in a user-involved innovation process...

  18. Changing Age and Household Patterns

    DEFF Research Database (Denmark)

    Højbjerg Jacobsen, Rasmus; Hougaard Jensen, Svend E.

    2014-01-01

    finances by almost 1% of GDP on the yearly budget. While the net fiscal effect of changing household structures is minor, the gross effects are substantial. In a future characterized by population ageing, public finances may be adversely affected by changes in both age and household structures, thus...

  19. Household vehicles energy consumption 1994

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-08-01

    Household Vehicles Energy Consumption 1994 reports on the results of the 1994 Residential Transportation Energy Consumption Survey (RTECS). The RTECS is a national sample survey that has been conducted every 3 years since 1985. For the 1994 survey, more than 3,000 households that own or use some 6,000 vehicles provided information to describe vehicle stock, vehicle-miles traveled, energy end-use consumption, and energy expenditures for personal vehicles. The survey results represent the characteristics of the 84.9 million households that used or had access to vehicles in 1994 nationwide. (An additional 12 million households neither owned or had access to vehicles during the survey year.) To be included in then RTECS survey, vehicles must be either owned or used by household members on a regular basis for personal transportation, or owned by a company rather than a household, but kept at home, regularly available for the use of household members. Most vehicles included in the RTECS are classified as {open_quotes}light-duty vehicles{close_quotes} (weighing less than 8,500 pounds). However, the RTECS also includes a very small number of {open_quotes}other{close_quotes} vehicles, such as motor homes and larger trucks that are available for personal use.

  20. Food discard practices of householders.

    Science.gov (United States)

    Van Garde, S J; Woodburn, M J

    1987-03-01

    Food discard patterns and reasons were determined for a sample of 243 households in Oregon. Personal interviews were conducted, and 7-day records of discards were collected. Discards over a 3-day period also were collected from a subsample of 50. The householder's estimate of amount, converted from measures to grams using food composition tables, was found to be 97% of the actual grams of food, as weighed in the laboratory. Households discarded an average of 1,587 gm ($2.88) food in a 7-day period on the basis of the 79% completed usable records. Major reasons were poor quality for fruits and vegetables; storage time for meat, fish, and poultry; non-use of leftovers for combination dishes; and plate waste for cereals and dairy products. Twenty-nine percent of the discarded food (by cost) was considered to be unsafe to eat by the householder. Aesthetic factors dominated decisions by the 18- to 25-year age group, but experiences related to food storage were the basis for decisions by half of the respondents more than 65 years old. Discards increased with number of members in the household and were influenced by age of children. Household income was not linearly related to amount of discard. As household refrigerator temperatures increased from 1.7 degrees C to 20 degrees C, the amount of discards also increased. Consumers generally lacked criteria for evaluating the safety of foods. PMID:3819252

  1. AAS 228: Day 1 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    extraterrestrial life. The jets are highly alkaline and may contain molecular hydrogen, which links the inorganic and living worlds as a reactant and energy source. Although Cassinis very fruitful mission will come to a close in 2017 with a death spiral into Saturn, the future is still bright for Enceladus. Glein closed with a preview of the next mission to this special moon: ELF, the Enceladus Life Finder, will fly through and analyze Enceladuss icy plume in unprecedented detail using state-of-the-art instruments and is predicted to fly in 2031. 102: The NASA K2 Mission (by Meredith Rawls)Everyones favorite planet finding telescope continues to impress. In this morning session, we heard highlights about how the repurposed Kepler mission (K2) is contributing to research in areas ranging from nearby brown dwarfs to extragalactic supernovae. The session kicked off with an overview by Knicole Colon, who happily reported extended funding for K2 through 2018, when its fuel is projected to run out. Colon: despite a glitch in the celebratory cake, #K2mission has been extended until the end of life! #aas228 pic.twitter.com/9umZozOy0n Geert Barentsen (@GeertHub) June 13, 2016Bradley Tucker discussed recent extragalactic results from K2, and supernovae in particular. So far, the Kepler Extragalactic Survey has found 17 supernovae and they hope to find at least 20 more in the next three years. Because Kepler observations are so frequent, they reveal previously hidden subtleties in how supernovae fade over time..@btucker22: #K2mission is providing a statistical sample of high-precision supernova lightcurves! #aas228 pic.twitter.com/GWZUJhtmRW Geert Barentsen (@GeertHub) June 13, 2016Of course, exoplanet science is still a primary goal for the K2 team. Matthew Penny updated us on the status of the in-progress microlensing campaign, which uses Kepler to search for one-off brightening events that indicate the presence of a planet due to gravitational microlensing. Work is also underway by

  2. Modulators of intestinal alkaline phosphatase.

    Science.gov (United States)

    Bobkova, Ekaterina V; Kiffer-Moreira, Tina; Sergienko, Eduard A

    2013-01-01

    Small molecule modulators of phosphatases can lead to clinically useful drugs and serve as invaluable tools to study functional roles of various phosphatases in vivo. Here, we describe lead discovery strategies for identification of inhibitors and activators of intestinal alkaline phosphatases. To identify isozyme-selective inhibitors and activators of the human and mouse intestinal alkaline phosphatases, ultrahigh throughput chemiluminescent assays, utilizing CDP-Star as a substrate, were developed for murine intestinal alkaline phosphatase (mIAP), human intestinal alkaline phosphatase (hIAP), human placental alkaline phosphatase (PLAP), and human tissue-nonspecific alkaline phosphatase (TNAP) isozymes. Using these 1,536-well assays, concurrent HTS screens of the MLSMR library of 323,000 compounds were conducted for human and mouse IAP isozymes monitoring both inhibition and activation. This parallel screening approach led to identification of a novel inhibitory scaffold selective for murine intestinal alkaline phosphatase. SAR efforts based on parallel testing of analogs against different AP isozymes generated a potent inhibitor of the murine IAP with IC50 of 540 nM, at least 65-fold selectivity against human TNAP, and >185 selectivity against human PLAP. PMID:23860652

  3. The Antiproton Accumulator (AA)

    CERN Multimedia

    1980-01-01

    Section 06 - 08*) of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A vacuum-tank, two bending magnets (BST06 and BST07 in blue) with a quadrupole (QDN07, in red) in between, another vacuum-tank, a wide quadrupole (QFW08) and a further tank . The tanks are covered with heating tape for bake-out. The tank left of BST06 contained the stack core pickup for stochastic cooling (see 7906193, 7906190, 8005051), the two other tanks served mainly as vacuum chambers in the region where the beam was large. Peter Zettwoch works on BST06. *) see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984)

  4. Alkaline battery, separator therefore

    Science.gov (United States)

    Schmidt, George F. (Inventor)

    1980-01-01

    An improved battery separator for alkaline battery cells has low resistance to electrolyte ion transfer and high resistance to electrode ion transfer. The separator is formed by applying an improved coating to an electrolyte absorber. The absorber, preferably, is a flexible, fibrous, and porous substrate that is resistant to strong alkali and oxidation. The coating composition includes an admixture of a polymeric binder, a hydrolyzable polymeric ester and inert fillers. The coating composition is substantially free of reactive fillers and plasticizers commonly employed as porosity promoting agents in separator coatings. When the separator is immersed in electrolyte, the polymeric ester of the film coating reacts with the electrolyte forming a salt and an alcohol. The alcohol goes into solution with the electrolyte while the salt imbibes electrolyte into the coating composition. When the salt is formed, it expands the polymeric chains of the binder to provide a film coating substantially permeable to electrolyte ion transfer but relatively impermeable to electrode ion transfer during use.

  5. Households Headed by Women: Income, Employment and Household Organization

    OpenAIRE

    SHAHNAZ KAZI; BILQUEES RAZA

    1988-01-01

    The poverty of households headed by women has emerged as an important development issue in the recent past. Evidence from many developing countries, specially in Latin America and Africa, has underlined the economic vulnerability of this group and predicted an increasing incidence of female-headed households in developing societies [Buvinic and Youssef (1978); Kossaudji and Mueller (1983); Merrick and Schmink (1983)]. Among Asian countries sample surveys have revealed, a significant proportio...

  6. The Antiproton Accumulator (AA)

    CERN Multimedia

    1980-01-01

    A section of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A large vacuum-tank, a quadrupole (QDN09*), a bending magnet (BST08), another vacuum-tank, a wide quadrupole (QFW08) and (in the background) a further bending magnet (BST08). The tanks are covered with heating tape for bake-out. The tank left of QDN09 contained the kickers for stochastic pre-cooling (see 790621, 8002234, 8002637X), the other one served mainly as vacuum chamber in the region where the beam was large. Peter Zettwoch works on QFW08. * see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984) See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  7. Marriage in Rural Philippine Households

    OpenAIRE

    Evenson, Robert E.

    1994-01-01

    Utilizing intergenerational data from a sample of rural households in Laguna Province, this article tests the proposition that rural families are responsive to economic conditions as choices are made regarding children’s educational needs, their location and occupation choices.

  8. Household vehicles energy consumption 1991

    Energy Technology Data Exchange (ETDEWEB)

    1993-12-09

    The purpose of this report is to provide information on the use of energy in residential vehicles in the 50 States and the District of Columbia. Included are data about: the number and type of vehicles in the residential sector, the characteristics of those vehicles, the total annual Vehicle Miles Traveled (VMT), the per household and per vehicle VMT, the vehicle fuel consumption and expenditures, and vehicle fuel efficiencies. The data for this report are based on the household telephone interviews from the 1991 RTECS, conducted during 1991 and early 1992. The 1991 RTECS represents 94.6 million households, of which 84.6 million own or have access to 151.2 million household motor vehicles in the 50 States and the District of Columbia.

  9. Car use within the household

    DEFF Research Database (Denmark)

    de Borger, Bruno; Mulalic, Ismir; Rouwendal, Jan

    2013-01-01

    In this paper we study the demand for car kilometres in two-car households, focusing on the substitution between cars in response to fuel price changes. We use a large sample of detailed Danish data on two-car households to estimate—for each car owned by the household—own and cross-price effects...... of increases in fuel costs per kilometre. The empirical results show that failure to capture substitution between cars within the household can result in substantial misspecification biases. Ignoring substitution, we estimate fuel price elasticities of –0.81 and -0.65 for the primary and secondary cars...... efficient car, finding partial support for the underlying hypothesis. More importantly, the results of this extended model emphasize the importance of behavioural differences related to the position of the most fuel efficient car in the household, suggesting that households’ fuel efficiency choices...

  10. Simulating Household Waste Management Behaviours

    OpenAIRE

    Peter Tucker; Andrew Smith

    1999-01-01

    The paper reports the outcome of research to demonstrate the proof of concept for simulating individual, collective and interactive household waste management behaviours to provide a tool for efficient integrated waste management planning. The developed model simulates whole communities as distributions of individual households engaged in managing their own domestic waste, through home composting or recycling activities. The research addresses the personal hierarchical ordering of these activ...

  11. Sale of electricity to households

    International Nuclear Information System (INIS)

    The Company Slovenske elektrarne (SE) Predaj has after two years of presence in the market expanded their business activities to the households segment. The first customers can be particularly employees of Slovenske elektrarne. This chance will be provided to them starting from 1 October of this year. 'The electricity supplies for households will only be supplementary segment of sales at SE Predaj Company. We will still focus mainly at businesses with higher consumption,' says director of the Company Mr. Stanislav Reguli. (author)

  12. The alkaline and alkaline-carbonatite magmatism from Southern Brazil

    Science.gov (United States)

    Ruberti, E.; Gomes, C. D. B.; Comin-Chiaramonti, P.

    2015-12-01

    Early to Late Cretaceous lasting to Paleocene alkaline magmatism from southern Brazil is found associated with major extensional structural features in and around the Paraná Basin and grouped into various provinces on the basis of several data. Magmatism is variable in size, mode of occurrence and composition. The alkaline rocks are dominantly potassic, a few occurrences showing sodic affinity. The more abundant silicate rocks are evolved undersaturated to saturated in silica syenites, displaying large variation in igneous forms. Less evolved types are restricted to subvolcanic environments and outcrops of effusive suites occur rarely. Cumulatic mafic and ultramafic rock types are very common, particularly in the alkali-carbonatitic complexes. Carbonatite bodies are represented by Ca-carbonatites and Mg-carbonatites and more scarcely by Fe-carbonatites. Available radiometric ages for the alkaline rocks fit on three main chronological groups: around 130 Ma, subcoveal with the Early Cretaceous flood tholeiites of the Paraná Basin, 100-110 Ma and 80-90 Ma (Late Cretaceous). The alkaline magmatism also extends into Paleocene times, as indicated by ages from some volcanic lavas. Geochemically, alkaline potassic and sodic rock types are distinguished by their negative and positive Nb-Ta anomalies, respectively. Negative spikes in Nb-Ta are also a feature common to the associated tholeiitic rocks. Sr-Nd-Pb systematics confirm the contribution of both HIMU and EMI mantle components in the formation of the alkaline rocks. Notably, Early and Late Cretaceous carbonatites have the same isotopic Sr-Nd initial ratios of the associated alkaline rocks. C-O isotopic Sr-Nd isotopic ratios indicate typical mantle signature for some carbonatites and the influence of post-magmatic processes in others. Immiscibility of liquids of phonolitic composition, derived from mafic alkaline parental magmas, has been responsible for the origin of the carbonatites. Close association of alkaline

  13. Alkaline protease from Thermoactinomyces sp. RS1 mitigates industrial pollution.

    Science.gov (United States)

    Verma, Amit; Ansari, Mohammad W; Anwar, Mohmmad S; Agrawal, Ruchi; Agrawal, Sanjeev

    2014-05-01

    Proteases have found a wide application in the several industrial processes, such as laundry detergents, protein recovery or solubilization, prion degradation, meat tenderizations, and in bating of hides and skins in leather industries. But the main hurdle in industrial application of proteases is their economical production on a large scale. The present investigation aimed to exploit the locally available inexpensive agricultural and household wastes for alkaline protease production using Thermoactinomyces sp. RS1 via solid-state fermentation (SSF) technique. The alkaline enzyme is potentially useful as an additive in commercial detergents to mitigate pollution load due to extensive use of caustic soda-based detergents. Thermoactinomyces sp. RS1 showed good protease production under SSF conditions of 55 °C, pH 9, and 50 % moisture content with potato peels as solid substrate. The presented findings revealed that crude alkaline protease produced by Thermoactinomyces sp. RS1 via SSF is of potential application in silver recovery from used X-ray films. PMID:24122212

  14. AAS 227: Day 2

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  15. Have Labour Market Outcomes Affected Household Structure in South Africa? A Descriptive Analysis of Households

    OpenAIRE

    Farah Pirouz

    2005-01-01

    This paper seeks to investigate how the demography of households relates to individual labour market outcomes. We comprehensively examine household size and structures in the October Household Surveys 1995, 1997, 1999 and the Labour Force Surveys September 2001 and 2002. Over the 1995-2002 period, the number of households has increased in the face of rising unemployment and the average household size has decreased signifi cantly. A rising proportion of single households mostly drives this res...

  16. Determinants of Soviet Household Income

    Directory of Open Access Journals (Sweden)

    by Kenneth Smith

    2007-06-01

    Full Text Available World Values Survey data are used to examine household income in the Soviet Union. The data, gathered Summer/Fall 1990, provide a rare opportunity to empirically examine microeconomic factors influencing a Soviet household’s position in the regional/national income distribution. The survey contains data - collected regionally - from the three Baltic republics, Belarus, and the Moscow region. The data indicate certain patterns that existed and determined Soviet household income though there are often considerable regional variations. Further, there are marked differences between income distribution determinants in the Soviet Union and the U.S. and West Germany though similarities exist as well

  17. AAS 227: Day 1

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or at astrobites.com, or catch ourlive-tweeted updates from the @astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto have so many people tell us that they already know about and useastrobites, and we were excited to introduce a new cohort of students at AAS to astrobites for the first time.Tuesday morning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended today.Opening Address (by Becky Smethurst)The President of the AAS, aka our fearless leader Meg Urry kicked off the meeting this morning at the purely coffee powered hour of 8am this morning. She spoke about the importance of young astronomers at the meeting (heres looking at you reader!) and also the importance of the new Working Group for Accessibility and Disabilities (aka WGAD pronounced like wicked) at the AAS. The Society has made extra effort this year to make the conference accessible to all,a message which was very well received by everyone in attendance.Kavli Lecture: New Horizons Alan Stern (by Becky Smethurst)We were definitely spoilt with the first Plenary lecture at this years conference Alan Stern gave us a a review of the New Horizons mission of the Pluto Fly By (astrobites covered the mission back in July with this post). We were treated to beautiful images, wonderful results and a foray into geology.Before (Hubble) and after #NewHorizons. #thatisall #science #astro alanstern #aas227 pic.twitter.com/kkMt6RsSIR Science News (@topsciencething) January 5, 2016Some awesome facts from the lecture that blew my mind:New Horizons is now 2AU (!) beyond Pluto

  18. AAS 227: Day 2

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  19. AAS 227: Day 3

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 3 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Henry Norris Russell Lecture: Viewing the Universe with Infrared Eyes: The Spitzer Space Telescope (by Erika Nesvold)The Henry Norris Russell Award is the highest honor given by the AAS, for a lifetime of eminence in astronomy research. This years award went to Giovanni Fazio of the Harvard-Smithsonian Center for Astrophysics. Fazio became a leader in gamma ray astronomy before switching mid-career to the study of infrared astronomy, and he gave his award lecture on the latter subject, specifically on the Spitzer Space Telescope, one of the most successful infrared telescopes of all time.Artists rendering of the Spitzer space telescope. [NASA/JPL-Caltech]Spitzer has been operating for more than twelve years, and has resulted in over six thousand papers in refereed journals in that time. The telescope sits in an Earth-trailing orbit around the Sun, and is now farther from the Earth (1.4 AU) than the Earth is from the Sun. Fazio gave the audience a fascinating overview of the science done by Spitzer over more than a decade. One of the most productive areas of research for Spitzer is the study of exoplanets, which hadnt even been discovered when the Spitzer Telescope was first conceived. Spitzers high sensitivity and ability to observe exoplanets over

  20. Household Portfolios in the Netherlands

    NARCIS (Netherlands)

    Alessie, R.J.M.; Hochgürtel, S.; van Soest, A.H.O.

    2000-01-01

    We describe and analyse the portfolio structure of Dutch households using micro panel data from the CentER Savings Survey, 1993-1998.The data allows for a distinction between many types of assets.Moreover, we have information on mortgage debt, consumer debt, etc.We analyse the composition of househo

  1. Making Psychology a Household Word

    Science.gov (United States)

    Levant, Ronald F.

    2006-01-01

    This article addresses Ronald F. Levant's four APA presidential initiatives for 2005. "Making Psychology a Household Word" was both the general theme for his presidency as well as an initiative in its own right. The other three initiatives were "Promoting Health Care for the Whole Person," "Enhancing Diversity Within APA," and "Developing an APA…

  2. Households' recycling efforts

    Energy Technology Data Exchange (ETDEWEB)

    Bruvoll, Annegrete; Halvorsen, Bente [Research Department, Statistics Norway, 8131 Dep, N-0033 Oslo (Norway); Nyborg, Karine [The Ragnar Frisch Centre of Economic Research, Gaustadalleen 21, N-0349 Oslo (Norway)

    2002-11-01

    Households' recycling effort is often argued to be of an insignificant size. It is also frequently argued that this contribution, if significant, is not a cost to households, since it is voluntary. Thus households' use of time and energy are frequently disregarded in cost-benefit analyses of stricter recycling targets. In this survey, based on 1162 interviews, we find that sorting at source involves significant extra use of time and energy in the households. On average, each of those asked reported that they use close to half an hour a week for cleaning, sorting and transporting recyclable waste. On average, 185 h is used per tonne of waste. Four out of ten reported that they use warm or hot water to clean the materials. When investigating the motives for sorting waste, we find that many perceive sorting as mandatory, while some in fact find it a pleasant activity in itself. Moral motives for sorting at source are also widespread. A majority would prefer that a company took over the sorting if this were possible, and on average, the respondents are willing to pay US$ 20/year for this service.

  3. AAS 227: Day 3

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 3 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Henry Norris Russell Lecture: Viewing the Universe with Infrared Eyes: The Spitzer Space Telescope (by Erika Nesvold)The Henry Norris Russell Award is the highest honor given by the AAS, for a lifetime of eminence in astronomy research. This years award went to Giovanni Fazio of the Harvard-Smithsonian Center for Astrophysics. Fazio became a leader in gamma ray astronomy before switching mid-career to the study of infrared astronomy, and he gave his award lecture on the latter subject, specifically on the Spitzer Space Telescope, one of the most successful infrared telescopes of all time.Artists rendering of the Spitzer space telescope. [NASA/JPL-Caltech]Spitzer has been operating for more than twelve years, and has resulted in over six thousand papers in refereed journals in that time. The telescope sits in an Earth-trailing orbit around the Sun, and is now farther from the Earth (1.4 AU) than the Earth is from the Sun. Fazio gave the audience a fascinating overview of the science done by Spitzer over more than a decade. One of the most productive areas of research for Spitzer is the study of exoplanets, which hadnt even been discovered when the Spitzer Telescope was first conceived. Spitzers high sensitivity and ability to observe exoplanets over

  4. The Drentsche Aa valley system

    International Nuclear Information System (INIS)

    This thesis is composed of five papers concerned with Late Quaternary geology and geomorphology of the Aa valley system. The correlation and chronostratigraphic position of the layers have been established by radiocarbon dating. (Auth.)

  5. Household Safety: Preventing Poisoning (For Parents)

    Science.gov (United States)

    ... spend a lot of time there). continue Cleaning Products and Other Household Chemicals Never put cleaning products in old soda ... poison on the floors of your home. Store household cleaning products and aerosol sprays in a high cabinet far ...

  6. A Picture of Subsidized Households 2009

    Data.gov (United States)

    Department of Housing and Urban Development — Picture of Subsidized Households describes the nearly 5 million households living in HUD-subsidized housing in the United States for the year 2009. Picture 2009...

  7. Recent Refrigeration Cycle Technologies for Household Refrigerators

    Science.gov (United States)

    Nagatomo, Shigemi

    The household refrigerator is one of the most important and the biggest energy-consuming home appliances. This paper summarize recent refrigeration cycle developments in the field of domestic household refrigerators based on a survey of publications.

  8. Effects of pH and chloride concentration on pitting corrosion of AA6061 aluminum alloy

    Energy Technology Data Exchange (ETDEWEB)

    Zaid, B. [Division de Technologie du Combustible, Departement de Metallurgie, Centre de Recherche Nucleaire de Draria, BP. 43 Seballa, Draria (Algeria)], E-mail: zaidbachir@yahoo.com; Saidi, D. [Division de Technologie du Combustible, Departement de Metallurgie, Centre de Recherche Nucleaire de Draria, BP. 43 Seballa, Draria (Algeria); Benzaid, A. [Divisionde Physique et Application Nucleaires, Departement Application Nucleaires, Centre de Recherche Nucleaire de Draria, BP. 43 Seballa, Draria (Algeria); Hadji, S. [Division de Technologie du Combustible, Departement du combustible, Centre de Recherche Nucleaire de Draria, BP. 43 Seballa, Draria (Algeria)

    2008-07-15

    Effects of pH solution and chloride (Cl{sup -}) ion concentration on the corrosion behaviour of alloy AA6061 immersed in aqueous solutions of NaCl have been investigated using measurements of weight loss, potentiodynamic polarisation, linear polarisation, cyclic polarisation experiment combined with open circuit potential transient technique and optical or scanning electron microscopy. The corrosion behaviour of the AA6061 aluminum alloy was found to be dependant on the pH and chloride concentration [NaCl] of solution. In acidic or slightly neutral solutions, general and pitting corrosion occurred simultaneously. In contrast, exposure to alkaline solutions results in general corrosion. Experience revealed that the alloy AA6061 was susceptible to pitting corrosion in all chloride solution of concentration ranging between 0.003 wt% and 5.5 wt% NaCl and an increase in the chloride concentration slightly shifted both the pitting E{sub pit} and corrosion E{sub cor} potentials to more active values. In function of the conditions of treatment, the sheets of the alloy AA6061 undergo two types of localised corrosion process, leading to the formation of hemispherical and crystallographic pits. Polarisation resistance measurements in acidic (pH = 2) and alkaline chloride solutions (pH = 12) which are in good agreement with those of weight loss, show that the corrosion kinetic is minimised in slightly neutral solutions (pH = 6)

  9. AAS 228: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors fromastrobites.com, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  10. Characterization of household food waste in Denmark

    DEFF Research Database (Denmark)

    Edjabou, Vincent Maklawe Essonanawe; Petersen, C.; Scheutz, Charlotte;

    This paper presents a methodology and the results of compositional analysis of food waste from Danish families living in single-family houses. Residual household waste was sampled and manually sorted from 211 single-family houses in the suburb of Copenhagen. The main fractions contributing...... to the household food waste were avoidable vegetable food waste and non-avoidable vegetable food waste. Statistical analysis found a positive linear relationship between household size and the amount of the household food waste....

  11. ICT and Household-Firm Relations

    OpenAIRE

    Lindbeck, Assar; Wikström, Solveig

    1999-01-01

    This paper discusses how ICT and emerging electronic commerce in consumer products influence the relative efficiency in production of households and firms, resulting in changes in the division of tasks between these two types of agents. Increased information and competence of households, in combination with stiffer competition among firms, will also increase the power of households relative to firms, at least in a long-term perspective with free entry of firms. Households will also get more p...

  12. Household Behavior and the Marriage Market

    OpenAIRE

    Del Boca, Daniela; Flinn, Christopher

    2012-01-01

    There is some controversy in the field of household economics regarding the efficiency of household decisions. We make the point that a flexible specification of spousal preferences and the household production technology precludes the possibility of using revealed preference data on household time allocations to determine the manner in which spouses interact: efficiently or inefficiently. Under strong, but standard, assumptions regarding marriage market equilibria, marital sorting patterns c...

  13. Household Food Demand in Rural China

    OpenAIRE

    Davis, John

    2008-01-01

    Abstract This paper explores rural household food consumption behaviour in China using a large household data set from Jilin Province. Data are classified into four main food groups?grain, vegetable products, animal products and other foods. A household food demand system, incorporating four household characteristics, is estimated using an LA-AIDS model, assuming a three-stage budgeting procedure. Expenditure elasticities for a range of food groups are estimated, with a particular...

  14. Household energy and consumption and expenditures, 1990

    International Nuclear Information System (INIS)

    The purpose of this supplement to the Household Energy Consumption and Expenditures 1990 report is to provide information on the use of energy in residential housing units, specifically at the four Census regions and nine Census division levels. This report includes household energy consumption, expenditures, and prices for natural gas, electricity, fuel oil, liquefied petroleum gas (LPG), and kerosene as well as household wood consumption. For national-level data, see the main report, Household Energy Consumption and Expenditures 1990

  15. Nucleotide sequences encoding a thermostable alkaline protease

    Science.gov (United States)

    Wilson, David B.; Lao, Guifang

    1998-01-01

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

  16. Household Consumption, Investment and Life Insurance

    DEFF Research Database (Denmark)

    Bruhn, Kenneth; Steffensen, Mogens

    2011-01-01

    This paper develops a continuous-time Markov model for utility optimization of households. The household optimizes expected future utility from consumption by controlling consumption, investments and purchase of lifeinsurance for each person in the household. The optimal controls are investigated...

  17. 7 CFR 273.1 - Household concept.

    Science.gov (United States)

    2010-01-01

    .... Editorial Note: For Federal Register citations affecting § 273.1, see the List of CFR Sections Affected... 7 Agriculture 4 2010-01-01 2010-01-01 false Household concept. 273.1 Section 273.1 Agriculture... FOOD STAMP AND FOOD DISTRIBUTION PROGRAM CERTIFICATION OF ELIGIBLE HOUSEHOLDS § 273.1 Household...

  18. Division of household tasks and financial management

    NARCIS (Netherlands)

    Antonides, G.

    2011-01-01

    Both the standard economic model and bargaining theory make predictions about financial management and the division of household labor between household partners. Using a large Internet survey, we have tested several predictions about task divisions reported by Dutch household partners. The division

  19. Spending time and money within the household

    DEFF Research Database (Denmark)

    Browning, Martin; Gørtz, Mette

    We consider theoretically and empirically the allocation of time and money within the household. The novelty of our empirical work is that we have a survey which provides information on both time use and the allocation of some goods within the household, for the same households. We can consider...

  20. AAS 227: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from http://web.physics.ucsb.edu/ ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  1. Financial planning for young households

    DEFF Research Database (Denmark)

    Pedersen, Anne Marie Boiden; Weissensteiner, Alex; Poulsen, Rolf

    2013-01-01

    We analyze the financial planning problems of young households whose main decisions are how to finance the purchase of a house (liabilities) and how to allocate investments in pension savings schemes (assets). The problems are solved using a multi-stage stochastic programming model where the unce......We analyze the financial planning problems of young households whose main decisions are how to finance the purchase of a house (liabilities) and how to allocate investments in pension savings schemes (assets). The problems are solved using a multi-stage stochastic programming model where...... the uncertainty is described by a scenario tree generated from a vector auto-regressive process for equity returns and interest rate evolution. We find strong evidence of the importance of taking into account the multi-stage nature of the problem, as well as the need to consider the asset and liability sides...

  2. Development of alkaline fuel cells.

    Energy Technology Data Exchange (ETDEWEB)

    Hibbs, Michael R.; Jenkins, Janelle E.; Alam, Todd Michael; Janarthanan, Rajeswari [Colorado School of Mines, Golden, CO; Horan, James L. [Colorado School of Mines, Golden, CO; Caire, Benjamin R. [Colorado School of Mines, Golden, CO; Ziegler, Zachary C. [Colorado School of Mines, Golden, CO; Herring, Andrew M. [Colorado School of Mines, Golden, CO; Yang, Yuan [Colorado School of Mines, Golden, CO; Zuo, Xiaobing [Argonne National Laboratory, Argonne, IL; Robson, Michael H. [University of New Mexico, Albuquerque, NM; Artyushkova, Kateryna [University of New Mexico, Albuquerque, NM; Patterson, Wendy [University of New Mexico, Albuquerque, NM; Atanassov, Plamen Borissov [University of New Mexico, Albuquerque, NM

    2013-09-01

    This project focuses on the development and demonstration of anion exchange membrane (AEM) fuel cells for portable power applications. Novel polymeric anion exchange membranes and ionomers with high chemical stabilities were prepared characterized by researchers at Sandia National Laboratories. Durable, non-precious metal catalysts were prepared by Dr. Plamen Atanassov's research group at the University of New Mexico by utilizing an aerosol-based process to prepare templated nano-structures. Dr. Andy Herring's group at the Colorado School of Mines combined all of these materials to fabricate and test membrane electrode assemblies for single cell testing in a methanol-fueled alkaline system. The highest power density achieved in this study was 54 mW/cm2 which was 90% of the project target and the highest reported power density for a direct methanol alkaline fuel cell.

  3. Development of alkaline fuel cells.

    Energy Technology Data Exchange (ETDEWEB)

    Hibbs, Michael R.; Jenkins, Janelle E.; Alam, Todd Michael; Janarthanan, Rajeswari; Horan, James L.; Caire, Benjamin R.; Ziegler, Zachary C.; Herring, Andrew M.; Yang, Yuan; Zuo, Xiaobing; Robson, Michael H.; Artyushkova, Kateryna; Patterson, Wendy; Atanassov, Plamen Borissov

    2013-09-01

    This project focuses on the development and demonstration of anion exchange membrane (AEM) fuel cells for portable power applications. Novel polymeric anion exchange membranes and ionomers with high chemical stabilities were prepared characterized by researchers at Sandia National Laboratories. Durable, non-precious metal catalysts were prepared by Dr. Plamen Atanassovs research group at the University of New Mexico by utilizing an aerosol-based process to prepare templated nano-structures. Dr. Andy Herrings group at the Colorado School of Mines combined all of these materials to fabricate and test membrane electrode assemblies for single cell testing in a methanol-fueled alkaline system. The highest power density achieved in this study was 54 mW/cm2 which was 90% of the project target and the highest reported power density for a direct methanol alkaline fuel cell.

  4. Regional gross disposable household income

    OpenAIRE

    Eddie Holmes

    2008-01-01

    Presents estimates published in May 2008, an overview of methodology used and future plans for regional economic dataThis article looks at estimates for regional gross disposable household income (GDHI) at current basic prices, published in May 2008. These data are published using the European Union Nomenclature of Units for Territorial Statistics (NUTS) regions. Data are published for the NUTS1, NUTS2 and NUTS3 levels for the period 1995 to 2006. There is an overview of the methodology used ...

  5. Household Poverty Dynamics in Malawi

    OpenAIRE

    Bokosi, Fanwell Kenala

    2006-01-01

    This paper’s goal is to identify the sources of expenditure and poverty dynamics among Malawian households between 1998 and 2002 and to model poverty transitions in Malawi using a bivariate probit model with endogenous selection to address the "initial conditions' problem. The exogeneity of the initial state is strongly rejected and could result in considerable overstatement of the effects of the explanatory factors. The results of the bivariate probit model do indicate that education of th...

  6. Householder triangularization of a quasimatrix

    OpenAIRE

    Trefethen, Lloyd N.

    2008-01-01

    A standard algorithm for computing the QR factorization of a matrix A is Householder triangularization. Here this idea is generalized to the situation in which A is a quasimatrix, that is, a “matrix” whose “columns” are functions defined on an interval [a,b]. Applications are mentioned to quasimatrix leastsquares fitting, singular value decomposition, and determination of ranks, norms, and condition numbers, and numerical illustrations are presented using the chebfun system.

  7. AAS 228: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors fromastrobites.com, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  8. Inconsistent pathways of household waste

    International Nuclear Information System (INIS)

    The aim of this study was to provide policy-makers and waste management planners with information about how recycling programs affect the quantities of specific materials recycled and disposed of. Two questions were addressed: which factors influence household waste generation and pathways? and how reliable are official waste data? Household waste flows were studied in 35 Swedish municipalities, and a wide variation in the amount of waste per capita was observed. When evaluating the effect of different waste collection policies, it was found to be important to identify site-specific factors influencing waste generation. Eleven municipal variables were investigated in an attempt to explain the variation. The amount of household waste per resident was higher in populous municipalities and when net commuting was positive. Property-close collection of dry recyclables led to increased delivery of sorted metal, plastic and paper packaging. No difference was seen in the amount of separated recyclables per capita when weight-based billing for the collection of residual waste was applied, but the amount of residual waste was lower. Sixteen sources of error in official waste statistics were identified and the results of the study emphasize the importance of reliable waste generation and composition data to underpin waste management policies.

  9. Cloning of an alkaline lipase gene from Penicillium cyclopium and its expression in Escherichia coli.

    Science.gov (United States)

    Wu, Minchen; Qian, Zhikang; Jiang, Peihong; Min, Taishan; Sun, Chongrong; Huang, Weida

    2003-03-01

    The gene encoding an alkaline lipase of Penicillium cyclopium PG37 was cloned with four steps of PCR amplification based on different principles. The cloned gene was 1,480 nucleotides in length, consisted of 94 bp of promoter region, and had 6 exons and 5 short introns ranging from 50 to 70 nucleotides. The open reading frame encoded a protein of 285 amino acid residues consisting of a 27-AA signal peptide and a 258-AA mature peptide, with a conserved motif of Gly-X-Ser-X-Gly shared by all types of alkaline lipases. However, this protein had a low homology with lipases of P. camembertii (22.9%), Humicola lanuginosa (25.6%), and Rhizomucor miehei (22.3%) at the amino acid level. The mature peptide-encoding cDNA was cloned and expressed in Escherichia coli on pET-30a for confirmation. A distinct band with a M.W. of 33 kDa was detected on SDS-PAGE. Results of a Western blot analysis and an enzyme activity assay verified the recombinant 33-kDa protein as an alkaline lipase. Its catalytic properties were not changed when compared with its natural counterpart. PMID:12784858

  10. AAS 227: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from http://web.physics.ucsb.edu/ ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  11. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor

    OpenAIRE

    Pérez, Claudia; Fernandez, Luisa E.; Sun, Jianguang; Folch, Jorge Luis; Gill, Sarjeet S.; Soberón, Mario; Bravo, Alejandra

    2005-01-01

    Bacillus thuringiensis subsp. israelensis produces crystal proteins, Cry (4Aa, 4Ba, 10Aa, and 11Aa) and Cyt (1Aa and 2Ba) proteins, toxic to mosquito vectors of human diseases. Cyt1Aa overcomes insect resistance to Cry11Aa and Cry4 toxins and synergizes the toxicity of these toxins. However, the molecular mechanism of synergism remains unsolved. Here, we provide evidence that Cyt1Aa functions as a receptor of Cry11Aa. Sequential-binding analysis of Cyt1Aa and Cry11Aa revealed that Cyt1Aa bind...

  12. Is amyloid A (AA) amyloidosis always secondary?

    OpenAIRE

    Maury, C P; Törnroth, T; Wegelius, O

    1985-01-01

    The case is reported of a patient with systemic AA amyloidosis associated with non-specific mesenteric lymphadenitis and chronic sideropenia. Renal, small bowel, and rectal biopsies showed amyloid deposits containing AA protein, as defined by potassium permanganate sensitivity and by reactivity with AA antiserum. Reversal of the nephrotic syndrome occurred during steroid-azathioprine therapy.

  13. Households in the smart grid

    DEFF Research Database (Denmark)

    Christensen, Toke Haunstrup; Friis, Freja; Gram-Hanssen, Kirsten

    It is a widespread assumption within the energy sector that the “smart grid” will be a crucial element of a future low-carbon energy system, and households are assigned an important role in this (particularly in relation to balancing consumption and production). However, this raises questions about...... the integration of consumers’ everyday life practices in this system. This paper introduces the ideas of the smart grid and review relevant demonstration projects. Special focus is on the role of consumers and electric vehicles. The paper ends with introducing major research questions and presents a new research...

  14. The householders' guide to radon

    International Nuclear Information System (INIS)

    This guide is a follow-up to the leaflet Radon in Houses which was issued previously by the Department of the Environment. It is intended for people who live in areas with high levels of radon. It is written particularly for householders whose homes have already been tested and found to have an appreciable level of radon. It explains what radon is, how it gets into houses and what the effects on health may be. It also outlines some of the ways of reducing the level of radon and gives guidance both on how to get the work done and likely costs. (author)

  15. Alkaline fuel cell performance investigation

    Science.gov (United States)

    Martin, R. E.; Manzo, M. A.

    1988-01-01

    An exploratory experimental fuel cell test program was conducted to investigate the performance characteristics of alkaline laboratory research electrodes. The objective of this work was to establish the effect of temperature, pressure, and concentration upon performance and evaluate candidate cathode configurations having the potential for improved performance. The performance characterization tests provided data to empirically establish the effect of temperature, pressure, and concentration upon performance for cell temperatures up to 300 F and reactant pressures up to 200 psia. Evaluation of five gold alloy cathode catalysts revealed that three doped gold alloys had more that two times the surface areas of reference cathodes and therefore offered the best potential for improved performance.

  16. Fuel choices in urban Indian households

    Energy Technology Data Exchange (ETDEWEB)

    Farsi, Mehdi; Filippini, Massimo [Centre for Energy Policy and Economics, Department of Management, Technology and Economics, ETH Zurich, Switzerland and Department of Economics, University of Lugano, (Switzerland); Pachauri, Shonali [International Institute for Applied Systems Analysis, Schlossplatz 1, A-2361, Laxenburg, (Austria)

    2007-12-15

    This paper applies an ordered discrete choice framework to model fuel choices and patterns of cooking fuel use in urban Indian households. The choices considered are for three main cooking fuels: firewood, kerosene, and LPG (liquid petroleum gas). The models, estimated using a large microeconomic dataset, show a reasonably good performance in the prediction of households' primary and secondary fuel choices. This suggests that ordered models can be used to analyze multiple fuel use patterns in the Indian context. The results show that lack of sufficient income is one of the main factors that retard households from using cleaner fuels, which usually also require the purchase of relatively expensive equipment. The results also indicate that households are sensitive to LPG prices. In addition to income and price, several socio-demographic factors such as education and sex of the head of the household are also found to be important in determining household fuel choice. (Author).

  17. Development of electrochemical biosensor based on the immobilisation of alkaline fosfatase for the determination of 2,4-dichlorophenoxyacetic acid

    International Nuclear Information System (INIS)

    An electrochemical biosensor based on the immobilisation of alkaline phosphatase was developed for the determination of 2,4-dichlorophenoxyacetic acid (2,4-D). The biosensor was constructed from the immobilization of alkaline phosphatase enzyme onto a screen-printed electrode (SPE). The ascorbic acid 2-phosphate (AA2P) was used as substrate for the enzymic reaction. The enzyme was entrapped in a hybrid sol-gel/ chitosan material with certain fixed composition. The determination of toxicity of 2,4-D pesticides quantitatively and qualitatively could be carried out by the inhibition of the alkaline phosphatase. A potential of +600 mV was suitable to be used for the oxidation of the products from the enzyme-substrate reaction, where the reaction pH was at 8.5. The linear response range of the biosensor to the AA2P substrates was 10 μM - 80 μM. The inhibition of the alkaline phosphatase enzyme of the 2,4-D biosensor was maximum at 80 ppm 2,4-D (50 % inhibition). (author)

  18. Alkaline Water and Longevity: A Murine Study.

    Science.gov (United States)

    Magro, Massimiliano; Corain, Livio; Ferro, Silvia; Baratella, Davide; Bonaiuto, Emanuela; Terzo, Milo; Corraducci, Vittorino; Salmaso, Luigi; Vianello, Fabio

    2016-01-01

    The biological effect of alkaline water consumption is object of controversy. The present paper presents a 3-year survival study on a population of 150 mice, and the data were analyzed with accelerated failure time (AFT) model. Starting from the second year of life, nonparametric survival plots suggest that mice watered with alkaline water showed a better survival than control mice. Interestingly, statistical analysis revealed that alkaline water provides higher longevity in terms of "deceleration aging factor" as it increases the survival functions when compared with control group; namely, animals belonging to the population treated with alkaline water resulted in a longer lifespan. Histological examination of mice kidneys, intestine, heart, liver, and brain revealed that no significant differences emerged among the three groups indicating that no specific pathology resulted correlated with the consumption of alkaline water. These results provide an informative and quantitative summary of survival data as a function of watering with alkaline water of long-lived mouse models.

  19. Impact of Weather Shocks on MENA Households

    OpenAIRE

    Wodon, Quentin; Liverani, Andrea

    2014-01-01

    Do households living in climate affected areas in the MENA region believe that changes in climate patterns and their environment are taking place? Have households been affected by extreme weather events, and if so to what extent and which events have had the largest impact? What are the coping strategies that households declare having used, or could be using to cope with climate change and...

  20. GENERATION OF RECYCLABLES BY RURAL HOUSEHOLDS

    OpenAIRE

    Jakus, Paul M.; Tiller, Kelly; Park, William M.

    1996-01-01

    Rising landfill costs have forced solid waste managers to consider ways to reduce the waste stream. Using survey data, models explaining the weight of recyclables generated by households are estimated for paper and glass. Results indicate that households respond to the time cost of recycling paper but not glass. The waste generation models imply total monthly willingness to pay for recycling is $5.78 per household. Waste managers may increase the weight of recycled waste stream with programs ...

  1. Demand for Nutrients: The Household Production Approach

    OpenAIRE

    Chung, Rebecca H.; Lee, Jonq-Ying; Brown, Mark G.

    1998-01-01

    This study uses the household production theory to study the demand for nutrients, i.e., households purchase a combination of food items from the market and produce the needed nutrients from these food items. By following the traditional household production approach, shadow prices for nutrients in food consumption are calculated. The cost function that generates the shadow prices appears plausible in terms of its elasticities of substitution and factor demand. After obtaining the calculated ...

  2. Spending time and money within the household

    OpenAIRE

    Martin BROWNING; Gørtz, Metter

    2006-01-01

    We consider, both theoretically and empirically, the allocation of time and money within the household. The research question is whether a married person who enjoys more leisure than their partner also receives more consumption (which seems to indicate the outcome of power within the household) or receives less consumption (which seems to indicate differing intrahousehold preferences). We develop a simple parametric structural model with household production that is tested on survey data. We ...

  3. Education Financing of Rural Households in China

    OpenAIRE

    Wang, Hua-shu; Moll, Henk

    2010-01-01

    The purpose of this paper was to examine children’s education financing alternatives among households in rural China. Data on education financing was from a household survey conducted in three poverty villages in Guizhou, China. The difference in financing education by households was verified through non-parametric testing. Findings show that private savings is dominant in financing education of children in school. Formal loans are almost absent even in the highest wealth group examined. The ...

  4. Carbon Dioxide, Energy Taxes and Household Income

    OpenAIRE

    Cathal O'Donoghue

    1997-01-01

    This paper examines the impact of a carbon tax on the income distribution in Ireland using the 1987 Household Budget Survey. Previous studies have focused on the direct impact of the carbon tax on expenditures on domestic fuels. This study however, drawing on previous work expands the analysis to cover the indirect impact of carbon taxes on other household purchases> A direct and indirect tax would have a less regressive effect on the income distribution than a simple direct tax on household ...

  5. Financial Satisfaction from Intra-Household Perspectives

    OpenAIRE

    Namkee Ahn; Victoria Ateca; Arantza Ugidos

    2007-01-01

    We address individuals’ financial satisfaction from the intra-household perspective. Our purpose is twofold. First, we want to contrast the hypothesis of relative income within the household. Does the income level of one individual relative to that of other members of the same household matter in his/her income satisfaction? Second, we want to test procedural utility hypothesis in that different sources of income may contribute differentially to individuals’ income satisfaction. In particular...

  6. Grace DAKASEP alkaline battery separator

    Science.gov (United States)

    Giovannoni, R. T.; Lundquist, J. T.; Choi, W. M.

    1987-01-01

    The Grace DAKASEP separator was originally developed as a wicking layer for nickel-zinc alkaline batteries. The DAKASEP is a filled non-woven separator which is flexible and heat sealable. Through modification of formulation and processing variables, products with a variety of properties can be produced. Variations of DAKASEP were tested in Ni-H2, Ni-Zn, Ni-Cd, and primary alkaline batteries with good results. The properties of DAKASEP which are optimized for Hg-Zn primary batteries are shown in tabular form. This separator has high tensile strength, 12 micron average pore size, relatively low porosity at 46-48 percent, and consequently moderately high resistivity. Versions were produced with greater than 70 percent porosity and resistivities in 33 wt percent KOH as low as 3 ohm cm. Performance data for Hg-Zn E-1 size cells containing DAKASEP with the properties shown in tabular form, are more reproducible than data obtained with a competitive polypropylene non-woven separator. In addition, utilization of active material is in general considerably improved.

  7. Household energy consumption and expenditures, 1990

    International Nuclear Information System (INIS)

    This report, Household Energy Consumption and Expenditures 1990, is based upon data from the 1990 Residential Energy Consumption Survey (RECS). Focusing on energy end-use consumption and expenditures of households, the 1990 RECS is the eighth in a series conducted since 1978 by the Energy Information Administration (EIA). Over 5,000 households were surveyed, providing information on their housing units, housing characteristics, energy consumption and expenditures, stock of energy-consuming appliances, and energy-related behavior. The information provided represents the characteristics and energy consumption of 94 million households nationwide

  8. Alkaline and alkaline earth metal phosphate halides and phosphors

    Science.gov (United States)

    Lyons, Robert Joseph; Setlur, Anant Achyut; Cleaver, Robert John

    2012-11-13

    Compounds, phosphor materials and apparatus related to nacaphite family of materials are presented. Potassium and rubidium based nacaphite family compounds and phosphors designed by doping divalent rare earth elements in the sites of alkaline earth metals in the nacaphite material families are descried. An apparatus comprising the phosphors based on the nacaphite family materials are presented herein. The compounds presented is of formula A.sub.2B.sub.1-yR.sub.yPO.sub.4X where the elements A, B, R, X and suffix y are defined such that A is potassium, rubidium, or a combination of potassium and rubidium and B is calcium, strontium, barium, or a combination of any of calcium, strontium and barium. X is fluorine, chlorine, or a combination of fluorine and chlorine, R is europium, samarium, ytterbium, or a combination of any of europium, samarium, and ytterbium, and y ranges from 0 to about 0.1.

  9. Progress of research on the influence of alkaline cation and alkaline solution on bentonite properties

    International Nuclear Information System (INIS)

    Based on the previous laboratory studies and numerical simulation on bentonite in alkaline environments, the effects of alkaline cation and alkaline solution on mineral composition, microstructure, swelling capacity and hydraulic properties of bentonite are emphasized in this paper, temperature, pH values and concentration are discussed as main affecting factors. When bentonite is exposed to alkaline cation or alkaline solution, microstructure of bentonite will be changed due to the dissolution of montmorillonite and the formation of secondary minerals, which results in the decrease of swelling pressure. The amount of the reduction of swelling pressure depends on the concentration of alkaline solution. Temperature, polyvalent cation, salinity and concentration are the main factors affecting hydraulic properties of bentonite under alkaline conditions. Therefore, future research should focus on the mechanism of coupling effects of weak alkaline solutions on the mineral composition, microstructure, swelling capacity and hydraulic properties of bentonite under different temperatures and different pH values. (authors)

  10. ATTITUDES AND HOUSEHOLD CHARACTERISTICS INFLUENCING SOLID WASTE GENERATION: A HOUSEHOLD GARBAGE ANALYSIS

    OpenAIRE

    Epp, Donald J.; Mauger, Paul C.

    1989-01-01

    A survey of household decision-makers and an analysis of their garbage was used to suggest factors affecting the weight of household contributions to municipal solid waste. Iterative regression was used to build a model from the data that is hypothesized to explain garbage weight. Food expenditure, environmental attitude, consumption of soft drinks in plastic bottles, and cats in the household were significant for all households. Self-sufficiency and energy-conscious behavioral scales also af...

  11. Smart Energy Management for Households

    Directory of Open Access Journals (Sweden)

    Sonja van Dam

    2013-06-01

    Full Text Available The aim of the research presented in this thesis was to infer design-related insights and guidelines to improve the use and effectiveness of home energy management systems (HEMS. This was done through an empirical evaluation of the longitudinal effectiveness of these devices and an exploration of factors that influence their use and effectiveness. Three case studies executed with three different HEMS in households, a life cycle assessment (LCA on those three HEMS, as well as a reflection on the challenges of both researching and implementing HEMS in existing housing gave a comprehensive picture of the opportunities and barriers for HEMS. The research revealed five typical use patterns that emerged amongst households. It also revealed average energy savings of 7.8%, which however decreased in the follow-up that was conducted, and factors that may influence the use and effectiveness of HEMS. Nonetheless, the LCA calculations divulged that the HEMS can achieve net energy savings when taking their embedded energy into account.Problem statementThe goal of reducing the energy consumption of existing housing formed the basis for this research. There are many facets to this energy consumption, including the characteristics of the house, its appliances, and the behaviours of its inhabitants. Because of this complexity, addressing only one of these facets is not effective in substantially reducing the overall energy consumption of households. This called for an interdisciplinary approach, merging the domains of design for sustainability, sustainable housing transformation and environmental psychology. In this thesis, HEMS were chosen as the intervention to address the various elements that contribute to household energy consumption, thereby functioning as a pivot. By giving feedback and/or helping manage consumption they can assist households in changing their behaviour and help save energy. However, in analysing literature on HEMS, four critique points

  12. Alkaline azide mutagenicity in cowpea

    International Nuclear Information System (INIS)

    Sodium azide is known as a potent mutagen in cereals and legumes. It is very effective in acidic medium in barley. Here an attempt is made to measure the effectiveness of sodium azide in alkaline medium (pH 7.4) on cowpea (Vigna unguiculata (L.) Walp., variety FS-68). Seeds pre-soaked in distilled water for 5 hours were treated with different concentrations (10-6, 10-5, 10-4 and 10-3M) of sodium azide (NaN3) for 4 hours at 28± 2 deg. C. Bottles were intermittently shaken, then the seeds were thoroughly washed in running tap water and subsequently planted in pots. The treatment caused significant biological damage such as reduction in seed germination, length of root and shoot, number of nodules and pods per plant and morphological leaf variations. Morphological, as well as chlorophyll mutants, were detected in M2

  13. 7 CFR 254.5 - Household eligibility.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Household eligibility. 254.5 Section 254.5 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE... 253.7. (b) Urban places. No household living in an urban place in Oklahoma shall be eligible for...

  14. Can survey participation alter household saving behaviour?

    NARCIS (Netherlands)

    Crossley, Thomas; de Bresser, Jochem; Delaney, L.; Winter, Joachim

    2016-01-01

    We document an effect of survey participation on household saving. Indentification comes from random assignment to modules within a population-representative internet panel. The saving measure is based on linked administrative wealth data. Households that responded to a detailed questionnaire on nee

  15. Micro Econometric Modelling of Household Energy Use

    DEFF Research Database (Denmark)

    Leth-Petersen, Søren

    2002-01-01

    Presents a micro econometric analysis of household electricity and natural gas demand for Danish households observed in 1996. Dependence between demand for gas and demand for electricity; Separability of demand for gas from demand for electricity; Relation between energy consumption and the age...

  16. Household income distribution in the USA

    Science.gov (United States)

    Efthimiou, Costas J.; Wearne, Adam

    2016-03-01

    In this article we present an alternative model for the distribution of household incomes in the United States. We provide arguments from two differing perspectives which both yield the proposed income distribution curve, and then fit this curve to empirical data on household income distribution obtained from the United States Census Bureau.

  17. Passenger transport and household activity patterns

    DEFF Research Database (Denmark)

    Jørgensen, Kaj

    1997-01-01

    Review of Danish passenger transport patterns and analysis of energy consumption, emissions and safety impacts for selected typical households' travelling......Review of Danish passenger transport patterns and analysis of energy consumption, emissions and safety impacts for selected typical households' travelling...

  18. Does Income Taxation Affect Partners’ Household Chores?

    NARCIS (Netherlands)

    van Soest, A.H.O.; Stancanelli, E.G.F.

    2010-01-01

    We study the impact of income taxation on both partners‟ allocation of time to market work and unpaid house work in households with two adults. We estimate a structural household utility model in which the marginal utilities of leisure and house work of both partners are modelled as random coefficie

  19. Household consumption and environment. 2011 edition

    International Nuclear Information System (INIS)

    This report presents and comments numerous data and indicators concerning the constraints and impacts on the environment related to household consumption and behaviour. After a presentation of context indicators (household number and size, household consumption expenses) and of some global indicators (water and carbon footprint of household consumption), several specific aspects are addressed: housing (electric and electronic equipment, water, space and energy consumption, renewable energies, CO2 emissions), transport (general statistics on travels, CO2 and pollutant emissions related to motor cars), food (water print and carbon print related to household food, consumption of bio-agriculture products and of conditioned beverages), and wastes (production and composition, electronic and electric equipment wastes, waste treatment)

  20. Capitalization of Local Products through Agro- Household

    Directory of Open Access Journals (Sweden)

    Ramona Ciolac

    2010-10-01

    Full Text Available In every household there are many family activities that provide the necessary income or living foods. Some activities are related to cultivation of land, others for breeding other means services provided by the vilagers. The products of the own household must cover 40% of meals offered to tourists. These products are produced by the householder work in their household, the tourist having the opportunity to observe how the products are produced and participate effectively in this production. Specific rural household products can be recovered through tourism by both indirect and direct ways. Both variants can generate increased profitability and interest of the tourist business activity and impose a sense of satisfaction for quality benefit, issues that may be, in turn, assumptions favorable to the extension of this work.

  1. Laboratory Astrophysics Division of the AAS (LAD)

    Science.gov (United States)

    Salama, Farid; Drake, R. P.; Federman, S. R.; Haxton, W. C.; Savin, D. W.

    2012-01-01

    The purpose of the Laboratory Astrophysics Division (LAD) is to advance our understanding of the Universe through the promotion of fundamental theoretical and experimental research into the underlying processes that drive the Cosmos. LAD represents all areas of astrophysics and planetary sciences. The first new AAS Division in more than 30 years, the LAD traces its history back to the recommendation from the scientific community via the White Paper from the 2006 NASA-sponsored Laboratory Astrophysics Workshop. This recommendation was endorsed by the Astronomy and Astrophysics Advisory Committee (AAAC), which advises the National Science Foundation (NSF), the National Aeronautics and Space Administration (NASA), and the U.S. Department of Energy (DOE) on selected issues within the fields of astronomy and astrophysics that are of mutual interest and concern to the agencies. In January 2007, at the 209th AAS meeting, the AAS Council set up a Steering Committee to formulate Bylaws for a Working Group on Laboratory Astrophysics (WGLA). The AAS Council formally established the WGLA with a five-year mandate in May 2007, at the 210th AAS meeting. From 2008 through 2012, the WGLA annually sponsored Meetings in-a-Meeting at the AAS Summer Meetings. In May 2011, at the 218th AAS meeting, the AAS Council voted to convert the WGLA, at the end of its mandate, into a Division of the AAS and requested draft Bylaws from the Steering Committee. In January 2012, at the 219th AAS Meeting, the AAS Council formally approved the Bylaws and the creation of the LAD. The inaugural gathering and the first business meeting of the LAD were held at the 220th AAS meeting in Anchorage in June 2012. You can learn more about LAD by visiting its website at http://lad.aas.org/ and by subscribing to its mailing list.

  2. Wood fuels consumption in households in Montenegro

    Directory of Open Access Journals (Sweden)

    Glavonjić Branko D.

    2013-01-01

    Full Text Available The paper presents the results of researching wood fuels consumption in households in Montenegro in the heating season 2011/2012. The research was conducted in the period October-November 2012 on the sample of 5% of the total number of households which stated to use solid fuels for heating purposes in the 2011 census. Results of the conducted researches on the presence and amounts of fuels consumed in households in Montenegro showed that total firewood consumption in the heating season 2011/2012 (both urban and rural households was 703,571 m3. Wood consumption is the lowest in the households in the municipalities in the coastal zone, it is somewhat higher in central zone and the highest in the zone on the north of Montenegro. Average wood consumption in households in the coastal zone municipalities is 3.79 m3, in the central zone it is 5.02 m3 and on the north of Montenegro it is 6.74 m3/household. Observed on the level of Montenegro, average firewood consumption per household was 5.49 m3 and as such it best represents relatively low consumption level in the coastal zone and high consumption level on the north of Montenegro. Compared to the neighboring countries, average firewood consumption per household in Montenegro in the amount of 5.49 m3 is significantly lower than the average consumption in Serbia which is 7.3 m3/household as well as in Slovenia in the amount of 6.5 m3.

  3. A Green Approach to SNF Reprocessing: Are Common Household Reagents the Answer?

    Energy Technology Data Exchange (ETDEWEB)

    Peper, Shane M.; McNamara, Bruce K.; O' Hara, Matthew J.; Douglas, Matthew

    2008-04-03

    It has been discovered that UO2, the principal component of spent nuclear fuel (SNF), can efficiently be dissolved at room temperature using a combination of common household reagents, namely hydrogen peroxide, baking soda, and ammonia. This rather serendipitous discovery opens up the possibility, for the first time, of considering a non-acidic process for recycling U from SNF. Albeit at the early stages of development, our unconventional dissolution approach possesses many attractive features that could make it a reality in the future. With dissolution byproducts of water and oxygen, our approach poses a minimal threat to the environment. Moreover, the use of common household reagents to afford actinide oxide dissolution suggests a certain degree of economic favorability. With the use of a “closed” digestion vessel as a reaction chamber, our approach has substantial versatility with the option of using either aqueous or gaseous reactant feeds or a combination of both. Our approach distinguishes itself from all existing reprocessing technologies in two important ways. First and foremost, it is an alkaline rather than an acidic process, using mild non-corrosive chemicals under ambient conditions to effect actinide separations. Secondly, it does not dissolve the entire SNF matrix, but rather selectively solubilizes U and other light actinides for subsequent separation, resulting in potentially faster head-end dissolution and fewer downstream separation steps. From a safeguards perspective, the use of oxidizing alkaline solutions to effect actinide separations also potentially offers a degree of inherent proliferation resistance, by allowing the U to be selectively removed from the remaining dissolver solution while keeping Pu grouped with the other minor actinides and fission products. This paper will describe the design and general experimental setup of a “closed” digestion vessel for performing uranium oxide dissolutions under alkaline conditions using

  4. Household Consumption Characteristics of Cookies: The Case of Uganda

    OpenAIRE

    Fu, Shengfei; Florkowski, Wojciech J.; Nambiar, Padmanand Madhavan; Resurreccion, Anna V.A.; Chinnan, Manjeet S.

    2013-01-01

    The cookie consumption and purchase characteristics of households were investigated in six cities in Uganda using household survey data. Cookies can be fortified with vitamins to improve child nutrition. The application of a Logit model permitted the identification of factors significantly affecting household decision to eat cookies. They are household food buyer/preparer’s age, employment status, education level, household monthly income, household location, number of children from 4 to 18 y...

  5. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor.

    Science.gov (United States)

    Pérez, Claudia; Fernandez, Luisa E; Sun, Jianguang; Folch, Jorge Luis; Gill, Sarjeet S; Soberón, Mario; Bravo, Alejandra

    2005-12-20

    Bacillus thuringiensis subsp. israelensis produces crystal proteins, Cry (4Aa, 4Ba, 10Aa, and 11Aa) and Cyt (1Aa and 2Ba) proteins, toxic to mosquito vectors of human diseases. Cyt1Aa overcomes insect resistance to Cry11Aa and Cry4 toxins and synergizes the toxicity of these toxins. However, the molecular mechanism of synergism remains unsolved. Here, we provide evidence that Cyt1Aa functions as a receptor of Cry11Aa. Sequential-binding analysis of Cyt1Aa and Cry11Aa revealed that Cyt1Aa binding to Aedes aegypti brush border membrane vesicles enhanced the binding of biotinylated-Cry11Aa. The Cyt1Aa- and Cry11Aa-binding epitopes were mapped by means of the yeast two-hybrid system, peptide arrays, and heterologous competition assays with synthetic peptides. Two exposed regions in Cyt1Aa, loop beta6-alphaE and part of beta7, bind Cry11Aa. On the other side, Cry11Aa binds Cyt1Aa proteins by means of domain II-loop alpha8 and beta-4, which are also involved in midgut receptor interaction. Characterization of single-point mutations in Cry11Aa and Cyt1Aa revealed key Cry11Aa (S259 and E266) and Cyt1Aa (K198, E204 and K225) residues involved in the interaction of both proteins and in synergism. Additionally, a Cyt1Aa loop beta6-alphaE mutant (K198A) with enhanced synergism to Cry11Aa was isolated. Data provided here strongly indicates that Cyt1Aa synergizes or suppresses resistance to Cry11Aa toxin by functioning as a membrane-bound receptor. Bacillus thuringiensis subsp. israelensis is a highly effective pathogenic bacterium because it produces a toxin and also its functional receptor, promoting toxin binding to the target membrane and causing toxicity. PMID:16339907

  6. Sources of household salt in South Africa.

    Science.gov (United States)

    Jooste, Pieter L

    2005-01-01

    Marketing of non-iodized salt through unconventional distribution channels is one of the factors weakening the national salt iodization program in South Africa. The aim of this study was therefore to quantify the various sources of household salt, and to relate this information to socio-economic status. Questionnaire information was collected by personal interview during home visits from a multistage, cluster, probability sample of 2164 adults representative of the adult population. Nationally 77.7% of households obtained their table salt from the typical food shops distributing iodized salt. However, in the nine different provinces between 8 and 37.3% of households used unconventional sources, distributing mainly non-iodized salt, to obtain their household salt. These alternative sources include distributors of agricultural salt, small general dealer shops called spaza shops, in peri-urban and rural townships, street vendors and salt saches placed in the packaging of maize meal bags. Country-wide around 30% of low socio-economic households obtained their salt from unconventional sources compared to less than 5% in high socio-economic households, emphasizing the vulnerability of low socio-economic groups to the use of non-iodized salt. Intervention strategies should mobilize all role players involved in unconventional marketing channels of household salt to provide only iodized salt to consumers, as required by law. PMID:15927933

  7. ASSESSMENT OF HOUSEHOLD CARBON FOOTPRINT REDUCTION POTENTIALS

    Energy Technology Data Exchange (ETDEWEB)

    Kramer, Klaas Jan; Homan, Greg; Brown, Rich; Worrell, Ernst; Masanet, Eric

    2009-04-15

    The term ?household carbon footprint? refers to the total annual carbon emissions associated with household consumption of energy, goods, and services. In this project, Lawrence Berkeley National Laboratory developed a carbon footprint modeling framework that characterizes the key underlying technologies and processes that contribute to household carbon footprints in California and the United States. The approach breaks down the carbon footprint by 35 different household fuel end uses and 32 different supply chain fuel end uses. This level of end use detail allows energy and policy analysts to better understand the underlying technologies and processes contributing to the carbon footprint of California households. The modeling framework was applied to estimate the annual home energy and supply chain carbon footprints of a prototypical California household. A preliminary assessment of parameter uncertainty associated with key model input data was also conducted. To illustrate the policy-relevance of this modeling framework, a case study was conducted that analyzed the achievable carbon footprint reductions associated with the adoption of energy efficient household and supply chain technologies.

  8. Information content of household-stratified epidemics.

    Science.gov (United States)

    Kinyanjui, T M; Pellis, L; House, T

    2016-09-01

    Household structure is a key driver of many infectious diseases, as well as a natural target for interventions such as vaccination programs. Many theoretical and conceptual advances on household-stratified epidemic models are relatively recent, but have successfully managed to increase the applicability of such models to practical problems. To be of maximum realism and hence benefit, they require parameterisation from epidemiological data, and while household-stratified final size data has been the traditional source, increasingly time-series infection data from households are becoming available. This paper is concerned with the design of studies aimed at collecting time-series epidemic data in order to maximize the amount of information available to calibrate household models. A design decision involves a trade-off between the number of households to enrol and the sampling frequency. Two commonly used epidemiological study designs are considered: cross-sectional, where different households are sampled at every time point, and cohort, where the same households are followed over the course of the study period. The search for an optimal design uses Bayesian computationally intensive methods to explore the joint parameter-design space combined with the Shannon entropy of the posteriors to estimate the amount of information in each design. For the cross-sectional design, the amount of information increases with the sampling intensity, i.e., the designs with the highest number of time points have the most information. On the other hand, the cohort design often exhibits a trade-off between the number of households sampled and the intensity of follow-up. Our results broadly support the choices made in existing epidemiological data collection studies. Prospective problem-specific use of our computational methods can bring significant benefits in guiding future study designs. PMID:27663787

  9. Information content of household-stratified epidemics

    Directory of Open Access Journals (Sweden)

    T.M. Kinyanjui

    2016-09-01

    Full Text Available Household structure is a key driver of many infectious diseases, as well as a natural target for interventions such as vaccination programs. Many theoretical and conceptual advances on household-stratified epidemic models are relatively recent, but have successfully managed to increase the applicability of such models to practical problems. To be of maximum realism and hence benefit, they require parameterisation from epidemiological data, and while household-stratified final size data has been the traditional source, increasingly time-series infection data from households are becoming available. This paper is concerned with the design of studies aimed at collecting time-series epidemic data in order to maximize the amount of information available to calibrate household models. A design decision involves a trade-off between the number of households to enrol and the sampling frequency. Two commonly used epidemiological study designs are considered: cross-sectional, where different households are sampled at every time point, and cohort, where the same households are followed over the course of the study period. The search for an optimal design uses Bayesian computationally intensive methods to explore the joint parameter-design space combined with the Shannon entropy of the posteriors to estimate the amount of information in each design. For the cross-sectional design, the amount of information increases with the sampling intensity, i.e., the designs with the highest number of time points have the most information. On the other hand, the cohort design often exhibits a trade-off between the number of households sampled and the intensity of follow-up. Our results broadly support the choices made in existing epidemiological data collection studies. Prospective problem-specific use of our computational methods can bring significant benefits in guiding future study designs.

  10. The Household Market for Electric Vehicles: Testing the Hybrid Household Hypothesis -- A Reflexively Designed Survey of New-Car-Buying Multi-Vehicle California Households

    OpenAIRE

    Turrentine, Thomas; Kurani, Kenneth S

    2001-01-01

    We report the results of a survey of the potential demand for electric vehicles (EVs) among a subset of California households. We limit our analysis to one group of potential hybrid households. These households own two or more light duty vehicles and buy new vehicles of the body styles we expect will be offered as electric vehicles. These characteristics identify households who may be able to incorporate at least one limited range vehicle into their household vehicle holdings with no, or mini...

  11. Effects of applied potential on the stress corrosion cracking behavior of 7003 aluminum alloy in acid and alkaline chloride solutions

    Science.gov (United States)

    Zhang, Xiao-yan; Song, Ren-guo; Sun, Bin; Lu, Hai; Wang, Chao

    2016-07-01

    Potentiodynamic polarization tests and slow strain rate test (SSRT) in combination with fracture morphology observations were conducted to investigate the stress corrosion cracking (SCC) behavior of 7003 aluminum alloy (AA7003) in acid and alkaline chloride solutions under various applied potentials ( E a). The results show that AA7003 is to a certain extent susceptible to SCC via anodic dissolution (AD) at open-circuit potential (OCP) and is highly susceptible to hydrogen embrittlement (HE) at high negative E a in the solutions with pH levels of 4 and 11. The susceptibility increases with negative shift in the potential when E a is less than -1000 mV vs. SCE. However, the susceptibility distinctly decreases because of the inhibition of AD when E a is equal to -1000 mV vs. SCE. In addition, the SCC susceptibility of AA7003 in the acid chloride solution is higher than that in the alkaline solution at each potential. Moreover, the effect of hydrogen on SCC increases with increasing hydrogen ion concentration.

  12. Characterization of household waste in Greenland

    DEFF Research Database (Denmark)

    Eisted, Rasmus; Christensen, Thomas Højlund

    2011-01-01

    by magazine type paper) and glass (7%) were other important material fractions of the household waste. The remaining approximately 10% constituted of steel (1.5%), aluminum (0.5%), plastic (2.4%), wood (1.0%), non-combustible waste (1.8%) and household hazardous waste (1.2%). The high content of biowaste...... and the low content of paper make Greenlandic waste much different from Danish household waste. The moisture content, calorific value and chemical composition (55 elements, of which 22 were below detection limits) were determined for each material fraction. These characteristics were similar to what has been...

  13. Raising household saving: does financial education work?

    Science.gov (United States)

    Gale, William G; Harris, Benjamin H; Levine, Ruth

    2012-01-01

    This article highlights the prevalence and economic outcomes of financial illiteracy among American households, and reviews previous research that examines how improving financial literacy affects household saving. Analysis of the research literature suggests that previous financial literacy efforts have yielded mixed results. Evidence suggests that interventions provided for employees in the workplace have helped increase household saving, but estimates of the magnitude of the impact vary widely. For financial education initiatives targeted to other groups, the evidence is much more ambiguous, suggesting a need for more econometrically rigorous evaluations.

  14. Spending Time and Money within the Household

    DEFF Research Database (Denmark)

    Browning, Martin; Gørtz, Mette

    2012-01-01

    We consider, both theoretically and empirically, the allocation of time and money within the household. The research question is whether a married person who enjoys more leisure than their partner also receives more consumption (which seems to indicate the outcome of power within the household......) or receives less consumption (which seems to indicate differing intrahousehold preferences). We develop a simple parametric structural model with household production that is tested on survey data. We find that relative wages have an impact on power. For leisure, this effect is dominated by a conventional...

  15. Substitution between cars within the household

    DEFF Research Database (Denmark)

    De Borger, Bruno; Mulalic, Ismir; Rouwendal, Jan

    The purpose of this paper is to study to what extent two-car households substitute the use of their less fuel efficient car by the use of their more fuel efficient car after an increase in fuel prices. Based on a simple theoretical framework we use a large sample of detailed Danish data on two-car...... households to estimate, for each car owned by the household, own and cross-price effects of increases in fuel costs per kilometer. The empirical results point at important substitution effects, so that models that estimate responses to fuel prices on the implicit or explicit assumption of one car per...

  16. Price elasticity of household fuel comsumption

    OpenAIRE

    Clerc, M.; Marcus, V.

    2009-01-01

    The high levels reached by world oil prices and fuel prices in mid 2008 have raised notable concerns about the risk of future significant drops in household purchasing power. In the framework of a national strategy to reduce CO2 emissions, a tax reform on fossil fuels is also being studied. In this context, this paper aims to identify the categories of households that are most exposed to an energy-price increase and to assess the sensitivity of household consumption to changes in fuel prices ...

  17. Cloning and sequence analysis of complete gene encoding an alkaline lipase from Penicillium cyclopium.

    Science.gov (United States)

    Zhang, H M; Wu, M C; Guo, J; Li, J F

    2011-01-01

    The complete gene (PG37 lipI) encoding an alkaline lipase (PG37 LipI) was cloned from the genomic DNA of Penicillium cyclopium PG37. The cloned PG37 lipI is 2020 bp in length, consisting of 632 bp of the 5' flanking promoter region and 1388 bp of the downstream fragment that contains 6 exons and 5 short introns. The promoter region harbors putative TATA box, CAAT box and several transcription factor binding sites. The open reading frame (ORF) encodes a PG37 LipI of 285 amino acid residues, which was predicted to contain a 20-aa signal peptide, a 7-aa propeptide and a 258-aa mature peptide with a conserved motif Gly-X-Ser-X-Gly. However, PG37 LipI shows only 32%, 30%, 28% and 26% identity with lipases of Aspergillus parasiticus, Penicillium camembertii, Thermomyces lanuginosus and Rhizomucor miehei, respectively. It was predicted that the main secondary structures of PG37 LipI are alpha-helix and random coil. Three amino acid residues, Ser132-Asp188-His241, compose the enzymatic active center in the tertiary structure. PMID:22288192

  18. Alkaline sorbent injection for mercury control

    Science.gov (United States)

    Madden, Deborah A.; Holmes, Michael J.

    2003-01-01

    A mercury removal system for removing mercury from combustion flue gases is provided in which alkaline sorbents at generally extremely low stoichiometric molar ratios of alkaline earth or an alkali metal to sulfur of less than 1.0 are injected into a power plant system at one or more locations to remove at least between about 40% and 60% of the mercury content from combustion flue gases. Small amounts of alkaline sorbents are injected into the flue gas stream at a relatively low rate. A particulate filter is used to remove mercury-containing particles downstream of each injection point used in the power plant system.

  19. Inorganic-organic separators for alkaline batteries

    Science.gov (United States)

    Sheibley, D. W. (Inventor)

    1978-01-01

    A flexible separator is reported for use between the electrodes of Ni-Cd and Ni-Zn batteries using alkaline electrolytes. The separator was made by coating a porous substrate with a battery separator composition. The coating material included a rubber-based resin copolymer, a plasticizer and inorganic and organic fillers which comprised 55% by volume or less of the coating as finally dried. One or more of the filler materials, whether organic or inorganic, is preferably active with the alkaline electrolyte to produce pores in the separator coating. The plasticizer was an organic material which is hydrolyzed by the alkaline electrolyte to improve conductivity of the separator coating.

  20. Storage Stability Improvement of Copolymer Grafted Polypropylene-AcrylicAcid (PP-AA), by means of Various After Treatment Processes

    International Nuclear Information System (INIS)

    Polypropylene yams that have been subjected to irradiation induced graftco-polymerization with acrylic acid, have gained its moisture regain and dyeability, that fulfilled the requirement as textile material for garment.However, the copolymer grafted PP-AA has suffered from degradation in thestorage, which was indicated in the previous study that the strengthretention has dropped tremendously by photo-oxidation or photo-degradation.After treatments of PP-AA yams with chemical compound that was able toprevent further photo-oxidation, will be expected to improve the stability ofPP-AA in storage. In this research activity, the polypropylene (PP) yams weresubjected to irradiation induced graft co-polymerization by means ofγ-Ray Co-60 as irradiation source with acrylic acid (AA) as monomer.Various after treatments were subjected to the grafted PP-AA yams such asalkalisation process; dyeing (anionic dyes, cationic dyes and nonionic dyes);as well as processing with optical brightening agent and UV stabilizer,separately. The PP-AA yams (before and after treatment) were subjected tostorage from 1 month up to 42 months, and then being tested for theirmoisture regain, strength retention and elongation at breaks. The samplesbeing stored for 12 months were subjected to radical analysis. It isconcluded from the experiment that after treatment of grafted PP-AA by meansof those various processes were able to improve the stability of copolymergrafted PP-AA in storage. The presence of peroxide radical in the ESR(electron spin resonance) spectrum on PP-AA yams before treatment and theones after treated with alkaline and being stored for 12 months haveindicated the presence of photo oxidation or photo degradation, while thepresence of poly enyl radical in the ESR spectrum of after treated PP-AA withdyes having azo and azine compound as chromophore, as well as with UVstabilizer with carbonyl as chromophore and being stored for 12 months haveproved that its presence have protected such

  1. Household wealth and child health in India.

    Science.gov (United States)

    Chalasani, Satvika; Rutstein, Shea

    2014-03-01

    Using data from the Indian National Family Health Surveys (1992-93, 1998-99, 2005-06), this study examined how the relationship between household wealth and child health evolved during a time of significant economic change in India. The main predictor was an innovative measure of household wealth that captures changes in wealth over time. Discrete-time logistic models (with community fixed effects) were used to examine mortality and malnutrition outcomes: infant, child, and under-5 mortality; stunting, wasting, and being underweight. Analysis was conducted at the national, urban/rural, and regional levels, separately for boys and girls. The results indicate that the relationship between household wealth and under-5 mortality weakened over time but this result was dominated by infant mortality. The relationship between wealth and child mortality stayed strong for girls. The relationship between household wealth and malnutrition became stronger over time for boys and particularly for girls, in urban and (especially) rural areas.

  2. Household energy consumption and expenditures 1993

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-10-05

    This presents information about household end-use consumption of energy and expenditures for that energy. These data were collected in the 1993 Residential Energy Consumption Survey; more than 7,000 households were surveyed for information on their housing units, energy consumption and expenditures, stock of energy-consuming appliances, and energy-related behavior. The information represents all households nationwide (97 million). Key findings: National residential energy consumption was 10.0 quadrillion Btu in 1993, a 9% increase over 1990. Weather has a significant effect on energy consumption. Consumption of electricity for appliances is increasing. Houses that use electricity for space heating have lower overall energy expenditures than households that heat with other fuels. RECS collected data for the 4 most populous states: CA, FL, NY, TX.

  3. Substitution between Cars within the Household

    DEFF Research Database (Denmark)

    de Borger, Bruno; Mulalic, Ismir; Rouwendal, Jan

    In this paper we study the demand for car kilometres in two-car households, focusing on the substitution between cars in response to fuel price changes. We use a large sample of detailed Danish data on two-car households to estimate—for each car owned by the household—own and cross-price effects...... of increases in fuel costs per kilometre. The empirical results show that failure to capture substitution between cars within the household can result in substantial misspecification biases. Ignoring substitution, we estimate fuel price elasticities of –0.81 and -0.65 for the primary and secondary cars...... efficient car, finding partial support for the underlying hypothesis. More importantly, the results of this extended model emphasize the importance of behavioural differences related to the position of the most fuel efficient car in the household, suggesting that households’ fuel efficiency choices...

  4. Substitution between cars within the household

    DEFF Research Database (Denmark)

    De Borger, Bruno; Mulalic, Ismir; Rouwendal, Jan

    2016-01-01

    In this paper we study the demand for car kilometres in two-car households, focusing on the substitution between cars of different fuel efficiency in response to fuel price changes. We use a large sample of detailed Danish data on two-car households to estimate – for each car owned by the household...... – own and cross-price effects of increases in fuel costs per kilometre. The empirical results show that failure to capture substitution between cars within the household can result in substantial misspecification biases. Ignoring substitution, the basic model yielded fuel price elasticities of 0.......98 and 1.41 for the primary and secondary cars, respectively. Accounting for substitution effects, these figures reduce to, respectively, 0.32 and 0.45. Consistent with substitution behaviour, we find that the fuel price elasticity of fuel demand exceeds the elasticity of kilometre demands with respect...

  5. Medical Expenditure Panel Survey Household Component

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Medical Expenditure Panel Survey (MEPS) Household Component (HC) collects data from a sample of families and individuals in selected communities across the...

  6. Household Formation, Poverty and Unemployment – The Case of Rural Households in South Africa

    OpenAIRE

    Sonja Keller

    2004-01-01

    The paper examines household formation and composition decisions within the context of risk reduction and risk mitigation strategies of the poor in South Africa. A multi-level heckprobit estimator is employed in order to capture the influence of various factors at the individual, household and regional level, and we focus on the implications of the presence of pensioners and the unemployment on household composition and structure. Results are consistent with earlier findings that pensions are...

  7. The World Distribution of Household Wealth

    OpenAIRE

    James B. Davies; Sandström, Susanna; Shorrocks, Anthony; Wolff, Edward N.

    2007-01-01

    There has been much recent research on the world distribution of income, but also growing recognition of the importance of other contributions to well-being, including those of household wealth. Wealth is important in providing security and opportunity, particularly in poorer countries that lack full social safety nets and adequate facilities for borrowing and lending. We find, however, that it is precisely in the latter countries where household wealth is the lowest, both in absolute and rel...

  8. A Comparison of Farm and Nonfarm Households

    OpenAIRE

    Katchova, Ani L.

    2005-01-01

    This study compares the economic well-being of farm and nonfarm households using data from the 2001 Agricultural Resource Management Survey and the 2001 Survey of Consumer Finances. Comparisons are made in terms of income and wealth using Tukey-Kramer mean separation tests, regression analysis, and Gini coefficients. The results show that income and wealth of rural residence and intermediate farms are comparable to those of nonfarm households without businesses, while the well-being of commer...

  9. Banded Householder representation of linear subspaces

    CERN Document Server

    Irving, Geoffrey

    2011-01-01

    We show how to compactly represent any $n$-dimensional subspace of $R^m$ as a banded product of Householder reflections using $n(m - n)$ floating point numbers. This is optimal since these subspaces form a Grassmannian space $Gr_n(m)$ of dimension $n(m - n)$. The representation is stable and easy to compute: any matrix can be factored into the product of a banded Householder matrix and a square matrix using two to three QR decompositions.

  10. Researches of odour emitted by household waste

    OpenAIRE

    Eglė Marčiulaitienė; Tadas Lukauskas

    2015-01-01

    The article deals with odour emitted by household waste, the chemical composition of household waste. The experiment was made with food waste (1000 g) placed in 5 litter containers. Food waste was containing products of animal origin (meat, fish, dairy products) and plant origin (vegetables, fruit) waste. Time of the experiment was 14 days 19±3 °C at environment temperature. Odour concentration is determined by dynamic olfactometry method. Studies have shown that the strongest odour of all ho...

  11. Equity in dental care among Canadian households

    OpenAIRE

    Grootendorst Paul; Quiñonez Carlos

    2011-01-01

    Abstract Background Changes in third party financing, whether public or private, are linked to a household's ability to access dental care. By removing costs at point of purchase, changes in financing influence the need to reach into one's pocket, thus facilitating or limiting access. This study asks: How have historical changes in dental care financing influenced household out-of-pocket expenditures for dental care in Canada? Methods This is a mixed methods study, comprised of an historical ...

  12. Do disaster expectations explain household portfolios?

    OpenAIRE

    Alan, Sule

    2012-01-01

    Quantitative Economics 3 (2012), 1–28 1759-7331/20120001 Do disaster expectations explain household portfolios? Sule Alan Faculty of Economics and CFAP, University of Cambridge and College of Administrative Sciences, Koc University It has been argued that rare economic disasters can explain most asset pricing puzzles. If this is the case, perceived risk associated with a disaster in stock mar-kets should be revealed in household portfolios. That is, the framework that sol...

  13. Rising Food Insecurity: Dimensions in Farm Households

    OpenAIRE

    Okezie C. Austin; Aloysius C. Nwosu; Amir H. Baharuddin

    2011-01-01

    Problem statement: Nigeria runs the risk of slowing further progress toward the achievement of MDG-1 to eradicate extreme hunger and poverty; the fourth goal, to reduce child mortality since over 30% of child deaths are attributable to malnutrition and the fifth goal relating to reduction in maternal mortality. This study evaluated the manifestation of food insecurity in households in Abia State, Nigeria. Approach: Systematic sampling was adopted in selecting households from the three geopoli...

  14. Sustainable reverse logistics for household plastic waste

    OpenAIRE

    Bing, X.

    2014-01-01

    Summary of the thesis titled “Sustainable Reverse Logistics for Household Plastic Waste” PhD Candidate: Xiaoyun Bing Recycled plastic can be used in the manufacturing of plastic products to reduce the use of virgin plastics material. The cost of recycled plastics is usually lower than that of virgin plastics. Therefore, it is environmentally and economically beneficial to improve the plastic recycling system to ensure more plastic waste from households is properly collected and pr...

  15. Household transitions to energy efficient lighting

    OpenAIRE

    Mills, Bradford; Schleich, Joachim

    2014-01-01

    New energy efficient lighting technologies have the potential to significantly reduce household electricity consumption. But adoption of many technologies has been slow. This paper employs a unique dataset of German households to examine the factors associated with the replacement of old incandescent lamps (ILs) with new energy efficient compact fluorescent lamps (CFLs) and light emitting diodes (LEDs). The 'rebound' effect of increased light luminosity during the transition to energy efficie...

  16. Modeling Social Ties and Household Mobility

    OpenAIRE

    Metcalf, Sara S.

    2013-01-01

    Underlying the aggregate phenomena of persistent problems such as urban sprawl and spatial socio-economic disparity is the individual choice of where to live. This study develops an agent-based model to simulate social and economic influences on neighborhood choice. With Danville, Illinois as an empirical context, a pattern-oriented approach is employed to examine the role of social ties in shaping intra-urban household mobility. In the model, household agents decide whether and where to relo...

  17. Technetium recovery from high alkaline solution

    Science.gov (United States)

    Nash, Charles A.

    2016-07-12

    Disclosed are methods for recovering technetium from a highly alkaline solution. The highly alkaline solution can be a liquid waste solution from a nuclear waste processing system. Methods can include combining the solution with a reductant capable of reducing technetium at the high pH of the solution and adding to or forming in the solution an adsorbent capable of adsorbing the precipitated technetium at the high pH of the solution.

  18. Alkaline tolerant dextranase from streptomyces anulatus

    Science.gov (United States)

    Decker, Stephen R.; Adney, William S.; Vinzant, Todd B.; Himmel, Michael E.

    2003-01-01

    A process for production of an alkaline tolerant dextranase enzyme comprises culturing a dextran-producing microorganism Streptomyces anulatus having accession no. ATCC PTA-3866 to produce an alkaline tolerant dextranase, Dex 1 wherein the protein in said enzyme is characterized by a MW of 63.3 kDa and Dex 2 wherein its protein is characterized by a MW of 81.8 kDa.

  19. Chemical Associations of Lead, Cadmium, Chromium, Nickel and Zinc in Household Dust of Kathmandu Metropolitan Area

    International Nuclear Information System (INIS)

    Dust samples were collected from roadside houses of seven major locations in Kathmandu metropolitan area and trace element compositions was determined by atomic absorption spectrophotometer (AAS). Results show significant concentrations of Zn, Pb, Ni, Cr and Cd in the test household dusts as compared to the undisturbed (control) area. The mean concentrations of all the studied locations were found to be 76.2 mg/kg for Zn, 40.6 mg/kg for Pb, 29.9 mg/kg for Cr, 23.9 mg/kg for Ni and 8.2 mg/kg for Cd, respectively. Increase in these trace metals in the dust can most likely be attributed to rapid urbanization, increased vehicle emissions to the atmosphere and other anthropogenic sources. Elevated Zn abundance in household dust probably originates from traffic sources. Besides, enrichment factor reveals that the household dust was most severely affected by Cd in almost all the locations. Also, correlations between metal levels in dust samples for all the metals were investigated. (author)

  20. Domestic energy use and householders' energy behaviour

    International Nuclear Information System (INIS)

    This paper discusses domestic energy use and energy behaviour. It shows some improvement in domestic energy consumption and adoption of good energy practice. The survey conducted indicated that 35% of homes could improve their energy efficiency by improved tank insulation. In the last 5 years condensing boilers have been installed only in 3% of homes, indicating that householders are unaware of their advantages. Although 88% of surveyed homes had purchased a major appliance in the last 2 years, only 16% had any idea of the energy rating of their new appliances. Use of energy saving light bulbs is predominant in kitchens compared to other rooms. 70–80% of householders undertook some kind of day-to-day energy efficiency measures. 20–35% of householders would like to invest in energy-saving measures but found cost to be a key barrier. Approximately 84% of those surveyed were unaware of the energy rating of their household appliances. Price and brand were the most important factors determining the purchase of a new appliance. Significant energy-saving could be achieved by providing appropriate information to the general public regarding temperature control, efficiency of appliances and energy-saving heating systems. - Highlights: ▶ Good practice in household energy use is being adopted but actual use is rising. ▶ Cost is dominant in energy related decisions purchasing of household appliances. ▶ Energy behaviour is improving but level of awareness needs more work.

  1. Household energy requirement and value patterns

    International Nuclear Information System (INIS)

    For an effective consumer energy policy, it is important to know why some households require more energy than others. The aim of the study described here was to examine whether there is a relationship between the total household energy requirement, on one hand, and value patterns, the motivation to save energy or the problem perception of climate change, on the other. To examine these relationships, we held a consumer survey among 2304 respondent households. We did not find significant differences in the energy requirement of groups of households with different value patterns, taking into account the differences in the socio-economic situation of households. Only for the 'motivation to save energy' we did find that the least motivated group requires 10 GJ more energy than the average and most motivated groups; this is about 4% of the total household energy requirement. This means that a self-regulating energy policy, solely based on the fact that a strategy of internalising environmental responsibility will not be effective in saving energy. There are indications that a social dilemma is one of the reasons why people's consumption patterns do not conform to their value patterns, problem perception or motivation to save energy

  2. AA, closed orbit observation pickup

    CERN Multimedia

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. Werner Sax contemplates his achievement. See also 8001383, 8010042, 8010045.

  3. AA, closed orbit observation pickup

    CERN Multimedia

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles QFW, at maximum dispersion. See also 8001372, 8001383, 8010045

  4. AA, closed orbit observation pickup

    CERN Multimedia

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. See also 8001372, 8010042, 8010045

  5. AA, closed orbit observation pickup

    CERN Multimedia

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles, QFW, at maximum dispersion. See also 8001372,8001383, 8010042

  6. Life cycle assessment of three different management options for spent alkaline batteries.

    Science.gov (United States)

    Xará, Susana; Almeida, Manuel Fonseca; Costa, Carlos

    2015-09-01

    The potential environmental impact of Landfilling, Incineration and Recycling of spent household alkaline batteries collected in continental Portugal was compared using LCA methodology and the Recipe Impact Assessment method. Major contributors and improvement opportunities for each system were identified and scenarios for 2012 and 2016 legislation targets were evaluated. For 13 out of the 18 impact categories, the Recycling system is the worst alternative, Incineration is the worst option for 4 and Landfill is the worst option only for one impact category. However if additionally in each system the recovery of materials and energy is taken into account there is a noticeable advantage of the Recycling system for all the impact categories. The environmental profiles for 2012 and 2016 scenarios (25% and 45% recycling rates, respectively) show the dominance of the Recycling system for most of the impact categories. Based on the results of this study, it is questioned whether there are environmental benefits of recycling abroad the household alkaline batteries collected in continental Portugal and, since the low environmental performance of the Recycling system is particularly due to the international transport of the batteries to the recycling plant, is foreseen that a recycling facility located in Portugal, could bring a positive contribution to the environmental impact of the legislation compliance. PMID:26119009

  7. Identification and estimation of a class of household production models

    NARCIS (Netherlands)

    Kerkhofs, M; Kooreman, P

    2003-01-01

    We consider a class of household production models characterized by a dichotomy property, In these models the amount of time spent on household production does not depend on the household utility function, conditional on household members having a paid job. We analyse the (non-parametric) identifiab

  8. Improved electrodes and gas impurity investigations on alkaline electrolysers

    DEFF Research Database (Denmark)

    Reissner, R.; Schiller, G.; Knoeri, T.;

    Alkaline water electrolysis for hydrogenproduction is a well-established techniquebut some technological issues regarding thecoupling of alkaline water electrolysis andRenewable Energy Sources (RES) remain tobe improved.......Alkaline water electrolysis for hydrogenproduction is a well-established techniquebut some technological issues regarding thecoupling of alkaline water electrolysis andRenewable Energy Sources (RES) remain tobe improved....

  9. 21 CFR 864.7660 - Leukocyte alkaline phosphatase test.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Leukocyte alkaline phosphatase test. 864.7660... Leukocyte alkaline phosphatase test. (a) Identification. A leukocyte alkaline phosphatase test is a device used to identify the enzyme leukocyte alkaline phosphatase in neutrophilic granulocytes...

  10. AAS 228: Day 3 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  11. AAS 228: Day 3 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  12. Integration into the South African Core Economy: Household Level Covariates

    OpenAIRE

    Sten Dieden

    2003-01-01

    The aim of this paper is to further improve the understanding of income generation among the formerly underprivileged and often impoverished majority of households in South Africa. This study uses household survey data for the analysis of households' integration into the South African core economy. The emerging picture of household income generation is one that disputes common perceptions of the multitude of means by which African households are assumed to generate their income. The majority ...

  13. Prophylactic treatment with alkaline phosphatase in cardiac surgery induces endogenous alkaline phosphatase release

    NARCIS (Netherlands)

    Kats, Suzanne; Brands, Ruud; Hamad, Mohamed A. Soliman; Seinen, Willem; Schamhorst, Volkher; Wulkan, Raymond W.; Schoenberger, Jacques P.; van Oeveren, Wim

    2012-01-01

    Introduction: Laboratory and clinical data have implicated endotoxin as an important factor in the inflammatory response to cardiopulmonary bypass. We assessed the effects of the administration of bovine intestinal alkaline phosphatase (bIAP), an endotoxin detoxifier, on alkaline phosphatase levels

  14. Household Transmission of Vibrio cholerae in Bangladesh.

    Directory of Open Access Journals (Sweden)

    Jonathan D Sugimoto

    2014-11-01

    Full Text Available Vibrio cholerae infections cluster in households. This study's objective was to quantify the relative contribution of direct, within-household exposure (for example, via contamination of household food, water, or surfaces to endemic cholera transmission. Quantifying the relative contribution of direct exposure is important for planning effective prevention and control measures.Symptom histories and multiple blood and fecal specimens were prospectively collected from household members of hospital-ascertained cholera cases in Bangladesh from 2001-2006. We estimated the probabilities of cholera transmission through 1 direct exposure within the household and 2 contact with community-based sources of infection. The natural history of cholera infection and covariate effects on transmission were considered. Significant direct transmission (p-value<0.0001 occurred among 1414 members of 364 households. Fecal shedding of O1 El Tor Ogawa was associated with a 4.9% (95% confidence interval: 0.9%-22.8% risk of infection among household contacts through direct exposure during an 11-day infectious period (mean length. The estimated 11-day risk of O1 El Tor Ogawa infection through exposure to community-based sources was 2.5% (0.8%-8.0%. The corresponding estimated risks for O1 El Tor Inaba and O139 infection were 3.7% (0.7%-16.6% and 8.2% (2.1%-27.1% through direct exposure, and 3.4% (1.7%-6.7% and 2.0% (0.5%-7.3% through community-based exposure. Children under 5 years-old were at elevated risk of infection. Limitations of the study may have led to an underestimation of the true risk of cholera infection. For instance, available covariate data may have incompletely characterized levels of pre-existing immunity to cholera infection. Transmission via direct exposure occurring outside of the household was not considered.Direct exposure contributes substantially to endemic transmission of symptomatic cholera in an urban setting. We provide the first estimate of

  15. Equity in dental care among Canadian households

    Directory of Open Access Journals (Sweden)

    Grootendorst Paul

    2011-04-01

    Full Text Available Abstract Background Changes in third party financing, whether public or private, are linked to a household's ability to access dental care. By removing costs at point of purchase, changes in financing influence the need to reach into one's pocket, thus facilitating or limiting access. This study asks: How have historical changes in dental care financing influenced household out-of-pocket expenditures for dental care in Canada? Methods This is a mixed methods study, comprised of an historical review of Canada's dental care market and an econometric analysis of household out-of-pocket expenditures for dental care. Results We demonstrate that changes in financing have important implications for out-of-pocket expenditures: with more financing come drops in the amount a household has to spend, and with less financing come increases. Low- and middle-income households appear to be most sensitive to changes in financing. Conclusions Alleviating the price barrier to care is a fundamental part of improving equity in dental care in Canada. How people have historically spent money on dental care highlights important gaps in Canadian dental care policy.

  16. Demographic and Expenditure Profiles of Zambian Households: Evidence from the June 1991 Zambian Household Expenditure and Income Survey

    OpenAIRE

    Gary Stampley

    1993-01-01

    The HEIS's linkage of household-level demographic and expenditure data for Zambia provides the foundation for an analysis of household expenditure patterns. For this report, total household expenditure was composed of two broad expenditure classifications, food and nonfood. An analytical emphasis was placed on developing the food expenditure patterns of household groups identified by various socioeconomic characteristics. In general, within the various household classifications, there were th...

  17. The Household Market for Electric Vehicles: Testing the Hybrid Household Hypothesis--A Reflively Designed Survey of New-car-buying, Multi-vehicle California Households

    OpenAIRE

    Turrentine, Thomas; Kurani, Kenneth

    1995-01-01

    We report the results of a survey of the potential demand for electric vehicles (EVs) among a subset of California households. We limit our analysis to one group of potential hybrid households. These households own two or more light duty vehicles and buy new vehicles of the body styles we expect will be offered as electric vehicles. These characteristics identify households who may be able to incorporate at least one limited range vehicle into thei...

  18. Household's use of information and communication technologies

    DEFF Research Database (Denmark)

    Jensen, Jesper Ole; Gram-Hanssen, Kirsten; Røpke, Inge;

    2009-01-01

    of theories of domestication of technologies, it is argued that aspects such as consumers' creativity in technology use and their non-adaption are relevant aspects to include in policy and regulation discussions on how to limit the escalating electricity consumption from household ICT use.......Increasing consumption of electricity due to a growing number of information and communication technology (ICT) appliances in households is a major challenge to reducing energy consumption. Several studies have predicted escalating ICT-related energy consumption, but relatively little has been said...... and done about possible initiatives to curb this increase. This paper presents results of a research project focusing on how dynamics of consumption influence household energy consumption on ICT. Results of the project include scenarios on how electricity consumption on ICT is expected to grow, suggesting...

  19. Human Capital Diversification within the Household

    DEFF Research Database (Denmark)

    Lilleør, Helene Bie

    Lack of primary schooling among rural children in developing countries is often attributed to credit constraints and household demand for child labour, implying that direct and indirect costs of schooling are high. Surprisingly few studies have considered the importance of parents' expected returns...... of investing in their childrens human capital, despite the fact that most parents rely on their children for old-age support and subsistence. In this paper, I propose an alternative model for human capital investment based on the household, rather than the individual child, incorporating the fact that parents...... bear the costs of educating all their children and face uncertainty about the level and share of future returns. This uncertainty can make it optimal for parents to ensure a certain degree of human capital diversification within the household. The model implications allow me to test whether...

  20. Household food waste in Nordic countries

    DEFF Research Database (Denmark)

    Gjerris, Mickey; Gaiani, Silvia

    2013-01-01

    This study focuses on food waste generated by households in four Nordic countries: Finland, Denmark, Norway, and Sweden. Based on existing literature we present (A) comparable data on amounts and monetary value of food waste; (B) explanations for food waste at household level; (C) a number...... of public and private initiatives at national levels aiming to reduce food waste; and (D) a discussion of ethical issues related to food waste with a focus on possible contributions from ecocentric ethics. We argue that reduction of food waste at household level, which has an impact on issues...... such as climate change and unjust distribution of food resources, needs to be based on an appreciative and relational understanding of nature and food and not only on economic and moralizing arguments. This is done by drawing on an ecocentric perspective where food is seen as one of the areas where new narratives...

  1. Electricity savings in households with everyday IT

    DEFF Research Database (Denmark)

    Kibsgaard, Kaj; Larsen, Anders; leth, Søren;

    This paper analyzes the effect of supplying online feedback by SMS-text messages and email about electricity consumption on the level of total household electricity consumption. An experiment was conducted where 1,452 households were randomly allocated to three experimental groups and two control...... groups. Feedback was supplied throughout 2007 to members of the experiment groups who accepted the invitation, and data on consumption of electricity for 2006 and 2007 collected for all participants and control group members. 30% of the households invited to receive feedback accepted the invitation....... The estimated effects of the feedback on consumption of electricity are estimated to be in the range of 2-3%. The feedback technology is cheap to implement and therefore likely to be cost-effective...

  2. Household batteries: Evaluation of collection methods

    Energy Technology Data Exchange (ETDEWEB)

    Seeberger, D.A.

    1992-01-01

    While it is difficult to prove that a specific material is causing contamination in a landfill, tests have been conducted at waste-to-energy facilities that indicate that household batteries contribute significant amounts of heavy metals to both air emissions and ash residue. Hennepin County, MN, used a dual approach for developing and implementing a special household battery collection. Alternative collection methods were examined; test collections were conducted. The second phase examined operating and disposal policy issues. This report describes the results of the grant project, moving from a broad examination of the construction and content of batteries, to a description of the pilot collection programs, and ending with a discussion of variables affecting the cost and operation of a comprehensive battery collection program. Three out-of-state companies (PA, NY) were found that accept spent batteries; difficulties in reclaiming household batteries are discussed.

  3. Household batteries: Evaluation of collection methods

    Energy Technology Data Exchange (ETDEWEB)

    Seeberger, D.A.

    1992-12-31

    While it is difficult to prove that a specific material is causing contamination in a landfill, tests have been conducted at waste-to-energy facilities that indicate that household batteries contribute significant amounts of heavy metals to both air emissions and ash residue. Hennepin County, MN, used a dual approach for developing and implementing a special household battery collection. Alternative collection methods were examined; test collections were conducted. The second phase examined operating and disposal policy issues. This report describes the results of the grant project, moving from a broad examination of the construction and content of batteries, to a description of the pilot collection programs, and ending with a discussion of variables affecting the cost and operation of a comprehensive battery collection program. Three out-of-state companies (PA, NY) were found that accept spent batteries; difficulties in reclaiming household batteries are discussed.

  4. First circulating beam in the AA

    CERN Multimedia

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.56 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are too numerous to name them all, but the 3 most prominent ones are at the centre (left to right): Roy Billinge (Joint AA Project Leader, with his hand on the control box), Eifionydd Jones (white shirt), Simon van der Meer (spiritus rector and Joint AA Project Leader). The first antiprotons were injected, made to circulate and cooled soon after, on 14 July 1980.

  5. Effect of supplementation of arachidonic acid (AA) or a combination of AA plus docosahexaenoic acid on breastmilk fatty acid composition

    NARCIS (Netherlands)

    Smit, EN; Koopmann, M; Boersma, ER; Muskiet, FAJ

    2000-01-01

    We investigated whether supplementation with arachidonic acid (20:4 omega 6; AA), ora combination of AA and docosahexaenoic acid (22:6 omega 3; DHA) would affect human milk polyunsaturated fatty acid (PUFA) composition. Ten women were daily supplemented with 300 mg AA, eight with 300 mg AA, 110 mg e

  6. Targeting antibiotics to households for trachoma control.

    Directory of Open Access Journals (Sweden)

    Isobel M Blake

    Full Text Available BACKGROUND: Mass drug administration (MDA is part of the current trachoma control strategy, but it can be costly and results in many uninfected individuals receiving treatment. Here we explore whether alternative, targeted approaches are effective antibiotic-sparing strategies. METHODOLOGY/PRINCIPAL FINDINGS: We analysed data on the prevalence of ocular infection with Chlamydia trachomatis and of active trachoma disease among 4,436 individuals from two communities in The Gambia (West Africa and two communities in Tanzania (East Africa. An age- and household-structured mathematical model of transmission was fitted to these data using maximum likelihood. The presence of active inflammatory disease as a marker of infection in a household was, in general, significantly more sensitive (between 79% [95%CI: 60%-92%] and 86% [71%-95%] across the four communities than as a marker of infection in an individual (24% [16%-33%]-66% [56%-76%]. Model simulations, under the best fit models for each community, showed that targeting treatment to households has the potential to be as effective as and significantly more cost-effective than mass treatment when antibiotics are not donated. The cost (2007US$ per incident infection averted ranged from 1.5 to 3.1 for MDA, from 1.0 to 1.7 for household-targeted treatment assuming equivalent coverage, and from 0.4 to 1.7 if household visits increased treatment coverage to 100% in selected households. Assuming antibiotics were donated, MDA was predicted to be more cost-effective unless opportunity costs incurred by individuals collecting antibiotics were included or household visits improved treatment uptake. Limiting MDA to children was not as effective in reducing infection as the other aforementioned distribution strategies. CONCLUSIONS/SIGNIFICANCE: Our model suggests that targeting antibiotics to households with active trachoma has the potential to be a cost-effective trachoma control measure, but further work is

  7. Materiality and automation of household practices

    DEFF Research Database (Denmark)

    Christensen, Toke Haunstrup; Friis, Freja

    2016-01-01

    from a Danish household trial that combined static time-of-use pricing with electric vehicles. On the basis of the empirical findings from qualitative interviews, the paper discusses what role materiality plays in the interviewed households’ experiences with time shifting their electricity......-)automatization. In addition, the empirical findings indicate that not only the specific design of technologies but also the general materiality and physical layout of the home influence to what extent the households did time shift their practices. This also points to the importance of recognising how everyday practices...

  8. Household and Small Business Across the Disciplines

    Directory of Open Access Journals (Sweden)

    Nicoletta Stame

    2015-08-01

    Full Text Available Households, which are seen as income pooling units (Wallerstein, Martin, Dickinson 1982, play a crucial role in the world-system analysis. Individuals enjoy income that accrues to their households, a unit embedded in a network of different social relationships among people, kin or not kin, living under the same roof or sharing some important living function. Thus, social relations are seen as ways of obtaining different types of income (wages, rent, pro?t, social exchange, gifts and ways of ensuring different welfare services.

  9. An inquiry into the household economy

    Science.gov (United States)

    Samuelson, R. D.

    1979-01-01

    The value of the time which people devote to each activity of their lives is compared with the money they spend on the activity. After tax wage rates are used to value an individual's time. The enormous size of the household economy and the fact that for most activities the value of the consumer's time devoted to an activity exceeds the money expenditures on the activity, suggest that there are many opportunities for productivity improvements in the household economy which have been overlooked in most traditional thinking on productivity.

  10. Specific Examples of Hybrid Alkaline Cement

    OpenAIRE

    Fernández-Jiménez Ana; García-Lodeiro Inés; Donatello Shane; Maltseva Olga; Palomo Ángel

    2014-01-01

    Hybrid alkaline cements are obtained by alkali-activating cementitious blends in the Na2O-CaO-SiO2-Al2O3-H2O system. The present paper discusses the results of activating different cementitious blends containing a low OPC clinker content ( 15MPa a 2 days) different alkaline activators were used (liquid and solid). The reaction products obtained were also characterised by XRD, SEM/EDX and 27Al and 29Si NMRMAS. The results showed that the main reaction product was a mix of cementitious gels C-A...

  11. Alkaline Capacitors Based on Nitride Nanoparticles

    Science.gov (United States)

    Aldissi, Matt

    2003-01-01

    High-energy-density alkaline electrochemical capacitors based on electrodes made of transition-metal nitride nanoparticles are undergoing development. Transition- metal nitrides (in particular, Fe3N and TiN) offer a desirable combination of high electrical conductivity and electrochemical stability in aqueous alkaline electrolytes like KOH. The high energy densities of these capacitors are attributable mainly to their high capacitance densities, which, in turn, are attributable mainly to the large specific surface areas of the electrode nanoparticles. Capacitors of this type could be useful as energy-storage components in such diverse equipment as digital communication systems, implanted medical devices, computers, portable consumer electronic devices, and electric vehicles.

  12. Alkaline earth filled nickel skutterudite antimonide thermoelectrics

    Science.gov (United States)

    Singh, David Joseph

    2013-07-16

    A thermoelectric material including a body centered cubic filled skutterudite having the formula A.sub.xFe.sub.yNi.sub.zSb.sub.12, where A is an alkaline earth element, x is no more than approximately 1.0, and the sum of y and z is approximately equal to 4.0. The alkaline earth element includes guest atoms selected from the group consisting of Be, Mb, Ca, Sr, Ba, Ra and combinations thereof. The filled skutterudite is shown to have properties suitable for a wide variety of thermoelectric applications.

  13. Electrochemical behaviour of alkaline copper complexes

    Indian Academy of Sciences (India)

    C L Aravinda; S M Mayanna; V R Muralidharan

    2000-10-01

    A search for non-cyanide plating baths for copper resulted in the development of alkaline copper complex baths containing trisodium citrate [TSC] and triethanolamine [TEA]. Voltammetric studies were carried out on platinum to understand the electrochemical behaviour of these complexes. In TSC solutions, the deposition of copper involves the slow formation of a monovalent species. Adsorption of this species obeys Langmuir isotherm. In TEA solutions the deposition involves the formation of monovalent ions obeying the non-activated Temkin isotherm. Conversion of divalent to monovalent copper is also slow. In TEA and TSC alkaline copper solutions, the predominant species that undergo stepwise reduction contain only TEA ligands

  14. Friction Stir Weldabilities of AA1050-H24 and AA6061-T6 Aluminum Alloys

    Institute of Scientific and Technical Information of China (English)

    Huijie LIU; Hidetoshi FUJIN; Masakatsu MAEDA; Kiyoshi NOGI

    2005-01-01

    The friction stir weldabilities of the strain-hardened AA1050-H24 and precipitate-hardened AA6061-T6 aluminum alloys were examined to reveal the effects of material properties on the friction stir welding behavior. The experimental results are obtlained. (1) For AA1050-H24, the weld can possess smoother surface ripples; there is no elliptical weld nugget in the weld; there is no discernible interface between the stir zone and the thermomechanically affected zone;and the internal defect of the weld looks like a long crack and is located in the lower part of the weld. (2) For AA6061-T6, the weld usually possesses slightly rougher surface ripples; an elliptical weld nugget clearly exists in the weld; there are discernible interfaces among the weld nugget, thermomechanically affected zone and heat affected zone; and the internal defect of the weld is similar to that of the AA1050-H24 weld. (3) The effective range of welding parameters for AA1050-H24 is narrow, while the one for AA6061-T6 is very wide. (4) The maximum tensile strength efficiency of the AA1050-H24 joints is similar to that of the AA6061-T6 joints, i.e. 79% and 77%, respectively.

  15. Personal exposure to household particulate matter, household activities and heart rate variability among housewives.

    Directory of Open Access Journals (Sweden)

    Ya-Li Huang

    Full Text Available BACKGROUND: The association between indoor air pollution and heart rate variability (HRV has been well-documented. Little is known about effects of household activities on indoor air quality and HRV alteration. To investigate changes in HRV associated with changes in personal exposure to household particulate matter (PM and household activities. METHODS: We performed 24-h continuous monitoring of electrocardiography and measured household PM exposure among 50 housewives. The outcome variables were log10-transformed standard deviation of normal-to-normal (NN intervals (SDNN and the square root of the mean of the sum of the squares of differences between adjacent NN intervals (r-MSSD. Household PM was measured as the mass concentration of PM with an aerodynamic diameter <2.5 µm (PM2.5. We used mixed-effects models to examine the association between household PM2.5 exposure and log10-transformed HRV indices. RESULTS: After controlling for potential confounders, an interquartile range change in household PM2.5 with 1- to 4-h mean was associated with 1.25-4.31% decreases in SDNN and 0.12-3.71% decreases in r-MSSD. Stir-frying, cleaning with detergent and burning incense may increase household PM2.5 concentrations and modify the effects of household PM2.5 on HRV indices among housewives. CONCLUSIONS: Indoor PM2.5 exposures were associated with decreased SDNN and r-MSSD among housewives, especially during stir-frying, cleaning with detergent and burning incense.

  16. Measures of Farm Household Well-Being Tell Different Stories

    OpenAIRE

    Jones, Carol Adaire; Milkove, Daniel

    2010-01-01

    Traditionally, the economic well-being of households is gauged by indicators of the financial resources available–— household income and, when available, wealth. ERS publishes estimates of farm household income and wealth based on responses to USDA’s annual Agricultural Resource Management Survey (ARMS). Since 1998, average farm operator household income has exceeded that of the typical U.S. household by 3 to 21 percent, and median farm household wealth has been 4-5 times that of all U....

  17. The power of alternative assessments (AAs)

    Institute of Scientific and Technical Information of China (English)

    张千茜

    2013-01-01

    This article starts by discussing the potential disadvantages of traditional assessment towards young English as a Second Language (ESL) learners within the American public school education system. In response to such disadvantages, researchers ’call for the implementation of alternative assessments (AAs) is therefore introduced along with the various benefits of AAs. However, the current mainstream education policy in the US, namely No Child Left Behind (NCLB) Policy, is still largely based on the tra-ditional ways of testing, making policy-oriented implementation of AAs on large scales remarkably difficult. After careful analysis, the author points out several implications concerning how, under such an existing policy of NCLB, can practitioners effectively accommodate young ESL learners by applying the power of AAs.

  18. CALCULATING AUSTRALIA'S GROSS HOUSEHOLD PRODUCT: MEASURING THE ECONOMIC VALUE OF THE HOUSEHOLD ECONOMY 1970-2000

    OpenAIRE

    FAYE SOUPOURMAS; DUNCAN IRONMONGER

    2002-01-01

    This paper presents estimates for a thirty year period of Australia’s Gross Household Product (GHP), the economic value added by unpaid labour and the households own capital. In 2000 GHP was estimated to be worth $471 billion. Gross Market Product (GDP minus the imputed value of owner-occupied housing) was worth $604 billion in 2000. The household economy was nearly 80 per cent of the size of the market economy in 2000. More importantly, the GHP is nearly half (44%) of total economic activity...

  19. Dicty_cDB: FCL-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA03 (Link to dictyBase) - - - Contig-U15092-1 FCL-AA03E ...(Link to Original site) - - - - - - FCL-AA03E 627 Show FCL-AA03 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA03Q.Seq.d/ Representative seq. ID FCL-AA...03E (Link to Original site) Representative DNA sequence >FCL-AA03 (FCL-AA03Q) /CSM/FCL/FCL-AA/FCL-AA...03Q.Seq.d/ ACATAATGTTCCAAAAGAAAGCAATTGTTATTGATGGCAAAGGTCATTTGTTAGGTCGTT TAGCCTCCGTTGTTGCTAAATCCCTCCTCTCTGGTCAAAA

  20. Dicty_cDB: FCL-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA02 (Link to dictyBase) - - - Contig-U16560-1 FCL-AA02F ...(Link to Original site) FCL-AA02F 620 - - - - - - Show FCL-AA02 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ Representative seq. ID FCL-AA...02F (Link to Original site) Representative DNA sequence >FCL-AA02 (FCL-AA02Q) /CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ ATTAA...ATACAAAATACAAATACAAATAACAAATACTTTACTATAGCTTTTTTTTCTTATT TATTTCTCCAAATAATTTTTTAATATGCAAATCTTTGTTAAAA

  1. Dicty_cDB: FCL-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA09 (Link to dictyBase) - - - Contig-U16453-1 FCL-AA09F ...(Link to Original site) FCL-AA09F 485 - - - - - - Show FCL-AA09 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ Representative seq. ID FCL-AA...09F (Link to Original site) Representative DNA sequence >FCL-AA09 (FCL-AA09Q) /CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ GACAA...AAGTAAATAAAACATGTCCGCAAGTAATAAAGATGACCAACTCATGAAAAATGAG TTCGAAAGTACCTACGACAAAATTGTCGATTCATTCGACAA

  2. Dicty_cDB: FCL-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA08 (Link to dictyBase) - - - Contig-U16200-1 FCL-AA08Z ...(Link to Original site) - - FCL-AA08Z 574 - - - - Show FCL-AA08 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA08Q.Seq.d/ Representative seq. ID FCL-AA...08Z (Link to Original site) Representative DNA sequence >FCL-AA08 (FCL-AA08Q) /CSM/FCL/FCL-AA/FCL-AA...08Q.Seq.d/ XXXXXXXXXXTCGAAGCCAAAGGTCGTCTCGAAGAAGAATTCCATCGCTCGTACCAACTC TGATCGTTCAAGAAAGAGACTCGAAGCTGAAA

  3. Dicty_cDB: FC-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA09 (Link to dictyBase) - - - Contig-U15086-1 FC-AA09E (Li...nk to Original site) - - - - - - FC-AA09E 562 Show FC-AA09 Library FC (Link to library) Clone ID FC-AA09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA09Q.Seq.d/ Representative seq. ID FC-AA...09E (Link to Original site) Representative DNA sequence >FC-AA09 (FC-AA09Q) /CSM/FC/FC-AA/FC-AA09Q.Seq....d/ GATACATTATCACCATGGCAGGAAAAAAAGTCAAATCTAACACACCAAAACAAGACTTAT CTGTCTCTAAATCAAAGCTCACCAGCATTAAAGCCCCAGCTGCTGCCATCAAAGCTAAA

  4. Dicty_cDB: FC-AA14 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA14 (Link to dictyBase) - - - Contig-U15088-1 FC-AA14E (Li...nk to Original site) - - - - - - FC-AA14E 431 Show FC-AA14 Library FC (Link to library) Clone ID FC-AA14 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA14Q.Seq.d/ Representative seq. ID FC-AA...14E (Link to Original site) Representative DNA sequence >FC-AA14 (FC-AA14Q) /CSM/FC/FC-AA/FC-AA14Q.Seq.d/ CTATGTCTGAAATCAAAA...CTGAAGAACTCGCTTGCATCTACTCCGGTCTTTTATTACAAG ATGACGGTATTGAAATCACCGCTGATAAAATCAAAACCTTATTAGAAGCTGCCAA

  5. Dicty_cDB: FCL-AA04 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA04 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA04Z ...(Link to Original site) - - FCL-AA04Z 530 - - - - Show FCL-AA04 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA04Q.Seq.d/ Representative seq. ID FCL-AA...04Z (Link to Original site) Representative DNA sequence >FCL-AA04 (FCL-AA04Q) /CSM/FCL/FCL-AA/FCL-AA...04Q.Seq.d/ XXXXXXXXXXCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTTCAGTCAAAGAAATT AAAAGAGGTATGGTCGCTGGTGACTCCAAAAACGATCCACCACAAGAAA

  6. Dicty_cDB: FC-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA20 (Link to dictyBase) - - - Contig-U16455-1 FC-AA20Z (Li...nk to Original site) - - FC-AA20Z 607 - - - - Show FC-AA20 Library FC (Link to library) Clone ID FC-AA20 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA20Q.Seq.d/ Representative seq. ID FC-AA...20Z (Link to Original site) Representative DNA sequence >FC-AA20 (FC-AA20Q) /CSM/FC/FC-AA/FC-AA20Q.Seq....d/ XXXXXXXXXXCTTTGCCCCAGCTGGTCTCTCAACTGAAGTCAAATCAGTCGAAATGCATC ACGAACAACTCCCAGAAGCCCGTCCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTT CAGTCAA

  7. Dicty_cDB: FCL-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA15 (Link to dictyBase) - - - Contig-U16011-1 FCL-AA15Z ...(Link to Original site) - - FCL-AA15Z 442 - - - - Show FCL-AA15 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA15Q.Seq.d/ Representative seq. ID FCL-AA...15Z (Link to Original site) Representative DNA sequence >FCL-AA15 (FCL-AA15Q) /CSM/FCL/FCL-AA/FCL-AA...15Q.Seq.d/ XXXXXXXXXXCCATTCATCTGTCCAATCGATTGTCGTCGTGGTCTCTACAAGAATATCGT CTTATCTGGTGGTTCAACCATGTTTAAAGATTTTGGTAAACGTCTTCAA

  8. Dicty_cDB: FC-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA13 (Link to dictyBase) - - - Contig-U15674-1 FC-AA13Z (Li...nk to Original site) - - FC-AA13Z 528 - - - - Show FC-AA13 Library FC (Link to library) Clone ID FC-AA13 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA13Q.Seq.d/ Representative seq. ID FC-AA...13Z (Link to Original site) Representative DNA sequence >FC-AA13 (FC-AA13Q) /CSM/FC/FC-AA/FC-AA13Q.Seq.d/ XXXXXXXXXXAAAGCAAA...CTCGTGCTGGTCAACGTACCCGTTTCAAGGCTTTCGTCGTTG TTGGTGATCACAACGGTCATGTAGGTCTCGGTGTTAAATGCGCTAAGGAA

  9. Dicty_cDB: FCL-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA20 (Link to dictyBase) - - - Contig-U15052-1 FCL-AA20E ...(Link to Original site) - - - - - - FCL-AA20E 1159 Show FCL-AA20 Library FCL (Link to library) Clone ID FCL-AA...L http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ Representative seq. ID FCL-AA...20E (Link to Original site) Representative DNA sequence >FCL-AA20 (FCL-AA20Q) /CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ AAAA...CATTTACAAATGATGACCACAGAAGATGTACAACCAATTGAAACTACCAAAGATGG TGTAGTAGTATTAAATTATAGCGATTTAATTGCAGGTAAA

  10. Dicty_cDB: FC-AA23 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA23 (Link to dictyBase) - - - Contig-U16090-1 FC-AA23E (Li...nk to Original site) - - - - - - FC-AA23E 387 Show FC-AA23 Library FC (Link to library) Clone ID FC-AA23 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA23Q.Seq.d/ Representative seq. ID FC-AA...23E (Link to Original site) Representative DNA sequence >FC-AA23 (FC-AA23Q) /CSM/FC/FC-AA/FC-AA23Q.Seq.d/ AAACTCGATTATATTCTTAA...TCTTAAAGTTCAAGATTTCATGGAAAGACGTCTCCAAACT TTAGTCTTCAAAAATGGTCTTGCCAAATCAATCCATCACGCTCGTGTTTTAATCAAA

  11. Dicty_cDB: FC-AA12 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA12 (Link to dictyBase) - - - Contig-U15087-1 FC-AA12E (Li...nk to Original site) - - - - - - FC-AA12E 454 Show FC-AA12 Library FC (Link to library) Clone ID FC-AA12 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA12Q.Seq.d/ Representative seq. ID FC-AA...12E (Link to Original site) Representative DNA sequence >FC-AA12 (FC-AA12Q) /CSM/FC/FC-AA/FC-AA12Q.Seq.d/ AAATAATAATAATATAAAAA...TGGAAATTAAAGTTTTAGCTAAAAGAAAAGTATCAGCAAA ACGTGCAAATGAAATATTAGGAAAATTTATTTTAGAAAGAAAAGCAAATGAAGAAAA

  12. Dicty_cDB: FC-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA01 (Link to dictyBase) - - - Contig-U15084-1 FC-AA01E (Li...nk to Original site) - - - - - - FC-AA01E 701 Show FC-AA01 Library FC (Link to library) Clone ID FC-AA01 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA01Q.Seq.d/ Representative seq. ID FC-AA...01E (Link to Original site) Representative DNA sequence >FC-AA01 (FC-AA01Q) /CSM/FC/FC-AA/FC-AA01Q.Seq.d/ GAGAAATATTTCTTATTAA...CAATTGCATGCGTTGTATTCAACCCAACATGGTGGAATATT ACAGCAAGAATGGAATATAATGCTAATAAATAACAACCATTTTCTTTACTTCCACAAA

  13. Dicty_cDB: FCL-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA10 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA10Z ...(Link to Original site) - - FCL-AA10Z 627 - - - - Show FCL-AA10 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA10Q.Seq.d/ Representative seq. ID FCL-AA...10Z (Link to Original site) Representative DNA sequence >FCL-AA10 (FCL-AA10Q) /CSM/FCL/FCL-AA/FCL-AA...10Q.Seq.d/ XXXXXXXXXXTAAACCAGGTATGGTCGTCACCTTTTGCCCCAGCTGGTCTCTCAACTGAA GTCAAATCAGTCGAAATGCATCACGAACAACTCCCAGAA

  14. Dicty_cDB: FC-AA19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA19 (Link to dictyBase) - - - Contig-U16072-1 FC-AA19F (Li...nk to Original site) FC-AA19F 539 - - - - - - Show FC-AA19 Library FC (Link to library) Clone ID FC-AA19 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA19Q.Seq.d/ Representative seq. ID FC-AA...19F (Link to Original site) Representative DNA sequence >FC-AA19 (FC-AA19Q) /CSM/FC/FC-AA/FC-AA19Q.Seq.d/ CAGAAA...TCACTGGTTTTTCATTCCAATTATTTAATATTATCAGTATTTGGAATGTTGATC AAACATCATTCAATAGCTACAGTCTTCCAATTTGGTTACCAGCCATTCAA

  15. Dicty_cDB: FC-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA02 (Link to dictyBase) - - - Contig-U16527-1 FC-AA02Z (Li...nk to Original site) - - FC-AA02Z 458 - - - - Show FC-AA02 Library FC (Link to library) Clone ID FC-AA02 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA02Q.Seq.d/ Representative seq. ID FC-AA...02Z (Link to Original site) Representative DNA sequence >FC-AA02 (FC-AA02Q) /CSM/FC/FC-AA/FC-AA02Q.Seq.d/ XXXXXXXXXXCAAAAA...GGCTCCTGGTCCGGAAGGATTGGGTAATCATTTGAATTTCCTAC GTAACTGGGCTTGATCTTTGTAATTATTGATCATAAACGAGGAATTCCTTGTAAGCGTAA

  16. Dicty_cDB: FCL-AA24 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA24 (Link to dictyBase) - - - Contig-U16467-1 FCL-AA24E ...(Link to Original site) - - - - - - FCL-AA24E 779 Show FCL-AA24 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA24Q.Seq.d/ Representative seq. ID FCL-AA...24E (Link to Original site) Representative DNA sequence >FCL-AA24 (FCL-AA24Q) /CSM/FCL/FCL-AA/FCL-AA...24Q.Seq.d/ CTAGAAATTTCTAAACAATTATTTATTTGAAGAGGTTTTTTAAAAAAAGAAAAAAATCAG AGCATCCAAATAATAACCGCAGTAAGGGGGGGATGGTTGTTAA

  17. Dicty_cDB: FCL-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA05 (Link to dictyBase) - - - Contig-U16473-1 FCL-AA05Z ...(Link to Original site) - - FCL-AA05Z 603 - - - - Show FCL-AA05 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA05Q.Seq.d/ Representative seq. ID FCL-AA...05Z (Link to Original site) Representative DNA sequence >FCL-AA05 (FCL-AA05Q) /CSM/FCL/FCL-AA/FCL-AA...05Q.Seq.d/ XXXXXXXXXXTGGCGCCATCATTACTGGTGGAGGTGGTGTTGCTATCACTCAAGCTCAAC CATCATACCAAGCTGATGCCGTTGCCACTTACATCAAAA

  18. Magnetic horn of the Antiproton Accumulator (AA)

    CERN Multimedia

    Photographic Service

    1988-01-01

    In the 1960s, the invention of this "current sheet lens" has helped to greatly improve the flux of neutrino beams. It was used again at the AA, collecting antiprotons from the production target at angles too large to fit into the acceptance of the AA. It was machined from aluminium to a thickness of 1.4 mm and pulsed at 400 kA for 15 microseconds (half-sine).

  19. The Alkaline Diet: Is There Evidence That an Alkaline ph Diet Benefits Health?

    International Nuclear Information System (INIS)

    This review looks at the role of an alkaline diet in health. Pub med was searched looking for articles on ph, potential renal acid loads, bone health, muscle, growth hormone, back pain, vitamin D and chemotherapy. Many books written in the lay literature on the alkaline diet were also reviewed and evaluated in light of the published medical literature. There may be some value in considering an alkaline diet in reducing morbidity and mortality from chronic diseases and further studies are warranted in this area of medicine

  20. The Alkaline Diet: Is There Evidence That an Alkaline pH Diet Benefits Health?

    Directory of Open Access Journals (Sweden)

    Gerry K. Schwalfenberg

    2012-01-01

    Full Text Available This review looks at the role of an alkaline diet in health. Pubmed was searched looking for articles on pH, potential renal acid loads, bone health, muscle, growth hormone, back pain, vitamin D and chemotherapy. Many books written in the lay literature on the alkaline diet were also reviewed and evaluated in light of the published medical literature. There may be some value in considering an alkaline diet in reducing morbidity and mortality from chronic diseases and further studies are warranted in this area of medicine.

  1. Household Food Security Study Summaries. 2001 Edition.

    Science.gov (United States)

    Seavey, Dorie; Sullivan, Ashley F.

    This report provides the most recent data on the food security of United States households. Based on studies using the Food Security Core Module (FSCM), a tool facilitating direct documentation of the extent of food insecurity and hunger caused by income limitations, this report summarizes 35 studies representing 20 states and Canada. The report…

  2. Interlinked diversification strategies in Italian rural households

    NARCIS (Netherlands)

    Dries, L.K.E.; Pascucci, S.; Gardebroek, C.

    2011-01-01

    This paper analyzes interlinkages between farm household diversification strategies in rural Italy. Existing studies often ignore the correlation between different strategies that are in competition for the same resources (land, labor, capital). This can lead to biased results. We employ a multivari

  3. Independence, Individualism & Connection among Share Householders

    Science.gov (United States)

    Natalier, Kristin

    2007-01-01

    How do young people who are financially dependent on their parents but living in share households conceive of the concept of independence? The meanings of independence are discussed in relation to a qualitative study of young people who described themselves as independent although they accepted money on a regular basis from their parents. Their…

  4. IEC and China Household Electrical Appliance Standardization

    Institute of Scientific and Technical Information of China (English)

    Zhu Yan; Li Yi

    2006-01-01

    @@ Year 2006 is the year marking the 100th anniversary of the founding of International Electrotechnical Commission (IEC).IEC has kept close ties with international electrical and electronic products and their manufactures for nearly 100 years. As an integral part of electrical and electronic product portfolio, Household electrical product development has also been directly influenced by IEC.

  5. User Behavior Assessment of Household Electric Usage

    Directory of Open Access Journals (Sweden)

    Nur Budi Mulyono

    2014-02-01

    Full Text Available Abstract. Energy resilience is one of the famous issues among researchers and practitioners in energy sector. With enabling new technologies in power engineering for smart grid such as distributed generation, distributed storage, and intelligent information and management, each household community can establish a resilience energy production, distribution, and consumption. A household in smart grid system behaves as a customer and producer at the same time. This condition enabled them to reduce the power shortage in the peak hours, reduce CO2 pollution using renewable electricity, and minimizing electricity usage by changing life style. In developing countries, the amount of electricity supply is less than its demand. Most of the demand comes from the household that has peak load on nighttime. Keywords: User behavior, Game theory, Smart grid, Heating and cooling appliances, Energy resilientdoi:10.12695/ajtm.2013.6.2.1 How to cite this article:Mulyono, N. B. (2013. User Behavior Assessment of Household Electric Usage. The Asian Journal of Technology Management 6 (2: 65-71. Print ISSN: 1978-6956; Online ISSN: 2089-791X. doi:10.12695/ajtm.2013.6.2.1  

  6. Household Water Treatments in Developing Countries

    Science.gov (United States)

    Smieja, Joanne A.

    2011-01-01

    Household water treatments (HWT) can help provide clean water to millions of people worldwide who do not have access to safe water. This article describes four common HWT used in developing countries and the pertinent chemistry involved. The intent of this article is to inform both high school and college chemical educators and chemistry students…

  7. Future Changes in Age and Household Patterns

    DEFF Research Database (Denmark)

    Højbjerg Jacobsen, Rasmus; Hougaard Jensen, Svend E.

    2014-01-01

    status, we show that, based on a point forecast, the fiscal impact of changes in household structures amounts to an annual negative effect of 0.5% of GDP, and the effect of changes in age structures is forecast to worsen the public budget by 3.7% of GDP per year. While being subject to a considerable...

  8. Inattention and Inertia in Household Finance

    DEFF Research Database (Denmark)

    Andersen, Steffen; Campbell, John Y.; Meisner Nielsen, Kasper;

    This paper studies inattention to mortgage refinancing incentives among Danish households. Danish data are particularly suitable for this purpose because there are minimal barriers to refinancing, yet many borrowers fail to refinance optimally, and the characteristics of these borrowers can be ac...

  9. Steps to Design a Household Energy Game

    Directory of Open Access Journals (Sweden)

    Jan Dirk Fijnheer

    2016-09-01

    Full Text Available Research where gamification is used to influence household energy consumption is an emerging field. This paper reviews the design and effectiveness of ten games that aim to influence household energy consumption and presents a novel gamification approach in which real world activities are implemented in a game design. From the review suggestions for the design of a new game have been identified, such as including real life missions in order to optimize the transfer between the game world and the real world, feedback from monitoring the electricity meter, the presence of a strong storyline, personalized game characters, social interaction, etc. Based on this comparative analysis, the new game 'Powersaver Game' focused on reducing energy consumption has been designed and its prototype is described. In the next stage of iterative design, end-users evaluated the match between in-game scenes and household energy saving activities. This considerate user-centered design process should allow us to build a serious game that is potentially effective in reducing household energy consumption. 

  10. Rural Household Demographics, Livelihoods and the Environment.

    Science.gov (United States)

    de Sherbinin, Alex; Vanwey, Leah; McSweeney, Kendra; Aggarwal, Rimjhim; Barbieri, Alisson; Henry, Sabina; Hunter, Lori M; Twine, Wayne

    2008-02-01

    This paper reviews and synthesizes findings from scholarly work on linkages among rural household demographics, livelihoods and the environment. Using the livelihood approach as an organizing framework, we examine evidence on the multiple pathways linking environmental variables and the following demographic variables: fertility, migration, morbidity and mortality, and lifecycles. Although the review draws on studies from the entire developing world, we find the majority of micro-level studies have been conducted in either marginal (mountainous or arid) or frontier environments, especially Amazonia. Though the linkages are mediated by many complex and often context-specific factors, there is strong evidence that dependence on natural resources intensifies when households lose human and social capital through adult morbidity and mortality, and qualified evidence for the influence of environmental factors on household decision-making regarding fertility and migration. Two decades of research on lifecycles and land-cover change at the farm level have yielded a number of insights about how households make use of different land-use and natural resource management strategies at different stages. A thread running throughout the review is the importance of managing risk through livelihood diversification, ensuring future income security, and culture-specific norms regarding appropriate and desirable activities and demographic responses. Recommendations for future research are provided.

  11. Household energy isn't all stoves

    NARCIS (Netherlands)

    Clancy, J.S.

    1998-01-01

    When people talk about 'household energy', most people automatically think of stoves. A lot of attention has been paid to improving stoves to make them more energy efficient and to reduce their pollution. This is one side of the 'stoves' approach, whilst others look at the 'supply' side of the probl

  12. Labor Laws Affecting Private Household Workers.

    Science.gov (United States)

    Women's Bureau (DOL), Washington, DC.

    Wages and working conditions for private household workers have not kept pace with other occupations, partly because of lack of coverage by labor laws. This pamphlet describes the protection available to domestics under both federal and state laws. Not only wages and hours, but also coverage by Unemployment Compensation, Workmen's Compensation,…

  13. Distributed Coordination of Household Electricity Consumption

    DEFF Research Database (Denmark)

    Juelsgaard, Morten; Teixeira, Andre; Johansson, Mikael;

    2014-01-01

    This work presents a distributed framework for coordination of flexible electricity consumption for a number of households in the distribution grid. We conduct coordination with the purpose of minimizing a trade-off between individual concerns about discomfort and electricity cost, on the one hand...

  14. Sustainable reverse logistics for household plastic waste

    NARCIS (Netherlands)

    Bing, X.

    2014-01-01

    Summary of the thesis titled “Sustainable Reverse Logistics for Household Plastic Waste” PhD Candidate: Xiaoyun Bing Recycled plastic can be used in the manufacturing of plastic products to reduce the use of virgin plastics material. The cost of recycled plastics is usually lower than th

  15. NATIONAL HOUSEHOLD SURVEY ON DRUG ABUSE (NHSDA)

    Science.gov (United States)

    The National Household Survey on Drug Abuse (NHSDA) is sponsored by the Substance Abuse and Mental Health Services Administration (SAMHSA). The survey has been conducted since 1971 and serves as the primary source of information on the prevalence and incidence of illicit drug, al...

  16. Modeling Social Ties and Household Mobility.

    Science.gov (United States)

    Metcalf, Sara S

    2014-01-01

    Underlying the aggregate phenomena of persistent problems such as urban sprawl and spatial socio-economic disparity is the individual choice of where to live. This study develops an agent-based model to simulate social and economic influences on neighborhood choice. With Danville, Illinois as an empirical context, a pattern-oriented approach is employed to examine the role of social ties in shaping intra-urban household mobility. In the model, household agents decide whether and where to relocate within the community based upon factors such as neighborhood attractiveness, affordability, and the density of a household's social network in the prospective block group. Social network and neighborhood choices are encoded with logit utility functions. The relative influence of factors affecting the formation of social ties in the simulated social network, such as geographic proximity, similarity of income, race, and presence of children, are adjusted using parameter variation to create alternative model settings. Simulated migration patterns resulting from different network and neighborhood choice coefficients are compared with observed migration patterns over a two-year period. Based upon 1000 simulation experiments, a regression of homeowner migration error (the difference between simulated and observed migration) relative to the parameter settings revealed components of social network choice such as income, race, and probability of local ties to be significant in matching observed migration patterns. A non-linear effect of simulated social networks on household mobility and thus migration error was exhibited in this study. PMID:25035520

  17. Hazardous household waste management in Vinnytsia region

    OpenAIRE

    Ishchenko, Vitalii; Petruk, Roman; Kozak, Yana

    2016-01-01

    The article analyzes hazardous household waste, including detergents, paints, adhesives, expired medicines, luminescent lamps, pesticides, fertilizers, batteries and accumulators, electrical and electronic waste, mercury-containing materials. Research shows that they contain a large quantity of dangerous and toxic substances (compounds of heavy metals, chlorinated polymers, aromatic hydrocarbons, surfactants, etc.), which pose a significant risk to the environment and ...

  18. Handbook in nonresponse in household surveys

    NARCIS (Netherlands)

    J.G. Bethlehem; F. Cobben; B. Schouten

    2011-01-01

    This volume presents an all-inclusive guide to the problem of nonresponse in household surveys, providing an overview of the theory while also describing practical implications. The book begins with a general overview of the nonresponse problem, outlining existing sources of error and guidelines for

  19. A semiparametric model of household gasoline demand

    International Nuclear Information System (INIS)

    Gasoline demand studies typically generate a single price and income elasticity for a country. It is however possible that these elasticities may differ among various socio-economic groups. At the same time, parametric gasoline demand models may not be flexible enough to capture the changes in price elasticities with different levels of income. This paper models US gasoline demand using more flexible semiparametric techniques, accommodating the possibility of differences in responses among households. The econometric model employs a non-parametric bivariate smoothing for price and income and a parametric representation of other explanatory variables. Possible heterogeneity in price and income elasticities is modelled through interacting price and income with demographic variables. Results show that price responses do vary with demographic variables such as income, multiple vehicle holding, presence of multiple wage earners or rural or urban residential locations. Households' responses to a price change decrease with higher income. Multiple vehicle and multiple earner households also show higher sensitivity to a price change. Households located in urban areas reduce consumption more than those in rural areas in response to an increase in price. Comparison of the flexible semiparametric model with a parametric translog model, however, reveals no significant differences between results, and the parametric models have the advantage of lower computational requirements and better interpretability. (author)

  20. HOUSEHOLD PURIFICATION OF FLUORIDE CONTAMINATED MAGADI (TRONA)

    DEFF Research Database (Denmark)

    Nielsen, Joan Maj; Dahi, Elian

    1997-01-01

    Purification of fluoride contaminated magadi is studied using bone char sorption and calcium precipitation. The bone char treatment is found to be workable both in columns and in batches where the magadi is dissolved in water prior to treatment. The concentrations in the solutions were 89 g magadi...... treatment method. A procedure for purification of fluoride contaminated magadi at household level is described....

  1. Persistently increased intestinal fraction of alkaline phosphatase

    DEFF Research Database (Denmark)

    Nathan, E; Baatrup, G; Berg, H;

    1984-01-01

    Persistent elevation of the intestinal fraction of the alkaline phosphatase (API) as an isolated finding has to our knowledge not been reported previously. It was found in a boy followed during a period of 5.5 years. The only symptom was transient periodic fatigue observed at home, but not apparent...... phosphatase activity could be demonstrated....

  2. Use Alkalinity Monitoring to Optimize Bioreactor Performance.

    Science.gov (United States)

    Jones, Christopher S; Kult, Keegan J

    2016-05-01

    In recent years, the agricultural community has reduced flow of nitrogen from farmed landscapes to stream networks through the use of woodchip denitrification bioreactors. Although deployment of this practice is becoming more common to treat high-nitrate water from agricultural drainage pipes, information about bioreactor management strategies is sparse. This study focuses on the use of water monitoring, and especially the use of alkalinity monitoring, in five Iowa woodchip bioreactors to provide insights into and to help manage bioreactor chemistry in ways that will produce desirable outcomes. Results reported here for the five bioreactors show average annual nitrate load reductions between 50 and 80%, which is acceptable according to established practice standards. Alkalinity data, however, imply that nitrous oxide formation may have regularly occurred in at least three of the bioreactors that are considered to be closed systems. Nitrous oxide measurements of influent and effluent water provide evidence that alkalinity may be an important indicator of bioreactor performance. Bioreactor chemistry can be managed by manipulation of water throughput in ways that produce adequate nitrate removal while preventing undesirable side effects. We conclude that (i) water should be retained for longer periods of time in bioreactors where nitrous oxide formation is indicated, (ii) measuring only nitrate and sulfate concentrations is insufficient for proper bioreactor operation, and (iii) alkalinity monitoring should be implemented into protocols for bioreactor management.

  3. DAILY WATER CONSUMPTION FOR HOUSEHOLD PURPOSES AND ITS VARIABILITY IN A RURAL HOUSEHOLD

    OpenAIRE

    Tomasz Bergel; Tomasz Kotowski; Olga Woyciechowska

    2016-01-01

    The paper presents an analysis of daily water consumption for household purposes carried out within one year in a selected rural household. The study was undertaken because so far the guidelines for designing rural water supply systems have not been updated for a very long time and needed verification. It involved a comprehensive system for measuring water consumption equipped with automatic readers and data recorders. The research clearly showed that actual water consumption was much lower t...

  4. Time use within the household: Household production, work-life balance and racial discrimination

    OpenAIRE

    Giménez Nadal, José Ignacio; Molina Chueca, José Alberto

    2011-01-01

    This doctoral dissertation uses microeconomic analysis to examine the behaviour of the members of the household, developing 3 lines of investigation that focus on time-allocation decisions. The first line of research analyzes how social norms can influence the time allocation decisions of individuals, which in turn may influence life decisions such as partnership formation, especially in countries with more traditional gender norms regarding the distribution of household chores. The second li...

  5. Identifying motivations and barriers to minimising household food waste

    OpenAIRE

    Graham-Rowe, Ella; Jessop, Donna C; Sparks, Paul

    2014-01-01

    The amount of food discarded by UK households is substantial and, to a large extent, avoidable. Furthermore, such food waste has serious environmental consequences. If household food waste reduction initiatives are to be successful they will need to be informed by people's motivations and barriers to minimising household food waste. This paper reports a qualitative study of the thoughts, feelings and experiences of 15 UK household food purchasers, based on semi-structured interviews. Two core...

  6. Seasonal variation of household food waste in Denmark

    OpenAIRE

    Edjabou, Vincent Maklawe Essonanawe; Petersen, Claus; Scheutz, Charlotte; Astrup, Thomas Fruergaard

    2015-01-01

    This paper analysed the influence of seasonal variation in the generation of the Danish household food waste. Residual household waste was sampled and manually sorted into six food waste fractions. Vegetable food wastes were the main fraction contributing to the household food waste. Statistical analysis showed a significant relationship between avoidable food waste and household size. However, there were no significant seasonal differences in the amount of avoidable food waste.

  7. Addressing household air pollution : a case study in rural Madagascar

    OpenAIRE

    Dasgupta, Susmita; Martin, Paul; Samad, Hussain A.

    2013-01-01

    Household air pollution is the second leading cause of disease in Madagascar, where more than 99 percent of households rely on solid biomass, such as charcoal, wood, and crop waste, as the main cooking fuel. Only a limited number of studies have looked at the emissions and health consequences of cook stoves in Africa. This paper summarizes an initiative to monitor household air pollution in two towns in Madagascar, with a stratified sample of 154 and 184 households. Concentrations of fine par...

  8. Food security experiences of displaced North Korean households

    OpenAIRE

    Lee, Soo-Kyung; Nam, So-Young

    2014-01-01

    BACKGROUND/OBJECTIVES Food shortage situation in North Korea has gained much interest, however food insecurity caused by the food shortage in North Korean households has not been much investigated. This study examined food security experiences and food consumption pattern of displaced North Korean households currently living in South Korea. SUBJECTS/METHODS Food security experience among 51 North Korean households living in South Korea was examined using the Household Food Insecurity Access S...

  9. Microeconomic theory of the household and nutrition programs

    OpenAIRE

    Chernichovsky, Dov; Zangwill, Linda

    1988-01-01

    Lack of food is no longer the major cause of malnutrition. Many households and individuals remain malnourished when income and supplies of food are adequate. Nutrition policy and programs must be based on a sound knowledge of household behaviour patterns. The microeconomic theory of the household focuses on the household's decisionmaking about scarce food resources based upon such considerations as: (i) the size of the family; (ii) the purchasing power of the family; (iii) the availability of...

  10. Household expenditure on food at home in Malaysia

    OpenAIRE

    Tey, (John) Yeong-Sheng

    2008-01-01

    “Engel’s law” explains that the share of household expenditure on food typically falls as income and expenditure increase. The objectives of this study are to investigate the food expenditure patterns of different income groups and the relationships between household characteristics and expenditure patterns. Household Expenditure Survey 2004/2005 data from Department of Statistics was used to analyze the food expenditure pattern of households. An expenditure model was developed and the coeffi...

  11. The Demand and Supply of Credit for Households

    OpenAIRE

    Bali Swain, Ranjula

    2008-01-01

    Abstract The demand and supply of credit in the rural credit markets is investigated in this paper using household data from India. The aim is to study the effects of household, farm productive characteristics and the policy variables on the demand and supply of credit. A type 3 Tobit model is estimated which corrects for sample selection and endogeniety bias. In addition, a generalised Double Hurdle model is estimated where the information on the household?s access to credit is in...

  12. Seasonal variation of household food waste in Denmark

    DEFF Research Database (Denmark)

    Edjabou, Vincent Maklawe Essonanawe; Petersen, Claus; Scheutz, Charlotte;

    This paper analysed the influence of seasonal variation in the generation of the Danish household food waste. Residual household waste was sampled and manually sorted into six food waste fractions. Vegetable food wastes were the main fraction contributing to the household food waste. Statistical...... analysis showed a significant relationship between avoidable food waste and household size. However, there were no significant seasonal differences in the amount of avoidable food waste....

  13. WEEE and portable batteries in residual household waste: Quantification and characterisation of misplaced waste

    Energy Technology Data Exchange (ETDEWEB)

    Bigum, Marianne, E-mail: mkkb@env.dtu.dk [Technical University of Denmark, Department of Environmental Engineering, Miljøvej 113, 2500 Kgs. Lyngby (Denmark); Petersen, Claus, E-mail: claus_petersen@econet.dk [Econet A/S, Strandboulevarden 122, 5, 2100 København Ø (Denmark); Christensen, Thomas H., E-mail: thho@env.dtu.dk [Technical University of Denmark, Department of Environmental Engineering, Miljøvej 113, 2500 Kgs. Lyngby (Denmark); Scheutz, Charlotte, E-mail: chas@env.dtu.dk [Technical University of Denmark, Department of Environmental Engineering, Miljøvej 113, 2500 Kgs. Lyngby (Denmark)

    2013-11-15

    Highlights: • We analyse 26.1 Mg of residual waste from 3129 Danish households. • We quantify and characterise misplaced WEEE and portable batteries. • We compare misplaced WEEE and batteries to collection through dedicated schemes. • Characterisation showed that primarily small WEEE and light sources are misplaced. • Significant amounts of misplaced batteries were discarded as built-in WEEE. - Abstract: A total of 26.1 Mg of residual waste from 3129 households in 12 Danish municipalities was analysed and revealed that 89.6 kg of Waste Electrical and Electronic Equipment (WEEE), 11 kg of batteries, 2.2 kg of toners and 16 kg of cables had been wrongfully discarded. This corresponds to a Danish household discarding 29 g of WEEE (7 items per year), 4 g of batteries (9 batteries per year), 1 g of toners and 7 g of unidentifiable cables on average per week, constituting 0.34% (w/w), 0.04% (w/w), 0.01% (w/w) and 0.09% (w/w), respectively, of residual waste. The study also found that misplaced WEEE and batteries in the residual waste constituted 16% and 39%, respectively, of what is being collected properly through the dedicated special waste collection schemes. This shows that a large amount of batteries are being discarded with the residual waste, whereas WEEE seems to be collected relatively successfully through the dedicated special waste collection schemes. Characterisation of the misplaced batteries showed that 20% (w/w) of the discarded batteries were discarded as part of WEEE (built-in). Primarily alkaline batteries, carbon zinc batteries and alkaline button cell batteries were found to be discarded with the residual household waste. Characterisation of WEEE showed that primarily small WEEE (WEEE directive categories 2, 5a, 6, 7 and 9) and light sources (WEEE directive category 5b) were misplaced. Electric tooth brushes, watches, clocks, headphones, flashlights, bicycle lights, and cables were items most frequently found. It is recommended that these

  14. AAS 228: Day 3 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session 2015 Newton Lacy Pierce Prize Lecture: The Elephant in the Room: Effects of Distant, Massive Companions on Planetary System Architectures (by Leonardo dos Santos)The first session on Wednesday at 228th AAS Meeting was the Newton Lacy Pierce Prize Lecture by Heather Knutson (California Institute of Technology). This talk featured a broad range of research efforts on exoplanets, with the main focus on how we study the composition of their atmospheres, and how multi-body interactions carve the structure of the planetary systems we observe.One of her first points is the well-known idea that the Solar System is an oddball, compared to the exoplanet systems we have found so far: most of these systems contain hot Jupiters and mini-Neptunes at very close-in orbits around their host stars. Moreover, even when studying their transmission spectra, it is difficult to know the exact composition of their atmospheres.Knutson: it is difficult to constrain atmospheric composition of exoplanets (H-poor or H-rich+clouds?) #aas228pic.twitter.com/LdyN4o9RC7 astrobites (@astrobites) June 15, 2016The main proposal on how these systems formed is the migration scenario. In order to validate this idea, Dr. Knutson and her group The Friends of Hot Jupiters study systems with close-in gas giants and their frequency of binary companions, which are supposed to be the main culprits causing gas-giant migration. They found that approximately half of the observed systems have long-distance companions, providing strong validation of the migration scenario. Moreover, Dr. Knutson speculates that wide binaries have more

  15. Optimization of NaOH Molarity, LUSI Mud/Alkaline Activator, and Na2SiO3/NaOH Ratio to Produce Lightweight Aggregate-Based Geopolymer

    OpenAIRE

    Rafiza Abdul Razak; Mohd Mustafa Al Bakri Abdullah; Kamarudin Hussin; Khairul Nizar Ismail; Djwantoro Hardjito; Zarina Yahya

    2015-01-01

    This paper presents the mechanical function and characterization of an artificial lightweight geopolymer aggregate (ALGA) using LUSI (Sidoarjo mud) and alkaline activator as source materials. LUSI stands for LU-Lumpur and SI-Sidoarjo, meaning mud from Sidoarjo which erupted near the Banjarpanji-1 exploration well in Sidoarjo, East Java, Indonesia on 27 May 2006. The effect of NaOH molarity, LUSI mud/Alkaline activator (LM/AA) ratio, and Na2SiO3/NaOH ratio to the ALGA are investigated at a sin...

  16. Household Expenditures on Private Tutoring: Emerging Evidence from Malaysia

    Science.gov (United States)

    Kenayathulla, Husaina Banu

    2013-01-01

    Private tutoring has been a burgeoning phenomenon in Malaysia for decades. This study examines the determinants of private tutoring expenditures in Malaysia using the 2004/2005 Household Expenditures Survey and applies hurdle regression models to the data. The results indicate that total household expenditures, household head's level of…

  17. Food waste from Danish households: Generation and composition.

    Science.gov (United States)

    Edjabou, Maklawe Essonanawe; Petersen, Claus; Scheutz, Charlotte; Astrup, Thomas Fruergaard

    2016-06-01

    Sustainable solutions for reducing food waste require a good understanding of food waste generation and composition, including avoidable and unavoidable food waste. We analysed 12tonnes of residual household waste collected from 1474 households, without source segregation of organic waste. Food waste was divided into six fractions according to avoidability, suitability for home-composting and whether or not it was cooked, prepared or had been served within the household. The results showed that the residual household waste generation rate was 434±18kg per household per year, of which 183±10kg per year was food waste. Unavoidable food waste amounted to 80±6kg per household per year, and avoidable food waste was 103±9kg per household per year. Food waste mass was influenced significantly by the number of occupants per household (household size) and the housing type. The results also indicated that avoidable food waste occurred in 97% of the households, suggesting that most Danish households could avoid or at least reduce how much they generate. Moreover, avoidable and unavoidable food waste was more likely to be found in houses containing more than one person than in households with only one occupant. PMID:27026492

  18. Utilization of Household Sewage Sludge in Brick making

    Institute of Scientific and Technical Information of China (English)

    SunGuofeng

    2005-01-01

    Household sewage sludge is a kind of solid waste produced in sewage purifying at sewage farm. in procedure of water purifying, which can be used as raw material for producing fired brick. This article compares the chemical composition between household sewage sludge and clay, and explores two kinds of production process for making brick with Household sewage sludge.

  19. Cleaning sprays, household help and asthma among elderly women.

    NARCIS (Netherlands)

    Bédard, A.; Varraso, R.; Sanchez, M.; Clavel-Chapelon, F.; Zock, J.P.; Kauffmann, F.; Moual, N. le

    2014-01-01

    Objective: There is increasing evidence on the deleterious role in asthma of the use of household cleaning products in spray forms in adults. Household help might induce misclassification errors. The aim of the present analysis was to study associations between household exposure to cleaning sprays

  20. 7 CFR 2902.48 - General purpose household cleaners.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 15 2010-01-01 2010-01-01 false General purpose household cleaners. 2902.48 Section... PROCUREMENT Designated Items § 2902.48 General purpose household cleaners. (a) Definition. Products designed to clean multiple common household surfaces. This designated item does not include products that...

  1. The dynamics of Chinese rural households' participation in labor markets

    NARCIS (Netherlands)

    Brosig, S.; Glauben, T.; Herzfeld, T.; Rozelle, S.; Wang, X.

    2007-01-01

    The work is devoted to the dynamics of labor market participation of Chinese rural households. Based on a theoretical farm household framework the choice between four distinct labor market participation states is empirically analyzed. Using household data over the period 1995¿2002 from the province

  2. Towards sustainable household energy use in the Netherlands

    NARCIS (Netherlands)

    van der Wal, J; Moll, H.C.

    2001-01-01

    Households consume direct energy, using natural gas, heating oil, gasoline and electricity, and consume indirect energy, the energy related to the production of goods and the delivery of services for the households. Past trends and present-day household energy use (direct and indirect) are analysed

  3. Taxation and the household saving rate: evidence from OECD countries

    Directory of Open Access Journals (Sweden)

    Vito Tanzi

    2000-03-01

    Full Text Available This paper analyzes anew the relationship between taxation and the household saving rate. On the basis of standard savings and tax revenue data from a sample of OECD countries, it provides compelling empirical evidence of a powerful impact of taxes on household savings. In particular, income taxes are shown to affect negatively the household saving rate much more than consumption taxes.

  4. Breakup of New Orleans Households after Hurricane Katrina

    Science.gov (United States)

    Rendall, Michael S.

    2011-01-01

    Theory and evidence on disaster-induced population displacement have focused on individual and population-subgroup characteristics. Less is known about impacts on households. I estimate excess incidence of household breakup resulting from Hurricane Katrina by comparing a probability sample of pre-Katrina New Orleans resident adult household heads…

  5. 50 CFR 36.36 - Sled dogs and household pets.

    Science.gov (United States)

    2010-10-01

    ... Sled dogs and household pets. The general trespass provisions of 50 CFR 26.21 shall not apply to household pets and sled, work, or pack dogs under the direct control of their owners or handlers, but such... 50 Wildlife and Fisheries 6 2010-10-01 2010-10-01 false Sled dogs and household pets....

  6. Household Structure and Short-Run Economic Change in Nicaragua

    Science.gov (United States)

    Winters, Paul; Stecklov, Guy; Todd, Jessica

    2009-01-01

    During the economic crises Nicaragua suffered between 2000 and 2002, a conditional cash transfer program targeting poor households began operating. Using panel data on 1,397 households from the program's experimentally designed evaluation, we examined the impact of the program on household structure. Our findings suggest that the program enabled…

  7. Using EIS to study the electrochemical response of alloy AA5083 in solutions of NaCl

    Energy Technology Data Exchange (ETDEWEB)

    Aballe, A.; Bethencourt, M.; Botana, F.J.; Osuna, R. [Cadiz Univ. (Spain). Dept. de Ciencia de los Materiales e Ingenieria Metalurgica y Quimica Inorganica; Marcos, M. [Cadiz Univ. (Spain). Dept. de Ingenieria Mecanica y Diseno Industrial

    2001-03-01

    The corrosion behavior of alloy AA5083 in aerated solutions of NaCl has been studied. Special attention has been paid to the analysis of the electrochemical response of this alloy using electrochemical impedance spectroscopy (EIS). Analysis of the obtained data has enabled an evaluation of the contributions made by each of the corrosion processes active in the system: localized alkaline corrosion in the areas surrounding the intermetallic precipitates and growth of the layer of oxide on the matrix. It has been determined that the process of localized corrosion has the greatest verifiable intensity, but this process reduces with length of exposure time. (orig.)

  8. AAS 228: Day 1 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session: From Space Archeology to Serving the World Today: A 20-year Journey from the Jungles of Guatemala to a Network of Satellite Remote Sensing Facilities Around the World(by Michael Zevin)In the conferences second plenary session, NASAs Daniel Irwin turned the eyes of the conference back to Earth by highlighting the huge impact that NASA missions play in protecting and developing our own planet.Daniel Irwin: using satellite imagery to detect differences in vegetation and find ancient Mayan cities. #aas228 pic.twitter.com/9LFPQdCHTM astrobites (@astrobites) June 13, 2016Irwin came to be involved in NASA through his work mapping Guatemalan jungles, where he would spend 22 days at a time exploring the treacherous jungles on foot armed with a 1st generation GPS, a compass, and a machete. A colleague introduced Irwin to the satellite imagery thathe was exploring, demonstratinghow these images are a strong complement to field work. The sharing of this satellite data with nearby villages helped to show the encroachment of agriculture and the necessity of connecting space to the village. Satellite imagery also played a role in archeological endeavors, uncovering dozens of Mayan cities that have been buried for over a millennia by vegetation, and it provided evidence that the fall of the Mayan civilization may have been due to massive deforestation that ledto drought.Glacial retreat in Chile imaged by ISERV.Irwin displayed the constellation of NASAs Earth-monitoring satellites that have played an integral role in conserving our planet and alerting the world of natural disasters. He also showed

  9. Experimentale Study of Alkaline Precipitation on Thermal Process SeaWater Desalination Condition

    International Nuclear Information System (INIS)

    The experiment of alkaline precipitation by separated method has beencarry out. Experiment took please by heating sea water simulation with eachother consist of a).142 ppm bicarbonate and 400 ppm calcium ion b). 142 ppmbicarbonate and magnesium ion at temperature 40,50,60,70,80,90,100,110 and120 oC respectively by using autoclave. Sampling has been done periodicalfor 30 minute in interval 300 minute for each temperature. The calculation ofalkaline precipitation on each step calculated through the decreasing ofcalcium and magnesium concentration with analysis by AAS. From experimentdata have the information that alkaline precipitation have been formed since40 oC. From time variable have been the information that the precipitationformed at 30th minute rapidly. Whether at further time the increasing ofprecipitation are not significant. This phenomena can explained that at eachheating step from 40 oC bicarbonate ion be come decomposition with theresult carbonate and hydroxide ion and react with calcium and magnesium formcalcium carbonate and magnesium hydroxide. From this information could beimplemented as base for avoiding using chemical material in desalinationthermal process. (author)

  10. Anticipatory child fostering and household economic security in Malawi

    Directory of Open Access Journals (Sweden)

    Lauren Bachan

    2014-04-01

    Full Text Available Background: While there is a rich literature on the practice of child fostering in sub-Saharan Africa, little is known about how fostering impacts receiving households, as few studies consider household conditions both before and after fostering. Despite the fact that circumstancessurrounding fostering vary, the literature's key distinction of fostering is often drawn along the simple line of whether or not a household is fostering a child. This paper argues that anticipation of fostering responsibilities, in particular, is a useful dimension to distinguish fostering experiences for receiving households. Objective: This paper examines the relationship between receiving a foster child and subsequent changes in household wealth. Particular emphasis is placed on how these changes are conditioned by differing levels of anticipation of the fostering event. Methods: This study uses data from Tsogolo la Thanzi (TLT, a longitudinal survey in Balaka, Malawi. Using data from 1754 TLT respondents, fixed effects pooled time-series models are estimated to assess whether and how receiving a foster child changes household wealth. Results: This paper demonstrates the heterogeneity of fostering experiences for receiving households.The results show that households that anticipate fostering responsibilities experience a greater increase in household wealth than both households that do not foster and those that are surprised by fostering. Conclusions: Households that anticipate fostering responsibilities exhibit the greatest increase in householdwealth. While fostering households that do not anticipate fostering responsibilities may not experience these gains, there is no evidence to indicate that such households are negatively impacted relative to households that do not foster. This finding suggests that additional childcare responsibilities may not be as detrimental to African households as some researchers have feared.

  11. Bacterial Zoonoses Transmitted by Household Pets

    DEFF Research Database (Denmark)

    Damborg, Peter Panduro; Broens, E.M.; Chomel, B.B.;

    2016-01-01

    The close contact between household pets and people offers favourable conditions for bacterial transmission. In this article, the aetiology, prevalence, transmission, impact on human health and preventative measures are summarized for selected bacterial zoonoses transmissible by household pets. Six...... zoonoses representing distinct transmission routes were selected arbitrarily based on the available information on incidence and severity of pet-associated disease caused by zoonotic bacteria: bite infections and cat scratch disease (physical injuries), psittacosis (inhalation), leptospirosis (contact...... with urine), and campylobacteriosis and salmonellosis (faecal–oral ingestion). Antimicrobial resistance was also included due to the recent emergence of multidrug-resistant bacteria of zoonotic potential in dogs and cats. There is a general lack of data on pathogen prevalence in the relevant pet population...

  12. Powder electrostatic enamelling of household appliances

    Science.gov (United States)

    Bragina, L.; Shalygina, O.; Kuryakin, N.; Annenkov, V.; Guzenko, N.; Kupriyanenko, K.; Hudyakov, V.; Landik, A.

    2011-12-01

    Principles and practices of contemporary resource and energy saving technology of powder electrostatic application (POESTA)of vitreous enamel coatings are described. Its technological, economic and ecological advantages over slip enamelling in household appliances manufacture are discussed. We develop the principles of synthesis of special glass frits with high electric resistivity for POESTA and discuss the results of studies aimed at the development and industrial implementation of ground, direct-on and coloured cover enamels for household appliances and direct-on thermally resistant chemically durable coatings with antibacterial effect for protection of inner tanks of water heaters. Finally, we describe the development of compositions for easy-to-clean, catalytic and pyrolytic coatings.

  13. The AA disappearing under concrete shielding

    CERN Multimedia

    1982-01-01

    When the AA started up in July 1980, the machine stood freely in its hall, providing visitors with a view through the large window in the AA Control Room. The target area, in which the high-intensity 26 GeV/c proton beam from the PS hit the production target, was heavily shielded, not only towards the outside but also towards the AA-Hall. However, electrons and pions emanating from the target with the same momentum as the antiprotons, but much more numerous, accompanied these through the injection line into the AA ring. The pions decayed with a half-time corresponding to approximately a revolution period (540 ns), whereas the electrons lost energy through synchrotron radiation and ended up on the vacuum chamber wall. Electrons and pions produced the dominant component of the radiation level in the hall and the control room. With operation times far exceeding original expectations, the AA had to be buried under concrete shielding in order to reduce the radiation level by an order of magnitude.

  14. Specific Examples of Hybrid Alkaline Cement

    Directory of Open Access Journals (Sweden)

    Fernández-Jiménez Ana

    2014-04-01

    Full Text Available Hybrid alkaline cements are obtained by alkali-activating cementitious blends in the Na2O-CaO-SiO2-Al2O3-H2O system. The present paper discusses the results of activating different cementitious blends containing a low OPC clinker content ( 15MPa a 2 days different alkaline activators were used (liquid and solid. The reaction products obtained were also characterised by XRD, SEM/EDX and 27Al and 29Si NMRMAS. The results showed that the main reaction product was a mix of cementitious gels C-A-S-H and (N,C-A-S-H, and that their relative proportions were strongly influenced by the calcium content in the initial binder

  15. High temperature and pressure alkaline electrolysis

    DEFF Research Database (Denmark)

    Allebrod, Frank; Chatzichristodoulou, Christodoulos; Mogensen, Mogens Bjerg

    2013-01-01

    Alkaline electrolyzers have proven to operate reliable for decades on a large scale, but in order to become commercially attractive and compete against conventional technologies for hydrogen production, the production and investment costs have to be reduced. This may occur by increasing the...... operational temperature and pressure to produce pressurized hydrogen at high rate (m3 H2·h-1·m-2 cell area) and high electrical efficiency. This work describes an exploratory technical study of the possibility to produce hydrogen and oxygen with a new type of alkaline electrolysis cell at high temperatures...... SrTiO3 was used for immobilization of aqueous KOH solutions. Electrolysis cells with this electrolyte and metal foam based gas diffusion electrodes were successfully demonstrated at temperatures up to 250 °C at 40 bar. Different electro-catalysts were tested in order to reduce the oxygen and hydrogen...

  16. How Financial Literacy Affects Household Wealth Accumulation

    OpenAIRE

    Behrman, Jere R.; Mitchell, Olivia S.; Soo, Cindy K.; David Bravo

    2012-01-01

    This study isolates the causal effects of financial literacy and schooling on wealth accumulation using a new household dataset and an instrumental variables (IV) approach. Financial literacy and schooling attainment are both strongly positively associated with wealth outcomes in linear regression models, whereas the IV estimates reveal even more potent effects of financial literacy. They also indicate that the schooling effect only becomes positive when interacted with financial literacy. Es...

  17. The relationship between advertising and household loans

    OpenAIRE

    Sahlin, Daniel; Sjögren, Gustav

    2008-01-01

    Advertising expenditures are increasing on a yearly basis. An interesting question emerges from this: What are the macroeconomic effects of increasing advertising spending? Does the aggregate consumption increase or does it only rearrange consumption between different products and markets? The relationship between advertising and consumption was found in the literature, this relationship was further developed and the relationship between advertising and household loans emerged as an interesti...

  18. Intra-Household Allocation of Parental Leave

    OpenAIRE

    Gobbi, Paula Eugenia; Parys, Juliane; Schwerhoff, Gregor

    2015-01-01

    We introduce childcare sharing in a collective model of household behavior to investigate which factors make spouses increase or decrease their share of parental leave. The concern about future consumption motivates parents to invest in their human capital and to limit their leave duration. Using relative income and the age difference between spouses as distribution factors, we cannot reject Pareto efficiency in childcare sharing. Higher relative incomes and larger age differences shift the c...

  19. Wages, Violence and Health in the Household

    OpenAIRE

    Anna Aizer

    2007-01-01

    Three quarters of all violence against women is perpetrated by domestic partners. I study both the economic causes and consequences of domestic violence. I find that decreases in the male-female wage gap reduce violence against women, consistent with a household bargaining model. The relationship between the wage gap and violence suggests that reductions in violence may provide an alternative explanation for the well-established finding that child health improves when mothers control a greate...

  20. Internet and its use in households

    OpenAIRE

    Dobešová, Zuzana

    2013-01-01

    The thesis deals with the internet and its use by households. First part describes the origins of the internet and its history, including description of what internet really is and which are its characteristics. Next part analyzes different types of internet connections and their features, advantages and disadvantages. This examination is followed by another chapter, which deals with the most widely used internet browsers in the Czech Republic. The thesis also shown and explained most comm...

  1. DESCRIPTIVE ANALYSIS OF HOUSEHOLD INSECTICIDE IN COMMUNITY

    Directory of Open Access Journals (Sweden)

    Aram Sih Joharina

    2014-06-01

    Full Text Available The most popular and effective vector control is the use of insecticides. Surveywas done in the houses and some supermarket to know many kind of insecticides usedby people. The formulation, active ingredients, and concentration were recorded andanalyzed. Based on the results of the survey, household insecticides formulated invarious formulations such as liquid, mosquito coils, aerosol, mat and liquid vaporizer,chalk and paper burn. In addition to formulation, active ingredients and concentrationalso vary. Almost all household insecticide products on the market using the syntheticpyrethroid. Selection of household insecticides should be adapted to the type of insectpests because each type of active ingredients and formulations have advantages anddisadvantages. Efficacy of various active ingredients in various formulations has beenstudied and the results vary widely. Insecticide efficacy is influenced by the type ofactive ingredient, dosage, concentration, formulation, and the susceptibility of insectspecies, temperature, sunlight, wind, and application method.Key word: household insecticide, insecticides formulation, active ingredientsABSTRAKPengendalian serangga vektor penyakit yang paling efektif dan populer adalahpenggunaan insektisida. Survei dilakukan di masyarakat dan supermarket untuk mengetahuijcnis-jenis insektisida yang digunakan oleh masyarakat. Berdasarkan hasil survei, insektisidarumah tangga terkemas dalam berbagai formulasi antara lain liquid, mosquito coil, aerosol, mat& liquid vaporizer, kapur serangga dan kertas bakar. Disamping formulasi, bahan aktif dankonsentrasi yang digunakan juga bermacam-macam. Hampir semua produk insektisida rumahtangga di pasaran menggunakan bahan aktif golongan piretroid sintetik. Pemilihan insektisidarumah tangga hendaknya disesuaikan dengan jenis serangga sasaran karena tiap jenis bahan aktifdan formulasi memiliki kelcbihan dan kekurangan. Efikasi berbagai bahan aktif dalam berbagaiformulasi telah

  2. Financial Literacy and Household Savings in Romania

    OpenAIRE

    Elisabeth Beckmann

    2013-01-01

    We present new evidence from the Euro Survey of the Austrian Central Bank on the level of financial literacy in Romania and analyze how financial literacy is related to household savings. Less than 5% of respondents were able to correctly answer the three “core” financial literacy questions on interest compounding, inflation, and risk diversification, with the risk diversification question posing the greatest difficulties. Twenty percent of respondents are able to answer both the interest com...

  3. Synthesis of Ethyl Salicylate Using Household Chemicals

    Science.gov (United States)

    Solomon, Sally; Hur, Chinhyu; Lee, Alan; Smith, Kurt

    1996-02-01

    Ethyl salicylate is synthesized, isolated, and characterized in a three-step process using simple equipment and household chemicals. First, acetylsalicylic acid is extracted from aspirin tablets with isopropyl alcohol, then hydrolyzed to salicylic acid with muriatic acid, and finally, the salicylic acid is esterified using ethanol and a boric acid catalyst. The experiment can be directed towards high school or university level students who have sufficient background in organic chemistry to recognize the structures and reactions that are involved.

  4. Labour Force Participation and Household Debt

    OpenAIRE

    Rochelle Belkar; Lynne Cockerell; Rebecca Edwards

    2007-01-01

    In the past decade or so there has been a substantial rise in the indebtedness and debt-servicing obligations of Australian households. This has been accompanied by a trend increase in labour force participation (LFP) for women and more recently for men. Microeconomic data show a clear positive correlation between indebtedness and LFP. This paper models the LFP decision of prime-age Australian women and men accounting for the influence of debt and assets along with a range of other variables ...

  5. Household Assets and Rural Finance in Nigeria

    OpenAIRE

    Onafowokan O. Oluyombo

    2013-01-01

    The study assesses the roles played by the loan service of cooperatives on household assets acquisition among cooperative members in rural communities of Ogun State where there is no bank.Independent student test and one way analysis of variance were used to analyze the data collected through questionnaire from 302 members. The study shows that the following assets – land, generator, television, radio and refrigerator – were more likely to be acquired by members than non-members. This is an i...

  6. Vietnam’s Household Registration System

    OpenAIRE

    World Bank Group; Vietnam Academy of Social Sciences

    2016-01-01

    The household registration system known as ho khau has been a part of the fabric of life in the country for over 50 years. The system was implemented as an instrument of public security, economic planning, and control of migration, at a time when the state played a stronger role in direct management of the economy and the life of its citizens. Although the system has become less rigid over...

  7. Stock Market Expectations of Dutch Households

    OpenAIRE

    Hurd, Michael; Rooij, Maarten van; Winter, Joachim

    2009-01-01

    Despite its importance for the analysis of life-cycle behavior, stock ownership by households is poorly understood. Among other approaches to the investigation of this puzzle, recent research has elicited the expectations of stock market returns by individuals. This paper reports findings from a study that collected data over a two-year period both on stock market expectations (subjective probabilities of gains or losses) and on stock ownership. On average stock market expectations are much m...

  8. Food waste from Danish households: Generation and composition

    DEFF Research Database (Denmark)

    Edjabou, Maklawe Essonanawe; Petersen, Claus; Scheutz, Charlotte;

    2016-01-01

    Sustainable solutions for reducing food waste require a good understanding of food waste generation and composition, including avoidable and unavoidable food waste. We analysed 12 tonnes of residual household waste collected from 1474 households, without source segregation of organic waste. Food...... waste was divided into six fractions according to avoidability, suitability for home-composting and whether or not it was cooked, prepared or had been served within the household. The results showed that the residual household waste generation rate was 434 ± 18 kg per household per year, of which 183...

  9. CARINA alkalinity data in the Atlantic Ocean

    Directory of Open Access Journals (Sweden)

    A. Velo

    2009-08-01

    Full Text Available Data on carbon and carbon-relevant hydrographic and hydrochemical parameters from previously non-publicly available cruise data sets in the Arctic, Atlantic and Southern Ocean have been retrieved and merged to a new database: CARINA (CARbon IN the Atlantic.

    These data have gone through rigorous quality control (QC procedures to assure the highest possible quality and consistency. The data for most of the measured parameters in the CARINA data base were objectively examined in order to quantify systematic differences in the reported values, i.e. secondary quality control. Systematic biases found in the data have been corrected in the data products, i.e. three merged data files with measured, calculated and interpolated data for each of the three CARINA regions; Arctic, Atlantic and Southern Ocean. Out of a total of 188 cruise entries in the CARINA database, 98 were conducted in the Atlantic Ocean and of these, 75 cruises report alkalinity values.

    Here we present details of the secondary QC on alkalinity for the Atlantic Ocean part of CARINA. Procedures of quality control, including crossover analysis between cruises and inversion analysis of all crossover data are briefly described. Adjustments were applied to the alkalinity values for 16 of the cruises in the Atlantic Ocean region. With these adjustments the CARINA database is consistent both internally as well as with GLODAP data, an oceanographic data set based on the World Hydrographic Program in the 1990s. Based on our analysis we estimate the internal accuracy of the CARINA-ATL alkalinity data to be 3.3 μmol kg−1. The CARINA data are now suitable for accurate assessments of, for example, oceanic carbon inventories and uptake rates and for model validation.

  10. Alkaline leaching of iron and steelmaking dust

    OpenAIRE

    Stafanova, Anna; Aromaa, Jari

    2012-01-01

    Steel production generates significant quantities of dust and sludge in blast furnaces (BF),basic oxygen furnaces (BOF), and electric arc furnaces (EAF). These dusts contain toxicelements, such as heavy metals, and are thus classified as harmful waste making the disposalof them expensive. In addition, direct recycling of dust back to steel production is hindered dueto the presence of zinc. In this literature survey the alkaline leaching of zinc from iron and steelmaking dusts isreviewed. T...

  11. Alkaline earth cation extraction from acid solution

    Science.gov (United States)

    Dietz, Mark; Horwitz, E. Philip

    2003-01-01

    An extractant medium for extracting alkaline earth cations from an aqueous acidic sample solution is described as are a method and apparatus for using the same. The separation medium is free of diluent, free-flowing and particulate, and comprises a Crown ether that is a 4,4'(5')[C.sub.4 -C.sub.8 -alkylcyclohexano]18-Crown-6 dispersed on an inert substrate material.

  12. Ubiquitous Monitoring of Electrical Household Appliances

    Science.gov (United States)

    Lloret, Jaime; Macías, Elsa; Suárez, Alvaro; Lacuesta, Raquel

    2012-01-01

    The number of appliances at home is increasing continuously, mainly because they make our lives easier. Currently, technology is integrated in all objects of our daily life. TCP/IP let us monitor our home in real time and check ubiquitously if something is happening at home. Bearing in mind this idea, we have developed a low-cost system, which can be used in any type of electrical household appliance that takes information from the appliance and posts the information to the Twitter Social network. Several sensors placed in the household appliances gather the sensed data and send them wired or wirelessly, depending on the case, using small and cheap devices to a gateway located in the home. This gateway takes decisions, based on the received data, and sends notifications to Twitter. We have developed a software application that takes the values and decides when to issue an alarm to the registered users (Twitter friends of our smart home). The performance of our system has been measured taking into account the home network (using IEEE 802.3u and IEEE 802.11g) and the data publishing in Twitter. As a result, we have generated an original product and service for any electrical household appliance, regardless of the model and manufacturer, that helps home users improve their quality of life. The paper also shows that there is no system with the same innovative features like the ones presented in this paper. PMID:23202205

  13. Researches of odour emitted by household waste

    Directory of Open Access Journals (Sweden)

    Eglė Marčiulaitienė

    2015-10-01

    Full Text Available The article deals with odour emitted by household waste, the chemical composition of household waste. The experiment was made with food waste (1000 g placed in 5 litter containers. Food waste was containing products of animal origin (meat, fish, dairy products and plant origin (vegetables, fruit waste. Time of the experiment was 14 days 19±3 °C at environment temperature. Odour concentration is determined by dynamic olfactometry method. Studies have shown that the strongest odour of all household waste used in this experiment was emitted by meat and fish waste (76 444 OUE/m3. Meat and fish waste emits the strongest odour as waste contains proteins, their decomposition releases into the environment a strong unpleasant odour, hydrogen sulphide and ammonia. Protein degradation releases into the environment are, characterized by a strong unpleasant smell of hydrogen sulphide and ammonia gas. During the anaerobic decomposition of organic matter a variety of other fragrant compounds: alcohols (e.g., ethanol and methanol, vinegar, formic acid, etc. is found.

  14. The economic burden of cancers on Indian households.

    Directory of Open Access Journals (Sweden)

    Ajay Mahal

    Full Text Available We assessed the burden of cancer on households' out-of-pocket health spending, non-medical consumption, workforce participation, and debt and asset sales using data from a nationally representative health and morbidity survey in India for 2004 of nearly 74 thousand households. Propensity scores were used to match households containing a member diagnosed with cancer (i.e. cancer-affected households to households with similar socioeconomic and demographic characteristics (controls. Our estimates are based on data from 1,645 households chosen through matching. Cancer-affected households experienced higher levels of outpatient visits and hospital admissions and increased out-of-pocket health expenditures per member, relative to controls. Cancer-affected households spent between Indian Rupees (INR 66 and INR 85 more per member on healthcare over a 15-day reference period, than controls and additional expenditures (per member incurred on inpatient care by cancer-affected households annually is equivalent to 36% to 44% of annual household expenditures of matched controls. Members without cancer in cancer-affected households used less health-care and spent less on healthcare. Overall, adult workforce participation rates were lower by between 2.4 and 3.2 percentage points compared to controls; whereas workforce participation rates among adult members without cancer were higher than in control households. Cancer-affected households also had significantly higher rates of borrowing and asset sales for financing outpatient care that were 3.3% to 4.0% higher compared to control households; and even higher for inpatient care.

  15. AAS Nova and Astrobites: Making current astronomy research accessible

    Science.gov (United States)

    Kohler, Susanna; Astrobites Team

    2016-10-01

    AAS Nova and Astrobites are two resources available for astronomers, astronomy students, and astronomy enthusiasts to keep up with some of the most recent research published across the field of astronomy. Both supported by the AAS, these two daily astrophysical literature blogs provide accessible summaries of recent publications on the arXiv and in AAS journals. We present the goals, content, and readership of AAS Nova and Astrobites, and discuss how they might be used as tools in the undergraduate classroom.

  16. Alkaline and ultrasound assisted alkaline pretreatment for intensification of delignification process from sustainable raw-material.

    Science.gov (United States)

    Subhedar, Preeti B; Gogate, Parag R

    2014-01-01

    Alkaline and ultrasound-assisted alkaline pretreatment under mild operating conditions have been investigated for intensification of delignification. The effect of NaOH concentration, biomass loading, temperature, ultrasonic power and duty cycle on the delignification has been studied. Most favorable conditions for only alkaline pretreatment were alkali concentration of 1.75 N, solid loading of 0.8% (w/v), temperature of 353 K and pretreatment time of 6 h and under these conditions, 40.2% delignification was obtained. In case of ultrasound-assisted alkaline approach, most favorable conditions obtained were alkali concentration of 1N, paper loading of 0.5% (w/v), sonication power of 100 W, duty cycle of 80% and pretreatment time of 70 min and the delignification obtained in ultrasound-assisted alkaline approach under these conditions was 80%. The material samples were characterized by FTIR, SEM, XRD and TGA technique. The lignin was recovered from solution by precipitation method and was characterized by FTIR, GPC and TGA technique.

  17. Dicty_cDB: FC-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA03 (Link to dictyBase) - - - Contig-U15331-1 FC-AA03P (Li...nk to Original site) FC-AA03F 595 FC-AA03Z 546 FC-AA03P 1141 - - Show FC-AA03 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA03Q.Seq.d/ Representative seq. ID FC-AA...03P (Link to Original site) Representative DNA sequence >FC-AA03 (FC-AA03Q) /CSM/FC/FC-AA/FC-AA03Q.Seq.d/ AA...AATGTCATCTTATTTATTCACTAGTGAATCCGTCACCGAAGTCATCCAGATAAAATCT GTGATCAAGTATCAGATGCTGTTCTCGATGCTTGTTTAGCTCAA

  18. Dicty_cDB: FC-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA10 (Link to dictyBase) - - - Contig-U16358-1 FC-AA10P (Li...nk to Original site) FC-AA10F 659 FC-AA10Z 544 FC-AA10P 1203 - - Show FC-AA10 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA10Q.Seq.d/ Representative seq. ID FC-AA...10P (Link to Original site) Representative DNA sequence >FC-AA10 (FC-AA10Q) /CSM/FC/FC-AA/FC-AA10Q.Seq.d/ AA...ATGACTACCTTTAACGAATATCCATTCTTGGCTGAATTAGGCATTAAAGCTGAAAATA ATGATGGAGTCTTCAATGGAAAATGGGGAGGTGCTGGTGAAATCATCAA

  19. Flow Injection and Atomic Absorption Spectrometry (FI-AAS) -

    DEFF Research Database (Denmark)

    Hansen, Elo Harald

    1996-01-01

    of (especially HG- forming) elements. In the words of the one of the authorities of AAS and foremost pioneers of FI-AAS - Professor Z. L. Fang, who is the author on two recently published monographs on this hyphenated technique - the impact of FI on AAS is "so dramatic" that it has brought "new vitality...

  20. Estimating household food waste in Denmark:case study of single family households

    DEFF Research Database (Denmark)

    Edjabou, Vincent Maklawe Essonanawe; Petersen, C.; Scheutz, Charlotte;

    Food waste prevention remains the first priority in the European Waste Framework Directive, which aimed to halve the amount of food wasted within the EU Member States by 2025. Thus, reliable data on food waste composition and quantity are crucial for assessing the current food waste situation and...... determine potential improvements. In Denmark, although many sorting campaigns involving household waste has been conducted, little attention has been placed on food waste. Comparison of recent studies made for examples in Austria, and the UK suggests that quantity and material composition of food waste vary...... significantly among the studies and differ from one country to another. Here, we provide a consistent methodology for characterization of household food waste, so that data comparability and source information are ensured. In this study, residual household waste was sampled and manually sorted from more than...

  1. AAS 228: Day 2 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  2. AAS 228: Day 2 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  3. AAS 228: Day 2 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  4. Household response to environmental incentives for rain garden adoption

    Science.gov (United States)

    Newburn, David A.; Alberini, Anna

    2016-02-01

    A decentralized approach to encourage the voluntary adoption of household stormwater management practices is increasingly needed to mitigate urban runoff and to comply with more stringent water quality regulations. We analyze the household response to a hypothetical rebate program to incentivize rain garden adoption using household survey data from the Baltimore-Washington corridor. We asked respondents whether the household would adopt a rain garden without a rebate or when offered a randomly assigned rebate. An interval-data model is used to estimate household demand on the willingness to pay (WTP) for a rain garden as a function of demographic factors, gardening activities, environmental attitudes, and other household characteristics. Estimation results indicate that mean WTP for a rain garden in our sample population is approximately $6.72 per square foot, corresponding to almost three-fourths of the installation cost. The expected adoption rate more than tripled when comparing no rebate versus a government rebate set at one-third of the installation cost, indicating that economic incentives matter. There is substantial heterogeneity in the WTP among households. Higher levels of WTP are estimated for households with higher environmental concern for the Chesapeake Bay and local streams, garden experience, higher income, and non-senior citizen adults. We conclude that a cost-share rebate approach is likely to significantly affect household adoption decisions, and the partial contributions paid by households can assist with lowering the substantial compliance costs for local governments to meet water quality requirements.

  5. Electricity saving in households-A social cognitive approach

    Energy Technology Data Exchange (ETDEWEB)

    Thogersen, John, E-mail: jbt@asb.d [Aarhus University, School of Business and Social Sciences, Department of Marketing, Haslegaardsvej 10, DK-8210 Aarhus (Denmark); Gronhoj, Alice, E-mail: alg@asb.d [Aarhus University, School of Business and Social Sciences, Department of Marketing, Haslegaardsvej 10, DK-8210 Aarhus (Denmark)

    2010-12-15

    We propose a conceptual framework for understanding the (lack of) energy saving efforts of private households based on Bandura's (1986) social cognitive theory. Results from applying this framework on a sample of Danish private electricity consumers are presented and it is concluded (a) that households' electricity consumption depends on both structural and motivational factors, (b) that their electricity saving effort depends on the strength of their internalized norms or self-expectations and on self-efficacy related factors, and (c) that there are predictable patterns of interaction among household members that influence their electricity consumption. The results suggest two approaches to promote electricity saving in households: (1) to change the socio-structural environment to be more facilitating for energy saving and empower householders to be more effective in their striving towards this goal through improved feedback about their household's electricity consumption and (2) social norms marketing, communicating social expectations and others' successful electricity saving achievements. - Research highlights: {yields}A combination of survey and meter reading data is used to analyze energy saving in households. {yields}Up to two adults from each household answered the questionnaire. {yields}Dyadic data analysis is used to investigate interactions between household members. {yields}Both structural and motivational factors account for households' electricity consumption. {yields}Electricity saving efforts depends on internalized norms, self-efficacy and social interaction.

  6. Electricity saving in households-A social cognitive approach

    International Nuclear Information System (INIS)

    We propose a conceptual framework for understanding the (lack of) energy saving efforts of private households based on Bandura's (1986) social cognitive theory. Results from applying this framework on a sample of Danish private electricity consumers are presented and it is concluded (a) that households' electricity consumption depends on both structural and motivational factors, (b) that their electricity saving effort depends on the strength of their internalized norms or self-expectations and on self-efficacy related factors, and (c) that there are predictable patterns of interaction among household members that influence their electricity consumption. The results suggest two approaches to promote electricity saving in households: (1) to change the socio-structural environment to be more facilitating for energy saving and empower householders to be more effective in their striving towards this goal through improved feedback about their household's electricity consumption and (2) social norms marketing, communicating social expectations and others' successful electricity saving achievements. - Research highlights: →A combination of survey and meter reading data is used to analyze energy saving in households. →Up to two adults from each household answered the questionnaire. →Dyadic data analysis is used to investigate interactions between household members. →Both structural and motivational factors account for households' electricity consumption. →Electricity saving efforts depends on internalized norms, self-efficacy and social interaction.

  7. AAS 228: Day 2 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  8. AA, vacuum tank for stochastic precooling

    CERN Multimedia

    1979-01-01

    The vaccum tank in which the fast stochastic precooling kicker was installed. It is clad with heating jackets for bake-out to 200 deg C, indispensable for reaching the operational vacuum of 7E-11 Torr. Alain Poncet, responsible for AA vacuum, is looking on. See also 7910268, 8002234.

  9. AA, mating of BST magnet halves

    CERN Multimedia

    1980-01-01

    The AA had 2 types of bending magnets: BLG (window-frame,long and narrow) and BST (H-type, short and wide). The BST had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the mating of two BST halves.

  10. Investigating design issues in household environments

    DEFF Research Database (Denmark)

    Baillie, Lynne; Benyon, David; Macauley, Catriona;

    2003-01-01

    This paper argues that the current involvement of end users in the design of technological artefacts is too superficial. It is common to involve people in requirements generation, but rarely in product inception or design. A study is reported involving five households in central Scotland, who were...... each visited on three occasions, using a new investigative framework. Illustrative examples are provided of the strengths and weaknesses of the methods used. Despite the latter, it is demonstrated that the general public can both generate and critique design ideas and that valuable contributions...... to understanding people's relationships with technologies can be expected both from children and from the elderly....

  11. RES Hydrogen: efficient pressurised alkaline electrolysers

    DEFF Research Database (Denmark)

    Bowen, Jacob R.; Bentzen, Janet Jonna; Jørgensen, Peter Stanley;

    The RESelyser project addresses issues associated with coupling alkaline electrolysis to renewable energy sources such as electrode stability and gas purity by implementing improved electrodes and a new separator membrane concept. The project aims to improve performance, operation pressure and...... reduce system cost. The project supports DTU Energy's activities on electrodes within the larger FCH-JU project. The overall project demonstrated: improved electrode efficiency also during cyclic operation, safe gas purity at a system pressure of 30 bar, 10 kW stack operation and estimated system costs...

  12. Alkaline carbonates in blast furnace process

    Directory of Open Access Journals (Sweden)

    P. Besta

    2014-10-01

    Full Text Available The production of iron in blast furnaces is a complex of physical, chemical and mechanical processes. The input raw materials contain not only metallic components, but also a number of negative elements. The most important negative elements include alkaline carbonates. They can significantly affect the course of the blast furnace process and thus the overall performance of the furnace. As a result of that, it is essential to accurately monitor the alkali content in the blast furnace raw materials. The article analyzes the alkali content in input and output raw materials and their impact on the blast furnace process.

  13. EValuation of the thixoformability of AA7004 and AA7075 alloys

    Directory of Open Access Journals (Sweden)

    Eugenio José Zoqui

    2010-09-01

    Full Text Available This study involved a complete evaluation of the thixoformability of AA7004 and AA7075 alloys, from their microstructural characterization to their viscous behavior. The alloys were subjected to globularization heat treatments for 0, 30, 90 and 210 seconds in two conditions of solid fractions, 45 and 60%, and to viscosity assays under the same conditions. Heat treatments promote the globularization of primary phase particles; hence, the best viscosity results were achieved for alloys with low solid fractions heat-treated for 210 seconds. Alloys AA7004 and AA7075 showed an apparent viscosity of 10(4 to 10(5 (Pa.s. The behavior of materials in this range is similar to that of molten glass and they show high formability. However, the AA7075 alloy showed a better performance than the AA7004 due to the smaller size of its primary particles and original grains, their lower growth during reheating, and depending on the condition, their viscosity of 10(4 Pa.s, which is extremely low for thixoforming standards.

  14. Processing and Optimization of Dissimilar Friction Stir Welding of AA 2219 and AA 7039 Alloys

    Science.gov (United States)

    Venkateswarlu, D.; Nageswara rao, P.; Mahapatra, M. M.; Harsha, S. P.; Mandal, N. R.

    2015-12-01

    The present paper discusses the optimization of dissimilar friction stir welding of AA 2219 and AA 7039 alloys with respect to tool design issues including microstructural study of weld. The optimized ultimate tensile strength was ~280 MPa, and % elongation was ~11.5. It was observed that the extent of tool shoulder flat surface and tool rotational speed influenced the weld quality significantly. A mathematical model was also developed using response surface regression analysis to predict the effects of tool geometry and process variables on dissimilar AA 2219 and AA 7039 alloys welds. The microstructure evolution and mechanical properties were investigated by employing electron backscatter diffraction technique, Vickers microhardness, and tensile testing, respectively. The microstructural observations indicated that the grain size obtained at advancing side (AA 2219 alloy side) was much finer compared to the retreating side (AA 7039 alloy side). Hardness distribution in the stir zone was inhomogeneous, which might be due to inadequate mixing of weld zone material. The hardness values observed at the weld zone were lower than that in the base materials.

  15. Predicted intake of trace elements and minerals via household drinking water by 6-year-old children from Krakow (Poland). Part 3: Aluminum

    OpenAIRE

    Barton, Henryk

    2008-01-01

    Abstract In order to evaluate aluminum intake via drinking water by children, ca. 400 households in urban, peripheral and rural areas were investigated. The study comprised ca. 200 of 5-7-year-old children in the period between 2000-2001. The samples of drinking water (DW) were collected by double sampling method (morning, evening). Aluminium (Al) was measured by the GF-AAS method. Geometric means (GM in ?g L-1, C.I.) were for evening samples: urban 72.5(13.2-398), peripheral 6.3(0...

  16. WEEE and portable batteries in residual household waste: quantification and characterisation of misplaced waste.

    Science.gov (United States)

    Bigum, Marianne; Petersen, Claus; Christensen, Thomas H; Scheutz, Charlotte

    2013-11-01

    A total of 26.1Mg of residual waste from 3129 households in 12 Danish municipalities was analysed and revealed that 89.6kg of Waste Electrical and Electronic Equipment (WEEE), 11kg of batteries, 2.2kg of toners and 16kg of cables had been wrongfully discarded. This corresponds to a Danish household discarding 29g of WEEE (7 items per year), 4g of batteries (9 batteries per year), 1g of toners and 7g of unidentifiable cables on average per week, constituting 0.34% (w/w), 0.04% (w/w), 0.01% (w/w) and 0.09% (w/w), respectively, of residual waste. The study also found that misplaced WEEE and batteries in the residual waste constituted 16% and 39%, respectively, of what is being collected properly through the dedicated special waste collection schemes. This shows that a large amount of batteries are being discarded with the residual waste, whereas WEEE seems to be collected relatively successfully through the dedicated special waste collection schemes. Characterisation of the misplaced batteries showed that 20% (w/w) of the discarded batteries were discarded as part of WEEE (built-in). Primarily alkaline batteries, carbon zinc batteries and alkaline button cell batteries were found to be discarded with the residual household waste. Characterisation of WEEE showed that primarily small WEEE (WEEE directive categories 2, 5a, 6, 7 and 9) and light sources (WEEE directive category 5b) were misplaced. Electric tooth brushes, watches, clocks, headphones, flashlights, bicycle lights, and cables were items most frequently found. It is recommended that these findings are taken into account when designing new or improving existing special waste collection schemes. Improving the collection of WEEE is also recommended as one way to also improve the collection of batteries due to the large fraction of batteries found as built-in. The findings in this study were comparable to other western European studies, suggesting that the recommendations made in this study could apply to other

  17. WEEE and portable batteries in residual household waste: quantification and characterisation of misplaced waste.

    Science.gov (United States)

    Bigum, Marianne; Petersen, Claus; Christensen, Thomas H; Scheutz, Charlotte

    2013-11-01

    A total of 26.1Mg of residual waste from 3129 households in 12 Danish municipalities was analysed and revealed that 89.6kg of Waste Electrical and Electronic Equipment (WEEE), 11kg of batteries, 2.2kg of toners and 16kg of cables had been wrongfully discarded. This corresponds to a Danish household discarding 29g of WEEE (7 items per year), 4g of batteries (9 batteries per year), 1g of toners and 7g of unidentifiable cables on average per week, constituting 0.34% (w/w), 0.04% (w/w), 0.01% (w/w) and 0.09% (w/w), respectively, of residual waste. The study also found that misplaced WEEE and batteries in the residual waste constituted 16% and 39%, respectively, of what is being collected properly through the dedicated special waste collection schemes. This shows that a large amount of batteries are being discarded with the residual waste, whereas WEEE seems to be collected relatively successfully through the dedicated special waste collection schemes. Characterisation of the misplaced batteries showed that 20% (w/w) of the discarded batteries were discarded as part of WEEE (built-in). Primarily alkaline batteries, carbon zinc batteries and alkaline button cell batteries were found to be discarded with the residual household waste. Characterisation of WEEE showed that primarily small WEEE (WEEE directive categories 2, 5a, 6, 7 and 9) and light sources (WEEE directive category 5b) were misplaced. Electric tooth brushes, watches, clocks, headphones, flashlights, bicycle lights, and cables were items most frequently found. It is recommended that these findings are taken into account when designing new or improving existing special waste collection schemes. Improving the collection of WEEE is also recommended as one way to also improve the collection of batteries due to the large fraction of batteries found as built-in. The findings in this study were comparable to other western European studies, suggesting that the recommendations made in this study could apply to other

  18. Dicty_cDB: FC-AA11 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA11 (Link to dictyBase) - - - Contig-U16273-1 FC-AA11P (Li...nk to Original site) FC-AA11F 631 FC-AA11Z 502 FC-AA11P 1133 - - Show FC-AA11 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA11Q.Seq.d/ Representative seq. ID FC-AA...11P (Link to Original site) Representative DNA sequence >FC-AA11 (FC-AA11Q) /CSM/FC/FC-AA/FC-AA...11Q.Seq.d/ GGTGAATTAATTGTTGAACCAGTTGATCAAAAATATATTTTCAAGACTGAACGTAAAGTT CCAAGAATGGGTGTTATGATTGTTGGTTTATGTGGTAACAATGGTACAA

  19. Dicty_cDB: FC-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA18 (Link to dictyBase) - - - Contig-U15943-1 FC-AA18P (Li...nk to Original site) FC-AA18F 506 FC-AA18Z 293 FC-AA18P 799 - - Show FC-AA18 Library FC (Link to library) Clone ID FC-AA...al site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA18Q.Seq.d/ Representative seq. ID FC-AA...18P (Link to Original site) Representative DNA sequence >FC-AA18 (FC-AA18Q) /CSM/FC/FC-AA/FC-AA18Q.Seq.d/ AAA...AGATAGAGAAGAAAGAAAACTTGAACGTGAGAAGGAACTTGAACGTGAACGTGAGAA AGAACTTGAGCGTGAGCGTGAACGTGAACAACGTCGTCTTGAAA

  20. Dicty_cDB: FCL-AA07 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA07 (Link to dictyBase) - - - Contig-U14973-1 FCL-AA07P ...(Link to Original site) FCL-AA07F 527 FCL-AA07Z 253 FCL-AA07P 780 - - Show FCL-AA07 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA07Q....Seq.d/ Representative seq. ID FCL-AA07P (Link to Original site) Representative DNA sequence >FCL-AA07 (FCL-AA07Q) /CSM/FCL/FCL-AA.../FCL-AA07Q.Seq.d/ CAAAATAAAAAATGTTATCAAATTTTTTAAAAGTCAACAGTAAAGCACTAGGACATATAA GAACTTTTGCCTCAAAGAGTGGTGAAATTAAA

  1. Dicty_cDB: FCL-AA12 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA12 (Link to dictyBase) - - - Contig-U16034-1 FCL-AA12P ...(Link to Original site) FCL-AA12F 629 FCL-AA12Z 540 FCL-AA12P 1169 - - Show FCL-AA12 Library FCL (Link to library) Clone ID FCL-AA...4-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA12Q....Seq.d/ Representative seq. ID FCL-AA12P (Link to Original site) Representative DNA sequence >FCL-AA12 (FCL-AA12Q) /CSM/FCL/FCL-AA.../FCL-AA12Q.Seq.d/ ATCAAATGTTTATTCAACAACAACCATCAGATTCAATTGTTTGTAATCGTTATATTCATC CAGCCATTGTTGTTTTGGTTGACCAA

  2. Dicty_cDB: FCL-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA21 (Link to dictyBase) - - - Contig-U14936-1 FCL-AA21P ...(Link to Original site) FCL-AA21F 520 FCL-AA21Z 356 FCL-AA21P 876 - - Show FCL-AA21 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA21Q....Seq.d/ Representative seq. ID FCL-AA21P (Link to Original site) Representative DNA sequence >FCL-AA21 (FCL-AA21Q) /CSM/FCL/FCL-AA.../FCL-AA21Q.Seq.d/ ATCATAATCATATATTTTTAATAGATATTGATATATATATTTAAAAAAATAAAATAAAAT AAAATAAAAAATGTCAACAGAGGAAACAAAAA

  3. Dicty_cDB: FCL-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA01 (Link to dictyBase) - - - Contig-U16033-1 FCL-AA01P ...(Link to Original site) FCL-AA01F 603 FCL-AA01Z 411 FCL-AA01P 1014 - - Show FCL-AA01 Library FCL (Link to library) Clone ID FCL-AA...3-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA01Q....Seq.d/ Representative seq. ID FCL-AA01P (Link to Original site) Representative DNA sequence >FCL-AA01 (FCL-AA01Q) /CSM/FCL/FCL-AA.../FCL-AA01Q.Seq.d/ GCAAATAATAATATTATGGGTATTGACTTTGGTACACATTTCGCATGTGTTGGTATTTTC AAGAATGAAAGAATTGAAATCTGTCCAAA

  4. Dicty_cDB: FCL-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA13 (Link to dictyBase) - - - - FCL-AA13P (Link to Original site) FCL-AA...13F 635 FCL-AA13Z 350 FCL-AA13P 985 - - Show FCL-AA13 Library FCL (Link to library) Clone ID FCL-AA...dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ Representative seq. ID FCL-AA...13P (Link to Original site) Representative DNA sequence >FCL-AA13 (FCL-AA13Q) /CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ CATATTTATAA...TTATATCTTTTTTGTTTAATAAAAAAGAAAGAATACCAACATGAGACTT TTATTGTGTTTAATTTTCTTAGTTTTTGTTTTCAATTTTGCATTATCAA

  5. Dicty_cDB: FC-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA06 (Link to dictyBase) - - - Contig-U15909-1 FC-AA06P (Li...nk to Original site) FC-AA06F 532 FC-AA06Z 501 FC-AA06P 1033 - - Show FC-AA06 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA06Q.Seq.d/ Representative seq. ID FC-AA...06P (Link to Original site) Representative DNA sequence >FC-AA06 (FC-AA06Q) /CSM/FC/FC-AA/FC-AA...06Q.Seq.d/ GTGAATATAACGATTTAGATTTAGTGTATGATAAAGATGTTTATCAAAAATTAATAGAGA ATGGTGTAGATTCATTATTATCAAAA

  6. Dicty_cDB: FC-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA08 (Link to dictyBase) - - - Contig-U15942-1 FC-AA08P (Li...nk to Original site) FC-AA08F 620 FC-AA08Z 510 FC-AA08P 1130 - - Show FC-AA08 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA08Q.Seq.d/ Representative seq. ID FC-AA...08P (Link to Original site) Representative DNA sequence >FC-AA08 (FC-AA08Q) /CSM/FC/FC-AA/FC-AA...08Q.Seq.d/ ATCAGTTACATGTACTGCACCAGTTAATATTGCAGTTATCAAATATTGGGGAAAGAGAGA TGAAAATATTATTTTACCATTAAATTCATCACTCAGTGGAA

  7. Environmental income improves household-level poverty assessments and dynamics

    DEFF Research Database (Denmark)

    Walelign, Solomon Zena; Charlery, Lindy Callen; Smith-Hall, Carsten;

    2016-01-01

    Household-level poverty assessments and analyses of poverty dynamics in developing countries typically do not include environmental income. Using household (n = 427 in 2006, 2009 and 2012) total income panel data sets, with and without environmental income, from Nepal, we analysed the importance...... of environmental income in household-level poverty assessments (Foster-Greer-Thorbecke indices) and dynamics (movements in the Poverty Transition Matrix). Random effects logit and ordered logit models were applied to estimate variables covarying with poverty categories and compared for annual household incomes...... with and without environmental income. Using the without environmental income data set significantly changed the number of households classified as poor, as well as rates of movements in and out of poverty. Excluding household-level environmental income also distorted estimation of covariates of poverty incidence...

  8. Household health care facility utilization in the Philippines.

    Science.gov (United States)

    Russo, G; Herrin, A N; Pons, M C

    This paper presents probit estimates of household utilization of health care facilities in the Philippines. Using household data from the 1987 National Health Survey and supply data from the Department of Health, separate probit equations are estimated for each of the four major types of facilities in the Philippines: Public hospitals, private hospitals, major rural health units and barangay (village) health stations. The probability that a household will utilize services from these facilities is estimated as a function of socioeconomic, demographic and supply variables. The results indicate substantial differences in utilization patterns by income class. Households in the highest income quartile are approximately twice as likely (0.451 versus 0.236) to utilize private hospital services vis-à-vis households in the lowest income quartile, ceteris paribus. The results also indicate substantial substitution between public and private services. An increase in the availability of private hospital beds significantly reduces the probability that a household will utilize government facilities. PMID:10050192

  9. Standard of Electrical Washing Machine for Household and Similar Purposes

    Institute of Scientific and Technical Information of China (English)

    Lu Jianguo

    2011-01-01

    Background With further improvement of people's living,the household washing machine industry has entered a new stage of development.However,some indicators of GB/T 4288-2003 have become no longer suitable for the development of household washing machine products at present.Particularly,with an increasing number of basic functions and auxiliary functions,many aspects are not covered by the existing standard.In order to further improve the overall quality of China's household washing machines and enhance their competitiveness in the international market,guide manufacturers to produce household washing machines in line with the demands of consumers and instruct consumers to properly purchase and use household washing machines,it is imperative to revise the GB/T 4288-2003 Household Electric Washing Machine.

  10. Household time allocation – Theoretical and empirical results from Denmark

    Directory of Open Access Journals (Sweden)

    Jens Bonke

    2005-10-01

    Full Text Available Using data from a sample of households in 1994 we find that Danish household labour allocation choices are bestdescribed by a collective model in which decisions are made cooperatively. Individual preferences are similar butthere are important differences due to the differences in educational attainment. Households can be characterized as utilitarian with a sharing rule which depends on household income and is feminist rather than egalitarian. The allocation of tasks within the family depends on both the individuals’ comparative advantage in labour markets andindividual preferences for paid work as well as the intra-household distribution of income. These results do not require explicit assumptions about labour supply that are often employed in the household time allocation literature.

  11. Household energy consumption and consumer electronics: The case of television

    International Nuclear Information System (INIS)

    In recent years, there has been a dramatic rise in the number of consumer electronics in households. These new technologies and the services that support them enable new highly energy intensive behaviours. Using in-depth interview data collected from 20 households in 2006, this paper explores these energy intensive behaviours, using the example of the use of televisions. In doing so, it illustrates how the design and marketing of consumer electronics, and the services which support them, actively encourage energy intensive behaviours and how householders are reconfiguring their homes and lifestyles to fit these behaviours. This latter point is significant because, as householders change their homes and daily lives to fit energy intensive consuming behaviours, it will become increasingly difficult to encourage people to reduce their household energy consumption. This paper concludes with the implications of the research findings for policies designed to reduce household energy consumption

  12. Definition of Household Membership in International Migration Surveys

    Directory of Open Access Journals (Sweden)

    Turgay Ünalan

    2005-01-01

    Full Text Available Using data from national surveys conducted within the scope of the Eurostat project titled “Push and Pull Factors of International Migration”, analyses are presented using different definitions (narrow versus wide of household membership in migrant-sending countries (Egypt, Ghana, Morocco, Senegal and Turkey to see if different definitions are helpful in identifying and increasing the number of migrants who are or was a part of those households. When broad definition was used, the increase in the international migrant members was especially considerable in recent and current migrant households. The findings demonstrated that it was possible to trace an important number of international migrants back in their country of origin and to collect data using proxy interviews. However, it was still impossible to survey emigrants who left the country as a household, those who were not expected to return to the household, those belonging to some dissolved households, or those who died.

  13. Stochastic SIR epidemics in a population with households and schools

    CERN Document Server

    Ouboter, Tanneke; Trapman, Pieter

    2015-01-01

    We study the spread of stochastic SIR (Susceptible $\\to$ Infectious $\\to$ Recovered) epidemics in two types of structured populations, both consisting of schools and households. In each of the types, every individual is part of one school and one household. In the independent partition model, the partitions of the population into schools and households are independent of each other. This model corresponds to the well-studied household-workplace model. In the hierarchical model which we introduce here, members of the same household are also members of the same school. We introduce computable branching process approximations for both types of populations and use these to compare the probabilities of a large outbreak. The branching process approximation in the hierarchical model is novel and of independent interest. We prove by a coupling argument that if all households and schools have the same size, an epidemic spreads easier (in the sense that the number of individuals infected is stochastically larger) in th...

  14. Environmental income improves household-level poverty assessments and dynamics

    DEFF Research Database (Denmark)

    Walelign, Solomon Zena; Charlery, Lindy Callen; Smith-Hall, Carsten;

    2016-01-01

    Household-level poverty assessments and analyses of poverty dynamics in developing countries typically do not include environmental income. Using household (n = 427 in 2006, 2009 and 2012) total income panel data sets, with and without environmental income, from Nepal, we analysed the importance of...... environmental income in household-level poverty assessments (Foster-Greer-Thorbecke indices) and dynamics (movements in the Poverty Transition Matrix). Random effects logit and ordered logit models were applied to estimate variables covarying with poverty categories and compared for annual household incomes...... with and without environmental income. Using the without environmental income data set significantly changed the number of households classified as poor, as well as rates of movements in and out of poverty. Excluding household-level environmental income also distorted estimation of covariates of...

  15. Household and non-household activities of youths: issues of modelling, data and estimation strategies.

    OpenAIRE

    Rosenzweig MR

    1980-01-01

    Working paper introducing an econometric model to test the labour economics of child labour in Indian rural areas. Analyses impact of wage rates, land ownership, labour supply, employment opportunities, parental employment (esp. women workers and married women) and children labour force participation, unpaid work in the household and school attendance, and derives conclusions on impact of family planning, educational policy and other programmes.

  16. Food Insecurity in Households with Children: Prevalence, Severity, and Household Characteristics. ERS Report Summary

    Science.gov (United States)

    Nord, Mark

    2009-01-01

    Food security is especially important for children because their nutrition affects not only their current health, but also their future health and well-being. Previous studies that used various data sources suggest that children in food-insecure households face elevated risks of health and development problems, compared with children in otherwise…

  17. Getting outside help : How trust problems explain household differences in household outsourcing

    NARCIS (Netherlands)

    Ruijter, E.H.M. de; Lippe, T. van der

    2009-01-01

    This article examines the influence of trust problems on the use of domestic outsourcing by couples from a gender perspective. The authors argue that trust problems matter in outsourcing decisions, because an outsider enters the privacy of the household and takes over tasks of special value. Analyse

  18. Subsidized Housing and Household Hardship among Low-Income Single-Mother Households

    Science.gov (United States)

    Berger, Lawrence M.; Heintze, Theresa; Naidich, Wendy B.; Meyers, Marcia K.

    2008-01-01

    We investigate associations of housing assistance with housing and food-related hardship among low-income single-mother households using data from the National Survey of America's Families (N = 5,396). Results from instrumental variables models suggest that receipt of unit-based assistance, such as traditional public housing, is associated with a…

  19. "Raising Him . . . to Pull His Own Weight": Boys' Household Work in Single-Mother Households

    Science.gov (United States)

    Berridge, Clara W.; Romich, Jennifer L.

    2011-01-01

    In this study, the authors examine boys' household work in low- and moderate-income single-mother families. Through describing the work that boys do, why they do this work, and the meaning that they and their mothers give to this work, they add to the understanding of housework as an arena for gender role reproduction or interruption. Their data…

  20. Alkaline chemistry of transuranium elements and technetium and the treatment of alkaline radioactive wastes

    International Nuclear Information System (INIS)

    Goal of this survey is to generalize the known data on fundamental physical-chemical properties of TRUs and Tc, methods for their isolation, and to provide recommendations that will be useful for partitioning them from alkaline high-level wastes

  1. Alkaline chemistry of transuranium elements and technetium and the treatment of alkaline radioactive wastes

    Energy Technology Data Exchange (ETDEWEB)

    Delegard, C.H. [Westinghouse Hanford Co., Richland, WA (United States); Peretrukhin, V.F.; Shilov, V.P.; Pikaev, A.K. [Russian Academy of Sciences (Russian Federation). Inst. of Physical Chemistry

    1995-05-01

    Goal of this survey is to generalize the known data on fundamental physical-chemical properties of TRUs and Tc, methods for their isolation, and to provide recommendations that will be useful for partitioning them from alkaline high-level wastes.

  2. Low serum alkaline phosphatase activity in Wilson's disease.

    Science.gov (United States)

    Shaver, W A; Bhatt, H; Combes, B

    1986-01-01

    Low values for serum alkaline phosphatase activity were observed early in the course of two patients with Wilson's disease presenting with the combination of severe liver disease and Coombs' negative acute hemolytic anemia. A review of other cases of Wilson's disease revealed that 11 of 12 patients presenting with hemolytic anemia had values for serum alkaline phosphatase less than their respective sex- and age-adjusted mean values; in eight, serum alkaline phosphatase activity was less than the lower value for the normal range of the test. Low values for serum alkaline phosphatase were much less common in Wilson's disease patients with more chronic forms of presentation. Copper added in high concentration to serum in vitro did not have an important effect on serum alkaline phosphatase activity. The mechanism responsible for the decrease in serum alkaline phosphatase activity in patients is uncertain.

  3. Electric household appliances lighting. Synthesis; Electromenager eclairage. Note de synthese

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-09-01

    This study has been realized on 10000 families in order to know the French behavior concerning the electric household appliances and the lighting of their accommodation. The document presents statistically the answers to the questions on the electric household in the accommodation, the choice criteria, the use conditions, the washing temperatures, the nature of the electric household appliances, the microwave ovens, the influence of the energy-label on the appliances and the lighting. (A.L.B.)

  4. AN ECO-FRIENDLY MANAGEMENT OF HOUSEHOLD ORGANIC WASTE

    OpenAIRE

    Puneeta Dandotiya; Praval Singh Chauhan; Hemant Samadhiya; O.P. Agrawal

    2015-01-01

    The household organic wastes commonly include dust, food and kitchen waste, garden waste, paper waste etc. that is generated everyday from every house. This highly nutritive organic waste is the house of infectious bacteria, vector and insect. A study was conducted to explore the possibility of vermicomposting of household organic waste at home level. For this study household waste (HW) and garden (leaves with soil-dust) waste (GW) were selected. They were mixed with dried dung powder (DDP) a...

  5. An analysis of household's tobacco consumption decisions: Evidence from India

    OpenAIRE

    Rijo John

    2004-01-01

    Tobacco products such as bidi and cigarette, both of which are smoked, cater to different kinds of households in India, and analyzing them separately may yield results that are useful for public policy. Hence, we analyze the consumption patterns, socio-economic distribution and the household choice of a variety of tobacco products across rural and urban India. Using a Multinomial Logit Model, we analyze the choice behavior of a household in deciding whether and which tobacco products to consu...

  6. Household waste recycling: National survey evidence from Italy

    OpenAIRE

    Fiorillo, Damiano

    2011-01-01

    The paper analyses the determinants of household recycling in Italy with particular emphasis on social behaviour. The econometric analysis is based on two waves - 1998 and 2000 - of the Multipurpose Household Survey conducted annually by the Italian Central Statistics Office. In Italy household recycling was substantially voluntary in the years from 1998 to 2000 with no monetary incentives or pecuniary sanctions. Five different materials are investigated: paper, glass, plastic, aluminium and ...

  7. Standby-consumption in households; Standby-Verbrauch im Haushalt

    Energy Technology Data Exchange (ETDEWEB)

    Zehnder, U.

    2006-07-01

    This final report for the Swiss Federal Office of Energy (SFOE) presents the results of a study made in five types of housing on the standby-consumption of various household appliances. 461 measurements were made in 37 households, whereby three modes - ready-for-use, standby and sleep - were examined. 71 different appliances were looked at in six consumer groups. These included entertainment, hygiene/health, kitchen/household, communication, office and garage. Data is presented in tabular form and commented on.

  8. Estimating the level and distribution of global household wealth

    OpenAIRE

    DAVIES, JAMES B; Sandström, Susanna; Shorrocks, Anthony; Wolff, Edward N.

    2007-01-01

    We provide the first estimate of the level and distribution of global household wealth. Mean assets and debts within countries are measured, partly or wholly, for 38 countries using household balance sheet and survey data centred on the year 2000. Determinants of mean financial assets, non-financial assets, and liabilities are studied empirically, and the results are used to impute values to countries lacking wealth data. Household wealth per adult is US$43,494 in PPP terms, and ranges region...

  9. Household food diversity and nutritional status among adults in Brazil

    OpenAIRE

    Sichieri Rosely; Bezerra Ilana N

    2011-01-01

    Abstract Background The aims of this study were to evaluate whether a diversity of healthy foods in a household would decrease the availability of unhealthy foods and to evaluate the association between a healthy dietary diversity score (DDS) and nutritional status among adults. Methods Data from the 2002-2003 Brazilian Household Budget Survey were used. This nationwide survey used a two-stage sampling technique: households were selected after selection of primary sample units (PSUs). Analyse...

  10. Household Income Determination and Regional Income Differential in Rural China

    OpenAIRE

    Meng, Xin; Wu, Harry

    1994-01-01

    Regional income dispersion is a sensitive issue in China in terms of judging the impact of economic reform. This study looks closely at the issue as to what are the determinants of income variation among households in general, and which are the key determinants of income dispersion among different regions. The study uses the data from a sample survey on 1000 rural households in five Chinese provinces. Household income equations are estimated to assess the determinants of income variations am...

  11. Household Level Pollution in India: Patterns and Projections

    OpenAIRE

    K.S. Kavi Kumar; Brinda Viswanatha

    2011-01-01

    Solid fuels are still a major source for cooking in many households in India causing significant disease and global warming burden. This study analyses the pollution-income relationship (for both local and global pollution), separately across rural and urban households in India based on unit record data on fuel consumption obtained through National Sample Survey data for 2004-05. Based on the estimated relationship, the study makes an attempt to project household level pollution for 2026. The...

  12. Demand for Electric Vehicles in Hybrid Households: An Exploratory Analysis

    OpenAIRE

    Kurani, Kenneth S; Turrentine, Tom; Sperling, Daniel

    1994-01-01

    Previous studies of the potential market for battery electric vehicles (BEVs) have reached contradictory conclusions. What they share are untested or implausible assumptions about consumer response to new transportation technology. We frame the BEV purchase decision in terms of a household's entire stock of vehicles, car purchase behavior and travel behavior. Within this framework, households which own both electric vehicles and gasoline vehicles are called "hybrid households". Because nearly...

  13. Socio-economic Determinants of Household Food Insecurity in Pakistan

    OpenAIRE

    Asghar, Zahid; Muhammad, Ahmed

    2013-01-01

    This study investigates the determinants of food insecurity for both general and farmer households. It is based on Pakistan Social and Living standard Measurement (PSLM) 2007-08 survey conducted by the Federal Bureau of Statistics, Pakistan. After having descriptive analysis of the important determinants of food insecurity, we have used logit model to find the probability for being household secure or insecure. The model is initially fitted with 16 (for general) and 19 (for farmer households)...

  14. Mental Accounting and Remittances: A Study of Malawian Households

    OpenAIRE

    Davies, Simon; Easaw, Joshy; Ghoshray, Atanu

    2006-01-01

    In this paper we use a behavioural approach to studying household consumption behaviour in Malawi. In particular we are interested to know whether households use mental accounting when consuming different categories of good. It is useful for assessing the impact of remittances on household consumption behaviour. We use 1998 cross-sectional data to find the following key results: (i) mental accounting systems are in operation. Remittance income exhibits a higher marginal propensity to save th...

  15. Are Children Decision-Makers Within the Household?

    OpenAIRE

    Dauphin, Anyck; El Lahga,Abdelrahmen; Fortin, Bernard; Lacroix, Guy

    2008-01-01

    Children are seldom accounted for in household behavioural models. They are usually assumed to have neither the capacity nor the power to influence the household decision process. The literature on collective models has so far incorporated children through the "caring preferences" of their parents or has treated them as household public goods [Bourguignon (1999); Blundell et al. (2005)]. This paper seeks to determine whether children of a certain age are decision-makers. We focus on the decis...

  16. Why are Saving Rates of Urban Households in China Rising?

    OpenAIRE

    Chamon, Marcos; Prasad, Eswar

    2008-01-01

    From 1995 to 2005, the average urban household saving rate in China rose by 7 percentage points, to about one quarter of disposable income. We use household-level data to explain why households are postponing consumption despite rapid income growth. Tracing cohorts over time indicates a virtual absence of consumption smoothing over the life cycle. Saving rates have increased across all demographic groups although the age profile of savings has an unusual pattern in recent years, with younger ...

  17. Incense and Joss Stick Making in Small Household Factories, Thailand

    OpenAIRE

    S Siripanich; Siriwong, W.; P Keawrueang; M Borjan; Robson, M.

    2014-01-01

    Background: Incense and joss stick are generally used in the world. Most products were made in small household factories. There are many environmental and occupational hazards in these factories.Objective: To evaluate the workplace environmental and occupational hazards in small household incense and joss stick factories in Roi-Et, Thailand.Methods: Nine small household factories in rural areas of Roi-Et, Thailand, were studied. Dust concentration and small aerosol particles were counted thro...

  18. Estimating energy conservation patterns of Greek households

    International Nuclear Information System (INIS)

    This paper develops an empirical model to investigate the main determinants of household energy conservation patterns in Greece employing cross-section data. In the empirical analysis, household energy-conserving choices models are employed, using a discrete and a latent trait variable respectively as a dependent variable. The results show that socio-economic variables such as consumers' income and family size are suitable to explain differences towards energy conservation preferences. In addition, the results suggest that electricity expenditures and age of the respondent are negatively associated with the number of energy-conserving actions that a consumer is willing to adopt. Finally, other variables such as environmental information feedback and consciousness of energy problems are characteristics of the energy-saver consumer. By evaluating consumer's decision-making process with regards to energy conservation measures, we are able to formulate and propose an effective energy conservation framework for Greece. An energy policy framework is among the main prerequisites not only to achieve sustainable development but also to maintain consumers' quality of life

  19. Measuring consumption in households. Interpretations and strategies

    Energy Technology Data Exchange (ETDEWEB)

    Jensen, Jesper Ole [Danish Building Research Institute, Aalborg University, Hoersholm (Denmark)

    2008-12-01

    The paper discusses the connection between environmental awareness and metering data on household consumption (electricity, heating, water), and it is based on recent Danish studies. It is discussed, how families' understanding of environmental awareness and environmental practices relates to their overall household consumption. The paper indicates that residents' environmental practices in everyday life are often overshadowed by consumption practices in other areas, and that such practices are often rooted in quite different rationales than environmental awareness. These findings are seen as an example of what Pierre Bourdieu calls the 'economy of symbolic goods', offering an explanation for why some symbolic actions apparently play a larger role than other, more environmentally serious consumption practices. From this, it is argued that the social structures underlying consumption and green behaviour should be recognised in the formulation of environmental policies, and that instead of using sustainable practices such as 'environmental awareness' as a sales argument, more reflexive strategies that take consumers' preferences into account should be considered. (author)

  20. DNA DAMAGE QUANTITATION BY ALKALINE GEL ELECTROPHORESIS.

    Energy Technology Data Exchange (ETDEWEB)

    SUTHERLAND,B.M.; BENNETT,P.V.; SUTHERLAND, J.C.

    2004-03-24

    Physical and chemical agents in the environment, those used in clinical applications, or encountered during recreational exposures to sunlight, induce damages in DNA. Understanding the biological impact of these agents requires quantitation of the levels of such damages in laboratory test systems as well as in field or clinical samples. Alkaline gel electrophoresis provides a sensitive (down to {approx} a few lesions/5Mb), rapid method of direct quantitation of a wide variety of DNA damages in nanogram quantities of non-radioactive DNAs from laboratory, field, or clinical specimens, including higher plants and animals. This method stems from velocity sedimentation studies of DNA populations, and from the simple methods of agarose gel electrophoresis. Our laboratories have developed quantitative agarose gel methods, analytical descriptions of DNA migration during electrophoresis on agarose gels (1-6), and electronic imaging for accurate determinations of DNA mass (7-9). Although all these components improve sensitivity and throughput of large numbers of samples (7,8,10), a simple version using only standard molecular biology equipment allows routine analysis of DNA damages at moderate frequencies. We present here a description of the methods, as well as a brief description of the underlying principles, required for a simplified approach to quantitation of DNA damages by alkaline gel electrophoresis.

  1. Advanced inorganic separators for alkaline batteries

    Science.gov (United States)

    Sheibley, D. W. (Inventor)

    1982-01-01

    A flexible, porous battery separator comprising a coating applied to a porous, flexible substrate is described. The coating comprises: (1) a thermoplastic rubber-based resin which is insoluble and unreactive in the alkaline electrolyte; (2) a polar organic plasticizer which is reactive with the alkaline electrolyte to produce a reaction product which contains a hydroxyl group and/or a carboxylic acid group; and (3) a mixture of polar particulate filler materials which are unreactive with the electrolyte, the mixture comprising at least one first filler material having a surface area of greater than 25 meters sq/gram, at least one second filler material having a surface area of 10 to 25 sq meters/gram, wherein the volume of the mixture of filler materials is less than 45% of the total volume of the fillers and the binder, the filler surface area per gram of binder is about 20 to 60 sq meters/gram, and the amount of plasticizer is sufficient to coat each filler particle. A method of forming the battery separator is also described.

  2. The effect of alkaline agents on retention of EOR chemicals

    Energy Technology Data Exchange (ETDEWEB)

    Lorenz, P.B.

    1991-07-01

    This report summarizes a literature survey on how alkaline agents reduce losses of surfactants and polymers in oil recovery by chemical injection. Data are reviewed for crude sulfonates, clean anionic surfactants, nonionic surfactants, and anionic and nonionic polymers. The role of mineral chemistry is briefly described. Specific effects of various alkaline anions are discussed. Investigations needed to improve the design of alkaline-surfactant-polymer floods are suggested. 62 refs., 28 figs., 6 tabs.

  3. The role of household saving in the modern economy

    Directory of Open Access Journals (Sweden)

    J. STEINDL

    2013-12-01

    Full Text Available The work considers the role of household saving in the modern industrial economy. It is argued that an increased saving of households depresses business profits and leads to government deficits. From the point of view of full employment policy household savings are more troublesome than business savings because, unlike the latter, they do not stimulate investment decisions. In light of this the question of functional distribution ceases to be the only matter of concern, and the question of the inequality of personal incomes moves to the foreground. Thus the consideration of the trend of household saving may involve a certain shift in attitudes of economists interested in full employment.

  4. Barriers to household investment in residential energy conservation: preliminary assessment

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, W.L.

    1982-12-01

    A general assessment of the range of barriers which impede household investments in weatherization and other energy efficiency improvements for their homes is provided. The relationship of similar factors to households' interest in receiving a free energy audits examined. Rates of return that underly household investments in major conservation improvements are assessed. A special analysis of household knowledge of economically attractive investments is provided that compares high payback improvements specified by the energy audit with the list of needed or desirable conservation improvements identified by respondents. (LEW)

  5. Microstructure analysis of aluminum extrusion: grain size distribution in AA6060, AA6082 and AA7075 alloys

    Energy Technology Data Exchange (ETDEWEB)

    Schikorra, M.; Tekkaya, A. E. [Institute of Forming Technology and Lightweight Construction, Dortmund (Germany); Donate, L.; Iomesani, L. [University of Bologna, Bologna (Italy)

    2007-10-15

    Microstructure and material flow of aluminum alloys have a significant influence on the mechanical properties and surface quality. In extrusion of aluminum billets at high temperatures the microstructure is dependent on the alloy and the forming and temperature history. A prediction of grain size and precipitation is of increasing importance in order to design the process by adjustment of parameters such as punch speed, temperatures, and quenching. To give references for microstructure prediction based on material flow, and with it strain and strain rate history, this paper deals with the microstructure during the extrusion process of AA6060, AA6082, and AA7075 alloys. Billets have been partly extruded to axisymmetric round profiles and the microstructure of the press rests consisting of the billet rests in container and die has been considered. Furthermore, these rests have been analyzed to show the material flow, dynamic and static recrystallization based on macro etchings and visible microstructure under different conditions, e.g. as in the area of high strain rate near the container wall, or in dead zones. To allow an accurate simulation of the extrusion process, punch force and temperature conditions during the tests have been measured and are presented in this paper, too.

  6. Household Metabolism in the Five Cities. Swedish National Report - Stockholm

    Energy Technology Data Exchange (ETDEWEB)

    Carlsson-Kanyama, Annika; Karlsson, Rebecka [Stockholm Univ. and Swedish Defence Research Agency, Stockholm (Sweden). Environmental Strategies Research Group; Moll, Henri; Kok, Rixt [Univ. of Groningen (Netherlands). IVEM; Wadeskog, Anders [Statistics Sweden, Stockholm (Sweden)

    2002-08-01

    The study present results from a European project, ToolSust, in which direct and indirect energy use of household consumption is quantified. The focus is on households in Stockholm and how their spending contributes to energy use. A Dutch energy analyses programme, EAP, was modified to portray Swedish conditions, and analyses of more than 300 consumer goods were performed. These data were matched with information about family expenditure patterns from 1996. Six households were analysed, Swedish average, Stockholm City average and four households from Stockholm City. The results show that it is possible to portray households' total energy use, even the indirect one, with the help of the EAP programme and Swedish statistics. Further, indirect energy use may account for more than half of households total energy use and therefore it needs to be considered in policy making. The total primary energy use for the average households varied from 240 to 260 GJ during 1996. Heating, food and transportation were large contributors. The energy efficiency of total household spending varied from 8.8 MJ per Euro 13 MJ per Euro. Information about the energy efficiency on spending is valuable but cannot be presented and used without considering basic needs and quality of life. The total energy use per person varied from 50 to 350 GJ per year, a difference of factor seven. The analyses of energy efficiency of spending, MJ per SEK, indicate important opportunities for less energy demanding spending patterns, but those with low incomes have fewer opportunities than those with high incomes. The energy profiles for different households show that the individual ones may differ a lot from the average picture. There is a need for individual household advice about how to find more energy efficient spending patterns. Large cuts in household energy use means substantial changes in both energy intensity of goods and services and expenditure profiles. Expenditure levels should also be

  7. Household transmission of leptospira infection in urban slum communities.

    Directory of Open Access Journals (Sweden)

    Elves A P Maciel

    Full Text Available BACKGROUND: Leptospirosis, a spirochaetal zoonotic disease, is the cause of epidemics associated with high mortality in urban slum communities. Infection with pathogenic Leptospira occurs during environmental exposures and is traditionally associated with occupational risk activities. However, slum inhabitants reside in close proximity to environmental sources of contamination, suggesting that transmission during urban epidemics occurs in the household environment. METHODS AND FINDINGS: A survey was performed to determine whether Leptospira infection clustered within households located in slum communities in the city of Salvador, Brazil. Hospital-based surveillance identified 89 confirmed cases of leptospirosis during an outbreak. Serum samples were obtained from members of 22 households with index cases of leptospirosis and 52 control households located in the same slum communities. The presence of anti-Leptospira agglutinating antibodies was used as a marker for previous infection. In households with index cases, 22 (30% of 74 members had anti-Leptospira antibodies, whereas 16 (8% of 195 members from control households had anti-Leptospira antibodies. Highest titres were directed against L. interrogans serovars of the Icterohaemorrhagiae serogroup in 95% and 100% of the subjects with agglutinating antibodies from case and control households, respectively. Residence in a household with an index case of leptospirosis was associated with increased risk (OR 5.29, 95% CI 2.13-13.12 of having had a Leptospira infection. Increased infection risk was found for all age groups who resided in a household with an index case, including children <15 years of age (P = 0.008. CONCLUSIONS: This study identified significant household clustering of Leptospira infection in slum communities where recurrent epidemics of leptospirosis occur. The findings support the hypothesis that the household environment is an important transmission determinant in the urban slum

  8. HOUSEHOLD NUCLEATION, DEPENDENCY AND CHILD HEALTH OUTCOMES IN GHANA.

    Science.gov (United States)

    Annim, Samuel Kobina; Awusabo-Asare, Kofi; Amo-Adjei, Joshua

    2015-09-01

    This study uses three key anthropometric measures of nutritional status among children (stunting, wasting and underweight) to explore the dual effects of household composition and dependency on nutritional outcomes of under-five children in Ghana. The objective is to examine changes in household living arrangements of under-five children to explore the interaction of dependency and nucleation on child health outcomes. The concept of nucleation refers to the changing structure and composition of household living arrangements, from highly extended with its associated socioeconomic system of production and reproduction, social behaviour and values, towards single-family households - especially the nuclear family, containing a husband and wife and their children alone. A negative relationship between levels of dependency, as measured by the number of children in the household, and child health outcomes is premised on the grounds that high dependency depletes resources, both tangible and intangible, to the disadvantage of young children. Data were drawn from the last four rounds of the Ghana Demographic and Health Surveys (GDHSs), from 1993 to 2008, for the first objective - to explore changes in household composition. For the second objective, the study used data from the 2008 GDHS. The results show that, over time, households in Ghana have been changing towards nucleation. The main finding is that in households with the same number of dependent children, in nucleated households children under age 5 have better health outcomes compared with children under age 5 in non-nucleated households. The results also indicate that the effect of dependency on child health outcomes is mediated by household nucleation and wealth status and that, as such, high levels of dependency do not necessarily translate into negative health outcomes for children under age 5, based on anthropometric measures. PMID:25167165

  9. Poverty Analysis of Rice Farming Households: A Multidimensional Approach

    Directory of Open Access Journals (Sweden)

    Adenuga A. H

    2013-12-01

    Full Text Available The official measurement and analysis of poverty in Nigeria has historically relied upon the single dimension, consumption based monetary approach with little attention on multidimensional poverty assessment. This study was therefore carried out to assess the multidimensional poverty index of rice farming households in Nasarawa/Benue Rice Hub, Nigeria. The study employed stratified random sampling technique to select 149 rice farming households in the study area. Descriptive statistics, the Alkire and Foster Multidimensional Poverty Index Methodology using two different cut-off points and the Tobit regression model were the main analytical tools employed for the study. The results of the multidimensional poverty index analysis revealed that female headed households were poorer than the male headed households. On the overall, 66 percent of the rice farming households was multidimensionally poor. The study also showed that the rice farming households were deprived in 48 percent of the dimensions. A multidimensional poverty index of 0.32 was obtained for the rice farming households in the study area with varying values obtained for the male and female headed households. The result of the Tobit regression model showed that gender of the household head, health, marital status and membership of association were the major determinants of multidimensional poverty of the rice farming households in the study area. The study concluded that the rice farming households in the study area were multidimensionally poor. It was recommended that the government should give priorities to the development of the rural areas with special consideration for women through the provision of essential infrastructural facilities.

  10. Dolomite Dissolution in Alkaline Cementious Media

    Science.gov (United States)

    Mittermayr, Florian; Klammer, Dietmar; Köhler, Stephan; Dietzel, Martin

    2010-05-01

    Chemical alteration of concrete has gained much attention over the past years as many cases of deterioration due to sulphate attack, thaumasite formation (TSA) or alkali silica reactions (ASR) have been reported in various constructions (Schmidt et al, 2009). Much less is known about the so called alkali carbonate reaction (ACR). It is believed that dolomite aggregates can react with the alkalis from the cement, dissolve and form calcite and brucite (Katayama, 2004). Due to very low solubility of dolomite in alkaline solutions this reaction seems doubtful. In this study we are trying to gain new insides about the conditions that can lead to the dissolution of dolomite in concrete. Therefore we investigated concrete samples from Austrian tunnels that show partially dissolved dolomite aggregates. Petrological analysis such as microprobe, SEM and Raman spectroscopy as well as a hydrochemical analysis of interstitial solutions and ground water and modelling with PhreeqC (Parkhurst and Appelo, 1999) are carried out. In addition a series of batch experiments is set up. Modelling approaches by PhreeqC show a thermodynamically possibility in the alkaline range when additional Ca2+ in solution causes dolomite to become more and more undersaturated as calcite gets supersaturated. Interacting ground water is enriched in Ca2+and saturated with respect to gypsum as marine evaporites are found in situ rocks. Furthermore it is more likely that Portlandite (Ca(OH)2) plays a more important role than Na and K in the cement. Portlandite acts as an additional Ca2+ source and is much more abundant than the alkalies. Some interstitial solutions are dominated mainly by Na+ and SO42- and reach concentrations up to 30 g/l TDS. It is believed that solutions can even reach thenardite saturation as efflorescences are found on the tunnel walls. In consequence dolomite solubility increases with increasing ionic strength. pH > 11 further accelerate the process of dedolomitization by the removal

  11. Eat, Drink, Man, Woman: Gender, Income Share and Household Expenditure in South Africa

    Science.gov (United States)

    Gummerson, Elizabeth; Schneider, Daniel

    2013-01-01

    This study examines how gendered household bargaining occurs in non-nuclear family households. We employ two South African data sets and use linear regression and household fixed effects to investigate the relationship between women's income shares and household expenditures. In married couple households, when women garner larger shares of income,…

  12. Integration of Smart Grid Technologies in Households

    DEFF Research Database (Denmark)

    Friis, Freja; Gram-Hanssen, Kirsten

    2013-01-01

    This article considers the interplay between new smart grid technologies and households everyday practices. The research focuses on how Electric Vehicles (EVs) and Dynamic Pricing influence on Danish households’ everyday life and how these technologies constitutes and change routines and practices......, is analysed from the analytical concept offered by the Social Practice Theory. Overall, the case-study demonstrates that the smart grid technologies influence the ‘way of driving’ and changed the temporal patterns of consumption in the families during the test-period. The inquiry attempts to contribute...... to a more complex and multiple consideration of the interplay between households’ social practices and new smart grid technologies - and thereby helps to fill out the lack of research on the integration of peak-shaving technologies in the end-user design....

  13. Dynamic Stock Market Participation of Households

    DEFF Research Database (Denmark)

    Khorunzhina, Natalia

    This paper develops and estimates a dynamic model of stock market participation, where consumers’ decisions regarding stock market participation are influenced by participation costs. The practical significance of the participation costs is considered as being a channel through which financial...... education programs can affect consumers’ investment decisions. Using household data from the Panel Study of Income Dynamics, I estimate the magnitude of the participation cost, allowing for individual heterogeneity in it. The results show the average stock market articipation cost is about 5% of labor...... income; however, it varies substantially over consumers’ life. The model successfully predicts the level of the observed articipation rate and the increasing pattern of stock market participation over the consumers’ life cycle....

  14. Financial Literacy and Household Savings in Romania

    Directory of Open Access Journals (Sweden)

    Elisabeth Beckmann

    2013-07-01

    Full Text Available We present new evidence from the Euro Survey of the Austrian Central Bank on the level of financial literacy in Romania and analyze how financial literacy is related to household savings. Less than 5% of respondents were able to correctly answer the three “core” financial literacy questions on interest compounding, inflation, and risk diversification, with the risk diversification question posing the greatest difficulties. Twenty percent of respondents are able to answer both the interest compounding and inflation questions correctly. Financial literacy levels differ between regions and across rural and urban areas. Older and less-educated individuals perform worst on the financial literacy questions, but those who remember previous periods of economic turbulence during transition perform better. We find that financial literacy is positively and significantly related to saving and investment.

  15. Albanian Households Behavior towards the Investment Alternatives

    Directory of Open Access Journals (Sweden)

    Brikena Leka

    2009-12-01

    Full Text Available The article presents issues related to the investment alternatives for the households and the opportunities offers especially to Albanian families by the financial market. The main part of this study consists in developing empirical models, which can explain the behavior of Albanian individuals to invest in a particular portfolio. A survey was conducted consisting in 300 questionnaires. The research covered different cities in Albania, selected basically on their size and geographical location. The models are developed the Binar Models (models with discrete values, where the dependable variables are binary. Undependable variables are category. In the developed equations are reflected the main factors influencing the probability of undertaking by individuals investments with no risk or with risk.

  16. Absorption spectra of AA-stacked graphite

    Energy Technology Data Exchange (ETDEWEB)

    Chiu, C W; Lee, S H; Chen, S C; Lin, M F [Department of Physics, National Cheng Kung University, Taiwan (China); Shyu, F L, E-mail: fl.shyu@msa.hinet.ne, E-mail: mflin@mail.ncku.edu.t [Department of Physics, ROC Military Academy, 830 Kaohsiung, Taiwan (China)

    2010-08-15

    AA-stacked graphite shows strong anisotropy in geometric structures and velocity matrix elements. However, the absorption spectra are isotropic for the polarization vector on the graphene plane. The spectra exhibit one prominent plateau at middle energy and one shoulder structure at lower energy. These structures directly reflect the unique geometric and band structures and provide sufficient information for experimental fitting of the intralayer and interlayer atomic interactions. On the other hand, monolayer graphene shows a sharp absorption peak but no shoulder structure; AA-stacked bilayer graphene has two absorption peaks at middle energy and abruptly vanishes at lower energy. Furthermore, the isotropic features are expected to exist in other graphene-related systems. The calculated results and the predicted atomic interactions could be verified by optical measurements.

  17. Hydrogen in aluminum during alkaline corrosion

    Energy Technology Data Exchange (ETDEWEB)

    Adhikari, Saikat; Ai, Jiahe [Department of Chemical and Biological Engineering, Iowa State University, Ames, IA 50011 (United States); Hebert, Kurt R., E-mail: krhebert@iastate.ed [Department of Chemical and Biological Engineering, Iowa State University, Ames, IA 50011 (United States); Ho, K.M.; Wang, C.Z. [US DOE, Ames Laboratory, Ames, IA 50011 (United States)] [Department of Physics and Astronomy, Iowa State University, Ames, IA 50011 (United States)

    2010-07-30

    The thermodynamic state of hydrogen in aluminum during alkaline corrosion was investigated, using a two-compartment hydrogen permeation cell with an Al/Pd bilayer membrane. The open-circuit potential of the Pd layer in a pH 7.0 buffer solution was monitored to sense the hydrogen chemical potential, {mu}{sub H}. At pH 12.5-13.5, the measurements established a minimum {mu}{sub H} of 0.55 eV relative to the ideal gas reference, equivalent to a H{sub 2} gas pressure of 5.7 GPa. Statistical mechanics calculations show that vacancy-hydrogen defects are stable in Al at this condition. A dissolution mechanism was proposed in which H at very high {mu}{sub H} is produced by oxidation of interfacial aluminum hydride. The mechanism explains the observed rapid accumulation of H in the metal by extensive formation of vacancy-hydrogen defects.

  18. Alkaline lixiviation of uranium in granitic pegmatite

    International Nuclear Information System (INIS)

    The work described herein concerns the determination of the experimental optimum conditions for the alkaline lixiviation of uranium based on the following parameters: time, pH, temperature, density and grane size. The samples were obtained from the Supamo complex, near the Currupia river in the Piar District of the Bolivar State in Venezuela. They have a granitic composition and graphitic texture. The uranium was found in them as a secondary oxidized mineral of green-yellow colour localized in fractures fissures, intergranular spaces and also in the mica as. Secondary uranitite. The lixiviation process was carried out using Na2CO3/NaHCO3 buffer solution and for 100 gr. samples the best values for an efficient process were found by using 170 mesh grane size and 500 ml of pH buffer at 700C for a 24 hour time period. (author)

  19. Alkaline oxide conversion coatings for aluminum alloys

    Energy Technology Data Exchange (ETDEWEB)

    Buchheit, R.G.

    1996-02-01

    Three related conversion coating methods are described that are based on film formation which occurs when aluminum alloys are exposed to alkaline Li salt solutions. Representative examples of the processing methods, resulting coating structure, composition and morphology are presented. The corrosion resistance of these coatings to aerated 0.5 M NaCl solution has been evaluated as a function of total processing time using electrochemical impedance spectroscopy (EIS). This evaluation shows that excellent corrosion resistance can be uniformly achieved using no more than 20 minutes of process time for 6061-T6. Using current methods a minimum of 80 minutes of process time is required to get marginally acceptable corrosion resistance for 2024-T3. Longer processing times are required to achieve uniformly good corrosion resistance.

  20. Alkaline pulping of some eucalypts from Sudan.

    Science.gov (United States)

    Khristova, P; Kordsachia, O; Patt, R; Dafaalla, S

    2006-03-01

    Four eucalypts (Eucalyptus camaldulensis, Eucalyptus microtheca, Eucalyptus tereticornis and Eucalyptus citriodora) grown in Sudan were examined for their suitability for pulping and papermaking with different alkaline methods. Their physical, morphological and chemical characteristics are reported. The pulping trials with E. citriodora and E. tereticornis were carried out using the kraft-AQ, soda-AQ, modified AS/AQ (ASA), ASAM and kraft methods. For the other two species, only the ASAM and the kraft process were applied. ASAM pulping gave the best results in terms of yield, degree of delignification, mechanical and optical pulp properties. The best pulps, obtained in kraft and ASAM cooking of E. citriodora, were bleached to 88% ISO brightness in a totally chlorine free bleaching sequence (OQ1O/PQ2P). The bleached pulps, especially the ASAM pulp, showed good papermaking properties and would be suitable for manufacture of writing and printing grades of paper. PMID:15935655

  1. Moral discourses and pharmaceuticalised governance in households.

    Science.gov (United States)

    Dew, Kevin; Norris, Pauline; Gabe, Jonathan; Chamberlain, Kerry; Hodgetts, Darrin

    2015-04-01

    This article extends our understanding of the everyday practices of pharmaceuticalisation through an examination of moral concerns over medication practices in the household. Moral concerns of responsibility and discipline in relation to pharmaceutical consumption have been identified, such as passive or active medication practices, and adherence to orthodox or unorthodox accounts. This paper further delineates dimensions of the moral evaluations of pharmaceuticals. In 2010 and 2011 data were collected from 55 households across New Zealand and data collection techniques, such as photo- and diary-elicitation interviews, allowed the participants to develop and articulate reflective stories of the moral meaning of pharmaceuticals. Four repertoires were identified: a disordering society repertoire where pharmaceuticals evoke a society in an unnatural state; a disordering self repertoire where pharmaceuticals signify a moral failing of the individual; a disordering substances repertoire where pharmaceuticals signify a threat to one's physical or mental equilibrium; a re-ordering substances repertoire where pharmaceuticals signify the restoration of function. The research demonstrated that the dichotomies of orthodox/unorthodox and compliance/resistance do not adequately capture how medications are used and understood in everyday practice. Attitudes change according to why pharmaceuticals are taken and who is taking them, their impacts on social relationships, and different views on the social or natural production of disease, the power of the pharmaceutical industry, and the role of health experts. Pharmaceuticals are tied to our identity, what we want to show of ourselves, and what sort of world we see ourselves living in. The ordering and disordering understandings of pharmaceuticals intersect with forms of pharmaceuticalised governance, where conduct is governed through pharmaceutical routines, and where self-responsibility entails following the prescription of other

  2. Enzymatic Hydrolysis of Alkaline Pretreated Coconut Coir

    Directory of Open Access Journals (Sweden)

    Akbarningrum Fatmawati

    2013-06-01

    Full Text Available The purpose of this research is to study the effect of concentration and temperature on the cellulose and lignin content, and the reducing sugars produced in the enzymatic hydrolysis of coconut coir. In this research, the coconut coir is pretreated using 3%, 7%, and 11% NaOH solution at 60oC, 80oC, and 100oC. The pretreated coir were assayed by measuring the amount of cellulose and lignin and then hydrolysed using Celluclast and Novozyme 188 under various temperature (30oC, 40oC, 50oC and pH (3, 4, 5. The hydrolysis results were assayed for the reducing sugar content. The results showed that the alkaline delignification was effective to reduce lignin and to increase the cellulose content of the coir. The best delignification condition was observed at 11% NaOH solution and 100oC which removed 14,53% of lignin and increased the cellulose content up to 50,23%. The best condition of the enzymatic hydrolysis was obtained at 50oC and pH 4 which produced 7,57 gr/L reducing sugar. © 2013 BCREC UNDIP. All rights reservedReceived: 2nd October 2012; Revised: 31st January 2013; Accepted: 6th February 2013[How to Cite: Fatmawati, A., Agustriyanto, R., Liasari, Y. (2013. Enzymatic Hydrolysis of Alkaline Pre-treated Coconut Coir. Bulletin of Chemical Reaction Engineering & Catalysis, 8 (1: 34-39 (doi:10.9767/bcrec.8.1.4048.34-39[Permalink/DOI: http://dx.doi.org/10.9767/bcrec.8.1.4048.34-39] | View in  |

  3. AA, inner conductor of a magnetic horn

    CERN Multimedia

    CERN PhotoLab

    1981-01-01

    At the start-up of the AA and during its initial operation, magnetic horns focused the antiprotons emanating from the production target. These "current-sheet lenses" had a thin inner conductor (for minimum absorption of antiprotons), machined from aluminium to wall thicknesses of 0.7 or 1 mm. The half-sine pulses rose to 150 kA in 8 microsec. The angular acceptance was 50 mrad.

  4. Research in development: the approach of AAS

    OpenAIRE

    Dugan, P.; Apgar, M.; Douthwaite, B.

    2013-01-01

    The CGIAR Research Program on Aquatic Agricultural Systems (AAS) is pursuing a Research in Development approach that emphasizes the importance of embedding research in the development context. Reflecting this emphasis the six elements of this approach are a commitment to people and place, participatory action research, gender transformative research, learning and networking, partnerships, and capacity building. It is through the careful pursuit of these six elements that we believe that the p...

  5. First circulating beam in the AA

    CERN Multimedia

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.5 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are to numerous to name them all. Heribert Koziol, apparently asleep, is answering the call from an impatient director. See also 8007094.

  6. AA Prototype-Quadrupole on Measurement Stand

    CERN Multimedia

    1979-01-01

    The very particular lattice of the AA required 2 types of quadrupoles: narrow ones (QFN, QDN) and wide ones (QFW, QDW). The wide ones, although rather short (steel length 0.54 m), had an unusually large aperture of 0.75 m in width, 0.68 m "good field". A prototype was built at CERN in 1978. Here we see it on its test stand, with a measurement coil inserted, Brian Pincott taking readings.

  7. AA, assembly of wide bending magnet

    CERN Multimedia

    1980-01-01

    The very particular lattice of the AA required 2 types of dipoles (bending magnets; BST, short and wide; BLG, long and narrow). The wide ones had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the copper coils being hoisted onto the lower half of a BST. See also 7811105, 8006050. For a BLG, see 8001044.

  8. AA Prototype-Quadrupole on Measurement Stand

    CERN Multimedia

    1978-01-01

    The very particular lattice of the AA required 2 types of quadrupoles: narrow ones (QFN, QDN) and wide ones (QFW, QDW). The wide ones, although not very long (steel length 0.54 m), had an unusually large aperture of 0.75 m in width, 0.68 m "good field". A prototype was built in 1978. Here we see it on its test stand, with Ray Brown positioning the measurement coil.

  9. Emissions trading for households? : A behavioral law and economics perspective

    NARCIS (Netherlands)

    Woerdman, Edwin; Bolderdijk, Jan

    2016-01-01

    This is the first research article on expanding emissions trading in the EU to households in which law and economics is explicitly and systematically combined with behavioral science. The goal of the article is neither to plead in favor nor against emissions trading for households, but rather to pro

  10. What Determines Financial Exclusion? Evidence from Bolivian Household Data

    OpenAIRE

    Yener Altunbas; John Thornton; Alper Kara

    2010-01-01

    We use a bivariate probit model with sample selection to investigate the factors affecting financial exclusion of Bolivian households. We find evidence that for heads of households, being female and indigenous is likely to result in exclusion from formal credit mechanisms, though being employed in the public sector and, for females, by having a university education, mitigates this.

  11. Household Energy Conservation from Elementary Science Teacher Candidates' Perspective

    Science.gov (United States)

    Sahin, Elvan

    2016-01-01

    This study was conducted to understand the complex nature of gender differentiation in household energy consumption, and uncover the factors characterizing Turkish female university students' contribution on household energy conservation. Specifically, the study hypothesized that energy-related attributes would significantly differentiate female…

  12. 16 CFR 303.12 - Trimmings of household textile articles.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Trimmings of household textile articles. 303... CONGRESS RULES AND REGULATIONS UNDER THE TEXTILE FIBER PRODUCTS IDENTIFICATION ACT § 303.12 Trimmings of household textile articles. (a) Trimmings incorporated in articles of wearing apparel and other...

  13. Farm household risk balancing: empirical evidence from Switzerland

    NARCIS (Netherlands)

    Mey, de Yann; Wauters, E.; Schmid, D.; Passel, van S.; Vancauteren, Mark; Lips, M.

    2016-01-01

    This paper presents the first empirical evidence on household risk balancing behavior, i.e., strategic off-farm decisions in response to changes in expected business risk. Using Swiss FADN data, we estimate a fixed effects seemingly unrelated regression model to analyze how farm households jointly a

  14. Household debt and consumption during the financial crisis

    DEFF Research Database (Denmark)

    Andersen, Asger Lau; Duus, Charlotte; Jensen, Thais Lærkholm

    2014-01-01

    We use data for nearly 800,000 Danish families to examine whether high household leverage prior to the financial crisis may have amplified the reduction in household spending over the course of the crisis. We find a strong negative correlation between pre-crisis leverage and the change in non-hou...

  15. Ambiguity Aversion and Household Portfolio Choice Puzzles: Empirical Evidence

    NARCIS (Netherlands)

    S.G. Dimmock (Stephen); R.R.P. Kouwenberg (Roy); O.S. Mitchell (Olivia); K. Peijnenburg (Kim)

    2016-01-01

    markdownabstractWe test the relation between ambiguity aversion and five household portfolio choice puzzles: nonparticipation in equities, low allocations to equity, home-bias, own-company stock ownership, and portfolio under-diversification. In a representative US household survey, we measure ambig

  16. The Impact of Child SSI Enrollment on Household Outcomes

    Science.gov (United States)

    Duggan, Mark G.; Kearney, Melissa Schettini

    2007-01-01

    We use data from the Survey of Income and Program Participation (SIPP) to investigate the impact that child Supplemental Security Income (SSI) enrollment has on household outcomes, including poverty, household earnings, and health insurance coverage. The longitudinal nature of the SIPP allows us to control for unobserved, time-invariant…

  17. Features implementation of controlling in management system of householding organization

    OpenAIRE

    Shulepina Svetlana Aleksandrovna; Degaltseva Zhanna Vladimirovna

    2015-01-01

    Difficulties of controlling introduction in workflow of Russian companies are described in the article. Problems of costs controlling introduction in household organization are presented. The structure of responsibility centers and grouping cost centers by type of business processes in household organizations are suggested.

  18. PERFORMANCE OF HYDROCARBONS IN A HOUSEHOLD REFRIGERATOR/FREEZER

    Science.gov (United States)

    The paper discusses the performance of hydrocarbons in a household refrigerator/freezer (R/F). t focuses on the utilization of specific hydrocarbons (propane and isobutane) as drop-in replacements for CFC-12 in household R/Fs. esults, from this experimental work can be extrapolat...

  19. Shared Learning: Feminist Student Research on Household Reuse Behavior

    Science.gov (United States)

    Medley, Kimberly E.; Zhou, Ying; Condon, Darcy

    2006-01-01

    This paper describes collaborative student research on waste management that first compiled home interviews with women professors in Oxford, Ohio, USA, and Beijing, China, on household reuse for a graduate thesis and then communicated the findings in a handbook for undergraduate students. The women participants described diverse household reuse…

  20. 77 FR 32901 - State Enforcement of Household Goods Consumer Protection

    Science.gov (United States)

    2012-06-04

    ... Household Goods Consumer Protection AGENCY: Federal Motor Carrier Safety Administration (FMCSA), DOT. ACTION... SAFETEA-LU. The Agency amended its household goods regulations on November 29, 2010 (75 FR 72987). States... goods regulatory authorities and State attorneys general may enforce certain consumer...

  1. Sustainability effects of household-scale biogas in rural China

    NARCIS (Netherlands)

    Gosens, J.; Lu Yonglong,; He Guizhen,; Bluemling, B.; Beckers, T.A.M.

    2013-01-01

    Households in rural China rely heavily on low quality fuels which results in reduced quality of life and environmental degradation. This study assesses the comparative contribution of household scale biogas installations to the broad set of sustainability objectives in the Chinese biogas policy fram

  2. Influence of household demographic and socio-economic factors on household expenditure on tobacco in six New Independent States

    Directory of Open Access Journals (Sweden)

    Gotsadze George

    2007-08-01

    Full Text Available Abstract Background To identify demographic and socio-economic factors that are associated with household expenditure on tobacco in Azerbaijan, Georgia, Kazakhstan, Kyrgyzstan, Russian Federation, and Tajikistan. Methods Secondary analysis of the data available through the World Bank Living Standards Monitoring Survey conducted in aforementioned countries in 1995–2000. The role of different variables (e.g. mean age of household members, household area of residence, household size, share of adult males, share of members with high education in determining household expenditure on tobacco (defined as tobacco expenditure share out of total monthly HH consumption was assessed by using multiple regression analysis. Results Significant differences were found between mean expenditure on tobacco between rich and poor – in absolute terms the rich spend significantly more compared with the poor. Poor households devote significantly higher shares of their monthly HH consumption for tobacco products. Shares of adult males were significantly associated with the share of household consumption devoted for tobacco. There was a significant negative association between shares of persons with tertiary education within the HH and shares of monthly household consumption devoted for tobacco products. The correlation between household expenditures on tobacco and alcohol was found to be positive, rather weak, but statistically significant. Conclusion Given the high levels of poverty and high rates of smoking in the New Independent States, these findings have important policy implications. They indicate that the impact and opportunity costs of smoking on household finances are more significant for the poor than for the rich. Any reductions in smoking prevalence within poor households could have a positive economic impact.

  3. Introducing the AAS Astronomy Ambassadors Program

    Science.gov (United States)

    Gurton, S.; Fienberg, R. T.; Fraknoi, A.; Prather, E. E.

    2013-04-01

    Newly established by the American Astronomical Society (AAS), the Astronomy Ambassadors program is designed to support early-career AAS members with training in resources and techniques for effective outreach to students and/or the public. A pilot Astronomy Ambassadors workshop will be held at the January 2013 AAS meeting. Workshop participants will learn to communicate effectively with public and school audiences; find outreach opportunities and establish ongoing partnerships with local schools, science centers, museums, parks, and/or community centers; reach audiences with personal stories, hands-on activities, and jargon-free language; identify strategies and techniques to improve their presentation skills; gain access to a menu of outreach resources that work in a variety of settings; and become part of an active community of astronomers who do outreach. Applications are welcome from advanced undergraduates (those doing research and committed to continuing in astronomy), graduate students, and postdocs and new faculty in their first two years after receipt of the PhD. We especially encourage applications from members of groups that are presently underrepresented in science.

  4. AAS Publishing News: Astronomical Software Citation Workshop

    Science.gov (United States)

    Kohler, Susanna

    2015-07-01

    Do you write code for your research? Use astronomical software? Do you wish there were a better way of citing, sharing, archiving, or discovering software for astronomy research? You're not alone! In April 2015, AAS's publishing team joined other leaders in the astronomical software community in a meeting funded by the Sloan Foundation, with the purpose of discussing these issues and potential solutions. In attendance were representatives from academic astronomy, publishing, libraries, for-profit software sharing platforms, telescope facilities, and grantmaking institutions. The goal of the group was to establish “protocols, policies, and platforms for astronomical software citation, sharing, and archiving,” in the hopes of encouraging a set of normalized standards across the field. The AAS is now collaborating with leaders at GitHub to write grant proposals for a project to develop strategies for software discoverability and citation, in astronomy and beyond. If this topic interests you, you can find more details in this document released by the group after the meeting: http://astronomy-software-index.github.io/2015-workshop/ The group hopes to move this project forward with input and support from the broader community. Please share the above document, discuss it on social media using the hashtag #astroware (so that your conversations can be found!), or send private comments to julie.steffen@aas.org.

  5. Nucleotide and amino acid sequences of human intestinal alkaline phosphatase: close homology to placental alkaline phosphatase

    International Nuclear Information System (INIS)

    A cDNA clone for human adult intestinal alkaline phosphatase (ALP) [orthophosphoric-monoester phosphohydrolase (alkaline optimum); EC 3.1.3.1] was isolated from a λgt11 expression library. The cDNA insert of this clone is 2513 base pairs in length and contains an open reading frame that encodes a 528-amino acid polypeptide. This deduced polypeptide contains the first 40 amino acids of human intestinal ALP, as determined by direct protein sequencing. Intestinal ALP shows 86.5% amino acid identity to placental (type 1) ALP and 56.6% amino acid identity to liver/bone/kidney ALP. In the 3'-untranslated regions, intestinal and placental ALP cDNAs are 73.5% identical (excluding gaps). The evolution of this multigene enzyme family is discussed

  6. Estimating household food waste in Denmark:case study of single family households

    OpenAIRE

    Edjabou, Vincent Maklawe Essonanawe; Petersen, C.; Scheutz, Charlotte; Astrup, Thomas Fruergaard

    2014-01-01

    Food waste prevention remains the first priority in the European Waste Framework Directive, which aimed to halve the amount of food wasted within the EU Member States by 2025. Thus, reliable data on food waste composition and quantity are crucial for assessing the current food waste situation and determine potential improvements. In Denmark, although many sorting campaigns involving household waste has been conducted, little attention has been placed on food waste. Comparison of recent studie...

  7. Space-time variability of alkalinity in the Mediterranean Sea

    Directory of Open Access Journals (Sweden)

    G. Cossarini

    2014-09-01

    Full Text Available The paper provides a basin assessment of the spatial distribution of ocean alkalinity in the Mediterranean Sea. The assessment is made using a 3-D transport-biogeochemical-carbonate model to integrate the available experimental findings, which also constrains model output. The results indicate that the Mediterranean Sea shows alkalinity values that are much higher than those observed in the Atlantic Ocean on a basin-wide scale. A marked west-to-east surface gradient of alkalinity is reproduced as a response to the terrestrial discharges, the mixing effect with the Atlantic water entering from the Gibraltar Strait and the Black Sea water from Dardanelles, and the surface flux of evaporation minus precipitation. Dense water production in marginal seas (Adriatic and Aegean Seas, where alkaline inputs are relevant, and the Mediterranean thermohaline circulation sustains the west-to-east gradient along the entire water column. In the surface layers, alkalinity has a relevant seasonal cycle (up to 40 μmol kg−1 that is driven both by physical and biological processes. A comparison of alkalinity vs. salinity indicates that different regions present different relationships. In regions of freshwater influence, the two measures are negatively correlated due to riverine alkalinity input, whereas they are positively correlated in open seas. Alkalinity always is much higher than in the Atlantic waters, which might indicate a higher than usual buffering capacity towards ocean acidification, even at high concentrations of dissolved inorganic carbon.

  8. Increased river alkalinization in the Eastern U.S.

    Science.gov (United States)

    Kaushal, Sujay S; Likens, Gene E; Utz, Ryan M; Pace, Michael L; Grese, Melissa; Yepsen, Metthea

    2013-09-17

    The interaction between human activities and watershed geology is accelerating long-term changes in the carbon cycle of rivers. We evaluated changes in bicarbonate alkalinity, a product of chemical weathering, and tested for long-term trends at 97 sites in the eastern United States draining over 260,000 km(2). We observed statistically significant increasing trends in alkalinity at 62 of the 97 sites, while remaining sites exhibited no significant decreasing trends. Over 50% of study sites also had statistically significant increasing trends in concentrations of calcium (another product of chemical weathering) where data were available. River alkalinization rates were significantly related to watershed carbonate lithology, acid deposition, and topography. These three variables explained ~40% of variation in river alkalinization rates. The strongest predictor of river alkalinization rates was carbonate lithology. The most rapid rates of river alkalinization occurred at sites with highest inputs of acid deposition and highest elevation. The rise of alkalinity in many rivers throughout the Eastern U.S. suggests human-accelerated chemical weathering, in addition to previously documented impacts of mining and land use. Increased river alkalinization has major environmental implications including impacts on water hardness and salinization of drinking water, alterations of air-water exchange of CO2, coastal ocean acidification, and the influence of bicarbonate availability on primary production.

  9. DIFFERENTIATION OF WELFARE OF RURAL HOUSEHOLDS IN POLAND IN 2012

    Directory of Open Access Journals (Sweden)

    Krystyna Hanusik

    2014-03-01

    Full Text Available The subject of the research in focus was the material welfare of households. In particular, there were analysed the level and differentiation of the welfare of rural households in 2012, after more than twenty years of developing of market economy in Poland. In addition, there was examined the relationship between income, consumer spending and household equipment and the level and differentiation of measures of the welfare distinguished by the criterion of the main sources of income of households groups. In the study both econometrical and statistical analysis was used. The study was based on primarily source of information coming from the panel study of household budgets conducted by the Central Statistical Office, as well as the data contained in the statistical yearbooks of the Republic of Poland.

  10. Household costs of leprosy reactions (ENL in rural India.

    Directory of Open Access Journals (Sweden)

    David J Chandler

    2015-01-01

    Full Text Available Erythema nodosum leprosum (ENL is a common immune-mediated complication of lepromatous (LL and borderline lepromatous (BL leprosy. Most patients experience chronic or multiple acute ENL over many years during an economically active period of their lives. Understanding the economic burden of ENL is essential to provide effective patient support, yet this area has not been investigated.Ninety-one patients with LL or BL leprosy attending a leprosy hospital in Purulia district of West Bengal, India, were interviewed using a structured questionnaire. Cases (n = 53 were identified as those who had one or more episodes of ENL within the last 3 years. Controls (n = 38 had LL or BL leprosy but no history of ENL. Data were collected on household income, direct and indirect costs, and coping strategies.The total household cost was Rs 1543 per month or 27.9% (IQR 13.2-52.6 of monthly household income for cases, and Rs 237 per month or 4.9% (IQR 1.7-13.4 of monthly household income for controls. Indirect costs accounted for 65% of total household costs for cases. Direct costs accounted for the remaining 35% of household costs, and resulted almost entirely from treatment-seeking in the private sector. Total household costs exceeded 40% of household income for 37.7% of cases (n = 20 and 2.6% of controls (n = 1 [1 USD = 59 INR].Households affected by ENL face significant economic burden and are at risk of being pushed further into poverty. Health policy should acknowledge the importance of private sector provision and the significant contribution to total household costs of lost productivity (indirect cost. Further work is needed to explore this area and identify solutions.

  11. Effects of season on household food security and the nutritional status of smallholder rural households in Nakuru District, Kenya

    NARCIS (Netherlands)

    Kigutha, H.N.

    1995-01-01

    Leiden [etc.] : African Studies Centre [etc.] (FNSP Report, no. 55), p. 71, 1995.This study investigates the effects of a unimodal climatic pattern on household food availability among rural households with limited landholdings and low cash incomes, and how this in turn affects food consumption and

  12. Phosphatidylinositol anchor of HeLa cell alkaline phosphatase

    International Nuclear Information System (INIS)

    Alkaline phosphatase from cancer cells, HeLa TCRC-1, was biosynthetically labeled with either 3H-fatty acids or [3H]ethanolamine as analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and fluorography of immunoprecipitated material. Phosphatidylinositol-specific phospholipase C (PI-PLC) released a substantial proportion of the 3H-fatty acid label from immunoaffinity-purified alkaline phosphatase but had no effect on the radioactivity of [3H]ethanolamine-labeled material. PI-PLC also liberated catalytically active alkaline phosphatase from viable cells, and this could be selectively blocked by monoclonal antibodies to alkaline phosphatase. However, the alkaline phosphatase released from 3H-fatty acid labeled cells by PI-PLC was not radioactive. By contrast, treatment with bromelain removed both the 3H-fatty acid and the [3H]ethanolamine label from purified alkaline phosphatase. Subtilisin was also able to remove the [3H]ethanolamine label from the purified alkaline phosphatase. The 3H radioactivity in alkaline phosphatase purified from [3H]ethanolamine-labeled cells comigrated with authentic [3H]ethanolamine by anion-exchange chromatography after acid hydrolysis. The data suggest that the 3H-fatty acid and [3H]ethanolamine are covalently attached to the carboxyl-terminal segment since bromelain and subtilisin both release alkaline phosphatase from the membrane by cleavage at that end of the polypeptide chain. The data are consistent with findings for other proteins recently shown to be anchored in the membrane through a glycosylphosphatidylinositol structure and indicate that a similar structure contributes to the membrane anchoring of alkaline phosphatase

  13. Phosphatidylinositol anchor of HeLa cell alkaline phosphatase

    Energy Technology Data Exchange (ETDEWEB)

    Jemmerson, R.; Low, M.G.

    1987-09-08

    Alkaline phosphatase from cancer cells, HeLa TCRC-1, was biosynthetically labeled with either /sup 3/H-fatty acids or (/sup 3/H)ethanolamine as analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and fluorography of immunoprecipitated material. Phosphatidylinositol-specific phospholipase C (PI-PLC) released a substantial proportion of the /sup 3/H-fatty acid label from immunoaffinity-purified alkaline phosphatase but had no effect on the radioactivity of (/sup 3/H)ethanolamine-labeled material. PI-PLC also liberated catalytically active alkaline phosphatase from viable cells, and this could be selectively blocked by monoclonal antibodies to alkaline phosphatase. However, the alkaline phosphatase released from /sup 3/H-fatty acid labeled cells by PI-PLC was not radioactive. By contrast, treatment with bromelain removed both the /sup 3/H-fatty acid and the (/sup 3/H)ethanolamine label from purified alkaline phosphatase. Subtilisin was also able to remove the (/sup 3/H)ethanolamine label from the purified alkaline phosphatase. The /sup 3/H radioactivity in alkaline phosphatase purified from (/sup 3/H)ethanolamine-labeled cells comigrated with authentic (/sup 3/H)ethanolamine by anion-exchange chromatography after acid hydrolysis. The data suggest that the /sup 3/H-fatty acid and (/sup 3/H)ethanolamine are covalently attached to the carboxyl-terminal segment since bromelain and subtilisin both release alkaline phosphatase from the membrane by cleavage at that end of the polypeptide chain. The data are consistent with findings for other proteins recently shown to be anchored in the membrane through a glycosylphosphatidylinositol structure and indicate that a similar structure contributes to the membrane anchoring of alkaline phosphatase.

  14. Comparison between ARB and CARB processes on an AA5754/AA6061 composite

    Science.gov (United States)

    Verstraete, K.; Helbert, A.-L.; Brisset, F.; Baudin, T.

    2014-08-01

    The present work aims to compare two processes: Accumulative Roll Bonding and Cross Accumulative Roll Bonding (CARB). Both processes consist in the repetition of rolling but the second technique adds a 90° rotation of the sheet around its normal direction between each rolling. Microstructure, mechanical properties and texture were compared for both processes on an AA5754/AA6061 composite. As a result a thinner and less elongated microstructure was obtained in the CARB process leading to an isotropy and an improvement of the mechanical properties. Besides, the texture was characterized by the rotated Cube component for both processes but for CARB it is of less strength.

  15. Simon van der Meer in the AA Control Room

    CERN Multimedia

    1984-01-01

    Simon van der Meer, spiritus rector of the Antiproton Accumulator, in the AA Control Room. Inventor of stochastic cooling, on which the AA was based, and of the magnetic horn, with which the antiprotons were focused, he also wrote most of the software with which the AA was controlled, and spent uncountable numbers of hours in this chair to tickle the AA to top performance. 8 months after this picture was taken, he received, in October 1984, the Nobel prize, together with Carlo Rubbia, the moving force behind the whole Proton-Antiproton Collider project that led to the discovery, in 1983, of the W and Z intermediate bosons.

  16. The effect of irrigated rice cropping on the alkalinity of two alkaline rice soils in the Sahel

    NARCIS (Netherlands)

    Asten, van P.J.A.; Zelfde, van 't J.A.; Zee, van der S.E.A.T.M.; Hammecker, C.

    2004-01-01

    Irrigated rice cropping is practiced to reclaim alkaline-sodic soils in many parts of the world. This practice is in apparent contrast with earlier studies in the Sahel, which suggests that irrigated rice cropping may lead to the formation of alkaline-sodic soils. Soil column experiments were done w

  17. Dicty_cDB: FC-AA22 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA22 (Link to dictyBase) - - - Contig-U14948-1 FC-AA22E (Li...nk to Original site) - - - - - - FC-AA22E 576 Show FC-AA22 Library FC (Link to library) Clone ID FC-AA22 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA22Q.Seq.d/ Representative seq. ID FC-AA...22E (Link to Original site) Representative DNA sequence >FC-AA22 (FC-AA22Q) /CSM/FC/FC-AA/FC-AA22Q.Seq.d/ ATGAA...TACGATGATAGTGATTCAGACTTTTGACCAATTGAAAAAACCAGCAACAGAAATG GTACTGGTTTGGTCTCCTCCACTTTTAAGGTTGCCCCTTCCTTCTCTACCATTCAAAAAC AACAA

  18. Dicty_cDB: FC-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA15 (Link to dictyBase) - G01144 DDB0204372 Contig-U15089-1 FC-AA...15E (Link to Original site) - - - - - - FC-AA15E 522 Show FC-AA15 Library FC (Link to library) Clone ID FC-AA...9-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA15Q.Se...q.d/ Representative seq. ID FC-AA15E (Link to Original site) Representative DNA sequence >FC-AA15 (FC-AA15Q) /CSM/FC/FC-AA/FC-AA...15Q.Seq.d/ CAAATCACACATAAAAGTTTAATATAAAAATGGGTACACCAATTAAAAAGATTAGTACAG TAATTATTAAAATGGTTTCATCAGCCAA

  19. Dicty_cDB: FC-AA17 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA17 (Link to dictyBase) - - - Contig-U15091-1 FC-AA17E (Li...nk to Original site) - - - - - - FC-AA17E 347 Show FC-AA17 Library FC (Link to library) Clone ID FC-AA17 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA17Q.Seq.d/ Representative seq. ID FC-AA...17E (Link to Original site) Representative DNA sequence >FC-AA17 (FC-AA17Q) /CSM/FC/FC-AA/FC-AA17Q.Seq.d/ CCCAAAAGCCCGTAA...GACTCACTGTGTCAAGTGCAACAAACACACCCCACACAAGGTTAC CCAATACAAAGCTGGTAAACCAAGTCTTTTCGCACAAGGTAAAAGACGTTACGATCGTAA ACAA

  20. Dicty_cDB: FC-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA05 (Link to dictyBase) - G01143 DDB0190243 Contig-U15085-1 FC-AA...05E (Link to Original site) - - - - - - FC-AA05E 675 Show FC-AA05 Library FC (Link to library) Clone ID FC-AA...5-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA05Q.Se...q.d/ Representative seq. ID FC-AA05E (Link to Original site) Representative DNA sequence >FC-AA05 (FC-AA05Q) /CSM/FC/FC-AA/FC-AA...05Q.Seq.d/ AAACAAAAAAAAAAGGTATGGAAATTTTTGCATTTGTACCATTAGCAGTGTTAACAGCAT TATGTGTTGTTATTTCACTCTTTGTTAAAAGAGAGAAA

  1. Dicty_cDB: FCL-AA23 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA23 (Link to dictyBase) - G01759 DDB0201558 Contig-U15118-1 FCL-AA...23E (Link to Original site) - - - - - - FCL-AA23E 1045 Show FCL-AA23 Library FCL (Link to library) Clone ID FCL-AA...ig-U15118-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...23Q.Seq.d/ Representative seq. ID FCL-AA23E (Link to Original site) Representative DNA sequence >FCL-AA23 (FCL-AA...23Q) /CSM/FCL/FCL-AA/FCL-AA23Q.Seq.d/ ATAACTATATAACTATGTCTAACCAAAAGAAAAACGACGTATCTTCATTTGTTAAAGATT CTTTAA

  2. Dicty_cDB: FC-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA21 (Link to dictyBase) - - - Contig-U15450-1 FC-AA21E (Li...nk to Original site) - - - - - - FC-AA21E 839 Show FC-AA21 Library FC (Link to library) Clone ID FC-AA21 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA21Q.Seq.d/ Representative seq. ID FC-AA...21E (Link to Original site) Representative DNA sequence >FC-AA21 (FC-AA21Q) /CSM/FC/FC-AA/FC-AA21Q.Seq.d/ AATTATTTTCATTAA...TTTTAGCTTTATTCCTTGTCAACTCCGCTGTTGTCTCTTCACTCG ACTCATGTAGTATTTGTGTTGATTTTGTTGGTAACTCACTCAATGATCTTTTAAATATTA TCCTTAA

  3. Dicty_cDB: FCL-AA22 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA22 (Link to dictyBase) - G01758 DDB0229949 Contig-U15119-1 FCL-AA...22E (Link to Original site) - - - - - - FCL-AA22E 840 Show FCL-AA22 Library FCL (Link to library) Clone ID FCL-AA...g-U15119-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...22Q.Seq.d/ Representative seq. ID FCL-AA22E (Link to Original site) Representative DNA sequence >FCL-AA22 (FCL-AA...22Q) /CSM/FCL/FCL-AA/FCL-AA22Q.Seq.d/ AAAATGAGCAAAATCTCAAGCGACCAAGTTAGATCAATCGTCTCCCAACTTTTCAAAGAA GCACAAGAATCCAAAA

  4. Dicty_cDB: FCL-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA06 (Link to dictyBase) - G24322 DDB0216974 Contig-U15228-1 FCL-AA...06E (Link to Original site) - - - - - - FCL-AA06E 791 Show FCL-AA06 Library FCL (Link to library) Clone ID FCL-AA...g-U15228-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...06Q.Seq.d/ Representative seq. ID FCL-AA06E (Link to Original site) Representative DNA sequence >FCL-AA06 (FCL-AA...06Q) /CSM/FCL/FCL-AA/FCL-AA06Q.Seq.d/ AAAATCCCAATTTCATTAGCAGTGGAAGTAACGGAATGAATTGGGGTGGTTCTTTGAACA CTTGTGACTCTGGAGGATTCAA

  5. Dicty_cDB: FCL-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA18 (Link to dictyBase) - G24323 DDB0191144 Contig-U15229-1 FCL-AA...18Z (Link to Original site) - - FCL-AA18Z 623 - - - - Show FCL-AA18 Library FCL (Link to library) Clone ID FCL-AA...g-U15229-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...18Q.Seq.d/ Representative seq. ID FCL-AA18Z (Link to Original site) Representative DNA sequence >FCL-AA18 (FCL-AA...18Q) /CSM/FCL/FCL-AA/FCL-AA18Q.Seq.d/ XXXXXXXXXXGTCAATGTCATTATTGGTGAACAATCTGATGGTTCGTTGGAACAAATCGC TAGAAATCCACAACCAA

  6. Dicty_cDB: FC-AA16 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA16 (Link to dictyBase) - G22556 DDB0204121 Contig-U15090-1 FC-AA...16E (Link to Original site) - - - - - - FC-AA16E 933 Show FC-AA16 Library FC (Link to library) Clone ID FC-AA...0-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA16Q.Se...q.d/ Representative seq. ID FC-AA16E (Link to Original site) Representative DNA sequence >FC-AA16 (FC-AA16Q) /CSM/FC/FC-AA/FC-AA...16Q.Seq.d/ GGGCAGGATCATCATTTAATACTAAAGATTCAACAATAATTGCAAAAACTCAATTTTATC AAAAAAATATTCAAATTTATAAAGGTGATCAA

  7. Microbial thiocyanate utilization under highly alkaline conditions.

    Science.gov (United States)

    Sorokin, D Y; Tourova, T P; Lysenko, A M; Kuenen, J G

    2001-02-01

    Three kinds of alkaliphilic bacteria able to utilize thiocyanate (CNS-) at pH 10 were found in highly alkaline soda lake sediments and soda soils. The first group included obligate heterotrophs that utilized thiocyanate as a nitrogen source while growing at pH 10 with acetate as carbon and energy sources. Most of the heterotrophic strains were able to oxidize sulfide and thiosulfate to tetrathionate. The second group included obligately autotrophic sulfur-oxidizing alkaliphiles which utilized thiocyanate nitrogen during growth with thiosulfate as the energy source. Genetic analysis demonstrated that both the heterotrophic and autotrophic alkaliphiles that utilized thiocyanate as a nitrogen source were related to the previously described sulfur-oxidizing alkaliphiles belonging to the gamma subdivision of the division Proteobacteria (the Halomonas group for the heterotrophs and the genus Thioalkalivibrio for autotrophs). The third group included obligately autotrophic sulfur-oxidizing alkaliphilic bacteria able to utilize thiocyanate as a sole source of energy. These bacteria could be enriched on mineral medium with thiocyanate at pH 10. Growth with thiocyanate was usually much slower than growth with thiosulfate, although the biomass yield on thiocyanate was higher. Of the four strains isolated, the three vibrio-shaped strains were genetically closely related to the previously described sulfur-oxidizing alkaliphiles belonging to the genus Thioalkalivibrio. The rod-shaped isolate differed from the other isolates by its ability to accumulate large amounts of elemental sulfur inside its cells and by its ability to oxidize carbon disulfide. Despite its low DNA homology with and substantial phenotypic differences from the vibrio-shaped strains, this isolate also belonged to the genus Thioalkalivibrio according to a phylogenetic analysis. The heterotrophic and autotrophic alkaliphiles that grew with thiocyanate as an N source possessed a relatively high level of cyanase

  8. Household hazardous waste data for the UK by direct sampling.

    Science.gov (United States)

    Slack, Rebecca J; Bonin, Michael; Gronow, Jan R; Van Santen, Anton; Voulvoulis, Nikolaos

    2007-04-01

    The amount of household hazardous waste (HHW) disposed of in the United Kingdom (UK) requires assessment. This paper describes a direct analysis study carried out in three areas in southeast England involving over 500 households. Each participating householder was provided with a special bin in which to place items corresponding to a list of HHW. The amount of waste collected was split into nine broad categories: batteries, home maintenance (DIY), vehicle upkeep, pesticides, pet care, pharmaceuticals, photographic chemicals, household cleaners, and printer cartridges. Over 1 T of waste was collected from the sample households over a 32-week period, which would correspond to an estimated 51,000 T if extrapolated to the UK population for the same period or over 7,000 T per month. Details of likely disposal routes adopted by householders were also sought, demonstrating the different pathways selected for different waste categories. Co-disposal with residual household waste dominated for waste batteries and veterinary medicines, hence avoiding classification as hazardous waste under new UK waste regulations. The information can be used to set a baseline for the management of HHW and provides information for an environmental risk assessment of the disposal of such wastes to landfill. PMID:17438817

  9. Analysis of Capability of Households to Finance Higher Education

    Directory of Open Access Journals (Sweden)

    Tarasenko Yuliya V.

    2013-12-01

    Full Text Available The article analyses possibilities of financing higher education by households, it proves, using example of households of Ukraine and Russia, wish and capability of households to finance higher education. Analysis of such a capability of households reveals both possibilities for development of the education system and possibilities of overcoming problems in the structure of own finances. In the result of the analysis, the article identifies problems that require solution for adjustment of stable financing. One of the main problems is imbalance of household expenditures. The structure of these expenditures, which is individual for each country, should be taken into account when identifying cost of education, since household finances become one of the priority sources of financing higher education. Due to this, the article identifies a formula of the cost of education, which should be taken into account when it is established and which includes household capabilities. The article identifies a model, with the help of which it is possible to assess the quality of financing higher education when combining various sources of financing.

  10. Household Contact Screening Adherence among Tuberculosis Patients in Northern Ethiopia.

    Directory of Open Access Journals (Sweden)

    Gebremedhin Berhe Gebregergs

    Full Text Available Household contacts of active tuberculosis cases are at high risk of getting tuberculosis disease. Tuberculosis detection rate among contacts of household members is high. Hence, this study investigated household contact screening adherence and associated factors among tuberculosis patients in Amhara region, Ethiopia.A cross-sectional study was conducted from April 10 - June 30, 2013 in five urban districts of Amhara region, where 418 patients receiving treatment at tuberculosis clinic were interviewed. All patients were interviewed using structured and pre-tested questionnaire. Bringing at least one household contact to TB clinic was regarded as adherent to household contacts screening. Bivariate and multiple logistic regressions were used to investigate association.The overall adherence to household contact screening in Amhara region was 33.7%. Adherence was higher among Muslims than Christians. Adherence was high if patient took health education from Health Care Worker [AOR: 3.22, 95% CI: 1.88 to 5.51] and 2.17 times higher if patient had sufficient knowledge on tuberculosis [AOR: 2.17, 95% CI: 1.29 to 3.67] during interview. Relationship with contact was a significant [AOR: 0.4, 95% CI: 0.2 to 0.9] social related factor.One third of tuberculosis patients adhered to household contact screening in health facilities during their treatment course. Promoting knowledge of tuberculosis in the community and continuous health education to tuberculosis patients are recommended.

  11. What’s the Score? Walkable Environments and Subsidized Households

    Directory of Open Access Journals (Sweden)

    Young-Jae Kim

    2016-04-01

    Full Text Available Neighborhood walkability can influence individual health, social interactions, and environmental quality, but the relationships between subsidized households and their walkable environment have not been sufficiently examined in previous empirical studies. Focusing on two types of subsidized housing developments (Low-Income Housing Tax Credit (LIHTC and Public Housing (PH in Austin, Texas, this study evaluates the neighborhood walkability of place-based subsidized households, utilizing objectively measured Walk Score and walking-related built environment data. We also used U.S. Census block group data to account for the socio-demographic covariates. Based on various data, we employed bivariate and multivariate analyses to specify the relationships between subsidized households and their neighborhood walkable environment. The results of our bivariate analyses show that LIHTC households tend to be located in car-dependent neighborhoods and have more undesirable walking-related built environment conditions compared with non-LIHTC neighborhoods. Our regression results also represent that LIHTC households are more likely to be exposed to neighborhoods with low Walk Score, less sidewalk coverage, and more highways and major roads, while there are no significant associations for PH households. These findings imply that more attention and effort toward reducing the inequitable distributions of walkable neighborhood features supporting rather than hindering healthy lifestyles must be provided to subsidized households.

  12. Titratable Acidity and Alkalinity of Red Soil Surfaces

    Institute of Scientific and Technical Information of China (English)

    SHAOZONG-CHEN; HEQUN; 等

    1993-01-01

    The surfaces of red soils have an apparent amphoteric character,carrying titratable acidity and titratable alkalinity simultaneously.The titratable acidity arises from deprotonation of hydroxyl groups of hydrous oxide-type surfaces and dissociation of weak-acid functional groups of soil organic matter,while the titratable alkalinity is derived from release of hydroxyl groups of hydrous oxide-type surfaces.The titratable acidity and titratable alkalinity mainly depended on the composition and content of iron and aluminum oxides in the soils.The results showed that the titratable acidity and titratable alkalinity were in significantly positive correlation not only with the content of amorphous aluminum oxide(Alo) and iron oxide(Feo) extracted with acid ammonium oxalate solution,free iron oxide(Fed) extracted with sodium dithionite-citrate-bicarbonate(DCB) and clays,but also with the zero point of charge (ZPC) of the samples.Organic matter made an important contribution to the titratable acidity.the titratable alkalinity was closely correlated with the amount of fluoride ions adsorbed.The titratable acidity and titratable alkalinity of red soils were influenced by parent materials,being in the order of red soil derived from basalt> that from tuff> that from granite.The titratable acidity and titratable alkalinity ware closely related with origination of the variable charges of red soils,and to a certain extent were responsible for variable negative and positive charges of the soils.

  13. Francisella DnaK Inhibits Tissue-nonspecific Alkaline Phosphatase*

    Science.gov (United States)

    Arulanandam, Bernard P.; Chetty, Senthilnath Lakshmana; Yu, Jieh-Juen; Leonard, Sean; Klose, Karl; Seshu, Janakiram; Cap, Andrew; Valdes, James J.; Chambers, James P.

    2012-01-01

    Following pulmonary infection with Francisella tularensis, we observed an unexpected but significant reduction of alkaline phosphatase, an enzyme normally up-regulated following inflammation. However, no reduction was observed in mice infected with a closely related Gram-negative pneumonic organism (Klebsiella pneumoniae) suggesting the inhibition may be Francisella-specific. In similar fashion to in vivo observations, addition of Francisella lysate to exogenous alkaline phosphatase (tissue-nonspecific isozyme) was inhibitory. Partial purification and subsequent proteomic analysis indicated the inhibitory factor to be the heat shock protein DnaK. Incubation with increasing amounts of anti-DnaK antibody reduced the inhibitory effect in a dose-dependent manner. Furthermore, DnaK contains an adenosine triphosphate binding domain at its N terminus, and addition of adenosine triphosphate enhances dissociation of DnaK with its target protein, e.g. alkaline phosphatase. Addition of adenosine triphosphate resulted in decreased DnaK co-immunoprecipitated with alkaline phosphatase as well as reduction of Francisella-mediated alkaline phosphatase inhibition further supporting the binding of Francisella DnaK to alkaline phosphatase. Release of DnaK via secretion and/or bacterial cell lysis into the extracellular milieu and inhibition of plasma alkaline phosphatase could promote an orchestrated, inflammatory response advantageous to Francisella. PMID:22923614

  14. Ethylene glycol, hazardous substance in the household.

    Science.gov (United States)

    Patocka, Jirí; Hon, Zdenek

    2010-01-01

    Ethylene glycol is a colorless, odorless, sweet-tasting but poisonous type of alcohol found in many household products. The major use of ethylene glycol is as an antifreeze in, for example, automobiles, in air conditioning systems, in de-icing fluid for windshields, and else. People sometimes drink ethylene glycol mistakenly or on purpose as a substitute for alcohol. Ethylene glycol is toxic, and its drinking should be considered a medical emergency. The major danger from ethylene glycol is following ingestion. Due to its sweet taste, peoples and occasionally animals will sometimes consume large quantities of it if given access to antifreeze. While ethylene glycol itself has a relatively low degree of toxicity, its metabolites are responsible for extensive cellular damage to various tissues, especially the kidneys. This injury is caused by the metabolites, glycolic and oxalic acid and their respective salts, through crystal formation and possibly other mechanisms. Toxic metabolites of ethylene glycol can damage the brain, liver, kidneys, and lungs. The poisoning causes disturbances in the metabolism pathways, including metabolic acidosis. The disturbances may be severe enough to cause profound shock, organ failure, and death. Ethylene glycol is a common poisoning requiring antidotal treatment. PMID:20608228

  15. Anodic stripping voltammetry of technetium alkaline media

    International Nuclear Information System (INIS)

    A method of direct determination of technetium in 0.1 M NaOH by anodic stripping voltametry at glassy carbon electrode has been elaborated. The peak height of anodic TcO2(OH)2 dissolution was found to be linearly dependent on preconcentration time, and the concentration of technetium in the range 5.0 * 10-8 -6 M. The detection limit for the Tc determination by ASV technique under study was found to be 5.0 * 10-8 M with standard deviation 5-7% (p2(OH)2 anodic dissolution peak current. Addition of 1.0* 10-6 M U(UI) to the sample solution was found to shift the peak of the TcO2(OH)2 100 mV towards negative direction and disturb the linearity of the calibration curve. Therefore; for a successful application of the developed ASV technique for Tc determination in the alkaline media, uranium should be removed from the analyte before determination

  16. 2nd Generation alkaline electrolysis. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Yde, L. [Aarhus Univ. Business and Social Science - Centre for Energy Technologies (CET), Aarhus (Denmark); Kjartansdottir, C.K. [Technical Univ. of Denmark. DTU Mechanical Engineering, Kgs. Lyngby (Denmark); Allebrod, F. [Technical Univ. of Denmark. DTU Energy Conversion, DTU Risoe Campus, Roskilde (Denmark)] [and others

    2013-03-15

    The overall purpose of this project has been to contribute to this load management by developing a 2{sup nd} generation of alkaline electrolysis system characterized by being compact, reliable, inexpensive and energy efficient. The specific targets for the project have been to: 1) Increase cell efficiency to more than 88% (according to the higher heating value (HHV)) at a current density of 200 mA /cm{sup 2}; 2) Increase operation temperature to more than 100 degree Celsius to make the cooling energy more valuable; 3) Obtain an operation pressure more than 30 bar hereby minimizing the need for further compression of hydrogen for storage; 4) Improve stack architecture decreasing the price of the stack with at least 50%; 5) Develop a modular design making it easy to customize plants in the size from 20 to 200 kW; 6) Demonstrating a 20 kW 2{sup nd} generation stack in H2College at the campus of Arhus University in Herning. The project has included research and development on three different technology tracks of electrodes; an electrochemical plating, an atmospheric plasma spray (APS) and finally a high temperature and pressure (HTP) track with operating temperature around 250 deg. C and pressure around 40 bar. The results show that all three electrode tracks have reached high energy efficiencies. In the electrochemical plating track a stack efficiency of 86.5% at a current density of 177mA/cm{sup 2} and a temperature of 74.4 deg. C has been shown. The APS track showed cell efficiencies of 97%, however, coatings for the anode side still need to be developed. The HTP cell has reached 100 % electric efficiency operating at 1.5 V (the thermoneutral voltage) with a current density of 1. 1 A/cm{sup 2}. This track only tested small cells in an externally heated laboratory set-up, and thus the thermal loss to surroundings cannot be given. The goal set for the 2{sup nd} generation electrolyser system, has been to generate 30 bar pressure in the cell stack. An obstacle to be

  17. Revisiting zinc passivation in alkaline solutions

    International Nuclear Information System (INIS)

    Highlights: • Zinc passive films were characterised by electrochemical tests coupled with cross sectional FIB-SEM. • Passive layers at pH > 12 comprised of an outer precipitated layer and inner compact oxide. • The electrolyte pH influences the nature/stability of the outer precipitated layer and this impacts the passive state on zinc. • The precipitated layers on zinc at pH 12 support cathode reactions and catalyse oxide growth. -- Abstract: Passive films nominally consist of an inner compact oxide and the outer precipitated layer. In the case of zinc (Zn), the outer layer is mainly precipitated ZnO/Zn(OH)2. Electrolyte pH controls the stability of the outer precipitated layer. In a pH 13 solution, formation of soluble Zn(OH)3− and Zn(OH)42− phases render the precipitated layer unstable increasing zinc corrosion, whereas at pH 12, the precipitated layer (ZnO/Zn(OH)2) is more stable making it an effective anodic barrier upon zinc. These precipitated oxides formed at pH 12 support cathodic reactions on their surface which in turn catalyse further oxide growth by a cathodically driven process. Focused ion beam-scanning electron microscopy (FIB-SEM) was used to support some of the electrochemical assertions, revealing the form and morphology of the passive layers that grow upon zinc exposed to alkaline solutions

  18. Alkaline lipase of glyoxysomes is a glycoprotein

    International Nuclear Information System (INIS)

    In castor bean endosperm, the glyoxysomal alkaline lipase is an intrinsic membrane protein. At four days post-germination, the enzyme is also present in the endoplasmic reticulum where it accounts for approximately 15% of total activity. The active enzyme was purified by Maeshima and Beevers from isolated glyoxysomes. Specific antibodies to the 62 kD subunit were raised in rabbits. The anti-lipase has been used in preliminary experiments to determine the relationship between the lipase of the glyoxysomal membrane and the ER. Results indicate the presence of 3 cross-reacting antigens in carbonate-washed ER and glyoxysomal membranes. The 62 kD subunit, found predominantly in glyoxysomes, was eluted form Con-A Sepharose by 0.5 M α-methylglucoside. An 86kD form present in 2-d ER (but not in 4-d ER) and glyoxysomes did not bind Con-A Sepharose. This form appears to be an unglycosylated precursor or the 62 kD subunit. A 67 kD form was the only species seen in 4-d ER. In a time course experiment, the 67 kD form appeared on the glyoxysomal membrane

  19. Response of Desulfovibrio vulgaris to Alkaline Stress

    Energy Technology Data Exchange (ETDEWEB)

    Stolyar, S.; He, Q.; He, Z.; Yang, Z.; Borglin, S.E.; Joyner, D.; Huang, K.; Alm, E.; Hazen, T.C.; Zhou, J.; Wall, J.D.; Arkin, A.P.; Stahl, D.A.

    2007-11-30

    The response of exponentially growing Desulfovibrio vulgarisHildenborough to pH 10 stress was studied using oligonucleotidemicroarrays and a study set of mutants with genes suggested by microarraydata to be involved in the alkaline stress response deleted. The datashowed that the response of D. vulgaris to increased pH is generallysimilar to that of Escherichia coli but is apparently controlled byunique regulatory circuits since the alternative sigma factors (sigma Sand sigma E) contributing to this stress response in E. coli appear to beabsent in D. vulgaris. Genes previously reported to be up-regulated in E.coli were up-regulated in D. vulgaris; these genes included three ATPasegenes and a tryptophan synthase gene. Transcription of chaperone andprotease genes (encoding ATP-dependent Clp and La proteases and DnaK) wasalso elevated in D. vulgaris. As in E. coli, genes involved in flagellumsynthesis were down-regulated. The transcriptional data also identifiedregulators, distinct from sigma S and sigma E, that are likely part of aD. vulgaris Hildenborough-specific stress response system.Characterization of a study set of mutants with genes implicated inalkaline stress response deleted confirmed that there was protectiveinvolvement of the sodium/proton antiporter NhaC-2, tryptophanase A, andtwo putative regulators/histidine kinases (DVU0331 andDVU2580).

  20. Process for treating alkaline wastes for vitrification

    Science.gov (United States)

    Hsu, Chia-lin W.

    1994-01-01

    According to its major aspects and broadly stated, the present invention is a process for treating alkaline waste materials, including high level radioactive wastes, for vitrification. The process involves adjusting the pH of the wastes with nitric acid, adding formic acid (or a process stream containing formic acid) to reduce mercury compounds to elemental mercury and MnO{sub 2} to the Mn(II) ion, and mixing with class formers to produce a melter feed. The process minimizes production of hydrogen due to noble metal-catalyzed formic acid decomposition during, treatment, while producing a redox-balanced feed for effective melter operation and a quality glass product. An important feature of the present invention is the use of different acidifying and reducing, agents to treat the wastes. The nitric acid acidifies the wastes to improve yield stress and supplies acid for various reactions; then the formic acid reduces mercury compounds to elemental mercury and MnO{sub 2}) to the Mn(II) ion. When the pH of the waste is lower, reduction of mercury compounds and MnO{sub 2}) is faster and less formic acid is needed, and the production of hydrogen caused by catalytically-active noble metals is decreased.

  1. Magic wavelengths in the alkaline earth ions

    CERN Document Server

    Kaur, Jasmeet; Arora, Bindiya; Sahoo, B K

    2015-01-01

    We present magic wavelengths for the $nS$ - $nP_{1/2,3/2}$ and $nS$ - $mD_{3/2,5/2}$ transitions, with the respective ground and first excited $D$ states principal quantum numbers $n$ and $m$, in the Mg$^+$, Ca$^+$, Sr$^+$ and Ba$^+$ alkaline earth ions for linearly polarized lights by plotting dynamic polarizatbilities of the $nS$, $nP_{1/2,3/2}$ and $mD_{3/2,5/2}$ states of the ions. These dynamic polarizabilities are evaluated by employing a relativistic all-order perturbative method and their accuracies are ratified by comparing their static values with the available high precision experimental or other theoretical results. Moreover, some of the magic wavelengths identified by us in Ca$^+$ concurs with the recent measurements reported in [{\\bf Phys. Rev. Lett. 114, 223001 (2015)}]. Knowledge of these magic wavelengths are propitious to carry out many proposed high precision measurements trapping the above ions in the electric fields with the corresponding frequencies.

  2. Study on Fabrication of AA4032/AA6069 Cladding Billet Using Direct Chill Casting Process

    Science.gov (United States)

    Han, Xing; Zhang, Haitao; Shao, Bo; Li, Lei; Liu, Xuan; Cui, Jianzhong

    2016-04-01

    AA4032/AA6069 cladding billet in size of φ130 mm/φ110 mm was prepared by the modified direct chill casting process, and the parametric effect on casting performance was investigated using numerical simulation. Microstructures, elements distribution, and mechanical properties of the bonding interface were examined. The results show that metallurgical bonding interface can be obtained with the optimal parameters: the casting speed of 130 to 140 mm/min, the internal liquid level height of 50 to 60 mm, and the contact height of 40 to 50 mm. The metallurgical bonding interface is free of any discontinuities due to the fact that the alloying elements diffused across the interface and formed Ni-containing phase. Tensile strength of the cladding billet reaches 225.3 MPa, and the fracture position was located in AA6069 side, suggesting that the interface bonding strength is higher than the strength of AA6069. The interfacial shearing strength is 159.3 MPa, indicating excellent metallurgical bonding.

  3. Is Knowledge Shared within Households? Theory and Evidence for Bangladesh

    OpenAIRE

    Kaushik Basu; Ambar Narayan; Martin Ravallion

    2001-01-01

    A member of a collective-action household may or may not share knowledge with others in that household. Shared income gains from shared knowledge may well be offset by a shift in the balance of power within the family. Using household survey data for Bangladesh we find strong external effects of education on individual earnings. Holding a range of personal attributes constant, an illiterate adult earns significantly more in the non-farm economy when living in a family with at least one litera...

  4. Insuring against health shocks: Health insurance and household choices.

    Science.gov (United States)

    Liu, Kai

    2016-03-01

    This paper provides empirical evidence on the role of public health insurance in mitigating adverse outcomes associated with health shocks. Exploiting the rollout of a universal health insurance program in rural China, I find that total household income and consumption are fully insured against health shocks even without access to health insurance. Household labor supply is an important insurance mechanism against health shocks. Access to health insurance helps households to maintain investment in children's human capital during negative health shocks, which suggests that one benefit of health insurance could arise from reducing the use of costly smoothing mechanisms. PMID:26836108

  5. Modern Trends in the Formation of Household Incomes in Ukraine

    Directory of Open Access Journals (Sweden)

    Andrey N. Zaika

    2014-03-01

    Full Text Available The article is devoted to modern trends in the formation of household incomes in Ukraine, finding the relation between different types of income on the basis of statistical and financial classification. Identifying modern trends in the generation of household income is important for the disclosure of labour market formation. Formation of a diversified system of household incomes, harmoniously combining both primary and secondary incomes, incomes from the payment of wage labour, entrepreneurship and self-employment, as well as other types of income, can protect people during crises in the financial and real sectors of the economy.

  6. Agricultural use of household compost in Brazzaville market gardening belt

    Directory of Open Access Journals (Sweden)

    Matondo, H.

    1990-01-01

    Full Text Available After the finalization of the household filth processing through aerobic fermentation or compostage, which allowed us to get an organic tool, so important in the plant production, the following communication studies the fertilising values of compost from household filth and raw wastes. Conducted in the fields, the study has revelead being successful with positive effects of the burying of compost upon the output of gardenmarket cultivation (in the Brazzaville poor soil. More over, the direct burying of household filth go along with depressive effects mainly on short-cycle vegetative cultivation.

  7. Income as a factor of consumer behaviour in Latvian households

    Directory of Open Access Journals (Sweden)

    Voronov V. V., Krasko V. D.

    2011-03-01

    Full Text Available Socially oriented public policy in the area of household consumption plays an important role in achieving stable socio-economic development. At the macroeconomic level, the state regulates the process of consumption based on fiscal policy and fair taxation of households, encouraging domestic demand and economic activity. Therefore, the urgent task of modern macroeconomic policy in Latvia is the development and support of socially relevant tools and methods of state regulation of consumption and consumer behaviour of the households, taking into account its main factors: income and taxation.

  8. Energy economics of cooking in households in Nepal

    International Nuclear Information System (INIS)

    This paper focuses on the economic analysis of energy consumed for cooking in urban households in Nepal. In this paper, annual energy requirements, energy efficiency, various combinations of fuels, stoves and utensils used for cooking and their corresponding costs have been examined through lab experiments and surveys. The estimate of system efficiencies for household cooking is one of the major contributions of this paper. The paper also discusses costs of energy use and compares various energy alternatives for cooking. It is believed that the analysis presented here will be helpful to the policy planners to devise better energy options for households

  9. Air pollution: Household soiling and consumer welfare losses

    Science.gov (United States)

    Watson, W.D.; Jaksch, J.A.

    1982-01-01

    This paper uses demand and supply functions for cleanliness to estimate household benefits from reduced particulate matter soiling. A demand curve for household cleanliness is estimated, based upon the assumption that households prefer more cleanliness to less. Empirical coefficients, related to particulate pollution levels, for shifting the cleanliness supply curve, are taken from available studies. Consumer welfare gains, aggregated across 123 SMSAs, from achieving the Federal primary particulate standard, are estimated to range from $0.9 to $3.2 million per year (1971 dollars). ?? 1982.

  10. Determinants of Household Fuel Choice in Major Cities in Ethiopia

    OpenAIRE

    Mekonnen, Alemu; Köhlin, Gunnar

    2008-01-01

    This paper looks at the fuel choice of urban households in major Ethiopian cities, using panel data collected in 2000 and 2004. It examines use of multiple fuels by households in some detail, a topic not much explored in the household fuel-choice literature in general, and in sub-Saharan Africa in particular. The results suggest that as households’ total expenditures rise, they increase the number of fuels used, even in urban areas, and they also spend more on the fuels they consume (includin...

  11. The egg consumption of the average household in Italy

    OpenAIRE

    Giacomo Migliorati; Armando Giovannini; Valentina Rizzi; Vincenza Prencipe

    2010-01-01

    A survey was conducted over a one-year period by means of telephone interviews with 7 991 Italian households to establish the domestic consumption of eggs, the distribution by source of supply, seasonal variations and storage and preparation methods used. Eggs are mainly purchased from large retailers (53%), followed by small retailers (25.2%), direct purchase from producers (16%), and local or itinerant markets (5.8%). It was found that 69.9% of households buy packaged eggs; 92% of household...

  12. Video game demand in Japan : a household data analysis

    OpenAIRE

    Harada, Nobuyuki

    2004-01-01

    There are many empirical studies of supply-side data for the video games industry. This paper,on the contrary, highlights the household side, estimating demand equations for video games.Using the “total households” data of the Family Income and Expenditure Survey, whichincludes one-person households and households engaged in agriculture, forestry and fishery,estimation results show that a household’s income factor has a positive effect on its share of expenditure on video games. It is also ve...

  13. Three Essays Examining Household Energy Demand and Behavior

    Science.gov (United States)

    Murray, Anthony G.

    This dissertation consists of three essays examining household energy decisions and behavior. The first essay examines the adoption of energy efficient Energy Star home appliances by U.S. households. Program effectiveness requires that consumers be aware of the labeling scheme and also change their purchase decisions based on label information. The first essay examines the factors associated with consumer awareness of the Energy Star label of recently purchased major appliances and the factors associated with the choice of Energy Star labeled appliances. The findings suggest that eliminating identified gaps in Energy Star appliance adoption would result in house electricity cost savings of $164 million per year and associated carbon emission reductions of about 1.1 million metric tons per year. The second essay evaluates household energy security and the effectiveness of the Low-Income Home Energy Assistance Program (LIHEAP), the single largest energy assistance program available to poor households within the United States. Energy security is conceptually akin to the well-known concept of food security. Rasch models and household responses to energy security questions in the 2005 Residential Energy Consumption Survey are used to generate an energy insecurity index that is consistent with those found in the food insecurity literature. Participating in LIHEAP is found to significantly reduce household energy insecurity score in the index. Further, simulations show that the elimination of the energy assistance safety net currently available to households increases the number of energy insecure house- holds by over 16 percent. The third essay develops a five equation demand system to estimate household own-price, cross-price and income elasticities between electricity, natural gas, food at home, food away from home, and non-durable commodity groups. Household cross-price elasticities between energy and food commodities are of particular importance. Energy price shocks

  14. AAS Special Session: Policy Making in Astronomy

    Science.gov (United States)

    Cardelli, J. A.; Massa, D.

    1995-12-01

    The professional astronomical community today is more diverse than at any time in its history. Individuals participating in creative research programs can be found in a wide range of positions. This type of diversity, which mixes research, education, and service (e.g. contract) work, represents the strength of contemporary astronomy. While recognizing the unavoidable reductions in funding and restructuring of organizations like NASA, it is imperative that the significance of the current diversity be considered during these processes. Creative ideas are one of the cornerstones of quality research, and they can originate anywhere. Consequently, it is essential that adequate research resources remain available for free and open competition by all astronomers. Our goal in this session is to bring together officials from the AAS, NASA, and the NSF to discuss how the policy and decision making process operates and whether it should be changed to better serve the general needs of the professional astronomical community. Examples of the issues we believe are important include: In establishing new policy, how can the needs of the average research astronomer be better addressed? How could input from such astronomers be provided to those who craft NASA/NSF policy? How can/should the AAS serve as an interface between policy/decision making bodies and its membership? Should the AAS membership become more actively/effectively involved in the decision making process and, if so, how? More information on this session and related issues can be found at the Association of Research Astronomers Home Page: http://www.phy.vill.edu/astro/faculty/ara/ara_home.htm

  15. The aluminum chemistry and corrosion in alkaline solutions

    Energy Technology Data Exchange (ETDEWEB)

    Zhang Jinsuo [International Nuclear System Engineering, MS-K 575, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)], E-mail: jszhang@lanl.gov; Klasky, Marc; Letellier, Bruce C. [International Nuclear System Engineering, MS-K 575, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)

    2009-02-15

    Aluminum-alkaline solution systems are very common in engineering applications including nuclear engineering. Consequently, a thorough knowledge of the chemistry of aluminum and susceptibility to corrosion in alkaline solutions is reviewed. The aluminum corrosion mechanism and corrosion rate are examined based on current experimental data. A review of the phase transitions with aging time and change of environment is also performed. Particular attention is given to effect of organic and inorganic ions. As an example, the effect of boron is examined in detail because of the application in nuclear reactor power systems. Methods on how to reduce the corrosion rate of aluminum in alkaline solutions are also highlighted.

  16. Mixed alkaline earth effect in sodium aluminosilicate glasses

    DEFF Research Database (Denmark)

    Kjeldsen, Jonas; Smedskjær, Morten Mattrup; Mauro, John C.;

    2013-01-01

    While the mixed alkali effect has received significant attention in the glass literature, the mixed alkaline earth effect has not been thoroughly studied. Here, we investigate the latter effect by partial substitution of magnesium for calcium in sodium aluminosilicate glasses. We use Raman and NMR...... spectroscopies to obtain insights into the structural and topological features of these glasses, and hence into the mixed alkaline earth effect. We demonstrate that the mixed alkaline earth effect manifests itself as a maximum in the amount of bonded tetrahedral units and as a minimum in liquid fragility index...

  17. Polyvinyl alcohol battery separator containing inert filler. [alkaline batteries

    Science.gov (United States)

    Sheibley, D. W.; Hsu, L. C.; Manzo, M. A. (Inventor)

    1981-01-01

    A cross-linked polyvinyl alcohol battery separator is disclosed. A particulate filler, inert to alkaline electrolyte of an alkaline battery, is incorporated in the separator in an amount of 1-20% by weight, based on the weight of the polyvinyl alcohol, and is dispersed throughout the product. Incorporation of the filler enhances performance and increases cycle life of alkaline batteries when compared with batteries containing a similar separator not containing filler. Suitable fillers include titanates, silicates, zirconates, aluminates, wood floor, lignin, and titania. Particle size is not greater than about 50 microns.

  18. Genesis of rare-metal pegmatites and alkaline apatite-fluorite rocks of Burpala massi, Northern Baikal folded zone

    Science.gov (United States)

    Sotnikova, Irina; Vladykin, Nikolai

    2015-04-01

    Burpalinsky rare metal alkaline massif in the Northern Baikal folded zone in southern margin of Siberian Platform, is a of intrusion central type, created 287 Ma covering area of about 250 km2. It is composed of nepheline syenites and pulaskites grading to quartz syenites in the contacts. Veines and dykes are represented by shonkinites, sodalite syenite, leucocratic granophyres, alkali granites and numerous rare metal alkaline syenite pegmatites and two dykes of carbonatites. All rocks except for granites are cut by a large apatite-fluorite dyke rocks with mica and magnetite, which in turn is cut by alaskite granites dyke. The massif has been studied by A.M. Portnov, A.A. Ganzeev et al. (1992) Burpalinsky massif is highly enriched with trace elements, which are concentrated in pegmatite dykes. About 70 rare-metal minerals we found in massif. Zr-silicates: zircon, eudialyte, lovenite, Ti-lovenite, velerite, burpalite, seidozerite, Ca- seidozerite, Rosenbuschite, vlasovite, katapleite, Ca-katapleite, elpidite. Ti- minerals:- sphene, astrophyllite, ramsaite, Mn-neptunite bafertisite, chevkinite, Mn-ilmenite, pirofanite, Sr-perrerit, landauite, rutile, anatase, brookite; TR- minerals - loparite, metaloparite, britolite, rinkolite, melanocerite, bastnesite, parisite, ankilite, monazite, fluocerite, TR-apatite; Nb- minerals - pyrochlore, loparite. Other rare minerals leucophanite, hambergite, pyrochlore, betafite, torite, thorianite, tayniolite, brewsterite, cryolite and others. We have proposed a new scheme massif: shonkinites - nepheline syenites - alkaline syenite - quartz syenites - veined rocks: mariupolites, rare-metal pegmatites, apatite, fluorite rock alyaskite and alkaline granites and carbonatites (Sotnikova, 2009). Apatite-fluorite rocks are found in the central part of massif. This is a large vein body of 2 km length and a 20 m width cutting prevailing pulaskites. Previously, these rocks were regarded as hydrothermal low-temperature phase. New geological and

  19. AA, Inner Conductor of Magnetic Horn

    CERN Multimedia

    1979-01-01

    Antiprotons emerging at large angles from the production target (hit by an intense 26 GeV proton beam from the PS), were focused into the acceptance of the injection line of the AA by means of a "magnetic horn" (current-sheet lens). Here we see an early protype of the horn's inner conductor, machined from solid aluminium to a thickness of less than 1 mm. The 1st version had to withstand pulses of 150 kA, 15 us long, every 2.4 s. See 8801040 for a later version.

  20. Wooden Model of Wide AA Bending Magnet

    CERN Multimedia

    1978-01-01

    The very particular lattice of the AA required 2 types of dipoles (bending magnets: BLG, long and narrow; BST, short and wide). A wide one had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. A wooden model was build in 1978, to gain dimensional experience. Here, Peter Zettwoch, one of the largest men at CERN at that time, is putting a hand in the mouth of the wooden BST monster.

  1. Atlas of Vega: 3850 -- 6860 \\AA

    CERN Document Server

    Kim, Hyun-Sook; Valyavin, G; Lee, Byeong-Cheol; Shimansky, V; Galazutdinov, G A

    2009-01-01

    We present a high resolving power ($\\lambda$ / $\\Delta\\lambda$ = 90,000) and high signal-to-noise ratio ($\\sim$700) spectral atlas of Vega covering the 3850 -- 6860 \\AA wavelength range. The atlas is a result of averaging of spectra recorded with the aid of the echelle spectrograph BOES fed by the 1.8-m telescope at Bohyunsan observatory (Korea). The atlas is provided only in machine-readable form (electronic data file) and will be available in the SIMBAD database upon publication.

  2. Cultural repertoires and food-related household technology within colonia households under conditions of material hardship

    Directory of Open Access Journals (Sweden)

    Dean Wesley R

    2012-05-01

    Full Text Available Abstract Introduction Mexican-origin women in the U.S. living in colonias (new-destination Mexican-immigrant communities along the Texas-Mexico border suffer from a high incidence of food insecurity and diet-related chronic disease. Understanding environmental factors that influence food-related behaviors among this population will be important to improving the well-being of colonia households. This article focuses on cultural repertoires that enable food choice and the everyday uses of technology in food-related practice by Mexican-immigrant women in colonia households under conditions of material hardship. Findings are presented within a conceptual framework informed by concepts drawn from sociological accounts of technology, food choice, culture, and material hardship. Methods Field notes were provided by teams of promotora-researchers (indigenous community health workers and public-health professionals trained as participant observers. They conducted observations on three separate occasions (two half-days during the week and one weekend day within eight family residences located in colonias near the towns of Alton and San Carlos, Texas. English observations were coded inductively and early observations stressed the importance of technology and material hardship in food-related behavior. These observations were further explored and coded using the qualitative data package Atlas.ti. Results Technology included kitchen implements used in standard and adapted configurations and household infrastructure. Residents employed tools across a range of food-related activities identified as forms of food acquisition, storage, preparation, serving, feeding and eating, cleaning, and waste processing. Material hardships included the quality, quantity, acceptability, and uncertainty dimensions of food insecurity, and insufficient consumption of housing, clothing and medical care. Cultural repertoires for coping with material hardship included reliance on

  3. The cytochrome P450 2AA gene cluster in zebrafish (Danio rerio): Expression of CYP2AA1 and CYP2AA2 and response to phenobarbital-type inducers

    Energy Technology Data Exchange (ETDEWEB)

    Kubota, Akira [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Bainy, Afonso C.D. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Departamento de Bioquímica, CCB, Universidade Federal de Santa Catarina, Florianopolis, SC 88040-900 (Brazil); Woodin, Bruce R.; Goldstone, Jared V. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Stegeman, John J., E-mail: jstegeman@whoi.edu [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States)

    2013-10-01

    The cytochrome P450 (CYP) 2 gene family is the largest and most diverse CYP gene family in vertebrates. In zebrafish, we have identified 10 genes in a new subfamily, CYP2AA, which does not show orthology to any human or other mammalian CYP genes. Here we report evolutionary and structural relationships of the 10 CYP2AA genes and expression of the first two genes, CYP2AA1 and CYP2AA2. Parsimony reconstruction of the tandem duplication pattern for the CYP2AA cluster suggests that CYP2AA1, CYP2AA2 and CYP2AA3 likely arose in the earlier duplication events and thus are most diverged in function from the other CYP2AAs. On the other hand, CYP2AA8 and CYP2AA9 are genes that arose in the latest duplication event, implying functional similarity between these two CYPs. A molecular model of CYP2AA1 showing the sequence conservation across the CYP2AA cluster reveals that the regions with the highest variability within the cluster map onto CYP2AA1 near the substrate access channels, suggesting differing substrate specificities. Zebrafish CYP2AA1 transcript was expressed predominantly in the intestine, while CYP2AA2 was most highly expressed in the kidney, suggesting differing roles in physiology. In the liver CYP2AA2 expression but not that of CYP2AA1, was increased by 1,4-bis [2-(3,5-dichloropyridyloxy)] benzene (TCPOBOP) and, to a lesser extent, by phenobarbital (PB). In contrast, pregnenolone 16α-carbonitrile (PCN) increased CYP2AA1 expression, but not CYP2AA2 in the liver. The results identify a CYP2 subfamily in zebrafish that includes genes apparently induced by PB-type chemicals and PXR agonists, the first concrete in vivo evidence for a PB-type response in fish. - Highlights: • A tandemly duplicated cluster of ten CYP2AA genes was described in zebrafish. • Parsimony and duplication analyses suggest pathways to CYP2AA diversity. • Homology models reveal amino acid positions possibly related to functional diversity. • The CYP2AA locus does not share synteny with

  4. Food acquisition and intra-household consumption patterns: a study of low and middle income urban households in Delhi, India

    Directory of Open Access Journals (Sweden)

    MR Pradhan

    2013-12-01

    Full Text Available Background: Food habits and choices in India are shifting due to many factors: changing food markets, fast urbanization, food price inflation, uncertain food production and unequal distribution during the past decade. This study aims to explore food acquisition and intra-household consumption patterns in urban low and middle income (LMI households in Delhi. Methods: Twenty households were randomly selected from the Center for Cardio-metabolic Risk Reduction in South Asia (CARRS surveillance study. Data were derived from 20 questionnaires administered to women responsible for food preparation, four key-informant-interviews, and 20 in-depth interviews with household heads during September-November 2011. STATA and ATLAS.ti software were used for data analysis. Results: Half of the households spent at least two-thirds of their income on food. The major expenditures were on vegetables (22% of total food expenditure, milk and milk products (16%, and cereal and related products (15%. Income, food prices, food preferences, and seasonal variation influenced food expenditure. Adults usually ate two to three times a day while children ate more frequently. Eating sequence was based on the work pattern within the household and cultural beliefs. Contrary to previous evidence, there was no gender bias in intra-household food distribution. Women considered food acquisition, preparation and distribution part of their self-worth and played a major role in food related issues in the household. Conclusion: Women’s key roles in food acquisition, preparation and intra household food consumption should be considered in formulating food policies and programs. 

  5. Partially melted zone cracking in AA6061 welds

    Energy Technology Data Exchange (ETDEWEB)

    Prasad Rao, K. [Department of Metallurgical and Materials Engineering, Indian Institute of Technology Madras, Chennai (India)], E-mail: kpr@iitm.ac.in; Ramanaiah, N. [Sri Kalahasteeswara Institute of Technology, Srikalahasti (India); Viswanathan, N. [Defence Research and Development Laboratory, Hyderabad (India)

    2008-07-01

    Partially melted zone (PMZ) cracking susceptibility in AA6061 alloy was studied. Role of prior thermal history, gas tungsten arc welding techniques such as continuous current (CC) and pulsed current (PC) and use of different fillers (AA4043 and AA5356) were studied. Role of different grain refiners such as scandium, zirconium and Tibor in the above fillers was studied. Varestraint test was used to study the PMZ cracking susceptibility. Metallurgical analysis was done to corroborate the results. PMZ cracking was severe in T6 temper than in T4 irrespective of filler material. PMZ cracking susceptibility was more with AA5356 than in AA4043. It was less with pulsed current GTAW. PMZ cracking susceptibility was reduced with addition of grain refiners. Out of all, lowest PMZ cracking susceptibility was observed with 0.5%Sc addition to fusion zone through AA4043 filler and PC technique. The concentrations of magnesium and silicon were reduced at the PMZ grain boundaries with grain refiner additions to fusion zone through AA5356 or AA4043.

  6. Optimization of NaOH Molarity, LUSI Mud/Alkaline Activator, and Na2SiO3/NaOH Ratio to Produce Lightweight Aggregate-Based Geopolymer

    Directory of Open Access Journals (Sweden)

    Rafiza Abdul Razak

    2015-05-01

    Full Text Available This paper presents the mechanical function and characterization of an artificial lightweight geopolymer aggregate (ALGA using LUSI (Sidoarjo mud and alkaline activator as source materials. LUSI stands for LU-Lumpur and SI-Sidoarjo, meaning mud from Sidoarjo which erupted near the Banjarpanji-1 exploration well in Sidoarjo, East Java, Indonesia on 27 May 2006. The effect of NaOH molarity, LUSI mud/Alkaline activator (LM/AA ratio, and Na2SiO3/NaOH ratio to the ALGA are investigated at a sintering temperature of 950 °C. The results show that the optimum NaOH molarity found in this study is 12 M due to the highest strength (lowest AIV value of 15.79% with lower water absorption and specific gravity. The optimum LUSI mud/Alkaline activator (LM/AA ratio of 1.7 and the Na2SiO3/NaOH ratio of 0.4 gives the highest strength with AIV value of 15.42% with specific gravity of 1.10 g/cm3 and water absorption of 4.7%. The major synthesized crystalline phases were identified as sodalite, quartz and albite. Scanning Electron Microscope (SEM image showed more complete geopolymer matrix which contributes to highest strength of ALGA produced.

  7. Optimization of NaOH Molarity, LUSI Mud/Alkaline Activator, and Na2SiO3/NaOH Ratio to Produce Lightweight Aggregate-Based Geopolymer.

    Science.gov (United States)

    Razak, Rafiza Abdul; Abdullah, Mohd Mustafa Al Bakri; Hussin, Kamarudin; Ismail, Khairul Nizar; Hardjito, Djwantoro; Yahya, Zarina

    2015-05-21

    This paper presents the mechanical function and characterization of an artificial lightweight geopolymer aggregate (ALGA) using LUSI (Sidoarjo mud) and alkaline activator as source materials. LUSI stands for LU-Lumpur and SI-Sidoarjo, meaning mud from Sidoarjo which erupted near the Banjarpanji-1 exploration well in Sidoarjo, East Java, Indonesia on 27 May 2006. The effect of NaOH molarity, LUSI mud/Alkaline activator (LM/AA) ratio, and Na2SiO3/NaOH ratio to the ALGA are investigated at a sintering temperature of 950 °C. The results show that the optimum NaOH molarity found in this study is 12 M due to the highest strength (lowest AIV value) of 15.79% with lower water absorption and specific gravity. The optimum LUSI mud/Alkaline activator (LM/AA) ratio of 1.7 and the Na2SiO3/NaOH ratio of 0.4 gives the highest strength with AIV value of 15.42% with specific gravity of 1.10 g/cm3 and water absorption of 4.7%. The major synthesized crystalline phases were identified as sodalite, quartz and albite. Scanning Electron Microscope (SEM) image showed more complete geopolymer matrix which contributes to highest strength of ALGA produced.

  8. Recovery of manganese oxides from spent alkaline and zinc–carbon batteries. An application as catalysts for VOCs elimination

    Energy Technology Data Exchange (ETDEWEB)

    Gallegos, María V., E-mail: plapimu@yahoo.com.ar [Pla.Pi.Mu-Planta Piloto Multipropósito, (CICPBA-UNLP) Cno. Centenario y 505, M.B. Gonnet, Buenos Aires (Argentina); Falco, Lorena R., E-mail: mlfalco@quimica.unlp.edu.ar [Pla.Pi.Mu-Planta Piloto Multipropósito, (CICPBA-UNLP) Cno. Centenario y 505, M.B. Gonnet, Buenos Aires (Argentina); Peluso, Miguel A., E-mail: apelu@quimica.unlp.edu.ar [Centro de Investigación y Desarrollo en Ciencias Aplicadas, “Dr. J. Ronco” CINDECA (CONICET CCT La Plata), 47 N°257, La Plata, Buenos Aires (Argentina); Sambeth, Jorge E., E-mail: sambeth@quimica.unlp.edu.ar [Centro de Investigación y Desarrollo en Ciencias Aplicadas, “Dr. J. Ronco” CINDECA (CONICET CCT La Plata), 47 N°257, La Plata, Buenos Aires (Argentina); Thomas, Horacio J. [Pla.Pi.Mu-Planta Piloto Multipropósito, (CICPBA-UNLP) Cno. Centenario y 505, M.B. Gonnet, Buenos Aires (Argentina)

    2013-06-15

    Highlights: • Manganese oxides were synthesized using spent batteries as raw materials. • Spent alkaline and zinc–carbon size AA batteries were used. • A biohydrometallurgical process was employed to bio-lixiviate batteries. • Manganese oxides were active in the oxidation of VOCs (ethanol and heptane). - Abstract: Manganese, in the form of oxide, was recovered from spent alkaline and zinc–carbon batteries employing a biohydrometallurgy process, using a pilot plant consisting in: an air-lift bioreactor (containing an acid-reducing medium produced by an Acidithiobacillus thiooxidans bacteria immobilized on elemental sulfur); a leaching reactor (were battery powder is mixed with the acid-reducing medium) and a recovery reactor. Two different manganese oxides were recovered from the leachate liquor: one of them by electrolysis (EMO) and the other by a chemical precipitation with KMnO{sub 4} solution (CMO). The non-leached solid residue was also studied (RMO). The solids were compared with a MnO{sub x} synthesized in our laboratory. The characterization by XRD, FTIR and XPS reveal the presence of Mn{sub 2}O{sub 3} in the EMO and the CMO samples, together with some Mn{sup 4+} cations. In the solid not extracted by acidic leaching (RMO) the main phase detected was Mn{sub 3}O{sub 4}. The catalytic performance of the oxides was studied in the complete oxidation of ethanol and heptane. Complete conversion of ethanol occurs at 200 °C, while heptane requires more than 400 °C. The CMO has the highest oxide selectivity to CO{sub 2}. The results show that manganese oxides obtained using spent alkaline and zinc–carbon batteries as raw materials, have an interesting performance as catalysts for elimination of VOCs.

  9. The Saving Behaviour of a Two Person Household

    DEFF Research Database (Denmark)

    Browning, Martin

    on the distribution of income within the household. It is also shown that the introduction of an actuarially fair state pension scheme may have non-neutral effects on saving. Finally it is shown that households may invest in both an annuity and insurance for the same person which is not possible in a unitary model......Wives are typically younger than their husbands and women typically live longer than men. These two facts mean that for a typical married couple, wives have more incentive to save for old age than do husbands. This paper presents a theoretical model of the determination of household saving...... and portfolio choice taking into account differences in preferences for saving. The model is a non-cooperative game in which each person can use their own current income to contribute to current (household) consumption or to a range of assets. The results derived are in marked contrast to 'unitary' models...

  10. Low Income Home Energy Assistance Program FY 2008 Household Data

    Data.gov (United States)

    U.S. Department of Health & Human Services — State-reported annual data collected on the presence of elderly, disabled, and young children in eligible households receiving Low Income Home Energy Assistance...

  11. Household crowding and psychosocial health among Inuit in Greenland

    DEFF Research Database (Denmark)

    Riva, Mylène; Larsen, Christina Viskum Lytken; Bjerregaard, Peter

    2014-01-01

    OBJECTIVES: Poor housing conditions experienced by many Indigenous peoples threaten their health and well-being. This study examines whether household crowding is associated with poorer psychosocial health among Greenlanders, and the mediating role of social support. It also assesses whether Inuit...... men and women are differently influenced by their housing conditions. METHODS: Data on more than 3,000 Inuit aged 18 years and older are from the Inuit health in transition Greenland survey. Associations between household crowding and composition, and mental well-being and binge drinking were examined...... using logistic regression models, adjusting for individuals' characteristics. RESULTS: Household crowding was associated with poorer mental well-being. Binge drinking was more common among people living in households without children. These effects were more important for women than for men...

  12. 78 FR 75484 - Federal Management Regulation (FMR); Shipping Household Goods

    Science.gov (United States)

    2013-12-12

    ...] RIN 3090-AJ38 Federal Management Regulation (FMR); Shipping Household Goods AGENCY: Office of... shipping means the reimbursement rate the Federal employee receives for moving his/her own HHG or...

  13. A review of intervention studies aimed at household energy conservation

    NARCIS (Netherlands)

    Abrahamse, W; Steg, L; Vlek, C; Rothengatter, T; Rothengatter, J.A.

    2005-01-01

    This article reviews and evaluates the effectiveness of interventions aiming to encourage households to reduce energy consumption. Thirty-eight studies performed within the field of (applied) social and environmental psychology are reviewed, and categorized as involving either antecedent strategies

  14. The egg consumption of the average household in Italy

    Directory of Open Access Journals (Sweden)

    Giacomo Migliorati

    2010-09-01

    Full Text Available A survey was conducted over a one-year period by means of telephone interviews with 7 991 Italian households to establish the domestic consumption of eggs, the distribution by source of supply, seasonal variations and storage and preparation methods used. Eggs are mainly purchased from large retailers (53%, followed by small retailers (25.2%, direct purchase from producers (16%, and local or itinerant markets (5.8%. It was found that 69.9% of households buy packaged eggs; 92% of households store them in the refrigerator, although this percentage varies considerably, according to the type of presentation (packaged or loose and the number of eggs bought. Italian households mainly eat eggs cooked (48.9%, followed by partly cooked (35.0% and raw (16.1%.

  15. The egg consumption of the average household in Italy.

    Science.gov (United States)

    Prencipe, Vincenza; Rizzi, Valentina; Giovannini, Armando; Migliorati, Giacomo

    2010-01-01

    A survey was conducted over a one-year period by means of telephone interviews with 7 991 Italian households to establish the domestic consumption of eggs, the distribution by source of supply, seasonal variations and storage and preparation methods used. Eggs are mainly purchased from large retailers (53%), followed by small retailers (25.2%), direct purchase from producers (16%), and local or itinerant markets (5.8%). It was found that 69.9% of households buy packaged eggs; 92% of households store them in the refrigerator, although this percentage varies considerably, according to the type of presentation (packaged or loose) and the number of eggs bought. Italian households mainly eat eggs cooked (48.9%), followed by partly cooked (35.0%) and raw (16.1%). PMID:20857379

  16. Accounting for household heterogeneity in general equilibrium economic growth models

    International Nuclear Information System (INIS)

    We describe and evaluate a new method of aggregating heterogeneous households that allows for the representation of changing demographic composition in a multi-sector economic growth model. The method is based on a utility and labor supply calibration that takes into account time variations in demographic characteristics of the population. We test the method using the Population-Environment-Technology (PET) model by comparing energy and emissions projections employing the aggregate representation of households to projections representing different household types explicitly. Results show that the difference between the two approaches in terms of total demand for energy and consumption goods is negligible for a wide range of model parameters. Our approach allows the effects of population aging, urbanization, and other forms of compositional change on energy demand and CO2 emissions to be estimated and compared in a computationally manageable manner using a representative household under assumptions and functional forms that are standard in economic growth models.

  17. Households' Perceived Responsibilities in Flood Risk Management in The Netherlands

    NARCIS (Netherlands)

    Terpstra, Teun; Gutteling, Jan M.

    2008-01-01

    Flood risk management in the Netherlands is on the eve of shifting primarily from prevention towards risk management, including disaster preparedness and response and citizen participation. This study explores Dutch households' perceived responsibility for taking private protection measures. Survey

  18. Dicty_cDB: FCL-AA17 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA17 (Link to dictyBase) - G03264 DDB0191099 Contig-U15602-1 FCL-AA...17P (Link to Original site) FCL-AA17F 547 FCL-AA17Z 610 FCL-AA17P 1157 - - Show FCL-AA17 Library F...CL (Link to library) Clone ID FCL-AA17 (Link to dictyBase) Atlas ID - NBRP ID G03264 dictyBase ID DDB0191099... Link to Contig Contig-U15602-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA.../FCL-AA17Q.Seq.d/ Representative seq. ID FCL-AA17P (Link to Original site) Representative DNA sequence >FCL-AA

  19. Dicty_cDB: FCL-AA14 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA14 (Link to dictyBase) - G03263 DDB0218474 Contig-U16035-1 FCL-AA...14P (Link to Original site) FCL-AA14F 647 FCL-AA14Z 550 FCL-AA14P 1197 - - Show FCL-AA14 Library F...CL (Link to library) Clone ID FCL-AA14 (Link to dictyBase) Atlas ID - NBRP ID G03263 dictyBase ID DDB0218474... Link to Contig Contig-U16035-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA.../FCL-AA14Q.Seq.d/ Representative seq. ID FCL-AA14P (Link to Original site) Representative DNA sequence >FCL-AA

  20. Dicty_cDB: FCL-AA19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA19 (Link to dictyBase) - G01757 DDB0230128 Contig-U16036-1 FCL-AA...19P (Link to Original site) FCL-AA19F 246 FCL-AA19Z 568 FCL-AA19P 814 - - Show FCL-AA19 Library FC...L (Link to library) Clone ID FCL-AA19 (Link to dictyBase) Atlas ID - NBRP ID G01757 dictyBase ID DDB0230128 ...Link to Contig Contig-U16036-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...19Q.Seq.d/ Representative seq. ID FCL-AA19P (Link to Original site) Representative DNA sequence >FCL-AA