WorldWideScience

Sample records for aa genotype carriers

  1. The FAS-670 AA genotype is associated with high proviral load in peruvian HAM/TSP patients.

    Science.gov (United States)

    Rosado, Jason; Morales, Sandra; López, Giovanni; Clark, Daniel; Verdonck, Kristien; Gotuzzo, Eduardo; Van Camp, Guy; Talledo, Michael

    2017-04-01

    Human T-lymphotropic virus 1 (HTLV-1) is the etiologic agent of the HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). Apoptosis is a mechanism of defense elicited by many triggers, including cross-linking of the FAS receptor expressed in viruses-infected cells, and the ligand FASL presented by T-cytotoxic cells. As HAM/TSP has been associated with high levels of proviral load (PVL), we hypothesized that certain genotypes of single-nucleotide polymorphisms (SNPs) associated with a decreased protein expression of FAS and FASL could be risk factors for this disease. Three SNPs: FAS-670A/G (rs1800682), FAS-1377G/A (rs2234767), and FASL-844C/T (rs763110) were analyzed in 73 HAM/TSP patients and 143 HTLV-1 asymptomatic carriers. Ancestry informative markers were used to adjust for ethnicity through a principal component analysis. Gender, age, PVL, and the first three principal components were used as covariates. The FAS/FASL genotype distribution was not associated with HAM/TSP presence (P-> 0.05). The FAS-670 AA genotype was associated with high PVL in comparison to FAS-670 GG in HAM/TSP patients (P = 0.015), while in asymptomatic carriers low levels of PVL were observed (P > 0.05). Our findings suggest that rs1800682, rs2234767, and rs763110 genotypes are not associated with the presence of HAM/TSP, but that the FAS-670 AA genotype can promote higher PVL values in HAM/TSP patients. J. Med. Virol. 89:726-731, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  2. HBV Viral Load and Liver Enzyme Levels May Be Associated with the Wild MBL2 AA Genotype

    Directory of Open Access Journals (Sweden)

    Tuane Carolina Ferreira Moura

    2017-01-01

    Full Text Available The present study investigated the frequencies of rs1800450 (MBL ⁎B, G>A, rs1800451 (MBL ⁎C, G>A, and rs5030737 (MBL ⁎D, C>T polymorphisms in exon 1 of the MBL2 gene among patients with chronic viral hepatitis. Blood samples from patients infected with hepatitis B virus (HBV; n=65, hepatitis C virus (HCV; n=92, and a noninfected control group (n=300 were investigated. The presence of polymorphisms was detected using a real-time polymerase chain reaction to correlate with liver disease pathogenesis and fibrosis staging according to the Metavir classification. The genotypic and allelic frequencies showed no significant differences between the groups, but patients with active HBV and the wild AA genotype presented a positive correlation between increased transaminase and HBV DNA levels and the presence of mild to moderate fibrosis. Patients with HCV and the wild AA genotype presented mild inflammation and higher HCV RNA levels, although the same association was not observed for the fibrosis scores. The results suggest that the mutations in exon 1 of the MBL2 gene do not contribute directly to the clinical and laboratory features of HCV and HBV infections, but further studies should be performed to confirm whether the wild AA genotype has indirect effect on disease progression.

  3. Higher lifetime chance of spontaneous surface antigen loss in hepatitis B carriers with genotype C infection.

    Science.gov (United States)

    Tseng, T-C; Liu, C-J; Chen, C-L; Yang, W-T; Yang, H-C; Su, T-H; Wang, C-C; Kuo, S F-T; Liu, C-H; Chen, P-J; Chen, D-S; Kao, J-H

    2015-05-01

    Clearance of hepatitis B surface antigen (HBsAg) indicates clinical control of hepatitis B virus (HBV) infection. However, little is known about the impact of viral genomic variations on HBsAg loss. We explored the association between viral genomic factors and HBsAg loss in 2121HBeAg-negative patients. HBV pre-core stop codon (1896) and basal core promoter (BCP) (1762/1764) sequences were determined in patients with HBV DNA ≥200 IU/mL (N = 1693). The effect of HBV genotype on HBsAg loss was further validated in the whole cohort of 3445 HBsAg carriers. The cumulative lifetime (age 28-75 years) incidence of HBsAg loss was 50.4% in 2121 HBeAg-negative patients. We found that genotype C, but not pre-core stop codon or BCP mutants, was associated with HBsAg loss. Compared to genotype B patients, genotype C patients had higher lifetime chance of HBsAg loss, with hazard ratio of 1.8 (95% confidence interval: 1.4-2.4). Multivariable analysis showed that male sex, elevated ALT levels, lower serum HBV DNA and HBsAg levels, and genotype C infection were associated with higher chance of HBsAg loss independently. We then performed sensitivity analysis, which re-included HBeAg-positive, cirrhotic and treatment-experienced patients, and confirmed the robustness of our results in 3445 HBsAg carriers. Genotype C infection, compared to genotype B, is associated with a higher lifetime chance of HBsAg loss in Asian HBV carriers. © 2015 John Wiley & Sons Ltd.

  4. The rs2071559 AA VEGFR-2 Genotype Frequency Is Significantly Lower in Neovascular Age-Related Macular Degeneration Patients

    Directory of Open Access Journals (Sweden)

    Stefano Lazzeri

    2012-01-01

    Full Text Available In this prospective, case-control genetic study, 120 consecutive neovascular age-related macular degeneration (AMD cases and 78 controls were enrolled. Two SNPs (rs2071559 and rs1870377 of VEGF-A receptor-2 (VEGFR-2 gene were analyzed with the technique of Real-Time PCR to investigate a genetic link between AMD and VEGFR-2 gene polymorphisms in Italian patients. The frequency of the VEGFR-2 genotype rs2071559 AA was significantly lower (18.33% in patients with AMD than in the control subjects (34.62%; P=0.0095, chi-square test; Pcorr=0.038; OR=0.42, 95% CI 0.22 to 0.82. In conclusion, although with the limitations of a small sample size and the few SNPs studied, this study demonstrates a lower frequency of VEGFR-2 rs2071559 AA genotype in an AMD patient population, suggesting future studies on the role VEGFR-2 SNPs.

  5. Comparative haematological parameters of HbAA and HbAS genotype children infected with Plasmodium falciparum malaria in Yemen.

    Science.gov (United States)

    Albiti, Anisa H; Nsiah, Kwabena

    2014-04-01

    Sickle haemoglobin (HbS) is known to offer considerable protection against falciparum malaria. However, the mechanism of protection is not yet completely understood. In this study, we investigate how the presence of the sickle cell trait affects the haematological profile of AS persons with malaria, in comparison with similarly infected persons with HbAA. This study is based on the hypothesis that the sickle cell trait plays a protective role against malaria. Children from an endemic malaria transmission area in Yemen were enrolled in this study. Hematological parameters were estimated using manual methods, the percentage of parasite density on stained thin smear was calculated, haemoglobin genotypes were determined on paper electrophoresis, ferritin was measured using enzyme-linked immunosorbent assay, serum iron and TIBC were assayed using spectrophotometer, transferrin saturation index was calculated by dividing serum iron by TIBC and expressing the result as a percentage. Haematological parameters were compared in HbAA- and HbAS-infected children. Falciparum malaria parasitaemia was confirmed in the blood smears of 62 children, 44 (55.7%) of AA and 18 (37.5%) AS, so there was higher prevalence in HbAA children (P = 0.047). Parasite density was lower in HbAS- than HbAA-infected children (P = 0.003). Anaemia was prominent in malaria-infected children, with high proportions of moderate and severe forms in HbAA (P = 0.001). The mean levels of haemoglobin, packed cell volume, reticulocyte count, platelets count, lymphocytes, eosinophils, and serum iron were significantly lower while total leukocytes, immature granulocytes, monocytes, erythrocyte sedimentation rate, transferrin saturation, and serum ferritin were significantly higher in HbAA-infected children than HbAS-infected children. Infection with Plasmodium falciparum malaria caused more significant haematological alterations of HbAA children than HbAS. This study supports the observation that sickle cell trait

  6. Thalassemia intermedia as a result of heterozygosis for ß0-thalassemia and aaaanti-3.7/aa genotype in a Brazilian patient

    Directory of Open Access Journals (Sweden)

    Kimura E.M.

    2003-01-01

    Full Text Available We report a case in which the interaction of heterozygosis for both the ß0-IVS-II-1 (G->A mutation and the aaaanti-3.7 allele was the probable cause for the clinical occurrence of thalassemia intermedia. The propositus, a 6-year-old Caucasian Brazilian boy of Portuguese descent, showed a moderately severe chronic anemia in spite of having the ß-thalassemia trait. Investigation of the alpha-globin gene status revealed heterozygosis for alpha-gene triplication (aaa/aa. The patient's father, also presenting mild microcytic and hypochromic anemia, had the same alpha and ß genotypes as his son, while the mother, not related to the father and hematologically normal, was also a carrier of the aaaanti-3.7 allele. The present case emphasizes the need for considering the possibility of alpha-gene triplication in ß-thalassemia heterozygotes who display an unexpected severe phenotype. The ß-thalassemia mutation found here is being described for the first time in Brazil.

  7. The Utilization of Nitrogen Gas as a Carrier Gas in the Determination of Hg Ions Using Cold Vapor-Atomic Absorption Spectrophotometer (CV-AAS)

    OpenAIRE

    Panggabean, Aman Sentosa; Pasaribu, Subur P; Kristiana, Farida

    2018-01-01

    The research about utilization of nitrogen gas as a carrier gas in the determination of Hg ions by using Cold Vapor-Atomic Absorption Spectrophotometer (CV-AAS) method has been conducted. To optimize the measurement results, several parameters that affect hydride generator have been studied. Some specified important parameters are SnCl2 concentration as reductant, acid concentration, and the analytical performance such as repeatability and reproducibility (% RSD), linearity (r), limits of det...

  8. Genotype-phenotype correlations among BRCA1 4153delA and 5382insC mutation carriers from Latvia

    Science.gov (United States)

    2011-01-01

    Background Mutations in the high penetrance breast and ovarian cancer susceptibility gene BRCA1 account for a significant percentage of hereditary breast and ovarian cancer cases. Genotype-phenotype correlations of BRCA1 mutations located in different parts of the BRCA1 gene have been described previously; however, phenotypic differences of specific BRCA1 mutations have not yet been fully investigated. In our study, based on the analysis of a population-based series of unselected breast and ovarian cancer cases in Latvia, we show some aspects of the genotype-phenotype correlation among the BRCA1 c.4034delA (4153delA) and c.5266dupC (5382insC) founder mutation carriers. Methods We investigated the prevalence of the BRCA1 founder mutations c.4034delA and c.5266dupC in a population-based series of unselected breast (n = 2546) and ovarian (n = 795) cancer cases. Among the BRCA1 mutation carriers identified in this analysis we compared the overall survival, age at diagnosis and family histories of breast and ovarian cancers. Results We have found that the prevalence of breast and ovarian cancer cases (breast: ovarian cancer ratio) differs significantly among the carriers of the c.5266dupC and c.4034delA founder mutations (OR = 2.98, 95%CI = 1.58 to 5.62, P < 0.001). We have also found a difference in the prevalence of breast and ovarian cancer cases among the 1st and 2nd degree relatives of the c.4034delA and c.5266dupC mutation carriers. In addition, among the breast cancer cases the c.4034delA mutation has been associated with a later age of onset and worse clinical outcomes in comparison with the c.5266dupC mutation. Conclusions Our data suggest that the carriers of the c.4034delA and c.5266dupC founder mutations have different risks of breast and ovarian cancer development, different age of onset and prognosis of breast cancer. PMID:22032251

  9. Influence of the temperature and the genotype of the HSP90AA1 gene over sperm chromatin stability in Manchega Rams.

    Directory of Open Access Journals (Sweden)

    Manuel Ramón

    Full Text Available The present study addresses the effect of heat stress on males' reproduction ability. For that, we have evaluated the sperm DNA fragmentation (DFI by SCSA of ejaculates incubated at 37 °C during 0, 24 and 48 hours after its collection, as a way to mimic the temperature circumstances to which spermatozoa will be subject to in the ewe uterus. The effects of temperature and temperature-humidity index (THI from day 60 prior collection to the date of semen collection on DFI were examined. To better understand the causes determining the sensitivity of spermatozoa to heat, this study was conducted in 60 males with alternative genotypes for the SNP G/C-660 of the HSP90AA1 promoter, which encode for the Hsp90α protein. The Hsp90α protein predominates in the brain and testis, and its role in spermatogenesis has been described in several species. Ridge regression analyses showed that days 29 to 35 and 7 to 14 before sperm collection (bsc were the most critical regarding the effect of heat stress over DFI values. Mixed model analyses revealed that DFI increases over a threshold of 30 °C for maximum temperature and 22 for THI at days 29 to 35 and 7 to 14 bsc only in animals carrying the GG-660 genotype. The period 29-35 bsc coincide with the meiosis I process for which the effect of the Hsp90α has been described in mice. The period 7-14 bsc may correspond with later stages of the meiosis II and early stages of epididymal maturation in which the replacement of histones by protamines occurs. Because of GG-660 genotype has been associated to lower levels of HSP90AA1 expression, suboptimal amounts of HSP90AA1 mRNA in GG-660 animals under heat stress conditions make spermatozoa DNA more susceptible to be fragmented. Thus, selecting against the GG-660 genotype could decrease the DNA fragmentation and spermatozoa thermal susceptibility in the heat season, and its putative subsequent fertility gains.

  10. Phenotype-genotype correlation in potential female carriers of X-linked developmental cataract (Nance-Horan syndrome).

    Science.gov (United States)

    Khan, Arif O; Aldahmesh, Mohammed A; Mohamed, Jawahir Y; Alkuraya, Fowzan S

    2012-06-01

    To correlate clinical examination with underlying genotype in asymptomatic females who are potential carriers of X-linked developmental cataract (Nance-Horan syndrome). An ophthalmologist blind to the pedigree performed comprehensive ophthalmic examination for 16 available family members (two affected and six asymptomatic females, five affected and three asymptomatic males). Facial features were also noted. Venous blood was collected for sequencing of the gene NHS. All seven affected family members had congenital or infantile cataract and facial dysmorphism (long face, bulbous nose, abnormal dentition). The six asymptomatic females ranged in age from 4-35 years old. Four had posterior Y-suture centered lens opacities; these four also exhibited the facial dysmorphism of the seven affected family members. The fifth asymptomatic girl had scattered fine punctate lens opacities (not centered on the Y-suture) while the sixth had clear lenses, and neither exhibited the facial dysmorphism. A novel NHS mutation (p.Lys744AsnfsX15 [c.2232delG]) was found in the seven patients with congenital or infantile cataract. This mutation was also present in the four asymptomatic girls with Y-centered lens opacities but not in the other two asymptomatic girls or in the three asymptomatic males (who had clear lenses). Lens opacities centered around the posterior Y-suture in the context of certain facial features were sensitive and specific clinical signs of carrier status for NHS mutation in asymptomatic females. Lens opacities that did not have this characteristic morphology in a suspected female carrier were not a carrier sign, even in the context of her affected family members.

  11. The IL1B-511 Polymorphism (rs16944 AA Genotype Is Increased in Aspirin-Exacerbated Respiratory Disease in Mexican Population

    Directory of Open Access Journals (Sweden)

    Ramcés Falfán-Valencia

    2012-01-01

    Full Text Available Aspirin exacerbated respiratory disease (AERD is characterized by chronic hyperplastic rhinosinusitis, nasal polyposis, asthma, and aspirin sensitivity. The mechanisms which produce these manifestations of intolerance are not fully defined, current research focuses on cyclooxygenase 1 (COX-1 inhibition, metabolism of arachidonic acid, and the COX pathway to the lipoxygenase (LO route, inducing increased synthesis of leukotrienes (LT. The biological plausibility of this model has led to the search for polymorphisms in genes responsible for proinflammatory cytokines synthesis, such as IL1B and IL8. We performed a genetic association study between IL8-251 (rs4073 and IL1B-511 (rs16944 polymorphisms in AERD, aspirin-tolerant asthma (ATA, and healthy control subjects. Using allelic discrimination by real-time PCR, we found statistically nonsignificant associations between AERD, ATA, and healthy control subjects for the GG and GA genotypes of IL1B (rs16944. Interestingly, the AA genotype showed an increased frequency in the AERD patients versus the ATA group (GF = 0.19 versus 0.07, =0.018, OR 2.98, and 95% CI 1.17–7.82. This is the first observation that IL1B polymorphisms are involved in AERD. Thus, future studies must investigate whether interleukin-1 is released in the airways of AERD patients and whether it relates to genetic polymorphisms in the IL1B gene.

  12. The IL1B-511 Polymorphism (rs16944 AA Genotype) Is Increased in Aspirin-Exacerbated Respiratory Disease in Mexican Population

    Science.gov (United States)

    Falfán-Valencia, Ramcés; Pavón-Romero, Gandhi F.; Camarena, Angel; García, María de la Luz; Galicia-Negrete, Gustavo; Negrete-García, María Cristina; Teran, Luis Manuel

    2012-01-01

    Aspirin exacerbated respiratory disease (AERD) is characterized by chronic hyperplastic rhinosinusitis, nasal polyposis, asthma, and aspirin sensitivity. The mechanisms which produce these manifestations of intolerance are not fully defined, current research focuses on cyclooxygenase 1 (COX-1) inhibition, metabolism of arachidonic acid, and the COX pathway to the lipoxygenase (LO) route, inducing increased synthesis of leukotrienes (LT). The biological plausibility of this model has led to the search for polymorphisms in genes responsible for proinflammatory cytokines synthesis, such as IL1B and IL8. We performed a genetic association study between IL8-251 (rs4073) and IL1B-511 (rs16944) polymorphisms in AERD, aspirin-tolerant asthma (ATA), and healthy control subjects. Using allelic discrimination by real-time PCR, we found statistically nonsignificant associations between AERD, ATA, and healthy control subjects for the GG and GA genotypes of IL1B (rs16944). Interestingly, the AA genotype showed an increased frequency in the AERD patients versus the ATA group (GF = 0.19 versus 0.07, p = 0.018, OR 2.98, and 95% CI 1.17–7.82). This is the first observation that IL1B polymorphisms are involved in AERD. Thus, future studies must investigate whether interleukin-1β is released in the airways of AERD patients and whether it relates to genetic polymorphisms in the IL1B gene. PMID:22132000

  13. Genotyping and serotyping of macrolide and multidrug resistant Streptococcus pneumoniae isolated from carrier children

    Directory of Open Access Journals (Sweden)

    S F Swedan

    2016-01-01

    Full Text Available Aims: Streptococcus pneumoniae, an opportunistic pathogen commonly carried asymptomatically in the nasopharynx of children, is associated with increasing rates of treatment failures due to a worldwide increase in drug resistance. We investigated the carriage of S. pneumoniae in children 5 years or younger, the identity of prevalent serotypes, the rates of resistance to macrolides and other antimicrobial agents and the genotypes responsible for macrolide resistance. Materials and Methods: Nasopharyngeal swabs were collected from 157 children under 5 years for cultural isolation of S. pneumoniae. Antibiogram of isolates  was determined using the disk diffusion test, and the minimal inhibitory concentration to macrolides was determined using the E-test. Isolate serotypes and macrolide resistance genes, erm(B and mef(E, were identified using multiplex polymerase chain reactions. Results: S. pneumoniae was recovered from 33.8% of children; 41.9% among males and 21.9% among females (P = 0.009. The highest carriage rate occurred among age groups 7-12 months and 49-60 months. Most frequent serotypes were 19F, 6A/B, 11A, 19A, 14 and 15B/C.  Resistance to macrolides was 60.4%. Resistance to oxacillin, trimethoprim/sulfamethoxazole and clindamycin was present among 90.6%, 54.7% and 32.1% of isolates, respectively. All isolates were susceptible to chloramphenicol, levofloxacin and vancomycin. Isolates resistant to one or more macrolide drugs were more likely to be multidrug resistant. Resistance to clindamycin or oxacillin coexisted with macrolide resistance. Among the erythromycin-resistant isolates, erm(B, mef(E and erm(B and mef(E genes were present at rates of 43.8%, 37.5% and 6.3%, respectively. Erm(B and mef(E were associated with very high level and moderate-to-high level resistance to macrolides, respectively. Conclusion: A significant proportion of children harboured macrolide and multidrug-resistant S. pneumoniae.

  14. NEPHRITOGENIC ACTIVITY OF STREPTOCOCCUS PYOGENES emm1 AND emm12 GENOTYPES ISOLATED FROM PATIENTS AND ASYMPTOMATIC CARRIERS

    Directory of Open Access Journals (Sweden)

    L. A. Burova

    2015-01-01

    Full Text Available In this paper the nephritogenic activity of Streptococcus pyogenes genotype emm1 and emm12 clinical isolates from scarlet fever patients and healthy children was considered. As earlier established, strains of these types differ in Fc-binding profile, interacting with native IgG and immune complexes (IC, respectively. As expected, all the type emm1 strains bound native IgG; besides, ICs interacted only with strains from patients but not with those from carriers. In contrast, all type emm12 strains appeared to be negative for native IgG, whereas ICs were bound by strains from patients exclusively. None of the tested strains bound IgG3. By immunization of rabbits, binding of native IgG as well as ICs was associated with increasing of anti-IgG antibodies titer, formation of ICs, «crescent» deposition of IgG and C3-complement, local production of the proinflammatory cytokine TNFα, аnd also with accumulation of lymphocytes in kidney tissue. These signs indicated immune inflammation, leading to experimental membrane-proliferative glomerulonephritis (PSGN. It is known that PSGN development depends on IC-binding by tissue FcγR, on complement activation as well as on tissue infiltration by macrophages/monocytes. According to the data of morphometric evaluation the nephritogenic activity of the type emm12 strains exceeded those of type emm1. On testing of three IC-binding emm12 strains in six rabbits, typical PSGN developed in 5 of them and an abortive process in 1 animal. In case of five IgG-binding type emm1 strains, out of ten rabbits full-blown PSGN was observed only in 3 of them, but abortive changes in 5 and negative result in 2 animals. No pathologic changes were elicited by the «carrier» strains of either genotype; the inability of these to bind ICs, according to literature data, could be explained by mutation in the Mga-regulator gene thereby impeding M-proteins synthesis. We conclude that isolation of type emm12 IC-binding strains at acute

  15. Fibronectin gene polymorphisms and clinical manifestations of mixed cryoglobulinemic syndrome: increased risk of lymphoma associated to MspI DD and HaeIII AA genotypes

    Directory of Open Access Journals (Sweden)

    C. Fabro

    2011-09-01

    Full Text Available Objective: To analyse FN gene polymorphisms in type II mixed cryoglobulinemic syndrome (MCsn, an immune-complex mediated systemic vasculitis linked to hepatitis C virus (HCV infection and characterized by rheumatoid factor (RF positive B-cell proliferation at high risk for the progression into non Hodgkin’s lymphoma (NHL. Methods: Samples from eighty-one patients, with MCsn (type II serum cryoglobulins and clinical signs of vasculitis were studied. Sixthy-five (65/81, 80.3% patients were HCV-positive. Twenty-one (25.9% patients had developed a B-cell NHL during the course of MCsn. Seventy-two patients with HCV-negative and MC-unrelated NHL and 110 healthy blood donors (HBDs were taken as controls. HaeIIIb and MspI FN gene polymorphisms were analysed by PCR and specific restriction enzyme digestions, following reported procedures. Plasma FN levels were analysed by ELISA, whenever possible. Results: HaeIIIb and MspI allele and genotype frequencies did not differ between MCsn patients and HBDs. Of note, the DD-MspI (OR=5.56; CI=1.67-18.51, p=0.0046 and the AA-HaeIIIb (OR=5.54; CI=1.64-18.76, p=0.0066 homozygosis appeared significantly and independently associated with the development of B-cell NHL in MCsn patients, with the HaeIIIb A allele possibly conferring an increased risk of NHL in the general population (OR=1.72, CI=1.128- 2.635, p=0.0133. In contrast, the major vasculitic manifestations, such as peripheral neuropathy, skin ulcers and glomerulonephritis tended to be associated with the counterpart MspI C allele. No association between FN plasma levels and FN genotypes was found. Conclusion: Genotyping for MspI and HaeIIIb FN gene polymorphisms may be clinically relevant to define the predisposition to the major clinical manifestations in MCsn.

  16. Higher prevalence of FTO gene risk genotypes AA rs9939609, CC rs1421085, and GG rs17817449 and saliva containing Staphylococcus aureus in obese women in Croatia.

    Science.gov (United States)

    Huđek, Ana; Škara, Lucija; Smolkovič, Barbara; Kazazić, Snježana; Ravlić, Sanda; Nanić, Lucia; Osvatić, Martina Matovinović; Jelčić, Jozo; Rubelj, Ivica; Bačun-Družina, Višnja

    2018-02-01

    Obesity is composed of multifunctional interactions of eating habits, behaviors, microbiota, genetics, and other unknown factors. We hypothesize that correlations occur between the fat mass and obesity-associated single nucleotide polymorphisms (FTO SNPs), the composition of microorganisms in the saliva, and life habits in obese women from Zagreb County. Our results of the analysis of 3 FTO SNPs showed a statistically significant positive correlation among the frequencies of the high-risk genotypes AA rs9939609 (P = .0367), CC rs1421085 (P = .0367), and GG rs17817449 (P = .0065) of the FTO gene in obese cases. Interestingly, 39.13% of obese women were triple homozygous for all 3 risk alleles. Furthermore, the composition of the oral microbiota in the obese group showed a higher occurrence of a major human pathogen, bacterium Staphylococcus aureus, but a significantly low presence of bacteria Streptococcus oralis, Streptococcus mitis, and Serratia ureilytica compared with the control group. The investigation also revealed that obese women prefer to consume candy and snacks and more meat and meat-derived products, sleep less than 6 hours per day, and had higher hypertension in comparison with the control group. These results support the hypothesis that female obesity is strongly related to all 3 variants of the FTO gene and perhaps a specific composition of microbiota in saliva due to dietary habits. Considering the bimodal distribution of the SNPs and bacterial content of saliva in obese women taken together are factors to consider for risk of obesity. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Carriers of the TCF7L2 rs7903146 TT genotype have elevated levels of plasma glucose, serum proinsulin and plasma gastric inhibitory polypeptide (GIP) during a meal test

    DEFF Research Database (Denmark)

    Gjesing, A P; Kjems, L L; Vestmar, M A

    2011-01-01

    , proinsulin, insulin, C-peptide, glucagon, glucagon-like peptide-1 (GLP-1), glucagon-like peptide-2 (GLP-2) and gastric inhibitory polypeptide (GIP) among individuals carrying the high-risk rs7903146 TT genotype and low-risk CC genotype following a meal test. Methods A meal challenge was performed in 31......, 45, 60, 75, 90, 105, 120, 135, 150, 180, 210, and 240 min after ingestion of a standardised breakfast meal. Results An elevated incremental AUC for plasma glucose was observed among TT genotype carriers (CC carriers 21.8¿±¿101.9 mmol/l¿×¿min vs TT carriers 97.9¿±¿89.2 mmol/l¿×¿min, p¿=¿0.001). TT...

  18. IL28B Gene Polymorphism SNP rs8099917 Genotype GG Is Associated with HTLV-1-Associated Myelopathy/Tropical Spastic Paraparesis (HAM/TSP) in HTLV-1 Carriers

    Science.gov (United States)

    Luiz, Olinda do Carmo; Malta, Fernanda; Pinho, João Renato Rebello; Gonçalves, Fernanda de Toledo; Duarte, Alberto Jose da Silva; de Oliveira, Augusto Cesar Penalva

    2014-01-01

    Background The polymorphisms of IL28B have been described as important in the pathogenesis of infections caused by some viruses. The aim of this research was to evaluate whether IL28B gene polymorphisms (SNP rs8099917 and SNP rs12979860) are associated with HAM/TSP. Methods The study included 229 subjects, classified according to their neurological status in two groups: Group I (136 asymptomatic HTLV-1 carriers) and Group II (93 HAM/TSP patients). The proviral loads were quantified, and the rs8099917 and rs12979860 SNPs in the region of IL28B-gene were analyzed by StepOnePlus Real-time PCR System. Results A multivariate model analysis, including gender, age, and HTLV-1 DNA proviral load, showed that IL28B polymorphisms were independently associated with HAM/TSP outcome in rs12979860 genotype CT (OR = 2.03; IC95% = 0.96–4.27) and in rs8099917 genotype GG (OR = 7.61; IC95% = 1.82–31.72). Conclusion Subjects with SNP rs8099917 genotype GG and rs12979618 genotype CT may present a distinct immune response against HTLV-1 infection. So, it seems reasonable to suggest that a search for IL28B polymorphisms should be performed for all HTLV-1-infected subjects in order to monitor their risk for disease development; however, since this is the first description of such finding in the literature, we should first replicate this study with more HTLV-1-infected persons to strengthen the evidence already provided by our results. PMID:25233462

  19. [Study on the correlation between chronic asymptomatic HBV carriers of yin asthenia constitution and genotypes of HLA-DRB1 and HLA DQA1 alleles].

    Science.gov (United States)

    Guo, Jian-chun; Xiao, Li-na; Xun, Yun-hao

    2012-08-01

    To study on the correlation between chronic asymptomatic HBV carriers (ASC) of yin asthenia constitution and genotypes of HLA-DRB1 and HLA DQA1 alleles. Totally 105 ASC were assigned to two groups according to their constitutions, i.e., the yin asthenia group (47 cases) and the non-yin asthenia group (58 cases). The genotypes of HLA-DRB1 and HLA DQA1 alleles were determined using PCR-SSP. The gene frequency of HLA-DRB1 * 09 allele and HLA-DQA1 * 0301 allele (being 12.1% and 19.1%) were obviously lower in the yin asthenia group than in the non-yin asthenia group (being 27.8% and 39.7%, P HLA-DQA1 * 0501 allele were obviously higher in the yin asthenia group (being 12.1% and 28.7%) than in the non-yin asthenia group (4.3% and 9.5%), showing statistical difference (P HLA-DQA1 * 0301 allele might be the molecular bases for non-yin asthenia patients with ASC. HLA-DRB1 * 11 allele and HLA-DQA1 * 0501 allele might be the molecular bases for yin asthenia patients with ASC.

  20. AA Index

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa index provides a long climatology of global geomagnetic activity using 2 antipodal observatories at Greenwich and Melbourne- IAGA Bulletin 37,...

  1. The ABCB1, rs9282564, AG and TT Genotypes and the COMT, rs4680, AA Genotype are Less Frequent in Deceased Patients with Opioid Addiction than in Living Patients with Opioid Addiction

    DEFF Research Database (Denmark)

    Christoffersen, Dorte J; Damkier, Per; Feddersen, Søren

    2016-01-01

    Sudden death due to acute intoxication occurs frequently in patients with opioid addiction (OA). In order to examine if certain genotypes were associated with this, we examined the frequencies of 29 SNPs located in candidate genes related to opioid pharmacology: ABCB1, OPRM1, UGT2B7, CYP3A5, CYP2B6...

  2. Abia, AA

    African Journals Online (AJOL)

    Abia, AA. Vol 4, No 6 (2010) - Articles Studies on the kinetics and intraparticle diffusivities of BOD, colour and TSS reduction from palm oil mill effluent (POME) using boiler fly ash. Abstract PDF. ISSN: 1996-0786. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More ...

  3. Adejumo, AA

    African Journals Online (AJOL)

    Adejumo, AA. Vol 6, No 2 (2014) - Articles Assessment of Tourists Flow and Revenue Generation in Kainji Lake National Park, Nigeria Abstract PDF. ISSN: 2141-1778. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and ...

  4. Adepeju, AA

    African Journals Online (AJOL)

    Adepeju, AA. Vol 19, No 2 (2010) - Articles Assessment of Ethical and Other Professional Standards in Private Medical Laboratories; Osun State Experience. Abstract. ISSN: 1116-1043. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's ...

  5. Wornyo, AA

    African Journals Online (AJOL)

    Wornyo, AA. Vol 2, No 1 (2012) - Articles Addressing the Difficulties of Learners in the Reading Class Abstract. ISSN: 2026-6081. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and Conditions of Use · Contact AJOL ...

  6. Multilocus sequence typing (MLST) of JP2 genotype isolates of Aggregatibacter actinomycetemcomitans collected from carriers of African and non-African origin

    DEFF Research Database (Denmark)

    Claesson, Rolf; Åberg, Carola Høglund; Haubek, Dorte

    The bacterium Aggregatibacter actinomycetemcomitans is associated with aggressive periodontitis. Individuals colonised with the highly leukotoxic JP2 genotype of the bacterium, are at increased risk for developing periodontitis. The JP2 genotype is considered to emerge from North Africa and subse...

  7. Serum concentration of immunoglobulin G-type antibodies against the whole Epstein-Barr nuclear antigen 1 and its aa35-58 or aa398-404 fragments in the sera of patients with systemic lupus erythematosus and multiple sclerosis.

    Science.gov (United States)

    Csuka, D; Simon, D; Hóbor, R; Uray, K; Prohászka, Z; Bánlaki, Z; Jani, P K; Szilágyi, Á; Hudecz, F; Rajczy, K; Beke, G; Boros Major, A; Tordai, A; Illés, Z; Berki, T; Czirják, L; Füst, G

    2013-03-01

    Several studies suggest that infection by Epstein-Barr virus (EBV) might be one of the environmental factors which facilitates the development of autoimmune disorders in genetically susceptible individuals. Recent data indicate that high anti-Epstein-Barr nuclear antigen 1 (EBNA)-1 immunoglobulin (Ig)G titre is a strong risk factor for multiple sclerosis (MS) in patients both with and without the main genetic predisposing trait, human leucocyte antigen (HLA)-DRB1*15:01. Because no similar studies have been published in systemic lupus erythematosus (SLE) patients, we determined the HLA-DRB1*15:01 carrier state and the serum titres against the whole EBNA-1 and its small fragments aa35-58 and aa398-404 in 301 SLE patients, 135 MS patients and in 345 healthy controls. The carrier state of the HLA-DRB1*15:01 allele was deduced from genotyping of a tagSNP (rs3135388) by applying a Taqman-based assay. The serum concentrations of antibodies to EBNA-1 and its aa35-58 or aa398-404 fragments were determined using a commercial assay (ETI-EBNA-G) and home-made enzyme-linked immunosorbent assays, respectively. The serum concentration of anti-EBNA-1 antibodies was significantly (P HLA-DRB1*15:01 carriers and non-carriers. Furthermore, titres of antibodies against the aa35-58 EBNA-1 fragment were elevated both in MS and SLE patients. By contrast, the levels of aa398-404 EBNA-1 antibodies were elevated significantly only in the SLE patients. These findings indicate that high anti-EBNA-1 IgG titres are HLA-DRB1*15:01-independent risk factors not only for MS, but also for SLE, while high antibody titres against the aa398-404 fragment are characteristic for SLE. © 2012 British Society for Immunology.

  8. Interaction with the MAPT H1H1 Genotype Increases Dementia Risk in APOE ε4 Carriers in a Population of Southern India.

    Science.gov (United States)

    Jairani, P S; Aswathy, P M; Gopala, Srinivas; Verghese, Joe; Mathuranath, P S

    2016-01-01

    This study delineates the role of the interaction of apolipoprotein E (APOE) and MAPT alleles in contributing to disease risks of dementia in a southern Indian population. A sample of 419 patients comprising Alzheimer's disease (AD; n = 156), mild cognitive impairment (MCI; n = 87), frontotemporal dementia (FTD; n = 127), vascular dementia (VD; n = 37), and dementia with Lewy bodies (DLB; n = 12) was analysed in comparison with a control group (n = 138). APOE genotyping and MAPT haplotyping were performed on all study subjects. Multivariate logistic regression analysis showed that variability on the APOE locus influenced the relative risk of dementia in the study population. The APOE ε4 allele increased the disease risk most significantly for AD (OR = 3.468, p India when compared to other dementia groups, while the transcriptional differences between MAPT haplotypes have a limited role in Indian dementia patients. © 2016 S. Karger AG, Basel.

  9. Aa Ah Nak

    Science.gov (United States)

    Tha, Na Gya; Wus, Thay

    2017-01-01

    In this article, Aa Ah Nak, the authors' methodology presents not only various reflections but also diverse contradictions about the Aa Nii language as well as language revitalization. This article explores language foundation and how the Aa Nii language revitalization is inextricably linked to the genocide and resulting historic trauma pervasive…

  10. Carrier Diagnosis

    Science.gov (United States)

    ... Inheritance of Hemophilia Definitions & Terminology Bleeding Symptoms Carrier Diagnosis When to Test for Carrier Status Family Planning and Pregnancy Conception Options Prenatal Diagnosis Fetal Sex ...

  11. AA under construction

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    The AA at an early stage of construction, in the newly built AA-Hall. Cable-trays already outline the shape of the accumulator ring. To the right are huge cable-drums for the pulse-forming-network (PFN) of the injection kicker. Seeing this picture, can one imagine that only 8 months later beams were circulating in the completed accumulator ring ?

  12. Radionuclide carriers

    International Nuclear Information System (INIS)

    Hartman, F.A.; Kretschmar, H.C.; Tofe, A.J.

    1977-01-01

    The invention provides physiologically acceptable particulate radionuclide carriers comprising a reducing agent bound to an anionic starch derivative, useful in the preparation of organ-specific diagnostic radiopharmaceuticals

  13. Geomagnetic aa Indices

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa indices are the continuation of the series beginning in the year 1868. A full description of these indices is given in the International...

  14. Radionuclide carriers

    International Nuclear Information System (INIS)

    Hartman, F.A.; Kretschmar, H.C.

    1976-01-01

    A new carrier for radionuclide technetium 99m has been prepared for scintiscanning purposes. The new preparate consists of physiologically acceptable water-insoluble Tcsup(99m)-carrier containing from 0.2 to 0.8 weight percent of stannic ion as reductor, bound to an anionic starch derivative with about 1-20% of phosphate substituents. (EG)

  15. Alcohol dehydrogenase 3 genotype as a risk factor for upper aerodigestive tract cancers

    DEFF Research Database (Denmark)

    Nishimoto, Inês Nobuko; Pinheiro, Nidia A; Rogatto, Silvia R

    2004-01-01

    for ADH3 genotypes using logistic regression models. RESULTS: After adjustment for sex, age, tobacco use, and history of cancer in first-degree family relatives, a significantly higher odds ratio for UADT cancer was observed among individuals with AA genotype and low cumulative alcohol consumption...... (among individuals with AA genotype and low tobacco consumption (adjusted model. CONCLUSIONS: These results suggest that genotype AA may......OBJECTIVE: To assess alcohol dehydrogenase 3 (ADH3) polymorphism at position Ile349Val as indicator of risk factor for upper aerodigestive tract (UADT) cancer to verify its association with UADT cancer in nonalcoholic or nonsmoking individuals. DESIGN: Cross-sectional study. SETTING: Primary care...

  16. Fred-Jaiyesimi, AA

    African Journals Online (AJOL)

    Fred-Jaiyesimi, AA. Vol 12 (2008) - Articles Hypoglycaemic And Alpha-Amylase Inhibitory Activities Of Fermented Seeds Of Parkia Biglobosa (Jacq) Benth Abstract. ISSN: 1118-6267. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's ...

  17. Associations of GSTM1*0 and GSTA1*A genotypes with the risk of cardiovascular death among hemodialyses patients.

    Science.gov (United States)

    Suvakov, Sonja; Damjanovic, Tatjana; Pekmezovic, Tatjana; Jakovljevic, Jovana; Savic-Radojevic, Ana; Pljesa-Ercegovac, Marija; Radovanovic, Slavica; Simic, Dragan V; Pljesa, Steva; Zarkovic, Milos; Mimic-Oka, Jasmina; Dimkovic, Nada; Simic, Tatjana

    2014-01-14

    The presence of glutathione transferase (GST) M1 null genotype (GSTM1-null) in end-stage renal disease (ESRD) patients is associated with lower overall survival rate in comparison to those with GSTM1-active variants. We examined association between GSTM1 and GSTT1 deletion polymorphisms as well as SNPs in GSTA1/rs3957357 and GSTP1/rs1695 genes with overall and cause-specific cardiovascular mortality in ESRD patients. Total of 199 patients undergoing hemodialysis were included in the study. Median value of time elapsed from dialysis initiation until the death, or the end of follow-up was 8 ± 5 years. The effect of GSTM1, GSTT1, GSTP1 and GSTA1 gene polymorphisms on predicting overall and specific cardiovascular outcomes (myocardial infarction, MI or stroke) was analyzed using Cox regression model, and differences in survival were determined by Kaplan-Meier. GSTM1-null genotype in ESRD patients was found to be independent predictor of overall and cardiovascular mortality. However, after false discovery rate and Bonferroni corrections this effect was lost. The borderline effect modification by wild-type GSTA1*A/*A genotype on associations between GSTM1-null and analyzed outcomes was found only for death from stroke. Homozygous carriers of combined GSTM1*0/GSTA1*A genotype exhibited significantly shorter time to death of stroke or MI in comparison with carriers of either GSTM1-active or at least one GSTA1*B gene variant. The best survival rate regarding cardiovascular outcome was found for ESRD patients with combined GSTM1-active and mutant GSTA1*B/*B genotype. Combined GSTM1*0/GSTA1*A genotypes might be considered as genetic markers for cardiovascular death risk in ESRD patients, which may permit targeting of preventive and early intervention.

  18. AL SAHLI, AA; OKOLI, JU

    African Journals Online (AJOL)

    ADOWIE PERE

    bioline.org.br/ja. The Use of Soil Palynomorphs in Forensics. *. 1. ABDULRAHAMAN, AA;. 2. AL SAHLI, AA;. 1. OKOLI, JU. 1Applied Plant Anatomy and Wood Technology Laboratory, Department of Plant Biology, University of Ilorin, Ilorin, Nigeria.

  19. Aircraft Carriers

    DEFF Research Database (Denmark)

    Nødskov, Kim; Kværnø, Ole

    as their purchases of aircraft carrier systems, makes it more than likely that the country is preparing such an acquisition. China has territorial disputes in the South China Sea over the Spratly Islands and is also worried about the security of its sea lines of communications, by which China transports the majority...... of its foreign trade, as well as its oil imports, upon which the country is totally dependent. China therefore has good reasons for acquiring an aircraft carrier to enable it to protect its national interests. An aircraft carrier would also be a prominent symbol of China’s future status as a great power......, then the country will also acquire the capability to project military power into the region beyond Taiwan, which it does not possess today. In this way, China will have the military capability to permit a change of strategy from the mainly defensive, mainland, Taiwan-based strategy to a more assertive strategy...

  20. The Antiproton Accumulator (AA)

    CERN Multimedia

    1980-01-01

    Section 06 - 08*) of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A vacuum-tank, two bending magnets (BST06 and BST07 in blue) with a quadrupole (QDN07, in red) in between, another vacuum-tank, a wide quadrupole (QFW08) and a further tank . The tanks are covered with heating tape for bake-out. The tank left of BST06 contained the stack core pickup for stochastic cooling (see 7906193, 7906190, 8005051), the two other tanks served mainly as vacuum chambers in the region where the beam was large. Peter Zettwoch works on BST06. *) see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984)

  1. AA, bending magnet, BLG

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    The very particular lattice of the AA required 2 types of dipole (bending magnets; BLG, long and narrow; BST, short and wide). The BLG had a steel length of 4.70 m, a good field width of 0.24 m, and a weight of about 70 t. Jean-Claude Brunet inspects the lower half of a BLG. For the BST magnets see 7811105 and 8006036.

  2. The Antiproton Accumulator (AA)

    CERN Multimedia

    1980-01-01

    A section of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A large vacuum-tank, a quadrupole (QDN09*), a bending magnet (BST08), another vacuum-tank, a wide quadrupole (QFW08) and (in the background) a further bending magnet (BST08). The tanks are covered with heating tape for bake-out. The tank left of QDN09 contained the kickers for stochastic pre-cooling (see 790621, 8002234, 8002637X), the other one served mainly as vacuum chamber in the region where the beam was large. Peter Zettwoch works on QFW08. * see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984) See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  3. Interleukin-6 genotypes and serum levels in Chinese Hui population.

    Science.gov (United States)

    Gao, Shu-Ping; Liang, Shu; Pan, Min; Sun, Rong-Liang; Chen, Chu; Luan, Hong; Jiang, Min-Hui

    2014-01-01

    Interleukin-6 (IL-6) is a key pro-inflammatory cytokine involved in different physiologic and pathophysiologic processes, and circulating levels of IL-6 differ greatly between individuals. The Chinese Hui is one of the largest ethnic minorities, little is known about the distribution of IL-6 genetic variations and their effects on serum levels in Hui population. The aim of the present study is to determine the prevalence of -174G/C (rs1800795), -597G/A (rs1800797), and -634C/G (rs1800796) polymorphisms in the IL-6 gene promoter region and their association with IL-6 serum levels in the Ningxia Hui population. A total of 96 Hui subjects, (57 men and 39 women; mean age 49.65 ± 19.73 years) unrelated nationality residents in Ningxia Hui Autonomous Region were enrolled. Genotyping of the three polymorphisms were performed by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) combined with gel electrophoresis and then confirmed by direct sequencing. The -174G/C (97.92% GG, 2.08% GC, and 0% CC) and -597G/A (98.96% GG, 1.04% GA, and 0% AA) polymorphisms were rare. The frequencies of -634C/G genotypes CC, CG, and GG were found to be 54.17%, 40.62%, and 5.21%, respectively in total studied subjects, the derived allele frequencies for the C and G alleles were 74.48% and 25.52%. Increased IL-6 levels were correlated with the IL-6 -634G allele carriers (CG+GG genotypes). The results suggest that IL-6 -174G/C and -597G/A are rare but -634C/G is common in the Ningxia Hui population, and the -634G allele is associated with circulating levels of IL-6.

  4. Resting-State Brain and the FTO Obesity Risk Allele: Default Mode, Sensorimotor, and Salience Network Connectivity Underlying Different Somatosensory Integration and Reward Processing between Genotypes

    Science.gov (United States)

    Olivo, Gaia; Wiemerslage, Lyle; Nilsson, Emil K.; Solstrand Dahlberg, Linda; Larsen, Anna L.; Olaya Búcaro, Marcela; Gustafsson, Veronica P.; Titova, Olga E.; Bandstein, Marcus; Larsson, Elna-Marie; Benedict, Christian; Brooks, Samantha J.; Schiöth, Helgi B.

    2016-01-01

    Single-nucleotide polymorphisms (SNPs) of the fat mass and obesity associated (FTO) gene are linked to obesity, but how these SNPs influence resting-state neural activation is unknown. Few brain-imaging studies have investigated the influence of obesity-related SNPs on neural activity, and no study has investigated resting-state connectivity patterns. We tested connectivity within three, main resting-state networks: default mode (DMN), sensorimotor (SMN), and salience network (SN) in 30 male participants, grouped based on genotype for the rs9939609 FTO SNP, as well as punishment and reward sensitivity measured by the Behavioral Inhibition (BIS) and Behavioral Activation System (BAS) questionnaires. Because obesity is associated with anomalies in both systems, we calculated a BIS/BAS ratio (BBr) accounting for features of both scores. A prominence of BIS over BAS (higher BBr) resulted in increased connectivity in frontal and paralimbic regions. These alterations were more evident in the obesity-associated AA genotype, where a high BBr was also associated with increased SN connectivity in dopaminergic circuitries, and in a subnetwork involved in somatosensory integration regarding food. Participants with AA genotype and high BBr, compared to corresponding participants in the TT genotype, also showed greater DMN connectivity in regions involved in the processing of food cues, and in the SMN for regions involved in visceral perception and reward-based learning. These findings suggest that neural connectivity patterns influence the sensitivity toward punishment and reward more closely in the AA carriers, predisposing them to developing obesity. Our work explains a complex interaction between genetics, neural patterns, and behavioral measures in determining the risk for obesity and may help develop individually-tailored strategies for obesity prevention. PMID:26924971

  5. AAS 227: Day 1

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or at astrobites.com, or catch ourlive-tweeted updates from the @astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto have so many people tell us that they already know about and useastrobites, and we were excited to introduce a new cohort of students at AAS to astrobites for the first time.Tuesday morning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended today.Opening Address (by Becky Smethurst)The President of the AAS, aka our fearless leader Meg Urry kicked off the meeting this morning at the purely coffee powered hour of 8am this morning. She spoke about the importance of young astronomers at the meeting (heres looking at you reader!) and also the importance of the new Working Group for Accessibility and Disabilities (aka WGAD pronounced like wicked) at the AAS. The Society has made extra effort this year to make the conference accessible to all,a message which was very well received by everyone in attendance.Kavli Lecture: New Horizons Alan Stern (by Becky Smethurst)We were definitely spoilt with the first Plenary lecture at this years conference Alan Stern gave us a a review of the New Horizons mission of the Pluto Fly By (astrobites covered the mission back in July with this post). We were treated to beautiful images, wonderful results and a foray into geology.Before (Hubble) and after #NewHorizons. #thatisall #science #astro alanstern #aas227 pic.twitter.com/kkMt6RsSIR Science News (@topsciencething) January 5, 2016Some awesome facts from the lecture that blew my mind:New Horizons is now 2AU (!) beyond Pluto

  6. AAS 227: Day 2

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  7. AAS 227: Day 3

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 3 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Henry Norris Russell Lecture: Viewing the Universe with Infrared Eyes: The Spitzer Space Telescope (by Erika Nesvold)The Henry Norris Russell Award is the highest honor given by the AAS, for a lifetime of eminence in astronomy research. This years award went to Giovanni Fazio of the Harvard-Smithsonian Center for Astrophysics. Fazio became a leader in gamma ray astronomy before switching mid-career to the study of infrared astronomy, and he gave his award lecture on the latter subject, specifically on the Spitzer Space Telescope, one of the most successful infrared telescopes of all time.Artists rendering of the Spitzer space telescope. [NASA/JPL-Caltech]Spitzer has been operating for more than twelve years, and has resulted in over six thousand papers in refereed journals in that time. The telescope sits in an Earth-trailing orbit around the Sun, and is now farther from the Earth (1.4 AU) than the Earth is from the Sun. Fazio gave the audience a fascinating overview of the science done by Spitzer over more than a decade. One of the most productive areas of research for Spitzer is the study of exoplanets, which hadnt even been discovered when the Spitzer Telescope was first conceived. Spitzers high sensitivity and ability to observe exoplanets over

  8. AAS 228: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors fromastrobites.com, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  9. The Drentsche Aa valley system

    International Nuclear Information System (INIS)

    Gans, W. de.

    1981-01-01

    This thesis is composed of five papers concerned with Late Quaternary geology and geomorphology of the Aa valley system. The correlation and chronostratigraphic position of the layers have been established by radiocarbon dating. (Auth.)

  10. AAS 227: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from http://web.physics.ucsb.edu/ ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  11. Immobilization of glucose isomerase onto radiation synthesized P(AA-co-AMPS hydrogel and its application

    Directory of Open Access Journals (Sweden)

    H. Kamal

    2014-04-01

    Full Text Available Isomerization of glucose to fructose was carried out using Glucose isomerase (GI that immobilized by entrapment into Poly(acrylic acid P(AA and Poly(acrylic acid-co-2-Acrylamido 2-methyl Propane sulfonic acid P(AA-co-AMPS polymer networks, the enzyme carriers were prepared by radiation induced copolymerization in the presence of (Methylene-bisacrylamide (MBAA as a crosslinking agent. The maximum gel fraction of pure P(AA and P(AA-co-AMPS hydrogel was found to be 95.2% and 89.6% for P(AA and P(AA-co-AMPS, respectively at a total dose of 20 kGy. Effects of immobilization conditions such as radiation dose, MBAA concentration, comonomer composition and amount of GI were investigated. The influence of reaction conditions on the activity of immobilized GI were studied, the optimum pH value of the reaction solution is 7.5 and reaction temperature is 65 °C. The immobilized GI into P(AA-co-AMPS and P(AA polymer networks retained 81% and 69%, respectively of its initial activity after recycled for 15 times while it retained 87% and 71%, respectively of its initial activity after stored at 4 °C for 48 days. The Km values of free and immobilized GI onto P(AA-co-AMPS and onto P(AA matrices were found to be 34, 29.2 and 14.5 mg/mL, respectively while the Vmax Values calculated to be 3.87, 1.6 and 0.79 mg/mL min, respectively. GI entrapped into P(AA-co-AMPS hydrogel show promising behavior that may be useful as the newly glucose isomerase reactor in biomedical applications.

  12. Carrier screening in the era of expanding genetic technology.

    Science.gov (United States)

    Arjunan, Aishwarya; Litwack, Karen; Collins, Nick; Charrow, Joel

    2016-12-01

    The Center for Jewish Genetics provides genetic education and carrier screening to individuals of Jewish descent. Carrier screening has traditionally been performed by targeted mutation analysis for founder mutations with an enzyme assay for Tay-Sachs carrier detection. The development of next-generation sequencing (NGS) allows for higher detection rates regardless of ethnicity. Here, we explore differences in carrier detection rates between genotyping and NGS in a primarily Jewish population. Peripheral blood samples or saliva samples were obtained from 506 individuals. All samples were analyzed by sequencing, targeted genotyping, triplet-repeat detection, and copy-number analysis; the analyses were carried out at Counsyl. Of 506 individuals screened, 288 were identified as carriers of at least 1 condition and 8 couples were carriers for the same disorder. A total of 434 pathogenic variants were identified. Three hundred twelve variants would have been detected via genotyping alone. Although no additional mutations were detected by NGS in diseases routinely screened for in the Ashkenazi Jewish population, 26.5% of carrier results and 2 carrier couples would have been missed without NGS in the larger panel. In a primarily Jewish population, NGS reveals a larger number of pathogenic variants and provides individuals with valuable information for family planning.Genet Med 18 12, 1214-1217.

  13. Allele and genotype frequencies of -β lactoglobulin gene in Iranian ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-08-04

    Aug 4, 2009 ... marker systems. β-Lactoglobulin is the major milk whey protein in the ruminants. Studies have indicated that ... Najdi cattle and buffalo. The genotype frequencies of AA, AB, and BB in Najdi cattle and buffalo were 0, ... Agarose (2.5%) electrophoresis patterns of 247 bp PCR products of β- lactoglobulin gene ...

  14. Relationship of tumor necrosis factor alpha genotypes with various biochemical parameters of normal, over weight and obese human subjects

    International Nuclear Information System (INIS)

    Raza, M.; Chaudhary, B.; Shakoori, A.R.

    2008-01-01

    Tumor Necrosis Factor (TNF-alpha) is expressed primarily in adipocytes and elevated levels of this cytokine have been associated with obesity. The purpose of this investigation was to test whether the TNF-alpha -308 polymorphism were associated with insulin resistance or obesity related traits in non-diabetic and diabetic patients visiting Sheikh Zayed Hospital, Lahore, Fatima Hospital and Irfan Clinic in Sargodha. In non diabetic subjects the AA allele carriers, compared with homozygous G allele carriers had significantly lower (28%) triglyceride values and 15% higher HDL yal ues, whereas other parameters tested 81id not show any significant variation. In diabetic patients the AA allele carriers, compared with GG allele carriers, besides having 31 % higher FBS and 26% higher creatinine, had 20% higher cholesterol and 34% higher triglycerides. The HDL values were 14% less, compared to GG allele carriers. In normal subjects (BMI 22.85:1:0.25 kgim2), the AA allele carriers showed 132%, 125%, 65% and 112% higher triglycerides, cholesterol and LDL values compared with GG allele carriers. The HDL and creatinine did not show any significant change. In the overweight subjects (BMI: 27.17+-0.17 kgim/sup 2/) all these values were lower than in AA allele carriers compared with GG allele carriers. The AA allele carries had FBS, triglycerides, cholesterol and LDL 28%, 48%, 14% and 14% lower than in the GG allele' carriers, respectively. In obese subjects, (BMI: 36.73+-0.78kgm/sup 2/), however, the FBS, triglycerides, cholesterol and creatinine values were 5%, 8%, 7% and 14% higher in AA allele carries compared to GG allele carriers, respectively. The LDL content was 8% lower in AA allele carrier as compared with the respective GG allele carriers, It is concluded that replacement of G at -308 with A leads to reduced risk for cardiovascular disease in non-diabetic subject, whereas in diabetic patients this mutation-increases the risk of CVD. Using BMI as index of obesity, it was

  15. Amino acid digestibility of different rye genotypes in caecectomised laying hens.

    Science.gov (United States)

    Zuber, Tobias; Miedaner, Thomas; Rosenfelder, Pia; Rodehutscord, Markus

    2016-12-01

    This study investigated the variability of amino acid (AA) digestibility of rye grains in laying hens. Relationships between AA digestibility and physical properties (thousand seed weight, test weight, falling number, and extract viscoelasticity), chemical composition (proximate nutrients, non-starch polysaccharides, AA, minerals, and inositol phosphates), gross energy concentration, and in vitro solubility of nitrogen (N) of the grains were also examined. Twenty rye genotypes were grown under standardised agronomic and environmental conditions as part of a collaborative research project known as "GrainUp". Each genotype was added to a basal diet at 500 g/kg at the expense of maize starch to produce 20 rye diets. The experimental design comprised four Latin Squares (6 × 6) distributed over two runs, resulting in 12 experimental periods. Caecectomised laying hens (LSL-Classic) were individually kept in metabolism cages. Excreta were collected quantitatively for 4 d, and AA digestibility of the rye genotypes was determined using a regression approach. The digestibility of AA was generally low but varied significantly among the 20 rye genotypes, especially for Lys (digestibility range 35-59%), Met (57-75%), Thr (34-54%), and Trp (36-71%). Nevertheless, physical and chemical characteristics as well as the in vitro solubility of N correlated in only a few cases with AA digestibility. Multiple linear regression was used to calculate equations to predict AA digestibility based on the analysed characteristics. However, their explanatory power, as judged by the adjusted R(2), was not sufficiently precise for practical application (below 0.6 for most AA). In conclusion, the AA digestibility of rye grain is generally low and varies significantly between crop genotypes. Equations based on its physical and chemical characteristics are not sufficiently precise to be useful for feed formulation.

  16. Quantifying uncertainty in genotype calls.

    Science.gov (United States)

    Carvalho, Benilton S; Louis, Thomas A; Irizarry, Rafael A

    2010-01-15

    Genome-wide association studies (GWAS) are used to discover genes underlying complex, heritable disorders for which less powerful study designs have failed in the past. The number of GWAS has skyrocketed recently with findings reported in top journals and the mainstream media. Microarrays are the genotype calling technology of choice in GWAS as they permit exploration of more than a million single nucleotide polymorphisms (SNPs) simultaneously. The starting point for the statistical analyses used by GWAS to determine association between loci and disease is making genotype calls (AA, AB or BB). However, the raw data, microarray probe intensities, are heavily processed before arriving at these calls. Various sophisticated statistical procedures have been proposed for transforming raw data into genotype calls. We find that variability in microarray output quality across different SNPs, different arrays and different sample batches have substantial influence on the accuracy of genotype calls made by existing algorithms. Failure to account for these sources of variability can adversely affect the quality of findings reported by the GWAS. We developed a method based on an enhanced version of the multi-level model used by CRLMM version 1. Two key differences are that we now account for variability across batches and improve the call-specific assessment of each call. The new model permits the development of quality metrics for SNPs, samples and batches of samples. Using three independent datasets, we demonstrate that the CRLMM version 2 outperforms CRLMM version 1 and the algorithm provided by Affymetrix, Birdseed. The main advantage of the new approach is that it enables the identification of low-quality SNPs, samples and batches. Software implementing of the method described in this article is available as free and open source code in the crlmm R/BioConductor package. Supplementary data are available at Bioinformatics online.

  17. Susceptibility to scrapie and disease phenotype in sheep: cross-PRNP genotype experimental transmissions with natural sources

    OpenAIRE

    González, Lorenzo; Jeffrey, Martin; Dagleish, Mark P; Goldmann, Wilfred; Sisó, Sílvia; Eaton, Samantha L; Martin, Stuart; Finlayson, Jeanie; Stewart, Paula; Steele, Philip; Pang, Yvonne; Hamilton, Scott; Reid, Hugh W; Chianini, Francesca

    2012-01-01

    Abstract It has long been established that the sheep Prnp genotype influences the susceptibility to scrapie, and some studies suggest that it can also determine several aspects of the disease phenotype. Other studies, however, indicate that the source of infection may also play a role in such phenotype. To address this question an experiment was set up in which either of two different natural scrapie sources, AAS from AA136 Suffolk and VVC from VV136 Cheviot sheep, were inoculated into AA136,...

  18. The association between Interleukin (IL)-4 gene intron 3 VNTR polymorphism and alopecia areata (AA) in Turkish population.

    Science.gov (United States)

    Kalkan, Göknur; Karakus, Nevin; Baş, Yalçın; Takçı, Zennure; Ozuğuz, Pınar; Ateş, Omer; Yigit, Serbulent

    2013-09-25

    Alopecia areata (AA) is hypothesized to be an organ-specific autoimmune disease of hair follicles mediated by T cells. As immunological and genetic factors have been implicated in the pathogenesis of AA, the purpose of the present study was to investigate possible associations between the functional Interleukin (IL)-4 gene intron 3 VNTR polymorphism and AA susceptibility and disease progression in Turkish population. The study group consisted of 116 unrelated patients with AA and 125 unrelated healthy controls. Genomic DNA was isolated and IL-4 gene 70 bp VNTR polymorphism determined by using polymerase chain reaction (PCR) with specific primers. No association was observed between AA patients and controls according to genotype distribution (p=0.051). The allele distribution of IL-4 gene intron 3 VNTR polymorphism was statistically different between AA patients and control group (p=0.026). The frequency of P1 allele in patients was significantly higher than that in the control group. When the P2P2 genotype was compared with P1P2+P1P1 genotypes, a statistically significant difference was observed between patients and controls (p=0.036). Intron 3 VNTR polymorphism in the IL-4 gene was found to be associated with AA susceptibility in Turkish population. The results suggest that IL-4 VNTR polymorphism in the intron 3 region may be a risk factor for the development of AA among Turkish population. This is the first to report that intron 3 VNTR polymorphism in the IL-4 gene is associated with AA susceptibility. © 2013.

  19. Interaction Effect between Handedness and CNTNAP2 Polymorphism (rs7794745 genotype on Voice-specific Frontotemporal Activity in Healthy Individuals: An fMRI Study

    Directory of Open Access Journals (Sweden)

    Michihiko eKoeda

    2015-04-01

    Full Text Available Recent neuroimaging studies have demonstrated that Contactin-associated protein-like2 (CNTNAP2 polymorphisms affect left-hemispheric function of language processing in healthy individuals, but no study has investigated the influence of these polymorphisms on right-hemispheric function involved in human voice perception. Further, although recent reports suggest that determination of handedness is influenced by genetic effect, the interaction effect between handedness and CNTNAP2 polymorphisms for brain activity in human voice perception and language processing has not been revealed. We aimed to investigate the interaction effect of handedness and CNTNAP2 polymorphisms in respect to brain function for human voice perception and language processing in healthy individuals. Brain function of 108 healthy volunteers (74 right-handed and 34 non-right-handed was examined while they were passively listening to reverse sentences (rSEN, identifiable non-vocal sounds (SND, and sentences (SEN. Full factorial design analysis was calculated by using three factors: 1 rs7794745 (A/A or A/T, 2 rs2710102 (G/G or A carrier (A/G and A/A, and 3 voice-specific response (rSEN or SND. The main effect of rs7794745 (A/A or A/T was significantly revealed at the right middle frontal gyrus (MFG and bilateral superior temporal gyrus (STG. This result suggests that rs7794745 genotype affects voice-specific brain function. Furthermore, interaction effect was significantly observed among MFG-STG activations by human voice perception, rs7794745 (A/A or A/T, and handedness. These results suggest that CNTNAP2 polymorphisms could be one of the important factors in the neural development related to vocal communication and language processing in both right-handed and non-right-handed healthy individuals.

  20. TERT rs2736100 genotypes are associated with differential risk of myeloproliferative neoplasms in Swedish and Chinese male patient populations.

    Science.gov (United States)

    Dahlström, Jenny; Liu, Tiantian; Yuan, Xiaotian; Saft, Leonie; Ghaderi, Mehran; Wei, Ya Bin; Lavebratt, Catharina; Li, Ping; Zheng, Chengyun; Björkholm, Magnus; Xu, Dawei

    2016-10-01

    The telomerase reverse transcriptase (TERT) gene rs2736100_C allele has recently been shown to be associated with an increased risk for myeloproliferative neoplasms (MPNs) among Caucasians. However, it is unknown if this association is present in other ethnical populations and whether rs2736100 allele frequencies mirror the incidence of MPNs in a population. Here we genotyped TERT rs2736100 variants in 126 Swedish and 101 Chinese MPN patients and their age-, sex-, and ethnically-matched healthy controls. Healthy Chinese adults had a higher frequency of the A allele and lower frequencies of the C allele compared to Swedish counterparts (57.4 vs 47.0 % for A, 42.6 vs 53.0 % for C, P = 0.006). Both Swedish and Chinese patients harbored significantly higher C allele frequency than their controls (62.7 vs 53.0 % and 57.4 vs 42.6 % for Swedish and Chinese, respectively, P = 0.004). Swedes and Chinese bearing the CC genotype had a significantly increased risk of MPN compared to AA carriers (OR = 2.47; 95 % CI: 1.33-4.57, P = 0.003, for Swedes, and OR = 3.45; 95 % CI: 1.52-7.85, P = 0.005, for Chinese). Further analyses showed that rs2736100_CC was associated with robustly enhanced risk in males only (CC vs AA, OR = 5.11; 95 % CI: 2.19-11.92, P frequency.

  1. HLA genotyping in pediatric celiac disease patients

    Science.gov (United States)

    Stanković, Biljana; Radlović, Nedeljko; Leković, Zoran; Ristić, Dragana; Radlović, Vladimir; Nikčević, Gordana; Kotur, Nikola; Vučićević, Ksenija; Kostić, Tatjana; Pavlović, Sonja; Zukić, Branka

    2014-01-01

    Celiac disease (CD) is a chronic inflammatory disease in the small intestine triggered by gluten uptake that occurs in genetically susceptible individuals. HLA-DQ2 protein encoded by HLA-DQA1*05 and DQB1*02 alleles is found in 90-95% of CD patients. All of the remaining patients carry HLA-DQ8 protein encoded by HLA-DQA1*03 and DQB1*03:02 alleles. Specific HLA-DQ genotypes define different risk for CD incidence. Presence of susceptible HLA-DQ genotypes does not predict certain disease development, but their absence makes CD very unlikely, close to 100%. Here we presented for the first time the distribution of HLA-DQ genotypes in the group of pediatric celiac patients from the University Children’s Hospital, Belgrade, Serbia and estimated risk for CD development that these genotypes confer. Seventy three celiac disease patients and 62 healthy individuals underwent genotyping for DQA1, DQB1 alleles and DRB1 allele. 94.5% of patients carried alleles that encode DQ2 protein variant and 2.7% carried alleles that encode DQ8 protein variant. Two patients carried single DQB1*02 allele. No patients were negative for all the alleles predisposing to CD. The highest HLA-DQ genotype risk for CD development was found in group of patients homozygous for DQ2.5 haplotype, followed by the group of heterozygous carriers of DQ2.5 haplotype in combination with DQB1*02 allele within the other haplotype. The lowest risk was observed in carriers of a single copy of DQB1*02 or DQA1*05 allele or other non-predisposing alleles. HLA genotyping, more informative than serological testing commonly used, proved to be a useful diagnostic tool for excluding CD development. PMID:25172978

  2. HLA genotyping in pediatric celiac disease patients

    Directory of Open Access Journals (Sweden)

    Biljana Stanković

    2014-08-01

    Full Text Available Celiac disease (CD is a chronic inflammatory disease in the small intestine triggered by gluten uptake that occurs in genetically susceptible individuals. HLA-DQ2 protein encoded by HLA-DQA1*05 and DQB1*02 alleles is found in 90-95% of CD patients. All of the remaining patients carry HLA-DQ8 protein encoded by HLA-DQA1*03 and DQB1*03:02 alleles. Specific HLA-DQ genotypes define different risk for CD incidence. Presence of susceptible HLA-DQ genotypes does not predict certain disease development, but their absence makes CD very unlikely, close to 100%. Here we presented for the first time the distribution of HLA-DQ genotypes in the group of pediatric celiac patients from the University Children’s Hospital, Belgrade, Serbia and estimated risk for CD development that these genotypes confer. Seventy three celiac disease patients and 62 healthy individuals underwent genotyping for DQA1, DQB alleles and DRB1 allele. 94.5% of patients carried alleles that encode DQ2 protein variant and 2.7% carried alleles that encode DQ8 protein variant. Two patients carried single DQB1*02 allele. No patients were negative for all the alleles predisposing to CD. The highest HLA-DQ genotype risk for CD development was found in group of patients homozygous for DQ2.5 haplotype, followed by the group of heterozygous carriers of DQ2.5 haplotype in combination with DQB1*02 allele within the other haplotype. The lowest risk was observed in carriers of a single copy of DQB1*02 or DQA1*05 allele or other non-predisposing alleles. HLA genotyping, more informative than serological testing commonly used, proved to be a useful diagnostic tool for excluding CD development.

  3. A.A., constructivism, and reflecting teams.

    Science.gov (United States)

    Nevels, B

    1997-12-01

    Numerous studies and clinical anecdotes reveal a relationship between attendance at A.A. meetings and/or degree of involvement in A.A. and maintenance of sobriety. Hypotheses as to how A.A. and/or the A.A. meeting is helpful to its members have ranged from a focus on factors common to all therapy groups, to aspects of A.A. "treatment" which are behavioral in nature. Presented here is another way of understanding A.A.'s effectiveness within the frame of more recent, constructivistic approaches to family therapy. In particular, the A.A. topic meeting is compared to the reflecting team concept of Tom Anderson.

  4. KIR genotype distribution among Lebanese patients with Hodgkin's lymphoma.

    Science.gov (United States)

    Hoteit, Rouba; Abboud, Miguel; Bazarbachi, Ali; Salem, Ziad; Shammaa, Dina; Zaatari, Ghazi; Mahfouz, Rami

    2015-06-01

    In addition to their important role in fighting infection, natural killer cells are cytotoxic to cancer cells. Studies demonstrated that some KIR genes were responsible for the reduction of the risk of Hodgkin's lymphoma (HL) while others were associated with an increased risk of HL. The aim of this study is to assess KIR genotypic distribution in Lebanese patients with Hodgkin's lymphoma. KIR genotype was analyzed in 41 HL patients and 120 healthy Lebanese individuals using the KIR Genotyping SSP kit. No significant association between HL and any KIR gene was found. Among HL patients, the AA, AB, and BB genotype frequencies were, respectively, 41.46%, 43.9% and 14.63% with an A:B ratio of 1.73:1. As for the controls, the AA, AB, and BB genotype frequencies were, respectively, 39.17%, 50%, and 10.83% with an A:B ratio of 1.79:1. In this first study from the Mediterranean region, KIR genotype does not seem to be associated with Hodgkin's lymphoma. Further clinical and translational research is needed to rule out the protective or predisposing role of KIR genes in this important clinical entity.

  5. Laboratory Astrophysics Division of the AAS (LAD)

    Science.gov (United States)

    Salama, Farid; Drake, R. P.; Federman, S. R.; Haxton, W. C.; Savin, D. W.

    2012-01-01

    The purpose of the Laboratory Astrophysics Division (LAD) is to advance our understanding of the Universe through the promotion of fundamental theoretical and experimental research into the underlying processes that drive the Cosmos. LAD represents all areas of astrophysics and planetary sciences. The first new AAS Division in more than 30 years, the LAD traces its history back to the recommendation from the scientific community via the White Paper from the 2006 NASA-sponsored Laboratory Astrophysics Workshop. This recommendation was endorsed by the Astronomy and Astrophysics Advisory Committee (AAAC), which advises the National Science Foundation (NSF), the National Aeronautics and Space Administration (NASA), and the U.S. Department of Energy (DOE) on selected issues within the fields of astronomy and astrophysics that are of mutual interest and concern to the agencies. In January 2007, at the 209th AAS meeting, the AAS Council set up a Steering Committee to formulate Bylaws for a Working Group on Laboratory Astrophysics (WGLA). The AAS Council formally established the WGLA with a five-year mandate in May 2007, at the 210th AAS meeting. From 2008 through 2012, the WGLA annually sponsored Meetings in-a-Meeting at the AAS Summer Meetings. In May 2011, at the 218th AAS meeting, the AAS Council voted to convert the WGLA, at the end of its mandate, into a Division of the AAS and requested draft Bylaws from the Steering Committee. In January 2012, at the 219th AAS Meeting, the AAS Council formally approved the Bylaws and the creation of the LAD. The inaugural gathering and the first business meeting of the LAD were held at the 220th AAS meeting in Anchorage in June 2012. You can learn more about LAD by visiting its website at http://lad.aas.org/ and by subscribing to its mailing list.

  6. Laboratory Astrophysics Division of The AAS (LAD)

    Science.gov (United States)

    Salama, Farid; Drake, R. P.; Federman, S. R.; Haxton, W. C.; Savin, D. W.

    2012-10-01

    The purpose of the Laboratory Astrophysics Division (LAD) is to advance our understanding of the Universe through the promotion of fundamental theoretical and experimental research into the underlying processes that drive the Cosmos. LAD represents all areas of astrophysics and planetary sciences. The first new AAS Division in more than 30 years, the LAD traces its history back to the recommendation from the scientific community via the White Paper from the 2006 NASA-sponsored Laboratory Astrophysics Workshop. This recommendation was endorsed by the Astronomy and Astrophysics Advisory Committee (AAAC), which advises the National Science Foundation (NSF), the National Aeronautics and Space Administration (NASA), and the U.S. Department of Energy (DOE) on selected issues within the fields of astronomy and astrophysics that are of mutual interest and concern to the agencies. In January 2007, at the 209th AAS meeting, the AAS Council set up a Steering Committee to formulate Bylaws for a Working Group on Laboratory Astrophysics (WGLA). The AAS Council formally established the WGLA with a five-year mandate in May 2007, at the 210th AAS meeting. From 2008 through 2012, the WGLA annually sponsored Meetings in-a-Meeting at the AAS Summer Meetings. In May 2011, at the 218th AAS meeting, the AAS Council voted to convert the WGLA, at the end of its mandate, into a Division of the AAS and requested draft Bylaws from the Steering Committee. In January 2012, at the 219th AAS Meeting, the AAS Council formally approved the Bylaws and the creation of the LAD. The inaugural gathering and the first business meeting of the LAD were held at the 220th AAS meeting in Anchorage in June 2012. You can learn more about LAD by visiting its website at http://lad.aas.org/ and by subscribing to its mailing list.

  7. AA, closed orbit observation pickup

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles QFW, at maximum dispersion. See also 8001372, 8001383, 8010045

  8. AA, closed orbit observation pickup

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles, QFW, at maximum dispersion. See also 8001372,8001383, 8010042

  9. AA, closed orbit observation pickup

    CERN Multimedia

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. See also 8001372, 8010042, 8010045

  10. AA, closed orbit observation pickup

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. Werner Sax contemplates his achievement. See also 8001383, 8010042, 8010045.

  11. Cardiac involvement in carriers of Duchenne and Becker muscular dystrophy.

    Science.gov (United States)

    Hoogerwaard, E M; van der Wouw, P A; Wilde, A A; Bakker, E; Ippel, P F; Oosterwijk, J C; Majoor-Krakauer, D F; van Essen, A J; Leschot, N J; de Visser, M

    1999-07-01

    A cross-sectional study in a cohort of DNA proven carriers of Duchenne (DMD) and Becker (BMD) muscular dystrophy was undertaken with the following objectives: (1) to estimate the frequency of electrocardiographic (ECG) and echocardiographic abnormalities; (2) to establish the proportion of carriers with dilated cardiomyopathy and (3) to assess possible associations between dilated cardiomyopathy and genotype. One hundred and twenty nine DMD and BMD carriers, aged 18-60 years, were traced through the files of the central register kept at the department of Human Genetics in Leiden. Investigations included full medical history, physical examination, ECG and two-dimensional and M-mode echocardiographic examination. Forty-seven percent had ECG changes. Thirty-six percent (DMD 41%, BMD 27%) had at least one abnormality as is usually found in the male patients. Echocardiographic examination was abnormal in 36% (DMD 38%, BMD 34%). Dilated cardiomyopathy was found in seven DMD carriers (8%), and in none of BMD carriers. In addition, 18% had left ventricle dilatation (DMD 19%, BMD 16%). Only 38% had a completely normal investigation of the heart. We found no association between genotype and cardiac manifestations. Our study underlines that cardiac involvement is part of the dystrophinopathies. Carriers should be told about the increased risk of this complication when asking genetic advice. It also implicates that a complete cardiological evaluation should be performed at least once in all carriers. If left ventricle dilatation or dilated cardiomyopathy is present a yearly follow up is needed, in order to start timely therapy.

  12. AAS 228: Day 3 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  13. Willis H Carrier

    Indian Academy of Sciences (India)

    New York State. His father was Duane Carrier who settled down to farming after trying his hand at various other occupations. His mother was Elizabeth Haviland, whose .... Specific Volume is the cubic meter of moist air per kg of dry air represented as m3/kg. .... Carrier converted data obtained from his tests into equations,.

  14. Peptide-Carrier Conjugation

    DEFF Research Database (Denmark)

    Hansen, Paul Robert

    2015-01-01

    To produce antibodies against synthetic peptides it is necessary to couple them to a protein carrier. This chapter provides a nonspecialist overview of peptide-carrier conjugation. Furthermore, a protocol for coupling cysteine-containing peptides to bovine serum albumin is outlined....

  15. Air Carrier Traffic Statistics.

    Science.gov (United States)

    2013-11-01

    This report contains airline operating statistics for large certificated air carriers based on data reported to U.S. Department of Transportation (DOT) by carriers that hold a certificate issued under Section 401 of the Federal Aviation Act of 1958 a...

  16. Genotype variability in composition of antioxidant vitamins and minerals in vegetable amaranth

    Directory of Open Access Journals (Sweden)

    Sarker Umakanta

    2015-01-01

    Full Text Available Twenty five vegetable amaranth genotypes were evaluated to investigate the antioxidant vitamins and minerals composition and its genetic variability in a RCBD with three replications at Bangabandhu Sheikh Mujibur Rahman Agricultural University in Bangladesh during kharif1 season 2012 and 2013, respectively. Significant Mean Sum of Square revealed a wide range of genotypic variability among traits. Vegetable amaranth was rich in iron, zinc, manganese, magnesium and potassium. Ten strains gave the best (more than 5 kg foliage yield with rich in antioxidant minerals and vitamins. Selection of these genotypes would be economically useful for antioxidant vitamins, minerals and yield aspects. On the other hand, eight genotypes had high amounts of antioxidant vitamins and minerals with below average foliage yield and could be utilized as donor parents for introgression of genes in vitamins and minerals deficient lines. Considering genetic parameter six traits i e., Fe, Zn, Mn, ascorbic acid, number of leaves plant and foliage yield would be selected for the improvement of vegetable amaranth genotypes under study. However, correlation study revealed that selection based on Fe, Mn, ascorbic acid and number of leaves per plant could lead to increase the foliage yield of vegetable amaranth strains. Insignificant genotypic correlations between foliage yield with most of the antioxidant vitamins and minerals traits indicating that selection for high vitamins and minerals content might be possible without compromising yield loss. Based on mean, genetic parameters and correlation coefficient values, five vegetable amaranth genotypes i. e., AA19, AA10, AA3, AA24 and AA7 might be selected as high vitamin and minerals containing high yielding vegetable amaranth varieties.

  17. A retrospective study on fourteen year hemoglobin genotype ...

    African Journals Online (AJOL)

    This suggests the possibility of many other residents in the capital city of Ondo state carrying the abnormal forms of hemoglobin genotype, and calling for more efforts in the area of genetic counseling. The gene frequencies of A, S, and C were 0.91, 0.08 and 0.01, respectively. The prevalence of HbAA in this study has been ...

  18. AAS 228: Day 1 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Come visit astrobites at the AAS booth we have swag!Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto hear from undergrads who already know and love the site, educators who want to use it in their classrooms, and students who had not yet been introduced to astrobites and were excited about a new resource!For the rest of the meeting we will be stationed at theAAS booth in the exhibit hall (booth #211-213), so drop by if you want to learn more (or pick up swag: weve got lots of stickers and sunglasses)!Mondaymorning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended this morning.Opening Address(by Susanna Kohler)AAS President Meg Urry kicked off the meeting this morning at 8am with an overview of some of the great endeavors AAS is supporting. We astrobiters had personal motivation to drag ourselves out of bed that early: during this session, Urryannounced the new partnership between AAS and astrobites!Urry touched on some difficult topics in her welcome, including yesterdays tragedy in Orlando. Shereiteratedthe AASs support fortheCommittee for Sexual-Orientation and Gender Minorities in Astronomy (SGMA). She also reminded meeting attendees about the importance ofkeeping conference interactions professional, and pointed to the meetings anti-harassment policy.Partnership Announcement (by Michael Zevin)This morning, the American Astronomical Society announced the new partnership that it will have with Astrobites! We are beyond excited to embark on this new partnership with the

  19. Early-Life Adversity Interacts with FKBP5 Genotypes: Altered Working Memory and Cardiac Stress Reactivity in the Oklahoma Family Health Patterns Project.

    Science.gov (United States)

    Lovallo, William R; Enoch, Mary-Anne; Acheson, Ashley; Cohoon, Andrew J; Sorocco, Kristen H; Hodgkinson, Colin A; Vincent, Andrea S; Goldman, David

    2016-06-01

    Exposure to stress during critical periods of development can have adverse effects on adult health behaviors, and genetic vulnerabilities may enhance these stress effects. We carried out an exploratory examination of psychological, physiological, and behavioral characteristics of 252 healthy young adults for the impact of early-life adversity (ELA) in relation to the G-to-A single nucleotide polymorphism (SNP), rs9296158, of the FKBP5 gene. FKBP5 is a molecular cochaperone that contributes to the functional status of the glucocorticoid receptor (GR) and to the quality of corticosteroid signaling. FKBP5 expression is upregulated by cortisol exposure during stressful episodes, with greater upregulation seen in A-allele carriers. As such, FKBP5 expression and GR function may be environmentally sensitive in A-allele carriers and therefore suitable for the study of gene-by-environment (G × E) interactions. Compared with FKBP5, GG homozygotes (N=118), A-allele carriers (N = 132) without psychiatric morbidity had progressively worse performance on the Stroop color-word task with increasing levels of ELA exposure (Genotype × ELA, F=5.14, P=0.007), indicating a G × E interaction on working memory in early adulthood. In addition, heart rate response to mental stress was diminished overall in AA/AG-allele carriers (F=5.15, P=0.024). Diminished working memory and attenuated autonomic responses to stress are both associated with risk for alcoholism and other substance use disorders. The present data suggest that FKBP5 in the GR pathway may be a point of vulnerability to ELA, as seen in this group of non-traumatized young adults. FKBP5 is accordingly a potential target for more extensive studies of the impact of ELA on health and health behaviors in adulthood.

  20. Genotype to phenotype

    National Research Council Canada - National Science Library

    Malcolm, Sue; Goodship, Timothy H. J

    2001-01-01

    ... Disorders Molecular Genetics of Hypertension Human Gene EvolutionAnalysis of Multifactorial Disease Transcription Factors Molecular Genetics of Cancer, Second edition Genotype to Phenotype, second e...

  1. (PCL/AA) hydrogel for controlled drug delivery

    Indian Academy of Sciences (India)

    Administrator

    PCL-g-AA) on the .... Solvent replacement method was used for porosity meas- urement. Weighed dried discs were immersed in .... Regression coefficient (r) values obtained from PCL/AA hydrogels at varying contents of AA and EGDMA are.

  2. Standardized ileal digestibility of amino acids in eight genotypes of soft winter wheat fed to growing pigs

    DEFF Research Database (Denmark)

    Rosenfelder, P; Mosenthin, R; Spindler, H K

    2015-01-01

    –column design with 9 pigs and 8 periods of 6 d each. Wheat was the sole dietary source of CP and AA. Among the 8 wheat genotypes, contents of CP ranged from 10.9 to 13.3% (as-fed basis), whereas contents of total nonstarch polysaccharides ranged from 8.0 to 9.4% (as-fed basis). The SID of CP in the 8 genotypes...... such as fiber fractions are not suitable due to low variation among the 8 genotypes. The present study provides a comprehensive database on nutritional composition and SID of CP and AA of 8 wheat genotypes grown under identical conditions. Because the SID values in these genotypes are lower when compared...

  3. (Cyamopsis tetragonoloba) genotypes

    Indian Academy of Sciences (India)

    Molecular assessment of genetic diversity in cluster bean. (Cyamopsis tetragonoloba) genotypes. Rakesh Pathak, S. K. Singh, Manjit Singh and A. Henry. J. Genet. 89, 243–246. Figure 1. RAPD profile of 1–16 Cyamopsis tetragonoloba genotypes amplified with arbitrary primer OPA-16. Figure 2. RAPD profile of 17–32 ...

  4. (Prunus armeniaca L.) genotypes

    African Journals Online (AJOL)

    STORAGESEVER

    2009-03-20

    Mar 20, 2009 ... Table 2. Leaf stomatal frequency, stomata size and stomatal conductance of apricot genotypes. Stomatal conductance (mmol m-2 s-1). Apricot genotype. Stomata frequency. (number/mm2). Stomata size. (μm). 2006. 2007. Orange Red. 349.0 a. 71.6 abc. 192 a-d. 176 bc. Palstein. 311.7 ab. 76.6 abc.

  5. First circulating beam in the AA

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.56 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are too numerous to name them all, but the 3 most prominent ones are at the centre (left to right): Roy Billinge (Joint AA Project Leader, with his hand on the control box), Eifionydd Jones (white shirt), Simon van der Meer (spiritus rector and Joint AA Project Leader). The first antiprotons were injected, made to circulate and cooled soon after, on 14 July 1980.

  6. AAS 228: Day 3 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session 2015 Newton Lacy Pierce Prize Lecture: The Elephant in the Room: Effects of Distant, Massive Companions on Planetary System Architectures (by Leonardo dos Santos)The first session on Wednesday at 228th AAS Meeting was the Newton Lacy Pierce Prize Lecture by Heather Knutson (California Institute of Technology). This talk featured a broad range of research efforts on exoplanets, with the main focus on how we study the composition of their atmospheres, and how multi-body interactions carve the structure of the planetary systems we observe.One of her first points is the well-known idea that the Solar System is an oddball, compared to the exoplanet systems we have found so far: most of these systems contain hot Jupiters and mini-Neptunes at very close-in orbits around their host stars. Moreover, even when studying their transmission spectra, it is difficult to know the exact composition of their atmospheres.Knutson: it is difficult to constrain atmospheric composition of exoplanets (H-poor or H-rich+clouds?) #aas228pic.twitter.com/LdyN4o9RC7 astrobites (@astrobites) June 15, 2016The main proposal on how these systems formed is the migration scenario. In order to validate this idea, Dr. Knutson and her group The Friends of Hot Jupiters study systems with close-in gas giants and their frequency of binary companions, which are supposed to be the main culprits causing gas-giant migration. They found that approximately half of the observed systems have long-distance companions, providing strong validation of the migration scenario. Moreover, Dr. Knutson speculates that wide binaries have more

  7. Components of litter size in gilts with different prolactin receptor genotypes

    NARCIS (Netherlands)

    Rens, van B.T.T.M.; Evans, G.J.; Lende, van der T.

    2003-01-01

    Behavioral estrus and components of litter size at Day 35/36 of pregnancy were studied in gilts with prolactin receptor (PRLR) genotype AA (n = 9), AB (n = 25), and BB (n = 22). This PRLR polymorphism (two alleles, A and B) has been associated with litter size, although it is not known whether the

  8. Combined genotype and haplotype distributions of MTHFR C677T and A1298C polymorphisms

    Science.gov (United States)

    Fan, Shujun; Yang, Boyi; Zhi, Xueyuan; Wang, Yanxun; Zheng, Quanmei; Sun, Guifan

    2016-01-01

    Abstract Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms are, independently and/or in combination, associated with many disorders. However, data on the combined genotype and haplotype distributions of the 2 polymorphisms in Chinese population were limited. We recruited 13,473 adult women from 9 Chinese provinces, collected buccal cell samples, and determined genotypes, to estimate the combined genotype and haplotype distributions of the MTHFR C677T and A1298C polymorphisms. In the total sample, the 6 common combined genotypes were CT/AA (29.5%), TT/AA (21.9%), CC/AA (15.4%), CC/AC (14.9%), CT/AC (13.7%), and CC/CC (3.4%); the 3 frequent haplotypes were 677T-1298A (43.6%), 677C-1298A (37.9%), and 677C-1298C (17.6%). Importantly, we observed that there were 51 (0.4%) individuals with the CT/CC genotype, 92 (0.7%) with the TT/AC genotype, 17 (0.1%) with the TT/CC genotype, and that the frequency of the 677T-1298C haplotype was 0.9%. In addition, the prevalence of some combined genotypes and haplotypes varied among populations residing in different areas and even showed apparent geographical gradients. Further linkage disequilibrium analysis showed that the D’ and r2 values were 0.883 and 0.143, respectively. In summary, the findings of our study provide further strong evidence that the MTHFR C677T and A1298C polymorphisms are usually in trans and occasionally in cis configurations. The frequencies of mutant genotype combinations were relatively higher in Chinese population than other populations, and showed geographical variations. These baseline data would be useful for future related studies and for developing health management programs. PMID:27902594

  9. AAS 228: Day 1 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session: From Space Archeology to Serving the World Today: A 20-year Journey from the Jungles of Guatemala to a Network of Satellite Remote Sensing Facilities Around the World(by Michael Zevin)In the conferences second plenary session, NASAs Daniel Irwin turned the eyes of the conference back to Earth by highlighting the huge impact that NASA missions play in protecting and developing our own planet.Daniel Irwin: using satellite imagery to detect differences in vegetation and find ancient Mayan cities. #aas228 pic.twitter.com/9LFPQdCHTM astrobites (@astrobites) June 13, 2016Irwin came to be involved in NASA through his work mapping Guatemalan jungles, where he would spend 22 days at a time exploring the treacherous jungles on foot armed with a 1st generation GPS, a compass, and a machete. A colleague introduced Irwin to the satellite imagery thathe was exploring, demonstratinghow these images are a strong complement to field work. The sharing of this satellite data with nearby villages helped to show the encroachment of agriculture and the necessity of connecting space to the village. Satellite imagery also played a role in archeological endeavors, uncovering dozens of Mayan cities that have been buried for over a millennia by vegetation, and it provided evidence that the fall of the Mayan civilization may have been due to massive deforestation that ledto drought.Glacial retreat in Chile imaged by ISERV.Irwin displayed the constellation of NASAs Earth-monitoring satellites that have played an integral role in conserving our planet and alerting the world of natural disasters. He also showed

  10. Magnetic horn of the Antiproton Accumulator (AA)

    CERN Multimedia

    Photographic Service

    1988-01-01

    In the 1960s, the invention of this "current sheet lens" has helped to greatly improve the flux of neutrino beams. It was used again at the AA, collecting antiprotons from the production target at angles too large to fit into the acceptance of the AA. It was machined from aluminium to a thickness of 1.4 mm and pulsed at 400 kA for 15 microseconds (half-sine).

  11. Duchenne muscular dystrophy carriers

    International Nuclear Information System (INIS)

    Matsumura, K.; Nakano, I.

    1989-01-01

    By means of magnetic resonance imaging (MRI), the proton spin-lattice relaxation times (T1 values) of the skeletal muscles were measured in Duchenne muscular dystrophy (DMD) carriers and normal controls. The bound water fraction (BWF) was calculated from the T1 values obtained, according to the fast proton diffusion model. In the DMD carriers, T1 values of the gluteus maximus and quadriceps femoris muscles were significantly higher, and BWFs of these muscles were significantly lower than in normal control. Degenerative muscular changes accompanied by interstitial edema were presumed responsible for this abnormality. No correlation was observed between the muscle T1 and serum creatine kinase values. The present study showed that MRI could be a useful method for studying the dynamic state of water in both normal and pathological skeletal muscles. Its possible utility for DMD carrier detection was discussed briefly. (orig.)

  12. APOE Genotyping, Cardiovascular Disease

    Science.gov (United States)

    ... it ordered? As a test to evaluate lipid metabolism or cardiovascular risk, APOE genotyping is ordered when someone has: Significantly elevated cholesterol and triglyceride levels that do not respond to dietary and ...

  13. Interaction of parental KIR and fetal HLA-C genotypes with the risk of preeclampsia.

    Science.gov (United States)

    Yu, Hong; Pan, Ning; Shen, Yang; Jin, Shuo; Zhai, Jingli; Qiao, Dongyan; Shen, Yanting; Miao, Fengqin; Wang, Lina; He, Youji; Ren, Mulan; Zhang, Jianqiong

    2014-11-01

    The aim of this study is to investigate whether certain combination of maternal killer cell immunoglobulin-like receptors (KIR) and fetal human leukocyte antigen-C (HLA-C) is risk for preeclampsia in the Chinese Han population. A case-control study was conducted in 47 pregnant women with preeclampsia and 54 normal pregnant women. Twelve KIR genes were genotyped by PCR-sequence-specific primer in mothers. High-resolution HLA-C genotyping was performed in couples and fetuses by a routine sequencing-based typing method. The frequency of KIR2DS1 was decreased (p = 0.028) and AA genotype was increased (p = 0.017) in preeclampsia compared with controls. More women with KIR AA genotype have fewer C2 genes than their fetuses in preeclampsia than controls. Women with KIR AA genotype and fewer C2 genes than their fetuses were at risk for preeclampsia in the Chinese Han population, supporting that maternal-fetal KIR-HLA-C interaction plays an important role in preeclampsia development.

  14. Spatial pattern separation differences in older adult carriers and non-carriers for the apolipoprotein E epsilon 4 allele.

    Science.gov (United States)

    Sheppard, David P; Graves, Lisa V; Holden, Heather M; Delano-Wood, Lisa; Bondi, Mark W; Gilbert, Paul E

    2016-03-01

    We examined the performance of healthy young (n=57) and older adults (n=43) genotyped as apolipoprotein E-ε4 (APOE-ε4) carriers or APOE-ε4 non-carriers on a delayed match-to-sample task involving varying degrees of spatial interference hypothesized to assess spatial pattern separation. Older adult ε4 carriers were further divided into "impaired" and "unimpaired" groups based on their performance on a standardized test of verbal memory. We found that performance on the spatial pattern separation test increased as a function of decreased spatial interference across all groups. The older ε4 carriers in the impaired group performed significantly worse (ppattern separation may be less efficient in a subset of healthy older adults with subtle memory decline who are carriers of the ε4 allele. However, pattern separation performance may be comparable to that of young adults in a subset of older adult ε4 carriers and more broadly among non-carriers. Our findings offer additional evidence that pattern separation may vary in older adults, and they provide novel insight into pattern separation efficiency in ε4-positive older adults. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Effect of supplementation of arachidonic acid (AA) or a combination of AA plus docosahexaenoic acid on breastmilk fatty acid composition

    NARCIS (Netherlands)

    Smit, EN; Koopmann, M; Boersma, ER; Muskiet, FAJ

    We investigated whether supplementation with arachidonic acid (20:4 omega 6; AA), ora combination of AA and docosahexaenoic acid (22:6 omega 3; DHA) would affect human milk polyunsaturated fatty acid (PUFA) composition. Ten women were daily supplemented with 300 mg AA, eight with 300 mg AA, 110 mg

  16. Willis H Carrier

    Indian Academy of Sciences (India)

    Permanent link: http://www.ias.ac.in/article/fulltext/reso/017/02/0117-0138. Keywords. W H Carrier; rational psychrometric formulae; psychrometric chart; invention of centrifugal machine; law of dew-point depression. Author Affiliations. R V Simha1. Director Airtron Consulting Engineers Pvt Ltd, No. 502/A, Ist Main Jayanagar ...

  17. Asymmetric Carrier Random PWM

    DEFF Research Database (Denmark)

    Mathe, Laszlo; Lungeanu, Florin; Rasmussen, Peter Omand

    2010-01-01

    index. The flat motor current spectrum generates an acoustical noise close to the white noise, which may improve the acoustical performance of the drive. The new carrier wave is easy to implement digitally, without employing any external circuits. The modulation method can be used in open, as well...

  18. Willis H Carrier

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 17; Issue 2. Willis H. Carrier - Father of Air Conditioning. R V Simha. General Article Volume 17 Issue 2 February 2012 pp 117-138. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/017/02/0117-0138 ...

  19. Obesity is a significant susceptibility factor for idiopathic AA amyloidosis.

    Science.gov (United States)

    Blank, Norbert; Hegenbart, Ute; Dietrich, Sascha; Brune, Maik; Beimler, Jörg; Röcken, Christoph; Müller-Tidow, Carsten; Lorenz, Hanns-Martin; Schönland, Stefan O

    2018-01-24

    To investigate obesity as susceptibility factor in patients with idiopathic AA amyloidosis. Clinical, biochemical and genetic data were obtained from 146 patients with AA amyloidosis. Control groups comprised 40 patients with long-standing inflammatory diseases without AA amyloidosis and 56 controls without any inflammatory disease. Patients with AA amyloidosis had either familial Mediterranean fever (FMF) or long-standing rheumatic diseases as underlying inflammatory disease (n = 111, median age 46 years). However, in a significant proportion of patients with AA amyloidosis no primary disease was identified (idiopathic AA; n = 37, median age 60 years). Patients with idiopathic AA amyloidosis were more obese and older than patients with AA amyloidosis secondary to FMF or rheumatic diseases. Serum leptin levels correlated with the body mass index (BMI) in all types of AA amyloidosis. Elevated leptin levels of more than 30 µg/l were detected in 18% of FMF/rheumatic + AA amyloidosis and in 40% of patients with idiopathic AA amyloidosis (p = .018). Finally, the SAA1 polymorphism was confirmed as a susceptibility factor for AA amyloidosis irrespective of the type of the disease. Obesity, age and the SAA1 polymorphism are susceptibility factors for idiopathic AA amyloidosis. Recent advances in treatment of FMF and rheumatic disorders will decrease the incidence of AA amyloidosis due to these diseases. Idiopathic AA, however, might be an emerging problem in the ageing and increasingly obese population.

  20. AAS 228: Day 2 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  1. The JP2 genotype of Aggregatibacter actinomycetemcomitans and marginal periodontitis in the mixed dentition

    DEFF Research Database (Denmark)

    Jensen, Anne Birkeholm; Ennibi, Oum Keltoum; Ismaili, Zouheir

    2016-01-01

    AIM: To perform a cross-sectional study on the carrier frequency of JP2 and non-JP2 genotypes of A. actinomycetemcomitans in Moroccan schoolchildren and relate the presence of these genotypes to the periodontal status in the mixed dentition. MATERIAL AND METHODS: A plaque sample from 513 children...... the JP2 genotype and 186 (36.3%) were positive for non-JP2 genotypes, whereas A. actinomycetemcomitans could not be detected in the remaining 281 subjects. Among 75 subjects with mixed dentition and selected for clinical examination, clinical attachment loss (CAL) ≥3 mm at two or more periodontal sites...

  2. The AA disappearing under concrete shielding

    CERN Multimedia

    CERN PhotoLab

    1982-01-01

    When the AA started up in July 1980, the machine stood freely in its hall, providing visitors with a view through the large window in the AA Control Room. The target area, in which the high-intensity 26 GeV/c proton beam from the PS hit the production target, was heavily shielded, not only towards the outside but also towards the AA-Hall. However, electrons and pions emanating from the target with the same momentum as the antiprotons, but much more numerous, accompanied these through the injection line into the AA ring. The pions decayed with a half-time corresponding to approximately a revolution period (540 ns), whereas the electrons lost energy through synchrotron radiation and ended up on the vacuum chamber wall. Electrons and pions produced the dominant component of the radiation level in the hall and the control room. With operation times far exceeding original expectations, the AA had to be buried under concrete shielding in order to reduce the radiation level by an order of magnitude.

  3. AAS 228: Day 2 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  4. Campylobacter concisus: an evaluation of certain phenotypic and genotypic characteristics

    DEFF Research Database (Denmark)

    Engberg, J.; Bang, D. D.; Aabenhus, R.

    2005-01-01

    primers identified 37 unique profiles, but requires further evaluation. The isolates obtained from healthy carriers were distinguished by cluster analysis from the isolates obtained from patients with diarrhoea. All the isolates were susceptible to 11 antimicrobial agents tested. Overall......, there was considerable variability between the C. concisus isolates, but there were no clear phenotypic or genotypic differences between isolates from patients with diarrhoea and isolates from healthy carriers. Further evidence is needed to support the possible role of C. concisus as a human enteric pathogen....

  5. Detection of AA76, a Common Form of Amyloid A Protein, as a Way of Diagnosing AA Amyloidosis.

    Science.gov (United States)

    Sato, Junji; Okuda, Yasuaki; Kuroda, Takeshi; Yamada, Toshiyuki

    2016-01-01

    Reactive amyloid deposits consist of amyloid A (AA) proteins, the degradation products of serum amyloid A (SAA). Since the most common species of AA is the amino terminal portion produced by cleavage between residues 76 and 77 of SAA (AA76), the presence of AA76 in tissues could be a consequence of AA amyloid deposition. This study assessed the diagnostic significance of the detection of AA76 for AA amyloidosis using two different approaches. Biopsy specimens (n=130 from 54 subjects) from gastroduodenal mucosa or abdominal fat (n=9 from 9 subjects) of patients who had already been diagnosed with or were suspected of having AA amyloidosis were used. Fixed mucosal sections were subjected to immunohistochemistry using a newly developed antibody recognizing the carboxyl terminal end of AA76 (anti-AA76). The non-fixed materials from gastroduodenal mucosa or abdominal fat were subjected to immunoblotting for detection of the size of AA76. Among the gastroduodenal specimens (n=115) from already diagnosed patients, the positive rates of Congo red staining, immunohistochemistry using anti-AA76, and immunoblotting were 68.4%, 73.0%, and 92.2%, respectively. The anti-AA76 did not stain the supposed SAA in the blood or leakage, which was stained by anti-SAA antibody. AA76 was not detected either by immunohistochemistry or by immunoblot in the materials from patients in whom AA amyloidosis had been ruled out. In the abdominal fat, the immunoblot detected AA76 in 8 materials from 8 already diagnosed patients and did not in 1 patient whose gastroduodenal mucosa was negative. In conclusion, the detection of AA76 may alter the ability to diagnose AA amyloidosis. In immunohistochemistry for fixed specimens, the new anti-AA76 antibody can improve the specificity. Immunoblot for non-fixed materials, which can considerably improve the sensitivity, should be beneficial for small materials like abdominal fat. © 2016 by the Association of Clinical Scientists, Inc.

  6. Yarn carrier with clutch

    Science.gov (United States)

    Doyne, Richard A. (Inventor); Benson, Rio H. (Inventor); El-Shiekh, Aly (Inventor)

    1994-01-01

    A yarn carrier apparatus particularly suited for use in braiding machinery or the like due to its capability of continuous yarn feeding and retraction of long lengths of yarn. The yarn carrier apparatus comprises a yarn supply spool which is rotatably mounted within the housing, a spring motor also mounted within the housing and operatively connected to the yarn supply spool through a mechanical transmission assembly which is adapted to multiply rotational movement between the first element of the gear assembly operatively connected to the spring motor and the final element of the gear assembly operatively connected to the yarn supply spool. The spring motor is adapted to tension the yarn during both feeding and retraction thereof, and it is further adapted to periodically rotatably slip within the housing and partially unwind so as to allow for continuous withdrawal of a long length of yarn without the spring motor becoming fully wound and preventing further yarn retraction.

  7. Carrier transport uphill. I. General

    DEFF Research Database (Denmark)

    Rosenberg, T; Wilbrandt, W

    1963-01-01

    A quantitative treatment of a carrier pump operating with two carrier forms C and Z is presented. Asymmetric metabolic reactions are assumed to transform Z into C on one and C into Z on the other side of the membrane, establishing a carrier cycle. The kinetical consequences of this mechanism...

  8. Microneedle-mediated transdermal delivery of nanostructured lipid carriers for alkaloids from Aconitum sinomontanum.

    Science.gov (United States)

    Guo, Teng; Zhang, Yongtai; Li, Zhe; Zhao, Jihui; Feng, Nianping

    2017-09-12

    A combination method using microneedle (MN) pretreatment and nanostructured lipid carriers (NLCs) was developed to improve the transdermal delivery of therapeutics. The MN treatment of the skin and co-administration of NLCs loaded with total alkaloids isolated from Aconitum sinomontanum (AAS-NLCs) significantly increased the skin permeation of the drugs. Fluorescence imaging confirmed that MNs could provide microchannels penetrating the stratum corneum, and delivery of NLCs through the channels led to their deeper permeation. In vivo studies showed that combination of AAS-NLCs with MNs (AAS-NLCs-MN) in transdermal delivery could improve the bioavailability and maintain stable drug concentrations in the blood. Moreover, AAS-NLCs-MN showed benefits in eliminating paw swelling, decreasing inflammation and pain, and regulating immune function in adjuvant arthritis rats. After administration of AAS-NLCs-MN, no skin irritation was observed in rabbits, and electrocardiograms of rats showed improved arrhythmia. These results indicated that the dual approach combining MN insertion and NLCs has the potential to provide safe transdermal delivery and to improve the therapeutic efficacy through sustained release of AAS.

  9. Genotype 1 hepatitis C virus envelope features that determine antiviral response assessed through optimal covariance networks.

    Directory of Open Access Journals (Sweden)

    John M Murray

    Full Text Available The poor response to the combined antiviral therapy of pegylated alfa-interferon and ribavarin for hepatitis C virus (HCV infection may be linked to mutations in the viral envelope gene E1E2 (env, which can result in escape from the immune response and higher efficacy of viral entry. Mutations that result in failure of therapy most likely require compensatory mutations to achieve sufficient change in envelope structure and function. Compensatory mutations were investigated by determining positions in the E1E2 gene where amino acids (aa covaried across groups of individuals. We assessed networks of covarying positions in E1E2 sequences that differentiated sustained virological response (SVR from non-response (NR in 43 genotype 1a (17 SVR, and 49 genotype 1b (25 SVR chronically HCV-infected individuals. Binary integer programming over covariance networks was used to extract aa combinations that differed between response groups. Genotype 1a E1E2 sequences exhibited higher degrees of covariance and clustered into 3 main groups while 1b sequences exhibited no clustering. Between 5 and 9 aa pairs were required to separate SVR from NR in each genotype. aa in hypervariable region 1 were 6 times more likely than chance to occur in the optimal networks. The pair 531-626 (EI appeared frequently in the optimal networks and was present in 6 of 9 NR in one of the 1a clusters. The most frequent pairs representing SVR were 431-481 (EE, 500-522 (QA in 1a, and 407-434 (AQ in 1b. Optimal networks based on covarying aa pairs in HCV envelope can indicate features that are associated with failure or success to antiviral therapy.

  10. Dicty_cDB: FC-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA02 (Link to dictyBase) - - - Contig-U16527-1 FC-AA02Z (Li...nk to Original site) - - FC-AA02Z 458 - - - - Show FC-AA02 Library FC (Link to library) Clone ID FC-AA02 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA02Q.Seq.d/ Representative seq. ID FC-AA...02Z (Link to Original site) Representative DNA sequence >FC-AA02 (FC-AA02Q) /CSM/FC/FC-AA/FC-AA02Q.Seq.d/ XXXXXXXXXXCAAAAA...GGCTCCTGGTCCGGAAGGATTGGGTAATCATTTGAATTTCCTAC GTAACTGGGCTTGATCTTTGTAATTATTGATCATAAACGAGGAATTCCTTGTAAGCGTAA

  11. Dicty_cDB: FCL-AA04 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA04 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA04Z ...(Link to Original site) - - FCL-AA04Z 530 - - - - Show FCL-AA04 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA04Q.Seq.d/ Representative seq. ID FCL-AA...04Z (Link to Original site) Representative DNA sequence >FCL-AA04 (FCL-AA04Q) /CSM/FCL/FCL-AA/FCL-AA...04Q.Seq.d/ XXXXXXXXXXCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTTCAGTCAAAGAAATT AAAAGAGGTATGGTCGCTGGTGACTCCAAAAACGATCCACCACAAGAAA

  12. Dicty_cDB: FCL-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA03 (Link to dictyBase) - - - Contig-U15092-1 FCL-AA03E ...(Link to Original site) - - - - - - FCL-AA03E 627 Show FCL-AA03 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA03Q.Seq.d/ Representative seq. ID FCL-AA...03E (Link to Original site) Representative DNA sequence >FCL-AA03 (FCL-AA03Q) /CSM/FCL/FCL-AA/FCL-AA...03Q.Seq.d/ ACATAATGTTCCAAAAGAAAGCAATTGTTATTGATGGCAAAGGTCATTTGTTAGGTCGTT TAGCCTCCGTTGTTGCTAAATCCCTCCTCTCTGGTCAAAA

  13. Dicty_cDB: FCL-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA09 (Link to dictyBase) - - - Contig-U16453-1 FCL-AA09F ...(Link to Original site) FCL-AA09F 485 - - - - - - Show FCL-AA09 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ Representative seq. ID FCL-AA...09F (Link to Original site) Representative DNA sequence >FCL-AA09 (FCL-AA09Q) /CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ GACAA...AAGTAAATAAAACATGTCCGCAAGTAATAAAGATGACCAACTCATGAAAAATGAG TTCGAAAGTACCTACGACAAAATTGTCGATTCATTCGACAA

  14. Dicty_cDB: FCL-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA08 (Link to dictyBase) - - - Contig-U16200-1 FCL-AA08Z ...(Link to Original site) - - FCL-AA08Z 574 - - - - Show FCL-AA08 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA08Q.Seq.d/ Representative seq. ID FCL-AA...08Z (Link to Original site) Representative DNA sequence >FCL-AA08 (FCL-AA08Q) /CSM/FCL/FCL-AA/FCL-AA...08Q.Seq.d/ XXXXXXXXXXTCGAAGCCAAAGGTCGTCTCGAAGAAGAATTCCATCGCTCGTACCAACTC TGATCGTTCAAGAAAGAGACTCGAAGCTGAAA

  15. Dicty_cDB: FCL-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA10 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA10Z ...(Link to Original site) - - FCL-AA10Z 627 - - - - Show FCL-AA10 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA10Q.Seq.d/ Representative seq. ID FCL-AA...10Z (Link to Original site) Representative DNA sequence >FCL-AA10 (FCL-AA10Q) /CSM/FCL/FCL-AA/FCL-AA...10Q.Seq.d/ XXXXXXXXXXTAAACCAGGTATGGTCGTCACCTTTTGCCCCAGCTGGTCTCTCAACTGAA GTCAAATCAGTCGAAATGCATCACGAACAACTCCCAGAA

  16. Dicty_cDB: FC-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA01 (Link to dictyBase) - - - Contig-U15084-1 FC-AA01E (Li...nk to Original site) - - - - - - FC-AA01E 701 Show FC-AA01 Library FC (Link to library) Clone ID FC-AA01 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA01Q.Seq.d/ Representative seq. ID FC-AA...01E (Link to Original site) Representative DNA sequence >FC-AA01 (FC-AA01Q) /CSM/FC/FC-AA/FC-AA01Q.Seq.d/ GAGAAATATTTCTTATTAA...CAATTGCATGCGTTGTATTCAACCCAACATGGTGGAATATT ACAGCAAGAATGGAATATAATGCTAATAAATAACAACCATTTTCTTTACTTCCACAAA

  17. Dicty_cDB: FC-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA20 (Link to dictyBase) - - - Contig-U16455-1 FC-AA20Z (Li...nk to Original site) - - FC-AA20Z 607 - - - - Show FC-AA20 Library FC (Link to library) Clone ID FC-AA20 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA20Q.Seq.d/ Representative seq. ID FC-AA...20Z (Link to Original site) Representative DNA sequence >FC-AA20 (FC-AA20Q) /CSM/FC/FC-AA/FC-AA20Q.Seq....d/ XXXXXXXXXXCTTTGCCCCAGCTGGTCTCTCAACTGAAGTCAAATCAGTCGAAATGCATC ACGAACAACTCCCAGAAGCCCGTCCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTT CAGTCAA

  18. Dicty_cDB: FC-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA13 (Link to dictyBase) - - - Contig-U15674-1 FC-AA13Z (Li...nk to Original site) - - FC-AA13Z 528 - - - - Show FC-AA13 Library FC (Link to library) Clone ID FC-AA13 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA13Q.Seq.d/ Representative seq. ID FC-AA...13Z (Link to Original site) Representative DNA sequence >FC-AA13 (FC-AA13Q) /CSM/FC/FC-AA/FC-AA13Q.Seq.d/ XXXXXXXXXXAAAGCAAA...CTCGTGCTGGTCAACGTACCCGTTTCAAGGCTTTCGTCGTTG TTGGTGATCACAACGGTCATGTAGGTCTCGGTGTTAAATGCGCTAAGGAA

  19. Dicty_cDB: FCL-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA02 (Link to dictyBase) - - - Contig-U16560-1 FCL-AA02F ...(Link to Original site) FCL-AA02F 620 - - - - - - Show FCL-AA02 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ Representative seq. ID FCL-AA...02F (Link to Original site) Representative DNA sequence >FCL-AA02 (FCL-AA02Q) /CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ ATTAA...ATACAAAATACAAATACAAATAACAAATACTTTACTATAGCTTTTTTTTCTTATT TATTTCTCCAAATAATTTTTTAATATGCAAATCTTTGTTAAAA

  20. Dicty_cDB: FCL-AA24 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA24 (Link to dictyBase) - - - Contig-U16467-1 FCL-AA24E ...(Link to Original site) - - - - - - FCL-AA24E 779 Show FCL-AA24 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA24Q.Seq.d/ Representative seq. ID FCL-AA...24E (Link to Original site) Representative DNA sequence >FCL-AA24 (FCL-AA24Q) /CSM/FCL/FCL-AA/FCL-AA...24Q.Seq.d/ CTAGAAATTTCTAAACAATTATTTATTTGAAGAGGTTTTTTAAAAAAAGAAAAAAATCAG AGCATCCAAATAATAACCGCAGTAAGGGGGGGATGGTTGTTAA

  1. Dicty_cDB: FCL-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA20 (Link to dictyBase) - - - Contig-U15052-1 FCL-AA20E ...(Link to Original site) - - - - - - FCL-AA20E 1159 Show FCL-AA20 Library FCL (Link to library) Clone ID FCL-AA...L http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ Representative seq. ID FCL-AA...20E (Link to Original site) Representative DNA sequence >FCL-AA20 (FCL-AA20Q) /CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ AAAA...CATTTACAAATGATGACCACAGAAGATGTACAACCAATTGAAACTACCAAAGATGG TGTAGTAGTATTAAATTATAGCGATTTAATTGCAGGTAAA

  2. Dicty_cDB: FCL-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA15 (Link to dictyBase) - - - Contig-U16011-1 FCL-AA15Z ...(Link to Original site) - - FCL-AA15Z 442 - - - - Show FCL-AA15 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA15Q.Seq.d/ Representative seq. ID FCL-AA...15Z (Link to Original site) Representative DNA sequence >FCL-AA15 (FCL-AA15Q) /CSM/FCL/FCL-AA/FCL-AA...15Q.Seq.d/ XXXXXXXXXXCCATTCATCTGTCCAATCGATTGTCGTCGTGGTCTCTACAAGAATATCGT CTTATCTGGTGGTTCAACCATGTTTAAAGATTTTGGTAAACGTCTTCAA

  3. Dicty_cDB: FC-AA14 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA14 (Link to dictyBase) - - - Contig-U15088-1 FC-AA14E (Li...nk to Original site) - - - - - - FC-AA14E 431 Show FC-AA14 Library FC (Link to library) Clone ID FC-AA14 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA14Q.Seq.d/ Representative seq. ID FC-AA...14E (Link to Original site) Representative DNA sequence >FC-AA14 (FC-AA14Q) /CSM/FC/FC-AA/FC-AA14Q.Seq.d/ CTATGTCTGAAATCAAAA...CTGAAGAACTCGCTTGCATCTACTCCGGTCTTTTATTACAAG ATGACGGTATTGAAATCACCGCTGATAAAATCAAAACCTTATTAGAAGCTGCCAA

  4. Dicty_cDB: FC-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA09 (Link to dictyBase) - - - Contig-U15086-1 FC-AA09E (Li...nk to Original site) - - - - - - FC-AA09E 562 Show FC-AA09 Library FC (Link to library) Clone ID FC-AA09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA09Q.Seq.d/ Representative seq. ID FC-AA...09E (Link to Original site) Representative DNA sequence >FC-AA09 (FC-AA09Q) /CSM/FC/FC-AA/FC-AA09Q.Seq....d/ GATACATTATCACCATGGCAGGAAAAAAAGTCAAATCTAACACACCAAAACAAGACTTAT CTGTCTCTAAATCAAAGCTCACCAGCATTAAAGCCCCAGCTGCTGCCATCAAAGCTAAA

  5. Dicty_cDB: FCL-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA05 (Link to dictyBase) - - - Contig-U16473-1 FCL-AA05Z ...(Link to Original site) - - FCL-AA05Z 603 - - - - Show FCL-AA05 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA05Q.Seq.d/ Representative seq. ID FCL-AA...05Z (Link to Original site) Representative DNA sequence >FCL-AA05 (FCL-AA05Q) /CSM/FCL/FCL-AA/FCL-AA...05Q.Seq.d/ XXXXXXXXXXTGGCGCCATCATTACTGGTGGAGGTGGTGTTGCTATCACTCAAGCTCAAC CATCATACCAAGCTGATGCCGTTGCCACTTACATCAAAA

  6. Dicty_cDB: FC-AA19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA19 (Link to dictyBase) - - - Contig-U16072-1 FC-AA19F (Li...nk to Original site) FC-AA19F 539 - - - - - - Show FC-AA19 Library FC (Link to library) Clone ID FC-AA19 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA19Q.Seq.d/ Representative seq. ID FC-AA...19F (Link to Original site) Representative DNA sequence >FC-AA19 (FC-AA19Q) /CSM/FC/FC-AA/FC-AA19Q.Seq.d/ CAGAAA...TCACTGGTTTTTCATTCCAATTATTTAATATTATCAGTATTTGGAATGTTGATC AAACATCATTCAATAGCTACAGTCTTCCAATTTGGTTACCAGCCATTCAA

  7. Resistance of different stocks and transferrin genotypes of coho salmon, Oncorhynchus kisutch, and steelhead trout, Salmo gairdneri, to bacterial kidney disease and vibriosis

    Science.gov (United States)

    Winter , Gary W.; Schreck, Carl B.; McIntyre, John D.

    1979-01-01

    Juvenile coho salmon and steelhead trout ofdifferentstocks and three transferrin genotypes(AA, AC, and CCl, all reared in identical or similar environments, were experimentally infected with Corynebacterium sp., the causative agent ofbacterial kidney disease, or with Vibrio anguillarum, the causative agent of vibriosis. Mortality due to the pathogens was compared among stocks within a species and among transferrin genotypes within a stock to determine whetherthere was a geneticbasis for resistance to disease. Differences in resistance to bacterial kidney disease among coho salmon stocks had a genetic basis. Stock susceptibility to vibriosis was strongly influenced by environmental factors. Coho salmon orsteelhead trout of one stock may be resistant to one disease but susceptible to another. The importance of transferrin genotype of coho salmon in resistance to bacterial kidney disease was stock specific; in stocks that showed differential resistance of genotypes, the AA was the most susceptible. No differencesin resistance to vibriosis were observed among transferrin genotypes.

  8. Axiom turkey genotyping array

    Science.gov (United States)

    The Axiom®Turkey Genotyping Array interrogates 643,845 probesets on the array, covering 643,845 SNPs. The array development was led by Dr. Julie Long of the USDA-ARS Beltsville Agricultural Research Center under a public-private partnership with Hendrix Genetics, Aviagen, and Affymetrix. The Turk...

  9. (Phaseolus vulgaris L) Genotypes

    African Journals Online (AJOL)

    Bruening 2001; Ho 1988). At whole plant level, the differences in drought resistance among drought-resistant and susceptible genotypes are related to the ability to accumulate biomass, remobilization of stored biomass to reproductive organs and the subsequent capacity to establish new reproductive sinks (Koç et al. 2003 ...

  10. AA, sandwich line with magnetic horn

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Continuation from 8010293: Finally, the sandwich line with the horn is placed on the ground, for the horn to be inspected and, if needed, exchanged for a new one. The whole procedure was trained with several members of the AA team, for quick and safe handling, and to share the radiation dose amongst them.

  11. Overall view of AA (Bld 193)

    CERN Multimedia

    1980-01-01

    See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  12. Overview of the Antiproton Accumulator (AA)

    CERN Multimedia

    1982-01-01

    See photo 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  13. Overall view of AA in Bld. 193

    CERN Multimedia

    1980-01-01

    See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  14. AA, mating of BST magnet halves

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    The AA had 2 types of bending magnets: BLG (window-frame,long and narrow) and BST (H-type, short and wide). The BST had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the mating of two BST halves.

  15. AA, vacuum tank for stochastic precooling

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    The vaccum tank in which the fast stochastic precooling kicker was installed. It is clad with heating jackets for bake-out to 200 deg C, indispensable for reaching the operational vacuum of 7E-11 Torr. Alain Poncet, responsible for AA vacuum, is looking on. See also 7910268, 8002234.

  16. The association of complex liver disorders with HBV genotypes prevalent in Pakistan

    Directory of Open Access Journals (Sweden)

    Qureshi Huma

    2007-11-01

    Full Text Available Abstract Background Genotyping of HBV is generally used for determining the epidemiological relationship between various virus strains and origin of infection mostly in research studies. The utility of genotyping for clinical applications is only beginning to gain importance. Whether HBV genotyping will constitute part of the clinical evaluation of Hepatitis B patients depends largely on the availability of the relevance of the evidence based information. Since Pakistan has a HBV genotype distribution which has been considered less virulent as investigated by earlier studies from south East Asian countries, a study on correlation between HBV genotypes and risk of progression to further complex hepatic infection was much needed Methods A total of 295 patients with HBsAg positive were selected from the Pakistan Medical Research Council's (PMRC out patient clinics. Two hundred and twenty six (77% were males, sixty nine (23% were females (M to F ratio 3.3:1. Results Out of 295 patients, 156 (53.2% had Acute(CAH, 71 (24.2% were HBV Carriers, 54 (18.4% had Chronic liver disease (CLD Hepatitis. 14 (4.7% were Cirrhosis and HCC patients. Genotype D was the most prevalent genotype in all categories of HBV patients, Acute (108, Chronic (39, and Carrier (53. Cirrhosis/HCC (7 were HBV/D positive. Genotype A was the second most prevalent with 28 (13% in acute cases, 12 (22.2% in chronics, 14 (19.7% in carriers and 5 (41.7 in Cirrhosis/HCC patients. Mixed genotype (A/D was found in 20 (12.8% of Acute patients, 3 (5.6% of Chronic and 4 (5.6% of carriers, none in case of severe liver conditions. Conclusion Mixed HBV genotypes A, D and A/D combination were present in all categories of patients except that no A/D combination was detected in severe conditions. Genotype D was the dominant genotype. However, genotype A was found to be more strongly associated with severe liver disease. Mixed genotype (A/D did not significantly appear to influence the clinical outcome.

  17. Intestinal solute carriers

    DEFF Research Database (Denmark)

    Steffansen, Bente; Nielsen, Carsten Uhd; Brodin, Birger

    2004-01-01

    A large amount of absorptive intestinal membrane transporters play an important part in absorption and distribution of several nutrients, drugs and prodrugs. The present paper gives a general overview on intestinal solute carriers as well as on trends and strategies for targeting drugs and...... membrane transporters in the small intestine in order to increase oral bioavailabilities of drug or prodrug, the major influence on in vivo pharmacokinetics is suggested to be dose-dependent increase in bioavailability as well as prolonged blood circulation due to large capacity facilitated absorption...

  18. Intestinal solute carriers

    DEFF Research Database (Denmark)

    Steffansen, Bente; Nielsen, Carsten Uhd; Brodin, Birger

    2004-01-01

    membrane transporters in the small intestine in order to increase oral bioavailabilities of drug or prodrug, the major influence on in vivo pharmacokinetics is suggested to be dose-dependent increase in bioavailability as well as prolonged blood circulation due to large capacity facilitated absorption......A large amount of absorptive intestinal membrane transporters play an important part in absorption and distribution of several nutrients, drugs and prodrugs. The present paper gives a general overview on intestinal solute carriers as well as on trends and strategies for targeting drugs and...

  19. Longitudinal study of experimental induction of AA amyloidosis in mice seeded with homologous and heterologous AA fibrils.

    Science.gov (United States)

    Muhammad, Naeem; Murakami, Tomoaki; Inoshima, Yasuo; Ishiguro, Naotaka

    2016-09-01

    To investigate pathogenesis and kinetics of experimentally induced murine AA amyloidosis seeded with homologous (murine) and heterologous (bovine) AA fibrils. Experimental AA amyloidosis was induced by administration of inflammatory stimulus and preformed AA fibrils to a total of 111 female C57/Black mice. In this longitudinal study, heterologous (bovine) as well as homologous (murine) AA fibrils were injected intraperitoneally to mice in various combinations. Re-stimulation was done at 120 or 300 days post first inoculation. To analyze the intensity of amyloid depositions in mice organs, immunohistochemical techniques and image J software were used. Assessment of cytokines level in sera was done using a Mouse Th1/Th2/Th17 Cytokine CBA Kit. Incidence and severity of AA amyloidosis were quite low in mice inoculated with heterologous bovine AA fibrils than homologous murine one. Homologous AA fibrils administration at first and second inoculation caused maximum amount of amyloid depositions and severe systemic form of amyloidosis. Increase in the level of pro-inflammatory cytokine IL-6 was observed after first inoculation, while second inoculation caused a further increase in the level of anti-inflammatory cytokine IL-10. AA amyloidosis can be induced by heterologous as well as homologous AA fibrils. Severity of AA amyloidosis induced with homologous AA fibrils is higher compared to heterologous AA fibrils.

  20. [Risk control of traditional Chinese medicines containing aristolochis acids (AAs) based on influencing factors of content of AAs].

    Science.gov (United States)

    Tian, Jing-Zhuo; Liang, Ai-Hua; Liu, Jing; Zhang, Bo-Li

    2017-12-01

    Aristolochic acids (AAs) widely exist in such plants as Aristolochia and Asarum. The renal toxicity of AAs as well as its carcinogenicity to urinary system have been widely known. In 2003 and 2004, China prohibited the use of Aristolochiae Radix, Aristolochiae Manshuriensis Caulis and Aristolochiae Fangchi Radix, and required administering other AAs-containing medicines in accordance with the regulations for prescription drugs. In this paper, we retrieved literatures on the content determination of AAs in recent 10 years in China. It suggested that the AAs content is lower in Asarum herb, especially in its roots and rhizomes, and most of which do not show detectable amount of AA-I. Some of traditional Chinese medicines show fairly small amount of detectable AA-I. The AAs content in Aristolochia herb (including Fructus Aristolochiae, kaempfer dutchmanspipe root) is relatively high; however, there are fewer literatures for studying the content determination of AAs in Chinese patent medicines. There were many factors affecting AAs content, including the parts used, origins, processing methods, extraction process. It suggested that we should pay attention to the toxicity of Chinese medicines containing AAs and use these decoction pieces and traditional Chinese medicines cautiously. In addition, basic studies for the origins, processing methods and extraction process of Chinese patent medicines containing AAs, as well as supervision and detection of AAs content in traditional Chinese medicinal materials, decoction pieces and Chinese patent medicines shall be strengthened for reducing medication risk and guaranteeing clinical medication safety. Copyright© by the Chinese Pharmaceutical Association.

  1. Systemic AA amyloidosis: epidemiology, diagnosis, and management.

    Science.gov (United States)

    Real de Asúa, Diego; Costa, Ramón; Galván, Jose María; Filigheddu, María Teresa; Trujillo, Davinia; Cadiñanos, Julen

    2014-01-01

    The term "amyloidosis" encompasses the heterogeneous group of diseases caused by the extracellular deposition of autologous fibrillar proteins. The global incidence of amyloidosis is estimated at five to nine cases per million patient-years. While amyloid light-chain (AL) amyloidosis is more frequent in developed countries, amyloid A (AA) amyloidosis is more common in some European regions and in developing countries. The spectrum of AA amyloidosis has changed in recent decades owing to: an increase in the median age at diagnosis; a percent increase in the frequency of primary AL amyloidosis with respect to the AA type; and a substantial change in the epidemiology of the underlying diseases. Diagnosis of amyloidosis is based on clinical organ involvement and histological evidence of amyloid deposits. Among the many tinctorial characteristics of amyloid deposits, avidity for Congo red and metachromatic birefringence under unidirectional polarized light remain the gold standard. Once the initial diagnosis has been made, the amyloid subtype must be identified and systemic organ involvement evaluated. In this sense, the (123)I-labeled serum amyloid P component scintigraphy is a safe and noninvasive technique that has revolutionized the diagnosis and monitoring of treatment in systemic amyloidosis. It can successfully identify anatomical patterns of amyloid deposition throughout the body and enables not only an initial estimation of prognosis, but also the monitoring of the course of the disease and the response to treatment. Given the etiologic diversity of AA amyloidosis, common therapeutic strategies are scarce. All treatment options should be based upon a greater control of the underlying disease, adequate organ support, and treatment of symptoms. Nevertheless, novel therapeutic strategies targeting the formation of amyloid fibrils and amyloid deposition may generate new expectations for patients with AA amyloidosis.

  2. Variability in amino acid digestibility of triticale grain from diverse genotypes as studied in cecectomized laying hens.

    Science.gov (United States)

    Zuber, T; Maurer, H P; Möhring, J; Nautscher, N; Siegert, W; Rosenfelder, P; Rodehutscord, M

    2016-12-01

    Triticale, an anthropogenic hybrid grain, is increasing in importance as a feed grain for laying hens. However, our limited knowledge of its nutritional qualities and their impact on hen performance prevents optimization of its use. The present study investigated the digestibility of amino acids ( AA: ) in triticale grain in laying hens, and additionally examined relationships between AA digestibility and chemical and physical characteristics of the grain. Twenty genotypes of triticale were grown under standardized agronomic and environmental conditions and were characterized according to their physical properties (thousand-seed weight, test weight, falling number, extract viscoelasticity), chemical composition (proximate nutrients, non-starch polysaccharides, AA, minerals, inositol phosphates) and gross energy concentration. Additionally, the in vitro solubility of nitrogen was determined. The animal trial comprised 4 Latin Squares (6 × 6) distributed among 2 subsequent runs. Twelve cecectomized LSL-Classic hens were individually housed in metabolism cages and either fed a basal diet containing 500 g/kg cornstarch or one of 20 triticale diets, each replacing the cornstarch with one triticale genotype, for 8 d. During the last 4 d, feed intake was recorded and excreta were collected quantitatively. Amino acid digestibility of the triticale genotypes was calculated by linear regression. The digestibility of all AA differed significantly between the 20 genotypes, including Lys (digestibility range 68 to 80%), Met (77 to 86%), Thr (68 to 78%) and Trp (74 to 83%). However, AA digestibility only correlated with characteristics of the grain in few cases, without a consistent pattern among AA. Equations to predict AA digestibility based on the grain's physical and chemical characteristics were calculated by multiple linear regression. The explanatory power (adjusted R 2 ;) of these prediction equations was below 0.7 for most AA and thus not sufficiently precise to be

  3. A retrospective study on fourteen year hemoglobin genotype variants recorded at five government hospitals in Akure, Ondo State, Southwestern Nigeria

    Directory of Open Access Journals (Sweden)

    Akeem Akinboro

    2016-10-01

    Results and conclusion: Six hemoglobin genotypes were identified as HbAA, HbAS, HbAC, HbSS, HbSC and HbCC. The overall average values of their prevalence in decreasing order were HbAA (88.11% > HbAS (10.23% > HbAC (0.78% > HbSS (0.72%, HbSC (0.15% and HbCC (0.01%. There was a steady increase in the number of people who visited the hospitals for hemoglobin genotype determination throughout the years covered in this investigation, as the proportion of abnormal hemoglobin genotypes to the normal HbAA tremendously increased in the last four years (2010–2013. This suggests the possibility of many other residents in the capital city of Ondo state carrying the abnormal forms of hemoglobin genotype, and calling for more efforts in the area of genetic counseling. The gene frequencies of A, S, and C were 0.91, 0.08 and 0.01, respectively. The prevalence of HbAA in this study has been the highest reported in the Southwest and Nigeria as a whole.

  4. A comparison of Mg/Ca ratios in Globigerinoides ruber (white): sensu stricto versus a mixture of genotypes

    Digital Repository Service at National Institute of Oceanography (India)

    Naik, S.S.

    Mg/Ca ratios were measured in core AAS9/21 from the eastern Arabian Sea (EAS), on two sets of planktonic foraminifera, one with a mixture of Globigerinoides ruber genotypes (sensu stricto and sensu lato) and the second which contained only G. ruber...

  5. Increased Virulence and Competitive Advantage of a/α Over a/a or α/α Offspring Conserves the Mating System of Candida albicans

    Science.gov (United States)

    Lockhart, Shawn R.; Wu, Wei; Radke, Joshua B.; Zhao, Rui; Soll, David R.

    2005-01-01

    The majority of Candida albicans strains in nature are a/α and must undergo homozygosis to a/a or α/α to mate. Here we have used a mouse model for systemic infection to test the hypothesis that a/α strains predominate in nature because they have a competitive advantage over a/a and α/α offspring in colonizing hosts. Single-strain injection experiments revealed that a/α strains were far more virulent than either their a/a or α/α offspring. When equal numbers of parent a/α and offspring a/a or α/α cells were co-injected, a/α always exhibited a competitive advantage at the time of extreme host morbidity or death. When equal numbers of an engineered a/a/α2 strain and its isogenic a/a parent strain were co-injected, the a/a/α2 strain exhibited a competitive advantage at the time of host morbidity or death, suggesting that the genotype of the mating-type (MTL) locus, not associated genes on chromosome 5, provides a competitive advantage. We therefore propose that heterozygosity at the MTL locus not only represses white-opaque switching and genes involved in the mating process, but also affects virulence, providing a competitive advantage to the a/α genotype that conserves the mating system of C. albicans in nature. PMID:15695357

  6. Increased virulence and competitive advantage of a/alpha over a/a or alpha/alpha offspring conserves the mating system of Candida albicans.

    Science.gov (United States)

    Lockhart, Shawn R; Wu, Wei; Radke, Joshua B; Zhao, Rui; Soll, David R

    2005-04-01

    The majority of Candida albicans strains in nature are a/alpha and must undergo homozygosis to a/a or alpha/alpha to mate. Here we have used a mouse model for systemic infection to test the hypothesis that a/alpha strains predominate in nature because they have a competitive advantage over a/a and alpha/alpha offspring in colonizing hosts. Single-strain injection experiments revealed that a/alpha strains were far more virulent than either their a/a or alpha/alpha offspring. When equal numbers of parent a/alpha and offspring a/a or alpha/alpha cells were co-injected, a/alpha always exhibited a competitive advantage at the time of extreme host morbidity or death. When equal numbers of an engineered a/a/alpha2 strain and its isogenic a/a parent strain were co-injected, the a/a/alpha2 strain exhibited a competitive advantage at the time of host morbidity or death, suggesting that the genotype of the mating-type (MTL) locus, not associated genes on chromosome 5, provides a competitive advantage. We therefore propose that heterozygosity at the MTL locus not only represses white-opaque switching and genes involved in the mating process, but also affects virulence, providing a competitive advantage to the a/alpha genotype that conserves the mating system of C. albicans in nature.

  7. Autonomous component carrier selection

    DEFF Research Database (Denmark)

    Garcia, Luis Guilherme Uzeda; Pedersen, Klaus; Mogensen, Preben

    2009-01-01

    management and efficient system operation. Due to the expected large number of user-deployed cells, centralized network planning becomes unpractical and new scalable alternatives must be sought. In this article, we propose a fully distributed and scalable solution to the interference management problem......Low-power base stations such as e.g. Femto-cells are one of the candidates for high data rate provisioning in local areas, such as residences, apartment complexes, business offices and outdoor hotspot scenarios. Unfortunately, the benefits are not without new challenges in terms of interference...... in local areas, basing our study case on LTE-Advanced. We present extensive network simulation results to demonstrate that a simple and robust interference management scheme, called autonomous component carrier selection allows each cell to select the most attractive frequency configuration; improving...

  8. Absorption spectra of AA-stacked graphite

    International Nuclear Information System (INIS)

    Chiu, C W; Lee, S H; Chen, S C; Lin, M F; Shyu, F L

    2010-01-01

    AA-stacked graphite shows strong anisotropy in geometric structures and velocity matrix elements. However, the absorption spectra are isotropic for the polarization vector on the graphene plane. The spectra exhibit one prominent plateau at middle energy and one shoulder structure at lower energy. These structures directly reflect the unique geometric and band structures and provide sufficient information for experimental fitting of the intralayer and interlayer atomic interactions. On the other hand, monolayer graphene shows a sharp absorption peak but no shoulder structure; AA-stacked bilayer graphene has two absorption peaks at middle energy and abruptly vanishes at lower energy. Furthermore, the isotropic features are expected to exist in other graphene-related systems. The calculated results and the predicted atomic interactions could be verified by optical measurements.

  9. First circulating beam in the AA

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.5 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are to numerous to name them all. Heribert Koziol, apparently asleep, is answering the call from an impatient director. See also 8007094.

  10. AA, assembly of wide bending magnet

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    The very particular lattice of the AA required 2 types of dipoles (bending magnets; BST, short and wide; BLG, long and narrow). The wide ones had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the copper coils being hoisted onto the lower half of a BST. See also 7811105, 8006050. For a BLG, see 8001044.

  11. AA, inner conductor of a magnetic horn

    CERN Multimedia

    CERN PhotoLab

    1981-01-01

    At the start-up of the AA and during its initial operation, magnetic horns focused the antiprotons emanating from the production target. These "current-sheet lenses" had a thin inner conductor (for minimum absorption of antiprotons), machined from aluminium to wall thicknesses of 0.7 or 1 mm. The half-sine pulses rose to 150 kA in 8 microsec. The angular acceptance was 50 mrad.

  12. 40 CFR Appendix A to Subpart Aa of... - Applicability of General Provisions (40 CFR Part 63, Subpart A) to Subpart AA

    Science.gov (United States)

    2010-07-01

    ... (40 CFR Part 63, Subpart A) to Subpart AA A Appendix A to Subpart AA of Part 63 Protection of... Hazardous Air Pollutants From Phosphoric Acid Manufacturing Plants Pt. 63, Subpt. AA, App. A Appendix A to Subpart AA of Part 63—Applicability of General Provisions (40 CFR Part 63, Subpart A) to Subpart AA 40 CFR...

  13. Dicty_cDB: FC-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA10 (Link to dictyBase) - - - Contig-U16358-1 FC-AA10P (Li...nk to Original site) FC-AA10F 659 FC-AA10Z 544 FC-AA10P 1203 - - Show FC-AA10 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA10Q.Seq.d/ Representative seq. ID FC-AA...10P (Link to Original site) Representative DNA sequence >FC-AA10 (FC-AA10Q) /CSM/FC/FC-AA/FC-AA10Q.Seq.d/ AA...ATGACTACCTTTAACGAATATCCATTCTTGGCTGAATTAGGCATTAAAGCTGAAAATA ATGATGGAGTCTTCAATGGAAAATGGGGAGGTGCTGGTGAAATCATCAA

  14. Dicty_cDB: FC-AA04 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA04 (Link to dictyBase) - - - Contig-U15354-1 FC-AA04P (Li...nk to Original site) FC-AA04F 546 FC-AA04Z 484 FC-AA04P 1030 - - Show FC-AA04 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA04Q.Seq.d/ Representative seq. ID FC-AA...04P (Link to Original site) Representative DNA sequence >FC-AA04 (FC-AA04Q) /CSM/FC/FC-AA/FC-AA04Q.Seq.d/ AA...TAATACACATAAAAAATTTATTAAATAAAAATGACTACAACAACAACAAATGAAGTTT ATATAGTTGATTGTATTCGTACACCAATTGGTAGAGGATATAGTAA

  15. Dicty_cDB: FC-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA03 (Link to dictyBase) - - - Contig-U15331-1 FC-AA03P (Li...nk to Original site) FC-AA03F 595 FC-AA03Z 546 FC-AA03P 1141 - - Show FC-AA03 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA03Q.Seq.d/ Representative seq. ID FC-AA...03P (Link to Original site) Representative DNA sequence >FC-AA03 (FC-AA03Q) /CSM/FC/FC-AA/FC-AA03Q.Seq.d/ AA...AATGTCATCTTATTTATTCACTAGTGAATCCGTCACCGAAGTCATCCAGATAAAATCT GTGATCAAGTATCAGATGCTGTTCTCGATGCTTGTTTAGCTCAA

  16. _. AA~ AA, _ _

    Indian Academy of Sciences (India)

    It is probably very difficult to find a person who has not been charmed by the exquisite beauty of soap bubbles. Invariably, our appre- ciation of soap bubbles ends with an admira- tion of their shapes and colours. We do not realise that there is a profound science behind their beauty. The best book to start learning.

  17. Avaliação agronômica em híbridos diplóides (AA de bananeira Agronomical evaluation of (AA banana diploid hybrids

    Directory of Open Access Journals (Sweden)

    Lauro Saraiva Lessa

    2009-01-01

    Full Text Available Objetivou-se avaliar características agronômicas em híbridos diplóides (AA de bananeira. No experimento, conduzido no campo experimental da Embrapa Mandioca e Fruticultura Tropical, em blocos casualizados com quatro repetições, foram avaliados 11 híbridos diplóides (AA de bananeira (4279-06, TH03-01, 8987-01, 0323-03, 1318-01, 0116-01, 8694-20, 1304-06, 9179-03, 4223-06 e SH3263. Os dados dos caracteres agronômicos avaliados foram submetidos à análise de variância e as médias dos genótipos foram agrupadas pelo teste de Scott-Knott, a 5% de probabilidade. O genótipo SH3263 apresentou valores favoráveis ao melhoramento para número de pencas e de frutos por cacho e baixa incidência de Sigatoka-amarela na floração, além de menor número de dias da floração à colheita, maior peso da segunda penca e comprimento de fruto acima de 10 cm. O híbrido 0323-03 apresentou a maior retenção de folhas vivas na colheita do cacho e, também, a menor nota para incidência de sigatoka-amarela na colheita. A alta variabilidade encontrada com a avaliação dos híbridos permite a seleção de diplóides (AA com potencial para utilização em programas de melhoramento da cultura.The aim of the present work was to characterize horticultural characteristics in (AA banana diploid hybrids. The experiment was carried out at the experimental field of Embrapa Cassava and Tropical Fruits in randomized blocks with four replicates and 11 (AA banana diploid hybrids were evaluated: (4279-06, TH03-01, 8987-01, 0323-03, 1318-01, 0116-01, 8694-20, 1304-06, 9179-03, 4223-06 and SH3263. Data of the agronomical characteristics evaluated were submitted to the analysis of variance and the averages of the genotypes grouped by the Scott-Knott test at 5% of probability. The SH3263 genotype presented favorable values to the breeding for number of hands per bunch, number of fruits per bunch, low yellow-sigatoka incidence during flowering and also lower number of days

  18. The energy carrier hydrogen

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    The potential of hydrogen to be used as a clean fuel for the production of heat and power, as well as for the propulsion of aeroplanes and vehicles, is described, in particular for Germany. First, attention is paid to the application of hydrogen as a basic material for the (petro)chemical industry, as an indirect energy source for (petro)chemical processes, and as a direct energy source for several purposes. Than the importance of hydrogen as an energy carrier in a large-scale application of renewable energy sources is discussed. Next an overview is given of new and old hydrogen production techniques from fossil fuels, biomass, or the electrolysis of water. Energetic applications of hydrogen in the transportation sector and the production of electric power and heat are mentioned. Brief descriptions are given of techniques to store hydrogen safely. Finally attention is paid to hydrogen research in Germany. Two hydrogen projects, in which Germany participates, are briefly dealt with: the Euro-Quebec project (production of hydrogen by means of hydropower), and the HYSOLAR project (hydrogen production by means of solar energy). 18 figs., 1 tab., 7 refs

  19. Evidence for classification of c.1852_1853AA>GC in MLH1 as a neutral variant for Lynch syndrome

    Directory of Open Access Journals (Sweden)

    Llor Xavier

    2011-01-01

    Full Text Available Abstract Background Lynch syndrome (LS is an autosomal dominant inherited cancer syndrome characterized by early onset cancers of the colorectum, endometrium and other tumours. A significant proportion of DNA variants in LS patients are unclassified. Reports on the pathogenicity of the c.1852_1853AA>GC (p.Lys618Ala variant of the MLH1 gene are conflicting. In this study, we provide new evidence indicating that this variant has no significant implications for LS. Methods The following approach was used to assess the clinical significance of the p.Lys618Ala variant: frequency in a control population, case-control comparison, co-occurrence of the p.Lys618Ala variant with a pathogenic mutation, co-segregation with the disease and microsatellite instability in tumours from carriers of the variant. We genotyped p.Lys618Ala in 1034 individuals (373 sporadic colorectal cancer [CRC] patients, 250 index subjects from families suspected of having LS [revised Bethesda guidelines] and 411 controls. Three well-characterized LS families that fulfilled the Amsterdam II Criteria and consisted of members with the p.Lys618Ala variant were included to assess co-occurrence and co-segregation. A subset of colorectal tumour DNA samples from 17 patients carrying the p.Lys618Ala variant was screened for microsatellite instability using five mononucleotide markers. Results Twenty-seven individuals were heterozygous for the p.Lys618Ala variant; nine had sporadic CRC (2.41%, seven were suspected of having hereditary CRC (2.8% and 11 were controls (2.68%. There were no significant associations in the case-control and case-case studies. The p.Lys618Ala variant was co-existent with pathogenic mutations in two unrelated LS families. In one family, the allele distribution of the pathogenic and unclassified variant was in trans, in the other family the pathogenic variant was detected in the MSH6 gene and only the deleterious variant co-segregated with the disease in both

  20. Molecular analysis of hepatitis B virus "a" determinant in asymptomatic and symptomatic Mexican carriers

    Directory of Open Access Journals (Sweden)

    Alvarez-Muñoz Ma-Teresa

    2007-01-01

    Full Text Available Abstract Background Hepatitis B virus (HBV is a small DNA-containing virus with 4 genes, C, S, X and P. The S gene codes for the surface antigen (HBsAg, which contains the "a" determinant, the main region for induction of a protective humoral immune response. To compare the genotype and sequence of the "a" determinant between strains isolated from asymptomatic and symptomatic Mexican HBV carriers. Results 21 asymptomatic (blood donors and 12 symptomatic (with clinical signs and with >1 year lamivudine treatment HBV carriers were studied; all patients were positive for the HBsAg in serum. Viral load, genotypes, and subtypes were determined in plasma. A fragment of the S gene including the "a" determinant was PCR amplified and sequenced to determine genotype, subtype and to identify mutations. Mean viral load was 0.7965 × 104 copies/ml in asymptomatic carriers and 2.73 × 106 copies/ml in symptomatic patients. Genotypes H, C, and F were identified in asymptomatic individuals; whereas H was dominant in symptomatic patients. A fragment of 279 bp containing the "a" determinant was amplified from all 33 carriers and sequences aligned with S gene sequences in the GenBank. Mutations identified were Y100N, T126I, Q129H and N146K in the asymptomatic group, and F93I and A128V in the symptomatic group. Conclusion Differences in genotype and in mutations in the "a" determinant were found between strains from asymptomatic and symptomatic HBV Mexican carriers.

  1. Dicty_cDB: FC-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA18 (Link to dictyBase) - - - Contig-U15943-1 FC-AA18P (Li...nk to Original site) FC-AA18F 506 FC-AA18Z 293 FC-AA18P 799 - - Show FC-AA18 Library FC (Link to library) Clone ID FC-AA...al site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA18Q.Seq.d/ Representative seq. ID FC-AA...18P (Link to Original site) Representative DNA sequence >FC-AA18 (FC-AA18Q) /CSM/FC/FC-AA/FC-AA18Q.Seq.d/ AAA...AGATAGAGAAGAAAGAAAACTTGAACGTGAGAAGGAACTTGAACGTGAACGTGAGAA AGAACTTGAGCGTGAGCGTGAACGTGAACAACGTCGTCTTGAAA

  2. Dicty_cDB: FCL-AA12 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA12 (Link to dictyBase) - - - Contig-U16034-1 FCL-AA12P ...(Link to Original site) FCL-AA12F 629 FCL-AA12Z 540 FCL-AA12P 1169 - - Show FCL-AA12 Library FCL (Link to library) Clone ID FCL-AA...4-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA12Q....Seq.d/ Representative seq. ID FCL-AA12P (Link to Original site) Representative DNA sequence >FCL-AA12 (FCL-AA12Q) /CSM/FCL/FCL-AA.../FCL-AA12Q.Seq.d/ ATCAAATGTTTATTCAACAACAACCATCAGATTCAATTGTTTGTAATCGTTATATTCATC CAGCCATTGTTGTTTTGGTTGACCAA

  3. Dicty_cDB: FCL-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA01 (Link to dictyBase) - - - Contig-U16033-1 FCL-AA01P ...(Link to Original site) FCL-AA01F 603 FCL-AA01Z 411 FCL-AA01P 1014 - - Show FCL-AA01 Library FCL (Link to library) Clone ID FCL-AA...3-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA01Q....Seq.d/ Representative seq. ID FCL-AA01P (Link to Original site) Representative DNA sequence >FCL-AA01 (FCL-AA01Q) /CSM/FCL/FCL-AA.../FCL-AA01Q.Seq.d/ GCAAATAATAATATTATGGGTATTGACTTTGGTACACATTTCGCATGTGTTGGTATTTTC AAGAATGAAAGAATTGAAATCTGTCCAAA

  4. Dicty_cDB: FCL-AA07 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA07 (Link to dictyBase) - - - Contig-U14973-1 FCL-AA07P ...(Link to Original site) FCL-AA07F 527 FCL-AA07Z 253 FCL-AA07P 780 - - Show FCL-AA07 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA07Q....Seq.d/ Representative seq. ID FCL-AA07P (Link to Original site) Representative DNA sequence >FCL-AA07 (FCL-AA07Q) /CSM/FCL/FCL-AA.../FCL-AA07Q.Seq.d/ CAAAATAAAAAATGTTATCAAATTTTTTAAAAGTCAACAGTAAAGCACTAGGACATATAA GAACTTTTGCCTCAAAGAGTGGTGAAATTAAA

  5. Dicty_cDB: FCL-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA21 (Link to dictyBase) - - - Contig-U14936-1 FCL-AA21P ...(Link to Original site) FCL-AA21F 520 FCL-AA21Z 356 FCL-AA21P 876 - - Show FCL-AA21 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA21Q....Seq.d/ Representative seq. ID FCL-AA21P (Link to Original site) Representative DNA sequence >FCL-AA21 (FCL-AA21Q) /CSM/FCL/FCL-AA.../FCL-AA21Q.Seq.d/ ATCATAATCATATATTTTTAATAGATATTGATATATATATTTAAAAAAATAAAATAAAAT AAAATAAAAAATGTCAACAGAGGAAACAAAAA

  6. Dicty_cDB: FC-AA11 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA11 (Link to dictyBase) - - - Contig-U16273-1 FC-AA11P (Li...nk to Original site) FC-AA11F 631 FC-AA11Z 502 FC-AA11P 1133 - - Show FC-AA11 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA11Q.Seq.d/ Representative seq. ID FC-AA...11P (Link to Original site) Representative DNA sequence >FC-AA11 (FC-AA11Q) /CSM/FC/FC-AA/FC-AA...11Q.Seq.d/ GGTGAATTAATTGTTGAACCAGTTGATCAAAAATATATTTTCAAGACTGAACGTAAAGTT CCAAGAATGGGTGTTATGATTGTTGGTTTATGTGGTAACAATGGTACAA

  7. Dicty_cDB: FC-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA08 (Link to dictyBase) - - - Contig-U15942-1 FC-AA08P (Li...nk to Original site) FC-AA08F 620 FC-AA08Z 510 FC-AA08P 1130 - - Show FC-AA08 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA08Q.Seq.d/ Representative seq. ID FC-AA...08P (Link to Original site) Representative DNA sequence >FC-AA08 (FC-AA08Q) /CSM/FC/FC-AA/FC-AA...08Q.Seq.d/ ATCAGTTACATGTACTGCACCAGTTAATATTGCAGTTATCAAATATTGGGGAAAGAGAGA TGAAAATATTATTTTACCATTAAATTCATCACTCAGTGGAA

  8. Dicty_cDB: FC-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA06 (Link to dictyBase) - - - Contig-U15909-1 FC-AA06P (Li...nk to Original site) FC-AA06F 532 FC-AA06Z 501 FC-AA06P 1033 - - Show FC-AA06 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA06Q.Seq.d/ Representative seq. ID FC-AA...06P (Link to Original site) Representative DNA sequence >FC-AA06 (FC-AA06Q) /CSM/FC/FC-AA/FC-AA...06Q.Seq.d/ GTGAATATAACGATTTAGATTTAGTGTATGATAAAGATGTTTATCAAAAATTAATAGAGA ATGGTGTAGATTCATTATTATCAAAA

  9. Dicty_cDB: FCL-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA13 (Link to dictyBase) - - - - FCL-AA13P (Link to Original site) FCL-AA...13F 635 FCL-AA13Z 350 FCL-AA13P 985 - - Show FCL-AA13 Library FCL (Link to library) Clone ID FCL-AA...dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ Representative seq. ID FCL-AA...13P (Link to Original site) Representative DNA sequence >FCL-AA13 (FCL-AA13Q) /CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ CATATTTATAA...TTATATCTTTTTTGTTTAATAAAAAAGAAAGAATACCAACATGAGACTT TTATTGTGTTTAATTTTCTTAGTTTTTGTTTTCAATTTTGCATTATCAA

  10. Hippocampal, amygdalar, and global brain atrophy in different apolipoprotein E genotypes

    NARCIS (Netherlands)

    den Heijer, T; Oudkerk, M; Launer, LJ; van Duijn, CM; Hofman, A; Breteler, MMB

    2002-01-01

    The epsilon4 allele of the APOE gene increases the risk for AD, whereas the epsilon2 allele may be protective. The authors assessed the impact of APOE genotype on hippocampal, amygdalar, and global brain atrophy as putative markers of preclinical AD in a nondemented population. Carriers Of epsilon4

  11. Effect of specific ADRB1/ADRB2/AGT genotype combinations on the association between survival and carvedilol treatment in chronic heart failure

    DEFF Research Database (Denmark)

    Petersen, Morten; Andersen, Jon T; Jimenez-Solem, Espen

    2012-01-01

    the downregulated ADRB2 genotype (Gln27-carrier) was added to the ADRB1/AGT combination (Pinteraction=0.0005; hazard ratio 2.67, 95% confidence interval 1.51-4.72, P=0.0007). Two hundred and four patients were treated with metoprolol. There was no interaction between metoprolol treatment and the specific genotype...

  12. Poorer frontolimbic white matter integrity is associated with chronic cannabis use, FAAH genotype, and increased depressive and apathy symptoms in adolescents and young adults

    Directory of Open Access Journals (Sweden)

    Skyler G. Shollenbarger

    2015-01-01

    Conclusions: Consistent with prior findings, cannabis use was associated with reduced frontolimbic WM integrity. WM integrity was also moderated by FAAH genotype, in that cannabis-using FAAH C/C carriers and A carrying controls had reduced WM integrity compared to control C/C carriers. Observed frontolimbic white matter abnormalities were linked with increased depressive and apathy symptoms in the cannabis users.

  13. AA, Inner Conductor of Magnetic Horn

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    Antiprotons emerging at large angles from the production target (hit by an intense 26 GeV proton beam from the PS), were focused into the acceptance of the injection line of the AA by means of a "magnetic horn" (current-sheet lens). Here we see an early protype of the horn's inner conductor, machined from solid aluminium to a thickness of less than 1 mm. The 1st version had to withstand pulses of 150 kA, 15 us long, every 2.4 s. See 8801040 for a later version.

  14. 7 CFR 35.4 - Carrier.

    Science.gov (United States)

    2010-01-01

    ... AND PLUMS Definitions § 35.4 Carrier. Carrier means any common or private carrier, including, but not being limited to, trucks, rail, airplanes, vessels, tramp or chartered steamers, whether carrying for...

  15. Basic Stand Alone Carrier Line Items PUF

    Data.gov (United States)

    U.S. Department of Health & Human Services — This release contains the Basic Stand Alone (BSA) Carrier Line Items Public Use Files (PUF) with information from Medicare Carrier claims. The CMS BSA Carrier Line...

  16. Impact of carriers in oral absorption

    DEFF Research Database (Denmark)

    Gram, Luise Kvisgaard; Rist, Gerda Marie; Lennernäs, Hans

    2009-01-01

    Carriers may mediate the permeation across enterocytes for drug substances being organic anions. Carrier mediated permeation for the organic anions estrone-3-sulfate (ES) and glipizide across Caco-2 cells were investigated kinetically, and interactions on involved carriers evaluated. Initial...

  17. KIR and Human Leukocyte Antigen Genotype Associated Risk of Cytomegalovirus Disease in Renal Transplant Patients.

    Science.gov (United States)

    Michelo, Clive M; van der Meer, Arnold; Tijssen, Henk J; Zomer, Ramona; Stelma, Foekje; Hilbrands, Luuk B; Joosten, Irma

    2015-07-01

    Cytomegalovirus(CMV) infections have a significant effect on morbidity and mortality in kidney transplants. We conducted a study to ascertain the association of natural killer cell killer immunoglobulin-like receptors and human leukocyte antigen (HLA) genotype with risk of CMV disease. The 90 CMV-negative patients receiving a first renal transplantation from a CMV-positive donor in this study received triple immunosuppressive therapy and prophylactic CMV treatment for up to 3 months after transplantation. We observed a 43.3% incidence rate of CMV disease within the first year after transplantation. Twenty-seven recipients experienced a rejection episode, 14 of which had CMV disease, mostly after rejection, suggesting that in this group, CMV disease is not a risk factor for rejection. KIR gene or genotype distribution were similar between the CMV diseased and CMV disease-free group. Twenty-seven recipients (30%) carried KIR-AA genotype, of which nine (33%) had CMV disease. Of the remaining 63 (70%) recipients with KIR-BX genotype, 30 (48%) had CMV disease. There was no significant difference between the two genotype groups with regard to occurrence of CMV disease, although there was a trend toward a lower incidence of CMV disease in recipients carrying the KIR-AA genotype. For CMV disease, we found no significant risk associated with the number of activating or inhibitory KIRs. Neither was missing KIR ligands for the inhibitory KIRs (HLA-C1/C2/Bw4) in recipients associated with lower rates of CMV disease. In CMV-negative recipients, genotypic analysis of KIR repertoire and HLA ligands does not provide risk factors for primary CMV disease after renal transplantation.

  18. Susceptibility to scrapie and disease phenotype in sheep: cross-PRNP genotype experimental transmissions with natural sources

    Directory of Open Access Journals (Sweden)

    González Lorenzo

    2012-07-01

    Full Text Available Abstract It has long been established that the sheep Prnp genotype influences the susceptibility to scrapie, and some studies suggest that it can also determine several aspects of the disease phenotype. Other studies, however, indicate that the source of infection may also play a role in such phenotype. To address this question an experiment was set up in which either of two different natural scrapie sources, AAS from AA136 Suffolk and VVC from VV136 Cheviot sheep, were inoculated into AA136, VA136 and VV136 sheep recipients (n = 52. The immunohistochemical (IHC profile of disease-associated PrP (PrPd accumulation in the brain of recipient sheep was highly consistent upon codon 136 homologous and semi-homologous transmission, but could be either similar to or different from those of the inoculum donors. In contrast, the IHC profiles were highly variable upon heterologous transmission (VVC to AA136 and AAS to VV136. Furthermore, sheep of the same Prnp genotype could exhibit different survival times and PrPd profiles depending on the source of infection, and a correlation was observed between IHC and Western blot profiles. It was found that additional polymorphisms at codons 112 or 141 of AA136 recipients resulted in a delayed appearance of clinical disease or even in protection from infection. The results of this study strongly suggest that the scrapie phenotype in sheep results from a complex interaction between source, donor and recipient factors, and that the Prnp genotype of the recipient sheep does not explain the variability observed upon codon 136 heterologous transmissions, arguing for other genetic factors to be involved.

  19. Susceptibility to scrapie and disease phenotype in sheep: cross-PRNP genotype experimental transmissions with natural sources.

    Science.gov (United States)

    González, Lorenzo; Jeffrey, Martin; Dagleish, Mark P; Goldmann, Wilfred; Sisó, Sílvia; Eaton, Samantha L; Martin, Stuart; Finlayson, Jeanie; Stewart, Paula; Steele, Philip; Pang, Yvonne; Hamilton, Scott; Reid, Hugh W; Chianini, Francesca

    2012-07-02

    It has long been established that the sheep Prnp genotype influences the susceptibility to scrapie, and some studies suggest that it can also determine several aspects of the disease phenotype. Other studies, however, indicate that the source of infection may also play a role in such phenotype. To address this question an experiment was set up in which either of two different natural scrapie sources, AAS from AA136 Suffolk and VVC from VV136 Cheviot sheep, were inoculated into AA136, VA136 and VV136 sheep recipients (n = 52). The immunohistochemical (IHC) profile of disease-associated PrP (PrPd) accumulation in the brain of recipient sheep was highly consistent upon codon 136 homologous and semi-homologous transmission, but could be either similar to or different from those of the inoculum donors. In contrast, the IHC profiles were highly variable upon heterologous transmission (VVC to AA136 and AAS to VV136). Furthermore, sheep of the same Prnp genotype could exhibit different survival times and PrPd profiles depending on the source of infection, and a correlation was observed between IHC and Western blot profiles. It was found that additional polymorphisms at codons 112 or 141 of AA136 recipients resulted in a delayed appearance of clinical disease or even in protection from infection. The results of this study strongly suggest that the scrapie phenotype in sheep results from a complex interaction between source, donor and recipient factors, and that the Prnp genotype of the recipient sheep does not explain the variability observed upon codon 136 heterologous transmissions, arguing for other genetic factors to be involved.

  20. Phenotypic and genotypic screening of rice genotypes at seedling ...

    African Journals Online (AJOL)

    Selection for salinity tolerance genotypes of rice based on phenotypic performance alone is less reliable and will delay progress in breeding. Recent advent of molecular markers, microsatellites or simple sequence repeats (SSRs) are used to find out salt tolerant rice genotypes. Three selected SSR markers; RM7075, ...

  1. Nanostructured Lipid Carriers: A potential drug carrier for cancer chemotherapy

    Directory of Open Access Journals (Sweden)

    Selvamuthukumar Subramanian

    2012-11-01

    Full Text Available Abstract Nanotechnology having developed exponentially, the aim has been on therapeutic undertaking, particularly for cancerous disease chemotherapy. Nanostructured lipid carriers have attracted expanding scientific and commercial vigilance in the last couple of years as alternate carriers for the pharmaceutical consignment, particularly anticancer pharmaceuticals. Shortcomings often came across with anticancer mixtures, such as poor solubility, normal tissue toxicity, poor specificity and steadiness, as well as the high incidence rate of pharmaceutical resistance and the rapid degradation, need of large-scale output procedures, a fast release of the pharmaceutical from its carrier scheme, steadiness troubles, the residues of the organic solvents utilized in the output method and the toxicity from the polymer with esteem to the carrier scheme are anticipated to be overcome through use of the Nanostructured Lipid Carrier. In this review the benefits, types, drug release modulations, steadiness and output techniques of NLCs are discussed. In supplement, the function of NLC in cancer chemotherapy is presented and hotspots in research are emphasized. It is foreseen that, in the beside future, nanostructured lipid carriers will be further advanced to consign cytotoxic anticancer compounds in a more efficient, exact and protected manner.

  2. Common genotypes of hepatitis B virus

    International Nuclear Information System (INIS)

    Idrees, M.; Khan, S.; Riazuddin, S.

    2004-01-01

    Objective: To find out the frequency of common genotypes of hepatitis-B virus (HBV). Subjects and Methods: HBV genotypes were determined in 112 HBV DNA positive sera by a simple and precise molecular genotyping system base on PCR using type-specific primers for the determination of genotypes of HBV A through H. Results: Four genotypes (A,B,C and D) out of total eight reported genotypes so far were identified. Genotypes A, B and C were predominant. HBV genotype C was the most predominant in this collection, appearing in 46 samples (41.7%). However, the genotypes of a total of 5 (4.46%) samples could not be determined with the present genotyping system. Mixed genotypes were seen in 8(7.14% HBV) isolates. Five of these were infected with genotypes A/D whereas two were with genotypes C/D. One patient was infected with 4 genotypes (A/B/C/D). Genotype A (68%) was predominant in Sindh genotype C was most predominant in North West Frontier Province (NWFP) (68.96) whereas genotype C and B were dominant in Punjab (39.65% and 25.86% respectively). Conclusion: All the four common genotypes of HBV found worldwide (A,B,C and D) were isolated. Genotype C is the predominant Genotypes B and C are predominant in Punjab and N.W.F.P. whereas genotype A is predominant in Sindh. (author)

  3. APOE-ɛ4 Carrier Status and Donepezil Response in Patients with Alzheimer’s Disease

    Science.gov (United States)

    Waring, Jeffrey F.; Tang, Qi; Robieson, Weining Z.; King, David P.; Das, Ujjwal; Dubow, Jordan; Dutta, Sandeep; Marek, Gerard J.; Gault, Laura M.

    2015-01-01

    Abstract Background: Previous studies have investigated associations between apolipoprotein E (APOE)-ɛ4 allele status and acetylcholinesterase inhibitor treatment response in patients with Alzheimer’s disease. The ability to draw definitive conclusions regarding the effect of APOE-ɛ4 genotype on treatment response has been hindered by inconsistent results among studies and methodological limitations that restrict interpretation of study findings. Objective: To determine whether APOE-ɛ4 carrier status influences the magnitude of change in 13-item Alzheimer’s Disease Assessment Scale−Cognitive Subscale (ADAS-cog) score associated with acetylcholinesterase inhibitor treatment (i.e., donepezil). Methods: Analyses were performed using pooled data from the donepezil and placebo treatment arms of three consecutive, similarly designed, 12-week, multi-national, randomized clinical studies that enrolled patients with mild-to-moderate Alzheimer’s disease. Correlations between APOE-ɛ4 carrier status and ADAS-cog scores were evaluated using analysis of covariance. Results: No appreciable interaction between donepezil response and APOE-ɛ4 carrier status or copy number was detected. Both carriers and non-carriers of APOE-ɛ4 who received donepezil experienced significant improvements from baseline in ADAS-cog score versus placebo (p donepezil treatment group was – 2.95 for APOE-ɛ4 carriers and – 4.09 for non-carriers (p = 0.23). In contrast, non-carriers of APOE-ɛ4 in the placebo treatment group exhibited a greater improvement from baseline versus carriers (–2.38 versus – 0.60, p = 0.05). Conclusion: Within this population, APOE genotype had no statistically significant effect on cognitive response to donepezil treatment; however, APOE-ɛ4 allele status was associated with a difference in the magnitude of the change in ADAS-cog of placebo-treated patients. PMID:26402762

  4. Experimental immunologically mediated aplastic anemia (AA) in mice: cyclosporin A fails to protect against AA

    International Nuclear Information System (INIS)

    Knospe, W.H.; Steinberg, D.; Gratwohl, A.; Speck, B.

    1984-01-01

    Immunologically mediated aplastic anemia (AA) in mice was induced by the i.v. injection of 10(7) lymph node cells (LNC) from H-2k identical but Mls mismatched CBA/J donor mice into previously irradiated (600 rad total body gamma) C3H/HeJ mice. Cyclosporin A (CsA), 25 mg/kg, was administered subcutaneously from day -1 to day 30. Control mice included C3H/HeJ mice which received 600 rad alone, C3H/HeJ mice which received 600 rad plus CsA as above, and C3H/HeJ mice which received 600 rad total body irradiation followed by 10(7) LNC from CBA/J donors. CsA failed to prevent lethal AA. These results suggest that the pathogenetic mechanisms operating in immunologically mediated AA differ from the mechanisms operating in rodents transplanted with allogeneically mismatched marrow or spleen cells which develop graft-versus-host disease. The results are consistent with a non-T cell-dependent mechanism causing the AA

  5. Simon van der Meer in the AA Control Room

    CERN Multimedia

    CERN PhotoLab

    1984-01-01

    Simon van der Meer, spiritus rector of the Antiproton Accumulator, in the AA Control Room. Inventor of stochastic cooling, on which the AA was based, and of the magnetic horn, with which the antiprotons were focused, he also wrote most of the software with which the AA was controlled, and spent uncountable numbers of hours in this chair to tickle the AA to top performance. 8 months after this picture was taken, he received, in October 1984, the Nobel prize, together with Carlo Rubbia, the moving force behind the whole Proton-Antiproton Collider project that led to the discovery, in 1983, of the W and Z intermediate bosons.

  6. Flow Injection and Atomic Absorption Spectrometry (FI-AAS) -

    DEFF Research Database (Denmark)

    Hansen, Elo Harald

    1996-01-01

    One of the advantages of the flow injection (FI) concept is that it is compatible with virtually all detection techniques. Being a versatile vehicle for enhancing the performance of the individual detection devices, the most spectacular results have possibly been obtained in conjunction with atomic...... absorption spectrometry (AAS). Initially with flame-AAS (fAAS) procedures, later for hydride generation (HG) techniques, and most recently in combination with electrothermal AAS (ETAAS). The common denominator for all these procedures is the inherently precise and strictly reproducible timing in FI from...

  7. Solute carrier transporters: Pharmacogenomics research ...

    African Journals Online (AJOL)

    Aghogho

    2010-12-27

    -binding cassette) transporters, which include MDR1, a protein that pumps xenobiotics from cells, and the SLC (solute carrier) trans- porters, which take up neurotransmitters, nutrients, heavy metals, and other substrates into ...

  8. Methylenetetrahydrofolate reductase genotypes and haplotypes associated with susceptibility to colorectal cancer in an eastern Chinese Han population.

    Science.gov (United States)

    Li, H; Xu, W L; Shen, H L; Chen, Q Y; Hui, L L; Long, L L; Zhu, X L

    2011-12-14

    Methylenetetrahydrofolate reductase (MTHFR) plays an important role in folate metabolism and is involved in DNA synthesis, DNA repair and DNA methylation. The two common functional polymorphisms of MTHFR, C677T and A1298C have been associated with several diseases, including cancer. We made a case-control study to analyze a possible association of MTHFR gene polymorphisms C677T and A1298C with risk for colorectal cancer in an eastern Chinese Han population of 137 patients with a confirmed histopathological diagnosis of CRC and 145 age- and gender-matched controls with no history of cancer. DNA was isolated from peripheral blood samples and the genotypes were determined by PCR-RFLP. The concentrations of folate in plasma were measured by chemiluminescence immunoassay. The MTHFR 677TT genotype had a protective effect against colorectal cancer, with an odds ratio (OR) = 0.467 (95% confidence interval (CI) = 0.225-0.966). The 1298CC genotype was significantly correlated with a reduced risk of colorectal cancer (OR = 0.192; 95%CI = 0.040-0.916). Compared with the MTHFR 677CC and MTHFR 1298 AA genotypes, for individuals who carried both MTHFR 677CC and 1298CC genotypes, the OR of colorectal cancer was 0.103 (95%CI = 0.012-0.900); among individuals who carried both MTHFR 677TT and 1298AC genotypes, the OR for risk of colorectal cancer was 0.169 (95%CI = 0.044-0.654). MTHFR 677TT+CT genotypes had a significantly lower plasma folate concentration than those with the MTHFR 677CC genotype. MTHFR 1298AC+CC genotypes had a lower plasma folate concentration than those with the MTHFR 1298AA genotype (P < 0.05). In conclusion, subjects with the MTHFR 677TT and MTHFR 1298CC genotypes appeared to have a significantly lower risk for colorectal cancer. MTHFR haplotypes 677CC/1298CC and 677TT/1298AC were less common in cases than in controls. These haplotypes, when compared to the most common haplotype 677CC/1298AA, were associated with a decreased risk for colorectal cancer. We

  9. Moessbauer spectrometer MsAa-3

    International Nuclear Information System (INIS)

    Gornicki, R.; Blachowski, A.; Ruebenbauer, K.

    2007-01-01

    The paper is aimed at the description of the newly developed Moessbauer spectrometer MsAa-3. The spectrometer MsAa-3 consists of a high quality γ--ray spectrometer including either a proportional gas detector head or a scintillation detector head, a transducer driving system including the transducer, data storage system, and data communication system based on the TCP/IP protocol. Additionally, the Michelson-Morley interferometer is provided for precise calibration of the transducer velocity. The spectrometer is equipped with an integrated simple temperature controller. All the essential functions are remotely controlled over the TCP/IP link allowing for the spectrometer set-up as the stand-alone unit in the computer network, e.g. on the Internet. External γ-ray detectors or external complete nuclear blocks could be used as well. The spectrometer is equipped with software allowing for setting all the functions, to perform on-line control, and retrieve data. The Moessbauer data processing software MOSGRAF is enclosed as well. The latter software allows for the calculation of the variety of velocity reference functions. (authors)

  10. Stable wafer-carrier system

    Energy Technology Data Exchange (ETDEWEB)

    Rozenzon, Yan; Trujillo, Robert T; Beese, Steven C

    2013-10-22

    One embodiment of the present invention provides a wafer-carrier system used in a deposition chamber for carrying wafers. The wafer-carrier system includes a base susceptor and a top susceptor nested inside the base susceptor with its wafer-mounting side facing the base susceptor's wafer-mounting side, thereby forming a substantially enclosed narrow channel. The base susceptor provides an upward support to the top susceptor.

  11. HBV Genotypic Variability in Cuba

    Science.gov (United States)

    Loureiro, Carmen L.; Aguilar, Julio C.; Aguiar, Jorge; Muzio, Verena; Pentón, Eduardo; Garcia, Daymir; Guillen, Gerardo; Pujol, Flor H.

    2015-01-01

    The genetic diversity of HBV in human population is often a reflection of its genetic admixture. The aim of this study was to explore the genotypic diversity of HBV in Cuba. The S genomic region of Cuban HBV isolates was sequenced and for selected isolates the complete genome or precore-core sequence was analyzed. The most frequent genotype was A (167/250, 67%), mainly A2 (149, 60%) but also A1 and one A4. A total of 77 isolates were classified as genotype D (31%), with co-circulation of several subgenotypes (56 D4, 2 D1, 5 D2, 7 D3/6 and 7 D7). Three isolates belonged to genotype E, two to H and one to B3. Complete genome sequence analysis of selected isolates confirmed the phylogenetic analysis performed with the S region. Mutations or polymorphisms in precore region were more common among genotype D compared to genotype A isolates. The HBV genotypic distribution in this Caribbean island correlates with the Y lineage genetic background of the population, where a European and African origin prevails. HBV genotypes E, B3 and H isolates might represent more recent introductions. PMID:25742179

  12. The androgen receptor CAG repeat polymorphism and modification of breast cancer risk in BRCA1 and BRCA2 mutation carriers

    International Nuclear Information System (INIS)

    Spurdle, Amanda B; Purdie, David M; Newman, Beth; Dite, Gillian S; Apicella, Carmel; Southey, Melissa C; Giles, Graham G; Hopper, John L; Chenevix-Trench, Georgia; Easton, Douglas F; Antoniou, Antonis C; Duffy, David L; Pandeya, Nirmala; Kelemen, Livia; Chen, Xiaoqing; Peock, Susan; Cook, Margaret R; Smith, Paula L

    2005-01-01

    The androgen receptor (AR) gene exon 1 CAG repeat polymorphism encodes a string of 9–32 glutamines. Women with germline BRCA1 mutations who carry at least one AR allele with 28 or more repeats have been reported to have an earlier age at onset of breast cancer. A total of 604 living female Australian and British BRCA1 and/or BRCA2 mutation carriers from 376 families were genotyped for the AR CAG repeat polymorphism. The association between AR genotype and disease risk was assessed using Cox regression. AR genotype was analyzed as a dichotomous covariate using cut-points previously reported to be associated with increased risk among BRCA1 mutation carriers, and as a continuous variable considering smaller allele, larger allele and average allele size. There was no evidence that the AR CAG repeat polymorphism modified disease risk in the 376 BRCA1 or 219 BRCA2 mutation carriers screened successfully. The rate ratio associated with possession of at least one allele with 28 or more CAG repeats was 0.74 (95% confidence interval 0.42–1.29; P = 0.3) for BRCA1 carriers, and 1.12 (95% confidence interval 0.55–2.25; P = 0.8) for BRCA2 carriers. The AR exon 1 CAG repeat polymorphism does not appear to have an effect on breast cancer risk in BRCA1 or BRCA2 mutation carriers

  13. [Changes of CD34(+) and CD71(+)CD45(-) cell levels in bone marrow of MDS and AA patients].

    Science.gov (United States)

    Yan, Zhen-Yu; Tian, Xu; Li, Ying; Yang, Mei-Rong; Zhang, Song; Wang, Xie-Ming; Zhang, Hai-Xia; Cheng, Nai-Yao

    2014-04-01

    This study was aimed to investigate the changes of CD34(+) and CD71(+)CD45(-) cell levels in MDS and AA patients. A total of 25 cases MDS and 43 cases of AA (18 cases SAA and 25 cases of NSAA) from January 2010 to October 2013 in the Department of Hematology, affiliated hospital of Hebei United University were enrolled in this study. The complete blood count, bone marrow smears, bone marrow biopsy, karyotype analysis and bone marrow blood cell immune genotyping (mainly the proportion of CD34(+) cells, CD71(+)CD45(-) cells in nucleated cells) were carried out for all patients; the changes of CD34(+) and CD71(+)CD45(-) cell levels in patients with MDS and AA (SAA NSAA) were compared; the differences of white blood cell count, platelet count and hemoglobin concentration in patients with count of CD71(+)CD45(-) ≥ 15% or MDS group was higher than that in AA (NSAA and SAA) group (P MDS group was higher than that in SAA (P MDS group. In MDS group with CD71(+)CD45(-) ≥ 15%, the platelet count was significantly higher than that in NSAA group (P MDS and NSAA group with CD71(+)CD45(-) 0.05). It is concluded that the count of CD34(+) cells in MDS patients is significantly higher than that in AA and SAA patients. The count of CD71(+)CD45(-) cells in MDS group is significantly higher than that of SAA group. The platelet count in MDS patients with CD71(+)CD45(-) cells ≥ 15% is significantly higher than that of the NSAA group.

  14. Combined genotype and haplotype distributions of MTHFR C677T and A1298C polymorphisms: A cross-sectional descriptive study of 13,473 Chinese adult women.

    Science.gov (United States)

    Fan, Shujun; Yang, Boyi; Zhi, Xueyuan; Wang, Yanxun; Zheng, Quanmei; Sun, Guifan

    2016-11-01

    Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms are, independently and/or in combination, associated with many disorders. However, data on the combined genotype and haplotype distributions of the 2 polymorphisms in Chinese population were limited.We recruited 13,473 adult women from 9 Chinese provinces, collected buccal cell samples, and determined genotypes, to estimate the combined genotype and haplotype distributions of the MTHFR C677T and A1298C polymorphisms.In the total sample, the 6 common combined genotypes were CT/AA (29.5%), TT/AA (21.9%), CC/AA (15.4%), CC/AC (14.9%), CT/AC (13.7%), and CC/CC (3.4%); the 3 frequent haplotypes were 677T-1298A (43.6%), 677C-1298A (37.9%), and 677C-1298C (17.6%). Importantly, we observed that there were 51 (0.4%) individuals with the CT/CC genotype, 92 (0.7%) with the TT/AC genotype, 17 (0.1%) with the TT/CC genotype, and that the frequency of the 677T-1298C haplotype was 0.9%. In addition, the prevalence of some combined genotypes and haplotypes varied among populations residing in different areas and even showed apparent geographical gradients. Further linkage disequilibrium analysis showed that the D' and r values were 0.883 and 0.143, respectively.In summary, the findings of our study provide further strong evidence that the MTHFR C677T and A1298C polymorphisms are usually in trans and occasionally in cis configurations. The frequencies of mutant genotype combinations were relatively higher in Chinese population than other populations, and showed geographical variations. These baseline data would be useful for future related studies and for developing health management programs.

  15. IQ, educational attainment, memory and plasma lipids: associations with apolipoprotein E genotype in 5995 children.

    Science.gov (United States)

    Taylor, Amy E; Guthrie, Philip A I; Smith, George Davey; Golding, Jean; Sattar, Naveed; Hingorani, Aroon D; Deanfield, John E; Day, Ian N M

    2011-07-15

    Apolipoprotein E (APOE) genotype (ε2/ε3/ε4: rs429358 ε4 allele; rs7412 ε2 allele) is strongly associated with both lipid levels and Alzheimer's disease. Although there is also evidence of milder cognitive impairment in later life in carriers of the APOE ε4 allele, there have been few studies investigating the impact of APOE genotype on cognitive function in children. We determined APOE genotype in 5995 children from the Avon Longitudinal Study of Parents and Children and investigated associations between APOE genotype and plasma lipids (at age 9), IQ (at age 8), memory (at ages 8 and 10), and performance in school attainment tests (at ages 7, 11, and 14). Observed genotype group counts were consistent with Hardy-Weinberg equilibrium (χ(2)p value = .84). There were strong relationships between APOE genotype and low-density lipoprotein cholesterol, high-density lipoprotein cholesterol, and triglycerides, which follow the same patterns as in adults. There was no strong evidence to suggest that APOE genotype was associated with IQ (all p values ≥ .46), memory function (p ≥ .35), or school attainment test results (p ≥ .28). Although APOE genotype does have strong associations with lipid levels in childhood, there does not seem to be meaningful effects on cognitive performance, suggesting that any detrimental effects of the ε4 allele on cognitive function are not important until later life. Copyright © 2011 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  16. Idiopathic systemic AA-amyloidosis in a skunk (Mephitis mephitis).

    Science.gov (United States)

    Elhensheri, Mohamed; Linke, Reinhold P; Blankenburg, Anja; Beineke, Andreas

    2012-03-01

    This report describes a case of systemic amyloidosis in a captive striped skunk. At necropsy, bilateral alopecia, as well as reno-, hepato-, and splenomegaly were present. Congo red staining and immunohistochemistry revealed depositions of AA-amyloid in different organs. The lack of a predisposing disease is suggestive of idiopathic systemic AA-amyloidosis.

  17. Partially melted zone cracking in AA6061 welds

    International Nuclear Information System (INIS)

    Prasad Rao, K.; Ramanaiah, N.; Viswanathan, N.

    2008-01-01

    Partially melted zone (PMZ) cracking susceptibility in AA6061 alloy was studied. Role of prior thermal history, gas tungsten arc welding techniques such as continuous current (CC) and pulsed current (PC) and use of different fillers (AA4043 and AA5356) were studied. Role of different grain refiners such as scandium, zirconium and Tibor in the above fillers was studied. Varestraint test was used to study the PMZ cracking susceptibility. Metallurgical analysis was done to corroborate the results. PMZ cracking was severe in T6 temper than in T4 irrespective of filler material. PMZ cracking susceptibility was more with AA5356 than in AA4043. It was less with pulsed current GTAW. PMZ cracking susceptibility was reduced with addition of grain refiners. Out of all, lowest PMZ cracking susceptibility was observed with 0.5%Sc addition to fusion zone through AA4043 filler and PC technique. The concentrations of magnesium and silicon were reduced at the PMZ grain boundaries with grain refiner additions to fusion zone through AA5356 or AA4043

  18. Partially melted zone cracking in AA6061 welds

    Energy Technology Data Exchange (ETDEWEB)

    Prasad Rao, K. [Department of Metallurgical and Materials Engineering, Indian Institute of Technology Madras, Chennai (India)], E-mail: kpr@iitm.ac.in; Ramanaiah, N. [Sri Kalahasteeswara Institute of Technology, Srikalahasti (India); Viswanathan, N. [Defence Research and Development Laboratory, Hyderabad (India)

    2008-07-01

    Partially melted zone (PMZ) cracking susceptibility in AA6061 alloy was studied. Role of prior thermal history, gas tungsten arc welding techniques such as continuous current (CC) and pulsed current (PC) and use of different fillers (AA4043 and AA5356) were studied. Role of different grain refiners such as scandium, zirconium and Tibor in the above fillers was studied. Varestraint test was used to study the PMZ cracking susceptibility. Metallurgical analysis was done to corroborate the results. PMZ cracking was severe in T6 temper than in T4 irrespective of filler material. PMZ cracking susceptibility was more with AA5356 than in AA4043. It was less with pulsed current GTAW. PMZ cracking susceptibility was reduced with addition of grain refiners. Out of all, lowest PMZ cracking susceptibility was observed with 0.5%Sc addition to fusion zone through AA4043 filler and PC technique. The concentrations of magnesium and silicon were reduced at the PMZ grain boundaries with grain refiner additions to fusion zone through AA5356 or AA4043.

  19. The Use of Soil Palynomorphs in Forensics * ABDULRAHAMAN, AA ...

    African Journals Online (AJOL)

    ADOWIE PERE

    The Use of Soil Palynomorphs in Forensics. *. 1. ABDULRAHAMAN, AA;. 2. AL SAHLI, AA;. 1. OKOLI, JU. 1Applied Plant Anatomy and Wood Technology Laboratory, Department of Plant Biology, University of Ilorin, Ilorin, Nigeria. 2Department of Botany and Microbiology, College of Science, King Saud University, Riyadh, ...

  20. Evolution of geomagnetic aa index near sunspot minimum

    Directory of Open Access Journals (Sweden)

    R. P. Kane

    2002-10-01

    Full Text Available The smoothed values of the minima of sunspot number Rz and the geomagnetic index aa were compared for sunspot cycles 12–23. In one cycle, aa(min occurred earlier than Rz(min, but remained at that low from a few months before Rz(min to a few months after Rz(min. In two cycles, Rz(min and aa(min coincided within a month or two. In nine cycles, aa(min occurred more than three months later than Rz(min. The aa(min coincided with the minima of some solar radio emission indices originating in the solar corona. For sunspot cycles 21, 22, 23, the minimum of solar wind velocity V occurred 0–9 months later than the aa(min. The minimum of solar wind total magnetic field B occurred near Rz(min. The solar wind ion density N had maxima (instead of minima near Rz(min, and again near Rz(max, indicating a  ~5-year periodicity, instead of an 11-year periodicity. The maxima of aa, V and B occurred near Rz(max and/or later in the declining phase of Rz. The aa index was very well correlated with the functions BV and BV 2.Key words. Geomagnetism and paleomagnetism (time variations, diurnal to secular – time variations, secular and long term Interplanetary physics (interplanetary magnetic field

  1. Development and application of hepatitis C reporter viruses with genotype 1 to 7 core-nonstructural protein 2 (NS2) expressing fluorescent proteins or luciferase in modified JFH1 NS5A

    DEFF Research Database (Denmark)

    Gottwein, Judith M; Jensen, Tanja B; Mathiesen, Christian K

    2011-01-01

    domain III of the genotype 2a virus J6/JFH1 [2a(J6)]. During Huh7.5 cell culture adaptation, 2a(J6)-EGFP acquired a 40-amino-acid (aa) (¿40) or 25-aa (¿25) deletion in NS5A domain II, rescuing the impairment of viral assembly caused by the EGFP insertion. ¿40 conferred efficient growth characteristics...

  2. 29 CFR 1201.1 - Carrier.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 4 2010-07-01 2010-07-01 false Carrier. 1201.1 Section 1201.1 Labor Regulations Relating to Labor (Continued) NATIONAL MEDIATION BOARD DEFINITIONS § 1201.1 Carrier. The term carrier includes any express company, sleeping car company, carrier by railroad, subject to the Interstate Commerce Act...

  3. Carbon: Hydrogen Carrier or Disappearing Skeleton?

    NARCIS (Netherlands)

    Jong, K.P. de; Wechem, H.M.H. van

    1994-01-01

    The use of liquid hydrocarbons as energy carriers implies the use of carbon as a carrier for hydrogen to facilitate hydrogen transport and storage. The current trend for liquid energy carriers used in the transport sector is to maximize the load of hydrogen on the carbon carrier. The recently

  4. AA, shims and washers on quadrupole ends

    CERN Multimedia

    CERN PhotoLab

    1981-01-01

    Due to the fact that much of the field of the quadrupoles was outside the iron (in particular with the wide quadrupoles) and that thus the fields of quadrupoles and bending magnets interacted, the lattice properties of the AA could not be predicted with the required accuracy. After a first running period in 1980, during which detailed measurements were made with proton test beams, corrections to the quadrupoles were made in 1981, in the form of laminated shims at the ends of the poles, and with steel washers. With the latter ones, further refinements were made in an iterative procedure with measurements on the circulating beam. This eventually resulted, amongst other things, in a very low chromaticity, with the Q-values being constant to within +- 0.001 over the total momentum range of 6 %. Here we see the shims and washers on a narrow qudrupole (QFN, QDN). See also 8103203, 8103204, 8103205, 8103206.

  5. Hot stamping of AA7075 aluminum sheets

    Science.gov (United States)

    Mendiguren, J.; Saenz de Argandona, E.; Galdos, L.

    2016-11-01

    In this work the formability of a high strength aluminium alloy (AA7075-T6) for the stamping of an automotive component has been studied. Due to the low formability of the selected alloy, two different heat assisted forming strategies have been analysed. On the one hand, the W-temper process, where the thermal process is carried out prior to the forming operation. On the other hand, the hot stamping process, where the thermal process is carried out at the same time as the forming. The results showed that both technology were able to form the component avoiding any failure of the material. On the contrary, both processes reduced the final mechanical properties of the material compared to the as received material condition. However, the obtained mechanical properties doubled the strength of commonly used 5xxx and 6xxx aluminium alloys.

  6. Straddle carrier radiation portal monitoring

    Science.gov (United States)

    Andersen, Eric S.; Samuel, Todd J.; Mullen, O. Dennis

    2005-05-01

    U.S. Customs and Border Protection (CBP) is the primary enforcement agency protecting the nation"s ports of entry. CBP is enhancing its capability to interdict the illicit import of nuclear and radiological materials and devices that may be used by terrorists. Pacific Northwest National Laboratory (PNNL) is providing scientific and technical support to CBP in their goal to enable rapid deployment of nuclear and radiation detection systems at U. S. ports of entry to monitor 100% of the incoming international traffic and cargo while not adversely impacting the operations or throughput of the ports. The U.S. ports of entry include the following vectors: land border crossings, seaports, airports, rail crossings, and mail and express consignment courier facilities. U.S. Customs and Border Protection (CBP) determined that a screening solution was needed for Seaport cargo containers being transported by Straddle Carriers (straddle carriers). A stationary Radiation Portal Monitor (RPM) for Straddle Carriers (SCRPM) is needed so that cargo containers can be scanned while in transit under a Straddle Carrier. The Straddle Carrier Portal operational impacts were minimized by conducting a time-motion study at the Port, and adaptation of a Remotely Operated RPM (RO-RPM) booth concept that uses logical lighting schemes for traffic control, cameras, Optical Character Recognition, and wireless technology.

  7. Bacterial Carriers for Glioblastoma Therapy

    Directory of Open Access Journals (Sweden)

    Nalini Mehta

    2017-03-01

    Full Text Available Treatment of aggressive glioblastoma brain tumors is challenging, largely due to diffusion barriers preventing efficient drug dosing to tumors. To overcome these barriers, bacterial carriers that are actively motile and programmed to migrate and localize to tumor zones were designed. These carriers can induce apoptosis via hypoxia-controlled expression of a tumor suppressor protein p53 and a pro-apoptotic drug, Azurin. In a xenograft model of human glioblastoma in rats, bacterial carrier therapy conferred a significant survival benefit with 19% overall long-term survival of >100 days in treated animals relative to a median survival of 26 days in control untreated animals. Histological and proteomic analyses were performed to elucidate the safety and efficacy of these carriers, showing an absence of systemic toxicity and a restored neural environment in treated responders. In the treated non-responders, proteomic analysis revealed competing mechanisms of pro-apoptotic and drug-resistant activity. This bacterial carrier opens a versatile avenue to overcome diffusion barriers in glioblastoma by virtue of its active motility in extracellular space and can lead to tailored therapies via tumor-specific expression of tumoricidal proteins.

  8. Contribution of Matrix Metalloproteinase-7 Genotypes to the Risk of Non-solid Tumor, Childhood Leukemia.

    Science.gov (United States)

    Pei, Jen-Sheng; Chou, An-Kuo; Hsu, Pei-Chen; Tsai, Chia-Wen; Chang, Wen-Shin; Wu, Meng-Feng; Wu, Ming-Hsien; Hsia, Te-Chun; Cheng, Shun-Ping; Bau, DA-Tian

    2017-12-01

    The matrix metalloproteinases (MMPs) are important in inflammation and carcinogenesis, and the genotypic role of MMP7 has never been examined in leukemia to date. Therefore, in this study we aimed to evaluate the contribution of the genotypic variants in the promoter region of MMP7 (A-181G and C-153T) to childhood acute lymphoblastic leukemia (ALL) risk in Taiwan. In this case-control study, 266 patients with childhood ALL and 266 non-cancer controls were genotyped by polymerase chain reaction-restriction fragment length polymorphism methodology. The distribution of AA, AG and GG for MMP7 promoter A-181G genotype was 83.5, 12.0 and 4.5% in the childhood ALL group and 89.8%, 9.4 and 0.8% in the non-cancer control group, respectively (p for trend=0.0134), significantly differentially distributed between childhood ALL and control groups. The comparisons in allelic frequency distribution also support the findings that G appears to be the risky allele in childhood ALL. In genotype and gender interaction analysis, it was found that boys carrying the MMP7 A-181G GG and AG+GG genotypes had 9.05- and 2.45-fold odds ratios (ORs) (p=0.0135 and 0.0142, respectively) for childhood ALL compared to those carrying wild-type AA genotype. But these differences were not found in girls. Analysis of genotype interaction with age of onset age showed those aged less than 3.5 years at onset carrying the GG or AG+GG genotypes also had elevated ORs of 8.79- and 2.04-fold (p=0.0150 and 0.0413, respectively) for childhood ALL, but there was no such difference for those having an age at onset of 3.5 years or more. Our results indicate that the MMP7 A-181G genotype interacts with age and gender and may serve as an early and predictive biomarker for childhood ALL. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  9. Echinococcus granulosus genotypes in Iran

    Science.gov (United States)

    Sharafi, Seyedeh Maryam; Rostami-Nejad, Mohammad; Moazeni, Mohammad; Yousefi, Morteza; Saneie, Behnam; Hosseini-Safa, Ahmad

    2014-01-01

    Hydatidosis, caused by Echinococcus granulosus is one of the most important zoonotic diseases, throughout most parts of the world. Hydatidosis is endemic in Iran and responsible for approximately 1% of admission to surgical wards. There are extensive genetic variations within E. granulosus and 10 different genotypes (G1–G10) within this parasite have been reported. Identification of strains is important for improvement of control and prevention of the disease. No new review article presented the situation of Echinococcus granulosus genotypes in Iran in the recent years; therefore in this paper we reviewed the different studies regarding Echinococcus granulosus genotypes in Iran. PMID:24834298

  10. Dicty_cDB: FC-AA17 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA17 (Link to dictyBase) - - - Contig-U15091-1 FC-AA17E (Li...nk to Original site) - - - - - - FC-AA17E 347 Show FC-AA17 Library FC (Link to library) Clone ID FC-AA17 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA17Q.Seq.d/ Representative seq. ID FC-AA...17E (Link to Original site) Representative DNA sequence >FC-AA17 (FC-AA17Q) /CSM/FC/FC-AA/FC-AA17Q.Seq.d/ CCCAAAAGCCCGTAA...GACTCACTGTGTCAAGTGCAACAAACACACCCCACACAAGGTTAC CCAATACAAAGCTGGTAAACCAAGTCTTTTCGCACAAGGTAAAAGACGTTACGATCGTAA ACAA

  11. Dicty_cDB: FCL-AA22 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA22 (Link to dictyBase) - G01758 DDB0229949 Contig-U15119-1 FCL-AA...22E (Link to Original site) - - - - - - FCL-AA22E 840 Show FCL-AA22 Library FCL (Link to library) Clone ID FCL-AA...g-U15119-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...22Q.Seq.d/ Representative seq. ID FCL-AA22E (Link to Original site) Representative DNA sequence >FCL-AA22 (FCL-AA...22Q) /CSM/FCL/FCL-AA/FCL-AA22Q.Seq.d/ AAAATGAGCAAAATCTCAAGCGACCAAGTTAGATCAATCGTCTCCCAACTTTTCAAAGAA GCACAAGAATCCAAAA

  12. Dicty_cDB: FC-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA05 (Link to dictyBase) - G01143 DDB0190243 Contig-U15085-1 FC-AA...05E (Link to Original site) - - - - - - FC-AA05E 675 Show FC-AA05 Library FC (Link to library) Clone ID FC-AA...5-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA05Q.Se...q.d/ Representative seq. ID FC-AA05E (Link to Original site) Representative DNA sequence >FC-AA05 (FC-AA05Q) /CSM/FC/FC-AA/FC-AA...05Q.Seq.d/ AAACAAAAAAAAAAGGTATGGAAATTTTTGCATTTGTACCATTAGCAGTGTTAACAGCAT TATGTGTTGTTATTTCACTCTTTGTTAAAAGAGAGAAA

  13. Dicty_cDB: FC-AA16 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA16 (Link to dictyBase) - G22556 DDB0204121 Contig-U15090-1 FC-AA...16E (Link to Original site) - - - - - - FC-AA16E 933 Show FC-AA16 Library FC (Link to library) Clone ID FC-AA...0-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA16Q.Se...q.d/ Representative seq. ID FC-AA16E (Link to Original site) Representative DNA sequence >FC-AA16 (FC-AA16Q) /CSM/FC/FC-AA/FC-AA...16Q.Seq.d/ GGGCAGGATCATCATTTAATACTAAAGATTCAACAATAATTGCAAAAACTCAATTTTATC AAAAAAATATTCAAATTTATAAAGGTGATCAA

  14. Dicty_cDB: FCL-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA06 (Link to dictyBase) - G24322 DDB0216974 Contig-U15228-1 FCL-AA...06E (Link to Original site) - - - - - - FCL-AA06E 791 Show FCL-AA06 Library FCL (Link to library) Clone ID FCL-AA...g-U15228-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...06Q.Seq.d/ Representative seq. ID FCL-AA06E (Link to Original site) Representative DNA sequence >FCL-AA06 (FCL-AA...06Q) /CSM/FCL/FCL-AA/FCL-AA06Q.Seq.d/ AAAATCCCAATTTCATTAGCAGTGGAAGTAACGGAATGAATTGGGGTGGTTCTTTGAACA CTTGTGACTCTGGAGGATTCAA

  15. Dicty_cDB: FC-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA15 (Link to dictyBase) - G01144 DDB0204372 Contig-U15089-1 FC-AA...15E (Link to Original site) - - - - - - FC-AA15E 522 Show FC-AA15 Library FC (Link to library) Clone ID FC-AA...9-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA15Q.Se...q.d/ Representative seq. ID FC-AA15E (Link to Original site) Representative DNA sequence >FC-AA15 (FC-AA15Q) /CSM/FC/FC-AA/FC-AA...15Q.Seq.d/ CAAATCACACATAAAAGTTTAATATAAAAATGGGTACACCAATTAAAAAGATTAGTACAG TAATTATTAAAATGGTTTCATCAGCCAA

  16. Dicty_cDB: FC-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA21 (Link to dictyBase) - - - Contig-U15450-1 FC-AA21E (Li...nk to Original site) - - - - - - FC-AA21E 839 Show FC-AA21 Library FC (Link to library) Clone ID FC-AA21 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA21Q.Seq.d/ Representative seq. ID FC-AA...21E (Link to Original site) Representative DNA sequence >FC-AA21 (FC-AA21Q) /CSM/FC/FC-AA/FC-AA21Q.Seq.d/ AATTATTTTCATTAA...TTTTAGCTTTATTCCTTGTCAACTCCGCTGTTGTCTCTTCACTCG ACTCATGTAGTATTTGTGTTGATTTTGTTGGTAACTCACTCAATGATCTTTTAAATATTA TCCTTAA

  17. Dicty_cDB: FCL-AA23 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA23 (Link to dictyBase) - G01759 DDB0201558 Contig-U15118-1 FCL-AA...23E (Link to Original site) - - - - - - FCL-AA23E 1045 Show FCL-AA23 Library FCL (Link to library) Clone ID FCL-AA...ig-U15118-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...23Q.Seq.d/ Representative seq. ID FCL-AA23E (Link to Original site) Representative DNA sequence >FCL-AA23 (FCL-AA...23Q) /CSM/FCL/FCL-AA/FCL-AA23Q.Seq.d/ ATAACTATATAACTATGTCTAACCAAAAGAAAAACGACGTATCTTCATTTGTTAAAGATT CTTTAA

  18. Dicty_cDB: FCL-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA18 (Link to dictyBase) - G24323 DDB0191144 Contig-U15229-1 FCL-AA...18Z (Link to Original site) - - FCL-AA18Z 623 - - - - Show FCL-AA18 Library FCL (Link to library) Clone ID FCL-AA...g-U15229-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...18Q.Seq.d/ Representative seq. ID FCL-AA18Z (Link to Original site) Representative DNA sequence >FCL-AA18 (FCL-AA...18Q) /CSM/FCL/FCL-AA/FCL-AA18Q.Seq.d/ XXXXXXXXXXGTCAATGTCATTATTGGTGAACAATCTGATGGTTCGTTGGAACAAATCGC TAGAAATCCACAACCAA

  19. Dicty_cDB: FC-AA22 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA22 (Link to dictyBase) - - - Contig-U14948-1 FC-AA22E (Li...nk to Original site) - - - - - - FC-AA22E 576 Show FC-AA22 Library FC (Link to library) Clone ID FC-AA22 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA22Q.Seq.d/ Representative seq. ID FC-AA...22E (Link to Original site) Representative DNA sequence >FC-AA22 (FC-AA22Q) /CSM/FC/FC-AA/FC-AA22Q.Seq.d/ ATGAA...TACGATGATAGTGATTCAGACTTTTGACCAATTGAAAAAACCAGCAACAGAAATG GTACTGGTTTGGTCTCCTCCACTTTTAAGGTTGCCCCTTCCTTCTCTACCATTCAAAAAC AACAA

  20. States' Flexibility Waiver Plans for Alternate Assessments Based on Alternate Achievement Standards (AA-AAS). Synthesis Report 96

    Science.gov (United States)

    Lazarus, Sheryl S.; Edwards, Lynn M.; Thurlow, Martha L.; Hodgson, Jennifer R.

    2014-01-01

    All states have alternate assessments based on alternate achievement standards (AA-AAS) for students with the most significant cognitive disabilities. For accountability purposes, the Elementary and Secondary Education Act (ESEA) allows up to 1% of students to be counted as proficient with this assessment option. In 2011 the U.S. Department of…

  1. 78 FR 66801 - Motor Carrier Safety Advisory Committee; Charter Renewal

    Science.gov (United States)

    2013-11-06

    ... DEPARTMENT OF TRANSPORTATION Federal Motor Carrier Safety Administration [Docket No. FMCSA-2006-26367] Motor Carrier Safety Advisory Committee; Charter Renewal AGENCY: Federal Motor Carrier Safety... and recommendations on motor carrier safety programs and motor carrier safety regulations through a...

  2. Is increased susceptibility to Balkan endemic nephropathy in carriers of common GSTA1 (*A/*B) polymorphism linked with the catalytic role of GSTA1 in ochratoxin a biotransformation? Serbian case control study and in silico analysis.

    Science.gov (United States)

    Reljic, Zorica; Zlatovic, Mario; Savic-Radojevic, Ana; Pekmezovic, Tatjana; Djukanovic, Ljubica; Matic, Marija; Pljesa-Ercegovac, Marija; Mimic-Oka, Jasmina; Opsenica, Dejan; Simic, Tatjana

    2014-08-08

    Although recent data suggest aristolochic acid as a putative cause of Balkan endemic nephropathy (BEN), evidence also exists in favor of ochratoxin A (OTA) exposure as risk factor for the disease. The potential role of xenobiotic metabolizing enzymes, such as the glutathione transferases (GSTs), in OTA biotransformation is based on OTA glutathione adducts (OTHQ-SG and OTB-SG) in blood and urine of BEN patients. We aimed to analyze the association between common GSTA1, GSTM1, GSTT1, and GSTP1 polymorphisms and BEN susceptibility, and thereafter performed an in silico simulation of particular GST enzymes potentially involved in OTA transformations. GSTA1, GSTM1, GSTT1 and GSTP1 genotypes were determined in 207 BEN patients and 138 non-BEN healthy individuals from endemic regions by polymerase chain reaction (PCR). Molecular modeling in silico was performed for GSTA1 protein. Among the GST polymorphisms tested, only GSTA1 was significantly associated with a higher risk of BEN. Namely, carriers of the GSTA1*B gene variant, associated with lower transcriptional activation, were at a 1.6-fold higher BEN risk than those carrying the homozygous GSTA1*A/*A genotype (OR = 1.6; p = 0.037). In in silico modeling, we found four structures, two OTB-SG and two OTHQ-SG, bound in a GSTA1 monomer. We found that GSTA1 polymorphism was associated with increased risk of BEN, and suggested, according to the in silico simulation, that GSTA1-1 might be involved in catalyzing the formation of OTHQ-SG and OTB-SG conjugates.

  3. Is Increased Susceptibility to Balkan Endemic Nephropathy in Carriers of Common GSTA1 (*A/*B Polymorphism Linked with the Catalytic Role of GSTA1 in Ochratoxin A Biotransformation? Serbian Case Control Study and In Silico Analysis

    Directory of Open Access Journals (Sweden)

    Zorica Reljic

    2014-08-01

    Full Text Available Although recent data suggest aristolochic acid as a putative cause of Balkan endemic nephropathy (BEN, evidence also exists in favor of ochratoxin A (OTA exposure as risk factor for the disease. The potential role of xenobiotic metabolizing enzymes, such as the glutathione transferases (GSTs, in OTA biotransformation is based on OTA glutathione adducts (OTHQ-SG and OTB-SG in blood and urine of BEN patients. We aimed to analyze the association between common GSTA1, GSTM1, GSTT1, and GSTP1 polymorphisms and BEN susceptibility, and thereafter performed an in silico simulation of particular GST enzymes potentially involved in OTA transformations. GSTA1, GSTM1, GSTT1 and GSTP1 genotypes were determined in 207 BEN patients and 138 non-BEN healthy individuals from endemic regions by polymerase chain reaction (PCR. Molecular modeling in silico was performed for GSTA1 protein. Among the GST polymorphisms tested, only GSTA1 was significantly associated with a higher risk of BEN. Namely, carriers of the GSTA1*B gene variant, associated with lower transcriptional activation, were at a 1.6-fold higher BEN risk than those carrying the homozygous GSTA1*A/*A genotype (OR = 1.6; p = 0.037. In in silico modeling, we found four structures, two OTB-SG and two OTHQ-SG, bound in a GSTA1 monomer. We found that GSTA1 polymorphism was associated with increased risk of BEN, and suggested, according to the in silico simulation, that GSTA1-1 might be involved in catalyzing the formation of OTHQ-SG and OTB-SG conjugates.

  4. The cytochrome P450 2AA gene cluster in zebrafish (Danio rerio): Expression of CYP2AA1 and CYP2AA2 and response to phenobarbital-type inducers

    Energy Technology Data Exchange (ETDEWEB)

    Kubota, Akira [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Bainy, Afonso C.D. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Departamento de Bioquímica, CCB, Universidade Federal de Santa Catarina, Florianopolis, SC 88040-900 (Brazil); Woodin, Bruce R.; Goldstone, Jared V. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Stegeman, John J., E-mail: jstegeman@whoi.edu [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States)

    2013-10-01

    The cytochrome P450 (CYP) 2 gene family is the largest and most diverse CYP gene family in vertebrates. In zebrafish, we have identified 10 genes in a new subfamily, CYP2AA, which does not show orthology to any human or other mammalian CYP genes. Here we report evolutionary and structural relationships of the 10 CYP2AA genes and expression of the first two genes, CYP2AA1 and CYP2AA2. Parsimony reconstruction of the tandem duplication pattern for the CYP2AA cluster suggests that CYP2AA1, CYP2AA2 and CYP2AA3 likely arose in the earlier duplication events and thus are most diverged in function from the other CYP2AAs. On the other hand, CYP2AA8 and CYP2AA9 are genes that arose in the latest duplication event, implying functional similarity between these two CYPs. A molecular model of CYP2AA1 showing the sequence conservation across the CYP2AA cluster reveals that the regions with the highest variability within the cluster map onto CYP2AA1 near the substrate access channels, suggesting differing substrate specificities. Zebrafish CYP2AA1 transcript was expressed predominantly in the intestine, while CYP2AA2 was most highly expressed in the kidney, suggesting differing roles in physiology. In the liver CYP2AA2 expression but not that of CYP2AA1, was increased by 1,4-bis [2-(3,5-dichloropyridyloxy)] benzene (TCPOBOP) and, to a lesser extent, by phenobarbital (PB). In contrast, pregnenolone 16α-carbonitrile (PCN) increased CYP2AA1 expression, but not CYP2AA2 in the liver. The results identify a CYP2 subfamily in zebrafish that includes genes apparently induced by PB-type chemicals and PXR agonists, the first concrete in vivo evidence for a PB-type response in fish. - Highlights: • A tandemly duplicated cluster of ten CYP2AA genes was described in zebrafish. • Parsimony and duplication analyses suggest pathways to CYP2AA diversity. • Homology models reveal amino acid positions possibly related to functional diversity. • The CYP2AA locus does not share synteny with

  5. Apolipoprotein e genotype, plasma cholesterol, and cancer: a Mendelian randomization study.

    LENUS (Irish Health Repository)

    Trompet, Stella

    2009-12-01

    Observational studies have shown an association between low plasma cholesterol levels and increased risk of cancer, whereas most randomized clinical trials involving cholesterol-lowering medications have not shown this association. Between 1997 and 2002, the authors assessed the association between plasma cholesterol levels and cancer risk, free from confounding and reverse causality, in a Mendelian randomization study using apolipoprotein E (ApoE) genotype. ApoE genotype, plasma cholesterol levels, and cancer incidence and mortality were measured during a 3-year follow-up period among 2,913 participants in the Prospective Study of Pravastatin in the Elderly at Risk. Subjects within the lowest third of plasma cholesterol level at baseline had increased risks of cancer incidence (hazard ratio (HR) = 1.90, 95% confidence interval (CI): 1.34, 2.70) and cancer mortality (HR = 2.03, 95% CI: 1.23, 3.34) relative to subjects within the highest third of plasma cholesterol. However, carriers of the ApoE2 genotype (n = 332), who had 9% lower plasma cholesterol levels than carriers of the ApoE4 genotype (n = 635), did not have increased risk of cancer incidence (HR = 0.86, 95% CI: 0.50, 1.47) or cancer mortality (HR = 0.70, 95% CI: 0.30, 1.60) compared with ApoE4 carriers. These findings suggest that low cholesterol levels are not causally related to increased cancer risk.

  6. Crack-free yttria stabilized zirconia thin films by aerosol assisted chemical vapor deposition: Influence of water and carrier gas

    Energy Technology Data Exchange (ETDEWEB)

    Schlupp, M.V.F., E-mail: Meike.Schlupp@mat.ethz.ch [Nonmetallic Inorganic Materials, ETH Zuerich, Wolfgang-Pauli-Str. 10, 8093 Zuerich (Switzerland); Binder, S.; Martynczuk, J.; Prestat, M. [Nonmetallic Inorganic Materials, ETH Zuerich, Wolfgang-Pauli-Str. 10, 8093 Zuerich (Switzerland); Gauckler, L.J. [Nonmetallic Inorganic Materials, ETH Zuerich, Wolfgang-Pauli-Str. 10, 8093 Zuerich (Switzerland); International Institute for Carbon Neutral Energy Research (WPI-I2CNER), Kyushu University, 744 Moto-oka, Nishi-ku, Fukuoka 819-0395 (Japan)

    2012-11-01

    Yttria stabilized zirconia thin films are deposited on silicon single crystal substrates by aerosol assisted chemical vapor deposition from precursor solutions of zirconium and yttrium 2,4-pentanedionate in ethanol. Continuous films are obtained using pure oxygen, pure nitrogen, or mixtures of both as carrier gas. In the simultaneous presence of water and oxygen, crack formation is observed for films deposited at intermediate substrate temperatures (450 Degree-Sign C), while those deposited at low (300 Degree-Sign C) and high (600 Degree-Sign C) temperatures remain crack-free. Crack-free films can be deposited at 450 Degree-Sign C in a water-free setting, or in the presence of water using pure nitrogen as carrier gas. The addition of water to the precursor solutions also significantly reduces film growth rates. - Highlights: Black-Right-Pointing-Pointer Thin film deposition by aerosol assisted chemical vapor deposition (AA-CVD) Black-Right-Pointing-Pointer Yttria stabilized zirconia (YSZ) thin films deposited between 300 Degree-Sign C and 600 Degree-Sign C Black-Right-Pointing-Pointer Water decreases growth rates and leads to crack formation in AA-CVD of YSZ. Black-Right-Pointing-Pointer Crack-free YSZ thin films deposited using oxygen and/or nitrogen as carrier gas Black-Right-Pointing-Pointer YSZ thin films deposited by AA-CVD show low shrinkage on annealing at 1000 Degree-Sign C.

  7. Lack of significance of the BRCA2 promoter methylation status in different genotypes of the MTHFR a1298c polymorphism in ovarian cancer cases in Iran.

    Science.gov (United States)

    Darehdori, Ahmad Shabanizadeh; Dastjerdi, Mehdi Nikbakht; Dahim, Hajar; Slahshoor, Mohammadreza; Babazadeh, Zahra; Taghavi, Mohammad Mohsen; Taghipour, Zahra; Gaafarineveh, Hamidreza

    2012-01-01

    Promoter methylation, which can be regulated by MTHFR activity, is associated with silencing of genes. In this study we evaluated the methylation status (type) of the BRCA2 promoter in ovarian cancer patients carrying different genotypes of the MTHFR gene (A or C polymorphisms at position 1298). The methylation type of the BRCA2 promoter was evaluated using bisulfate-modified DNA in methylation- specific PCR and the MTHFRa1278c polymorphism was assessed by PCR-RFLP. Analysis of the BRCA2 promoter methylation type of cases showed that 7 out of 60 cases (11.7%) were methylated while the remaining 53 (88.3%) were unmethylated. In methylated cases, one out of the 7 cases had a CC genotype and the remaining 6 methylated cases had an AC genotype. The AA genotype was absent. In unmethylated cases, 34, 18, and one out of these had AC, AA and CC genotype, respectively. There was no significant relationship between the methylation types of the BRCA2 promoter in different genotypes of MTHFRa1298c polymorphism in ovarian cancer; p=0.255. There was no significant relation between the methylation types of the BRCA2 promoter in different genotypes of the MTHFRa1298c polymorphism in ovarian cancer.

  8. Prediction of Breast and Prostate Cancer Risks in Male BRCA1 and BRCA2 Mutation Carriers Using Polygenic Risk Scores

    DEFF Research Database (Denmark)

    Lecarpentier, Julie; Silvestri, Valentina; Kuchenbaecker, Karoline B

    2017-01-01

    for male carriers of BRCA1/ 2 mutations and implications for cancer risk prediction. Materials and Methods We genotyped 1,802 male carriers of BRCA1/2 mutations from the Consortium of Investigators of Modifiers of BRCA1/2 by using the custom Illumina OncoArray. We investigated the combined effects......Purpose BRCA1/2 mutations increase the risk of breast and prostate cancer in men. Common genetic variants modify cancer risks for female carriers of BRCA1/2 mutations. We investigated-for the first time to our knowledge-associations of common genetic variants with breast and prostate cancer risks...... of established breast and prostate cancer susceptibility variants on cancer risks for male carriers of BRCA1/2 mutations by constructing weighted polygenic risk scores (PRSs) using published effect estimates as weights. Results In male carriers of BRCA1/2 mutations, PRS that was based on 88 female breast cancer...

  9. Prediction of Breast and Prostate Cancer Risks in Male BRCA1 and BRCA2 Mutation Carriers Using Polygenic Risk Scores

    DEFF Research Database (Denmark)

    Lecarpentier, Julie; Silvestri, Valentina; Kuchenbaecker, Karoline B

    2017-01-01

    % for carriers of BRCA2 mutations, respectively. Conclusion PRSs may provide informative cancer risk stratification for male carriers of BRCA1/2 mutations that might enable these men and their physicians to make informed decisions on the type and timing of breast and prostate cancer risk management.......Purpose BRCA1/2 mutations increase the risk of breast and prostate cancer in men. Common genetic variants modify cancer risks for female carriers of BRCA1/2 mutations. We investigated-for the first time to our knowledge-associations of common genetic variants with breast and prostate cancer risks...... for male carriers of BRCA1/ 2 mutations and implications for cancer risk prediction. Materials and Methods We genotyped 1,802 male carriers of BRCA1/2 mutations from the Consortium of Investigators of Modifiers of BRCA1/2 by using the custom Illumina OncoArray. We investigated the combined effects...

  10. Hereditary Hemochromatosis (HFE genotypes in heart failure: Relation to etiology and prognosis

    Directory of Open Access Journals (Sweden)

    Torp-Pedersen Christian

    2010-07-01

    Full Text Available Abstract Background It is believed that hereditary hemochromatosis (HH might play a role in cardiac disease (heart failure (HF and ischemia. Mutations within several genes are HH-associated, the most common being the HFE gene. In a large cohort of HF patients, we sought to determine the etiological role and the prognostic significance of HFE genotypes. Methods We studied 667 HF patients (72.7% men with depressed systolic function, enrolled in a multicentre trial with a follow-up period of up to 5 years. All were genotyped for the known HFE variants C282Y, H63D and S65C. Results The genotype and allele frequencies in the HF group were similar to the frequencies determined in the general Danish population. In multivariable analysis mortality was not predicted by C282Y-carrier status (HR 1.2, 95% CI: 0.8-1.7; H63D-carrier status (HR 1.0, 95% CI: 0.7-1.3; nor S65C-carrier status (HR 1.2, 95% CI: 0.7-2.0. We identified 27 (4.1% homozygous or compound heterozygous carriers of HFE variants. None of these carriers had a clinical presentation suggesting hemochromatosis, but hemoglobin and ferritin levels were higher than in the rest of the cohort. Furthermore, a trend towards reduced mortality was seen in this group in univariate analyses (HR 0.4, 95% CI: 0.2-0.9, p = 0.03, but not in multivariate (HR 0.5, 95% CI: 0.2-1.2. Conclusion HFE genotypes do not seem to be a significant contributor to the etiology of heart failure in Denmark. HFE variants do not affect mortality in HF.

  11. Hot carrier degradation in semiconductor devices

    CERN Document Server

    2015-01-01

    This book provides readers with a variety of tools to address the challenges posed by hot carrier degradation, one of today’s most complicated reliability issues in semiconductor devices.  Coverage includes an explanation of carrier transport within devices and book-keeping of how they acquire energy (“become hot”), interaction of an ensemble of colder and hotter carriers with defect precursors, which eventually leads to the creation of a defect, and a description of how these defects interact with the device, degrading its performance. • Describes the intricacies of hot carrier degradation in modern semiconductor technologies; • Covers the entire hot carrier degradation phenomenon, including topics such as characterization, carrier transport, carrier-defect interaction, technological impact, circuit impact, etc.; • Enables detailed understanding of carrier transport, interaction of the carrier ensemble with the defect precursors, and an accurate assessment of how the newly created defects imp...

  12. Solute carrier transporters: Pharmacogenomics research ...

    African Journals Online (AJOL)

    This paper reviews the solute carrier transporters and highlights the fact that there is much to be learnt from characterizing human genomic variation in South Africa and sub-Saharan Africa, especially with regards to health applications. Genomic diversity in this region is indeed relatively under-studied despite being home to ...

  13. Carrier multiplication in germanium nanocrystals

    NARCIS (Netherlands)

    Saeed, S.; de Weerd, C.; Stallinga, P.; Spoor, F.C.M.; Houtepen, A.J.; Siebbeles, L.D.A.; Gregorkiewicz, T.

    2015-01-01

    Carrier multiplication is demonstrated in a solid-state dispersion of germanium nanocrystals in a silicon-dioxide matrix. This is performed by comparing ultrafast photo-induced absorption transients at different pump photon energies below and above the threshold energy for this process. The average

  14. Transforming microbial genotyping: a robotic pipeline for genotyping bacterial strains.

    Directory of Open Access Journals (Sweden)

    Brian O'Farrell

    Full Text Available Microbial genotyping increasingly deals with large numbers of samples, and data are commonly evaluated by unstructured approaches, such as spread-sheets. The efficiency, reliability and throughput of genotyping would benefit from the automation of manual manipulations within the context of sophisticated data storage. We developed a medium- throughput genotyping pipeline for MultiLocus Sequence Typing (MLST of bacterial pathogens. This pipeline was implemented through a combination of four automated liquid handling systems, a Laboratory Information Management System (LIMS consisting of a variety of dedicated commercial operating systems and programs, including a Sample Management System, plus numerous Python scripts. All tubes and microwell racks were bar-coded and their locations and status were recorded in the LIMS. We also created a hierarchical set of items that could be used to represent bacterial species, their products and experiments. The LIMS allowed reliable, semi-automated, traceable bacterial genotyping from initial single colony isolation and sub-cultivation through DNA extraction and normalization to PCRs, sequencing and MLST sequence trace evaluation. We also describe robotic sequencing to facilitate cherrypicking of sequence dropouts. This pipeline is user-friendly, with a throughput of 96 strains within 10 working days at a total cost of 200,000 items were processed by two to three people. Our sophisticated automated pipeline can be implemented by a small microbiology group without extensive external support, and provides a general framework for semi-automated bacterial genotyping of large numbers of samples at low cost.

  15. Genotypic to expression profiling of bovine calcium channel, voltage-dependent, alpha-2/delta subunit 1 gene, and their association with bovine mastitis among Frieswal (HFX Sahiwal) crossbred cattle of Indian origin.

    Science.gov (United States)

    Deb, Rajib; Singh, Umesh; Kumar, Sushil; Kumar, Arun; Singh, Rani; Sengar, Gyanendra; Mann, Sandeep; Sharma, Arjava

    2014-04-03

    Calcium channel, voltage-dependent, alpha-2/delta subunit 1 (CACNA2D1) gene is considered to be an important noncytokine candidate gene influencing mastitis. Scanty of reports are available until today regarding the role play of CACNA2D1 gene on the susceptibility of bovine mastitis. We interrogated the CACNA2D1 G519663A [A>G] SNP by PCR-RFLP among two hundreds Frieswal (HF X Sahiwal) crossbred cattle of Indian origin. Genotypic frequency of AA (51.5, n=101) was comparatively higher than AG (35, n=70) and GG (14.5, n=29). Association of Somatic cell score (SCS) with genotypes revealed that, GG genotypes showing lesser count (less susceptible to mastitis) compare to AA and AG. Relative expression of CACNA2D1 transcript (in milk samples) was significantly higher among GG than AG and AA. Further we have also isolated blood sample from the all groups and PBMCs were cultured from each blood sample as per the standard protocol. They were treated with Calcium channel blocker and the expression level of the CACNA2D1 gene was evaluated by Real Time PCR. Results show that expression level decline in each genotypic group after treatment and expression level of GG are again significantly higher than AA and AG. Thus, it may be concluded that GG genotypic animals are favorable for selecting disease resistant breeds.

  16. Corrosion issues of powder coated AA6060 aluminium profiles

    DEFF Research Database (Denmark)

    Din, Rameez Ud; Valgarðsson, Smári; Jellesen, Morten Stendahl

    2015-01-01

    In this study detailed microstructural investigation of the reason for unexpected corrosion of powder coated aluminium alloy AA6060 windows profiles has been performed. The results from this study reveals that the failure of the window profiles was originated from the surface defects present...... on the extruded AA6060 aluminium profile after metallurgical process prior to powder coating. Surface defects are produced due to intermetallic particles in the alloy, which disturb the flow during the extrusion process. The corrosion mechanism leading to the failure of the powder coated AA6060 aluminium profiles...

  17. Software papers and citation in the AAS Journals

    Science.gov (United States)

    Robitaille, Thomas; Lintott, Chris

    2018-01-01

    At the start of 2016, AAS Publishing released a policy statement that officially opened the door for papers describing novel software to be published in the AAS Journals without a requirement for novel results to also be included. This statement also describes how the use of software should be cited in articles. In this talk, I will give an overview of this policy and will give an overview of the growth of software papers and software citation in AAS Journals over the last two years.

  18. Effect of pressurized steam on AA1050 aluminium

    DEFF Research Database (Denmark)

    Jariyaboon, Manthana; Møller, Per; Ambat, Rajan

    2012-01-01

    Purpose - The purpose of this paper is to understand the effect of pressurized steam on surface changes, structures of intermetallic particles and corrosion behavior of AA1050 aluminium. Design/methodology/approach - Industrially pure aluminium (AA1050, 99.5 per cent) surfaces were exposed...... reactivities was observed due to the formation of the compact oxide layer. Originality/value - This paper reveals a detailed investigation of how pressurized steam can affect the corrosion behaviour of AA1050 aluminium and the structure of Fe-containing intermetallic particles....

  19. Univariate stability analysis methods for determining genotype ...

    African Journals Online (AJOL)

    Twenty two different stability statistics were used for analyzing genotype × environment (GE) interaction of durum wheat experimental data (20 genotypes in 15 environments). Combined analysis of variance indicated that GE interaction significantly influenced genotypes yield. According to type I stability concept, genotypes ...

  20. CYP1A2 Genotype Variations Do Not Modify the Benefits and Drawbacks of Caffeine during Exercise: A Pilot Study

    Directory of Open Access Journals (Sweden)

    Juan J. Salinero

    2017-03-01

    Full Text Available Previous investigations have determined that some individuals have minimal or even ergolytic performance effects after caffeine ingestion. The aim of this study was to analyze the influence of the genetic variations of the CYP1A2 gene on the performance enhancement effects of ingesting a moderate dose of caffeine. In a double-blind randomized experimental design, 21 healthy active participants (29.3 ± 7.7 years ingested 3 mg of caffeine per kg of body mass or a placebo in testing sessions separated by one week. Performance in the 30 s Wingate test, visual attention, and side effects were evaluated. DNA was obtained from whole blood samples and the CYP1A2 polymorphism was analyzed (rs762551. We obtained two groups: AA homozygotes (n = 5 and C-allele carriers (n = 16. Caffeine ingestion increased peak power (682 ± 140 vs. 667 ± 137 W; p = 0.008 and mean power during the Wingate test (527 ± 111 vs. 518 ± 111 W; p < 0.001 with no differences between AA homozygotes and C-allele carriers (p > 0.05. Reaction times were similar between caffeine and placebo conditions (276 ± 31 vs. 269 ± 71 milliseconds; p = 0.681 with no differences between AA homozygotes and C-allele carriers. However, 31.3% of the C-allele carriers reported increased nervousness after caffeine ingestion, while none of the AA homozygotes perceived this side effect. Genetic variations of the CYP1A2 polymorphism did not affect the ergogenic effects and drawbacks derived from the ingestion of a moderate dose of caffeine.

  1. Experimental verification of carrier multiplication in graphene.

    Science.gov (United States)

    Plötzing, T; Winzer, T; Malic, E; Neumaier, D; Knorr, A; Kurz, H

    2014-09-10

    We report on the first direct experimental observation of carrier multiplication in graphene reaching a multiplication factor of up to 2 and persisting on a picoseconds time scale. Exploiting multicolor pump-probe measurement techniques, the excited nonequilibrium carrier distribution is retrieved on an ultrafast time scale. This provides access to the temporal evolution of the optically excited carrier density and thus allows quantitative conclusions on possible carrier multiplication. Microscopic time- and momentum-resolved calculations on the ultrafast relaxation dynamics of optically excited carriers confirm the observation of carrier multiplication under corresponding experimental conditions, suggesting graphene as a promising material for novel high-efficiency photodetection devices.

  2. Dicty_cDB: FCL-AA14 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA14 (Link to dictyBase) - G03263 DDB0218474 Contig-U16035-1 FCL-AA...14P (Link to Original site) FCL-AA14F 647 FCL-AA14Z 550 FCL-AA14P 1197 - - Show FCL-AA14 Library F...CL (Link to library) Clone ID FCL-AA14 (Link to dictyBase) Atlas ID - NBRP ID G03263 dictyBase ID DDB0218474... Link to Contig Contig-U16035-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA.../FCL-AA14Q.Seq.d/ Representative seq. ID FCL-AA14P (Link to Original site) Representative DNA sequence >FCL-AA

  3. Dicty_cDB: FCL-AA19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA19 (Link to dictyBase) - G01757 DDB0230128 Contig-U16036-1 FCL-AA...19P (Link to Original site) FCL-AA19F 246 FCL-AA19Z 568 FCL-AA19P 814 - - Show FCL-AA19 Library FC...L (Link to library) Clone ID FCL-AA19 (Link to dictyBase) Atlas ID - NBRP ID G01757 dictyBase ID DDB0230128 ...Link to Contig Contig-U16036-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...19Q.Seq.d/ Representative seq. ID FCL-AA19P (Link to Original site) Representative DNA sequence >FCL-AA

  4. Dicty_cDB: FCL-AA17 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA17 (Link to dictyBase) - G03264 DDB0191099 Contig-U15602-1 FCL-AA...17P (Link to Original site) FCL-AA17F 547 FCL-AA17Z 610 FCL-AA17P 1157 - - Show FCL-AA17 Library F...CL (Link to library) Clone ID FCL-AA17 (Link to dictyBase) Atlas ID - NBRP ID G03264 dictyBase ID DDB0191099... Link to Contig Contig-U15602-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA.../FCL-AA17Q.Seq.d/ Representative seq. ID FCL-AA17P (Link to Original site) Representative DNA sequence >FCL-AA

  5. SNP genotypes of olfactory receptor genes associated with olfactory ability in German Shepherd dogs.

    Science.gov (United States)

    Yang, M; Geng, G-J; Zhang, W; Cui, L; Zhang, H-X; Zheng, J-L

    2016-04-01

    To find out the relationship between SNP genotypes of canine olfactory receptor genes and olfactory ability, 28 males and 20 females from German Shepherd dogs in police service were scored by odor detection tests and analyzed using the Beckman GenomeLab SNPstream. The representative 22 SNP loci from the exonic regions of 12 olfactory receptor genes were investigated, and three kinds of odor (human, ice drug and trinitrotoluene) were detected. The results showed that the SNP genotypes at the OR10H1-like:c.632C>T, OR10H1-like:c.770A>T, OR2K2-like:c.518G>A, OR4C11-like:c.511T>G and OR4C11-like:c.692G>A loci had a statistically significant effect on the scenting abilities (P odor influenced the performances of the dogs (P odor at the following loci: OR10H1-like:c.632C>T, OR10H1-like:c.770A>T, OR4C11-like:c.511T>G and OR4C11-like:c.692G>A (P dogs with genotype CC at the OR10H1-like:c.632C>T, genotype AA at the OR10H1-like:c.770A>T, genotype TT at the OR4C11-like:c.511T>G and genotype GG at the OR4C11-like:c.692G>A loci did better at detecting the ice drug. We concluded that there was linkage between certain SNP genotypes and the olfactory ability of dogs and that SNP genotypes might be useful in determining dogs' scenting potential. © 2015 Stichting International Foundation for Animal Genetics.

  6. Serum Proteome Changes in Healthy Subjects with Different Genotypes of NOS1AP in the Chinese Population

    Directory of Open Access Journals (Sweden)

    Feng Jiang

    2013-01-01

    Full Text Available Type 2 diabetes and its chronic complications have become a worldwide epidemic nowadays. However, its molecular mechanism is still unknown. We have previously identified a novel variant rs12742393 of NOS1AP for type 2 diabetes susceptibility in the Chinese population. In this study, we analyzed the total serum profiling among three genotypes of rs12742393 to discover potential crosstalk under the variant and the disease through proteomic analyses for the first time. We used OFFGEL peptide fractionation, LC-MS/MS analysis, and label-free quantification to profile the fasting human serum samples of the genotypes in rs12742393 (n=4, for CC, AC, and AA, resp.. Four proteins were identified, including apoA4, alpha1-ACT, HABP2, and keratin 10, with blood levels changed significantly between CC and AA homozygotes of rs12742393. Compared with AA group, the levels of apoA4 increased (P=0.000265, whereas the concentration of alpha1-ACT, HABP2, and keratin 10 decreased in CC group (P=0.011116, 0.021175, and 0.015661, resp.. Then we selected additional fasting serum samples for ELISA and western blot validation. However, no significant differences were identified by neither ELISA nor western blot (P>0.05. The protein profiling changes between the genotypes of rs12742393 indicated that this SNP might play a role in the development of type 2 diabetes.

  7. An Adolescent Substance Prevention Model Blocks the Effect of CHRNA5 Genotype on Smoking During High School.

    Science.gov (United States)

    Vandenbergh, David J; Schlomer, Gabriel L; Cleveland, H Harrington; Schink, Alisa E; Hair, Kerry L; Feinberg, Mark E; Neiderhiser, Jenae M; Greenberg, Mark T; Spoth, Richard L; Redmond, Cleve

    2016-02-01

    Prevention intervention programs reduce substance use, including smoking, but not all individuals respond. We tested whether response to a substance use prevention/intervention program varies based upon a set of five markers (rs16969968, rs1948, rs578776, rs588765, and rs684513) within the cluster of nicotinic acetylcholine receptor subunit genes (CHRNA5/A3/B4). Participants (N = 424) were randomly assigned to either control condition, or a family-based intervention in grade 6 and a school-based drug preventive intervention in grade 7. Smoking in the past month was assessed in grades 9-12 using a four-point scale (0 = never smoked, 1 = smoked but not in last month, 2 = one or a few times, 3 = about once a week or more). There was a main effect of both the intervention (b = -0.24, P smoking. Using dummy coding to allow for nonlinear effects, individuals with the A/A genotype smoked more often than those with G/G (b = 0.33, P smoking among those with A/A and G/A genotypes to levels similar to those with the G/G genotype (G/G vs. A/A: b = -0.67, P Preventive interventions can reduce the genetic risk for smoking from rs16969968. © The Author 2015. Published by Oxford University Press on behalf of the Society for Research on Nicotine and Tobacco. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Simulation de la formabilite des alliages d'aluminium AA5754 et AA6063

    Science.gov (United States)

    Eljaafari, Samira

    Les besoins de reduction du poids se sont concretement traduits par l'introduction de nouvelles nuances plus legeres dans les structures automobiles. Ainsi, des alliages d'aluminium ont commence a etre integres dans les pieces de structure de plusieurs vehicules. La faible masse volumique des alliages d'aluminium (2,7g/cm3) permet d'alleger le poids du vehicule qui entraine une diminution de la consommation de carburant et, donc, des emissions de gaz a effet de serre. La striction et la rupture sont les principaux modes de defaillance qui entrainent le rebut systematique des pieces. C'est pourquoi, ameliorer la prediction d'apparition de ces defauts lors de la simulation va dans le sens d'une meilleure maitrise du procede. Dans le cadre de ce travail doctoral, deux modeles sont developpes pour simuler le comportement a grandes deformations d'alliages d'aluminium: un modele polycristallin de type Taylor et un modele a un ou plusieurs elements finis par grain. Les diagrammes limites de formage (DLF) pour les deux alliages d'aluminium AA5754 et AA6063 ont ete simules numeriquement en utilisant une formulation par elements finis pour les polycristaux basee sur l'hypothese de Taylor. Les DLF conventionnels et de l'hydroformage ont ete traces. L'effet des chemins de deformation sur la formabilite des alliages d'aluminium a aussi ete etudie. Finalement, des simulations numeriques avec les donnees de diffraction des electrons retrodiffuses (EBSD) pour 1'alliage d'aluminium AA5754 ont ete effectuees en utilisant le modele a un ou plusieurs elements par grain. Ces simulations sont executees avec differents modeles du durcissement (Asaro, Bassani et puissance). Mots-cles: Formabilite; Alliage d'aluminium; Hydroformage; Glissement cristallographique; Durcissement; Calcul parallele; Diagramme limite de formage (DLF); Diffraction electron.

  9. Genotype-Phenotype Correlations of β-Thalassemia Mutations in an Azerbaijani Population

    Directory of Open Access Journals (Sweden)

    Chingiz Asadov

    2017-09-01

    Full Text Available β-Thalassemia is the most common inherited disorder in Azerbaijan. The aim of our study was to reveal genotype-to-phenotype correlations of the most common β-thalassemia mutations in an Azerbaijani population. Patients with codon 8 (-AA, IVS-I-6 (T>C, and IVS-II-1 (G>A mutations, which are reportedly the most common β-globin gene mutations among the local population, were tested for hematologic parameters. Fifty-five previously tested patients with known genotypes were included in the study. Hematologic indices and hemoglobin fractions were tested in order to reveal the phenotypic manifestation of the mutations. The results obtained indicate that clinical presentation varies between different β-globin gene mutations: individuals with IVS-I-6 (T>C mutations showed milder presentation than those with codon 8 (-AA and IVS-II-1 (G>A, which is associated with the molecular basis of the mutations. These data can be of assistance to predict clinical presentation and select the best possible therapeutic approach via early genotype identification.

  10. A&A Painting and Restoration Co., Inc. Information Sheet

    Science.gov (United States)

    A&A Painting and Restoration Co., Inc. (the Company) is located in Great Mills, Maryland. The settlement involves renovation activities conducted at properties constructed prior to 1978, located in Drayden, Maryland.

  11. FTO genotype and weight loss

    DEFF Research Database (Denmark)

    Livingstone, Katherine M; Celis-Morales, Carlos; Papandonatos, George D

    2016-01-01

    OBJECTIVE: To assess the effect of the FTO genotype on weight loss after dietary, physical activity, or drug based interventions in randomised controlled trials. DESIGN: Systematic review and random effects meta-analysis of individual participant data from randomised controlled trials. DATA SOURCES...... circumference in response to weight loss intervention were not significantly different between FTO genotypes. Sensitivity analyses indicated that differential changes in body mass index, body weight, and waist circumference by FTO genotype did not differ by intervention type, intervention length, ethnicity......, sample size, sex, and baseline body mass index and age category. CONCLUSIONS: We have observed that carriage of the FTO minor allele was not associated with differential change in adiposity after weight loss interventions. These findings show that individuals carrying the minor allele respond equally...

  12. Characteristics of AA amyloidosis patients in San Francisco.

    Science.gov (United States)

    Lejmi, Hiba; Jen, Kuang-Yu; Olson, Jean L; James, Sam H; Sam, Ramin

    2016-04-01

    AA amyloidosis due to subcutaneous injection of drugs of abuse has been described in the USA, but all the existing literature is from more than 20 years ago. There is more recent literature from Europe. We have observed a high incidence of AA amyloidosis in the county hospital in San Francisco. Here, we describe 24 patients who had kidney biopsy-proven AA amyloidosis from our hospital from 1998 to 2013. All the patients were thought to have AA amyloidosis from skin popping of illicit drugs after having exhausted the intravenous route. These patients with biopsy-proven AA amyloidosis were analysed further. All patients were found to have hepatitis C infection, hypertension was not common, most had advanced kidney failure, and acidosis was common as was tubulointerstitial involvement on the kidney biopsy. Other organ involvement included hepatomegaly and splenomegaly in a number of patients; direct myocardial involvement was not seen, but pulmonary hypertension, history of deep vein thrombosis and pulmonary embolism were common. The prognosis of these patients was poor. The mortality rate approached 50% 1 year after biopsy, and most of the patient needed dialysis shortly after diagnosis. Cessation of drug use seemed beneficial but rarely achievable. AA amyloidosis from skin popping is common in San Francisco. Most patients with renal involvement end up on dialysis, and mortality rates are exceedingly high. © 2015 Asian Pacific Society of Nephrology.

  13. Bake hardening of nanograin AA7075 aluminum alloy

    International Nuclear Information System (INIS)

    Dehghani, Kamran

    2011-01-01

    Highlights: ► The bake hardening behavior of AA7075 was studied and compared with its coarse-grain counterpart. ► Nanograin AA7075 exhibited 88–100% increase in bake hardenability. ► Nanograin AA7075 exhibited 36–38% increase in final yield strength after baking. ► Maximum bake hardenability and final yield stress were about 185 MPa and 719 MPa. - Abstract: In the present work, the bake hardening of nanostructured AA7075 aluminum alloy was compared with that of its coarse-grain counterpart. Surface severe plastic deformation (SSPD) was used to produce nanograin layers on both surfaces of workpieces. The nanostructured layers were characterized using scanning electron microscopy (SEM) and atomic force microscopy (AFM) techniques. The thickness of nanostructured layer, having the grains of 50–110 nm, was about 75 μm on each side of workpiece. The bake hardenability of nanograin and coarse-grain AA7075 was then compared by pre-straining to 2, 4 and 6% followed by baking at 100 °C and 200 °C for 20 min. Comparing to coarse-grain case, there was about 88–100% increase in bake hardenability and about 36–38% increase in yield strength after the bake hardening of present nanograin AA7075. Such an increase in bake hardenability and strength was achieved when the thickness of two nanograin layers was about only one-tenth of the whole thickness.

  14. Efficiency of some spectrochemical carriers

    International Nuclear Information System (INIS)

    Gomes, R.P.

    1978-01-01

    A comparative study of the efficiency of some spectrochemical carriers for the quantitative spectrographic analysis of Ag, Al, B, Bi, Cd, Cr, Cu, Fe, Mg, Mn, Mo, Ni, P, Pb, Si, Sn, V and Zn in uranium-base materials is presented. The volatility behavior of the eighteen elements is verified by means of the moving plate technique and each of the mentioned carriers. The best results are obtained with 4% In 2 O 3 , 6% AgCl and 5% NaF in a U 3 O 8 matrix. The sensitivities for some elements were extended to fractions of p.p.m. The precision, accuracy and acceptability of the method are calculated for all elements. The total error values as approximately in the range of 16-45% [pt

  15. Genotypes of pathogenic Leptospira spp isolated from rodents in Argentina

    Science.gov (United States)

    Loffler, Sylvia Grune; Pavan, Maria Elisa; Vanasco, Bibiana; Samartino, Luis; Suarez, Olga; Auteri, Carmelo; Romero, Graciela; Brihuega, Bibiana

    2014-01-01

    Leptospirosis is the most widespread zoonosis in the world and significant efforts have been made to determine and classify pathogenic Leptospira strains. This zoonosis is maintained in nature through chronic renal infections of carrier animals, with rodents and other small mammals serving as the most important reservoirs. Additionally, domestic animals, such as livestock and dogs, are significant sources of human infection. In this study, a multiple-locus variable-number tandem repeat analysis (MLVA) was applied to genotype 22 pathogenic Leptospira strains isolated from urban and periurban rodent populations from different regions of Argentina. Three MLVA profiles were identified in strains belonging to the species Leptospira interrogans (serovars Icterohaemorrhagiae and Canicola); one profile was observed in serovar Icterohaemorrhagiae and two MLVA profiles were observed in isolates of serovars Canicola and Portlandvere. All strains belonging to Leptospira borgpetersenii serovar Castellonis exhibited the same MLVA profile. Four different genotypes were isolated from urban populations of rodents, including both mice and rats and two different genotypes were isolated from periurban populations. PMID:24676656

  16. At What Cost a Carrier?

    Science.gov (United States)

    2013-03-01

    unmanned aircra" – generally described as UCAVs , for “unmanned combat aerial vehicles” – as well as submarines in combination with long- range precision...means of operational e!ectiveness in the future. The Way Forward All these factors indicate that a turn toward UCAVs is long overdue. #e advent of...18 in accelerating the development and production of a UCAV that could operate both from large carriers and from smaller, less expensive, light

  17. A novel Cry9Aa with increased toxicity for Spodoptera exigua (Hübner)

    NARCIS (Netherlands)

    Naimov, S.; Nedyalkova, R.; Staykov, N.; Weemen-Hendriks, M.; Minkov, I.; Maagd, de R.A.

    2014-01-01

    Cry9Aa, produced by Bacillus thuringiensis is reported to be not active against Spodoptera exigua (beet armyworm). In this study we have cloned a new cry9Aa5 gene encoding a protoxin with increased activity against S. exigua as compared to Cry9Aa1. When aligned to Cry9Aa1, four amino acid

  18. 14 CFR 221.2 - Carrier's duty.

    Science.gov (United States)

    2010-01-01

    ... foreign air carrier from liability for violations of the statute, nor shall the filing of a tariff, or... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Carrier's duty. 221.2 Section 221.2... REGULATIONS TARIFFS General § 221.2 Carrier's duty. (a) Must file tariffs. (1) Except as provided in paragraph...

  19. 14 CFR 254.4 - Carrier liability.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Carrier liability. 254.4 Section 254.4... REGULATIONS DOMESTIC BAGGAGE LIABILITY § 254.4 Carrier liability. On any flight segment using large aircraft... large aircraft, an air carrier shall not limit its liability for provable direct or consequential...

  20. 14 CFR Section 04 - Air Carrier Groupings

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Air Carrier Groupings Section 04 Section 04 Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF TRANSPORTATION (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS UNIFORM SYSTEM OF ACCOUNTS AND REPORTS FOR LARGE CERTIFICATED AIR CARRIERS Section 04 Air Carrier Groupings (a) All large...

  1. Protein carriers of conjugate vaccines

    Science.gov (United States)

    Pichichero, Michael E

    2013-01-01

    The immunogenicity of polysaccharides as human vaccines was enhanced by coupling to protein carriers. Conjugation transformed the T cell-independent polysaccharide vaccines of the past to T cell-dependent antigenic vaccines that were much more immunogenic and launched a renaissance in vaccinology. This review discusses the conjugate vaccines for prevention of infections caused by Hemophilus influenzae type b, Streptococcus pneumoniae, and Neisseria meningitidis. Specifically, the characteristics of the proteins used in the construction of the vaccines including CRM, tetanus toxoid, diphtheria toxoid, Neisseria meningitidis outer membrane complex, and Hemophilus influenzae protein D are discussed. The studies that established differences among and key features of conjugate vaccines including immunologic memory induction, reduction of nasopharyngeal colonization and herd immunity, and antibody avidity and avidity maturation are presented. Studies of dose, schedule, response to boosters, of single protein carriers with single and multiple polysaccharides, of multiple protein carriers with multiple polysaccharides and conjugate vaccines administered concurrently with other vaccines are discussed along with undesirable consequences of conjugate vaccines. The clear benefits of conjugate vaccines in improving the protective responses of the immature immune systems of young infants and the senescent immune systems of the elderly have been made clear and opened the way to development of additional vaccines using this technology for future vaccine products. PMID:23955057

  2. Cytopathological effects of Bacillus sphaericus Cry48Aa/Cry49Aa toxin on binary toxin-susceptible and -resistant Culex quinquefasciatus larvae.

    Science.gov (United States)

    de Melo, Janaina Viana; Jones, Gareth Wyn; Berry, Colin; Vasconcelos, Romero Henrique Teixeira; de Oliveira, Cláudia Maria Fontes; Furtado, André Freire; Peixoto, Christina Alves; Silva-Filha, Maria Helena Neves Lobo

    2009-07-01

    The Cry48Aa/Cry49Aa mosquitocidal two-component toxin was recently characterized from Bacillus sphaericus strain IAB59 and is uniquely composed of a three-domain Cry protein toxin (Cry48Aa) and a binary (Bin) toxin-like protein (Cry49Aa). Its mode of action has not been elucidated, but a remarkable feature of this protein is the high toxicity against species from the Culex complex, besides its capacity to overcome Culex resistance to the Bin toxin, the major insecticidal factor in B. sphaericus-based larvicides. The goal of this work was to investigate the ultrastructural effects of Cry48Aa/Cry49Aa on midgut cells of Bin-toxin-susceptible and -resistant Culex quinquefasciatus larvae. The major cytopathological effects observed after Cry48Aa/Cry49Aa treatment were intense mitochondrial vacuolation, breakdown of endoplasmic reticulum, production of cytoplasmic vacuoles, and microvillus disruption. These effects were similar in Bin-toxin-susceptible and -resistant larvae and demonstrated that Cry48Aa/Cry49Aa toxin interacts with and displays toxic effects on cells lacking receptors for the Bin toxin, while B. sphaericus IAB59-resistant larvae did not show mortality after treatment with Cry48Aa/Cry49Aa toxin. The cytopathological alterations in Bin-toxin-resistant larvae provoked by Cry48Aa/Cry49Aa treatment were similar to those observed when larvae were exposed to a synergistic mixture of Bin/Cry11Aa toxins. Such effects seemed to result from a combined action of Cry-like and Bin-like toxins. The complex effects caused by Cry48Aa/Cry49Aa provide evidence for the potential of these toxins as active ingredients of a new generation of biolarvicides that conjugate insecticidal factors with distinct sites of action, in order to manage mosquito resistance.

  3. Caffeine, CYP1A2 Genotype, and Endurance Performance in Athletes.

    Science.gov (United States)

    Guest, Nanci; Corey, Paul; Vescovi, Jason; El-Sohemy, Ahmed

    2018-03-05

    Many studies have examined the effect of caffeine on exercise performance, but findings have not always been consistent. The objective of this study was to determine whether variation in the CYP1A2 gene, which affects caffeine metabolism, modifies the ergogenic effects of caffeine in a 10-km cycling time trial. Competitive male athletes (n=101; age: 25 ± 4 years) completed the time trial under three conditions: 0, 2 or 4 mg of caffeine per kg body mass, using a split-plot randomized, double-blinded, placebo-controlled design. DNA was isolated from saliva and genotyped for the -163A>C polymorphism in the CYP1A2 gene (rs762551). Overall, 4 mg/kg caffeine decreased cycling time by 3% (mean ± SEM) versus placebo (17.6 ± 0.1 vs. 18.1 ± 0.1 min, p = 0.01). However, a significant (p <0.0001) caffeine-gene interaction was observed. Among those with the AA genotype, cycling time decreased by 4.8% at 2 mg/kg (17.0 ± 0.3 vs. 17.8 ± 0.4 min, p = 0.0005) and by 6.8% at 4 mg/kg (16.6 ± 0.3 vs. 17.8 ± 0.4 min, p < .0001). In those with the CC genotype, 4 mg/kg increased cycling time by 13.7% versus placebo (20.8 ± 0.8 vs. 18.3 ± 0.5 min, p = 0.04). No effects were observed among those with the AC genotype. Our findings show that both 2 and 4 mg/kg caffeine improve 10-km cycling time, but only in those with the AA genotype. Caffeine had no effect in those with the AC genotype and diminished performance at 4 mg/kg in those with the CC genotype. CYP1A2 genotype should be considered when deciding whether an athlete should use caffeine for enhancing endurance performance.

  4. Influence of Process Parameters in the Friction Surfacing of AA 6082-T6 over AA 2024-T3

    OpenAIRE

    Gandra, J.; Pereira, D.; Miranda, R.M.; Vilaça, P.

    2013-01-01

    VK: T20309 Friction Surfacing is a solid state coating technique with applications in hardfacing, corrosion protection and repair. Since it doesn’t require the fusion of the materials involved, it is suitable to join aluminium alloys while avoiding several of their processing difficulties. The present study addresses the deposition of AA 6082-T6 coatings on AA 2024-T3 substrates, while focusing on the effect of process parameters, such as, axial force, rotation and travel speed. Sound alum...

  5. NOD2/CARD15 genotype and common gastrointestinal diseases in 43 600 individuals

    DEFF Research Database (Denmark)

    Yazdanyar, S.; Nordestgaard, B.G.

    2010-01-01

    appendicitis, 646 irritable bowel syndrome, 1301 infectious diseases of the gastrointestinal tract, 681 anal fissure, fistula and abscess, 826 gastrointestinal cancer and 161 developed cancer in liver and pancreas. Results. Some 89% were non-carriers, 11% heterozygotes, 0.15% homozygotes and 0.23% compound...... heterozygotes. Cumulative incidences differed by genotype for appendicitis (log-rank P = 0.02), anal fissure, fistula and abscess (P = 0.003) and gastrointestinal cancer (P = 0.004), but not for any of the other endpoints. Compared with non-carriers, age and sex adjusted hazard ratios were 2.7 (95% CI 1.......4-5.5) for appendicitis amongst compound heterozygotes, 3.2 (1.3-7.8) for anal fissure, fistula and abscess amongst compound heterozygotes, and 3.8 (1.6-9.2) for gastrointestinal cancer amongst homozygotes, whilst other genotypes did not have increased risk. The increased risk of gastrointestinal cancer amongst...

  6. NOD2/CARD15 genotype and common gastrointestinal diseases in 43 600 individuals

    DEFF Research Database (Denmark)

    Yazdanyar, S.; Nordestgaard, B.G.

    2010-01-01

    associate with risk of nine common gastrointestinal diseases. Design and setting. We genotyped 43 596 white individuals from the Danish general population followed for 31 years, during which time 782 developed oesophagitis and reflux, 1395 ulcus ventriculi and duodeni, 1384 gastritis and dyspepsia, 1407...... appendicitis, 646 irritable bowel syndrome, 1301 infectious diseases of the gastrointestinal tract, 681 anal fissure, fistula and abscess, 826 gastrointestinal cancer and 161 developed cancer in liver and pancreas. Results. Some 89% were non-carriers, 11% heterozygotes, 0.15% homozygotes and 0.23% compound...... heterozygotes. Cumulative incidences differed by genotype for appendicitis (log-rank P = 0.02), anal fissure, fistula and abscess (P = 0.003) and gastrointestinal cancer (P = 0.004), but not for any of the other endpoints. Compared with non-carriers, age and sex adjusted hazard ratios were 2.7 (95% CI 1...

  7. 49 CFR 376.22 - Exemption for private carrier leasing and leasing between authorized carriers.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 5 2010-10-01 2010-10-01 false Exemption for private carrier leasing and leasing... MOTOR CARRIER SAFETY REGULATIONS LEASE AND INTERCHANGE OF VEHICLES Exemptions for the Leasing Regulations § 376.22 Exemption for private carrier leasing and leasing between authorized carriers. Regardless...

  8. Effects of composite casein and beta-lactoglobulin genotypes on renneting properties and composition of bovine milk by assuming an animal model

    Directory of Open Access Journals (Sweden)

    T. IKONEN

    2008-12-01

    Full Text Available The effects of kappa-beta-casein genotypes and b-lactoglobulin genotypes on the renneting properties and composition of milk were estimated for 174 and 155 milk samples of 59 Finnish Ayrshire and 55 Finnish Friesian cows, respectively. As well as the random additive genetic and permanent environmental effects of a cow, the model included the fixed effects for parity, lactation stage, season, kappa-beta-casein genotypes and b-lactoglobulin genotypes. Favourable renneting properties were associated with kappa-beta-casein genotypes ABA 1 A 2 , ABA 1 A 1 and AAA 1 A 2 in the Finnish Ayrshire, and with ABA 2 B, AAA 1 A 3 , AAA 2 A 3 , ABA 1 A 2 and ABA 2 A 2 in the Finnish Friesian. The favourable effect of these genotypes on curd firming time and on firmness of the curd was partly due to their association with a high kappa-casein concentration in the milk. The effect of the kappa-casein E allele on renneting properties was unfavourable compared with that of the kappa-casein B allele, and possibly with that of the A allele. The beta-lactoglobulin genotypes had no effect on renneting properties but they had a clear effect on the protein composition of milk. The beta-lactoglobulin AA genotype was associated with a high whey protein % and beta-lactoglobulin concentration and the BB genotype with a high casein % and casein number.;

  9. Identification of bovine kappa-casein genotypes at the DNA level.

    Science.gov (United States)

    Rando, A; Di Gregorio, P; Masina, P

    1988-01-01

    By using a bovine kappa-Cn cDNA as probe and the PstI endonuclease we demonstrate that the DNA restriction patterns of kappa-Cn AA and kappa-Cn BB cows are different. Besides two invariant fragments (about 6.8kb and 1.1kb) the former shows two fragments of about 4.3 kb and 0.3 kb and the latter one fragment of about 4.6 kb. kappa-Cn AB cows show intermediate pattern. Therefore, it is possible to determine the bovine kappa-Cn genotypes even in absence of gene product.

  10. Interaction between FOXO1A-209 Genotype and Tea Drinking is Significantly Associated with Reduced Mortality at Advanced Ages

    DEFF Research Database (Denmark)

    Zeng, Yi; Chen, Huashuai; Ni, Ting

    2016-01-01

    Based on the genotypic/phenotypic data from Chinese Longitudinal Healthy Longevity Survey (CLHLS) and Cox proportional hazard model, the present study demonstrates that interactions between carrying FOXO1A-209 genotypes and tea drinking are significantly associated with lower risk of mortality...... at advanced ages. Such significant association is replicated in two independent Han Chinese CLHLS cohorts (p =0.028-0.048 in the discovery and replication cohorts, and p =0.003-0.016 in the combined dataset). We found the associations between tea drinking and reduced mortality are much stronger among carriers...... of the FOXO1A-209 genotype compared to non-carriers, and drinking tea is associated with a reversal of the negative effects of carrying FOXO1A-209 minor alleles, that is, from a substantially increased mortality risk to substantially reduced mortality risk at advanced ages. The impacts are considerably...

  11. SCREENING SOYBEAN GENOTYPES FOR PROMISCUOUS ...

    African Journals Online (AJOL)

    ACSS

    2016-02-25

    Feb 25, 2016 ... Symbiotic potential, competitiveness and compatibility of indigenous. Bradyrhizobium Japonicum isolates to three soybean genotypes of two distinct agro- climatic regions of Rajasthan, India. Saudi. Journal of Biological Sciences 17: 303- 310. Muhammad, A. 2010. Response of a promiscuous soybean ...

  12. FTO genotype and weight loss

    DEFF Research Database (Denmark)

    Livingstone, Katherine M; Celis-Morales, Carlos; Papandonatos, George D

    2016-01-01

    : Ovid Medline, Scopus, Embase, and Cochrane from inception to November 2015. ELIGIBILITY CRITERIA FOR STUDY SELECTION: Randomised controlled trials in overweight or obese adults reporting reduction in body mass index, body weight, or waist circumference by FTO genotype (rs9939609 or a proxy) after...

  13. Epidemiological markers in Neisseria meningitidis: an estimate of the performance of genotyping vs phenotyping

    DEFF Research Database (Denmark)

    Weis, N; Lind, I

    1998-01-01

    In order to estimate the performance of genotypic vs phenotypic characterization of Neisseria meningitidis, 2 methods, DNA fingerprinting and multilocus enzyme electrophoresis (MEE), were assessed as regards applicability, reproducibility and discriminating capacity. 50 serogroup B and 52 serogroup...... C Neisseria meningitidis strains from 96 patients with meningococcal disease and 22 serogroup C strains from healthy carriers were investigated. Both methods were 100% applicable to meningococcal strains and results of DNA fingerprinting as well as of MEE were reproducible. The number of types...

  14. Do incident and recurrent venous thromboembolism risks truly differ between heterozygous and homozygous Factor V Leiden carriers? A retrospective cohort study.

    Science.gov (United States)

    Perez Botero, J; Ormsby, W D; Ashrani, A A; McBane, R D; Wysokinski, W E; Patnaik, M M; Lewis, B R; Grill, D E; Pruthi, R K; Heit, J A

    2016-05-01

    While Factor V Leiden (F5 rs6025 A allele) is a known venous thromboembolism (VTE) risk factor, VTE risk among heterozygous vs. homozygous carriers is uncertain. In a retrospective cohort study of Mayo Clinic patients referred for genotyping between 1996 and 2013, we tested Factor V Leiden genotype as a risk factor for incident and recurrent VTE. Among heterozygous (n=268) and homozygous (n=111) carriers, the prevalence of VTE was 54% and 68%, respectively (p=0.016). While mean patient age at first VTE event (43.9 vs. 42.9years; p=0.70) did not differ significantly, median VTE-free survival was modestly shorter for homozygous carriers (56.8 vs 59.5 years; p=0.04). Sixty-nine (48%) and 31 (42%) heterozygous and homozygous carriers had ≥1 VTE recurrence (p=0.42). In a multivariable model, idiopathic incident VTE and a second thrombophilia were associated with increased and anticoagulation duration >6months with reduced hazards of VTE recurrence; Factor V Leiden genotype was not an independent predictor of recurrence. Aside from a higher VTE prevalence and modestly reduced VTE-free survival, VTE penetrance and phenotype severity did not differ significantly among homozygous vs. heterozygous carriers, suggesting that VTE prophylaxis and management should not differ by Factor V Leiden genotype. Copyright © 2016 European Federation of Internal Medicine. Published by Elsevier B.V. All rights reserved.

  15. Effect of heating on the stability of amyloid A (AA) fibrils and the intra- and cross-species transmission of AA amyloidosis.

    Science.gov (United States)

    Ogawa, Saki; Murakami, Tomoaki; Inoshima, Yasuo; Ishiguro, Naotaka

    2015-01-01

    Amyloid A (AA) amyloidosis is a protein misfolding disease characterized by extracellular deposition of AA fibrils. AA fibrils are found in several tissues from food animals with AA amyloidosis. For hygienic purposes, heating is widely used to inactivate microbes in food, but it is uncertain whether heating is sufficient to inactivate AA fibrils and prevent intra- or cross-species transmission. We examined the effect of heating (at 60 °C or 100 °C) and autoclaving (at 121 °C or 135 °C) on murine and bovine AA fibrils using Western blot analysis, transmission electron microscopy (TEM), and mouse model transmission experiments. TEM revealed that a mixture of AA fibrils and amorphous aggregates appeared after heating at 100 °C, whereas autoclaving at 135 °C produced large amorphous aggregates. AA fibrils retained antigen specificity in Western blot analysis when heated at 100 °C or autoclaved at 121 °C, but not when autoclaved at 135 °C. Transmissible pathogenicity of murine and bovine AA fibrils subjected to heating (at 60 °C or 100 °C) was significantly stimulated and resulted in amyloid deposition in mice. Autoclaving of murine AA fibrils at 121 °C or 135 °C significantly decreased amyloid deposition. Moreover, amyloid deposition in mice injected with murine AA fibrils was more severe than that in mice injected with bovine AA fibrils. Bovine AA fibrils autoclaved at 121 °C or 135 °C did not induce amyloid deposition in mice. These results suggest that AA fibrils are relatively heat stable and that similar to prions, autoclaving at 135 °C is required to destroy the pathogenicity of AA fibrils. These findings may contribute to the prevention of AA fibril transmission through food materials to different animals and especially to humans.

  16. Variations in the chemical composition and standardized ileal digestibility of amino acids in eight genotypes of triticale fed to growing pigs.

    Science.gov (United States)

    Strang, E J P; Eklund, M; Rosenfelder, P; Htoo, J K; Mosenthin, R

    2017-04-01

    The study was conducted to determine the chemical composition, physical characteristics, and standardized ileal digestibility (SID) of CP and AA of 8 currently available genotypes of triticale fed to growing pigs. The genotypes included Grenado, Cando, Agostino, Massimo, Tarzan, HYT Prime, SW Talentro, and Cultivo. Eight barrows with an initial BW of 31 ± 2 kg were fitted with simple T-cannulas at the distal ileum and allotted to an 8 × 8 Latin square design with 8 periods of 7 d each and 8 assay diets. The N-free method was used to determine basal ileal endogenous CP and AA losses. The 8 assay diets contained 1 of 8 triticale genotypes as the sole source of CP and AA. The triticale genotypes were grown under identical environmental conditions on the same site. Among the 8 genotypes, contents of CP ranged from 104.7 to 118.1 g/kg (as-fed basis). The content of total nonstarch polysaccharides and NDF ranged, on an as-fed basis, from 84.6 to 99.5 g/kg and from 88.4 to 149.0 g/kg, respectively. Among the 8 genotypes, SID of CP ranged from 81% in Grenado to 85% in Massimo and Tarzan. The SID of CP and AA did not differ among triticale genotypes except for SID of Arg, Glu, and Gly ( < 0.05). The mean SID of CP, Lys, Met, and Trp was 4, 4, 4, and 1 percantage units less and SID of Trp was 5 percantage units greater compared with values in current feed tables. Among the 8 triticale genotypes, standardized ileal digestible content (cSID) of CP followed total CP content and ranged from 84.8 to 98.7 g/kg (as-fed basis), with the lowest ( < 0.001) values for Grenado and the greatest ( < 0.001) values for SW Talentro and Cultivo. For CP and most AA, cSID linearly decreased as the content of total, soluble, and insoluble β-glucans increased ( < 0.05) in the 8 genotypes of triticale. There was a positive correlation between thousand seed weight and cSID of CP and most AA ( < 0.01). These variables may help to predict cSID in triticale batches, whereas other nutrients are not

  17. BDNF val66met genotype and schizotypal personality traits interact to influence probabilistic association learning.

    Science.gov (United States)

    Skilleter, Ashley Jayne; Weickert, Cynthia Shannon; Moustafa, Ahmed Abdelhalim; Gendy, Rasha; Chan, Mico; Arifin, Nur; Mitchell, Philip Bowden; Weickert, Thomas Wesley

    2014-11-01

    The brain derived neurotrophic factor (BDNF) val66met polymorphism rs6265 influences learning and may represent a risk factor for schizophrenia. Healthy people with high schizotypal personality traits display cognitive deficits that are similar to but not as severe as those observed in schizophrenia and they can be studied without confounds of antipsychotics or chronic illness. How genetic variation in BDNF may impact learning in individuals falling along the schizophrenia spectrum is unknown. We predicted that schizotypal personality traits would influence learning and that schizotypal personality-based differences in learning would vary depending on the BDNF val66met genotype. Eighty-nine healthy adults completed the Schizotypal Personality Questionnaire (SPQ) and a probabilistic association learning test. Blood samples were genotyped for the BDNF val66met polymorphism. An ANOVA was performed with BDNF genotype (val homozygotes and met-carriers) and SPQ score (high/low) as grouping variables and probabilistic association learning as the dependent variable. Participants with low SPQ scores (fewer schizotypal personality traits) showed significantly better learning than those with high SPQ scores. BDNF met-carriers displaying few schizotypal personality traits performed best, whereas BDNF met-carriers displaying high schizotypal personality traits performed worst. Thus, the BDNF val66met polymorphism appears to influence probabilistic association learning differently depending on the extent of schizotypal personality traits displayed. Crown Copyright © 2014. Published by Elsevier B.V. All rights reserved.

  18. Putting attention in the spotlight: The influence of APOE genotype on visual search in mid adulthood.

    Science.gov (United States)

    Lancaster, Claire; Forster, Sophie; Tabet, Naji; Rusted, Jennifer

    2017-09-15

    The Apolipoprotein E e4 allele is associated with greater cognitive decline with age, yet effects of this gene are also observed earlier in the lifespan. This research explores genotype differences (e2, e3, e4) in the allocation of visuospatial attention in mid-adulthood. Sixty-six volunteers, aged 45-55 years, completed two paradigms probing the active selection of information at the focus of attention (a dynamic scaling task) and perceptual capacity differences. Two methods of statistical comparison (parametric statistics, Bayesian inference) found no significant difference between e4 carriers and the homozygous e3 group on either the dynamic scaling or perceptual load task. E2 carriers, however, demonstrated less efficient visual search performance on the dynamic scaling task. The lack of an e4 difference in visuospatial attention, despite previous suggestion in the literature of genotype effects, indicates that select attentional processes are intact in e4 carriers in mid-adulthood. The association of e2 genotype with slower visual search performance complicates the premised protective effects of this allele in cognitive ageing. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Outcomes From AAS Hack Day at the 227th AAS Meeting

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This is a final post from the 227th AAS Meeting in Kissimmee, FL. This special summary of AAS Hack Day, a meeting of AAS members to collaboratively work on various small projects, was written by Meredith Rawls (@Merrdiff) and was originally posted on astrobites.com.As the 227thAmerican Astronomical Society meeting drew to a close (see highlights from Day 1, Day 2, Day 3, and Day 4), a group of at least 50 attendees spent Day 4working on small projects fondly called hacks. Thanks to sponsorship from LSST and Northrup Grumman, the industrious hackers werewell-caffeinated and fed so we could devote time and energy toworking in groups on one-day projects.TheHack Day beganat 10am with pitches. Anybody with a project idea was welcome to briefly speak and try to convince others to work with them. Only someideas panned out, but the enthusiasm was palpable. Its not every day you get a full room of astronomers and affiliates eager to spend hours working on fun and useful projects to benefit the community.#hackAAS is getting underway! #aas227 pic.twitter.com/yX7jlOnSCK James R A Davenport (@jradavenport) January 8, 2016Here is a rundown of what we accomplished. Pretty impressive for a single day! Many thanks to fellow astrobiter Erika Nesvold (now at Carnegie DTM; @erikanesvold) whose hack was live-documenting all the other hacks. Her tweets as @astrobites appeared with the #hackaas hashtag, and her notes made this recap post infinitely easier to write.Interested in joining the fun? Sign up for Hack Day at the 2017 JanuaryAAS meeting (its free with meeting registration), and consider applying for the .Astronomy conference this summer.Towards Optimal Session Scheduling:Adrian Price-Whelan (Columbia), David Hogg (NYU), and Scott Idem (AAS) began writing a program to take all submitted abstracts to a conference like AAS and sort them using keywords to avoid scheduling similar talks in parallel sessions. Its impossible to make everyone happy, but minimizing conflicts

  20. 76 FR 32390 - Motor Carrier Safety Advisory Committee Public Meeting

    Science.gov (United States)

    2011-06-06

    ... DEPARTMENT OF TRANSPORTATION Federal Motor Carrier Safety Administration [Docket No. FMCSA-2006-26367] Motor Carrier Safety Advisory Committee Public Meeting AGENCY: Federal Motor Carrier Safety Administration (FMCSA), DOT. ACTION: Notice of Motor Carrier Safety Advisory Committee (MCSAC) Meeting. SUMMARY...

  1. 77 FR 46555 - Motor Carrier Safety Advisory Committee: Public Meeting

    Science.gov (United States)

    2012-08-03

    ... DEPARTMENT OF TRANSPORTATION Federal Motor Carrier Safety Administration [Docket No. FMCSA-2006-26367] Motor Carrier Safety Advisory Committee: Public Meeting AGENCY: Federal Motor Carrier Safety Administration (FMCSA), DOT. ACTION: Notice of meeting of Motor Carrier Safety Advisory Committee (MCSAC...

  2. 75 FR 2923 - Motor Carrier Safety Advisory Committee Public Meeting

    Science.gov (United States)

    2010-01-19

    ... DEPARTMENT OF TRANSPORTATION Federal Motor Carrier Safety Administration [Docket No. FMCSA-2006-26367] Motor Carrier Safety Advisory Committee Public Meeting AGENCY: Federal Motor Carrier Safety Administration (FMCSA), DOT. ACTION: Notice of Motor Carrier Safety Advisory Committee Meeting. SUMMARY: FMCSA...

  3. 75 FR 29384 - Motor Carrier Safety Advisory Committee Public Meeting

    Science.gov (United States)

    2010-05-25

    ... DEPARTMENT OF TRANSPORTATION Federal Motor Carrier Safety Administration [Docket No. FMCSA-2010-0143] Motor Carrier Safety Advisory Committee Public Meeting AGENCY: Federal Motor Carrier Safety Administration (FMCSA), DOT. ACTION: Notice of Motor Carrier Safety Advisory Committee meeting. SUMMARY: FMCSA...

  4. 75 FR 72863 - Motor Carrier Safety Advisory Committee Public Meeting

    Science.gov (United States)

    2010-11-26

    ... DEPARTMENT OF TRANSPORTATION Federal Motor Carrier Safety Administration [Docket No. FMCSA-2006-26367] Motor Carrier Safety Advisory Committee Public Meeting AGENCY: Federal Motor Carrier Safety Administration, DOT. ACTION: Notice of Motor Carrier Safety Advisory Committee Meeting. SUMMARY: FMCSA announces...

  5. 75 FR 50797 - Motor Carrier Safety Advisory Committee Public Meeting

    Science.gov (United States)

    2010-08-17

    ... DEPARTMENT OF TRANSPORTATION Federal Motor Carrier Safety Administration [Docket No. FMCSA-2010-0143] Motor Carrier Safety Advisory Committee Public Meeting AGENCY: Federal Motor Carrier Safety Administration (FMCSA), DOT. ACTION: Notice of Motor Carrier Safety Advisory Committee Meeting. SUMMARY: FMCSA...

  6. Interaction of Lysinibacillus sphaericus Cry48Aa/Cry49Aa toxin with midgut brush-border membrane fractions from Culex quinquefasciatus larvae.

    Science.gov (United States)

    Guo, Q-Y; Hu, X-M; Cai, Q-X; Yan, J-P; Yuan, Z-M

    2016-04-01

    The Cry48Aa/Cry49Aa mosquitocidal toxin from Lysinibacillus sphaericus was uniquely composed of a three-domain (Cry) toxin and binary (Bin) toxin-like protein, with high toxicity against Culex spp. However, its mode of action against the target mosquitoes is still unknown. In this study, Cry48Aa, Cry49Aa and its N- and C-terminal truncated proteins were expressed and purified, and the binding affinities of the purified proteins with midgut brush-border membrane fractions (BBMFs) from Culex quin-quefasciatus larvae were performed. The results showed that both Cry48Aa and Cry49Aa have specific and high binding affinity to BBMFs, with dissociation constants of 9.5 ± 1.8 and 25.4 ± 3.8 nM, respectively. Competition assays demonstrated that Cry49Aa C-terminal derivatives were able to bind to the BBMFs, whereas Far-Western dot blot analysis revealed that its N-terminal constructs interacted with Cry48Aa. Nevertheless, larvicidal activity was almost lost when Cry49Aa truncated proteins, either individually or in pairs, combined with Cry48Aa. It is concluded that Cry49Aa is responsible for receptor binding and interaction with Cry48Aa and plays an important role in the mechanism of action of these two-component toxins. © 2016 The Royal Entomological Society.

  7. FADS genotypes and desaturase activity estimated by the ratio of arachidonic acid to linoleic acid are associated with inflammation and coronary artery disease.

    Science.gov (United States)

    Martinelli, Nicola; Girelli, Domenico; Malerba, Giovanni; Guarini, Patrizia; Illig, Thomas; Trabetti, Elisabetta; Sandri, Marco; Friso, Simonetta; Pizzolo, Francesca; Schaeffer, Linda; Heinrich, Joachim; Pignatti, Pier Franco; Corrocher, Roberto; Olivieri, Oliviero

    2008-10-01

    The delta-5 and delta-6 desaturases, encoded by FADS1 and FADS2 genes, are key enzymes in polyunsaturated fatty acid (PUFA) metabolism that catalyze the conversion of linoleic acid (LA) into arachidonic acid (AA) and that of alpha-linolenic acid (ALA) into eicosapentaenoic acid (EPA). Single-nucleotide polymorphisms (SNPs) in FADS1 and FADS2 have been associated with different concentrations of AA and LA, and those associations have possible functional consequences for desaturase activity. We aimed to evaluate the possible association among FADS genotypes, desaturase activity, inflammation, and coronary artery disease (CAD). Thirteen FADS SNPs and the ratio of AA to LA (AA/LA) on red blood cell (RBC) membranes, a marker of desaturase activity, were evaluated in 876 subjects with (n = 610) or without (n = 266) angiographically documented CAD. Both AA/LA and the ratio of EPA to ALA (EPA/ALA) were higher in patients with CAD than in those without CAD, but, in a multiple logistic regression model, only a higher AA/LA resulted an independent risk factor for CAD (odds ratio: 2.55; 95% CI: 1.61, 4.05 for higher compared with lower ratio tertile; P for trend FADS haplotypes, including the alleles associated with a higher ratio. In populations following a Western diet, subjects carrying FADS haplotypes that are associated with higher desaturase activity may be prone to a proinflammatory response favoring atherosclerotic vascular damage.

  8. Serotonin transporter genotype linked to adolescent substance use treatment outcome through externalizing behavior

    Directory of Open Access Journals (Sweden)

    Tammy eChung

    2014-07-01

    Full Text Available Meta-analyses suggest that the serotonin transporter linked polymorphic region (5-HTTLPR short (S allele, relative to the long (L allele, is associated with risk for alcohol dependence, particularly among individuals with early onset antisocial alcoholism. Youth in substance use treatment tend to show antisocial or externalizing behaviors, such as conduct problems, which predict worse treatment outcome. This study examined a pathway in which 5-HTTLPR genotype is associated with externalizing behavior, and the intermediate phenotype of externalizing behavior serves as a link between 5-HTTLPR genotype and substance use treatment outcome in youth. Adolescents (n=142 who were recruited from addictions treatment were genotyped for 5-HTTLPR polymorphisms (S and LG carriers vs. LALA, assessed for externalizing and internalizing behaviors shortly after starting treatment, and followed over 6-months. 5-HTTLPR genotype was not associated with internalizing behaviors, and was not directly associated with 6-month substance use outcomes. However, 5-HTTLPR genotype was associated with externalizing behaviors (S and LG > LALA, and externalizing behaviors predicted alcohol and marijuana problem severity at 6-month follow-up. Results indicated an indirect (p<.05 and non-specific (i.e., both alcohol and marijuana severity effect of 5-HTTLPR genotype on youth substance use treatment outcomes, with externalizing behaviors as an important linking factor. Adolescents in substance use treatment with low expressing (S and LG 5-HTTLPR alleles and externalizing behavior might benefit from intervention that addresses serotonergic functioning, externalizing behaviors, and substance use to improve outcomes.

  9. Physical and verbal aggressive behavior and COMT genotype: Sensitivity to the environment.

    Science.gov (United States)

    Tuvblad, Catherine; Narusyte, Jurgita; Comasco, Erika; Andershed, Henrik; Andershed, Anna-Karin; Colins, Olivier F; Fanti, Kostas A; Nilsson, Kent W

    2016-07-01

    Catechol-O-methyltransferase (COMT) genotype has been implicated as a vulnerability factor for several psychiatric diseases as well as aggressive behavior, either directly, or in interaction with an adverse environment. The present study aimed at investigating the susceptibility properties of COMT genotype to adverse and favorable environment in relation to physical and verbal aggressive behavior. The COMT Val158Met polymorphism was genotyped in a Swedish population-based cohort including 1,783 individuals, ages 20-24 years (47% males). A significant three-way interaction was found, after correction for multiple testing, between COMT genotype, exposure to violence, and parent-child relationship in association with physical but not verbal aggressive behavior. Homozygous for the Val allele reported lower levels of physical aggressive behavior when they were exposed to violence and at the same time experienced a positive parent-child relationship compared to Met carriers. Thus, susceptibility properties of COMT genotype were observed in relation to physical aggressive behavior supporting the hypothesis that COMT genotypes are modifying the sensitivity to environment that confers either risk or protection for aggressive behavior. As these are novel findings, they warrant further investigation and replication in independent samples. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  10. Genotype-phenotype associations in filaggrin loss-of-function mutation carriers

    NARCIS (Netherlands)

    Landeck, Lilla; Visser, Maaike; Kezic, Sanja; John, Swen M.

    2013-01-01

    Loss-of-function mutations in the filaggrin gene (FLG) have been reported to be associated with specific phenotypic characteristics such as hyperlinearity and keratosis pilaris. To study phenotypic features in patients with occupational irritant contact eczema of the hands in relation to FLG

  11. Hypogonadotropic hypogonadism in a trisomy X carrier: phenotype description and genotype correlation.

    Science.gov (United States)

    Fiorio, Patrizia; Rosaia De Santis, Lucia; Cuoco, Cristina; Gimelli, Giorgio; Gastaldi, Roberto; Bonatti, Fabrizia; Ravazzolo, Roberto; Bocciardi, Renata

    2016-01-01

    We report on a 31-year old female who presented at genetic counseling for a small uterus, secondary amenorrhea and sterility. Gonadotropic hormone levels were low, suggesting a Hypogonadotropic Hypogonadism (HH) condition. Cytogenetic analysis demonstrated the presence of Trisomy X associated to an interstitial deletion of chromosome 4q13.2, resulting in the complete loss of a copy of the GNRHR gene. As GNRHR is known to be responsible for an autosomal recessive form of HH, we checked the status of the undeleted allele and we found the Q106R substitution. In conclusion, the results of our cytogenetic and molecular analyses have allowed us to clarify the etiology of the patient's condition.

  12. Wuestite - a solar energy carrier

    Energy Technology Data Exchange (ETDEWEB)

    Weidenkaff, A.; Nueesch, P.; Wokaun, A. [Paul Scherrer Inst. (PSI), Villigen (Switzerland); Reller, A. [Hamburg Univ., Hamburg (Germany)

    1997-06-01

    Hydrogen is produced when Wuestite (Fe{sub 1-y}O) is oxidised by water. This reaction is part of a two-step thermochemical metal oxide cycle for the storage of solar energy in the form of chemical energy carriers, characterised by a high chemical potential. The reaction was studied in a tubular furnace with on-line gas analysis and further characterised in detail by DTA und high-temperature X-ray powder diffraction. The influence of non-stoichiometry, morphology and temperature on the mechanism and kinetics of the water-splitting reaction was determined. (author) 3 figs., tabs., 3 refs.

  13. Biocheese: A Food Probiotic Carrier

    Science.gov (United States)

    Castro, J. M.; Tornadijo, M. E.; Fresno, J. M.; Sandoval, H.

    2015-01-01

    This review describes some aspects related to the technological barriers encountered in the development and stability of probiotic cheeses. Aspects concerning the viability of probiotic cultures in this matrix are discussed and the potential of cheese as a biofunctional food carrier is analyzed, outlying some points related to health and safety. In general, the manufacture of probiotic cheese should have little change when compared with the elaboration of cheese in the traditional way. The physicochemical and technological parameters influencing the quality of these products have also to be measured so as to obtain a process optimization. PMID:25802862

  14. Standardized ileal digestibility of amino acids in eight genotypes of soft winter wheat fed to growing pigs

    DEFF Research Database (Denmark)

    Rosenfelder, P; Mosenthin, R; Spindler, H K

    2015-01-01

    , Event, Tommi, and Adler. The 8 genotypes were grown under identical environmental conditions on the same site, and they were harvested and processed under the same conditions. Nine barrows with an initial BW of 32 ± 2 kg were surgically fitted with simple ileal T-cannulas and allotted to a row......–column design with 9 pigs and 8 periods of 6 d each. Wheat was the sole dietary source of CP and AA. Among the 8 wheat genotypes, contents of CP ranged from 10.9 to 13.3% (as-fed basis), whereas contents of total nonstarch polysaccharides ranged from 8.0 to 9.4% (as-fed basis). The SID of CP in the 8 genotypes...

  15. Brain-derived neurotrophic factor Val66Met genotype modulates amygdala habituation.

    Science.gov (United States)

    Perez-Rodriguez, M Mercedes; New, Antonia S; Goldstein, Kim E; Rosell, Daniel; Yuan, Qiaoping; Zhou, Zhifeng; Hodgkinson, Colin; Goldman, David; Siever, Larry J; Hazlett, Erin A

    2017-05-30

    A deficit in amygdala habituation to repeated emotional stimuli may be an endophenotype of disorders characterized by emotion dysregulation, such as borderline personality disorder (BPD). Amygdala reactivity to emotional stimuli is genetically modulated by brain-derived neurotrophic factor (BDNF) variants. Whether amygdala habituation itself is also modulated by BDNF genotypes remains unknown. We used imaging-genetics to examine the effect of BDNF Val66Met genotypes on amygdala habituation to repeated emotional stimuli. We used functional magnetic resonance imaging (fMRI) in 57 subjects (19 BPD patients, 18 patients with schizotypal personality disorder [SPD] and 20 healthy controls [HC]) during a task involving viewing of unpleasant, neutral, and pleasant pictures, each presented twice to measure habituation. Amygdala responses across genotypes (Val66Met SNP Met allele-carriers vs. Non-Met carriers) and diagnoses (HC, BPD, SPD) were examined with ANOVA. The BDNF 66Met allele was significantly associated with a deficit in amygdala habituation, particularly for emotional pictures. The association of the 66Met allele with a deficit in habituation to unpleasant emotional pictures remained significant in the subsample of BPD patients. Using imaging-genetics, we found preliminary evidence that deficient amygdala habituation may be modulated by BDNF genotype. Copyright © 2017. Published by Elsevier B.V.

  16. Genotypic stability and clustering analysis of confectionery ...

    African Journals Online (AJOL)

    Nine groundnut genotypes were evaluated in terminal moisture-stress areas of northeastern Ethiopia during 2005 and 2006 cropping seasons with the objective of analyzing genotypic stability and clustering of confectionery groundnut for seed and protein yield. The genotypes were evaluated on a plot size of 15 m2 at Kobo ...

  17. Genotype x environment interaction and optimum resource ...

    African Journals Online (AJOL)

    ... x E) interaction and to determine the optimum resource allocation for cassava yield trials. The effects of environment, genotype and G x E interaction were highly significant for all yield traits. Variations due to G x E interaction were greater than those due to genotypic differences for all yield traits. Genotype x location x year ...

  18. Fecal transmission of AA amyloidosis in the cheetah contributes to high incidence of disease

    Science.gov (United States)

    Zhang, Beiru; Une, Yumi; Fu, Xiaoying; Yan, Jingmin; Ge, FengXia; Yao, Junjie; Sawashita, Jinko; Mori, Masayuki; Tomozawa, Hiroshi; Kametani, Fuyuki; Higuchi, Keiichi

    2008-01-01

    AA amyloidosis is one of the principal causes of morbidity and mortality in captive cheetahs (Acinonyx jubatus), which are in danger of extinction, but little is known about the underlying mechanisms. Given the transmissible characteristics of AA amyloidosis, transmission between captive cheetahs may be a possible mechanism involved in the high incidence of AA amyloidosis. In this study of animals with AA amyloidosis, we found that cheetah feces contained AA amyloid fibrils that were different from those of the liver with regard to molecular weight and shape and had greater transmissibility. The infectious activity of fecal AA amyloid fibrils was reduced or abolished by the protein denaturants 6 M guanidine·HCl and formic acid or by AA immunodepletion. Thus, we propose that feces are a vehicle of transmission that may accelerate AA amyloidosis in captive cheetah populations. These results provide a pathogenesis for AA amyloidosis and suggest possible measures for rescuing cheetahs from extinction. PMID:18474855

  19. Association of GLUT2 and TAS1R2 genotypes with risk for dental caries.

    Science.gov (United States)

    Kulkarni, G V; Chng, T; Eny, K M; Nielsen, D; Wessman, C; El-Sohemy, A

    2013-01-01

    To determine whether common polymorphisms in the sweet taste receptor (TAS1R2) and glucose transporter (GLUT2) genes are associated with dental caries, 80 healthy Caucasian individuals aged 21-32 years were genotyped and grouped based on the TAS1R2 (Ile191Val) and GLUT2 (Thr110Ile) polymorphisms. Clinical and radiographic examinations were conducted by a single examiner who was blinded to the genotypes. To assess caries prevalence, three different caries scores were determined: DMFT (decayed, missing, and filled teeth), DMFT + X-ray and ICDAS (International Caries Detection and Assessment System). Associations between genotypes and caries prevalence were analyzed using Student's t test. Based on the genotypes for each of the GLUT2 and TAS1R2 genes, individuals were stratified into four groups for comparison of caries scores. A higher DMFT score (mean ± SE; 4.3 ± 0.4 vs. 6.1 ± 1.2, p = 0.04) was observed among carriers of the Ile allele for GLUT2 (risk group). Carriers of the Val allele for TAS1R2 (resistant group) demonstrated lower caries scores: DMFT (4.1 ± 0.5 vs. 5.8 ± 0.9, p = 0.05), DMFT + X-ray (4.9 ± 0.6 vs. 7.5 ± 0.9, p = 0.01), and ICDAS (19.5 ± 2.2 vs. 26.14 ± 2.82, p = 0.03). Based on genotype stratification, caries scores were significantly lower in the double resistant group as compared to the double risk groups: DMFT (9.1 ± 0.08 vs. 4.2 ± 0.01, p caries risk. Considering the combination of risk/resistance genotypes might further our understanding of genetic predispositions to dental caries and improve the accuracy of caries prediction models. Copyright © 2012 S. Karger AG, Basel.

  20. Yield and flow properties of aluminum alloy AA 8001

    International Nuclear Information System (INIS)

    Lyons, J.S.; Johnson, H.W.; Han, E.G.

    1995-01-01

    Aluminum alloy AA 8001 is being used at the Westinghouse Savannah River Company (WSRC) for nuclear reactor fuel and target components. The objective of this research was to determine parameters for predictive models of the compressive flow properties of AA 8001. Seventy-five true strain-rate, hot compression tests were performed. New, quantitative information about the yield and flow behavior of aluminum alloy AA 8001 was determined. Parameters were determined to use in a hyperbolic sine constitutive law so that the yield stress, the peak stress, and the peak strain can be predicted from the temperature-compensated strain-rate, Z. It was found that the onset of strain softening was more strongly dependent on Z than the onset of yielding was

  1. Pharmacogenetic typing for oral anti-coagulant response among factor V Leiden mutation carriers

    Science.gov (United States)

    Nahar, Risha; Saxena, Renu; Deb, Roumi; Verma, Ishwar C.

    2012-01-01

    CONTEXT: Factor V Leiden mutation is the most common inherited predisposition for hypercoagulability and thereby a common genetic cause for initiation of oral anti-coagulation therapy. There is a dearth of knowledge of coumarin response profile in such thrombophilic population. AIMS: The current pilot study aims to estimate coumarin sensitivity in an Indian cohort with an inherited thrombophilia risk factor (Factor V Leiden mutation carriers) based on the observed frequency of CYP2C9 *2, *3 and VKORC1-1639G >A genotype combinations. SETTINGS AND DESIGN: A retrospective study carried out in a tertiary health care center in India. MATERIALS AND METHODS: Carriers of FVL mutation were genotyped for CYP2C9 (*2, F*3) and VKORC1 (-1639G >A) variants by PCR-RFLP technique. STATISTICAL ANALYSIS USED: Chi-square test to analyze difference in expected and observed genotype frequency. RESULTS: Sixty-one (n = 61) unrelated carriers of FVL mutation were observed in the 13 years study period. The allele frequency of CYP2C9 *2, CYP2C9 *3, and VKORC1-1639A in this cohort was 0.06, 0.11, and 0.16, respectively. Six (9.7%) individuals had two of the three variant alleles (heterozygous or homozygous), and 28 (45.9%) were heterozygous for at least one polymorphism. CONCLUSIONS: Pre-prescription genotyping for coumarin drugs, if introduced in Indians with inherited thrombophilia (in whom oral anti-coagulant therapy may be necessary), is likely to identify 9.7% (hypersensitive) subjects in whom the optimum anti-coagulation may be achieved with reduced dosages, 44.3% (normal sensitivity) who may require higher dose and also 55.6% (hyper and moderate sensitivity) subjects who are likely to experience bleeding episodes. PMID:23716941

  2. Genetic Divergence in Sugarcane Genotypes

    OpenAIRE

    Tahir, Mohammad; Rahman, Hidayatur; Gul, Rahmani; Ali, Amjad; Khalid, Muhammad

    2012-01-01

    To assess genetic divergence of sugarcane germplasm, an experiment comprising 25 sugarcane genotypes was conducted at Sugar Crops Research Institute (SCRI), Mardan, Khyber Pakhtunkhwa, Pakistan, in quadruple lattice design during 2008-09. Among the 14 parameters evaluated, majority exhibited significant differences while some showed nonsignificant mean squares. The initial correlation matrix revealed medium to high correlations. Principal Component Analysis (PCA) showed that there were two pr...

  3. Low-complexity Joint Sub-carrier Phase Noise Compensation for Digital Multi-carrier Systems

    DEFF Research Database (Denmark)

    Yankov, Metodi Plamenov; Barletta, Luca; Zibar, Darko

    2017-01-01

    Joint sub-carrier phase noise processing is proposed which recovers the SNR penalty related to decreased sub-carrier baudrate w.r.t. single carrier systems. The method enables digital sub-banding to be safely employed for nonlinear mitigation for modulation formats of up to 256-QAM.......Joint sub-carrier phase noise processing is proposed which recovers the SNR penalty related to decreased sub-carrier baudrate w.r.t. single carrier systems. The method enables digital sub-banding to be safely employed for nonlinear mitigation for modulation formats of up to 256-QAM....

  4. Inert carriers for column extraction chromatography

    International Nuclear Information System (INIS)

    Katykhin, G.S.

    1978-01-01

    Inert carriers used in column extraction chromatography are reviewed. Such carriers are devided into two large groups: hydrophilic carriers which possess high surface energy and are well wetted only with strongly polar liquids (kieselguhrs, silica gels, glasses, cellulose, Al 2 O 3 ) and water-repellent carriers which possess low surface energy and are well wetted with various organic solvents (polyethylene, polytetrafluorethylene polytrifluorochlorethylene). Properties of various carriers are presented: structure, chemical and radiation stability, adsorption properties, extracting agent capacity. The effect of structure and sizes of particles on the efficiency of chromatography columns is considered. Ways of immovable phase deposition on the carrier and the latter's regeneration. Peculiarities of column packing for preparative and continuous chromatography are discussed

  5. Fatigue behaviour of GMAW welded aluminium alloy AA7020

    OpenAIRE

    Bloem, Carlos; Salvador Moya, Mª Dolores; Amigó, Vicente; Vicente-Escuder, Ángel

    2009-01-01

    [EN] The aim of this investigation is to evaluate the influence on fatigue behaviour of the finishing of the bulge in a welded aluminium zinc magnesium alloy AA7020. It was determined that total or partial elimination of the bulge has very little influence on its behaviour, giving a very similar result on both cases, where one is better than the other by only 3%. Bloem, C.; Salvador Moya, MD.; Amigó, V.; Vicente-Escuder, Á. (2009). Fatigue behaviour of GMAW welded aluminium alloy AA7020. W...

  6. Short communication: Effect of alphaS1-casein (CSN1S1) and kappa-casein (CSN3) genotypes on milk composition in Murciano-Granadina goats.

    Science.gov (United States)

    Caravaca, F; Carrizosa, J; Urrutia, B; Baena, F; Jordana, J; Amills, M; Badaoui, B; Sánchez, A; Angiolillo, A; Serradilla, J M

    2009-06-01

    The effects of the caprine alpha(S1)-casein (CSN1S1) polymorphisms on milk quality have been widely demonstrated. However, much less is known about the consequences of the kappa-casein (CSN3) genotype on milk composition in goats. Moreover, the occurrence of interactions between CSN3 and CSN1S1 genotypes has not been investigated. In this study, an association analysis between CSN1S1 and CSN3 genotypes and milk quality traits was performed in 89 Murciano-Granadina goats. Total milk yield as well as total protein, fat, solids-not-fat, lactose, alpha(S1)-casein (CSN1S1), and alpha(S2)-casein (CSN1S2) contents were recorded every other month during a whole lactation (316 observations). Data analysis using a linear mixed model for repeated observations revealed no interaction between the CSN1S1 and CSN3 genotypes. With regard to the effect of the CSN3 locus, AB and BB genotypes were significantly associated with higher levels of total casein and protein content compared with the AA CSN3 genotype. In strong contrast with French breeds, the CSN1S1 genotype did not affect protein, casein, and fat concentrations in Murciano-Granadina goats. These results highlight the importance of taking into consideration the CSN3 genotype when performing selection for milk composition in dairy goats.

  7. Homozygous carriers of the TCF7L2 rs7903146 T-allele show altered postprandial response in triglycerides and triglyceride-rich lipoproteins

    DEFF Research Database (Denmark)

    Engelbrechtsen, L; Hansen, T H; Mahendran, Y

    2017-01-01

    to CC carriers. Additionally, TT carriers had lower postprandial levels of total triglycerides (TG) (q = 0.03), VLDL-TG (q = 0.05, including medium, small and extra small, q = 0.048, q = 0.0009, q = 0.04, respectively), HDL-TG (triglycerides in high density lipoproteins q = 0.037) and S-HDL-TG (q = 0.......00003). In conclusion, TT carriers show altered postprandial triglyceride response, mainly influencing VLDL and HDL subclasses suggesting a genotype-mediated effect on hepatic lipid regulation....

  8. Modulatory effects of the piccolo genotype on emotional memory in health and depression.

    Directory of Open Access Journals (Sweden)

    Saskia Woudstra

    Full Text Available Major depressive disorder (MDD has been associated with biased memory formation for mood-congruent information, which may be related to altered monoamine levels. The piccolo (PCLO gene, involved in monoaminergic neurotransmission, has previously been linked to depression in a genome-wide association study. Here, we investigated the role of the PCLO risk allele on functional magnetic resonance imaging (MRI correlates of emotional memory in a sample of 89 MDD patients (64 PCLO risk allele carriers and 29 healthy controls (18 PCLO risk allele carriers. During negative word encoding, risk allele carriers showed significant lower activity relative to non-risk allele carriers in the insula, and trend-wise in the anterior cingulate cortex and inferior frontal gyrus. Moreover, depressed risk allele carriers showed significant lower activity relative to non-risk allele carriers in the striatum, an effect which was absent in healthy controls. Finally, amygdalar response during processing new positive words vs. known words was blunted in healthy PCLO+ carriers and in MDD patients irrespective of genotype, which may indicate that signalling of salient novel information does not occur to the same extent in PCLO+ carriers and MDD patients. The PCLO risk allele may increase vulnerability for MDD by modulating local brain function with regard to responsiveness to salient stimuli (i.e. insula and processing novel negative information. Also, depression-specific effects of PCLO on dorsal striatal activation during negative word encoding and the absence of amygdalar salience signalling for novel positive information further suggest a role of PCLO in symptom maintenance in MDD.

  9. Global Telecommunications Services: Strategies of Major Carriers

    OpenAIRE

    Jerry Mccreary; William R. Boulton; Chetan Sankar

    1993-01-01

    The globalization of telecommunications markets is of primary concern for today’s large telecommunications carriers. International business telecommunications is growing at a rate twice that of domestic traffic. Multi-national customers with offices around the world are demanding integrated solutions to their telecommunications needs. As telecommunication carriers respond to these customers’ needs, the carriers are beginning to expand outside their national boundaries. This paper identifi...

  10. Both Hemophilia Health Care Providers and Hemophilia A Carriers Report that Carriers have Excessive Bleeding

    Science.gov (United States)

    Paroskie, Allison; Oso, Olatunde; DeBaun, Michael R.; Sidonio, Robert F

    2014-01-01

    Introduction Hemophilia A, the result of reduced factor VIII (FVIII) activity, is an X-linked recessive bleeding disorder. Previous reports of Hemophilia A carriers suggest an increased bleeding tendency. Our objective was to determine the attitudes and understanding of the Hemophilia A carrier bleeding phenotype, and opinions regarding timing of carrier testing from the perspective of both medical providers and affected patients. Data from this survey was used as preliminary data for an ongoing prospective study. Material and Methods An electronic survey was distributed to physicians and nurses employed at Hemophilia Treatment Centers (HTC), and Hemophilia A carriers who were members of Hemophilia Federation of America. Questions focused on the clinical understanding of bleeding symptoms and management of Hemophilia A carriers, and the timing and intensity of carrier testing. Results Our survey indicates that 51% (36/51) of providers compared to 78% (36/46) of carriers believe that Hemophilia A carriers with normal FVIII activity have an increased bleeding tendency (pHemophilia A carriers report a high frequency of bleeding symptoms. Regarding carrier testing, 72% (50/69) of medical providers recommend testing after 14 years of age, conversely 65% (29/45) of Hemophilia A carriers prefer testing to be done prior to this age (pHemophilia A carriers self-report a higher frequency of bleeding than previously acknowledged, and have a preference for earlier testing to confirm carrier status. PMID:24309601

  11. Experimental transmission of AA amyloidosis by injecting the AA amyloid protein into interleukin-1 receptor antagonist knockout (IL-1raKO) mice.

    Science.gov (United States)

    Watanabe, K; Uchida, K; Chambers, J K; Tei, M; Shoji, A; Ushio, N; Nakayama, H

    2015-05-01

    The incidence of AA amyloidosis is high in humans with rheumatoid arthritis and several animal species, including cats and cattle with prolonged inflammation. AA amyloidosis can be experimentally induced in mice using severe inflammatory stimuli and a coinjection of AA amyloid; however, difficulties have been associated with transmitting AA amyloidosis to a different animal species, and this has been attributed to the "species barrier." The interleukin-1 receptor antagonist knockout (IL-1raKO) mouse, a rodent model of human rheumatoid arthritis, has been used in the transmission of AA amyloid. When IL-1raKO and BALB/c mice were intraperitoneally injected with mouse AA amyloid together with a subcutaneous pretreatment of 2% AgNO3, all mice from both strains that were injected with crude or purified murine AA amyloid developed AA amyloidosis. However, the amyloid index, which was determined by the intensity of AA amyloid deposition, was significantly higher in IL-1raKO mice than in BALB/c mice. When IL-1raKO and BALB/c mice were injected with crude or purified bovine AA amyloid together with the pretreatment, 83% (5/6 cases) and 38% (3/8 cases) of IL-1raKO mice and 17% (1/6 cases) and 0% (0/6 cases) of BALB/c mice, respectively, developed AA amyloidosis. Similarly, when IL-1raKO and BALB/c mice were injected with crude or purified feline AA amyloid, 33% (2/6 cases) and 88% (7/8 cases) of IL-1raKO mice and 0% (0/6 cases) and 29% (2/6 cases) of BALB/c mice, respectively, developed AA amyloidosis. These results indicated that IL-1raKO mice are a useful animal model for investigating AA amyloidogenesis. © The Author(s) 2014.

  12. The Contribution of Matrix Metalloproteinase-7 Promoter Genotypes in Breast Cancer in Taiwan.

    Science.gov (United States)

    Chou, An-Kuo; Hsiao, Chieh-Lun; Shih, Tzu-Ching; Wang, Hwei-Chung; Tsai, Chia-Wen; Chang, Wen-Shin; Liu, Liang-Chih; Way, Tzong-DER; Chung, Jing-Gung; Bau, DA-Tian

    2017-09-01

    The matrix metalloproteinase (MMP) family of enzymes are in charge of degradation of various components of the extracellular matrix and their functional genetic polymorphisms may be associated with cancer susceptibility. The functional polymorphisms in the promoter region of MMP7 (A-181G and C-153T) have been reported to influence the binding capacity of nuclear proteins and may contribute to genetic susceptibility to cancer. In this study, we focused on investigating the contribution of the genotypes of MMP7 (A-181G and C-153T) to breast cancer in Taiwan. These two polymorphisms were genotyped in 1,232 patients with breast cancer and 1,232 controls by polymerase chain reaction-restriction fragment length polymorphism methodology. The odds ratios (ORs) after adjusting for age, family history of cancer, smoking and alcohol drinking status for those carrying AG and GG genotypes at MMP7 promoter A-181G were 1.22 (95%CI=0.91-1.63, p=0.2235) and 2.84 (95%CI=1.64-7.48, p=0.0007) respectively, compared to those carrying the wild-type AA genotype. Supporting this finding, the adjusted OR for those carrying the G allele at MMP7 promoter A-181G was 1.57 (95%CI=1.29-1.93, p=0.0008), compared to those carrying the wild-type A allele. There was no polymorphic genotype at MMP7 C-153T found among any of the investigated individuals. Our findings suggest that the MMP7 A-181G polymorphisms may play a role in determining personal cancer susceptibility and GG genotype at MMP7 A-181G may serve as a biomarker for early detection and prediction of breast cancer in Taiwanese. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  13. 5,10-Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms: genotype frequency and association with homocysteine and folate levels in middle-southern Italian adults.

    Science.gov (United States)

    Zappacosta, Bruno; Graziano, Mirella; Persichilli, Silvia; Di Castelnuovo, Augusto; Mastroiacovo, Pierpaolo; Iacoviello, Licia

    2014-01-01

    Two genetic polymorphisms of methylenetetrahydrofolate reductase (MTHFR) gene (C677T and A1298C) can influence the plasma homocysteine (Hcy) levels, especially in the presence of an inadequate folate status. The aim of this study was to evaluate the frequencies of C677T and of A1298C MTHFR polymorphisms and their correlation with Hcy and serum folate concentrations in a population of blood donors living in a region of middle-southern Italy (the Molise Region). One hundred ninety seven blood donors were studied for total plasma Hcy, serum folate and C677T and A1298C MTHFR genotypes. The frequency of C677T genotypes was 20.8% (CC), 49.8% (CT) and 29.4% (TT); for the A1298C genotypes: 48.7% (AA), 43.7% (AC) and 7.6% (CC). Hcy and serum folate concentrations were significantly different among genotypes of the C677T polymorphism (CC versus CT versus TT: A1298C polymorphism, the difference among genotypes (AA versus AC versus CC; p: 0.026 for Hcy and 0.014 for serum folate), showed an opposite trend for both parameters, with Hcy higher in the wild-type and lower in the homozygotes and serum folate higher in CC than in AA subjects. In conclusion, we found a high frequency of MTHFR allele associated with high level of Hcy and low levels of folate in an Italian southern population. Copyright © 2013 John Wiley & Sons, Ltd.

  14. Caffeine and 3-km cycling performance: Effects of mouth rinsing, genotype, and time of day.

    Science.gov (United States)

    Pataky, M W; Womack, C J; Saunders, M J; Goffe, J L; D'Lugos, A C; El-Sohemy, A; Luden, N D

    2016-06-01

    We assessed the efficacy of caffeine mouth rinsing on 3-km cycling performance and determined whether caffeine mouth rinsing affects performance gains influenced by the CYP1A2 polymorphism. Thirty-eight recreational cyclists completed four simulated 3-km time trials (TT). Subjects ingested either 6 mg/kg BW of caffeine or placebo 1 h prior to each TT. Additionally, 25 mL of 1.14% caffeine or placebo solution were mouth rinsed before each TT. The treatments were Placebo, caffeine Ingestion, caffeine Rinse and Ingestion+Rinse. Subjects were genotyped and classified as AA homozygotes or AC heterozygotes for the rs762551 polymorphism of the CYP1A2 gene involved in caffeine metabolism. Magnitude-based inferences were used to evaluate treatment differences in mean power output based on a predetermined meaningful treatment effect of 1.0%. AC heterozygotes (4.1%) and AA homozygotes (3.4%) benefited from Ingestion+Rinse, but only AC performed better with Ingestion (6.0%). Additionally, Rinse and Ingestion+Rinse elicited better performance relative to Placebo among subjects that performed prior to 10:00 h (Early) compared with after 10:00 h (Late). The present study provides additional evidence of genotype and time of day factors that affect the ergogenic value of caffeine intake that may allow for more personalized caffeine intake strategies to maximize performance. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. KIR genotype distribution among patients with multiple myeloma: Higher prevalence of KIR 2DS4 and KIR 2DS5 genes.

    Science.gov (United States)

    Hoteit, R; Bazarbachi, A; Antar, A; Salem, Z; Shammaa, D; Mahfouz, R

    2014-12-01

    Natural killer (NK) cells possess an antitumor activity against multiple myeloma cells proven by the susceptibility of plasmocytes to NK lysis. In the early stage of MM, the killing of MM cells is mediated by natural cytotoxicity receptors (NRC) and NKG2D-dependent pathway, while in the late stage, NK cells lose their killing potential against MM cells due to the high expression of HLA class I molecules on MM cells. The aim of this paper is to study KIR expression of NK cells in MM patients and in healthy controls, to check for any association between KIR genotypes and MM. KIR genotype was analyzed in 120 healthy Lebanese individuals and 34 MM patients using the KIR Genotyping SSP kit. KIR 2DS4*001/002 and KIR 2DS5 were found to be significantly more prevalent among MM patients as compared to controls. For MM patients, the AA, AB, and BB genotype frequencies were, respectively, 38.23%, 47.06% and 14.71% with an A:B ratio of 1.62:1. As for the healthy controls, the AA, AB, and BB genotype frequencies were, respectively, 39.17%, 50%, and 10.83% with an A:B ratio of 1.80:1. The interesting observation of the significant presence of KIR2DS4 and KIR2DS5 genes more among multiple myeloma patients than controls is worth further clinical, translational as well as survival research studies in these cases.

  16. Cyclodextrins in drug carrier systems.

    Science.gov (United States)

    Uekama, K; Otagiri, M

    1987-01-01

    One of the important characteristics of cyclodextrins is the formation of an inclusion complex with a variety of drug molecules in solution and in the solid state. As a consequence of intensive basic research, exhaustive toxic studies, and realization of industrial production during the past decade, there seem to be no more barriers for the practical application of natural cyclodextrins in the biomedical field. Recently, a number of cyclodextrin derivatives and cyclodextrin polymers have been prepared to obtain better inclusion abilities than parent cyclodextrins. The natural cyclodextrins and their synthetic derivatives have been successfully utilized to improve various drug properties, such as solubility, dissolution and release rates, stability, or bioavailability. In addition, the enhancement of drug activity, selective transfer, or the reduction of side effects has been achieved by means of inclusion complexation. The drug-cyclodextrin complex is generally formed outside of the body and, after administration, it dissociates, releasing the drug into the organism in a fast and nearly uniform manner. In the biomedical application of cyclodextrins, therefore, particular attention should be directed to the magnitude of the stability constant of the inclusion complex. In the case of parenteral application, a rather limited amount of work has been done because the cyclodextrins in the drug carrier systems have to be more effectively designed to compete with various biological components in the circulatory system. However, the works published thus far apparently indicate that the inclusion phenomena of cyclodextrin analogs may allow the rational design of drug formulation and that the combination of molecular encapsulation with other carrier systems will become a very effective and valuable method for the development of a new drug delivery system in the near future.

  17. Swedish CDKN2A mutation carriers do not present the atypical mole syndrome phenotype.

    Science.gov (United States)

    Nielsen, Kari; Harbst, Katja; Måsbäck, Anna; Jönsson, Göran; Borg, Ake; Olsson, Håkan; Ingvar, Christian

    2010-08-01

    Phenotypic characteristics were examined in melanoma-prone southern Swedish CDKN2A (p16-113insArg/p14ARF-128insSer) mutation families, in relation to the CDKN2A genotype, nevi, clinically atypical nevi (CAN) and melanoma. Individuals from eight melanoma-prone families, with index patients carrying the CDKN2A mutation, were offered skin examinations and genotyping (CDKN2A and MC1R). Ninety-three individuals above 18 years of age participated; 29 invasive melanomas in 16 patients were recorded, all in the 38 verified CDKN2A mutation carriers. Median age at diagnosis was 36 years. Several MC1R variants were observed. A significant correlation to CAN (P=0.01) and red hair colour (P=0.02) could be confirmed in melanoma patients. A positive mutation status (CDKN2A) was correlated to one or more CAN (P=0.007) but neither to blue eyes, red hair colour, heavy freckling nor high number of nevi. For mutation carriers, median total naevus count was 24 and interquartile range was 12-47 (mean 31); whereas for the whole cohort, median total naevus count was 12 and interquartile range was 5-25 (mean 22). No participant fulfilled the atypical mole syndrome phenotype criteria. Melanomas were diagnosed only in mutation carriers, and melanoma diagnosis was statistically correlated to the presence of one or more CAN and red hair colour, supporting the possible synergistic effect of a MC1R mutation on increased risk of melanoma in patients with a CDKN2A mutation. Family history, with verified tumour diagnoses, remains an important clinical tool for finding mutation carriers for referral to clinical geneticists and simultaneous presence of CAN in probable mutation carriers might strengthen this indication. The atypical mole syndrome phenotype was, however, not verified in the studied families and total naevus counts were low.

  18. The effect of the hemochromatosis (HFE genotype on lead load and iron metabolism among lead smelter workers.

    Directory of Open Access Journals (Sweden)

    Guangqin Fan

    Full Text Available Both an excess of toxic lead (Pb and an essential iron disorder have been implicated in many diseases and public health problems. Iron metabolism genes, such as the hemochromatosis (HFE gene, have been reported to be modifiers for lead absorption and storage. However, the HFE gene studies among the Asian population with occupationally high lead exposure are lacking.To explore the modifying effects of the HFE genotype (wild-type, H63D variant and C282Y variant on the Pb load and iron metabolism among Asian Pb-workers with high occupational exposure.Seven hundred and seventy-one employees from a lead smelter manufacturing company were tested to determine their Pb intoxication parameters, iron metabolic indexes and identify the HFE genotype. Descriptive and multivariate analyses were conducted.Forty-five H63D variant carriers and no C282Y variant carrier were found among the 771 subjects. Compared with subjects with the wild-type genotype, H63D variant carriers had higher blood lead levels, even after controlling for factors such as age, sex, marriage, education, smoking and lead exposure levels. Multivariate analyses also showed that the H63D genotype modifies the associations between the blood lead levels and the body iron burden/transferrin.No C282Y variant was found in this Asian population. The H63D genotype modified the association between the lead and iron metabolism such that increased blood lead is associated with a higher body iron content or a lower transferrin in the H63D variant. It is indicated that H63D variant carriers may be a potentially highly vulnerable sub-population if they are exposed to high lead levels occupationally.

  19. Systemic AA amyloidosis in the red fox (Vulpes vulpes).

    Science.gov (United States)

    Rising, Anna; Cederlund, Ella; Palmberg, Carina; Uhlhorn, Henrik; Gaunitz, Stefan; Nordling, Kerstin; Ågren, Erik; Ihse, Elisabet; Westermark, Gunilla T; Tjernberg, Lars; Jörnvall, Hans; Johansson, Jan; Westermark, Per

    2017-11-01

    Amyloid A (AA) amyloidosis occurs spontaneously in many mammals and birds, but the prevalence varies considerably among different species, and even among subgroups of the same species. The Blue fox and the Gray fox seem to be resistant to the development of AA amyloidosis, while Island foxes have a high prevalence of the disease. Herein, we report on the identification of AA amyloidosis in the Red fox (Vulpes vulpes). Edman degradation and tandem MS analysis of proteolyzed amyloid protein revealed that the amyloid partly was composed of full-length SAA. Its amino acid sequence was determined and found to consist of 111 amino acid residues. Based on inter-species sequence comparisons we found four residue exchanges (Ser31, Lys63, Leu71, Lys72) between the Red and Blue fox SAAs. Lys63 seems unique to the Red fox SAA. We found no obvious explanation to how these exchanges might correlate with the reported differences in SAA amyloidogenicity. Furthermore, in contrast to fibrils from many other mammalian species, the isolated amyloid fibrils from Red fox did not seed AA amyloidosis in a mouse model. © 2017 The Protein Society.

  20. Contribution to comprehensive study of aluminium alloy Aa 5083 ...

    African Journals Online (AJOL)

    Corrosion induced by elemental mercury in aqueous media of industrial Aluminium alloys AA5083 used in heat exchanger industries of natural gas liquefaction has been studied by linear sweep voltammétry on rotating amalgamated disk electrode. Corrosion process depends on: • Chemical processes of amalgamation of ...

  1. Churg-Strauss syndrome associated with AA amyloidosis: a case ...

    African Journals Online (AJOL)

    Churg Strauss syndrome is a rare systemic and pulmonary vasculitis exceptionally associated with AA amyloidosis. We report the case of a 65-year old woman with past medical history of asthma. She developed polyarthralgia, headache and purpura. A laboratory workout found hypereosinophilia (1150/μL), positive ...

  2. Backend solutions for AA in the MUSE network supporting FMC

    NARCIS (Netherlands)

    Neerbos, A.N.R. van; Prins, M.; Melander, B.; Pimilla Larrucea, I.; Thakur, M.J.; Fredricx, F.

    2007-01-01

    The European MUSE project investigated fixed-mobile convergence from the perspective of an unbundled fixed network. A major part of the work consisted of finding solutions for the authentication and authorisation of users who roam from their home network to a visited network. This paper shows how AA

  3. Three body abrasion of laser surface alloyed aluminium AA1200

    CSIR Research Space (South Africa)

    Mabhali, Luyolo AB

    2012-06-01

    Full Text Available Laser surface alloying of aluminium AA1200 was performed with a 4 kW Nd:YAG laser to improve the abrasion wear resistance. Aluminium surfaces reinforced with metal matrix composites and intermetallic phases were achieved. The phases present depended...

  4. Recovery and recrystallization in the superplastic deformation of AA5182

    NARCIS (Netherlands)

    Chen, Z.; Kazantzis, A. V.; De Hosson, J. Th. M.

    The coarse-grained Al alloy AA5182 exhibits poor superplasticity with a maximum elongation to failure not exceeding 220% at 450 degrees C and at 10(-2) s(-1). The low values of the strain rate sensitivity indicate that the dislocation velocity is quite high and necking is developed quite soon during

  5. Impact toughness of laser alloyed aluminium AA1200 alloys

    CSIR Research Space (South Africa)

    Mabhali, Luyolo AB

    2013-08-01

    Full Text Available Laser surface alloying of aluminium AA1200 was performed with a 4kW Nd:YAG laser and impact resistance of the alloys was investigated. The alloying powders were a mixture of Ni, Ti and SiC in different proportions. Surfaces reinforced...

  6. Pollution assessment and heavy metal determination by AAS in ...

    African Journals Online (AJOL)

    Foisal

    below detective level. This study points out the health risk status of waste water for residents and aquatic living being, an ultimate concern for their survival in the region. Key words: Waste water, pollution assessment, physico-chemical parameters, atomic absorption spectrophotometer (AAS), heavy metal contamination.

  7. Making ET AAS Determination Less Dependent on Vapourization ...

    African Journals Online (AJOL)

    NICO

    The quantification of the analytes in ET AAS is normally attained by the measurement and integration of transient absorbance. High degree of atomization and constant vapour transportation rate for the analyte atoms in the absorption volume are considered to be crucial to grant correctness of the measurements. However ...

  8. Association of genetic polymorphisms of PON1 and CETP with the presence of metabolic syndrome; the effects of genotypes on their serum activity and concentrations

    Directory of Open Access Journals (Sweden)

    Behdokht Fathi Dizaji

    2018-01-01

    Conclusions: There were no associations between the PON1 polymorphisms, or haplotypes with MetS. There was an association between CETPrs5882 and metabolic syndrome. AA genotype of CETPrs5882 appeared to be protective against MetS in our studied population. There were no association between the PON1 and CETP polymorphisms with PON1enzymatic activities and CETP protein levels at base line and after curcumin supplementation.

  9. Usefulness of real time PCR for the differentiation and quantification of 652 and JP2 Actinobacillus actinomycetemcomitans genotypes in dental plaque and saliva

    Directory of Open Access Journals (Sweden)

    Piras Vincenzo

    2006-06-01

    Full Text Available Abstract Background The aim of our study is to describe a fast molecular method, able to distinguish and quantize the two different genotypes (652 and JP2 of an important periodontal pathogen: Actinobacillus actinomycetemcomitans. The two genotypes show differences in the expression of an important pathogenic factor: the leukotoxin (ltx. In order to evidence this, we performed a real time PCR procedure on the ltx operon, able to recognize Aa clinical isolates with different leukotoxic potentials. Methods The specificity of the method was confirmed in subgingival plaque and saliva specimens collected from eighty-one Italian (Sardinian subjects with a mean age of 43.9, fifty five (68 % of whom had various clinical forms of periodontal disease. Results This procedure showed a good sensitivity and a high linear dynamic range of quantization (107-102 cells/ml for all genotypes and a good correlation factor (R2 = 0.97–0.98. Compared with traditional cultural methods, this real time PCR procedure is more sensitive; in fact in two subgingival plaque and two positive saliva specimens Aa was only detected with the molecular method. Conclusion A low number of Sardinian patients was found positive for Aa infections in the oral cavity, (just 10 positive periodontal cases out of 81 and two of these were also saliva positive. The highly leukotoxic JP2 strain was the most representative (60 % of the positive specimens; the samples from periodontal pockets and from saliva showed some ltx genotype for the same patient. Our experience suggests that this approach is suitable for a rapid and complete laboratory diagnosis for Aa infection.

  10. Signaling Pathways Related to Protein Synthesis and Amino Acid Concentration in Pig Skeletal Muscles Depend on the Dietary Protein Level, Genotype and Developmental Stages.

    Science.gov (United States)

    Liu, Yingying; Li, Fengna; Kong, Xiangfeng; Tan, Bie; Li, Yinghui; Duan, Yehui; Blachier, François; Hu, Chien-An A; Yin, Yulong

    2015-01-01

    Muscle growth is regulated by the homeostatic balance of the biosynthesis and degradation of muscle proteins. To elucidate the molecular interactions among diet, pig genotype, and physiological stage, we examined the effect of dietary protein concentration, pig genotype, and physiological stages on amino acid (AA) pools, protein deposition, and related signaling pathways in different types of skeletal muscles. The study used 48 Landrace pigs and 48 pure-bred Bama mini-pigs assigned to each of 2 dietary treatments: lower/GB (Chinese conventional diet)- or higher/NRC (National Research Council)-protein diet. Diets were fed from 5 weeks of age to respective market weights of each genotype. Samples of biceps femoris muscle (BFM, type I) and longissimus dorsi muscle (LDM, type II) were collected at nursery, growing, and finishing phases according to the physiological stage of each genotype, to determine the AA concentrations, mRNA levels for growth-related genes in muscles, and protein abundances of mechanistic target of rapamycin (mTOR) signaling pathway. Our data showed that the concentrations of most AAs in LDM and BFM of pigs increased (Prelated AA, including Met, Phe, Tyr, Pro, and Ser, compared with Landrace pigs. The mRNA levels for myogenic determining factor, myogenin, myocyte-specific enhancer binding factor 2 A, and myostatin of Bama mini-pigs were higher (P<0.05) than those of Landrace pigs, while total and phosphorylated protein levels for protein kinase B, mTOR, and p70 ribosomal protein S6 kinases (p70S6K), and ratios of p-mTOR/mTOR, p-AKT/AKT, and p-p70S6K/p70S6K were lower (P<0.05). There was a significant pig genotype-dependent effect of dietary protein on the levels for mTOR and p70S6K. When compared with the higher protein-NRC diet, the lower protein-GB diet increased (P<0.05) the levels for mTOR and p70S6K in Bama mini-pigs, but repressed (P<0.05) the level for p70S6K in Landrace pigs. The higher protein-NRC diet increased ratio of p-mTOR/mTOR in

  11. Carrier-carrier relaxation kinetics in quantum well semiconductor structures with nonparabolic energy bands

    DEFF Research Database (Denmark)

    Dery, H.; Tromborg, Bjarne; Eisenstein, G.

    2003-01-01

    We describe carrier-carrier scattering dynamics in an inverted quantum well structure including the nonparabolic nature of the valance band. A solution of the semiconductor Bloch equations yields strong evidence to a large change in the temporal evolution of the carrier distributions compared...

  12. Profile of Mutations in the Reverse Transcriptase and Overlapping Surface Genes of Hepatitis B Virus (HBV) in Treatment-Naïve Indonesian HBV Carriers.

    Science.gov (United States)

    Yamani, Laura Navika; Yano, Yoshihiko; Utsumi, Takako; Wasityastuti, Widya; Rinonce, Hanggoro Tri; Widasari, Dewiyani Indah; Juniastuti; Lusida, Maria Inge; Soetjipto; Hayashi, Yoshitake

    2017-11-22

    Mutations in the reverse transcriptase (RT) region of the hepatitis B virus (HBV) genome are an important factor in low therapeutic effectiveness. Nonetheless, the prevalence of these mutations in HBV strains isolated previously in Indonesia has not been systematically examined. Therefore, in this study, we investigated the profile of mutations in the RT region and the associations of these mutations with amino acid changes in the surface protein in the virus of treatment-naïve Indonesian HBV carriers. Overall, 96 sequences of the full-length Indonesian HBV genomes (genotype B, n = 54; genotype C, n = 42) were retrieved from the National Center for Biotechnology Information. Naturally occurring primary and/or compensatory drug resistance mutations were found in 6/54 (11.1%) genotype B strains and in 1/42 (2.4%) genotype C strains. The potential mutations underlying resistance to a nucleos(t)ide analog and/or pretreatment mutations were more frequent in both genotypes but more frequent in genotype C strains than in genotype B strains. The A-B interdomain region in the RT gene was more frequently mutated in genotype C than in genotype B (3.51 ± 2.53 vs. 1.08 ± 1.52, P < 0.001). Knowledge about the mutational profiles of the RT gene and changes in the surface protein may help clinicians to select the most appropriate antiviral drug and vaccination or HBV immunoglobulin regimen for management of HBV infection in Indonesia.

  13. Decoding noises in HIV computational genotyping.

    Science.gov (United States)

    Jia, MingRui; Shaw, Timothy; Zhang, Xing; Liu, Dong; Shen, Ye; Ezeamama, Amara E; Yang, Chunfu; Zhang, Ming

    2017-11-01

    Lack of a consistent and reliable genotyping system can critically impede HIV genomic research on pathogenesis, fitness, virulence, drug resistance, and genomic-based healthcare and treatment. At present, mis-genotyping, i.e., background noises in molecular genotyping, and its impact on epidemic surveillance is unknown. For the first time, we present a comprehensive assessment of HIV genotyping quality. HIV sequence data were retrieved from worldwide published records, and subjected to a systematic genotyping assessment pipeline. Results showed that mis-genotyped cases occurred at 4.6% globally, with some regional and high-risk population heterogeneities. Results also revealed a consistent mis-genotyping pattern in gp120 in all studied populations except the group of men who have sex with men. Our study also suggests novel virus diversities in the mis-genotyped cases. Finally, this study reemphasizes the importance of implementing a standardized genotyping pipeline to avoid genotyping disparity and to advance our understanding of virus evolution in various epidemiological settings. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. NRF2 genotype improves endurance capacity in response to training.

    Science.gov (United States)

    He, Z; Hu, Y; Feng, L; Lu, Y; Liu, G; Xi, Y; Wen, L; McNaughton, L R

    2007-09-01

    The aim of this work was to examine the association between the polymorphisms in nuclear respiratory factor (NRF2) gene and endurance capacity measured prior to and after an 18-wk endurance training program in young Chinese men. The phenotypes measured were running economy (RE) and VO(2max). The RE was determined by measuring submaximal VO(2) for 5 min at a constant running speed of 12 km x h (-1) and VO(2max) was measured during an incremental test to volitional exhaustion. Genomic DNA was extracted from white cells of peripheral blood and the genotypes were examined in SNPrs12594956, rs8031031 and rs7181866 by PCR-RFLP. Genotype distributions were in Hardy-Weinberg equilibrium at three loci, and linkage disequilibrium was observed (LD D' = 1 and r (2) = 0.903) between rs8031031 and rs7181866. The VO(2max) was associated with rs12594956 at baseline while the training response of VO(2) at RE, was associated with rs12594956, rs8031031 and rs7181866. When the three SNPs were considered together, those carrying the ATG haplotype had 57.5 % higher training response in VO(2) at RE (p = 0.006) than non-carriers. In conclusion, polymorphisms in NRF2 gene may explain some of the between-person variance in endurance capacity.

  15. The 5-HTTLPR genotype modulates heart rate variability and its adjustment by pharmacological panic challenge in healthy men.

    Science.gov (United States)

    Agorastos, Agorastos; Kellner, Michael; Stiedl, Oliver; Muhtz, Christoph; Becktepe, Jos S; Wiedemann, Klaus; Demiralay, Cüneyt

    2014-03-01

    Abnormal serotonin transporter (5-HTT) function and autonomic nervous system (ANS) dysregulation has been proposed in panic disorder. However, in contrast to hypothalamo-pituitary-adrenocortical (HPA) functioning, ANS reactivity during panic response has yet not been investigated in humans with respect to the 5-HTT genotype. The present study assessed the influence of challenging by cholecystokinin tetrapeptide (CCK-4) on heart rate variability (HRV) measures, to monitor autonomic reactivity and its relationship to 5-HTT-linked polymorphic region (5-HTTLPR) genotypes. We hypothesized substantial effects of the 5-HTTLPR genotype on autonomic reactivity. We studied 30 healthy young men, 15 of each with the long/long (l/l) or short/short (s/s) genotype for the 5-HTTLPR. All participants received an intravenous application of 50 μg CCK-4. HRV measures were assessed in both groups at baseline and immediately after CCK-4 application. Our results indicated lower parasympathetic activity in s/s carriers during baseline, time and frequency domain measures. CCK-4 application significantly enhanced the sympathetic tone in both groups, leading to diminished group differences. A significant treatment by genotype effect indicated reduced autonomic reactivity to CCK-4 challenge in the s/s compared to l/l carriers. Our findings show enhanced sympathetic and/or diminished cardiac vagal activity under basal conditions and blunted autonomic reactivity in s/s vs. l/l carriers. Our study provides novel data supporting claims that the s/s genotype represents a genetic vulnerability factor associated with inadequate hyporeactivity to stress and extends current knowledge on the impact of the central serotonergic activity on the sympathoadrenal pathway. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. A Status Report on the AAS Astronomy Ambassadors Program

    Science.gov (United States)

    Fienberg, Richard Tresch; Fraknoi, Andrew; Gurton, Suzanne; Hurst, Anna; Schatz, Dennis L.

    2014-06-01

    The American Astronomical Society, in partnership with the Astronomical Society of the Pacific (ASP), has launched a series of professional-development workshops and a community of practice designed to improve early-career astronomers’ ability to communicate effectively with students and the public. Called AAS Astronomy Ambassadors, the program provides training and mentoring for young astronomers, from advanced undergraduates to beginning faculty; it also provides them access to resources and a network of contacts within the astronomy education and public outreach (EPO) community. Ambassadors are provided with a library of outreach activities and resource materials suitable for a range of venues and audiences. For much of this library we are using resources developed by organizations such as the ASP, the Pacific Science Center, and the Center for Astronomy Education for other outreach programs, though some resources have been created by one of us (AF) specifically for this program. After a period of evaluation and revision, the program’s “Menu of Outreach Opportunities for Science Education” (MOOSE) is now posted on the AAS website at http://aas.org/outreach/moose-menu-outreach-opportunities-science-education.The first two Astronomy Ambassadors workshops were held at AAS meetings in January 2013 and January 2014; each served 30 young astronomers chosen from about twice that many applicants. Web-based follow-up activities are being provided through a website at the ASP designed to keep cohorts of educators trained in their programs in touch with one another. The AAS is exploring ways to fund additional workshops at future winter meetings; suggestions are most welcome. Meanwhile, the Astronomy Ambassadors trained to date have logged more than 150 outreach events, reaching many thousands of children and adults across the U.S. and Canada.

  17. Providing resilience for carrier ethernet multicast traffic

    DEFF Research Database (Denmark)

    Ruepp, Sarah Renée; Wessing, Henrik; Zhang, Jiang

    2009-01-01

    This paper presents an overview of the Carrier Ethernet technology with specific focus on resilience. In particular, we detail how multicast traffic, which is essential for e.g. IPTV can be protected. We present Carrier Ethernet resilience methods for linear and ring networks and show by simulation...... that the availability of a multicast connection can be significantly increased by applying relevant resilience techniques....

  18. Driver citation/carrier data relationship project

    Science.gov (United States)

    1996-09-01

    The Driver/Carrier Relationship Project was commissioned to address three issues. The first was to determine if drivers of commercial motor vehicles get tickets at a different rate, depending on the carrier that they are working for. The second issue...

  19. Influence of APOE Genotype on Hippocampal Atrophy over Time - An N=1925 Surface-Based ADNI Study.

    Directory of Open Access Journals (Sweden)

    Bolun Li

    Full Text Available The apolipoprotein E (APOE e4 genotype is a powerful risk factor for late-onset Alzheimer's disease (AD. In the Alzheimer's Disease Neuroimaging Initiative (ADNI cohort, we previously reported significant baseline structural differences in APOE e4 carriers relative to non-carriers, involving the left hippocampus more than the right--a difference more pronounced in e4 homozygotes than heterozygotes. We now examine the longitudinal effects of APOE genotype on hippocampal morphometry at 6-, 12- and 24-months, in the ADNI cohort. We employed a new automated surface registration system based on conformal geometry and tensor-based morphometry. Among different hippocampal surfaces, we computed high-order correspondences, using a novel inverse-consistent surface-based fluid registration method and multivariate statistics consisting of multivariate tensor-based morphometry (mTBM and radial distance. At each time point, using Hotelling's T(2 test, we found significant morphological deformation in APOE e4 carriers relative to non-carriers in the full cohort as well as in the non-demented (pooled MCI and control subjects at each follow-up interval. In the complete ADNI cohort, we found greater atrophy of the left hippocampus than the right, and this asymmetry was more pronounced in e4 homozygotes than heterozygotes. These findings, combined with our earlier investigations, demonstrate an e4 dose effect on accelerated hippocampal atrophy, and support the enrichment of prevention trial cohorts with e4 carriers.

  20. Carrier multiplication in graphene under Landau quantization.

    Science.gov (United States)

    Wendler, Florian; Knorr, Andreas; Malic, Ermin

    2014-04-16

    Carrier multiplication is a many-particle process giving rise to the generation of multiple electron-hole pairs. This process holds the potential to increase the power conversion efficiency of photovoltaic devices. In graphene, carrier multiplication has been theoretically predicted and recently experimentally observed. However, due to the absence of a bandgap and competing phonon-induced electron-hole recombination, the extraction of charge carriers remains a substantial challenge. Here we present a new strategy to benefit from the gained charge carriers by introducing a Landau quantization that offers a tunable bandgap. Based on microscopic calculations within the framework of the density matrix formalism, we report a significant carrier multiplication in graphene under Landau quantization. Our calculations reveal a high tunability of the effect via externally accessible pump fluence, temperature and the strength of the magnetic field.

  1. Microstructure and Mechanical Properties of Accumulative Roll-Bonded AA1050A/AA5005 Laminated Metal Composites

    Directory of Open Access Journals (Sweden)

    Frank Kümmel

    2016-03-01

    Full Text Available Laminated metal composites (LMCs with alternating layers of commercial pure aluminum AA1050A and aluminum alloy AA5005 were produced by accumulative roll-bonding (ARB. In order to vary the layer thickness and the number of layer interfaces, different numbers of ARB cycles (4, 8, 10, 12, 14 and 16 were performed. The microstructure and mechanical properties were characterized in detail. Up to 8 ARB cycles, the ultrafine-grained (UFG microstructure of the layers in the LMC evolves almost equally to those in AA1050A and AA5005 mono-material sheets. However, the grain size in the composites tends to have smaller values. Nevertheless, the local mechanical properties of the individual layers in the LMCs are very similar to those of the mono-material sheets, and the macroscopic static mechanical properties of the LMCs can be calculated as the mean value of the mono-material sheets applying a linear rule of mixture. In contrast, for more than 12 ARB cycles, a homogenous microstructure was obtained where the individual layers within the composite cannot be visually separated any longer; thus, the hardness is at one constant and a high level across the whole sheet thickness. This results also in a significant higher strength in tensile testing. It was revealed that, with decreasing layer thickness, the layer interfaces become more and more dominating.

  2. Dynamic Response and Microstructure Evolution of AA2219-T4 and AA2219-T6 Aluminum Alloys

    Science.gov (United States)

    Olasumboye, A.; Owolabi, G.; Odeshi, A.; Zeytinci, A.; Yilmaz, N.

    2018-02-01

    In this study, the dynamic deformation behavior of AA2219 aluminum alloy was investigated in two different temper conditions: T4 and T6, with a view to determining the effect of heat treatment on the microstructure and flow behavior of the material under high strain rates. Split Hopkinson pressure bar experiment was used in determining the dynamic response of the alloy while a digital image correlation system was employed in visualizing and tracking the surface deformation of the specimens. Optical microscopy and scanning electron microscopy were used to assess the microstructure of the material after following standard metallographic specimen preparation techniques. The results obtained showed heterogeneous deformation of the alloy in the two temper conditions. It was observed that the dynamic mechanical behavior of each sample preparation was dependent on its strength properties due to aging type, which in turn controls the metamorphosis of the strengthening precipitates and the initial microstructure. At the maximum strain rate of 3500 s-1, transformed bands leading to crack nucleation was observed in the AA2219-T4 aluminum alloy while AA2219-T6 had fractured at the same strain rate. The modes of crack formation and growth in the two alloys were found to be similar: nucleation, growth and coalescence of voids. However, shear band bifurcation phenomenon was observed only in the AA2219-T6 alloy.

  3. African Ancestry Influences CCR5 –2459G>A Genotype-Associated Virologic Success of Highly Active Antiretroviral Therapy

    Science.gov (United States)

    Cheruvu, Vinay K.; Igo, Robert P.; Jurevic, Richard J.; Serre, David; Zimmerman, Peter A.; Rodriguez, Benigno; Mehlotra, Rajeev K.

    2014-01-01

    Introduction In a North American, HIV-positive, highly active antiretroviral therapy (HAART)-treated, adherent cohort of self-identified white and black patients, we previously observed that chemokine (C-C motif) receptor 5 (CCR5) –2459G>A genotype had a strong association with time to achieve virologic success (TVLS) in black but not in white patients. Methods Using 128 genome-wide ancestry informative markers, we performed a quantitative assessment of ancestry in these patients (n = 310) to determine (1) whether CCR5 –2459G>A genotype is still associated with TVLS of HAART when ancestry, not self-identified race, is considered and (2) whether this association is influenced by varying African ancestry. Results We found that the interaction between CCR5 –2459G>A genotype and African ancestry (≤0.125 vs. ≥0.425 and A genotype and TVLS was stronger in patients with African ancestry ≥0.71 than in patients with African ancestry ≥0.452, in both Kaplan-Meier (log-rank P = 0.039 and 0.057, respectively, for AA, GA, and GG) and Cox proportional hazards regression (relative hazard for GG compared with AA 2.59 [95% CI, 1.27–5.22; P = 0.01] and 2.26 [95% CI, 1.18–4.32; P = 0.01], respectively) analyses. Conclusions We observed that the association between CCR5 –2459G>A genotype and TVLS of HAART increased with stronger African ancestry. Understanding the genomic mechanisms by which African ancestry influences this association is critical, and requires further studies. PMID:24714069

  4. Applications of blood group genotyping

    Directory of Open Access Journals (Sweden)

    Mariza A. Mota

    2006-03-01

    Full Text Available Introduction: The determination of blood group polymorphism atthe genomic level facilitates the resolution of clinical problemsthat cannot be addressed by hemagglutination. They are useful to(a determine antigen types for which currently available antibodiesare weakly reactive; (b type patients who have been recentlytransfused; (c identify fetuses at risk for hemolytic disease of thenewborn; and (d to increase the reliability of repositories of antigennegative RBCs for transfusion. Objectives: This review assessedthe current applications of blood group genotyping in transfusionmedicine and hemolytic disease of the newborn. Search strategy:Blood group genotyping studies and reviews were searched ingeneral database (MEDLINE and references were reviewed.Selection criteria: All published data and reviews were eligible forinclusion provided they reported results for molecular basis ofblood group antigens, DNA analysis for blood group polymorphisms,determination of fetal group status and applications of blood groupgenotyping in blood transfusion. Data collection: All data werecollected based on studies and reviews of blood grouppolymorphisms and their clinical applications.

  5. Differential Analysis of the Nasal Microbiome of Pig Carriers or Non-Carriers of Staphylococcus aureus

    DEFF Research Database (Denmark)

    Espinosa-Gongora, Carmen; Larsen, Niels; Schonning, Kristian

    2016-01-01

    system. Carriers and non-carriers were selected on the basis of quantitative longitudinal data on S. aureus carriage in 600 pigs sampled at 20 Danish herds included in two previous studies in Denmark. Raw sequences were analysed with the BION meta package and the resulting abundance matrix was analysed...... using the DESeq2 package in R to identify operational taxonomic units (OTUs) with differential abundance between S. aureus carriers and non-carriers. Twenty OTUs were significantly associated to non-carriers, including species with known probiotic potential and antimicrobial effect such as lactic acid...

  6. Diagnostic performance of amyloid A protein quantification in fat tissue of patients with clinical AA amyloidosis

    NARCIS (Netherlands)

    Hazenberg, Bouke P. C.; Bijzet, Johannes; Limburg, Pieter C.; Skinner, Martha; Hawkins, Philip N.; Butrimiene, Irena; Livneh, Avi; Lesnyak, Olga; Nasonov, Evgeney L.; Filipowicz-Sosnowska, Anna; Guel, Ahmet; Merlini, Giampaolo; Wiland, Piotr; Oezdogan, Huri; Gorevic, Peter D.; Ben Maiz, Hedi; Benson, Merrill D.; Direskeneli, Haner; Kaarela, Kalevi; Garceau, Denis; Hauck, Wendy; van Rijswijk, Martin

    Objective. Amyloid A protein quantification in fat tissue is a new immunochemical method for detecting AA amyloidosis, a rare but serious disease. The objective was to assess diagnostic performance in clinical AA amyloidosis. Methods. Abdominal subcutaneous fat tissue of patients with AA amyloidosis

  7. Displaying Now-Understanding: The Finnish Change-of-State Token "aa"

    Science.gov (United States)

    Koivisto, Aino

    2015-01-01

    This article discusses the use of the Finnish change-of-state token "aa" that has previously not been identified. The central claim is that even though "aa" indicates a cognitive shift experienced by the speaker, it does not function as a receipt of new information. Instead, the token "aa" indicates that the speaker…

  8. An Analysis of the Rise and Fall of the AA-MAS Policy

    Science.gov (United States)

    Lazarus, Sheryl S.; Thurlow, Martha L.; Ysseldyke, James E.; Edwards, Lynn M.

    2015-01-01

    In 2005, to address concerns about students who might fall in the "gap" between the regular assessment and the alternate assessment based on alternate achievement standards (AA-AAS), the U.S. Department of Education announced that states could develop alternate assessments based on modified achievement standards (AA-MAS). This article…

  9. 47 CFR 64.1140 - Carrier liability for slamming.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 3 2010-10-01 2010-10-01 false Carrier liability for slamming. 64.1140 Section... Providers § 64.1140 Carrier liability for slamming. (a) Carrier Liability for Charges. Any submitting... unauthorized carrier, the subscriber is absolved of liability for charges imposed by the unauthorized carrier...

  10. Methanol as an energy carrier

    Energy Technology Data Exchange (ETDEWEB)

    Biedermann, P.; Grube, T.; Hoehlein, B. (eds.)

    2006-07-01

    For the future, a strongly growing energy demand is expected in the transport sector worldwide. Economically efficient oil production will run through a maximum in the next decade. Higher fuel prices and an environmentally desirable reduction of emissions will increase the pressure for reducing fuel consumption and emissions in road traffic. These criteria show the urgent necessity of structural changes in the fuel market. Due to its advantages concerning industrial-scale production, storage and global availability, methanol has the short- to medium-term potential for gaining increased significance as a substitution product in the energy market. Methanol can be produced both from fossil energy sources and from biomass or waste materials through the process steps of synthesis gas generation with subsequent methanol synthesis. Methanol has the potential to be used in an environmentally friendly manner in gasoline/methanol mixtures for flexible fuel vehicles with internal combustion engines and in diesel engines with pure methanol. Furthermore, it can be used in fuel cell vehicles with on-board hydrogen production in direct methanol fuel cell drives, and in stationary systems for electricity and heat generation as well as for hydrogen production. Finally, in portable applications it serves as an energy carrier for electric power generation. In this book, the processes for the production and use of methanol are presented and evaluated, markets and future options are discussed and issues of safety and environmental impacts are addressed by a team of well-known authors. (orig.)

  11. Hydrogen: the future energy carrier.

    Science.gov (United States)

    Züttel, Andreas; Remhof, Arndt; Borgschulte, Andreas; Friedrichs, Oliver

    2010-07-28

    Since the beginning of the twenty-first century the limitations of the fossil age with regard to the continuing growth of energy demand, the peaking mining rate of oil, the growing impact of CO2 emissions on the environment and the dependency of the economy in the industrialized world on the availability of fossil fuels became very obvious. A major change in the energy economy from fossil energy carriers to renewable energy fluxes is necessary. The main challenge is to efficiently convert renewable energy into electricity and the storage of electricity or the production of a synthetic fuel. Hydrogen is produced from water by electricity through an electrolyser. The storage of hydrogen in its molecular or atomic form is a materials challenge. Some hydrides are known to exhibit a hydrogen density comparable to oil; however, these hydrides require a sophisticated storage system. The system energy density is significantly smaller than the energy density of fossil fuels. An interesting alternative to the direct storage of hydrogen are synthetic hydrocarbons produced from hydrogen and CO2 extracted from the atmosphere. They are CO2 neutral and stored like fossil fuels. Conventional combustion engines and turbines can be used in order to convert the stored energy into work and heat.

  12. Optimal carrier frequency assignments for a two-carrier-level SCPS system

    Science.gov (United States)

    Vuong, X. T.; Forsey, R. J.

    A two-carrier-level SCPC system may occur in a star network where one master station (hub) with large G/T communicates with many remote stations with small G/T via one satellite transponder. By properly assigning the frequencies of carriers passing through the transponder, one can reduce and balance the relative intermodulation power levels falling into the SCPC channels. Through computer simulation, optimal carrier frequency assignments are found for four different criteria of optimality. The optimal assignments vary with respect to the difference in the two levels of carrier output power. All four criteria provide the conclusion that when the difference is around 3 dB, the assignment with small carriers stacked in the middle is best; and, when the difference is large (greater than 6 dB) the assignment with large carriers and small carriers alternated is best.

  13. Evaluation of biochars from different stock materials as carriers of bacterial strain for remediation of heavy metal-contaminated soil

    OpenAIRE

    Wang, Ting; Sun, Hongwen; Ren, Xinhao; Li, Bing; Mao, Hongjun

    2017-01-01

    Two kinds of biochars, one derived from corn straw and one from pig manure, were studied as carriers of a mutant genotype from Bacillus subtilis (B38) for heavy metal contaminated soil remediation. After amendment with biochar, the heavy metal bioavailability decreased. Moreover, the heavy metal immobilization ability of the biochar was enhanced by combining it with B38. The simultaneous application of B38 and pig manure-derived biochar exhibited a superior effect on the promotion of plant gr...

  14. Hepatitis C Virus: Virology and Genotypes

    KAUST Repository

    Abdel Aziz, Ahmed

    2017-12-01

    Hepatitis C virus (HCV) is a major causative agent of chronic liver disease worldwide. HCV is characterized by genetic heterogeneity, with at least six genotypes identified. The geographic distribution of genotypes has shown variations in different parts of the world over the past decade because of variations in population structure, immigration, and routes of transmission. Genotype differences are of epidemiologic interest and help the study of viral transmission dynamics to trace the source of HCV infection in a given population. HCV genotypes are also of considerable clinical importance because they affect response to antiviral therapy and represent a challenging obstacle for vaccine development.

  15. Localization of aristolochic acid in mouse kidney tissues by immunohistochemistry using an anti-AA-I and AA-II monoclonal antibody.

    Science.gov (United States)

    Li, Xiao-Wei; Yokota, Sadaki; Wang, Dan; Wang, Xuan; Shoyama, Yukihiro; Cai, Shao-Qing

    2014-01-01

    Aristolochic acids (AAs) are found in herbal medicines of Aristolochiaceae plants, including Aristolochia and Asarum species. AAs are associated with a rapidly progressive interstitial nephritis, which is called aristolochic acid nephropathy (AAN). However, the in-situ localization of AAs in the target organ, the kidney, has not been investigated yet. In the present study, the accumulation of aristolochic acid I (AA-I) in mouse kidney was revealed by immunoperoxidase light microscopy as well as colloidal gold immunoelectron microscopy (IEM) based on an anti-AA-I and AA-II monoclonal antibody (mAb). Male BALB/c mice were treated with 1.25 or 2.50 mg kg(-1) of AA-I per day for 5 days. Paraffin sections and ultra-thin sections of kidney tissue were respectively prepared. Under light microscopy, the apical surface of proximal tubules was strongly stained for AA-I, whereas no obvious immunostaining was found in the distal tubules and glomerulus, which remained relatively intact. Under electron microscopy, epithelial cells of the proximal tubules, distal tubules and collecting tubules were broken to various degrees. Gold labeling in the proximal and distal tubules was stronger than that in the collecting tubules. In renal tubules, immunogold signals of AA-I tended to accumulate in the mitochondria and peroxisomes, though the signals could be observed all over the cell. Gold signals were also found in the erythrocytes of glomeruli. The MAb against AA-I and AA-II provides a clue for the identification of proteins or factors which might interact with AA-I and thus induce targeted damage of kidney.

  16. Genotype-Phenotype Correlations in Multiple Sclerosis: "HLA" Genes Influence Disease Severity Inferred by [superscript 1]HMR Spectroscopy and MRI Measures

    Science.gov (United States)

    Okuda, D. T.; Srinivasan, R.; Oksenberg, J. R.; Goodin, D. S.; Baranzini, S. E.; Beheshtian, A.; Waubant, E.; Zamvil, S. S.; Leppert, D.; Qualley, P.; Lincoln, R.; Gomez, R.; Caillier, S.; George, M.; Wang, J.; Nelson, S. J.; Cree, B. A. C.; Hauser, S. L.; Pelletier, D.

    2009-01-01

    Genetic susceptibility to multiple sclerosis (MS) is associated with the human leukocyte antigen (HLA) "DRB1*1501" allele. Here we show a clear association between DRB1*1501 carrier status and four domains of disease severity in an investigation of genotype-phenotype associations in 505 robust, clinically well characterized MS patients evaluated…

  17. Influence of the MDM2 single nucleotide polymorphism SNP309 on tumour development in BRCA1 mutation carriers

    Directory of Open Access Journals (Sweden)

    Johnson Peter W

    2006-03-01

    Full Text Available Abstract Background The MDM2 gene encodes a negative regulator of the p53 tumour suppressor protein. A single nucleotide polymorphism (SNP in the MDM2 promoter (a T to G exchange at nucleotide 309 has been reported to produce accelerated tumour formation in individuals with inherited p53 mutations. We have investigated the effect of the MDM2 SNP309 on clinical outcome in a cohort of patients with germline mutations of BRCA1. Methods Genomic DNA was obtained for 102 healthy controls and 116 patients with established pathogenic mutations of BRCA1 and Pyrosequencing technology™ was used to determine the genotype at the MDM2 SNP309 locus. Results The polymorphism was present in 52.9% of the controls (G/T in 37.3% and G/G in 15.6% and 58.6% of the BRCA1 mutation carriers (47.4% G/T and 11.2% G/G. Incidence of malignancy in female BRCA1 carriers was not significantly higher in SNP309 carriers than in wildtype (T/T individuals (72.7% vs. 75.6%, p = 1.00. Mean age of diagnosis of first breast cancer was 41.2 years in the SNP309 G/G genotype carriers, 38.6 years in those with the SNP309 G/T genotype and 39.0 years in wildtype subjects (p = 0.80. Conclusion We found no evidence that the MDM2 SNP309 accelerates tumour development in carriers of known pathogenic germline mutations of BRCA1.

  18. Carrier testing for autosomal-recessive disorders.

    Science.gov (United States)

    Vallance, Hilary; Ford, Jason

    2003-08-01

    The aim of carrier testing is to identify carrier couples at risk of having offspring with a serious genetic (autosomal recessive) disorder. Carrier couples are offered genetic consultation where their reproductive options, including prenatal diagnosis, are explained. The Ashkenazi Jewish population is at increased risk for several recessively inherited disorders (Tay-Sachs disease, Cystic fibrosis, Canavan disease, Gaucher disease, Familial Dysautonomia, Niemann-Pick disease, Fanconi anemia, and Bloom syndrome). Unlike Tay-Sachs disease, there is no simple biochemical or enzymatic test to detect carriers for these other disorders. However, with the rapid identification of disease-causing genes in recent years, DNA-based assays are increasingly available for carrier detection. Approximately 5% of the world's population carries a mutation affecting the globin chains of the hemoglobin molecule. Among the most common of these disorders are the thalassemias. The global birth rate of affected infants is at least 2 per 1000 (in unscreened populations), with the greatest incidence in Southeast Asian, Indian, Mediterranean, and Middle Eastern ethnic groups. Carriers are detected by evaluation of red cell indices and morphology, followed by more sophisticated hematological testing and molecular analyses. The following issues need to be considered in the development of a carrier screening program: (1) test selection based on disease severity and test accuracy; (2) funding for testing and genetic counselling; (3) definition of the target population to be screened; (4) development of a public and professional education program; (5) informed consent for screening; and (6) awareness of community needs.

  19. Does adult ADHD interact with COMT val (158) met genotype to influence working memory performance?

    Science.gov (United States)

    Biehl, Stefanie C; Gschwendtner, Kathrin M; Guhn, Anne; Müller, Laura D; Reichert, Susanne; Heupel, Julia; Reif, Andreas; Deckert, Jürgen; Herrmann, Martin J; Jacob, Christian P

    2015-03-01

    Both attention-deficit/hyperactivity disorder (ADHD) and catechol-O-methyltransferase (COMT) genotype have been linked to altered dopaminergic transmission and possible impairment in frontal lobe functioning. This study offers an investigation of a possible interaction between ADHD diagnosis and COMT genotype on measures of working memory and executive function. Thirty-five adults with ADHD, who were recruited from the ADHD outpatient clinic at the Department of Psychiatry, Psychosomatics and Psychotherapy, University of Würzburg, and thirty-five matched healthy controls completed the Digit Span test and the Stroop Color Word Test. While there were no main effects of ADHD or COMT, the two factors interacted on both Digit Span subtests with the two groups' met/met carriers showing significantly different performance on the Digit Span Forward subtest and the val/val carriers showing significantly different performance on the Digit Span Backward subtest. Findings provide preliminary support for a differential impact of COMT genotype on working memory measures in adult patients with ADHD compared to healthy controls.

  20. Role of cytochrome P450 genotype in the steps toward personalized drug therapy

    Directory of Open Access Journals (Sweden)

    Cavallari LH

    2011-11-01

    Full Text Available Larisa H Cavallari1,2, Hyunyoung Jeong1,2, Adam Bress11Department of Pharmacy Practice, 2Department of Biopharmaceutical Sciences, College of Pharmacy, University of Illinois at Chicago, Chicago, IL, USAAbstract: Genetic polymorphism for cytochrome 450 (P450 enzymes leads to interindividual variability in the plasma concentrations of many drugs. In some cases, P450 genotype results in decreased enzyme activity and an increased risk for adverse drug effects. For example, individuals with the CYP2D6 loss-of-function genotype are at increased risk for ventricular arrhythmia if treated with usual does of thioridazine. In other cases, P450 genotype may influence the dose of a drug required to achieve a desired effect. This is the case with warfarin, with lower doses often necessary in carriers of a variant CYP2C9*2 or *3 allele to avoid supratherapeutic anticoagulation. When a prodrug, such as clopidogrel or codeine, must undergo hepatic biotransformation to its active form, a loss-of-function P450 genotype leads to reduced concentrations of the active drug and decreased drug efficacy. In contrast, patients with multiple CYP2D6 gene copies are at risk for opioid-related toxicity if treated with usual doses of codeine-containing analgesics. At least 25 drugs contain information in their US Food and Drug Administration-approved labeling regarding P450 genotype. The CYP2C9, CYP2C19, and CYP2D6 genes are the P450 genes most often cited. To date, integration of P450 genetic information into clinical decision making is limited. However, some institutions are beginning to embrace routine P450 genotyping to assist in the treatment of their patients. Genotyping for P450 variants may carry less risk for discrimination compared with genotyping for disease-associated variants. As such, P450 genotyping is likely to lead the way in the clinical implementation of pharmacogenomics. This review discusses variability in the CYP2C9, CYP2C19, and CYP2D6 genes and the

  1. Heterozygous carriers of a Parkin or PINK1 mutation share a common functional endophenotype

    DEFF Research Database (Denmark)

    van Nuenen, BF; Siebner, Hartwig; Weiss, MM

    2008-01-01

    inherited Parkinson disease alters the cortical control of sequential finger movements. METHODS: Nonmanifesting individuals carrying a single heterozygous Parkin (n = 13) or PINK1 (n = 9) mutation and 23 healthy controls without these mutations were studied with functional MRI (fMRI). During f...... rostral dorsal premotor cortex in mutation carriers but not in controls. Task-related activation of these premotor areas was similar in carriers of a Parkin or PINK1 mutation. CONCLUSION: Mutations in different genes linked to recessively inherited Parkinson disease are associated with an additional...... recruitment of rostral supplementary motor area and rostral dorsal premotor cortex during a simple motor sequence task. These premotor areas were recruited independently of the underlying genotype. The observed activation most likely reflects a "generic" compensatory mechanism to maintain motor function...

  2. CYP1A2 Genotype Variations Do Not Modify the Benefits and Drawbacks of Caffeine during Exercise: A Pilot Study.

    Science.gov (United States)

    Salinero, Juan J; Lara, Beatriz; Ruiz-Vicente, Diana; Areces, Francisco; Puente-Torres, Carlos; Gallo-Salazar, César; Pascual, Teodoro; Del Coso, Juan

    2017-03-11

    Previous investigations have determined that some individuals have minimal or even ergolytic performance effects after caffeine ingestion. The aim of this study was to analyze the influence of the genetic variations of the CYP1A2 gene on the performance enhancement effects of ingesting a moderate dose of caffeine. In a double-blind randomized experimental design, 21 healthy active participants (29.3 ± 7.7 years) ingested 3 mg of caffeine per kg of body mass or a placebo in testing sessions separated by one week. Performance in the 30 s Wingate test, visual attention, and side effects were evaluated. DNA was obtained from whole blood samples and the CYP1A2 polymorphism was analyzed (rs762551). We obtained two groups: AA homozygotes ( n = 5) and C-allele carriers ( n = 16). Caffeine ingestion increased peak power (682 ± 140 vs. 667 ± 137 W; p = 0.008) and mean power during the Wingate test (527 ± 111 vs. 518 ± 111 W; p 0.05). Reaction times were similar between caffeine and placebo conditions (276 ± 31 vs. 269 ± 71 milliseconds; p = 0.681) with no differences between AA homozygotes and C-allele carriers. However, 31.3% of the C-allele carriers reported increased nervousness after caffeine ingestion, while none of the AA homozygotes perceived this side effect. Genetic variations of the CYP1A2 polymorphism did not affect the ergogenic effects and drawbacks derived from the ingestion of a moderate dose of caffeine.

  3. High capacity carrier ethernet transport networks

    DEFF Research Database (Denmark)

    Rasmussen, Anders; Zhang, Jiang; Yu, Hao

    2009-01-01

    technology, making the use of Ethernet as a convergence layer for Next Generation Networks a distinct possibility. Triple Play services, in particular IPTV, are expected to be a main drivers for carrier Ethernet, however, a number of challenges must be addressed including QoS enabled control plane, enhanced...... OAM functions, survivability and the increased bandwidth requirements of carrier class systems. This article provides an overview of PBB-TE and T-MPLS and demonstrates how IPTV services can be realized in the framework of Carrier Ethernet. In addition we provide a case study on performing bit error...

  4. Spectroscopy of carrier multiplication in nanocrystals.

    Science.gov (United States)

    Bruhn, Benjamin; Limpens, Rens; Chung, Nguyen Xuan; Schall, Peter; Gregorkiewicz, Tom

    2016-02-08

    Carrier multiplication in nanostructures promises great improvements in a number of widely used technologies, among others photodetectors and solar cells. The decade since its discovery was ridden with fierce discussions about its true existence, magnitude, and mechanism. Here, we introduce a novel, purely spectroscopic approach for investigation of carrier multiplication in nanocrystals. Applying this method to silicon nanocrystals in an oxide matrix, we obtain an unambiguous spectral signature of the carrier multiplication process and reveal details of its size-dependent characteristics-energy threshold and efficiency. The proposed method is generally applicable and suitable for both solid state and colloidal samples, as well as for a great variety of different materials.

  5. Tunable carrier multiplication and cooling in graphene.

    Science.gov (United States)

    Johannsen, Jens Christian; Ulstrup, Søren; Crepaldi, Alberto; Cilento, Federico; Zacchigna, Michele; Miwa, Jill A; Cacho, Cephise; Chapman, Richard T; Springate, Emma; Fromm, Felix; Raidel, Christian; Seyller, Thomas; King, Phil D C; Parmigiani, Fulvio; Grioni, Marco; Hofmann, Philip

    2015-01-14

    Time- and angle-resolved photoemission measurements on two doped graphene samples displaying different doping levels reveal remarkable differences in the ultrafast dynamics of the hot carriers in the Dirac cone. In the more strongly (n-)doped graphene, we observe larger carrier multiplication factors (>3) and a significantly faster phonon-mediated cooling of the carriers back to equilibrium compared to in the less (p-)doped graphene. These results suggest that a careful tuning of the doping level allows for an effective manipulation of graphene's dynamical response to a photoexcitation.

  6. Interactions between Social/ behavioral factors and ADRB2 genotypes may be associated with health at advanced ages in China

    DEFF Research Database (Denmark)

    Zeng, Y.; Cheng, L. G.; Zhao, L.

    2013-01-01

    ages. This study intends to fill in this research gap. Method: We conducted an exploratory analysis, using longitudinal survey phenotype/genotype data from 877 oldest-old aged 90+. To estimate association of GxE interactions with health outcome, adjusted for the potential correlation between genotypes...... and positively associated with good cognitive function; interaction between regular exercise and carrying rs1042718 or rs1042719 minor allele is significantly and positively associated with self-reported good health; and interaction between social-leisure activities and carrying rs1042719 minor allele...... exercise and social-leisure activities with cognitive function and self-reported health, and negative association of negative emotion with cognitive function, were much stronger among carriers of rs1042718 or rs1042719 alleles, compared to the non-carriers. Conclusions: The results indicate significant...

  7. Fine-Scale Mapping at 9p22.2 Identifies Candidate Causal Variants That Modify Ovarian Cancer Risk in BRCA1 and BRCA2 Mutation Carriers

    DEFF Research Database (Denmark)

    Vigorito, E.; Kuchenbaecker, Karoline B; Beesley, J

    2016-01-01

    Population-based genome wide association studies have identified a locus at 9p22.2 associated with ovarian cancer risk, which also modifies ovarian cancer risk in BRCA1 and BRCA2 mutation carriers. We conducted fine-scale mapping at 9p22.2 to identify potential causal variants in BRCA1 and BRCA2...... mutation carriers. Genotype data were available for 15,252 (2,462 ovarian cancer cases) BRCA1 and 8,211 (631 ovarian cancer cases) BRCA2 mutation carriers. Following genotype imputation, ovarian cancer associations were assessed for 4,873 and 5,020 SNPs in BRCA1 and BRCA2 mutation carriers respectively...... of BNC2. In BRCA2 mutation carriers one region, up to 45 kb upstream of BNC2, and containing 100 correlated SNPs was identified as candidate causal (top SNP rs62543585, HR: 0.69, 95% CI: 0.59 to 0.80, p-value 1.0 x 10-6). The candidate causal in BRCA1 mutation carriers did not include the strongest...

  8. Genotyping of β-Lactoglobulin gene by PCR-RFLP in Sahiwal and Tharparkar cattle breeds

    Directory of Open Access Journals (Sweden)

    Gupta Neelam

    2006-05-01

    Full Text Available Abstract Background Improvement of efficiency and economic returns is an important goal in dairy farming, as in any agricultural enterprise. The primary goal of dairy industry has been to identify an efficient and economical way of increasing milk production and its constituents without increasing the size of the dairy herd. Selection of animals with desirable genotypes and mating them to produce the next generation has been the basis of livestock improvement and this would continue to remain the same in the coming years. The use of polymorphic genes as detectable molecular markers is a promising alternative to the current methods of trait selection once these genes are proven to be associated with traits of interest in animals. The point mutations in exon IV of bovine β-Lactoglobulin gene determine two allelic variants A and B. These variants were distinguished by Polymerase Chain Reaction and Restriction Fragment Length Polymorphism (PCR-RFLP analysis in two indigenous Bos indicus breeds viz. Sahiwal and Tharparkar cattle. DNA samples (228 in Sahiwal and 86 in Tharparkar were analyzed for allelic variants of β-Lactoglobulin gene. Polymorphism was detected by digestion of PCR amplified products with Hae III enzyme, and separation on 12% non-denaturing gels and resolved by silver staining. Results The allele B of β-Lactoglobulin occurred at a higher frequency than the allele A in both Sahiwal and Tharparkar breeds. The genotypic frequencies of AA, AB, and BB in Sahiwal and Tharparkar breeds were 0.031, 0.276, 0.693 and 0.023, 0.733, 0.244 respectively. Frequencies of A and B alleles were 0.17 and 0.83, and 0.39 and 0.61 in Sahiwal and Tharparkar breeds respectively. The Chi-square test results (at one degree of freedom at one per cent level revealed that the Tharparkar population was not in Hardy-Weinberg equilibrium as there was a continuous migration of animals in the herd studied, where as, the results are not significant for the Sahiwal

  9. Anti-D Antibodies in Pregnant D Variant Antigen Carriers Initially Typed as RhD+

    Science.gov (United States)

    Lukacevic Krstic, Jelena; Dajak, Slavica; Bingulac-Popovic, Jasna; Dogic, Vesna; Mratinovic-Mikulandra, Jela

    2016-01-01

    Background To evaluate the incidence, the consequences, and the prevention strategy of anti-D alloimmunizations of D variant carriers in the obstetric population of Split-Dalmatia County, Croatia. Methods RhD immunization events were evaluated retrospectively for the period between 1993 and 2012. Women were tested for RhD antigen and irregular antibodies. Those with anti-D antibody who were not serologically D- were genotyped for RHD. They were evaluated for their obstetric and transfusion history and their titer of anti-D. The neonates were evaluated for RhD status, direct antiglobulin test (DAT), hemoglobin and bilirubin levels, transfusion therapy as well as phototherapy and outcome. Results Out of 104,884 live births 102,982 women were tested for RhD antigen. Anti-D immunization occurred in 184 women which accounts for 0.9% of individuals at risk of anti-D formation. 181 cases occurred in women serologically typed as D-. Three women were partial D carriers (DVa n = 2, DNB n = 1), initially typed RhD+, and recognized as D variant carriers after the immunization occurred. Anti-D titer varied from 1:1 to 1:16. Six children were RhD+, four had positive DAT, and two underwent phototherapy. Conclusion Anti-D immunization occurred in pregnant partial D carriers (DVa, DNB). RhD+ children had serologic markers of hemolytic disease of the fetus and newborn (HDFN), with no cases of severe HDFN. PMID:27994529

  10. Anti-D Antibodies in Pregnant D Variant Antigen Carriers Initially Typed as RhD.

    Science.gov (United States)

    Lukacevic Krstic, Jelena; Dajak, Slavica; Bingulac-Popovic, Jasna; Dogic, Vesna; Mratinovic-Mikulandra, Jela

    2016-11-01

    To evaluate the incidence, the consequences, and the prevention strategy of anti-D alloimmunizations of D variant carriers in the obstetric population of Split-Dalmatia County, Croatia. RhD immunization events were evaluated retrospectively for the period between 1993 and 2012. Women were tested for RhD antigen and irregular antibodies. Those with anti-D antibody who were not serologically D- were genotyped for RHD. They were evaluated for their obstetric and transfusion history and their titer of anti-D. The neonates were evaluated for RhD status, direct antiglobulin test (DAT), hemoglobin and bilirubin levels, transfusion therapy as well as phototherapy and outcome. Out of 104,884 live births 102,982 women were tested for RhD antigen. Anti-D immunization occurred in 184 women which accounts for 0.9% of individuals at risk of anti-D formation. 181 cases occurred in women serologically typed as D-. Three women were partial D carriers (DVa n = 2, DNB n = 1), initially typed RhD+, and recognized as D variant carriers after the immunization occurred. Anti-D titer varied from 1:1 to 1:16. Six children were RhD+, four had positive DAT, and two underwent phototherapy. Anti-D immunization occurred in pregnant partial D carriers (DVa, DNB). RhD+ children had serologic markers of hemolytic disease of the fetus and newborn (HDFN), with no cases of severe HDFN.

  11. Fine-Scale Mapping at 9p22.2 Identifies Candidate Causal Variants That Modify Ovarian Cancer Risk in BRCA1 and BRCA2 Mutation Carriers

    Science.gov (United States)

    Vigorito, Elena; Kuchenbaecker, Karoline B.; Beesley, Jonathan; Adlard, Julian; Agnarsson, Bjarni A.; Andrulis, Irene L.; Arun, Banu K.; Barjhoux, Laure; Belotti, Muriel; Benitez, Javier; Berger, Andreas; Bojesen, Anders; Bonanni, Bernardo; Brewer, Carole; Caldes, Trinidad; Caligo, Maria A.; Campbell, Ian; Chan, Salina B.; Claes, Kathleen B. M.; Cohn, David E.; Cook, Jackie; Daly, Mary B.; Damiola, Francesca; Davidson, Rosemarie; de Pauw, Antoine; Delnatte, Capucine; Diez, Orland; Domchek, Susan M.; Dumont, Martine; Durda, Katarzyna; Dworniczak, Bernd; Easton, Douglas F.; Eccles, Diana; Edwinsdotter Ardnor, Christina; Eeles, Ros; Ejlertsen, Bent; Ellis, Steve; Evans, D. Gareth; Feliubadalo, Lidia; Fostira, Florentia; Foulkes, William D.; Friedman, Eitan; Frost, Debra; Gaddam, Pragna; Ganz, Patricia A.; Garber, Judy; Garcia-Barberan, Vanesa; Gauthier-Villars, Marion; Gehrig, Andrea; Gerdes, Anne-Marie; Giraud, Sophie; Godwin, Andrew K.; Goldgar, David E.; Hake, Christopher R.; Hansen, Thomas V. O.; Healey, Sue; Hodgson, Shirley; Hogervorst, Frans B. L.; Houdayer, Claude; Hulick, Peter J.; Imyanitov, Evgeny N.; Isaacs, Claudine; Izatt, Louise; Izquierdo, Angel; Jacobs, Lauren; Jakubowska, Anna; Janavicius, Ramunas; Jaworska-Bieniek, Katarzyna; Jensen, Uffe Birk; John, Esther M.; Vijai, Joseph; Karlan, Beth Y.; Kast, Karin; Investigators, KConFab; Khan, Sofia; Kwong, Ava; Laitman, Yael; Lester, Jenny; Lesueur, Fabienne; Liljegren, Annelie; Lubinski, Jan; Mai, Phuong L.; Manoukian, Siranoush; Mazoyer, Sylvie; Meindl, Alfons; Mensenkamp, Arjen R.; Montagna, Marco; Nathanson, Katherine L.; Neuhausen, Susan L.; Nevanlinna, Heli; Niederacher, Dieter; Olah, Edith; Olopade, Olufunmilayo I.; Ong, Kai-ren; Osorio, Ana; Park, Sue Kyung; Paulsson-Karlsson, Ylva; Pedersen, Inge Sokilde; Peissel, Bernard; Peterlongo, Paolo; Pfeiler, Georg; Phelan, Catherine M.; Piedmonte, Marion; Poppe, Bruce; Pujana, Miquel Angel; Radice, Paolo; Rennert, Gad; Rodriguez, Gustavo C.; Rookus, Matti A.; Ross, Eric A.; Schmutzler, Rita Katharina; Simard, Jacques; Singer, Christian F.; Slavin, Thomas P.; Soucy, Penny; Southey, Melissa; Steinemann, Doris; Stoppa-Lyonnet, Dominique; Sukiennicki, Grzegorz; Sutter, Christian; Szabo, Csilla I.; Tea, Muy-Kheng; Teixeira, Manuel R.; Teo, Soo-Hwang; Terry, Mary Beth; Thomassen, Mads; Tibiletti, Maria Grazia; Tihomirova, Laima; Tognazzo, Silvia; van Rensburg, Elizabeth J.; Varesco, Liliana; Varon-Mateeva, Raymonda; Vratimos, Athanassios; Weitzel, Jeffrey N.; McGuffog, Lesley; Kirk, Judy; Toland, Amanda Ewart; Hamann, Ute; Lindor, Noralane; Ramus, Susan J.; Greene, Mark H.; Couch, Fergus J.; Offit, Kenneth; Pharoah, Paul D. P.; Chenevix-Trench, Georgia; Antoniou, Antonis C.

    2016-01-01

    Population-based genome wide association studies have identified a locus at 9p22.2 associated with ovarian cancer risk, which also modifies ovarian cancer risk in BRCA1 and BRCA2 mutation carriers. We conducted fine-scale mapping at 9p22.2 to identify potential causal variants in BRCA1 and BRCA2 mutation carriers. Genotype data were available for 15,252 (2,462 ovarian cancer cases) BRCA1 and 8,211 (631 ovarian cancer cases) BRCA2 mutation carriers. Following genotype imputation, ovarian cancer associations were assessed for 4,873 and 5,020 SNPs in BRCA1 and BRCA 2 mutation carriers respectively, within a retrospective cohort analytical framework. In BRCA1 mutation carriers one set of eight correlated candidate causal variants for ovarian cancer risk modification was identified (top SNP rs10124837, HR: 0.73, 95%CI: 0.68 to 0.79, p-value 2× 10−16). These variants were located up to 20 kb upstream of BNC2. In BRCA2 mutation carriers one region, up to 45 kb upstream of BNC2, and containing 100 correlated SNPs was identified as candidate causal (top SNP rs62543585, HR: 0.69, 95%CI: 0.59 to 0.80, p-value 1.0 × 10−6). The candidate causal in BRCA1 mutation carriers did not include the strongest associated variant at this locus in the general population. In sum, we identified a set of candidate causal variants in a region that encompasses the BNC2 transcription start site. The ovarian cancer association at 9p22.2 may be mediated by different variants in BRCA1 mutation carriers and in the general population. Thus, potentially different mechanisms may underlie ovarian cancer risk for mutation carriers and the general population. PMID:27463617

  12. Fine-Scale Mapping at 9p22.2 Identifies Candidate Causal Variants That Modify Ovarian Cancer Risk in BRCA1 and BRCA2 Mutation Carriers.

    Directory of Open Access Journals (Sweden)

    Elena Vigorito

    Full Text Available Population-based genome wide association studies have identified a locus at 9p22.2 associated with ovarian cancer risk, which also modifies ovarian cancer risk in BRCA1 and BRCA2 mutation carriers. We conducted fine-scale mapping at 9p22.2 to identify potential causal variants in BRCA1 and BRCA2 mutation carriers. Genotype data were available for 15,252 (2,462 ovarian cancer cases BRCA1 and 8,211 (631 ovarian cancer cases BRCA2 mutation carriers. Following genotype imputation, ovarian cancer associations were assessed for 4,873 and 5,020 SNPs in BRCA1 and BRCA 2 mutation carriers respectively, within a retrospective cohort analytical framework. In BRCA1 mutation carriers one set of eight correlated candidate causal variants for ovarian cancer risk modification was identified (top SNP rs10124837, HR: 0.73, 95%CI: 0.68 to 0.79, p-value 2× 10-16. These variants were located up to 20 kb upstream of BNC2. In BRCA2 mutation carriers one region, up to 45 kb upstream of BNC2, and containing 100 correlated SNPs was identified as candidate causal (top SNP rs62543585, HR: 0.69, 95%CI: 0.59 to 0.80, p-value 1.0 × 10-6. The candidate causal in BRCA1 mutation carriers did not include the strongest associated variant at this locus in the general population. In sum, we identified a set of candidate causal variants in a region that encompasses the BNC2 transcription start site. The ovarian cancer association at 9p22.2 may be mediated by different variants in BRCA1 mutation carriers and in the general population. Thus, potentially different mechanisms may underlie ovarian cancer risk for mutation carriers and the general population.

  13. Fine-Scale Mapping at 9p22.2 Identifies Candidate Causal Variants That Modify Ovarian Cancer Risk in BRCA1 and BRCA2 Mutation Carriers.

    Science.gov (United States)

    Vigorito, Elena; Kuchenbaecker, Karoline B; Beesley, Jonathan; Adlard, Julian; Agnarsson, Bjarni A; Andrulis, Irene L; Arun, Banu K; Barjhoux, Laure; Belotti, Muriel; Benitez, Javier; Berger, Andreas; Bojesen, Anders; Bonanni, Bernardo; Brewer, Carole; Caldes, Trinidad; Caligo, Maria A; Campbell, Ian; Chan, Salina B; Claes, Kathleen B M; Cohn, David E; Cook, Jackie; Daly, Mary B; Damiola, Francesca; Davidson, Rosemarie; Pauw, Antoine de; Delnatte, Capucine; Diez, Orland; Domchek, Susan M; Dumont, Martine; Durda, Katarzyna; Dworniczak, Bernd; Easton, Douglas F; Eccles, Diana; Edwinsdotter Ardnor, Christina; Eeles, Ros; Ejlertsen, Bent; Ellis, Steve; Evans, D Gareth; Feliubadalo, Lidia; Fostira, Florentia; Foulkes, William D; Friedman, Eitan; Frost, Debra; Gaddam, Pragna; Ganz, Patricia A; Garber, Judy; Garcia-Barberan, Vanesa; Gauthier-Villars, Marion; Gehrig, Andrea; Gerdes, Anne-Marie; Giraud, Sophie; Godwin, Andrew K; Goldgar, David E; Hake, Christopher R; Hansen, Thomas V O; Healey, Sue; Hodgson, Shirley; Hogervorst, Frans B L; Houdayer, Claude; Hulick, Peter J; Imyanitov, Evgeny N; Isaacs, Claudine; Izatt, Louise; Izquierdo, Angel; Jacobs, Lauren; Jakubowska, Anna; Janavicius, Ramunas; Jaworska-Bieniek, Katarzyna; Jensen, Uffe Birk; John, Esther M; Vijai, Joseph; Karlan, Beth Y; Kast, Karin; Investigators, KConFab; Khan, Sofia; Kwong, Ava; Laitman, Yael; Lester, Jenny; Lesueur, Fabienne; Liljegren, Annelie; Lubinski, Jan; Mai, Phuong L; Manoukian, Siranoush; Mazoyer, Sylvie; Meindl, Alfons; Mensenkamp, Arjen R; Montagna, Marco; Nathanson, Katherine L; Neuhausen, Susan L; Nevanlinna, Heli; Niederacher, Dieter; Olah, Edith; Olopade, Olufunmilayo I; Ong, Kai-Ren; Osorio, Ana; Park, Sue Kyung; Paulsson-Karlsson, Ylva; Pedersen, Inge Sokilde; Peissel, Bernard; Peterlongo, Paolo; Pfeiler, Georg; Phelan, Catherine M; Piedmonte, Marion; Poppe, Bruce; Pujana, Miquel Angel; Radice, Paolo; Rennert, Gad; Rodriguez, Gustavo C; Rookus, Matti A; Ross, Eric A; Schmutzler, Rita Katharina; Simard, Jacques; Singer, Christian F; Slavin, Thomas P; Soucy, Penny; Southey, Melissa; Steinemann, Doris; Stoppa-Lyonnet, Dominique; Sukiennicki, Grzegorz; Sutter, Christian; Szabo, Csilla I; Tea, Muy-Kheng; Teixeira, Manuel R; Teo, Soo-Hwang; Terry, Mary Beth; Thomassen, Mads; Tibiletti, Maria Grazia; Tihomirova, Laima; Tognazzo, Silvia; van Rensburg, Elizabeth J; Varesco, Liliana; Varon-Mateeva, Raymonda; Vratimos, Athanassios; Weitzel, Jeffrey N; McGuffog, Lesley; Kirk, Judy; Toland, Amanda Ewart; Hamann, Ute; Lindor, Noralane; Ramus, Susan J; Greene, Mark H; Couch, Fergus J; Offit, Kenneth; Pharoah, Paul D P; Chenevix-Trench, Georgia; Antoniou, Antonis C

    2016-01-01

    Population-based genome wide association studies have identified a locus at 9p22.2 associated with ovarian cancer risk, which also modifies ovarian cancer risk in BRCA1 and BRCA2 mutation carriers. We conducted fine-scale mapping at 9p22.2 to identify potential causal variants in BRCA1 and BRCA2 mutation carriers. Genotype data were available for 15,252 (2,462 ovarian cancer cases) BRCA1 and 8,211 (631 ovarian cancer cases) BRCA2 mutation carriers. Following genotype imputation, ovarian cancer associations were assessed for 4,873 and 5,020 SNPs in BRCA1 and BRCA 2 mutation carriers respectively, within a retrospective cohort analytical framework. In BRCA1 mutation carriers one set of eight correlated candidate causal variants for ovarian cancer risk modification was identified (top SNP rs10124837, HR: 0.73, 95%CI: 0.68 to 0.79, p-value 2× 10-16). These variants were located up to 20 kb upstream of BNC2. In BRCA2 mutation carriers one region, up to 45 kb upstream of BNC2, and containing 100 correlated SNPs was identified as candidate causal (top SNP rs62543585, HR: 0.69, 95%CI: 0.59 to 0.80, p-value 1.0 × 10-6). The candidate causal in BRCA1 mutation carriers did not include the strongest associated variant at this locus in the general population. In sum, we identified a set of candidate causal variants in a region that encompasses the BNC2 transcription start site. The ovarian cancer association at 9p22.2 may be mediated by different variants in BRCA1 mutation carriers and in the general population. Thus, potentially different mechanisms may underlie ovarian cancer risk for mutation carriers and the general population.

  14. Natural Aging Behaviour Of AA6111 Aluminium | Quainoo | Ghana ...

    African Journals Online (AJOL)

    Natural aging is observed to affect the kinetic reaction of AA6111. Dans la campagne continue pour la réduction en poids dans le nouveau modèle d\\' automobile, les séries 6000 d\\' aluminium en alliage ont émergé comme le matériau de feuille de carrosserie la plus prometteuse endurcirable avec l\\'âge dans l\\'industrie de ...

  15. Evolutionary status of AA Doradus: still an enigma?

    International Nuclear Information System (INIS)

    Sarna, M.J.

    1985-01-01

    The evolutionary scenarios for AA Dor are reconsidered using new contraction times for degenerate red dwarfs. It is found that both types of models considered by Paczynski (1980) with the primary being either an hydrogen shell burning helium white dwarf or a double shell burning carbon-oxygen white dwarf are consistent with the available data. The second model requires a very narrow range of the initial parameters of the binary system. 26 refs. (author)

  16. Mexican obsidian samples analysed by PIXE and AAS

    Energy Technology Data Exchange (ETDEWEB)

    Tenorio, D.; Jimenez-Reyes, M. [Inst. Nacional de Investigaciones Nucleares, Mexico (Mexico); Lagarde, G.

    1997-12-31

    Proton induced X-ray emission analysis results are reported for obsidian artifacts from different sites of the State of Mexico: Teotenango, Calixtlahuaca, La Marqueza, Malinalco and Tonatico. Twenty elements were analysed by PIXE and some of them were verified by AAS. The results show that the samples came from three different sources: Teotenango and Calixtlahuaca samples from the first, La Marqueza and Malinalco samples from the second and Tonatico samples from the third. (author)

  17. Wooden models of an AA quadrupole between bending magnets

    CERN Multimedia

    CERN PhotoLab

    1978-01-01

    At two points in the AA lattice, a quadrupole (QDN, defocusing, narrow) was tightly wedged between two bending magnets (BST, short, wide). This picture of wooden models lets one imagine the strong interaction between their magnetic fields. There was no way one could calculate with the necessary accuracy the magnetic effects and their consequences for the machine optics. The necessary corrections were made after measurements with a circulating beam, in a tedious iterative procedure, with corrrection coils and shims.

  18. Core-corona PSt/P(BA-AA) composite particles by two-stage emulsion polymerization

    Science.gov (United States)

    Xie, Delong; Ren, Xiaolin; Zhang, Xinya; Liao, Shijun

    2016-03-01

    Raspberry-shaped composite particles with polystyrene (PSt) as core and poly(n-butyl acrylate-co-acrylic acid) (P(BA-AA)) as corona were synthesized via emulsion polymerization. The random copolymer, P(BA-AA), was pre-prepared and used as a polymeric surfactant, its emulsifying properties adjusted by changing the mass ratio of BA and AA. The morphology of the resulting core-corona composite particles, P(St/P(BA-AA)), could be regulated and controlled by varying the concentrations of P(BA-AA) or the mass ratio of BA:AA in P(BA-AA). The experimental results indicate that 3.0-6.0 wt% of P(BA-AA) is required to obtain stable composite emulsions, and P(BA-AA) with a mass ratio of BA:AA = 1:2 is able to generate distinct core-corona structures. A mechanism of composite particle formation is proposed based on the high affinity between the PSt core and the hydrophobic segments of P(BA-A). The regular morphology of the colloidal film is expected to facilitate potential application of core-corona particles in the field of light scattering. Furthermore, the diversity of core-corona particles can be expanded by replacing P(BA-AA) corona particles with other amphiphilic particles.

  19. New perspectives on contributing factors to the monthly behavior of the aa geomagnetic index

    Science.gov (United States)

    Mendoza, Blanca; Pazos, Marni; González, Luis Xavier

    2016-12-01

    We studied the Aa geomagnetic index ( aa index daily average) behavior on a monthly timescale using data from 1868 to 2015 for cycles 11-24. We identified solar- and lunar-associated periodicities in the Aa time series and found statistically significant Aa minima values a few days before the full Moon and high Aa values during the new Moon. When considering all the cycles, it was clear that the deepest Aa minima occurred during the Aa descending activity phase. However, when the cycles were separated according to the direction of the interplanetary magnetic field (IMF), the Aa minima came from the contribution of cycles with the IMF pointing toward the Sun (Type 1). Furthermore, during the descending phase of cycles with the IMF pointing away from the Sun (Type 2), the smallest Aa index values were found along with smaller changes compared to Type 1 cases. This behavior implies that during Type 1 cycles there are larger Aa perturbations than during Type 2 cycles. It is very likely that the mechanisms responsible for the Aa monthly behavior are a combination of solar and lunar effects that depend on several factors: (a) the Moon phases (new and full Moon), (b) the phase of the solar cycle (ascending or descending), and (c) the direction of the interplanetary magnetic field (away or toward the Sun).

  20. Resistência à ferrugem da folha e potencial produtivo em genótipos de trigo Leaf rust resistance and grain yield potential in wheat genotypes

    Directory of Open Access Journals (Sweden)

    João Carlos Felicio

    2008-12-01

    Full Text Available Foram avaliados 18 genótipos de trigo provenientes de cruzamentos entre a linhagem BH1146//AA"S"/WIN"S", oriunda de cruzamentos interespecíficos entre Triticum aestivum L. e Triticum durum L., e as cultivares IAC 289 e IAC 1004, em experimentos instalados em condições de sequeiro em Manduri (Zona A; Capão Bonito e Itapeva (Zona B e Paranapanema (Zona C, no período de 2003 a 2005. As avaliações dos genótipos ao agente causal da ferrugem da folha foram feitas no estádio de plântulas em casa de vegetação, onde os genótipos foram submetidos à inoculação, individualmente, com esporos de 12 raças de Puccinia triticina, as quais representavam o espectro de virulência do patógeno ocorrente no Brasil e sob infecção natural no campo. Foram avaliados os rendimentos de grãos de cada genótipo nas diferentes regiões e no conjunto dos experimentos, bem como a estabilidade e adaptabilidade. Os genótipos 8 (BH1146//AA"S"/WIN"S"/3/BUC/FKL//MYNA/VUL, 12 e 14 (BH1146//AA"S"/WIN"S"/3/VEE//DOVE/BUC destacaram-se por sua resistência às raças fisiológicas de Puccinia triticina em casa de vegetação na fase de plântulas. Em condições de infecção natural da doença, destacaram-se os genótipos 4, 5, 8, 12, 13, 16 e 20 e a cultivar IAC 1004 (T. durum com resistência à ferrugem da folha no triênio. Os melhores rendimentos de grãos foram obtidos pelos genótipos 8 (BH1146//AA"S"/WIN"S"/3/BUC/FKL//MYNA/VUL, 7 (BH1146//AA"S"/WIN"S"/3/HANN*2/PRL e 18 (CMH 75.A.66/ SERI/3/BH1146//AA"S"/WIN"S". O menor foi obtido pelo genótipo 16 (KAUZ/3/ BH1146//AA"S"/WIN"S".Eighteen wheat genotypes obtained from crosses between the parental line BH1146//AA"S"/WIN"S" originated from interespecific crosses between Triticum aestivum L. and Triticum durum L. and the cultivars IAC 289 and IAC 1004 were evaluated in experiments carried out in upland conditions at Manduri (Zone A; Capão Bonito and Itapeva (Zone B and Paranapanema (Zone C, in the State of S

  1. Corrosion of AA2024-T3 Part III: Propagation

    International Nuclear Information System (INIS)

    Glenn, A.M.; Muster, T.H.; Luo, C.; Zhou, X.; Thompson, G.E.; Boag, A.; Hughes, A.E.

    2011-01-01

    Research highlights: → Corrosion of AA2024 in 0.1 M NaCl was examined for immersion times up to 120 min. → Rings of corrosion product with H 2 evolution developed after 5 min immersion. → Intergranular attack penetrated up to 60 μm below the rings within 120 min. → After 240 min mixed intergranular attack and grain etchout were observed. - Abstract: Optical and electron microscopies and EBSD were used to study the early stages of corrosion propagation during stable pit formation on AA2024-T3. Polished AA2024-T3 developed large scale rings of corrosion product, typically a few hundred microns in diameter, within 2 h of exposure to 0.1 M NaCl at room temperature. These features were sectioned using diamond ultramicrotomy and substantial subsurface attack, in the form of intergranular corrosion was observed beneath these sites with virtually no grain etchout. A model is proposed for the mechanism of stable pit progression which involves extensive grain boundary attack, followed by grain etchout leading to open pit formation.

  2. Renal Involvement in AA Amyloidosis: Clinical Outcomes and Survival

    Directory of Open Access Journals (Sweden)

    Murvet Yilmaz

    2013-03-01

    Full Text Available Background: The natural history of AA amyloidosis is typically progressive, leading to multiple organ failure and death. We analyzed the etiology as well as clinical and laboratory features of patients with biopsy-proven AA amyloidosis and evaluated the ultimate outcome. Methods: Seventy-three patients (24 female; mean age 41.85±15.89 years were analyzed retrospectively. Demographic, clinical and laboratory features were studied and the outcome was assessed. Results: Familial Mediterranean Fever and tuberculosis were the most frequent causes of amyloidosis. Mean serum creatinine and proteinuria at diagnosis were 4.65±4.89 mg/dl and 8.04±6.09 g/day, respectively; and stage I, II, III, IV and V renal disease were present in 19.2%, 13.7%, 16.4%, 11%, and 39.7% of the patients, respectively. ESRD developed in 16 patients during the follow-up period. All of the ESRD patients started a dialysis programme. Thirty patients (41% died during the follow-up period; median patient survival was 35.9±6.12 months. Old age, tuberculosis etiology, advanced renal disease and low serum albumin levels were associated with a worse prognosis. Serum albumin was a predictor of mortality in logistic regression analysis. Conclusion: The ultimate outcome of the patients with AA amyloidosis is poor, possibly due to the late referral to the nephrology clinics. Early referral may be helpful to improve prognosis.

  3. Characterizing the Constitutive Properties of AA7075 for Hot Forming

    Science.gov (United States)

    Omer, K.; Kim, S.; Butcher, C.; Worswick, M.

    2017-09-01

    The work presented herein investigates the constitutive properties of AA7075 as it undergoes a hot stamping/die quenching process. Tensile specimens were solutionized inside a heated furnace set to 470°C. Once solutionized, the samples were quenched to an intermediate temperature using a vortex air chiller at a minimum rate of 52°C/s. Tensile tests were conducted at steady state temperatures of 470, 400, 300, 200, 115 and 25°C. This solutionizing and subsequent quenching process replicated the temperature cycle and quench rates representative of a die quenching operation. The results of the tensile test were analyzed with digital imaging correlation using an area reduction approach. The area reduction approach approximated the cross-sectional area of the tensile specimen as it necked. The approach allowed for the true stress-strain response to be calculated well past the initial necking point. The resulting true stress-strain curves showed that the AA7075 samples experienced almost no hardening at 470°C. As steady state temperature decreased, the rate of hardening as well as overall material strength increased. The true stress strain curves were fit to a modified version of the extended Voce constitutive model. The resulting fits can be used in a finite element model to predict the behaviour of an AA7075 blank during a die quenching operation.

  4. Long-term biases in geomagnetic K and aa indices

    Science.gov (United States)

    Love, J.J.

    2011-01-01

    Analysis is made of the geomagnetic-activity aa index and its source K-index data from groups of ground-based observatories in Britain, and Australia, 1868.0-2009.0, solar cycles 11-23. The K data show persistent biases, especially for high (low) K-activity levels at British (Australian) observatories. From examination of multiple subsets of the K data we infer that the biases are not predominantly the result of changes in observatory location, localized induced magnetotelluric currents, changes in magnetometer technology, or the modernization of K-value estimation methods. Instead, the biases appear to be artifacts of the latitude-dependent scaling used to assign K values to particular local levels of geomagnetic activity. The biases are not effectively removed by weighting factors used to estimate aa. We show that long-term averages of the aa index, such as annual averages, are dominated by medium-level geomagnetic activity levels having K values of 3 and 4. ?? 2011 Author(s).

  5. Effects of Friction Stir Welding Speed on AA2195 alloy

    Directory of Open Access Journals (Sweden)

    Lee Ho-Sung

    2016-01-01

    Full Text Available The application of friction stir welding (FSW to aerospace has grown rapidly due to the high efficiency and environmental friendly nature of the process. FSW is achieved by plastic flow of frictionally heated material in solid state and offers many advantages of avoiding hot cracking and limiting component distortion. Recently low density, high modulus and high strength AA2195 are used as substitute for conventional aluminum alloys since the weight saving is critical in aerospace applications. One of the problems for this alloy is weld metal porosity formation leading to hot cracking. Combination of FSW and AA2195 provides synergy effect to improve mechanical properties and weight saving of aerospace structure such as cryogenic fuel tanks for launch systems. The objective of this paper is to investigate the effect of friction stir welding speed on mechanical and microstructural properties of AA2195. The friction stir welded materials were joined with four different tool rotation speeds (350~800 rpm and five welding speeds (120~360 mm/min, which are the two prime welding parameters in this process.

  6. Cell volume regulation in hemoglobin CC and AA erythrocytes

    International Nuclear Information System (INIS)

    Berkowitz, L.R.; Orringer, E.P.

    1987-01-01

    Swelling hemoglobin CC erythrocytes stimulates a ouabain-insensitive K flux that restores original cell volume. Studies were performed with the K analog, 86 Rb. This volume regulatory pathway was characterized for its anion dependence, sensitivity to loop diuretics, and requirement for Na. The swelling-induced K flux was eliminated if intracellular chloride was replaced by nitrate and both swelling-activated K influx and efflux were partially inhibited by 1 mM furosemide or bumetanide. K influx in swollen hemoglobin CC cells was not diminished when Na in the incubation medium was replaced with choline, indicating Na independence of the swelling-induced flux. Identical experiments with hemoglobin AA cells also demonstrated a swelling-induced increase in K flux, but the magnitude and duration of this increase were considerably less than that seen with hemoglobin CC cells. The increased K flux in hemoglobin AA cells was likewise sensitive to anion replacement and to loop diuretics and did not require the presence of Na. These data indicate that a volume-activated K pathway with similar transport characteristics exists in both hemoglobin CC and AA red cells

  7. Phenotype and genotype differentiation between flathead grey ...

    African Journals Online (AJOL)

    This study aimed to study the phenotype and genotype differentiation and to compare the amount of differences in phenotype based on morphometric character indices and meristic counts with the amount of differences in genotype based on random amplified polymorphic DNA (RAPD) fingerprinting between two Mugilidae, ...

  8. Genetic relationship among Musa genotypes revealed by ...

    African Journals Online (AJOL)

    Genetic relationship among Musa genotypes revealed by microsatellite markers. NAP Abdullah, GB Saleh, ETS Putra, ZB Wahab. Abstract. A banana germplasm was established containing 44 Musa genotypes collected from various locations in Malaysia. To detect their genetic variation and to rule out duplicates among ...

  9. Genotypic identification and technological characterization of lactic ...

    African Journals Online (AJOL)

    enoh

    2012-04-05

    Apr 5, 2012 ... genotypic characterization, the dominant LAB were identified as Lactobacillus paracasei (43.3%), ... Lactobacillus brevis (5.2%), Enterococcus faecium (5.2%), Lactobacillus fermentum (4.1%) and ... Key words: Lactic acid bacteria, genotypic characterization, technological characterization, tulum cheese.

  10. Fruit characteristics of the selected fig genotypes

    African Journals Online (AJOL)

    GREGORY

    2010-09-13

    Sep 13, 2010 ... The aim of this research was determine of fruit characteristics and select of some significant fig genotypes grown in Kiziltepe district of Mardin province. No studies have been made on the fig genotypes in Kiziltepe district by researchers up to now. Therefore, this study was very important. In this research, six ...

  11. Genotyping isolates of the entomopathogenic fungus Beauveria ...

    African Journals Online (AJOL)

    Multi-locus denaturing gradient gel electrophoresis (DGGE) analysis was developed to investigate the genotypes of Beauveria bassiana sensu lato. ... These results demonstrated that multi-locus DGGE is a potentially useful molecular marker for genotyping, identifying and tracking the fates of experimentally released ...

  12. Simultaneous genotyping of HPA-17w to -21w by PCR-SSP in Chinese Cantonese.

    Science.gov (United States)

    Zhou, Haojie; Ding, Haoqiang; Chen, Yangkai; Li, Xiaofan; Ye, Xin; Nie, Yongmei

    2015-01-01

    Studies have reported the polymorphism of human platelet antigen (HPA)-17w, -18w, -19w, -20w, and -21w. However, the distribution of these five antigens in Chinese Cantonese is still unknown. In this study, we designed new sequence-specific primers for HPA-19w to -21w and used published primers for HPA-17w and -18w to develop a polymerase chain reaction with the sequence-specific primers (PCR-SSP) method for simultaneously genotyping HPA-17w to -21w. A total of 820 unrelated Cantonese apheresis platelet donors in Guangzhou were involved in this study. Among the five HPAs, complete a/a homozygosity was observed for HPA-17w to -20w with an allele frequency of 1.0000. For HPA-21w, nine individuals (9/820, 1.10%) were found to be HPA-21a/bw heterozygous and the allele frequencies of HPA-21a and HPA-21bw were 0.9945 (1631/1640) and 0.0055 (9/1640), respectively. The reliability of the PCR-SSP method was determined by comparing with the genotyping results by DNA sequencing, and no inconsistencies were observed between the two methods. This study provides a reliable PCR-SSP method for simultaneously genotyping HPA-17w to -21w and could improve HPA-matched platelet transfusion in Chinese Cantonese.

  13. Dependence of deodorant usage on ABCC11 genotype: scope for personalized genetics in personal hygiene.

    Science.gov (United States)

    Rodriguez, Santiago; Steer, Colin D; Farrow, Alexandra; Golding, Jean; Day, Ian N M

    2013-07-01

    Earwax type and axillary odor are genetically determined by rs17822931, a single-nucleotide polymorphism (SNP) located in the ABCC11 gene. The literature has been concerned with the Mendelian trait of earwax, although axillary odor is also Mendelian. Ethnic diversity in rs17822931 exists, with higher frequency of allele A in east Asians. Influence on deodorant usage has not been investigated. In this work, we present a detailed analysis of the rs17822931 effect on deodorant usage in a large (N∼17,000 individuals) population cohort (the Avon Longitudinal Study of Parents and Children (ALSPAC)). We found strong evidence (P=3.7 × 10(-20)) indicating differential deodorant usage according to the rs17822931 genotype. AA homozygotes were almost 5-fold overrepresented in categories of never using deodorant or using it infrequently. However, 77.8% of white European genotypically nonodorous individuals still used deodorant, and 4.7% genotypically odorous individuals did not. We provide evidence of a behavioral effect associated with rs17822931. This effect has a biological basis that can result in a change in the family's environment if an aerosol deodorant is used. It also indicates potential cost saving to the nonodorous and scope for personalized genetics usage in personal hygiene choices, with consequent reduction of inappropriate chemical exposures for some.

  14. Air Carrier Financial Statistics : second quarter.

    Science.gov (United States)

    2013-01-01

    This report presents airline financial statistics obtained from carrier reports to DOT on BTS Form 41 financial schedules. Effective with a rule (ER-1297) adopted July 1982, the filing frequency for income statement and balance sheet data was changed...

  15. Air Carrier Financial Statistics : first quarter.

    Science.gov (United States)

    2010-01-01

    This report presents airline financial statistics obtained from carrier reports to DOT on BTS Form 41 financial schedules. Effective with a rule (ER-1297) adopted July 1982, the filing frequency for income statement and balance sheet data was changed...

  16. Air Carrier Financial Statistics : third quarter.

    Science.gov (United States)

    2010-01-01

    This report presents airline financial statistics obtained from carrier reports to DOT on BTS Form 41 financial schedules. Effective with a rule (ER-1297) adopted July 1982, the filing frequency for income statement and balance sheet data was changed...

  17. Air Carrier Financial Statistics : fourth quarter.

    Science.gov (United States)

    2012-01-01

    This report presents airline financial statistics obtained from carrier reports to DOT on BTS Form 41 financial schedules. Effective with a rule (ER-1297) adopted July 1982, the filing frequency for income statement and balance sheet data was changed...

  18. Maryland motor carrier program performance enhancement.

    Science.gov (United States)

    2014-02-01

    Using the inspection summary data (24-1 reports) from SHA for years 2006 to 2010 and inspection and violation : files of Motor Carrier Management Information System (MCMIS) for the same years, the Maryland State Police : (MSP) and Maryland Transporta...

  19. Auto Carrier Transporter Loading and Unloading Improvement

    National Research Council Canada - National Science Library

    Miller, Brian

    2003-01-01

    .... Any reduction in time and energy will result in a significant savings of money. The intent of this research is to develop an algorithm to solve the Auto Carrier Transport Pickup and Delivery Problem...

  20. Multiple sclerosis in an adrenoleukodystrophy carrier

    Directory of Open Access Journals (Sweden)

    Thomas Jenkins

    2011-11-01

    Full Text Available X-linked adrenoleukodystrophy (X-ALD is a rare inherited metabolic disorder, in which accumulation of very long chain fatty acids (VLCFAs results in damage to the central nervous system. As the disease is X-linked, males are affected severely, but female carriers may also present with neurological symptoms. We report the case of a young adult female, who presented with episodic sensorimotor symptoms. Although she was a heterozygous female carrier of X-ALD, subsequent investigations confirmed a diagnosis of multiple sclerosis (MS. To the best of our knowledge, this is the first reported case of a female X-ALD carrier in which the clinical features were more consistent with co-existent MS than ALD-related pathology. The case serves as a reminder that alternative, more common diagnoses should also be considered in carriers of rare neurological syndromes.

  1. What It Means to be a Carrier

    Science.gov (United States)

    ... begins the process with medical tests for any infectious diseases, RH type, thyroid and general health screening, etc. The egg donors go through their own screening, which includes hormone levels, genetic screening usually including FMR1 screening, and other carrier ...

  2. The Kinetics of Carrier Transport Inhibition

    DEFF Research Database (Denmark)

    Rosenberg, T.; Wilbrandt, Robert Walter

    1962-01-01

    The kinetical treatment of enzymatic carrier transports as given in previous communications has been extended to conditions of inhibition. Various possible types of inhibitors have been considered differing in the site of attack (enzyme or carrier), in the mode of action (competing...... and polyphloretinephosphate. The results of the analysis for these inhibitors indicate a substrate competitive mode of action. The effect of reversing the transport direction by interchanging the substrate concentration has been treated for the case of a non-penetrating substrate competitive inhibitor in the external medium...... with the substrate for the enzyme or the carrier or for both, competing with the carrier for the enzyme, or non-competitive) and in the ability of penetrating the membrane. Experiments are reported on the inhibition of glucose and fructose transport across the human red cell membrane by phlorizine, phloretine...

  3. Effect of gaussian beam on microstructural and mechanical properties of dissimilarlaser welding ofAA5083 and AA6061 alloys

    Science.gov (United States)

    Srinivas, B.; Cheepu, Muralimohan; Sivaprasad, K.; Muthupandi, V.

    2018-03-01

    The present study focuses on a sheet thickness of 4 mm using different laser power and welding rate by the laser beam welding (LBW) at a beam size180 μm. The observations on the weldments are showing that thermal conductivity of the materials plays a major role on microstructural changes. The as-welded mechanical properties were studied by correlation with its microstructures. Due to the steeper temperature gradient during the laser beam welding AA6061 was showing the greater variation compares with AA5083 side in the micro hardness studies.Also, the tensile strength of 241 MPa has been reported as highest with the welds made of laser powerat 3.5 kW and welding rate at 3.5 mmin-1.

  4. Prediction of shear and tensile strength of the diffusion bonded AA5083 and AA7075 aluminium alloy using ANN

    International Nuclear Information System (INIS)

    Sagai Francis Britto, A.; Raj, R. Edwin; Mabel, M. Carolin

    2017-01-01

    Diffusion bonding is a pressure welding technique to establish bonds by inter diffusion of atoms. Bonding characteristics were generated by varying the significant process conditions such as the bonding temperature, the pressing load and the duration of pressure while bonding the aluminium alloys AA5083 and AA7075. Deriving analytical correlation with the process variables to weld strength is quite involved due to the non-linear dependency of the process variables with the mechanical strength of the joints. An arbitrary function approximation mechanism, the artificial neural network (ANN) is therefore employed to develop the models for predicting the mechanical properties of the bonded joints. Back propagation technique, which alters the network weights to minimize the mean square error was used to develop the ANN models. The models were tested, validated and found to be satisfactory with good prediction accuracy.

  5. China’s Aircraft Carrier Dilemma

    Science.gov (United States)

    2006-01-01

    per response, including the time for reviewing instructions, searching existing data sources, gathering and maintaining the data needed, and completing...When it comes to obtaining a working carrier, China has several options, but each largely limits what the carrier could be used for. Buying a big -deck...nothing developed from them. Empresa Nacional Bazán, which merged with Astilleros Españoles S.A. (AESA) to form Navantia in 2000, reportedly attempted

  6. 29 CFR 1202.13 - Air carriers.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 4 2010-07-01 2010-07-01 false Air carriers. 1202.13 Section 1202.13 Labor Regulations Relating to Labor (Continued) NATIONAL MEDIATION BOARD RULES OF PROCEDURE § 1202.13 Air carriers. By the terms of title II of the Railway Labor Act, which was approved April 10, 1936, all of title I, except section 3, which relates to the National...

  7. Protection switching for carrier ethernet multicast

    DEFF Research Database (Denmark)

    Ruepp, Sarah Renée; Wessing, Henrik; Berger, Michael Stübert

    2010-01-01

    This paper addresses network survivability for IPTV multicast transport in Carrier Ethernet networks. The impact of link failures is investigated and suggestions for intelligent multicast resilience schemes are proposed. In particular, functions of the multicast tree are integrated with the Carrier...... recovery path length, recovery time, number of branch nodes and operational complexity. The integrated approach therefore shows significant potential to increase the QoE for IPTV users in case of network failures and recovery actions....

  8. Evaluating multicast resilience in carrier ethernet

    DEFF Research Database (Denmark)

    Ruepp, Sarah Renée; Wessing, Henrik; Zhang, Jiang

    2010-01-01

    This paper gives an overview of the Carrier Ethernet technology with specific focus on resilience. In particular, we show how multicast traffic, which is essential for IPTV can be protected. We detail the ackground for resilience mechanisms and their control and e present Carrier Ethernet...... resilience methods for linear nd ring networks. By simulation we show that the vailability of a multicast connection can be significantly increased by applying protection methods....

  9. Sequence anatomy of mitochondrial anion carriers

    Czech Academy of Sciences Publication Activity Database

    Ježek, Petr; Ježek, Jan

    2003-01-01

    Roč. 534, 1-3 (2003), s. 15-25 ISSN 0014-5793 R&D Projects: GA AV ČR IAA5011106; GA ČR GA301/02/1215; GA MŠk ME 389 Institutional research plan: CEZ:AV0Z5011922 Keywords : mitochondrial anion carriers * carrier genomics * bioinformatics Subject RIV: CE - Biochemistry Impact factor: 3.609, year: 2003

  10. Toward fully automated genotyping: Genotyping microsatellite markers by deconvolution

    Energy Technology Data Exchange (ETDEWEB)

    Perlin, M.W.; Lancia, G.; See-Kiong, Ng [Carnegie Mellon Univ., Pittsburgh, PA (United States)

    1995-11-01

    Dense genetic linkage maps have been constructed for the human and mouse genomes, with average densities of 2.9 cM and 0.35 cM, respectively. These genetic maps are crucial for mapping both Mendelian and complex traits and are useful in clinical genetic diagnosis. Current maps are largely comprised of abundant, easily assayed, and highly polymorphic PCR-based microsatellite markers, primarily dinucleotide (CA){sub n} repeats. One key limitation of these length polymorphisms is the PCR stutter (or slippage) artifact that introduces additional stutter bands. With two (or more) closely spaced alleles, the stutter bands overlap, and it is difficult to accurately determine the correct alleles; this stutter phenomenon has all but precluded full automation, since a human must visually inspect the allele data. We describe here novel deconvolution methods for accurate genotyping that mathematically remove PCR stutter artifact from microsatellite markers. These methods overcome the manual interpretation bottleneck and thereby enable full automation of genetic map construction and use. New functionalities, including the pooling of DNAs and the pooling of markers, are described that may greatly reduce the associated experimentation requirements. 32 refs., 5 figs., 3 tabs.

  11. Ascaris: development of selected genotypes in mice.

    Science.gov (United States)

    Peng, Weidong; Yuan, Keng; Peng, Guohua; Qiu, Lin; Dai, Zhifang; Yuan, Fang; Hu, Yinying; Hu, Ningyan

    2012-05-01

    Using nucleotide variation in the first internal transcribed spacer of nuclear ribosomal DNA, five different genotypes (designated G1-G5) have been identified and the preponderance of genotype G1 in humans and of genotype G3 in pigs led to the proposal that parasites bearing the two genotypes have an affinity for a particular host species. A subsequent study using eggs of genotype G1 from humans and G3 from pigs to infect pigs and mice indicated that there is a significant difference in the ability to infect and establish as larvae in mice and as adults in pigs between the two genotypes. Extending previous investigations, the present study investigated whether there are differences in development as designated by egg hatching, larvae migration and distribution in the mice between the Ascaris strains with known genotypes. Ascaris eggs of genotypes G1 (predominating in human-derived worms) and G3 (predominating in pig-derived worms) were used to infect C57BL/6 mice orally. Eggs/larvae were examined from the small and large intestines, thoracic and abdominal cavities, peripheral blood, livers and lungs at intervals of 2h until 12h post-infection, then periodically until 34 days of infection. Results showed distinct differences in egg hatching (the timing and location of hatching, and the numbers hatched), and in larvae migration and distribution (the means and constituent ratios, the time of peak recovery, and larvae reappearing in intestines) between the two strains. The results can explain the findings of significantly higher larval recovery of genotype G1 than G3 in the mice, and may shed some enlightenment to understand the difference in host affiliation of Ascaris of different genotypes. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. [A review for recent advances in AA amyloid research and therapeutic approach to AA amyloidosis complicating rheumatoid arthritis].

    Science.gov (United States)

    Tamura, Hiroaki; Hasegawa, Kiminori

    2009-02-01

    AA amyloidosis is a life threatening clinical complication of chronic inflammatory diseases such as rheumatoid arthritis. It has been demonstrated biochemically that amyloidosis resulted from abnormal folding of proteins, which are deposited as insoluble fibrils in extracellular tissue, leading to the disruption of their normal function. In this regard, amyloidosis has been recognized as a conformation disorder. Interestingly, genetic polymorphisms of amyloid precursor protein (SAA) have been reported to associate with increased risk for AA amyloidosis. Also recent biochemical research revealed that SAA is synthesized under the influence of the proinflammatory cytokines, such as IL-6, TNF-alpha, IL-1. Additionally, it was suggested that amyloid deposits in extracellular tissue could reflect to the serum level of SAA in the reversible fashion, leading to the hypothesis that the control of the SAA synthesis could be beneficial to the treatment of amyloidosis. In this context, anti-cytokine therapies may be most effective. Especially the inhibition of IL-6 is critical to suppression of SAA production, so treatment with a humanized monoclonal antibody against human IL-6 receptor may not only ameliorate RA disease activity but also pave the way for the treatment of AA amyloidosis.

  13. The effect of weight loss on HDL subfractions and LCAT activity in two genotypes of APOA-II -265T>C polymorphism.

    Science.gov (United States)

    Moradi, Masoumeh; Mahmoudi, Maryam; Saedisomeolia, Ahmad; Zahirihashemi, Roxana; Koohdani, Fariba

    2017-05-25

    People may have different responses to the same environmental changes. It has been reported that genome variations may be responsible for these differences. Also, HDL subfractions may be influenced by different genetic variations. The aim of the present study was to determine gene-diet interactions and to evaluate the influence of weight loss on HDL subfractions between two genotypes of -265 T>C APOA-II polymorphism. In the present study, 56 overweight and obese patients with type 2 diabetes mellitus were selected from 697 genotype-specified subjects. After matching for gender, age and BMI at the beginning of the study, an equal number of patients remained on each genotype of APOA-II (TT/TC and CC group). After a 6-week calorie restriction program, 44 patients completed the study. Serum HDL subfractions, including HDL2 and HDL3 and LCAT activity, were compared between the two genotypes and, before and after the intervention, were separated in each genotype. Serum concentration of HDL and its subfractions decreased significantly due to the weight loss. A comparison of the mean changes between the genotypes showed that HDL3 significantly decreased in the CC genotype while, in the TT/TC group, the serum concentration of HDL2 was significantly reduced. However, the increase of LCAT activity was not significant among the two genotypes. A comparison of mean changes of variables within two genotype groups showed that C homozygote carriers lead to a general shift toward larger size HDL subfractions and T allele carriers shift toward smaller size HDL subfractions after weight loss.

  14. A combined RT-PCR and dot-blot hybridization method reveals the coexistence of SJNNV and RGNNV betanodavirus genotypes in wild meagre (Argyrosomus regius).

    Science.gov (United States)

    Lopez-Jimena, B; Cherif, N; Garcia-Rosado, E; Infante, C; Cano, I; Castro, D; Hammami, S; Borrego, J J; Alonso, M C

    2010-10-01

    To detect the possible coexistence of striped jack nervous necrosis virus (SJNNV) and red-spotted grouper nervous necrosis virus (RGNNV) genotypes in a single fish, a methodology based on the combination of PCR amplification and blot hybridization has been developed and applied in this study. The degenerate primers designed for the PCR procedure target the T4 region within the capsid gene, resulting in the amplification of both genotypes. The subsequent hybridization of these amplification products with two different specific digoxigenin-labelled probes resulted in the identification of both genotypes separately. The application of the RT-PCR protocol to analyse blood samples from asymptomatic wild meagre (Argyrosomus regius) specimens has shown a 46.87% of viral nervous necrosis virus carriers. The combination of RT-PCR and blot hybridization increases the detection rate up to 90.62%, and, in addition, it has shown the coexistence of both genotypes in 18 out of the 32 specimens analysed (56.25%). This study reports the coexistence of betanodaviruses belonging to two different genotypes (SJNNV and RGNNV) in wild fish specimens. This is the first report demonstrating the presence of SJNNV and RGNNV genotypes in the same specimen. This study also demonstrates a carrier state in this fish species for the first time. © 2010 The Authors. Journal compilation © 2010 The Society for Applied Microbiology.

  15. Inhomogeneous and nonstationary Hall states of the CDW with quantized normal carriers

    Science.gov (United States)

    Brazovskii, S.

    2015-03-01

    We suggest a theory for a deformable and sliding charge density wave (CDW) in the Hall bar geometry for the quantum limit when the carriers in remnant small pockets are concentrated at lowest Landau levels (LL) forming a fractionally (ν central region via sharp domain walls. Resulting picture is that of compensated collective and normal pulsing counter-currents driven by the Hall voltage. This scenario is illustrated by numerical modeling for nonstationary distributions of the current and the electric field. This picture can interpret experiments in mesa-junctions showing depinning by the Hall voltage and the generation of voltage-controlled high frequency oscillations (Yu.I. Latyshev, P. Monceau, A.A. Sinchenko, et al., Presented at ECRYS-2011, unpublished [1]).

  16. Combined factor V Leiden and prothrombin genotyping in patients presenting with thromboembolic episodes.

    Science.gov (United States)

    Friedline, J A; Ahmad, E; Garcia, D; Blue, D; Ceniza, N; Mattson, J C; Crisan, D

    2001-01-01

    Several genetic defects are associated with increased risk of venous thrombosis. The factor V Leiden (FVL) and prothrombin G20210A mutations are the most frequent causes of inherited thrombophilia. To evaluate combined genotyping for these 2 mutations in patients presenting with thromboembolic episodes and to correlate genotypic findings with clinical characteristics. Blood specimens were collected from 401 patients presenting with thromboembolic disease between January 1998 and September 1998, and genotyping for both FVL and prothrombin mutations was performed. Thirty-two patients (8%) were heterozygous for FVL, 4 (1%) were homozygous for FVL, and 20 (5%) were heterozygous for the prothrombin mutation. Two cases (0.5%) were identified with combined FVL and prothrombin mutations. The most common clinical presentation was lower-extremity deep vein thrombosis with or without pulmonary embolism. Arterial events were rare. The thromboembolic episodes were often precipitated by additional risk factors. Recurrent disease was found in 73.9% of FVL carriers and 52.9% of prothrombin mutation carriers; 52% of the patients with FVL and 50% of prothrombin mutation carriers had a first thrombotic episode before age 45 years. The 2 cases with combined genetic defects demonstrate amplified thrombotic risk. In the first case this was effected in thrombosis at a young age, and recurrence of thrombotic events even in the absence of precipitating factors. A complex interplay between genetic and additional risk factors was seen in the second case. Identification of both FVL and prothrombin mutations is important in the overall assessment and management of patients with thrombophilia. Detection of these mutations can identify patients at high risk and help evaluate the interaction of genetic and acquired risk factors.

  17. OPRM1 genotype interacts with serotonin system dysfunction to predict alcohol-heightened aggression in primates.

    Science.gov (United States)

    Driscoll, Carlos A; Lindell, Stephen G; Schwandt, Melanie L; Suomi, Stephen J; Higley, J Dee; Heilig, Markus; Barr, Christina S

    2017-11-01

    Although the notion that alcohol promotes violence is widespread, not all individuals are aggressive while intoxicated. Genetic variation could be a contributing factor to individual differences in alcohol-heightened aggression. The present study examines the effects of OPRM1C77G genotype on responses to threat in rhesus macaques under normal conditions and following alcohol administration. Prior studies have shown that a low CSF level of 5-HIAA is a trait marker for individuals prone to escalated aggression. We wanted to examine whether the predictive value for this marker on aggression was moderated by OPRM1 genotype. Animals were administered alcohol (BAC 100-200 mg%), were provoked by a human intruder, and aggressive responses were recorded. Factor analysis was performed to generate aggressive response factors, which were then used as dependent variables for ANOVA, with OPRM1 genotype and CSF 5-HIAA as independent variables. Factor analysis generated three factors ('Threatening', 'Distance Decreasing' and 'High Intensity'). We found that High Intensity aggression was increased among carriers of the OPRM1 G allele, especially among individuals with low CSF levels of 5-HIAA. Aggression in the non-intoxicated state was predicted by 5-HIAA, but not by genotype. This study demonstrates that OPRM1 genotype predicts alcohol-heightened aggression in rhesus macaques with low CSF levels of 5-HIAA. Because OPRM1 variation predicts similar effects on alcohol response and behavior in humans and macaques, this study could suggest a role for OPRM1 genotype in alcohol-heightened aggression in humans. If so, it may be that compounds that block this receptor could reduce alcohol-associated violence in selected patient populations. © Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

  18. BDNF genotype interacts with motor-function to influence rehabilitation responsiveness post-stroke

    Directory of Open Access Journals (Sweden)

    Christine T Shiner

    2016-05-01

    Full Text Available Background. Persistent motor impairment is common but highly heterogeneous post-stroke. Genetic polymorphisms, including those identified on the brain derived neurotrophic factor (BDNF and apolipoprotein E (APOE genes, may contribute to this variability by limiting the capacity for use-dependent neuroplasticity, and hence rehabilitation responsiveness.Objective. To determine whether BDNF and APOE genotypes influence motor improvement facilitated by post-stroke upper-limb rehabilitation. Methods. BDNF Val66Met and APOE isoform genotypes were determined using leukocyte DNA for 55 community-dwelling patients 2-123 months post-stroke. All patients completed a dose-matched upper-limb rehabilitation program of either Wii-based Movement Therapy or Constraint-induced Movement Therapy. Upper-limb motor-function was assessed pre- and post-therapy using a suite of functional measures. Results. Motor-function improved for all patients post-therapy, with no difference between therapy groups. In the pooled data, there was no significant effect of BDNF or APOE genotype on motor-function at baseline, or following the intervention. However, a significant interaction between the level of residual motor-function and BDNF genotype was identified (p=0.029, whereby post-therapy improvement was significantly less for Met allele carriers with moderate and high, but not low motor-function. There was no significant association between APOE genotype and therapy outcomes. Conclusions. This study identified a novel interaction between the BDNF Val66Met polymorphism, motor-function status and the magnitude of improvement with rehabilitation in chronic stroke. This polymorphism does not preclude, but may reduce, the magnitude of motor improvement with therapy, particularly for patients with higher but not lower residual motor-function. BDNF genotype should be considered in the design and interpretation of clinical trials.

  19. Genomic evaluations with many more genotypes

    Directory of Open Access Journals (Sweden)

    Wiggans George R

    2011-03-01

    Full Text Available Abstract Background Genomic evaluations in Holstein dairy cattle have quickly become more reliable over the last two years in many countries as more animals have been genotyped for 50,000 markers. Evaluations can also include animals genotyped with more or fewer markers using new tools such as the 777,000 or 2,900 marker chips recently introduced for cattle. Gains from more markers can be predicted using simulation, whereas strategies to use fewer markers have been compared using subsets of actual genotypes. The overall cost of selection is reduced by genotyping most animals at less than the highest density and imputing their missing genotypes using haplotypes. Algorithms to combine different densities need to be efficient because numbers of genotyped animals and markers may continue to grow quickly. Methods Genotypes for 500,000 markers were simulated for the 33,414 Holsteins that had 50,000 marker genotypes in the North American database. Another 86,465 non-genotyped ancestors were included in the pedigree file, and linkage disequilibrium was generated directly in the base population. Mixed density datasets were created by keeping 50,000 (every tenth of the markers for most animals. Missing genotypes were imputed using a combination of population haplotyping and pedigree haplotyping. Reliabilities of genomic evaluations using linear and nonlinear methods were compared. Results Differing marker sets for a large population were combined with just a few hours of computation. About 95% of paternal alleles were determined correctly, and > 95% of missing genotypes were called correctly. Reliability of breeding values was already high (84.4% with 50,000 simulated markers. The gain in reliability from increasing the number of markers to 500,000 was only 1.6%, but more than half of that gain resulted from genotyping just 1,406 young bulls at higher density. Linear genomic evaluations had reliabilities 1.5% lower than the nonlinear evaluations with 50

  20. Risk of new tumors in von Hippel-Lindau patients depends on age and genotype

    DEFF Research Database (Denmark)

    Binderup, Marie Louise Mølgaard; Budtz-Jørgensen, Esben; Bisgaard, Søs Marie Luise

    2016-01-01

    is not constant throughout the life span of vHL patients; instead, it varies significantly with age and genotype and depends on anatomical location. Retinal surveillance is crucial during the teenage years, whereas cerebellar surveillance is especially important in adulthood.Genet Med advance online publication......PURPOSE: The von Hippel-Lindau (vHL) phenotype is variable, which complicates genetic counseling and surveillance. We describe how the rate of new tumor development varies through the lifetimes of vHL patients and how it is influenced by age and genotype. METHODS: In a national cohort study, we...... included 52 VHL mutation carriers who were retrospectively followed for a total of 799 person-years. From birth to current age, 581 manifestations were diagnosed during 2,583 examinations in the study subjects. Manifestation rates were analyzed using Poisson regression and compared in groups of different...

  1. Valores de ferritina sérica em beta talassemia heterozigota Serum ferritin levels in beta thalassemia carrier

    Directory of Open Access Journals (Sweden)

    Isabeth F. Estevão

    2010-01-01

    Full Text Available A low iron level, the commonest nutritional deficiency in the world, is a public health problem in developing countries. On the other hand, an excessive amount of iron is toxic, causing several organic dysfunctions, such as diabetes, cirrhosis, endocrinopathies and heart disease. Researchers have reported an association of iron overload with beta-thalassemia. The aim of this paper was to compare the serum ferritin levels of women with the beta-thalassemia trait. The results of serologic tests of 137 women of childbearing age were analyzed; 63 had the beta-thalassemia trait and 74 had Hb AA. In the beta-thalassemia carriers, the median ferritin value was 51.90 ng/mL and in the non-carriers 31.60 ng/mL (p = 0.0052. Levels of less than 20 and above 150 ng/mL were observed in 28% and 3% of the non-carriers and in 16% and 11% of the carriers, respectively. With these results it is possible to conclude that women in the reproductive age with the beta-thalassemia trait present higher ferritin levels in the northeastern region of São Paulo State. Further studies are necessary to clarify possible genetic and/or environment factors which interfere in iron absorption.

  2. Effects of MAOA-Genotype, Alcohol Consumption, and Aging on Violent Behavior

    Science.gov (United States)

    Tikkanen, Roope; Sjöberg, Rickard L.; Ducci, Francesca; Goldman, David; Holi, Matti; Tiihonen, Jari; Virkkunen, Matti

    2009-01-01

    Background Environmental factors appear to interact with a functional polymorphism (MAOA-LPR) in the promoter region of the monoamine oxidase A gene (MAOA) in determining some forms of antisocial behavior. However, how MAOA-LPR modulates the effects of other factors such as alcohol consumption related to antisocial behavior is not completely understood. Methods This study examines the conjunct effect of MAOA-LPR, alcohol consumption, and aging on the risk for violent behavior. Recidivism in severe impulsive violent behavior was assessed after 7 to 15 years in a sample of 174 Finnish alcoholic offenders, the majority of whom exhibited antisocial or borderline personality disorder or both, and featured impulsive temperament traits. Results The risk for committing new acts of violence increased by 2.3% for each kilogram of increase in yearly mean alcohol consumption (p = 0.004) and decreased by 7.3% for every year among offenders carrying the high activity MAOA genotype. In contrast, alcohol consumption and aging failed to affect violent behavior in the low activity MAOA genotyped offenders. MAOA-LPR showed no main effect on the risk for recidivistic violence. Conclusions Violent offenders carrying the high activity MAOA genotype differ in several ways from carriers with the low activity MAOA risk allele previously associated with antisocial behavior. Finnish high activity MAOA genotyped risk alcoholics exhibiting antisocial behavior, high alcohol consumption, and abnormal alcohol-related impulsive and uncontrolled violence might represent an etiologically distinct alcohol dependence subtype. PMID:19120058

  3. GSTM1 genotype is an independent prognostic factor in clear cell renal cell carcinoma.

    Science.gov (United States)

    Coric, Vesna M; Simic, Tatjana P; Pekmezovic, Tatjana D; Basta-Jovanovic, Gordana M; Savic-Radojevic, Ana R; Radojevic-Skodric, Sanja M; Matic, Marija G; Suvakov, Sonja R; Dragicevic, Dejan P; Radic, Tanja M; Dzamic, Zoran M; Pljesa-Ercegovac, Marija S

    2017-06-01

    Owing to dual functionality of cytosolic glutathione S-transferases (GSTs), they might affect both the development and the progression of renal cell carcinoma (RCC). However, the data on the prognostic value of GST polymorphism in patients with RCC are scarce. Hence, we evaluated the effect of GST gene variants on both the risk of RCC development and the postoperative prognosis in patients with clear cell RCC (ccRCC). GST genotypes were determined in 305 patients with RCC and 326 matched controls, whereas the overall survival was evaluated in patients with ccRCC only. The presence of GSTM1:ASK1 protein-protein interaction in ccRCC tissue samples was analyzed by methods of immunoprecipitation and immunoblot. We noted an increased risk of RCC development in carriers of GSTM1-null and GSTP1-variant genotype (Prisk of RCC development. On the contrary, GSTM1-null genotype is associated with favorable postoperative prognosis in ccRCC. The possible molecular mechanism underlying the role of GSTM1 protein in RCC progression might be the presence of GSTM1:ASK1 protein-protein interaction. Hence, determination of GSTM1-genotype might serve as a valuable indicator in both RCC risk assessment and postoperative prognosis. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Sleep duration, depression, and oxytocinergic genotype influence prepulse inhibition of the startle reflex in postpartum women.

    Science.gov (United States)

    Comasco, Erika; Gulinello, Maria; Hellgren, Charlotte; Skalkidou, Alkistis; Sylven, Sara; Sundström-Poromaa, Inger

    2016-04-01

    The postpartum period is characterized by a post-withdrawal hormonal status, sleep deprivation, and susceptibility to affective disorders. Postpartum mothering involves automatic and attentional processes to screen out new external as well as internal stimuli. The present study investigated sensorimotor gating in relation to sleep duration, depression, as well as catecholaminergic and oxytocinergic genotypes in postpartum women. Prepulse inhibition (PPI) of the startle reflex and startle reactivity were assessed two months postpartum in 141 healthy and 29 depressed women. The catechol-O-methyltransferase (COMT) Val158Met, and oxytocin receptor (OXTR) rs237885 and rs53576 polymorphisms were genotyped, and data on sleep duration were collected. Short sleep duration (less than four hours in the preceding night) and postpartum depression were independently associated with lower PPI. Also, women with postpartum depression had higher startle reactivity in comparison with controls. The OXTR rs237885 genotype was related to PPI in an allele dose-dependent mode, with T/T healthy postpartum women carriers displaying the lowest PPI. Reduced sensorimotor gating was associated with sleep deprivation and depressive symptoms during the postpartum period. Individual neurophysiological vulnerability might be mediated by oxytocinergic genotype which relates to bonding and stress response. These findings implicate the putative relevance of lower PPI of the startle response as an objective physiological correlate of liability to postpartum depression. Copyright © 2016 Elsevier B.V. and ECNP. All rights reserved.

  5. The Contribution of Matrix Metalloproteinase-1 Promoter Genotypes in Taiwan Lung Cancer Risk.

    Science.gov (United States)

    Shen, Te-Chun; Chang, Wen-Shin; Tsai, Chia-Wen; Chao, Che-Yi; Lin, Yi-Ting; Hsiao, Chieh-Lun; Hsu, Che-Lun; Chen, Wei-Chun; Hsia, Te-Chun; Bau, DA-Tian

    2018-01-01

    Up-regulation of metallo-proteinase (MMP) proteins has been shown in various types of solid cancers and the genotype of MMP1 has been associated with the risk of solid cancers. The contribution of MMP1 genotype to lung cancer has been investigated in various countries, though, to our knowledge, not in Taiwan. Therefore, in this study, we focused on the contribution of a polymorphism in the promoter region of MMP1 to lung cancer risk in Taiwan population. Genomic DNA was isolated from peripheral blood of 358 patients with lung cancer and 716 healthy individuals (non-cancer patients). MMP1 rs1799750 polymorphic genotypes of each sample were determined using the typical methodology of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The percentages of 2G/2G, 1G/2G, and 1G/1G for MMP1 -1607 genotypes were 34.4%, 41.3% and 24.3% in the disease group and 33.9%, 44.0%, and 22.1% in the control group (p trend=0.6298), respectively. The results of carrier comparisons in dominant and recessive models also support the findings that 1G or 2G appears not to be a determinant allelic biomarker for Taiwan lung cancer. The MMP1 -1607 1G allele is a non-significant protective biomarker for lung cancer in Taiwan. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  6. [AA amyloidosis: a little-known complication of chronic leg ulcer].

    Science.gov (United States)

    Waton, J; Fays-Michel, S; Chandeclerc, M L; Corby, S; Cuny, J F; Barbaud, A; Schmutz, J-L

    2008-02-01

    AA amyloidosis, secondary to inflammatory chronic diseases like rheumatoid arthritis, is often complicated by renal failure. Chronic inflammatory dermatoses constitute rare causes of AA amyloidosis. We describe two cases of AA amyloidosis discovered after renal failure in patients presenting leg ulcers for several years. AL amyloidosis was suspected in both cases because of a history of monoclonal gammopathy in one patient and of plasmocytoma in the other. The diagnosis of AA amyloidosis was confirmed on renal histology through the detection of AA antibodies in amyloid deposits. No extrarenal amyloidosis was seen in either patient and there were no inflammatory diseases other than chronic leg ulcers. AA amyloidosis is caused by serum amyloid protein A (SAA), a reactive inflammatory protein. AA amyloidosis is thus caused by chronic inflammatory diseases, but only rarely by cutaneous inflammatory diseases. To our knowledge, the literature contains only seven other published cases of AA amyloidosis secondary to chronic leg ulcers. A review of the literature does not indicate whether cure of ulcers has any effect on the accompanying renal failure. We imagine that AA amyloidosis secondary to leg ulcer is in fact under-diagnosed. However, since the first specific treatment for AA amyloidosis is currently being evaluated by the Food and Drug Administration, it is essential that this serious complication of chronic leg ulcers be widely recognised.

  7. Role and mechanism of AT1-AA in the pathogenesis of HELLP syndrome.

    Science.gov (United States)

    Bu, Shurui; Wang, Yuxian; Sun, Shuqing; Zheng, Yanqian; Jin, Zhu; Zhi, Jianming

    2018-01-10

    HELLP syndrome remains a leading cause of maternal and neonatal mortality and morbidity worldwide, which symptoms include hemolysis, elevated liver enzymes and low platelet count. The objective of this study was to determine whether HELLP is associated with AT1-AA. The positive rate and titer of AT1-AA in plasma from pregnant women were determined, and the correlation of AT1-AA titer with the grade of HELLP was analyzed. A HELLP rat model established by intravenous injection of AT1-AA. Our experimental results show the AT1-AA titer and positive rate were significantly higher in HELLP group, and AT1-AA titer were positively correlated with the level of TNF-α and ET-1 in plasma and the grade of HELLP syndrome. The results of animal experiments showed that the typical features of HELLP in the pregnant rats after AT1-AA injection. The levels of TNF-α and ET-1 in plasma and liver tissue were significantly increased in AT1-AA-treated rats compared with control rats. The HELLP syndrome induced by AT1-AA was attenuated markedly after administration of losartan. These data support the hypothesis that one the potential pathway that AT1-AA induce damage to capillary endothelial cells and liver during pregnancy is through activation of TNF-α and ET-1.

  8. Adverse effects of doping with anabolic androgenic steroids (AAS) in competitive athletics, recreational sports and bodybuilding.

    Science.gov (United States)

    Vorona, Elena; Nieschlag, Eberhard

    2018-02-19

    Despite the fact that sports organizations and legislators have introduced various mechanisms to discourage athletes from using performance and appearance enhancing substances a high percentage of athletes admits to their unabated application. In competitive athletics, bodybuilding and in recreational sports anabolic androgenic steroids (AAS) continue to be the substances most abused. This review summarizes the side effects of AAS abuse on organs and system functions in both sexes. High doses of AAS cause a significant increase of erythrocytes und haemoglobin concentration, which may lead to thromboembolism, intracardiac thrombosis and stroke. Long-term AAS abusers have a higher incidence of arrhythmias, atherosclerosis, concentric left-ventricular myocardial hypertrophy with impaired diastolic function and also sudden cardiac death. Changes of liver function and structure, up to hepatocellular carcinoma, have been described, mainly in cases of chronic misuse of 17α-alkylated AAS. Sleeplessness, increased irritability, depressive mood status are often observed in AAS abuse. In former AAS abusers depression, anxiety and melancholy may persist for many years. Due to negative feedback in the regulation of the hypothalamic-pituitary-gonadal axis AAS can cause reversible suppression of spermatogenesis up to azoospermia. In women the changes most often caused by AAS abuse are hirsutism, irreversible deepening of voice, dysmenorrhoea, secondary amenorrhoea with anovulation and infertility. AAS abuse notwithstanding, under clinical conditions testosterone remains the most important hormone for substitution therapy of male hypogonadism.

  9. Core–corona PSt/P(BA–AA) composite particles by two-stage emulsion polymerization

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Delong; Ren, Xiaolin; Zhang, Xinya, E-mail: cexyzh@scut.edu.cn; Liao, Shijun [South China University of Technology, School of Chemistry and Chemical Engineering (China)

    2016-03-15

    Raspberry-shaped composite particles with polystyrene (PSt) as core and poly(n-butyl acrylate-co-acrylic acid) (P(BA–AA)) as corona were synthesized via emulsion polymerization. The random copolymer, P(BA–AA), was pre-prepared and used as a polymeric surfactant, its emulsifying properties adjusted by changing the mass ratio of BA and AA. The morphology of the resulting core–corona composite particles, P(St/P(BA–AA)), could be regulated and controlled by varying the concentrations of P(BA–AA) or the mass ratio of BA:AA in P(BA–AA). The experimental results indicate that 3.0–6.0 wt% of P(BA–AA) is required to obtain stable composite emulsions, and P(BA–AA) with a mass ratio of BA:AA = 1:2 is able to generate distinct core–corona structures. A mechanism of composite particle formation is proposed based on the high affinity between the PSt core and the hydrophobic segments of P(BA–A). The regular morphology of the colloidal film is expected to facilitate potential application of core–corona particles in the field of light scattering. Furthermore, the diversity of core–corona particles can be expanded by replacing P(BA–AA) corona particles with other amphiphilic particles.

  10. Core–corona PSt/P(BA–AA) composite particles by two-stage emulsion polymerization

    International Nuclear Information System (INIS)

    Xie, Delong; Ren, Xiaolin; Zhang, Xinya; Liao, Shijun

    2016-01-01

    Raspberry-shaped composite particles with polystyrene (PSt) as core and poly(n-butyl acrylate-co-acrylic acid) (P(BA–AA)) as corona were synthesized via emulsion polymerization. The random copolymer, P(BA–AA), was pre-prepared and used as a polymeric surfactant, its emulsifying properties adjusted by changing the mass ratio of BA and AA. The morphology of the resulting core–corona composite particles, P(St/P(BA–AA)), could be regulated and controlled by varying the concentrations of P(BA–AA) or the mass ratio of BA:AA in P(BA–AA). The experimental results indicate that 3.0–6.0 wt% of P(BA–AA) is required to obtain stable composite emulsions, and P(BA–AA) with a mass ratio of BA:AA = 1:2 is able to generate distinct core–corona structures. A mechanism of composite particle formation is proposed based on the high affinity between the PSt core and the hydrophobic segments of P(BA–A). The regular morphology of the colloidal film is expected to facilitate potential application of core–corona particles in the field of light scattering. Furthermore, the diversity of core–corona particles can be expanded by replacing P(BA–AA) corona particles with other amphiphilic particles.

  11. Associations of cerebrovascular metabolism genotypes with neuropsychiatric symptoms and age at onset of Alzheimer’s disease dementia

    Directory of Open Access Journals (Sweden)

    Fabricio F. de Oliveira

    Full Text Available Objective: To study associations of cerebrovascular metabolism genotypes and haplotypes with age at Alzheimer’s disease dementia (AD onset and with neuropsychiatric symptoms according to each dementia stage. Methods: Consecutive outpatients with late-onset AD were assessed for age at dementia onset and Neuropsychiatric Inventory scores according to Clinical Dementia Rating scores, apolipoprotein E gene (APOE haplotypes, angiotensin-converting enzyme gene (ACE variants rs1800764 and rs4291, low-density lipoprotein cholesterol receptor gene (LDLR variants rs11669576 and rs5930, cholesteryl ester transfer protein gene (CETP variants I422V and TaqIB, and liver X receptor beta gene (NR1H2 polymorphism rs2695121. Results: Considering 201 patients, only APOE-ɛ4 carriers had earlier dementia onset in multiple correlations, as well as less apathy, more delusions, and more aberrant motor behavior. Both ACE polymorphisms were associated with less intense frontally mediated behaviors. Regarding LDLR variants, carriers of the A allele of rs11669576 had less anxiety and more aberrant motor behavior, whereas carriers of the A allele of rs5930 had less delusions, less anxiety, more apathy, and more irritability. CETP variants that included G alleles of I422V and TaqIB were mostly associated with less intense frontally mediated behaviors, while severely impaired carriers of the T allele of rs2695121 had more anxiety and more aberrant motor behavior. Conclusion: Though only APOE haplotypes affected AD onset, cerebrovascular metabolism genotypes were associated with differences in several neuropsychiatric manifestations of AD.

  12. Genotype V Japanese Encephalitis Virus Is Emerging

    Science.gov (United States)

    Li, Ming-Hua; Fu, Shi-Hong; Chen, Wei-Xin; Wang, Huan-Yu; Guo, Yu-Hong; Liu, Qi-Yong; Li, Yi-Xing; Luo, Hui-Ming; Da, Wa; Duo Ji, Dun Zhu; Ye, Xiu-Min; Liang, Guo-Dong

    2011-01-01

    Japanese encephalitis (JE) is a global public health issue that has spread widely to more than 20 countries in Asia and has extended its geographic range to the south Pacific region including Australia. JE has become the most important cause of viral encephalitis in the world. Japanese encephalitis viruses (JEV) are divided into five genotypes, based on the nucleotide sequence of the envelope (E) gene. The Muar strain, isolated from patient in Malaya in 1952, is the sole example of genotype V JEV. Here, the XZ0934 strain of JEV was isolated from Culex tritaeniorhynchus, collected in China. The complete nucleotide and amino acid sequence of XZ0934 strain have been determined. The nucleotide divergence ranged from 20.3% to 21.4% and amino acid divergence ranged from 8.4% to 10.0% when compared with the 62 known JEV isolates that belong to genotype I–IV. It reveals low similarity between XZ0934 and genotype I–IV JEVs. Phylogenetic analysis using both complete genome and structural gene nucleotide sequences demonstrates that XZ0934 belongs to genotype V. This, in turn, suggests that genotype V JEV is emerging in JEV endemic areas. Thus, increased surveillance and diagnosis of viral encephalitis caused by genotype V JEV is an issue of great concern to nations in which JEV is endemic. PMID:21750744

  13. ACTN3 Genotype in Professional Sport Climbers.

    Science.gov (United States)

    Ginszt, Michał; Michalak-Wojnowska, Małgorzata; Gawda, Piotr; Wojcierowska-Litwin, Magdalena; Korszeń-Pilecka, Iwona; Kusztelak, Małgorzata; Muda, Rafał; Filip, Agata A; Majcher, Piotr

    2018-02-01

    The functional RR genotype of the alpha-actinin-3 (ACTN3) gene has been reported to be associated with elite sprint/power athlete status. Although large and rapidly increasing number of studies have investigated the associations between the ACTN3 genotypes and athletic performance in various sport disciplines, there is a lack of studies on the genetic predisposition in Sport Climbing, which was selected to be part of the next Summer Olympic Games in Tokyo 2020 with three subdisciplines ('Lead Climbing', 'Speed Climbing' and 'Bouldering'). The aim of the study is to determine the frequency distribution of ACTN3 genotypes and alleles in professional lead climbers and boulderers.100 professional sport climbers from Poland, Russia and Austria, divided into two equal groups: professional boulderers and professional lead climbers were involved in the study. ACTN3 allele frequencies and genotypes were compared with 100 sedentary controls. Genotypes were determined using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism method. The percent distribution of RR genotype in the boulderers was significantly higher than in lead climbers and controls (62% vs. 26%; 33%, respectively; χ2=17.230, p=0.0017). The frequencies of ACTN3 R allele in boulderers differed significantly from lead climbers and controls (77% vs. 51%; 58%, respectively; χ2=15.721, p=0.0004). The proportion of the ACTN3 RR genotype is significantly higher in boulderers than in lead climbers and may be related to the specific type of predisposition to this subdiscipline.

  14. Correlation of normal-range FMR1 repeat length or genotypes and reproductive parameters.

    Science.gov (United States)

    Maslow, Bat-Sheva L; Davis, Stephanie; Engmann, Lawrence; Nulsen, John C; Benadiva, Claudio A

    2016-09-01

    This study aims to ascertain whether the length of normal-ranged CGG repeats on the FMR1 gene correlates with abnormal reproductive parameters. We performed a retrospective, cross-sectional study of all FMR1 carrier screening performed as part of routine care at a large university-based fertility center from January 2011 to March 2014. Correlations were performed between normal-range FMR1 length and baseline serum anti-Müllerian hormone (AMH), cycle day 3 follicle stimulating hormone (FSH), ovarian volumes (OV), antral follicle counts (AFC), and incidence of diminished ovarian reserve (DOR), while controlling for the effect of age. Six hundred three FMR1 screening results were collected. One subject was found to be a pre-mutation carrier and was excluded from the study. Baseline serum AMH, cycle day 3 FSH, OV, and AFC data were collected for the 602 subjects with normal-ranged CGG repeats. No significant difference in median age was noted amongst any of the FMR1 repeat genotypes. No significant correlation or association was found between any allele length or genotype, with any of the reproductive parameters or with incidence of DOR at any age (p > 0.05). However, subjects who were less than 35 years old with low/low genotype were significantly more likely to have below average AMH levels compared to those with normal/normal genotype (RR 3.82; 95 % CI 1.38-10.56). This large study did not demonstrate any substantial association between normal-range FMR1 repeat lengths and reproductive parameters.

  15. The effects of MAOA genotype, childhood trauma, and sex on trait and state-dependent aggression.

    Science.gov (United States)

    Verhoeven, Floor E A; Booij, Linda; Kruijt, Anne-Wil; Cerit, Hilâl; Antypa, Niki; Does, Willem

    2012-11-01

    Monoamine oxidase A (MAOA) genotypic variation has been associated with variation in aggression, especially in interaction with childhood trauma or other early adverse events. Male carriers of the low-expressing variant (MAOA-L) with childhood trauma or other early adverse events seem to be more aggressive, whereas female carriers with the high-expressing variant (MAOA-H) with childhood trauma or other early adverse events may be more aggressive. We further investigated the effects of MAOA genotype and its interaction with sex and childhood trauma or other early adverse events on aggression in a young adult sample. We hypothesized that the association between genotype, childhood trauma, and aggression would be different for men and women. We also explored whether this association is different for dispositional (trait) aggression versus aggression in the context of dysphoric mood. In all, 432 Western European students (332 women, 100 men; mean age 20.2) were genotyped for the MAOA gene. They completed measures of childhood trauma, state and trait measures of aggression-related behaviors (STAXI), and cognitive reactivity to sad mood (LEIDS-R), including aggression reactivity. Women with the MAOA-H had higher aggression reactivity scores than women with the MAOA-L. This effect was not observed in men, although the nonsignificant findings in men may be a result of low power. Effects on the STAXI were not observed, nor were there gene by environment interactions on any of the aggression measures. A protective effect of the low-expression variant in women on aggression reactivity is consistent with previous observations in adolescent girls. In females, the MAOA-H may predispose to aggression-related problems during sad mood.

  16. Hepatitis B virus in Pakistan: A systematic review of prevalence, risk factors, awareness status and genotypes

    Directory of Open Access Journals (Sweden)

    Afzal Samia

    2011-03-01

    Full Text Available Abstract In Pakistan, there are estimated 7-9 million carriers of hepatitis B virus (HBV with a carrier rate of 3-5%. This article reviews the available literature about the prevalence, risk factors, awareness status and genotypes of the HBV in Pakistan by using key words; HBV prevalence, risk factors, awareness status and genotypes in Pakistani population in PubMed, PakMediNet, Directory of Open Access Journals (DOAJ and Google Scholar. One hundred and six different studies published from 1998 to 2010 were included in this study. Weighted mean and standard deviation were determined for each population group. The percentage of hepatitis B virus infection in general population was 4.3318% ± 1.644%, healthy blood donors (3.93% ± 1.58%, military recruits (4.276% ± 1.646%, healthcare persons (3.25% ± 1.202%, pregnant women (5.872% ± 4.984, prisoners (5.75% ± 0.212%, surgical patients (7.397% ± 2.012%, patients with cirrhosis (28.87% ± 11.90%, patients with HCC (22% ± 2.645%, patients with hepatitis (15.896% ± 14.824%, patients with liver diseases (27.54% ± 6.385%, multiple transfused patients (6.223% ± 2.121%, opthalmic patients (3.89% ± 1.004% and users of injectable drugs (14.95% ± 10.536%. Genotype D (63.71% is the most prevalent genotype in Pakistani population. Mass vaccination and awareness programs should be initiated on urgent basis especially in populations with HBV infection rates of more than 5%.

  17. Gray matter maturation and cognition in children with different APOE ε genotypes.

    Science.gov (United States)

    Chang, Linda; Douet, Vanessa; Bloss, Cinnamon; Lee, Kristin; Pritchett, Alexandra; Jernigan, Terry L; Akshoomoff, Natacha; Murray, Sarah S; Frazier, Jean; Kennedy, David N; Amaral, David G; Gruen, Jeffrey; Kaufmann, Walter E; Casey, B J; Sowell, Elizabeth; Ernst, Thomas

    2016-08-09

    The aims of the current study were to determine whether children with the 6 different APOE ε genotypes show differences in gray matter maturation, particularly for those with ε4 and ε2 alleles, which are associated with poorer outcomes in many neurologic disorders. A total of 1,187 healthy children (aged 3-20 years, 52.1% boys, 47.9% girls) with acceptable data from the cross-sectional Pediatric Imaging Neurocognition and Genetics Study were evaluated for the effects of 6 APOE ε genotypes on macroscopic and microscopic cortical and subcortical gray matter structures (measured with 3-tesla MRI and FreeSurfer for automated morphometry) and on cognition (NIH Toolbox). Among APOE ε4 carriers, age-related changes in brain structures and cognition varied depending on genotype, with the smallest hippocampi in ε2ε4 children, the lowest hippocampal fractional anisotropy in younger ε4ε4 children, the largest medial orbitofrontal cortical areas in ε3ε4 children, and age-dependent thinning of the entorhinal cortex in ε4ε4 children. Younger ε4ε4 children had the lowest scores on executive function and working memory, while younger ε2ε4 children performed worse on attention tasks. Larger parietal gyri in the younger ε2ε4 children, and thinner temporal and cingulate isthmus cortices or smaller hippocampi in the younger ε4ε4 children, predicted poorer performance on attention or working memory. Our findings validated and extended prior smaller studies that showed altered brain development in APOE ε4-carrier children. The ε4ε4 and ε2ε4 genotypes may negatively influence brain development and brain aging at the extremes of age. Studying APOE ε polymorphisms in young children may provide the earliest indicators for individuals who might benefit from early interventions or preventive measures for future brain injuries and dementia. © 2016 American Academy of Neurology.

  18. Confirmation that the AKT1 (rs2494732) genotype influences the risk of psychosis in cannabis users.

    Science.gov (United States)

    Di Forti, Marta; Iyegbe, Conrad; Sallis, Hannah; Kolliakou, Anna; Falcone, M Aurora; Paparelli, Alessandra; Sirianni, Miriam; La Cascia, Caterina; Stilo, Simona A; Marques, Tiago Reis; Handley, Rowena; Mondelli, Valeria; Dazzan, Paola; Pariante, Carmine; David, Anthony S; Morgan, Craig; Powell, John; Murray, Robin M

    2012-11-15

    Cannabis use is associated with an increased risk of psychosis. One study has suggested that genetic variation in the AKT1 gene might influence this effect. In a case-control study of 489 first-episode psychosis patients and 278 control subjects, we investigated the interaction between variation at the AKT1 rs2494732 single nucleotide polymorphism and cannabis use in increasing the risk of psychosis. The rs2494732 locus was not associated with an increased risk of a psychotic disorder, with lifetime cannabis use, or with frequency of use. We did, however, find that the effect of lifetime cannabis use on risk of psychosis was significantly influenced by the rs2494732 locus (likelihood ratio statistic for the interaction = 8.54; p = .014). Carriers of the C/C genotype with a history of cannabis use showed a greater than twofold increased likelihood of a psychotic disorder (odds ratio = 2.18 [95% confidence interval: 1.12, 4.31]) when compared with users who were T/T carriers. Moreover, the interaction between the rs2494732 genotype and frequency of use was also significant at the 5% level (likelihood ratio = 13.39; p = .010). Among daily users, C/C carriers demonstrated a sevenfold increase in the odds of psychosis compared with T/T carriers (odds ratio = 7.23 [95% confidence interval: 1.37, 38.12]). Our findings provide strong support for the initial report that genetic variation at rs2494732 of AKT1 influences the risk of developing a psychotic disorder in cannabis users. Copyright © 2012 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  19. Differential Analysis of the Nasal Microbiome of Pig Carriers or Non-Carriers of Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Carmen Espinosa-Gongora

    Full Text Available Staphylococcus aureus is presently regarded as an emerging zoonotic agent due to the spread of specific methicillin-resistant S. aureus (MRSA clones in pig farms. Studying the microbiota can be useful for the identification of bacteria that antagonize such opportunistic veterinary and zoonotic pathogen in animal carriers. The aim of this study was to determine whether the nasal microbiome of pig S. aureus carriers differs from that of non-carriers. The V3-V5 region of the 16S rRNA gene was sequenced from nasal swabs of 44 S. aureus carriers and 56 non-carriers using the 454 GS FLX titanium system. Carriers and non-carriers were selected on the basis of quantitative longitudinal data on S. aureus carriage in 600 pigs sampled at 20 Danish herds included in two previous studies in Denmark. Raw sequences were analysed with the BION meta package and the resulting abundance matrix was analysed using the DESeq2 package in R to identify operational taxonomic units (OTUs with differential abundance between S. aureus carriers and non-carriers. Twenty OTUs were significantly associated to non-carriers, including species with known probiotic potential and antimicrobial effect such as lactic acid-producing isolates described among Leuconostoc spp. and some members of the Lachnospiraceae family, which is known for butyrate production. Further 5 OTUs were significantly associated to carriage, including known pathogenic bacteria such as Pasteurella multocida and Klebsiella spp. Our results show that the nasal microbiome of pigs that are not colonized with S. aureus harbours several species/taxa that are significantly less abundant in pig carriers, suggesting that the nasal microbiota may play a role in the individual predisposition to S. aureus nasal carriage in pigs. Further research is warranted to isolate these bacteria and assess their possible antagonistic effect on S. aureus for the pursuit of new strategies to control MRSA in pig farming.

  20. APOE Genotype and Nonrespiratory Sleep Parameters in Cognitively Intact Older Adults.

    Science.gov (United States)

    Spira, Adam P; An, Yang; Peng, Yu; Wu, Mark N; Simonsick, Eleanor M; Ferrucci, Luigi; Resnick, Susan M

    2017-08-01

    The apolipoprotein E (APOE) Ɛ4 allele increases Alzheimer's disease (AD) risk and has been linked to a greater risk of sleep-disordered breathing. We investigated the association of APOE genotype with nonrespiratory sleep parameters. We studied 1264 cognitively normal participants in the Baltimore Longitudinal Study of Aging (mean = 57.5 ± 16.1 years, range 19.9-92.0, 48.2% women, 19.8% African American) with APOE genotyping and self-reported sleep duration (≥9, 7 or 8, ≤6 hours), difficulty falling/staying asleep, and napping. We compared Ɛ4 carriers with all noncarriers and compared persons at reduced (Ɛ2/Ɛ2 or Ɛ2/Ɛ3) or elevated AD risk (≥1 Ɛ4 allele) with those neutral for AD risk (Ɛ3/Ɛ3). In fully adjusted models, those with ≥1 Ɛ4 allele had a greater odds of being in a shorter sleep duration category compared to all noncarriers (odds ratio [OR] = 1.41, 95% confidence interval [CI] 1.06, 1.88) and Ɛ3/Ɛ3 carriers (OR = 1.43, 95% CI 1.06, 1.92). Compared to Ɛ3/Ɛ3 carriers, Ɛ2/Ɛ2 or Ɛ2/Ɛ3 carriers had a lower odds of reporting napping (OR = 0.64, 95% CI 0.43, 0.96). Among participants aged ≥50 years, sleep duration findings remained and Ɛ4 carriers had a greater odds of trouble falling/staying asleep than noncarriers (OR = 1.49, 95% CI 1.02, 2.17). We found some evidence for stronger associations of Ɛ4 with sleep duration among African Americans. Self-reported sleep duration, napping, and trouble falling/staying asleep differ by APOE genotype. Studies are needed to examine whether APOE promotes AD by degrading sleep and to clarify the role of race in these associations. Published by Oxford University Press on behalf of Sleep Research Society (SRS) 2017. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  1. Performance of Uplink Carrier Aggregation in LTE-Advanced Systems

    DEFF Research Database (Denmark)

    Wang, Hua; Rosa, Claudio; Pedersen, Klaus

    2010-01-01

    Carrier aggregation (CA) has been proposed to aggregate two or more component carriers (CCs) to support a much wider transmission bandwidth for LTE-Advanced systems. With carrier aggregation, it is possible to schedule a user equipment (UE) on multiple component carriers simultaneously. In this p...

  2. Antiangiogenic effects of AA-PMe on HUVECs in vitro and zebrafish in vivo

    Directory of Open Access Journals (Sweden)

    Jing Y

    2018-04-01

    Full Text Available Yue Jing,1,2,* Gang Wang,1,* Qi Xiao,1 Yachun Zhou,1 Yingjie Wei,3 Zhunan Gong1 1Center for New Drug Research and Development, College of Life Science, Nanjing Normal University, Nanjing, China; 2Central Laboratory of Stomatology, Nanjing Stomatological Hospital, Medical School of Nanjing University, Nanjing, China; 3Key Laboratory of Oral Drug Delivery System of Chinese Materia Medica of State Administration of Traditional Chinese Medicine, Jiangsu Branch of China Academy of Chinese Medical Science, Nanjing, China *These authors contributed equally to this work Abstract: Angiogenesis plays a vital role in many physiological and pathological processes and several diseases are connected with its dysregulation. Asiatic acid (AA has demonstrated anticancer properties and we suspect this might be attributable to an effect on angiogenesis. A modified derivative of AA, N-(2α,3β,23-acetoxyurs-12-en-28-oyl-L-proline methyl ester (AA-PMe, has improved efficacy over its parent compound, but its effect on blood vessel development remains unclear. Methods: In this study, we investigated the antiangiogenic activity of AA and AA-PMe in zebrafish embryos and human umbilical vein endothelial cells (HUVECs. First of all, we treated HUVECs with increasing concentrations of AA-PMe or AA, with or without vascular endothelial growth factor (VEGF present, and assessed cell viability, tube formation, and cell migration and invasion. Quantitative real-time polymerase chain reaction and Western blot analysis were later used to determine the role of vascular endothelial growth factor receptor 2 (VEGFR2-mediated signaling in AA-PMe inhibition of angiogenesis. We extended these studies to follow angiogenesis using Tg(fli:EGFP transgenic zebrafish embryos. For these experiments, embryos were treated with varying concentrations of AA-PMe or AA from 24 to 72 hours postfertilization prior to morphological observation, angiogenesis assessment, and endogenous alkaline

  3. Introducing the AAS Working Group on Astroinformatics and Astrostatistics

    Science.gov (United States)

    Ivezic, Zeljko

    2014-01-01

    In response to two White Papers submitted to the Astro2010 Decadal Survey (1,2), a new AAS Working Group on Astroinformatics and Astrostatistics (WGAA) has been approved by the AAS Council at the 220th Meeting, June 2012, in Anchorage. The motivation for this WG is the growing importance of the interface between astronomy and various branches of applied mathematics, computer science and the emerging field of data science. With the new data-intensive projects envisioned for the coming decade, the need for advice derived from the focused attention of a group of AAS members who work in these areas is bound to increase. The Working Group is charged with spreading awareness of rapidly advancing computational techniques, sophsticated statistical methods, and highly capble software to further the goals of astronomical and astrophysical research. The three main strategic goals adopted by the WGAA Steering Committee for the next few years are to: (i) develop, organize and maintain methodological resources (such as software tools, papers, books, and lectures); (ii) enhance human resources (such as foster the creation of career paths, establish a Speakers' Bureau, establish and maintain an archived discussion forum, enable periodic news distribution); and (iii) organize topical meetings. The WGAA Steering Committee at this time includes twelve members: Kirk Borne, George Djorgovski, Eric Feigelson, Eric Ford, Alyssa Goodman, Joe Hilbe, Zeljko Ivezic (chair), Ashish Mahabal, Aneta Siemiginowska, Alex Szalay, Rick White, and Padma Yanamandra-Fisher. I will summarize our accomplishments since July 2012. (1) Astroinformatics: A 21st Century Approach to Astronomy (Borne & 90 coauthors), (2) The Astronomical Information Sciences: A Keystone for 21st-Century Astronomy (Loredo & 72 coauthors)

  4. Effect of precipitates on mechanical properties of AA2195

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jae-Hee [Launcher Structure and Materials Team, Korea Aerospace Research Institute, Daejeon (Korea, Republic of); Jeun, Jeong-Hoon [Department of Materials Science and Engineering, Seoul National University, Seoul (Korea, Republic of); Chun, Hyun-Jin [Southeast University, Nanjing (China); Lee, Ye Rim [Department of Aerospace System Engineering, University of Science & Technology, Daejeon (Korea, Republic of); Yoo, Joon-Tae [Launcher Structure and Materials Team, Korea Aerospace Research Institute, Daejeon (Korea, Republic of); Yoon, Jong-Hoon [Launcher Structure and Materials Team, Korea Aerospace Research Institute, Daejeon (Korea, Republic of); Department of Aerospace System Engineering, University of Science & Technology, Daejeon (Korea, Republic of); Lee, Ho-Sung, E-mail: hslee@kari.re.kr [Launcher Structure and Materials Team, Korea Aerospace Research Institute, Daejeon (Korea, Republic of); Department of Aerospace System Engineering, University of Science & Technology, Daejeon (Korea, Republic of)

    2016-06-05

    Addition of 1–4 wt.% lithium into a conventional Al–Cu–Mg alloy allows lower density and higher mechanical properties, which are attractive for aerospace applications. In this study, fundamental investigations including phase and microstructure evolution, resulting in strengthening, of the AA2195 are conducted to observe a possibility of production with commercial level. Precipitation sequence and kinetics during post-annealing were evaluated with variations of temperature and holding time. Microstructures revealed formation and evolution in representative precipitates including θ (Al{sub 2}Cu), ß′ (Al{sub 3}Zr), and T (Al{sub x}Li{sub y}Cu) series. Aluminum alloys have low hardness, modulus, and strength before aging, but precipitates such as θ′ (Al{sub 2}Cu), ß′ (Al{sub 3}Zr), and T{sub 1} (Al{sub 2}LiCu) show enhanced mechanical properties of AA2195 tempered because of their interaction with dislocation. However, longer holding time and higher annealing temperature result in significant decreases in mechanical properties due to the presence of incoherent precipitates (θ phase) and coarsening of the precipitates via grain-boundary diffusion. In the current study, the tensile strength of 560 MPa was obtained with post-heat treatment without work hardening. This value has never been achieved in other studies. The maximum strength was reported as 500 MPa without a work hardening process. - Highlights: • A relationship between microstructure and mechanical properties to post annealing AA2195. • A formation and dissolution of the precipitates were observed for various treatment. • An optimum post-annealing condition was obtained.

  5. KIR genotyping in the selected population in Andhra Pradesh (India).

    Science.gov (United States)

    Vaishnav, G; Krupanidhi, S; Sanjeevi, C B

    2014-01-01

    The population is not always homogeneous in relation to the representation and functioning of genes. Therefore, the presence of allogenicity is a universal phenomenon. The profound variability is noticed among the members of the human population with reference to the resistance against infections and late onset of diseases. In this line, a few sets of alleles which come under the domain of immune function namely KIRs (Killer immunoglobulin-like receptor genes) and HLA-I have been chosen to report in the population of Puttaparthi (India). The genotyping of the population is the current ongoing focus of our team wherein the distribution of the following alleles has been taken up in the mixed ethnic groups of Puttaparthi as a prelude to earmark them as genotypic markers in future studies relating to susceptible diseases. The PCR protocols for the identified immune related genes viz., KIR- 2DL1, 2DL2, 2DL3, 2DL4, 2DL5, 3DL1, 3DL2, 3DL3, 3DS1, 2DS1, 2DS2, 2DS3, 2DS4, 2DS5, 2DP1, 3DP1; HLA- C1 and HLA-C2 have been standardized. In the present study, except KIR 2DL2, the other non-framework inhibitory KIR genes were represented at higher percentage and ranged from 57% to 80% in the chosen population which would suggest its higher survival adaptation. Interestingly, the majority of activating KIR genes were least represented and varied between 5% to 32.5% which is also in compliance with the survival adaptation of the chosen population. The carrier gene frequencies of KIRs were compared with the other populations' viz., Chinese Mongolian, Chinese Han, Greek and Brazilian data. The expected heterozygosity of KIR alleles and their rank in gene diversity among the population of Puttaparthi were also discussed.

  6. Extracting hot carriers from photoexcited semiconductor nanocrystals

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Xiaoyang

    2014-12-10

    This research program addresses a fundamental question related to the use of nanomaterials in solar energy -- namely, whether semiconductor nanocrystals (NCs) can help surpass the efficiency limits, the so-called “Shockley-Queisser” limit, in conventional solar cells. In these cells, absorption of photons with energies above the semiconductor bandgap generates “hot” charge carriers that quickly “cool” to the band edges before they can be utilized to do work; this sets the solar cell efficiency at a limit of ~31%. If instead, all of the energy of the hot carriers could be captured, solar-to-electric power conversion efficiencies could be increased, theoretically, to as high as 66%. A potential route to capture this energy is to utilize semiconductor nanocrystals. In these materials, the quasi-continuous conduction and valence bands of the bulk semiconductor become discretized due to confinement of the charge carriers. Consequently, the energy spacing between the electronic levels can be much larger than the highest phonon frequency of the lattice, creating a “phonon bottleneck” wherein hot-carrier relaxation is possible via slower multiphonon emission. For example, hot-electron lifetimes as long as ~1 ns have been observed in NCs grown by molecular beam epitaxy. In colloidal NCs, long lifetimes have been demonstrated through careful design of the nanocrystal interfaces. Due to their ability to slow electronic relaxation, semiconductor NCs can in principle enable extraction of hot carriers before they cool to the band edges, leading to more efficient solar cells.

  7. Carbon: Hydrogen carrier or disappearing skeleton?

    International Nuclear Information System (INIS)

    De Jong, K.P.; Van Wechem, H.M.H.

    1994-01-01

    The use of liquid hydrocarbons as energy carriers implies the use of carbon as a carrier for hydrogen to facilitate hydrogen transport and storage. The current trend for liquid energy carriers used in the transport sector is to maximize the load of hydrogen on the carbon carrier. The recently developed Shell Middle Distillate Hydrogenation process for the manufacture of high quality diesel from aromatic refinery streams fits this picture. In the future, the hydrogen required to raise the product H/C ratio will be increasingly produced via gasification of large amounts of heavy residues. In the light of the strong preference towards using liquid fuels in the transport sector, the Shell Middle Distillate Synthesis process to convert natural gas into diesel of very high quality is discussed. Finally, a few comments on the use of hydrogen without a carbon carrier are made. Long lead times and the likelihood of producing the 'first' hydrogen from fossil fuel are highlighted. 13 figs., 6 tabs., 5 refs

  8. Carrier transport in layered nanolaminated carbides

    Science.gov (United States)

    Konar, Aniruddha; Pandey, Rajan K.; Ethirajan, Tamilmani

    2017-10-01

    This paper summarizes the ab-initio electronic and phonon band structures and the temperature-dependent carrier transport in layered Ti2AlC. It is found that the cylindrical Fermi surface is the origin of the anisotropic carrier effective mass (infinite effective mass along the c axis), which leads to a strong anisotropic (insulator along the c axis and metallic along the layer) carrier transport in these films. Using electronic and phonon band structure calculations, we have developed an analytical model for the carrier-phonon interaction and the in-plane carrier conductivity originating from the strong inter-valley (s → d) scattering in Ti2AlC. The density functional theory is used to calculate the average deformation potential corresponding to the acoustic phonon vibrations. The calculated deformation potential is in good agreement with the extracted deformation potential from the transport data available in the literature. The extracted deformation potential will be useful for predicting the transport quantities of these metals at elevated temperatures.

  9. Estimating motor carrier management information system crash file underreporting from carrier records : research brief.

    Science.gov (United States)

    2017-08-01

    This study estimated a significant amount of underreporting to the MCMIS crash file by the States, for the carriers who cooperated in the study. For the study carriers, it appears that the MCMIS file contained about 66 percent of their reportable cra...

  10. Estimating Motor Carrier Management Information System Crash File Underreporting from Carrier Records.

    Science.gov (United States)

    2017-08-01

    This FMCSA-sponsored research investigated the claim that motor carriers have a substantial number of crashes in their own records that are not contained in the Motor Carrier Management Information System (MCMIS) crash file. Based on the results of t...

  11. Hepatitis C virus genotypes in Pakistan: a systemic review

    Directory of Open Access Journals (Sweden)

    Ali Ijaz

    2011-09-01

    Full Text Available Abstract Background and aim Phylogenetic analysis has led to the classification of hepatitis C virus (HCV into 1-6 major genotypes. HCV genotypes have different biological properties, clinical outcome and response to antiviral treatment and provide important clues for studying the epidemiology, transmission and pathogenesis. This article deepens the current molecular information about the geographical distribution of HCV genotypes and subgenotypes in population of four provinces of Pakistan. 34 published papers (1996-2011 related to prevalence of HCV genotypes/serotypes and subgenotypes in Pakistan were searched. Result HCV genotype/s distribution from all 34 studies was observed in 28,400 HCV infected individuals in the following pattern: 1,999 (7.03% cases of genotype 1; 1,085 (3.81% cases of genotype 2; 22,429 (78.96% cases of genotype 3; 453 (1.59% cases of genotype 4; 29 (0.10% cases of genotype 5; 37 (0.13% cases of genotype 6; 1,429 (5.03% cases of mixed genotypes, and 939 (3.30% cases of untypeable genotypes. Overall, genotype 3a was the predominant genotype with a rate of 55.10%, followed by genotype 1a, 3b and mixed genotype with a rate of 10.25%, 8.20%, and 5.08%, respectively; and genotypes 4, 5 and 6 were rare. Genotype 3 occurred predominately in all the provinces of Pakistan. Second more frequently genotype was genotype 1 in Punjab province and untypeable genotypes in Sindh, Khyber Pakhtunkhwa and Balochistan provinces.

  12. Inside Hall 193 for the Antiproton Accumulator (AA) ring

    CERN Multimedia

    1979-01-01

    Installation work is in full swing. A model quadrupole on the left shows where the magnet ring will be. The cables wound on drums are part of the pulse-forming network for the injection kicker. See Annual Report 1979 p. 103, Fig. 9 and photo 7911303. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  13. The effect of atmospheric corona treatment on AA1050 aluminium

    DEFF Research Database (Denmark)

    Jariyaboon, Manthana; Møller, Per; Dunin-Borkowski, Rafal E.

    2010-01-01

    The effect of atmospheric corona discharge on AM 050 aluminium surface was investigated using electrochemical polarization, SEM-EDX, FIB-SEM. and XPS. The corona treatment was performed with varying time (1, 5, and 15 min) in atmospheric air. A 200 nm oxide layer was generated on AA1050 after...... the 15 min air corona treatment. A significant reduction in anodic and cathodic reactivities was observed starting from 1 min exposure, which further decreased with prolonged exposure (15 min) and after delayed testing (after 30 days). The reduction in surface reactivity is due to the formation...

  14. Conscientiousness is Negatively Associated with Grey Matter Volume in Young APOE ɛ4-Carriers.

    Science.gov (United States)

    Kunz, Lukas; Reuter, Martin; Axmacher, Nikolai; Montag, Christian

    2017-01-01

    The etiology of late onset Alzheimer's disease (LOAD) depends on multiple factors, among which the APOE ɛ4 allele is the most adverse genetic determinant and conscientiousness represents an influential personality trait. A potential association of both factors with brain structure in young adulthood may constitute a constellation that sets the course toward or against the subtle disease progression of LOAD that starts decades before clinical manifestation. Hence, in the present study, we examined the modulating effects of APOE ɛ4 on the relation between personality dimensions, including conscientiousness, and total grey matter volume (GMV) in young healthy adults using an a priori genotyping design. 105 participants completed an inventory assessing the Five Factor Model of Personality (NEO-FFI) and a structural MRI scan. Total GMV was estimated using both Freesurfer as well as VBM8. Across all participants, total GMV was positively associated with extraversion and negatively related to age. In APOE ɛ4-carriers- but not in APOE ɛ4-non-carriers- conscientiousness was negatively associated with total GMV. In line with the hypothesis of antagonistic pleiotropy of the APOE ɛ4 allele, this result suggests that young APOE ɛ4-carriers with increased total GMV may particularly benefit from cognitive advantages and thus have a lower need to engage in conscientious behavior. In this subset of young APOE ɛ4-carriers, the reduction in conscientiousness could then bring along adverse health behavior in the long run, potentiating the risk for LOAD. Hence, young APOE ɛ4-carriers with increased total GMV may be at a particularly high risk for LOAD.

  15. High prevalence of hepatitis B virus genotype C/C1 in the Minangkabau ethnic group in Indonesia

    Directory of Open Access Journals (Sweden)

    Siburian Marlinang D

    2013-01-01

    Full Text Available Abstract Background The Minangkabau is one of the major ethnic groups in Indonesia. Previous studies with a limited number of samples have shown a different prevalence of HBV/C in the Minangkabau compared to the Indonesian population in general. The aim of this study was to assess the HBV genotype distribution pattern and the prevalence of pre-S, T1753V and A1762T/G1764A mutations among the Minangkabau HBV carriers. The samples were collected from Padang, West Sumatera and from western Java. Mixed primers for specific genotypes were used to determine the HBV genotype. Pre-S or S genes were amplified, sequenced and aligned with reference sequences from GenBank to derive a phylogenetic tree for subgenotyping. Pre-S genes were also analyzed for mutations. The basal core promoter (BCP region was amplified and directly sequenced to analyze T1753V and A1762T/G1764A mutations. Results The predominant HBV genotype among the Minangkabau HBV carriers (n=117 was C (72.6% followed by B (24.8% and co-infection with B and C (2.6%. The prevalence of pre-S mutations, including both the pre-S deletion and pre-S2 start codon mutation, was 41.0%, and the T1753V and A1762T/G1764A mutations were found in 51.9% and 71.2% respectively. HBV/C1 was the predominant HBV subgenotype in the Minangkabau HBV carriers, and was found in 66.2%, followed by B3, B7, C8, B2, B9, C2, and C10 (18.3%, 7.0%, 2.8%, 1.4%, 1.4%, 1.4%, and 1.4% respectively. From samples that were found to be co-infected with HBV B and C, two samples were successfully cloned and subgenotyped, including one with mixed subgenotypes of B3 and C1, and another one with mixed subgenotypes of B7, C1, putative intergenotypic of B/A, and C/A. Furthermore, three samples from donors of non-Minangkabau ethnicity from Padang were found to be infected with an intragenotypic recombination form, including a putative recombinant of B8/B3 and B9/B7. Conclusion HBV/C with subgenotype C1 was the predominant HBV genotype among

  16. Microstructural characterization of fly ash particulate reinforced AA6063 aluminium alloy for aerospace applications

    Science.gov (United States)

    Razzaq, A. M.; Majid, D. L. Abang Abdul; Ishak, M. R.; Uday, M. B.

    2017-12-01

    Aluminium-fly ash (FA) particulate reinforced composites (AA6063-FA) have been used in automotive and aerospace industries because of their low density and good mechanical properties. Three different weight fraction of FA: 2%, 4% and 6% are added to AA6063 alloy using compocasting method. The effect of FA particulates on microstructure, density and compression strength of AA6063- FA composites are investigated. Field Emission Scanning Electron Microscope (FESEM) micrographs reveal that the FA particulates are uniformly distributed in AA6063 alloy. The results also show that density, compression strength and microstructure of the AA6063-FA composites are significantly influenced by the FA amount. The increase in the weight fraction of FA will improve the microstructure and enhance the compression strength. The density of AA6063-FA composites decreases as the incorporation of FA increases.

  17. Bacillus thuringiensis Cry1Aa toxin-binding region of Bombyx mori aminopeptidase N.

    Science.gov (United States)

    Yaoi, K; Nakanishi, K; Kadotani, T; Imamura, M; Koizumi, N; Iwahana, H; Sato, R

    1999-12-17

    The Bacillus thuringiensis Cry1Aa toxin-binding region of Bombyx mori aminopeptidase N (APN) was analyzed, to better understand the molecular mechanism of susceptibility to the toxin and the development of resistance in insects. APN was digested with lysylendopeptidase and the ability of the resulting fragments to bind to Cry1Aa and 1Ac toxins was examined. The binding abilities of the two toxins to these fragments were different. The Cry1Aa toxin bound to the fragment containing 40-Asp to 313-Lys, suggesting that the Cry1Aa toxin-binding site is located in the region between 40-Asp and 313-Lys, while Cry1Ac toxin bound exclusively to mature APN. Next, recombinant APN of various lengths was expressed in Escherichia coli cells and its ability to bind to Cry1Aa toxin was examined. The results localized the Cry1Aa toxin binding to the region between 135-Ile and 198-Pro.

  18. Hepatitis B virus genotypes circulating in Brazil: molecular characterization of genotype F isolates.

    Science.gov (United States)

    Mello, Francisco C A; Souto, Francisco J D; Nabuco, Leticia C; Villela-Nogueira, Cristiane A; Coelho, Henrique Sergio M; Franz, Helena Cristina F; Saraiva, Joao Carlos P; Virgolino, Helaine A; Motta-Castro, Ana Rita C; Melo, Mabel M M; Martins, Regina M B; Gomes, Selma A

    2007-11-23

    Hepatitis B virus (HBV) isolates have been classified in eight genotypes, A to H, which exhibit distinct geographical distributions. Genotypes A, D and F are predominant in Brazil, a country formed by a miscegenated population, where the proportion of individuals from Caucasian, Amerindian and African origins varies by region. Genotype F, which is the most divergent, is considered indigenous to the Americas. A systematic molecular characterization of HBV isolates from different parts of the world would be invaluable in establishing HBV evolutionary origins and dispersion patterns. A large-scale study is needed to map the region-by-region distribution of the HBV genotypes in Brazil. Genotyping by PCR-RFLP of 303 HBV isolates from HBsAg-positive blood donors showed that at least two of the three genotypes, A, D, and F, co-circulate in each of the five geographic regions of Brazil. No other genotypes were identified. Overall, genotype A was most prevalent (48.5%), and most of these isolates were classified as subgenotype A1 (138/153; 90.2%). Genotype D was the most common genotype in the South (84.2%) and Central (47.6%) regions. The prevalence of genotype F was low (13%) countrywide. Nucleotide sequencing of the S gene and a phylogenetic analysis of 32 HBV genotype F isolates showed that a great majority (28/32; 87.5%) belonged to subgenotype F2, cluster II. The deduced serotype of 31 of 32 F isolates was adw4. The remaining isolate showed a leucine-to-isoleucine substitution at position 127. The presence of genotypes A, D and F, and the absence of other genotypes in a large cohort of HBV infected individuals may reflect the ethnic origins of the Brazilian population. The high prevalence of isolates from subgenotype A1 (of African origin) indicates that the African influx during the colonial slavery period had a major impact on the circulation of HBV genotype A currently found in Brazil. Although most genotype F isolates belonged to cluster II, the presence of some

  19. Hepatitis B virus genotypes circulating in Brazil: molecular characterization of genotype F isolates

    Directory of Open Access Journals (Sweden)

    Virgolino Helaine A

    2007-11-01

    Full Text Available Abstract Background Hepatitis B virus (HBV isolates have been classified in eight genotypes, A to H, which exhibit distinct geographical distributions. Genotypes A, D and F are predominant in Brazil, a country formed by a miscegenated population, where the proportion of individuals from Caucasian, Amerindian and African origins varies by region. Genotype F, which is the most divergent, is considered indigenous to the Americas. A systematic molecular characterization of HBV isolates from different parts of the world would be invaluable in establishing HBV evolutionary origins and dispersion patterns. A large-scale study is needed to map the region-by-region distribution of the HBV genotypes in Brazil. Results Genotyping by PCR-RFLP of 303 HBV isolates from HBsAg-positive blood donors showed that at least two of the three genotypes, A, D, and F, co-circulate in each of the five geographic regions of Brazil. No other genotypes were identified. Overall, genotype A was most prevalent (48.5%, and most of these isolates were classified as subgenotype A1 (138/153; 90.2%. Genotype D was the most common genotype in the South (84.2% and Central (47.6% regions. The prevalence of genotype F was low (13% countrywide. Nucleotide sequencing of the S gene and a phylogenetic analysis of 32 HBV genotype F isolates showed that a great majority (28/32; 87.5% belonged to subgenotype F2, cluster II. The deduced serotype of 31 of 32 F isolates was adw4. The remaining isolate showed a leucine-to-isoleucine substitution at position 127. Conclusion The presence of genotypes A, D and F, and the absence of other genotypes in a large cohort of HBV infected individuals may reflect the ethnic origins of the Brazilian population. The high prevalence of isolates from subgenotype A1 (of African origin indicates that the African influx during the colonial slavery period had a major impact on the circulation of HBV genotype A currently found in Brazil. Although most genotype F

  20. Maternal fatty acid desaturase genotype correlates with infant immune responses at 6 months

    DEFF Research Database (Denmark)

    Muc, Magdalena; Kreiner-Møller, Eskil; Larsen, Jeppe Madura

    2015-01-01

    Breast milk long-chain PUFA (LCPUFA) have been associated with changes in early life immune responses and may modulate T-cell function in infancy. We studied the effect of maternal fatty acid desaturase (FADS) genotype and breast milk LCPUFA levels on infants' blood T-cell profiles and ex vivo...... ex vivo-activated immune cells. We observed no association between T-cell distribution and maternal or infant FADS gene variants. We conclude that increased maternal LCPUFA synthesis and breast milk AA are associated with decreased levels of IL-5, IL-13 (type-2 related), IL-17 (type-17 related......) and IL-10 (regulatory immune responses), but not with interferon-γ and TNF-α, which could be due to an effect of the maternal FADS variants on the offspring immune response transferred via breast milk LCPUFA. Copyright © The Authors 2015....

  1. in common bean ( Phaseolus Vulgaris L.) genotypes

    African Journals Online (AJOL)

    Bako, Boshe and Gute) and years (2004 – 2005) with the objective of identifying high yielding, stable and adaptable varieties for western parts of Ethiopia. Regression and AMMI analysis were computed to identify stable genotypes across ...

  2. Global distribution of novel rhinovirus genotype

    DEFF Research Database (Denmark)

    Briese, Thomas; Renwick, Neil; Venter, Marietjie

    2008-01-01

    Global surveillance for a novel rhinovirus genotype indicated its association with community outbreaks and pediatric respiratory disease in Africa, Asia, Australia, Europe, and North America. Molecular dating indicates that these viruses have been circulating for at least 250 years Udgivelsesdato...

  3. HMSRP Hawaiian Monk Seal Microsatellite Genotypes

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Currently ~2,400 Hawaiian monk seal specimens have been analyzed genetically, providing genotypes at 18 microsatellite loci. These data are organized by individual,...

  4. Hearing impairment in genotyped Wolfram syndrome patients.

    NARCIS (Netherlands)

    Plantinga, R.F.; Pennings, R.J.E.; Huygen, P.L.M.; Bruno, R.; Eller, P.; Barrett, T.G.; Vialettes, B.; Paquis-Fluklinger, V.; Lombardo, F.; Cremers, C.W.R.J.

    2008-01-01

    OBJECTIVES: Wolfram syndrome is a progressive neurodegenerative syndrome characterized by the features "DIDMOAD" (diabetes insipidus, diabetes mellitus, optic atrophy, and deafness). We sought to study the audiometric data of genotyped Wolfram syndrome patients with sensorineural hearing impairment.

  5. Forensic SNP genotyping with SNaPshot

    DEFF Research Database (Denmark)

    Fondevila, M; Børsting, C; Phillips, C

    2017-01-01

    This review explores the key factors that influence the optimization, routine use, and profile interpretation of the SNaPshot single-base extension (SBE) system applied to forensic single-nucleotide polymorphism (SNP) genotyping. Despite being a mainly complimentary DNA genotyping technique...... to routine STR profiling, use of SNaPshot is an important part of the development of SNP sets for a wide range of forensic applications with these markers, from genotyping highly degraded DNA with very short amplicons to the introduction of SNPs to ascertain the ancestry and physical characteristics...... of an unidentified contact trace donor. However, this technology, as resourceful as it is, displays several features that depart from the usual STR genotyping far enough to demand a certain degree of expertise from the forensic analyst before tackling the complex casework on which SNaPshot application provides...

  6. Candidate genetic modifiers for breast and ovarian cancer risk in BRCA1 and BRCA2 mutation carriers

    Science.gov (United States)

    Peterlongo, Paolo; Chang-Claude, Jenny; Moysich, Kirsten B.; Rudolph, Anja; Schmutzler, Rita K.; Simard, Jacques; Soucy, Penny; Eeles, Rosalind A.; Easton, Douglas F.; Hamann, Ute; Wilkening, Stefan; Chen, Bowang; Rookus, Matti A.; Schmidt, Marjanka K; van der Baan, Frederieke H.; Spurdle, Amanda B.; Walker, Logan C.; Lose, Felicity; Maia, Ana-Teresa; Montagna, Marco; Matricardi, Laura; Lubinski, Jan; Jakubowska, Anna; Gómez Garcia, Encarna B.; Olopade, Olufunmilayo I.; Nussbaum, Robert L.; Nathanson, Katherine L.; Domchek, Susan M.; Rebbeck, Timothy R.; Arun, Banu K.; Karlan, Beth Y.; Orsulic, Sandra; Lester, Jenny; Chung, Wendy K.; Miron, Alex; Southey, Melissa C.; Goldgar, David E.; Buys, Saundra S.; Janavicius, Ramunas; Dorfling, Cecilia M.; van Rensburg, Elizabeth J.; Ding, Yuan Chun; Neuhausen, Susan L.; Hansen, Thomas V. O.; Gerdes, Anne-Marie; Ejlertsen, Bent; Jønson, Lars; Osorio, Ana; Martínez-Bouzas, Cristina; Benitez, Javier; Conway, Edye E.; Blazer, Kathleen R.; Weitzel, Jeffrey N.; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Barile, Monica; Ficarazzi, Filomena; Mariette, Frederique; Fortuzzi, Stefano; Viel, Alessandra; Giannini, Giuseppe; Papi, Laura; Martayan, Aline; Tibiletti, Maria Grazia; Radice, Paolo; Vratimos, Athanassios; Fostira, Florentia; Garber, Judy E.; Donaldson, Alan; Brewer, Carole; Foo, Claire; Evans, D. Gareth R.; Frost, Debra; Eccles, Diana; Brady, Angela; Cook, Jackie; Tischkowitz, Marc; Adlard, Julian; Barwell, Julian; Walker, Lisa; Izatt, Louise; Side, Lucy E.; Kennedy, M. John; Rogers, Mark T.; Porteous, Mary E.; Morrison, Patrick J.; Platte, Radka; Davidson, Rosemarie; Hodgson, Shirley V.; Ellis, Steve; Cole, Trevor; Godwin, Andrew K.; Claes, Kathleen; Van Maerken, Tom; Meindl, Alfons; Gehrig, Andrea; Sutter, Christian; Engel, Christoph; Niederacher, Dieter; Steinemann, Doris; Plendl, Hansjoerg; Kast, Karin; Rhiem, Kerstin; Ditsch, Nina; Arnold, Norbert; Varon-Mateeva, Raymonda; Wappenschmidt, Barbara; Wang-Gohrke, Shan; Bressac-de Paillerets, Brigitte; Buecher, Bruno; Delnatte, Capucine; Houdayer, Claude; Stoppa-Lyonnet, Dominique; Damiola, Francesca; Coupier, Isabelle; Barjhoux, Laure; Venat-Bouvet, Laurence; Golmard, Lisa; Boutry-Kryza, Nadia; Sinilnikova, Olga M.; Caron, Olivier; Pujol, Pascal; Mazoyer, Sylvie; Belotti, Muriel; Piedmonte, Marion; Friedlander, Michael L.; Rodriguez, Gustavo C.; Copeland, Larry J; de la Hoya, Miguel; Segura, Pedro Perez; Nevanlinna, Heli; Aittomäki, Kristiina; van Os, Theo A.M.; Meijers-Heijboer, Hanne E.J.; van der Hout, Annemarie H.; Vreeswijk, Maaike P.G.; Hoogerbrugge, Nicoline; Ausems, Margreet G.E.M.; van Doorn, Helena C.; Collée, J. Margriet; Olah, Edith; Diez, Orland; Blanco, Ignacio; Lazaro, Conxi; Brunet, Joan; Feliubadalo, Lidia; Cybulski, Cezary; Gronwald, Jacek; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Sukiennicki, Grzegorz; Arason, Adalgeir; Chiquette, Jocelyne; Teixeira, Manuel R.; Olswold, Curtis; Couch, Fergus J.; Lindor, Noralane M.; Wang, Xianshu; Szabo, Csilla I.; Offit, Kenneth; Corines, Marina; Jacobs, Lauren; Robson, Mark E.; Zhang, Liying; Joseph, Vijai; Berger, Andreas; Singer, Christian F.; Rappaport, Christine; Kaulich, Daphne Geschwantler; Pfeiler, Georg; Tea, Muy-Kheng M.; Phelan, Catherine M.; Greene, Mark H.; Mai, Phuong L.; Rennert, Gad; Mulligan, Anna Marie; Glendon, Gord; Tchatchou, Sandrine; Andrulis, Irene L.; Toland, Amanda Ewart; Bojesen, Anders; Pedersen, Inge Sokilde; Thomassen, Mads; Jensen, Uffe Birk; Laitman, Yael; Rantala, Johanna; von Wachenfeldt, Anna; Ehrencrona, Hans; Askmalm, Marie Stenmark; Borg, Åke; Kuchenbaecker, Karoline B.; McGuffog, Lesley; Barrowdale, Daniel; Healey, Sue; Lee, Andrew; Pharoah, Paul D.P.; Chenevix-Trench, Georgia; Antoniou, Antonis C.; Friedman, Eitan

    2014-01-01

    Background BRCA1 and BRCA2 mutation carriers are at substantially increased risk for developing breast and ovarian cancer. The incomplete penetrance coupled with the variable age at diagnosis in carriers of the same mutation suggests the existence of genetic and non-genetic modifying factors. In this study we evaluated the putative role of variants in many candidate modifier genes. Methods Genotyping data from 15,252 BRCA1 and 8,211 BRCA2 mutation carriers, for known variants (n=3,248) located within or around 445 candidate genes, were available through the iCOGS custom-designed array. Breast and ovarian cancer association analysis was performed within a retrospective cohort approach. Results The observed p-values of association ranged between 0.005-1.000. None of the variants was significantly associated with breast or ovarian cancer risk in either BRCA1 or BRCA2 mutation carriers, after multiple testing adjustments. Conclusion There is little evidence that any of the evaluated candidate variants act as modifiers of breast and/or ovarian cancer risk in BRCA1 or BRCA2 mutation carriers. Impact Genome-wide association studies have been more successful at identifying genetic modifiers of BRCA1/2 penetrance than candidate gene studies. PMID:25336561

  7. Candidate genetic modifiers for breast and ovarian cancer risk in BRCA1 and BRCA2 mutation carriers.

    Science.gov (United States)

    Peterlongo, Paolo; Chang-Claude, Jenny; Moysich, Kirsten B; Rudolph, Anja; Schmutzler, Rita K; Simard, Jacques; Soucy, Penny; Eeles, Rosalind A; Easton, Douglas F; Hamann, Ute; Wilkening, Stefan; Chen, Bowang; Rookus, Matti A; Schmidt, Marjanka K; van der Baan, Frederieke H; Spurdle, Amanda B; Walker, Logan C; Lose, Felicity; Maia, Ana-Teresa; Montagna, Marco; Matricardi, Laura; Lubinski, Jan; Jakubowska, Anna; Gómez Garcia, Encarna B; Olopade, Olufunmilayo I; Nussbaum, Robert L; Nathanson, Katherine L; Domchek, Susan M; Rebbeck, Timothy R; Arun, Banu K; Karlan, Beth Y; Orsulic, Sandra; Lester, Jenny; Chung, Wendy K; Miron, Alex; Southey, Melissa C; Goldgar, David E; Buys, Saundra S; Janavicius, Ramunas; Dorfling, Cecilia M; van Rensburg, Elizabeth J; Ding, Yuan Chun; Neuhausen, Susan L; Hansen, Thomas V O; Gerdes, Anne-Marie; Ejlertsen, Bent; Jønson, Lars; Osorio, Ana; Martínez-Bouzas, Cristina; Benitez, Javier; Conway, Edye E; Blazer, Kathleen R; Weitzel, Jeffrey N; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Barile, Monica; Ficarazzi, Filomena; Mariette, Frederique; Fortuzzi, Stefano; Viel, Alessandra; Giannini, Giuseppe; Papi, Laura; Martayan, Aline; Tibiletti, Maria Grazia; Radice, Paolo; Vratimos, Athanassios; Fostira, Florentia; Garber, Judy E; Donaldson, Alan; Brewer, Carole; Foo, Claire; Evans, D Gareth R; Frost, Debra; Eccles, Diana; Brady, Angela; Cook, Jackie; Tischkowitz, Marc; Adlard, Julian; Barwell, Julian; Walker, Lisa; Izatt, Louise; Side, Lucy E; Kennedy, M John; Rogers, Mark T; Porteous, Mary E; Morrison, Patrick J; Platte, Radka; Davidson, Rosemarie; Hodgson, Shirley V; Ellis, Steve; Cole, Trevor; Godwin, Andrew K; Claes, Kathleen; Van Maerken, Tom; Meindl, Alfons; Gehrig, Andrea; Sutter, Christian; Engel, Christoph; Niederacher, Dieter; Steinemann, Doris; Plendl, Hansjoerg; Kast, Karin; Rhiem, Kerstin; Ditsch, Nina; Arnold, Norbert; Varon-Mateeva, Raymonda; Wappenschmidt, Barbara; Wang-Gohrke, Shan; Bressac-de Paillerets, Brigitte; Buecher, Bruno; Delnatte, Capucine; Houdayer, Claude; Stoppa-Lyonnet, Dominique; Damiola, Francesca; Coupier, Isabelle; Barjhoux, Laure; Venat-Bouvet, Laurence; Golmard, Lisa; Boutry-Kryza, Nadia; Sinilnikova, Olga M; Caron, Olivier; Pujol, Pascal; Mazoyer, Sylvie; Belotti, Muriel; Piedmonte, Marion; Friedlander, Michael L; Rodriguez, Gustavo C; Copeland, Larry J; de la Hoya, Miguel; Segura, Pedro Perez; Nevanlinna, Heli; Aittomäki, Kristiina; van Os, Theo A M; Meijers-Heijboer, Hanne E J; van der Hout, Annemarie H; Vreeswijk, Maaike P G; Hoogerbrugge, Nicoline; Ausems, Margreet G E M; van Doorn, Helena C; Collée, J Margriet; Olah, Edith; Diez, Orland; Blanco, Ignacio; Lazaro, Conxi; Brunet, Joan; Feliubadalo, Lidia; Cybulski, Cezary; Gronwald, Jacek; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Sukiennicki, Grzegorz; Arason, Adalgeir; Chiquette, Jocelyne; Teixeira, Manuel R; Olswold, Curtis; Couch, Fergus J; Lindor, Noralane M; Wang, Xianshu; Szabo, Csilla I; Offit, Kenneth; Corines, Marina; Jacobs, Lauren; Robson, Mark E; Zhang, Liying; Joseph, Vijai; Berger, Andreas; Singer, Christian F; Rappaport, Christine; Kaulich, Daphne Geschwantler; Pfeiler, Georg; Tea, Muy-Kheng M; Phelan, Catherine M; Greene, Mark H; Mai, Phuong L; Rennert, Gad; Mulligan, Anna Marie; Glendon, Gord; Tchatchou, Sandrine; Andrulis, Irene L; Toland, Amanda Ewart; Bojesen, Anders; Pedersen, Inge Sokilde; Thomassen, Mads; Jensen, Uffe Birk; Laitman, Yael; Rantala, Johanna; von Wachenfeldt, Anna; Ehrencrona, Hans; Askmalm, Marie Stenmark; Borg, Åke; Kuchenbaecker, Karoline B; McGuffog, Lesley; Barrowdale, Daniel; Healey, Sue; Lee, Andrew; Pharoah, Paul D P; Chenevix-Trench, Georgia; Antoniou, Antonis C; Friedman, Eitan

    2015-01-01

    BRCA1 and BRCA2 mutation carriers are at substantially increased risk for developing breast and ovarian cancer. The incomplete penetrance coupled with the variable age at diagnosis in carriers of the same mutation suggests the existence of genetic and nongenetic modifying factors. In this study, we evaluated the putative role of variants in many candidate modifier genes. Genotyping data from 15,252 BRCA1 and 8,211 BRCA2 mutation carriers, for known variants (n = 3,248) located within or around 445 candidate genes, were available through the iCOGS custom-designed array. Breast and ovarian cancer association analysis was performed within a retrospective cohort approach. The observed P values of association ranged between 0.005 and 1.000. None of the variants was significantly associated with breast or ovarian cancer risk in either BRCA1 or BRCA2 mutation carriers, after multiple testing adjustments. There is little evidence that any of the evaluated candidate variants act as modifiers of breast and/or ovarian cancer risk in BRCA1 or BRCA2 mutation carriers. Genome-wide association studies have been more successful at identifying genetic modifiers of BRCA1/2 penetrance than candidate gene studies. ©2014 American Association for Cancer Research.

  8. Natural carriers in bioremediation: A review

    Directory of Open Access Journals (Sweden)

    Anna Dzionek

    2016-09-01

    Full Text Available Bioremediation of contaminated groundwater or soil is currently the cheapest and the least harmful method of removing xenobiotics from the environment. Immobilization of microorganisms capable of degrading specific contaminants significantly promotes bioremediation processes, reduces their costs, and also allows for the multiple use of biocatalysts. Among the developed methods of immobilization, adsorption on the surface is the most common method in bioremediation, due to the simplicity of the procedure and its non-toxicity. The choice of carrier is an essential element for successful bioremediation. It is also important to consider the type of process (in situ or ex situ, type of pollution, and properties of immobilized microorganisms. For these reasons, the article summarizes recent scientific reports about the use of natural carriers in bioremediation, including efficiency, the impact of the carrier on microorganisms and contamination, and the nature of the conducted research.

  9. Hiding secret data into a carrier image

    Directory of Open Access Journals (Sweden)

    Ovidiu COSMA

    2012-06-01

    Full Text Available The object of steganography is embedding hidden information in an appropriate multimedia carrier, e.g., image, audio, or video. There are several known methods of solving this problem, which operate either in the space domain or in the frequency domain, and are distinguished by the following characteristics: payload, robustness and strength. The payload is the amount of secret data that can be embedded in the carrier without inducing suspicious artefacts, robustness indicates the degree in which the secret data is affected by the normal processing of the carrier e.g., compression, and the strength indicate how easy the presence of hidden data can be detected by steganalysis techniques. This paper presents a new method of hiding secret data into a digital image compressed by a technique based on the Discrete Wavelet Transform (DWT [2] and the Set Partitioning In Hierarchical Trees (SPIHT subband coding algorithm [6]. The proposed method admits huge payloads and has considerable strength.

  10. Development of radioisotope labeled polymeric carriers

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Seung Jin; Jeong, Jea Min; Hwang, Hyun Jeong [Ewha Womans University, Seoul (Korea)

    2000-04-01

    This research was performed with the aim of developing polymeric radioisotope or drug carriers for obtaining efficient diagnostic therapeutic efficacy. As polymers, polyethylene oxides, polylactides, polycaprolactone were chosen to prepare the devices including micelle system, microemulsion, nanospheres. In addition, anticancer drug loaded polylactide microparticulates were fabricated as a regional chemotherapeutics for the treatment of cancer. Technetium or radioactive iodine was labeled to the polymeric carriers via ligands such as DTPA and HPP, respectively. Labeling efficiency was above 90% and stable enough up to 24 hours. Moreover, injected polymer carriers demonstrated higher blood maintenance and bone uptake than Tin colloid, a control. These results suggested that radioisotope carrying polymeric particulate are promising tools for diagnosing blood vessels or bones. Besides, anticancer drug loaded particulates demonstrated appropriate maintenance of therapeutic concentration and localization. Therefore it was proposed that this therapeutic system may be potential as a cancer therapy modality. 20 refs., 24 figs.,5 tabs. (Author)

  11. Comparison of calculated and experimentally determined SID of CP and AA in complex diets differing in AA contents for grower finisher pigs.

    Science.gov (United States)

    Büsing, K; Berk, A; Müller, S; Kieckhäven, S; Krüger, K; Zeyner, A

    2017-10-01

    In practice, the content of standardized ileal digestible AA in complex feeds for pigs is calculated on the basis of tabulated values for individual feedstuffs. It comes into question, however, whether this truly reflects an accurate content based upon the estimate made for the individual feedstuffs. The objective of this study was to compare standardized ileal digestibility (SID) of crude protein (CP) and selected AA in complex feeds for grower and finisher pigs either calculated or experimentally determined. Six diets with increasing AA levels were prepared for grower (BW from 30 to 70 kg) and finisher (BW from 70 to 120 kg) feed. Crystalline L-lys, DL-met and L-thr were added to both diets, L-trp and L-val only to the grower feed. SID of both CP and AA was calculated from feed tables and experimentally determined in six adult minipigs (MINILEWE) with ileorectal anastomosis. With increasing AA levels, experimentally determined SID of supplemented AA increased (p AA via tabulated values for individual feedstuffs, however, seems to be acceptable for practical use. Journal of Animal Physiology and Animal Nutrition © 2017 Blackwell Verlag GmbH.

  12. Pancreaticobiliary cancers with deficient methylenetetrahydrofolate reductase genotypes.

    Science.gov (United States)

    Matsubayashi, Hiroyuki; Skinner, Halcyon G; Iacobuzio-Donahue, Christine; Abe, Tadayoshi; Sato, Norihiro; Riall, Taylor Sohn; Yeo, Charles J; Kern, Scott E; Goggins, Michael

    2005-08-01

    Methyl group deficiency might promote carcinogenesis by inducing DNA breaks and DNA hypomethylation. We hypothesized that deficient methylenetetrahydrofolate reductase (MTHFR) genotypes could promote pancreatic cancer development. First, we performed a case-control study of germline MTHFR polymorphisms (C677T, A1298C) in 303 patients with pancreatic cancer and 305 matched control subjects. Pancreatic neoplasms frequently lose an MTHFR allele during tumorigenesis; we hypothesized that such loss could promote carcinogenesis. We therefore evaluated the cancer MTHFR genotypes of 82 patients with pancreaticobiliary cancers and correlated them to genome-wide measures of chromosomal deletion by using 386 microsatellite markers. Finally, MTHFR genotypes were correlated with global DNA methylation in 68 cancer cell lines. Germline MTHFR polymorphisms were not associated with an increased likelihood of having pancreatic cancer. Fractional allelic loss (a measure of chromosomal loss) trended higher in cancers with 677T genotypes than in cancers with other genotypes (P = .055). Among cancers with loss of an MTHFR allele, cancers with 677T MTHFR alleles had more deletions at folate-sensitive fragile sites (36.9%) and at tumor suppressor gene loci (68.5%) than 677C cancers (28.7% and 47.8%, P = .079 and .014, respectively). LINE1 methylation was lower in cancers with less functional 677T/TT genotypes (24.4%) than in those with 677CT (26.0%) and CC/C genotypes (32.5%) (P = .014). Cancers with defective MTHFR genotypes have more DNA hypomethylation and more chromosomal losses. Deficient MTHFR function due to loss of an MTHFR allele by an evolving neoplasm might, by promoting chromosomal losses, accelerate cancer development.

  13. Genotype List String: a grammar for describing HLA and KIR genotyping results in a text string.

    Science.gov (United States)

    Milius, R P; Mack, S J; Hollenbach, J A; Pollack, J; Heuer, M L; Gragert, L; Spellman, S; Guethlein, L A; Trachtenberg, E A; Cooley, S; Bochtler, W; Mueller, C R; Robinson, J; Marsh, S G E; Maiers, M

    2013-08-01

    Knowledge of an individual's human leukocyte antigen (HLA) genotype is essential for modern medical genetics, and is crucial for hematopoietic stem cell and solid-organ transplantation. However, the high levels of polymorphism known for the HLA genes make it difficult to generate an HLA genotype that unambiguously identifies the alleles that are present at a given HLA locus in an individual. For the last 20 years, the histocompatibility and immunogenetics community has recorded this HLA genotyping ambiguity using allele codes developed by the National Marrow Donor Program (NMDP). While these allele codes may have been effective for recording an HLA genotyping result when initially developed, their use today results in increased ambiguity in an HLA genotype, and they are no longer suitable in the era of rapid allele discovery and ultra-high allele polymorphism. Here, we present a text string format capable of fully representing HLA genotyping results. This Genotype List (GL) String format is an extension of a proposed standard for reporting killer-cell immunoglobulin-like receptor (KIR) genotype data that can be applied to any genetic data that use a standard nomenclature for identifying variants. The GL String format uses a hierarchical set of operators to describe the relationships between alleles, lists of possible alleles, phased alleles, genotypes, lists of possible genotypes, and multilocus unphased genotypes, without losing typing information or increasing typing ambiguity. When used in concert with appropriate tools to create, exchange, and parse these strings, we anticipate that GL Strings will replace NMDP allele codes for reporting HLA genotypes. © 2013 The Authors. Tissue Antigens published by John Wiley & Sons Ltd.

  14. Genotype-specific interactions between parasitic arthropods.

    Science.gov (United States)

    Orsucci, M; Navajas, M; Fellous, S

    2017-03-01

    Despite the ubiquity of coinfection, we know little of the effects of intra-specific genetic variability on coinfection by distinct parasite species. Here we test the hypothesis that parasite multiplication depends on the combination of parasite genotypes that coinfect the host (that is Genotype. parasite × Genotype .parasite interaction). To that aim, we infected tomato leaves with the ecto-parasitic mites Tetranychus urticae and Tetranychus evansi. We tested all possible combinations between four T. urticae and two T. evansi populations sampled on different hosts or localities. There was no universal (that is genotype-independent) effect of coinfection on mite multiplication; in many cases the two species had no effect on each other. However, several combinations of T. evansi and T. urticae populations led to elevated T. evansi numbers. Similarly, T. urticae reproduction largely depended on the interaction between T. urticae and T. evansi populations. This evidence for genotype-by-genotype interaction between coinfecting parasites indicates that the effect of coinfection on parasite epidemiology and evolution may vary in space according to the genetic composition of local parasite populations; it further suggests the possibility of coevolution between parasites species that share the same hosts.

  15. The effects of metallothionein 2A polymorphism on lead metabolism: are pregnant women with a heterozygote genotype for metallothionein 2A polymorphism and their newborns at risk of having higher blood lead levels?

    Science.gov (United States)

    Tekin, Deniz; Kayaaltı, Zeliha; Söylemezoğlu, Tülin

    2012-08-01

    Numerous studies indicate that certain genetic polymorphisms modify lead toxicokinetics. Metallothioneins are protective against the toxicity of many metals, including lead. The aim of this study was to determine whether the maternal metallothionein 2A (MT2A) -5 A/G single-nucleotide polymorphism is related to the lead levels in maternal blood, placental tissue and cord blood in 91 pregnant women and their newborns. Venous blood from the mother was collected to investigate lead levels and MT2A polymorphism. Cord blood and placenta were collected for lead levels. Analyses were made using an Atomic Absorption Graphite Furnace Spectrophotometer. Standard PCR-RFLP technique was used to determine MT2A polymorphism. Blood lead levels of heterozygote genotype (AG) mothers were statistically higher than those of homozygote genotype (AA) (P lead levels were significantly associated with cord blood lead levels for pregnant women with AA genotype (P lead level for newborns with mothers of AG genotype was slightly higher than others, though the difference was not significant. No significant difference existed in placenta lead levels between the groups. This study suggests that pregnant women with AG genotype for MT2A polymorphism might have high blood lead levels and their newborns may be at risk of low-level cord blood lead variation.

  16. Experimental transmission of systemic AA amyloidosis in autoimmune disease and type 2 diabetes mellitus model mice

    Science.gov (United States)

    Maeda, Mayuko; Murakami, Tomoaki; Muhammad, Naeem; Inoshima, Yasuo; Ishiguro, Naotaka

    2016-01-01

    AA amyloidosis is a protein misfolding disease characterized by extracellular deposition of amyloid A (AA) fibrils. AA amyloidosis has been identified in food animals, and it has been postulated that AA amyloidosis may be transmissible to different animal species. Since the precursor protein of AA fibrils is serum amyloid A (SAA), which is an inflammatory acute phase protein, AA amyloidosis is considered to be associated with inflammatory diseases such as rheumatoid arthritis. Chronic diseases such as autoimmune disease and type 2 diabetes mellitus could be potential factors for AA amyloidosis. In this study, to examine the relationship between the induction of AA amyloidosis and chromic abnormalities such as autoimmune disease or type 2 diabetes mellitus, amyloid fibrils from mice, cattle, or chickens were experimentally injected into disease model mice. Wild-type mice were used as controls. The concentrations of SAA, IL-6, and IL-10 in autoimmune disease model mice were higher than those of control mice. However, induction of AA amyloidosis in autoimmune disease and type 2 diabetes mellitus model mice was lower than that in control mice, and the amount of amyloid deposits in the spleens of both mouse models was lower than that of control mice according to Congo red staining and immunohistochemistry. These results suggest that factors other than SAA levels, such as an inflammatory or anti-inflammatory environment in the immune response, may be involved in amyloid deposition. PMID:27321428

  17. Prevalence, Attitude, Knowledge, and Practice of Anabolic Androgenic Steroid (AAS) Use Among Gym Participants.

    Science.gov (United States)

    Althobiti, Sami D; Alqurashi, Nassar M; Alotaibi, Abdulmajeed S; Alharthi, Turki F; Alswat, Khaled A

    2018-03-01

    Anabolic steroids (AS) are synthetic testosterone derivatives that last longer than physiological androgens in the body. Anabolic-androgenic steroid (AAS) abuse is spreading among athletes. The aim of this study is to assess the knowledge, attitudes, and practices of gym participants in Saudi Arabia. A cross-sectional survey was carried out among gym users from February 2017 to May 2017. The questionnaire included information on demographics related to the use of AAS and lifestyle habits. Any willing male gym participant could be included. A total of 4860 male gym participants with a mean age of 28.6 ± 6.2 years were included. A majority were single, with a bachelor's degree or higher. Moreover, 9.8% of the participants used AAS, of which 76.7% reported improved fitness. Friends were the main source of AAS-related information, but only 38.0% of AAS users sought medical consults. The oral route was most common, and testosterone enanthate was the AAS most used. Also, 9.8% of gym participants used AAS and were more likely to be involved in risky habits, such as smoking and growth hormone abuse. They were less aware of potential complications of AAS, with gym trainers being the predominant source of AAS substances.

  18. Lu AA21004, a novel multimodal antidepressantwith activity exerted through serotonergic targets

    DEFF Research Database (Denmark)

    Mork, A.; Pehrson, A.; Montezinho, L. C. P.

    2012-01-01

    of contextual memory in rats were studied in the fear conditioning paradigm, and episodic memory was evaluated in the novel object recognition test. Results: Administration of Lu AA21004 (0.1-10 mg/kg, sc) demonstrated that the compound dose-dependently occupied the studied targets. Moreover, Lu AA21004...... increased extracellular levels of 5-HT, NA, DA, ACh and Hist in the brain. Lu AA21004 counteracted the immobility of FSL rats in the forced swim test and enhanced memory of the rats in the cognition models. Conclusions: Lu AA21004 in vivo engages relevant targets and affects several neurotransmitter systems...

  19. Spontaneous, Experimentally Induced, and Transmissible AA Amyloidosis in Japanese Quail ( Coturnix japonica).

    Science.gov (United States)

    Nakayama, Yumi; Kamiie, Junichi; Watanabe, Gen; Suzuki, Kazuhiko; Murakami, Tomoaki

    2017-11-01

    The authors describe a spontaneous case of amyloid A (AA) amyloidosis in an adult female Japanese quail ( Coturnix japonica). The bird developed AA amyloidosis secondary to chronic peritonitis caused by a Gram-negative bacillus infection. Mild amyloid deposition was also identified in the intestinal tract of apparently healthy adult individuals, suggesting that quail may develop intestinal amyloidosis with age. Based on these observations, it was hypothesized that quail can develop AA amyloidosis following inflammatory stimulation with lipopolysaccharide (LPS). Therefore, adult quail were repeatedly injected with LPS and the development of AA amyloidosis was confirmed. The amyloid deposition in this model increased when quail amyloid was intravenously injected as an amyloid-enhancing factor. The experiments were repeated with young quail, but amyloid deposits were not observed following LPS injections. However, AA amyloidosis did develop when quail amyloid was injected in addition to LPS. These results indicated that adult quail develop AA amyloidosis after inflammatory stimulation with LPS. Furthermore, quail AA amyloidosis was shown to have transmissibility regardless of age. Interestingly, the authors found that administration of chicken amyloid fibrils also induced AA amyloidosis in young quail. This is the first report of cross-species transmission of avian AA amyloidosis.

  20. Experimental transmission of systemic AA amyloidosis in autoimmune disease and type 2 diabetes mellitus model mice.

    Science.gov (United States)

    Maeda, Mayuko; Murakami, Tomoaki; Muhammad, Naeem; Inoshima, Yasuo; Ishiguro, Naotaka

    2016-11-01

    AA amyloidosis is a protein misfolding disease characterized by extracellular deposition of amyloid A (AA) fibrils. AA amyloidosis has been identified in food animals, and it has been postulated that AA amyloidosis may be transmissible to different animal species. Since the precursor protein of AA fibrils is serum amyloid A (SAA), which is an inflammatory acute phase protein, AA amyloidosis is considered to be associated with inflammatory diseases such as rheumatoid arthritis. Chronic diseases such as autoimmune disease and type 2 diabetes mellitus could be potential factors for AA amyloidosis. In this study, to examine the relationship between the induction of AA amyloidosis and chromic abnormalities such as autoimmune disease or type 2 diabetes mellitus, amyloid fibrils from mice, cattle, or chickens were experimentally injected into disease model mice. Wild-type mice were used as controls. The concentrations of SAA, IL-6, and IL-10 in autoimmune disease model mice were higher than those of control mice. However, induction of AA amyloidosis in autoimmune disease and type 2 diabetes mellitus model mice was lower than that in control mice, and the amount of amyloid deposits in the spleens of both mouse models was lower than that of control mice according to Congo red staining and immunohistochemistry. These results suggest that factors other than SAA levels, such as an inflammatory or anti-inflammatory environment in the immune response, may be involved in amyloid deposition.

  1. Antiangiogenic effects of AA-PMe on HUVECs in vitro and zebrafish in vivo.

    Science.gov (United States)

    Jing, Yue; Wang, Gang; Xiao, Qi; Zhou, Yachun; Wei, Yingjie; Gong, Zhunan

    2018-01-01

    Angiogenesis plays a vital role in many physiological and pathological processes and several diseases are connected with its dysregulation. Asiatic acid (AA) has demonstrated anticancer properties and we suspect this might be attributable to an effect on angio-genesis. A modified derivative of AA, N-(2α,3β,23-acetoxyurs-12-en-28-oyl)-L-proline methyl ester (AA-PMe), has improved efficacy over its parent compound, but its effect on blood vessel development remains unclear. In this study, we investigated the antiangiogenic activity of AA and AA-PMe in zebrafish embryos and human umbilical vein endothelial cells (HUVECs). First of all, we treated HUVECs with increasing concentrations of AA-PMe or AA, with or without vascular endothelial growth factor (VEGF) present, and assessed cell viability, tube formation, and cell migration and invasion. Quantitative real-time polymerase chain reaction and Western blot analysis were later used to determine the role of vascular endothelial growth factor receptor 2 (VEGFR2)-mediated signaling in AA-PMe inhibition of angiogenesis. We extended these studies to follow angiogenesis using Tg(fli:EGFP) transgenic zebrafish embryos. For these experiments, embryos were treated with varying concentrations of AA-PMe or AA from 24 to 72 hours postfertilization prior to morphological observation, angiogenesis assessment, and endogenous alkaline phosphatase assay. VEGFR2 expression in whole embryos following AA-PMe treatment was also determined. We found AA-PMe decreased cell viability and inhibited migration and tube formation in a dose-dependent manner in HUVECs. Similarly, AA-PMe disrupted the formation of intersegmental vessels, the dorsal aorta, and the posterior cardinal vein in zebrafish embryos. Both in vitro and in vivo AA-PMe surpassed AA in its ability to block angiogenesis by suppressing VEGF-induced phosphorylation of VEGFR2 and disrupting downstream extracellular regulated protein kinase and AKT signaling. For the first time

  2. Common alleles at 6q25.1 and 1p11.2 are associated with breast cancer risk for BRCA1 and BRCA2 mutation carriers

    DEFF Research Database (Denmark)

    Antoniou, Antonis C; Kartsonaki, Christiana; Sinilnikova, Olga M

    2011-01-01

    11249433 at 1p11.2 and rs999737 in RAD51L1 at 14q24.1. Although previously identified breast cancer susceptibility variants have been shown to be associated with breast cancer risk for BRCA1 and BRCA2 mutation carriers, the involvement of these SNPs to breast cancer susceptibility in mutation carriers...... is currently unknown. To address this, we genotyped these SNPs in BRCA1 and BRCA2 mutation carriers from 42 studies from the Consortium of Investigators of Modifiers of BRCA1/2. In the analysis of 14 123 BRCA1 and 8053 BRCA2 mutation carriers of European ancestry, the 6q25.1 SNPs (r(2) = 0.14) were...... for BRCA2 carriers (HR = 1.14, 95% CI: 1.01-1.28, P-trend = 0.031). SNP rs11249433 (1p11.2) was associated with the risk of breast cancer for BRCA2 mutation carriers (HR = 1.09, 95% CI: 1.02-1.17, P-trend = 0.015), but was not associated with breast cancer risk for BRCA1 mutation carriers (HR = 0.97, 95...

  3. Hot-carrier effects in MOS devices

    CERN Document Server

    Takeda, Eiji; Miura-Hamada, Akemi

    1995-01-01

    The exploding number of uses for ultrafast, ultrasmall integrated circuits has increased the importance of hot-carrier effects in manufacturing as well as for other technological applications. They are rapidly movingout of the research lab and into the real world.This book is derived from Dr. Takedas book in Japanese, Hot-Carrier Effects, (published in 1987 by Nikkei Business Publishers). However, the new book is much more than a translation. Takedas original work was a starting point for developing this much more complete and fundamental text on this increasingly important topic. The new work

  4. Effective Charge Carrier Utilization in Photocatalytic Conversions.

    Science.gov (United States)

    Zhang, Peng; Wang, Tuo; Chang, Xiaoxia; Gong, Jinlong

    2016-05-17

    Continuous efforts have been devoted to searching for sustainable energy resources to alleviate the upcoming energy crises. Among various types of new energy resources, solar energy has been considered as one of the most promising choices, since it is clean, sustainable, and safe. Moreover, solar energy is the most abundant renewable energy, with a total power of 173 000 terawatts striking Earth continuously. Conversion of solar energy into chemical energy, which could potentially provide continuous and flexible energy supplies, has been investigated extensively. However, the conversion efficiency is still relatively low since complicated physical, electrical, and chemical processes are involved. Therefore, carefully designed photocatalysts with a wide absorption range of solar illumination, a high conductivity for charge carriers, a small number of recombination centers, and fast surface reaction kinetics are required to achieve a high activity. This Account describes our recent efforts to enhance the utilization of charge carriers for semiconductor photocatalysts toward efficient solar-to-chemical energy conversion. During photocatalytic reactions, photogenerated electrons and holes are involved in complex processes to convert solar energy into chemical energy. The initial step is the generation of charge carriers in semiconductor photocatalysts, which could be enhanced by extending the light absorption range. Integration of plasmonic materials and introduction of self-dopants have been proved to be effective methods to improve the light absorption ability of photocatalysts to produce larger amounts of photogenerated charge carriers. Subsequently, the photogenerated electrons and holes migrate to the surface. Therefore, acceleration of the transport process can result in enhanced solar energy conversion efficiency. Different strategies such as morphology control and conductivity improvement have been demonstrated to achieve this goal. Fine-tuning of the

  5. Viruses - from pathogens to vaccine carriers.

    Science.gov (United States)

    Small, Juliana C; Ertl, Hildegund C J

    2011-10-01

    Vaccination is mankind's greatest public health success story. By now vaccines to many of the viruses that once caused fatal childhood diseases are routinely used throughout the world. Traditional methods of vaccine development through inactivation or attenuation of viruses have failed for some of the most deadly human pathogens, necessitating new approaches. Genetic modification of viruses not only allows for their attenuation but also for incorporation of sequences from other viruses, turning one pathogen into a vaccine carrier for another. Recombinant viruses have pros and cons as vaccine carriers, as discussed below using vectors based on adenovirus, herpesvirus, flavivirus, and rhabdovirus as examples.

  6. Low overhead slipless carrier phase estimation scheme.

    Science.gov (United States)

    Cheng, Haiquan; Li, Yan; Kong, Deming; Zang, Jizhao; Wu, Jian; Lin, Jintong

    2014-08-25

    Two slipless schemes are compared with application to single carrier 30 Gbaud quadrature phase shift keying (QPSK) system. An equivalent linewidth model considering the phase noise induced by both the laser linewidth and fiber nonlinearity is applied in the performance analysis. The simulation results show that it is possible to mitigate cycle slip (CS) using only 0.39% pilot overhead for the proposed blind carrier phase recovery (CPR) + pilot-symbols-aided phase unwrapping (PAPU) scheme within 1 dB signal-to-noise ratio (SNR) penalty limit at the bit error ratio (BER) of 10(-3) with 4 MHz equivalent linewidth.

  7. BISMUTH PHOSPHATE CARRIER PROCESS FOR Pu RECOVERY

    Science.gov (United States)

    Finzel, T.G.

    1959-02-01

    An improvement in the bismuth phosphate carrier precipitation process for recovering plutonium is described. It has been found that a more granular and more easily filterable carrier precipitiite is formed if the addition of the bismuth and phosphate ions is effected by first adding 9/10 of the bismuth ions necessary, then slowly adding all of the source of the phosphate ions to be incorporated in the precipitate, while digesting at 75 C and afterwards incorporating the remainder of the total bismuth ions necessary

  8. Performance evaluation of the Abbott RealTime HCV Genotype II for hepatitis C virus genotyping.

    Science.gov (United States)

    Sohn, Yong-Hak; Ko, Sun-Young; Kim, Myeong Hee; Oh, Heung-Bum

    2010-04-01

    The Abbott RealTime hepatitis C virus (HCV) Genotype II (Abbott Molecular Inc.) for HCV genotyping, which uses real-time PCR technology, has recently been developed. Accuracy and sensitivity of detection were assessed using the HCV RNA PHW202 performance panel (SeraCare Life Sciences). Consistency with restriction fragment mass polymorphism (RFMP) data, cross-reactivity with other viruses, and the ability to detect minor strains in mixtures of genotypes 1 and 2 were evaluated using clinical samples. All performance panel viruses were correctly genotyped at levels of >500 IU/mL. Results were 100% concordant with RFMP genotypic data (66/66). However, 5% (3/66) of the samples examined displayed probable genotypic cross reactivity. No cross reactivity with other viruses was evident. Minor strains in the mixtures were not effectively distinguished, even at quantities higher than the detection limit. The Abbott RealTime HCV Genotype II assay was very accurate and yielded results consistent with RFMP data. Although the assay has the advantages of automation and short turnaround time, we suggest that further improvements are necessary before it is used routinely in clinical practice. Efforts are needed to decrease cross reactivity among genotypes and to improve the ability to detect minor genotypes in mixed infections.

  9. Line broadening caused by Coulomb carrier-carrier correlations and dynamics of carrier capture and emission in quantum dots

    DEFF Research Database (Denmark)

    Uskov, Alexander V; Magnúsdóttir, Ingibjörg; Tromborg, Bjarne

    2001-01-01

    Mechanisms of pure dephasing in quantum dots due to Coulomb correlations and the dynamics of carrier capture and emission are suggested, and a phenomenological model for the dephasing is developed. It is shown that, if the rates of these capture and emission processes are sufficiently high, signi...

  10. AAS, growth hormone, and insulin abuse: psychological and neuroendocrine effects

    Directory of Open Access Journals (Sweden)

    Michael R Graham

    2008-06-01

    Full Text Available Michael R Graham1, Peter Evans2, Bruce Davies1, Julien S Baker11Health and Exercise Science Research Unit, Faculty of Health Sport and Science, University of Glamorgan, Pontypridd, Wales, United Kingdom; 2Royal Gwent Hospital, Newport, Gwent, United KingdomAbstract: The nontherapeutic use of prescription medicines by individuals involved in sport is increasing. Anabolic-androgenic steroids (AAS are the most widely abused drug. Much of our knowledge of the psychological and physiological effects of human growth hormone (hGH and insulin has been learned from deficiency states. As a consequence of the Internet revolution, previously unobtainable and expensive designer drugs, particularly recombinant human growth hormone (rhGH and insulin, have become freely available at ridiculously discounted prices from countries such as China and are being abused. These drugs have various physiological and psychological effects and medical personnel must become aware that such prescription medicine abuse appears to be used not only for performance and cosmetic reasons, but as a consequence of psychological pre-morbidity.Keywords: AAS, cosmesis, growth hormone, insulin, performance, strength

  11. AAS Publishing News: Preparing Your Manuscript Just Got Easier

    Science.gov (United States)

    Kohler, Susanna

    2016-03-01

    Watermarking using the command watermark{DRAFT, v2}.Are you an astronomer considering submitting a paper to an AAS journal (i.e., AJ, ApJ, ApJ Letters, or ApJ Supplements)? If so, this post is for you! Read on to find out about the exciting new things you can do with the AASs newest LaTeX class file, available for download now.Why the Update?AAS publishing has maintained a consistent class file for LaTeX manuscript preparation for the past decade. But academic publishing is changing rapidly in todays era of electronic journals! Since its journals went fully electronic, the AAS has been continuously adding new publishing capabilities based on the recommendations of the Journals Task Force and the needs and requests of AAS authors. The AASs manuscript preparation tools are now being updated accordingly.Whats New in AASTex 6.0?There are many exciting new features and capabilities in AASTex 6.0. Here are just a few:Tracking options for author revisions include added{text}, deleted{text}, replaced{old}{new}, and explain{text}.Based on emulateapjDo you use the popular class file emulateapj to prepare your manuscripts? AASTex 6.0 is based on emulateapj, rather than on the older AASTex 5.2 (though 5.2 is still supported). This means that it is easy to produce a double-columned, single-spaced, and astro-ph-ready manuscript. Since two thirds of the AAS journals authors use emulateapj, this transition was designed to make manuscript preparation and sharing an easier and more seamless process.Tools for collaborationsDo you work in a large collaboration? AASTex now includes new tools to make preparing a manuscript within a collaboration easier. Drafts can now be watermarked to differentiate between versions. New markup for large author lists streamlines the display so that readers can access article information immediately, yet they can still access the full author list and affiliations at the end of the paper. And author revision markup allows members of a collaboration to

  12. Springback analysis on AA 6061 aluminum alloy sheets

    Science.gov (United States)

    Ramulu, Perumalla Janaki; Rao, P. Srinivasa; Yimer, Wassihun

    2016-10-01

    In automotive industry, sheet metal forming process play a key role with respect to economy and weight reduction ratio. In sheet metal forming, one of the operations is bending operation in which sheet will not go under sever deformation. The end components are made by applying the continuous load on the sheet in the bending process. In bending process, elastic limits of materials are exceeded, but flow limit thereof cannot be exceeded. Therefore, the material still keeps a portion of its original flexibility character. When the load is released, the material on forcing compress side tries to enlarge, whereas the material on tensile side tries to shrink. As a result, the material tries to spring back and the bended material by flexing slightly tries to open. Springback varies according to thickness of the material, material and process parameters, type of material, period when punch load stays on the material, dimensions of die, force applied, and bending radius. In order to make bending at a desired angle, springback amounts should be avoided. In the present work, experimentation on AA 6061 alloy sheet springback analysis has done with seven different rolling directions. Results are noted with respect to load, displacement, and die angle on the springback effect. It observed that springback affect is existed notably in the AA 6061 alloys with respect to die angle.

  13. A possible genetic link between MTHFR genotype and smoking behavior.

    Directory of Open Access Journals (Sweden)

    Michael Linnebank

    Full Text Available BACKGROUND: Hyperhomocysteinemia is an independent risk factor for stroke and other vascular events. The variant methylenetetrahydrofolate reductase (MTHFR C677T is associated with elevated homocysteine levels, cardiovascular disease and stroke, which supports a causal relationship between hyperhomocysteinemia and vascular disease. However, MTHFR variants have also been reported to be associated with smoking behavior, which could be an important confounder. METHODOLOGY/PRINCIPAL FINDINGS: We analyzed the MTHFR variants C677T and A1298C in two independent samples of 525 and 535 individuals, respectively. 21% of the non-smokers, but only 12% of the smokers were homozygous carriers of both MTHFR wildtype alleles, i.e. 677CC and 1298AA (Chi² = 15.8; p<0.001; binary regression. Plasma homocysteine levels were higher in smokers (13.9±4.1 µmol/L than in non-smokers (12.6±4.0 µmol/L; F = 11.4; p = 0.001; ANOVA. Smoking MTHFR 677TT individuals had the highest plasma homocysteine levels (16.2±5.2 µmol/L, non-smoking 677CC individuals had the lowest (12.2±13.6 µmol/L. CONCLUSIONS/SIGNIFICANCE: In our study samples, MTHFR variants and smoking behaviour were associated with homocysteine plasma levels. In addition, the MTHFR variants were associated with smoking behaviour. Such an association may be a relevant confounder between MTHFR variants, homocysteine plasma levels and vascular diseases.

  14. An original phylogenetic approach identified mitochondrial haplogroup T1a1 as inversely associated with breast cancer risk in BRCA2 mutation carriers

    DEFF Research Database (Denmark)

    Blein, Sophie; Bardel, Claire; Danjean, Vincent

    2015-01-01

    INTRODUCTION: Individuals carrying pathogenic mutations in BRCA1/2 genes have a high lifetime risk of breast cancer. BRCA1 and BRCA2 are involved in DNA double strand break repair, DNA alterations that can be caused by exposure to reactive oxygen species, a main source of which are mitochondria...... species production, leading to cancer risk. Here we test the hypothesis that mitochondrial haplogroups modify breast cancer risk in BRCA1/2 mutation carriers. METHODS: We genotyped 22214 (11421 affected, 10793 unaffected) mutation carriers belonging to the Consortium of Investigators of Modifiers of BRCA1/2...

  15. Are the common genetic variants associated with colorectal cancer risk for DNA mismatch repair gene mutation carriers?

    Science.gov (United States)

    Win, Aung Ko; Hopper, John L.; Buchanan, Daniel D.; Young, Joanne P.; Tenesa, Albert; Dowty, James G.; Giles, Graham G.; Goldblatt, Jack; Winship, Ingrid; Boussioutas, Alex; Young, Graeme P.; Parry, Susan; Baron, John A.; Duggan, David; Gallinger, Steven; Newcomb, Polly A.; Haile, Robert W.; Le Marchand, Loïc; Lindor, Noralane M.; Jenkins, Mark A.

    2013-01-01

    Background Genome-wide association studies have identified at least 15 independent common genetic variants associated with colorectal cancer (CRC) risk. The aim of this study was to investigate whether 11 of these variants are associated with CRC risk for carriers of germline mutations in DNA mismatch repair (MMR) genes. Methods A total of 927 MMR gene mutation carriers (360 MLH1, 442 MSH2, 85 MSH6 and 40 PMS2) from 315 families enrolled in the Colon Cancer Family Registry, were genotyped for the SNPs: rs16892766 (8q23.3), rs6983267 (8q24.21), rs719725 (9p24), rs10795668 (10p14), rs3802842 (11q23.1), rs4444235 (14q22.2), rs4779584 (15q13.3), rs9929218 (16q22.1), rs4939827 (18q21.1), rs10411210 (19q13.1) and rs961253 (20p12.3). We used a weighted Cox regression to estimate CRC risk for homozygous and heterozygous carriers of the risk allele compared with homozygous non-carriers as well as for an additive per allele model (on the log scale). Results Over a total of 40,978 person-years observation, 426 (46%) carriers were diagnosed with CRC at a mean age of 44.3 years. For all carriers combined, we found no evidence of an association between CRC risk and the total number of risk alleles (hazard ratio [HR] per risk allele=0.97, 95% confidence interval [CI]=0.88–1.07, p=0.52). Conclusions We found no evidence that the SNPs associated with CRC in the general population are modifiers of the risk for MMR gene mutation carriers overall, and therefore any evidence of proven clinical utility in Lynch syndrome. PMID:23434150

  16. Prognostic significance of FTO genotype in the development of obesity in Japanese: the J-SHIPP study.

    Science.gov (United States)

    Tabara, Y; Osawa, H; Guo, H; Kawamoto, R; Onuma, H; Shimizu, I; Takara, Y; Nishida, W; Yamamoto, M; Makino, H; Kohara, K; Miki, T

    2009-11-01

    Susceptibility of fat mass and obesity-associated (FTO) gene polymorphisms to obesity has been reported in various populations. Polymorphisms in the melanocortin 4 receptor (MC4R) gene were recently explored as another susceptible locus. However, prognostic significance of these genetic variations has not been fully elucidated. Here, we investigated the involvement of FTO rs9939609 and MC4R rs17782313 polymorphisms in the development of obesity. Association with type 2 diabetes mellitus (T2DM) was also investigated. We analyzed 2806 community-dwelling middle-aged to elderly subjects (61+/-14 years). Clinical parameters were obtained from the subjects' personal health records, evaluated at their annual medical check-up. FTO genotype was significantly associated with current body mass index (BMI; TT 23.2+/-3.2, TA 23.7+/-3.2, AA 24.4+/-3.2 kg m(-2), P=2.5 x 10(-6)) and frequency of obesity (26.6, 32.0, 43.0% respectively, P=2.0 x 10(-4)). Age- and sex-adjusted odds ratio for obesity was 1.30 (P=0.004) in TA and 2.07 (P=0.002) in AA genotype. During the 9.4 years comprising the follow-up period, 214 new cases of obesity were diagnosed among 1718 subjects whose retrospective data were available. A allele frequency of the FTO genotype was significantly higher in subjects who developed obesity (22.2, 15.8%, P=0.001), Age-, sex- and initial BMI-adjusted odds ratio for the development of obesity was 1.46 (95% confidence interval, 1.04-2.04) (P=0.031). However, association studies and meta-analysis of T2DM did not actively support the involvement of FTO genotype. No significant differences were observed between the MC4R genotype and BMI (P=0.015), and the frequency of obesity (P=0.284). FTO genotype is an independent risk factor for future development of obesity.

  17. Composite β-κ-casein genotypes and their effect on composition and coagulation of milk from Estonian Holstein cows.

    Science.gov (United States)

    Vallas, M; Kaart, T; Värv, S; Pärna, K; Jõudu, I; Viinalass, H; Pärna, E

    2012-11-01

    The objective of this study was to estimate the effect of composite β-κ-CN genotypes on milk coagulation and composition traits, and on the additive genetic variation of these traits in Estonian Holstein dairy cattle. A total of 23,970 milk samples, repeated measurements from the first to third lactation from 2,859 Estonian Holstein cows from 78 herds across the country, were analyzed for milk yield, milk fat and protein percentages, somatic cell count, and milk coagulation properties (milk coagulation time and curd firmness). Each cow had at least 3 measurements per lactation. Two single-trait random regression animal models were fitted for the traits studied. The first model considered fixed effects of year-season of sampling and year-season of calving, calving age (nested within lactation), sample age (only for milk coagulation traits) and days in milk, and random herd, additive genetic, and permanent environmental effects. The animal and permanent environmental effects were modeled over the lactation period by using Legendre polynomials. The second model had the additional fixed β-κ-casein effect in the form of a third-order Legendre polynomial. The 2 most frequent β-κ-casein composite genotypes were A2A2AA and A1A2AA, both with prevalence greater than 20%. Percentages of the remaining 31 genotypes were less than 8%, including 20 genotypes with percentages less than 1%. The β-κ-casein genotype-specific lactation curves were significantly different for milk coagulation traits and milk protein percentage. The B variant of κ-casein showed a favorable effect on both milk coagulation traits, whereas the IB haplotype had an increasing effect on curd firmness and protein percentage. Inclusion of the β-κ-casein genotype effects in the model resulted in decreases in the mean additive genetic variations for milk coagulation time and curd firmness of 12.9 and 51.1%, respectively. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc

  18. Naturally occurring mutations in large surface genes related to occult infection of hepatitis B virus genotype C.

    Directory of Open Access Journals (Sweden)

    Hong Kim

    Full Text Available Molecular mechanisms related to occult hepatitis B virus (HBV infection, particularly those based on genotype C infection, have rarely been determined thus far in the ongoing efforts to determine infection mechanisms. Therefore, we aim to elucidate the mutation patterns in the surface open reading frame (S ORF underlying occult infections of HBV genotype C in the present study. Nested PCRs were applied to 624 HBV surface antigen (HBsAg negative Korean subjects. Cloning and sequencing of the S ORF gene was applied to 41 occult cases and 40 control chronic carriers. Forty-one (6.6% of the 624 Korean adults with HBsAg-negative serostatus were found to be positive for DNA according to nested PCR tests. Mutation frequencies in the three regions labeled here as preS1, preS2, and S were significantly higher in the occult subjects compared to the carriers in all cases. A total of two types of deletions, preS1 deletions in the start codon and preS2 deletions as well as nine types of point mutations were significantly implicated in the occult infection cases. Mutations within the "a" determinant region in HBsAg were found more frequently in the occult subjects than in the carriers. Mutations leading to premature termination of S ORF were found in 16 occult subjects (39.0% but only in one subject from among the carriers (2.5%. In conclusion, our data suggest that preS deletions, the premature termination of S ORF, and "a" determinant mutations are associated with occult infections of HBV genotype C among a HBsAg-negative population. The novel mutation patterns related to occult infection introduced in the present study can help to broaden our understanding of HBV occult infections.

  19. Genotype x environment interactions and yield stability of stress ...

    African Journals Online (AJOL)

    Genotype x environment interactions are inherent in multilocational trials and complicate identification of superior genotypes. The aim of the study was to determine yield performance and stability of 13 maize genotypes in five locations of the Eastern Cape province, South Africa. The genotypes assessed were: ZM305, ...

  20. Phenotypic characterization of nevus and tumor patterns in MITF E318K mutation carrier melanoma patients.

    Science.gov (United States)

    Sturm, Richard A; Fox, Carly; McClenahan, Phil; Jagirdar, Kasturee; Ibarrola-Villava, Maider; Banan, Parastoo; Abbott, Nicola C; Ribas, Gloria; Gabrielli, Brian; Duffy, David L; Peter Soyer, H

    2014-01-01

    A germline polymorphism of the microphthalmia transcription factor (MITF) gene encoding a SUMOylation-deficient E318K-mutated protein has recently been described as a medium-penetrance melanoma gene. In a clinical assessment of nevi from 301 volunteers taken from Queensland, we identified six individuals as MITF E318K mutation carriers. The phenotype for 5 of these individuals showed a commonality of fair skin, body freckling that varied over a wide range, and total nevus count between 46 and 430; in addition, all were multiple primary melanoma patients. The predominant dermoscopic signature pattern of nevi was reticular, and the frequency of globular nevi in carriers varied, which does not suggest that the MITF E318K mutation acts to force the continuous growth of nevi. Excised melanocytic lesions were available for four MITF E318K carrier patients and were compared with a matched range of wild-type (WT) melanocytic lesions. The MITF staining pattern showed a predominant nuclear signal in all sections, with no significant difference in the nuclear/cytoplasmic ratio between mutation-positive or -negative samples. A high incidence of amelanotic melanomas was found within the group, with three of the five melanomas from one patient suggesting a genetic interaction between the MITF E318K allele and an MC1R homozygous red hair color (RHC) variant genotype.