WorldWideScience

Sample records for aa hd patients

  1. Seismic analysis of HD 43587Aa, a solar-like oscillator in a multiple system

    NARCIS (Netherlands)

    Boumier, P.; Benomar, O.; Baudin, F.; Verner, G.; Appourchaux, T.; Lebreton, Y.; Gaulme, P.; Chaplin, W.; García, R.A.; Hekker, S.; Regulo, C.; Salabert, D.; Stahn, T.; Elsworth, Y.; Gizon, L.; Hall, M.; Mathur, S.; Michel, E.; Morel, T.; Mosser, B.; Poretti, E.; Rainer, M.; Roxburgh, I.; do Nascimento Jr., J.D.; Samadi, R.; Auvergne, M.; Chaintreuil, S.; Baglin, A.; Catala, C.

    2014-01-01

    Context. The object HD 43587Aa is a G0V star observed during the 145-day LRa03 run of the COnvection, ROtation and planetary Transits space mission (CoRoT), for which complementary High Accuracy Radial velocity Planet Searcher (HARPS) spectra with S/N > 300 were also obtained. Its visual magnitude

  2. Characteristics of AA amyloidosis patients in San Francisco.

    Science.gov (United States)

    Lejmi, Hiba; Jen, Kuang-Yu; Olson, Jean L; James, Sam H; Sam, Ramin

    2016-04-01

    AA amyloidosis due to subcutaneous injection of drugs of abuse has been described in the USA, but all the existing literature is from more than 20 years ago. There is more recent literature from Europe. We have observed a high incidence of AA amyloidosis in the county hospital in San Francisco. Here, we describe 24 patients who had kidney biopsy-proven AA amyloidosis from our hospital from 1998 to 2013. All the patients were thought to have AA amyloidosis from skin popping of illicit drugs after having exhausted the intravenous route. These patients with biopsy-proven AA amyloidosis were analysed further. All patients were found to have hepatitis C infection, hypertension was not common, most had advanced kidney failure, and acidosis was common as was tubulointerstitial involvement on the kidney biopsy. Other organ involvement included hepatomegaly and splenomegaly in a number of patients; direct myocardial involvement was not seen, but pulmonary hypertension, history of deep vein thrombosis and pulmonary embolism were common. The prognosis of these patients was poor. The mortality rate approached 50% 1 year after biopsy, and most of the patient needed dialysis shortly after diagnosis. Cessation of drug use seemed beneficial but rarely achievable. AA amyloidosis from skin popping is common in San Francisco. Most patients with renal involvement end up on dialysis, and mortality rates are exceedingly high. © 2015 Asian Pacific Society of Nephrology.

  3. HD-tDCS in refractory lateral frontal lobe epilepsy patients.

    Science.gov (United States)

    Karvigh, Sanaz Ahmadi; Motamedi, Mahmoud; Arzani, Mahsa; Roshan, Javad Hasan Nia

    2017-04-01

    To evaluate the anticonvulsant effect of the novel high definition transcranial direct current stimulation (HD-tDCS) method on patients with refractory lateral frontal lobe epilepsy. The effects of HD-tDCS on working memory were also examined. 10 adult patients with intractable lateral frontal lobe epilepsy were studied. A central cathode electrode was placed on the epileptogenic zone according to LTM, and 20-min sessions of 2mA HD-tDCS were applied for 10 consecutive days. The primary endpoint was to make changes in the epileptiform discharges (EDs) during a 1-h EEG. Moreover, the seizure frequency based on seizure diary and neuropsychiatric parameters was evaluated. All patients tolerated HD-tDCS stimulation course without any adverse reaction. The frequency of EDs increased immediately and one month after the stimulation course by an average of 6.4% and 1.2%, respectively. However, these changes in the EDs frequency were not statistically significant (p-value >0.05). The mean seizure frequency changes showed decrement by an average of 17.9% immediately, and increment by an average of 38.1% one month after the HD-tDCS. These changes were not significant statistically (p-value >0.05). One patient experienced exacerbation of seizures during the stimulations hence dropped out of the study. Attention and working memory improved significantly immediately and one month after the HD-tDCS in all patients. Changes of EDs and mean seizure frequency caused by HD-tDCS were not statistically significant for the whole group; however, this method could improve the patients' working memory scores. Copyright © 2017 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  4. Diagnostic performance of amyloid A protein quantification in fat tissue of patients with clinical AA amyloidosis

    NARCIS (Netherlands)

    Hazenberg, Bouke P. C.; Bijzet, Johannes; Limburg, Pieter C.; Skinner, Martha; Hawkins, Philip N.; Butrimiene, Irena; Livneh, Avi; Lesnyak, Olga; Nasonov, Evgeney L.; Filipowicz-Sosnowska, Anna; Guel, Ahmet; Merlini, Giampaolo; Wiland, Piotr; Oezdogan, Huri; Gorevic, Peter D.; Ben Maiz, Hedi; Benson, Merrill D.; Direskeneli, Haner; Kaarela, Kalevi; Garceau, Denis; Hauck, Wendy; van Rijswijk, Martin

    Objective. Amyloid A protein quantification in fat tissue is a new immunochemical method for detecting AA amyloidosis, a rare but serious disease. The objective was to assess diagnostic performance in clinical AA amyloidosis. Methods. Abdominal subcutaneous fat tissue of patients with AA amyloidosis

  5. Adequacy of Dietary Intake of Vitamin D in Stable HD Patients: Are they meeting their needs

    Directory of Open Access Journals (Sweden)

    Sara Mahdavi

    2012-06-01

    Full Text Available Hypovitaminosis D is associated with reduced survival, increased cardiovascular events, and impaired bone-mineral balance in dialysis. The KDOQI guidelines do not have specific recommendations regarding vitamin D (VitD intake in dialysis patients. The purpose of this study was to determine whether stable prevalent hemodialysis (HD patients, for whom standard clinical dietary restrictions had been recommended, were able to meet their Recommended Daily Allowance (RDA for VitD. An observational study was conducted to examine serum 25-OHD levels in relation to 3-day diet analysis, supplementation, anthropometrics and nutritional status (using Malnutrition Inflammation Score (MIS in 81 HD patients. Sixty-nine completed 3-day dietary intake records (1 dialysis day, 1 non-dialysis day, 1 weekend-non-dialysis day. Mean dietary VitD intake of the group was 2.5 μg/day SD±3.6, which is less than 15% of RDA of ∼17 μg/day. Only 2 out of 69 subjects (3% met the RDA for VitD with mean intakes of 20.8±2.6 μg/day that corresponded with mean serum 25OHD of 43.5±17.6 nmol/L. Mean serum 25OHD levels for the group were 42.4 ±23.1 nmol/L, with 19 classified as deficient (28% 75nmol/L in terms of 25OHD levels. 20 of the 69 (29% took a VitD supplement and had significantly higher serum 25OHD than ones who did not take any (53.7±17.3 nmol/L vs 38.7±22.4 nmol/L, p-value=0.013. Multiple regression analysis revealed dietary calcium (p=0.001, and dietary protein (p=0.006 were positively related and HD-vintage (p=0.037, inversely related to dietary VitD whereas total kilocalories, dietary phosphate, MIS and dry body mass did not relate to it. Thus, inadequate intake of VitD is a common (97% and modifiable risk factor for hypovitaminosis D in HD patietns. Factors affecting reduced intake of VitD in our patients included dietary protein and calcium but not dietary phosphorous. VitD levels were low even in the face of adequate VitD intake through supplementation

  6. Using A Web-Based Nutrition Algorithm In Hemodialysis (Hd Patients

    Directory of Open Access Journals (Sweden)

    Alison Steiber

    2012-06-01

    Full Text Available Nutrition care is complex and encompasses evaluation and correction of protein-energy wasting plus many nutrition abnormalities such as hyperphosphatemia, abdominal obesity, and risk factors of cardiovascular disease. The purpose of this study was to test a nutritionally comprehensive algorithm for feasibility and functionality in a diverse group of HD patients. This was a prospective, observational study designed to test a nutrition algorithm for 1 clinical feasibility; 2 logical progression; 3 ability to collect data; and 4 effectiveness in improving outcomes. Patients included in this study were enrolled by renal dietitians (RD working in HD units based in five different countries. To select study subjects, RD were asked to screen and consent patients in their facilities until 4 patients were identified as at nutrition risk per the algorithm’s screening tool. All data were collected via the algorithm including screening, assessment, nutrition related diagnosis, etiology of the nutrition diagnosis, nutrition related barriers, nutrition focused interventions, and outcome parameters. Statistics were performed using SPSS vs 20.0 and significance set at p<0.05. One hundred patients, enrolled by 29 RD, were included in this analysis. The screening parameters that triggered an “at risk flag” for more than 50% of the patients were: PTH, serum cholesterol and unintentional weight loss. Of the patients with an albumin of <3.8 mg/dl (37% of sample, 73% were given a nutritional diagnosis of insufficient protein intake. Overall, patients with insufficient intake had significantly lower serum albumin concentrations at baseline than those who did not have this (3.7±0.4 vs. 4.0±0.4, p<0.05. Patients with a diagnosis of “high phosphorus” had decreases in serum PTH (349.5±184.5 to 201.7±113.6, p=0.06 and phosphorus (from 6.5±1.0–5.3±1.9 mg/dl, p=0.04 at the three month data collection. This study is the first of its kind to show that a web

  7. Metabolic syndrome in HD patients: association with body composition, nutritional status, inflammation and serum iron.

    Science.gov (United States)

    Rasic-Milutinovic, Zorica; Perunicic, Gordana; Pljesa, Steva; Gluvic, Zoran; Ilic, Mirka; Stokić, Edith

    2007-01-01

    Insulin resistance and metabolic syndrome (MeS) are common in end-stage renal disease (ESRD) patients on maintenance hemodialysis (HD). Such metabolic and clinical abnormalities may lead to an increased risk for cardiovascular disease. The study group included 22 well-nourished and 20 middle- to moderate-malnourished, stable ESRD patients, with median dialysis duration of 48 months (IQR 24.5-82.0). To determine nutritional status, body composition, inflammatory biomarkers and the presence of MeS subjective global assessment (SGA), anthropometrical measurements (BMI and waist circumference), bioelectrical impedance analysis (BIA), and biochemical parameters [the levels of serum albumin, cholesterol, HDL-cholesterol, triglyceride, hematocrit, hemoglobin, iron, TIBC, transferrin saturation (TSAT), ferritin, calcium, phosphorus, intact parathormone (i-PTH), TNF-alpha, IL-6 and high sensitivity C-reactive protein (hs-CRP)] were used. All parameters were evaluated by comparisons between two groups, with MeS (Group 2) and without it (Group 1). Logistical regression analysis was used to evaluate the correlation between measured variables and the presence of MeS in HD patients. Independent variables for MeS were identified by backward multivariate regression analysis. To identify the independent predictors for insulin resistance index (HOMA-IR) multivariate regression analysis was conducted, after linear regression analysis. After adjustment for confounding variables, a model consisting of serum levels of iron, transferrin saturation (TSAT), and BMI which accounted for 62% of the variance in MeS, determined only BMI as an independent marker (according to ATP-III criteria). But, serum glucose level, iron, waist and total fat mass accounted for 68% of the variance in MeS, according to IDF criteria. Glucose level was an independent predictor. BMI and iron, as independent variables, contributed to 29% of the variance in IR HOMA, the sensitive marker of MeS. The present study

  8. The effect of an ankle-foot orthosis in walking ability and coordination by hd patients: A pilot study

    NARCIS (Netherlands)

    Burer, B.; Houdijk, H.; Lamoth, C.; De Boer, K.; Van Den Bogaard, S.

    2009-01-01

    Background: During the swing phase of the gait of HD patients, some patients show an irregular, uncoordinated movement of the foot, or the foot can not be held in dorsal flexion. These symptoms affect the manner of walking and therefore an individual's ability to participate in daily living. In

  9. Renal AA amyloidosis in a patient with hereditary complete complement C4 deficiency

    Directory of Open Access Journals (Sweden)

    Imed Helal

    2011-01-01

    Full Text Available Hereditary complete C4 deficiency has until now been reported in 30 cases only. A disturbed clearance of immune- complexes probably predisposes these individuals to systemic lupus erythematosus, other immune- complex diseases and recurrent microbial infections. We present here a 20- year- old female with hereditary complete C4 deficiency. Renal biopsy demonstrated renal AA amyloidosis. This unique case further substantiates that deficiency of classical pathway components predisposes to the development of recurrent microbial infections and that the patients may develop AA amyloidosis. Furthermore, in clinical practice, the nephrotic syndrome occurring in a patient with hereditary complete complement C4 deficiency should lead to the suspicion of renal AA amyloidosis.

  10. Impact of the Number of Anti-Thrombosis Agents in Hemodialysis Patients: BOREAS-HD2 Study

    Directory of Open Access Journals (Sweden)

    Marenao Tanaka

    2017-09-01

    Full Text Available Background/Aims: Relationships between the number of anti-thrombosis agents, clinical benefits and adverse events in hemodialysis (HD patients are unclear. Methods: All patients on HD in 22 institutes (n = 1,071 were enrolled and followed up for 3 years. After exclusion of patients with missing data, kidney transplantation or retraction of consent during the follow-up period (n = 204, mortality rate and ischemic and hemorrhagic events were compared between different regimens of anti-thrombosis agents. Results: The use of dual or triple antiplatelet (AP agents (HR:2.03, 95% CI:1.01-4.13, p = 0.04 and the combination of an AP agent and warfarin (WF (HR:4.84, 95%CI 1.96-11.96, p < 0.001 were associated with an increase in hemorrhagic events compared with no use of anti-thrombosis agents. No anti-thrombosis regimen was associated with a significant change in risk of ischemic stroke. The use of dual or triple AP agents, but not WF, was associated with an increase in cardiovascular mortality (HR:2.48, 95% CI:1.24-4.76, p = 0.01. Conclusion: A significant increase in hemorrhagic events by the use of dual or more AP agents and by co-administration of an AP agent and WF in patients on HD should be considered in planning their anti-thrombosis regimen.

  11. Supplementation with a powdered blend of PUFAs normalizes DHA and AA levels in patients with PKU.

    Science.gov (United States)

    Jans, Judith J; de Sain-van der Velden, Monique G M; van Hasselt, Peter M; van den Hurk, Dorine T A M; Vaz, Frederic M; Visser, Gepke; Verhoeven-Duif, Nanda M

    2013-06-01

    Patients with phenylketonuria (PKU) have a poor LC-PUFA status and require supplementation. The objective of this study was to evaluate the LC-PUFA status of PKU patients supplemented with fish oil or the fatty acid supplement KeyOmega. Plasma and erythrocyte docosahexaenoic acid (DHA) and arachidonic acid (AA) levels were determined in 54 patients (1-18.5years of age) with confirmed PKU. The influence of supplementation with fish oil versus KeyOmega, a powdered blend of DHA and AA, on LC-PUFA status was investigated and compared to the status in samples obtained from unsupplemented patients. Differential effects on LC-PUFA status were observed upon suppletion with fish oil versus KeyOmega. Whereas supplementation with fish oil increased the level of DHA, the AA concentration did not increase to normal values in these patients. In contrast, both DHA and AA levels increased and reached reference values upon supplementation with KeyOmega. these results indicate that KeyOmega offers additional benefit over fish oil since both AA and DHA status are normalized in PKU patients supplemented with KeyOmega. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. HD5980

    Science.gov (United States)

    Koenigsberger, C.

    HD5980 is a multiple system containing at least 3 very massive and luminous stars. Located in the Small Magellanic Cloud, it is an ideal system for studying the massive star structure and evolutionary processes in low-metallicity environments. Intensely observed over the past few decades, HD5980 is a treasure trove of information on stellar wind structure, on wind-wind collisions and on the formation of wind-blown circumstellar structures. In addition, its characteristics suggest that the eclipsing WR+LBV stars of the system are the product of quasihomogeneous chemical evolution, thus making them candidate pair production supernovae or GRB progenitors. This paper summarizes some of the outstanding results derived from half a century of observations and recent theoretical studies.

  13. Identifying Motor, Emotional-Behavioral, and Cognitive Deficits that Comprise the Triad of HD Symptoms from Patient, Caregiver, and Provider Perspectives

    Directory of Open Access Journals (Sweden)

    David Victorson

    2014-04-01

    Full Text Available Background: The objective of this study was to identify important attributes associated with the triad of symptoms (cognition, emotional–behavioral, and motor of Huntington's disease (HD from patient, caregiver, and medical provider perspectives to facilitate development of a new disease‐specific, health‐related quality of life (HRQOL instrument. Methods: We conducted a targeted literature review of HD and HRQOL instruments, expert surveys, and patient and caregiver phone‐based interviews to extract information on the symptoms and issues most relevant to the HD symptom triad (HD triad. The data collected from these sources were used to generate themes and subdomains and to develop an integrated schema that highlights the key dimensions of the triad. Results: The search identified the following areas: emotional functioning/behavioral changes (e.g., positive emotions, sadness/depression; cognitive functioning (e.g., memory/learning, attention/comprehension; physical functioning (e.g., motor functioning, medication; social functioning (e.g., leisure, interpersonal relationships; end‐of‐life concerns/planning; and gene testing. Fifteen individuals diagnosed with HD and 16 HD caregivers, recruited from several Huntington's Disease Society of America support group networks, completed phone interviews. Nineteen US medical providers who specialize in HD completed the online survey. Twenty‐six subdomains of the HD symptom triad (seven cognition, 12 emotional–behavioral, and seven motor emerged relatively consistently across patient, caregiver, and provider samples. These included movements/chorea, memory impairment, depression, and anxiety. Discussion: Based on an integrated, mixed‐methods approach, important HD triad symptom were identified and organized into a guiding schema. These patient‐, caregiver‐, and provider‐triangulated data served as the basis for development of a HD‐specific HRQOL instrument, the HD‐PRO‐TRIAD™.

  14. Increased incidence of chronic GvHD and CMV disease in patients with vitamin D deficiency before allogeneic stem cell transplantation.

    Science.gov (United States)

    von Bahr, L; Blennow, O; Alm, J; Björklund, A; Malmberg, K-J; Mougiakakos, D; Le Blanc, A; Oefner, P J; Labopin, M; Ljungman, P; Le Blanc, K

    2015-09-01

    Vitamin D has emerged as a central player in the immune system, with its deficiency being implicated in the pathogenesis of several autoimmune diseases, including chronic GvHD. This is a retrospective cohort analysis of 166 patients, who underwent allogeneic hematopoietic stem cell transplantation (HSCT) at the Karolinska University Hospital, evaluating GvHD, graft failure, infectious complications and survival after HSCT in relation to pre-transplantation vitamin D levels. Most of the patients were deficient in vitamin D before HSCT (median 42 nmol/L). In multivariate analysis, vitamin D level before HSCT was identified as a significant independent risk factor for development of cGvHD. The increased incidence of cGvHD was not coupled to better disease-free survival; instead there was a trend towards lower overall survival in the vitamin D-deficient patients. In addition, we found a significant correlation between vitamin D deficiency and incidence of CMV disease, with no case of CMV disease occurring in patients with sufficient levels of vitamin D before HSCT. Our results support a role of vitamin D in immune tolerance following HSCT. These findings could be highly relevant for the care of HSCT patients, and prospective, randomized studies on the effect of vitamin D supplementation are therefore needed.

  15. Relapse Analysis of Irradiated Patients Within the HD15 Trial of the German Hodgkin Study Group

    Energy Technology Data Exchange (ETDEWEB)

    Kriz, Jan; Reinartz, Gabriele [Department of Radiation Oncology, University of Münster, Münster (Germany); Dietlein, Markus; Kobe, Carsten; Kuhnert, Georg [Department of Nuclear Medicine, University of Cologne, Cologne (Germany); Haverkamp, Heinz [First Department of Internal Medicine, University of Cologne, Cologne (Germany); Haverkamp, Uwe [Department of Radiation Oncology, University of Münster, Münster (Germany); Engenhart-Cabillic, Rita [Department of Radiation Oncology, University of Marburg, Marburg (Germany); Herfarth, Klaus [Department of Radiation Oncology, University Heidelberg, Heidelberg (Germany); Lukas, Peter [Department of Radiation Oncology, University of Innsbruck, Innsbruck (Austria); Schmidberger, Heinz [Department of Radiation Oncology, University of Mainz, Mainz (Germany); Staar, Susanne [Department of Radiation Oncology, Klinikum Bremen-Mitte, Bremen (Germany); Hegerfeld, Kira [Department of Radiation Oncology, University of Münster, Münster (Germany); Baues, Christian [Department of Radiation Oncology, University of Cologne, Cologne (Germany); Engert, Andreas [First Department of Internal Medicine, University of Cologne, Cologne (Germany); Eich, Hans Theodor, E-mail: hans.eich@ukmuenster.de [Department of Radiation Oncology, University of Münster, Münster (Germany)

    2015-05-01

    Purpose: To determine, in the setting of advanced-stage of Hodgkin lymphoma (HL), whether relapses occur in the irradiated planning target volume and whether the definition of local radiation therapy (RT) used by the German Hodgkin Study Group (GHSG) is adequate, because there is no harmonization of field and volume definitions among the large cooperative groups in the treatment of advanced-stage HL. Methods and Materials: All patients with residual disease of ≥2.5 cm after multiagent chemotherapy (CTX) were evaluated using additional positron emission tomography (PET), and those with a PET-positive result were irradiated with 30 Gy to the site of residual disease. We re-evaluated all sites of disease before and after CTX, as well as the PET-positive residual tumor that was treated in all relapsed patients. Documentation of radiation therapy (RT), treatment planning procedures, and portal images were carefully analyzed and compared with the centrally recommended RT prescription. The irradiated sites were compared with sites of relapse using follow-up computed tomography scans. Results: A total of 2126 patients were enrolled, and 225 patients (11%) received RT. Radiation therapy documents of 152 irradiated patients (68%) were analyzed, with 28 irradiated patients (11%) relapsing subsequently. Eleven patients (39%) had an in-field relapse, 7 patients (25%) relapsed outside the irradiated volume, and an additional 10 patients (36%) showed mixed in- and out-field relapses. Of 123 patients, 20 (16%) with adequately performed RT relapsed, compared with 7 of 29 patients (24%) with inadequate RT. Conclusions: The frequency and pattern of relapses suggest that local RT to PET-positive residual disease is sufficient for patients in advanced-stage HL. Insufficient safety margins of local RT may contribute to in-field relapses.

  16. Quality of life of patients with graft-versus-host disease (GvHD) post-hematopoietic stem cell transplantation.

    Science.gov (United States)

    Proença, Sibéli de Fátima Ferraz Simão; Machado, Celina Mattos; Coelho, Raquel de Castro Figueiredo Pereira; Sarquis, Leila Maria Mansano; Guimarães, Paulo Ricardo Bittencourt; Kalinke, Luciana Puchalski

    2016-01-01

    Assessing the quality of life of adult patients with hematological cancer in the 100 days after transplantation of hematopoietic stem cells and verifying whether the variable graft-versus-host disease (GvHD) is predictive of worse results. An observational correlational and quantitative study with 36 adult participants diagnosed with hematologic cancer who underwent hematopoietic stem cell transplantation from September 2013 to June 2015. The mean age was 37 years, 52.78% were female, and 61.11% were diagnosed with leukemia. Quality of life scores showed a significant impact between pre-transplantation and pre-hospital discharge, and also within the 100 days post-transplantation. The statistical analysis between the scores for the groups with and without GvHD showed a significant difference between the presence of the complication and worse results. Quality of life is altered as a result of hematopoietic stem cells transplantation, especially in patients who have graft-versus-host disease. Avaliar a qualidade de vida de pacientes adultos com câncer hematológico nos 100 dias do transplante de células-tronco hematopoéticas e verificar se a variável doença do enxerto contra o hospedeiro é preditiva de piores resultados. Estudo observacional, correlacional e quantitativo, com 36 participantes adultos, diagnosticados com câncer hematológico que se submeteram ao transplante de células-tronco hematopoéticas de setembro de 2013 a junho de 2015. A média de idade foi 37 anos, 52,78% eram do sexo feminino, e 61,11% com diagnóstico de leucemia. Os escores de qualidade de vida demonstraram impacto significativo entre o pré-transplante e a pré-alta hospitalar e entre os 100 dias pós-transplante. A análise estatística entre os escores dos grupos com e sem doença do enxerto contra o hospedeiro evidenciou significância entre a presença desta complicação e piores resultados. A qualidade de vida é alterada em decorrência do transplante de c

  17. Prevalence and patterns of cognitive impairment in adult hemodialysis patients: the COGNITIVE-HD study.

    Science.gov (United States)

    van Zwieten, Anita; Wong, Germaine; Ruospo, Marinella; Palmer, Suetonia C; Barulli, Maria Rosaria; Iurillo, Annalisa; Saglimbene, Valeria; Natale, Patrizia; Gargano, Letizia; Murgo, Marco; Loy, Clement T; Tortelli, Rosanna; Craig, Jonathan C; Johnson, David W; Tonelli, Marcello; Hegbrant, Jörgen; Wollheim, Charlotta; Logroscino, Giancarlo; Strippoli, Giovanni F M

    2017-11-22

    Mounting evidence indicates an increased risk of cognitive impairment in adults with end-stage kidney disease on dialysis, but the extent and pattern of deficits across the spectrum of cognitive domains are uncertain. We conducted a cross-sectional study of 676 adult hemodialysis patients from 20 centers in Italy, aiming to evaluate the prevalence and patterns of cognitive impairment across five domains of learning and memory, complex attention, executive function, language and perceptual-motor function. We assessed cognitive function using a neuropsychological battery of 10 tests and calculated test and domain z-scores using population norms (age or age/education). We defined cognitive impairment as a z-score  ≤ -1.5. Participants' median age was 70.9 years (range 21.6-94.1) and 262 (38.8%) were women. Proportions of impairment on each domain were as follows: perceptual-motor function 31.5% (150/476), language 41.2% (273/662), executive function 41.7% (281/674), learning and memory 42.2% (269/638), complex attention 48.8% (329/674). Among 474 participants with data for all domains, only 28.9% (n  =  137) were not impaired on any domain, with 25.9% impaired on a single domain (n  =  123), 17.3% on two (n  =  82), 13.9% on three (n  =  66), 9.1% on four (n  =  43) and 4.9% (n  =  23) on all five. Across patients, patterns of impairment combinations were diverse. In conclusion, cognitive impairment is extremely common in hemodialysis patients, across numerous domains, and patients often experience multiple deficits simultaneously. Clinical care should be tailored to meet the needs of patients with different types of cognitive impairment and future research should focus on identifying risk factors for cognitive decline.

  18. Nutrition and hydration status improve with exercise training using stationary cycling during hemodialysis (HD) in patients with end-stage renal disease (ESRD).

    Science.gov (United States)

    Załuska, Alicja; Załuska, Wojciech T; Bednarek-Skublewska, Anna; Ksiazek, Andrzej

    2002-01-01

    Patients with end-stage renal disease (ESRD) undergoing hemodialysis and peritoneal dialysis are functionally limited as a consequence of their physical, emotional, and social problems. Exercise intolerance is a major problem in chronic renal failure. Stationary cycle training during hemodialysis is recommended as safe, effective, and practical in ESRD patients treated on hemodialysis. The aim of the present study was to evaluate the effect of cycling exercises in 10 HD patients during 6-month period (including each of dialysis sessions) on nutrition, dialysis adequacy, and fluid parameters as measured by biochemical, and bioimpedance parameters. A significant increase in serum albumin concentration, Kt/V, and nPCR, and decrease in serum CRP have been observed after 6 months of regular stationary cycling during hemodialysis. Relative changes (pre-post HD) in extracellular water compartment and ECW/TBW ratio have significantly increased after 6 months of observation period.

  19. Effect of different types of blood purification treatment (HD and HDF) on the serum PTH, leptin and Hcy levels in patients with chronic renal failure

    International Nuclear Information System (INIS)

    Yao Yongliang

    2009-01-01

    Objective: To investigate the effect of different type of blood purification treatment (hemodialysis and hemodiafiltration) on the serum PTH, Leptin and Hcy levels in patients with chronic renal failure(CRF). Methods: Serum levels of PTH(with ECLIA), Leptin(with RIA) and Hcy(with biochemistry) were measured in 30 patients treated with hemodialysis(HD) and 30 patients treated with hemodiafiltration(HDF) both before and after treatment. Results: The concentration of PTH decreased significantly from 60.8±32.5pmol/L to 28.2±17.2pmol/L in patients treated with HDF(P 0.05). Yet the concentration of Hcy also decreased significantly from 31.5μ10.5μmol/L to 20.4±8.5μmol/L(P<0.01) in patients treated HD. Conclusion: HDF can eliminate serum PTH, leptin and Hcy better than HD does. (authors)

  20. Clinical implications of eicosapentaenoic acid/arachidonic acid ratio (EPA/AA) in adult patients with congenital heart disease.

    Science.gov (United States)

    Kanoh, Miki; Inai, Kei; Shinohara, Tokuko; Tomimatsu, Hirofumi; Nakanishi, Toshio

    2017-12-01

    Recent studies showed that a low ratio between the levels of eicosapentaenoic acid and those of arachidonic acid (EPA/AA) is associated with higher incidence of coronary artery disease and poor prognosis of heart failure, arrhythmia, and cardiac sudden death. However, the clinical implications of EPA/AA in adult patients with congenital heart disease remain unclear. We aimed to assess the prognostic value of EPA/AA regarding cardiac events in adult patients with congenital heart disease. We measured the serum levels of eicosapentaenoic acid and arachidonic acid in 130 adult patients (median age, 31 years) stratified into two groups according to their EPA/AA (low, ≤0.22; high, >0.22). We prospectively analyzed the association between EPA/AA and incidence of cardiac events during a mean observation period of 15 months, expressed in terms of hazard ratio (HR) with 95% confidence interval (95% CI). In the subgroup of patients with biventricular circulation (2VC) (n = 76), we analyzed the same clinical endpoints. In our study population, EPA/AA was not associated with the incidence of arrhythmic events (HR, 1.52; 95% CI, 0.82-2.85; p = 0.19), but low EPA/AA was a predictor of heart failure hospitalization (HR, 2.83; 95% CI, 1.35-6.30; p heart failure hospitalization (HR, 5.20; 95% CI, 1.78-18.1; p congenital heart disease.

  1. Activation of coagulation and hyperfibrinolysis in patients with aortic arch atheromatosis (Aortic AA) as a risk factor for cerebral ischemia.

    Science.gov (United States)

    Siemens, Hans-Joachim G; Mirau, Wladimir; Brueckner, Sabine; Jahn, Juergen; Roth-Isigkeit, Angela; Gutsche, Sven; Mitusch, Rolf; Sheikhzadeh, Abdolhamid

    2005-04-01

    In patients with cerebral ischemia, a frequent finding is atheromatous plaques in the ascending aorta and the aortic arch. Since we were able to demonstrate that patients with atrial fibrillation have an increased coagulatory activity, we wanted to evaluate a potential systemic activation of the coagulatory system in patients with aortic arch atheromatosis (Aortic AA). In 134 consecutive patients, we determined several parameters of the coagulatory and fibrinolytic systems as well as several thrombophilia risk factors and compared the results with 134 age- and sex-matched healthy controls. In 90 of the 134 patients, transesophageal echocardiography showed Aortic AA, and in the remaining 44 patients, there were no aortic findings. The Aortic AA group showed higher concentrations of thrombin-antithrombin (TAT) and plasmin-antiplasmin complexes (PAP). Further division into 4 subgroups of different severity (grade I: no plaques; grade II: plaques 2-5 mm, grade III: plaques > 5 mm, grade IV: mobile plaques), revealed increasing concentrations of fibrinogen, D-dimers and tissue-type plasminogen activator. The grade IV-group displayed the highest values in comparison to all other groups. In conclusion, Aortic AA as such is a risk factor for cerebral ischemia. It causes a systemically detectable activation of coagulation which substantially exceeds the values for controls. This observation is in accordance with our findings in patients with atrial fibrillation.

  2. [Changes of CD34(+) and CD71(+)CD45(-) cell levels in bone marrow of MDS and AA patients].

    Science.gov (United States)

    Yan, Zhen-Yu; Tian, Xu; Li, Ying; Yang, Mei-Rong; Zhang, Song; Wang, Xie-Ming; Zhang, Hai-Xia; Cheng, Nai-Yao

    2014-04-01

    This study was aimed to investigate the changes of CD34(+) and CD71(+)CD45(-) cell levels in MDS and AA patients. A total of 25 cases MDS and 43 cases of AA (18 cases SAA and 25 cases of NSAA) from January 2010 to October 2013 in the Department of Hematology, affiliated hospital of Hebei United University were enrolled in this study. The complete blood count, bone marrow smears, bone marrow biopsy, karyotype analysis and bone marrow blood cell immune genotyping (mainly the proportion of CD34(+) cells, CD71(+)CD45(-) cells in nucleated cells) were carried out for all patients; the changes of CD34(+) and CD71(+)CD45(-) cell levels in patients with MDS and AA (SAA NSAA) were compared; the differences of white blood cell count, platelet count and hemoglobin concentration in patients with count of CD71(+)CD45(-) ≥ 15% or MDS group was higher than that in AA (NSAA and SAA) group (P MDS group was higher than that in SAA (P MDS group. In MDS group with CD71(+)CD45(-) ≥ 15%, the platelet count was significantly higher than that in NSAA group (P MDS and NSAA group with CD71(+)CD45(-) 0.05). It is concluded that the count of CD34(+) cells in MDS patients is significantly higher than that in AA and SAA patients. The count of CD71(+)CD45(-) cells in MDS group is significantly higher than that of SAA group. The platelet count in MDS patients with CD71(+)CD45(-) cells ≥ 15% is significantly higher than that of the NSAA group.

  3. IFNγ production in peripheral blood of early Lyme disease patients to hLFAαL (aa326-345

    Directory of Open Access Journals (Sweden)

    Wormser Gary P

    2002-10-01

    Full Text Available Abstract Background It has been proposed that outer surface protein A (OspA of Borrelia burgdorferi sensu stricto contains a T helper 1 (Th1 cell epitope that could play a role in an autoimmune response to hLFA1. Methods We used two peptides, hLFAαL (aa326-345 and Borrelia burgdorferi OspAB31 (aa164-183, as stimulating antigens to measure Th1 proinflammatory IFNγ cytokine production in peripheral blood of Lyme disease patients presenting with EM without history of arthritis, as well as in peripheral blood of healthy individuals. Results IFNγ responses to hLFA1 peptide were observed in 11 of 19 Lyme disease patients and in 3 of 15 healthy controls. In contrast, only 2 of 19 of the Lyme disease patients and none of the controls responded to the homologous OspAB31 peptide. Conclusions IFNγ was produced in response to stimulation with peptide hLFAαL (aa326-345 in peripheral blood of 58% of patients with early Lyme disease without signs of arthritis, as well as in peripheral blood of 20% of healthy individuals, but not in response to stimulation with the homologous OspAB31 (aa164-183 peptide (p

  4. Pro Tools HD

    CERN Document Server

    Camou, Edouard

    2013-01-01

    An easy-to-follow guide for using Pro Tools HD 11 effectively.This book is ideal for anyone who already uses ProTools and wants to learn more, or is new to Pro Tools HD and wants to use it effectively in their own audio workstations.

  5. The rs2071559 AA VEGFR-2 Genotype Frequency Is Significantly Lower in Neovascular Age-Related Macular Degeneration Patients

    Directory of Open Access Journals (Sweden)

    Stefano Lazzeri

    2012-01-01

    Full Text Available In this prospective, case-control genetic study, 120 consecutive neovascular age-related macular degeneration (AMD cases and 78 controls were enrolled. Two SNPs (rs2071559 and rs1870377 of VEGF-A receptor-2 (VEGFR-2 gene were analyzed with the technique of Real-Time PCR to investigate a genetic link between AMD and VEGFR-2 gene polymorphisms in Italian patients. The frequency of the VEGFR-2 genotype rs2071559 AA was significantly lower (18.33% in patients with AMD than in the control subjects (34.62%; P=0.0095, chi-square test; Pcorr=0.038; OR=0.42, 95% CI 0.22 to 0.82. In conclusion, although with the limitations of a small sample size and the few SNPs studied, this study demonstrates a lower frequency of VEGFR-2 rs2071559 AA genotype in an AMD patient population, suggesting future studies on the role VEGFR-2 SNPs.

  6. Studies of FCAPT uvby Photometry with Period04: The mCP Stars HD 5797, HD 36792, HD 27309, HD 47913, HD 74521, HD 120198, HD 171263, and HD 215441

    Science.gov (United States)

    Dukes, Robert J., Jr.; Adelman, Saul J.

    2018-04-01

    We present differential Strömgren uvby Four College Automated Photometric Telescope (FCAPT) observations of eight magnetic chemically peculiar stars: HD 5797, HD 26792, HD 27309, HD 49713, HD 74521, HD 120198, HD 171263, and HD 215441. Our data sets are larger than those of most mCP stars in the literature. These are the first FCAPT observations of HD 5797, HD 26792, HD 49713, and HD 171263. Those for the other four stars substantially extend published FCAPT data sets. The FCAPT has observed some stars for a longer time range and with greater accuracy than other optical region telescopes. We determine very accurate periods and u, v, b, and y amplitudes, as well as if there are any long-term periods. Further, we compare our results with those of magnetic field measurements, when they exist, to help interpret the light curves. For each star, we used the Period04 computer program to analyze the uvby light curves. This program provides errors for the derived quantities. Our derived periods of 68.0457 ± 0.0200 days for HD 5797, 3.80205 ± 0.00015 days for HD 26792, 1.5688908 ± 0.0000046 days for HD 27309, 2.135361 ± 0.000031 days for HD 49713, 7.05053 ± 0.00024 for days HD 74521, 1.3857690 ± 0.0000058 days for HD 120198, 3.99744 ± 0.00015 days for HD 171263, and 9.487792 ± 0.000049 days for HD 215441 are refinements of the last determinations in the literature. We also found a low-frequency term for HD 49713 in all four filters.

  7. Sevelamer is cost effective versus calcium carbonate for the first-line treatment of hyperphosphatemia in new patients to hemodialysis: a patient-level economic evaluation of the INDEPENDENT-HD study.

    Science.gov (United States)

    Ruggeri, Matteo; Bellasi, Antonio; Cipriani, Filippo; Molony, Donald; Bell, Cynthia; Russo, Domenico; Di Iorio, Biagio

    2015-10-01

    The recent multicenter, randomized, open-label INDEPENDENT study demonstrated that sevelamer improves survival in new to hemodialysis (HD) patients compared with calcium carbonate. The objective of this study was to determine the cost-effectiveness of sevelamer versus calcium carbonate for patients new to HD, using patient-level data from the INDEPENDENT study. Cost-effectiveness analysis. Adult patients new to HD in Italy. A patient-level cost-effectiveness analysis was conducted from the perspective of the Servizio Sanitario Nazionale, Italy's national health service. The analysis was conducted for a 3-year time horizon. The cost of dialysis was excluded from the base case analysis. Sevelamer was compared to calcium carbonate. Total life years (LYs), total costs, and the incremental cost per LY gained were calculated. Bootstrapping was used to estimate confidence intervals around LYs, costs, and cost-effectiveness and to calculate the cost-effectiveness acceptability curve. Sevelamer was associated with a gain of 0.26 in LYs compared to calcium carbonate, over the 3-year time horizon. Total drug costs were €3,282 higher for sevelamer versus calcium carbonate, while total hospitalization costs were €2,020 lower for sevelamer versus calcium carbonate. The total incremental cost of sevelamer versus calcium carbonate was €1,262, resulting in a cost per LY gained of €4,897. The bootstrap analysis demonstrated that sevelamer was cost effective compared with calcium carbonate in 99.4 % of 10,000 bootstrap replicates, assuming a willingness-to-pay threshold of €20,000 per LY gained. Data on hospitalizations was taken from a post hoc retrospective chart review of the patients included in the INDEPENDENT study. Patient quality of life or health utility was not included in the analysis. Sevelamer is a cost-effective alternative to calcium carbonate for the first-line treatment of hyperphosphatemia in new to HD patients in Italy.

  8. Transgenic Rat Model of Huntington’s Disease: A Histopathological Study and Correlations with Neurodegenerative Process in the Brain of HD Patients

    Directory of Open Access Journals (Sweden)

    Yvona Mazurová

    2014-01-01

    Full Text Available Rats transgenic for Huntington’s disease (tgHD51 CAG rats, surviving up to two years, represent an animal model of HD similar to the late-onset form of human disease. This enables us to follow histopathological changes in course of neurodegenerative process (NDP within the striatum and compare them with postmortem samples of human HD brains. A basic difference between HD pathology in human and tgHD51 rats is in the rate of NDP progression that originates primarily from slow neuronal degeneration consequently resulting in lesser extent of concomitant reactive gliosis in the brain of tgHD51 rats. Although larger amount of striatal neurons displays only gradual decrease in their size, their number is significantly reduced in the oldest tgHD51 rats. Our quantitative analysis proved that the end of the first year represents the turn in the development of morphological changes related to the progression of NDP in tgHD51 rats. Our data also support the view that all types of CNS glial cells play an important, irreplaceable role in NDP. To the best of our knowledge, our findings are the first to document that tgHD51 CAG rats can be used as a valid animal model for detailed histopathological studies related to HD in human.

  9. Dabigatran and rivaroxaban do not affect AA- and ADP-induced platelet aggregation in patients receiving concomitant platelet inhibitors.

    Science.gov (United States)

    Olivier, Christoph B; Weik, Patrick; Meyer, Melanie; Weber, Susanne; Diehl, Philipp; Bode, Christoph; Moser, Martin; Zhou, Qian

    2016-08-01

    Dabigatran and rivaroxaban are novel, vitamin K-independent oral anticoagulants (NOACs) and act via antagonism of the coagulation factor (F) IIa (dabigatran) or FXa (rivaroxaban), respectively. Compared to vitamin-K-antagonists, NOACs have shown non-inferiority of risk and benefit in patients with non valvular atrial fibrillation (AF). In clinical practice there is increasing use of NOACs combined with platelet inhibitors in patients with AF and coronary artery disease. However, whether NOACs affect the function of platelet inhibitors remains incompletely known. This observational study aimed to assess the platelet function in patients receiving dabigatran or rivaroxaban and concomitant platelet inhibitors. A single centre observational study was performed analysing the platelet aggregation of patients treated with dabigatran or rivaroxaban with or without concomitant platelet inhibitors. Measurements before the initiation of NOAC therapy served as the respective control group. Platelet aggregation was measured by multiple electrode aggregometry and was induced with adenosine diphosphate (ADP, 6.5 µM) and arachidonic acid (AA, 0.5 mM), respectively. In order to evaluate whether NOACs interact with platelet inhibition by ASA or the P2Y12-antagonist clopidogrel, 87 patients were grouped according to their concomitant antiplatelet medication. Comparing the ADP- and AA-induced platelet aggregation in patients without concomitant platelet inhibitors (n = 45) no significant differences under therapy with dabigatran (d) or rivaroxaban (r) compared to the control group (c) were observed. In patients taking clopidogrel as a concomitant platelet inhibitor (n = 21), neither dabigatran nor rivaroxaban affected the ADP-induced platelet aggregation (c 20 ± 11, d 21 ± 14, r 18 ± 8 AU*min, p = 0.200). Patients receiving dabigatran or rivaroxaban in combination with ASA (n = 42; 21 ASA only, 21 ASA + clopidogrel) showed no significant differences of the AA

  10. AA Index

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa index provides a long climatology of global geomagnetic activity using 2 antipodal observatories at Greenwich and Melbourne- IAGA Bulletin 37,...

  11. Abundance analysis of Am binaries and search for tidally driven abundance anomalies - III. HD 116657, HD 138213, HD 155375, HD 159560, HD 196544 and HD 204188

    Science.gov (United States)

    Stateva, I.; Iliev, I. Kh.; Budaj, J.

    2012-02-01

    We continue here the systematic abundance analysis of a sample of Am binaries in order to search for possible abundance anomalies driven by tidal interaction in these binary systems. New CCD observations of HD 116657, HD 138213, HD 155375, HD 159560, HD 196544 and HD 204188 were obtained in two spectral regions (6400-6500 and 6660-6760 Å). A synthetic spectrum analysis was carried out and the basic stellar properties, effective temperatures, gravities, projected rotational velocities, masses, ages and abundances of several elements were determined. We conclude that all six stars are Am stars. These stars were put into the context of other Am binaries with 10 Royer et al. and Abt & Morrell.

  12. The Danish HD Registry

    DEFF Research Database (Denmark)

    Gilling, M.; Budtz-Jorgensen, E.; Boonen, S. E.

    2017-01-01

    The Danish Huntington's Disease Registry (DHR) is a nationwide family registry comprising 14 245 individuals from 445 Huntington's disease (HD) families of which the largest family includes 845 individuals in 8 generations. 1136 DNA and/or blood samples and 18 fibroblast cultures are stored...

  13. Datablock: hd141

    Indian Academy of Sciences (India)

    2016-01-15

    Jan 15, 2016 ... checkCIF/PLATON page 2 http://checkcif.iucr.org/cgibin/checkcif_hkl.pl. 1/3. checkCIF (basic structural check) running. checkCIF/PLATON (basic structural check). Structure factors have been supplied for datablock(s) hd141. THIS REPORT IS FOR GUIDANCE ONLY. IF USED AS PART OF A REVIEW.

  14. Relationship between patient-reported outcomes and clinical outcomes in metastatic castration-resistant prostate cancer: post hoc analysis of COU-AA-301 and COU-AA-302.

    Science.gov (United States)

    Cella, D; Traina, S; Li, T; Johnson, K; Ho, K F; Molina, A; Shore, N D

    2018-02-01

    Patient-reported outcomes (PROs) are used to assess benefit-risk in drug development. The relationship between PROs and clinical outcomes is not well understood. We aim to elucidate the relationships between changes in PRO measures and clinical outcomes in metastatic castration-resistant prostate cancer (mCRPC). We investigated relationships between changes in self-reported fatigue, pain, functional well-being (FWB), physical well-being (PWB) and prostate cancer-specific symptoms with overall survival (OS) and radiographic progression-free survival (rPFS) after 6 and 12 months of treatment in COU-AA-301 (N = 1195) or COU-AA-302 (N = 1088). Eligible COU-AA-301 patients had progressed after docetaxel and had Eastern Cooperative Oncology Group performance status (ECOG PS) ≤ 2. Eligible COU-AA-302 patients had no prior chemotherapy and ECOG PS 0 or 1. Patients were treated with abiraterone acetate (1000 mg/day) plus prednisone (10 mg/day) or prednisone alone daily. Association between self-reported fatigue, pain and functional status, and OS and/or rPFS, using pooled data regardless of treatment, was assessed. Cox proportional hazard regression modeled time to death or radiographic progression. In COU-AA-301 patients, PRO improvements were associated with longer OS and longer time to radiographic progression versus worsening or stable PROs (P AA-302 patients, worsening PROs were associated with higher likelihood of radiographic progression (P ≤ 0.025) compared with improved or stable PROs. In multivariate models, worsening PWB remained associated with worse rPFS. The 12-month analysis confirmed the 6-month results. PROs are significantly associated with clinically relevant time-to-event efficacy outcomes in clinical trials and may complement and help predict traditional clinical practice methods for monitoring patients for disease progression. © The Author 2017. Published by Oxford University Press on behalf of the European Society for

  15. Effects of dialysate to serum sodium (Na+) alignment in chronic hemodialysis (HD) patients: retrospective cohort study from a quality improvement project.

    Science.gov (United States)

    Raimann, Jochen G; Ficociello, Linda H; Usvyat, Len A; Zhang, Hanjie; Pacelli, Lisa; Moore, Sandi; Sheppard, Penny; Xiao, Qingqing; Wang, Yuedong; Mullon, Claudy; Balter, Paul; Sullivan, Terry; Kotanko, Peter

    2018-04-02

    Evidence indicates favorable effects of dialysate (DNa + ) to serum sodium concentration (SNa + ) alignment, however, results from larger sample populations are needed. For this reason, we conducted a retrospective propensity score-matched cohort study from a quality improvement project to investigate the effects of alignment on population of maintenance hemodialysis patients. At 4 participating hemodialysis (HD) clinics, patients with SNa + lower than the standard DNa + of 137 mEq/L who received HD with DNa + aligned to the average of the last 4 SNa + measurements were evaluated (clinicaltrials.gov # NCT01825590 ). In this retrospective data analysis, an intention-to-treat (primary) and an as-treated "intervention" (secondary) cohort were created. "Aligned" patients from both cohorts (N = 163 for the primary and N = 137 for the secondary) were then propensity-score matched in a 1:1 fashion to "unaligned" patients from the Renal Research Institute database. The propensity score was generated based on age, gender, white race, Hispanic ethnicity, absence or presence of diabetes, hemodialysis vintage, interdialytic weight gain (IDWG; as a percentage of postdialysis body weight), catheter as primary dialysis access, predialysis systolic blood pressure, serum sodium concentration, hospitalization count during baseline. T-Test was employed for group comparisons of changes to the primary (volume-related and hemodynamic parameters) and tertiary outcomes. All-cause and fluid overload-related hospitalization admission rates were compared using Wilcoxon Rank Sum test and Cox regression analysis for repeated events. In the primary analysis, aligned and unaligned subjects showed comparable demographics at baseline. Treatment effects were significant for IDWG [-0.12 (95% CI -0.24 to 0) L] and showed decreasing non-significant trends for pre-dialysis hemodynamic parameters. Count comparison and Cox regression analysis showed no clear advantage of alignment in terms of

  16. HD 285507b

    DEFF Research Database (Denmark)

    Quinn, Samuel N.; White, Russel J.; Latham, David W.

    2014-01-01

    We report the discovery of the first hot Jupiter in the Hyades open cluster. HD 285507b orbits a V = 10.47 K4.5V dwarf (M * = 0.734 M ☉; R * = 0.656 R ☉) in a slightly eccentric () orbit with a period of days. The induced stellar radial velocity corresponds to a minimum companion mass of M Psin i...

  17. Eicosapentaenoic acid to arachidonic acid (EPA/AA) ratio as an associated factor of high risk plaque on coronary computed tomography in patients without coronary artery disease.

    Science.gov (United States)

    Nagahara, Yasuomi; Motoyama, Sadako; Sarai, Masayoshi; Ito, Hajime; Kawai, Hideki; Takakuwa, Yoko; Miyagi, Meiko; Shibata, Daisuke; Takahashi, Hiroshi; Naruse, Hiroyuki; Ishii, Junichi; Ozaki, Yukio

    2016-07-01

    Coronary computed tomography angiography (CCTA)-verified high risk plaque (HRP) characteristics including positive remodeling and low attenuation plaque have been associated with acute coronary syndromes. Several studies reported that the n-3 polyunsaturated fatty acids have been associated with cardiovascular events. However, the relationship between serum eicosapentaenoic acid to arachidonic acid (EPA/AA) ratio and CCTA-verified HRP in patients without known coronary artery disease (CAD) is unclear. We aimed at investigating the relation between EPA/AA and CCTA-verified HRP in patients without known CAD. We included 193 patients undergoing CCTA without known CAD (65.5 ± 12.0 years, 55.0% male). No patient has been treated with EPA. The relation of coronary risk factors, lipid profile, high-sensitivity C-reactive protein, coronary artery calcification score (CACS), number of vessel disease, plaque burden, and EPA/AA with the presence of HRP was evaluated by logistic regression analysis. Incremental value of EPA/AA to predict HRP was also analyzed by C-index, NRI, and IDI. A Cox proportional hazards model was used to estimate the time to cardiovascular event. HRP was observed in 37 (19%) patients. Multivariable logistic regression analysis revealed that current smoking (OR 2.58; p=0.046), number of vessel disease (OR 1.87; p=0.031), and EPA/AA ratio (OR 0.65; p=0.0006) were independent associated factors of HRP on CCTA. Although the addition of EPA/AA to the baseline model did not significantly improve C-index, both NRI (0.60, p=0.0049) and IDI (0.054, p=0.0072) were significantly improved. Patients with HRP had significantly higher rate of events compared with patients without HRP (14% vs. 3%, Logrank p=0.0004). On multivariable Cox hazard analysis, baseline EPA/AA ratio was an independent predictor (HR 0.57, p=0.047). Low EPA/AA was an associated factor of HRP on CCTA in patients without CAD. In addition to conventional coronary risk factors and CACS, EPA/AA

  18. Abia, AA

    African Journals Online (AJOL)

    Abia, AA. Vol 4, No 6 (2010) - Articles Studies on the kinetics and intraparticle diffusivities of BOD, colour and TSS reduction from palm oil mill effluent (POME) using boiler fly ash. Abstract PDF. ISSN: 1996-0786. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More ...

  19. Adejumo, AA

    African Journals Online (AJOL)

    Adejumo, AA. Vol 6, No 2 (2014) - Articles Assessment of Tourists Flow and Revenue Generation in Kainji Lake National Park, Nigeria Abstract PDF. ISSN: 2141-1778. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and ...

  20. Adepeju, AA

    African Journals Online (AJOL)

    Adepeju, AA. Vol 19, No 2 (2010) - Articles Assessment of Ethical and Other Professional Standards in Private Medical Laboratories; Osun State Experience. Abstract. ISSN: 1116-1043. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's ...

  1. Wornyo, AA

    African Journals Online (AJOL)

    Wornyo, AA. Vol 2, No 1 (2012) - Articles Addressing the Difficulties of Learners in the Reading Class Abstract. ISSN: 2026-6081. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and Conditions of Use · Contact AJOL ...

  2. Subsequent Chemotherapy and Treatment Patterns After Abiraterone Acetate in Patients with Metastatic Castration-resistant Prostate Cancer: Post Hoc Analysis of COU-AA-302.

    Science.gov (United States)

    de Bono, Johann S; Smith, Matthew R; Saad, Fred; Rathkopf, Dana E; Mulders, Peter F A; Small, Eric J; Shore, Neal D; Fizazi, Karim; De Porre, Peter; Kheoh, Thian; Li, Jinhui; Todd, Mary B; Ryan, Charles J; Flaig, Thomas W

    2017-04-01

    Treatment patterns for metastatic castration-resistant prostate cancer (mCRPC) have changed substantially in the last few years. In trial COU-AA-302 (chemotherapy-naïve men with mCRPC), abiraterone acetate plus prednisone (AA) significantly improved radiographic progression-free survival and overall survival (OS) when compared to placebo plus prednisone (P). This post hoc analysis investigated clinical responses to docetaxel as first subsequent therapy (FST) among patients who progressed following protocol-specified treatment with AA, and characterized subsequent treatment patterns among older (≥75 yr) and younger (AA arm received subsequent treatment with one or more agents approved for mCRPC. Efficacy analysis was performed for patients for whom baseline and at least one post-baseline prostate-specific antigen (PSA) values were available. Baseline and at least one post-baseline PSA values were available for 100 AA patients who received docetaxel as FST. While acknowledging the limitations of post hoc analyses, 40% (40/100) of these patients had an unconfirmed ≥50% PSA decline with first subsequent docetaxel therapy, and 27% (27/100) had a confirmed ≥50% PSA decline. The median docetaxel treatment duration among these 100 patients was 4.2 mo. Docetaxel was the most common FST among older and younger patients from each treatment arm. However, 43% (79/185) of older patients who progressed on AA received no subsequent therapy for mCRPC, compared with 17% (60/361) of younger patients. Patients with mCRPC who progress with AA treatment may still derive benefit from subsequent docetaxel therapy. These data support further assessment of treatment patterns following AA treatment for mCRPC, particularly among older patients. ClinicalTrials.gov NCT00887198. Treatment patterns for advanced prostate cancer have changed substantially in the last few years. This additional analysis provides evidence of clinical benefit for subsequent chemotherapy in men with advanced

  3. The FAS-670 AA genotype is associated with high proviral load in peruvian HAM/TSP patients.

    Science.gov (United States)

    Rosado, Jason; Morales, Sandra; López, Giovanni; Clark, Daniel; Verdonck, Kristien; Gotuzzo, Eduardo; Van Camp, Guy; Talledo, Michael

    2017-04-01

    Human T-lymphotropic virus 1 (HTLV-1) is the etiologic agent of the HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). Apoptosis is a mechanism of defense elicited by many triggers, including cross-linking of the FAS receptor expressed in viruses-infected cells, and the ligand FASL presented by T-cytotoxic cells. As HAM/TSP has been associated with high levels of proviral load (PVL), we hypothesized that certain genotypes of single-nucleotide polymorphisms (SNPs) associated with a decreased protein expression of FAS and FASL could be risk factors for this disease. Three SNPs: FAS-670A/G (rs1800682), FAS-1377G/A (rs2234767), and FASL-844C/T (rs763110) were analyzed in 73 HAM/TSP patients and 143 HTLV-1 asymptomatic carriers. Ancestry informative markers were used to adjust for ethnicity through a principal component analysis. Gender, age, PVL, and the first three principal components were used as covariates. The FAS/FASL genotype distribution was not associated with HAM/TSP presence (P-> 0.05). The FAS-670 AA genotype was associated with high PVL in comparison to FAS-670 GG in HAM/TSP patients (P = 0.015), while in asymptomatic carriers low levels of PVL were observed (P > 0.05). Our findings suggest that rs1800682, rs2234767, and rs763110 genotypes are not associated with the presence of HAM/TSP, but that the FAS-670 AA genotype can promote higher PVL values in HAM/TSP patients. J. Med. Virol. 89:726-731, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  4. What is HD - Huntington's Disease?

    Science.gov (United States)

    ... END TO HD? WHERE TO FIND HELP PUBLICATIONS Huntington’s disease (HD) is a fatal genetic disorder that causes the progressive breakdown of nerve ... personal and there is no "right" answer. The Huntington's Disease Society of ... who are considering genetic testing do so at a genetic testing center ...

  5. Stages of Huntington's Disease (HD)

    Science.gov (United States)

    ... END TO HD? WHERE TO FIND HELP PUBLICATIONS Huntington’s disease (HD) is a fatal genetic disorder that causes the progressive breakdown of nerve ... personal and there is no "right" answer. The Huntington's Disease Society of ... who are considering genetic testing do so at a genetic testing center ...

  6. Effects of Biologic Agents in Patients with Rheumatoid Arthritis and Amyloidosis Treated with Hemodialysis

    Science.gov (United States)

    Kuroda, Takeshi; Tanabe, Naohito; Nozawa, Yukiko; Sato, Hiroe; Nakatsue, Takeshi; Kobayashi, Daisuke; Wada, Yoko; Saeki, Takako; Nakano, Masaaki; Narita, Ichiei

    2016-01-01

    Objective Our objective was to examine the safety and effects of therapy with biologics on the prognosis of rheumatoid arthritis (RA) patients with reactive amyloid A (AA) amyloidosis on hemodialysis (HD). Methods Twenty-eight patients with an established diagnosis of reactive AA amyloidosis participated in the study. The survival was calculated from the date of HD initiation until the time of death, or up to end of June 2015 for the patients who were still alive. HD initiation was according to the program of HD initiation for systemic amyloidosis patients associated with RA. Results Ten patients had been treated with biologics before HD initiation for a mean of 28.2 months (biologic group), while 18 had not (non-biologic group). HD was initiated in patients with similar characteristics except for the tender joint count, swollen joint count, and disease activity score (DAS)28-C-reactive protein (CRP). History of biologics showed that etanercept was frequently used for 8 patients as the first biologic. There was no significant difference in the mortality rate according to a Kaplan-Meier analysis (p=0.939) and or associated risk of death in an age-adjusted Cox proportional hazards model (p=0.758) between both groups. Infections were significantly more frequent causes of death in the biologic group than in the non-biologic group (p=0.021). However, treatment with biologics improved the DAS28-CRP score (p=0.004). Conclusion Under the limited conditions of AA amyloidosis treated with HD, the use of biologics might affect infection and thus may not improve the prognosis. Strict infection control is necessary for the use of biologics with HD to improve the prognosis. PMID:27725536

  7. Obesity is a significant susceptibility factor for idiopathic AA amyloidosis.

    Science.gov (United States)

    Blank, Norbert; Hegenbart, Ute; Dietrich, Sascha; Brune, Maik; Beimler, Jörg; Röcken, Christoph; Müller-Tidow, Carsten; Lorenz, Hanns-Martin; Schönland, Stefan O

    2018-01-24

    To investigate obesity as susceptibility factor in patients with idiopathic AA amyloidosis. Clinical, biochemical and genetic data were obtained from 146 patients with AA amyloidosis. Control groups comprised 40 patients with long-standing inflammatory diseases without AA amyloidosis and 56 controls without any inflammatory disease. Patients with AA amyloidosis had either familial Mediterranean fever (FMF) or long-standing rheumatic diseases as underlying inflammatory disease (n = 111, median age 46 years). However, in a significant proportion of patients with AA amyloidosis no primary disease was identified (idiopathic AA; n = 37, median age 60 years). Patients with idiopathic AA amyloidosis were more obese and older than patients with AA amyloidosis secondary to FMF or rheumatic diseases. Serum leptin levels correlated with the body mass index (BMI) in all types of AA amyloidosis. Elevated leptin levels of more than 30 µg/l were detected in 18% of FMF/rheumatic + AA amyloidosis and in 40% of patients with idiopathic AA amyloidosis (p = .018). Finally, the SAA1 polymorphism was confirmed as a susceptibility factor for AA amyloidosis irrespective of the type of the disease. Obesity, age and the SAA1 polymorphism are susceptibility factors for idiopathic AA amyloidosis. Recent advances in treatment of FMF and rheumatic disorders will decrease the incidence of AA amyloidosis due to these diseases. Idiopathic AA, however, might be an emerging problem in the ageing and increasingly obese population.

  8. Chemical analysis of three barium stars: HD 51959, HD 88035, HD 121447

    Science.gov (United States)

    Karinkuzhi, Drisya; Goswami, Aruna; Sridhar, Navin; Masseron, Thomas; Purandardas, Meenakshi

    2018-02-01

    We present elemental abundance results from high resolution spectral analysis of three nitrogen-enhanced barium stars. The analysis is based on spectra obtained with the FEROS attached to 1.52m telescope at ESO, Chile. The spectral resolution is R˜48000 and the spectral coverage spans from 3500-9000Å . For the objects HD51959 and HD88035, we present the first time abundance analyses results. Although a few studies are available in literature on the object HD121447, the results are significantly different from each other. We have therefore carried out a detailed chemical composition study for this object based on a high resolution spectrum with high S/N ratio, for a better understanding of the origin of the abundance patterns observed in this star. Stellar atmospheric parameters, the effective temperature, surface gravity, microturbulence and metallicity of the stars are determined from the LTE analysis using model atmospheres. The metallicity of HD51959 and HD88035 are found to be near-solar; they exhibit enhanced abundances of neutron-capture elements. HD121447 is found to be moderately metal-poor with [Fe/H]=-0.65. While carbon is near-solar in the other two objects, HD121447 shows carbon enhancement at a level, [C/Fe]=0.82. Neutron-capture elements are highly enhanced with [X/Fe]>2 (X: Ba, La, Pr, Nd, Sm) in this object. The α- and iron-peak elements show abundances very similar to field giants with the same metallicity. From kinematic analysis all the three objects are found to be members of thin disk population with a high probability of 0.99, 0.99 and 0.92 for HD51959, HD88035 and HD121447 respectively.

  9. Chemical analysis of three barium stars: HD 51959, HD 88035, and HD 121447

    Science.gov (United States)

    Karinkuzhi, Drisya; Goswami, Aruna; Sridhar, Navin; Masseron, Thomas; Purandardas, Meenakshi

    2018-05-01

    We present elemental abundance results from high-resolution spectral analysis of three nitrogen-enhanced barium stars. The analysis is based on spectra obtained with the fibre-fed extended range optical spectrograph attached to 1.52 m telescope at European Southern Observatory, Chile. The spectral resolution is R ˜ 48,000 and the spectral coverage spans from 3500 to 9000Å . For the objects HD 51959 and HD 88035, we present the first-time abundance analyses results. Although a few studies are available in literature on the object HD 121447, the results are significantly different from each other. We have therefore carried out a detailed chemical composition study for this object based on a high-resolution spectrum with high S/N ratio, for a better understanding of the origin of the abundance patterns observed in this star. Stellar atmospheric parameters, the effective temperature, surface gravity, microturbulence, and metallicity of the stars are determined from the local thermodynamic equilibrium analysis using model atmospheres. The metallicities of HD 51959 and HD 88035 are found to be near-solar; they exhibit enhanced abundances of neutron-capture elements. HD 121447 is found to be moderately metal-poor with [Fe/H] = -0.65. While carbon is near-solar in the other two objects, HD 121447 shows carbon enhancement at a level, [C/Fe] = 0.82. Neutron-capture elements are highly enhanced with [X/Fe] > 2 (X: Ba, La, Pr, Nd, Sm) in this object. The α- and iron-peak elements show abundances very similar to field giants with the same metallicity. From kinematic analysis all the three objects are found to be members of thin disc population with a high probability of 0.99, 0.99, and 0.92 for HD 51959, HD 88035, and HD 121447, respectively.

  10. Oral protein supplementation alone improves anabolism in a dose-dependent manner in chronic hemodialysis patients.

    Science.gov (United States)

    Sundell, Mary B; Cavanaugh, Kerri L; Wu, Pingsheng; Shintani, Ayumi; Hakim, Raymond M; Ikizler, T Alp

    2009-09-01

    We examined the protein anabolic effects of Pro-Stat 64, a high nitrogen-containing, enzyme-hydrolyzed, tryptophan-fortified, collagen protein supplement administrated during hemodialysis, at two different dosing regimens. This was a randomized, controlled, prospective study with 3 different groups: control, single dose of supplementation, and double dose of supplementation. This study was performed at a clinical research center. Six prevalent chronic hemodialysis (HD) patients were enrolled: 5 males, 1 female, 4 African Americans, and 2 Caucasians. Their mean age was 45 +/- 11 years (S.D.). Two patients were diabetic. Protein turnover studies were performed using amino-acid (AA) balance and primed constant infusion of L-(1-(13)C) leucine. Whole-body protein balance was determined according to substrate kinetics. There were no statistically significant difference at any time point between protocols for blood chemistries and hormonal markers, except for minor variations in plasma glucose. All plasma AA groups displayed decreases during a control study, in which no supplementation was given. Compared with the control group, plasma nonessential AA and total AA concentrations were statistically significantly higher during HD after both single and double doses of supplementation. The forearm arteriovenous AA balance was statistically significantly better for essential, nonessential, and total AA uptake after both single-dose and double-dose supplementation compared with the control group, except for nonessential AA, which was significantly better only after a double dose. Whole-body protein breakdown and net protein balance were statistically significantly better during HD with a double-dose administration in a dose-dependent manner, compared with the control and single-dose groups. Oral AA supplementation alone improves whole-body and skeletal muscle protein anabolism in a dose-dependent manner in chronic HD patients. These data should be taken into account during

  11. [High frequency of dyslipidemia in VIH-infected patients in aa peruvian public hospital].

    Science.gov (United States)

    Rondan, Paola L; Flores-Flores, Oscar; Doria, Nicole A; Valencia-Mesias, Gustavo; Chávez-Pérez, Víctor; Soria, Jaime

    2017-01-01

    The objective of the study was to determine the frequency and characteristics of dyslipidemia in patients with HIV in highly active antiretroviral therapy (HAART) in a Peruvian public hospital. A cross-sectional study was carried out in patients with complete lipid profile after receiving at least six months of HAART. Dyslipidemia was defined according to the criteria of the NCEP-ATP III. We reviewed 2 975 clinical histories, and included 538 (18.1%) in the analysis. The frequency of dyslipidemia was 74.7%. HAART regimens which include protease inhibitors (PI) (odds ratio [OR]: 1.22; confidence interval at 95% [CI 95%]: 1.11-1.33) and to be older than 40 years (OR: 1.17; CI 95%: 1.05-1.28) were associated with dyslipidemia, adjusted by viral load, CD4 lymphocyte level and gender. In conclusion, dyslipidemia was very common in our sample and was mainly associated with the use of PI. It is necessary to promote the dyslipidemia control as part of the comprehensive care of the patient with HIV.

  12. Updated interim efficacy analysis and long-term safety of abiraterone acetate in metastatic castration-resistant prostate cancer patients without prior chemotherapy (COU-AA-302).

    Science.gov (United States)

    Rathkopf, Dana E; Smith, Matthew R; de Bono, Johann S; Logothetis, Christopher J; Shore, Neal D; de Souza, Paul; Fizazi, Karim; Mulders, Peter F A; Mainwaring, Paul; Hainsworth, John D; Beer, Tomasz M; North, Scott; Fradet, Yves; Van Poppel, Hendrik; Carles, Joan; Flaig, Thomas W; Efstathiou, Eleni; Yu, Evan Y; Higano, Celestia S; Taplin, Mary-Ellen; Griffin, Thomas W; Todd, Mary B; Yu, Margaret K; Park, Youn C; Kheoh, Thian; Small, Eric J; Scher, Howard I; Molina, Arturo; Ryan, Charles J; Saad, Fred

    2014-11-01

    Abiraterone acetate (an androgen biosynthesis inhibitor) plus prednisone is approved for treating patients with metastatic castration-resistant prostate cancer (mCRPC). Study COU-AA-302 evaluated abiraterone acetate plus prednisone versus prednisone alone in mildly symptomatic or asymptomatic patients with progressive mCRPC without prior chemotherapy. Report the prespecified third interim analysis (IA) of efficacy and safety outcomes in study COU-AA-302. Study COU-AA-302, a double-blind placebo-controlled study, enrolled patients with mCRPC from April 2009 to June 2010. A total of 1088 patients were stratified by Eastern Cooperative Oncology Group performance status (0 vs 1). Patients were randomised 1:1 to abiraterone 1000mg plus prednisone 5mg twice daily by mouth versus prednisone. Co-primary end points were radiographic progression-free survival (rPFS) and overall survival (OS). Median times to event outcomes were estimated using the Kaplan-Meier method. Hazard ratios (HRs) and 95% confidence intervals (CIs) were derived using the Cox model, and treatment comparison used the log-rank test. The O'Brien-Fleming Lan-DeMets α-spending function was used for OS. Adverse events were summarised descriptively. With a median follow-up duration of 27.1 mo, improvement in rPFS was statistically significant with abiraterone treatment versus prednisone (median: 16.5 vs 8.2 mo; HR: 0.52 [95% CI, 0.45-0.61]; ppatient-reported outcomes improved. While the post hoc nature of the long-term safety analysis is a limitation, the safety profile with longer treatment exposure was consistent with prior reports. The updated IA of study COU-AA-302 in patients with mCRPC without prior chemotherapy confirms that abiraterone delays disease progression, pain, and functional deterioration and has clinical benefit with a favourable safety profile, including in patients treated for ≥24 mo. Study COU-AA-302, ClinicalTrials.gov number, NCT00887198. The updated results of this ongoing study

  13. The massive multiple system HD 64315

    Science.gov (United States)

    Lorenzo, J.; Simón-Díaz, S.; Negueruela, I.; Vilardell, F.; Garcia, M.; Evans, C. J.; Montes, D.

    2017-10-01

    Context. The O6 Vn star HD 64315 is believed to belong to the star-forming region known as NGC 2467, but previous distance estimates do not support this association. Moreover, it has been identified as a spectroscopic binary, but existing data support contradictory values for its orbital period. Aims: We explore the multiple nature of this star with the aim of determining its distance, and understanding its connection to NGC 2467. Methods: A total of 52 high-resolution spectra have been gathered over a decade. We use their analysis, in combination with the photometric data from All Sky Automated Survey and Hipparcos catalogues, to conclude that HD 64315 is composed of at least two spectroscopic binaries, one of which is an eclipsing binary. We have developed our own program to fit four components to the combined line shapes. Once the four radial velocities were derived, we obtained a model to fit the radial-velocity curves using the Spectroscopic Binary Orbit Program (SBOP). We then implemented the radial velocities of the eclipsing binary and the light curves in the Wilson-Devinney code iteratively to derive stellar parameters for its components. We were also able to analyse the non-eclipsing binary, and to derive minimum masses for its components which dominate the system flux. Results: HD 64315 contains two binary systems, one of which is an eclipsing binary. The two binaries are separated by 0.09 arcsec (or 500 AU) if the most likely distance to the system, 5 kpc, is considered. The presence of fainter companions is not excluded by current observations. The non-eclipsing binary (HD 64315 AaAb) has a period of 2.70962901 ± 0.00000021 d. Its components are hotter than those of the eclipsing binary, and dominate the appearance of the system. The eclipsing binary (HD 64315 BaBb) has a shorter period of 1.0189569 ± 0.0000008 d. We derive masses of 14.6 ± 2.3 M⊙ for both components of the BaBb system. They are almost identical; both stars are overfilling their

  14. Solubilization, Activation, and Insecticidal Activity of Bacillus thuringiensis Serovar thompsoni HD542 Crystal Proteins

    NARCIS (Netherlands)

    Naimov, S.; Boncheva, R.; Karlova, R.B.; Dukiandjiev, S.; Minkov, I.; Maagd, de R.A.

    2008-01-01

    Cry15Aa protein, produced by Bacillus thuringiensis serovar thompsoni HD542 in a crystal together with a 40 kDa accompanying protein is one of a small group of non-typical, less well-studied members of the Cry family of insecticidal proteins, and may provide an alternative for the more commonly used

  15. AAS 227: Day 3

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    many orbits has made it a powerhouse for learning about the temperatures, atmospheres, and orbits of exoplanets. The list of examples that Fazio provided included the first global temperature map of an exoplanet (HD 189733b), the detection of the closest transiting exoplanet (HD 219134b), and the measurement of thermal emission from a super-Earth (55 Cnc e). Spitzers large distance from the Earth (specifically, the ground-based telescopes on Earth) even allowed astronomers to observe an exoplanet via gravitational microlensing using a special technique called space-based parallax.Spitzer has also been extremely useful for observing everything from Solar System scales (such as the enormous infrared dust ring around Saturn) to galactic structures. Comparing images of galaxies observed at visible wavelengths with Spitzer images of the same galaxies at infrared wavelengths has allowed us to probe the structure and composition of galaxies at a new level.Astronomers have also used Spitzer to explore the evolution of stars. Thanks to its infrared detectors, Spitzer can look through large clouds of dust that are opaque at visible wavelengths, and observe young stellar objects in their birth environments. Cosmologists can use Spitzer to study the early universe and the formation of galaxies over twelve billion years ago. Fazio used all of these examples and more to demonstrate that Spitzer has truly changed our understanding of the universe.Climate Change for Astronomers (Meredith Rawls)Every astronomer at #aas227 wants to learn about climate change! WOW this room is ridiculously full. pic.twitter.com/ud9an0gLJG Meredith Rawls (@merrdiff) January 7, 2016The second half of the session was a presentation by Doug Duncan featuring an activity from his 101-level college course. He uses climate change as a way to teach critical thinking and scientific reasoning. Members of the audience were walked through an exercise that included interpreting plots of changing surface temperatures

  16. Serum concentration of immunoglobulin G-type antibodies against the whole Epstein-Barr nuclear antigen 1 and its aa35-58 or aa398-404 fragments in the sera of patients with systemic lupus erythematosus and multiple sclerosis.

    Science.gov (United States)

    Csuka, D; Simon, D; Hóbor, R; Uray, K; Prohászka, Z; Bánlaki, Z; Jani, P K; Szilágyi, Á; Hudecz, F; Rajczy, K; Beke, G; Boros Major, A; Tordai, A; Illés, Z; Berki, T; Czirják, L; Füst, G

    2013-03-01

    Several studies suggest that infection by Epstein-Barr virus (EBV) might be one of the environmental factors which facilitates the development of autoimmune disorders in genetically susceptible individuals. Recent data indicate that high anti-Epstein-Barr nuclear antigen 1 (EBNA)-1 immunoglobulin (Ig)G titre is a strong risk factor for multiple sclerosis (MS) in patients both with and without the main genetic predisposing trait, human leucocyte antigen (HLA)-DRB1*15:01. Because no similar studies have been published in systemic lupus erythematosus (SLE) patients, we determined the HLA-DRB1*15:01 carrier state and the serum titres against the whole EBNA-1 and its small fragments aa35-58 and aa398-404 in 301 SLE patients, 135 MS patients and in 345 healthy controls. The carrier state of the HLA-DRB1*15:01 allele was deduced from genotyping of a tagSNP (rs3135388) by applying a Taqman-based assay. The serum concentrations of antibodies to EBNA-1 and its aa35-58 or aa398-404 fragments were determined using a commercial assay (ETI-EBNA-G) and home-made enzyme-linked immunosorbent assays, respectively. The serum concentration of anti-EBNA-1 antibodies was significantly (P HLA-DRB1*15:01 carriers and non-carriers. Furthermore, titres of antibodies against the aa35-58 EBNA-1 fragment were elevated both in MS and SLE patients. By contrast, the levels of aa398-404 EBNA-1 antibodies were elevated significantly only in the SLE patients. These findings indicate that high anti-EBNA-1 IgG titres are HLA-DRB1*15:01-independent risk factors not only for MS, but also for SLE, while high antibody titres against the aa398-404 fragment are characteristic for SLE. © 2012 British Society for Immunology.

  17. Development of a disease-specific quality of life questionnaire for patients with aplastic anemia and/or paroxysmal nocturnal hemoglobinuria (QLQ-AA/PNH)-report on phases I and II.

    Science.gov (United States)

    Groth, Martha; Singer, Susanne; Niedeggen, Cathrin; Petermann-Meyer, Andrea; Röth, Alexander; Schrezenmeier, Hubert; Höchsmann, Britta; Brümmendorf, Tim H; Panse, Jens

    2017-02-01

    Acquired aplastic anemia (AA) and paroxysmal nocturnal hemoglobinuria (PNH) are interrelated ultra-rare diseases. Quality of life (QoL) evaluation tools used in studies for AA and PNH are unspecific and designed for cancer patients (e.g., the European Organization for Research and Treatment of Cancer Quality of Life Questionnaire, EORTC QLQ-C30). Given the complexity of AA and PNH, variation in symptoms and treatments, younger age of many patients, and the fact that AA and PNH are not classified as malignant diseases, it is likely that cancer-specific questionnaires are inappropriate. We generate an AA/PNH-specific QoL questionnaire (QLQ-AA/PNH), performed according to EORTC guidelines. QoL issues were obtained from the literature and interviews with patients and physicians (phase I), then ranked by patients and physicians. In phase II, items were created. Patients in more than 25 German and Swiss cities were interviewed face to face. In phase I, interviews of 19 patients and 8 physicians specialized in AA/PNH treatment resulted in 649 QoL issues; these were condensed to 175 and graded according to their importance by 30 patients and 14 physicians (phase II). Five physicians took part in phases I and II. Altogether, 97 issues were rated important. Twelve EORTC QLQ-C30 items were not rated important, while several new QoL aspects were brought up. Modifications in wording and phrasing led to two questionnaires with 77 items regarding general QoL aspects and 20 items regarding medical care. Important QoL aspects of PNH/AA patients are inappropriately captured with available QoL tools. Developing a new QoL questionnaire specific for this patient group is warranted.

  18. A Concept Map of What Helps People with HD Live with their Condition.

    Science.gov (United States)

    Smith, Steve; D'Cruz, Gibson; Gray, Richard; Flaherty, Helen; Ivanecka, Ada; Deane, Katherine H O

    2015-01-01

    The complex effects of Huntington's disease (HD) negatively impact on every area of independent living. The perspectives of people impacted by HD on how to best manage the disease are not clearly understood. To identify what is most helpful for living with HD from the perspectives of people with HD, family caregivers and health professionals. A cross-sectional, mixed methods concept mapping methodology was used. Participants generated statements during brainstorming in response to the question 'what helps people with HD live with their condition'. Participants then prioritised statements for importance and they grouped together statements that were related into clusters. Concept mapping software ('Ariadne' ®) used multi-dimensional scaling and hierarchical cluster analysis to produce a conceptual framework of participants views about what is helpful for people living with HD. Thirty nine people at various stages of HD disease progression, 48 family caregivers and 39 health professionals with experience of HD care (n = 126) participated. The most helpful factors for living with HD were identified as access to expert assessment and treatment for co-morbid mental health problems, integrated specialist multi-disciplinary HD expertise, and the provision of flexible care. HD requires specialist, expert, multidisciplinary care teams to manage it well. Specialists need to focus on the mental health aspects, and the provision must be flexible and responsive to current needs. Patients may have impaired insight into their abilities (e.g. driving) or the need for interventions, so carers' opinions should also be respected.

  19. Detection of AA76, a Common Form of Amyloid A Protein, as a Way of Diagnosing AA Amyloidosis.

    Science.gov (United States)

    Sato, Junji; Okuda, Yasuaki; Kuroda, Takeshi; Yamada, Toshiyuki

    2016-01-01

    Reactive amyloid deposits consist of amyloid A (AA) proteins, the degradation products of serum amyloid A (SAA). Since the most common species of AA is the amino terminal portion produced by cleavage between residues 76 and 77 of SAA (AA76), the presence of AA76 in tissues could be a consequence of AA amyloid deposition. This study assessed the diagnostic significance of the detection of AA76 for AA amyloidosis using two different approaches. Biopsy specimens (n=130 from 54 subjects) from gastroduodenal mucosa or abdominal fat (n=9 from 9 subjects) of patients who had already been diagnosed with or were suspected of having AA amyloidosis were used. Fixed mucosal sections were subjected to immunohistochemistry using a newly developed antibody recognizing the carboxyl terminal end of AA76 (anti-AA76). The non-fixed materials from gastroduodenal mucosa or abdominal fat were subjected to immunoblotting for detection of the size of AA76. Among the gastroduodenal specimens (n=115) from already diagnosed patients, the positive rates of Congo red staining, immunohistochemistry using anti-AA76, and immunoblotting were 68.4%, 73.0%, and 92.2%, respectively. The anti-AA76 did not stain the supposed SAA in the blood or leakage, which was stained by anti-SAA antibody. AA76 was not detected either by immunohistochemistry or by immunoblot in the materials from patients in whom AA amyloidosis had been ruled out. In the abdominal fat, the immunoblot detected AA76 in 8 materials from 8 already diagnosed patients and did not in 1 patient whose gastroduodenal mucosa was negative. In conclusion, the detection of AA76 may alter the ability to diagnose AA amyloidosis. In immunohistochemistry for fixed specimens, the new anti-AA76 antibody can improve the specificity. Immunoblot for non-fixed materials, which can considerably improve the sensitivity, should be beneficial for small materials like abdominal fat. © 2016 by the Association of Clinical Scientists, Inc.

  20. VizieR Online Data Catalog: HD17674, HD29021, and HD42012 radial velocities (Rey+, 2017)

    Science.gov (United States)

    Rey, J.; Hebrard, G.; Bouchy, F.; Bourrier, V.; Boisse, I.; Santos, N. C.; Arnold, L.; Astudillo-Defru, N.; Bonfils, X.; Borgniet, S.; Courcol, B.; Deleuil, M.; Delfosse, X.; Demangeon, O.; Diaz, R. F.; Ehrenreich, D.; Forveille, T.; Marmier, M.; Moutou, C.; Pepe, F.; Santerne, A.; Sahlmann, J.; Segransan, D.; Udry, S.; Wilson, P. A.

    2017-04-01

    HD17674, HD29021 and HD42012 were observed with the ELODIE and SOPHIE spectrographs mounted on the 193cm telescope of Haute Provence Observatory, in the south of France. Data include the epoch of observation, radial velocities, uncertainties on the radial velocities and the corresponding spectrograph used for the observations. Data were acquired in 101, 66 and 32 epochs spread over 18, 4 and 8 years for HD17674, HD29021 and HD42012 respectively. Tables 5, 6, and 7 list all RVs in the barycentric reference frame of the Solar System. (3 data files).

  1. Detection of planet candidates around K giants. HD 40956, HD 111591, and HD 113996

    Science.gov (United States)

    Jeong, G.; Lee, B.-C.; Han, I.; Omiya, M.; Izumiura, H.; Sato, B.; Harakawa, H.; Kambe, E.; Mkrtichian, D.

    2018-02-01

    Aims: The purpose of this paper is to detect and investigate the nature of long-term radial velocity (RV) variations of K-type giants and to confirm planetary companions around the stars. Methods: We have conducted two planet search programs by precise RV measurement using the 1.8 m telescope at Bohyunsan Optical Astronomy Observatory (BOAO) and the 1.88 m telescope at Okayama Astrophysical Observatory (OAO). The BOAO program searches for planets around 55 early K giants. The OAO program is looking for 190 G-K type giants. Results: In this paper, we report the detection of long-period RV variations of three K giant stars, HD 40956, HD 111591, and HD 113996. We investigated the cause of the observed RV variations and conclude the substellar companions are most likely the cause of the RV variations. The orbital analyses yield P = 578.6 ± 3.3 d, m sin i = 2.7 ± 0.6 MJ, a = 1.4 ± 0.1 AU for HD 40956; P = 1056.4 ± 14.3 d, m sin i = 4.4 ± 0.4 MJ, a = 2.5 ± 0.1 AU for HD 111591; P = 610.2 ± 3.8 d, m sin i = 6.3 ± 1.0 MJ, a = 1.6 ± 0.1 AU for HD 113996. Based on observations made with the BOES at BOAO in Korea and HIDES at OAO in Japan.Tables 3-5 are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/610/A3

  2. Aa Ah Nak

    Science.gov (United States)

    Tha, Na Gya; Wus, Thay

    2017-01-01

    In this article, Aa Ah Nak, the authors' methodology presents not only various reflections but also diverse contradictions about the Aa Nii language as well as language revitalization. This article explores language foundation and how the Aa Nii language revitalization is inextricably linked to the genocide and resulting historic trauma pervasive…

  3. Stress-related salivary alpha-amylase (sAA) activity in alcohol dependent patients with and without a history of childhood maltreatment.

    Science.gov (United States)

    Muehlhan, Markus; Höcker, Anja; Höfler, Michael; Wiedemann, Klaus; Barnow, Sven; Schäfer, Ingo

    2017-06-01

    Alcohol-dependent (AD) patients with a history of childhood maltreatment (CM) have shown a more severe clinical profile and a higher risk of relapse than those without CM. It was hypothesized that stress responsivity plays an important role in moderating the relationship between CM and AD. Surprisingly, systematic investigations about the stress responsivity in AD patients with CM are rare. This study compared physiological and subjective stress responses in AD patients with and without CM as well as in healthy controls with and without CM. A total of 130 participants performed the Trier Social Stress Test (TSST). Physiological stress reactivity related to the noradrenergic system was assessed by salivary alpha-amylase (sAA) activity. Subjective ratings of anxiety, nervousness, distress, and mood were rated on visual analogue scales. AD patients showed significantly lower stress-related sAA activity than healthy controls (p ≤ 0.024; z ≥ 1.97). A different pattern was found in the subjective ratings. In particular, anticipatory anxiety revealed a clear effect of CM (p ≤ 0.005; z ≥ 2.43) but no difference between AD patients and healthy controls (p > 0.05). After the TSST, distress ratings differed between AD patients with CM and AD patients without CM (p ≤ 0.009; z ≥ 2.61). The discrepancy between physiological responsivity and subjective stress experiences may account for an increased inability to cope with stressful situations, which in turn might explain the enhanced risk of relapse in AD patients with a history of CM during early abstinence.

  4. Quality control of involved field radiotherapy in the HD 13 and HD 14 trials. Report of the radiotherapy panel of the German Hodgkin Study Group (GHSG)

    Energy Technology Data Exchange (ETDEWEB)

    Kriz, J.; Haverkamp, U.; Eich, H.T. [University of Muenster, Department of Radiation Oncology, Muenster (Germany); Baues, C. [University of Cologne, Department of Radiation Oncology, Cologne (Germany); Engenhart-Cabillic, R. [University of Marburg, Department of Radiation Oncology, Marburg (Germany); Herfarth, K. [University of Heidelberg, Department of Radiation Oncology, Heidelberg (Germany); Lukas, P. [University of Innsbruck, Department of Radiation Oncology, Innsbruck (Austria); Pluetschow, A.; Fuchs, M.; Engert, A. [University of Cologne, Department of Internal Medicine, Cologne (Germany); Schmidberger, H. [University of Mainz, Department of Radiation Oncology, Mainz (Germany); Staar, S. [Bremen Mitte, Department of Radiation Oncology, Bremen (Germany)

    2017-02-15

    As part of the foundation of the German Hodgkin Study Group (GHSG) in 1978, a central radiotherapy (RT) reference centre was established to evaluate and to improve the quality of treatment. During the study generations, the quality assurance programs (QAP) were continued and adapted to the demands of each study. The purpose of this article is to demonstrate the results of the fifth study generation and to compare them to the previous findings. With the start of the fourth GHSG study generation (HD10-12), a central prospective review of all diagnostic images was established to create an individual treatment plan for each early stage study patient. The quality of involved field RT was retrospectively evaluated by an expert panel of radiation oncologists. In the fifth study generation (HD13-15), the retrospective review of radiotherapy performed was refined and the results were compared with the findings of the fourth generation. The expert panel analyzed the RT planning and application of 1037 (28 %) patients (HD13 n = 465, HD14 n = 572). Simulation films were available in 85 % of cases and verification films in 87 %. RT was assessed as major violation in 46 % (HD13 = 38 %, HD14 = 52 %), minor violation in 9 % (HD13 = 9 %, HD14 = 9 %) and according to the protocol in 45 % (HD13 = 52 %, HD14 = 38 %). The value for QAP of RT within the GHSG trials is well known. Still there were several protocol violations. In the future, the QAP program has to be adapted to the requirements of ''modern RT'' in malignant lymphoma. (orig.) [German] Seit Gruendung der German Hodgkin Study Group (GHSG) im Jahr 1978 wurde ein zentrales Qualitaetssicherungsprogramm (QAP) der Radiotherapie (RT) etabliert, um die Qualitaet der RT sicherzustellen. Waehrend der fortlaufenden Studiengenerationen wurde dieses QAP kontinuierlich weiterentwickelt. In dieser Auswertung werden die Ergebnisse der fuenften Studiengeneration (HD13-15) praesentiert und mit frueheren Ergebnissen

  5. No planet for HD 166435

    OpenAIRE

    Queloz, D.; Henry, G. W.; Sivan, J. P.; Baliunas, S. L.; Beuzit, J. L.; Mayor, R. A. Donahue M.; Naef, D.; Perrier, C.; Udry, S.

    2001-01-01

    The G0V star HD166435 has been observed by the fiber-fed spectrograph ELODIE as one of the targets in the large extra-solar planet survey that we are conducting at the Observatory of Haute-Provence. We detected coherent, low-amplitude, radial-velocity variations with a period of 3.7987days, suggesting a possible close-in planetary companion. Subsequently, we initiated a series of high-precision photometric observations to search for possible planetary transits and an additional series of CaII...

  6. PHOTOELECTRIC OBSERVATIONS OF HD 8358

    Directory of Open Access Journals (Sweden)

    Woo-Baik Lee

    1989-06-01

    Full Text Available UBV photoelectric observations of RS CVn type variable star HD 8358 were made using the 61cm reflector at Sobaeksan Astronomical Observatory. The data were obtained on 15 nights from October 1987 to December 1988. Double peaks of maximum light is seen from the light curve and continuous change of phase in notified from the times of maximum lights. The colors of October, 1987 - January, 1988 observations are bluer in ∆(b-u, but redder in ∆(u-b, than those of November -December, 1988 observations.

  7. Accurate effective temperatures of the metal-poor benchmark stars HD 140283, HD 122563, and HD 103095 from CHARA interferometry

    Science.gov (United States)

    Karovicova, I.; White, T. R.; Nordlander, T.; Lind, K.; Casagrande, L.; Ireland, M. J.; Huber, D.; Creevey, O.; Mourard, D.; Schaefer, G. H.; Gilmore, G.; Chiavassa, A.; Wittkowski, M.; Jofré, P.; Heiter, U.; Thévenin, F.; Asplund, M.

    2018-03-01

    Large stellar surveys of the Milky Way require validation with reference to a set of `benchmark' stars whose fundamental properties are well determined. For metal-poor benchmark stars, disagreement between spectroscopic and interferometric effective temperatures has called the reliability of the temperature scale into question. We present new interferometric measurements of three metal-poor benchmark stars, HD 140283, HD 122563, and HD 103095, from which we determine their effective temperatures. The angular sizes of all the stars were determined from observations with the PAVO beam combiner at visible wavelengths at the CHARA array, with additional observations of HD 103095 made with the VEGA instrument, also at the CHARA array. Together with photometrically derived bolometric fluxes, the angular diameters give a direct measurement of the effective temperature. For HD 140283, we find θLD = 0.324 ± 0.005 mas, Teff = 5787 ± 48 K; for HD 122563, θLD = 0.926 ± 0.011 mas, Teff = 4636 ± 37 K; and for HD 103095, θLD = 0.595 ± 0.007 mas, Teff = 5140 ± 49 K. Our temperatures for HD 140283 and HD 103095 are hotter than the previous interferometric measurements by 253 and 322 K, respectively. We find good agreement between our temperatures and recent spectroscopic and photometric estimates. We conclude some previous interferometric measurements have been affected by systematic uncertainties larger than their quoted errors.

  8. Impact of bone-targeted therapies in chemotherapy-naïve metastatic castration-resistant prostate cancer patients treated with abiraterone acetate: post hoc analysis of study COU-AA-302.

    Science.gov (United States)

    Saad, Fred; Shore, Neal; Van Poppel, Hendrik; Rathkopf, Dana E; Smith, Matthew R; de Bono, Johann S; Logothetis, Christopher J; de Souza, Paul; Fizazi, Karim; Mulders, Peter F A; Mainwaring, Paul; Hainsworth, John D; Beer, Tomasz M; North, Scott; Fradet, Yves; Griffin, Thomas A; De Porre, Peter; Londhe, Anil; Kheoh, Thian; Small, Eric J; Scher, Howard I; Molina, Arturo; Ryan, Charles J

    2015-10-01

    Metastatic castration-resistant prostate cancer (mCRPC) often involves bone, and bone-targeted therapy (BTT) has become part of the overall treatment strategy. Investigation of outcomes for concomitant BTT in a post hoc analysis of the COU-AA-302 trial, which demonstrated an overall clinical benefit of abiraterone acetate (AA) plus prednisone over placebo plus prednisone in asymptomatic or mildly symptomatic chemotherapy-naïve mCRPC patients. This report describes the third interim analysis (prespecified at 55% overall survival [OS] events) for the COU-AA-302 trial. Patients were grouped by concomitant BTT use or no BTT use. Radiographic progression-free survival and OS were coprimary end points. This report describes the third interim analysis (prespecified at 55% OS events) and involves patients treated with or without concomitant BTT during the COU-AA-302 study. Median follow-up for OS was 27.1 mo. Median time-to-event variables with 95% confidence intervals (CIs) were estimated using the Kaplan-Meier method. Adjusted hazard ratios (HRs), 95% CIs, and p values for concomitant BTT versus no BTT were obtained via Cox models. While the post hoc nature of the analysis is a limitation, superiority of AA and prednisone versus prednisone alone was demonstrated for clinical outcomes with or without BTT use. Compared with no BTT use, concomitant BTT significantly improved OS (HR 0.75; p=0.01) and increased the time to ECOG deterioration (HR 0.75; pAA was similar to that reported for AA in the overall intent-to-treat population. Osteonecrosis of the jaw (all grade 1/2) with concomitant BTT use was reported in AA with concomitant BTT was safe and well tolerated in men with chemotherapy-naïve mCRPC. The benefits of AA on clinical outcomes were increased with concomitant BTT. Treatment of advanced prostate cancer often includes bone-targeted therapy. This post hoc analysis showed that in patients with advanced prostate cancer who were treated with abiraterone acetate and

  9. AA under construction

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    The AA at an early stage of construction, in the newly built AA-Hall. Cable-trays already outline the shape of the accumulator ring. To the right are huge cable-drums for the pulse-forming-network (PFN) of the injection kicker. Seeing this picture, can one imagine that only 8 months later beams were circulating in the completed accumulator ring ?

  10. Bortezomib Induction and Maintenance Treatment in Patients With Newly Diagnosed Multiple Myeloma: Results of the Randomized Phase III HOVON-65/GMMG-HD4 Trial

    NARCIS (Netherlands)

    Sonneveld, Pieter; Schmidt-Wolf, Ingo G. H.; van der Holt, Bronno; el Jarari, Laila; Bertsch, Uta; Salwender, Hans; Zweegman, Sonja; Vellenga, Edo; Broyl, Annemiek; Blau, Igor W.; Weisel, Katja C.; Wittebol, Shulamiet; Bos, Gerard M. J.; Stevens-Kroef, Marian; Scheid, Christof; Pfreundschuh, Michael; Hose, Dirk; Jauch, Anna; van der Velde, Helgi; Raymakers, Reinier; Schaafsma, Martijn R.; Kersten, Marie-Jose; van Marwijk-Kooy, Marinus; Duehrsen, Ulrich; Lindemann, Walter; Wijermans, Pierre W.; Lokhorst, Henk M.; Goldschmidt, Hartmut M.

    2012-01-01

    Purpose We investigated whether bortezomib during induction and maintenance improves survival in newly diagnosed multiple myeloma (MM). Patients and Methods In all, 827 eligible patients with newly diagnosed symptomatic MM were randomly assigned to receive induction therapy with vincristine,

  11. Bortezomib Induction and Maintenance Treatment in Patients With Newly Diagnosed Multiple Myeloma : Results of the Randomized Phase III HOVON-65/GMMG-HD4 Trial

    NARCIS (Netherlands)

    Sonneveld, Pieter; Schmidt-Wolf, Ingo G. H.; van der Holt, Bronno; el Jarari, Laila; Bertsch, Uta; Salwender, Hans; Zweegman, Sonja; Vellenga, Edo; Broyl, Annemiek; Blau, Igor W.; Weisel, Katja C.; Wittebol, Shulamiet; Bos, Gerard M. J.; Stevens-Kroef, Marian; Scheid, Christof; Pfreundschuh, Michael; Hose, Dirk; Jauch, Anna; van der Velde, Helgi; Raymakers, Reinier; Schaafsma, Martijn R.; Kersten, Marie-Jose; van Marwijk-Kooy, Marinus; Duehrsen, Ulrich; Lindemann, Walter; Wijermans, Pierre W.; Lokhorst, Henk M.; Goldschmidt, Hartmut M.

    2012-01-01

    Purpose We investigated whether bortezomib during induction and maintenance improves survival in newly diagnosed multiple myeloma (MM). Patients and Methods In all, 827 eligible patients with newly diagnosed symptomatic MM were randomly assigned to receive induction therapy with vincristine,

  12. HD 101065, the Most Peculiar Star

    Indian Academy of Sciences (India)

    2016-01-27

    Jan 27, 2016 ... In this paper we discuss the prospects for asteroseismology with spatial resolution and motivate studies of the most chemically peculiar roAp star HD 101065. We present the first results from a high-precision radial velocity (RV) study of HD 101065 based on data spanning four nights that were acquired ...

  13. Carboxy-terminal extension effects on crystal formation and insecticidal properties of Cry15Aa

    NARCIS (Netherlands)

    Naimov, S.; Valkova, R.; Dukjandiev, S.; Minkov, J.; Maagd, de R.A.

    2011-01-01

    Cry15Aa protein, produced by Bacillus thuringiensis serovar thompsoni HD542, in a crystal together with a 40 kDa accompanying protein, is one of a small group of non-typical, less well-studied members of the Cry family of insecticidal proteins, and may provide an alternative for the more commonly

  14. Huntington's disease (HD): the neuropathology of a multisystem neurodegenerative disorder of the human brain.

    Science.gov (United States)

    Rüb, U; Seidel, K; Heinsen, H; Vonsattel, J P; den Dunnen, W F; Korf, H W

    2016-11-01

    Huntington's disease (HD) is an autosomal dominantly inherited, and currently untreatable, neuropsychiatric disorder. This progressive and ultimately fatal disease is named after the American physician George Huntington and according to the underlying molecular biological mechanisms is assigned to the human polyglutamine or CAG-repeat diseases. In the present article we give an overview of the currently known neurodegenerative hallmarks of the brains of HD patients. Subsequent to recent pathoanatomical studies the prevailing reductionistic concept of HD as a human neurodegenerative disease, which is primarily and more or less exclusively confined to the striatum (ie, caudate nucleus and putamen) has been abandoned. Many recent studies have improved our neuropathological knowledge of HD; many of the early groundbreaking findings of neuropathological HD research have been rediscovered and confirmed. The results of this investigation have led to the stepwise revision of the simplified pathoanatomical and pathophysiological HD concept and culminated in the implementation of the current concept of HD as a multisystem degenerative disease of the human brain. The multisystem character of the neuropathology of HD is emphasized by a brain distribution pattern of neurodegeneration (i) which apart from the striatum includes the cerebral neo-and allocortex, thalamus, pallidum, brainstem and cerebellum, and which (ii) therefore, shares more similarities with polyglutamine spinocerebellar ataxias than previously thought. © 2016 International Society of Neuropathology.

  15. Polarized Disk Emission from Herbig Ae/Be Stars Observed Using Gemini Planet Imager: HD 144432, HD 150193, HD 163296, and HD 169142

    Energy Technology Data Exchange (ETDEWEB)

    Monnier, John D.; Aarnio, Alicia; Adams, Fred C.; Calvet, Nuria; Hartmann, Lee [Astronomy Department, University of Michigan, Ann Arbor, MI 48109 (United States); Harries, Tim J.; Hinkley, Sasha; Kraus, Stefan [University of Exeter, Exeter (United Kingdom); Andrews, Sean; Wilner, David [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 91023 (United States); Espaillat, Catherine [Boston University, Boston, MA (United States); McClure, Melissa [European Southern Observatory, Garching (Germany); Oppenheimer, Rebecca [American Museum of Natural History, New York (United States); Perrin, Marshall [Space Telescope Science Institute, Baltimore, MD (United States)

    2017-03-20

    In order to look for signs of ongoing planet formation in young disks, we carried out the first J -band polarized emission imaging of the Herbig Ae/Be stars HD 150193, HD 163296, and HD 169142 using the Gemini Planet Imager, along with new H band observations of HD 144432. We confirm the complex “double ring” structure for the nearly face-on system HD 169142 first seen in H -band, finding the outer ring to be substantially redder than the inner one in polarized intensity. Using radiative transfer modeling, we developed a physical model that explains the full spectral energy distribution and J - and H -band surface brightness profiles, suggesting that the differential color of the two rings could come from reddened starlight traversing the inner wall and may not require differences in grain properties. In addition, we clearly detect an elongated, off-center ring in HD 163296 (MWC 275), locating the scattering surface to be 18 au above the midplane at a radial distance of 77 au, co-spatial with a ring seen at 1.3 mm by ALMA linked to the CO snow line. Lastly, we report a weak tentative detection of scattered light for HD 150193 (MWC 863) and a non-detection for HD 144432; the stellar companion known for each of these targets has likely disrupted the material in the outer disk of the primary star. For HD 163296 and HD 169142, the prominent outer rings we detect could be evidence for giant planet formation in the outer disk or a manifestation of large-scale dust growth processes possibly related to snow-line chemistry.

  16. Geomagnetic aa Indices

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa indices are the continuation of the series beginning in the year 1868. A full description of these indices is given in the International...

  17. Infrared absorption spectra of gaseous HD. II. Collision-induced fundamental band of HD in HD--Ne and HD--Ar mixtures at room temperature

    International Nuclear Information System (INIS)

    Prasad, R.D.G.; Reddy, S.P.

    1976-01-01

    The collision-induced infrared absorption spectra of the fundamental band of HD in binary mixtures of HD with Ne and Ar at room temperature have been studied with an absorption path length of 105.2 cm for different base densities of HD in the range 8--20 amagat and a number of total gas densities up to 175 amagat. The observed features of the profiles of the enhancement of absorption in these mixtures resemble closely those of the corresponding profiles of the fundamental band of H 2 in binary mixtures with Ne and Ar. The binary absorption coefficients of the band obtained from the measured integrated intensities are (1.84 +- 0.06) x 10 -35 and (4.41 +- 0.06) x 10 -35 cm 6 s -1 for HD--Ne and HD--Ar, respectively. The characteristic half-width parameters, delta/subd/ and delta/subc/ of the overlap transitions and delta/subq/ (and delta/subq//sub prime/) of the quadrupolar transitions, are obtained from an analysis of the profiles of the enhancement of absorption in both these mixtures. The quantity delta/subc/ which is the half-width of the intercollisional interference dip of the Q branch increases with the density of the perturbing gas Ne or Ar, and for HD--Ne it varies in a manner similar to that for HD--He as described in Paper I of this series

  18. SU-E-T-209: Comparison of Plan Quality Between Arm Avoidance (AA) Vs. Non Arm Avoidance VMAT Planning Techniques for Breast Cancer Patients with Bilateral Implant Reconstructions Receiving Postmastectomy Radiation

    Energy Technology Data Exchange (ETDEWEB)

    Kuo, L; Ballangrud, A; Ho, A; Mechalakos, J; Li, G; Hong, L [Memorial Sloan Kettering Cancer Center, New York, NY (United States)

    2015-06-15

    Purpose: Breast cancer patients with bilateral implant reconstructions who require postmastectomy radiotherapy can pose unique treatment planning challenges. The use of VMAT may provide advantages over conventional tangent or multi-beam IMRT techniques. Moreover, daily setup uncertainly of the arm position, however, could have significant impact on accurate dose delivery. This study compares the plan qualities between non-AA and AA VMAT techniques. Methods: Three breast cancer patients receiving left chest wall and regional nodal irradiation with bilateral implant reconstructions were studied. PTV included chest wall and IMNs (PTV-CW), and supraclavicular and axillary lymph nodes (PTV-SCV). For each patient, one non-AA VMAT plan (VMAT-S) with 4 partial arcs encompassing the ipsilateral arm and three AA VMAT plans where no arcs were entering or existing through the ipsilateral arm were generated. VMAT-AA1 uses 2 arcs for PTV-CW and 2 arcs for PTV-SCV. VMAT-AA2 used two static fields for PTV-SCV with 2 arcs for PTV-CW. VMAT-AA3 used 2 narrow arcs for PTV-CW and 2 long arcs for all PTVs. Prescription dose (PD) was 50 Gy (25 fractions). All plans were normalized to have 95% of PD to 95 % of PTV. PTV dose inhomogeneity and dose to the heart, left lung, right thyroid dose and left humerus were evaluated. Results: For VMAT-S, VMAT-AA1, VMAT-AA2 and VMAT-AA3, respectively, the average and standard deviation (in Gy unless specified otherwise) of PTV D05 are 54.7±0.9, 55.9±0.4, 56.7±0.7 and 55.7±0.4; mean Heart dose: 7.1±0.7, 7.2±0.8, 7.3±0.9 and 6.9±1.0; left lung V20Gy (in %): 28.1±1.0, 28.8+2.2, 32.2±4.1 and 27.8±2.0; mean right thyroid dose: 8.1±0.6, 5.1±2.1, 2.1±0.4 and 5.0±2.0; mean left humerus dose: 20.0±4.4,15.6±4.4, 15.2±8.2 and 15.3±4.6. Conclusion: AA VMAT can produce acceptable clinical plans while eliminating dosimetric impact related to arm setup uncertainty. These data require validation in larger planning studies prior to routine clinical

  19. Differences in clinical outcome between docetaxel and abiraterone acetate as the first-line treatment in chemo-naïve metastatic castration-resistant prostate cancer patients with or without the ineligible clinical factors of the COU-AA-302 study

    Directory of Open Access Journals (Sweden)

    Darren M.C. Poon

    2018-03-01

    Conclusions: Compared to T, AA treatment resulted in longer PFS and similar OS in chemo-naïve mCRPC patients, irrespective of the presence of ineligible factors, suggesting that the initial treatment by AA may still be beneficial to those with the aforementioned ineligible factors.

  20. Thalassemia intermedia as a result of heterozygosis for ß0-thalassemia and aaaanti-3.7/aa genotype in a Brazilian patient

    Directory of Open Access Journals (Sweden)

    Kimura E.M.

    2003-01-01

    Full Text Available We report a case in which the interaction of heterozygosis for both the ß0-IVS-II-1 (G->A mutation and the aaaanti-3.7 allele was the probable cause for the clinical occurrence of thalassemia intermedia. The propositus, a 6-year-old Caucasian Brazilian boy of Portuguese descent, showed a moderately severe chronic anemia in spite of having the ß-thalassemia trait. Investigation of the alpha-globin gene status revealed heterozygosis for alpha-gene triplication (aaa/aa. The patient's father, also presenting mild microcytic and hypochromic anemia, had the same alpha and ß genotypes as his son, while the mother, not related to the father and hematologically normal, was also a carrier of the aaaanti-3.7 allele. The present case emphasizes the need for considering the possibility of alpha-gene triplication in ß-thalassemia heterozygotes who display an unexpected severe phenotype. The ß-thalassemia mutation found here is being described for the first time in Brazil.

  1. Banana (Musa. spp.) strain HD-1 appraisal

    International Nuclear Information System (INIS)

    Longyan, G.; Xinguo, L.; Lingxia, W.; Xuefei, J.

    2016-01-01

    Being one of the important tropical and subtropical fruit trees, banana (Musa spp.) belongs to the family Musaceae and the order Scitaminae with two genera, Musa and Ensete. In a field survey, research team has discovered a potential banana mutant strain HD-1 with a sound economic value. The results of the finding are as follows: based on Simmonds classification, the pseudostem of banana strain HD-1 is relatively short and purplish red; its upright outward petiole groove has red edges and wraps its pseudostem loosely. Its ploidy is 3, AAA type. Karyotype analysis shows that the number of chromosomes is 33, the karyotype formula is 2n=3x=33=2L + 3 M2 + 4 M1 + 2 S, HD-1 is classified as 1B type. With the help of ISSR molecular markers, we find thatbanana HD-1 has the closest relationship with Pubei and Tianbao dwarf banana; the similarity coefficient is 0.81. In an artificial simulation tests of cold, drought and salt resistance environment changes of physiological and biochemical indexes indicate that HD-1 exhibits stronger defense capability than Brazil banana. By way of inoculation with injury of root dipping method, we respectively treat two kinds of banana seedlings inoculated Banana Fusarium wilt race 4 small species. The results show that their resistance evaluation scores are 3 and 4, disease levels are susceptible and high sensitivity respectively. We conclude that HD-1 has stronger resistance ability to Fusarium wilt than Brazil banana. (author)

  2. TWO SMALL PLANETS TRANSITING HD 3167

    Energy Technology Data Exchange (ETDEWEB)

    Vanderburg, Andrew; Bieryla, Allyson; Latham, David W.; Mayo, Andrew W.; Berlind, Perry [Harvard–Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Duev, Dmitry A.; Jensen-Clem, Rebecca; Kulkarni, Shrinivas; Riddle, Reed [California Institute of Technology, Pasadena, CA 91125 (United States); Baranec, Christoph [University of Hawai‘i at Mānoa, Hilo, HI 96720 (United States); Law, Nicholas M. [University of North Carolina at Chapel Hill, Chapel Hill, NC 27599 (United States); Nieberding, Megan N. [National Optical Astronomy Observatory, 950 N. Cherry Avenue, Tucson, AZ 85719 (United States); Salama, Maïssa, E-mail: avanderburg@cfa.harvard.edu [University of Hawai‘i at Mānoa, Honolulu, HI 96822 (United States)

    2016-09-20

    We report the discovery of two super-Earth-sized planets transiting the bright (V = 8.94, K = 7.07) nearby late G-dwarf HD 3167, using data collected by the K2 mission. The inner planet, HD 3167 b, has a radius of 1.6 R {sub ⊕} and an ultra-short orbital period of only 0.96 days. The outer planet, HD 3167 c, has a radius of 2.9 R {sub ⊕} and orbits its host star every 29.85 days. At a distance of just 45.8 ± 2.2 pc, HD 3167 is one of the closest and brightest stars hosting multiple transiting planets, making HD 3167 b and c well suited for follow-up observations. The star is chromospherically inactive with low rotational line-broadening, ideal for radial velocity observations to measure the planets’ masses. The outer planet is large enough that it likely has a thick gaseous envelope that could be studied via transmission spectroscopy. Planets transiting bright, nearby stars like HD 3167 are valuable objects to study leading up to the launch of the James Webb Space Telescope .

  3. TWO SMALL PLANETS TRANSITING HD 3167

    International Nuclear Information System (INIS)

    Vanderburg, Andrew; Bieryla, Allyson; Latham, David W.; Mayo, Andrew W.; Berlind, Perry; Duev, Dmitry A.; Jensen-Clem, Rebecca; Kulkarni, Shrinivas; Riddle, Reed; Baranec, Christoph; Law, Nicholas M.; Nieberding, Megan N.; Salama, Maïssa

    2016-01-01

    We report the discovery of two super-Earth-sized planets transiting the bright (V = 8.94, K = 7.07) nearby late G-dwarf HD 3167, using data collected by the K2 mission. The inner planet, HD 3167 b, has a radius of 1.6 R ⊕ and an ultra-short orbital period of only 0.96 days. The outer planet, HD 3167 c, has a radius of 2.9 R ⊕ and orbits its host star every 29.85 days. At a distance of just 45.8 ± 2.2 pc, HD 3167 is one of the closest and brightest stars hosting multiple transiting planets, making HD 3167 b and c well suited for follow-up observations. The star is chromospherically inactive with low rotational line-broadening, ideal for radial velocity observations to measure the planets’ masses. The outer planet is large enough that it likely has a thick gaseous envelope that could be studied via transmission spectroscopy. Planets transiting bright, nearby stars like HD 3167 are valuable objects to study leading up to the launch of the James Webb Space Telescope .

  4. Plasma free amino acids and their metabolites in Taiwanese patients on hemodialysis and continuous ambulatory peritoneal dialysis.

    Science.gov (United States)

    Chuang, Chih-Kuang; Lin, Shuan-Pei; Chen, Han-Hsiang; Chen, Yi-Chou; Wang, Tuan-Jen; Shieh, Wen-Hsiang; Wu, Chih-Jen

    2006-02-01

    The high prevalence of protein-energy malnutrition is a critical issue for patients with end stage renal disease (ESRD) on hemodialysis (HD) or continuous ambulatory peritoneal dialysis (CAPD). Levels of plasma and intracellular amino acids are significant indicators of protein metabolism and nutritional status assessment. We measured plasma FAAs in patients on maintenance dialysis and to provide information in monitoring the therapeutic strategy, particularly in AA supplementary therapy or protein restriction. Fifty-five patients with ESRD were investigated, 25 on HD (male : female=14 : 11; 48-67 y) and 30 on CAPD (male : female=17 : 13; 45-64 y). The subjects had been on dialysis for an average of 13 months (range, 9 to 22 months). Their plasma FAAs (including their intermediate metabolites) were measured by ion exchange chromatography before and after HD or during CAPD and were compared with data obtained from 20 age- and sex-matched healthy controls. The total plasma FAA levels (urea and free ammonia, NH3 were excluded) in pre-HD samples (3911 +/- 709 micromol/l) was significantly higher than in the other groups (2570 +/- 378 in control, 3210 +/- 640 in post-HD, and 3468 +/- 271 in CAPD samples). The mean plasma FAA concentrations differed significantly between pre-HD and controls and between pre-HD and CAPD samples (pplasma of patients with ESRD, possibly producing higher levels of the waste products (urea and NH3) through the urea cycle and ammonia metabolism in liver. Maintenance dialysis can effectively eliminate excess FAAs in plasma, as there was a 17.9% reduction post-HD. The abnormalities in FAA metabolism found in patients with ESRD necessitate careful consideration of dialysis and dietary measures.

  5. Clinical and biomarker changes in premanifest Huntington disease show trial feasibility: a decade of the PREDICT-HD study

    Directory of Open Access Journals (Sweden)

    Jane S Paulsen

    2014-04-01

    Full Text Available There is growing consensus that intervention and treatment of Huntington disease (HD should occur at the earliest stage possible. Various early-intervention methods for this fatal neurodegenerative disease have been identified, but preventive clinical trials for HD are limited by a lack of knowledge of the natural history of the disease and a dearth of appropriate outcome measures. Objectives of the current study are to document the natural history of premanifest HD progression in the largest cohort ever studied and to develop a battery of imaging and clinical markers of premanifest HD progression that can be used as outcome measures in preventive clinical trials. PREDICT-HD is a 32-site, international, observational study of premanifest HD, with annual examination of 1013 participants with premanifest HD and 301 gene-expansion negative controls between 2001 and 2012. Findings document 39 variables representing imaging, motor, cognitive, functional, and psychiatric domains, showing different rates of decline between premanifest Huntington disease and controls. Required sample size and models of premanifest HD are presented to inform future design of clinical and preclinical research. Preventive clinical trials in premanifest HD with participants who have a medium or high probability of motor onset are calculated to be as resource-effective as those conducted in diagnosed HD and could interrupt disease seven to twelve years earlier. Methods and measures for preventive clinical trials in premanifest HD more than a dozen years from motor onset are also feasible. These findings represent the most thorough documentation of a clinical battery for experimental therapeutics in stages of premanifest HD, the time period for which effective intervention may provide the most positive possible outcome for patients and their families affected by this devastating disease.

  6. Clinical and Biomarker Changes in Premanifest Huntington Disease Show Trial Feasibility: A Decade of the PREDICT-HD Study.

    Science.gov (United States)

    Paulsen, Jane S; Long, Jeffrey D; Johnson, Hans J; Aylward, Elizabeth H; Ross, Christopher A; Williams, Janet K; Nance, Martha A; Erwin, Cheryl J; Westervelt, Holly J; Harrington, Deborah L; Bockholt, H Jeremy; Zhang, Ying; McCusker, Elizabeth A; Chiu, Edmond M; Panegyres, Peter K

    2014-01-01

    There is growing consensus that intervention and treatment of Huntington disease (HD) should occur at the earliest stage possible. Various early-intervention methods for this fatal neurodegenerative disease have been identified, but preventive clinical trials for HD are limited by a lack of knowledge of the natural history of the disease and a dearth of appropriate outcome measures. Objectives of the current study are to document the natural history of premanifest HD progression in the largest cohort ever studied and to develop a battery of imaging and clinical markers of premanifest HD progression that can be used as outcome measures in preventive clinical trials. Neurobiological predictors of Huntington's disease is a 32-site, international, observational study of premanifest HD, with annual examination of 1013 participants with premanifest HD and 301 gene-expansion negative controls between 2001 and 2012. Findings document 39 variables representing imaging, motor, cognitive, functional, and psychiatric domains, showing different rates of decline between premanifest HD and controls. Required sample size and models of premanifest HD are presented to inform future design of clinical and preclinical research. Preventive clinical trials in premanifest HD with participants who have a medium or high probability of motor onset are calculated to be as resource-effective as those conducted in diagnosed HD and could interrupt disease 7-12 years earlier. Methods and measures for preventive clinical trials in premanifest HD more than a dozen years from motor onset are also feasible. These findings represent the most thorough documentation of a clinical battery for experimental therapeutics in stages of premanifest HD, the time period for which effective intervention may provide the most positive possible outcome for patients and their families affected by this devastating disease.

  7. Shadows and cavities in protoplanetary disks: HD 163296, HD 141569A, and HD 150193A in polarized light

    Science.gov (United States)

    Garufi, A.; Quanz, S. P.; Schmid, H. M.; Avenhaus, H.; Buenzli, E.; Wolf, S.

    2014-08-01

    Context. The morphological evolution of dusty disks around young (a few Myr old) stars is pivotal for a better understanding of planet formation. Since both dust grains and the global disk geometry evolve on short timescales, high-resolution imaging of a sample of objects may provide important indications about this evolution. Aims: We enlarge the sample of protoplanetary disks imaged in polarized light with high-resolution imaging (≲0.2″) by observing the Herbig Ae/Be stars HD 163296, HD 141569A, and HD 150193A. We combine our data with previous datasets to understand the larger context of their morphology. Methods: Polarimetric differential imaging is an attractive technique with which to image at near-IR wavelengths a significant fraction of the light scattered by the circumstellar material. The unpolarized stellar light is canceled out by combining two simultaneous orthogonal polarization states. This allowed us to achieve an inner working angle and an angular resolution as low as ~0.1″. Results: We report a weak detection of the disk around HD 163296 in the H and KS bands. The disk is resolved as a broken ring structure with a significant surface brightness drop inward of 0.6″. No sign of extended polarized emission is detected from the disk around HD 141569A and HD 150193A. Conclusions: We propose that the absence of scattered light in the inner 0.6″ around HD 163296 and the non-detection of the disk around HD 150193A may be due to similar geometric factors. Since these disks are known to be flat or only moderately flared, self-shadowing by the disk inner wall is the favored explanation. We show that the polarized brightness of a number of disks is indeed related to their flaring angle. Other scenarios (such as dust grain growth or interaction with icy molecules) are also discussed. On the other hand, the non-detection of HD 141569A is consistent with previous datasets that revealed a huge cavity in the dusty disk. Based on observations collected at

  8. Introduction and feasibility study of the HD-270 MLC

    International Nuclear Information System (INIS)

    Kim, Dae Young; Kim Won Taek; Lee, Hwa Jung; Lee, Kang Hyeok

    2003-01-01

    The multileaf collimator(MLC) has many advantages, but use of the MLC increased effective penumbra and isodose undulation in dose distribution compared with that of an alloy block. In this work, we introduced the HD-270 MLC, which can improve the above disadvantages of MLC, and reported its feasibility study. The HD-270 MLC is a technique which combines the use of the existing Siemens multileaf collimator(3D MLC) with patient translation perpendicular to the leaf plane. The technique produces a smoothed isodose distribution with the reduced isodose undulation and effective penumbra. To assess the efficacy of the HD-270 technique and determine the appropriate resolution, a polygonal shaped MLC field was made to produce field edge angles from 0 degree to 75 degree with a step of 15 degree. Each HD-270 group was generated according to the allowed resolution, i. e., 5, 3, and 2 mm. The experiment was carried out on Primus, a Siemens linear accelerator configured with HD-270 MLC. The total 60 MU of 6 MV photon beam was delivered to X-Omat film (Kodak, USA) at a SAD of 100 cm and 1.5 cm depth in solid water phantom. Exposed films were scanned by Lumiscan75(LUMISYS) and analyzed using RIT113 software (Radiological Imaging Technology Inc., USA). To test the mechanical accuracy of table movement, the transverse, longitudinal, and vertical positions were controlled by a consol with ±5 mm, ±4 mm, ±3 mm, and ±2 mm steps, and then measured using a dial gauge with an accuracy of 0.001 inch. During the experiments, the table loaded with about 50 Kg human phantom to simulate the real treatment situation. The effective penumbra and isodose undulation became larger with increase the resolution and field edge angle. The accuracy of the table movement on each direction is good within the ±1 mm. Clinical use of the MLC can be increased by using of the HD-270 MLC which complements to the disadvantages of the MLC.

  9. Fred-Jaiyesimi, AA

    African Journals Online (AJOL)

    Fred-Jaiyesimi, AA. Vol 12 (2008) - Articles Hypoglycaemic And Alpha-Amylase Inhibitory Activities Of Fermented Seeds Of Parkia Biglobosa (Jacq) Benth Abstract. ISSN: 1118-6267. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's ...

  10. AL SAHLI, AA; OKOLI, JU

    African Journals Online (AJOL)

    ADOWIE PERE

    bioline.org.br/ja. The Use of Soil Palynomorphs in Forensics. *. 1. ABDULRAHAMAN, AA;. 2. AL SAHLI, AA;. 1. OKOLI, JU. 1Applied Plant Anatomy and Wood Technology Laboratory, Department of Plant Biology, University of Ilorin, Ilorin, Nigeria.

  11. Identification of GAD65 AA 114-122 reactive 'memory-like' NK cells in newly diagnosed Type 1 diabetic patients by HLA-class I pentamers.

    Science.gov (United States)

    Perri, Valentina; Gianchecchi, Elena; Cifaldi, Loredana; Pellegrino, Marsha; Giorda, Ezio; Andreani, Marco; Cappa, Marco; Fierabracci, Alessandra

    2017-01-01

    Type 1 diabetes is an autoimmune disease, in which pancreatic β cells are destroyed by autoreactive T cells in genetically predisposed individuals. Serum beta cell autoantibody specificities have represented the mainstay for classifying diabetes as autoimmune-mediated and for stratifying risk in first-degree relatives. In recent years, approaches were attempted to solve the difficult issue of detecting rare antigen-specific autoreactive T cells and their significance to etiopathogenesis such as the use of the MHC multimer technology. This tool allowed the specific detection of increased percentages of GAD65 autoreactive T cells by means of HLA A*02:01 GAD65 AA 114-122 pentamers in newly diagnosed diabetics. Here we provide evidence that GAD65 AA 114-122 pentamers can depict a GAD65 AA114-122 peptide expandable population of functionally and phenotypically skewed, preliminary characterized CD3-CD8dullCD56+ 'memory-like' NK cells in PBMC of newly diagnosed diabetics. Our data suggest that the NK cell subset could bind the HLA class I GAD65 AA 114-122 pentamer through ILT2 inhibitory receptor. CD107a expression revealed increased degranulation of CD3-CD8dullCD56+ NK cells in GAD65 AA 114-122 and FLU peptide expanded peripheral blood mononuclear cells of diabetics following GAD65 AA 114-122 peptide HLA A*02:01 presentation in respect to the unpulsed condition. CD107a expression was enriched in ILT2 positive NK cells. As opposite to basal conditions where similar percentages of CD3-CD56+ILT2+ cells were detected in diabetics and controls, CD3-CD56+CD107a+ and CD3-CD56+ILT2+CD107a+ cells were significantly increased in T1D PBMC either GAD65 AA 114-122 or FLU peptides stimulated after co-culture with GAD65 AA 114-122 pulsed APCs. As control, healthy donor NK cells showed similar degranulation against both GAD65 AA 114-122 pulsed and unpulsed APCs. The pathogenetic significance of the CD3-CD8dullCD56+ 'memory-like NK cell subset' with increased response upon secondary

  12. HD 30187 B and HD 39927 B: Two suspected nearby hot subdwarfs in resolved binaries (based on observations made with the ESA Hipparcos satellite)

    DEFF Research Database (Denmark)

    Makarov, V.V.; Fabricius, C.

    1999-01-01

    Stars: Individual: HD 30187 B -- Stars: Individual: HD 39927 B - Stars: White dwarfs - Stars: Binaries: Visual......Stars: Individual: HD 30187 B -- Stars: Individual: HD 39927 B - Stars: White dwarfs - Stars: Binaries: Visual...

  13. The Antiproton Accumulator (AA)

    CERN Multimedia

    1980-01-01

    Section 06 - 08*) of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A vacuum-tank, two bending magnets (BST06 and BST07 in blue) with a quadrupole (QDN07, in red) in between, another vacuum-tank, a wide quadrupole (QFW08) and a further tank . The tanks are covered with heating tape for bake-out. The tank left of BST06 contained the stack core pickup for stochastic cooling (see 7906193, 7906190, 8005051), the two other tanks served mainly as vacuum chambers in the region where the beam was large. Peter Zettwoch works on BST06. *) see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984)

  14. AA, bending magnet, BLG

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    The very particular lattice of the AA required 2 types of dipole (bending magnets; BLG, long and narrow; BST, short and wide). The BLG had a steel length of 4.70 m, a good field width of 0.24 m, and a weight of about 70 t. Jean-Claude Brunet inspects the lower half of a BLG. For the BST magnets see 7811105 and 8006036.

  15. The Antiproton Accumulator (AA)

    CERN Multimedia

    1980-01-01

    A section of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A large vacuum-tank, a quadrupole (QDN09*), a bending magnet (BST08), another vacuum-tank, a wide quadrupole (QFW08) and (in the background) a further bending magnet (BST08). The tanks are covered with heating tape for bake-out. The tank left of QDN09 contained the kickers for stochastic pre-cooling (see 790621, 8002234, 8002637X), the other one served mainly as vacuum chamber in the region where the beam was large. Peter Zettwoch works on QFW08. * see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984) See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  16. AN INTERFEROMETRIC AND SPECTROSCOPIC ANALYSIS OF THE MULTIPLE STAR SYSTEM HD 193322

    International Nuclear Information System (INIS)

    Ten Brummelaar, Theo A.; Farrington, Christopher D.; Schaefer, Gail H.

    2011-01-01

    The star HD 193322 is a remarkable multiple system of massive stars that lies at the heart of the cluster Collinder 419. Here we report on new spectroscopic observations and radial velocities of the narrow-lined component Ab1 which we use to determine its orbital motion around a close companion Ab2 (P = 312 days) and around a distant third star Aa (P = 35 years). We have also obtained long baseline interferometry of the target in the K' band with the CHARA Array which we use in two ways. First, we combine published speckle interferometric measurements with CHARA separated fringe packet measurements to improve the visual orbit for the wide Aa,Ab binary. Second, we use measurements of the fringe packet from Aa to calibrate the visibility of the fringes of the Ab1,Ab2 binary, and we analyze these fringe visibilities to determine the visual orbit of the close system. The two most massive stars, Aa and Ab1, have masses of approximately 21 and 23 M sun , respectively, and their spectral line broadening indicates that they represent extremes of fast and slow projected rotational velocity, respectively.

  17. The β Cephei star HD 167743

    International Nuclear Information System (INIS)

    Antoci, V; Handler, G; Shobbrook, R R; Romero-Colmenero, E; Barmania, S; Spann, R

    2008-01-01

    The β Cephei star HD 167743 was observed from three different observatories in the years 2006 and 2007. The data sets were collected through the filters Johnson UBV and Stroemgren uvy. First analyses show six independent and five combination frequencies. We present mode identifications, which are simplified by the rather high amplitudes of the star. No evidence for rotational splitting was found yet.

  18. The small molecular cloud toward HD 169454

    NARCIS (Netherlands)

    Jannuzi, B.T.; Black, J.H.; Lada, C.J.; Dishoeck, van E.F.

    1988-01-01

    Optical absorption line observations of the B1 supergiant HD 169454 reveal the presence of an intervening translucent interstellar cloud. Millimeter wavelength observations of CO emission show that the absorption lines can be attributed to a well-defined cloud approximately 18 by 22 min in extent at

  19. Project VeSElkA: results of abundance analysis for HD 53929 and HD 63975

    Science.gov (United States)

    Ndiaye, M. L.; LeBlanc, F.; Khalack, V.

    2018-03-01

    Project VeSElkA (Vertical Stratification of Element Abundances) has been initiated with the aim to detect and study the vertical stratification of element abundances in the atmosphere of chemically peculiar stars. Abundance stratification occurs in hydrodynamically stable stellar atmospheres due to the migration of the elements caused by atomic diffusion. Two HgMn stars, HD 53929 and HD 63975 were selected from the VeSElkA sample and analysed with the aim to detect some abundance peculiarities employing the ZEEMAN2 code. We present the results of abundance analysis of HD 53929 and HD 63975 observed recently with the spectropolarimeter ESPaDOnS at Canada-France-Hawaii Telescope. Evidence of phosphorus vertical stratification was detected in the atmosphere of these two stars. In both cases, phosphorus abundance increases strongly towards the superficial layers. The strong overabundance of Mn found in stellar atmosphere of both stars confirms that they are HgMn type stars.

  20. Systemic AA amyloidosis: epidemiology, diagnosis, and management.

    Science.gov (United States)

    Real de Asúa, Diego; Costa, Ramón; Galván, Jose María; Filigheddu, María Teresa; Trujillo, Davinia; Cadiñanos, Julen

    2014-01-01

    The term "amyloidosis" encompasses the heterogeneous group of diseases caused by the extracellular deposition of autologous fibrillar proteins. The global incidence of amyloidosis is estimated at five to nine cases per million patient-years. While amyloid light-chain (AL) amyloidosis is more frequent in developed countries, amyloid A (AA) amyloidosis is more common in some European regions and in developing countries. The spectrum of AA amyloidosis has changed in recent decades owing to: an increase in the median age at diagnosis; a percent increase in the frequency of primary AL amyloidosis with respect to the AA type; and a substantial change in the epidemiology of the underlying diseases. Diagnosis of amyloidosis is based on clinical organ involvement and histological evidence of amyloid deposits. Among the many tinctorial characteristics of amyloid deposits, avidity for Congo red and metachromatic birefringence under unidirectional polarized light remain the gold standard. Once the initial diagnosis has been made, the amyloid subtype must be identified and systemic organ involvement evaluated. In this sense, the (123)I-labeled serum amyloid P component scintigraphy is a safe and noninvasive technique that has revolutionized the diagnosis and monitoring of treatment in systemic amyloidosis. It can successfully identify anatomical patterns of amyloid deposition throughout the body and enables not only an initial estimation of prognosis, but also the monitoring of the course of the disease and the response to treatment. Given the etiologic diversity of AA amyloidosis, common therapeutic strategies are scarce. All treatment options should be based upon a greater control of the underlying disease, adequate organ support, and treatment of symptoms. Nevertheless, novel therapeutic strategies targeting the formation of amyloid fibrils and amyloid deposition may generate new expectations for patients with AA amyloidosis.

  1. Supporting autonomous vehicles by creating HD maps

    Directory of Open Access Journals (Sweden)

    Arpad Barsi

    2017-10-01

    Full Text Available Maps are constantly developing, also, the newly defined High Definition (HD maps increase the map content remarkably. They are based on three-dimensional survey, like laser scanning, and then stored in a fully new structured way to be able to support modern-day vehicles. Beyond the traditional lane based map content, they contain information about the roads’ neighbourhood. The goal of these maps is twofold. Primarily, they store the connections where the vehicles can travel with the description of the road-environment. Secondly, they efficiently support the exact vehicle positioning. The paper demonstrates the first results of a pilot study in the creation of HD map of an urban and a rural environment. The applied data collection technology was the terrestrial laser scanning, where the obtained point cloud was evaluated. The data storage has been solved by an in-house developed information storage model with the ability to help in vehicle control processes.

  2. AAS 227: Day 1

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or at astrobites.com, or catch ourlive-tweeted updates from the @astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto have so many people tell us that they already know about and useastrobites, and we were excited to introduce a new cohort of students at AAS to astrobites for the first time.Tuesday morning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended today.Opening Address (by Becky Smethurst)The President of the AAS, aka our fearless leader Meg Urry kicked off the meeting this morning at the purely coffee powered hour of 8am this morning. She spoke about the importance of young astronomers at the meeting (heres looking at you reader!) and also the importance of the new Working Group for Accessibility and Disabilities (aka WGAD pronounced like wicked) at the AAS. The Society has made extra effort this year to make the conference accessible to all,a message which was very well received by everyone in attendance.Kavli Lecture: New Horizons Alan Stern (by Becky Smethurst)We were definitely spoilt with the first Plenary lecture at this years conference Alan Stern gave us a a review of the New Horizons mission of the Pluto Fly By (astrobites covered the mission back in July with this post). We were treated to beautiful images, wonderful results and a foray into geology.Before (Hubble) and after #NewHorizons. #thatisall #science #astro alanstern #aas227 pic.twitter.com/kkMt6RsSIR Science News (@topsciencething) January 5, 2016Some awesome facts from the lecture that blew my mind:New Horizons is now 2AU (!) beyond Pluto

  3. AAS 227: Day 2

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  4. 89 Herculis and HD 161796 in 1988

    International Nuclear Information System (INIS)

    Fernie, J.D.

    1990-01-01

    New UBV photometry of V441 Herculis (89 Herculis) and 814 Herculis (HD 161796) obtained with the automatic photoelectric telescope service is presented. These two stars are members of a class of variable known as UU Herculis stars, high-latitude F supergiants that have curious properties. The intention behind the ongoing photometry is to obtain sufficient data with which to study the systematics of the variability of the stars

  5. Nanodiamonds around HD 97048 and Elias 1

    NARCIS (Netherlands)

    Van Kerckhoven, C; Tielens, AGGM; Waelkens, C

    We present an analysis of ISO-SWS observations of the Herbig Ae/Be stars HD 97048 and Elias 1. Besides the well-known family of IR emission bands at 3.3, 6.2, "7.7", 8.6 and 11.2 mum these objects show strong, peculiar emission features at 3.43 and 3.53 mum. The latter two features show pronounced

  6. HD 106104, 109281, 109463 and 110743

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging Solutions)

    (HD 109281 and 109463), but for the two bluer stars they would agree more com- fortably if altered by −0.3 km s−1. Not enough experience has yet been gained with the instrument for there to be any certainty about any colour dependence of the zero- point; for present purposes the empirical correction of −0.3 km s−1 has ...

  7. Asteroseismic modelling of the Binary HD 176465

    Directory of Open Access Journals (Sweden)

    Nsamba B.

    2017-01-01

    Full Text Available The detection and analysis of oscillations in binary star systems is critical in understanding stellar structure and evolution. This is partly because such systems have the same initial chemical composition and age. Solar-like oscillations have been detected by Kepler in both components of the asteroseismic binary HD 176465. We present an independent modelling of each star in this binary system. Stellar models generated using MESA (Modules for Experiments in Stellar Astrophysics were fitted to both the observed individual frequencies and complementary spectroscopic parameters. The individual theoretical oscillation frequencies for the corresponding stellar models were obtained using GYRE as the pulsation code. A Bayesian approach was applied to find the probability distribution functions of the stellar parameters using AIMS (Asteroseismic Inference on a Massive Scale as the optimisation code. The ages of HD 176465 A and HD 176465 B were found to be 2.81 ± 0.48 Gyr and 2.52 ± 0.80 Gyr, respectively. These results are in agreement when compared to previous studies carried out using other asteroseismic modelling techniques and gyrochronology.

  8. Characterization of depression in prodromal Huntington disease in the neurobiological predictors of HD (PREDICT-HD) study.

    Science.gov (United States)

    Epping, Eric A; Mills, James A; Beglinger, Leigh J; Fiedorowicz, Jess G; Craufurd, David; Smith, Megan M; Groves, Mark; Bijanki, Kelly R; Downing, Nancy; Williams, Janet K; Long, Jeffrey D; Paulsen, Jane S

    2013-10-01

    Depression causes significant morbidity and mortality, and this also occurs in Huntington Disease (HD), an inherited neurodegenerative illness with motor, cognitive, and psychiatric symptoms. The presentation of depression in this population remains poorly understood, particularly in the prodromal period before development of significant motor symptoms. In this study, we assessed depressive symptoms in a sample of 803 individuals with the HD mutation in the prodromal stage and 223 mutation-negative participants at the time of entry in the Neurobiological Predictors of HD (PREDICT-HD) study. Clinical and biological HD variables potentially related to severity of depression were analyzed. A factor analysis was conducted to characterize the symptom domains of depression in a subset (n=168) with clinically significant depressive symptoms. Depressive symptoms were found to be more prevalent in HD mutation carriers but did not increase with proximity to HD diagnosis and were not associated with length of the HD mutation. Increased depressive symptoms were significantly associated with female gender, self-report of past history of depression, and a slight decrease in functioning, but not with time since genetic testing. The factor analysis identified symptom domains similar to prior studies in other populations. These results show that individuals with the HD mutation are at increased risk to develop depressive symptoms at any time during the HD prodrome. The clinical presentation appears to be similar to other populations. Severity and progression are not related to the HD mutation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Elemental abundance studies of CP stars. II. The silicon stars HD 133029 and HD 192913

    CERN Document Server

    López-García, Z

    1999-01-01

    For pt.1 see ibid., vol.107, no.2, p.353-63 (1994). Fine analyses of the silicon stars HD 133029 and HD 192913 are presented using ATLAS9 model atmospheres whose predictions fit the optical region spectrophotometry and H gamma profiles and have the same bulk metallicity as the deduced abundances. Both are very He poor stars. The light elements are mostly solar except for silicon, and all the heavier elements, except nickel in HD 133029 which is solar, are greatly overabundant. The iron peak elements are typically 10 times overabundant. SrYZr are of order of 100 times solar. The rare earths are 1000 or more times overabundant. Table 4 is is only available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsweb.u-strasbg.fr/Abstract.html. (50 refs).

  10. Elemental abundance studies of CP stars. The silicon stars HD 87240 and HD 96729

    OpenAIRE

    C. Saffe; H. Levato; Z. López-García

    2005-01-01

    En este trabajo se comparan abundancias elementales de estrellas Ap de Si de campo y pertenecientes a cúmulos abiertos. En particular, se presenta un análisis de las estrellas Ap de Si HD 87240 y HD 96729, utilizando modelos de atmósferas de ATLAS9 y material observacional tomado con el espectrógrafo echelle REOSC, adosado al telescopio de 2.15 m Jorge Sahade de CASLEO. Estas es- trellas químicamente peculiares (CP) pertenecen a los cúmulos abiertos australes NGC 3114 y NGC ...

  11. ELEMENTAL ABUNDANCE STUDIES OF CP STARS. THE SILICON STARS HD 87405 AND HD 146555

    OpenAIRE

    C. Saff\\u000Be; H. Levato

    2009-01-01

    Presentamos un an lisis de las estrellas Ap(Si) HD 87405 y HD 146555 usando modelos de atm sferas de ATLAS9. Estas estrellas qu micamente peculiares (CP) pertenecen a los c mulos abiertos australes NGC 3114 y NGC 6087, respectivamente. Para ambas estrellas el C y el Ca (s lo una li ea) son - solares, el Mg, y el S se encuentran levemente por debajo del valor solar y el Si es sobreabundante por factores entre - 4 - 6. Los elementos m s pesados son todos sobreabundantes, el Ti, y el Cr por fact...

  12. AAS 228: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors fromastrobites.com, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  13. Toxicity, activation process, and histopathological effect of Bacillus thuringiensis vegetative insecticidal protein Vip3Aa16 on Tuta absoluta.

    Science.gov (United States)

    Sellami, Sameh; Cherif, Maroua; Abdelkefi-Mesrati, Lobna; Tounsi, Slim; Jamoussi, Kaïs

    2015-02-01

    Tuta absoluta is a destructive moth of Solanaceae plants and especially tomatoes. Here, we considered the entomopathogenic activity of the Bacillus thuringiensis Vip3Aa16 protein heterologously produced by Escherichia coli against T. absoluta. Purified Vip3Aa16 showed lower lethal concentration 50 % against third instar larvae (Toxin/tomato leaf) (335 ± 17 ng/cm(2)) compared to that of B. thuringiensis kurstaki HD1 δ-endotoxins (955 ± 4 ng/cm(2)) (P larvae gut soluble proteases, yielding derivative proteins essentially of about 62 and 33 kDa. The gut-soluble proteases could contain trypsin-like enzymes implicated in Vip3Aa16 activation since the proteolysis was inhibited using specific protease inhibitors. Additionally, we showed that the histopathological effect of Vip3Aa16 on T. absoluta larva midguts consisted on a microvillus damage and an epithelial cell rupture.

  14. The Drentsche Aa valley system

    International Nuclear Information System (INIS)

    Gans, W. de.

    1981-01-01

    This thesis is composed of five papers concerned with Late Quaternary geology and geomorphology of the Aa valley system. The correlation and chronostratigraphic position of the layers have been established by radiocarbon dating. (Auth.)

  15. Inhibiting the Progression of Arterial Calcification with Vitamin K in HemoDialysis Patients (iPACK-HD Trial: Rationale and Study Design for a Randomized Trial of Vitamin K in Patients with End Stage Kidney Disease

    Directory of Open Access Journals (Sweden)

    Rachel M Holden

    2015-05-01

    Full Text Available Background: Cardiovascular disease, which is due in part to progressive vascular calcification, is the leading cause of death among patients with end stage kidney disease (ESKD on dialysis. A role for vitamin K in the prevention of vascular calcification is plausible based on the presence of vitamin K dependent proteins in vascular tissue, including matrix gla protein (MGP. Evidence from animal models and observational studies support a role for vitamin K in the prevention of vascular calcification. A large-scale study is needed to investigate the effect of vitamin K supplementation on the progression of vascular calcification in patients with ESKD, a group at risk for sub-clinical vitamin K deficiency. Methods/Design: We plan a prospective, randomized, double-blind, multicenter controlled trial of incident ESKD patients on hemodialysis in centers within North America. Eligible subjects with a baseline coronary artery calcium score of greater than or equal to 30 Agatston Units, will be randomly assigned to either the treatment group (10 mg of phylloquinone three times per week or to the control group (placebo administration three times per week. The primary endpoint is the progression of coronary artery calcification defined as a greater than 15% increase in CAC score over baseline after 12 months. Discussion: Vitamin K supplementation is a simple, safe and cost-effective nutritional strategy that can easily be integrated into patient care. If vitamin K reduces the progression of coronary artery calcification it may lead to decreased morbidity and mortality in men and women with ESKD. Trial registration: NCT 01528800.

  16. AAS 227: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from http://web.physics.ucsb.edu/ ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  17. [AA amyloidosis: a little-known complication of chronic leg ulcer].

    Science.gov (United States)

    Waton, J; Fays-Michel, S; Chandeclerc, M L; Corby, S; Cuny, J F; Barbaud, A; Schmutz, J-L

    2008-02-01

    AA amyloidosis, secondary to inflammatory chronic diseases like rheumatoid arthritis, is often complicated by renal failure. Chronic inflammatory dermatoses constitute rare causes of AA amyloidosis. We describe two cases of AA amyloidosis discovered after renal failure in patients presenting leg ulcers for several years. AL amyloidosis was suspected in both cases because of a history of monoclonal gammopathy in one patient and of plasmocytoma in the other. The diagnosis of AA amyloidosis was confirmed on renal histology through the detection of AA antibodies in amyloid deposits. No extrarenal amyloidosis was seen in either patient and there were no inflammatory diseases other than chronic leg ulcers. AA amyloidosis is caused by serum amyloid protein A (SAA), a reactive inflammatory protein. AA amyloidosis is thus caused by chronic inflammatory diseases, but only rarely by cutaneous inflammatory diseases. To our knowledge, the literature contains only seven other published cases of AA amyloidosis secondary to chronic leg ulcers. A review of the literature does not indicate whether cure of ulcers has any effect on the accompanying renal failure. We imagine that AA amyloidosis secondary to leg ulcer is in fact under-diagnosed. However, since the first specific treatment for AA amyloidosis is currently being evaluated by the Food and Drug Administration, it is essential that this serious complication of chronic leg ulcers be widely recognised.

  18. Search for Exoplanets around Northern Circumpolar Stars. II. The Detection of Radial Velocity Variations in M Giant Stars HD 36384, HD 52030, and HD 208742

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Byeong-Cheol; Jeong, Gwanghui; Han, Inwoo; Lee, Sang-Min; Kim, Kang-Min [Korea Astronomy and Space Science Institute 776, Daedeokdae-ro, Yuseong-gu, Daejeon 305-348 (Korea, Republic of); Park, Myeong-Gu; Oh, Hyeong-Il [Department of Astronomy and Atmospheric Sciences, Kyungpook National University, Daegu 702-701 (Korea, Republic of); Mkrtichian, David E. [National Astronomical Research Institute of Thailand, Chiang Mai 50200 (Thailand); Hatzes, Artie P. [Thüringer Landessternwarte Tautenburg (TLS), Sternwarte 5, D-07778 Tautenburg (Germany); Gu, Shenghong; Bai, Jinming, E-mail: bclee@kasi.re.kr [Yunnan Observatories, Chinese Academy of Sciences, Kunming 650011 (China)

    2017-07-20

    We present the detection of long-period RV variations in HD 36384, HD 52030, and HD 208742 by using the high-resolution, fiber-fed Bohyunsan Observatory Echelle Spectrograph (BOES) for the precise radial velocity (RV) survey of about 200 northern circumpolar stars. Analyses of RV data, chromospheric activity indicators, and bisector variations spanning about five years suggest that the RV variations are compatible with planet or brown dwarf companions in Keplerian motion. However, HD 36384 shows photometric variations with a period very close to that of RV variations as well as amplitude variations in the weighted wavelet Z-transform (WWZ) analysis, which argues that the RV variations in HD 36384 are from the stellar pulsations. Assuming that the companion hypothesis is correct, HD 52030 hosts a companion with minimum mass 13.3 M {sub Jup} orbiting in 484 days at a distance of 1.2 au. HD 208742 hosts a companion of 14.0 M {sub Jup} at 1.5 au with a period of 602 days. All stars are located at the asymptotic giant branch (AGB) stage on the H–R diagram after undergoing the helium flash and leaving the giant clump.With stellar radii of 53.0 R {sub ⊙} and 57.2 R {sub ⊙} for HD 52030 and HD 208742, respectively, these stars may be the largest yet, in terms of stellar radius, found to host substellar companions. However, given possible RV amplitude variations and the fact that these are highly evolved stars, the planet hypothesis is not yet certain.

  19. Effects of Hd2 in the presence of the photoperiod-insensitive functional allele of Hd1 in rice

    Directory of Open Access Journals (Sweden)

    Zhen-Hua Zhang

    2016-11-01

    Full Text Available The role of photoperiod sensitivity (PS of flowering genes have become well recognized in rice, whereas little attention has been drawn to the non-PS component of these genes, especially to their influence on gene-by-gene interactions. Rice populations in which the photoperiod-sensitive allele at Hd1 has become insensitive to photoperiod but continued to affect heading date (HD were used in this study to fine-map a quantitative trait locus (QTL for HD and analyze its genetic relationship to Hd1. The QTL was delimitated to a 96.3-kb region on the distal end of the long arm of chromosome 7. Sequence comparison revealed that this QTL is identical to Hd2. In the near-isogenic line (NIL populations analyzed, Hd1 and Hd2 were shown to be photoperiod insensitive and have pleiotropic effects for HD, plant height and yield traits. The two genes were found to largely act additively in regulating HD and yield traits. The results indicate that non-PS components of flowering genes involved in photoperiod response play an important role in controlling flowering time and grain yield in rice, which should allow breeders to better manipulate pleiotropic genes for balancing adaptability and high-yielding accumulation.

  20. Hubble Space Telescope Observations of the HD 202628 Debris Disk

    Science.gov (United States)

    Krist, John E.; Stapelfeldt, Karl R.; Bryden, Geoffrey; Plavchan, Peter

    2012-01-01

    A ring-shaped debris disk around the G2V star HD 202628 (d = 24.4 pc) was imaged in scattered light at visible wavelengths using the coronagraphic mode of the Space Telescope Imaging Spectrograph on the Hubble Space Telescope. The ring is inclined by approx.64deg from face-on, based on the apparent major/minor axis ratio, with the major axis aligned along PA = 130deg. It has inner and outer radii (> 50% maximum surface brightness) of 139 AU and 193 AU in the northwest ansae and 161 AU and 223 AU in the southeast ((Delta)r/r approx. = 0.4). The maximum visible radial extent is approx. 254 AU. With a mean surface brightnesses of V approx. = 24 mag arcsec.(sup -2), this is the faintest debris disk observed to date in reflected light. The center of the ring appears offset from the star by approx.28 AU (deprojected). An ellipse fit to the inner edge has an eccentricity of 0.18 and a = 158 AU. This offset, along with the relatively sharp inner edge of the ring, suggests the influence of a planetary-mass companion. There is a strong similarity with the debris ring around Fomalhaut, though HD 202628 is a more mature star with an estimated age of about 2 Gyr. We also provide surface brightness limits for nine other stars in our study with strong Spitzer excesses around which no debris disks were detected in scattered light (HD 377, HD 7590, HD 38858, HD 45184, HD 73350, HD 135599, HD 145229, HD 187897, and HD 201219).

  1. HUBBLE SPACE TELESCOPE OBSERVATIONS OF THE HD 202628 DEBRIS DISK

    International Nuclear Information System (INIS)

    Krist, John E.; Bryden, Geoffrey; Stapelfeldt, Karl R.; Plavchan, Peter

    2012-01-01

    A ring-shaped debris disk around the G2V star HD 202628 (d = 24.4 pc) was imaged in scattered light at visible wavelengths using the coronagraphic mode of the Space Telescope Imaging Spectrograph on the Hubble Space Telescope. The ring is inclined by ∼64° from face-on, based on the apparent major/minor axis ratio, with the major axis aligned along P.A. = 130°. It has inner and outer radii (>50% maximum surface brightness) of 139 AU and 193 AU in the northwest ansae and 161 AU and 223 AU in the southeast (Δr/r ≈ 0.4). The maximum visible radial extent is ∼254 AU. With mean surface brightness of V ≈ 24 mag arcsec –2 , this is the faintest debris disk observed to date in reflected light. The center of the ring appears offset from the star by ∼28 AU (deprojected). An ellipse fit to the inner edge has an eccentricity of 0.18 and a = 158 AU. This offset, along with the relatively sharp inner edge of the ring, suggests the influence of a planetary-mass companion. There is a strong similarity with the debris ring around Fomalhaut, though HD 202628 is a more mature star with an estimated age of about 2 Gyr. We also provide surface brightness limits for nine other stars in our study with strong Spitzer excesses around which no debris disks were detected in scattered light (HD 377, HD 7590, HD 38858, HD 45184, HD 73350, HD 135599, HD 145229, HD 187897, and HD 201219).

  2. Serum Bicarbonate And Survival In Peritoneal Dialysis (Pd: Comparison With Hemodialysis (Hd

    Directory of Open Access Journals (Sweden)

    Tania Sharma

    2012-06-01

    Full Text Available Correction of metabolic acidosis is one of the goals of effective dialysis. The KDOQI guidelines recommend serum bicarbonate >22 meq/L irrespective of dialysis modality. Since the measured bicarbonate reflects the steady state in PD patients and the lowest inter-dialytic value in HD patients, we compared the survival predictability of serum bicarbonate 10,400 PD and 110,951 HD patients treated in DaVita facilities from 7/2001-6/2006 with follow-up through 6/2007. PD patients were substantially less likely to have lower serum bicarbonate (adjusted odds, 22 meq/L for all end-stage renal disease irrespective of dialysis modality.fx1

  3. Spectroscopic Variability of Supergiant Star HD14134, B3Ia

    Indian Academy of Sciences (India)

    Y. M. Maharramov

    2017-06-19

    Jun 19, 2017 ... Orion, Astrophys. J., 150, 535. Pasok, A., Kolka, I. 1992, The Hα profile variations in the spectrum of HD225094, B3Ia, IBVS, 3804. Prinja R. K. et al. 1996, Variability in the optical wind lines of HD151804 (O9Iaf), Astron. Astrophys., 311,. 264. Rosendhal, J. D. 1973, A survey of Hα emission in early-type.

  4. H/D isotope effects in high temperature proton conductors

    NARCIS (Netherlands)

    Bonanos, N.; Huijser, Jannetje Maria; Poulsen, F.W.

    2015-01-01

    The atomic mass ratio of ca. 2 between deuterium and hydrogen is the highest for any pair of stable isotopes and results in significant and measurable H/D isotope effects in high temperature proton conductors containing these species. This paper discusses H/D isotope effects manifested in O–H/O–D

  5. HD 12098 and Other Results from Nainital–Cape Survey

    Indian Academy of Sciences (India)

    2016-01-27

    Jan 27, 2016 ... Nainital;Cape Survey was started with an aim to search for new rapidly oscillating Ap stars in the northern hemisphere.We discovered one new mono-periodic roAp star HD 12098. The frequency separation of HD 12098 suggests a rotation period of 5.5 days for the star. We summarize here the observations ...

  6. A Comparison of Problem Behavior Profiles in Turkish Children with AD/HD and Non-AD/HD Children

    Science.gov (United States)

    Ozdemir, Selda

    2010-01-01

    Introduction: There is an increasing number of studies describing the symptoms of ADHD among school-age children in western cultures. Yet, studies on children with ADHD living in non-western cultures are limited. Thus, the purpose of this study was to compare problem behavior profiles of Turkish children with AD/HD and non-AD/HD children. Method:…

  7. Is the presence of AA amyloidosis associated with impaired coronary flow reserve?

    Science.gov (United States)

    Bulut, Mustafa; Keles, Nursen; Caliskan, Zuhal; Kostek, Osman; Aksu, Feyza; Ozdil, Kamil; Akcakoyun, Mustafa; Demircioglu, Kenan; Yilmaz, Yusuf; Kanbay, Mehmet; Caliskan, Mustafa

    2016-08-01

    Systemic amyloid A protein (AA) amyloidosis may occur as a complication of many chronic inflammatory disorders. Patients receiving inadequate anti-inflammatory and immunosuppressive therapies have an increased risk of developing systemic AA amyloidosis. Inflammation plays a role in all stages and the thrombotic complications of atherosclerosis. In the absence of epicardial coronary stenosis, coronary flow reserve (CFR) reflects coronary microvascular dysfunction. In the present study, we hypothesized that amyloid advanced subclinical inflammation in chronic inflammatory diseases (CID) patients may further affect coronary microcirculation. Thirty-two patients with biopsy-diagnosed renal AA, 73 patients with non-amyloid CID, and a group of healthy volunteers were included in the study. The measurements of coronary flow velocity were performed by a single investigator with expertise in transthoracic Doppler harmonic echocardiography (TTDE). The AA amyloidosis subgroup had significantly lower CFR values than other non-amyloid CID patients and the control individuals (1.8 (1.5-2.1) vs. 2.1 (2.0-2.4) and 3.0 (2.8-3.2), p AA amyloidosis and elevated hs - CRP independently predict impairment of the CFR (p AA amyloidosis is related to decreased CFR values and the presence of AA amyloidosis and elevated hs - CRP independently predict impairment of the CFR. Therefore, patients with AA amyloidosis may have an increased risk of developing coronary artery diseases. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  8. HD 156324: a tidally locked magnetic triple spectroscopic binary with a disrupted magnetosphere

    Science.gov (United States)

    Shultz, M.; Rivinius, Th; Wade, G. A.; Alecian, E.; Petit, V.

    2018-03-01

    HD 156324 is an SB3 (B2V/B5V/B5V) system in the Sco OB4 association. The He-strong primary possesses both a strong magnetic field and Hα emission believed to originate in its centrifugal magnetosphere. We analyse a large spectroscopic and high-resolution spectropolarimetric data set. The radial velocities (RVs) indicate that the system is composed of two subsystems, which we designate A and B. Period analysis of the RVs of the three components yields orbital periods Porb = 1.5806(1) d for the Aa and Ab components, and Porb = 6.67(2) d for the B component, a PGa star. Period analysis of the longitudinal magnetic field 〈Bz〉 and Hα equivalent widths, which should both be sensitive to the rotational period Prot of the magnetic Aa component, both yield ˜1.58 d. Since Porb = Prot Aa and Ab must be tidally locked. Consistent with this, the orbit is circularized, and the rotational and orbital inclinations are identical within uncertainty, as are the semimajor axis and the Kepler corotation radius. The star's Hα emission morphology differs markedly from both theoretical and observational expectations in that there is only one, rather than two, emission peaks. We propose that this unusual morphology may be a consequence of modification of the gravitocentrifugal potential by the presence of the close stellar companion. We also obtain upper limits on the magnetic dipole strength Bd for the Ab and B components, respectively, finding Bd < 2.6 and <0.7 kG.

  9. Detection of HD in the Orion molecular outflow

    Science.gov (United States)

    Bertoldi, Frank; Timmermann, Ralf; Rosenthal, Dirk; Drapatz, Siegfried; Wright, Christopher M.

    1999-06-01

    We report a detection in the interstellar medium of an infrared transition within the electronic ground state of the deuterated hydrogen molecule, HD. Through a deep integration with the Short-Wavelength-Spectrometer (SWS) on board the Infrared Space Observatory (ISO), the pure rotational v=0-0 R(5) line at 19.43 mu m was detected toward the Orion (OMC-1) outflow at its brightest H_2\\ emission region, Peak 1. The ~ 20'' beam-averaged observed flux of the line is (1.84 +/- 0.4) x 10(-5) erg cm(-2) s(-1) sr(-1) . Upper flux limits were derived for sixteen other rotational and ro-vibrational HD lines in the wavelength range 2.5 to 38 mu m. We utilize the rich spectrum of H_2\\ lines observed at the same position to correct for extinction, and to derive a total warm HD column density under the assumption that similar excitation conditions apply to H_2\\ and HD. Because the observed HD level population is not thermalized at the densities prevailing in the emitting region, the total HD column density is sensitive to the assumed gas density, temperature, and dissociation fraction. Accounting for non-LTE HD level populations in a partially dissociated gas, our best estimate for the total warm HD column density is N(HD)=(2.0+/- 0.75)x 10(16) cm(-2) . The warm molecular hydrogen column density is (2.21+/-0.24)x 10(21) cm(-2) , so that the relative abundance is [HD]/[H_2]=(9.0+/- 3.5)x 10(-6) . The observed emission presumably arises in the warm layers of partially dissociative magnetic shocks, where HD can be depleted relative to H_2 due to an asymmetry in the deuterium-hydrogen exchange reaction. This leads to an average HD depletion relative to H_2\\ of about 40%. Correcting for this chemical depletion, we derive a deuterium abundance in the warm shocked gas, [D]/[H]= (7.6+/- 2.9) x 10(-6) . The derived deuterium abundance is not very sensitive to the dissociation fraction in the emitting region, since both the non-LTE and the chemical depletion corrections act in

  10. Long-term prognosis of AL and AA renal amyloidosis: a Japanese single-center experience.

    Science.gov (United States)

    Ozawa, Masatoyo; Komatsuda, Atsushi; Ohtani, Hiroshi; Nara, Mizuho; Sato, Ryuta; Togashi, Masaru; Takahashi, Naoto; Wakui, Hideki

    2017-04-01

    Few studies have been conducted on the long-term prognosis of patients with amyloid light chain (AL) and amyloid A (AA) renal amyloidosis in the same cohort. We retrospectively examined 68 patients with biopsy-proven renal amyloidosis (38 AL and 30 AA). Clinicopathological findings at the diagnosis and follow-up data were evaluated in each patient. We analyzed the relationship between clinicopathological parameters and survival data. Significant differences were observed in several clinicopathological features, such as proteinuria levels, between the AL and AA groups. Among all patients, 84.2 % of the AL group and 93.3 % of the AA group received treatments for the underlying diseases of amyloidosis. During the follow-up period (median 18 months in AL and 61 months in AA), 36.8 % of the AL group and 36.7 % of the AA group developed end-stage renal failure requiring dialysis, while 71.1 % of the AL group and 56.7 % of the AA group died. Patient and renal survivals were significantly longer in the AA group than in the AL group. eGFR of >60 mL/min/1.73 m 2 at biopsy and an early histological stage of glomerular amyloid deposition were identified as low-risk factors. A multivariate analysis showed that cardiac amyloidosis and steroid therapy significantly influenced patient and renal survivals. Our results showed that heart involvement was the major predictor of poor outcomes in renal amyloidosis, and that the prognosis of AA renal amyloidosis was markedly better than that in previously reported cohorts. Therapeutic advances in inflammatory diseases are expected to improve the prognosis of AA amyloidosis.

  11. HD12098 and Other Results from Nainital-Cape Survey

    Science.gov (United States)

    Girish, V.

    2005-06-01

    Nainital-Cape Survey was started with an aim to search for new rapidly oscillating Ap stars in the northern hemisphere. We discovered one new mono-periodic roAp star HD12098. The frequency separation of HD12098 suggests a rotation period of 5.5 days for the star. We summarize here the observations of HD12098 and briefly discuss the results of the multi-site observation campaign organized to resolve the ambiguity in the determination of the rotation period of HD12098. Other interesting results like non-oscillating Ap stars discovered and two candidate stars in which roAp periodicity is seen but not confirmed are also discussed.

  12. Asymmetric H-D exchange reactions of fluorinated aromatic ketones

    KAUST Repository

    Zhao, Yujun

    2012-01-01

    Chiral bicyclic guanidine catalyzes the asymmetric H-D exchange reactions. Up to 30% ee was achieved. DFT calculations were employed to elucidate and explain the origin of the reaction\\'s stereoselectivity. © 2012 The Royal Society of Chemistry.

  13. Asteroseismology of the δ Scuti star HD 50844

    Science.gov (United States)

    Chen, X. H.; Li, Y.; Lai, X. J.; Wu, T.

    2016-09-01

    Aims: We aim to probe the internal structure and investigate with asteroseismology for more detailed information on the δ Scuti star HD 50844. Methods: We analyse the observed frequencies of the δ Scuti star HD 50844 and search for possible multiplets, which are based on the rotational splitting law of g-mode. We tried to disentangle the frequency spectra of HD 50844 only by means of rotational splitting. We then compare these with theoretical pulsation modes, which correspond to stellar evolutionary models with various sets of initial metallicity and stellar mass, to find the best-fitting model. Results: There are three multiplets, including two complete triplets and one incomplete quintuplet, in which mode identifications for spherical harmonic degree l and azimuthal number m are unique. The corresponding rotational period of HD 50844 is found to be 2.44 days. The physical parameters of HD 50844 are well limited in a small region by three modes that have been identified as nonradial ones (f11, f22, and f29) and by the fundamental radial mode (f4). Our results show that the three nonradial modes (f11, f22, and f29) are all mixed modes, which mainly represent the property of the helium core. The fundamental radial mode (f4) mainly represents the property of the stellar envelope. To fit these four pulsation modes, both the helium core and the stellar envelope need to be matched to the actual structure of HD 50844. Finally, the mass of the helium core of HD 50844 is estimated to be 0.173 ± 0.004 M⊙ for the first time. The physical parameters of HD 50844 are determined to be M = 1.81 ± 0.01 M⊙, Z = 0.008 ± 0.001. Teff = 7508 ± 125 K, log g = 3.658 ± 0.004, R = 3.300 ± 0.023 R⊙, L = 30.98 ± 2.39 L⊙.

  14. A New Analysis of the Exoplanet Hosting System HD 6434

    OpenAIRE

    Hinkel, Natalie R.; Kane, Stephen R.; Pilyavsky, Genady; Boyajian, Tabetha S.; James, David J.; Naef, Dominique; Fischer, Debra A.; Udry, Stephane

    2015-01-01

    The current goal of exoplanetary science is not only focused on detecting but characterizing planetary systems in hopes of understanding how they formed, evolved, and relate to the Solar System. The Transit Ephemeris Refinement and Monitoring Survey (TERMS) combines both radial velocity (RV) and photometric data in order to achieve unprecedented ground-based precision in the fundamental properties of nearby, bright, exoplanet-hosting systems. Here we discuss HD 6434 and its planet, HD 6434b, ...

  15. Bidirectional uncompressed HD video distribution over fiber employing VCSELs

    DEFF Research Database (Denmark)

    Estaran Tolosa, Jose Manuel; Vegas Olmos, Juan José; Rodes, G. A.

    2012-01-01

    We report on a bidirectional system in which VCSELs are simultaneously modulated with two uncompressed HD video signals. The results show a large power budget and a negligible penalty over 10 km long transmission links.......We report on a bidirectional system in which VCSELs are simultaneously modulated with two uncompressed HD video signals. The results show a large power budget and a negligible penalty over 10 km long transmission links....

  16. A.A., constructivism, and reflecting teams.

    Science.gov (United States)

    Nevels, B

    1997-12-01

    Numerous studies and clinical anecdotes reveal a relationship between attendance at A.A. meetings and/or degree of involvement in A.A. and maintenance of sobriety. Hypotheses as to how A.A. and/or the A.A. meeting is helpful to its members have ranged from a focus on factors common to all therapy groups, to aspects of A.A. "treatment" which are behavioral in nature. Presented here is another way of understanding A.A.'s effectiveness within the frame of more recent, constructivistic approaches to family therapy. In particular, the A.A. topic meeting is compared to the reflecting team concept of Tom Anderson.

  17. In Vivo Efficacy of HD0471953: A Novel GPR119 Agonist for the Treatment of Type 2 Diabetes Mellitus

    Directory of Open Access Journals (Sweden)

    So Ra Kim

    2013-01-01

    Full Text Available G-protein coupled receptor 119 (GPR119 has emerged as a promising new target for the treatment of type 2 diabetes mellitus. The expression of GPR119 on the pancreatic B cells and intestinal L cells provides a unique opportunity for a single drug to promote insulin and GLP-1 secretion. In this study, we identified a novel small molecule GPR119 agonist, HD0471953, from our large library of synthetic compounds based on its ability to anti-hyperglycemic effects on T2DM murine models. We have tested the acute efficacy of HD0471953 by the oral glucose tolerance test (OGTT with normal C57BL/6J mice. Then, chronic administrations of HD0471953 were performed to evaluate the efficacy on various diabetic rodent models. Single administration of HD0471953 showed improved glycemic control with a dose-dependent manner in OGTT with normal mice, and the insulin and GLP-1 were also increased. To identify chronic efficacy, we have observed a decline of blood glucose and fasting insulin in a dose-dependent manner of 10, 20, and 50 mpk in db/db mice. The results suggest that HD0471953 may be a potentially promising anti-hyperglycemic agent for the treatment of patients with type 2 diabetes mellitus.

  18. Changing epidemiology of AA amyloidosis: clinical observations over 25 years at a single national referral centre.

    Science.gov (United States)

    Lane, Thirusha; Pinney, Jennifer H; Gilbertson, Janet A; Hutt, David F; Rowczenio, Dorota M; Mahmood, Shameem; Sachchithanantham, Sajitha; Fontana, Marianna; Youngstein, Taryn; Quarta, Candida C; Wechalekar, Ashutosh D; Gillmore, Julian D; Hawkins, Philip N; Lachmann, Helen J

    2017-09-01

    Systemic AA amyloidosis is a serious complication of chronic inflammation; however, there are relatively few published data on its incidence. We investigated the changing epidemiology of AA amyloidosis over a 25-year period at a single national referral centre. We conducted a retrospective study of all patients diagnosed with AA amyloidosis who had attended the centre between 1990 and 2014 inclusive. Six hundred and twenty-five patients were studied in three cohorts: C1: 1990-1997; C2: 1998-2006; C3: 2007-2014. Mean age at presentation increased from 46 in C1 to 56 in C3 (p AA amyloidosis over a quarter of a century, reflecting advances in therapeutics and overall management of complex chronic disease in an ageing population. AA amyloidosis of uncertain aetiology presents an emerging major problem. Newer techniques such as next-generation sequencing may aid diagnosis and effective treatment, thereby improving overall survival.

  19. Spectroscopy of southern active stars. II - HD 32918, HD 82558, BD - 22 deg 3467, AB Doradus (HD 36705) and RST 137 B

    Science.gov (United States)

    Vilhu, O.; Gustafsson, B.; Walter, F. M.

    1991-01-01

    We have observed the southern active cool stars HD 32918 (K1 IIIp), HD 82558 (K2 V), BD-22°3467 (G8 III), AB Doradus (HD 36705, K1 IV) and Rst 137 B (M 3-5), each of which lies close to the chromospheric- coronal saturation limit. The fractional Hα-luminosities LHα/Lbol of the stars were close to 10-4. No significant radial velocity variations were detected in any of the stars. With the variations of the Fe I 6546-line profiles, as a function of the 9.55 d rotation period, the existence of a cool spot-region of HD 32918 was traced. The spectra were analysed by a surface imaging technique by Piskunov et al. (1990). The resulting image showed a large group of cool spots at the equatorial belt at one side of the star, and a smaller and less cool one extending to higher latitudes at the opposite longitude. Old photometry suggests that the equatorial spots might have been permanent during 7 yr at the same (active) longitude. The Hα-emission of HD 32918 was variable and asymmetric, comprising possibly of chromospheric and wind (or expanding chromosphere) components. The He I 5876 (D 3) absorption was remarkably strong in HD 32918, pointing to the existence of an extended and low density chromosphere. BD-22°3467, the cool companion to the hot central star of the planetary nebula Abell 35, experiences a photometric wave with a 0.77 d period (Jasniewicz & Acker, 1988). Our observations, performed around the same time with this photometry, resolved a blue-shifted Hα-emission at the minimum light. This behaviour was opposite to that found in HD 32918. The υ sin i value (90 km s-1) of BD-22°3467 is compatible with the interpretation that the 0.77 d photometric cycle is the star's rotation period. The Hα-emission of HD 82558 was stronger than in the previous observations by Fekel et al. (1986) and variable, but with no obvious rotational modulation. The Hα-emission strengths of the young pre-main-sequence pair AB Dor - Rst 137 B are compatible with those of the

  20. Renal Involvement in AA Amyloidosis: Clinical Outcomes and Survival

    Directory of Open Access Journals (Sweden)

    Murvet Yilmaz

    2013-03-01

    Full Text Available Background: The natural history of AA amyloidosis is typically progressive, leading to multiple organ failure and death. We analyzed the etiology as well as clinical and laboratory features of patients with biopsy-proven AA amyloidosis and evaluated the ultimate outcome. Methods: Seventy-three patients (24 female; mean age 41.85±15.89 years were analyzed retrospectively. Demographic, clinical and laboratory features were studied and the outcome was assessed. Results: Familial Mediterranean Fever and tuberculosis were the most frequent causes of amyloidosis. Mean serum creatinine and proteinuria at diagnosis were 4.65±4.89 mg/dl and 8.04±6.09 g/day, respectively; and stage I, II, III, IV and V renal disease were present in 19.2%, 13.7%, 16.4%, 11%, and 39.7% of the patients, respectively. ESRD developed in 16 patients during the follow-up period. All of the ESRD patients started a dialysis programme. Thirty patients (41% died during the follow-up period; median patient survival was 35.9±6.12 months. Old age, tuberculosis etiology, advanced renal disease and low serum albumin levels were associated with a worse prognosis. Serum albumin was a predictor of mortality in logistic regression analysis. Conclusion: The ultimate outcome of the patients with AA amyloidosis is poor, possibly due to the late referral to the nephrology clinics. Early referral may be helpful to improve prognosis.

  1. B-cell activating factor (BAFF) plasma level at the time of chronic GvHD diagnosis is a potential predictor of non-relapse mortality.

    Science.gov (United States)

    Saliba, R M; Sarantopoulos, S; Kitko, C L; Pawarode, A; Goldstein, S C; Magenau, J; Alousi, A M; Churay, T; Justman, H; Paczesny, S; Reddy, P; Couriel, D R

    2017-07-01

    Biological markers for risk stratification of chronic GvHD (cGvHD) could improve the care of patients undergoing allogeneic hematopoietic stem cell transplantation. Increased plasma levels of B-cell activating factor (BAFF), chemokine (C-X-C motif) ligand 9 (CXCL9) and elafin have been associated with the diagnosis, but not with outcome in patients with cGvHD. We evaluated the association between levels of these soluble proteins, measured by ELISA at the time of cGvHD diagnosis and before the initiation of therapy, with non-relapse-mortality (NRM). Based on the log-transformed values, factor levels were divided into tertiles defined respectively as low, intermediate, and high levels. On univariable analysis, BAFF levels were significantly associated with NRM, whereas CXCL9 and elafin levels were not. Both low (⩽2.3 ng/mL, hazard ratio (HR)=5.8, P=0.03) and high (>5.7 ng/mL, HR=5.4, P=0.03) BAFF levels were associated with a significantly higher NRM compared with intermediate BAFF level. The significant effect of high or low BAFF levels persisted in multivariable analysis. A subset of cGvHD patients had persistently low BAFF levels. In conclusion, our data show that BAFF levels at the time of cGvHD diagnosis are associated with NRM, and also are potentially useful for risk stratification. These results warrant confirmation in larger studies.

  2. Laboratory Astrophysics Division of the AAS (LAD)

    Science.gov (United States)

    Salama, Farid; Drake, R. P.; Federman, S. R.; Haxton, W. C.; Savin, D. W.

    2012-01-01

    The purpose of the Laboratory Astrophysics Division (LAD) is to advance our understanding of the Universe through the promotion of fundamental theoretical and experimental research into the underlying processes that drive the Cosmos. LAD represents all areas of astrophysics and planetary sciences. The first new AAS Division in more than 30 years, the LAD traces its history back to the recommendation from the scientific community via the White Paper from the 2006 NASA-sponsored Laboratory Astrophysics Workshop. This recommendation was endorsed by the Astronomy and Astrophysics Advisory Committee (AAAC), which advises the National Science Foundation (NSF), the National Aeronautics and Space Administration (NASA), and the U.S. Department of Energy (DOE) on selected issues within the fields of astronomy and astrophysics that are of mutual interest and concern to the agencies. In January 2007, at the 209th AAS meeting, the AAS Council set up a Steering Committee to formulate Bylaws for a Working Group on Laboratory Astrophysics (WGLA). The AAS Council formally established the WGLA with a five-year mandate in May 2007, at the 210th AAS meeting. From 2008 through 2012, the WGLA annually sponsored Meetings in-a-Meeting at the AAS Summer Meetings. In May 2011, at the 218th AAS meeting, the AAS Council voted to convert the WGLA, at the end of its mandate, into a Division of the AAS and requested draft Bylaws from the Steering Committee. In January 2012, at the 219th AAS Meeting, the AAS Council formally approved the Bylaws and the creation of the LAD. The inaugural gathering and the first business meeting of the LAD were held at the 220th AAS meeting in Anchorage in June 2012. You can learn more about LAD by visiting its website at http://lad.aas.org/ and by subscribing to its mailing list.

  3. Laboratory Astrophysics Division of The AAS (LAD)

    Science.gov (United States)

    Salama, Farid; Drake, R. P.; Federman, S. R.; Haxton, W. C.; Savin, D. W.

    2012-10-01

    The purpose of the Laboratory Astrophysics Division (LAD) is to advance our understanding of the Universe through the promotion of fundamental theoretical and experimental research into the underlying processes that drive the Cosmos. LAD represents all areas of astrophysics and planetary sciences. The first new AAS Division in more than 30 years, the LAD traces its history back to the recommendation from the scientific community via the White Paper from the 2006 NASA-sponsored Laboratory Astrophysics Workshop. This recommendation was endorsed by the Astronomy and Astrophysics Advisory Committee (AAAC), which advises the National Science Foundation (NSF), the National Aeronautics and Space Administration (NASA), and the U.S. Department of Energy (DOE) on selected issues within the fields of astronomy and astrophysics that are of mutual interest and concern to the agencies. In January 2007, at the 209th AAS meeting, the AAS Council set up a Steering Committee to formulate Bylaws for a Working Group on Laboratory Astrophysics (WGLA). The AAS Council formally established the WGLA with a five-year mandate in May 2007, at the 210th AAS meeting. From 2008 through 2012, the WGLA annually sponsored Meetings in-a-Meeting at the AAS Summer Meetings. In May 2011, at the 218th AAS meeting, the AAS Council voted to convert the WGLA, at the end of its mandate, into a Division of the AAS and requested draft Bylaws from the Steering Committee. In January 2012, at the 219th AAS Meeting, the AAS Council formally approved the Bylaws and the creation of the LAD. The inaugural gathering and the first business meeting of the LAD were held at the 220th AAS meeting in Anchorage in June 2012. You can learn more about LAD by visiting its website at http://lad.aas.org/ and by subscribing to its mailing list.

  4. Search for Exoplanets around Northern Circumpolar Stars III. Long-Period Radial Velocity Variations in HD 18438 and HD 158996

    Science.gov (United States)

    Bang, Tae-Yang; Lee, Byeong-Cheol; Jeong, Gwang-hui; Han, Inwoo; Park, Myeong-Gu

    2018-02-01

    Detecting exoplanets around giants are useful in understanding the later-stage evolution of planetary systems. We observed the M giant HD 18438 and the K giant HD 158996 as part of a Search for Exoplanets around Northern circumpolar Stars (SENS) and obtained 38 and 24 spectra from 2010 to 2017 using the high-resolution Bohyunsan Observatory Echelle Spectrograph (BOES) at the 1.8m telescope of Bohyunsan Optical Astronomy Observatory in Korea. We obtained precise RV measurements from the spectra and found long-period radial velocity (RV) variations with period 719.0 days for HD 18438 and 820.2 days for HD 158996. We checked the chromospheric activities using Ca II H and H_{α} lines, HIPPARCOS photometry and line bisectors to identify the origin of the observed RV variations. In the case of HD 18438, we conclude that the observed RV variations with period 719.0 days are likely to be caused by the pulsations because the periods of HIPPARCOS photometric and H_{α} EW variations for HD 18438 are similar to that of RV variations in Lomb-Scargle periodogram, and there are no correlations between bisectors and RV measurements. In the case of HD 158996, on the other hand, we did not find any similarity in the respective periodograms nor any correlation between RV variations and line bisector variations. In addition, the probability that the real rotational period can be as longer than the RV period for HD 158996 is only about 4.3%. Thus we conclude that observed RV variations with a period of 820.2 days of HD 158996 are caused by a planetary companion, which has the minimum mass of 14.0 M_{Jup}, the semi-major axis of 2.1 AU, and eccentricity of 0.13 assuming the stellar mass of 1.8 M_{⊙}. HD 158996 is so far one of the brightest and largest stars to harbor exoplanet candidate.

  5. Concordance between (99m)Tc-ECD SPECT and 18F-FDG PET interpretations in patients with cognitive disorders diagnosed according to NIA-AA criteria.

    Science.gov (United States)

    Ito, Kimiteru; Shimano, Yasumasa; Imabayashi, Etsuko; Nakata, Yasuhiro; Omachi, Yoshie; Sato, Noriko; Arima, Kunimasa; Matsuda, Hiroshi

    2014-10-01

    The purpose of this study was to clarify the concordance of diagnostic abilities and interobserver agreement between 18F-fluorodeoxyglucose (FDG) positron emission tomography (PET) and brain perfusion single photon-emission computed tomography (SPECT) in patients with Alzheimer's disease (AD) who were diagnosed according to the research criteria of the National Institute of Aging-Alzheimer's Association Workshop. Fifty-five patients with "AD and mild cognitive impairment (MCI)" (n = 40) and "non-AD" (n = 15) were evaluated with 18F-FDG PET and (99m)Tc-ethyl cysteinate dimer (ECD) SPECT during an 8-week period. Three radiologists independently graded the regional uptake in the frontal, temporal, parietal, and occipital lobes as well as the precuneus/posterior cingulate cortex in both images. Kappa values were used to determine the interobserver reliability regarding regional uptake. The regions with better interobserver reliability between 18F-FDG PET and (99m)Tc-ECD SPECT were the frontal, parietal, and temporal lobes. The (99m)Tc-ECD SPECT agreement in the occipital lobes was not significant. The frontal, temporal, and parietal lobes showed good correlations between 18F-FDG PET and (99m)Tc-ECD SPECT in the degree of uptake, but the occipital lobe and precuneus/posterior cingulate cortex did not show good correlations. The diagnostic accuracy rates of "AD and MCI" ranged from 60% to 70% in both of the techniques. The degree of uptake on 18F-FDG PET and (99m)Tc-ECD SPECT showed significant correlations in the frontal, temporal, and parietal lobes. The diagnostic abilities of 18F-FDG PET and (99m)Tc-ECD SPECT for "AD and MCI," when diagnosed according to the National Institute of Aging-Alzheimer's Association Workshop criteria, were nearly identical. Copyright © 2014 John Wiley & Sons, Ltd.

  6. AA, closed orbit observation pickup

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles QFW, at maximum dispersion. See also 8001372, 8001383, 8010045

  7. AA, closed orbit observation pickup

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles, QFW, at maximum dispersion. See also 8001372,8001383, 8010042

  8. AA, closed orbit observation pickup

    CERN Multimedia

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. See also 8001372, 8010042, 8010045

  9. AA, closed orbit observation pickup

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. Werner Sax contemplates his achievement. See also 8001383, 8010042, 8010045.

  10. HD 104860 and HD 192758: Two Debris Disks Newly Imaged in Scattered Light with the Hubble Space Telescope

    Science.gov (United States)

    Choquet, É.; Bryden, G.; Perrin, M. D.; Soummer, R.; Augereau, J.-C.; Chen, C. H.; Debes, J. H.; Gofas-Salas, E.; Hagan, J. B.; Hines, D. C.; Mawet, D.; Morales, F.; Pueyo, L.; Rajan, A.; Ren, B.; Schneider, G.; Stark, C. C.; Wolff, S.

    2018-02-01

    We present the first scattered-light images of two debris disks around the F8 star HD 104860 and the F0V star HD 192758, respectively ∼45 and ∼67 pc away. We detected these systems in the F110W and F160W filters through our reanalysis of archival Hubble Space Telescope (HST) NICMOS data with modern starlight-subtraction techniques. Our image of HD 104860 confirms the morphology previously observed by Herschel in thermal emission with a well-defined ring at a radius of ∼114 au inclined by ∼58°. Although the outer edge profile is consistent with dynamical evolution models, the sharp inner edge suggests sculpting by unseen perturbers. Our images of HD 192758 reveal a disk at radius ∼95 au inclined by ∼59°, never resolved so far. These disks have low scattering albedos of 10% and 13%, respectively, inconsistent with water ice grain compositions. They are reminiscent of several other disks with similar inclination and scattering albedos: Fomalhaut, HD 92945, HD 202628, and HD 207129. They are also very distinct from brighter disks in the same inclination bin, which point to different compositions between these two populations. Varying scattering albedo values can be explained by different grain porosities, chemical compositions, or grain size distributions, which may indicate distinct formation mechanisms or dynamical processes at work in these systems. Finally, these faint disks with large infrared excesses may be representative of an underlying population of systems with low albedo values. Searches with more sensitive instruments on HST or on the James Webb Space Telescope and using state-of-the art starlight-subtraction methods may help discover more of such faint systems.

  11. Análise da hiperinsuflação pulmonar dinâmica (HD após atividade de vida diária em pacientes com doença pulmonar obstrutiva crônica Analysis of dynamic pulmonary hyperinflation (DH following activities of daily living in patients with chronic obstructive pulmonary disease

    Directory of Open Access Journals (Sweden)

    IMB Sclauser Pessoa

    2007-12-01

    Full Text Available INTRODUÇÃO: A hiperinsuflação dinâmica (HD é um dos mecanismos ventilatórios que podem contribuir para a limitação das atividades de vida diária (AVD em pacientes com Doença Pulmonar Obstrutiva Crônica (DPOC. Os objetivos deste trabalho foram avaliar a presença da HD, pela capacidade inspiratória (CI, e sua razão CI/CPT (capacidade pulmonar total, e a sensação de dispnéia após uma AVD realizada com os membros superiores (MMSS. MÉTODOS: Participaram 32 pacientes com DPOC de moderada a muito grave, com idades entre 54 a 87 anos (69,4 ± 7,4. Os pacientes selecionados foram submetidos a testes de função pulmonar, espirometria e pletismografia de corpo inteiro. Para as manobras espirométricas e dos volumes pulmonares, foi utilizado um sistema convencional (Vmáx22 Autobox. A CI foi determinada usando um sistema de medidas ventilatórias (Vmáx229d. Foi solicitado elevar potes com pesos de 0,5 a 5,0kg no tempo total de 5 minutos, pegando os potes em cima de uma superfície situada no nível da cintura pélvica e posicionando-os em uma prateleira localizada acima do nível da cabeça. Em todos os pacientes, foram avaliados a CI e a escala de Borg para dispnéia. Para a análise dos dados, foram utilizados o teste t de Student para amostras pareadas, a correlação de Pearson, e o teste de Wilcoxon (pINTRODUCTION: Dynamic hyperinflation (DH is one of the ventilatory mechanisms that may contribute towards limiting the activities of daily living (ADLs in patients with chronic obstructive pulmonary disease (COPD. The objectives of this study were to evaluate the presence of DH, by means of inspiratory capacity (IC, IC / total lung capacity (TLC ratio and by the sensation of dyspnea, following an ADL performed using the upper limbs. METHOD: The participants were 32 individuals aged 54 to 87 years (69.4 ± 7.4 who presented moderate-to-severe COPD. The patients selected underwent pulmonary function tests, spirometry and whole

  12. Isolation and characterization of a new Bacillus thuringiensis strain Lip harboring a new cry1Aa gene highly toxic to Ephestia kuehniella (Lepidoptera: Pyralidae) larvae.

    Science.gov (United States)

    El Khoury, Micheline; Azzouz, Hichem; Chavanieu, Alain; Abdelmalak, Nouha; Chopineau, Joël; Awad, Mireille Kallassy

    2014-06-01

    The aim of this study was to characterize new Bacillus thuringiensis strains that have a potent insecticidal activity against Ephestia kuehniella larvae. Strains harboring cry1A genes were tested for their toxicity, and the Lip strain showed a higher insecticidal activity compared to that of the reference strain HD1 (LC50 of Lip and HD1 were 33.27 and 128.61 μg toxin/g semolina, respectively). B. thuringiensis Lip harbors and expresses cry1Aa, cry1Ab, cry1Ac, cry1Ad and cry2A. DNA sequencing revealed several polymorphisms in Lip Cry1Aa and Cry1Ac compared to the corresponding proteins of HD1. The activation process using Ephestia kuehniella midgut juice showed that Lip Cry1A proteins were more stable in the presence of larval proteases. Moreover, LipCry1A proteins exhibited higher insecticidal activity against these larvae. These results indicate that Lip is an interesting strain that could be used as an alternative to the worldwide used strain HD1.

  13. AAS 228: Day 3 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  14. The HD+ dissociative recombination rate coefficient at low temperature

    Directory of Open Access Journals (Sweden)

    Wolf A.

    2015-01-01

    Full Text Available The effect of the rotational temperature of the ions is considered for low-energy dissociative recombination (DR of HD+. Merged beams measurements with HD+ ions of a rotational temperature near 300 K are compared to multichannel quantum defect theory calculations. The thermal DR rate coefficient for a Maxwellian electron velocity distribution is derived from the merged-beams data and compared to theoretical results for a range of rotational temperatures. Good agreement is found for the theory with 300 K rotational temperature. For a low-temperature plasma environment where also the rotational temperature assumes 10 K, theory predicts a considerably higher thermal DR rate coefficient. The origin of this is traced to predicted resonant structures of the collision-energy dependent DR cross section at few-meV collision energies for the particular case of HD+ ions in the rotational ground state.

  15. Cryogenic Characterization of FBK RGB-HD SiPMs

    Science.gov (United States)

    Aalseth, C. E.; Acerbi, F.; Agnes, P.; Albuquerque, I. F. M.; Alexander, T.; Alici, A.; Alton, A. K.; Ampudia, P.; Antonioli, P.; Arcelli, S.; Ardito, R.; Arnquist, I. J.; Asner, D. M.; Back, H. O.; Batignani, G.; Bertoldo, E.; Bettarini, S.; Bisogni, M. G.; Bocci, V.; Bondar, A.; Bonfini, G.; Bonivento, W.; Bossa, M.; Bottino, B.; Bunker, R.; Bussino, S.; Buzulutskov, A.; Cadeddu, M.; Cadoni, M.; Caminata, A.; Canci, N.; Candela, A.; Cantini, C.; Caravati, M.; Cariello, M.; Carlini, M.; Carpinelli, M.; Castellani, A.; Catalanotti, S.; Cataudella, V.; Cavalcante, P.; Cereseto, R.; Chen, Y.; Chepurnov, A.; Chiavassa, A.; Cicalò, C.; Cifarelli, L.; Citterio, M.; Cocco, A. G.; Colocci, M.; Corgiolu, S.; Covone, G.; Crivelli, P.; D'Antone, I.; D'Incecco, M.; Da Rocha Rolo, M. D.; Daniel, M.; Davini, S.; De Candia, A.; De Cecco, S.; De Deo, M.; De Filippis, G.; De Guido, G.; De Rosa, G.; Dellacasa, G.; Demontis, P.; Derbin, A. V.; Devoto, A.; Di Eusanio, F.; Di Pietro, G.; Dionisi, C.; Dolgov, A.; Dormia, I.; Dussoni, S.; Empl, A.; Ferri, A.; Filip, C.; Fiorillo, G.; Fomenko, K.; Franco, D.; Froudakis, G. E.; Gabriele, F.; Gabrieli, A.; Galbiati, C.; Garcia Abia, P.; Gendotti, A.; Ghisi, A.; Giagu, S.; Gibertoni, G.; Giganti, C.; Giorgi, M.; Giovanetti, G. K.; Gligan, M. L.; Gola, A.; Gorchakov, O.; Goretti, A. M.; Granato, F.; Grassi, M.; Grate, J. W.; Grigoriev, G. Y.; Gromov, M.; Guan, M.; Guerra, M. B. B.; Guerzoni, M.; Gulino, M.; Haaland, R. K.; Harrop, B.; Hoppe, E. W.; Horikawa, S.; Hosseini, B.; Hughes, D.; Humble, P.; Hungerford, E. V.; Ianni, An.; Jimenez Cabre, S.; Johnson, T. N.; Keeter, K.; Kendziora, C. L.; Kim, S.; Koh, G.; Korablev, D.; Korga, G.; Kubankin, A.; Kugathasan, R.; Kuss, M.; Li, X.; Lissia, M.; Lodi, G. U.; Loer, B.; Longo, G.; Lussana, R.; Luzzi, L.; Ma, Y.; Machado, A. A.; Machulin, I. N.; Mais, L.; Mandarano, A.; Mapelli, L.; Marcante, M.; Margotti, A.; Mari, S. M.; Mariani, M.; Maricic, J.; Marinelli, M.; Marras, D.; Martoff, C. J.; Mascia, M.; Messina, A.; Meyers, P. D.; Milincic, R.; Moggi, A.; Moioli, S.; Monasterio, S.; Monroe, J.; Monte, A.; Morrocchi, M.; Mu, W.; Muratova, V. N.; Murphy, S.; Musico, P.; Nania, R.; Napolitano, J.; Navrer Agasson, A.; Nikulin, I.; Nosov, V.; Nozdrina, A. O.; Nurakhov, N. N.; Oleinik, A.; Oleynikov, V.; Orsini, M.; Ortica, F.; Pagani, L.; Pallavicini, M.; Palmas, S.; Pandola, L.; Pantic, E.; Paoloni, E.; Paternoster, G.; Pavletcov, V.; Pazzona, F.; Pelczar, K.; Pellegrini, L. A.; Pelliccia, N.; Perotti, F.; Perruzza, R.; Piemonte, C.; Pilo, F.; Pocar, A.; Portaluppi, D.; Poudel, S. S.; Pugachev, D. A.; Qian, H.; Radics, B.; Raffaelli, F.; Ragusa, F.; Randle, K.; Razeti, M.; Razeto, A.; Regazzoni, V.; Regenfus, C.; Reinhold, B.; Renshaw, A. L.; Rescigno, M.; Riffard, Q.; Rivetti, A.; Romani, A.; Romero, L.; Rossi, B.; Rossi, N.; Rubbia, A.; Sablone, D.; Salatino, P.; Samoylov, O.; Sands, W.; Sant, M.; Santorelli, R.; Savarese, C.; Scapparone, E.; Schlitzer, B.; Scioli, G.; Sechi, E.; Segreto, E.; Seifert, A.; Semenov, D. A.; Serci, S.; Shchagin, A.; Shekhtman, L.; Shemyakina, E.; Sheshukov, A.; Simeone, M.; Singh, P. N.; Skorokhvatov, M. D.; Smirnov, O.; Sobrero, G.; Sokolov, A.; Sotnikov, A.; Stanford, C.; Suffritti, G. B.; Suvorov, Y.; Tartaglia, R.; Testera, G.; Tonazzo, A.; Tosi, A.; Trinchese, P.; Unzhakov, E. V.; Vacca, A.; Verducci, M.; Viant, T.; Villa, F.; Vishneva, A.; Vogelaar, B.; Wada, M.; Wahl, J.; Walker, S.; Wang, H.; Wang, Y.; Watson, A. W.; Westerdale, S.; Wilhelmi, J.; Williams, R.; Wojcik, M. M.; Wu, S.; Xiang, X.; Xiao, X.; Yang, C.; Ye, Z.; Zappa, F.; Zappalà, G.; Zhu, C.; Zichichi, A.; Zuzel, G.

    2017-09-01

    We report on the cryogenic characterization of Red Green Blue - High Density (RGB-HD) SiPMs developed at Fondazione Bruno Kessler (FBK) as part of the DarkSide program of dark matter searches with liquid argon time projection chambers. A cryogenic setup was used to operate the SiPMs at varying temperatures and a custom data acquisition system and analysis software were used to precisely characterize the primary dark noise, the correlated noise, and the gain of the devices. We demonstrate that FBK RGB-HD SiPMs with low quenching resistance (RGB-HD-LRq) can be operated from 40 K to 300 K with gains in the range 105 to 106 and noise rates at a level of around 1 Hz/mm2.

  16. The Discovery of HD 37605c and a Dispositive Null Detection of Transits of HD 37605b

    DEFF Research Database (Denmark)

    Xuesong Wang, Sharon; Wright, Jason T.; Cochran, William

    2012-01-01

    We report the radial-velocity discovery of a second planetary mass companion to the K0 V star HD 37605, which was already known to host an eccentric, P~55 days Jovian planet, HD 37605b. This second planet, HD 37605c, has a period of ~7.5 years with a low eccentricity and an Msini of ~3.4 MJup. Our...... the predicted ephemeris, we performed a transit search for HD 37605b with the photometric data taken by the T12 0.8-m Automatic Photoelectric Telescope (APT) and the Microvariability and Oscillations of Stars (MOST) satellite. Though the APT photometry did not capture the transit window, it characterized...... the stellar activity of HD 37605, which is consistent of it being an old, inactive star, with a tentative rotation period of 57.67 days. The MOST photometry enabled us to report a dispositive null detection of a non-grazing transit for this planet. Within the predicted transit window, we exclude an edge...

  17. Stellar parameters of the post-AGB star HD 56126 from observations and non-linear radiative pulsation models

    Science.gov (United States)

    Le Coroller, Herve; Fokin, A. B.; Lèbre, A.; Gillet, D.

    2001-05-01

    After the AGB phase and before becoming planetary nebulae, the stars cross a post-AGB phase during a short time of approximately 10 000 years. Stars at this evolution stage are thus statistically rare and their pulsation mechanisms, probably related to the propagation of shocks in their atmosphere, remain badly known. It thus appeared essential to carry out an in-depth study on a typical post-AGB object. Thus, we present an analysis of the spectroscopic and photometric data on HD 56126, a post-AGB variable star, rich in carbon. A previous work (Barthes et al, 2000, A&A 359,168) finds a 37 days pulsation period. We present here the results of a non-linear model which allowed to deduce the stellar parameters of this star (Teff, L, M). We also discuss the limits of such a model to simulate the complex atmospheric dynamics of post-AGB objects.

  18. A spectroscopic analysis of the chemically peculiar star HD 207561

    Science.gov (United States)

    Joshi, S.; Semenko, E.; Martinez, P.; Sachkov, M.; Joshi, Y. C.; Seetha, S.; Chakradhari, N. K.; Mary, D. L.; Girish, V.; Ashoka, B. N.

    2012-08-01

    In this paper we present a high-resolution spectroscopic analysis of the chemically peculiar star HD 207561. During a survey programme to search for new rapidly oscillating Ap (roAp) stars in the Northern hemisphere, Joshi et al. observed significant photometric variability on two consecutive nights in the year 2000. The amplitude spectra of the light curves obtained on these two nights showed oscillations with a frequency of 2.79 mHz (P ˜ 6 min). However, subsequent follow-up observations could not confirm any rapid variability. In order to determine the spectroscopic nature of HD 207561, high-resolution spectroscopic and spectropolarimetric observations were carried out. A reasonable fit of the calculated Hβ line profile to the observed one yields an effective temperature (Teff) and surface gravity (log g) of 7300 K and 3.7 dex, respectively. The derived projected rotational velocity (v sin i) for HD 207561 is 74 km s-1, indicative of a relatively fast rotator. The position of HD 207561 in the Hertzsprung-Russell diagram implies that this is slightly evolved from the main-sequence and located well within the δ-Scuti instability strip. The abundance analysis indicates the star has slight underabundances of Ca and Sc and mild overabundances of iron-peak elements. The spectropolarimetric study of HD 207561 shows that the effective magnetic field is within the observational error of 100 G. The spectroscopic analysis revealed that the star has most of the characteristics similar to an Am star, rather than an Ap star, and that it lies in the δ-Scuti instability strip; hence roAp pulsations are not expected in HD 207561, but low-overtone modes might be excited. The present work is based on the analysis of data collected with the Russian 6-m telescope BTA operated by the Special Astrophysical Observatory of the Russian Academy of Sciences (SAO RAS).

  19. Quality of Life in Prodromal HD: Qualitative Analyses of Discourse from Participants and Companions

    Directory of Open Access Journals (Sweden)

    Rebecca E. Ready

    2011-01-01

    Full Text Available Persons who are at risk for Huntington's Disease (HD can be tested for the HD gene expansion before symptom onset. People with the gene expansion, but no clinical diagnosis, are in the prodromal phase of HD. This study explored quality of life (QOL in prodromal HD. Interviews about QOL, conducted with 9 prodromal HD participants and 6 companions, were transcribed. Discourse was coded for emotional valence, content (e.g., coping, spirituality, interpersonal relationships, HD in others, and employment, and time frame (e.g., current, past, and future. Respondents were more positive than negative about the present, which was their major focus. The most common statements were about positive attitudes. Positive statements were made about spirituality, and negative statements were made about HD in other people. Relationships, employment, and coping with HD reflected both positivity and negativity. Participants and companions spoke of the future with different concerns. Applicability of findings to the clinical management of HD are discussed.

  20. Nutritional status of twice and thrice-weekly hemodialysis patients with weekly Kt/V > 3.6.

    Science.gov (United States)

    Supasyndh, Ouppatham; Satirapoj, Bancha; Seenamngoen, Sudarat; Yongsiri, Somchai; Choovichian, Punbuppa; Vanichakarn, Supat

    2009-05-01

    Multiple lines of evidence have indicated that the dose of hemodialysis (HD) affects patient outcome. According to K-DOQI, daily spKt/V > 1.2 predicts the morbidity and mortality among thrice-weekly HD. However in developing countries, about three-fourths of end stage renal disease patients undergo twice-weekly HD. No data studied the outcome and nutritional status between twice- and thrice-weekly HD patients. To compare the nutritional parameters in twice- and thrice-weekly HD patients who had weekly Kt/V > 3.6. The cross-sectional study was performed in the HD unit of the National Kidney Foundation of Thailand. One hundred and forty two informed consent HD patients were enrolled in the present study. Nutritional status was evaluated following a HD treatment by bioelectrical impedance analysis. All patients were interviewed for three-day food record and data were analyzed by Inmucal software program. Sixty patients had thrice-weekly HD and 82 patients were on twice-weekly HD. The characteristics and duration of dialysis of both groups were similar except age. Duration of dialysis in thrice-weekly HD group was 82.64 +/- 50 82 and twice-weekly HD group was 68.92 +/- 31.49 months. The mean age of the thrice-weekly HD group and twice-weekly HD group patients were 47.78 +/- 9.89 and 41.63 +/- 10.47 years, respectively (p nutrition parameters except daily energy intake which was lower in the thrice-weekly HD group than twice-weekly HD group (19.21 +/- 6.42 vs. 25.02 +/- 7.70 kcal/kg/day, p patients with delivered weekly Kt/V > 3.6, nutritional status of patients undergoing twice-weekly HD are not different from that of thrice-weekly HD patients. Higher energy intake in twice-weekly HD patients might be the explanation.

  1. Vulnerability Analysis of HD Photo Image Viewer Applications

    Science.gov (United States)

    2007-09-01

    setting the trailing null to non-null (maybe for IFD entries using “ASCII” as the data type). This could be employed with Adobe Photoshop metadata tags...Photo file with the first IFD advertising an offset to a second IFD, but only one IFD exists in the file. This case reveals how the image viewer...ability to handle a HD Photo file which advertises that it the HD Photo image is laid out in Frequency mode, even though the image itself was created

  2. AAS 228: Day 1 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Come visit astrobites at the AAS booth we have swag!Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto hear from undergrads who already know and love the site, educators who want to use it in their classrooms, and students who had not yet been introduced to astrobites and were excited about a new resource!For the rest of the meeting we will be stationed at theAAS booth in the exhibit hall (booth #211-213), so drop by if you want to learn more (or pick up swag: weve got lots of stickers and sunglasses)!Mondaymorning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended this morning.Opening Address(by Susanna Kohler)AAS President Meg Urry kicked off the meeting this morning at 8am with an overview of some of the great endeavors AAS is supporting. We astrobiters had personal motivation to drag ourselves out of bed that early: during this session, Urryannounced the new partnership between AAS and astrobites!Urry touched on some difficult topics in her welcome, including yesterdays tragedy in Orlando. Shereiteratedthe AASs support fortheCommittee for Sexual-Orientation and Gender Minorities in Astronomy (SGMA). She also reminded meeting attendees about the importance ofkeeping conference interactions professional, and pointed to the meetings anti-harassment policy.Partnership Announcement (by Michael Zevin)This morning, the American Astronomical Society announced the new partnership that it will have with Astrobites! We are beyond excited to embark on this new partnership with the

  3. Effects of relative blood volume-controlled hemodialysis on blood pressure and volume status in hypertensive patients

    NARCIS (Netherlands)

    Dasselaar, J.J.; Huisman, R.M.; De Jong, P.E.; Burgerhof, J.G.M.; Franssen, C.F.M.

    2007-01-01

    In hypertensive hemodialysis (HD) patients, dry weight reduction to normalize blood pressure (BP) often results in increased frequency of HD hypotension. Because HD with blood volume tracking (BVT) has been shown to improve intra-HD hemodynamic stability, we performed a prospective, randomized study

  4. In vitro experiments for the development of a high density (HD) barium sulfate contrast medium

    International Nuclear Information System (INIS)

    Klein, J.

    1986-01-01

    In vitro experiments with the high-density (HD) barium meal Falibaryt HD are described. Several charges of BaSO 4 were tested together with certain additives influencing dispersion, stability of the suspension, flowability, surface tension etc. Particle size spectra were measured by the manufacturer, VEB Fahlberg-List. With a simple PVC test plate containing several grooves simulating small details (areae gastricae) the diagnostic capabilities of the HD contrast medium were evaluated in an in vitro test. The developed barium meal Falibaryt HD is in its physical and chemical parameters comparable with Prontobario-HD, one of the best HD barium meals. (author)

  5. Simultaneous X-Ray and UV Spectroscopy of the Symbiotic HD 154791

    Science.gov (United States)

    Chakrabarty, Deepto

    2005-01-01

    Our program consisted of three observations of the symbiotic neutron stadred giant binary 4U 1700+24/HD154791. Using an earlier 2002 TOO observation made in response to a new transient X-ray outburst, we had previously discovered a redshifted O VII line and submitted a paper on this discovery to the journal Astronomy and Astrophysics. In these new observations, we from analysis of the 2002 TOO observation of the symbiotic neutron-star binary 4U 1700+24, made in response to detection of a new transient outburst, we discovered a redshifted Oxygen VIII line (in collaboration with A. Tiengo of UVA), and submitted a paper on this result to A&A. Analysis of the three subsequent observations has found a number of other features also due to ionized oxygen, which we have found to vary as the source transits from outburst to quiescence. A paper describing these observations is being prepared for submission to the Astrophysical Journal, led by Co-I Duncan Galloway.

  6. Fusion with highly spin polarized HD and D2

    International Nuclear Information System (INIS)

    Honig, A.

    1992-01-01

    This report discusses the following topics relating to inertial confinement with spin polarized hydrogen targets: low temperature implementation of mating a target to omega; dilution-refrigerator cold-entry and retrieval system; target shell tensile strength characterization at low temperatures; and proton and deuteron spin-lattice relaxation measurements in HD in the millikelvin temperature range

  7. Spectroscopic Variability of Supergiant Star HD14134, B3Ia

    Indian Academy of Sciences (India)

    Y. M. Maharramov

    2017-06-19

    Jun 19, 2017 ... Abstract. Profile variations in the Hα and Hβ lines in the spectra of the star HD14134 are investigated using observations carried out in 2013–2014 and 2016 with the 2-m telescope at the Shamakhy Astrophysical Obser- vatory. The absorption and emission components of the Hα line are found to disappear ...

  8. Treating AD/HD with Hypnosis and Neurotherapy.

    Science.gov (United States)

    Barabasz, Arreed; Barabasz, Marianne

    2000-01-01

    Presents details of Instant Alert Hypnosis procedure as an adjunct to neurotherapy in the treatment of attention deficit/hyperactivity disorder. Discusses AD/HD diagnostic issues, demographics, traditional treatments, neurological basis, EEG assessment, implications for the use of hypnosis, and the efficacy and promise of neurotherapy with and…

  9. Spectroscopic Binaries near the North Galactic Pole Paper 24: HD ...

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging Solutions)

    Abstract. The four stars treated in this paper have been under observation with photoelectric radial-velocity spectrometers for many years. They have proved to be binaries with periods of 30, 1828, 1514 and 822 days respec- tively; the orbits are of modest eccentricity apart from that of HD 110743 which is indistinguishable ...

  10. HD 150136: towards one of the most massive systems?

    NARCIS (Netherlands)

    Mahy, L.; Gosset, E.; Sana, H.A.A.; Rauw, G.; Fauchez, T.; Nitschelm, C.

    2011-01-01

    We present the preliminary results of an intensive monitoring devoted to HD 150136. Already quoted as an O3+O6 binary, we detected a third O-type component physically linked to the system, making it one of the nearest (1.3 kpc) most massive systems known until now (~134M⊙). To determine the physical

  11. H/D isotope effects in high temperature proton conductors

    DEFF Research Database (Denmark)

    Bonanos, Nikolaos; Huijser, A.; Poulsen, Finn Willy

    2015-01-01

    -H/O-D vibration frequencies, the mobility of H+/D+ carriers, the kinetics of the electrochemical oxidation of H2/D2, the solubilities of H2O/D2O and, finally, the spontaneous electromotive force that appears across H2/D2 cells with proton conducting electrolytes. Comparable work on tritium-exchanged materials...

  12. Dosimetric validation of Monaco treatment planning system on an Elekta VersaHD linear accelerator.

    Science.gov (United States)

    Narayanasamy, Ganesh; Saenz, Daniel L; Defoor, Dewayne; Papanikolaou, Niko; Stathakis, Sotirios

    2017-11-01

    The purpose of this study is to perform dosimetric validation of Monaco treatment planning system version 5.1. The Elekta VersaHD linear accelerator with high dose rate flattening filter-free photon modes and electron energies was used in this study. The dosimetric output of the new Agility head combined with the FFF photon modes warranted this investigation into the dosimetric accuracy prior to clinical usage. A model of the VersaHD linac was created in Monaco TPS by Elekta using commissioned beam data including percent depth dose curves, beam profiles, and output factors. A variety of 3D conformal fields were created in Monaco TPS on a combined Plastic water/Styrofoam phantom and validated against measurements with a calibrated ion chamber. Some of the parameters varied including source to surface distance, field size, wedges, gantry angle, and depth for all photon and electron energies. In addition, a series of step and shoot IMRT, VMAT test plans, and patient plans on various anatomical sites were verified against measurements on a Delta 4 diode array. The agreement in point dose measurements was within 2% for all photon and electron energies in the homogeneous phantom and within 3% for photon energies in the heterogeneous phantom. The mean ± SD gamma passing rates of IMRT test fields yielded 93.8 ± 4.7% based on 2% dose difference and 2 mm distance-to-agreement criteria. Eight previously treated IMRT patient plans were replanned in Monaco TPS and five measurements on each yielded an average gamma passing rate of 95% with 6.7% confidence limit based on 3%, 3 mm gamma criteria. This investigation on dosimetric validation ensures accuracy of modeling VersaHD linac in Monaco TPS thereby improving patient safety. © 2017 The Authors. Journal of Applied Clinical Medical Physics published by Wiley Periodicals, Inc. on behalf of American Association of Physicists in Medicine.

  13. (PCL/AA) hydrogel for controlled drug delivery

    Indian Academy of Sciences (India)

    Administrator

    PCL-g-AA) on the .... Solvent replacement method was used for porosity meas- urement. Weighed dried discs were immersed in .... Regression coefficient (r) values obtained from PCL/AA hydrogels at varying contents of AA and EGDMA are.

  14. Mesenchymal stromal cells for treatment of steroid-refractory GvHD: a review of the literature and two pediatric cases

    Directory of Open Access Journals (Sweden)

    Wernicke Caroline M

    2011-08-01

    Full Text Available Abstract Severe acute graft versus host disease (GvHD is a life-threatening complication after allogeneic hematopoietic stem cell transplantation. Human mesenchymal stromal cells (MSCs play an important role in endogenous tissue repair and possess strong immune-modulatory properties making them a promising tool for the treatment of steroid-refractory GvHD. To date, a few reports exist on the use of MSCs in treatment of GvHD in children indicating that children tend to respond better than adults, albeit with heterogeneous results. We here present a review of the literature and the clinical course of two instructive pediatric patients with acute steroid-refractory GvHD after haploidentical stem cell transplantation, which exemplify the beneficial effects of third-party transplanted MSCs in treatment of acute steroid-refractory GvHD. Moreover, we provide a meta-analysis of clinical studies addressing the outcome of patients with steroid-refractory GvHD and treatment with MSCs in adults and in children (n = 183; 122 adults, 61 children. Our meta-analysis demonstrates that the overall response-rate is high (73.8% and confirms, for the first time, that children indeed respond better to treatment of GvHD with MSCs than adults (complete response 57.4% vs. 45.1%, respectively. These data emphasize the significance of this therapeutic approach especially in children and indicate that future prospective studies are needed to assess the reasons for the observed differential response-rates in pediatric and adult patients.

  15. ALMA and VLA observations of the HD 141569 system

    Science.gov (United States)

    White, Jacob Aaron; Boley, A. C.; MacGregor, M. A.; Hughes, A. M.; Wilner, D. J.

    2018-03-01

    We present VLA 9 mm (33 GHz) and archival ALMA 2.9 mm (103 GHz) observations of the HD 141569 system. The VLA observations achieve a resolution of 0.25 arcsec (˜28 au) and a sensitivity of 4.7 μJy beam- 1. We find (1) a 52 ± 5 μJy point source at the location of HD 141569A that shows potential variability, (2) the detected flux is contained within the SED-inferred central clearing of the disc meaning the spectral index of the dust disc is steeper than previously inferred, and (3) the M dwarf companions are also detected and variable. Previous lower resolution VLA observations (semester 14A) found a higher flux density, interpreted as solely dust emission. When combined with ALMA observations, the VLA 14A observations suggested the spectral index, and grain size distribution of HD 141569's disc was shallow and an outlier among debris systems. Using archival ALMA observations of HD 141569 at 0.87 and 2.9 mm, we find a dust spectral index of αmm = 1.81 ± 0.20. The VLA 16A flux corresponds to a brightness temperature of ˜5 × 106 K, suggesting strong non-disc emission is affecting the inferred grain properties. The VLA 16A flux density of the M2V companion HD 141569B is 149 ± 9 μJy, corresponding to a brightness temperature of ˜2 × 108 K and suggesting significant stellar variability when compared to the VLA14A observations, which are smaller by a factor of ˜6.

  16. Risk factors and outcomes of cytomegalovirus viremia in pediatric hematopoietic stem cell transplantation patients

    Directory of Open Access Journals (Sweden)

    Jhong-Lin Wu

    2017-06-01

    Conclusion: In pediatric posttransplantation patients, CMV viremia mostly occurred within 100 days after transplantation. Risk factors associated with CMV viremia include older diagnostic age, leukemic patients, unrelated donor HSCT, pretransplant ATG use, GvHD, and gastrointestinal GvHD.

  17. THE DISCOVERY OF HD 37605c AND A DISPOSITIVE NULL DETECTION OF TRANSITS OF HD 37605b

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Sharon Xuesong; Wright, Jason T.; Mahadevan, Suvrath [Department of Astronomy and Astrophysics, 525 Davey Laboratory, Pennsylvania State University, University Park, PA 16802 (United States); Cochran, William; Endl, Michael; MacQueen, Phillip J. [McDonald Observatory, University of Texas, Austin, TX 78712 (United States); Kane, Stephen R.; Von Braun, Kaspar [NASA Exoplanet Science Institute, Caltech, MS 100-22, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); Henry, Gregory W. [Center of Excellence in Information Systems, Tennessee State University, 3500 John A. Merritt Boulevard, Box 9501, Nashville, TN 37209 (United States); Payne, Matthew J.; Ford, Eric B. [Department of Astronomy, University of Florida, 211 Bryant Space Science Center, P.O. Box 112055, Gainesville, FL 32611 (United States); Valenti, Jeff A. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Antoci, Victoria; Dragomir, Diana; Matthews, Jaymie M. [Department of Physics and Astronomy, University of British Columbia, Vancouver, BC V6T1Z1 (Canada); Howard, Andrew W.; Marcy, Geoffrey W.; Isaacson, Howard, E-mail: xxw131@psu.edu, E-mail: jtwright@astro.psu.edu [Department of Astronomy, University of California, Berkeley, CA 94720 (United States)

    2012-12-10

    We report the radial velocity discovery of a second planetary mass companion to the K0 V star HD 37605, which was already known to host an eccentric, P {approx} 55 days Jovian planet, HD 37605b. This second planet, HD 37605c, has a period of {approx}7.5 years with a low eccentricity and an Msin i of {approx}3.4 M{sub Jup}. Our discovery was made with the nearly 8 years of radial velocity follow-up at the Hobby-Eberly Telescope and Keck Observatory, including observations made as part of the Transit Ephemeris Refinement and Monitoring Survey effort to provide precise ephemerides to long-period planets for transit follow-up. With a total of 137 radial velocity observations covering almost 8 years, we provide a good orbital solution of the HD 37605 system, and a precise transit ephemeris for HD 37605b. Our dynamic analysis reveals very minimal planet-planet interaction and an insignificant transit time variation. Using the predicted ephemeris, we performed a transit search for HD 37605b with the photometric data taken by the T12 0.8 m Automatic Photoelectric Telescope (APT) and the MOST satellite. Though the APT photometry did not capture the transit window, it characterized the stellar activity of HD 37605, which is consistent of it being an old, inactive star, with a tentative rotation period of 57.67 days. The MOST photometry enabled us to report a dispositive null detection of a non-grazing transit for this planet. Within the predicted transit window, we exclude an edge-on predicted depth of 1.9% at the >>10{sigma} level, and exclude any transit with an impact parameter b > 0.951 at greater than 5{sigma}. We present the BOOTTRAN package for calculating Keplerian orbital parameter uncertainties via bootstrapping. We made a comparison and found consistency between our orbital fit parameters calculated by the RVLIN package and error bars by BOOTTRAN with those produced by a Bayesian analysis using MCMC.

  18. THE DISCOVERY OF HD 37605c AND A DISPOSITIVE NULL DETECTION OF TRANSITS OF HD 37605b

    International Nuclear Information System (INIS)

    Wang, Sharon Xuesong; Wright, Jason T.; Mahadevan, Suvrath; Cochran, William; Endl, Michael; MacQueen, Phillip J.; Kane, Stephen R.; Von Braun, Kaspar; Henry, Gregory W.; Payne, Matthew J.; Ford, Eric B.; Valenti, Jeff A.; Antoci, Victoria; Dragomir, Diana; Matthews, Jaymie M.; Howard, Andrew W.; Marcy, Geoffrey W.; Isaacson, Howard

    2012-01-01

    We report the radial velocity discovery of a second planetary mass companion to the K0 V star HD 37605, which was already known to host an eccentric, P ∼ 55 days Jovian planet, HD 37605b. This second planet, HD 37605c, has a period of ∼7.5 years with a low eccentricity and an Msin i of ∼3.4 M Jup . Our discovery was made with the nearly 8 years of radial velocity follow-up at the Hobby-Eberly Telescope and Keck Observatory, including observations made as part of the Transit Ephemeris Refinement and Monitoring Survey effort to provide precise ephemerides to long-period planets for transit follow-up. With a total of 137 radial velocity observations covering almost 8 years, we provide a good orbital solution of the HD 37605 system, and a precise transit ephemeris for HD 37605b. Our dynamic analysis reveals very minimal planet-planet interaction and an insignificant transit time variation. Using the predicted ephemeris, we performed a transit search for HD 37605b with the photometric data taken by the T12 0.8 m Automatic Photoelectric Telescope (APT) and the MOST satellite. Though the APT photometry did not capture the transit window, it characterized the stellar activity of HD 37605, which is consistent of it being an old, inactive star, with a tentative rotation period of 57.67 days. The MOST photometry enabled us to report a dispositive null detection of a non-grazing transit for this planet. Within the predicted transit window, we exclude an edge-on predicted depth of 1.9% at the >>10σ level, and exclude any transit with an impact parameter b > 0.951 at greater than 5σ. We present the BOOTTRAN package for calculating Keplerian orbital parameter uncertainties via bootstrapping. We made a comparison and found consistency between our orbital fit parameters calculated by the RVLIN package and error bars by BOOTTRAN with those produced by a Bayesian analysis using MCMC.

  19. First circulating beam in the AA

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.56 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are too numerous to name them all, but the 3 most prominent ones are at the centre (left to right): Roy Billinge (Joint AA Project Leader, with his hand on the control box), Eifionydd Jones (white shirt), Simon van der Meer (spiritus rector and Joint AA Project Leader). The first antiprotons were injected, made to circulate and cooled soon after, on 14 July 1980.

  20. 76 FR 2243 - List of Approved Spent Fuel Storage Casks: NUHOMS ® HD System Revision 1

    Science.gov (United States)

    2011-01-13

    ... temperature from -20 [deg]F to -21 [deg]F; expand the authorized contents of the NUHOMS [supreg] HD System to... contents of the NUHOMS [supreg] HD System to include pressurized water reactor fuel assemblies with control... contents of the NUHOMS [supreg] HD System to include pressurized water reactor fuel assemblies with control...

  1. AAS 228: Day 3 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session 2015 Newton Lacy Pierce Prize Lecture: The Elephant in the Room: Effects of Distant, Massive Companions on Planetary System Architectures (by Leonardo dos Santos)The first session on Wednesday at 228th AAS Meeting was the Newton Lacy Pierce Prize Lecture by Heather Knutson (California Institute of Technology). This talk featured a broad range of research efforts on exoplanets, with the main focus on how we study the composition of their atmospheres, and how multi-body interactions carve the structure of the planetary systems we observe.One of her first points is the well-known idea that the Solar System is an oddball, compared to the exoplanet systems we have found so far: most of these systems contain hot Jupiters and mini-Neptunes at very close-in orbits around their host stars. Moreover, even when studying their transmission spectra, it is difficult to know the exact composition of their atmospheres.Knutson: it is difficult to constrain atmospheric composition of exoplanets (H-poor or H-rich+clouds?) #aas228pic.twitter.com/LdyN4o9RC7 astrobites (@astrobites) June 15, 2016The main proposal on how these systems formed is the migration scenario. In order to validate this idea, Dr. Knutson and her group The Friends of Hot Jupiters study systems with close-in gas giants and their frequency of binary companions, which are supposed to be the main culprits causing gas-giant migration. They found that approximately half of the observed systems have long-distance companions, providing strong validation of the migration scenario. Moreover, Dr. Knutson speculates that wide binaries have more

  2. Clinical outcomes and quality of life in hemodialysis diabetic patients versus non-diabetics

    OpenAIRE

    Soleymanian, Tayebeh; Kokabeh, Zeinab; Ramaghi, Rozita; Mahjoub, Alireza; Argani, Hassan

    2016-01-01

    Background Diabetes is the leading cause of end stage renal disease (ESRD) worldwide. Objectives We compared the clinical outcomes in diabetic patients on hemodialysis (HD) with non-diabetics. Patients and Methods Adult maintenance HD patients (N= 532) from 9 HD facilities were enrolled to this prospective cohort study in September 2012. Causes of death, hospitalization, and HD exit were recorded in a median 28 months follow up period. Results Forty-one percent of patients were diabetic. Diab...

  3. AAS 228: Day 1 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session: From Space Archeology to Serving the World Today: A 20-year Journey from the Jungles of Guatemala to a Network of Satellite Remote Sensing Facilities Around the World(by Michael Zevin)In the conferences second plenary session, NASAs Daniel Irwin turned the eyes of the conference back to Earth by highlighting the huge impact that NASA missions play in protecting and developing our own planet.Daniel Irwin: using satellite imagery to detect differences in vegetation and find ancient Mayan cities. #aas228 pic.twitter.com/9LFPQdCHTM astrobites (@astrobites) June 13, 2016Irwin came to be involved in NASA through his work mapping Guatemalan jungles, where he would spend 22 days at a time exploring the treacherous jungles on foot armed with a 1st generation GPS, a compass, and a machete. A colleague introduced Irwin to the satellite imagery thathe was exploring, demonstratinghow these images are a strong complement to field work. The sharing of this satellite data with nearby villages helped to show the encroachment of agriculture and the necessity of connecting space to the village. Satellite imagery also played a role in archeological endeavors, uncovering dozens of Mayan cities that have been buried for over a millennia by vegetation, and it provided evidence that the fall of the Mayan civilization may have been due to massive deforestation that ledto drought.Glacial retreat in Chile imaged by ISERV.Irwin displayed the constellation of NASAs Earth-monitoring satellites that have played an integral role in conserving our planet and alerting the world of natural disasters. He also showed

  4. HD 46487 is Now a Classical Be Star

    Science.gov (United States)

    Whelan, D. G.; Baker, R. D.

    2017-06-01

    We present the first observations of hydrogen line emission detected around the B-type star HD 46487, a well-studied star in the CoRoT field of view. The emission is only evident in the H-alpha line, for which the observed violet-red peak separation (Delta v_{p}) is typical of a Be star with a circumstellar disk. The absence of dust emission from the infrared spectral energy distribution excludes the possibility of a very young star. The star's magnitude (V=5.079) and regular use in the literature for a variety of studies suggests that the line emission had a high probability of being found previously, had it been evident; since such was not the case, we believe that the Be phenomenon for HD 46487 has only very recently "turned on." We therefore recommend that this star be spectroscopically and photometrically monitored to track continued changes to its circumstellar morphology.

  5. HD 38452 - J. R. Hind's star that changed colour

    Science.gov (United States)

    Warner, Brian; Sneden, Christopher

    1988-01-01

    In 1851, John Russell Hind announced that a star previously observed by him to be very red had become bluish white in color. It is shown that this star, HD 38451, is a ninth magnitude shell star which presumably was ejecting a shell when Hind first observed it. From high dispersion coude spectra, low dispersion IUE spectra, and ground-based photometry, HD 38451 is found to be a normal A21V shell star. Its current values of E(B-V) of about 0.14 is probably caused by interstellar rather than circumstellar reddening. There remains a problem to reconcile the large amount of reddening present when Hind first observed the star with its evidently small diminution in visual brightness at that time.

  6. Magnetic horn of the Antiproton Accumulator (AA)

    CERN Multimedia

    Photographic Service

    1988-01-01

    In the 1960s, the invention of this "current sheet lens" has helped to greatly improve the flux of neutrino beams. It was used again at the AA, collecting antiprotons from the production target at angles too large to fit into the acceptance of the AA. It was machined from aluminium to a thickness of 1.4 mm and pulsed at 400 kA for 15 microseconds (half-sine).

  7. Dynamic behavior of PE-HD pipes grade

    Czech Academy of Sciences Publication Activity Database

    Trnka, Jan; Buchar, Jaroslav; Nezbedová, E.

    2017-01-01

    Roč. 373, č. 1 (2017), č. článku 1700038. ISSN 1022-1360 R&D Projects: GA MŠk(CZ) EF15_003/0000493 Institutional support: RVO:61388998 Keywords : dynamic behavior * PE-HD * split Hopkinson pressure bar test * strain rate Subject RIV: JI - Composite Materials OBOR OECD: Composites (including laminates, reinforced plastics, cermets, combined natural and synthetic fibre fabrics http://onlinelibrary.wiley.com/doi/10.1002/masy.201700038/full

  8. El medio interestelar alrededor de estrellas Of: HD 108

    Science.gov (United States)

    Cappa, C.; Testori, J. C.

    Hemos analizado la distribución del hidrógeno neutro interestelar en la vecindad de la estrella Of HD 108 en base a perfiles de la línea de 21 cm. Estos datos nos han permitido encontrar una probable burbuja interestelar asociada a la estrella. Comparamos estos resultados con la emisión en otros rangos espectrales y estimamos los principales parámetros físicos de la estructura.

  9. Searching for stable orbits in the HD 10180 planetary system

    Directory of Open Access Journals (Sweden)

    Laskar J.

    2011-02-01

    Full Text Available A planetary system with at least seven planets has been found around the star HD 10180. However, the traditional Keplerian and n-body fits to the data provide an orbital solution that becomes unstable very quickly, which may quest the reliability of the observations. Here we show that stable orbital configurations can be obtained if general relativity and long-term dissipation raised by tides on the innermost planet are taken into account.

  10. Delay Tolerance: A Therapeutic Possibility for AD/HD?

    Directory of Open Access Journals (Sweden)

    Edmund J. S. Sonuga-Barke

    2004-01-01

    on these two insights to explore the possibility that the motivational alterations underpinning delay aversion can be modified through specific training regimes in a way equivalent to that found with executive and attentional training. The requirements for such an approach are set out. Delay fading is proposed as a possible basis for reorganizing delay experience, altering the incentive value of delay (e.g., increasing tolerance for delay, thereby reducing AD/HD symptoms.

  11. Short-term Outcome of Coronary Artery Bypass Grafting in Patients ...

    African Journals Online (AJOL)

    Introduction: Coronary artery disease is a major cause of death in patients on maintenance hemodialysis (HD). The morbidity and mortality of coronary artery bypass grafting (CABG) for patients on chronic HD are reported to be high. In the present study, the outcome of CABG in a group of HD patients was examined.

  12. Does hepatitis C increase the accumulation of advanced glycation end products in haemodialysis patients?

    NARCIS (Netherlands)

    Arsov, Stefan; Graaff, Reindert; Morariu, Aurora M.; van Oeveren, Wim; Smit, Andries J.; Busletic, Irena; Trajcevska, Lada; Selim, Gjulsen; Dzekova, Pavlina; Stegmayr, Bernd; Sikole, Aleksandar; Rakhorst, Gerhard

    Methods. AGE accumulation was measured by means of skin autofluorescence (AF) in 92 haemodialysis (HD) patients and 93 age-matched healthy controls. In the HD patients, CVD-related biochemical variables were also measured. The HD patients were tested for hepatitis C virus (HCV) antibodies and

  13. HD Photo: a new image coding technology for digital photography

    Science.gov (United States)

    Srinivasan, Sridhar; Tu, Chengjie; Regunathan, Shankar L.; Sullivan, Gary J.

    2007-09-01

    This paper introduces the HD Photo coding technology developed by Microsoft Corporation. The storage format for this technology is now under consideration in the ITU-T/ISO/IEC JPEG committee as a candidate for standardization under the name JPEG XR. The technology was developed to address end-to-end digital imaging application requirements, particularly including the needs of digital photography. HD Photo includes features such as good compression capability, high dynamic range support, high image quality capability, lossless coding support, full-format 4:4:4 color sampling, simple thumbnail extraction, embedded bitstream scalability of resolution and fidelity, and degradation-free compressed domain support of key manipulations such as cropping, flipping and rotation. HD Photo has been designed to optimize image quality and compression efficiency while also enabling low-complexity encoding and decoding implementations. To ensure low complexity for implementations, the design features have been incorporated in a way that not only minimizes the computational requirements of the individual components (including consideration of such aspects as memory footprint, cache effects, and parallelization opportunities) but results in a self-consistent design that maximizes the commonality of functional processing components.

  14. Stability of a planet in the HD 41004 binary system

    Science.gov (United States)

    Satyal, S.; Musielak, Z. E.

    2016-03-01

    The Hill stability criterion is applied to analyse the stability of a planet in the binary star system of HD 41004 AB, with the primary and secondary separated by 22 AU, and masses of 0.7 M_⊙ and 0.4 M_⊙, respectively. The primary hosts one planet in an S-type orbit, and the secondary hosts a brown dwarf (18.64 M_J) on a relatively close orbit, 0.0177 AU, thereby forming another binary pair within this binary system. This star-brown dwarf pair (HD 41004 B+Bb) is considered a single body during our numerical calculations, while the dynamics of the planet around the primary, HD 41004 Ab, is studied in different phase-spaces. HD 41004 Ab is a 2.6 M_J planet orbiting at the distance of 1.7 AU with orbital eccentricity 0.39. For the purpose of this study, the system is reduced to a three-body problem and is solved numerically as the elliptic restricted three-body problem (ERTBP). The {Hill stability} function is used as a chaos indicator to configure and analyse the orbital stability of the planet, HD 41004 Ab. The indicator has been effective in measuring the planet's orbital perturbation due to the secondary star during its periastron passage. The calculated Hill stability time series of the planet for the coplanar case shows the stable and quasi-periodic orbits for at least ten million years. For the reduced ERTBP the stability of the system is also studied for different values of planet's orbital inclination with the binary plane. Also, by recording the planet's {ejection time} from the system or {collision time} with a star during the integration period, stability of the system is analysed in a bigger phase-space of the planet's orbital inclination, ≤ 90o, and its semimajor axis, 1.65-1.75 AU. Based on our analysis it is found that the system can maintain a stable configuration for the planet's orbital inclination as high as 65o relative to the binary plane. The results from the Hill stability criterion and the planet's dynamical lifetime map are found to be

  15. Effect of supplementation of arachidonic acid (AA) or a combination of AA plus docosahexaenoic acid on breastmilk fatty acid composition

    NARCIS (Netherlands)

    Smit, EN; Koopmann, M; Boersma, ER; Muskiet, FAJ

    We investigated whether supplementation with arachidonic acid (20:4 omega 6; AA), ora combination of AA and docosahexaenoic acid (22:6 omega 3; DHA) would affect human milk polyunsaturated fatty acid (PUFA) composition. Ten women were daily supplemented with 300 mg AA, eight with 300 mg AA, 110 mg

  16. THE CHEMICAL COMPOSITIONS OF VERY METAL-POOR STARS HD 122563 AND HD 140283: A VIEW FROM THE INFRARED

    Energy Technology Data Exchange (ETDEWEB)

    Afşar, Melike [Department of Astronomy and Space Sciences, Ege University, 35100 Bornova, İzmir (Turkey); Sneden, Christopher; Kim, Hwihyun, E-mail: melike.afsar@ege.edu.tr, E-mail: chris@astro.as.utexas.edu, E-mail: dtj@astro.as.utexas.edu, E-mail: hwihyun@astro.as.utexas.edu, E-mail: mace@astro.as.utexas.edu, E-mail: afrebel@mit.edu [Department of Astronomy and McDonald Observatory, The University of Texas, Austin, TX 78712 (United States); and others

    2016-03-10

    From high resolution (R ≃ 45,000), high signal-to-noise ratio (S/N > 400) spectra gathered with the Immersion Grating Infrared Spectrograph (IGRINS) in the H and K photometric bands, we have derived elemental abundances of two bright, well-known metal-poor halo stars: the red giant HD 122563 and the subgiant HD 140283. Since these stars have metallicities approaching [Fe/H] = −3, their absorption features are generally very weak. Neutral-species lines of Mg, Si, S and Ca are detectable, as well as those of the light odd-Z elements Na and Al. The derived IR-based abundances agree with those obtained from optical-wavelength spectra. For Mg and Si the abundances from the infrared transitions are improvements to those derived from shorter wavelength data. Many useful OH and CO lines can be detected in the IGRINS HD 122563 spectrum, from which derived O and C abundances are consistent to those obtained from the traditional [O i] and CH features. IGRINS high resolutions H- and K-band spectroscopy offers promising ways to determine more reliable abundances for additional metal-poor stars whose optical features are either not detectable, or too weak, or are based on lines with analytical difficulties.

  17. Evidences of extragalactic origin and planet engulfment in the metal-poor twin pair HD 134439/HD 134440

    Science.gov (United States)

    Reggiani, Henrique; Meléndez, Jorge

    2018-04-01

    Recent studies of chemical abundances in metal-poor halo stars show the existence of different populations, which is important for studies of Galaxy formation and evolution. Here, we revisit the twin pair of chemically anomalous stars HD 134439 and HD 134440, using high resolution (R ˜ 72 000) and high S/N ratio (S/N ˜ 250) HDS/Subaru spectra. We compare them to the well-studied halo star HD 103095, using the line-by-line differential technique to estimate precise stellar parameters and LTE chemical abundances. We present the abundances of C, O, Na, Mg, Si, Ca, Sc, Ti, V, Cr, Mn, Co, Ni, Cu, Zn, Sr, Y, Ba, La, Ce, Nd, and Sm. We compare our results to the precise abundance patterns of Nissen & Schuster (2010) and data from dwarf Spheroidal galaxies (dSphs). We show that the abundance pattern of these stars appears to be closely linked to that of dSphs with [α/Fe] knee below [Fe/H] < -1.5. We also find a systematic difference of 0.06 ± 0.01 dex between the abundances of these twin binary stars, which could be explained by the engulfment of a planet, thus suggesting that planet formation is possible at low metallicities ([Fe/H] = -1.4).

  18. A HIGH-ECCENTRICITY COMPONENT IN THE DOUBLE-PLANET SYSTEM AROUND HD 163607 AND A PLANET AROUND HD 164509

    Energy Technology Data Exchange (ETDEWEB)

    Giguere, Matthew J.; Fischer, Debra A.; Spronck, Julien [Department of Astronomy, Yale University, 260 Whitney Ave., New Haven, CT 06511 (United States); Howard, Andrew W.; Marcy, Geoffrey W.; Isaacson, Howard T. [Department of Astronomy, University of California at Berkeley, Berkeley, CA 94720 (United States); Johnson, John A. [Department of Astrophysics, California Institute of Technology, MC 249-17, Pasadena, CA 91125 (United States); Henry, Gregory W. [Center of Excellence in Information Systems, Tennessee State University, 3500 John A. Merritt Blvd., Box 9501, Nashville, TN 37209 (United States); Wright, Jason T. [Department of Astronomy, 525 Davey Lab, The Pennsylvania State University, University Park, PA 16802 (United States); Hou Fengji [Center for Cosmology and Particle Physics, Department of Physics, New York University, 4 Washington Place, New York, NY 10003 (United States)

    2012-01-01

    We report the detection of three new exoplanets from Keck Observatory. HD 163607 is a metal-rich G5IV star with two planets. The inner planet has an observed orbital period of 75.29 {+-} 0.02 days, a semi-amplitude of 51.1 {+-} 1.4 m s{sup -1}, an eccentricity of 0.73 {+-} 0.02, and a derived minimum mass of M{sub P} sin i = 0.77 {+-} 0.02 M{sub Jup}. This is the largest eccentricity of any known planet in a multi-planet system. The argument of periastron passage is 78.7 {+-} 2.{sup 0}0; consequently, the planet's closest approach to its parent star is very near the line of sight, leading to a relatively high transit probability of 8%. The outer planet has an orbital period of 3.60 {+-} 0.02 years, an orbital eccentricity of 0.12 {+-} 0.06, and a semi-amplitude of 40.4 {+-} 1.3 m s{sup -1}. The minimum mass is M{sub P} sin i = 2.29 {+-} 0.16 M{sub Jup}. HD 164509 is a metal-rich G5V star with a planet in an orbital period of 282.4 {+-} 3.8 days and an eccentricity of 0.26 {+-} 0.14. The semi-amplitude of 14.2 {+-} 2.7 m s{sup -1} implies a minimum mass of 0.48 {+-} 0.09 M{sub Jup}. The radial velocities (RVs) of HD 164509 also exhibit a residual linear trend of -5.1 {+-} 0.7 m s{sup -1} year{sup -1}, indicating the presence of an additional longer period companion in the system. Photometric observations demonstrate that HD 163607 and HD 164509 are constant in brightness to submillimagnitude levels on their RV periods. This provides strong support for planetary reflex motion as the cause of the RV variations.

  19. AAS 228: Day 2 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  20. GRAVITY Spectro-interferometric Study of the Massive Multiple Stellar System HD 93206 A

    Science.gov (United States)

    Sanchez-Bermudez, J.; Alberdi, A.; Barbá, R.; Bestenlehner, J. M.; Cantalloube, F.; Brandner, W.; Henning, Th.; Hummel, C. A.; Maíz Apellániz, J.; Pott, J.-U.; Schödel, R.; van Boekel, R.

    2017-08-01

    Characterization of the dynamics of massive star systems and the astrophysical properties of the interacting components are a prerequisite for understanding their formation and evolution. Optical interferometry at milliarcsecond resolution is a key observing technique for resolving high-mass multiple compact systems. Here, we report on Very Large Telescope Interferometer/GRAVITY, Magellan/Folded-port InfraRed Echellette, and MPG2.2 m/FEROS observations of the late-O/early-B type system HD 93206 A, which is a member of the massive cluster Collinder 228 in the Carina nebula complex. With a total mass of about 90 {M}⊙ , it is one of the most compact massive quadruple systems known. In addition to measuring the separation and position angle of the outer binary Aa-Ac, we observe Brγ and He I variability in phase with the orbital motion of the two inner binaries. From the differential phase ({{{Δ }}}φ ) analysis, we conclude that the Brγ emission arises from the interaction regions within the components of the individual binaries, which is consistent with previous models for the X-ray emission of the system based on wind-wind interaction. With an average 3σ deviation of {{{Δ }}}φ ˜ 15^\\circ , we establish an upper limit of p ˜ 0.157 mas (0.35 au) for the size of the Brγ line-emitting region. Future interferometric observations with GRAVITY using the 8 m Unit Telescopes will allow us to constrain the line-emitting regions down to angular sizes of 20 μas (0.05 au at the distance of the Carina nebula).

  1. The AA disappearing under concrete shielding

    CERN Multimedia

    CERN PhotoLab

    1982-01-01

    When the AA started up in July 1980, the machine stood freely in its hall, providing visitors with a view through the large window in the AA Control Room. The target area, in which the high-intensity 26 GeV/c proton beam from the PS hit the production target, was heavily shielded, not only towards the outside but also towards the AA-Hall. However, electrons and pions emanating from the target with the same momentum as the antiprotons, but much more numerous, accompanied these through the injection line into the AA ring. The pions decayed with a half-time corresponding to approximately a revolution period (540 ns), whereas the electrons lost energy through synchrotron radiation and ended up on the vacuum chamber wall. Electrons and pions produced the dominant component of the radiation level in the hall and the control room. With operation times far exceeding original expectations, the AA had to be buried under concrete shielding in order to reduce the radiation level by an order of magnitude.

  2. The association between Interleukin (IL)-4 gene intron 3 VNTR polymorphism and alopecia areata (AA) in Turkish population.

    Science.gov (United States)

    Kalkan, Göknur; Karakus, Nevin; Baş, Yalçın; Takçı, Zennure; Ozuğuz, Pınar; Ateş, Omer; Yigit, Serbulent

    2013-09-25

    Alopecia areata (AA) is hypothesized to be an organ-specific autoimmune disease of hair follicles mediated by T cells. As immunological and genetic factors have been implicated in the pathogenesis of AA, the purpose of the present study was to investigate possible associations between the functional Interleukin (IL)-4 gene intron 3 VNTR polymorphism and AA susceptibility and disease progression in Turkish population. The study group consisted of 116 unrelated patients with AA and 125 unrelated healthy controls. Genomic DNA was isolated and IL-4 gene 70 bp VNTR polymorphism determined by using polymerase chain reaction (PCR) with specific primers. No association was observed between AA patients and controls according to genotype distribution (p=0.051). The allele distribution of IL-4 gene intron 3 VNTR polymorphism was statistically different between AA patients and control group (p=0.026). The frequency of P1 allele in patients was significantly higher than that in the control group. When the P2P2 genotype was compared with P1P2+P1P1 genotypes, a statistically significant difference was observed between patients and controls (p=0.036). Intron 3 VNTR polymorphism in the IL-4 gene was found to be associated with AA susceptibility in Turkish population. The results suggest that IL-4 VNTR polymorphism in the intron 3 region may be a risk factor for the development of AA among Turkish population. This is the first to report that intron 3 VNTR polymorphism in the IL-4 gene is associated with AA susceptibility. © 2013.

  3. AAS 228: Day 2 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  4. [Expression and characterization of recombinant Sj23HD-HSA fusion protein in Saccharomyces cerevisiae].

    Science.gov (United States)

    Zhang, Wei; Yu, Chuan-Xin; Yang, Jian-Linag; Feng, Wei; Yin, Xu-Ren; Song, Li-Jun; Wang, Jie; Qian, Chun-Yan; Ke, Xue-Dan

    2011-12-01

    To prepare the fusion protein of large hydrophilic domain of 23 kDa membrane protein of Schistosoma japonicum and the mature peptide of human serum albumin (Sj23HD-HSA) and investigate its immunoreactivity. A fusion protein gene encoding Sj23HD-HSA fusion protein was prepared by overlapping PCR, which was confirmed by TA cloning and DNA sequencing. The fusion gene of Sj23HD-HSA was directionally subcloned into yeast expression plasmid pWX530 to construct a recombinant plasmid Sj23HD-HSA/pWX530. The transformants of Saccharomyces cerevisiae containing the recombinant plasmid Sj23HD-HSA/pWX530 were screened on leu deficient SD medium after yeast competent cells were transformed with recombinant plasmid. The excretive Sj23HD-HSA protein was expressed by culturing the yeast transformants at 30 degrees C for 1 week, and the protein component of culture supernatant was analyzed by SDS-PAGE. Sj23HD-HSA fusion protein was purified through Ion Exchange Chromatography. The immunoreactivity of recombinant Sj23HD-HSA fusion protein was determined by Western blotting with sera of schistosomiasis, clonorchiasis and healthy. The gene encoding the Sj23HD-HSA fusion protein was constructed successfully, which was confirmed by DNA sequencing. The yeast transformants containing plasmid Sj23HD-HSA/pWX530 could express the excretive Sj23HD-HSA fusion protein without inducing. The results of Western blotting indicated Sj23HD-HSA could be recognized by the sera of schistosomiasis, but could not be recognized by the sera of clonorchiasis and healthy respectively. Sj23HD-HSA fusion protein with good immune reactivity is prepared successfully, which will be a potential antigen for schistosomiasis immunodiagnosis.

  5. Salvage therapy of progressive and recurrent Hodgkin's disease: results from a multicenter study of the pediatric DAL/GPOH-HD study group.

    NARCIS (Netherlands)

    Schellong, G.; Dorffel, W.; Claviez, A.; Korholz, D.; Mann, G.; Scheel-Walter, H.G.; Bökkerink, J.P.M.; Riepenhausen, M.; Luders, H.; Potter, R.; Ruhl, U.

    2005-01-01

    PURPOSE: To evaluate a salvage therapy (ST-HD-86) for patients with progressive and relapsed Hodgkin's disease after primary treatment in the pediatric DAL/GPOH studies. The essential chemotherapeutic regimens were ifosfamide, etoposide, and prednisone (IEP) and doxorubicin, bleomycin, vinblastine,

  6. The ABCB1, rs9282564, AG and TT Genotypes and the COMT, rs4680, AA Genotype are Less Frequent in Deceased Patients with Opioid Addiction than in Living Patients with Opioid Addiction

    DEFF Research Database (Denmark)

    Christoffersen, Dorte J; Damkier, Per; Feddersen, Søren

    2016-01-01

    Sudden death due to acute intoxication occurs frequently in patients with opioid addiction (OA). In order to examine if certain genotypes were associated with this, we examined the frequencies of 29 SNPs located in candidate genes related to opioid pharmacology: ABCB1, OPRM1, UGT2B7, CYP3A5, CYP2B6...

  7. Early and late-onset acute GvHD following hematopoietic cell transplantation: CT features of gastrointestinal involvement with clinical and pathological correlation

    Energy Technology Data Exchange (ETDEWEB)

    Brodoefel, H. [Department of Diagnostic Radiology, Eberhard-Karls-University, Hoppe-Seyler-Str. 3, 72076 Tuebingen (Germany)], E-mail: h.brodoefel@t-online.de; Bethge, W. [Department of Internal Medicine II, Oncology/Haematology, Eberhard-Karls-University, Otfried-Mueller-Str. 10, 72076 Tuebingen (Germany); Vogel, M.; Fenchel, M. [Department of Diagnostic Radiology, Eberhard-Karls-University, Hoppe-Seyler-Str. 3, 72076 Tuebingen (Germany); Faul, C. [Department of Internal Medicine II, Oncology/Haematology, Eberhard-Karls-University, Otfried-Mueller-Str. 10, 72076 Tuebingen (Germany); Wehrmann, M. [Department of Pathology, Eberhard-Karls-University, Liebermeister-Str. 8, 72076, Tuebingen (Germany); Claussen, C.; Horger, M. [Department of Diagnostic Radiology, Eberhard-Karls-University, Hoppe-Seyler-Str. 3, 72076 Tuebingen (Germany)

    2010-03-15

    Objective: With the introduction of non-myeloablative hematopoietic cell transplantation, acute graft-versus-host-disease (GvHD) is frequently observed beyond the traditional 100 days cut-off. The aim of this study was to describe and compare CT features of gastrointestinal early and late-onset GvHD and to correlate findings with clinical and pathology grading. Subjects and methods: Abdominal CT scans were obtained in 20 patients with early and 15 with late-onset GvHD. Examinations were assessed for intestinal and extraintestinal abnormalities and findings compared between the two subgroups of GvHD. Distinct CT abnormalities as well as a CT-score integrating multiple pathologies were correlated with gut, clinical or pathology grading. Results: Frequent intestinal abnormalities included wall thickening, abnormal enhancement, and excessive fluid-filling (94%, 89%, and 94%). 86% of patients showed concomitant small and large bowel involvement. A discontinuous distribution was observed in 54%. Bile tract abnormality was the most common extra-intestinal finding (74%). The distribution of pathologies was equal between subgroups of early or late-onset disease. Wall thickening and mucosal attenuation in non-enhanced scans were significantly related to clinical and pathology scores (P {<=} 0.018). Number of abnormal segments, small bowel dilatation, engorgement of the vasa recta, mesenteric fat stranding and ascites were linked to clinical grading (P {<=} 0.019). A CT-score integrating multiple abnormalities was correlated to gut, overall clinical and pathology grading (r = 0.64, 0.57, 0.50). Conclusion: CT morphology of acute GvHD is independent of its time of onset and, thus, facilitates differential diagnosis of late-onset acute GvHD. Correlation of CT morphology with clinical and pathological grading is important in terms of prognosis and may help guiding the therapeutic approach.

  8. Secondary Atmospheres on HD 219134 b and c

    Science.gov (United States)

    Dorn, Caroline; Heng, Kevin

    2018-01-01

    We analyze the interiors of HD 219134 b and c, which are among the coolest super-Earths detected thus far. Without using spectroscopic measurements, we aim at constraining if the possible atmospheres are hydrogen-rich or hydrogen-poor. In the first step, we employ a full probabilistic Bayesian inference analysis to rigorously quantify the degeneracy of interior parameters given the data of mass, radius, refractory element abundances, semimajor axes, and stellar irradiation. We obtain constraints on structure and composition for core, mantle, ice layer, and atmosphere. In the second step, we aim to draw conclusions on the nature of possible atmospheres by considering atmospheric escape. Specifically, we compare the actual possible atmospheres to a threshold thickness above which a primordial (H2-dominated) atmosphere can be retained against evaporation over the planet’s lifetime. The best-constrained parameters are the individual layer thicknesses. The maximum radius fraction of possible atmospheres are 0.18 and 0.13 R (radius), for planets b and c, respectively. These values are significantly smaller than the threshold thicknesses of primordial atmospheres: 0.28 and 0.19 R, respectively. Thus, the possible atmospheres of planets b and c are unlikely to be H2-dominated. However, whether possible volatile layers are made of gas or liquid/solid water cannot be uniquely determined. Our main conclusions are (1) the possible atmospheres for planets b and c are enriched and thus possibly secondary in nature, and (2) both planets may contain a gas layer, whereas the layer of HD 219134 b must be larger. HD 219134 c can be rocky.

  9. High-resolution abundance analysis of HD 140283

    Science.gov (United States)

    Siqueira-Mello, C.; Andrievsky, S. M.; Barbuy, B.; Spite, M.; Spite, F.; Korotin, S. A.

    2015-12-01

    Context. HD 140283 is a reference subgiant that is metal poor and confirmed to be a very old star. The element abundances of this type of old star can constrain the nature and nucleosynthesis processes that occurred in its (even older) progenitors. The present study may shed light on nucleosynthesis processes yielding heavy elements early in the Galaxy. Aims: A detailed analysis of a high-quality spectrum is carried out, with the intent of providing a reference on stellar lines and abundances of a very old, metal-poor subgiant. We aim to derive abundances from most available and measurable spectral lines. Methods: The analysis is carried out using high-resolution (R = 81 000) and high signal-to-noise ratio (800 literature. The newly NLTE Ba abundance, along with a NLTE Eu correction and a 3D Ba correction from literature, leads to [Eu/Ba] = + 0.59 ± 0.18. This result confirms a dominant r-process contribution, possibly together with a very small contribution from the main s-process, to the neutron-capture elements in HD 140283. Overabundances of the lighter heavy elements and the high abundances derived for Ba, La, and Ce favour the operation of the weak r-process in HD 140283. Based on observations within Brazilian time at the Canada-France-Hawaii Telescope (CFHT) which is operated by the National Research Council of Canada, the Institut National des Sciences de l'Univers of the Centre National de la Recherche Scientifique of France, and the University of Hawaii; Progr. ID 11AB01.Appendices A and B are available in electronic form at http://www.aanda.orgFull Tables A.1-A.3 are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (ftp://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/584/A86

  10. Lability of the pAA Virulence Plasmid in Escherichia coli O104:H4: Implications for Virulence in Humans.

    Directory of Open Access Journals (Sweden)

    Wenlan Zhang

    Full Text Available Escherichia coli O104:H4 that caused the large German outbreak in 2011 is a highly virulent hybrid of enterohemorrhagic (EHEC and enteroaggregative (EAEC E. coli. The strain displays "stacked-brick" aggregative adherence to human intestinal epithelial cells mediated by aggregative adherence fimbriae I (AAF/I encoded on the pAA plasmid. The AAF/I-mediated augmented intestinal adherence might facilitate systemic absorption of Shiga toxin, the major virulence factor of EHEC, presumably enhancing virulence of the outbreak strain. However, the stability of pAA in the outbreak strain is unknown. We therefore tested outbreak isolates for pAA, monitored pAA loss during infection, and determined the impact of pAA loss on adherence and clinical outcome of infection.E. coli O104:H4 outbreak isolates from 170 patients (128 with hemolytic uremic syndrome [HUS] and 42 with diarrhea without HUS were tested for pAA using polymerase chain reaction and plasmid profiling. pAA-harboring bacteria in stool samples were quantified using colony blot hybridization, and adherence to HCT-8 cells was determined. Isolates from 12 (7.1% patients lacked pAA. Analyses of sequential stool samples demonstrated that the percentages of pAA-positive populations in the initial stools were significantly higher than those in the follow-up stools collected two to eight days later in disease (P≤0.01. This indicates a rapid loss of pAA during infections of humans. The pAA loss was associated with loss of the aggregative adherence phenotype and significantly reduced correlation with HUS (P  = 0.001.The pAA plasmid can be lost by E. coli O104:H4 outbreak strain in the human gut in the course of disease. pAA loss might attenuate virulence and diminish the ability to cause HUS. The pAA instability has clinical, diagnostic, epidemiologic, and evolutionary implications.

  11. Production of recombinant non-structural protein-3 hydrophobic domain deletion (NS3ΔHD) protein of bluetongue virus from prokaryotic expression system as an efficient diagnostic reagent.

    Science.gov (United States)

    Mohanty, Nihar Nalini; Chacko, Nirmal; Biswas, Sanchay Kumar; Chand, Karam; Pandey, Awadh Bihari; Mondal, Bimalendu; Hemadri, Divakar; Shivachandra, Sathish Bhadravati

    2016-09-01

    Serological diagnostics for bluetongue (BT), which is an infectious, non-contagious and arthropod-borne virus disease of ruminants, are primarily dependent on availability of high quality native or recombinant antigen(s) based on either structural/non-structural proteins in sufficient quantity. Non-structural proteins (NS1-NS4) of BT virus are presumed candidate antigens in development of DIVA diagnostics. In the present study, NS3 fusion gene encoding for NS3 protein containing the N- and C-termini with a deletion of two hydrophobic domains (118A to S141 aa and 162S to A182 aa) and intervening variable central domain (142D to K161 aa) of bluetongue virus 23 was constructed, cloned and over-expressed using prokaryotic expression system. The recombinant NS3ΔHD fusion protein (∼38 kDa) including hexa-histidine tag on its both termini was found to be non-cytotoxic to recombinant Escherichia coli cells and purified by affinity chromatography. The purified rNS3ΔHD fusion protein was found to efficiently detect BTV-NS3 specific antibodies in indirect-ELISA format with diagnostic sensitivity (DSn = 94.4%) and specificity (DSp = 93.9%). The study indicated the potential utility of rNS3ΔHD fusion protein as candidate diagnostic reagent in developing an indirect-ELISA for sero-surveillance of animals for BTV antibodies under DIVA strategy, wherever monovalent/polyvalent killed BT vaccine formulations devoid of NS proteins are being practiced for immunization. Copyright © 2016 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

  12. K2 spots rotation in the helium star HD144941

    Science.gov (United States)

    Jeffery, C. Simon; Ramsay, Gavin

    2018-02-01

    HD144941 is an evolved early-type metal-poor low-mass star with a hydrogen-poor surface. It is frequently associated with other intermediate helium-rich subdwarfs and extreme helium stars. Previous photometric studies have failed to detect any variability. New observations with the K2 mission show complex but periodic variations with a full amplitude of 4 parts per thousand. It is proposed that these are due to an inhomogeneous surface brightness distribution (spots) superimposed on a rotation period of 13.9 ± 0.2 d. The cause of the surface inhomogeneity is not identified, although an oblique dipolar magnetic field origin is plausible.

  13. The novel reentrant fluid phase of HD physisorbed on graphite

    Energy Technology Data Exchange (ETDEWEB)

    Leinboeck, B.; Wiechert, H. [Mainz Univ., Mainz (Germany); Bienfait, M. [Centre Universitaire de Luminy, Aix-Marseille-2 Univ., 13 - Marseille (France); Johnson, M. [Institut Max von Laue - Paul Langevin (ILL), 38 - Grenoble (France)

    1999-11-01

    Quasielastic neutron-scattering measurements have been carried out on the backscattering spectrometer IN10 to gain new insight into the nature of the novel reentrant fluid phase occurring at the commensurate-incommensurate transition of deuterium hybrid (HD) monolayers physisorbed on the basal planes of graphite. Our high energy-resolution measurements show, for the first time, that translational particle mobility occurs in the reentrant fluid phase. This observation is consistent with the theory of the commensurate-incommensurate transition which predicts that the phase is a viscous fluid which can be characterised by thermally fluctuating striped domain walls separating commensurate micro-domains. (authors) 7 refs., 3 figs.

  14. HD-videokuvan jakaminen lähiverkossa

    OpenAIRE

    Kinnunen, Valtteri

    2017-01-01

    Tämän opinnäytetyön tarkoituksena oli selvittää Turun AMK:lle mahdollisia ratkaisuja HD-videokuvan jakamisesta lähiverkossa. Työssä tutustuttiin eri vaihtoehtoihin sekä tehtiin päätös keskittyä vain ohjelmistopohjaisiin ratkaisuihin. Tutkimuksessa kartoitetaan lähtötilanne, selvitetään vaatimuksia sekä testataan ja arvioidaan valittuja ohjelmistoja. Työssä tarkasteltiin ohjelmistohankinnan prosesseja organisaatiossa sekä miten ohjelmistohankinta etenee teoriassa. Ohjelmistonhankinta k...

  15. Stellar Variability of the Exoplanet Hosting Star HD 63454

    OpenAIRE

    {Kane} S.~R.; {Dragomir} D.; {Ciardi} D.~R.; {Lee} J.-W.; {Lo Curto} G.; {Lovis} C.; {Naef} D.; {Mahadevan} S.; {Pilyavsky} G.; {Udry} S.; {Wang} X.; {Wright} J.

    2011-01-01

    Of the hundreds of exoplanets discovered using the radial velocity technique, many are orbiting close to their host stars with periods less than 10 days. One of these, HD 63454, is a young active K dwarf which hosts a Jovian planet in a 2.82 day period orbit. The planet has a 14% transit probability and a predicted transit depth of 1.2%. Here we provide a re-analysis of the radial velocity data to produce an accurate transit ephemeris. We further analyse 8 nights of time series data to search...

  16. Fate and Transport of Chemical Warfare Agents VX and HD ...

    Science.gov (United States)

    Report The intent of this investigation was to study the fate and transport of CWA applied to painted/sealed materials including the potential partitioning of CWA into permeable paints/sealants and subsequently into underlying porous materials. Based on the results obtained from this investigation, VX and sulfur mustard (HD) have the ability to permeate into paints and sealants, including in some cases the underlying porous materials. It is likely that other permeable materials besides paints and sealants may also show similar behavior.

  17. CHEMICAL ABUNDANCES OF THE MAGNETIC CP STAR HD 168733

    OpenAIRE

    Ana Collado; Z. López-García

    2009-01-01

    Se ha llevado a cabo un an lisis detallado de las abundancias en la estrella CP magn tica HD 168733 utilizando espectros de alta resoluci n obtenidos con el espectr grafo echelle EBASIM del telescopio de 2.1 m de CASLEO en Argentina. Los espectros cubren la regi n 382{700 nm. La estrella no puede ser clasi cada ni como una peculiar de HgMn ni como perteneciente al grupo CP2 de silicio. Comparada con el Sol, C, N son levementes sobreabundantes mientras que el Mg y S son de cientes, Si es norma...

  18. K2 spots rotation in the helium star HD144941

    Science.gov (United States)

    Jeffery, C. Simon; Ramsay, Gavin

    2018-03-01

    HD144941 is an evolved early-type metal-poor low-mass star with a hydrogen-poor surface. It is frequently associated with other intermediate helium-rich subdwarfs and extreme helium stars. Previous photometric studies have failed to detect any variability. New observations with the K2 mission show complex but periodic variations with a full amplitude of 4 parts per thousand. It is proposed that these are due to an inhomogeneous surface brightness distribution (spots) superimposed on a rotation period of 13.9 ± 0.2 d. The cause of the surface inhomogeneity is not identified, although an oblique dipolar magnetic field origin is plausible.

  19. Shadows and spirals in the protoplanetary disk HD 100453

    Science.gov (United States)

    Benisty, M.; Stolker, T.; Pohl, A.; de Boer, J.; Lesur, G.; Dominik, C.; Dullemond, C. P.; Langlois, M.; Min, M.; Wagner, K.; Henning, T.; Juhasz, A.; Pinilla, P.; Facchini, S.; Apai, D.; van Boekel, R.; Garufi, A.; Ginski, C.; Ménard, F.; Pinte, C.; Quanz, S. P.; Zurlo, A.; Boccaletti, A.; Bonnefoy, M.; Beuzit, J. L.; Chauvin, G.; Cudel, M.; Desidera, S.; Feldt, M.; Fontanive, C.; Gratton, R.; Kasper, M.; Lagrange, A.-M.; LeCoroller, H.; Mouillet, D.; Mesa, D.; Sissa, E.; Vigan, A.; Antichi, J.; Buey, T.; Fusco, T.; Gisler, D.; Llored, M.; Magnard, Y.; Moeller-Nilsson, O.; Pragt, J.; Roelfsema, R.; Sauvage, J.-F.; Wildi, F.

    2017-01-01

    Context. Understanding the diversity of planets requires studying the morphology and physical conditions in the protoplanetary disks in which they form. Aims: We aim to study the structure of the 10 Myr old protoplanetary disk HD 100453, to detect features that can trace disk evolution and to understand the mechanisms that drive these features. Methods: We observed HD 100453 in polarized scattered light with VLT/SPHERE at optical (0.6 μm, 0.8 μm) and near-infrared (1.2 μm) wavelengths, reaching an angular resolution of 0.02'', and an inner working angle of 0.09''. Results: We spatially resolve the disk around HD 100453, and detect polarized scattered light up to 0.42'' ( 48 au). We detect a cavity, a rim with azimuthal brightness variations at an inclination of 38° with respect to our line of sight, two shadows and two symmetric spiral arms. The spiral arms originate near the location of the shadows, close to the semi major axis. We detect a faint feature in the SW that can be interpreted as the scattering surface of the bottom side of the disk, if the disk is tidally truncated by the M-dwarf companion currently seen at a projected distance of 119 au. We construct a radiative transfer model that accounts for the main characteristics of the features with an inner and outer disk misaligned by 72°. The azimuthal brightness variations along the rim are well reproduced with the scattering phase function of the model. While spirals can be triggered by the tidal interaction with the companion, the close proximity of the spirals to the shadows suggests that the shadows could also play a role. The change in stellar illumination along the rim induces an azimuthal variation of the scale height that can contribute to the brightness variations. Conclusions: Dark regions in polarized images of transition disks are now detected in a handful of disks and often interpreted as shadows due to a misaligned inner disk. However, the origin of such a misalignment in HD 100453, and

  20. H-D exchange on natural aluminosilicates of orthosilicate group

    International Nuclear Information System (INIS)

    Markevich, S.V.; Kolesnikov, I.M.

    1982-01-01

    Experimental data are presented on the effect of aluminium ion coordination in the composition of polyhedrons on the capability of polyhedrons to change the reaction rate of H-D exchange (on the example of ethylene). It is shown that at temperature lower 400 deg C the rate of isotopic exchange reaction is low. Experimental results both for irradiated and non-irradiated minerals are presented. The conclusion is made that the increase of aluminosilicates activity under radiation is connected with the presence of (AlO 4 )-tetrahedrons in the system and change of their state. (AlO 5 ) and (AlO 6 )-polyhedrons are not activated with gamma rays

  1. Profile of He I lambda5876 in the P-Cygni-type of star HD 152408

    International Nuclear Information System (INIS)

    Walborn, N.R.

    1975-01-01

    The blue-shifted absorption component of the P-Cygni profile at He I lambda 5876 in HD 152408 (O8: Iafpe) has been found to be extremely broad, extending -1000 km sec -1 from the emission maximum. This unusual profile is probably due to overpopulation of the lower level of lambda 5876, which permits it to form throughout a greater extent of the expanding atmosphere than most other lines. This observation confirms Hutchings' identification of very large velocities in the blue-violet spectrum of HD 152408, and in particular his interpretation of a similar feature at He I lambda 3889, which is metastable. The lambda 5876 profile in HD 152408 is compared to those in the similar but less extreme P-Cygni star HD 151804 (O8 Iaf), and in the Wolf-Rayet star HD 151932 (WN7-A). The similarity between the absorption components in HD 152408 and the WN star is striking

  2. Neural processing of emotions in traumatized children treated with Eye Movement Desensitization and Reprocessing therapy: a hdEEG study.

    Science.gov (United States)

    Trentini, Cristina; Pagani, Marco; Fania, Piercarlo; Speranza, Anna Maria; Nicolais, Giampaolo; Sibilia, Alessandra; Inguscio, Lucio; Verardo, Anna Rita; Fernandez, Isabel; Ammaniti, Massimo

    2015-01-01

    Eye Movement Desensitization and Reprocessing (EMDR) therapy has been proven efficacious in restoring affective regulation in post-traumatic stress disorder (PTSD) patients. However, its effectiveness on emotion processing in children with complex trauma has yet to be explored. High density electroencephalography (hdEEG) was used to investigate the effects of EMDR on brain responses to adults' emotions on children with histories of early maltreatment. Ten school-aged children were examined before (T0) and within one month after the conclusion of EMDR (T1). hdEEGs were recorded while children passively viewed angry, afraid, happy, and neutral faces. Clinical scales were administered at the same time. Correlation analyses were performed to detect brain regions whose activity was linked to children's traumatic symptom-related and emotional-adaptive problem scores. In all four conditions, hdEEG showed similar significantly higher activity on the right medial prefrontal and fronto-temporal limbic regions at T0, shifting toward the left medial and superior temporal regions at T1. Moreover, significant correlations were found between clinical scales and the same regions whose activity significantly differed between pre- and post-treatment. These preliminary results demonstrate that, after EMDR, children suffering from complex trauma show increased activity in areas implicated in high-order cognitive processing when passively viewing pictures of emotional expressions. These changes are associated with the decrease of depressive and traumatic symptoms, and with the improvement of emotional-adaptive functioning over time.

  3. Neural processing of emotions in traumatized children treated with Eye Movement Desensitization and Reprocessing therapy: A hdEEG study

    Directory of Open Access Journals (Sweden)

    Cristina eTrentini

    2015-11-01

    Full Text Available Eye Movement Desensitization and Reprocessing (EMDR therapy has been proven efficacious in restoring affective regulation in Post–Traumatic Stress Disorder (PTSD patients. However, its effectiveness on emotion processing in children with complex trauma has yet to be explored. High density Electroencephalography (hdEEG was used to investigate the effects of EMDR on brain responses to adults’ emotions on children with histories of early maltreatment. Ten school–aged children were examined before (T0 and within one month after the conclusion of EMDR (T1. hdEEGs were recorded while children passively viewed angry, afraid, happy, and neutral faces. Clinical scales were administered at the same time. Correlation analyses were performed to detect brain regions whose activity was linked to children’s traumatic symptom–related and emotional–adaptive problem scores. In all four conditions, hdEEG showed similar significantly higher activity on the right medial prefrontal and fronto–temporal limbic regions at T0, shifting towards the left medial and superior temporal regions at T1. Moreover, significant correlations were found between clinical scales and the same regions whose activity significantly differed between pre– and post–treatment. These preliminary results demonstrate that, after EMDR, children suffering from complex trauma show increased activity in areas implicated in high–order cognitive processing when passively viewing pictures of emotional expressions. These changes are associated with the decrease of depressive and traumatic symptoms, and with the improvement of emotional–adaptive functioning over time.

  4. Refusal of hemodialysis by hospitalized chronic kidney disease patients in Pakistan.

    Science.gov (United States)

    Shafi, Salman Tahir; Saleem, Mohammad; Anjum, Roshina; Abdullah, Wajid; Shafi, Tahir

    2018-01-01

    In Pakistan, patients with chronic kidney disease (CKD) are commonly diagnosed at a late stage. There is little information about the refusal of hemodialysis by hospitalized CKD patients who need hemodialysis (HD) and reasons for acceptance and refusal among these patients. All patients with Stage V CKD who had medical indications to undergo HD and were hospitalized at a tertiary care facility over a six-month period were invited to participate in this study. Patients were surveyed regarding acceptance or refusing of HD and reasons for their decisions. Demographic, socioeconomic, and clinical characteristics of patients were compared between patients who accepted or refused HD. A total of 125 patients were included in the study. The mean age of the patients was 47.9 ±12.1 years. The mean duration of diagnosis of CKD was 2.5 ± 0.6 months. Of all patients, 72 (57.6%) agreed to do HD and 53 (42.4%) refused HD. Patients with arteriovenous fistula in place (27.1 vs. 9.1%, P 0.02) and those in the middle- or higher-income group (64.4% vs. 38.6%, p = 0.03) were more willing to undergo HD. Trust in doctor's advice (86.1%) was the most common reason for acceptance of HD. Frequency of HD per week (52.8%), lifelong and permanent nature of HD (50.9%), advice by family members or friends (37.7%), perception of poor quality of life on HD (35.8%), and fear of HD needles and complications during HD (33.9%) were the most common reasons for refusal. Refusal of HD is common among hospitalized CKD patients with medical indications to undergo HD, especially in lower income group.

  5. HD 98618: A Star Closely Resembling Our Sun

    Science.gov (United States)

    Meléndez, Jorge; Dodds-Eden, Katie; Robles, José A.

    2006-04-01

    Despite the observational effort carried out in the last few decades, no perfect solar twin has been found to date. An important milestone was achieved a decade ago by Porto de Mello & da Silva, who showed that 18 Sco is almost a solar twin. In the present work, we use extremely high resolution (R=105), high signal-to-noise ratio Keck HIRES spectra to carry out a differential analysis of 16 solar-twin candidates. We show that HD 98618 is the second-closest solar twin and that the fundamental parameters of both HD 98618 and 18 Sco are very similar (within a few percent) to the host star of our solar system, including the likelihood of hosting a terrestrial planet within their habitable zones. We suggest that these stars should be given top priority in exoplanet and SETI surveys. The data presented herein were obtained at the W. M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California, and the National Aeronautics and Space Administration.

  6. Dicty_cDB: FC-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA02 (Link to dictyBase) - - - Contig-U16527-1 FC-AA02Z (Li...nk to Original site) - - FC-AA02Z 458 - - - - Show FC-AA02 Library FC (Link to library) Clone ID FC-AA02 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA02Q.Seq.d/ Representative seq. ID FC-AA...02Z (Link to Original site) Representative DNA sequence >FC-AA02 (FC-AA02Q) /CSM/FC/FC-AA/FC-AA02Q.Seq.d/ XXXXXXXXXXCAAAAA...GGCTCCTGGTCCGGAAGGATTGGGTAATCATTTGAATTTCCTAC GTAACTGGGCTTGATCTTTGTAATTATTGATCATAAACGAGGAATTCCTTGTAAGCGTAA

  7. Dicty_cDB: FCL-AA04 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA04 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA04Z ...(Link to Original site) - - FCL-AA04Z 530 - - - - Show FCL-AA04 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA04Q.Seq.d/ Representative seq. ID FCL-AA...04Z (Link to Original site) Representative DNA sequence >FCL-AA04 (FCL-AA04Q) /CSM/FCL/FCL-AA/FCL-AA...04Q.Seq.d/ XXXXXXXXXXCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTTCAGTCAAAGAAATT AAAAGAGGTATGGTCGCTGGTGACTCCAAAAACGATCCACCACAAGAAA

  8. Dicty_cDB: FCL-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA03 (Link to dictyBase) - - - Contig-U15092-1 FCL-AA03E ...(Link to Original site) - - - - - - FCL-AA03E 627 Show FCL-AA03 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA03Q.Seq.d/ Representative seq. ID FCL-AA...03E (Link to Original site) Representative DNA sequence >FCL-AA03 (FCL-AA03Q) /CSM/FCL/FCL-AA/FCL-AA...03Q.Seq.d/ ACATAATGTTCCAAAAGAAAGCAATTGTTATTGATGGCAAAGGTCATTTGTTAGGTCGTT TAGCCTCCGTTGTTGCTAAATCCCTCCTCTCTGGTCAAAA

  9. Dicty_cDB: FCL-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA09 (Link to dictyBase) - - - Contig-U16453-1 FCL-AA09F ...(Link to Original site) FCL-AA09F 485 - - - - - - Show FCL-AA09 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ Representative seq. ID FCL-AA...09F (Link to Original site) Representative DNA sequence >FCL-AA09 (FCL-AA09Q) /CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ GACAA...AAGTAAATAAAACATGTCCGCAAGTAATAAAGATGACCAACTCATGAAAAATGAG TTCGAAAGTACCTACGACAAAATTGTCGATTCATTCGACAA

  10. Dicty_cDB: FCL-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA08 (Link to dictyBase) - - - Contig-U16200-1 FCL-AA08Z ...(Link to Original site) - - FCL-AA08Z 574 - - - - Show FCL-AA08 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA08Q.Seq.d/ Representative seq. ID FCL-AA...08Z (Link to Original site) Representative DNA sequence >FCL-AA08 (FCL-AA08Q) /CSM/FCL/FCL-AA/FCL-AA...08Q.Seq.d/ XXXXXXXXXXTCGAAGCCAAAGGTCGTCTCGAAGAAGAATTCCATCGCTCGTACCAACTC TGATCGTTCAAGAAAGAGACTCGAAGCTGAAA

  11. Dicty_cDB: FCL-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA10 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA10Z ...(Link to Original site) - - FCL-AA10Z 627 - - - - Show FCL-AA10 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA10Q.Seq.d/ Representative seq. ID FCL-AA...10Z (Link to Original site) Representative DNA sequence >FCL-AA10 (FCL-AA10Q) /CSM/FCL/FCL-AA/FCL-AA...10Q.Seq.d/ XXXXXXXXXXTAAACCAGGTATGGTCGTCACCTTTTGCCCCAGCTGGTCTCTCAACTGAA GTCAAATCAGTCGAAATGCATCACGAACAACTCCCAGAA

  12. Dicty_cDB: FC-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA01 (Link to dictyBase) - - - Contig-U15084-1 FC-AA01E (Li...nk to Original site) - - - - - - FC-AA01E 701 Show FC-AA01 Library FC (Link to library) Clone ID FC-AA01 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA01Q.Seq.d/ Representative seq. ID FC-AA...01E (Link to Original site) Representative DNA sequence >FC-AA01 (FC-AA01Q) /CSM/FC/FC-AA/FC-AA01Q.Seq.d/ GAGAAATATTTCTTATTAA...CAATTGCATGCGTTGTATTCAACCCAACATGGTGGAATATT ACAGCAAGAATGGAATATAATGCTAATAAATAACAACCATTTTCTTTACTTCCACAAA

  13. Dicty_cDB: FC-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA20 (Link to dictyBase) - - - Contig-U16455-1 FC-AA20Z (Li...nk to Original site) - - FC-AA20Z 607 - - - - Show FC-AA20 Library FC (Link to library) Clone ID FC-AA20 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA20Q.Seq.d/ Representative seq. ID FC-AA...20Z (Link to Original site) Representative DNA sequence >FC-AA20 (FC-AA20Q) /CSM/FC/FC-AA/FC-AA20Q.Seq....d/ XXXXXXXXXXCTTTGCCCCAGCTGGTCTCTCAACTGAAGTCAAATCAGTCGAAATGCATC ACGAACAACTCCCAGAAGCCCGTCCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTT CAGTCAA

  14. Dicty_cDB: FC-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA13 (Link to dictyBase) - - - Contig-U15674-1 FC-AA13Z (Li...nk to Original site) - - FC-AA13Z 528 - - - - Show FC-AA13 Library FC (Link to library) Clone ID FC-AA13 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA13Q.Seq.d/ Representative seq. ID FC-AA...13Z (Link to Original site) Representative DNA sequence >FC-AA13 (FC-AA13Q) /CSM/FC/FC-AA/FC-AA13Q.Seq.d/ XXXXXXXXXXAAAGCAAA...CTCGTGCTGGTCAACGTACCCGTTTCAAGGCTTTCGTCGTTG TTGGTGATCACAACGGTCATGTAGGTCTCGGTGTTAAATGCGCTAAGGAA

  15. Dicty_cDB: FCL-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA02 (Link to dictyBase) - - - Contig-U16560-1 FCL-AA02F ...(Link to Original site) FCL-AA02F 620 - - - - - - Show FCL-AA02 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ Representative seq. ID FCL-AA...02F (Link to Original site) Representative DNA sequence >FCL-AA02 (FCL-AA02Q) /CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ ATTAA...ATACAAAATACAAATACAAATAACAAATACTTTACTATAGCTTTTTTTTCTTATT TATTTCTCCAAATAATTTTTTAATATGCAAATCTTTGTTAAAA

  16. Dicty_cDB: FCL-AA24 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA24 (Link to dictyBase) - - - Contig-U16467-1 FCL-AA24E ...(Link to Original site) - - - - - - FCL-AA24E 779 Show FCL-AA24 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA24Q.Seq.d/ Representative seq. ID FCL-AA...24E (Link to Original site) Representative DNA sequence >FCL-AA24 (FCL-AA24Q) /CSM/FCL/FCL-AA/FCL-AA...24Q.Seq.d/ CTAGAAATTTCTAAACAATTATTTATTTGAAGAGGTTTTTTAAAAAAAGAAAAAAATCAG AGCATCCAAATAATAACCGCAGTAAGGGGGGGATGGTTGTTAA

  17. Dicty_cDB: FCL-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA20 (Link to dictyBase) - - - Contig-U15052-1 FCL-AA20E ...(Link to Original site) - - - - - - FCL-AA20E 1159 Show FCL-AA20 Library FCL (Link to library) Clone ID FCL-AA...L http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ Representative seq. ID FCL-AA...20E (Link to Original site) Representative DNA sequence >FCL-AA20 (FCL-AA20Q) /CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ AAAA...CATTTACAAATGATGACCACAGAAGATGTACAACCAATTGAAACTACCAAAGATGG TGTAGTAGTATTAAATTATAGCGATTTAATTGCAGGTAAA

  18. Dicty_cDB: FCL-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA15 (Link to dictyBase) - - - Contig-U16011-1 FCL-AA15Z ...(Link to Original site) - - FCL-AA15Z 442 - - - - Show FCL-AA15 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA15Q.Seq.d/ Representative seq. ID FCL-AA...15Z (Link to Original site) Representative DNA sequence >FCL-AA15 (FCL-AA15Q) /CSM/FCL/FCL-AA/FCL-AA...15Q.Seq.d/ XXXXXXXXXXCCATTCATCTGTCCAATCGATTGTCGTCGTGGTCTCTACAAGAATATCGT CTTATCTGGTGGTTCAACCATGTTTAAAGATTTTGGTAAACGTCTTCAA

  19. Dicty_cDB: FC-AA14 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA14 (Link to dictyBase) - - - Contig-U15088-1 FC-AA14E (Li...nk to Original site) - - - - - - FC-AA14E 431 Show FC-AA14 Library FC (Link to library) Clone ID FC-AA14 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA14Q.Seq.d/ Representative seq. ID FC-AA...14E (Link to Original site) Representative DNA sequence >FC-AA14 (FC-AA14Q) /CSM/FC/FC-AA/FC-AA14Q.Seq.d/ CTATGTCTGAAATCAAAA...CTGAAGAACTCGCTTGCATCTACTCCGGTCTTTTATTACAAG ATGACGGTATTGAAATCACCGCTGATAAAATCAAAACCTTATTAGAAGCTGCCAA

  20. Dicty_cDB: FC-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA09 (Link to dictyBase) - - - Contig-U15086-1 FC-AA09E (Li...nk to Original site) - - - - - - FC-AA09E 562 Show FC-AA09 Library FC (Link to library) Clone ID FC-AA09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA09Q.Seq.d/ Representative seq. ID FC-AA...09E (Link to Original site) Representative DNA sequence >FC-AA09 (FC-AA09Q) /CSM/FC/FC-AA/FC-AA09Q.Seq....d/ GATACATTATCACCATGGCAGGAAAAAAAGTCAAATCTAACACACCAAAACAAGACTTAT CTGTCTCTAAATCAAAGCTCACCAGCATTAAAGCCCCAGCTGCTGCCATCAAAGCTAAA

  1. Dicty_cDB: FCL-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA05 (Link to dictyBase) - - - Contig-U16473-1 FCL-AA05Z ...(Link to Original site) - - FCL-AA05Z 603 - - - - Show FCL-AA05 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA05Q.Seq.d/ Representative seq. ID FCL-AA...05Z (Link to Original site) Representative DNA sequence >FCL-AA05 (FCL-AA05Q) /CSM/FCL/FCL-AA/FCL-AA...05Q.Seq.d/ XXXXXXXXXXTGGCGCCATCATTACTGGTGGAGGTGGTGTTGCTATCACTCAAGCTCAAC CATCATACCAAGCTGATGCCGTTGCCACTTACATCAAAA

  2. Dicty_cDB: FC-AA19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA19 (Link to dictyBase) - - - Contig-U16072-1 FC-AA19F (Li...nk to Original site) FC-AA19F 539 - - - - - - Show FC-AA19 Library FC (Link to library) Clone ID FC-AA19 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA19Q.Seq.d/ Representative seq. ID FC-AA...19F (Link to Original site) Representative DNA sequence >FC-AA19 (FC-AA19Q) /CSM/FC/FC-AA/FC-AA19Q.Seq.d/ CAGAAA...TCACTGGTTTTTCATTCCAATTATTTAATATTATCAGTATTTGGAATGTTGATC AAACATCATTCAATAGCTACAGTCTTCCAATTTGGTTACCAGCCATTCAA

  3. Game-based combined cognitive and neurofeedback training using Focus Pocus reduces symptom severity in children with diagnosed AD/HD and subclinical AD/HD.

    Science.gov (United States)

    Johnstone, Stuart J; Roodenrys, Steven J; Johnson, Kirsten; Bonfield, Rebecca; Bennett, Susan J

    2017-06-01

    Previous studies report reductions in symptom severity after combined working memory (WM) and inhibitory control (IC) training in children with AD/HD. Based on theoretical accounts of the role of arousal/attention modulation problems in AD/HD, the current study examined the efficacy of combined WM, IC, and neurofeedback training in children with AD/HD and subclinical AD/HD. Using a randomized waitlist control design, 85 children were randomly allocated to a training or waitlist condition and completed pre- and post-training assessments of overt behavior, trained and untrained cognitive task performance, and resting and task-related EEG activity. The training group completed twenty-five sessions of training using Focus Pocus software at home over a 7 to 8-week period. Trainees improved at the trained tasks, while enjoyment and engagement declined across sessions. After training, AD/HD symptom severity was reduced in the AD/HD and subclinical groups according to parents, and in the former group only according to blinded teachers and significant-others. There were minor improvements in two of six near-transfer tasks, and evidence of far-transfer of training effects in four of five far-transfer tasks. Frontal region changes indicated normalization of atypical EEG features with reduced delta and increased alpha activity. It is concluded that technology developments provide an interesting a vehicle for delivering interventions and that, while further research is needed, combined WM, IC, and neurofeedback training can reduce AD/HD symptom severity in children with AD/HD and may also be beneficial to children with subclinical AD/HD. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Genome-wide significance for a modifier of age at neurological onset in Huntington's Disease at 6q23-24: the HD MAPS study

    Directory of Open Access Journals (Sweden)

    Gillis Tammy

    2006-08-01

    Full Text Available Abstract Background Age at onset of Huntington's disease (HD is correlated with the size of the abnormal CAG repeat expansion in the HD gene; however, several studies have indicated that other genetic factors also contribute to the variability in HD age at onset. To identify modifier genes, we recently reported a whole-genome scan in a sample of 629 affected sibling pairs from 295 pedigrees, in which six genomic regions provided suggestive evidence for quantitative trait loci (QTL, modifying age at onset in HD. Methods In order to test the replication of this finding, eighteen microsatellite markers, three from each of the six genomic regions, were genotyped in 102 newly recruited sibling pairs from 69 pedigrees, and data were analyzed, using a multipoint linkage variance component method, in the follow-up sample and the combined sample of 352 pedigrees with 753 sibling pairs. Results Suggestive evidence for linkage at 6q23-24 in the follow-up sample (LOD = 1.87, p = 0.002 increased to genome-wide significance for linkage in the combined sample (LOD = 4.05, p = 0.00001, while suggestive evidence for linkage was observed at 18q22, in both the follow-up sample (LOD = 0.79, p = 0.03 and the combined sample (LOD = 1.78, p = 0.002. Epistatic analysis indicated that there is no interaction between 6q23-24 and other loci. Conclusion In this replication study, linkage for modifier of age at onset in HD was confirmed at 6q23-24. Evidence for linkage was also found at 18q22. The demonstration of statistically significant linkage to a potential modifier locus opens the path to location cloning of a gene capable of altering HD pathogenesis, which could provide a validated target for therapeutic development in the human patient.

  5. Pre-transplantation risk factors to develop sclerotic chronic GvHD after allogeneic HSCT: a multicenter retrospective study from the Société Française de Greffe de Moelle et de Thérapie Cellulaire (SFGM-TC).

    Science.gov (United States)

    Detrait, M Y; Morisset, S; Peffault de Latour, R; Yakoub-Agha, I; Crocchiolo, R; Tabrizi, R; Bay, J-O; Chevalier, P; Barraco, F; Raus, N; Vigouroux, S; Magro, L; Mohty, M; Milpied, N; Blaise, D; Socié, G; Michallet, M

    2015-02-01

    Sclerotic chronic GvHD (cGvHD) is one of the most severe complications after allo-hematopoietic stem cell transplantation (HSCT). Risk factors associated with this complication remain not very well defined. With the aim to define a pre-transplantation risk profile, we have conducted a French retrospective analysis in 705 consecutive patients between 2005 and 2010. Analyses to determine pre-transplantation risk factors included as variables: patient and donor age, kind of donor, HLA matching, ABO matching, sex-matching, diagnosis, stem cell source, gender, GvHD prophylaxis and antithymocyte globulin (ATG) in the conditioning regimen. The cumulative incidence of sclerotic cGvHD was 18% (95% CI, 16.6-19.6) 3 years after onset of cGvHD. In univariate analysis, we found a significantly lower number of sclerotic cGvHD form in patients transplanted from cord blood cells (P=0.0021), in patients with a one mismatched donor (P=0.041) and in patients who had received ATG in the conditioning regimen (P=0.002). In multivariate analysis, factors associated with an increased risk of sclerotic cGvHD were young patient age, multiple myeloma and PBSC as the stem cell source. ATG in conditioning regimen and cord blood unit as the stem cell source were associated with a lower risk.

  6. AA, sandwich line with magnetic horn

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Continuation from 8010293: Finally, the sandwich line with the horn is placed on the ground, for the horn to be inspected and, if needed, exchanged for a new one. The whole procedure was trained with several members of the AA team, for quick and safe handling, and to share the radiation dose amongst them.

  7. Overall view of AA (Bld 193)

    CERN Multimedia

    1980-01-01

    See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  8. Overview of the Antiproton Accumulator (AA)

    CERN Multimedia

    1982-01-01

    See photo 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  9. Overall view of AA in Bld. 193

    CERN Multimedia

    1980-01-01

    See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  10. AA, mating of BST magnet halves

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    The AA had 2 types of bending magnets: BLG (window-frame,long and narrow) and BST (H-type, short and wide). The BST had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the mating of two BST halves.

  11. AA, vacuum tank for stochastic precooling

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    The vaccum tank in which the fast stochastic precooling kicker was installed. It is clad with heating jackets for bake-out to 200 deg C, indispensable for reaching the operational vacuum of 7E-11 Torr. Alain Poncet, responsible for AA vacuum, is looking on. See also 7910268, 8002234.

  12. Longitudinal study of experimental induction of AA amyloidosis in mice seeded with homologous and heterologous AA fibrils.

    Science.gov (United States)

    Muhammad, Naeem; Murakami, Tomoaki; Inoshima, Yasuo; Ishiguro, Naotaka

    2016-09-01

    To investigate pathogenesis and kinetics of experimentally induced murine AA amyloidosis seeded with homologous (murine) and heterologous (bovine) AA fibrils. Experimental AA amyloidosis was induced by administration of inflammatory stimulus and preformed AA fibrils to a total of 111 female C57/Black mice. In this longitudinal study, heterologous (bovine) as well as homologous (murine) AA fibrils were injected intraperitoneally to mice in various combinations. Re-stimulation was done at 120 or 300 days post first inoculation. To analyze the intensity of amyloid depositions in mice organs, immunohistochemical techniques and image J software were used. Assessment of cytokines level in sera was done using a Mouse Th1/Th2/Th17 Cytokine CBA Kit. Incidence and severity of AA amyloidosis were quite low in mice inoculated with heterologous bovine AA fibrils than homologous murine one. Homologous AA fibrils administration at first and second inoculation caused maximum amount of amyloid depositions and severe systemic form of amyloidosis. Increase in the level of pro-inflammatory cytokine IL-6 was observed after first inoculation, while second inoculation caused a further increase in the level of anti-inflammatory cytokine IL-10. AA amyloidosis can be induced by heterologous as well as homologous AA fibrils. Severity of AA amyloidosis induced with homologous AA fibrils is higher compared to heterologous AA fibrils.

  13. [Risk control of traditional Chinese medicines containing aristolochis acids (AAs) based on influencing factors of content of AAs].

    Science.gov (United States)

    Tian, Jing-Zhuo; Liang, Ai-Hua; Liu, Jing; Zhang, Bo-Li

    2017-12-01

    Aristolochic acids (AAs) widely exist in such plants as Aristolochia and Asarum. The renal toxicity of AAs as well as its carcinogenicity to urinary system have been widely known. In 2003 and 2004, China prohibited the use of Aristolochiae Radix, Aristolochiae Manshuriensis Caulis and Aristolochiae Fangchi Radix, and required administering other AAs-containing medicines in accordance with the regulations for prescription drugs. In this paper, we retrieved literatures on the content determination of AAs in recent 10 years in China. It suggested that the AAs content is lower in Asarum herb, especially in its roots and rhizomes, and most of which do not show detectable amount of AA-I. Some of traditional Chinese medicines show fairly small amount of detectable AA-I. The AAs content in Aristolochia herb (including Fructus Aristolochiae, kaempfer dutchmanspipe root) is relatively high; however, there are fewer literatures for studying the content determination of AAs in Chinese patent medicines. There were many factors affecting AAs content, including the parts used, origins, processing methods, extraction process. It suggested that we should pay attention to the toxicity of Chinese medicines containing AAs and use these decoction pieces and traditional Chinese medicines cautiously. In addition, basic studies for the origins, processing methods and extraction process of Chinese patent medicines containing AAs, as well as supervision and detection of AAs content in traditional Chinese medicinal materials, decoction pieces and Chinese patent medicines shall be strengthened for reducing medication risk and guaranteeing clinical medication safety. Copyright© by the Chinese Pharmaceutical Association.

  14. A modern study of HD 166734: a massive supergiant system

    Science.gov (United States)

    Mahy, L.; Damerdji, Y.; Gosset, E.; Nitschelm, C.; Eenens, P.; Sana, H.; Klotz, A.

    2017-11-01

    Aims: HD 166734 is an eccentric eclipsing binary system composed of two supergiant O-type stars, orbiting with a 34.5-day period. In this rare configuration for such stars, the two objects mainly evolve independently, following single-star evolution so far. This system provides a chance to study the individual parameters of two supergiant massive stars and to derive their real masses. Methods: An intensive monitoring was dedicated to HD 166734. We analyzed mid- and high-resolution optical spectra to constrain the orbital parameters of this system. We also studied its light curve for the first time, obtained in the VRI filters. Finally, we disentangled the spectra of the two stars and modeled them with the CMFGEN atmosphere code in order to determine the individual physical parameters. Results: HD 166734 is a O7.5If+O9I(f) binary. We confirm its orbital period but we revise the other orbital parameters. In comparison to what we found in the literature, the system is more eccentric and, now, the hottest and the most luminous component is also the most massive one. The light curve exhibits only one eclipse and its analysis indicates an inclination of 63.0° ± 2.7°. The photometric analysis provides us with a good estimation of the luminosities of the stars, and therefore their exact positions in the Hertzsprung-Russell diagram. The evolutionary and the spectroscopic masses show good agreement with the dynamical masses of 39.5 M⊙ for the primary and 33.5 M⊙ for the secondary, within the uncertainties. The two components are both enriched in helium and in nitrogen and depleted in carbon. In addition, the primary also shows a depletion in oxygen. Their surface abundances are however not different from those derived from single supergiant stars, yielding, for both components, an evolution similar to that of single stars. Based on observations collected at the European Southern Observatory (La Silla, Chile) with FEROS and TAROT and on data collected at the San Pedro

  15. Comorbid externalising behaviour in AD/HD: evidence for a distinct pathological entity in adolescence.

    Directory of Open Access Journals (Sweden)

    Sharnel Perera

    Full Text Available While the profiling of subtypes of Attention Deficit Hyperactivity Disorder (AD/HD have been the subject of considerable scrutiny, both psychometrically and psychophysiologically, little attention has been paid to the effect of diagnoses comorbid with AD/HD on such profiles. This is despite the greater than 80% prevalence of comorbidity under the DSM-IV-TR diagnostic definitions. Here we investigate the event related potential (ERP and psychometric profiles of Controls, AD/HD, and comorbid AD/HD (particularly AD/HD+ODD/CD groups on six neurocognitive tasks thought to probe the constructs of selective and sustained attention, response inhibition and executive function. Data from 29 parameters extracted from a child group (age range 6 to 12; 52 Controls and 64 AD/HD and from an adolescent group (age range 13 to 17; 79 Controls and 88 AD/HD were reduced via a Principal Components Analysis, the 6 significant eigenvectors then used as determinants of cluster membership via a Two-Step Cluster Analysis. Two clusters were found in the analysis of the adolescent age group--a cluster dominated by Control and AD/HD participants without comorbidity, while the second cluster was dominated by AD/HD participants with externalising comorbidity (largely oppositional defiant/conduct disorder ODD/CD. A similar segregation within the child age group was not found. Further analysis of these objectively determined clusters in terms of their clinical diagnoses indicates a significant effect of ODD/CD comorbidity on a concurrent AD/HD diagnosis. We conclude that comorbid externalising behaviour in AD/HD constitutes a distinct pathological entity in adolescence.

  16. Nuclear Spin-Spin Coupling in HD, HT, and DT

    Science.gov (United States)

    Puchalski, Mariusz; Komasa, Jacek; Pachucki, Krzysztof

    2018-02-01

    The interaction between nuclear spins in a molecule is exceptionally sensitive to the physics beyond the standard model. However, all present calculations of the nuclear spin-spin coupling constant J are burdened by computational difficulties, which hinders the comparison to experimental results. Here, we present a variational approach and calculate the constant J in the hydrogen molecule with the controlled numerical precision, using the adiabatic approximation. The apparent discrepancy with experimental result is removed by an analysis of nonadiabatic effects based on the experimental values of the J constant for HD, HT, and DT molecules. This study significantly improves the reliability of the NMR theory for searching new physics in the spin-spin coupling.

  17. OBSERVATIONS OF ENHANCED RADIATIVE GRAIN ALIGNMENT NEAR HD 97300

    International Nuclear Information System (INIS)

    Andersson, B-G; Potter, S. B.

    2010-01-01

    We have obtained optical multi-band polarimetry toward sightlines through the Chamaeleon I cloud, particularly in the vicinity of the young B9/A0 star HD 97300. We show, in agreement with earlier studies, that the radiation field impinging on the cloud in the projected vicinity of the star is dominated by the flux from the star, as evidenced by a local enhancement in the grain heating. By comparing the differential grain heating with the differential change in the location of the peak of the polarization curve, we show that the grain alignment is enhanced by the increase in the radiation field. We also find a weak, but measurable, variation in the grain alignment with the relative angle between the radiation field anisotropy and the magnetic field direction. Such an anisotropy in the grain alignment is consistent with a unique prediction of modern radiative alignment torque theory and provides direct support for radiatively driven grain alignment.

  18. Estudio multifrecuencia del medio interestelar cercano a HD 192281

    Science.gov (United States)

    Arnal, E. M.; Cappa, C.; Cichowolski, S.; Pineault, S.; St-Louis, N.

    Una de las causas que modifica la estructura y dinámica del medio interestelar es la acción que los vientos de las estrellas de gran masa ejercen sobre el mismo. En este trabajo, mediante el uso de datos interferométricos obtenidos en la banda de radio en la transición de 21-cm del Hidrógeno neutro y de imágenes de la emisión de continuo en las bandas de 408 y 1420 MHz, de imágenes HIRES del satélite IRAS en 60 y 100 micrones, y de observaciones de continuo obtenidas con radiotelescopios de disco simple en 2695, 4850 y 8350 MHz se ha realizado un estudio multifrecuencia de los efectos que los vientos estelares de HD 192281, una estrella de tipo espectral O5 Vn((f))p, han tenido sobre el medio interestelar que rodea a la misma.

  19. Calculations of vibration-rotation energy levels of HD+

    International Nuclear Information System (INIS)

    Balint-Kurti, G.G.; Moss, R.E.; Sadler, I.A.; Shapiro, M.

    1990-01-01

    An artificial-channels scattering method [M. Shapiro and G. G. Balint-Kurti, J. Chem. Phys. 71, 1461 (1979)] is used with a transformed Hamiltonian [R. E. Moss and I. A. Sadler, Molec. Phys. 66, 591 (1989)] to calculate the energies of vibration-rotation levels for the ground electronic state of HD + . All nonadiabatic effects, except for part of the coupling of rotational and electronic angular momenta, are accounted for. The results, which are for v=0--21, J=0,1, together with some other levels involved in observed transitions, are compared with previous calculations, particularly those of Wolniewicz and Poll [Molec. Phys. 59, 953 (1986)]. Inclusion of a correction to the energies of J≠0 levels to allow for the remaining contribution of Π electronic states permits comparison with experimental transition energies. The agreement is excellent

  20. Calculations of vibration-rotation energy levels of HD+

    Science.gov (United States)

    Balint-Kurti, G. G.; Moss, R. E.; Sadler, I. A.; Shapiro, M.

    1990-05-01

    An artificial-channels scattering method [M. Shapiro and G. G. Balint-Kurti, J. Chem. Phys. 71, 1461 (1979)] is used with a transformed Hamiltonian [R. E. Moss and I. A. Sadler, Molec. Phys. 66, 591 (1989)] to calculate the energies of vibration-rotation levels for the ground electronic state of HD+. All nonadiabatic effects, except for part of the coupling of rotational and electronic angular momenta, are accounted for. The results, which are for v=0-21, J=0,1, together with some other levels involved in observed transitions, are compared with previous calculations, particularly those of Wolniewicz and Poll [Molec. Phys. 59, 953 (1986)]. Inclusion of a correction to the energies of J≠0 levels to allow for the remaining contribution of Π electronic states permits comparison with experimental transition energies. The agreement is excellent.

  1. Characterization of the Mysteriously Cool Brown Dwarf HD 4113

    Science.gov (United States)

    Ednie, Michaela; Follette, Katherine; Ward-Duong, Kimberly

    2018-01-01

    Characterizing the physical properties of brown dwarfs is necessary to expand and improve our understanding of low mass companions, including exoplanets. Systems with both close radial velocity companions and distant directly imaged companions are particularly powerful in understanding planet formation mechanisms. Early in 2017, members of the SPHERE team discovered a companion brown dwarf in the HD 4113 system, which also contains a known RV planet. Atmospheric model fits to the Y and J-band spectra and H2/H3 photometry of the brown dwarf suggested it is unusually cool. We obtained new Magellan data in the Z and K’ bands in mid-2017. This data will help us to complete a more detailed atmospheric and astrometric characterization of this unusually cool companion. Broader wavelength coverage will help in accurate spectral typing and estimations of luminosity, temperature, surface gravity, radius, and composition. Additionally, a second astrometric epoch will help constrain the architecture of the system.

  2. Perceived Quality of Full HD Video - Subjective Quality Assessment

    Directory of Open Access Journals (Sweden)

    Juraj Bienik

    2016-01-01

    Full Text Available In recent years, an interest in multimedia services has become a global trend and this trend is still rising. The video quality is a very significant part from the bundle of multimedia services, which leads to a requirement for quality assessment in the video domain. Video quality of a streamed video across IP networks is generally influenced by two factors “transmission link imperfection and efficiency of compression standards. This paper deals with subjective video quality assessment and the impact of the compression standards H.264, H.265 and VP9 on perceived video quality of these compression standards. The evaluation is done for four full HD sequences, the difference of scenes is in the content“ distinction is based on Spatial (SI and Temporal (TI Index of test sequences. Finally, experimental results follow up to 30% bitrate reducing of H.265 and VP9 compared with the reference H.264.

  3. Metformin intake associates with better cognitive function in patients with Huntington's disease.

    Directory of Open Access Journals (Sweden)

    David Hervás

    Full Text Available Huntington's disease (HD is an inherited, dominant neurodegenerative disorder caused by an abnormal expansion of CAG triplets in the huntingtin gene (htt. Despite extensive efforts to modify the progression of HD thus far only symptomatic treatment is available. Recent work suggests that treating invertebrate and mice HD models with metformin, a well-known AMPK activator which is used worldwide to treat type 2-diabetes, reduces mutant huntingtin from cells and alleviates many of the phenotypes associated to HD. Herein we report statistical analyses of a sample population of participants in the Enroll-HD database, a world-wide observational study on HD, to assess the effect of metformin intake in HD patients respect to cognitive status using linear models. This cross-sectional study shows for the first time that the use of metformin associates with better cognitive function in HD patients.

  4. Gas Modelling in the Disc of HD 163296

    Science.gov (United States)

    Tilling, I.; Woitke, P.; Meeus, G.; Mora, A.; Montesinos, B.; Riviere-Marichalar, P.; Eiroa, C.; Thi, W. -F.; Isella, A.; Roberge, A.; hide

    2011-01-01

    We present detailed model fits to observations of the disc around the Herbig Ae star HD 163296. This well-studied object has an age of approx. 4Myr, with evidence of a circumstellar disc extending out to approx. 540AU. We use the radiation thermo-chemical disc code ProDiMo to model the gas and dust in the circumstellar disc of HD 163296, and attempt to determine the disc properties by fitting to observational line and continuum data. These include new Herschel/PACS observations obtained as part of the open-time key program GASPS (Gas in Protoplanetary Systems), consisting of a detection of the [Oi] 63 m line and upper limits for several other far infrared lines. We complement this with continuum data and ground-based observations of the CO-12 3-2, 2-1 and CO-13 J=1-0 line transitions, as well as the H2 S(1) transition. We explore the effects of stellar ultraviolet variability and dust settling on the line emission, and on the derived disc properties. Our fitting efforts lead to derived gas/dust ratios in the range 9-100, depending on the assumptions made. We note that the line fluxes are sensitive in general to the degree of dust settling in the disc, with an increase in line flux for settled models. This is most pronounced in lines which are formed in the warm gas in the inner disc, but the low excitation molecular lines are also affected. This has serious implications for attempts to derive the disc gas mass from line observations. We derive fractional PAH abundances between 0.007 and 0.04 relative to ISM levels. Using a stellar and UV excess input spectrum based on a detailed analysis of observations, we find that the all observations are consistent with the previously assumed disc geometry

  5. Fusion with highly spin polarized HD and D2

    International Nuclear Information System (INIS)

    Honig, A.; Letzring, S.; Skupsky, S.

    1993-01-01

    Our experimental efforts over the past 5 years have been aimed at cazrying out ICF shots with spin-polarized 0 fuel. We successfully prepared polarized 0 in HD, and solved the problems of loading target shells with our carefully prepared isotopic -rnixt.l.l?-es, polarizing them so that the 0 polarization remains metastably frozen-in for about half a day, and carrying out the various cold transfer requirements at Syracuse, where the target is prepared, and at Rochester, where the cold target is inserted fusion chamber. Upon shooting the accurately positioned unpolarized high density cold target, no neutron yield was observed. Inspection inside the OMEGA tank after the shot indicated the absence of neutron yield was dus to mal-timing or insufficient retraction rate of OMEGA'S fast shroud mechanism, resulting in interception of at least 20 of the 24 laser beams by the faulty shroud. In spits of this, all alements of the complex experiment we originally undertook have been successfully demonstrated, and the cold retrieval concepts and methods we developed are being utilized on the ICF upgrades at Rochester and at Livermore. In addition to the solution of the interface problems, we obtained novel results on polymer shell characteristics at low temperatures, and continuation of these experiments is c = ently supported by KLUP. Extensive additional mappings were ca=ied out of nuclear spin relaxation rates of H and D in solid HD in the temperature-magnetic field rangs of 0.01 to 4.2K and 0 - 13 Tesla. New phenomena were discovered, such as association of impurity clustering with very low temperature motion, and inequality of the growth-rate and decay-rate of the magnetization

  6. H/D Isotope Effects in Hydrogen Bonded Systems

    Directory of Open Access Journals (Sweden)

    Aleksander Filarowski

    2013-04-01

    Full Text Available An extremely strong H/D isotope effect observed in hydrogen bonded A-H…B systems is connected with a reach diversity of the potential shape for the proton/deuteron motion. It is connected with the anharmonicity of the proton/deuteron vibrations and of the tunneling effect, particularly in cases of short bridges with low barrier for protonic and deuteronic jumping. Six extreme shapes of the proton motion are presented starting from the state without possibility of the proton transfer up to the state with a full ionization. The manifestations of the H/D isotope effect are best reflected in the infra-red absorption spectra. A most characteristic is the run of the relationship between the isotopic ratio nH/nD and position of the absorption band shown by using the example of NHN hydrogen bonds. One can distinguish a critical range of correlation when the isotopic ratio reaches the value of ca. 1 and then increases up to unusual values higher than . The critical range of the isotope effect is also visible in NQR and NMR spectra. In the critical region one observes a stepwise change of the NQR frequency reaching 1.1 MHz. In the case of NMR, the maximal isotope effect is reflected on the curve presenting the dependence of Δd (1H,2H on d (1H. This effect corresponds to the range of maximum on the correlation curve between dH and ΔpKa that is observed in various systems. There is a lack in the literature of quantitative information about the influence of isotopic substitution on the dielectric properties of hydrogen bond except the isotope effect on the ferroelectric phase transition in some hydrogen bonded crystals.

  7. ALMA OBSERVATIONS OF HD 141569’s CIRCUMSTELLAR DISK

    Energy Technology Data Exchange (ETDEWEB)

    White, J. A.; Boley, A. C. [Department of Physics and Astronomy, 6224 Agricultural Road, Vancouver, BC V6T 1Z1 (Canada); Hughes, A. M.; Flaherty, K. M. [Department of Astronomy, Van Vleck Observatory, Wesleyan University, 96 Foss Hill Drive, Middletown, CT 06459 (United States); Ford, E. [Center for Exoplanets and Habitable Worlds, 525 Davey Laboratory, The Pennsylvania State University, University Park, PA 16802-2111 (United States); Wilner, D.; Payne, M. [Harvard Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Corder, S., E-mail: jawhite@astro.ubc.ca [North American ALMA Science Center, National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA, 22903 (United States)

    2016-09-20

    We present ALMA band 7 (345 GHz) continuum and {sup 12}CO( J = 3-2) observations of the circumstellar disk surrounding HD 141569. At an age of about 5 Myr, the disk has a complex morphology that may be best interpreted as a nascent debris system with gas. Our 870 μ m ALMA continuum observations resolve a dust disk out to approximately 56 au from the star (assuming a distance of 116 pc) with 0.″38 resolution and 0.07 mJy beam{sup −1} sensitivity. We measure a continuum flux density for this inner material of 3.8 ± 0.4 mJy (including calibration uncertainties). The {sup 12}CO(3-2) gas is resolved kinematically and spatially from about 30 to 210 au. The integrated {sup 12}CO(3-2) line flux density is 15.7 ± 1.6 Jy km s{sup −1}. We estimate the mass of the millimeter debris and {sup 12}CO(3-2) gas to be ≳0.04 M {sub ⊕} and ∼2 × 10{sup −3} M {sub ⊕}, respectively. If the millimeter grains are part of a collisional cascade, then we infer that the inner disk (<50 au) has ∼160 M {sub ⊕} contained within objects less than 50 km in radius, depending on the planetesimal size distribution and density assumptions. Markov Chain Monte Carlo modeling of the system reveals a disk morphology with an inclination of 53.°4 centered around an M = 2.39 M {sub ⊙} host star ( M sin( i ) = 1.92 M {sub ⊙}). We discuss whether the gas in HD 141569's disk may be second generation. If it is, the system can be used to study the clearing stages of planet formation.

  8. The solar-like CoRoT target HD 170987: spectroscopic and seismic observations

    DEFF Research Database (Denmark)

    Mathur , S; Karoff, Christoffer

    2010-01-01

    that are lower than predicted. We present here the results from the analysis of the star HD 170987. Aims: The goal of this research work is to characterise the global parameters of HD 170987. We look for global seismic parameters such as the mean large separation, maximum amplitude of the modes, and surface...

  9. The Stroop Revisited: A Meta-Analysis of Interference Control in AD/HD

    Science.gov (United States)

    Van Mourik, Rosa; Oosterlaan, Jaap; Sergeant, Joseph A.

    2005-01-01

    Background: An inhibition deficit, including poor interference control, has been implicated as one of the core deficits in AD/HD. Interference control is clinically measured by the Stroop Colour-Word Task. The aim of this meta-analysis was to investigate the strength of an interference deficit in AD/HD as measured by the Stroop Colour-Word Task…

  10. Testing stellar evolution models with the retired A star HD 185351

    DEFF Research Database (Denmark)

    Hjørringgaard, J. G.; Silva Aguirre, V.; White, T. R.

    2017-01-01

    The physical parameters of the retired A star HD 185351 were analysed in great detail by Johnson et al. using interferometry, spectroscopy, and asteroseismology. Results from all independent methods are consistent with HD 185351 having a mass in excess of 1.5 M⊙. However, the study also showed...

  11. Observation of the v′=8←v=0 vibrational overtone in cold trapped HD +

    NARCIS (Netherlands)

    J.C.J. Koelemeij; D.W.E. Noom; D. de Jong; M.A. Haddad; W. Ubachs

    2011-01-01

    textabstractWe report the observation of the hitherto undetected v′=8←v=0 vibrational overtone in trapped HD+molecular ions, sympathetically cooled by laser-cooled Be+ions. The overtone is excited using 782 nm laser radiation, after which HD+ions in v=8 are photodissociated by the 313 nm laser used

  12. Wind collision effects in the early-type close binaries HD 47129 and AO Cassiopeiae

    Science.gov (United States)

    Sahade, Jorge; Brandi, Estela

    1991-01-01

    Selected regions of IUE spectra of the binaries HD 47129 and AO Cassiopeiae are analyzed, and evidence for the effect of wind collision in both objects is found. A possible alternative explanation for the behavior of the spectral lines of the 'secondary' component in HD 47129 is suggested.

  13. HDAC4-Myogenin Axis As an Important Marker of HD-Related Skeletal Muscle Atrophy

    Science.gov (United States)

    Smeets, Cleo J. L. M.; Franklin, Sophie A.; Bondulich, Marie K.; Jolinon, Nelly; Muller, Thomas; Ahmed, Mhoriam; Dick, James R. T.; Piotrowska, Izabela; Greensmith, Linda; Smolenski, Ryszard T.; Bates, Gillian P.

    2015-01-01

    Skeletal muscle remodelling and contractile dysfunction occur through both acute and chronic disease processes. These include the accumulation of insoluble aggregates of misfolded amyloid proteins that is a pathological feature of Huntington’s disease (HD). While HD has been described primarily as a neurological disease, HD patients’ exhibit pronounced skeletal muscle atrophy. Given that huntingtin is a ubiquitously expressed protein, skeletal muscle fibres may be at risk of a cell autonomous HD-related dysfunction. However the mechanism leading to skeletal muscle abnormalities in the clinical and pre-clinical HD settings remains unknown. To unravel this mechanism, we employed the R6/2 transgenic and HdhQ150 knock-in mouse models of HD. We found that symptomatic animals developed a progressive impairment of the contractile characteristics of the hind limb muscles tibialis anterior (TA) and extensor digitorum longus (EDL), accompanied by a significant loss of motor units in the EDL. In symptomatic animals, these pronounced functional changes were accompanied by an aberrant deregulation of contractile protein transcripts and their up-stream transcriptional regulators. In addition, HD mouse models develop a significant reduction in muscle force, possibly as a result of a deterioration in energy metabolism and decreased oxidation that is accompanied by the re-expression of the HDAC4-DACH2-myogenin axis. These results show that muscle dysfunction is a key pathological feature of HD. PMID:25748626

  14. The Reality of Living with AD/HD: Children's Concern about Educational and Medical Support

    Science.gov (United States)

    Hughes, Lesley

    2007-01-01

    A diagnosis of AD/HD may tell us that the child has the core characteristics of inattentiveness, impulsivity and or hyperactivity, but it fails to convey the extent to which the social context of the child's environment manipulates these characteristics. This article reports on how children with a diagnosis of AD/HD view the impact their social…

  15. Feasibility of Incremental 2-Times Weekly Hemodialysis in Incident Patients With Residual Kidney Function

    Directory of Open Access Journals (Sweden)

    Andrew I. Chin

    2017-09-01

    Discussion: More than 50% of incident HD patients with RKF have adequate kidney urea clearance to be considered for 2-times weekly HD. When additionally ultrafiltration volume and blood pressure stability are taken into account, more than one-fourth of the total cohort could optimally start HD in an incremental fashion.

  16. Absorption spectra of AA-stacked graphite

    International Nuclear Information System (INIS)

    Chiu, C W; Lee, S H; Chen, S C; Lin, M F; Shyu, F L

    2010-01-01

    AA-stacked graphite shows strong anisotropy in geometric structures and velocity matrix elements. However, the absorption spectra are isotropic for the polarization vector on the graphene plane. The spectra exhibit one prominent plateau at middle energy and one shoulder structure at lower energy. These structures directly reflect the unique geometric and band structures and provide sufficient information for experimental fitting of the intralayer and interlayer atomic interactions. On the other hand, monolayer graphene shows a sharp absorption peak but no shoulder structure; AA-stacked bilayer graphene has two absorption peaks at middle energy and abruptly vanishes at lower energy. Furthermore, the isotropic features are expected to exist in other graphene-related systems. The calculated results and the predicted atomic interactions could be verified by optical measurements.

  17. First circulating beam in the AA

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.5 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are to numerous to name them all. Heribert Koziol, apparently asleep, is answering the call from an impatient director. See also 8007094.

  18. AA, assembly of wide bending magnet

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    The very particular lattice of the AA required 2 types of dipoles (bending magnets; BST, short and wide; BLG, long and narrow). The wide ones had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the copper coils being hoisted onto the lower half of a BST. See also 7811105, 8006050. For a BLG, see 8001044.

  19. AA, inner conductor of a magnetic horn

    CERN Multimedia

    CERN PhotoLab

    1981-01-01

    At the start-up of the AA and during its initial operation, magnetic horns focused the antiprotons emanating from the production target. These "current-sheet lenses" had a thin inner conductor (for minimum absorption of antiprotons), machined from aluminium to wall thicknesses of 0.7 or 1 mm. The half-sine pulses rose to 150 kA in 8 microsec. The angular acceptance was 50 mrad.

  20. The thioacetate-ω(γ-lactam carboxamide) HDAC inhibitor ST7612AA1 as HIV-1 latency reactivation agent.

    Science.gov (United States)

    Badia, Roger; Grau, Judith; Riveira-Muñoz, Eva; Ballana, Ester; Giannini, Giuseppe; Esté, José A

    2015-11-01

    Antiretroviral therapy (ART) is unable to cure HIV infection. The ability of HIV to establish a subset of latent infected CD4(+) T cells, which remain undetectable to the immune system, becomes a major roadblock to achieve viral eradication. Histone deacetylase inhibitors (HDACi) have been shown to potently induce the reactivation of latent HIV. Here, we show that a new thiol-based HDACi, the thioacetate-ω(γ-lactam carboxamide) derivative ST7612AA1, is a potent inducer of HIV reactivation. We evaluated HIV reactivation activity of ST7612AA1 compared to panobinostat (PNB), romidepsin (RMD) and vorinostat (VOR) in cell culture models of HIV-1 latency, in latently infected primary CD4(+) T lymphocytes and in PBMCs from HIV(+) patients. ST7612AA1 potently induced HIV-1 reactivation at submicromolar concentrations with comparable potency to panobinostat or superior to vorinostat. The presence of known antiretrovirals did not affect ST7612AA1-induced reactivation and their activity was not affected by ST7612AA1. Cell proliferation and cell activation were not affected by ST7612AA1, or any other HDACi used. In conclusion, our results indicate that ST7612AA1 is a potent activator of latent HIV and that reactivation activity of ST7612AA1 is exerted without activation or proliferation of CD4(+) T cells. ST7612AA1 is a suitable candidate for further studies of HIV reactivation strategies and potential new therapies to eradicate the viral reservoirs. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. 40 CFR Appendix A to Subpart Aa of... - Applicability of General Provisions (40 CFR Part 63, Subpart A) to Subpart AA

    Science.gov (United States)

    2010-07-01

    ... (40 CFR Part 63, Subpart A) to Subpart AA A Appendix A to Subpart AA of Part 63 Protection of... Hazardous Air Pollutants From Phosphoric Acid Manufacturing Plants Pt. 63, Subpt. AA, App. A Appendix A to Subpart AA of Part 63—Applicability of General Provisions (40 CFR Part 63, Subpart A) to Subpart AA 40 CFR...

  2. Dicty_cDB: FC-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA10 (Link to dictyBase) - - - Contig-U16358-1 FC-AA10P (Li...nk to Original site) FC-AA10F 659 FC-AA10Z 544 FC-AA10P 1203 - - Show FC-AA10 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA10Q.Seq.d/ Representative seq. ID FC-AA...10P (Link to Original site) Representative DNA sequence >FC-AA10 (FC-AA10Q) /CSM/FC/FC-AA/FC-AA10Q.Seq.d/ AA...ATGACTACCTTTAACGAATATCCATTCTTGGCTGAATTAGGCATTAAAGCTGAAAATA ATGATGGAGTCTTCAATGGAAAATGGGGAGGTGCTGGTGAAATCATCAA

  3. Dicty_cDB: FC-AA04 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA04 (Link to dictyBase) - - - Contig-U15354-1 FC-AA04P (Li...nk to Original site) FC-AA04F 546 FC-AA04Z 484 FC-AA04P 1030 - - Show FC-AA04 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA04Q.Seq.d/ Representative seq. ID FC-AA...04P (Link to Original site) Representative DNA sequence >FC-AA04 (FC-AA04Q) /CSM/FC/FC-AA/FC-AA04Q.Seq.d/ AA...TAATACACATAAAAAATTTATTAAATAAAAATGACTACAACAACAACAAATGAAGTTT ATATAGTTGATTGTATTCGTACACCAATTGGTAGAGGATATAGTAA

  4. Dicty_cDB: FC-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA03 (Link to dictyBase) - - - Contig-U15331-1 FC-AA03P (Li...nk to Original site) FC-AA03F 595 FC-AA03Z 546 FC-AA03P 1141 - - Show FC-AA03 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA03Q.Seq.d/ Representative seq. ID FC-AA...03P (Link to Original site) Representative DNA sequence >FC-AA03 (FC-AA03Q) /CSM/FC/FC-AA/FC-AA03Q.Seq.d/ AA...AATGTCATCTTATTTATTCACTAGTGAATCCGTCACCGAAGTCATCCAGATAAAATCT GTGATCAAGTATCAGATGCTGTTCTCGATGCTTGTTTAGCTCAA

  5. Which Executive Functioning Deficits Are Associated with AD/HD, ODD/CD and Comorbid AD/HD+ODD/CD? (Attention Deficit/hyperactivity Disorder)(Oppositional Defiant Disorder)

    Science.gov (United States)

    Oosterlaan, Jaap; Scheres, Anouk; Sergeant, Joseph A.

    2005-01-01

    This study investigated (1) whether attention deficit/hyperactivity disorder (AD/HD) is associated with executive functioning (EF) deficits while controlling for oppositional defiant disorder/conduct disorder (ODD/CD), (2) whether ODD/CD is associated with EF deficits while controlling for AD/HD, and (3) whether a combination of AD/HD and ODD/CD…

  6. _. AA~ AA, _ _

    Indian Academy of Sciences (India)

    It is probably very difficult to find a person who has not been charmed by the exquisite beauty of soap bubbles. Invariably, our appre- ciation of soap bubbles ends with an admira- tion of their shapes and colours. We do not realise that there is a profound science behind their beauty. The best book to start learning.

  7. THREE-DIMENSIONAL ATMOSPHERIC CIRCULATION MODELS OF HD 189733b AND HD 209458b WITH CONSISTENT MAGNETIC DRAG AND OHMIC DISSIPATION

    International Nuclear Information System (INIS)

    Rauscher, Emily; Menou, Kristen

    2013-01-01

    We present the first three-dimensional circulation models for extrasolar gas giant atmospheres with geometrically and energetically consistent treatments of magnetic drag and ohmic dissipation. Atmospheric resistivities are continuously updated and calculated directly from the flow structure, strongly coupling the magnetic effects with the circulation pattern. We model the hot Jupiters HD 189733b (T eq ≈ 1200 K) and HD 209458b (T eq ≈ 1500 K) and test planetary magnetic field strengths from 0 to 30 G. We find that even at B = 3 G the atmospheric structure and circulation of HD 209458b are strongly influenced by magnetic effects, while the cooler HD 189733b remains largely unaffected, even in the case of B = 30 G and super-solar metallicities. Our models of HD 209458b indicate that magnetic effects can substantially slow down atmospheric winds, change circulation and temperature patterns, and alter observable properties. These models establish that longitudinal and latitudinal hot spot offsets, day-night flux contrasts, and planetary radius inflation are interrelated diagnostics of the magnetic induction process occurring in the atmospheres of hot Jupiters and other similarly forced exoplanets. Most of the ohmic heating occurs high in the atmosphere and on the dayside of the planet, while the heating at depth is strongly dependent on the internal heat flux assumed for the planet, with more heating when the deep atmosphere is hot. We compare the ohmic power at depth in our models, and estimates of the ohmic dissipation in the bulk interior (from general scaling laws), to evolutionary models that constrain the amount of heating necessary to explain the inflated radius of HD 209458b. Our results suggest that deep ohmic heating can successfully inflate the radius of HD 209458b for planetary magnetic field strengths of B ≥ 3-10 G.

  8. The HD 209458 system: a re-assessment

    Science.gov (United States)

    Ballester, G. E.

    2014-03-01

    The hot-Jupiter HD 209458b was the first exoplanet on which an extended upper atmosphere was discovered in H I reaching out to Roche-lobe distances (Vidal-Madjar et al. 2003; Ben-Jaffel 2008). Subsequently the heavier and abundant species of O I and C II were also observed, presumably dragged along in a strong hydrodynamic outflow of the lighter bulk hydrogen gas (Vidal-Madjar et al. 2004; Ben-Jaffel & Hosseini 2010). Recently, an extended nebula of Si III ions was reported from COS observations in contradiction with STIS observations that show no detection (Linsky et al. 2010; Vidal-Madjar et al. 2004). There is also a very recent detection of extended Mg I ions on this planet but not of Mg II as would be expected (Vidal-Madjar et al. 2013). Here we present new results from a study where we have re-analyzed all available HST FUV data on Si III for this system, showing that 7 out of 8 transit observations with STIS do not show any transit signature in Si III, and also showing the reported COS detection to be invalid because the observations used to represent the off-transit stellar flux showed a similar ~9% variability than the reported ~8% transit signature (Ballester and Ben- Jaffel 2014). The Mg I detection reveals that magnesium is not effectively removed by silicate condensation in the lower atmosphere of this planet, and consequently, that silicon should also be present in some form, most likely in the lower ionization state of Si II. The detection of Mg I and future potential detection of some form of silicon open a new avenue to study both upper and lower regions of the same atmosphere. On the top region, species are controlled principally by the huge stellar input. Here, we also present new results from a study of the star HD 290458, where we find evidence for low activity on a long-term basis (Ballester et al. 2014). This implies a significantly lower EUV flux to the planet than assumed in previous hydrodynamic and upper-atmospheric modeling of the hot

  9. Pharmacokinetics of erlotinib and its active metabolite OSI-420 in patients with non-small cell lung cancer and chronic renal failure who are undergoing hemodialysis.

    Science.gov (United States)

    Togashi, Yosuke; Masago, Katsuhiro; Fukudo, Masahide; Terada, Tomohiro; Ikemi, Yasuaki; Kim, Young Hak; Fujita, Shiro; Irisa, Kaoru; Sakamori, Yuichi; Mio, Tadashi; Inui, Ken-Ichi; Mishima, Michiaki

    2010-05-01

    Although erlotinib, an orally active and selective tyrosine kinase inhibitor of epidermal growth factor receptor, is mainly metabolized in the liver, its effectiveness and safety for patients with chronic renal failure (CRF) undergoing hemodialysis (HD) has not been reported. Thus, we investigated the pharmacokinetics (PK) of erlotinib and its active metabolite OSI-420 in such patients with nonsmall cell lung cancer (NSCLC). We administered 150 mg erlotinib daily to three patients with NSCLC and CRF undergoing HD (HD group) and five patients with NSCLC and normal organ function (control group) and analyzed the PK of erlotinib and OSI-420. In the HD group, PK analyses were performed on day 1 (off HD), day 8 (off HD), and day 9 (on HD) after starting administration of erlotinib, and in the control group, they were performed on day 1 and day 8. In the HD group, there were little differences in the PK data between day 8 and day 9. The PK data on day 1 and day 8 of the HD group were also similar to those of the control group. There were no serious adverse events in any cases, and one of the HD patients achieved partial response. Erlotinib was hardly affected by renal function and HD, which confirms the effectiveness and safety of erlotinib treatment in patients with NSCLC and CRF undergoing HD. Erlotinib can become one treatment option for such patients.

  10. Reducing Igf-1r levels leads to paradoxical and sexually dimorphic effects in HD mice.

    Directory of Open Access Journals (Sweden)

    Silvia Corrochano

    Full Text Available Many of the neurodegenerative diseases that afflict people in later life are associated with the formation of protein aggregates. These so-called "proteinopathies" include Alzheimer's disease (AD and Huntington's disease (HD. The insulin/insulin-like growth factor signalling (IIS pathway has been proposed to modulate such diseases in model organisms, as well as the general ageing process. In this pathway, insulin-like growth factor binds to insulin-like growth factor receptors, such as the insulin-like growth factor 1 receptor (IGF-1R. Heterozygous deletion of Igf-1r has been shown to lead to increased lifespan in mice. Reducing the activity of this pathway had benefits in a HD C. elegans model, and some of these may be attributed to the expected inhibition of mTOR activity resulting in an increase in autophagy, which would enhance mutant huntingtin clearance. Thus, we tested if heterozygous deletion of Igf-1r would lead to benefits in HD related phenotypes in the mouse. Surprisingly, reducing Igf-1r levels led to some beneficial effects in HD females, but also led to some detrimental effects in HD males. Interestingly, Igf-1r deficiency had no discernible effects on downstream mTOR signalling in HD mice. These results do not support a broad beneficial effect of diminishing the IIS pathway in HD pathology in a mammalian system.

  11. [Relationship between characteristic behaviors of children with AD/HD and mothers' parenting styles].

    Science.gov (United States)

    Mano, Shoko; Uno, Hiroyuki

    2007-01-01

    Previous studies have revealed that mothers of children with attention-deficit/hyperactivity disorder (AD/HD) have an authoritarian parenting style. However, the psychological process of developing an authoritarian parenting style has yet to be clearly defined. To clarify this psychological process, the present study examined the hypothesis that the characteristic behaviors of children with AD/HD initially increase the mothers' parenting stress, which influences their parenting style. Thirty-six mothers of children with AD/HD (children's mean age: 8.1 years) and the same number of controls (children's mean age: 8.4 years) participated in the present study. The mothers' parenting stress was assessed using the Japanese Parenting Stress Index. Parenting styles were assessed using the TK-style scale for evaluating the relationships between parents and children. The results indicated that the mothers of children with AD/HD had significantly higher scores than controls for all parenting stress items and negative parenting style variables (dissatisfaction, reproach, strictness, interference, inconsistency and disagreement of 10 attitudes). Stepwise multiple regression analysis revealed that the characteristic behaviors of children with AD/HD were associated with the degree of attachment in mothers, which was related to the strict and reproachful parenting style in the AD/HD group. These results suggest that mothers of children with AD/HD are likely to have a strict and reproachful parenting style as a result of a lack of attachment with the child.

  12. The relationship between executive function, AD/HD, overeating, and obesity.

    Science.gov (United States)

    Dempsey, Anita; Dyehouse, Janice; Schafer, John

    2011-08-01

    Attention-deficit/hyperactivity disorder (AD/HD) and obesity are complex, costly disorders affecting physical, emotional, and social well-being. Executive function (EF), the cognitive ability for self-understanding and regulation, is often impaired in AD/HD, yet rarely considered in treatment of obese individuals with AD/HD. The hypothesis for this study is that low EF is seen in individuals with 4 or more symptoms of adult AD/HD and is associated with overeating behaviors leading to obesity. A nonexperimental single group design was used. A volunteer convenience sample (n = 125) completed EF, AD/HD, eating, and BMI measures. Path analysis tested the hypothesized/ modified model. Chi square (χ(2) = 6.15, df = 6, p = .4) and RMSEA (0.014) indicated a very good fit for the data. Assessment of EF and AD/HD symptoms in obese individuals is supported. Further study is needed to more fully understand this relationship and to develop strategies to address overeating behaviors in obese individuals with AD/HD.

  13. Physical Activity Self-Management and Coaching Compared to Social Interaction in Huntington Disease: Results From the ENGAGE-HD Randomized, Controlled Pilot Feasibility Trial.

    Science.gov (United States)

    Busse, Monica; Quinn, Lori; Drew, Cheney; Kelson, Mark; Trubey, Rob; McEwan, Kirsten; Jones, Carys; Townson, Julia; Dawes, Helen; Tudor-Edwards, Rhiannon; Rosser, Anne; Hood, Kerenza

    2017-06-01

    Self-management and self-efficacy for physical activity is not routinely considered in neurologic rehabilitation. This study assessed feasibility and outcomes of a 14-week physical activity self-management and coaching intervention compared with social contact in Huntington disease (HD) to inform the design of a future full-scale trial. Assessor blind, multisite, randomized pilot feasibility trial. Participants were recruited and assessed at baseline, 16 weeks following randomization, and then again at 26 weeks in HD specialist clinics with intervention delivery by trained coaches in the participants' homes. People with HD were allocated to the ENGAGE-HD physical activity coaching intervention or a social interaction intervention. Eligibility, recruitment, retention, and intervention participation were determined at 16 weeks. Other outcomes of interest included measures of mobility, self-efficacy, physical activity, and disease-specific measures of motor and cognition. Fidelity and costs for both the physical activity and social comparator interventions were established. Forty percent ( n = 46) of eligible patients were enrolled; 22 were randomized to the physical intervention and 24 to social intervention. Retention rates in the physical intervention and social intervention were 77% and 92%, respectively. Minimum participation criteria were achieved by 82% of participants in the physical intervention and 100% in the social intervention. There was no indication of between-group treatment effects on function; however, increases in self-efficacy for exercise and self-reported levels of physical activity in the physical intervention lend support to our predefined intervention logic model. The use of self-report measures may have introduced bias. An HD physical activity self-management and coaching intervention is feasible and worthy of further investigation. © 2017 American Physical Therapy Association

  14. Involvement of p38MAPK in Impaired Neutrophil Bactericidal Activity of Hemodialysis Patients.

    Science.gov (United States)

    Kamikawa, Yasutaka; Sakai, Norihiko; Miyake, Taito; Sagara, Akihiro; Shinozaki, Yasuyuki; Kitajima, Shinji; Toyama, Tadashi; Hara, Akinori; Iwata, Yasunori; Shimizu, Miho; Furuichi, Kengo; Imamura, Ryu; Suda, Takashi; Kaneko, Shuichi; Wada, Takashi

    2018-01-10

    Mortality from infections has been reported to be higher in hemodialysis (HD) patients. Although dysfunction of neutrophils against bacterial infection was reported in HD patients, the precise mechanism remains to be clarified. We therefore examined the impacts of neutrophil inflammatory signaling on bactericidal activity in HD patients. Comprehensive analyses of intracellular signalings were performed in whole blood of HD patients and control using a microarray system. To confirm the contribution of the signaling to bactericidal activity in neutrophils, we examined the phosphorylation, bacterial killing function, reactive oxygen species (ROS) production, and myeloperoxidase (MPO) release in neutrophils against Staphylococcus aureus. RNA microarray analysis showed the suppression of p38 mitogen activated protein kinase (MAPK) signaling in HD patients. Neutrophils in HD patients showed the impairment of bactericidal activity against S. aureus compared to healthy subjects. Phosphorylation rate of p38MAPK of neutrophils in response to S. aureus was lower in HD patients than healthy subjects. The levels of ROS produced by neutrophils after co-culture with S. aureus were lower in HD patients, on the other hand, there was no difference of MPO release between HD patients and healthy subjects. A selective pharmacological inhibitor of p38MAPK suppressed bacterial killing function as well as ROS production in neutrophils of healthy subjects. Impairment of p38MAPK signaling pathway might contribute to the suppression of neutrophil bactericidal activity in HD patients through less production of ROS. © 2018 International Society for Apheresis, Japanese Society for Apheresis, and Japanese Society for Dialysis Therapy.

  15. Design of a polarized target made of pure HD: analysis and distillation of HD, resonant virtual Compton scattering on the nucleon at TJNAF

    International Nuclear Information System (INIS)

    Bouchigny, S.

    2004-04-01

    The first part describe my work on the frozen spin target project HYDILE. This target has to be made of very pure HD (Hydrogen Deuterium), better than 99.95%. However, commercial HD is never found with a concentration better than 98%. The goal was, then, to build an HD distillation facility which could produce pure HD. We describe, in this thesis, the design of the distillator and the implementation of a quadrupole mass spectrometer to monitor the HD purity during the distillation process. The second part of the thesis concerns the analysis taken at the electron accelerator facility TJNAF (Virginia, USA). We look at the electroproduction of Delta resonances involving Deep Virtual Compton Scattering (DeltaVCS). The interpretation of this reaction in terms of GPDs (Generalized Parton Distribution) can provide new insights to the nucleon structure. We focus on the measurement of the beam spin asymmetry which comes from the interference of the Bethe Heitler process with the DeltaVCS. (author)

  16. Positive evolutionary selection of an HD motif on Alzheimer precursor protein orthologues suggests a functional role.

    Directory of Open Access Journals (Sweden)

    István Miklós

    2012-02-01

    Full Text Available HD amino acid duplex has been found in the active center of many different enzymes. The dyad plays remarkably different roles in their catalytic processes that usually involve metal coordination. An HD motif is positioned directly on the amyloid beta fragment (Aβ and on the carboxy-terminal region of the extracellular domain (CAED of the human amyloid precursor protein (APP and a taxonomically well defined group of APP orthologues (APPOs. In human Aβ HD is part of a presumed, RGD-like integrin-binding motif RHD; however, neither RHD nor RXD demonstrates reasonable conservation in APPOs. The sequences of CAEDs and the position of the HD are not particularly conserved either, yet we show with a novel statistical method using evolutionary modeling that the presence of HD on CAEDs cannot be the result of neutral evolutionary forces (p<0.0001. The motif is positively selected along the evolutionary process in the majority of APPOs, despite the fact that HD motif is underrepresented in the proteomes of all species of the animal kingdom. Position migration can be explained by high probability occurrence of multiple copies of HD on intermediate sequences, from which only one is kept by selective evolutionary forces, in a similar way as in the case of the "transcription binding site turnover." CAED of all APP orthologues and homologues are predicted to bind metal ions including Amyloid-like protein 1 (APLP1 and Amyloid-like protein 2 (APLP2. Our results suggest that HDs on the CAEDs are most probably key components of metal-binding domains, which facilitate and/or regulate inter- or intra-molecular interactions in a metal ion-dependent or metal ion concentration-dependent manner. The involvement of naturally occurring mutations of HD (Tottori (D7N and English (H6R mutations in early onset Alzheimer's disease gives additional support to our finding that HD has an evolutionary preserved function on APPOs.

  17. Antimicrobial peptide, hdMolluscidin, purified from the gill of the abalone, Haliotis discus.

    Science.gov (United States)

    Seo, Jung-Kil; Go, Hye-Jin; Kim, Chan-Hee; Nam, Bo-Hye; Park, Nam Gyu

    2016-05-01

    A 4.7 kDa antimicrobial peptide was purified from the acidified gill extract of the Abalone, Haliotis discus, by cation-exchange and C18 reversed-phase high performance liquid chromatography (HPLC). Comparison of the amino acid sequences and molecular weight of this peptide with those of other known antimicrobial peptides revealed that this antimicrobial peptide have high sequence homology with that of cgMolluscidin and was designated hdMolluscidin. hdMolluscidin is composed of 46 amino acid residues containing several dibasic residue repeats like KK or K-R. hdMolluscidin showed potent antimicrobial activity against both Gram-positive bacteria including Bacillus subtilis and Staphylococcus aureus (minimal effective concentrations [MECs]; 0.8-19.0 μg/mL) and Gram-negative bacteria including Aeromonas hydrophila, Escherichia coli, Pseudomonas aeruginosa, Salmonella enterica, Shigella flexneri, and Vibrio parahemolyticus ([MECs]; 1.0-4.0 μg/mL) without hemolytic activity. However, hdMolluscidin did not show any significant activity against Candida albicans. The secondary structural prediction suggested that hdMolluscidin might not form an ordered or an amphipathic structure. hdMolluscidin did not show membrane permeabilization or leakage ability. The full-length hdMolluscidin cDNA contained 566-bp, including a 5'-untranslated region (UTR) of 63-bp, a 3'-UTR of 359-bp, and an open reading frame of 144-bp encoding 47 amino acids (containing Met). cDNA study of hdMolluscidin suggests that it is expressed as a mature peptide. Our results indicate that hdMolluscidin could relate to the innate immune defenses in abalone and it may not act directly on bacterial membrane. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. The mysterious companion of the hot subdwarf HD 49798

    Science.gov (United States)

    Mereghetti, S.; Pintore, F.; Esposito, P.; La Palombara, N.; Tiengo, A.; Israel, G.; Stella, L.

    2017-10-01

    The system HD 49798/RXJ0648.0-4418 is the only X-ray binary in which the companion star is a hot subdwarf. The short orbital period (1.5 days), circular orbit, and element abundances suggest that this system is the outcome of a common envelope evolution of a couple of intermediate mass stars. The X-ray pulsations at 13.2 s indicate that the compact object, with a dynamically measured mass of 1.3 solar masses, is a neutron star or a white dwarf. Given the large mass, the latter possibility, favoured by the low X-ray luminosity, implies that this system might be a good candidate progenitor for a type Ia supernova explosion. However, our recent discovery of a secular spin-up at a rate of 2×10^{-15} s s^{-1} is best explained assuming that the compact object is a neutron star fed by wind accretion. I discuss the possible interpretations of this unique system, showing that its X-ray spectral and timing properties are different from those of classical X-binaries and cataclismic variables, possibly due to the peculiar nature of the mass donor star.

  19. The Spectroscopic Orbit of the Planetary Companion Transiting HD 209458.

    Science.gov (United States)

    Mazeh; Naef; Torres; Latham; Mayor; Beuzit; Brown; Buchhave; Burnet; Carney; Charbonneau; Drukier; Laird; Pepe; Perrier; Queloz; Santos; Sivan; Udry; Zucker

    2000-03-20

    We report a spectroscopic orbit with period P=3.52433+/-0.00027 days for the planetary companion that transits the solar-type star HD 209458. For the metallicity, mass, and radius of the star, we derive [Fe/H&sqbr0;=0.00+/-0.02, M*=1.1+/-0.1 M middle dot in circle, and R*=1.2+/-0.1 R middle dot in circle. This is based on a new analysis of the iron lines in our HIRES template spectrum and also on the absolute magnitude, effective temperature, and color of the star, and it uses isochrones from four different sets of stellar evolution models. Using these values for the stellar parameters, we reanalyze the transit data and derive an orbital inclination of i=86&fdg;1+/-1&fdg;6. For the planet, we derive a mass of Mp=0.69+/-0.05 MJup, a radius of Rp=1.40+/-0.17 RJup, and a density of rho=0.31+/-0.07 g cm-3.

  20. Slow Motion and Zoom in HD Digital Videos Using Fractals

    Directory of Open Access Journals (Sweden)

    Maurizio Murroni

    2009-01-01

    Full Text Available Slow motion replay and spatial zooming are special effects used in digital video rendering. At present, most techniques to perform digital spatial zoom and slow motion are based on interpolation for both enlarging the size of the original pictures and generating additional intermediate frames. Mainly, interpolation is done either by linear or cubic spline functions or by motion estimation/compensation which both can be applied pixel by pixel, or by partitioning frames into blocks. Purpose of this paper is to present an alternative technique combining fractals theory and wavelet decomposition to achieve spatial zoom and slow motion replay of HD digital color video sequences. Fast scene change detection, active scene detection, wavelet subband analysis, and color fractal coding based on Earth Mover's Distance (EMD measure are used to reduce computational load and to improve visual quality. Experiments show that the proposed scheme achieves better results in terms of overall visual quality compared to the state-of-the-art techniques.

  1. Evidence for planet engulfment by the star HD82943.

    Science.gov (United States)

    Israelian, G; Santos, N C; Mayor, M; Rebolo, R

    2001-05-10

    Current models of the evolution of the known extrasolar planetary systems need to incorporate orbital migration and/or gravitational interactions among giant planets to explain the presence of large bodies close to their parent stars. These processes could also lead to planets being ingested by their parent stars, which would alter the relative abundances of elements heavier than helium in the stellar atmospheres. In particular, the abundance of the rare 6Li isotope, which is normally destroyed in the early evolution of solar-type stars but preserved intact in the atmospheres of giant planets, would be boosted substantially. 6Li has not hitherto been observed reliably in a metal-rich star, where metallicity refers to the total abundance of elements heavier than helium. Here we report the discovery of 6Li in the atmosphere of the metal-rich solar-type star HD82943, which is known to have an orbiting giant planet. The presence of 6Li can probably be interpreted as evidence for a planet (or planets) having been engulfed by the parent star.

  2. HD-RNAS: An automated hierarchical database of RNA structures

    Directory of Open Access Journals (Sweden)

    Shubhra Sankar eRay

    2012-04-01

    Full Text Available One of the important goals of most biological investigations is to classify and organize the experimental findings so that they are readily useful for deriving generalized rules. Although there is a huge amount of information on RNA structures in PDB, there are redundant files, ambiguous synthetic sequences etc. Moreover, a systematic hierarchical organization, reflecting RNA classification, is missing in PDB. In this investigation, we have classified all the available RNA crystal structures from PDB through a programmatic approach. Hence, it would be now a simple assignment to regularly update the classification as and when new structures are released. The classification can further determine (i a non-redundant set of RNA structures and (ii if available, a set of structures of identical sequence and function, which can highlight structural polymorphism, ligand-induced conformational alterations etc. Presently, we have classified the available structures (2095 PDB entries having RNA chain longer than 9 nucleotides solved by X-ray crystallography or NMR spectroscopy into nine functional classes. The structures of same function and same source are mostly seen to be similar with subtle differences depending on their functional complexation. The web-server is available online at http://www.saha.ac.in/biop/www/HD-RNAS.html and is updated regularly.

  3. Permeation of a H2 + HD + D2 gas mixture through a polymer membrane

    International Nuclear Information System (INIS)

    Mercea, P.; Cuna, S.; Kreibik, S.; Ursu, I.

    1990-01-01

    The selective permeation of a H 2 + HD + D 2 gas mixture through a polyethylene terephthalate membrane was studied at T 20 0 C. It was found that the permeation of the HD through the membrane leads to a smaller overall hydrogen-deuterium separation factor than that determined in the permeation experiments with pure H 2 and D 2 . On the other hand, a process of isotopic exchange between deuterium atoms from the penetrant gas stream and hydrogen atoms from the polymer membrane is assumed and discussed in order to explain temporal variations of the H 2 , HD and D 2 concentrations of the permanent gas stream. (author)

  4. Far-infrared HD emission as a measure of protoplanetary disk mass

    Science.gov (United States)

    Trapman, L.; Miotello, A.; Kama, M.; van Dishoeck, E. F.; Bruderer, S.

    2017-09-01

    Context. Protoplanetary disks around young stars are the sites of planet formation. While the dust mass can be estimated using standard methods, determining the gas mass - and thus the amount of material available to form giant planets - has proven to be very difficult. Hydrogen deuteride (HD) is a promising alternative to the commonly used gas mass tracer, carbon monoxide. However, the potential of HD has not yet been investigated with models incorporating both HD and CO isotopologue-specific chemistry, and its sensitivity to uncertainties in disk parameters has not yet been quantified. Aims: We examine the robustness of HD as tracer of the disk gas mass, specifically the effect of gas mass on HD far-infrared emission and its sensitivity to the vertical structure. Also, we seek to provide requirements for future far-infrared missions such as SPICA. Methods: Deuterium chemistry reactions relevant for HD were implemented in the thermochemical code DALI and more than 160 disk models were run for a range of disk masses and vertical structures. Results: The HD J = 1-0 line intensity depends directly on the gas mass through a sublinear power law relation with a slope of 0.8. Assuming no prior knowledge about the vertical structure of a disk and using only the HD 1-0 flux, gas masses can be estimated to within a factor of two for low mass disks (Mdisk ≤ 10-3M⊙). For more massive disks, this uncertainty increases to more than an order of magnitude. Adding the HD 2-1 line or independent information about the vertical structure can reduce this uncertainty to a factor of 3 for all disk masses. For TW Hya, using the radial and vertical structure from the literature, the observations constrain the gas mass to 6 × 10-3M⊙ ≤ Mdisk ≤ 9 × 10-3M⊙. Future observations require a 5σ sensitivity of 1.8 × 10-20 W m-2 (2.5 × 10-20 W m-2) and a spectral resolving power R ≥ 300 (1000) to detect HD 1-0 (HD 2-1) for all disk masses above 10-5M⊙ with a line

  5. Dicty_cDB: FC-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA18 (Link to dictyBase) - - - Contig-U15943-1 FC-AA18P (Li...nk to Original site) FC-AA18F 506 FC-AA18Z 293 FC-AA18P 799 - - Show FC-AA18 Library FC (Link to library) Clone ID FC-AA...al site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA18Q.Seq.d/ Representative seq. ID FC-AA...18P (Link to Original site) Representative DNA sequence >FC-AA18 (FC-AA18Q) /CSM/FC/FC-AA/FC-AA18Q.Seq.d/ AAA...AGATAGAGAAGAAAGAAAACTTGAACGTGAGAAGGAACTTGAACGTGAACGTGAGAA AGAACTTGAGCGTGAGCGTGAACGTGAACAACGTCGTCTTGAAA

  6. Dicty_cDB: FCL-AA12 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA12 (Link to dictyBase) - - - Contig-U16034-1 FCL-AA12P ...(Link to Original site) FCL-AA12F 629 FCL-AA12Z 540 FCL-AA12P 1169 - - Show FCL-AA12 Library FCL (Link to library) Clone ID FCL-AA...4-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA12Q....Seq.d/ Representative seq. ID FCL-AA12P (Link to Original site) Representative DNA sequence >FCL-AA12 (FCL-AA12Q) /CSM/FCL/FCL-AA.../FCL-AA12Q.Seq.d/ ATCAAATGTTTATTCAACAACAACCATCAGATTCAATTGTTTGTAATCGTTATATTCATC CAGCCATTGTTGTTTTGGTTGACCAA

  7. Dicty_cDB: FCL-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA01 (Link to dictyBase) - - - Contig-U16033-1 FCL-AA01P ...(Link to Original site) FCL-AA01F 603 FCL-AA01Z 411 FCL-AA01P 1014 - - Show FCL-AA01 Library FCL (Link to library) Clone ID FCL-AA...3-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA01Q....Seq.d/ Representative seq. ID FCL-AA01P (Link to Original site) Representative DNA sequence >FCL-AA01 (FCL-AA01Q) /CSM/FCL/FCL-AA.../FCL-AA01Q.Seq.d/ GCAAATAATAATATTATGGGTATTGACTTTGGTACACATTTCGCATGTGTTGGTATTTTC AAGAATGAAAGAATTGAAATCTGTCCAAA

  8. Dicty_cDB: FCL-AA07 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA07 (Link to dictyBase) - - - Contig-U14973-1 FCL-AA07P ...(Link to Original site) FCL-AA07F 527 FCL-AA07Z 253 FCL-AA07P 780 - - Show FCL-AA07 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA07Q....Seq.d/ Representative seq. ID FCL-AA07P (Link to Original site) Representative DNA sequence >FCL-AA07 (FCL-AA07Q) /CSM/FCL/FCL-AA.../FCL-AA07Q.Seq.d/ CAAAATAAAAAATGTTATCAAATTTTTTAAAAGTCAACAGTAAAGCACTAGGACATATAA GAACTTTTGCCTCAAAGAGTGGTGAAATTAAA

  9. Dicty_cDB: FCL-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA21 (Link to dictyBase) - - - Contig-U14936-1 FCL-AA21P ...(Link to Original site) FCL-AA21F 520 FCL-AA21Z 356 FCL-AA21P 876 - - Show FCL-AA21 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA21Q....Seq.d/ Representative seq. ID FCL-AA21P (Link to Original site) Representative DNA sequence >FCL-AA21 (FCL-AA21Q) /CSM/FCL/FCL-AA.../FCL-AA21Q.Seq.d/ ATCATAATCATATATTTTTAATAGATATTGATATATATATTTAAAAAAATAAAATAAAAT AAAATAAAAAATGTCAACAGAGGAAACAAAAA

  10. Dicty_cDB: FC-AA11 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA11 (Link to dictyBase) - - - Contig-U16273-1 FC-AA11P (Li...nk to Original site) FC-AA11F 631 FC-AA11Z 502 FC-AA11P 1133 - - Show FC-AA11 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA11Q.Seq.d/ Representative seq. ID FC-AA...11P (Link to Original site) Representative DNA sequence >FC-AA11 (FC-AA11Q) /CSM/FC/FC-AA/FC-AA...11Q.Seq.d/ GGTGAATTAATTGTTGAACCAGTTGATCAAAAATATATTTTCAAGACTGAACGTAAAGTT CCAAGAATGGGTGTTATGATTGTTGGTTTATGTGGTAACAATGGTACAA

  11. Dicty_cDB: FC-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA08 (Link to dictyBase) - - - Contig-U15942-1 FC-AA08P (Li...nk to Original site) FC-AA08F 620 FC-AA08Z 510 FC-AA08P 1130 - - Show FC-AA08 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA08Q.Seq.d/ Representative seq. ID FC-AA...08P (Link to Original site) Representative DNA sequence >FC-AA08 (FC-AA08Q) /CSM/FC/FC-AA/FC-AA...08Q.Seq.d/ ATCAGTTACATGTACTGCACCAGTTAATATTGCAGTTATCAAATATTGGGGAAAGAGAGA TGAAAATATTATTTTACCATTAAATTCATCACTCAGTGGAA

  12. Dicty_cDB: FC-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA06 (Link to dictyBase) - - - Contig-U15909-1 FC-AA06P (Li...nk to Original site) FC-AA06F 532 FC-AA06Z 501 FC-AA06P 1033 - - Show FC-AA06 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA06Q.Seq.d/ Representative seq. ID FC-AA...06P (Link to Original site) Representative DNA sequence >FC-AA06 (FC-AA06Q) /CSM/FC/FC-AA/FC-AA...06Q.Seq.d/ GTGAATATAACGATTTAGATTTAGTGTATGATAAAGATGTTTATCAAAAATTAATAGAGA ATGGTGTAGATTCATTATTATCAAAA

  13. Dicty_cDB: FCL-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA13 (Link to dictyBase) - - - - FCL-AA13P (Link to Original site) FCL-AA...13F 635 FCL-AA13Z 350 FCL-AA13P 985 - - Show FCL-AA13 Library FCL (Link to library) Clone ID FCL-AA...dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ Representative seq. ID FCL-AA...13P (Link to Original site) Representative DNA sequence >FCL-AA13 (FCL-AA13Q) /CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ CATATTTATAA...TTATATCTTTTTTGTTTAATAAAAAAGAAAGAATACCAACATGAGACTT TTATTGTGTTTAATTTTCTTAGTTTTTGTTTTCAATTTTGCATTATCAA

  14. AA, Inner Conductor of Magnetic Horn

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    Antiprotons emerging at large angles from the production target (hit by an intense 26 GeV proton beam from the PS), were focused into the acceptance of the injection line of the AA by means of a "magnetic horn" (current-sheet lens). Here we see an early protype of the horn's inner conductor, machined from solid aluminium to a thickness of less than 1 mm. The 1st version had to withstand pulses of 150 kA, 15 us long, every 2.4 s. See 8801040 for a later version.

  15. Experimental immunologically mediated aplastic anemia (AA) in mice: cyclosporin A fails to protect against AA

    International Nuclear Information System (INIS)

    Knospe, W.H.; Steinberg, D.; Gratwohl, A.; Speck, B.

    1984-01-01

    Immunologically mediated aplastic anemia (AA) in mice was induced by the i.v. injection of 10(7) lymph node cells (LNC) from H-2k identical but Mls mismatched CBA/J donor mice into previously irradiated (600 rad total body gamma) C3H/HeJ mice. Cyclosporin A (CsA), 25 mg/kg, was administered subcutaneously from day -1 to day 30. Control mice included C3H/HeJ mice which received 600 rad alone, C3H/HeJ mice which received 600 rad plus CsA as above, and C3H/HeJ mice which received 600 rad total body irradiation followed by 10(7) LNC from CBA/J donors. CsA failed to prevent lethal AA. These results suggest that the pathogenetic mechanisms operating in immunologically mediated AA differ from the mechanisms operating in rodents transplanted with allogeneically mismatched marrow or spleen cells which develop graft-versus-host disease. The results are consistent with a non-T cell-dependent mechanism causing the AA

  16. Simon van der Meer in the AA Control Room

    CERN Multimedia

    CERN PhotoLab

    1984-01-01

    Simon van der Meer, spiritus rector of the Antiproton Accumulator, in the AA Control Room. Inventor of stochastic cooling, on which the AA was based, and of the magnetic horn, with which the antiprotons were focused, he also wrote most of the software with which the AA was controlled, and spent uncountable numbers of hours in this chair to tickle the AA to top performance. 8 months after this picture was taken, he received, in October 1984, the Nobel prize, together with Carlo Rubbia, the moving force behind the whole Proton-Antiproton Collider project that led to the discovery, in 1983, of the W and Z intermediate bosons.

  17. Flow Injection and Atomic Absorption Spectrometry (FI-AAS) -

    DEFF Research Database (Denmark)

    Hansen, Elo Harald

    1996-01-01

    One of the advantages of the flow injection (FI) concept is that it is compatible with virtually all detection techniques. Being a versatile vehicle for enhancing the performance of the individual detection devices, the most spectacular results have possibly been obtained in conjunction with atomic...... absorption spectrometry (AAS). Initially with flame-AAS (fAAS) procedures, later for hydride generation (HG) techniques, and most recently in combination with electrothermal AAS (ETAAS). The common denominator for all these procedures is the inherently precise and strictly reproducible timing in FI from...

  18. Valsartan reduces AT1-AA-induced apoptosis through suppression oxidative stress mediated ER stress in endothelial progenitor cells.

    Science.gov (United States)

    Wang, Z-C; Qi, J; Liu, L-M; Li, J; Xu, H-Y; Liang, B; Li, B

    2017-03-01

    Valsartan has been reported to have the function of treating hypertension and improving the prognosis of patients. Many studies indicated that valsartan can also increase angiotensin II, andosterone and plasma renin activity (PRA). Autoantibodies against the angiotensin II type 1 receptor (AT1-AA) have been showed to increase reactive oxygen species (ROS) and calcium (Ca2+) and result in apoptosis in vascular smooth muscle cells. In this study, we attempted to explore the effect of valsartan on AT1-AA-induced apoptosis in endothelial progenitor cells. Endothelial progenitor cells (EPCs) were cultured. The cytotoxicity was determined by MTT assay. EPCs apoptosis was determined by DAPI staining and flow cytometry. Reactive oxygen species, intracellular calcium concentration and calpain activity were measured using Fluostar Omega Spectrofluorimeter. The expression of p-ERK, p-eIF-2a, CHOP, Bcl-2 and caspase-3 were detected by Western blot. MTT assays showed valsartan significantly inhibited AT1-AA- induced decline of the viability of EPCs. DAPI staining and flow cytometry results indicated valsartan inhibited AT1-AA-induced decline of the viability of EPCs via inhibiting AT1-AA-induced apoptosis. Furthermore, the increasing of reactive oxygen species, intracellular calcium and calpain activity induced by AT1-AA in EPCs were also recovered after pre-treated with valsartan. Meanwhile, the upregulation of p-ERK, p-eIF-2a and CHOP, downregulation of Bcl-2, and activation of Caspase-3 caused by AT1-AA were reversed after pre-incubated with valsartan. Valsartan could inhibit AT1-AA-induced apoptosis through inhibiting oxidative stress mediated ER stress in EPCs.

  19. Federally Owned Treatment Works (FOTW) Demonstration Test, Chronic Aquatic Toxicity of HD Bioeffluents

    National Research Council Canada - National Science Library

    Haley, Mark

    1998-01-01

    ...), a chemical warfare agent under the chemical stockpile disposal program. The mineralization of HD, through hot water hydrolysis followed by biodegradation in sequencing batch bioreactors, has been demonstrated to be an effective technology...

  20. Compensation in Preclinical Huntington's Disease: Evidence From the Track-On HD Study

    Directory of Open Access Journals (Sweden)

    Stefan Klöppel

    2015-10-01

    Interpretation: Our findings provide evidence for active compensatory processes in premanifest-HD for cognitive demands and suggest a higher vulnerability of the left hemisphere to the effects of regional atrophy.

  1. Draft Genome Sequence ofBacillus thuringiensissubsp.aizawaiHD133.

    Science.gov (United States)

    Fu, Zujiao; Xiao, Rong; Luo, Rongjun; Hu, Zhan; Yang, Hua; Guo, Zhaohui; Lei, Ping; Shan, Shiping

    2017-09-14

    We report here the 6,512,057-bp draft genome sequence of Bacillus thuringiensis subsp. aizawai HD133. This strain contains at least 6 cry genes and 13 candidate biosynthetic gene clusters. Copyright © 2017 Fu et al.

  2. Huntington's disease (HD) : the neuropathology of a multisystem neurodegenerative disorder of the human brain

    NARCIS (Netherlands)

    Rueb, U.; Seidel, K.; Heinsen, H.; Vonsattel, J. P.; den Dunnen, W. F.; Korf, H. W.

    2016-01-01

    Huntington's disease (HD) is an autosomal dominantly inherited, and currently untreatable, neuropsychiatric disorder. This progressive and ultimately fatal disease is named after the American physician George Huntington and according to the underlying molecular biological mechanisms is assigned to

  3. Feasibility of Formulating DECON GREEN with Airfraft Deicing Fluid: VX, GD, and HD Reactivity

    National Research Council Canada - National Science Library

    Wagner, George W; Procell, Lawrence R; Kiple, Joseph B; Taylor, Jeffrey S; Yang, Yu-Chu

    2005-01-01

    ...), hydrogen peroxide, and alcohol. The use of two currently fielded aircraft deicing fluids, containing ethylene glycol and/or propylene glycol and water, as substitutes for the alcohol constituent was assessed by examining the VX, GD, and HD...

  4. THz/Infrared Double Resonance Two-Photon Spectroscopy of HD+ for Determination of Fundamental Constants

    Directory of Open Access Journals (Sweden)

    Florin Lucian Constantin

    2017-10-01

    Full Text Available A double resonance two-photon spectroscopy scheme is discussed to probe jointly rotational and rovibrational transitions of ensembles of trapped HD+ ions. The two-photon transition rates and lightshifts are calculated with the two-photon tensor operator formalism. The rotational lines may be observed with sub-Doppler linewidth at the hertz level and good signal-to-noise ratio, improving the resolution in HD+ spectroscopy beyond the 10−12 level. The experimental accuracy, estimated at the 10−12 level, is comparable with the accuracy of theoretical calculations of HD+ energy levels. An adjustment of selected rotational and rovibrational HD+ lines may add clues to the proton radius puzzle, may provide an independent determination of the Rydberg constant, and may improve the values of proton-to-electron and deuteron-to-proton mass ratios beyond the 10−11 level.

  5. Clarifying the Status of HD 100546 as Observed by the Gemini Planet Imager

    Science.gov (United States)

    Currie, Thayne; Brittain, Sean; Grady, Carol A.; Kenyon, Scott J.; Muto, Takayuki

    2017-12-01

    HD 100546 is a young, early-type star and key laboratory for studying gas giant planet formation. GPI data taken in 2015 and reported by Currie et al. (2015) recover the previously-identified protoplanet candidate HD 100546 b and identify a second emission source at ~13--14 au: either a disk hot spot or a second protoplanetary candidate (HD 100546 "c"). In this short research note, we update the status of HD 100546 as observed by the Gemini Planet Imager by rereducing our original data using a different PSF subtraction method (KLIP instead of A-LOCI), rereducing recently public GPI Campaign Team (GPIES) data, and comparing the quality of the two data sets. Our results support the original findings in Currie et al. (2015).

  6. Intensive Nutritional Counselling And Support And Clinical Outcomes In Hemodialysis Patients

    OpenAIRE

    Alessio Molfino; Alessandro Laviano; Maria Grazia Chiappini; Thomas Amman; Filippo Rossi Fanelli; Maurizio Muscaritoli

    2012-01-01

    Protein-energy wasting is frequently found in haemodialysis (HD) patients. Anorexia and hypophagia contribute to malnutrition, increased morbidity and mortality, but the clinical impact of correcting hypophagia remains uncertain. We evaluated whether correction of hypophagia influences morbidity and mortality in anorexic HD patients. Thirty-four HD patients were enrolled in a 2-year follow-up programme including regular nutritional assessment. Patients not meeting nutritional requirements dur...

  7. Moessbauer spectrometer MsAa-3

    International Nuclear Information System (INIS)

    Gornicki, R.; Blachowski, A.; Ruebenbauer, K.

    2007-01-01

    The paper is aimed at the description of the newly developed Moessbauer spectrometer MsAa-3. The spectrometer MsAa-3 consists of a high quality γ--ray spectrometer including either a proportional gas detector head or a scintillation detector head, a transducer driving system including the transducer, data storage system, and data communication system based on the TCP/IP protocol. Additionally, the Michelson-Morley interferometer is provided for precise calibration of the transducer velocity. The spectrometer is equipped with an integrated simple temperature controller. All the essential functions are remotely controlled over the TCP/IP link allowing for the spectrometer set-up as the stand-alone unit in the computer network, e.g. on the Internet. External γ-ray detectors or external complete nuclear blocks could be used as well. The spectrometer is equipped with software allowing for setting all the functions, to perform on-line control, and retrieve data. The Moessbauer data processing software MOSGRAF is enclosed as well. The latter software allows for the calculation of the variety of velocity reference functions. (authors)

  8. Onyx HD-500 embolization of intracranial aneurysms: modified technique using continuous balloon inflation under conscious sedation.

    Science.gov (United States)

    Rahme, Ralph; Grande, Andrew; Jimenez, Lincoln; Abruzzo, Todd A; Ringer, Andrew J

    2014-08-01

    The conventional technique of intracranial aneurysm embolization using Onyx HD-500 (ev3 Neurovascular, Irvine, CA, USA) involves repetitive balloon inflation-deflation cycles under general anesthesia. By limiting parent artery occlusion to 5 minutes, this cyclic technique is thought to minimize cerebral ischemia. However, intermittent balloon deflation may lengthen procedure time and allow balloon migration, resulting in intimal injury or Onyx leakage. We report our experience using a modified technique of uninterrupted Onyx injection with continuous balloon occlusion under conscious sedation. All Onyx embolization procedures for unruptured aneurysms performed by the senior author (A.J.R.) between September 2008 and April 2010 were retrospectively reviewed. Demographic, clinical, angiographic, and procedural data were recorded. Twenty-four embolization procedures were performed in 21 patients with 23 aneurysms, including four recurrences. Twenty aneurysms (87%) involved the paraclinoid or proximal supraclinoid internal carotid artery. Size ranged from 2.5 to 24mm and neck diameter from 2 to 8mm. The modified technique was employed in 19 cases. All but one patient (94.4%) tolerated continuous balloon inflation. Complete occlusion was achieved in 20 aneurysms (83.3%) and subtotal occlusion in three (12.5%). Stable angiographic results were seen in 85%, 94%, 94%, and 100% of patients at 6, 12, 24, and 36months, respectively. There were no deaths. Permanent non-disabling neurological morbidity occurred in one patient (4.2%). Minor, transient, and/or angiographic complications were seen in three patients (12.5%), none related to the technique itself. Onyx embolization of unruptured intracranial aneurysms can be safely and effectively performed using continuous balloon inflation under conscious sedation. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Fusion with highly spin polarized HD and D2

    International Nuclear Information System (INIS)

    Honig, A.; Letzring, S.; Skupsky, S.

    1993-01-01

    The experimental efforts over the past 5 years have been aimed at carrying out ICF shots with spin-polarized D fuel. The authors successfully prepared polarized D in HD, and solved the problems of loading target shells with their carefully prepared isotopic mixtures, polarizing them so that the D polarization remains metastably frozen-in for about half a day, and carrying out the various cold transfer requirements at Syracuse, where the target is prepared, and at Rochester, where the cold target is inserted into the OMEGA fusion chamber. A principal concern during this past year was overcoming difficulties encountered in maintaining the integrity of the fragile cold target during the multitude of cold-transfers required for the experiment. These difficulties arose from insufficient rigidity of the cold transfer systems, which were constrained to be of small diameter by the narrow central access bore of the dilution refrigerator, and were exacerbated by the multitude of required target shell manipulations between different environments, each with different coupling geometry, including target shell permeation, polarization, storage, transport, retrieval and insertion into OMEGA. The authors did solve all of these problems, and were able to position a cold, high density but unpolarized target with required precision in OMEGA. Upon shooting the accurately positioned unpolarized high density cold target, no neutron yield was observed. Inspection inside the OMEGA tank after the shot indicated the absence of neutron yield was due to mal-timing or insufficient retraction rate of OMEGA's fast shroud mechanism, resulting in interception of at least 20 of the 24 laser beams by the faulty shroud. In spite of this, all elements of the complex experiment the authors originally undertook have been successfully demonstrated, and the cold retrieval concepts and methods they developed are being utilized on the ICF upgrades at Rochester and at Livermore

  10. SUBMILLIMETER POLARIZATION OBSERVATION OF THE PROTOPLANETARY DISK AROUND HD 142527

    Energy Technology Data Exchange (ETDEWEB)

    Kataoka, Akimasa; Dullemond, Cornelis P.; Pohl, Adriana [Zentrum für Astronomie der Universität Heidelberg, Institut für Theoretische Astrophysik, Albert-Ueberle-Str. 2, D-69120 Heidelberg (Germany); Tsukagoshi, Takashi; Momose, Munetake [College of Science, Ibaraki University, 2-1-1 Bunkyo, Mito, Ibaraki 310-8512 (Japan); Nagai, Hiroshi [National Astronomical Observatory of Japan, Mitaka, Tokyo 181-8588 (Japan); Muto, Takayuki [Division of Liberal Arts, Kogakuin University, 1-24-2 Nishi-Shinjuku, Shinjuku-ku, Tokyo 163-8677 (Japan); Fukagawa, Misato [Division of Particle and Astrophysical Science, Graduate School of Science, Nagoya University, Furo-cho, Chikusa-ku, Nagoya, Aichi 464-8602 (Japan); Shibai, Hiroshi [Graduate School of Science, Osaka University, 1-1 Machikaneyama, Toyonaka, Osaka 560-0043 (Japan); Hanawa, Tomoyuki [Center for Frontier Science, Chiba University, 1-33 Yayoi-cho, Inage, Chiba 263-8522 (Japan); Murakawa, Koji, E-mail: kataoka@uni-heidelberg.de [College of General Education, Osaka Sangyo University, 3-1-1, Nakagaito, Daito, Osaka 574-8530 (Japan)

    2016-11-10

    We present the polarization observations toward the circumstellar disk around HD 142527 by using Atacama Large Millimeter/submillimeter Array at the frequency of 343 GHz. The beam size is 0.″51 × 0.″44, which corresponds to the spatial resolution of ∼71 × 62 au. The polarized intensity displays a ring-like structure with a peak located on the east side with a polarization fraction of P = 3.26 ± 0.02%, which is different from the peak of the continuum emission from the northeast region. The polarized intensity is significantly weaker at the peak of the continuum where P = 0.220 ± 0.010%. The polarization vectors are in the radial direction in the main ring of the polarized intensity, while there are two regions outside at the northwest and northeast areas where the vectors are in the azimuthal direction. If the polarization vectors represent the magnetic field morphology, the polarization vectors indicate the toroidal magnetic field configuration on the main ring and the poloidal fields outside. On the other hand, the flip of the polarization vectors is predicted by the self-scattering of thermal dust emission due to the change of the direction of thermal radiation flux. Therefore, we conclude that self-scattering of thermal dust emission plays a major role in producing polarization at millimeter wavelengths in this protoplanetary disk. Also, this puts a constraint on the maximum grain size to be approximately 150 μ m if we assume compact spherical dust grains.

  11. NBM-HD-1: A Novel Histone Deacetylase Inhibitor with Anticancer Activity

    Directory of Open Access Journals (Sweden)

    Wei-Jan Huang

    2012-01-01

    Full Text Available HDAC inhibitors (HDACis have been developed as promising anticancer agents in recent years. In this study, we synthesized and characterized a novel HDACi, termed NBM-HD-1. This agent was derived from the semisynthesis of propolin G, isolated from Taiwanese green propolis (TGP, and was shown to be a potent suppressor of tumor cell growth in human breast cancer cells (MCF-7 and MDA-MB-231 and rat glioma cells (C6, with an IC50 ranging from 8.5 to 10.3 μM. Western blot demonstrated that levels of p21(Waf1/Cip1, gelsolin, Ac-histone 4, and Ac-tubulin markedly increased after treatment of cancer cells with NBM-HD-1. After NBM-HD-1 treatment for 1–4 h, p-PTEN and p-AKT levels were markedly decreased. Furthermore, we also found the anticancer activities of NBM-HD-1 in regulating cell cycle regulators. Treatment with NBM-HD-1, p21(Waf1/Cip1 gene expression had markedly increased while cyclin B1 and D1 gene expressions had markedly decreased. On the other hand, we found that NBM-HD-1 increased the expressions of tumor-suppressor gene p53 in a dose-dependent manner. Finally, we showed that NBM-HD-1 exhibited potent antitumor activity in a xenograft model. In conclusion, this study demonstrated that this compound, NBM-HD-1, is a novel and potent HDACi with anticancer activity in vitro and in vivo.

  12. HD-GYP domain proteins regulate biofilm formation and virulence in Pseudomonas aeruginosa

    DEFF Research Database (Denmark)

    Ryan, Robert P.; Lucey, Jean; O'Donovan, Karen

    2009-01-01

    HD-GYP is a protein domain involved in the hydrolysis of the bacterial second messenger cyclic-di-GMP. The genome of the human pathogen Pseudomonas aeruginosa PAO1 encodes two proteins (PA4108, PA4781) with an HD-GYP domain and a third protein, PA2572, which contains a domain with variant key res....... aeruginosa to larvae of the Greater Wax moth Galleria mellonella....

  13. The high-galactic-latitude O-type star HD 93521

    International Nuclear Information System (INIS)

    Hack, M.

    1977-01-01

    The spectrum of the peculiar O9 star HD 93521 is studied and compared with those of the standard stars 10 Lac and AE Aur. Several possibilities are examined which might explain the high galactic latitude of this star, corresponding to z>750 pc, and its slight helium excess. It is suggested that HD 93521 is a 'runaway' binary system composed of the O9 star plus a neutron star left over from a supernova explosion. (Auth.)

  14. The Significance of the Sodium Detection in the Extrasolar Planet HD209458b Atmosphere

    OpenAIRE

    Seager, S.

    2003-01-01

    The Hubble Space Telescope (HST) detection of an extrasolar planet atmosphere in 2001 was a landmark step forward for the characterization of extrasolar planets. HST detected the trace element sodium, via the neutral atomic resonance doublet at 593 nm, in the transiting extrasolar giant planet HD209458b. In this paper I discuss the significance of this first ever extrasolar planet atmosphere detection. I explain how the sodium measurement can be used as a constraint on HD209458b atmosphere mo...

  15. Coherence in children with AD/HD and excess alpha power in their EEG.

    Science.gov (United States)

    Robbie, Joel C; Clarke, Adam R; Barry, Robert J; Dupuy, Franca E; McCarthy, Rory; Selikowitz, Mark

    2016-05-01

    This study investigated differences in EEG coherence measures between two groups of children with Attention-Deficit/Hyperactivity Disorder (AD/HD) - one with the more common EEG profile (increased theta), and a group with excess alpha activity as the dominant EEG abnormality. 26 children (aged 9-13years) with AD/HD were included in each of the excess-theta and excess-alpha groups, and were age- and sex-matched with 26 control subjects. EEG was recorded from 19 electrode sites during an eyes-closed resting condition. Wave-shape coherence was calculated for eight intrahemispheric and eight interhemispheric electrode pairs, for the delta, theta, alpha and beta bands. In comparison with the controls, the excess-theta AD/HD group had increased theta intrahemispheric coherences at short-medium inter-electrode distances. Frontally, the excess-theta AD/HD group had increased interhemispheric theta and reduced beta coherences. The excess-alpha group primarily showed increased slow wave (delta and theta) intrahemispheric coherence at short-medium inter-electrode distances, and reduced alpha coherence at longer inter-electrode distances, compared with controls. An increase in frontal interhemispheric theta coherence was also found. These results suggest that AD/HD children with excess alpha power have an underlying connectivity dysfunction in the frontal lobes, which is found in common with other subjects with the excess-theta EEG profile. However, a number of qualitative differences exist that could be associated with other aspects of the AD/HD diagnosis. The excess-alpha group appeared to have fewer frontal-lobe abnormalities than the excess-theta AD/HD group. This is the first study to investigate coherence in AD/HD children who have the atypical profile of increased alpha power in their EEG. Copyright © 2016 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.

  16. Dialysis headache in patients undergoing peritoneal dialysis and hemodialysis.

    Science.gov (United States)

    Stojimirovic, Biljana; Milinkovic, Marija; Zidverc-Trajkovic, Jasna; Trbojevic-Stankovic, Jasna; Maric, Ivko; Milic, Miodrag; Andric, Branislav; Nikic, Petar

    2015-03-01

    Headache is among most frequently encountered neurological symptom during hemodialysis (HD), but still under investigated in peritoneal dialysis (PD) patients. The aim of this study was to assess the incidence and clinical characteristics of dialysis headache (DH) in HD and PD patients. A total of 409 patients (91 on PD and 318 on HD) were interviewed using a structured questionnaire, designed according to the diagnostic criteria of the International Headache Classification of Headache Disorders from 2004. Patients with DH underwent a thorough neurological examination. DH was reported by 21 (6.6%) HD patients and 0 PD patients. PD patients had significantly lower serum sodium, potassium, calcium, phosphate, urea and creatinine, calcium-phosphate product, and diastolic blood pressure than HD patients. HD patients had significantly lower hemoglobin compared to PD patients. Primary renal disease was mostly parenchymal in HD patients, and vascular in PD patients. DH appeared more frequently in men, mostly during the third hour of HD. It lasted less than four hours, was bilateral, non-pulsating and without associated symptoms. Biochemical alterations may be implicated in the pathophysiology of DH. Specific features of DH might contribute to better understanding of this secondary headache disorder.

  17. Daily dialysis reduces pulse wave velocity in chronic hemodialysis patients.

    Science.gov (United States)

    Di Micco, Lucia; Torraca, Serena; Sirico, Maria Luisa; Tartaglia, Domenico; Di Iorio, Biagio

    2012-05-01

    Pulse wave velocity (PWV) is a predictor of morbidity and mortality in patients with end-stage renal disease (ESRD). Dialysis patients show cyclic changes in PWV related to their hydration status and blood pressure. Our aim is to assess the impact of daily dialysis on PWV. We performed a randomized crossover study of 60 patients who underwent standard hemodialysis (HD) three times per week for at least 6 months. Patients were classified into three groups according to their PWV values before (pre-) and after (post-) HD, with a cutoff value of 12 m s(-1), as follows: the low-low (LL) group had normal pre-HD and post-HD PWV; the high-low (HL) group had high pre-HD PWV and normal post-HD PWV; and the high-high (HH) group had high pre- and post-HD PWV. All patients continued standard HD for 2 weeks. A total of 10 patients from each group were randomly assigned to continue standard HD for 1 week and then underwent daily dialysis for 1 week. The remaining 10 patients underwent daily dialysis for 1 week and then underwent standard HD for 1 week. PWV values were measured before and 1 h after each dialysis session. With daily dialysis treatment, 2 of 20 patients (10%) moved from the PWV-HH group to the PWV-HL group, whereas 18 of 20 patients (90%) moved from the PWV-HL group to the PWV-LL group (P = 0.030). Daily dialysis reduces PWV in the ESRD patients. As PWV is a strong predictor of mortality in ESRD and has cyclic variations in patients who are on standard HD, we believe that daily dialysis may be used in patients with high PWV levels to reduce their mortality risk.

  18. Interplay of auxin, KANADI and Class III HD-ZIP transcription factors in vascular tissue formation.

    Science.gov (United States)

    Ilegems, Michael; Douet, Véronique; Meylan-Bettex, Marlyse; Uyttewaal, Magalie; Brand, Lukas; Bowman, John L; Stieger, Pia A

    2010-03-01

    Class III HD-ZIP and KANADI gene family members have complementary expression patterns in the vasculature and their gain-of-function and loss-of-function mutants have complementary vascular phenotypes. This suggests that members of the two gene families are involved in the establishment of the spatial arrangement of phloem, cambium and xylem. In this study, we have investigated the role of these two gene families in vascular tissue differentiation, in particular their interactions with the plant hormone auxin. We have analyzed the vasculature of plants that have altered expression levels of Class III HD-ZIP and KANADI transcription factors in provascular cells. Removal of either KANADI or Class III HD-ZIP expression in procambium cells led to a wider distribution of auxin in internal tissues, to an excess of procambium cell recruitment and to increased cambium activity. Ectopic expression of KANADI1 in provascular cells inhibited procambium cell recruitment due to negative effects of KANADI1 on expression and polar localization of the auxin efflux-associated protein PIN-FORMED1. Ectopic expression of Class III HD-ZIP genes promoted xylem differentiation. We propose that Class III HD-ZIP and KANADI transcription factors control cambium activity: KANADI proteins by acting on auxin transport, and Class III HD-ZIP proteins by promoting axial cell elongation and xylem differentiation.

  19. DIRECT IMAGING OF AN ASYMMETRIC DEBRIS DISK IN THE HD 106906 PLANETARY SYSTEM

    Energy Technology Data Exchange (ETDEWEB)

    Kalas, Paul G.; Wang, Jason J.; Duchene, Gaspard; Dong, Ruobing; Graham, James R.; Rosa, Robert J. De [Astronomy Department, University of California, Berkeley CA 94720-3411 (United States); Rajan, Abhijith; Patience, Jennifer [School of Earth and Space Exploration, Arizona State University, P.O. Box 871404, Tempe, AZ 85287 (United States); Millar-Blanchaer, Maxwell A.; Chilcote, Jeffrey [Department of Astronomy and Astrophysics, University of Toronto, Toronto ON M5S 3H4 (Canada); Chen, Christine [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Fitzgerald, Michael P. [Department of Physics and Astronomy, UCLA, Los Angeles, CA 90095 (United States); Macintosh, Bruce [Kavli Institute for Particle Astrophysics and Cosmology, Stanford University, Stanford, CA 94305 (United States); Murray-Clay, Ruth [Department of Physics, University of California, Santa Barbara, CA 93106 (United States); Matthews, Brenda; Marois, Christian; Draper, Zachary H.; Lawler, Samantha [National Research Council of Canada Herzberg, 5071 West Saanich Road, Victoria, BC V9E 2E7 (Canada); Rameau, Julien; Doyon, René [Institut de Recherche sur les Exoplanetes, Département de Physique, Université de Montréal, Montréal QC H3C 3J7 (Canada); and others

    2015-11-20

    We present the first scattered light detections of the HD 106906 debris disk using the Gemini/Gemini Planet Imager in the infrared and Hubble Space Telescope (HST)/Advanced Camera for Surveys in the optical. HD 106906 is a 13 Myr old F5V star in the Sco–Cen association, with a previously detected planet-mass candidate HD 106906b projected 650 AU from the host star. Our observations reveal a near edge-on debris disk that has a central cleared region with radius ∼50 AU, and an outer extent >500 AU. The HST data show that the outer regions are highly asymmetric, resembling the “needle” morphology seen for the HD 15115 debris disk. The planet candidate is oriented ∼21° away from the position angle of the primary’s debris disk, strongly suggesting non-coplanarity with the system. We hypothesize that HD 106906b could be dynamically involved in the perturbation of the primary’s disk, and investigate whether or not there is evidence for a circumplanetary dust disk or cloud that is either primordial or captured from the primary. We show that both the existing optical properties and near-infrared colors of HD 106906b are weakly consistent with this possibility, motivating future work to test for the observational signatures of dust surrounding the planet.

  20. Shock tube study of the H-D exchange reaction between acetylene and deuterium

    International Nuclear Information System (INIS)

    Ogura, Hiroo

    1977-01-01

    H-D exchange reaction between acetylene and deuterium has been investigated in a single-pulse shock tube in the temperature range 1200-1500 K. Empirically, in the C 2 HD appearance the order with respect to acetylene was 0.25+-0.09, and that with respect to deuterium 1.14+-0.15. The rate constant of 1.39 th order for the C 2 HD increase was obtained as; k(cmsup(1.17) molsup(-0.39) s -1 )=(24.4+-7.5) x 10 11 exp((-51200+-2400)/RT). The isotopic distributions of acetylene and hydrogen as determined by mass spectrometry suggest that C 2 D 2 and H 2 are formed by the subsequent reactions of C 2 HD and HD, respectively. A free-radical chain mechanism initiated by the same bimolecular reaction of acetylene, viz, 2C 2 H 2 →C 4 H 3 +H, as in the pyrolysis and hydrogenation of acetylene was proposed. A steady-state treatment of the proposed mechanism shows that the empirical rate and concentration dependence of the C 2 HD increase are in line with those of the steady-state rate. (auth.)

  1. Warfarin use in hemodialysis patients: what is the risk?

    LENUS (Irish Health Repository)

    Phelan, P J

    2012-02-01

    BACKGROUND: There is a paucity of data concerning the risks associated with warfarin in hemodialysis (HD) patients. We compared major bleeding episodes in this group with HD patients not receiving warfarin and with a cohort of non-HD patients receiving warfarin. METHODS: A retrospective review of 141 HD patients on warfarin (HDW), 704 HD patients not on warfarin (HDNW) and 3,266 non-dialysis warfarin patients (NDW) was performed. Hospital admissions for hemorrhagic events and ischemic strokes were examined as was hospital length of stay and blood product use. INR variability was also assessed. RESULTS: The incidence rates for major hemorrhage per 100 patient years was 10.8 in the HDW group as compared to 8.0 in the HDNW (p = 0.593) and 2.1 in the NDW (p < 0.001) groups. Mean units of red blood cell transfusions required was higher in patients on dialysis with no significant difference between HDW and HDNW groups. The risk of ischemic stroke per 100 patient years was 1.7 in the HDW group as compared to 0.7 in the HDNW groups (p = 0.636) and 0.4 in the NDW (p = 0.003). The HDW group had higher inter-measurement INR variability compared to the NDW group (p = 0.034). In patients with atrial fibrillation, HDW group had a higher incidence of ischemic stroke than the NDW group (2.2 versus 0.4 events per 100 patient years; p = 0.024). CONCLUSIONS: This study confirms the higher bleeding risk associated with HD\\/ESRD but suggests that warfarin use in these patients may not add significantly to this risk. We also demonstrated high rates of ischemic stroke in HD patients despite warfarin use. SUMMARY: Our study compares the frequency of major hemorrhage and secondarily, ischemic stroke in HD patients receiving or not receiving warfarin, with non-HD patients receiving warfarin. The major finding was that frequency of hemorrhage was higher in HD patients receiving warfarin than in non-HD patients receiving warfarin, but not different in HD patients with or without warfarin. A

  2. Warfarin use in hemodialysis patients: what is the risk?

    LENUS (Irish Health Repository)

    Phelan, P J

    2011-03-01

    Background: There is a paucity of data concerning the risks associated with warfarin in hemodialysis (HD) patients. We compared major bleeding episodes in this group with HD patients not receiving warfarin and with a cohort of non-HD patients receiving warfarin. Methods: A retrospective review of 141 HD patients on warfarin (HDW), 704 HD patients not on warfarin (HDNW) and 3,266 non-dialysis warfarin patients (NDW) was performed. Hospital admissions for hemorrhagic events and ischemic strokes were examined as was hospital length of stay and blood product use. INR variability was also assessed. Results: The incidence rates for major hemorrhage per 100 patient years was 10.8 in the HDW group as compared to 8.0 in the HDNW (p = 0.593) and 2.1 in the NDW (p < 0.001) groups. Mean units of red blood cell transfusions required was higher in patients on dialysis with no significant difference between HDW and HDNW groups. The risk of ischemic stroke per 100 patient years was 1.7 in the HDW group as compared to 0.7 in the HDNW groups (p = 0.636) and 0.4 in the NDW (p = 0.003). The HDW group had higher inter-measurement INR variability compared to the NDW group (p = 0.034). In patients with atrial fibrillation, HDW group had a higher incidence of ischemic stroke than the NDW group (2.2 versus 0.4 events per 100 patient years; p = 0.024). Conclusions: This study confirms the higher bleeding risk associated with HD\\/ESRD but suggests that warfarin use in these patients may not add significantly to this risk. We also demonstrated high rates of ischemic stroke in HD patients despite warfarin use. Summary: Our study compares the frequency of major hemorrhage and secondarily, ischemic stroke in HD patients receiving or not receiving warfarin, with non-HD patients receiving warfarin. The major finding was that frequency of hemorrhage was higher in HD patients receiving warfarin than in non-HD patients receiving warfarin, but not different in HD patients with or without warfarin. A

  3. Idiopathic systemic AA-amyloidosis in a skunk (Mephitis mephitis).

    Science.gov (United States)

    Elhensheri, Mohamed; Linke, Reinhold P; Blankenburg, Anja; Beineke, Andreas

    2012-03-01

    This report describes a case of systemic amyloidosis in a captive striped skunk. At necropsy, bilateral alopecia, as well as reno-, hepato-, and splenomegaly were present. Congo red staining and immunohistochemistry revealed depositions of AA-amyloid in different organs. The lack of a predisposing disease is suggestive of idiopathic systemic AA-amyloidosis.

  4. Partially melted zone cracking in AA6061 welds

    International Nuclear Information System (INIS)

    Prasad Rao, K.; Ramanaiah, N.; Viswanathan, N.

    2008-01-01

    Partially melted zone (PMZ) cracking susceptibility in AA6061 alloy was studied. Role of prior thermal history, gas tungsten arc welding techniques such as continuous current (CC) and pulsed current (PC) and use of different fillers (AA4043 and AA5356) were studied. Role of different grain refiners such as scandium, zirconium and Tibor in the above fillers was studied. Varestraint test was used to study the PMZ cracking susceptibility. Metallurgical analysis was done to corroborate the results. PMZ cracking was severe in T6 temper than in T4 irrespective of filler material. PMZ cracking susceptibility was more with AA5356 than in AA4043. It was less with pulsed current GTAW. PMZ cracking susceptibility was reduced with addition of grain refiners. Out of all, lowest PMZ cracking susceptibility was observed with 0.5%Sc addition to fusion zone through AA4043 filler and PC technique. The concentrations of magnesium and silicon were reduced at the PMZ grain boundaries with grain refiner additions to fusion zone through AA5356 or AA4043

  5. Partially melted zone cracking in AA6061 welds

    Energy Technology Data Exchange (ETDEWEB)

    Prasad Rao, K. [Department of Metallurgical and Materials Engineering, Indian Institute of Technology Madras, Chennai (India)], E-mail: kpr@iitm.ac.in; Ramanaiah, N. [Sri Kalahasteeswara Institute of Technology, Srikalahasti (India); Viswanathan, N. [Defence Research and Development Laboratory, Hyderabad (India)

    2008-07-01

    Partially melted zone (PMZ) cracking susceptibility in AA6061 alloy was studied. Role of prior thermal history, gas tungsten arc welding techniques such as continuous current (CC) and pulsed current (PC) and use of different fillers (AA4043 and AA5356) were studied. Role of different grain refiners such as scandium, zirconium and Tibor in the above fillers was studied. Varestraint test was used to study the PMZ cracking susceptibility. Metallurgical analysis was done to corroborate the results. PMZ cracking was severe in T6 temper than in T4 irrespective of filler material. PMZ cracking susceptibility was more with AA5356 than in AA4043. It was less with pulsed current GTAW. PMZ cracking susceptibility was reduced with addition of grain refiners. Out of all, lowest PMZ cracking susceptibility was observed with 0.5%Sc addition to fusion zone through AA4043 filler and PC technique. The concentrations of magnesium and silicon were reduced at the PMZ grain boundaries with grain refiner additions to fusion zone through AA5356 or AA4043.

  6. The Use of Soil Palynomorphs in Forensics * ABDULRAHAMAN, AA ...

    African Journals Online (AJOL)

    ADOWIE PERE

    The Use of Soil Palynomorphs in Forensics. *. 1. ABDULRAHAMAN, AA;. 2. AL SAHLI, AA;. 1. OKOLI, JU. 1Applied Plant Anatomy and Wood Technology Laboratory, Department of Plant Biology, University of Ilorin, Ilorin, Nigeria. 2Department of Botany and Microbiology, College of Science, King Saud University, Riyadh, ...

  7. Evolution of geomagnetic aa index near sunspot minimum

    Directory of Open Access Journals (Sweden)

    R. P. Kane

    2002-10-01

    Full Text Available The smoothed values of the minima of sunspot number Rz and the geomagnetic index aa were compared for sunspot cycles 12–23. In one cycle, aa(min occurred earlier than Rz(min, but remained at that low from a few months before Rz(min to a few months after Rz(min. In two cycles, Rz(min and aa(min coincided within a month or two. In nine cycles, aa(min occurred more than three months later than Rz(min. The aa(min coincided with the minima of some solar radio emission indices originating in the solar corona. For sunspot cycles 21, 22, 23, the minimum of solar wind velocity V occurred 0–9 months later than the aa(min. The minimum of solar wind total magnetic field B occurred near Rz(min. The solar wind ion density N had maxima (instead of minima near Rz(min, and again near Rz(max, indicating a  ~5-year periodicity, instead of an 11-year periodicity. The maxima of aa, V and B occurred near Rz(max and/or later in the declining phase of Rz. The aa index was very well correlated with the functions BV and BV 2.Key words. Geomagnetism and paleomagnetism (time variations, diurnal to secular – time variations, secular and long term Interplanetary physics (interplanetary magnetic field

  8. AA, shims and washers on quadrupole ends

    CERN Multimedia

    CERN PhotoLab

    1981-01-01

    Due to the fact that much of the field of the quadrupoles was outside the iron (in particular with the wide quadrupoles) and that thus the fields of quadrupoles and bending magnets interacted, the lattice properties of the AA could not be predicted with the required accuracy. After a first running period in 1980, during which detailed measurements were made with proton test beams, corrections to the quadrupoles were made in 1981, in the form of laminated shims at the ends of the poles, and with steel washers. With the latter ones, further refinements were made in an iterative procedure with measurements on the circulating beam. This eventually resulted, amongst other things, in a very low chromaticity, with the Q-values being constant to within +- 0.001 over the total momentum range of 6 %. Here we see the shims and washers on a narrow qudrupole (QFN, QDN). See also 8103203, 8103204, 8103205, 8103206.

  9. Hot stamping of AA7075 aluminum sheets

    Science.gov (United States)

    Mendiguren, J.; Saenz de Argandona, E.; Galdos, L.

    2016-11-01

    In this work the formability of a high strength aluminium alloy (AA7075-T6) for the stamping of an automotive component has been studied. Due to the low formability of the selected alloy, two different heat assisted forming strategies have been analysed. On the one hand, the W-temper process, where the thermal process is carried out prior to the forming operation. On the other hand, the hot stamping process, where the thermal process is carried out at the same time as the forming. The results showed that both technology were able to form the component avoiding any failure of the material. On the contrary, both processes reduced the final mechanical properties of the material compared to the as received material condition. However, the obtained mechanical properties doubled the strength of commonly used 5xxx and 6xxx aluminium alloys.

  10. Benefits of a low intensity exercise programme during haemodialysis sessions in elderly patients

    Directory of Open Access Journals (Sweden)

    Vicent Esteve Simo

    2015-07-01

    Conclusions: (1 An adapted low intensity exercise programme improved muscle strength, functional capacity and health-related quality of life in our elderly patients on HD. (2 Our results highlight the benefits from exercise in HD patients even in this elderly population. (3 In elderly patients on HD, it is worth considering an adapted low intensity intradialytic exercise programme as a part of a comprehensive care.

  11. Dicty_cDB: FC-AA17 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA17 (Link to dictyBase) - - - Contig-U15091-1 FC-AA17E (Li...nk to Original site) - - - - - - FC-AA17E 347 Show FC-AA17 Library FC (Link to library) Clone ID FC-AA17 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA17Q.Seq.d/ Representative seq. ID FC-AA...17E (Link to Original site) Representative DNA sequence >FC-AA17 (FC-AA17Q) /CSM/FC/FC-AA/FC-AA17Q.Seq.d/ CCCAAAAGCCCGTAA...GACTCACTGTGTCAAGTGCAACAAACACACCCCACACAAGGTTAC CCAATACAAAGCTGGTAAACCAAGTCTTTTCGCACAAGGTAAAAGACGTTACGATCGTAA ACAA

  12. Dicty_cDB: FCL-AA22 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA22 (Link to dictyBase) - G01758 DDB0229949 Contig-U15119-1 FCL-AA...22E (Link to Original site) - - - - - - FCL-AA22E 840 Show FCL-AA22 Library FCL (Link to library) Clone ID FCL-AA...g-U15119-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...22Q.Seq.d/ Representative seq. ID FCL-AA22E (Link to Original site) Representative DNA sequence >FCL-AA22 (FCL-AA...22Q) /CSM/FCL/FCL-AA/FCL-AA22Q.Seq.d/ AAAATGAGCAAAATCTCAAGCGACCAAGTTAGATCAATCGTCTCCCAACTTTTCAAAGAA GCACAAGAATCCAAAA

  13. Dicty_cDB: FC-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA05 (Link to dictyBase) - G01143 DDB0190243 Contig-U15085-1 FC-AA...05E (Link to Original site) - - - - - - FC-AA05E 675 Show FC-AA05 Library FC (Link to library) Clone ID FC-AA...5-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA05Q.Se...q.d/ Representative seq. ID FC-AA05E (Link to Original site) Representative DNA sequence >FC-AA05 (FC-AA05Q) /CSM/FC/FC-AA/FC-AA...05Q.Seq.d/ AAACAAAAAAAAAAGGTATGGAAATTTTTGCATTTGTACCATTAGCAGTGTTAACAGCAT TATGTGTTGTTATTTCACTCTTTGTTAAAAGAGAGAAA

  14. Dicty_cDB: FC-AA16 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA16 (Link to dictyBase) - G22556 DDB0204121 Contig-U15090-1 FC-AA...16E (Link to Original site) - - - - - - FC-AA16E 933 Show FC-AA16 Library FC (Link to library) Clone ID FC-AA...0-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA16Q.Se...q.d/ Representative seq. ID FC-AA16E (Link to Original site) Representative DNA sequence >FC-AA16 (FC-AA16Q) /CSM/FC/FC-AA/FC-AA...16Q.Seq.d/ GGGCAGGATCATCATTTAATACTAAAGATTCAACAATAATTGCAAAAACTCAATTTTATC AAAAAAATATTCAAATTTATAAAGGTGATCAA

  15. Dicty_cDB: FCL-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA06 (Link to dictyBase) - G24322 DDB0216974 Contig-U15228-1 FCL-AA...06E (Link to Original site) - - - - - - FCL-AA06E 791 Show FCL-AA06 Library FCL (Link to library) Clone ID FCL-AA...g-U15228-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...06Q.Seq.d/ Representative seq. ID FCL-AA06E (Link to Original site) Representative DNA sequence >FCL-AA06 (FCL-AA...06Q) /CSM/FCL/FCL-AA/FCL-AA06Q.Seq.d/ AAAATCCCAATTTCATTAGCAGTGGAAGTAACGGAATGAATTGGGGTGGTTCTTTGAACA CTTGTGACTCTGGAGGATTCAA

  16. Dicty_cDB: FC-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA15 (Link to dictyBase) - G01144 DDB0204372 Contig-U15089-1 FC-AA...15E (Link to Original site) - - - - - - FC-AA15E 522 Show FC-AA15 Library FC (Link to library) Clone ID FC-AA...9-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA15Q.Se...q.d/ Representative seq. ID FC-AA15E (Link to Original site) Representative DNA sequence >FC-AA15 (FC-AA15Q) /CSM/FC/FC-AA/FC-AA...15Q.Seq.d/ CAAATCACACATAAAAGTTTAATATAAAAATGGGTACACCAATTAAAAAGATTAGTACAG TAATTATTAAAATGGTTTCATCAGCCAA

  17. Dicty_cDB: FC-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA21 (Link to dictyBase) - - - Contig-U15450-1 FC-AA21E (Li...nk to Original site) - - - - - - FC-AA21E 839 Show FC-AA21 Library FC (Link to library) Clone ID FC-AA21 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA21Q.Seq.d/ Representative seq. ID FC-AA...21E (Link to Original site) Representative DNA sequence >FC-AA21 (FC-AA21Q) /CSM/FC/FC-AA/FC-AA21Q.Seq.d/ AATTATTTTCATTAA...TTTTAGCTTTATTCCTTGTCAACTCCGCTGTTGTCTCTTCACTCG ACTCATGTAGTATTTGTGTTGATTTTGTTGGTAACTCACTCAATGATCTTTTAAATATTA TCCTTAA

  18. Dicty_cDB: FCL-AA23 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA23 (Link to dictyBase) - G01759 DDB0201558 Contig-U15118-1 FCL-AA...23E (Link to Original site) - - - - - - FCL-AA23E 1045 Show FCL-AA23 Library FCL (Link to library) Clone ID FCL-AA...ig-U15118-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...23Q.Seq.d/ Representative seq. ID FCL-AA23E (Link to Original site) Representative DNA sequence >FCL-AA23 (FCL-AA...23Q) /CSM/FCL/FCL-AA/FCL-AA23Q.Seq.d/ ATAACTATATAACTATGTCTAACCAAAAGAAAAACGACGTATCTTCATTTGTTAAAGATT CTTTAA

  19. Dicty_cDB: FCL-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA18 (Link to dictyBase) - G24323 DDB0191144 Contig-U15229-1 FCL-AA...18Z (Link to Original site) - - FCL-AA18Z 623 - - - - Show FCL-AA18 Library FCL (Link to library) Clone ID FCL-AA...g-U15229-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...18Q.Seq.d/ Representative seq. ID FCL-AA18Z (Link to Original site) Representative DNA sequence >FCL-AA18 (FCL-AA...18Q) /CSM/FCL/FCL-AA/FCL-AA18Q.Seq.d/ XXXXXXXXXXGTCAATGTCATTATTGGTGAACAATCTGATGGTTCGTTGGAACAAATCGC TAGAAATCCACAACCAA

  20. Dicty_cDB: FC-AA22 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA22 (Link to dictyBase) - - - Contig-U14948-1 FC-AA22E (Li...nk to Original site) - - - - - - FC-AA22E 576 Show FC-AA22 Library FC (Link to library) Clone ID FC-AA22 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA22Q.Seq.d/ Representative seq. ID FC-AA...22E (Link to Original site) Representative DNA sequence >FC-AA22 (FC-AA22Q) /CSM/FC/FC-AA/FC-AA22Q.Seq.d/ ATGAA...TACGATGATAGTGATTCAGACTTTTGACCAATTGAAAAAACCAGCAACAGAAATG GTACTGGTTTGGTCTCCTCCACTTTTAAGGTTGCCCCTTCCTTCTCTACCATTCAAAAAC AACAA

  1. AtHD2D gene plays a role in plant growth, development and response to abiotic stresses in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Zhaofen eHan

    2016-03-01

    Full Text Available Abstracts: The histone deacetylases play important roles in the regulation of gene expression and the subsequent control of a number of important biological processes, including those involved in the response to environmental stress. A specific group of histone deacetylase genes, HD2, is present in plants. In Arabidopsis, HD2s include HD2A, HD2B, HD2C and HD2D. Previous research showed that HD2A, HD2B and HD2C are more related in terms of expression and function, but not HD2D. In this report, we studied different aspects of AtHD2D in Arabidopsis with respect to plant response to drought and other abiotic stresses. Bioinformatics analysis indicates that HD2D is distantly related to other HD2 genes. Transient expression in Nicotiana benthamiana and stable expression in Arabidopsis of AtHD2D fused with gfp showed that AtHD2D was expressed in the nucleus. Overexpression of AtHD2D resulted in developmental changes including fewer main roots, more lateral roots, and a higher root:shoot ratio. Seed germination and plant flowering time were delayed in transgenic plants expressing AtHD2D, but these plants exhibited higher degrees of tolerance to abiotic stresses, including drought, salt and cold stresses. Physiological studies indicated that the malondialdehyde (MDA content was high in wild-type plants but in plants overexpressing HD2D the MDA level increased slowly in response to stress conditions of drought, cold, and salt stress. Furthermore, electrolyte leakage in leaf cells of wild type plants increased but remained stable in transgenic plants. Our results indicate that AtHD2D is unique among HD2 genes and it plays a role in plant growth and development regulation and these changes can modulate plant stress responses.

  2. States' Flexibility Waiver Plans for Alternate Assessments Based on Alternate Achievement Standards (AA-AAS). Synthesis Report 96

    Science.gov (United States)

    Lazarus, Sheryl S.; Edwards, Lynn M.; Thurlow, Martha L.; Hodgson, Jennifer R.

    2014-01-01

    All states have alternate assessments based on alternate achievement standards (AA-AAS) for students with the most significant cognitive disabilities. For accountability purposes, the Elementary and Secondary Education Act (ESEA) allows up to 1% of students to be counted as proficient with this assessment option. In 2011 the U.S. Department of…

  3. Bone Morphogenic Protein 4-Smad-Induced Upregulation of Platelet-Derived Growth Factor AA Impairs Endothelial Function.

    Science.gov (United States)

    Hu, Weining; Zhang, Yang; Wang, Li; Lau, Chi Wai; Xu, Jian; Luo, Jiang-Yun; Gou, Lingshan; Yao, Xiaoqiang; Chen, Zhen-Yu; Ma, Ronald Ching Wan; Tian, Xiao Yu; Huang, Yu

    2016-03-01

    Bone morphogenic protein 4 (BMP4) is an important mediator of endothelial dysfunction in cardio-metabolic diseases, whereas platelet-derived growth factors (PDGFs) are major angiogenic and proinflammatory mediator, although the functional link between these 2 factors is unknown. The present study investigated whether PDGF mediates BMP4-induced endothelial dysfunction in diabetes mellitus. We generated Ad-Bmp4 to overexpress Bmp4 and Ad-Pdgfa-shRNA to knockdown Pdgfa in mice through tail intravenous injection. SMAD4-shRNA lentivirus, SMAD1-shRNA, and SMAD5 shRNA adenovirus were used for knockdown in human and mouse endothelial cells. We found that PDGF-AA impaired endothelium-dependent vasodilation in aortas and mesenteric resistance arteries. BMP4 upregulated PDGF-AA in human and mouse endothelial cells, which was abolished by BMP4 antagonist noggin or knockdown of SMAD1/5 or SMAD4. BMP4-impared relaxation in mouse aorta was also ameliorated by PDGF-AA neutralizing antibody. Tail injection of Ad-Pdgfa-shRNA ameliorates endothelial dysfunction induced by Bmp4 overexpression (Ad-Bmp4) in vivo. Serum PDGF-AA was elevated in both diabetic patients and diabetic db/db mice compared with nondiabetic controls. Pdgfa-shRNA or Bmp4-shRNA adenovirus reduced serum PDGF-AA concentration in db/db mice. PDGF-AA neutralizing antibody or tail injection with Pdgfa-shRNA adenovirus improved endothelial function in aortas and mesenteric resistance arteries from db/db mice. The effect of PDGF-AA on endothelial function in mouse aorta was also inhibited by Ad-Pdgfra-shRNA to inhibit PDGFRα. The present study provides novel evidences to show that PDGF-AA impairs endothelium-dependent vasodilation and PDGF-AA mediates BMP4-induced adverse effect on endothelial cell function through SMAD1/5- and SMAD4-dependent mechanisms. Inhibition of PGDF-AA ameliorates vascular dysfunction in diabetic mice. © 2016 American Heart Association, Inc.

  4. A Petunia Homeodomain-Leucine Zipper Protein, PhHD-Zip, Plays an Important Role in Flower Senescence

    Science.gov (United States)

    Chang, Xiaoxiao; Donnelly, Linda; Sun, Daoyang; Rao, Jingping; Reid, Michael S.; Jiang, Cai-Zhong

    2014-01-01

    Flower senescence is initiated by developmental and environmental signals, and regulated by gene transcription. A homeodomain-leucine zipper transcription factor, PhHD-Zip, is up-regulated during petunia flower senescence. Virus-induced gene silencing of PhHD-Zip extended flower life by 20% both in unpollinated and pollinated flowers. Silencing PhHD-Zip also dramatically reduced ethylene production and the abundance of transcripts of genes involved in ethylene (ACS, ACO), and ABA (NCED) biosynthesis. Abundance of transcripts of senescence-related genes (SAG12, SAG29) was also dramatically reduced in the silenced flowers. Over-expression of PhHD-Zip accelerated petunia flower senescence. Furthermore, PhHD-Zip transcript abundance in petunia flowers was increased by application of hormones (ethylene, ABA) and abiotic stresses (dehydration, NaCl and cold). Our results suggest that PhHD-Zip plays an important role in regulating petunia flower senescence. PMID:24551088

  5. A Petunia homeodomain-leucine zipper protein, PhHD-Zip, plays an important role in flower senescence.

    Science.gov (United States)

    Chang, Xiaoxiao; Donnelly, Linda; Sun, Daoyang; Rao, Jingping; Reid, Michael S; Jiang, Cai-Zhong

    2014-01-01

    Flower senescence is initiated by developmental and environmental signals, and regulated by gene transcription. A homeodomain-leucine zipper transcription factor, PhHD-Zip, is up-regulated during petunia flower senescence. Virus-induced gene silencing of PhHD-Zip extended flower life by 20% both in unpollinated and pollinated flowers. Silencing PhHD-Zip also dramatically reduced ethylene production and the abundance of transcripts of genes involved in ethylene (ACS, ACO), and ABA (NCED) biosynthesis. Abundance of transcripts of senescence-related genes (SAG12, SAG29) was also dramatically reduced in the silenced flowers. Over-expression of PhHD-Zip accelerated petunia flower senescence. Furthermore, PhHD-Zip transcript abundance in petunia flowers was increased by application of hormones (ethylene, ABA) and abiotic stresses (dehydration, NaCl and cold). Our results suggest that PhHD-Zip plays an important role in regulating petunia flower senescence.

  6. A Petunia homeodomain-leucine zipper protein, PhHD-Zip, plays an important role in flower senescence.

    Directory of Open Access Journals (Sweden)

    Xiaoxiao Chang

    Full Text Available Flower senescence is initiated by developmental and environmental signals, and regulated by gene transcription. A homeodomain-leucine zipper transcription factor, PhHD-Zip, is up-regulated during petunia flower senescence. Virus-induced gene silencing of PhHD-Zip extended flower life by 20% both in unpollinated and pollinated flowers. Silencing PhHD-Zip also dramatically reduced ethylene production and the abundance of transcripts of genes involved in ethylene (ACS, ACO, and ABA (NCED biosynthesis. Abundance of transcripts of senescence-related genes (SAG12, SAG29 was also dramatically reduced in the silenced flowers. Over-expression of PhHD-Zip accelerated petunia flower senescence. Furthermore, PhHD-Zip transcript abundance in petunia flowers was increased by application of hormones (ethylene, ABA and abiotic stresses (dehydration, NaCl and cold. Our results suggest that PhHD-Zip plays an important role in regulating petunia flower senescence.

  7. The cytochrome P450 2AA gene cluster in zebrafish (Danio rerio): Expression of CYP2AA1 and CYP2AA2 and response to phenobarbital-type inducers

    Energy Technology Data Exchange (ETDEWEB)

    Kubota, Akira [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Bainy, Afonso C.D. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Departamento de Bioquímica, CCB, Universidade Federal de Santa Catarina, Florianopolis, SC 88040-900 (Brazil); Woodin, Bruce R.; Goldstone, Jared V. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Stegeman, John J., E-mail: jstegeman@whoi.edu [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States)

    2013-10-01

    The cytochrome P450 (CYP) 2 gene family is the largest and most diverse CYP gene family in vertebrates. In zebrafish, we have identified 10 genes in a new subfamily, CYP2AA, which does not show orthology to any human or other mammalian CYP genes. Here we report evolutionary and structural relationships of the 10 CYP2AA genes and expression of the first two genes, CYP2AA1 and CYP2AA2. Parsimony reconstruction of the tandem duplication pattern for the CYP2AA cluster suggests that CYP2AA1, CYP2AA2 and CYP2AA3 likely arose in the earlier duplication events and thus are most diverged in function from the other CYP2AAs. On the other hand, CYP2AA8 and CYP2AA9 are genes that arose in the latest duplication event, implying functional similarity between these two CYPs. A molecular model of CYP2AA1 showing the sequence conservation across the CYP2AA cluster reveals that the regions with the highest variability within the cluster map onto CYP2AA1 near the substrate access channels, suggesting differing substrate specificities. Zebrafish CYP2AA1 transcript was expressed predominantly in the intestine, while CYP2AA2 was most highly expressed in the kidney, suggesting differing roles in physiology. In the liver CYP2AA2 expression but not that of CYP2AA1, was increased by 1,4-bis [2-(3,5-dichloropyridyloxy)] benzene (TCPOBOP) and, to a lesser extent, by phenobarbital (PB). In contrast, pregnenolone 16α-carbonitrile (PCN) increased CYP2AA1 expression, but not CYP2AA2 in the liver. The results identify a CYP2 subfamily in zebrafish that includes genes apparently induced by PB-type chemicals and PXR agonists, the first concrete in vivo evidence for a PB-type response in fish. - Highlights: • A tandemly duplicated cluster of ten CYP2AA genes was described in zebrafish. • Parsimony and duplication analyses suggest pathways to CYP2AA diversity. • Homology models reveal amino acid positions possibly related to functional diversity. • The CYP2AA locus does not share synteny with

  8. Bacillus thuringiensis HD-1 Cry- : development of a safe, non-insecticidal simulant for Bacillus anthracis.

    Science.gov (United States)

    Bishop, A H; Robinson, C V

    2014-09-01

    A representative simulant for spores of Bacillus anthracis is needed for field testing. Bacillus thuringiensis is gaining recognition as a suitable organism. A strain that does not form the insecticidal, parasporal crystals that are characteristic of this species is a more accurate physical representative of B. anthracis spores. We developed noninsecticidal derivatives of two isolates of B. thuringiensis HD-1. Two plasmid-cured derivatives of B. thuringiensis HD-1, unable to make crystal toxins ('Cry(-) '), were isolated. These isolates and the existing Cry(-) strain, B. thuringiensis Al Hakam, were probed with PCR assays against the known insecticidal genes cry, vip and cyt. Their genomic DNA was sequenced to demonstrate a lack of insecticidal genes. This was confirmed by bioassays against a number of invertebrate species. Real-time PCR assays were developed to identify the B. thuringiensis HD-1 Cry(-) derivatives and an effective differential and selective medium was assessed. All three Cry(-) isolates are devoid of known insecticidal determinants. The B. thuringiensis HD-1 Cry(-) derivatives can easily be recovered from soil and identified by PCR with some selectivity. The B. thuringiensis HD-1 Cry(-) derivatives represent accurate, nongenetically manipulated simulants for B. anthracis with excellent human and environmental safety records. © 2014 Crown Copyright. Journal of Applied Microbiology © 2014 Society for Applied Microbiology This article is published with the permission of the Controller of HMSO and the Queen's Printer for Scotland.

  9. BD+15 2940 AND HD 233604: TWO GIANTS WITH PLANETS CLOSE TO THE ENGULFMENT ZONE

    Energy Technology Data Exchange (ETDEWEB)

    Nowak, G.; Niedzielski, A.; Adamow, M.; Maciejewski, G. [Torun Center for Astronomy, Faculty of Physics, Astronomy, and Informatics, Nicolaus Copernicus University, Grudziadzka 5, 87-100 Torun (Poland); Wolszczan, A., E-mail: grzegorz.nowak@astri.umk.pl, E-mail: andrzej.niedzielski@astri.umk.pl, E-mail: monika.adamow@astri.umk.pl, E-mail: gracjan.maciejewski@astri.umk.pl, E-mail: alex@astro.psu.edu [Department of Astronomy and Astrophysics, The Pennsylvania State University, 525 Davey Laboratory, University Park, PA 16802 (United States)

    2013-06-10

    We report the discovery of planetary-mass companions to two red giants by the ongoing Penn State-Torun Planet Search (PTPS) conducted with the 9.2 m Hobby-Eberly Telescope. The 1.1 M{sub Sun} K0-giant, BD+15 2940, has a 1.1 M{sub J} minimum mass companion orbiting the star at a 137.5 day period in a 0.54 AU orbit what makes it the closest-in planet around a giant and possible subject of engulfment as the consequence of stellar evolution. HD 233604, a 1.5 M{sub Sun} K5-giant, is orbited by a 6.6 M{sub J} minimum mass planet which has a period of 192 days and a semi-major axis of only 0.75 AU making it one of the least distant planets to a giant star. The chemical composition analysis of HD 233604 reveals a relatively high {sup 7}Li abundance which may be a sign of its early evolutionary stage or recent engulfment of another planet in the system. We also present independent detections of planetary-mass companions to HD 209458 and HD 88133, and stellar activity-induced radial velocity variations in HD 166435, as part of the discussion of the observing and data analysis methods used in the PTPS project.

  10. Design of a polarized target made of pure HD: analysis and distillation of HD, resonant virtual Compton scattering on the nucleon at TJNAF; Developpement d'une cible polarisee de pur HD: analyse et distillation du HD, diffusion compton virtuelle resonante sur le nucleon a TJNAF

    Energy Technology Data Exchange (ETDEWEB)

    Bouchigny, S

    2004-04-01

    The first part describe my work on the frozen spin target project HYDILE. This target has to be made of very pure HD (Hydrogen Deuterium), better than 99.95%. However, commercial HD is never found with a concentration better than 98%. The goal was, then, to build an HD distillation facility which could produce pure HD. We describe, in this thesis, the design of the distillator and the implementation of a quadrupole mass spectrometer to monitor the HD purity during the distillation process. The second part of the thesis concerns the analysis taken at the electron accelerator facility TJNAF (Virginia, USA). We look at the electroproduction of Delta resonances involving Deep Virtual Compton Scattering (DeltaVCS). The interpretation of this reaction in terms of GPDs (Generalized Parton Distribution) can provide new insights to the nucleon structure. We focus on the measurement of the beam spin asymmetry which comes from the interference of the Bethe Heitler process with the DeltaVCS. (author)

  11. Uncharacterized conserved motifs outside the HD-Zip domain in HD-Zip subfamily I transcription factors; a potential source of functional diversity

    Directory of Open Access Journals (Sweden)

    Cabello Julieta V

    2011-03-01

    Full Text Available Abstract Background Plant HD-Zip transcription factors are modular proteins in which a homeodomain is associated to a leucine zipper. Of the four subfamilies in which they are divided, the tested members from subfamily I bind in vitro the same pseudopalindromic sequence CAAT(A/TATTG and among them, several exhibit similar expression patterns. However, most experiments in which HD-Zip I proteins were over or ectopically expressed under the control of the constitutive promoter 35S CaMV resulted in transgenic plants with clearly different phenotypes. Aiming to elucidate the structural mechanisms underlying such observation and taking advantage of the increasing information in databases of sequences from diverse plant species, an in silico analysis was performed. In addition, some of the results were also experimentally supported. Results A phylogenetic tree of 178 HD-Zip I proteins together with the sequence conservation presented outside the HD-Zip domains allowed the distinction of six groups of proteins. A motif-discovery approach enabled the recognition of an activation domain in the carboxy-terminal regions (CTRs and some putative regulatory mechanisms acting in the amino-terminal regions (NTRs and CTRs involving sumoylation and phosphorylation. A yeast one-hybrid experiment demonstrated that the activation activity of ATHB1, a member of one of the groups, is located in its CTR. Chimerical constructs were performed combining the HD-Zip domain of one member with the CTR of another and transgenic plants were obtained with these constructs. The phenotype of the chimerical transgenic plants was similar to the observed in transgenic plants bearing the CTR of the donor protein, revealing the importance of this module inside the whole protein. Conclusions The bioinformatical results and the experiments conducted in yeast and transgenic plants strongly suggest that the previously poorly analyzed NTRs and CTRs of HD-Zip I proteins play an important

  12. Serum amino acid abnormalities in pediatric patients with chronic ...

    African Journals Online (AJOL)

    Results: HD patients had a significantly lower concentration of threonine, valine, methionine, leucine, tyrosine, phenylalanine and tryptophane than the control group (p= 0.032, 0.020, 0.046, 0.011, 0.000, 0.022, and 0.004 respectively). There was no significant difference between HD patients and the control group as regard ...

  13. Effects of hemodialysis on macular and retinal nerve fiber layer thicknesses in non-diabetic patients with end stage renal failure.

    Science.gov (United States)

    Atilgan, Cemile U; Guven, Dilek; Akarsu, Ozge P; Sakaci, Tamer; Sendul, Selam Y; Baydar, Yasemin; Atilgan, Kadir G; Turker, Ibrahim C

    2016-06-01

    To evaluate the thicknesses of retinal nerve fiber layer (RNFL) and macula by fourier-domain (FD) optical coherence tomography (OCT) in non-diabetic patients with end-stage-renal-failure (ESRF) undergoing hemodialysis (HD). This is a prospective and observational study. Both eyes of 20 patients receiving HD (group 1) and 34 control patients (group 2) were evaluated by FD-OCT. Macular and RNFL thicknesses were compared between groups and their correlation with age, duration of HD, and gender were examined. In group 1, macular and RNFL thicknesses were evaluated before and shortly after HD in the first day, first and sixth months.   In group 1, pre-HD temporal, inferior, average RNFL thicknesses were thinner than group 2. This thinning did not correlate with duration of HD, age and gender. Pre-HD macular thicknesses were thinner than group 2. These thinnings did not correlate with age, but the thinnings at superior, nasal and average thickness correlated negatively with duration of HD. Nasal, temporal, and average macular thicknesses were thinner in female patients. The thickenings of RNFL and macula that were observed in the after HD first day and first month did not showed consistency in the sixth month except superior quadrant RNFL. Macular and RNFL thicknesses of patients receiving HD were less than the normal population. Age has no effect on these thinnings. The duration of HD affects more than gender. Hemodialysis  session  causes a consistent increase in superior quadrant RNFL.

  14. Volumetric Analysis of the Hypothalamus in Huntington Disease Using 3T MRI: The IMAGE-HD Study

    Science.gov (United States)

    Gabery, Sanaz; Georgiou-Karistianis, Nellie; Lundh, Sofia Hult; Cheong, Rachel Y.; Churchyard, Andrew; Chua, Phyllis; Stout, Julie C.; Egan, Gary F.; Kirik, Deniz; Petersén, Åsa

    2015-01-01

    Huntington disease (HD) is a fatal neurodegenerative disorder caused by an expanded CAG repeat in the huntingtin gene. Non-motor symptoms and signs such as psychiatric disturbances, sleep problems and metabolic dysfunction are part of the disease manifestation. These aspects may relate to changes in the hypothalamus, an area of the brain involved in the regulation of emotion, sleep and metabolism. Neuropathological and imaging studies using both voxel-based morphometry (VBM) of magnetic resonance imaging (MRI) as well as positron emission tomography (PET) have demonstrated pathological changes in the hypothalamic region during early stages in symptomatic HD. In this investigation, we aimed to establish a robust method for measurements of the hypothalamic volume in MRI in order to determine whether the hypothalamic dysfunction in HD is associated with the volume of this region. Using T1-weighted imaging, we describe a reproducible delineation procedure to estimate the hypothalamic volume which was based on the same landmarks used in histologically processed postmortem hypothalamic tissue. Participants included 36 prodromal HD (pre-HD), 33 symptomatic HD (symp-HD) and 33 control participants who underwent MRI scanning at baseline and 18 months follow-up as part of the IMAGE-HD study. We found no evidence of cross-sectional or longitudinal changes between groups in hypothalamic volume. Our results suggest that hypothalamic pathology in HD is not associated with volume changes. PMID:25659157

  15. Volumetric analysis of the hypothalamus in Huntington Disease using 3T MRI: the IMAGE-HD Study.

    Directory of Open Access Journals (Sweden)

    Sanaz Gabery

    Full Text Available Huntington disease (HD is a fatal neurodegenerative disorder caused by an expanded CAG repeat in the huntingtin gene. Non-motor symptoms and signs such as psychiatric disturbances, sleep problems and metabolic dysfunction are part of the disease manifestation. These aspects may relate to changes in the hypothalamus, an area of the brain involved in the regulation of emotion, sleep and metabolism. Neuropathological and imaging studies using both voxel-based morphometry (VBM of magnetic resonance imaging (MRI as well as positron emission tomography (PET have demonstrated pathological changes in the hypothalamic region during early stages in symptomatic HD. In this investigation, we aimed to establish a robust method for measurements of the hypothalamic volume in MRI in order to determine whether the hypothalamic dysfunction in HD is associated with the volume of this region. Using T1-weighted imaging, we describe a reproducible delineation procedure to estimate the hypothalamic volume which was based on the same landmarks used in histologically processed postmortem hypothalamic tissue. Participants included 36 prodromal HD (pre-HD, 33 symptomatic HD (symp-HD and 33 control participants who underwent MRI scanning at baseline and 18 months follow-up as part of the IMAGE-HD study. We found no evidence of cross-sectional or longitudinal changes between groups in hypothalamic volume. Our results suggest that hypothalamic pathology in HD is not associated with volume changes.

  16. Outcomes of Critical Limb Ischemia in Hemodialysis Patients After Distal Bypass Surgery - Poor Limb Prognosis With Stage 4 Wound, Ischemia, and Foot Infection (WIfI).

    Science.gov (United States)

    Hoshina, Katsuyuki; Yamamoto, Kota; Miyata, Tetsuro; Watanabe, Toshiaki

    2016-10-25

    Distal bypass is the first-line treatment for patients with critical limb ischemia (CLI). In Japanese high-volume centers, approximately half of these patients are on hemodialysis (HD). We have treated such patients first with bypass using a multidisciplinary perioperative strategy. We reveal the recent characteristics of patients who underwent distal bypass and the surgical outcomes in Japan, especially focusing on the foot conditions by using the wound, ischemia, and foot infection (WIfI) classification.Methods and Results:The 152 patients underwent distal bypass in a tertiary center hospital, and we compared patients on HD (HD group) to those not on HD (non-HD group). There were significant differences between the 2 groups in the overall survival, major adverse cardiac event-free survival and amputation-free survival (AFS) rates (PWIfI stage, the AFS rate of the HD group was significantly worse than that of the non-HD group for WIfI stage 4 patients. The life and limb prognoses of patients with CLI and HD were worse than those of non-HD patients. There was no difference in surgical outcomes suggested by the graft patency rates between the 2 groups. AFS in WIfI stage 4 was significantly worse in the HD group, which indicated the importance of preoperative limb status. (Circ J 2016; 80: 2382-2387).

  17. Corrosion issues of powder coated AA6060 aluminium profiles

    DEFF Research Database (Denmark)

    Din, Rameez Ud; Valgarðsson, Smári; Jellesen, Morten Stendahl

    2015-01-01

    In this study detailed microstructural investigation of the reason for unexpected corrosion of powder coated aluminium alloy AA6060 windows profiles has been performed. The results from this study reveals that the failure of the window profiles was originated from the surface defects present...... on the extruded AA6060 aluminium profile after metallurgical process prior to powder coating. Surface defects are produced due to intermetallic particles in the alloy, which disturb the flow during the extrusion process. The corrosion mechanism leading to the failure of the powder coated AA6060 aluminium profiles...

  18. Software papers and citation in the AAS Journals

    Science.gov (United States)

    Robitaille, Thomas; Lintott, Chris

    2018-01-01

    At the start of 2016, AAS Publishing released a policy statement that officially opened the door for papers describing novel software to be published in the AAS Journals without a requirement for novel results to also be included. This statement also describes how the use of software should be cited in articles. In this talk, I will give an overview of this policy and will give an overview of the growth of software papers and software citation in AAS Journals over the last two years.

  19. Effect of pressurized steam on AA1050 aluminium

    DEFF Research Database (Denmark)

    Jariyaboon, Manthana; Møller, Per; Ambat, Rajan

    2012-01-01

    Purpose - The purpose of this paper is to understand the effect of pressurized steam on surface changes, structures of intermetallic particles and corrosion behavior of AA1050 aluminium. Design/methodology/approach - Industrially pure aluminium (AA1050, 99.5 per cent) surfaces were exposed...... reactivities was observed due to the formation of the compact oxide layer. Originality/value - This paper reveals a detailed investigation of how pressurized steam can affect the corrosion behaviour of AA1050 aluminium and the structure of Fe-containing intermetallic particles....

  20. Mechanical analysis of the Nb3Sn dipole magnet HD1

    International Nuclear Information System (INIS)

    Ferracin, Paolo; Bartlett, Scott E.; Caspi, Shlomo; Dietderich, Daniel R.; Gourlay, Steve A.; Hannaford, Carles R.; Hafalia, Aurelio R.; Lietzke, Alan F.; Mattafirri, Sara; Sabbi, Gianluca

    2005-01-01

    The Superconducting Magnet Group at Lawrence Berkeley National Laboratory (LBNL) has recently fabricated and tested HD1, a Nb 3 Sn dipole magnet. The magnet reached a 16 T field, and exhibited training quenches in the end regions and in the straight section. After the test, HD1 was disassembled and inspected, and a detailed 3D finite element mechanical analysis was done to investigate for possible quench triggers. The study led to minor modifications to mechanical structure and assembly procedure, which were verified in a second test (HD1b). This paper presents the results of the mechanical analysis, including strain gauge measurements and coil visual inspection. The adjustments implemented in the magnet structure are reported and their effect on magnet training discussed

  1. A portable cryostat for the cold transfer of polarized solid HD targets: HDice-I

    Energy Technology Data Exchange (ETDEWEB)

    Bass, Christopher D. [JLAB, Newport News, VA (United States); Sandorfi, Andy M. [JLAB, Newport News, VA (United States); Bade, C.; Blecher, M.; Caracappa, A.; D' Angelo, A.; Deur, A.; Dezern, G.; Glueckler, H.; Hanretty, C.; Ho, D.; Kageya, T.; Khandaker, M.; Laine, V.; Lincoln, F.; Lowry, M. M.; Mahon, J. C.; Connell, T. O.; Peng, P.; Preedom, B.; Seyfarth, H.; Stroeher, H.; Thorn, C. E.; Wei, X.; Whisnant, C. S.

    2014-02-01

    A device has been developed with moveable liquid nitrogen and liquid helium volumes that is capable of reaching over two meters into the coldest regions of a cryostat or dilution refrigerator and reliably extracting or installing a target of solid, polarized hydrogen deuteride (HD). This Transfer Cryostat incorporates a cylindrical neodymium rare-earth magnet that is configured as a Halbach dipole, which is maintained at 77 K and produces a 0.1 T field around the HD target. Multiple layers provide a hermetic 77 K-shield as the device is used to maintain a target at 2 K during a transfer between cryostats. Tests with frozen-spin HD show negligible polarization loss for either H or D over typical transfer periods. Multiple target transfers with this apparatus have shown an overall reliability of about 95% per transfer, which is a significant improvement over earlier versions of the device.

  2. A portable cryostat for the cold transfer of polarized solid HD targets: HDice-I

    Energy Technology Data Exchange (ETDEWEB)

    Bass, C.D., E-mail: bassc@lemoyne.edu [Thomas Jefferson National Accelerator Facility, Newport News, VA 23606 (United States); Bade, C. [Ohio University, Athens, OH 45701 (United States); Blecher, M. [Virginia Polytechnic Institute and State University, Blacksburg, VA 24061 (United States); Caracappa, A. [Brookhaven National Laboratory, Upton, NY 11973 (United States); D' Angelo, A. [Universita’ di Roma “Tor Vergata” and INFN Sezione di Roma2, 00133 Roma (Italy); Thomas Jefferson National Accelerator Facility, Newport News, VA 23606 (United States); Deur, A.; Dezern, G. [Thomas Jefferson National Accelerator Facility, Newport News, VA 23606 (United States); Glueckler, H. [Forschungszentrum Jülich GmbH, Jülich (Germany); Hanretty, C. [University of Virginia, Charlottesville, VA 22903 (United States); Ho, D. [Carnegie-Mellon University, Pittsburgh, PA 15213 (United States); Honig, A. [Syracuse University, Syracuse, NY 13210 (United States); Kageya, T. [Thomas Jefferson National Accelerator Facility, Newport News, VA 23606 (United States); Virginia Polytechnic Institute and State University, Blacksburg, VA 24061 (United States); Khandaker, M. [Norfolk State University, Norfolk, VA 23504 (United States); Laine, V. [Thomas Jefferson National Accelerator Facility, Newport News, VA 23606 (United States); Université Blaise Pascal, Clermont-Ferrand, 63177 Aubiere (France); Lincoln, F. [Brookhaven National Laboratory, Upton, NY 11973 (United States); Lowry, M.M. [Thomas Jefferson National Accelerator Facility, Newport News, VA 23606 (United States); Brookhaven National Laboratory, Upton, NY 11973 (United States); Mahon, J.C. [Ohio University, Athens, OH 45701 (United States); O' Connell, T. [University of Connecticut, Storrs-Mansfield, CT 06269 (United States); and others

    2014-02-11

    A device has been developed with moveable liquid nitrogen and liquid helium volumes that is capable of reaching over 2 m into the coldest regions of a cryostat or dilution refrigerator and reliably extracting or installing a target of solid, polarized hydrogen deuteride (HD). This Transfer Cryostat incorporates a cylindrical neodymium rare-earth magnet that is configured as a Halbach dipole, which is maintained at 77 K and produces a 0.1 T field around the HD target. Multiple layers provide a hermetic 77 K-shield as the device is used to maintain a target at 2 K during a transfer between cryostats. Tests with frozen-spin HD show very little polarization loss for either H (−1±2%, relative) or D (0±3%, relative) over typical transfer periods. Multiple target transfers with this apparatus have shown an overall reliability of about 95% per transfer, which is a significant improvement over earlier versions of the device.

  3. Hydrogen-deuterium (h-d) exchange reaction of warfarin in D(2)O solution.

    Science.gov (United States)

    Tode, Chisato; Takeuchi, Atsuko; Iwakawa, Seigo; Tatsumi, Akitoshi; Sugiura, Makiko

    2009-07-01

    To prove the presence of a hydrogen-deuterium (H-D) exchange reaction, (1)H- and (13)C-NMR spectra of warfarin were measured in solvents containing D(2)O and H(2)O. In D(2)O or D(2)O/dimethyl sulfoxide (DMSO)-d(6) solvent, signal pattern changes were observed on H12 and H11 as well as 14 methyl protons over time while no changes were observed on H(2)O or H(2)O/DMSO-d(6) solvent. The observed changes in the solvents containing D(2)O were concluded to be caused by the H-D exchange reaction on H12, the process of CH(2)-->CHD-->CD(2). MS spectroscopy also confirmed these H-D exchanges. The kinetics of this reaction were analyzed as the successive reaction, and the mechanism was also proposed.

  4. The HD(CP2 Data Archive for Atmospheric Measurement Data

    Directory of Open Access Journals (Sweden)

    Erasmia Stamnas

    2016-07-01

    Full Text Available The archiving of scientific data is a sophisticated mission in nearly all research projects. In this paper, we introduce a new online archive of atmospheric measurement data from the "High definition clouds and precipitation for advancing climate prediction" (HD(CP2 research initiative. The project data archive is quality managed, easy to use, and is now open for other atmospheric research data. The archive’s creation was already taken into account during the HD(CP2 project planning phase and the necessary resources were granted. The funding enabled the HD(CP2 project to build a sound archive structure, which guarantees that the collected data are accessible for all researchers in the project and beyond.

  5. Dicty_cDB: FCL-AA14 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA14 (Link to dictyBase) - G03263 DDB0218474 Contig-U16035-1 FCL-AA...14P (Link to Original site) FCL-AA14F 647 FCL-AA14Z 550 FCL-AA14P 1197 - - Show FCL-AA14 Library F...CL (Link to library) Clone ID FCL-AA14 (Link to dictyBase) Atlas ID - NBRP ID G03263 dictyBase ID DDB0218474... Link to Contig Contig-U16035-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA.../FCL-AA14Q.Seq.d/ Representative seq. ID FCL-AA14P (Link to Original site) Representative DNA sequence >FCL-AA

  6. Dicty_cDB: FCL-AA19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA19 (Link to dictyBase) - G01757 DDB0230128 Contig-U16036-1 FCL-AA...19P (Link to Original site) FCL-AA19F 246 FCL-AA19Z 568 FCL-AA19P 814 - - Show FCL-AA19 Library FC...L (Link to library) Clone ID FCL-AA19 (Link to dictyBase) Atlas ID - NBRP ID G01757 dictyBase ID DDB0230128 ...Link to Contig Contig-U16036-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...19Q.Seq.d/ Representative seq. ID FCL-AA19P (Link to Original site) Representative DNA sequence >FCL-AA

  7. Dicty_cDB: FCL-AA17 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA17 (Link to dictyBase) - G03264 DDB0191099 Contig-U15602-1 FCL-AA...17P (Link to Original site) FCL-AA17F 547 FCL-AA17Z 610 FCL-AA17P 1157 - - Show FCL-AA17 Library F...CL (Link to library) Clone ID FCL-AA17 (Link to dictyBase) Atlas ID - NBRP ID G03264 dictyBase ID DDB0191099... Link to Contig Contig-U15602-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA.../FCL-AA17Q.Seq.d/ Representative seq. ID FCL-AA17P (Link to Original site) Representative DNA sequence >FCL-AA

  8. HD 172555: Detection of 63 micrometers [OI] Emission in a Debris Disc

    Science.gov (United States)

    Riviere-Marichalar, P.; Barrado, D.; Augereau, J. -C.; Thi, W. F.; Roberge, A.; Eiroa, C.; Montesinos, B.; Meeus, G.; Howard, C.; Sandell, G.; hide

    2012-01-01

    Context. HD 172555 is a young A7 star belonging to the Beta Pictoris Moving Group that harbours a debris disc. The Spitzer IRS spectrum of the source showed mid-IR features such as silicates and glassy silica species, indicating the presence of a warm dust component with small grains, which places HD 172555 among the small group of debris discs with such properties. The IRS spectrum also shows a possible emission of SiO gas. Aims. We aim to study the dust distribution in the circumstellar disc of HD 172555 and to asses the presence of gas in the debris disc. Methods. As part of the GASPS Open Time Key Programme, we obtained Herschel-PACS photometric and spectroscopic observations of the source. We analysed PACS observations of HD 172555 and modelled the Spectral Energy Distribution (SED) with a modified blackbody and the gas emission with a two-level population model with no collisional de-excitation. Results. We report for the first time the detection of [OI] atomic gas emission at 63.18 micrometers in the HD 172555 circumstellar disc.We detect excesses due to circumstellar dust toward HD 172555 in the three photometric bands of PACS (70, 100, and 160 m). We derive a large dust particle mass of (4.8 plus-minus 0.6)x10(exp -4) Mass compared to Earth and an atomic oxygen mass of 2.5x10(exp -2)R(exp 2) Mass compared to Earth, where R in AU is the separation between the star and the inner disc. Thus, most of the detected mass of the disc is in the gaseous phase.

  9. Cathodal HD-tDCS on the right V5 improves motion perception in humans

    Directory of Open Access Journals (Sweden)

    Giuseppe Angelo Zito

    2015-09-01

    Full Text Available Brain lesions in the visual associative cortex are known to impair visual perception, i.e. the capacity to correctly perceive different aspects of the visual world, such as motion, color, or shapes. Visual perception can be influenced by non-invasive brain stimulation such as transcranial direct current stimulation (tDCS. In a recently developed technique called high definition (HD tDCS, small HD-electrodes are used instead of the sponge electrodes in the conventional approach. This is believed to achieve high focality and precision over the target area.In this paper we tested the effects of cathodal and anodal HD-tDCS over the right V5 on motion and shape perception in a single blind, within-subject, sham controlled, cross-over trial. The purpose of the study was to prove the high focality of the stimulation only over the target area.21 healthy volunteers received 20 min of 2 mA cathodal, anodal and sham stimulation over the right V5 and their performance on a visual test was recorded. The results showed significant improvement in motion perception in the left hemifield after cathodal HD-tDCS, but not in shape perception. Sham and anodal HD-tDCS did not affect performance.The specific effect of influencing performance of visual tasks by modulating the excitability of the neurons in the visual cortex might be explained by the complexity of perceptual information needed for the tasks. This provokes a noisy activation state of the encoding neuronal patterns. We speculate that in this case cathodal HD-tDCS may focus the correct perception by decreasing global excitation and thus diminishing the noise below threshold.

  10. Simulation de la formabilite des alliages d'aluminium AA5754 et AA6063

    Science.gov (United States)

    Eljaafari, Samira

    Les besoins de reduction du poids se sont concretement traduits par l'introduction de nouvelles nuances plus legeres dans les structures automobiles. Ainsi, des alliages d'aluminium ont commence a etre integres dans les pieces de structure de plusieurs vehicules. La faible masse volumique des alliages d'aluminium (2,7g/cm3) permet d'alleger le poids du vehicule qui entraine une diminution de la consommation de carburant et, donc, des emissions de gaz a effet de serre. La striction et la rupture sont les principaux modes de defaillance qui entrainent le rebut systematique des pieces. C'est pourquoi, ameliorer la prediction d'apparition de ces defauts lors de la simulation va dans le sens d'une meilleure maitrise du procede. Dans le cadre de ce travail doctoral, deux modeles sont developpes pour simuler le comportement a grandes deformations d'alliages d'aluminium: un modele polycristallin de type Taylor et un modele a un ou plusieurs elements finis par grain. Les diagrammes limites de formage (DLF) pour les deux alliages d'aluminium AA5754 et AA6063 ont ete simules numeriquement en utilisant une formulation par elements finis pour les polycristaux basee sur l'hypothese de Taylor. Les DLF conventionnels et de l'hydroformage ont ete traces. L'effet des chemins de deformation sur la formabilite des alliages d'aluminium a aussi ete etudie. Finalement, des simulations numeriques avec les donnees de diffraction des electrons retrodiffuses (EBSD) pour 1'alliage d'aluminium AA5754 ont ete effectuees en utilisant le modele a un ou plusieurs elements par grain. Ces simulations sont executees avec differents modeles du durcissement (Asaro, Bassani et puissance). Mots-cles: Formabilite; Alliage d'aluminium; Hydroformage; Glissement cristallographique; Durcissement; Calcul parallele; Diagramme limite de formage (DLF); Diffraction electron.

  11. Detection of AA-type amyloid protein in labial salivary glands.

    Science.gov (United States)

    Sacsaquispe, Sonia-Julia; Antúnez-de Mayolo, Eleazar-Antonio; Vicetti, Rodolfo; Delgado, Wilson-Alejandro

    2011-03-01

    Among the diverse forms of amyloidosis, secondary type is the most frequent one. Diagnosis of amyloid deposition is based on the identification of the fibrillary protein amyloid by means of Congo Red (CR) or crystal violet (CV) stains, but these techniques do not differentiate between the different types of amyloid fibrils. The aim of this study was to identify by immunofluorescence (IF) AA amyloid a pathological fibrillar low-molecular-weight protein formed by cleavage of serum amyloid A (SAA) protein in labial salivary gland (LSG) biopsies from patients with secondary amyloidosis. 98 LSG were studied, 65 were from patients with secondary amyloidosis and 33 from subjects with chronic inflammatory diseases without evidence of this anomaly. All sections were stained with hematoxylin and eosin (H &E), CV, CR and IF using anti-AA antibodies. Positive and negative controls were used for all techniques. CV and CR demonstrated that the amyloid substance was found mainly distributed periductally (93.8%), followed by periacinar and perivascular locations (p <0.001); however, the IF demonstrated that amyloid AA substance predominates in the periacinar area (73.8%), followed by periductal and perivascular locations (p <0.001). IF has a sensitivity of 83%, 100% of specificity, 100% of predictive positive value and 75% of predictive negative value. The results of this study confirm the efficacy of the LSG biopsy as a highly reliable method for diagnosis of secondary amyloidosis.

  12. [Pathological and clinical correlations in renal AA amyloidosis: A Moroccan series of 30 cases].

    Science.gov (United States)

    Bziz, Asmae; Rouas, Lamia; Lamalmi, Najat; Malihy, Abderrahmane; Cherradi, Nadia; Ouzeddoun, Naima; Bayahia, Rabia; Flayou, Kaoutar; Chala, Sanae; Bouclouze, Aziz; Benomar, Ali; Abouqal, Redouan; Alhamany, Zaitouna

    2015-12-01

    Study of histological and clinical correlations of 30 cases of renal amyloidosis AA diagnosed between November 2010 and December 2012. The main causes associated with amyloidosis AA were represented by chronic infectious diseases (60%). Nephrotic syndrome and renal failure were observed in 94% and 73% respectively. The distribution of amyloid deposits: 90% of patients had a glomerular form and 10% had a vascular form. Inflammatory reaction associated with AA renal amyloidosis was present in 50% of cases. This inflammation was observed near amyloid deposits associated with a deposition of immunoglobulin chains and/or complement factors. Our study confirms the predominance of AA amyloidosis complicating chronic infectious diseases, especially tuberculosis. Our data point out a relationship between the morphology of renal AA amyloidosis, its clinical presentation and prognosis. Copyright © 2015 Association Société de néphrologie. Published by Elsevier SAS. All rights reserved.

  13. Precise masses for the transiting planetary system HD 106315 with HARPS

    Science.gov (United States)

    Barros, S. C. C.; Gosselin, H.; Lillo-Box, J.; Bayliss, D.; Delgado Mena, E.; Brugger, B.; Santerne, A.; Armstrong, D. J.; Adibekyan, V.; Armstrong, J. D.; Barrado, D.; Bento, J.; Boisse, I.; Bonomo, A. S.; Bouchy, F.; Brown, D. J. A.; Cochran, W. D.; Collier Cameron, A.; Deleuil, M.; Demangeon, O.; Díaz, R. F.; Doyle, A.; Dumusque, X.; Ehrenreich, D.; Espinoza, N.; Faedi, F.; Faria, J. P.; Figueira, P.; Foxell, E.; Hébrard, G.; Hojjatpanah, S.; Jackman, J.; Lendl, M.; Ligi, R.; Lovis, C.; Melo, C.; Mousis, O.; Neal, J. J.; Osborn, H. P.; Pollacco, D.; Santos, N. C.; Sefako, R.; Shporer, A.; Sousa, S. G.; Triaud, A. H. M. J.; Udry, S.; Vigan, A.; Wyttenbach, A.

    2017-12-01

    Context. The multi-planetary system HD 106315 was recently found in K2 data. The planets have periods of Pb 9.55 and Pc 21.06 days, and radii of rb = 2.44 ± 0.17 R⊕ and rc = 4.35 ± 0.23 R⊕ . The brightness of the host star (V = 9.0 mag) makes it an excellent target for transmission spectroscopy. However, to interpret transmission spectra it is crucial to measure the planetary masses. Aims: We obtained high precision radial velocities for HD 106315 to determine the mass of the two transiting planets discovered with Kepler K2. Our successful observation strategy was carefully tailored to mitigate the effect of stellar variability. Methods: We modelled the new radial velocity data together with the K2 transit photometry and a new ground-based partial transit of HD 106315c to derive system parameters. Results: We estimate the mass of HD 106315b to be 12.6 ± 3.2 M⊕ and the density to be 4.7 ± 1.7 g cm-3, while for HD 106315c we estimate a mass of 15.2 ± 3.7 M⊕ and a density of 1.01 ± 0.29 g cm-3. Hence, despite planet c having a radius almost twice as large as planet b, their masses are consistent with one another. Conclusions: We conclude that HD 106315c has a thick hydrogen-helium gaseous envelope. A detailed investigation of HD 106315b using a planetary interior model constrains the core mass fraction to be 5-29%, and the water mass fraction to be 10-50%. An alternative, not considered by our model, is that HD 106315b is composed of a large rocky core with a thick H-He envelope. Transmission spectroscopy of these planets will give insight into their atmospheric compositions and also help constrain their core compositions. Based on observations collected at the European Organisation for Astronomical Research in the Southern Hemisphere under ESO programme 198.C-0168.

  14. Spectropolarimetric observations of the transiting planetary system of the K dwarf HD 189733

    OpenAIRE

    Moutou, C.; Donati, J. -F.; Savalle, R.; Hussain, G.; Alecian, E.; Bouchy, F.; Catala, C.; Cameron, A. Collier; Udry, S.; Vidal-Madjar, A.

    2007-01-01

    With a Jupiter-mass planet orbiting at a distance of only 0.031 AU, the active K2 dwarf HD 189733 is a potential candidate in which to study the magnetospheric interactions of a cool star with its recently-discovered close-orbiting giant planet. We decided to explore the strength and topology of the large-scale magnetosphere of HD 189733, as a future benchmark for quantitative studies for models of the star/planet magnetic interactions. To this end, we used ESPaDOnS, the new generation spectr...

  15. The Death Spiral of the Hot Jupiter Exoplanet HD 189733b

    Science.gov (United States)

    Dowling Jones, Liam; Marchioni, Lucas; Guinan, Edward; Engle, Scott

    2018-01-01

    HD 189733 is a quintessential example of hot Jupiter-type exoplanet systems in which a gas giant planet with a mass similar to Jupiter is orbiting extremely close to its host star. HD 189733 is the nearest and brightest hot Jupiter system discovered so far and undergoes transit eclipses. Because of this, HD 189733 is well studied across the electromagnetic spectrum. It consists of a 7.7 mag K1.5 V host star and a Jupiter-size planet orbiting with a period of P =2.22 days, only located only 0.030 AU from its host star.About ten years ago HD 189733 system was discovered to be accompanied by gravitationally-bound red dwarf M4 V star companion (HD 189733 B). It was found previously by Guinan et al. (2017) that the age measurement (~0.7 Gyr) of the K-type star indicated by its 11.95 day rotation period and corresponding moderately high levels of coronal X-ray and chromospheric emissions do not agree with the much older age of ~6 - 9 Gyr indicated from the low X-ray activity of the dM companion star. This age discrepancy is can be resolved by assuming an increase in angular momentum or “spin-up” of the HD 189733A by its hosted planet. It is probable is that this extra angular momentum was acquired from the orbiting exoplanet from the tidal and magnetic interactions of the planet and host star.Photometric observations of the planetary transit eclipses of HD 189733b have been carried out for over 11 years. Using new transit timings that we have obtained with the 1.3-m Robotically Controlled Telescope (RCT) when combined with numerous timings available in the literature, we have discovered a very small decrease in the orbital period of the HD 189733b. The change in period is dP/dt = 0.87 sec/100 yrs. This finding support the transfer of orbital angular momentum of the planet to the host star - thus spinning-up the host star and shrinking the orbit of the planet. At this rate of period decrease, the planet will be tidally disrupted in less than 40 million years. However

  16. A&A Painting and Restoration Co., Inc. Information Sheet

    Science.gov (United States)

    A&A Painting and Restoration Co., Inc. (the Company) is located in Great Mills, Maryland. The settlement involves renovation activities conducted at properties constructed prior to 1978, located in Drayden, Maryland.

  17. Effect of blood pressure and glycemic control on the plasma cell-free DNA in hemodialysis patients

    Directory of Open Access Journals (Sweden)

    Da Wun Jeong

    2015-12-01

    Conclusions: In patients with HD, cfDNA is elevated in diabetic patients and patients with cardiovascular diseases. Uncontrolled hypertension and poor glycemic control are independent determinants for the elevated cfDNA. Our data suggest that cfDNA might be a marker of vascular injury rather than proinflammatory condition in HD patients.

  18. Medical research and evaluation facility and studies supporting the Medical Chemical Defense Program. Time and dose response characterization of the prevention of HD-induced NAD+ depletion and HD-induced cytotoxicity by niacinamide and niacin. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Olson, C.T.; Johnson, J.B.; Blank, J.A.; Menton, R.G.; Starner, R.A.

    1997-01-01

    Studies were conducted under this task to Assess the time and concentration dependent nature of niacinamide (NM) protection against HD-induced NAD+ depletion and cytotoxicity. The HD concentrations used assess the time dependent nature of cytotoxicity and NAD+ depletion, and the impact of NM and niacin (NI) treatment were 13,62, 101, and 171 mu-M HD. Three concentrations of NM and NI were (0.01,0.1 and 1 mM) selected by USAMRICD for evaluation at 2, 4,8, 12, 16,20,24,48, and 72 hours after exposure to HD. Cytotoxicity and total culture NAD+ content were assessed. NAD+ concentrations following the addition of 1 mM NM frequently were significantly greater than those observed for the HD-exposed controls especially at 171mu-M HD. Multiple addition of NM had little protective effect relative to that by provided by pretreatment alone. At the 171mu-M HD concentration, the single addition of NM provided marginal but statistically significant (p<=0.05) protection. Comparisons of the different NM addition modes yielded mixed results, but usually the number of viable cells was greater with multiple additions of NM. NI did not provide protection against HD-induced NAD+ depletion or cytotoxicity.

  19. Survival of chronic hemodialysis patients over 80 years of age

    Directory of Open Access Journals (Sweden)

    Sladoje-Martinovic B

    2014-04-01

    Full Text Available Branka Sladoje-Martinovic, Ivana Mikolasevic, Ivan Bubic, Sanjin Racki, Lidija OrlicDepartment of Nephrology and Dialysis, Division of Internal Medicine, University Hospital Center Rijeka, Rijeka, CroatiaBackground/aim: The number of elderly patients with chronic kidney disease (CKD stage 5 management with hemodialysis (HD is steadily increasing. Therefore we analyzed the number of new CKD patients ≥80 years managed with HD and their survival through the study period. We aimed also, to identify which of several key variables might be independently associated with survival in this very elderly population of patients.Patients and methods: This was a single-center, retrospective cohort study that took place during the period from January 1987 to September 2012. The study consisted of 78 (50 male and 28 women very elderly patients (≥80 years of age; the mean age at which HD was initiated was 83.2±2.5 years. Survival and factors associated with mortality were studied. Survival was defined as the time from start of HD treatment to death (or end of study, if still alive.Results: In the period from 1987 to 2002, patients ≥80 years of age were only sporadically treated with HD, but since 2003, the number of new patients has been steadily increasing. The mean survival for our group of patients was 25.1±22.4 months (range 1–115 months. Furthermore, 30.8% patients survived <12 months, 29.5% patients survived 12–24 months, 30.8% patients survived 24–60 months, and 9% patients survived >60 months on HD treatment. Older patients were less likely to have diabetes, and primary renal disease did not influence survival. Patients with high C-reactive protein levels and poor nutritional status, as well as those who did not have pre-HD nephrology care and those that had a catheter as vascular access for HD had poor survival. In about half of our patients, the cause of death was cardiovascular disease.Conclusion: Among patients who were ≥80 years of

  20. Caregiver Burden, Anxiety, Depression, and Sleep Quality Differences in Caregivers of Hemodialysis Patients Compared With Renal Transplant Patients.

    Science.gov (United States)

    Avşar, U; Avşar, U Z; Cansever, Z; Yucel, A; Cankaya, E; Certez, H; Keles, M; Aydınlı, B; Yucelf, N

    2015-06-01

    We compared the caregivers of hemodialysis (HD) patients and caregivers of patients with renal transplantation (Tx) in terms of anxiety, depression, sleep quality, and caregiver burden. We believe that caregivers of HD have more difficult conditions than caregivers of the patients with Tx. This cross-sectional study analyzed the psychological status of caregivers of Tx patients compared with those of HD patients with using the Hospital Anxiety and Depression Scale, Zarit Burden Interview, and Pittsburg Sleep Quality Indexes. We recruited 133 caregivers-65 caregivers in the Tx group and 68 in the HD group. Mean age was 43.1 ± 8.5 years. The age, sex, income level, and education level were similar between the 2 groups. Caregivers in the HD group had significantly higher rates of anxiety and depression compared with the Tx group (P = .007 and P caregivers in the Tx group and caregivers in the HD group were 92% (n = 60) and 63% (n = 43), respectively. Poor sleep quality was significantly higher in caregivers in the HD group compared with caregivers in the Tx group (P Caregiver burden scores were significantly higher for caregivers in the HD group compared with caregivers in the Tx group (P caregivers who undertake the care of patients with end-stage renal disease and chronic kidney disease. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Effects of flaxseed consumption on systemic inflammation and serum lipid profile in hemodialysis patients with lipid abnormalities.

    Science.gov (United States)

    Khalatbari Soltani, Saman; Jamaluddin, Rosita; Tabibi, Hadi; Mohd Yusof, Barakatun Nisak; Atabak, Shahnaz; Loh, Su-Peng; Rahmani, Leila

    2013-04-01

    Inflammation and lipid abnormalities are two important risk factors for cardiovascular disease in hemodialysis (HD) patients. The present study was designed to investigate the effects of flaxseed consumption on systemic inflammation and serum lipid profile in HD patients with lipid abnormalities. This was an unblinded, randomized clinical trial. Thirty HD patients with dyslipidemia (triglyceride >200 mg/dL and/or high-density lipoprotein-cholesterol (HDL-C) consumption improves lipid abnormalities and reduces systemic inflammation in HD patients with lipid abnormalities. © 2012 The Authors. Hemodialysis International © 2012 International Society for Hemodialysis.

  2. Bake hardening of nanograin AA7075 aluminum alloy

    International Nuclear Information System (INIS)

    Dehghani, Kamran

    2011-01-01

    Highlights: ► The bake hardening behavior of AA7075 was studied and compared with its coarse-grain counterpart. ► Nanograin AA7075 exhibited 88–100% increase in bake hardenability. ► Nanograin AA7075 exhibited 36–38% increase in final yield strength after baking. ► Maximum bake hardenability and final yield stress were about 185 MPa and 719 MPa. - Abstract: In the present work, the bake hardening of nanostructured AA7075 aluminum alloy was compared with that of its coarse-grain counterpart. Surface severe plastic deformation (SSPD) was used to produce nanograin layers on both surfaces of workpieces. The nanostructured layers were characterized using scanning electron microscopy (SEM) and atomic force microscopy (AFM) techniques. The thickness of nanostructured layer, having the grains of 50–110 nm, was about 75 μm on each side of workpiece. The bake hardenability of nanograin and coarse-grain AA7075 was then compared by pre-straining to 2, 4 and 6% followed by baking at 100 °C and 200 °C for 20 min. Comparing to coarse-grain case, there was about 88–100% increase in bake hardenability and about 36–38% increase in yield strength after the bake hardening of present nanograin AA7075. Such an increase in bake hardenability and strength was achieved when the thickness of two nanograin layers was about only one-tenth of the whole thickness.

  3. Astrocytes generated from patient induced pluripotent stem cells recapitulate features of Huntington’s disease patient cells

    Directory of Open Access Journals (Sweden)

    Juopperi Tarja A

    2012-05-01

    Full Text Available Abstract Background Huntington’s Disease (HD is a devastating neurodegenerative disorder that clinically manifests as motor dysfunction, cognitive impairment and psychiatric symptoms. There is currently no cure for this progressive and fatal disorder. The causative mutation of this hereditary disease is a trinucleotide repeat expansion (CAG in the Huntingtin gene that results in an expanded polyglutamine tract. Multiple mechanisms have been proposed to explain the preferential striatal and cortical degeneration that occurs with HD, including non-cell-autonomous contribution from astrocytes. Although numerous cell culture and animal models exist, there is a great need for experimental systems that can more accurately replicate the human disease. Human induced pluripotent stem cells (iPSCs are a remarkable new tool to study neurological disorders because this cell type can be derived from patients as a renewable, genetically tractable source for unlimited cells that are difficult to acquire, such as neurons and astrocytes. The development of experimental systems based on iPSC technology could aid in the identification of molecular lesions and therapeutic treatments. Results We derived iPSCs from a father with adult onset HD and 50 CAG repeats (F-HD-iPSC and his daughter with juvenile HD and 109 CAG repeats (D-HD-iPSC. These disease-specific iPSC lines were characterized by standard assays to assess the quality of iPSC lines and to demonstrate their pluripotency. HD-iPSCs were capable of producing phenotypically normal, functional neurons in vitro and were able to survive and differentiate into neurons in the adult mouse brain in vivo after transplantation. Surprisingly, when HD-iPSCs were directed to differentiate into an astrocytic lineage, we observed the presence of cytoplasmic, electron clear vacuoles in astrocytes from both F-HD-iPSCs and D-HD-iPSCs, which were significantly more pronounced in D-HD-astrocytes. Remarkably, the vacuolation in

  4. Establishing Core Outcome Domains in Hemodialysis: Report of the Standardized Outcomes in Nephrology-Hemodialysis (SONG-HD) Consensus Workshop.

    Science.gov (United States)

    Tong, Allison; Manns, Braden; Hemmelgarn, Brenda; Wheeler, David C; Evangelidis, Nicole; Tugwell, Peter; Crowe, Sally; Van Biesen, Wim; Winkelmayer, Wolfgang C; O'Donoghue, Donal; Tam-Tham, Helen; Shen, Jenny I; Pinter, Jule; Larkins, Nicholas; Youssouf, Sajeda; Mandayam, Sreedhar; Ju, Angela; Craig, Jonathan C

    2017-01-01

    Evidence-informed decision making in clinical care and policy in nephrology is undermined by trials that selectively report a large number of heterogeneous outcomes, many of which are not patient centered. The Standardized Outcomes in Nephrology-Hemodialysis (SONG-HD) Initiative convened an international consensus workshop on November 7, 2015, to discuss the identification and implementation of a potential core outcome set for all trials in hemodialysis. The purpose of this article is to report qualitative analyses of the workshop discussions, describing the key aspects to consider when establishing core outcomes in trials involving patients on hemodialysis therapy. Key stakeholders including 8 patients/caregivers and 47 health professionals (nephrologists, policymakers, industry, and researchers) attended the workshop. Attendees suggested that identifying core outcomes required equitable stakeholder engagement to ensure relevance across patient populations, flexibility to consider evolving priorities over time, deconstruction of language and meaning for conceptual consistency and clarity, understanding of potential overlap and associations between outcomes, and an assessment of applicability to the range of interventions in hemodialysis. For implementation, they proposed that core outcomes must have simple, inexpensive, and validated outcome measures that could be used in clinical care (quality indicators) and trials (including pragmatic trials) and endorsement by regulatory agencies. Integrating these recommendations may foster acceptance and optimize the uptake and translation of core outcomes in hemodialysis, leading to more informative research, for better treatment and improved patient outcomes. Copyright © 2016 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.

  5. Structural Insights Reveal the Dynamics of the Repeating r(CAG Transcript Found in Huntington's Disease (HD and Spinocerebellar Ataxias (SCAs.

    Directory of Open Access Journals (Sweden)

    Arpita Tawani

    Full Text Available In humans, neurodegenerative disorders such as Huntington's disease (HD and many spinocerebellar ataxias (SCAs have been found to be associated with CAG trinucleotide repeat expansion. An important RNA-mediated mechanism that causes these diseases involves the binding of the splicing regulator protein MBNL1 (Muscleblind-like 1 protein to expanded r(CAG repeats. Moreover, mutant huntingtin protein translated from expanded r(CAG also yields toxic effects. To discern the role of mutant RNA in these diseases, it is essential to gather information about its structure. Detailed insight into the different structures and conformations adopted by these mutant transcripts is vital for developing therapeutics targeting them. Here, we report the crystal structure of an RNA model with a r(CAG motif, which is complemented by an NMR-based solution structure obtained from restrained Molecular Dynamics (rMD simulation studies. Crystal structure data of the RNA model resolved at 2.3 Å reveals non-canonical pairing of adenine in 5´-CAG/3´-GAC motif samples in different syn and anti conformations. The overall RNA structure has helical parameters intermediate to the A- and B-forms of nucleic acids due to the global widening of major grooves and base-pair preferences near internal AA loops. The comprehension of structural behaviour by studying the spectral features and the dynamics also supports the flexible nature of the r(CAG motif.

  6. YKL-40 in patients with end-stage renal disease receiving haemodialysis.

    Science.gov (United States)

    Nielsen, Ture Lange; Plesner, Louis Lind; Warming, Peder Emil; Pallisgaard, Jannik Langtved; Dalsgaard, Morten; Schou, Morten; Høst, Ulla; Rydahl, Casper; Brandi, Lisbet; Køber, Lars; Johansen, Julia Sidenius; Kastrup, Jens; Iversen, Kasper Karmark

    2018-03-08

    This study aimed to determine serum YKL-40 in patients with end-stage renal disease (ESRD) on haemodialysis (HD) and to evaluate the prognostic value of serum YKL-40. Patients >18 years on maintenance HD were included. Serum YKL-40 was measured using ELISA before and after a single HD treatment. A total of 306 patients were included. Median serum YKL-40 concentration was 238 µgL -1 (IQR: 193-291 µgL -1 ) before HD treatment and 198 µgL -1 (IQR: 147-258 µgL -1 ) after HD treatment, which corresponded to age-corrected 93th percentile in healthy subjects. All-cause mortality after 2.8 years was 35.9%. Patients with serum YKL-40 in the highest quartile compared with the lowest quartile had a univariate HR of 4.0 (95% CI: 2.2-7.3, p 40 after HD treatment had significant higher area under the curves from 90 d (p = 0.004) and throughout the rest of the follow-up period when compared to serum YKL-40 before HD treatment. YKL-40 was highly elevated in patients with ESRD on HD, and dialysis reduced serum YKL-40 concentrations approximately one-sixth. YKL-40 measured after dialysis was independently associated with mortality in HD patients.

  7. Effect of Aggregatibacter actinomycetemcomitans from Aggressive Periodontitis patients on Streptococcus mutans.

    Science.gov (United States)

    Kozlovsky, A; Wolff, A; Saminsky, M; Mazor, Y; Venezia, E; Bar-Ness Greenstein, R

    2015-11-01

    To determine in vivo association between Aggregatibacter actinomycetemcomitans (Aa) and Streptococcus mutans (Sm) in aggressive periodontitis patients (AgP) and the in vitro influence on Sm of saliva and of Aa strains isolated from individual Aa-positive patients. Clinical indices and saliva samples were taken from 30 AgP patients. Aa and mutans streptococci levels were determined. Antibacterial effect of saliva from 12 Aa-positive patients, and their individual Aa strain, was checked turbidimetrically in vitro on Sm. Aa salivary level was inversely correlated with levels of mutans streptococci and directly correlated with pockets of ≥7 mm. During exponential growth phase: (i) All Aa-positive and Aa-negative saliva samples showed no significant influence on Sm growth. (ii) Each individually isolated Aa strain presented significant inhibitory effect on Sm growth. During stationary growth phase, all the above demonstrated an inhibitory effect on Sm growth, with significantly greater influence of Aa individual strains. Saliva of each AgP Aa-positive subject had an inhibitory effect on Sm growth, which is most likely derived from Aa bacterial physiology. This research raises the possibility that suppression of Aa due to periodontal treatment may increase Sm levels and hence caries incidence. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. A novel Cry9Aa with increased toxicity for Spodoptera exigua (Hübner)

    NARCIS (Netherlands)

    Naimov, S.; Nedyalkova, R.; Staykov, N.; Weemen-Hendriks, M.; Minkov, I.; Maagd, de R.A.

    2014-01-01

    Cry9Aa, produced by Bacillus thuringiensis is reported to be not active against Spodoptera exigua (beet armyworm). In this study we have cloned a new cry9Aa5 gene encoding a protoxin with increased activity against S. exigua as compared to Cry9Aa1. When aligned to Cry9Aa1, four amino acid

  9. Cytopathological effects of Bacillus sphaericus Cry48Aa/Cry49Aa toxin on binary toxin-susceptible and -resistant Culex quinquefasciatus larvae.

    Science.gov (United States)

    de Melo, Janaina Viana; Jones, Gareth Wyn; Berry, Colin; Vasconcelos, Romero Henrique Teixeira; de Oliveira, Cláudia Maria Fontes; Furtado, André Freire; Peixoto, Christina Alves; Silva-Filha, Maria Helena Neves Lobo

    2009-07-01

    The Cry48Aa/Cry49Aa mosquitocidal two-component toxin was recently characterized from Bacillus sphaericus strain IAB59 and is uniquely composed of a three-domain Cry protein toxin (Cry48Aa) and a binary (Bin) toxin-like protein (Cry49Aa). Its mode of action has not been elucidated, but a remarkable feature of this protein is the high toxicity against species from the Culex complex, besides its capacity to overcome Culex resistance to the Bin toxin, the major insecticidal factor in B. sphaericus-based larvicides. The goal of this work was to investigate the ultrastructural effects of Cry48Aa/Cry49Aa on midgut cells of Bin-toxin-susceptible and -resistant Culex quinquefasciatus larvae. The major cytopathological effects observed after Cry48Aa/Cry49Aa treatment were intense mitochondrial vacuolation, breakdown of endoplasmic reticulum, production of cytoplasmic vacuoles, and microvillus disruption. These effects were similar in Bin-toxin-susceptible and -resistant larvae and demonstrated that Cry48Aa/Cry49Aa toxin interacts with and displays toxic effects on cells lacking receptors for the Bin toxin, while B. sphaericus IAB59-resistant larvae did not show mortality after treatment with Cry48Aa/Cry49Aa toxin. The cytopathological alterations in Bin-toxin-resistant larvae provoked by Cry48Aa/Cry49Aa treatment were similar to those observed when larvae were exposed to a synergistic mixture of Bin/Cry11Aa toxins. Such effects seemed to result from a combined action of Cry-like and Bin-like toxins. The complex effects caused by Cry48Aa/Cry49Aa provide evidence for the potential of these toxins as active ingredients of a new generation of biolarvicides that conjugate insecticidal factors with distinct sites of action, in order to manage mosquito resistance.

  10. The Populus Class III HD ZIP transcription factor POPCORONA affects cell differentiation during secondary growth of woody stems

    Science.gov (United States)

    Juan Du; Eriko Miura; Marcel Robischon; Ciera Martinez; Andrew Groover

    2011-01-01

    The developmental mechanisms regulating cell differentiation and patterning during the secondary growth of woody tissues are poorly understood. Class III HD ZIP transcription factors are evolutionarily ancient and play fundamental roles in various aspects of plant development. Here we investigate the role of a Class III HD ZIP transcription factor, ...

  11. Hemodialysis in the Poisoned Patient

    Directory of Open Access Journals (Sweden)

    Megan Boysen-Osborn

    2017-09-01

    Full Text Available Audience: This classic team based learning (cTBL didactic is aimed for emergency medicine residents and fourth year medical students entering emergency medicine. Introduction: Over one million visits per year to United States (US emergency departments (ED are related to poisonings.1 Extracorporeal treatment (ECTR, specifically hemodialysis (HD, is one potential method to enhance elimination of certain drugs and their toxic metabolites.2-12 While HD may be life-saving in certain poisonings, it may have no effect on others and it carries associated risks and costs. It is essential that emergency physicians know the indications for HD in the poisoned patient. This cTBL reviews many poisonings which may be managed by HD. Objectives: By the end of this cTBL, the learner will: 1 recognize laboratory abnormalities related to toxic alcohol ingestion; 2 calculate an anion gap and osmolal gap; 3 know the characteristics of drugs that are good candidates for HD; 4 discuss the management of patients with toxic alcohol ingestions; 5 discuss the management of patients with salicylate overdose; 6 know the indications for HD in patients with overdoses of antiepileptic drugs; 7 discuss the management of patients with lithium toxicity. Method: This didactic session is a cTBL (classic team based learning.

  12. Influence of Process Parameters in the Friction Surfacing of AA 6082-T6 over AA 2024-T3

    OpenAIRE

    Gandra, J.; Pereira, D.; Miranda, R.M.; Vilaça, P.

    2013-01-01

    VK: T20309 Friction Surfacing is a solid state coating technique with applications in hardfacing, corrosion protection and repair. Since it doesn’t require the fusion of the materials involved, it is suitable to join aluminium alloys while avoiding several of their processing difficulties. The present study addresses the deposition of AA 6082-T6 coatings on AA 2024-T3 substrates, while focusing on the effect of process parameters, such as, axial force, rotation and travel speed. Sound alum...

  13. Huntington's Disease and its therapeutic target genes: a global functional profile based on the HD Research Crossroads database

    Directory of Open Access Journals (Sweden)

    Kalathur Ravi Kiran

    2012-06-01

    Full Text Available Abstract Background Huntington’s disease (HD is a fatal progressive neurodegenerative disorder caused by the expansion of the polyglutamine repeat region in the huntingtin gene. Although the disease is triggered by the mutation of a single gene, intensive research has linked numerous other genes to its pathogenesis. To obtain a systematic overview of these genes, which may serve as therapeutic targets, CHDI Foundation has recently established the HD Research Crossroads database. With currently over 800 cataloged genes, this web-based resource constitutes the most extensive curation of genes relevant to HD. It provides us with an unprecedented opportunity to survey molecular mechanisms involved in HD in a holistic manner. Methods To gain a synoptic view of therapeutic targets for HD, we have carried out a variety of bioinformatical and statistical analyses to scrutinize the functional association of genes curated in the HD Research Crossroads database. In particular, enrichment analyses were performed with respect to Gene Ontology categories, KEGG signaling pathways, and Pfam protein families. For selected processes, we also analyzed differential expression, using published microarray data. Additionally, we generated a candidate set of novel genetic modifiers of HD by combining information from the HD Research Crossroads database with previous genome-wide linkage studies. Results Our analyses led to a comprehensive identification of molecular mechanisms associated with HD. Remarkably, we not only recovered processes and pathways, which have frequently been linked to HD (such as cytotoxicity, apoptosis, and calcium signaling, but also found strong indications for other potentially disease-relevant mechanisms that have been less intensively studied in the context of HD (such as the cell cycle and RNA splicing, as well as Wnt and ErbB signaling. For follow-up studies, we provide a regularly updated compendium of molecular mechanism, that are

  14. Huntington's disease and its therapeutic target genes: a global functional profile based on the HD Research Crossroads database.

    Science.gov (United States)

    Kalathur, Ravi Kiran Reddy; Hernández-Prieto, Miguel A; Futschik, Matthias E

    2012-06-28

    Huntington's disease (HD) is a fatal progressive neurodegenerative disorder caused by the expansion of the polyglutamine repeat region in the huntingtin gene. Although the disease is triggered by the mutation of a single gene, intensive research has linked numerous other genes to its pathogenesis. To obtain a systematic overview of these genes, which may serve as therapeutic targets, CHDI Foundation has recently established the HD Research Crossroads database. With currently over 800 cataloged genes, this web-based resource constitutes the most extensive curation of genes relevant to HD. It provides us with an unprecedented opportunity to survey molecular mechanisms involved in HD in a holistic manner. To gain a synoptic view of therapeutic targets for HD, we have carried out a variety of bioinformatical and statistical analyses to scrutinize the functional association of genes curated in the HD Research Crossroads database. In particular, enrichment analyses were performed with respect to Gene Ontology categories, KEGG signaling pathways, and Pfam protein families. For selected processes, we also analyzed differential expression, using published microarray data. Additionally, we generated a candidate set of novel genetic modifiers of HD by combining information from the HD Research Crossroads database with previous genome-wide linkage studies. Our analyses led to a comprehensive identification of molecular mechanisms associated with HD. Remarkably, we not only recovered processes and pathways, which have frequently been linked to HD (such as cytotoxicity, apoptosis, and calcium signaling), but also found strong indications for other potentially disease-relevant mechanisms that have been less intensively studied in the context of HD (such as the cell cycle and RNA splicing, as well as Wnt and ErbB signaling). For follow-up studies, we provide a regularly updated compendium of molecular mechanism, that are associated with HD, at http://hdtt.sysbiolab.eu Additionally

  15. Analysis of the sEMG/force relationship using HD-sEMG technique and data fusion: A simulation study.

    Science.gov (United States)

    Al Harrach, Mariam; Carriou, Vincent; Boudaoud, Sofiane; Laforet, Jeremy; Marin, Frederic

    2017-04-01

    The relationship between the surface Electromyogram (sEMG) signal and the force of an individual muscle is still ambiguous due to the complexity of experimental evaluation. However, understanding this relationship should be useful for the assessment of neuromuscular system in healthy and pathological contexts. In this study, we present a global investigation of the factors governing the shape of this relationship. Accordingly, we conducted a focused sensitivity analysis of the sEMG/force relationship form with respect to neural, functional and physiological parameters variation. For this purpose, we used a fast generation cylindrical model for the simulation of an 8×8 High Density-sEMG (HD-sEMG) grid and a twitch based force model for the muscle force generation. The HD-sEMG signals as well as the corresponding force signals were simulated in isometric non-fatiguing conditions and were based on the Biceps Brachii (BB) muscle properties. A total of 10 isometric constant contractions of 5s were simulated for each configuration of parameters. The Root Mean Squared (RMS) value was computed in order to quantify the sEMG amplitude. Then, an image segmentation method was used for data fusion of the 8×8 RMS maps. In addition, a comparative study between recent modeling propositions and the model proposed in this study is presented. The evaluation was made by computing the Normalized Root Mean Squared Error (NRMSE) of their fitting to the simulated relationship functions. Our results indicated that the relationship between the RMS (mV) and muscle force (N) can be modeled using a 3rd degree polynomial equation. Moreover, it appears that the obtained coefficients are patient-specific and dependent on physiological, anatomical and neural parameters. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Bound energy levels at the n=2 dissociation threshold in HD

    NARCIS (Netherlands)

    Pielage, T.G.P.; de Lange, A.; Brandi, F.; Ubachs, W.M.G.

    2002-01-01

    Level energies of g symmetry states lying just below the n = 2 dissociation threshold have been determined in a XUV + IR multi-step laser excitation experiment in HD, with an absolute accuracy of the excitation energy of 0.015 cm

  17. The non-thermal radio emitter HD 93250 resolved by long baseline interferometry

    NARCIS (Netherlands)

    Sana, H.; Le Bouquin, J.-B.; Berger, J.-P.; de Koter, A.; Mérand, A.

    2011-01-01

    As the brightest O-type X-ray source in the Carina nebula, HD 93250 (O4 III(fc)) is X-ray overluminous for its spectral type and has an unusually hard X-ray spectrum. Two different scenarios have been invoked to explain its X-ray properties: wind-wind interaction and magnetic wind confinement. Yet,

  18. Compensation in Preclinical Huntington's Disease: Evidence From the Track-On HD Study

    Science.gov (United States)

    Klöppel, Stefan; Gregory, Sarah; Scheller, Elisa; Minkova, Lora; Razi, Adeel; Durr, Alexandra; Roos, Raymund A.C.; Leavitt, Blair R.; Papoutsi, Marina; Landwehrmeyer, G. Bernhard; Reilmann, Ralf; Borowsky, Beth; Johnson, Hans; Mills, James A.; Owen, Gail; Stout, Julie; Scahill, Rachael I.; Long, Jeffrey D.; Rees, Geraint; Tabrizi, Sarah J.

    2015-01-01

    Background Cognitive and motor task performance in premanifest Huntington's disease (HD) gene-carriers is often within normal ranges prior to clinical diagnosis, despite loss of brain volume in regions involved in these tasks. This indicates ongoing compensation, with the brain maintaining function in the presence of neuronal loss. However, thus far, compensatory processes in HD have not been modeled explicitly. Using a new model, which incorporates individual variability related to structural change and behavior, we sought to identify functional correlates of compensation in premanifest-HD gene-carriers. Methods We investigated the modulatory effects of regional brain atrophy, indexed by structural measures of disease load, on the relationship between performance and brain activity (or connectivity) using task-based and resting-state functional MRI. Findings Consistent with compensation, as atrophy increased performance-related activity increased in the right parietal cortex during a working memory task. Similarly, increased functional coupling between the right dorsolateral prefrontal cortex and a left hemisphere network in the resting-state predicted better cognitive performance as atrophy increased. Such patterns were not detectable for the left hemisphere or for motor tasks. Interpretation Our findings provide evidence for active compensatory processes in premanifest-HD for cognitive demands and suggest a higher vulnerability of the left hemisphere to the effects of regional atrophy. PMID:26629536

  19. Interfacial Interactions and Nanostructure Changes in DPPG/HD Monolayer at the Air/Water Interface

    Directory of Open Access Journals (Sweden)

    Huaze Zhu

    2015-01-01

    Full Text Available Lung surfactant (LS plays a crucial role in regulating surface tension during normal respiration cycles by decreasing the work associated with lung expansion and therefore decreases the metabolic energy consumed. Monolayer surfactant films composed of a mixture of phospholipids and spreading additives are of optional utility for applications in lung surfactant-based therapies. A simple, minimal model of such a lung surfactant system, composed of 1,2-dipalmitoyl-sn-glycero-3-[phosphor-rac-(1-gylcerol] (DPPG and hexadecanol (HD, was prepared, and the surface pressure-area (π-A isotherms and nanostructure characteristics of the binary mixture were investigated at the air/water interface using a combination of Langmuir-Blodgett (LB and atomic force microscopy (AFM techniques. Based on the regular solution theory, the miscibility and stability of the two components in the monolayer were analyzed in terms of compression modulus (Cs-1 , excess Gibbs free energy (ΔGexcπ , activity coefficients (γ, and interaction parameter (ξ. The results of this paper provide valuable insight into basic thermodynamics and nanostructure of mixed DPPG/HD monolayers; it is helpful to understand the thermodynamic behavior of HD as spreading additive in LS monolayer with a view toward characterizing potential improvements to LS performance brought about by addition of HD to lung phospholipids.

  20. Molecular marker analysis of heading date Hd1 locus in Egyptian ...

    African Journals Online (AJOL)

    Nine molecular markers derived from the heading date QTL Hd1 DNA sequence for cultivated rice were used to study the heading date allelic diversity of the cultivated Egyptian rice varieties. The results showed that among the nine simple sequence repeats (SSR) and sequence tagged-sites (STS) markers used, one SSR ...

  1. HD 185330 — chemically peculiar 3He star in the Kepler field

    Science.gov (United States)

    Niemczura, E.; Vennes, S.; Różański, T.; Pigulski, A.; Hełminiak, K.; Lehmann, H.

    2018-01-01

    We analyzed high-resolution spectra of the chemically peculiar 3He star HD 185330. We determined its atmospheric parameters (Teff, log g, ξ) and constrained its rotation velocity and abundance pattern. In particular, we found a large (×100) phosphorus abundance excess and evidence of 3He and 4He abundance stratification in the atmosphere.

  2. THE EXTRAORDINARY COMPLEX MAGNETIC FIELD OF THE HELIUM-STRONG STAR HD 37776

    International Nuclear Information System (INIS)

    Kochukhov, Oleg; Lundin, Andreas; Romanyuk, Iosif; Kudryavtsev, Dmitry

    2011-01-01

    The early-type chemically peculiar stars often show strong magnetic fields on their surfaces. These magnetic topologies are organized on large scales and are believed to be close to an oblique dipole for most of the stars. In a striking exception to this general trend, the helium-strong star HD 37776 shows an extraordinary double-wave rotational modulation of the longitudinal magnetic field measurements, indicating a topologically complex and, possibly, record-strong magnetic field. Here we present a new investigation of the magnetic field structure of HD 37776, using both simple geometrical interpretation of the longitudinal field curve and detailed modeling of the time-resolved circular polarization line profiles with the help of a magnetic Doppler imaging technique. We derive a model of the magnetic field structure of HD 37776, which reconciles for the first time all magnetic observations available for this star. We find that the local surface field strength does not exceed ∼30 kG, while the overall field topology of HD 37776 is dominated by a non-axisymmetric component and represents by far the most complex magnetic field configuration found among early-type stars.

  3. Haploinsufficiency of the ESCRT Component HD-PTP Predisposes to Cancer

    Directory of Open Access Journals (Sweden)

    Sanaz Manteghi

    2016-05-01

    Full Text Available Endosomal sorting complexes required for transport (ESCRT drive cell surface receptor degradation resulting in attenuation of oncogenic signaling and pointing to a tumor suppressor function. Here, we show that loss of function of an ESCRT protein (HD-PTP encoded by the PTPN23 gene, located on the tumor suppressor gene cluster 3p21.3 drives tumorigenesis in vivo. Indeed, Ptpn23+/− loss predisposes mice to sporadic lung adenoma, B cell lymphoma, and promotes Myc-driven lymphoma onset, dissemination, and aggressiveness. Ptpn23+/−-derived tumors exhibit an unaltered remaining allele and maintain 50% of HD-PTP expression. Consistent with the role of HD-PTP in attenuation of integrin recycling, cell migration, and invasion, hemizygous Ptpn23+/− loss increases integrin β1-dependent B cell lymphoma survival and dissemination. Finally, we reveal frequent PTPN23 deletion and downregulation in human tumors that correlates with poor survival. Altogether, we establish HD-PTP/PTPN23 as a prominent haploinsufficient tumor suppressor gene preventing tumor progression through control of integrin trafficking.

  4. Haploinsufficiency of the ESCRT Component HD-PTP Predisposes to Cancer.

    Science.gov (United States)

    Manteghi, Sanaz; Gingras, Marie-Claude; Kharitidi, Dmitri; Galarneau, Luc; Marques, Maud; Yan, Ming; Cencic, Regina; Robert, Francis; Paquet, Marilène; Witcher, Michael; Pelletier, Jerry; Pause, Arnim

    2016-05-31

    Endosomal sorting complexes required for transport (ESCRT) drive cell surface receptor degradation resulting in attenuation of oncogenic signaling and pointing to a tumor suppressor function. Here, we show that loss of function of an ESCRT protein (HD-PTP encoded by the PTPN23 gene, located on the tumor suppressor gene cluster 3p21.3) drives tumorigenesis in vivo. Indeed, Ptpn23(+/-) loss predisposes mice to sporadic lung adenoma, B cell lymphoma, and promotes Myc-driven lymphoma onset, dissemination, and aggressiveness. Ptpn23(+/-)-derived tumors exhibit an unaltered remaining allele and maintain 50% of HD-PTP expression. Consistent with the role of HD-PTP in attenuation of integrin recycling, cell migration, and invasion, hemizygous Ptpn23(+/-) loss increases integrin β1-dependent B cell lymphoma survival and dissemination. Finally, we reveal frequent PTPN23 deletion and downregulation in human tumors that correlates with poor survival. Altogether, we establish HD-PTP/PTPN23 as a prominent haploinsufficient tumor suppressor gene preventing tumor progression through control of integrin trafficking. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  5. PAH charge state distribution and DIB carriers : Implications from the line of sight toward HD 147889

    NARCIS (Netherlands)

    Ruiterkamp, R; Cox, NLJ; Spaans, M; Kaper, L; Foing, BH; Salama, F; Ehrenfreund, P

    We have computed physical parameters such as density, degree of ionization and temperature, constrained by a large observational data set on atomic and molecular species, for the line of sight toward the single cloud HD147889. Diffuse interstellar bands ( DIBs) produced along this line of sight are

  6. HD 101065, the Most Peculiar Star: First Results from Precise Radial ...

    Indian Academy of Sciences (India)

    The roAp stars are a unique group of pulsators that present us with advantages for asteroseismic studies ... Another important advantage in asteroseismology of roAp stars is the possibility of the spatial filtration of ... (2004) yield a longitudinal magnetic field strength of half the value, or Hz = −1014±. 72 Gauss. HD 101065 ...

  7. 76 FR 2277 - List of Approved Spent Fuel Storage Casks: NUHOMS® HD System Revision 1

    Science.gov (United States)

    2011-01-13

    ... revise the definitions for Damaged Fuel Assembly and Transfer Operations; add definitions for Fuel Class... the Atomic Energy Act of 1954, as amended; the Energy Reorganization Act of 1974, as amended; the.... Certificate Expiration Date: January 10, 2027. Model Number: NUHOMS HD-32PTH. * * * * * Dated at Rockville...

  8. The Stroop revisited: a meta-analysis of interference control in AD/HD

    NARCIS (Netherlands)

    van Mourik, R.; Oosterlaan, J.; Sergeant, J.A.

    2005-01-01

    Background: An inhibition deficit, including poor interference control, has been implicated as one of the core deficits in AD/HD. Interference control is clinically measured by the Stroop Colour-Word Task. The aim of this meta-analysis was to investigate the strength of an interference deficit in

  9. Asteroseismology of the Transiting Exoplanet Host HD 17156 with Hubble Space Telescope Fine Guidance Sensor

    DEFF Research Database (Denmark)

    Gilliland, Ronald L.; McCullough, Peter R.; Nelan, Edmund P.

    2011-01-01

    Observations conducted with the Fine Guidance Sensor on the Hubble Space Telescope (HST) providing high cadence and precision time-series photometry were obtained over 10 consecutive days in 2008 December on the host star of the transiting exoplanet HD 17156b. During this time, 1.0 × 1012 photons...

  10. HD 140283: A STAR IN THE SOLAR NEIGHBORHOOD THAT FORMED SHORTLY AFTER THE BIG BANG

    Energy Technology Data Exchange (ETDEWEB)

    Bond, Howard E.; Nelan, Edmund P. [Space Telescope Science Institute, 3700 San Martin Dr., Baltimore, MD 21218 (United States); VandenBerg, Don A. [Department of Physics and Astronomy, University of Victoria, P.O. Box 3055, Victoria, BC V8W 3P6 (Canada); Schaefer, Gail H. [The CHARA Array of Georgia State University, Mount Wilson Observatory, Mount Wilson, CA 91023 (United States); Harmer, Dianne, E-mail: bond@stsci.edu, E-mail: nelan@stsci.edu, E-mail: vandenbe@uvic.ca, E-mail: schaefer@chara-array.org, E-mail: diharmer@noao.edu [National Optical Astronomy Observatories, 950 North Cherry Avenue, Tucson, AZ 85726 (United States)

    2013-03-01

    HD 140283 is an extremely metal-deficient and high-velocity subgiant in the solar neighborhood, having a location in the Hertzsprung-Russell diagram where absolute magnitude is most sensitive to stellar age. Because it is bright, nearby, unreddened, and has a well-determined chemical composition, this star avoids most of the issues involved in age determinations for globular clusters. Using the Fine Guidance Sensors on the Hubble Space Telescope, we have measured a trigonometric parallax of 17.15 {+-} 0.14 mas for HD 140283, with an error one-fifth of that determined by the Hipparcos mission. Employing modern theoretical isochrones, which include effects of helium diffusion, revised nuclear reaction rates, and enhanced oxygen abundance, we use the precise distance to infer an age of 14.46 {+-} 0.31 Gyr. The quoted error includes only the uncertainty in the parallax, and is for adopted surface oxygen and iron abundances of [O/H] = -1.67 and [Fe/H] = -2.40. Uncertainties in the stellar parameters and chemical composition, especially the oxygen content, now contribute more to the error budget for the age of HD 140283 than does its distance, increasing the total uncertainty to about {+-}0.8 Gyr. Within the errors, the age of HD 140283 does not conflict with the age of the Universe, 13.77 {+-} 0.06 Gyr, based on the microwave background and Hubble constant, but it must have formed soon after the big bang.

  11. Unravelling the Nature of HD 81032 – A New RS CVn Binary J. C. ...

    Indian Academy of Sciences (India)

    3USRA & Code 662, NASA/Goddard Space Flight Center, Greenbelt, MD 20771, USA. e-mail: drake@olegacy.gsfc.nasa.gov. Received 2005 April 13; accepted 2005 November 28. Abstract. BVR photometric and quasi-simultaneous optical spectro- scopic observations of the star HD81032 have been carried out during.

  12. XUV-laser spectroscopy of HD at 92-98 nm.

    NARCIS (Netherlands)

    Hinnen, P.C.; Werners, S.E.; Stolte, S.; Hogervorst, W.; Ubachs, W.M.G.

    1995-01-01

    Sub-Doppler excitation spectra of HD have been recorded in the range 9298 nm with the use of a narrow-band and tunable extreme ultraviolet laser in combination with a molecular beam. Frequencies of 147 transitions to the B 1u+, C 1 u, and EF 1g+ states have been calibrated with an average absolute

  13. HD 12098 and Other Results from Nainital–Cape Survey V. Girish

    Indian Academy of Sciences (India)

    -site observation campaign organized to resolve the ambiguity in the determination of the rotation period of HD 12098. Other interesting results like non-oscillating Ap stars discovered and two candidate stars in which. roAp periodicity is seen ...

  14. Simulation and control of a HD diesel engine equipped with new EGR technology

    NARCIS (Netherlands)

    Dekker, H.J.; Sturm, W.L.

    1996-01-01

    A dynamic model of a Heavy Duty (HD) turbocharged and aftercooled diesel engine was developed. The engine was equipped with high pressure diesel injection, a Variable Geometry Turbine (VGT) and an Exhaust Gas Recirculation (EGR) system. This engine was targeted at meeting EURO4 emission

  15. HD 101065, the Most Peculiar Star: First Results from Precise Radial ...

    Indian Academy of Sciences (India)

    fact that elements on the surface of Ap (including roAp) stars are distributed inhomo- geneously. Spectroscopic radial velocity measurements of elements that have a spotted distribution on the surface .... 4. Discussion and conclusion. A remarkable feature of the oscillation spectrum of HD 101065 is the existence of two.

  16. Can ICT in Biology Courses Improve AD/HD Students' Achievement?

    Science.gov (United States)

    Vassilopoulou, Antonia; Mavrikaki, Evangelia

    2016-01-01

    Attention deficit hyperactivity disorder (AD/HD) is one of the most frequently occurring disorders in school children, and information and communication technology (ICT) in education is one of the tools that is lately considered as helpful for the education of some children with disorders. This research is a case study--using mixed-methods--of the…

  17. No hydrogen exosphere detected around the super-Earth HD 97658 b

    Science.gov (United States)

    Bourrier, V.; Ehrenreich, D.; King, G.; Lecavelier des Etangs, A.; Wheatley, P. J.; Vidal-Madjar, A.; Pepe, F.; Udry, S.

    2017-01-01

    The exoplanet HD 97658 b provides a rare opportunity to probe the atmospheric composition and evolution of moderately irradiated super-Earths. It transits a bright K star at a moderate orbital distance of 0.08 au. Its low density is compatible with a massive steam envelope that could photodissociate at high altitudes and become observable as escaping neutral hydrogen. Our analysis of three transits with HST/STIS at Lyman-α reveals no such signature, suggesting that the thermosphere of HD 97658 b is not hydrodynamically expanding and is subjected to a low escape of neutral hydrogen (<108 g s-1 at 3σ). Using HST/STIS Lyman-α observations and Chandra/ACIS-S and XMM-Newton/EPIC X-ray observations at different epochs, we find that HD 97658 is in fact a weak and soft X-ray source with signs of chromospheric variability in the Lyman-α line core. We determine an average reference for the intrinsic Lyman-α line and X-EUV (XUV) spectrum of the star, and show that HD 97658 b is in mild conditions of irradiation compared to other known evaporating exoplanets with an XUV irradiation about three times lower than the evaporating warm Neptune GJ436 b. This could be the reason why the thermosphere of HD 97658 b is not expanding: the low XUV irradiation prevents an efficient photodissociation of any putative steam envelope. Alternatively, it could be linked to a low hydrogen content or inefficient conversion of the stellar energy input. The HD 97658 system provides clues for understanding the stability of low-mass planet atmospheres in terms of composition, planetary density, and irradiation. Our study of HD 97658 b can be seen as a control experiment of our methodology, confirming that it does not bias detections of atmospheric escape and underlining its strength and reliability. Our results show that stellar activity can be efficiently discriminated from absorption signatures by a transiting exospheric cloud. They also highlight the potential of observing the upper atmosphere

  18. Evidence for a modifier of onset age in Huntington disease linked to the HD gene in 4p16

    Science.gov (United States)

    Djoussé, Luc; Knowlton, Beth; Hayden, Michael R.; Almqvist, Elisabeth W.; Brinkman, Ryan R.; Ross, Christopher A.; Margolis, Russel L.; Rosenblatt, Adam; Durr, Alexandra; Dode, Catherine; Morrison, Patrick J.; Novelletto, Andrea; Frontali, Marina; Trent, Ronald J. A.; McCusker, Elizabeth; Gómez-Tortosa, Estrella; Mayo Cabrero, David; Jones, Randi; Zanko, Andrea; Nance, Martha; Abramson, Ruth K.; Suchowersky, Oksana; Paulsen, Jane S.; Harrison, Madaline B.; Yang, Qiong; Cupples, L. Adrienne; Mysore, Jayalakshmi; Gusella, James F.; MacDonald, Marcy E.

    2007-01-01

    Huntington disease (HD) is a neurodegenerative disorder caused by the abnormal expansion of CAG repeats in the HD gene on chromosome 4p16.3. A recent genome scan for genetic modifiers of age at onset of motor symptoms (AO) in HD suggests that one modifier may reside in the region close to the HD gene itself. We used data from 535 HD participants of the New England Huntington cohort and the HD MAPS cohort to assess whether AO was influenced by any of the three markers in the 4p16 region: MSX1 (Drosophila homeo box homologue 1, formerly known as homeo box 7, HOX7), Δ2642 (within the HD coding sequence), and BJ56 (D4S127). Suggestive evidence for an association was seen between MSX1 alleles and AO, after adjustment for normal CAG repeat, expanded repeat, and their product term (model P value 0.079). Of the variance of AO that was not accounted for by HD and normal CAG repeats, 0.8% could be attributed to the MSX1 genotype. Individuals with MSX1 genotype 3/3 tended to have younger AO. No association was found between Δ2642 (P=0.44) and BJ56 (P=0.73) and AO. This study supports previous studies suggesting that there may be a significant genetic modifier for AO in HD in the 4p16 region. Furthermore, the modifier may be present on both HD and normal chromosomes bearing the 3 allele of the MSX1 marker. PMID:15029481

  19. Identification of Heading Date Six (Hd6 Gene Derived from Rice Mutant Varieties

    Directory of Open Access Journals (Sweden)

    Aryanti Aryanti

    2017-04-01

    Full Text Available Genes which were associated with flowering time to indicate the early maturity is known as heading date (Hd. Heading date six (Hd6 gene was identified from rice mutant varieties were Atomita 2, Atomita 3, Atomita 4, Bestari, Cilosari, Diah Suci, Sidenuk, Kahayan, Mayang, Meraoke, Mira-1, Pandan Putri, Superwin, Suluttan Unsrat 1, Suluttan Unsrat 2, Winongo, Woyla, Yuwono, while the rice var. Nipponbare was used as a positive control. All of rice mutant varieties derived from mutation induction by the dose of 0.2 kGy. The aim of this experiment was to find out the data base of mutant varieties which could be used as parent material with earlier maturity trait genetically. To obtain the DNA of plants, young leaves of each variety were extracted by liquid nitrogen, and then lysis and extracted by Kit Plant Genomic DNA. The amplification of DNA with 7 primers of Hd6 conducted of 40 cycles by PCR and were continues to separated by 1 % agarose. The results were shown that the rice Mira-1 and Bestari varieties obtained from mutation of Cisantana highly different from one to another on 7 primers of Hd6 used. Mayang variety from mutation of cross breeding between Cilosari and IR64, Pandan putri from Pandan wangi and Woyla from mutation of cross breeding from Atomita 2 and IR64 were highly different with those of their parents. Identification of Hd6 gene on Sidenuk variety was shown the same bands pattern with Nipponbare as control positive toward all primers used, this variety would be better for earlier maturity parent material compared to others. The information could be useful for breeding programs aiming to develop early maturing widely adaptive and high yielding rice cultivars.

  20. The Prototypical Young L/T-Transition Dwarf HD 203030B Likely Has Planetary Mass

    Science.gov (United States)

    Miles-Páez, Paulo A.; Metchev, Stanimir; Luhman, Kevin L.; Marengo, Massimo; Hulsebus, Alan

    2017-12-01

    Upon its discovery in 2006, the young L7.5 companion to the solar analog HD 203030 was found to be ≈ 200 K cooler than older late-L dwarfs, which is quite unusual. HD 203030B offered the first clear indication that the effective temperature at the L-to-T spectral type transition depends on surface gravity: now a well-known characteristic of low-gravity ultra-cool dwarfs. An initial age analysis of the G8V primary star indicated that the system was 130-400 Myr old, and so the companion would be between 12 and 31 {M}{Jup}. Using moderate-resolution near-infrared spectra of HD 203030B, we now find features of very low gravity comparable to those of 10-150 Myr old L7-L8 dwarfs. We also obtained more accurate near-infrared and Spitzer/IRAC photometry, and we find a {(J-K)}{MKO} color of 2.56 ± 0.13 mag—comparable to those observed in other young planetary-mass objects—and a luminosity of log({L}{bol}/{L}⊙ ) = -4.75 ± 0.04 dex. We further re-assess the evidence for the young age of the host star, HD 203030, with a more comprehensive analysis of the photometry and updated stellar activity measurements and age calibrations. Summarizing the age diagnostics for both components of the binary, we adopt an age of 100 Myr for HD 203030B and an age range of 30-150 Myr. Using cloudy evolutionary models, the new companion age range and luminosity result in a mass of 11 {M}{Jup} with a range of 8-15 {M}{Jup}, and an effective temperature of 1040 ± 50 K.

  1. Effect of heating on the stability of amyloid A (AA) fibrils and the intra- and cross-species transmission of AA amyloidosis.

    Science.gov (United States)

    Ogawa, Saki; Murakami, Tomoaki; Inoshima, Yasuo; Ishiguro, Naotaka

    2015-01-01

    Amyloid A (AA) amyloidosis is a protein misfolding disease characterized by extracellular deposition of AA fibrils. AA fibrils are found in several tissues from food animals with AA amyloidosis. For hygienic purposes, heating is widely used to inactivate microbes in food, but it is uncertain whether heating is sufficient to inactivate AA fibrils and prevent intra- or cross-species transmission. We examined the effect of heating (at 60 °C or 100 °C) and autoclaving (at 121 °C or 135 °C) on murine and bovine AA fibrils using Western blot analysis, transmission electron microscopy (TEM), and mouse model transmission experiments. TEM revealed that a mixture of AA fibrils and amorphous aggregates appeared after heating at 100 °C, whereas autoclaving at 135 °C produced large amorphous aggregates. AA fibrils retained antigen specificity in Western blot analysis when heated at 100 °C or autoclaved at 121 °C, but not when autoclaved at 135 °C. Transmissible pathogenicity of murine and bovine AA fibrils subjected to heating (at 60 °C or 100 °C) was significantly stimulated and resulted in amyloid deposition in mice. Autoclaving of murine AA fibrils at 121 °C or 135 °C significantly decreased amyloid deposition. Moreover, amyloid deposition in mice injected with murine AA fibrils was more severe than that in mice injected with bovine AA fibrils. Bovine AA fibrils autoclaved at 121 °C or 135 °C did not induce amyloid deposition in mice. These results suggest that AA fibrils are relatively heat stable and that similar to prions, autoclaving at 135 °C is required to destroy the pathogenicity of AA fibrils. These findings may contribute to the prevention of AA fibril transmission through food materials to different animals and especially to humans.

  2. Hot granules medium pressure forming process of AA7075 conical parts

    Science.gov (United States)

    Dong, Guojiang; Zhao, Changcai; Peng, Yaxin; Li, Ying

    2015-05-01

    High strength aluminum alloy plate has a low elongation at room temperature, which leads to the forming of its components need a high temperature. Liquid or gas is used as the pressure-transfer medium in the existing flexible mould forming process, the heat resistance of the medium and pressurizing device makes the application of aluminum alloy plate thermoforming restricted. To solve this problem, the existing medium is replaced by the heat-resisting solid granules and the general pressure equipments are applied. Based on the pressure-transfer performance test of the solid granules medium, the feasibility that the assumption of the extended Drucker-Prager linear model can be used in the finite element analysis is proved. The constitutive equation, the yield function and the theoretical forming limit diagram(FLD) of AA7075 sheet are established. Through the finite element numerical simulation of hot granules medium pressure forming(HGMF) process, not only the influence laws of the process parameters, such as forming temperature, the blank-holder gap and the diameter of the slab, on sheet metal forming performance are discussed, but also the broken area of the forming process is analyzed and predicted, which are coincided with the technological test. The conical part whose half cone angle is 15° and relative height H/d 0 is 0.57, is formed in one process at 250°C. The HGMF process solves the problems of loading and seal in the existing flexible mould forming process and provides a novel technology for thermoforming of light alloy plate, such as magnesium alloy, aluminium alloy and titanium alloy.

  3. Prevalence of HCV Infections Among Hemodialysis Patients in Al ...

    African Journals Online (AJOL)

    1527 patients (11%) who were HCV free at the start of the study. By the end of the study, a total of 42.2% were found to be anti-HCV reactive. Conclusion: The study demonstrated high prevalence of anti-HCV in HD units in Al Gharbiyah Governorate. Similar studies must be conducted in all Egyptian governorates' HD units ...

  4. Outcomes From AAS Hack Day at the 227th AAS Meeting

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This is a final post from the 227th AAS Meeting in Kissimmee, FL. This special summary of AAS Hack Day, a meeting of AAS members to collaboratively work on various small projects, was written by Meredith Rawls (@Merrdiff) and was originally posted on astrobites.com.As the 227thAmerican Astronomical Society meeting drew to a close (see highlights from Day 1, Day 2, Day 3, and Day 4), a group of at least 50 attendees spent Day 4working on small projects fondly called hacks. Thanks to sponsorship from LSST and Northrup Grumman, the industrious hackers werewell-caffeinated and fed so we could devote time and energy toworking in groups on one-day projects.TheHack Day beganat 10am with pitches. Anybody with a project idea was welcome to briefly speak and try to convince others to work with them. Only someideas panned out, but the enthusiasm was palpable. Its not every day you get a full room of astronomers and affiliates eager to spend hours working on fun and useful projects to benefit the community.#hackAAS is getting underway! #aas227 pic.twitter.com/yX7jlOnSCK James R A Davenport (@jradavenport) January 8, 2016Here is a rundown of what we accomplished. Pretty impressive for a single day! Many thanks to fellow astrobiter Erika Nesvold (now at Carnegie DTM; @erikanesvold) whose hack was live-documenting all the other hacks. Her tweets as @astrobites appeared with the #hackaas hashtag, and her notes made this recap post infinitely easier to write.Interested in joining the fun? Sign up for Hack Day at the 2017 JanuaryAAS meeting (its free with meeting registration), and consider applying for the .Astronomy conference this summer.Towards Optimal Session Scheduling:Adrian Price-Whelan (Columbia), David Hogg (NYU), and Scott Idem (AAS) began writing a program to take all submitted abstracts to a conference like AAS and sort them using keywords to avoid scheduling similar talks in parallel sessions. Its impossible to make everyone happy, but minimizing conflicts

  5. Interaction of Lysinibacillus sphaericus Cry48Aa/Cry49Aa toxin with midgut brush-border membrane fractions from Culex quinquefasciatus larvae.

    Science.gov (United States)

    Guo, Q-Y; Hu, X-M; Cai, Q-X; Yan, J-P; Yuan, Z-M

    2016-04-01

    The Cry48Aa/Cry49Aa mosquitocidal toxin from Lysinibacillus sphaericus was uniquely composed of a three-domain (Cry) toxin and binary (Bin) toxin-like protein, with high toxicity against Culex spp. However, its mode of action against the target mosquitoes is still unknown. In this study, Cry48Aa, Cry49Aa and its N- and C-terminal truncated proteins were expressed and purified, and the binding affinities of the purified proteins with midgut brush-border membrane fractions (BBMFs) from Culex quin-quefasciatus larvae were performed. The results showed that both Cry48Aa and Cry49Aa have specific and high binding affinity to BBMFs, with dissociation constants of 9.5 ± 1.8 and 25.4 ± 3.8 nM, respectively. Competition assays demonstrated that Cry49Aa C-terminal derivatives were able to bind to the BBMFs, whereas Far-Western dot blot analysis revealed that its N-terminal constructs interacted with Cry48Aa. Nevertheless, larvicidal activity was almost lost when Cry49Aa truncated proteins, either individually or in pairs, combined with Cry48Aa. It is concluded that Cry49Aa is responsible for receptor binding and interaction with Cry48Aa and plays an important role in the mechanism of action of these two-component toxins. © 2016 The Royal Entomological Society.

  6. AAS Nov 07 Cover.indd

    African Journals Online (AJOL)

    BACKGROUND: The onset of colorectal cancer appears to be two to three decades earlier in developing countries. Data on whether colorectal cancer in the young has worse prognosis than in older patients is conflicting. METHOD: Clinical charts of 70 patients ≤40 years old were reviewed to determine clinical.

  7. AAS Nov 07 Cover.indd

    African Journals Online (AJOL)

    Ten patients with mild disease received unnecessary prophylactic antibiotics including metronidazole, cefuroxime, and tazobactam/ piperacillin for a median period of 7 days. In severe disease where antibiotic use is possibly justifiable, a carbapenem based antibiotic was prescribed for four patients. Nasojejunal feeding.

  8. AAS Nov 07 Cover.indd

    African Journals Online (AJOL)

    given stage of presentation (1). A number of studies from the developing countries suggest the proportion of young patients may be up to six times that reported for. Western literature (3-5). This report describes the clinical and pathological features of colorectal. Young patients with colorectal cancer at a tertiary hospital in ...

  9. Nutritional assessment and its correlation with anthropometric measurements in hemodialysis patients

    Directory of Open Access Journals (Sweden)

    Behrooz Ebrahimzadeh Koor

    2015-01-01

    Full Text Available One of the most important problems in patients on hemodialysis (HD is chronic malnutrition. This study is aimed to assess the prevalence of malnutrition using a subjective global assessment (SGA in HD patients referred to the Valie ASR Hospital, Arak, Iran. In this descriptive analysis study, 190 HD patients were selected with random sampling. SGA and anthropometric and biochemical measurements were assessed in all patients. Data were analyzed with the Chi-square and t-tests and Pearson correlation coefficient. P 50% of patients on maintenance HD had mild or moderate malnutrition. There was no case of severe malnutrition. Duration of dialysis treatment and some anthropometric indices (weight, BMI and MAC also showed a significant correlation with SGA score, which are important to determine the nutritional status of HD patients.

  10. Daily intake and serum concentration of menaquinone-4 (MK-4) in haemodialysis patients with chronic kidney disease.

    Science.gov (United States)

    Wyskida, Katarzyna; Żak-Gołąb, Agnieszka; Łabuzek, Krzysztof; Suchy, Dariusz; Ficek, Rafał; Pośpiech, Kornel; Olszanecka-Glinianowicz, Magdalena; Okopień, Bogusław; Więcek, Andrzej; Chudek, Jerzy

    2015-12-01

    Decreased concentration of menaquinone-4 (MK-4) seems to be an important risk factor of vascular calcification in haemodialysis (HD) patients. Optimal dietary intake, as well as serum MK-4 reference range, in HD has not been determined, yet. The aim of the present study was to assess daily vitamin K1 and MK-4 intakes and their relation to serum MK-4 concentration in HD patients. Daily vitamin K1 and MK-4, micro- and macronutrients and energy intakes were assessed using 3-day food diary completed by patients and serum MK-4 concentration was measured by HPLC [limit of quantification (LOQ): 0.055 ng/mL] in 85 HD patients (51 males) and 22 apparently healthy subjects. Daily MK-4 intake was significantly lower (by 29%) among HD, while K1 consumption was similar in both groups. Daily MK-4 intake was associated with fat and protein consumption in HD (r=0.43, pintakes were weaker in HD (r=0.38 and r=0.30 respectively) than in the control group (r=0.47 and r=0.45, respectively). In multiple regression analysis the variability of serum MK-4 concentrations in HD patients was explained by its daily intake. Decreased serum MK-4 concentration in HD patients is caused by lower dietary MK-4 intake, mainly due to diminished meat consumption, and in addition, probably reduced K1 conversion. Copyright © 2015 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  11. Fatal dialysis disequilibrium syndrome: A tale of two patients

    Directory of Open Access Journals (Sweden)

    Shaikh Nissar

    2010-01-01

    Full Text Available Dialysis disequilibrium syndrome (DDS is a central nervous system disorder, which occurs during hemodialysis (HD or within 24 h following the first HD. DDS commonly occurs in patients suffering from end-stage renal failure undergoing HD for the first time. In a critically ill patient suffering from severe sepsis or septic shock, the combined effects of post-HD brain edema and changes in the brain due to septic encephalopathy, may become amplified leading to DDS. Here we report 2 cases with acute renal failure (ARF, undergoing HD for more than a week and being ventilated and who developed DDS. DDS might have contributed to the sudden deterioration and death in these septic patients. The first case was a 31-year-old male, involved in a motor vehicle accident and had a severe abdominal injury. Underwent laparotomy and hemostasis was achieved. On day 4, the patient developed hemorrhagic shock associated with ARF, which prompted daily HD. On day 8, he went into septic shock. On day 16, 1 h after his daily HD, he became unresponsive and his pupils became dilated and fixed and he expired 2 days later. The second case was a young male who suffered severe abdominal and chest injury after a fall from a height. He developed ARF on day 3 and required HD. On day 9, he had septic shock. Three days later, during his daily HD, he became unconscious and his pupils were not reacting to light and the patient died on day 12. Conclusion: In patients with severe sepsis/septic shock, DDS may occur even after repeated sessions of HD. The acute care physicians, intensivists, and nephrologists should be aware of the risks of DDS.

  12. Understanding evaporation characteristics of a drop of distilled sulfur mustard (HD) chemical agent from stainless steel and aluminum substrates

    Energy Technology Data Exchange (ETDEWEB)

    Jung, H., E-mail: junghs@add.re.kr; Lee, H.W.

    2014-05-01

    Highlights: • Evaporation rates of HD are obtained from stainless steel and aluminum substrates. • The rates increase with temperature and are linearly proportional to drop size. • HD evaporation from stainless steel follows only constant contact area mechanism. • HD evaporation from aluminum proceeds by a combined mechanism. - Abstract: We report herein the evaporation rates and mechanism of a drop of distilled sulfur mustard (HD) agent from stainless steel and aluminum substrates. For systematic analysis, we used a laboratory-sized wind tunnel, thermal desorption (TD) connected to gas chromatograph/mass spectrometry (GC/MS) and drop shape analysis (DSA). We found that the evaporation rates of HD from stainless steel and aluminum increased with temperature. The rates were also linearly proportional to drop size. The time-dependent contact angle measurement showed that the evaporation of the drop of HD proceeded only by constant contact area mechanism from stainless steel surface. On the other hand, the evaporation of HD from aluminum proceeded by a combined mechanism of constant contact area mode and constant contact angle mode. Our experimental data sets and analysis could be used to predict vapor and contact hazard persistence of chemical warfare agents (CWAs) in the air and on exterior surfaces with chemical releases, which assists the military decision influencing personnel safety and decontamination of the site upon a chemical attack event.

  13. Understanding evaporation characteristics of a drop of distilled sulfur mustard (HD) chemical agent from stainless steel and aluminum substrates

    International Nuclear Information System (INIS)

    Jung, H.; Lee, H.W.

    2014-01-01

    Highlights: • Evaporation rates of HD are obtained from stainless steel and aluminum substrates. • The rates increase with temperature and are linearly proportional to drop size. • HD evaporation from stainless steel follows only constant contact area mechanism. • HD evaporation from aluminum proceeds by a combined mechanism. - Abstract: We report herein the evaporation rates and mechanism of a drop of distilled sulfur mustard (HD) agent from stainless steel and aluminum substrates. For systematic analysis, we used a laboratory-sized wind tunnel, thermal desorption (TD) connected to gas chromatograph/mass spectrometry (GC/MS) and drop shape analysis (DSA). We found that the evaporation rates of HD from stainless steel and aluminum increased with temperature. The rates were also linearly proportional to drop size. The time-dependent contact angle measurement showed that the evaporation of the drop of HD proceeded only by constant contact area mechanism from stainless steel surface. On the other hand, the evaporation of HD from aluminum proceeded by a combined mechanism of constant contact area mode and constant contact angle mode. Our experimental data sets and analysis could be used to predict vapor and contact hazard persistence of chemical warfare agents (CWAs) in the air and on exterior surfaces with chemical releases, which assists the military decision influencing personnel safety and decontamination of the site upon a chemical attack event

  14. Comparison of outcome and quality of life: haemodialysis versus peritoneal dialysis patients.

    Science.gov (United States)

    Noshad, H; Sadreddini, S; Nezami, N; Salekzamani, Y; Ardalan, M R

    2009-02-01

    Ever since peritoneal dialysis (PD) was introduced as a form of renal replacement therapy, its efficacy and complications have been compared with that of haemodialysis (HD). The aim of this study was to determine the efficacy and outcome of PD in comparison to HD in our region. We compared 60 patients on PD with 60 matched patients on HD in Tabriz's Sina Hospital during the period 2004-2006. The technique, patients' survival and quality of life were compared by means of a health-related quality-of-life questionnaire (GHQ-28). There was no significant difference in the mean age and duration of dialysis between patients on PD and HD. Survival of diabetic patients was better with HD than PD, but in non-diabetic patients, there was no difference in the survival rates between the two groups. Among patients on PD, diabetics had a 25 percent higher mortality rate and non-diabetic patients had a three percent higher mortality rate than their corresponding counterparts on HD. In all four axes of the questionnaire, i.e. psychophysical dysfunction, stress and sleep disorders, social dysfunction and major depression, PD patients had lower scores than HD patients (p-values are less than 0.001, less than 0.001, equal to 0.002 and less than 0.001, respectively), indicating that patients on PD had a better quality of life compared to those on HD. In this study, technique, patients' survival and their quality of life were better on PD than on HD. However, survival and mortality of diabetic patients on HD were better than those on PD.

  15. Chewing gum and a saliva substitute alleviate thirst and xerostomia in patients on haemodialysis

    NARCIS (Netherlands)

    Bots, Casper P.; Brand, Henk S.; Veerman, Enno C. I.; Korevaar, Johanna C.; Valentijn-Benz, Marianne; Bezemer, Pieter D.; Valentijn, Robert M.; Vos, Pieter F.; Bijlsma, Joost A.; ter Wee, Piet M.; van Amerongen, Barbara M.; Nieuw Amerongen, Arie V.

    2005-01-01

    Most patients on haemodialysis (HD) have to maintain a fluid-restricted diet to prevent a high interdialytic weight gain (IWG). The prevalence of xerostomia (the feeling of a dry mouth) is higher in HD patients than in controls. Recently, we demonstrated that xerostomia and thirst were positively

  16. Hypocretin and melanin-concentrating hormone in patients with Huntington disease.

    NARCIS (Netherlands)

    Aziz, A.; Fronczek, R.; Maat-Schieman, M.L.; Unmehopa, U.A.; Roelandse, F.W.; Overeem, S.; Duinen, S.G. van; Lammers, G.J.; Swaab, D.F.; Roos, R.A.C.

    2008-01-01

    To evaluate whether hypocretin-1 (orexin-A) and melanin-concentrating hormone (MCH) neurotransmission are affected in patients with Huntington disease (HD), we immunohistochemically stained hypocretin and MCH neurons and estimated their total numbers in the lateral hypothalamus of both HD patients

  17. Study of Pulsations in the Atmosphere of the roAp star HD 137949

    Science.gov (United States)

    Sachkov, M.; Hareter, M.; Ryabchikova, T.; Wade, G.; Kochukhov, O.; Weiss, W. W.

    The roAp star HD 137949 (33 Lib) shows the most complex pulsational behaviour among all roAp stars. Mkrtichian et al. (2003) found nearly anti-phase pulsations of Nd II and Nd III lines, which they attribute to the presence of a pulsation node high in the atmosphere of HD 137949. This was confirmed by Kurtz at al. (2005), who also find that in some REE lines the main frequency, corresponding to 8.27 min, and its harmonic have almost equal RV amplitudes. Based on high accuracy observations Ryabchikova et al. (2007a) studied pulsational characteristics of the HD 137949 atmosphere in detail. In general, spectroscopy provides 3D resolution of modes and allows to search for the photometrically undetectable frequencies. The high-accuracy space photometry provides very high-precision measurements of detected pulsation frequencies and enables an accurate phasing of multi-site spectroscopic data. A combination of simultaneous spectroscopy and photometry represents the most sophisticated asteroseismic dataset for any roAp star. In 2009 the star HD 137949 became a target of an intense observing campaign that combined ground-based spectroscopy with space photometry, obtained with the MOST satellite. We collected 780 spectra using the ESPaDOnS spectrograph mounted on the 3.6 m CFHT telescope; 374 spectra were obtained with the FIES spectrograph mounted on the 2.56-m NOT to perform the time-resolved spectroscopy of HD 137949. In addition, we used 111 UVES spectra (2004) from the ESO archive to check the mode stability. The frequency analysis of the new radial velocity (RV) measurements confirmed the previously reported frequency pattern (two frequencies and the first harmonic of the main frequency), and revealed an additional frequency at 1.991 mHz. The new frequency solution fits perfectly the RV variations from the 2004 and 2009 observational sets providing a strong support for the p-mode stability in the roAp star HD 137949 for at least 5 years.

  18. HD gas purification for polarized HDice targets production at Jefferson Lab

    Energy Technology Data Exchange (ETDEWEB)

    Whisnant, Charles; D' Angelo, Annalisa; Colaneri, Luca; Devilbiss, J; Kageya, Tsuneo; Loving, D A; Lowry, Michael; Rizzo, Alessandro; Sandorfi, Andrew; Schaerf, Carlo; Storey, J D; Wallace, C M; Wei, Xiangdong; Zonta, Irene

    2014-06-01

    Solid, frozen-spin targets of molecular HD were rst developed for nuclear physics by a collaboration between Syracuse University and Brookhaven National Lab. They have been successfully used in measurements with photon beams, rst at the Laser-Electron-Gamma-Source [1] and most recently at Je erson Lab during the running of the E06-101 (g14) experiment [2]. Preparations are underway to utilize the targets in future electron experiments after the completion of the 12 GeV JLab upgrade [3]. HD is an attractive target since all of the material is polarizable, of low Z, and requires only modest holding elds. At the same time, the small contributions from the target cell can be subtracted from direct measurements. Reaching the frozen-spin state with both high polarization and a signi cant spin relaxation time requires careful control of H2 and D2 impurities. Commercially available HD contains 0.5 - 2% concentrations of H2 and D2. Low-temperature distillation is required to reduce these concentrations to the 104 level to enable useful target production. This distillation is done using a column lled with heli-pack C [4] to give good separation e ciency. Approximately 12 moles of commercial HD is condensed into the mechanically refrigerated system at the base temperature of 11K. The system is then isolated and the temperature stabilized at 18K producing liquid HD, which is boiled by a resistive heater. The circulation established by the boil-o condensing throughout the column then ltering back down produces a steady-state isotopic separation permitting the extraction of HD gas with very low H2 and D2 content. A residual gas analyzer initially monitors distillation. Once the H2 concentration falls below its useful operating range, samples are periodically collected for analysis using gas chromatography [5] and Raman scattering. Where the measurement techniques overlap, good agreement is obtained. The operation of the distillery and results of gas analysis will be discussed

  19. Care of patients with Huntington's disease in South America: a survey

    OpenAIRE

    Maciel, Ricardo Oliveira Horta; Cardoso, Francisco Eduardo Costa; Chana-Cuevas, Pedro; Cosentino, Carlos; Fernandez, William; Rieder, Carlos R. M.; Serrano-Duenas, Marcos; Weiser, Roberto

    2013-01-01

    Huntington's disease (HD) is a rare neurodegenerative disease with a multitude of symptoms, which requires access to specialized multidisciplinary care for adequate management. The aim of this study was to survey the characteristics of care in various HD centers in South America (SA). Methods A questionnaire was sent to 24 centers involved in the care for HD patients in SA. Results Of the total 24 centers, 19 (79.2%) are academic units. The majority of centers (62.5%) are general movement ...

  20. The Influence of Renal Centre and Patient Sociodemographic Factors on Home Haemodialysis Prevalence in the UK.

    Science.gov (United States)

    Jayanti, Anuradha; Foden, Philip; Rae, Alasdair; Morris, Julie; Brenchley, Paul; Mitra, Sandip

    2017-01-01

    In the United Kingdom, socioeconomic disadvantage has been associated with lower use of home dialysis, mostly peritoneal dialysis. In this study, we explore the role of a patient's sociodemographic, socioeconomic differences and the centre's influence on home haemodialysis (HD) prevalence. Data is derived from the cross-sectional arm of the UK multi-centre study investigating barriers and enablers of home HD (BASIC-HHD study). Centres were classified as low- (8%). Sociodemographic and socioeconomic status data were ascertained. Patients were enrolled in hospital HD (n = 213), home HD (n = 93) and predialysis groups (n = 222). The treating renal centre to which the patient belonged was significantly associated with a patient's modality in prevalent HD groups and modality-choice in the "predialysis" group, in confounder-adjusted multivariable analyses. Non-white ethnicity was associated with lower odds of self-care dialysis modality choice (OR 0.21, 95% CI 0.07-0.62) and lower odds of home HD uptake in the prevalent HD group (OR 0.24, 95% CI 0.07-0.80). Other significant associations of home HD uptake in the HD cohort included lower age (OR 0.59, 95% CI 0.39-0.89), higher education (OR 2.99, 95% CI 1.25-7.16), home ownership (OR 0.26, 95% CI 0.09-0.70), childcare responsibility (OR 0.22, 95% CI 0.08-0.66) and unrestricted mobility (OR 0.31, 95% CI 0.11-0.91). "Centre" effect accounts for variation in home HD prevalence between renal units after accounting for sociodemographic parameters and co-morbidities. Unit practices and attitudes to home HD are likely to have a dominating impact on home HD prevalence rates and these aspects need to be explored systematically at the organisational level. © 2017 S. Karger AG, Basel.

  1. Fecal transmission of AA amyloidosis in the cheetah contributes to high incidence of disease

    Science.gov (United States)

    Zhang, Beiru; Une, Yumi; Fu, Xiaoying; Yan, Jingmin; Ge, FengXia; Yao, Junjie; Sawashita, Jinko; Mori, Masayuki; Tomozawa, Hiroshi; Kametani, Fuyuki; Higuchi, Keiichi

    2008-01-01

    AA amyloidosis is one of the principal causes of morbidity and mortality in captive cheetahs (Acinonyx jubatus), which are in danger of extinction, but little is known about the underlying mechanisms. Given the transmissible characteristics of AA amyloidosis, transmission between captive cheetahs may be a possible mechanism involved in the high incidence of AA amyloidosis. In this study of animals with AA amyloidosis, we found that cheetah feces contained AA amyloid fibrils that were different from those of the liver with regard to molecular weight and shape and had greater transmissibility. The infectious activity of fecal AA amyloid fibrils was reduced or abolished by the protein denaturants 6 M guanidine·HCl and formic acid or by AA immunodepletion. Thus, we propose that feces are a vehicle of transmission that may accelerate AA amyloidosis in captive cheetah populations. These results provide a pathogenesis for AA amyloidosis and suggest possible measures for rescuing cheetahs from extinction. PMID:18474855

  2. Yield and flow properties of aluminum alloy AA 8001

    International Nuclear Information System (INIS)

    Lyons, J.S.; Johnson, H.W.; Han, E.G.

    1995-01-01

    Aluminum alloy AA 8001 is being used at the Westinghouse Savannah River Company (WSRC) for nuclear reactor fuel and target components. The objective of this research was to determine parameters for predictive models of the compressive flow properties of AA 8001. Seventy-five true strain-rate, hot compression tests were performed. New, quantitative information about the yield and flow behavior of aluminum alloy AA 8001 was determined. Parameters were determined to use in a hyperbolic sine constitutive law so that the yield stress, the peak stress, and the peak strain can be predicted from the temperature-compensated strain-rate, Z. It was found that the onset of strain softening was more strongly dependent on Z than the onset of yielding was

  3. Resolving the HD 100546 Protoplanetary System with the Gemini Planet Imager: Evidence for Multiple Forming, Accreting Planets

    OpenAIRE

    Currie, Thayne; Cloutier, Ryan; Brittain, Sean; Grady, Carol; Burrows, Adam; Muto, Takayuki; Kenyon, Scott J.; Kuchner, Marc J.

    2015-01-01

    We report Gemini Planet Imager H band high-contrast imaging/integral field spectroscopy and polarimetry of the HD 100546, a 10 $Myr$-old early-type star recently confirmed to host a thermal infrared bright (super)jovian protoplanet at wide separation, HD 100546 b. We resolve the inner disk cavity in polarized light, recover the thermal-infrared (IR) bright arm, and identify one additional spiral arm. We easily recover HD 100546 b and show that much of its emission originates an unresolved, po...

  4. Fatigue behaviour of GMAW welded aluminium alloy AA7020

    OpenAIRE

    Bloem, Carlos; Salvador Moya, Mª Dolores; Amigó, Vicente; Vicente-Escuder, Ángel

    2009-01-01

    [EN] The aim of this investigation is to evaluate the influence on fatigue behaviour of the finishing of the bulge in a welded aluminium zinc magnesium alloy AA7020. It was determined that total or partial elimination of the bulge has very little influence on its behaviour, giving a very similar result on both cases, where one is better than the other by only 3%. Bloem, C.; Salvador Moya, MD.; Amigó, V.; Vicente-Escuder, Á. (2009). Fatigue behaviour of GMAW welded aluminium alloy AA7020. W...

  5. Factors affecting cerebral oxygenation in hemodialysis patients: cerebral oxygenation associates with pH, hemodialysis duration, serum albumin concentration, and diabetes mellitus.

    Directory of Open Access Journals (Sweden)

    Kiyonori Ito

    Full Text Available Patients undergoing hemodialysis (HD often develop cerebral disease complications. Furthermore, cerebral regional saturation of oxygen (rSO2 was previously reported to be significantly lower in HD patients than in healthy subjects. We aimed to identify the factors affecting the cerebral rSO2 in HD patients.Fifty-four HD patients (38 men and 16 women; mean age, 67.7 ± 1.2 years, HD duration, 6.5 ± 1.9 years were recruited. Cerebral rSO2 was monitored at the forehead before HD using an INVOS 5100C (Covidien Japan, Tokyo, Japan.The rSO2 levels were significantly lower in HD patients compared with healthy controls (49.5 ± 1.7% vs. 68.9 ± 1.6%, p <0.001. Multiple regression analysis showed that cerebral rSO2 independently associated with pH (standardized coefficient: -0.35, HD duration (standardized coefficient: -0.33, and serum albumin concentration (standardized coefficient: 0.28. Furthermore, the rSO2 was significantly lower in HD patients with diabetes mellitus (DM, compared with patients without DM (46.8 ± 1.7% vs. 52.1 ± 1.8%, p <0.05.In HD patients, cerebral rSO2 was affected by multiple factors, including pH, HD duration, and serum albumin concentration. Furthermore, this is the first report describing significantly lower levels of rSO2 in HD patients with DM than in those without DM.

  6. Some measurements of H/D polarizability isotope effects using differential refractometry

    International Nuclear Information System (INIS)

    Foster Smith, M.; Van Hook, W.A.

    1989-01-01

    Refractive index differences between the H and D isomers of some common molecules in the liquid phase were measured between 404.7 and 690.0 nm. The data are combined with information on molar volume isotope effects to yield values for H/D isotope effects on the static polarizability, the vibrational contribution to the static and frequency dependent parts of the polarizability, and the H/D isotope effect on the second moment of the electronic charge distribution. The present results suffice to demonstrate the practicability of this technique to measure the components of the polarizability listed above. However for accurate resolution of the vibrational and second moment contributions, refractive index data of still greater precision will be required. (orig.)

  7. NON-DETECTION OF PREVIOUSLY REPORTED TRANSITS OF HD 97658b WITH MOST PHOTOMETRY

    Energy Technology Data Exchange (ETDEWEB)

    Dragomir, Diana; Matthews, Jaymie M.; Antoci, Victoria [Department of Physics and Astronomy, University of British Columbia, Vancouver, BC V6T1Z1 (Canada); Howard, Andrew W.; Marcy, Geoffrey W. [Department of Astronomy, University of California, Berkeley, CA 94720-3411 (United States); Henry, Gregory W. [Center of Excellence in Information Systems, Tennessee State University, 3500 John A. Merritt Blvd., Box 9501, Nashville, TN 37209 (United States); Guenther, David B. [Department of Astronomy and Physics, St. Marys University Halifax, NS B3H 3C3 (Canada); Johnson, John A. [Department of Astronomy, California Institute of Technology, 1200 East California Boulevard, MC 249-17, Pasadena, CA 91125 (United States); Kuschnig, Rainer; Weiss, Werner W. [Universitaet Wien, Institut fuer Astronomie, Tuerkenschanzstrasse 17, A1180 Wien (Austria); Moffat, Anthony F. J. [Dept de physique, Univ de Montreal C.P. 6128, Succ. Centre-Ville, Montreal, QC H3C 3J7, and Obs. du mont Megantic (Canada); Rowe, Jason F. [NASA Ames Research Center, Moffett Field, CA 94035 (United States); Rucinski, Slavek M. [Department of Astronomy and Astrophysics, University of Toronto, 50 St. George Street, Toronto, ON M5S 3H4 (Canada); Sasselov, Dimitar, E-mail: diana@phas.ubc.ca [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)

    2012-11-10

    The radial velocity-discovered exoplanet HD 97658b was recently announced to transit, with a derived planetary radius of 2.93 {+-} 0.28 R{sub Circled-Plus }. As a transiting super-Earth orbiting a bright star, this planet would make an attractive candidate for additional observations, including studies of its atmospheric properties. We present and analyze follow-up photometric observations of the HD 97658 system acquired with the Microvariability and Oscillations of STars space telescope. Our results show no transit with the depth and ephemeris reported in the announcement paper. For the same ephemeris, we rule out transits for a planet with radius larger than 2.09 R{sub Circled-Plus }, corresponding to the reported 3{sigma} lower limit. We also report new radial velocity measurements which continue to support the existence of an exoplanet with a period of 9.5 days, and obtain improved orbital parameters.

  8. VizieR Online Data Catalog: Radial velocities of HD 6434 (Hinkel+, 2015)

    Science.gov (United States)

    Hinkel, N. R.; Kane, S. R.; Pilyavsky, G.; Boyajian, T. S.; James, D. J.; Naef, D.; Fischer, D. A.; Udry, S.

    2016-04-01

    Previous radial velocity observations of HD6434 (Mayor et al. 2004, cat. J/A+A/415/391) were undertaken with the CORALIE spectrometer mounted on the 1.2m Euler Swiss telescope at La Silla. Those observations were conducted as part of the CORALIE exoplanet search program (Udry et al. 2000, cat. J/A+A/356/590). We continued to monitor HD6434 using CORALIE to improve the Keplerian orbital solution and provide an accurate transit ephemeris. The complete data set of 137 measurements is shown in Table2 including previously acquired measurements and 59 new measurements. These new measurements extend the overall time baseline for the radial velocity observations by a factor of ~3.6, for a total baseline of ~15 years. (1 data file).

  9. Spectral analysis of the He-enriched sdO-star HD 127493

    Science.gov (United States)

    Dorsch, Matti; Latour, Marilyn; Heber, Ulrich

    2018-02-01

    The bright sdO star HD127493 is known to be of mixed H/He composition and excellent archival spectra covering both optical and ultraviolet ranges are available. UV spectra play a key role as they give access to many chemical species that do not show spectral lines in the optical, such as iron and nickel. This encouraged the quantitative spectral analysis of this prototypical mixed H/He composition sdO star. We determined atmospheric parameters for HD127493 in addition to the abundance of C, N, O, Si, S, Fe, and Ni in the atmosphere using non-LTE model atmospheres calculated with TLUSTY/SYNSPEC. A comparison between the parallax distance measured by Hipparcos and the derived spectroscopic distance indicate that the derived atmospheric parameters are realistic. From our metal abundance analysis, we find a strong CNO signature and enrichment in iron and nickel.

  10. Secondary electron emission from solid HD and a solid H2-D2 mixture

    DEFF Research Database (Denmark)

    Sørensen, H.; Børgesen, P.; Hao-Ming, Chen

    1983-01-01

    Secondary electron emission from solid HD and a solid 0.6 H2 + 0.4 D2 mixture has been studied for electron and hydrogen ion bombardment at primary energies from 0.5 to 3 keV and 2 to 10 keV/amu, respectively. The yield for solid HD is well explained by a simple stoichiometric model of the low......-energy stopping power for the internal secondaries. The secondary electron yield from the mixture is somewhat larger than the expected value, but lies between the values for pure solid H2 and D2. The secondary electron emission coefficient for solid tritium may be determined from a linear extrapolation...... of the present data....

  11. VizieR Online Data Catalog: HARPS timeseries data for HD41248 (Jenkins+, 2014)

    Science.gov (United States)

    Jenkins, J. S.; Tuomi, M.

    2017-05-01

    We modeled the HARPS radial velocities of HD 42148 by adopting the analysis techniques and the statistical model applied in Tuomi et al. (2014, arXiv:1405.2016). This model contains Keplerian signals, a linear trend, a moving average component with exponential smoothing, and linear correlations with activity indices, namely, BIS, FWHM, and chromospheric activity S index. We applied our statistical model outlined above to the full data set of radial velocities for HD 41248, combining the previously published data in Jenkins et al. (2013ApJ...771...41J) with the newly published data in Santos et al. (2014, J/A+A/566/A35), giving rise to a total time series of 223 HARPS (Mayor et al. 2003Msngr.114...20M) velocities. (1 data file).

  12. Significant association between renal function and area of amyloid deposition in kidney biopsy specimens in both AA amyloidosis associated with rheumatoid arthritis and AL amyloidosis.

    Science.gov (United States)

    Kuroda, Takeshi; Tanabe, Naohito; Hasegawa, Eriko; Wakamatsu, Ayako; Nozawa, Yukiko; Sato, Hiroe; Nakatsue, Takeshi; Wada, Yoko; Ito, Yumi; Imai, Naofumi; Ueno, Mitsuhiro; Nakano, Masaaki; Narita, Ichiei

    2017-06-01

    The kidney is a major target organ for systemic amyloidosis, which results in proteinuria and an elevated serum creatinine level. The clinical manifestations and precursor proteins of amyloid A (AA) and light-chain (AL) amyloidosis are different, and the renal damage due to amyloid deposition also seems to differ. The purpose of this study was to clarify haw the difference in clinical features between AA and AL amyloidosis are explained by the difference in the amount and distribution of amyloid deposition in the renal tissues. A total of 119 patients participated: 58 patients with an established diagnosis of AA amyloidosis (AA group) and 61 with AL amyloidosis (AL group). We retrospectively investigated the correlation between clinical data, pathological manifestations, and the area occupied by amyloid in renal biopsy specimens. In most of the renal specimens the percentage area occupied by amyloid was less than 10%. For statistical analyses, the percentage area of amyloid deposition was transformed to a common logarithmic value (Log 10 %amyloid). The results of sex-, age-, and Log 10 %amyloid-adjusted analyses showed that systolic blood pressure (SBP) was higher in the AA group. In terms of renal function parameters, serum creatinine, creatinine clearance (Ccr) and estimated glomerular filtration rate (eGFR) indicated significant renal impairment in the AA group, whereas urinary protein indicated significant renal impairment in the AL group. Pathological examinations revealed amyloid was predominantly deposited at glomerular basement membrane (GBM) and easily transferred to the mesangial area in the AA group, and it was predominantly deposited at in the AL group. The degree of amyloid deposition in the glomerular capillary was significantly more severe in AL group. The frequency of amyloid deposits in extraglomerular mesangium was not significantly different between the two groups, but in AA group, the degree amyloid deposition was significantly more severe, and

  13. Experimental transmission of AA amyloidosis by injecting the AA amyloid protein into interleukin-1 receptor antagonist knockout (IL-1raKO) mice.

    Science.gov (United States)

    Watanabe, K; Uchida, K; Chambers, J K; Tei, M; Shoji, A; Ushio, N; Nakayama, H

    2015-05-01

    The incidence of AA amyloidosis is high in humans with rheumatoid arthritis and several animal species, including cats and cattle with prolonged inflammation. AA amyloidosis can be experimentally induced in mice using severe inflammatory stimuli and a coinjection of AA amyloid; however, difficulties have been associated with transmitting AA amyloidosis to a different animal species, and this has been attributed to the "species barrier." The interleukin-1 receptor antagonist knockout (IL-1raKO) mouse, a rodent model of human rheumatoid arthritis, has been used in the transmission of AA amyloid. When IL-1raKO and BALB/c mice were intraperitoneally injected with mouse AA amyloid together with a subcutaneous pretreatment of 2% AgNO3, all mice from both strains that were injected with crude or purified murine AA amyloid developed AA amyloidosis. However, the amyloid index, which was determined by the intensity of AA amyloid deposition, was significantly higher in IL-1raKO mice than in BALB/c mice. When IL-1raKO and BALB/c mice were injected with crude or purified bovine AA amyloid together with the pretreatment, 83% (5/6 cases) and 38% (3/8 cases) of IL-1raKO mice and 17% (1/6 cases) and 0% (0/6 cases) of BALB/c mice, respectively, developed AA amyloidosis. Similarly, when IL-1raKO and BALB/c mice were injected with crude or purified feline AA amyloid, 33% (2/6 cases) and 88% (7/8 cases) of IL-1raKO mice and 0% (0/6 cases) and 29% (2/6 cases) of BALB/c mice, respectively, developed AA amyloidosis. These results indicated that IL-1raKO mice are a useful animal model for investigating AA amyloidogenesis. © The Author(s) 2014.

  14. Intensive Nutritional Counselling And Support And Clinical Outcomes In Hemodialysis Patients

    Directory of Open Access Journals (Sweden)

    Alessio Molfino

    2012-06-01

    In conclusion, in HD patients, nutritional counselling and nutritional support positively affect nutritional status in hypophagic patients and make the risk of morbidity and mortality in anorexic patients comparable to non-anorexic.

  15. NIST-Traceable NMR Method to Determine Quantitative Weight Percentage Purity of Mustard (HD) Feedstock Samples

    Science.gov (United States)

    2018-01-01

    analysis of this sample can be done periodically as part of the instrument QC validation. Detailed QC specifications are not included in this method ... method is measured in milligrams, and the Z level is arbitrarily based on detection limits of the current instrument . The data from a P&A test is...ECBC-TR-1506 NIST-TRACEABLE NMR METHOD TO DETERMINE QUANTITATIVE WEIGHT PERCENTAGE PURITY OF MUSTARD (HD) FEEDSTOCK SAMPLES David J

  16. HD 187885 and s-process elements in high galactic latitude supergiants

    NARCIS (Netherlands)

    VanWinckel, H; Waelkens, C; Waters, LBFM

    We present an accurate LTE chemical analysis of HD 187885 on the basis of high-resolution, high signal-to-noise spectra. The low iron abundance of [Fe/H] = -0.5 confirms the old, low-mass nature of the supergiant. With [C/Fe] = +0.9, [N/Fe] = +0.7, [O/Fe] = +0.6 and above all the high s-process

  17. Locus-specific microemulsion catalysts for sulfur mustard (HD) chemical warfare agent decontamination.

    Science.gov (United States)

    Fallis, Ian A; Griffiths, Peter C; Cosgrove, Terence; Dreiss, Cecile A; Govan, Norman; Heenan, Richard K; Holden, Ian; Jenkins, Robert L; Mitchell, Stephen J; Notman, Stuart; Platts, Jamie A; Riches, James; Tatchell, Thomas

    2009-07-22

    The rates of catalytic oxidative decontamination of the chemical warfare agent (CWA) sulfur mustard (HD, bis(2-chlororethyl) sulfide) and a range (chloroethyl) sulfide simulants of variable lipophilicity have been examined using a hydrogen peroxide-based microemulsion system. SANS (small-angle neutron scattering), SAXS (small-angle X-ray scattering), PGSE-NMR (pulsed-gradient spin-echo NMR), fluorescence quenching, and electrospray mass spectroscopy (ESI-MS) were implemented to examine the distribution of HD, its simulants, and their oxidation/hydrolysis products in a model oil-in-water microemulsion. These measurements not only present a means of interpreting decontamination rates but also a rationale for the design of oxidation catalysts for these toxic materials. Here we show that by localizing manganese-Schiff base catalysts at the oil droplet-water interface or within the droplet core, a range of (chloroethyl) sulfides, including HD, spanning some 7 orders of octanol-water partition coefficient (K(ow)), may be oxidized with equal efficacy using dilute (5 wt. % of aqueous phase) hydrogen peroxide as a noncorrosive, environmentally benign oxidant (e.g., t(1/2) (HD) approximately 18 s, (2-chloroethyl phenyl sulfide, C(6)H(5)SCH(2)CH(2)Cl) approximately 15 s, (thiodiglycol, S(CH(2)CH(2)OH)(2)) approximately 19 s {20 degrees C}). Our observations demonstrate that by programming catalyst lipophilicity to colocalize catalyst and substrate, the inherent compartmentalization of the microemulsion can be exploited to achieve enhanced rates of reaction or to exert control over product selectivity. A combination of SANS, ESI-MS and fluorescence quenching measurements indicate that the enhanced catalytic activity is due to the locus of the catalyst and not a result of partial hydrolysis of the substrate.

  18. Unravelling the Nature of HD 81032–A New RS CVn Binary

    Indian Academy of Sciences (India)

    2016-01-27

    Jan 27, 2016 ... BVR photometric and quasi-simultaneous optical spectroscopic observations of the star HD 81032 have been carried out during the years 2000–2004. A photometric period of 18.802 ± 0.07d has been detected for this star. A large group of spots with a migration period of 7.43 ± 0.07 years is inferred from ...

  19. Non-invasive acoustic-based monitoring of uranium in solution and H/D ratio

    Energy Technology Data Exchange (ETDEWEB)

    Pantea, Cristian [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Beedle, Christopher Craig [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Sinha, Dipen N. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Lakis, Rollin Evan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-08-01

    The primary objective of this project is to adapt existing non-invasive acoustic techniques (Swept-Frequency Acoustic Interferometry and Gaussian-pulse acoustic technique) for the purpose of demonstrating the ability to quantify U or H/D ratios in solution. Furthermore, a successful demonstration will provide an easily implemented, low cost, and non-invasive method for remote and unattended uranium mass measurements for International Atomic Energy Agency (IAEA).

  20. The TERMS Project: Improved Orbital Parameters and Photometry of HD168443 and the Photometry Pipeline

    Science.gov (United States)

    Pilyavsky, Genady; Mahadevan, S.; Kane, S. R.; Howard, A. W.; Ciardi, D. R.; de Pree, C.; Dragomir, D.; Fischer, D.; Henry, G. W.; Jensen, E. L. N.; Laughlin, G.; Marlowe, H.; Rabus, M.; von Braun, K.; Wright, J. T.; Wang, X.

    2012-01-01

    The discovery of transiting planets around bright stars holds the potential to greatly enhance our understanding of planetary atmospheres. The Transit Ephemeris Refinement and Monitoring Survey (TERMS) project focuses on updating the ephemerides of known exoplanets, put tighter constraints on the orbital parameters and shrink the large errors on the predicted transit windows, enabling photometric monitoring to search for a transit signature. Here, we present the revised orbital parameters and the photometric coverage during a predicted transit window of HD168443b, a massive planet orbiting the bright star HD 168443 (V = 6.92) with a period of 58.11 days. The high eccentricity of the planetary orbit (e = 0.53) significantly enhances the a-priori transit probability (3.7%) from what is expected for a circular orbit (2.5%). The transit ephemeris was updated using refined orbital parameters from additional Keck-HIRES radial velocities. The photometry obtained at the 1 m telescope in Cerro Tololo Inter-American Observatory (CTIO) and the T8 0.8 m Automated Photometric Telescope (APT) at Fairborn Observatory achieved the necessary millimag precision. The expected change in flux (0.5%) for HD168443 was not observed during the predicted transit window, thus allowing us to rule out the transit and put tighter constrains on the orbital inclination of HD168443b. Additionally, we present the software used to analyze the CTIO data. Developed by the TERMS team, this IDL based package is a fast, precise, and easy to use program which has eliminated the need for external software and command line prompts by utilizing the functionality of a graphical user interface (GUI).

  1. HD 140283: A Star in the Solar Neighborhood that Formed Shortly after the Big Bang

    Science.gov (United States)

    Bond, Howard E.; Nelan, Edmund P.; VandenBerg, Don A.; Schaefer, Gail H.; Harmer, Dianne

    2013-03-01

    HD 140283 is an extremely metal-deficient and high-velocity subgiant in the solar neighborhood, having a location in the Hertzsprung-Russell diagram where absolute magnitude is most sensitive to stellar age. Because it is bright, nearby, unreddened, and has a well-determined chemical composition, this star avoids most of the issues involved in age determinations for globular clusters. Using the Fine Guidance Sensors on the Hubble Space Telescope, we have measured a trigonometric parallax of 17.15 ± 0.14 mas for HD 140283, with an error one-fifth of that determined by the Hipparcos mission. Employing modern theoretical isochrones, which include effects of helium diffusion, revised nuclear reaction rates, and enhanced oxygen abundance, we use the precise distance to infer an age of 14.46 ± 0.31 Gyr. The quoted error includes only the uncertainty in the parallax, and is for adopted surface oxygen and iron abundances of [O/H] = -1.67 and [Fe/H] = -2.40. Uncertainties in the stellar parameters and chemical composition, especially the oxygen content, now contribute more to the error budget for the age of HD 140283 than does its distance, increasing the total uncertainty to about ±0.8 Gyr. Within the errors, the age of HD 140283 does not conflict with the age of the Universe, 13.77 ± 0.06 Gyr, based on the microwave background and Hubble constant, but it must have formed soon after the big bang. Based in part on observations made with the NASA/ESA Hubble Space Telescope, obtained by the Space Telescope Science Institute. STScI is operated by the Association of Universities for Research in Astronomy, Inc., under NASA contract NAS5-26555.

  2. Classroon demonstration: Foucault s currents explored by the computer hard disc (HD

    Directory of Open Access Journals (Sweden)

    Jorge Roberto Pimentel

    2008-09-01

    Full Text Available This paper making an experimental exploration of Foucault s currents (eddy currents through a rotor magnetically coupled to computer hard disc (HD that is no longer being used. The set-up allows to illustrate in a stimulating way electromagnetism classes in High Schools for mean of the qualitative observations of the currents which are created as consequence of the movement of an electric conductor in a region where a magnetic field exists.

  3. HD domain of SAMHD1 influences Vpx-induced degradation at a post-interaction step

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Jian; Hou, Jingwei; Zhao, Ke; Yu, Xiao-Fang; Du, Juan, E-mail: jdu@jlu.edu.cn

    2016-02-12

    Primate SAMHD1 proteins are potent inhibitors of viruses, including retroviruses such as HIV-1, HIV-2, and SIV. Vpx, a distinctive viral protein expressed by HIV-2 and some SIVs, induces SAMHD1 degradation by forming a Vpx-DCAF1-based ubiquitin ligase complex. Either the N- or the C-terminus of SAMHD1 is critical for Vpx-induced degradation, depending on the types of SAMHD1 and Vpx proteins. However, it was not fully understood whether other regions of SAMHD1 also contribute to its depletion by Vpx. In the present study, we report that SAMHD1 from chicken (SAMHD1{sub GG}) was not degraded by SIVmac Vpx, in contrast with results for human SAMHD1 (SAMHD1{sub HS}). Results regarding to SAMHD1{sub HS} and SAMHD1{sub GG} fusion proteins supported previous findings that the C-terminus of SAMHD1{sub HS} is essential for Vpx-induced degradation. Internal domain substitution, however, revealed that the HD domain also contributes to Vpx-mediated SAMHD1 degradation. Interestingly, the HD domain influenced Vpx-mediated SAMHD1 degradation without affecting Vpx-SAMHD1 interaction. Therefore, our findings revealed that factors in addition to Vpx-SAMHD1 binding influence the efficiency of Vpx-mediated SAMHD1 degradation. - Highlights: • SAMHD1{sub GG} from chicken could not be depleted by SIVmac Vpx. • The C-terminus of human SAMHD1{sub HS} is critical for its degradation by Vpx. • The HD domain is essential for Vpx-induced degradation of SAMHD1{sub HS}. • Altering the HD domain does not affect Vpx-SAMHD1 interaction.

  4. Computational Investigations of Rovibrational Quenching of HD due to Collisions in the Interstellar Medium

    Science.gov (United States)

    Goodman Veazey, Clark; Wan, Yier; Yang, Benhui H.; Stancil, P.

    2017-06-01

    When conducting an examination of distant astronomical objects, scientists rely on measurements derived from astronomical observations of these objects, which are primarily collected using spectroscopy. In order to interpret spectroscopic data collected on astronomical objects, it is necessary to have a background of accurate dynamical information on interstellar molecules at one’s disposal. Seeing as most of the observable infrared radiation in the universe is emitted by molecules excited by collisional processes in the interstellar gas, generating accurate data on the rate of molecular collisions is of salient interest to astronomical endeavors.The collisional system we will be focusing on here is He-HD, an atom-diatom system in which He collides with HD. We are primarily interested in the cooling capabilities of this system, as these species are predicted to have played an important role in the formation of primordial stars, which emerged from a background composed solely of Hydrogen, Helium, and their compounds. HD is being investigated because it has a finite dipole moment and is hence a powerful radiator, and He due to its relative abundance in the early universe. Using a hybrid OpenMP/MPI adaption (vrrm) of a public-domain scattering package, cross sections for He-HD collisions are computed for a swathe of both rotational and vibrational states across a range of relevant kinetic energies, then integrated to produce rate coefficients. Due to the vast computational requirements for performing these operations, the use of high-powered computational resources is necessary.The work of CV was funded by a UGA Center for Undergraduate Research Opportunities award. We thank the University of Georgia GACRC and NERSC at Lawrence-Berkeley for computational resources and Brendan McLaughlin for assistance.

  5. HD 101065, the Most Peculiar Star: First Results from Precise Radial ...

    Indian Academy of Sciences (India)

    2016-01-27

    Jan 27, 2016 ... The analysis of the whole data set showed the presence of multi-periodic oscillations with two groups of equally-spaced modes. We find = 65.2 Hz and = 7.3 Hz for the large and the small spacing, respectively. HD 101065 is the only roAp star to show the existence of two groups of = 0, 2 and ...

  6. HD 156324: A Tidally Locked Magnetic SB3 With an Orbitally Disrupted Centrifugal Magnetosphere

    Science.gov (United States)

    Shultz, M.; Rivinius, Th.; Wade, G. A.; Alecian, E.; Kochukhov, O.; BinaMIcS Collaboration

    2018-01-01

    Period analysis of radial velocity, equivalent width, and magnetic measurements of the SB3 system HD 156324 yield identical results in all cases, indicating the system is tidally locked with orbital and rotational periods of 1.58 d. Its Hα emission profile exhibits marked morphological departures from the usual pattern observed amongst magnetic B-type stars, which can plausibly be ascribed to tidal disruption of the gravitocentrifugal potential.

  7. Separated Fringe Packet Observations with the CHARA Array. II. Omega Andromeda, HD 178911, and Xi Cephei

    Science.gov (United States)

    2014-07-31

    are sufficiently separated produce their own interferometric fringe packets; these are referred to as separated fringe packet ( SFP ) binaries. These SFP ...calibration star is not needed, and the SFPs can provide an accurate vector separation. In this paper, we apply the SFP approach to ω Andromeda, HD 178911...Paper I) presenting the results from a program of separated fringe packet ( SFP ) observations of spectroscopic and visual binary star systems made with

  8. Production of H,D(2s, 2p) by electron impact (0 - 2000 eV) on simple hydrogen containing molecules, ch. 2, A2

    International Nuclear Information System (INIS)

    Moehlman, G.R.; Heer, F.J. de

    1977-01-01

    Absolute emission cross sections of Ly-α (H,D(2p → 1s)) radiation have been determined for 0 - 2000 eV electrons incident on H 2 , HD, HCl, H 2 O, NH 3 and CH 4 . By means of the application of electric quenching, the excitation cross sections of H,D(2s) could be obtained from the increase of the resulting Ly-α radiation for these molecules. Only in the case of electrons on H 2 , D 2 and HD was excitation of H,D(2s) found

  9. RNAi-mediated silencing of the HD-Zip gene HD20 in Nicotiana attenuata affects benzyl acetone emission from corollas via ABA levels and the expression of metabolic genes

    Science.gov (United States)

    2012-01-01

    Background The N. attenuata HD20 gene belongs to the homeodomain-leucine zipper (HD-Zip) type I family of transcription factors and it has been previously associated with the regulation of ABA accumulation in leaves and the emission of benzyl acetone (BA; 4-phenyl-2-butanone) from night flowers. In this study, N. attenuata plants stably reduced in the expression of HD20 (ir-hd20) were generated to investigate the mechanisms controlling the emission of BA from night flowers. Results The expression of HD20 in corollas of ir-hd20 plants was reduced by 85 to 90% compared to wild-type plants (WT) without affecting flower morphology and development. Total BA emitted from flowers of ir-hd20 plants was reduced on average by 60%. This reduction occurred mainly at the late phase of BA emission and it was correlated with 2-fold higher levels of ABA in the corollas of ir-hd20 plants. When a 2-fold decline in ABA corolla levels of these plants was induced by salt stress, BA emissions recovered to WT levels. Supplying ABA to WT flowers either through the cuticle or by pedicle feeding reduced the total BA emissions by 25 to 50%; this reduction occurred primarily at the late phase of emission (similar to the reduction observed in corollas of ir-hd20 plants). Gene expression profiling of corollas collected at 12 pm (six hours before the start of BA emission) revealed that 274 genes changed expression levels significantly in ir-hd20 plants compared to WT. Among these genes, more than 35% were associated with metabolism and the most prominent group was associated with the metabolism of aromatic compounds and phenylpropanoid derivatives. Conclusions The results indicated that regulation of ABA levels in corollas is associated with the late phase of BA emission in N. attenuata plants and that HD20 affects this latter process by mediating changes in both ABA levels and metabolic gene expression. PMID:22548747

  10. A MULTIPLE SCATTERING POLARIZED RADIATIVE TRANSFER MODEL: APPLICATION TO HD 189733b

    Energy Technology Data Exchange (ETDEWEB)

    Kopparla, Pushkar; Yung, Yuk L. [Division of Geological and Planetary Sciences, California Institute of Technology, Pasadena, CA (United States); Natraj, Vijay; Swain, Mark R. [Jet Propulsion Laboratory (NASA-JPL), Pasadena, CA (United States); Zhang, Xi [Lunar and Planetary Laboratory, University of Arizona, Tucson, AZ (United States); Wiktorowicz, Sloane J., E-mail: pkk@gps.caltech.edu [Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA (United States)

    2016-01-20

    We present a multiple scattering vector radiative transfer model that produces disk integrated, full phase polarized light curves for reflected light from an exoplanetary atmosphere. We validate our model against results from published analytical and computational models and discuss a small number of cases relevant to the existing and possible near-future observations of the exoplanet HD 189733b. HD 189733b is arguably the most well observed exoplanet to date and the only exoplanet to be observed in polarized light, yet it is debated if the planet’s atmosphere is cloudy or clear. We model reflected light from clear atmospheres with Rayleigh scattering, and cloudy or hazy atmospheres with Mie and fractal aggregate particles. We show that clear and cloudy atmospheres have large differences in polarized light as compared to simple flux measurements, though existing observations are insufficient to make this distinction. Futhermore, we show that atmospheres that are spatially inhomogeneous, such as being partially covered by clouds or hazes, exhibit larger contrasts in polarized light when compared to clear atmospheres. This effect can potentially be used to identify patchy clouds in exoplanets. Given a set of full phase polarimetric measurements, this model can constrain the geometric albedo, properties of scattering particles in the atmosphere, and the longitude of the ascending node of the orbit. The model is used to interpret new polarimetric observations of HD 189733b in a companion paper.

  11. New analysis indicates no thermal inversion in the atmosphere of HD 209458b

    International Nuclear Information System (INIS)

    Diamond-Lowe, Hannah; Stevenson, Kevin B.; Bean, Jacob L.; Line, Michael R.; Fortney, Jonathan J.

    2014-01-01

    An important focus of exoplanet research is the determination of the atmospheric temperature structure of strongly irradiated gas giant planets, or hot Jupiters. HD 209458b is the prototypical exoplanet for atmospheric thermal inversions, but this assertion does not take into account recently obtained data or newer data reduction techniques. We reexamine this claim by investigating all publicly available Spitzer Space Telescope secondary-eclipse photometric data of HD 209458b and performing a self-consistent analysis. We employ data reduction techniques that minimize stellar centroid variations, apply sophisticated models to known Spitzer systematics, and account for time-correlated noise in the data. We derive new secondary-eclipse depths of 0.119% ± 0.007%, 0.123% ± 0.006%, 0.134% ± 0.035%, and 0.215% ± 0.008% in the 3.6, 4.5, 5.8, and 8.0 μm bandpasses, respectively. We feed these results into a Bayesian atmospheric retrieval analysis and determine that it is unnecessary to invoke a thermal inversion to explain our secondary-eclipse depths. The data are well fitted by a temperature model that decreases monotonically between pressure levels of 1 and 0.01 bars. We conclude that there is no evidence for a thermal inversion in the atmosphere of HD 209458b.

  12. The Properties of Exomoons Around the Habitable Zone Planets, Kepler 22b and HD160691b

    Science.gov (United States)

    Bokorney, Jake; Fuse, Christopher R.

    2016-01-01

    As part of a larger study to understand the formation, evolution, and stability of exoplanet satellites, we have examined the Kepler 22 and HD160691 systems. Habitable zone planets (Kopparapu et al. 2013) are found in each system, with Kepler 22b at 0.85 AU and HD160691b at 1.5 AU. While these planets may be habitable, systems of satellites also hold the potential of supporting life. A series of N-body simulations were performed to examine the most stable configuration of moons orbiting each planet. A moonlet disk was designed to span 10 - 80% of the planet's Hill sphere (Ksting et al. 1993). The 100 bodies (mdisk/mplanet = 2 × 10-4) within the disk were randomly placed around each planet. Simulations were run for 500 kyrs, with the star, planets, and moonlets allowed to gravitationally evolve. The Kepler 22b system was able to retain three to four moons in 96% of the simulations, while the HD160691b systems had a stable pair of moons in 73% of the simulations. The remaining simulations produced systems with moons on highly eccentric orbits.

  13. Near-threshold H/D exchange in CD3CHO photodissociation

    Science.gov (United States)

    Heazlewood, Brianna R.; Maccarone, Alan T.; Andrews, Duncan U.; Osborn, David L.; Harding, Lawrence B.; Klippenstein, Stephen J.; Jordan, Meredith J. T.; Kable, Scott H.

    2011-06-01

    Measuring the isotopic abundance of hydrogen versus deuterium atoms is a key method for interrogating reaction pathways in chemistry. H/D ‘scrambling’ is the intramolecular rearrangement of labile isotopes of hydrogen atoms and when it occurs through unanticipated pathways can complicate the interpretation of such experiments. Here, we investigate H/D scrambling in acetaldehyde at the energetic threshold for breaking the formyl C-H bond and reveal an unexpected unimolecular mechanism. Laser photolysis experiments of CD3CHO show that up to 17% of the products have undergone H/D exchange to give CD2H + DCO. Transition-state theory calculations reveal that the dominant mechanism involves four sequential H- or D-shifts to form CD2HCDO, which then undergoes conventional C-C bond cleavage. At the lowest energy the molecule undergoes an average of 20 H- or D-shifts before products are formed, evincing significant scrambling of H and D atoms. Analogous photochemically induced isomerizations and isotope scrambling are probably important in both atmospheric chemistry and combustion reactions.

  14. Near-threshold H/D exchange in CD₃CHO photodissociation.

    Science.gov (United States)

    Heazlewood, Brianna R; Maccarone, Alan T; Andrews, Duncan U; Osborn, David L; Harding, Lawrence B; Klippenstein, Stephen J; Jordan, Meredith J T; Kable, Scott H

    2011-06-01

    Measuring the isotopic abundance of hydrogen versus deuterium atoms is a key method for interrogating reaction pathways in chemistry. H/D 'scrambling' is the intramolecular rearrangement of labile isotopes of hydrogen atoms and when it occurs through unanticipated pathways can complicate the interpretation of such experiments. Here, we investigate H/D scrambling in acetaldehyde at the energetic threshold for breaking the formyl C-H bond and reveal an unexpected unimolecular mechanism. Laser photolysis experiments of CD₃CHO show that up to 17% of the products have undergone H/D exchange to give CD₂H + DCO. Transition-state theory calculations reveal that the dominant mechanism involves four sequential H- or D-shifts to form CD₂HCDO, which then undergoes conventional C-C bond cleavage. At the lowest energy the molecule undergoes an average of 20 H- or D-shifts before products are formed, evincing significant scrambling of H and D atoms. Analogous photochemically induced isomerizations and isotope scrambling are probably important in both atmospheric chemistry and combustion reactions.

  15. Water Vapor in the Spectrum of the Extrasolar Planet HD 189733b. II. The Eclipse

    Science.gov (United States)

    Crouzet, Nicolas; McCullough, Peter R.; Deming, Drake; Madhusudhan, Nikku

    2014-11-01

    Spectroscopic observations of exoplanets are crucial to infer the composition and properties of their atmospheres. HD 189733b is one of the most extensively studied exoplanets and is a cornerstone for hot Jupiter models. In this paper, we report the dayside emission spectrum of HD 189733b in the wavelength range 1.1-1.7 μm obtained with the Hubble Space Telescope Wide Field Camera 3 (WFC3) in spatial scan mode. The quality of the data is such that even a straightforward analysis yields a high-precision Poisson noise-limited spectrum: the median 1σ uncertainty is 57 ppm per 0.02 μm bin. We also build a white-light curve correcting for systematic effects and derive an absolute eclipse depth of 96 ± 39 ppm. The resulting spectrum shows marginal evidence for water vapor absorption, but can also be well explained by a blackbody spectrum. However, the combination of these WFC3 data with previous Spitzer photometric observations is best explained by a dayside atmosphere of HD 189733b with no thermal inversion and a nearly solar or subsolar H2O abundance in a cloud-free atmosphere. Alternatively, this apparent subsolar abundance may be the result of clouds or hazes that future studies need to investigate.

  16. Blood Pressure of Maintenance Hemodialysis Patients in the Dalmatian Region of Croatia: Differences between Hospital and Out-of-Hospital Dialysis Centers.

    Science.gov (United States)

    Gulin, Marijana; Klarić, Dragan; Ilić, Mario; Radić, Josipa; Kovačić, Vedran; Šain, Milenka

    2017-01-01

    This study was aimed at comparing the incidence of arterial hypertension and blood pressure (BP) variance in hospital and out-of-hospital hemodialysis (HD) patients during HD sessions. A cross-sectional study was conducted for 1 week at all the HD centers in Dalmatia, Croatia. The pre-, intra-, and post-dialysis BP values were collected for 3 consecutive HD sessions per patient. Of the 399 subjects, 73.9% were hypertensives, who showed higher interdialytic weight gain compared to the normotensives (2.58 vs. 2.40). Hospital and out-of-hospital HD patients received identical antihypertensive therapies, except that beta blockers were more frequently administered to out-of-hospital HD patients. Higher pre-, intra-, and post-dialysis BP values were recorded in patients at out-of-hospital HD centers. The differences in BP variability and antihypertensive therapies administered to hospital HD patients as compared to out-of-hospital HD patients may reflect differing approaches by the nephrologists at these centers. © 2017 S. Karger AG, Basel.

  17. Nutritional profile of hemodialysis patients concerning treatment time.

    Science.gov (United States)

    Alvarenga, Livia de Almeida; Andrade, Bárbara Danelon; Moreira, Michelle Andrade; Nascimento, Roberto de Paula; Macedo, Isabela Dariú; Aguiar, Aline Silva de

    2017-01-01

    The mortality of the population with chronic kidney disease (CKD) on hemodialysis (HD) is very high and the protein-energy malnutrition stands out as one of the most common consequences in relation to this condition. To evaluate the association between time of hemodialysis and nutritional parameters of patients. It is a cross-sectional study with secondary data, developed of the University Hospital of the Federal University of Juiz de Fora (HU/UFJF). This study was approved by the Research Ethics Committee (Nº 1.233.142), a total of 36 patients. The medical records and collected data were analyzed for anthropometric markers, biochemical and diet, considering two groups: HD time less than three and greater than or equal to three years. There was reduction of mass of somatic protein with increased duration of HD. In relation to food intake was observed that in patients with increased duration of dialysis, an increase in average consumption of protein / kg of weight, calories, phosphorus and potassium, with a significant difference from the mean protein intake / kg (p = 0.04) and phosphorus (p = 0.045). Increasing HD time has altered body composition of patients, indicating a decline in the nutritional status of these individuals. HD patients are a risk group for protein-energy malnutrition, where HD time interferes with the nutritional status and food profile of the patient. The group HD time greater than or equal to 3 years presented worsening nutritional status.

  18. Nutritional profile of hemodialysis patients concerning treatment time

    Directory of Open Access Journals (Sweden)

    Livia de Almeida Alvarenga

    Full Text Available Abstract Introduction: The mortality of the population with chronic kidney disease (CKD on hemodialysis (HD is very high and the protein-energy malnutrition stands out as one of the most common consequences in relation to this condition. Objective: To evaluate the association between time of hemodialysis and nutritional parameters of patients. Methods: It is a cross-sectional study with secondary data, developed of the University Hospital of the Federal University of Juiz de Fora (HU/UFJF. This study was approved by the Research Ethics Committee (Nº 1.233.142, a total of 36 patients. The medical records and collected data were analyzed for anthropometric markers, biochemical and diet, considering two groups: HD time less than three and greater than or equal to three years. Results: There was reduction of mass of somatic protein with increased duration of HD. In relation to food intake was observed that in patients with increased duration of dialysis, an increase in average consumption of protein / kg of weight, calories, phosphorus and potassium, with a significant difference from the mean protein intake / kg (p = 0.04 and phosphorus (p = 0.045. Increasing HD time has altered body composition of patients, indicating a decline in the nutritional status of these individuals. Conclusion: HD patients are a risk group for protein-energy malnutrition, where HD time interferes with the nutritional status and food profile of the patient. The group HD time greater than or equal to 3 years presented worsening nutritional status.

  19. Home hemodialysis: a comprehensive review of patient-centered and economic considerations

    Directory of Open Access Journals (Sweden)

    Walker RC

    2017-02-01

    Full Text Available Rachael C Walker,1,2 Kirsten Howard,1 Rachael L Morton3 1School of Public Health, Sydney Medical School, University of Sydney, Sydney, Australia; 2Hawke’s Bay District Health Board, Hastings, New Zealand; 3NHMRC Clinical Trials Centre, Sydney Medical School, University of Sydney, Sydney, Australia Abstract: Internationally, the number of patients requiring treatment for end-stage kidney disease (ESKD continues to increase, placing substantial burden on health systems and patients. Home hemodialysis (HD has fluctuated in its popularity, and the rates of home HD vary considerably between and within countries although there is evidence suggesting a number of clinical, survival, economic, and quality of life (QoL advantages associated with this treatment. International guidelines encourage shared decision making between patients and clinicians for the type of dialysis, with an emphasis on a treatment that aligned to the patients’ lifestyle. This is a comprehensive literature review of patient-centered and economic impacts of home HD with the studies published between January 2000 and July 2016. Data from the primary studies representing both efficiency and equity of home HD were presented as a narrative synthesis under the following topics: advantages to patients, barriers to patients, economic factors influencing patients, cost-effectiveness of home HD, and inequities in home HD delivery. There were a number of advantages for patients on home HD including improved survival and QoL and flexibility and potential for employment, compared to hospital HD. Similarly, there were several barriers to patients preferring or maintaining home HD, and the strategies to overcome these barriers were frequently reported. Good evidence reported that indigenous, low-income, and other socially disadvantaged individuals had reduced access to home HD compared to other forms of dialysis and that this situation compounds already-poor health outcomes on renal

  20. HBV Viral Load and Liver Enzyme Levels May Be Associated with the Wild MBL2 AA Genotype

    Directory of Open Access Journals (Sweden)

    Tuane Carolina Ferreira Moura

    2017-01-01

    Full Text Available The present study investigated the frequencies of rs1800450 (MBL ⁎B, G>A, rs1800451 (MBL ⁎C, G>A, and rs5030737 (MBL ⁎D, C>T polymorphisms in exon 1 of the MBL2 gene among patients with chronic viral hepatitis. Blood samples from patients infected with hepatitis B virus (HBV; n=65, hepatitis C virus (HCV; n=92, and a noninfected control group (n=300 were investigated. The presence of polymorphisms was detected using a real-time polymerase chain reaction to correlate with liver disease pathogenesis and fibrosis staging according to the Metavir classification. The genotypic and allelic frequencies showed no significant differences between the groups, but patients with active HBV and the wild AA genotype presented a positive correlation between increased transaminase and HBV DNA levels and the presence of mild to moderate fibrosis. Patients with HCV and the wild AA genotype presented mild inflammation and higher HCV RNA levels, although the same association was not observed for the fibrosis scores. The results suggest that the mutations in exon 1 of the MBL2 gene do not contribute directly to the clinical and laboratory features of HCV and HBV infections, but further studies should be performed to confirm whether the wild AA genotype has indirect effect on disease progression.