WorldWideScience

Sample records for aa 2024-t3 substrate

  1. Corrosion of AA2024-T3 Part III: Propagation

    International Nuclear Information System (INIS)

    Research highlights: → Corrosion of AA2024 in 0.1 M NaCl was examined for immersion times up to 120 min. → Rings of corrosion product with H2 evolution developed after 5 min immersion. → Intergranular attack penetrated up to 60 μm below the rings within 120 min. → After 240 min mixed intergranular attack and grain etchout were observed. - Abstract: Optical and electron microscopies and EBSD were used to study the early stages of corrosion propagation during stable pit formation on AA2024-T3. Polished AA2024-T3 developed large scale rings of corrosion product, typically a few hundred microns in diameter, within 2 h of exposure to 0.1 M NaCl at room temperature. These features were sectioned using diamond ultramicrotomy and substantial subsurface attack, in the form of intergranular corrosion was observed beneath these sites with virtually no grain etchout. A model is proposed for the mechanism of stable pit progression which involves extensive grain boundary attack, followed by grain etchout leading to open pit formation.

  2. Blister Test for Measurements of Adhesion and Adhesion Degradation of Organic Polymers on AA2024-T3

    Science.gov (United States)

    Rincon Troconis, Brendy Carolina

    A key parameter for the performance of corrosion protective coatings applied to metals is adhesion. Surface preparation prior to coating application is known to be critical, but there is a lack of understanding of what controls adhesion. Numerous techniques have been developed in the last decades to measure the adhesion strength of coatings to metals. Nonetheless, they are generally non-quantitative, non-reproducible, performed in dry conditions, or overestimate adhesion. In this study, a quantitative and reproducible technique, the Blister Test (BT), is used. The BT offers the ability to study the effects of a range of parameters, including the presence or absence of a wetting liquid, and simulates the stress situation in the coating/substrate interface. The effects of roughness and surface topography were studied by the BT and Optical Profilometry, using AA2024-T3 substrates coated with polyvinyl butyral (PVB). Random abrasion generated a surface with lower average roughness than aligned abrasion due to the continual cross abrasion of the grooves. The BT could discern the effects of different mechanical treatments. An adhesion strength indicator was defined and found to be a useful parameter. The effectiveness of standard adhesion techniques such as ASTM D4541 (Pull-off Test) and ASTM D3359 (Tape Test) was compared to the BT. Also, different attempts to measure adhesion and adhesion degradation of organic polymers to AA2024-T3 were tested. The pull-off test does not produce adhesive failure across the entire interface, while the tape test is a very qualitative technique and does not discern between the effects of different coating systems on the adhesion performance. The BT produces adhesive failure of the primer studied, is very reproducible, and is able to rank different coating systems. Therefore, it was found to be superior to the others. The approaches tested for adhesion degradation were not aggressive enough to have a measurable effect. The effects of

  3. The corrosion protection of AA2024-T3 aluminium alloy by leaching of lithium-containing salts from organic coatings.

    Science.gov (United States)

    Visser, Peter; Liu, Yanwen; Zhou, Xiaorong; Hashimoto, Teruo; Thompson, George E; Lyon, Stuart B; van der Ven, Leendert G J; Mol, Arjan J M C; Terryn, Herman A

    2015-01-01

    Lithium carbonate and lithium oxalate were incorporated as leachable corrosion inhibitors in model organic coatings for the protection of AA2024-T3. The coated samples were artificially damaged with a scribe. It was found that the lithium-salts are able to leach from the organic coating and form a protective layer in the scribe on AA2024-T3 under neutral salt spray conditions. The present paper shows the first observation and analysis of these corrosion protective layers, generated from lithium-salt loaded organic coatings. The scribed areas were examined by scanning and transmission electron microscopy before and after neutral salt spray exposure (ASTM-B117). The protective layers typically consist of three different layered regions, including a relatively dense layer near the alloy substrate, a porous middle layer and a flake-shaped outer layer, with lithium uniformly distributed throughout all three layers. Scanning electron microscopy and white light interferometry surface roughness measurements demonstrate that the formation of the layer occurs rapidly and, therefore provides an effective inhibition mechanism. Based on the observation of this work, a mechanism is proposed for the formation of these protective layers. PMID:25927079

  4. Pinless Friction Stir Welding of AA2024-T3 Joint and Its Failure Modes

    Institute of Scientific and Technical Information of China (English)

    李文亚; 李锦锋; 张志函; 高大路; 王卫兵; 栾国红

    2014-01-01

    The joining of aluminum alloy sheets with thickness less than 2.0 mm is difficult via conventional friction stir welding owing to the defects in the joint, such as root flaw, keyhole and lazy S. In the present research, a newly designed pinless tool with involute grooves on its shoulder surface was applied to weld 1.5 mm thick AA2024-T3. The effects of the rotating speed and welding speed on the microstructure and mechanical properties of the joints were ana-lyzed. The experimental results showed that the root flaw and keyhole were successfully eliminated. The lazy S was also eliminated under the optimized welding parameters. The maximum tensile strength of the joints was 326 MPa, which is about 74.1% that of the base material. Moreover, all the tensile samples fractured from the retreating side. Two fracture modes were observed during the tensile tests, which are related with the lazy S.

  5. Numerical modeling of AA2024-T3 friction stir welding process for residual stress evaluation, including softening effects

    DEFF Research Database (Denmark)

    Sonne, Mads Rostgaard; Carlone, Pierpaolo; Palazzo, Gaetano S.;

    2014-01-01

    In the present paper, a numerical finite element model of the precipitation hardenable AA2024-T3 aluminum alloy, consisting of a heat transfer analysis based on the Thermal Pseudo Mechanical model for heat generation, and a sequentially coupled quasi-static stress analysis is proposed. Metallurgi...

  6. Integrated FEM-DBEM simulation of crack propagation in AA2024-T3 FSW butt joints considering manufacturing effects

    DEFF Research Database (Denmark)

    Sonne, Mads Rostgaard; Carlone, P.; Citarella, R.;

    2015-01-01

    This paper deals with a numerical and experimental investigation on the influence of residual stresses on fatigue crack growth in AA2024-T3 friction stir welded butt joints. An integrated FEM-DBEM procedure for the simulation of crack propagation is proposed and discussed. A numerical FEM model...... of the contour method. The computed stress field is transferred to a DBEM environment and superimposed to the stress field produced by a remote fatigue traction load applied on a friction stir welded cracked specimen. Numerical results are compared with experimental data showing good agreement and highlighting...... of the welding process of precipitation hardenable AA2024-T3 aluminum alloy is employed to infer the process induced residual stress field. The reliability of the FEM simulations with respect to the induced residual stresses is assessed comparing numerical outcomes with experimental data obtained by means...

  7. Multiple Crack Growth Prediction in AA2024-T3 Friction Stir Welded Joints, Including Manufacturing Effects

    DEFF Research Database (Denmark)

    Carlone, Pierpaolo; Citarella, Roberto; Sonne, Mads Rostgaard;

    2016-01-01

    A great deal of attention is currently paid by several industries toward the friction stir welding process to realize lightweight structures. Within this aim, the realistic prediction of fatigue behavior of welded assemblies is a key factor. In this work an integrated finite element method - dual...... boundary element method (FEM-DBEM) procedure, coupling the welding process simulation to the subsequent crack growth assessment, is proposed and applied to simulate multiple crack propagation, with allowance for manufacturing effects. The friction stir butt welding process of the precipitation hardened AA...

  8. Electro-assisted preparation of dodecyltrimethoxysilane/TiO{sub 2} composite films for corrosion protection of AA2024-T3 (aluminum alloy)

    Energy Technology Data Exchange (ETDEWEB)

    Li Mei; Yang Yaqin; Liu Liang [Department of Chemistry, Zhejiang University, Hangzhou 310027 (China); Hu Jiming, E-mail: kejmhu@zju.edu.c [Department of Chemistry, Zhejiang University, Hangzhou 310027 (China); Zhang Jianqing [Department of Chemistry, Zhejiang University, Hangzhou 310027 (China)

    2010-03-01

    Thin films of organosilanes have been successfully used as the alternative to toxic chromate coatings for surface pretreatment of metals and alloys. To further improve their corrosion performance, in the present work nano-scaled TiO{sub 2} particles were added to the dodecyltrimethoxysilane (DTMS) films coated onto AA2024-T3 substrates, by using either the dip-coating or the cathodically electro-assisted deposition process. The obtained composite films were investigated by scanning electron microscopy (SEM), atomic force microscopy (AFM), water contact angle measurements, Fourier transform reflection-absorption IR (FTRA-IR) and electrochemical impedance spectroscopy (EIS). The results show that these two techniques (nanoparticles incorporation and the electro-assisted deposition) both facilitate the deposition process of silane films, giving thicker deposit and higher coverage surface along with higher roughness and hydrophobicity, and thereby improve their corrosion resistance. Moreover, the corrosion performance of silane films is further improved by the combined use of nanoparticles modification and electro-assisted deposition.

  9. The role of Mg2+ ions in the corrosion behaviour of AA2024-T3 aluminium alloys immersed in chloride-containing environments

    International Nuclear Information System (INIS)

    It is well-known the harmful impact of chloride ions in the corrosion behaviour of aluminium and its alloys. The present work investigates the use of Mg2+ ions as corrosion inhibitors of AA2024-T3 samples immersed in chloride-containing electrolytes. AA2024-T3 samples were immersed into an electrolyte containing chloride ions, in absence or presence of Mg2+. The electrochemical behaviour was studied by potentiondynamic polarization and electrochemical impedance spectroscopy techniques. The results showed the beneficial effects afforded by the Mg2+ ions. First, the open circuit potential was shifted towards more cathodic values and, on the other hand, the impedance values obtained for samples tested in presence of Mg2+ were higher, suggesting a slowdown of the corrosion rate. The morphological characterization was performed using scanning electron microscopy and energy dispersive X-ray spectroscopy. The results demonstrated that the presence Mg2+ hinders Mg dealloying of the S phase particles, which delays their change from anodic to cathodic behaviour, so delaying the subsequent Al matrix galvanic attack. An additional protection mechanism is related to the blockage of cathodic areas by the precipitation of Mg(OH)2 in alkaline environments

  10. Experimental Study of the Forces Acting on the Tool in the Friction-Stir Welding of AA 2024 T3 Sheets

    Science.gov (United States)

    Astarita, A.; Squillace, A.; Carrino, L.

    2014-10-01

    In this paper, AA 2024 T3-rolled sheets were joined in butt joint configuration through the friction stir welding process. Different joints were carried out varying the principal process parameters (i.e., tool welding speed and tool rotational speed). The aim of this work was the study and the experimental characterization of the influence of the process parameters on the forces acting on the tool during the FSW process. Furthermore, it was studied the correlation between the forces and the grain size, in particular with the extension of the heat-affected zone. Forces acting along the axis parallel to the tool are actually greater than those acting along welding direction. All the recorded forces are strictly dependant on the process parameters adopted. No correlation has been found between the grain dimension within the weld bead and the recorded forces, while the greater the forces, the narrower the extension of the heat-affected zone.

  11. Protective film formation on AA2024-T3 aluminum alloy by leaching of lithium carbonate from an organic coating

    NARCIS (Netherlands)

    Liu, Y.; Visser, P.; Zhou, X.; Lyon, S.B.; Hashimoto, T.; Curioni, M.; Gholinia, A.; Thompson, G.E.; Smyth, G.; Gibbon, S.R.; Graham, D.; Mol, J.M.C.; Terryn, H.A.

    2015-01-01

    An investigation into corrosion inhibition properties of a primer coating containing lithium carbonate as corrosion inhibitive pigment for AA2024 aluminum alloy was conducted. It was found that, during neutral salt spray exposure, a protective film of about 0.2 to 1.5 μm thickness formed within the

  12. Modelling the residual stresses and microstructural evolution in Friction Stir Welding of AA2024-T3 including the Wagner-Kampmann precipitation model

    DEFF Research Database (Denmark)

    Sonne, Mads Rostgaard; Hattel, Jesper Henri

    In this work, a numerical finite element model for friction stir welding of 2024-T3 aluminum alloy, consisting of a heat transfer analysis and a sequentially coupled quasi-static stress analysis is proposed. Metallurgical softening of the material is properly considered and included...

  13. Análisis numérico de la conformabilidad de chapas de AA2024 - T3 en procesos de conformado incremental mono - punto usando DEFORM - 3D

    OpenAIRE

    Candel Carreras, Zoila

    2015-01-01

    El método de los elementos finitos es un método numérico muy usado en ingeniería para la resolución de problemas complejos . DEFORM™ - 3D es un software de elementos finitos de carácter robusto y basado en cálculo implícito, que tiene además una gran aplicación industrial. En este Trabajo de Fin de Grado se ha modelado en DEFORM™ - 3D un proceso de conformado incremental mono - punto o SPIF (del inglés Single Point Incremental Forming ) para chapas de aleación de aluminio AA2024 - T3, con obj...

  14. On the coupling between precipitation and plastic deformation in relation with friction stir welding of AA2024 T3 aluminium alloy

    Energy Technology Data Exchange (ETDEWEB)

    Genevois, Cecile [LTPCM, CNRS UMR 5614, Institut National Polytechnique de Grenoble, BP 75, 38 402 St. Martin d' Heres Cedex (France); Fabregue, Damien [LTPCM, CNRS UMR 5614, Institut National Polytechnique de Grenoble, BP 75, 38 402 St. Martin d' Heres Cedex (France); Deschamps, Alexis [LTPCM, CNRS UMR 5614, Institut National Polytechnique de Grenoble, BP 75, 38 402 St. Martin d' Heres Cedex (France)]. E-mail: alexis.deschamps@ltpcm.inpg.fr; Poole, Warren J. [Department of Metals and Materials Engineering, University of British Columbia, Vancouver (Canada)

    2006-12-15

    We have investigated the influence of plastic deformation on the precipitation kinetics of the S'(S) phase in the AA2024 aluminium alloy, with the objective of understanding the microstructures found in friction stir welds of the same alloy. Different types of thermo-mechanical treatments have been investigated, where plastic deformation has been carried out either before heating in a salt bath, or concurrently with the thermal treatment in a Gleeble compression apparatus. The volume fraction of precipitates has been measured by differential scanning calorimetry and the precipitate morphology has been observed by transmission electron microscopy. It is observed that plastic deformation increases the precipitation kinetics in the temperature range below 300 deg. C. This can be attributed both to the increase in the number of nucleation sites and to the increase in the effective diffusion coefficient. At higher temperatures the influence of plasticity on the volume fraction is negligible, however, in the presence of deformation during the heat treatment, the precipitate morphology is profoundly modified. The effect of plastic deformation is observed to be similar, whether plastic deformation is carried out before or during the heat treatment. These results are shown to be valuable tools in understanding the microstructures of friction stir welds of the same material. It is shown that taking into account the effect of plastic deformation is not absolutely necessary in the thermo-mechanically affected zone. However, we show that the precipitate microstructure in some parts of the heat-affected zone is strongly influenced by a small amount of plasticity.

  15. QUANTIFICATION OF SHEAR DAMAGE EVOLUTION IN ALUMINIUM ALLOY 2024T3

    Institute of Scientific and Technical Information of China (English)

    Tang Chak-yin; Fan Jianping; Tsui Chi-pong; Lee Tai-chiu; Chan Luen-chow; Rao Bin

    2007-01-01

    Shear damage may occur in the process of metal machining such as blanking and cutting, where localized shear deformation is developed. Experimental findings indicate that microscopic shear damage evolution in aluminium alloy 2024T3 (Al 2024T3) is a multi-stage mechanism, including particle cracking, micro-shear banding, matrix microcracking and coalescence of microcracks. This study is an attempt to use a set of equations to describe the multi-stage shear damage evolution in Al 2024T3. The shear damage variables in terms of multi-couple parameters of a power-law hardening material have been defined. An evolution curve of shearing damage has been calculated from experimental data. The values of the shear damage variable at different stages of damage have also been calculated. By making use of the findings, the relation between the microscopic shear damage evolution and the macroscopic shear response of the material has been discussed.

  16. Corrosion behaviour of sol-gel coatings doped with cerium salts on 2024-T3 aluminum alloy

    Energy Technology Data Exchange (ETDEWEB)

    Shi Hongwei; Liu Fuchun [State Key Laboratory for Corrosion and Protection, Institute of Metal Research, Chinese Academy of Sciences, Shenyang 110016 (China); Han Enhou, E-mail: ehhan@imr.ac.cn [State Key Laboratory for Corrosion and Protection, Institute of Metal Research, Chinese Academy of Sciences, Shenyang 110016 (China)

    2010-11-01

    The corrosion behaviour of the sol-gel coatings doped with cerium chloride or cerium nitrate on 2024-T3 aluminum alloy was investigated by using electrochemical impedance spectroscopy (EIS) and immersion tests. The sol-gel matrix was obtained through hydrolysis, condensation of 3-glycidoxypropyltrimethoxysilane (GPTMS) and tetramethoxysilane (TMOS), using diethylentriamine as curing agent. The results indicated that cerium nitrate with concentration of 1 x 10{sup -3} mol L{sup -1} in the silane solution was excellent on self-healing for the sol-gel coating, while cerium chloride had no obvious effect. This result suggested that the introduction of Cl{sup -} promoted the under-film pitting of 2024-T3 substrate. It was found that Ce(OH){sub 3} and Ce(OH){sub 2}{sup 2+} simultaneously existed in the silane solution by X-ray diffraction (XRD) analysis. Ce(OH){sub 2}{sup 2+} transformed to CeO{sub 2} due to high-temperature curing of sol-gel matrix demonstrated by X-ray photoelectron spectroscopy (XPS) analysis. Therefore, it can be considered that Ce(OH){sub 3} and CeO{sub 2} played inhibition roles in the corrosion process of the sol-gel coatings.

  17. Etude du soudage TIG de l'alliage d'aluminium 2024-T3

    OpenAIRE

    OUALLAM, Seddik; MASSE, Jean-Eric; DJEGHLAL, Lamine; Barrallier, Laurent; KABBA, L

    2013-01-01

    Recent programs of aircraft design are characterized in terms of materials, by introducing weldable alloys as alternatives to the traditional technique of riveting, open the way to reduce weight and allow cost reductions in production and maintenance. Understanding the influence of various parameters of TIG welding process applied to the alloy 2024-T3 aluminum should help us to take into account the behavior in service of assemblies, from the design of structures. This work deals with the def...

  18. Effect of aging time and temperature on exfoliation corrosion of aluminum alloys 2024-T3 and 7075-T6

    Energy Technology Data Exchange (ETDEWEB)

    Khoshnaw, F.M.; Gardi, R.H. [Wolfson School of Mechanical and Manufacturing Engineering Loughborough University, Loughborough, LE11 3TU Leicestershire (United Kingdom)

    2007-05-15

    Two types of aluminum alloys, 2024-T3 and 7075-T6, have been selected in this study to investigate the effect of metallurgical aspects on exfoliation corrosion. To determine and evaluate the metallurgical effects of heat treatments on corrosion behaviour of these alloys, G34 ASTM test was selected to investigate the exfoliation corrosion behaviour. The results showed that with increasing the aging time for the aluminum alloy type 2024-T3 the susceptibility to exfoliation corrosion increases, while for type 7075-T6 decreased. These results refer to precipitation of the intermetallic compound phases such as CuAl{sub 2}, and MgZn{sub 2}, in 2024-T3 and 7075-T6 respectively. The amount of these phases increases with increasing the aging time for both alloys. The investigations showed the phases that initiate in 2024-T3 act as anode sites while in 7075-T6 they act as cathode sites. (Abstract Copyright [2007], Wiley Periodicals, Inc.)

  19. Determination of anisotropy in impact toughness of aluminium alloy 2024 T3 plate

    Science.gov (United States)

    Siddiqui, M. H.; Hashmi, F.; Junaid, A.

    The research was aimed to quantify the existence of anisotropy in fracture toughness of aluminium alloy 2024 T3 plate (used in aircraft structural members). It was further needed to establish the direction in which the fracture toughness of aluminium alloy 2024 T3 plate is maximum and minimum. This could help ascertain the structural integrity of aircraft structural components; also while designing new components, the knowledge of variation in toughness with respect to direction helps in economizing dead weight of the aircraft. In this research, pursued at the College of Aeronautical Engineering, the anisotropy in toughness of aluminium alloy 2024 T3 plate was analysed using the Charpy V-notch impact toughness test. The effect of specimen orientation on the impact toughness values of the alloy was investigated and compared with known results to verify the reliability of the work and to ascertain the extent of anisotropy in fracture toughness of the said alloy. Charpy impact tests were carried out on ASTM E 23 standard specimens machined at a reference laboratory at room temperature (23° C +/- 2° C). Four different specimen orientations analysed for the purpose of this study were L-S, L-T, T-S and T-L directions. Subsequently, the results obtained at the research centre were then analysed and correlated with morphology of microstructure of the material to establish the reliability of the experimental results. Moreover, an analysis was also done to cater for the possible errors that could affect the fracture toughness values obtained from experimental results. It was concluded that the T-S orientation of the plate had maximum toughness, whereas, minimum toughness was observed in L-T direction.

  20. Adherence of electrodeposited Zn-Ni coatings on EN AW2024 T3 aluminium alloy

    OpenAIRE

    Alexis, Joël; Adrian, Denise; Masri, Talal; Petit, Jacques-Alain

    2004-01-01

    The use of hexavalent chromium in surface treatments will be reduced in the future, as it is suspected to be carcinogenic. Electrodeposition of Zn-Ni, which is currently used on steel, represents a non-chromate alternative surface treatment for the corrosion protection of aluminium alloys. Zn-Ni coatings were electrodeposited onto an EN AW2024 T3 aluminium alloy sheet in a laboratory flow cell. To obtain several percentages of Ni in the coatings, solutions with different Ni2+ concentrations w...

  1. Protection of 2024-T3 aluminium alloy by corrosion resistant phytic acid conversion coating

    Science.gov (United States)

    Shi, Hongwei; Han, En-Hou; Liu, Fuchun; Kallip, Silvar

    2013-09-01

    The corrosion protection properties of environmentally friendly phytic acid conversion coatings were studied on 2024-T3 aluminium alloy. The films were prepared under acidic conditions with various pH values and characterised by SEM, EDS, ATR-FTIR and electrochemical techniques. The results indicate that the conversion coatings obtained by immersing the alloy in phytic acid solutions at pH from 3 to 5.5 provide excellent corrosion resistance. ATR-FTIR confirms that the film is formed by deposition of reaction products between Al3+ and phosphate groups in phytic acid molecules. The conformation models of the deposition film are proposed.

  2. Pitting corrosion of Al2024-T3 in sodium chloride solution

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Pitting corrosion behavior of Al2024-T3 in sodium chloride solution was investigated by using potentiodynamic scanning (PDS) measurements and electrochemical impedance spectroscopy (EIS) technique. When pitting corrosion of the alloy occurs, there exists a passive region in the anodic branch of PDS polarization curve, which is enlarged with the increasing of immersion time due to the competition of the halide ions with OH- ions to adsorb on the oxide film to form the corrosion products film and the increase of pitting corrosion area. Two capacitive semicircles were observed in complex plane plot. For more extensive pitting and general corrosion of Al2024-T3, the passive region in PDS disappeared, while another depressed semicircle was observed in Nyquist plot because of the formation of corrosion products film. On the other hand, the low frequency inductive loop, which had often been regarded as a manifestation of pitting or formation and precipitation of a salt film, was not observed, which indicates that the low frequency inductive loop can not be the characteristic of pitting corrosion or the formation of salt film. The results also show that higher reactant CPE exponent values will correspond to more extensive transformation of a metal surface by very localized corrosion, while general corrosion can result in a smaller CPE exponent value.

  3. Friction stir spot welding of 2024-T3 aluminum alloy with SiC nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Paidar, Moslem; Sarab, Mahsa Laali [Islamic Azad University, Tehran (Iran, Islamic Republic of)

    2016-01-15

    In this study, the Friction stir spot welding (FSSW) of 2024-T3 aluminum alloy with 1.6 mm thickness was investigated. The effects of the silicon carbide (SiC) nanoparticles on the metallurgical and mechanical properties were discussed. The effects of particles on tension shear and wear tests were also investigated. The process was conducted at a constant rotational speed of 1000 rpm. Results showed that adding SiC nanoparticles to the weld during FSSW had a major effect on the mechanical properties. In fact, the addition of nanoparticles as barriers prevented grain growth in the Stir zone (SZ). The data obtained in the tensile-shear and wear tests showed that tensile-shear load and wear resistance increased with the addition of SiC nanoparticles, which was attributed to the fine grain size produced in the SZ.

  4. Analysis of the tool plunge in friction stir welding - comparison of aluminium alloys 2024 T3 and 2024 T351

    Directory of Open Access Journals (Sweden)

    Veljić Darko

    2016-01-01

    Full Text Available Temperature, plastic strain and heat generation during the plunge stage of the friction stir welding (FSW of high-strength aluminium alloys 2024 T3 and 2024 T351 are considered in this work. The plunging of the tool into the material is done at different rotating speeds. A three-dimensional finite element (FE model for thermomechanical simulation is developed. It is based on arbitrary Lagrangian-Eulerian formulation, and Johnson-Cook material law is used for modelling of material behaviour. From comparison of the numerical results for alloys 2024 T3 and 2024 T351, it can be seen that the former has more intensive heat generation from the plastic deformation, due to its higher strength. Friction heat generation is only slightly different for the two alloys. Therefore, temperatures in the working plate are higher in the alloy 2024 T3 for the same parameters of the plunge stage. Equivalent plastic strain is higher for 2024 T351 alloy, and the highest values are determined under the tool shoulder and around the tool pin. For the alloy 2024 T3, equivalent plastic strain is the highest in the influence zone of the tool pin. [Projekat Ministarstva nauke Republike Srbije, br. TR 34016 i br. TR 35006

  5. Review and study of physics driven pitting corrosion modeling in 2024-T3 aluminum alloys

    Science.gov (United States)

    Yu, Lingyu; Jata, Kumar V.

    2015-04-01

    Material degradation due to corrosion and corrosion fatigue has been recognized to significantly affect the airworthiness of civilian and military aircraft, especially for the current fleet of airplanes that have served beyond their initial design life. The ability to predict the corrosion damage development in aircraft components and structures, therefore, is of great importance in managing timely maintenance for the aging aircraft vehicles and in assisting the design of new ones. The assessment of aircraft corrosion and its influence on fatigue life relies on appropriate quantitative models that can evaluate the initiation of the corrosion as well as the accumulation during the period of operation. Beyond the aircraft regime, corrosion has also affected the maintenance, safety and reliability of other systems such as nuclear power systems, steam and gas turbines, marine structures and so on. In the work presented in this paper, we reviewed and studied several physics based pitting corrosion models that have been reported in the literature. The classic work of particle induced pitting corrosion by Wei and Harlow is reviewed in detail. Two types of modeling, a power law based simplified model and a microstructure based model, are compared for 2024-T3 alloy. Data from literatures are used as model inputs. The paper ends with conclusions and recommendations for future work.

  6. Investigation on a Sol-gel Coating Containing Inhibitors on 2024-T3 Aluminum Alloy

    Institute of Scientific and Technical Information of China (English)

    SHI Hong-wei; LIU Fu-chun; HAN En-hou; SUN Ming-cheng

    2006-01-01

    For a long time, chromate incorporated conversion coatings have been drawn special attention in corrosion protection of aircraft-used aluminum alloys. However,ever-increasing environmental pressures requires that non-chromate conversion coatings be developed because of the detrimental carcinogenic effects of the chromate compounds. In recent years, the sol-gel coatings doped with inhibitors were developed to replace chromate conversion coatings, and showed real promise. A sol-gel coating was prepared and its anti-corrosion behavior was investigated using the potentiodynamic scanning (PDS) and the electrochemical impedance spectroscopy (EIS). It is found that the sol-gel coating obtained by the hydrolysis and condensation of 3-glycidoxypropyltrimethoxysilane (GPTMS) and tetramethoxysilane (TMOS) is prone to form defects if cured at the room temperature, whereas if cured at a higher temperature (100 ℃), these flaws can be avoided. Furthermore, it can be seen that addition of anti-foam agents and surfactants will reduce the faults if cured at the room temperature. Effects of the corrosion inhibitors, CeCl3 and mercaptobenzothiazole (MBT), in the sol-gel coatings on 2024-T3 aluminum alloy were also investigated. Results show that the corrosion resistance of the sol-gel coatings containing CeCl3 proves to be better than that of the pure and MBT added sol-gel coatings by the electrochemical methods.

  7. Multiscale approach to micro/macro fatigue crack growth in 2024-T3 aluminum panel

    Science.gov (United States)

    Sih, G. C.

    2014-01-01

    When two contacting solid surfaces are tightly closed and invisible to the naked eye, the discontinuity is said to be microscopic regardless of whether its length is short or long. By this definition, it is not sufficient to distinguish the difference between a micro- and macro-crack by using the length parameter. Microcracks in high strength metal alloys have been known to be several centimeters or longer. Considered in this work is a dual scale fatigue crack growth model where the main crack can be micro or macro but there prevails an inherent microscopic tip region that is damaged depending on the irregularities of the microstructure. This region is referred to as the "micro-tip" and can be simulated by a sharp wedge with different angles in addition to mixed boundary conditions. The combination is sufficient to model microscopic entities in the form of voids, inclusions, precipitations, interfaces, in addition to subgrain imperfections, or cluster of dislocations. This is accomplished by using the method of "singularity representation" such that closed form asymptotic solutions can be obtained for the development of fatigue crack growth rate relations with three parameters. They include: (1) the crack surface tightness σ* represented by σ o/ σ ∞ = 0.3-0.5 for short cracks in region I, and 0.1-0.2 for long cracks in region II, (2) the micro/macro material properties reflected by the shear modulus ratio µ* (=µmicro/µmacro varying between 2 and 5) and (3) the most sensitive parameter d* being the micro-tip characteristic length d* (= d/ d o) whose magnitude decreases in the direction of region I→II. The existing fatigue crack growth data for 2024-T3 and 7075-T6 aluminum sheets are used to reinterpret the two-parameter d a/d N= C(Δ K) n relation where Δ K has now been re-derived for a microcrack with surfaces tightly in contact. The contact force will depend on the mean stress σm or mean stress ratio R as the primary parameter and on the stress

  8. Effect of multipath laser shock processing on microhardness, surface roughness, and wear resistance of 2024-T3 Al alloy.

    Science.gov (United States)

    Kadhim, Abdulhadi; Salim, Evan T; Fayadh, Saeed M; Al-Amiery, Ahmed A; Kadhum, Abdul Amir H; Mohamad, Abu Bakar

    2014-01-01

    Laser shock processing (LSP) is an innovative surface treatment technique with high peak power, short pulse, and cold hardening for strengthening metal materials. LSP is based on the application of a high intensity pulsed laser beam (I > 1 GW/cm(2); t surface into a high temperature and density plasma that immediately develops inducing a shock wave propagating into the material. The shock wave induces plastic deformation and a residual stress distribution in the target material. In this paper we study the increase of microhardness and surface roughness with the increase of laser pulse energy in 2024-T3 Al alloy. The influence of the thickness of the confining layer (water) on microhardness and surface roughness is also studied. In addition, the effect of LSP treatment with best conditions on wear behaviors of the alloy was investigated.

  9. Effect of Multipath Laser Shock Processing on Microhardness, Surface Roughness, and Wear Resistance of 2024-T3 Al Alloy

    Directory of Open Access Journals (Sweden)

    Abdulhadi Kadhim

    2014-01-01

    Full Text Available Laser shock processing (LSP is an innovative surface treatment technique with high peak power, short pulse, and cold hardening for strengthening metal materials. LSP is based on the application of a high intensity pulsed laser beam (I>1 GW/cm2;  t<50 ns at the interface between the metallic target and the surrounding medium (a transparent confining material, normally water forcing a sudden vaporization of the metallic surface into a high temperature and density plasma that immediately develops inducing a shock wave propagating into the material. The shock wave induces plastic deformation and a residual stress distribution in the target material. In this paper we study the increase of microhardness and surface roughness with the increase of laser pulse energy in 2024-T3 Al alloy. The influence of the thickness of the confining layer (water on microhardness and surface roughness is also studied. In addition, the effect of LSP treatment with best conditions on wear behaviors of the alloy was investigated.

  10. A bottom-up approach for optimization of friction stir processing parameters; a study on aluminium 2024-T3 alloy

    International Nuclear Information System (INIS)

    Highlights: • An experimental bottom-up approach has been developed for optimizing the process parameters for friction stir processing. • Optimum parameter processed samples were tested and characterized in detail. • Ultimate tensile strength of 1.3 times the base metal strength was obtained. • Residual stresses on the processed surface were only 10% of the yield strength of base metal. • Microstructure observations revealed fine equi-axed grains with precipitate particles at the grain boundaries. - Abstract: Friction stir processing (FSP) is emerging as one of the most competent severe plastic deformation (SPD) method for producing bulk ultra-fine grained materials with improved properties. Optimizing the process parameters for a defect free process is one of the challenging aspects of FSP to mark its commercial use. For the commercial aluminium alloy 2024-T3 plate of 6 mm thickness, a bottom-up approach has been attempted to optimize major independent parameters of the process such as plunge depth, tool rotation speed and traverse speed. Tensile properties of the optimum friction stir processed sample were correlated with the microstructural characterization done using Scanning Electron Microscope (SEM) and Electron Back-Scattered Diffraction (EBSD). Optimum parameters from the bottom-up approach have led to a defect free FSP having a maximum strength of 93% the base material strength. Micro tensile testing of the samples taken from the center of processed zone has shown an increased strength of 1.3 times the base material. Measured maximum longitudinal residual stress on the processed surface was only 30 MPa which was attributed to the solid state nature of FSP. Microstructural observation reveals significant grain refinement with less variation in the grain size across the thickness and a large amount of grain boundary precipitation compared to the base metal. The proposed experimental bottom-up approach can be applied as an effective method for

  11. Numerical analysis of static performance comparison of friction stir welded versus riveted 2024-T3 aluminum alloy stiffened panels

    Science.gov (United States)

    Shao, Qing; He, Yuting; Zhang, Teng; Wu, Liming

    2014-07-01

    Most researches on the static performance of stiffened panel joined by friction stir welding(FSW) mainly focus on the compression stability rather than shear stability. To evaluate the potential of FSW as a replacement for traditional rivet fastening for stiffened panel assembly in aviation application, finite element method(FEM) is applied to compare compression and shear stability performances of FSW stiffened panels with stability performances of riveted stiffened panels. FEMs of 2024-T3 aluminum alloy FSW and riveted stiffened panels are developed and nonlinear static analysis method is applied to obtain buckling pattern, buckling load and load carrying capability of each panel model. The accuracy of each FEM of FSW stiffened panel is evaluated by stability experiment of FSW stiffened panel specimens with identical geometry and boundary condition and the accuracy of each FEM of riveted stiffened panel is evaluated by semi-empirical calculation formulas. It is found that FEMs without considering weld-induced initial imperfections notably overestimate the static strengths of FSW stiffened panels. FEM results show that, buckling patterns of both FSW and riveted compression stiffened panels represent local buckling of plate between stiffeners. The initial buckling waves of FSW stiffened panel emerge uniformly in each plate between stiffeners while those of riveted panel mainly emerge in the mid-plate. Buckling patterns of both FSW and riveted shear stiffened panels represent local buckling of plate close to the loading corner. FEM results indicate that, shear buckling of FSW stiffened panel is less sensitive to the initial imperfections than compression buckling. Load carrying capability of FSW stiffened panel is less sensitive to the initial imperfections than initial buckling. It can be concluded that buckling loads of FSW panels are a bit lower than those of riveted panels whereas carrying capabilities of FSW panels are almost equivalent to those of riveted

  12. The Effect of the Solution Heat Treatment on the Mechanical Properties of Aluminum-Copper Alloy (2024-T3 Using Rolling Process

    Directory of Open Access Journals (Sweden)

    Khairia Salman Hassan

    2011-01-01

    Full Text Available The effect of solution heat treatment on the mechanical properties of Aluminum-Copper alloy. (2024-T3 by the rolling process is investigated. The solution heat treatment was implemented by heating the sheets to 480 C° and quenching them by water; then forming by rolling for many passes. And then natural aging is done for one month. Mechanical properties (tensile strength and hardness are evaluated and the results are compared with the metal without treatment during the rolling process. ANSYS analysis is used to show the stresses distribution in the sheet during the rolling process. It has been seen that good mechanical properties are evident in the alloy without heat treatment due to the strain hardening and also the mechanical properties are improved after heat treatment and rolling process but with lower forces and stresses when compared with the untreated.

  13. Corrosion behavior of aluminum alloy 2024-T3 by 8-hydroxy-quinoline and its derivative in 3.5% chloride solution

    Institute of Scientific and Technical Information of China (English)

    LI Song-mei; ZHANG Hong-rui; LIU Jian-hua

    2007-01-01

    The corrosion behavior of aluminum alloy 2024-T3 was studied in 3.5% NaCl solution with two fluorescence quinoline compounds named 8-hydroxy-quinoline(8HQ) and 8-hydroxy-quinoline-5-sulfonic acid(HQS). The open circuit potential(OCP) test result indicates that both compounds change the alloy corrosion potential by adsorbing on the electrode surface. Polarization measurements show that 8HQ is a mixed type inhibitor by blocking the active sites of the metal surface, while HQS is a corrosion accelerator by activating the cathodic reaction. Changes of the impedance parameters in the electrochemical impedance spectroscopy(EIS) are related to the adsorption of 8HQ on the metal surface, which leads to the formation of a protective layer. The impedance diagram in the solution with HQS is similar to the one without additional organic compounds. The morphology and composition of the protective layer were studied by using SEM/EDS. The result confirms the function of the additions that the effect of 8HQ is due to the insoluble aluminum chelate, Al(HQ)3, to prevent adsorption of chloride ion, while the effect of HQS is to break down the oxide film.

  14. Prediction of low-cycle fatigue-life by acoustic emission—1: 2024-T3 aluminum alloy, and —2: 7075-T6 aluminum alloy

    Energy Technology Data Exchange (ETDEWEB)

    Baram, J. [Ben-Gurion Univ. of the Negev, Beer Sheva (Israel). Materials Engineering Division; Rosen, M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Materials and Molecular Research Division

    1981-01-01

    1: In this paper, low-cycle fatigue tests were conducted by tension-tension until rupture, on a 2024-T3 aluminum alloy sheet. Initial crack sizes and orientations in the fatigue specimens were found to be randomly distributed. Acoustic emission was continuously monitored during the tests. Every few hundred cycles, the acoustic signal having the highest peak-amplitude, was recorded as an extremal event for the elapsed period. This high peak-amplitude is related to a fast crack propagation rate through a phenomenological relationship. The extremal peak amplitudes are shown by an ordered statistics treatment, to be extremally distributed. The statistical treatment enables the prediction of the number of cycles left until failure. Predictions performed a posteriori based on results gained early in each fatigue test are in good agreement with actual fatigue lives. Finally, the amplitude distribution analysis of the acoustic signals emitted during cyclic stress appears to be a promising nondestructive method of predicting fatigue life. 2: In this paper, low cycle high stress fatigue tests were conducted by tension-tension on an Alclad 7075-T6 aluminum sheet alloy, until rupture. Initial crack sizes and orientations in the fatigue specimens were randomly distributed. Acoustic emission was continuously monitored during the tests. Extremal peak-amplitudes, equivalent to extremal crack-propagation rates, are shown to be extremally Weibull distributed. The prediction of the number of cycles left until failure is made possible, using an ordered statistics treatment and an experimental equipment parameter obtained in previous experiments (Part 1). The predicted life-times are in good agreement with the actual fatigue lives. Finally, the amplitude distribution analysis of the acoustic signals emitted during cyclic stress has been proven to be a feasible nondestructive method of predicting fatigue life.

  15. Integrated Modelling of Crack Propagation in AA2024-T3 FSW Butt Joints Considering The Residual Stresses from the Manufacturing Process

    DEFF Research Database (Denmark)

    Sonne, M. R.; Carlone, P.; Citarella, R.;

    2015-01-01

    conducted to investigate the effect of shunting on nugget size in spot welding of HSLA steel sheets. Different cases with different spacing between weld spots have been examined. The nugget sizes have been measured by metallographic examination and have been compared with 3D finite element simulations......This research is focused on one of the problems frequently encountered in spot welding in industry. In many applications several spot welds are made close to each other. The spots made after the first spot may become smaller in size due to shunt effect. A numerical and experimental study has been....... The results of this study revealed that the shunt effect becomes negligible when the minimum weld spacing is about six times the electrode diameter. The results showed that the weld nugget diameter is more sensitive to shunt effect than the nugget height....

  16. Effect of welding heat input and post-welded heat treatment on hardness of stir zone for friction stir-welded 2024-T3 aluminum alloy%焊接热输入和焊后热处理对搅拌摩擦焊2024-T3铝合金焊核区硬度的影响

    Institute of Scientific and Technical Information of China (English)

    陈雨; 丁桦; 李继忠; 赵敬伟; 付明杰; 李晓华

    2015-01-01

    在不同焊接热输入条件下对2024-T3铝合金进行搅拌摩擦焊接,并利用透射电镜、差热分析和维氏硬度测试对焊核区的组织和硬度进行分析检测。研究表明,焊核区的硬度受到焊接热输入的影响。在高焊接热输入条件下,焊接速度的提升有利于提升焊核区硬度。而在低焊接热输入条件下,焊核区硬度随着旋转速度的增加而增加。焊后热处理导致组织过时效,焊核区硬度降低。相比于其他参数下获得的焊核区,旋转速度为500 r/min,焊接速度为100 mm/min条件下获得的焊核区拥有较高的抗过时效性能,硬度下降仅为3.8%,而其他焊核区的硬度下降超过10%。焊核区硬度主要受到强化相形态的影响。%The microstructure and hardness of the stir zone (SZ) with different welding heat inputs were investigated for friction stir-welded 2024-T3 aluminum by transmission electron microscopy, differential scanning calorimeter and Vickers micro-hardness test. The results show that welding heat input has a significant effect on the hardness of the SZ. Under high welding heat input condition, a higher welding speed is beneficial for improving the hardness of the SZ. However, when the welding heat input is low, the hardness of the SZ elevates with increasing the rotation speed. The hardness of the SZ decreases after post-welded heat treatment due to overaging. The joints welded at 500 r/min and 100 mm/min show a high resistance to overaging. The reduction of hardness in the SZ is only 3.8%, while in other joints, the reduction is more than 10%. The morphology of strengthening precipitates plays important roles for the improvement of hardness.

  17. Galvanostatic response of AA2024 aluminium alloy in 3.5% NaCl solution

    Indian Academy of Sciences (India)

    U DONATUS; G E THOMPSON

    2016-10-01

    Galvanostatic responses of AA2024T3 alloy in de-aerated and naturally aerated 3.5% NaCl solution have been investigated. In the de-aerated condition, two distinct stages of polarization were revealed. From the first stage, the relationships between the pitting incubation time, pitting potential and applied current density for AA2024T3 alloy in the de-aerated condition were established. The curves in the aerated condition showed no particular incubation time-applied current density relationship.

  18. Evaluación de diferentes sistemas de protección contra la corrosión marina en la aleación de aplicación aeronáutica Alclad 2024-T3 Evaluating protection systems against marine corrosion of aeronautic alloy Alclad 2024-T3

    Directory of Open Access Journals (Sweden)

    Pérez Londoño Fabian Andrés

    2011-05-01

    Full Text Available  

    Se muestra la obtención de dos sistemas de recubrimientos protectores como una alternativa de protección contra la corrosión de la aleación de aluminio Alclad 2024-T3, que es utilizada en la fabricación del compartimiento de la batería de los aviones T-41. Dichos sistemas constan de tres tipos de resinas orgánicas: una primera capa de resina poliéster P-115, a manera de imprimante en ambos sistemas de recubrimientos, y una segunda capa de resina de poliéster Hetron 197-3 en el primer caso, o de resina vinil-éster F-010 en el segundo. El análisis de la morfología superficial se realizó mediante microscopía electrónica de barrido (SEM, observando la rugosidad generada por el tratamiento superficial. El estudio electroquímico de los recubrimientos se desarrolló mediante la técnica de espectroscopía de impedancia electroquímica (EIS y curvas de polarización Tafel; de esta manera se encontró que todos los sistemas presentan un buen desempeño frente a la corrosión en un medio marino, y que el sistema con preparación superficial química muestra un comportamiento protector superior para el Alodine 5700 + Hetron 197-3; se obtuvo una velocidad de corrosión 1,42 x 10-12 mpy, mientras que para el sustrato la velocidad fue de 1,59 x 10-7 mpy.

     

     

  19. Acoustic emission monitoring of tensile testing of corroded and un-corroded clad aluminum 2024-T3 and characterization of effects of corrosion on AE source events and material tensile properties

    Science.gov (United States)

    Okafor, A. Chukwujekwu; Natarajan, Shridhar

    2014-02-01

    Corrosion damage affects structural integrity and deteriorates material properties of aluminum alloys in aircraft structures. Acoustic Emission (AE) is an effective nondestructive evaluation (NDE) technique for monitoring such damages and predicting failure in large structures of an aircraft. For successful interpretation of data from AE monitoring, sources of AE and factors affecting it need to be identified. This paper presents results of AE monitoring of tensile testing of corroded and un-corroded clad Aluminum 2024-T3 test specimens, and characterization of the effects of strain-rate and corrosion damage on material tensile properties and AE source events. Effect of corrosion was studied by inducing corrosion in the test specimens by accelerated corrosion testing in a Q-Fog accelerated corrosion chamber for 12 weeks. Eight (8) masked dog-bone shaped specimens were placed in the accelerated corrosion chamber at the beginning of the test. Two (2) dog-bone shaped specimens were removed from the corrosion chamber after exposure time of 3, 6, 9, and 12 weeks respectively, and subjected to tension testing till specimen failure along with AE monitoring, as well as two (2) reference samples not exposed to corrosion. Material tensile properties (yield strength, ultimate tensile strength, toughness, and elongation) obtained from tension test and AE parameters obtained from AE monitoring were analyzed and characterized. AE parameters increase with increase in exposure period of the specimens in the corrosive environment. Aluminum 2024-T3 is an acoustically silent material during tensile deformation without any damage. Acoustic emission events increase with increase of corrosion damage and with increase in strain rate above a certain value. Thus AE is suitable for structural health monitoring of corrosion damage. Ultimate tensile strength, toughness and elongation values decrease with increase of exposure period in corrosion chamber.

  20. Al2024-T3合金热变形加工工艺的流变应力预测%Flow stress prediction for hot deformation processing of 2024Al-T3 alloy

    Institute of Scientific and Technical Information of China (English)

    D. TRIMBLE; G. E. O’DONNELL

    2016-01-01

    Isothermal compression tests were conducted to predict the hot deformational flow stress behaviour of 2024Al-T3 alloy with respect to a wide range of strain rates (0.001−100 s−1), strains (0.1−0.5) and temperatures (573−773 K). The prediction capabilities of various constitutive models for 2024Al alloys and a recently developed constitutive model were evaluated using statistical parameters such as the average absolute relative error (AARE) and the correlation coefficient (R). Models recorded the lowest AARE (4.6%) and the highest correlation coefficient (R=0.99) were developed compared with the other models. Hence, this model can track the deformational behaviour of 2027Al-T3 alloy more accurately compared with other models throughout the entire processing domain investigated.%为了预测Al2024-T3合金热变形加工工艺的流变应力行为,在应变速率(0.001~100 s−1)、应变(0.1~0.5)和温度(573~773 K)条件下,进行了等温压缩试验。采用统计参数,如平均相对误差绝对值(AARE)和相关系数(R)评估了Al2024合金不同的本构模型和最新构建的本构模型的预测能力。与其他的模型相比,最新构建的模型能得到最低的AARE(4.6%)和最高的相关系数(0.99)。因此,与其他模型相比,该模型能更精确地描述Al2027-T3合金的变形行为。

  1. Corrosion Control of Friction Stir Welded AA2024-T351 Aluminium Alloys

    OpenAIRE

    Younes, Yousif Younes Abo

    2010-01-01

    Friction stir welding (FSW) is a modern solid state welding technique developed at thewelding institute (TWI) in 1991. The joining is achieved by heat generation, materialsoftening and plastic deformation following the travelling of non-consumable pin throughthe gap between the two workpieces to be joined.In present study, joining of AA 2024-T3 aluminium alloy, is achieved by FSW. Theinfluence of the FSW on the alloy microstructure and corrosion behaviour is determined.The effect of laser sur...

  2. Self-assembled monolayer of 3-aminopropyltrimethoxysilane for improved adhesion between aluminum alloy substrate and polyurethane coating

    International Nuclear Information System (INIS)

    A good adhesion between a polymer coating and a metal or metal alloy substrate such as Al 2024-T3 plays a critical role in corrosion protection of metal substrates. In our study, a self-assembled monolayer film of 3-aminopropyltrimethoxysilane was formed on Al 2024-T3 substrate by covalent bonding. The adhesion property of a self-priming polyurethane coating was evaluated by pull-off adhesion test, wet tape test and thermal cycling test. All the testing results indicate that both dry and wet adhesion properties of the polyurethane coating were improved significantly after APS treatment of Al 2024-T3 in polar solvents such as methanol and acetone. In nonpolar solvents such as hexane, the APS treatment led to inconsistent improvement or sometime decreased adhesion of polyurethane coating. X-ray photoelectron spectroscopic study revealed that while a monolayer film was formed on the aluminum alloy surface after treating the substrate with APS in methanol and acetone, a multilayer film was formed on the substrate surface when the treatment was conducted in hexane. The APS monolayer film served as a covalent bond linkage between polymer coating and aluminum alloy substrates, which led to the increased adhesion property of polymer coating and corrosion resistance of the metal alloy substrate

  3. Preparation of thin film nanofibrous composite NF membrane based on EDC/NHS modified PAN-AA nanofibrous substrate

    Science.gov (United States)

    Yang, Y.; Wang, X.; Hsiao, B. S.

    2016-07-01

    A novel kind of thin-film nanofibrous composite (TFNC) nanofiltration (NF) membranes consisting of a polyamide (PA) barrier layer were successfully fabricated by interfacial polymerization (IFP) based on electrospun double-layer nanofibrous substrates, which have an ultrathin poly (acrylonitrile-co-acrylic acid) (PAN-AA) nanofibrous layer as top layer and a thicker polyacrylonitrile (PAN) nanofiber layer as bottom porous support layer. Immersing PAN/PAN-AA nanofibrous substrates into 1-ethyl-(3-3-dimethylaminopropyl) carbodiimide hydrochloride/N-hydroxysuccinimide (EDC/NHS) aqueous solution and piperazine (PIP) aqueous solution (0.20 wt%) sequentially for a period of time, the carboxyl groups on PAN-AA nanofibers were activated by carbodiimide and then reacted with the amide groups. The as prepared composite membrane has an integrated structure with high rejection rate (98.0%); high permeate flux (40.4 L/m2h) for MgSO4 aqueous solution (2 g/L).

  4. Tensile and shear failure mechanisms of 2024-T3 aluminum alloy%2024-T3铝合金拉伸及剪切断裂行为

    Institute of Scientific and Technical Information of China (English)

    姜薇; 李亚智; 苏杰; 束一秀

    2015-01-01

    2024铝合金材料在拉伸和扭转载荷作用下表现出截然不同的失效机理。结合试验和数值方法,研究了应力状态对2024⁃T3铝合金韧性断裂行为的影响规律。首先,对圆棒和薄壁圆筒试验件分别进行了拉伸和扭转试验,从断面形貌以及断裂应变与应力状态间关系两个方面,考察了应力状态对2024⁃T3铝合金断裂机理的影响规律。然后,基于Gurson理论在商业有限元软件ABAQUS中开发了同时适用于拉伸和剪切断裂模式的细观损伤本构,对2024⁃T3铝合金的弹塑性响应和裂纹扩展路径进行了数值分析。与试验结果对比研究表明,本文发展的细观损伤本构能够较好预测延性金属材料在多种应力状态下的损伤破坏过程。%Under tensile and shear loading conditions, 2024 aluminum alloy exhibits two types of distinctive ductile rupture mechanisms. The growth and internal necking of voids governs the rupture mechanism in tension dominated loading mode, while the internal shearing in the ligaments between voids dominants for shear conditions. To investigate the influence of stress states on the material ductility of 2024⁃T3 aluminum alloy, tensile experiments of a smooth round bar and three notched round bars with different notch root radii as well as a pure torsion experiment were performed. Based on the modification of Gurson model by Nahshon and Hutchinson, a void⁃based meso⁃damage constitutive relationship which can deal with both tensile and shear problems was developed and implemented in commercial software ABAQUS. The tensile and shear fracture behaviors of 2024⁃T3 aluminum alloy including the load⁃displacement response and crack propagation path were analyzed using the proposed approach and compared with experi⁃mental data. It is shown that the proposed approach can be used to predict the failure of ductile materials under complex loading conditions.

  5. Microstructure and anisotropic mechanical behavior of friction stir welded AA2024 alloy sheets

    International Nuclear Information System (INIS)

    The anisotropic mechanical properties of friction stir welded (FSW) AA2024-T3 alloy joints were investigated based on the uniaxial tensile tests. The joint microstructure was examined by using electron back-scattered diffraction and transmission electron microscope. Results show that the evident anisotropic failure and yielding are present in the FSW joints. With the increase of loading angle from 0° to 90° the ultimate tensile strength and elongation of the specimens consistently decrease, or at first decrease and then increase, depending on the FSW process parameters. The specimen cut from the weld direction, i.e. a loading angle of 0°, exhibits the highest strength and elongation. - Highlights: • Microstructure and anisotropy of friction stir welded joints were studied. • The evident anisotropic failure and yielding are present in joints. • The lowest yield stress and UTS are at 45° and 60° loadings, respectively. • Rotation speed heavily impact on the anisotropy of joints

  6. Microstructure and anisotropic mechanical behavior of friction stir welded AA2024 alloy sheets

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Zhihan [State Key Laboratory of Solidification Processing, Shaanxi Key Laboratory of Friction Welding Technologies, Northwestern Polytechnical University, Xi' an 710072, Shaanxi (China); Li, Wenya, E-mail: liwy@nwpu.edu.cn [State Key Laboratory of Solidification Processing, Shaanxi Key Laboratory of Friction Welding Technologies, Northwestern Polytechnical University, Xi' an 710072, Shaanxi (China); Li, Jinglong [State Key Laboratory of Solidification Processing, Shaanxi Key Laboratory of Friction Welding Technologies, Northwestern Polytechnical University, Xi' an 710072, Shaanxi (China); Chao, Y.J. [Department of Mechanical Engineering, University of South Carolina, Columbia, SC 29208 (United States); Vairis, A. [Mechanical Engineering Department, TEI of Crete, Heraklion, Crete 71004 (Greece)

    2015-09-15

    The anisotropic mechanical properties of friction stir welded (FSW) AA2024-T3 alloy joints were investigated based on the uniaxial tensile tests. The joint microstructure was examined by using electron back-scattered diffraction and transmission electron microscope. Results show that the evident anisotropic failure and yielding are present in the FSW joints. With the increase of loading angle from 0° to 90° the ultimate tensile strength and elongation of the specimens consistently decrease, or at first decrease and then increase, depending on the FSW process parameters. The specimen cut from the weld direction, i.e. a loading angle of 0°, exhibits the highest strength and elongation. - Highlights: • Microstructure and anisotropy of friction stir welded joints were studied. • The evident anisotropic failure and yielding are present in joints. • The lowest yield stress and UTS are at 45° and 60° loadings, respectively. • Rotation speed heavily impact on the anisotropy of joints.

  7. Localised corrosion in aluminium alloy 2024-T3 using in situ TEM.

    Science.gov (United States)

    Malladi, Sairam; Shen, Chenggang; Xu, Qiang; de Kruijff, Tom; Yücelen, Emrah; Tichelaar, Frans; Zandbergen, Henny

    2013-11-28

    An approach to carry out chemical reactions using aggressive gases in situ in a transmission electron microscope (TEM), at ambient pressures of 1.5 bar using a windowed environmental cell, called a nanoreactor, is presented here. The nanoreactor coupled with a specially developed holder with platinum tubing permits the usage of aggressive chemicals like hydrochloric acid (HCl). PMID:24127075

  8. Localised corrosion in aluminium alloy 2024-T3 using in situ TEM

    OpenAIRE

    Malladi, S.; Shen, C.; Xu, Q.; De Kruijff, T.; Yücelen, E.; Tichelaar, F.; Zandbergen, H.

    2013-01-01

    An approach to carry out chemical reactions using aggressive gases in situ in a transmission electron microscope (TEM), at ambient pressures of 1.5 bar using a windowed environmental cell, called a nanoreactor, is presented here. The nanoreactor coupled with a specially developed holder with platinum tubing permits the usage of aggressive chemicals like hydrochloric acid (HCl).

  9. Mineralogical Transformation and Electrochemical Nature of Magnesium-Rich Primers during Natural Weathering

    Directory of Open Access Journals (Sweden)

    Shashi S. Pathak

    2014-07-01

    Full Text Available Magnesium-rich primers (MgRP have generated great interest as a promising alternative to chromium-based primers for the protection of aluminum substrates but their performance during exterior exposure has not been well documented. This paper focuses on the evaluation of MgRP during natural weathering to gain insight into its mineralogical phase transformation and electrochemical nature. Control studies were conducted on Mg and AA2024-T3 coupons. The results indicate that Mg particles in MgRP transform into a variety of hydroxide, carbonate, and hydroxy carbonates. During natural weathering, CO2 inhibited the dissolution of both Mg and AA2024-T3 as a result of protective carbonate layer formation in the coating.

  10. The effect of hardening laws and thermal softening on modeling residual stresses in FSW of aluminum alloy 2024-T3

    DEFF Research Database (Denmark)

    Sonne, Mads Rostgaard; Tutum, Cem Celal; Hattel, Jesper Henri;

    2013-01-01

    In the present paper, a numerical model consisting of a heat transfer analysis based on the Thermal Pseudo Mechanical (TPM) model for heat generation, and a sequentially coupled quasi-static stress analysis with a built-in metallurgical softening model was implemented in ABAQUS. Both isotropic...

  11. Microstructure of AA 2024 fixed joints formed by friction stir welding

    Science.gov (United States)

    Eliseev, A. A.; Kalashnikova, T. A.; Tarasov, S. Yu.; Rubtsov, V. E.; Fortuna, S. V.; Kolubaev, E. A.

    2015-10-01

    Friction stir welded butt joints on 2024T3 alloy have been obtained using different process parameters. The microstructures of all the weld joint zones have been examined and such structural parameters as grain size, particle size and volume content of particles have been determined in order to find correlations with the microhardness of the corresponding zones of the weld.

  12. AA Index

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa index provides a long climatology of global geomagnetic activity using 2 antipodal observatories at Greenwich and Melbourne- IAGA Bulletin 37,...

  13. Rating AAs.

    Science.gov (United States)

    Carter, Susan J.

    2001-01-01

    Why alternative investments? In a word: performance. Many higher education endowment and foundation managers are making increasing commitments to alternative investments, or AAs, in order to obtain higher returns and broader diversification for their investment portfolios than public securities instruments can usually provide. Learn how to handle…

  14. The effect of polymer morphology on the performance of a corrosion inhibiting polypyrrole/aluminum flake composite pigment

    International Nuclear Information System (INIS)

    Two different morphologies of polypyrrole (PPy) aluminum flake composites, namely spherical PPy/Al flake composites and wire PPy/Al flake composites, were synthesized by chemical oxidative polymerization. These composites were characterized by Fourier transform infrared spectroscopy (FT-IR), four point probe conductivity, conductive atomic force microscopy (C-AFM), scanning electron microscopy (SEM), and X-ray photoelectron spectroscopy (XPS). These composites were incorporated into an epoxy primer and coatings were applied on an aluminum alloy (AA 2024-T3) substrate. The coatings were exposed to salt spray according to ASTM B117 and prohesion conditions according to ASTM G85-A5. The corrosion resistance properties were monitored via electrochemical impedance spectroscopy (EIS). The current produced by corrosion reactions on the surface of the substrate was mapped using the scanning vibrating electrode technique (SVET). Galvanic coupling experiments were performed for measurement of galvanic current and mixed potential in controlled environment. It was observed that the morphology of PPy on the surface of aluminum flake has an effect on the conductivity and anticorrosion performance of the pigment. The wire PPy/Al flake composite coatings exhibited better anticorrosion performance than the spherical PPy/Al flake composite coatings and as received aluminum flake coatings. The enhancement in anticorrosion performance was attributed to the unique morphology and electrochemical activity of the PPy on the surface of aluminum flakes. It was also revealed that the wire PPy/Al flake composite coating was sacrificially protecting the AA 2024-T3 substrate in larger defects

  15. The cytochrome P450 2AA gene cluster in zebrafish (Danio rerio): Expression of CYP2AA1 and CYP2AA2 and response to phenobarbital-type inducers

    Energy Technology Data Exchange (ETDEWEB)

    Kubota, Akira [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Bainy, Afonso C.D. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Departamento de Bioquímica, CCB, Universidade Federal de Santa Catarina, Florianopolis, SC 88040-900 (Brazil); Woodin, Bruce R.; Goldstone, Jared V. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Stegeman, John J., E-mail: jstegeman@whoi.edu [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States)

    2013-10-01

    The cytochrome P450 (CYP) 2 gene family is the largest and most diverse CYP gene family in vertebrates. In zebrafish, we have identified 10 genes in a new subfamily, CYP2AA, which does not show orthology to any human or other mammalian CYP genes. Here we report evolutionary and structural relationships of the 10 CYP2AA genes and expression of the first two genes, CYP2AA1 and CYP2AA2. Parsimony reconstruction of the tandem duplication pattern for the CYP2AA cluster suggests that CYP2AA1, CYP2AA2 and CYP2AA3 likely arose in the earlier duplication events and thus are most diverged in function from the other CYP2AAs. On the other hand, CYP2AA8 and CYP2AA9 are genes that arose in the latest duplication event, implying functional similarity between these two CYPs. A molecular model of CYP2AA1 showing the sequence conservation across the CYP2AA cluster reveals that the regions with the highest variability within the cluster map onto CYP2AA1 near the substrate access channels, suggesting differing substrate specificities. Zebrafish CYP2AA1 transcript was expressed predominantly in the intestine, while CYP2AA2 was most highly expressed in the kidney, suggesting differing roles in physiology. In the liver CYP2AA2 expression but not that of CYP2AA1, was increased by 1,4-bis [2-(3,5-dichloropyridyloxy)] benzene (TCPOBOP) and, to a lesser extent, by phenobarbital (PB). In contrast, pregnenolone 16α-carbonitrile (PCN) increased CYP2AA1 expression, but not CYP2AA2 in the liver. The results identify a CYP2 subfamily in zebrafish that includes genes apparently induced by PB-type chemicals and PXR agonists, the first concrete in vivo evidence for a PB-type response in fish. - Highlights: • A tandemly duplicated cluster of ten CYP2AA genes was described in zebrafish. • Parsimony and duplication analyses suggest pathways to CYP2AA diversity. • Homology models reveal amino acid positions possibly related to functional diversity. • The CYP2AA locus does not share synteny with

  16. AA magnet measurement team

    CERN Multimedia

    1978-01-01

    Quickly improvised measurement equipment for the AA (Antiproton Accumulator) was all the tight schedule permitted, but the high motivation of the team made up for the lack of convenience. From left to right: Roy Billinge (Joint AA Project Leader, the other one was Simon van der Meer); Bruno Autin, Brian Pincott, Colin Johnson.

  17. Adhesion and Long-Term Barrier Restoration of Intrinsic Self-Healing Hybrid Sol-Gel Coatings.

    Science.gov (United States)

    Abdolah Zadeh, Mina; van der Zwaag, Sybrand; Garcia, Santiago J

    2016-02-17

    Self-healing polymeric coatings aiming at smart and on-demand protection of metallic substrates have lately attracted considerable attention. In the present paper, the potential application of a dual network hybrid sol-gel polymer containing reversible tetrasulfide groups as a protective coating for the AA2024-T3 substrate is presented. Depending on the constituent ratio, the developed polymer exhibited a hydrophobic surface, high adhesion strength, and an effective long-term corrosion protection in 0.5 M NaCl solution. Upon thermal treatment, the healable hybrid sol-gel coating demonstrated full restoration of the barrier properties as well as recovery of the coating adhesion and surface properties (e.g., hydrophobicity and surface topology) necessary for lifetime extension of corrosion protective coatings. Excellent long-term barrier restoration of the coating was only obtained if the scratch width was less than the coating thickness. PMID:26780101

  18. AAS 228: Welcome!

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Greetings from the 228th American Astronomical Society meeting in San Diego, California! This week, along with a team of fellow authorsfrom astrobites, Iwill bewritingupdates on selectedevents at themeeting and posting twiceeach day. You can follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.If youre at the meeting, come stop by the AAS booth (Booth #211-213) to learn about the newly-announced partnership between AAS and astrobites and pick up some swag.And dont forget to visit the IOP booth in the Exhibit Hall (Booth #223) to learn more about the new corridors for AAS Journals and to pick up a badge pin to representyour corridor!

  19. AA Narrow Quadrupole

    CERN Multimedia

    1979-01-01

    The very particular lattice of the AA required 2 types of quadrupoles: narrow ones (QFN, QDN) and wide ones (QFW, QDW). This is the first one of the narrow quadrupoles, delivered by industry early in 1979.

  20. AAS 227: Welcome!

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Greetings from the 227th American Astronomical Society meeting in Kissimmee, Florida! This week, along with several fellow authors from astrobites, Iwill bewritingupdates on selectedevents at themeeting and posting at the end of each day. You can follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.If youre an author or referee (or plan to be!) and youre here at the meeting, consider joining us at our Author and Referee Workshop on Wednesday in the Tallahassee room, where well be sharingsome of the exciting new features of the AAS journals. You can drop intoeither of the two-hour sessions(10 AM 12 PM or 1 PM 3 PM), and there will be afree buffet lunch at noon.Heres the agenda:Morning SessionTopic Speaker10:00 am 10:05 amIntroductionsJulie Steffen10:05 am 10:35 amChanges at AAS Journals; How to Be a Successful AAS AuthorEthan Vishniac10:35 am 11:00 amThe Peer Review ProcessButler Burton11:00 am 11:15 amAAS Nova: Sharing AAS Authors Research with the Broader CommunitySusanna Kohler11:15 am 11:30 amFixing Software and Instrumentation Publishing: New Paper Styles in AAS JournalsChris Lintott11:30 am 11:45 amMaking Article Writing Easier with the New AASTeX v6.0Greg Schwarz11:45 am 12:00 pmBringing JavaScript and Interactivity to Your AAS Journal FiguresGus MuenchLunch SessionTopic Speaker12:00 pm 12:15 pmUnified Astronomy ThesaurusKatie Frey12:15 pm 12:30 pmAAS/ADS ORCID Integration ToolAlberto Accomazzi12:30 pm 12:45 pmWorldWide Telescope and Video AbstractsJosh Peek12:45 pm 01:00 pmArizona Astronomical Data Hub (AADH)Bryan HeidornAfternoon SessionTopic Speaker01:00 pm 01:05 pmIntroductionsJulie Steffen01:05 pm 01:35 pmChanges at AAS Journals; How to Be a Successful AAS AuthorEthan Vishniac01:35 pm 02:00 pmThe Peer Review ProcessButler Burton02:00 pm 02:15 pmAAS Nova: Sharing AAS Authors Research with the Broader CommunitySusanna Kohler02:15 pm 02:30 pm

  1. Geomagnetic aa Indices

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa indices are the continuation of the series beginning in the year 1868. A full description of these indices is given in the International...

  2. AAS Career Services

    Science.gov (United States)

    Marvel, Kevin B.

    2012-08-01

    The American Astronomical Society provides substantial programs in the area of Career Services.Motivated by the Society's mission to enhance and share humanity's understanding of the Universe, the AAS provides a central resource for advertising positions, interviewing opportunities at its annual winter meeting and information, workshops and networks to enable astronomers to find employment.The programs of the Society in this area are overseen by an active committee on employment and the AAS Council itself.Additional resources that help characterize the field, its growth and facts about employment such as salaries and type of jobs available are regularly summarized and reported on by the American Institute of Physics.

  3. AAS Oral History Project

    Science.gov (United States)

    Buxner, Sanlyn; Holbrook, Jarita; AAS Oral History Team

    2016-06-01

    Now in its fourth year, the AAS Oral History Project has interviewed over 80 astronomers from all over the world. Led by the AAS Historical Astronomy Division (HAD) and partially funded by the American Institute of Physics Niels Bohr Library and ongoing support from the AAS, volunteers have collected oral histories from astronomers at professional meetings starting in 2015, including AAS, DPS, and the IAU general assembly. Each interview lasts one and a half to two hours and focuses on interviewees’ personal and professional lives. Questions include those about one’s family, childhood, strong influences on one’s scientific career, career path, successes and challenges, perspectives on how astronomy is changing as a field, and advice to the next generation. Each interview is audio recorded and transcribed, the content of which is checked with each interviewee. Once complete, interview transcripts are posted online as part of a larger oral history library at https://www.aip.org/history-programs/niels-bohr-library/oral-histories. Future analysis will reveal a rich story of astronomers and will help the community address issues of diversity, controversies, and the changing landscape of science. We are still recruiting individuals to be interviewed from all stages of career from undergraduate students to retired and emeritus astronomers. Contact Jarita Holbrook to schedule an interview or to find out more information about the project (astroholbrook@gmail.com). Also, contact Jarita Holbrook if you would like to become an interviewer for the project.

  4. The Antiproton Accumulator (AA)

    CERN Multimedia

    1980-01-01

    Section 06 - 08*) of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A vacuum-tank, two bending magnets (BST06 and BST07 in blue) with a quadrupole (QDN07, in red) in between, another vacuum-tank, a wide quadrupole (QFW08) and a further tank . The tanks are covered with heating tape for bake-out. The tank left of BST06 contained the stack core pickup for stochastic cooling (see 7906193, 7906190, 8005051), the two other tanks served mainly as vacuum chambers in the region where the beam was large. Peter Zettwoch works on BST06. *) see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984)

  5. Role(s) of pretreatment, inhibitors, and other process steps that effect surface composition on the under-paint corrosion of an aluminum-copper-magnesium alloy 2024-T3

    Science.gov (United States)

    Little, Daryl A.

    2006-12-01

    Under-paint corrosion is a surface corrosion that grows under a coating. The composition of an aluminum alloy, particularly Cu and Fe content, has a direct and dominant effect on the growth rate of filiform corrosion (FFC) and scribe-creep. The Cu and Fe content leads to formation of galvanic cells between intermetallic compounds (IMCs) or replated Cu and the aluminum-rich matrix. However, there is no model which describes scribe-creep behavior and can be used to predict the effect of material and surface pretreatment parameters such as inhibitors, chemical surface pretreatment, and alloy microstructure. Surface pretreatments and aging which control the amount of surface copper and alter IMC distributions decrease the growth rate of scribe-creep. Scribe-creep was observed to be enhanced by temperature, regardless of surface pretreatment, as well as by artificial aging and surface pretreatments. Scribe-creep was accelerated by pretreatments that increased surface copper or left a high capacity for Cu-replating such as Cu-containing IMCs. Pretreatment was rationalized to decrease the cathodic oxygen reduction reaction (ORR) rate, which supports anodic undercutting at the head of the corrosion front. In this galvanic corrosion mechanism, the scribe-creep rate will be proportional to the rate of the anodic dissolution at the head. This, in turn, is proportional to the galvanic corrosion rate. Both charge transfer controlled and mass transport controlled cathodic reaction rates occurred at the fastest rates at the scratch and tail. The charge transfer controlled cathodic reaction rate was directly proportional to the surface coverage of Cu (thetaCu) while the mass transport limited rate was a complex nonlinear function of thetaCu . Based on enhanced understanding a galvanic couple model that describes scribe-creep rates in terms of the relevant processes at the tail and head as well as ohmic voltage between the head and tail was developed in order to explain scribe-creep propagation. Utilizing a galvanic corrosion model it is possible to predict the effect of material, pretreatment, inhibitors, and physical parameters on the under-paint galvanic corrosion rate and scribe-creep rate. This can be used to predict the under-paint corrosion rate as well as help to identify and clarify methods which can be utilized to slow down the rate of under-paint corrosion.

  6. The Antiproton Accumulator (AA)

    CERN Multimedia

    1980-01-01

    A section of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A large vacuum-tank, a quadrupole (QDN09*), a bending magnet (BST08), another vacuum-tank, a wide quadrupole (QFW08) and (in the background) a further bending magnet (BST08). The tanks are covered with heating tape for bake-out. The tank left of QDN09 contained the kickers for stochastic pre-cooling (see 790621, 8002234, 8002637X), the other one served mainly as vacuum chamber in the region where the beam was large. Peter Zettwoch works on QFW08. * see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984) See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  7. INTEROGATION OF THE MANUFACTURING ROUTE OF ALUMINIUM AA 1050 USED IN LITHOGRAPHIC APPLICATION

    OpenAIRE

    Witkowska, Malgorzata Danuta

    2013-01-01

    The aluminium AA1050 alloy, known as commercially pure aluminium, contains 99.5% Al, together with Fe and Si as major alloying elements. During fabrication of aluminium substrates for lithographic printing plates in Bridgnorth Aluminium Ltd, the AA 1050 aluminium alloy proceeds through various stages of thermomechanical processing, with the conditions at each processing stage influencing the microstructure of the final coil. Because of its specific gravity, tensile strength, surface performa...

  8. Transformation from AA to AB-Stacked Bilayer Graphene on α-SiO2 under an Electric Field

    Institute of Scientific and Technical Information of China (English)

    LIU Yan; AO Zhi-Min; WANG Tao; WANG Wen-Bo; SHENG Kuang; YU Bin

    2011-01-01

    @@ The energetic and electronic structure of bilayered graphene(BLG) with AA stacking arrangement on a SiO2 substrate is investigated in the presence of an electric field F of different intensities by ab initio density functional calculations.The AA-stacked bilayer graphene is stable on the SiO2 substrate in the absence of an electric field.However, as F increases, the AA-stacked bilayer graphenes are gradually shifted with each other and finally transfers into AB-stacked bilayer graphenes.The bandgap is accordingly changed.

  9. Offshore Substrate

    Data.gov (United States)

    California Department of Resources — This shapefile displays the distribution of substrate types from Pt. Arena to Pt. Sal in central/northern California. Originally this data consisted of seven paper...

  10. AAS 227: Day 2

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  11. AAS 227: Day 1

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or at astrobites.com, or catch ourlive-tweeted updates from the @astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto have so many people tell us that they already know about and useastrobites, and we were excited to introduce a new cohort of students at AAS to astrobites for the first time.Tuesday morning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended today.Opening Address (by Becky Smethurst)The President of the AAS, aka our fearless leader Meg Urry kicked off the meeting this morning at the purely coffee powered hour of 8am this morning. She spoke about the importance of young astronomers at the meeting (heres looking at you reader!) and also the importance of the new Working Group for Accessibility and Disabilities (aka WGAD pronounced like wicked) at the AAS. The Society has made extra effort this year to make the conference accessible to all,a message which was very well received by everyone in attendance.Kavli Lecture: New Horizons Alan Stern (by Becky Smethurst)We were definitely spoilt with the first Plenary lecture at this years conference Alan Stern gave us a a review of the New Horizons mission of the Pluto Fly By (astrobites covered the mission back in July with this post). We were treated to beautiful images, wonderful results and a foray into geology.Before (Hubble) and after #NewHorizons. #thatisall #science #astro alanstern #aas227 pic.twitter.com/kkMt6RsSIR Science News (@topsciencething) January 5, 2016Some awesome facts from the lecture that blew my mind:New Horizons is now 2AU (!) beyond Pluto

  12. AAS 227: Day 2

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  13. AAS 227: Day 3

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 3 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Henry Norris Russell Lecture: Viewing the Universe with Infrared Eyes: The Spitzer Space Telescope (by Erika Nesvold)The Henry Norris Russell Award is the highest honor given by the AAS, for a lifetime of eminence in astronomy research. This years award went to Giovanni Fazio of the Harvard-Smithsonian Center for Astrophysics. Fazio became a leader in gamma ray astronomy before switching mid-career to the study of infrared astronomy, and he gave his award lecture on the latter subject, specifically on the Spitzer Space Telescope, one of the most successful infrared telescopes of all time.Artists rendering of the Spitzer space telescope. [NASA/JPL-Caltech]Spitzer has been operating for more than twelve years, and has resulted in over six thousand papers in refereed journals in that time. The telescope sits in an Earth-trailing orbit around the Sun, and is now farther from the Earth (1.4 AU) than the Earth is from the Sun. Fazio gave the audience a fascinating overview of the science done by Spitzer over more than a decade. One of the most productive areas of research for Spitzer is the study of exoplanets, which hadnt even been discovered when the Spitzer Telescope was first conceived. Spitzers high sensitivity and ability to observe exoplanets over

  14. AAS 227: Day 3

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 3 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Henry Norris Russell Lecture: Viewing the Universe with Infrared Eyes: The Spitzer Space Telescope (by Erika Nesvold)The Henry Norris Russell Award is the highest honor given by the AAS, for a lifetime of eminence in astronomy research. This years award went to Giovanni Fazio of the Harvard-Smithsonian Center for Astrophysics. Fazio became a leader in gamma ray astronomy before switching mid-career to the study of infrared astronomy, and he gave his award lecture on the latter subject, specifically on the Spitzer Space Telescope, one of the most successful infrared telescopes of all time.Artists rendering of the Spitzer space telescope. [NASA/JPL-Caltech]Spitzer has been operating for more than twelve years, and has resulted in over six thousand papers in refereed journals in that time. The telescope sits in an Earth-trailing orbit around the Sun, and is now farther from the Earth (1.4 AU) than the Earth is from the Sun. Fazio gave the audience a fascinating overview of the science done by Spitzer over more than a decade. One of the most productive areas of research for Spitzer is the study of exoplanets, which hadnt even been discovered when the Spitzer Telescope was first conceived. Spitzers high sensitivity and ability to observe exoplanets over

  15. The Drentsche Aa valley system

    International Nuclear Information System (INIS)

    This thesis is composed of five papers concerned with Late Quaternary geology and geomorphology of the Aa valley system. The correlation and chronostratigraphic position of the layers have been established by radiocarbon dating. (Auth.)

  16. AAS 228: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors fromastrobites.com, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  17. AAS 227: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from http://web.physics.ucsb.edu/ ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  18. AAS 228: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors fromastrobites.com, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  19. AAS 227: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from http://web.physics.ucsb.edu/ ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  20. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor

    OpenAIRE

    Pérez, Claudia; Fernandez, Luisa E.; Sun, Jianguang; Folch, Jorge Luis; Gill, Sarjeet S.; Soberón, Mario; Bravo, Alejandra

    2005-01-01

    Bacillus thuringiensis subsp. israelensis produces crystal proteins, Cry (4Aa, 4Ba, 10Aa, and 11Aa) and Cyt (1Aa and 2Ba) proteins, toxic to mosquito vectors of human diseases. Cyt1Aa overcomes insect resistance to Cry11Aa and Cry4 toxins and synergizes the toxicity of these toxins. However, the molecular mechanism of synergism remains unsolved. Here, we provide evidence that Cyt1Aa functions as a receptor of Cry11Aa. Sequential-binding analysis of Cyt1Aa and Cry11Aa revealed that Cyt1Aa bind...

  1. Is amyloid A (AA) amyloidosis always secondary?

    OpenAIRE

    Maury, C P; Törnroth, T; Wegelius, O

    1985-01-01

    The case is reported of a patient with systemic AA amyloidosis associated with non-specific mesenteric lymphadenitis and chronic sideropenia. Renal, small bowel, and rectal biopsies showed amyloid deposits containing AA protein, as defined by potassium permanganate sensitivity and by reactivity with AA antiserum. Reversal of the nephrotic syndrome occurred during steroid-azathioprine therapy.

  2. Laboratory Astrophysics Division of the AAS (LAD)

    Science.gov (United States)

    Salama, Farid; Drake, R. P.; Federman, S. R.; Haxton, W. C.; Savin, D. W.

    2012-01-01

    The purpose of the Laboratory Astrophysics Division (LAD) is to advance our understanding of the Universe through the promotion of fundamental theoretical and experimental research into the underlying processes that drive the Cosmos. LAD represents all areas of astrophysics and planetary sciences. The first new AAS Division in more than 30 years, the LAD traces its history back to the recommendation from the scientific community via the White Paper from the 2006 NASA-sponsored Laboratory Astrophysics Workshop. This recommendation was endorsed by the Astronomy and Astrophysics Advisory Committee (AAAC), which advises the National Science Foundation (NSF), the National Aeronautics and Space Administration (NASA), and the U.S. Department of Energy (DOE) on selected issues within the fields of astronomy and astrophysics that are of mutual interest and concern to the agencies. In January 2007, at the 209th AAS meeting, the AAS Council set up a Steering Committee to formulate Bylaws for a Working Group on Laboratory Astrophysics (WGLA). The AAS Council formally established the WGLA with a five-year mandate in May 2007, at the 210th AAS meeting. From 2008 through 2012, the WGLA annually sponsored Meetings in-a-Meeting at the AAS Summer Meetings. In May 2011, at the 218th AAS meeting, the AAS Council voted to convert the WGLA, at the end of its mandate, into a Division of the AAS and requested draft Bylaws from the Steering Committee. In January 2012, at the 219th AAS Meeting, the AAS Council formally approved the Bylaws and the creation of the LAD. The inaugural gathering and the first business meeting of the LAD were held at the 220th AAS meeting in Anchorage in June 2012. You can learn more about LAD by visiting its website at http://lad.aas.org/ and by subscribing to its mailing list.

  3. Species Differences in Alternative Substrate Utilization by the Antibacterial Target Undecaprenyl Pyrophosphate Synthase

    OpenAIRE

    Dodbele, Samantha; Martinez, Christina D.; Troutman, Jerry M.

    2014-01-01

    Undecaprenyl pyrophosphate synthase (UPPS) is a critical enzyme required for the biosynthesis of polysaccharides essential for bacterial survival. In this report, we have tested the substrate selectivity of UPPS derived from the mammalian symbiont Bacteroides fragilis, the human pathogen Vibrio vulnificus, and the typically benign but opportunistic pathogen Escherichia coli. An anthranilamide-containing substrate, 2-amideanilinogeranyl diphosphate (2AA-GPP), was an effective substrate for onl...

  4. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor.

    Science.gov (United States)

    Pérez, Claudia; Fernandez, Luisa E; Sun, Jianguang; Folch, Jorge Luis; Gill, Sarjeet S; Soberón, Mario; Bravo, Alejandra

    2005-12-20

    Bacillus thuringiensis subsp. israelensis produces crystal proteins, Cry (4Aa, 4Ba, 10Aa, and 11Aa) and Cyt (1Aa and 2Ba) proteins, toxic to mosquito vectors of human diseases. Cyt1Aa overcomes insect resistance to Cry11Aa and Cry4 toxins and synergizes the toxicity of these toxins. However, the molecular mechanism of synergism remains unsolved. Here, we provide evidence that Cyt1Aa functions as a receptor of Cry11Aa. Sequential-binding analysis of Cyt1Aa and Cry11Aa revealed that Cyt1Aa binding to Aedes aegypti brush border membrane vesicles enhanced the binding of biotinylated-Cry11Aa. The Cyt1Aa- and Cry11Aa-binding epitopes were mapped by means of the yeast two-hybrid system, peptide arrays, and heterologous competition assays with synthetic peptides. Two exposed regions in Cyt1Aa, loop beta6-alphaE and part of beta7, bind Cry11Aa. On the other side, Cry11Aa binds Cyt1Aa proteins by means of domain II-loop alpha8 and beta-4, which are also involved in midgut receptor interaction. Characterization of single-point mutations in Cry11Aa and Cyt1Aa revealed key Cry11Aa (S259 and E266) and Cyt1Aa (K198, E204 and K225) residues involved in the interaction of both proteins and in synergism. Additionally, a Cyt1Aa loop beta6-alphaE mutant (K198A) with enhanced synergism to Cry11Aa was isolated. Data provided here strongly indicates that Cyt1Aa synergizes or suppresses resistance to Cry11Aa toxin by functioning as a membrane-bound receptor. Bacillus thuringiensis subsp. israelensis is a highly effective pathogenic bacterium because it produces a toxin and also its functional receptor, promoting toxin binding to the target membrane and causing toxicity. PMID:16339907

  5. Power electronics substrate for direct substrate cooling

    Science.gov (United States)

    Le, Khiet; Ward, Terence G.; Mann, Brooks S.; Yankoski, Edward P.; Smith, Gregory S.

    2012-05-01

    Systems and apparatus are provided for power electronics substrates adapted for direct substrate cooling. A power electronics substrate comprises a first surface configured to have electrical circuitry disposed thereon, a second surface, and a plurality of physical features on the second surface. The physical features are configured to promote a turbulent boundary layer in a coolant impinged upon the second surface.

  6. AAS 228: Day 1 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Come visit astrobites at the AAS booth we have swag!Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto hear from undergrads who already know and love the site, educators who want to use it in their classrooms, and students who had not yet been introduced to astrobites and were excited about a new resource!For the rest of the meeting we will be stationed at theAAS booth in the exhibit hall (booth #211-213), so drop by if you want to learn more (or pick up swag: weve got lots of stickers and sunglasses)!Mondaymorning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended this morning.Opening Address(by Susanna Kohler)AAS President Meg Urry kicked off the meeting this morning at 8am with an overview of some of the great endeavors AAS is supporting. We astrobiters had personal motivation to drag ourselves out of bed that early: during this session, Urryannounced the new partnership between AAS and astrobites!Urry touched on some difficult topics in her welcome, including yesterdays tragedy in Orlando. Shereiteratedthe AASs support fortheCommittee for Sexual-Orientation and Gender Minorities in Astronomy (SGMA). She also reminded meeting attendees about the importance ofkeeping conference interactions professional, and pointed to the meetings anti-harassment policy.Partnership Announcement (by Michael Zevin)This morning, the American Astronomical Society announced the new partnership that it will have with Astrobites! We are beyond excited to embark on this new partnership with the

  7. AA, closed orbit observation pickup

    CERN Multimedia

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. Werner Sax contemplates his achievement. See also 8001383, 8010042, 8010045.

  8. AA, closed orbit observation pickup

    CERN Multimedia

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles QFW, at maximum dispersion. See also 8001372, 8001383, 8010045

  9. AA, closed orbit observation pickup

    CERN Multimedia

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. See also 8001372, 8010042, 8010045

  10. AA, closed orbit observation pickup

    CERN Multimedia

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles, QFW, at maximum dispersion. See also 8001372,8001383, 8010042

  11. AAS 228: Day 3 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  12. AAS 228: Day 3 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  13. AAS 228: Day 1 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Come visit astrobites at the AAS booth we have swag!Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto hear from undergrads who already know and love the site, educators who want to use it in their classrooms, and students who had not yet been introduced to astrobites and were excited about a new resource!For the rest of the meeting we will be stationed at theAAS booth in the exhibit hall (booth #211-213), so drop by if you want to learn more (or pick up swag: weve got lots of stickers and sunglasses)!Mondaymorning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended this morning.Opening Address(by Susanna Kohler)AAS President Meg Urry kicked off the meeting this morning at 8am with an overview of some of the great endeavors AAS is supporting. We astrobiters had personal motivation to drag ourselves out of bed that early: during this session, Urryannounced the new partnership between AAS and astrobites!Urry touched on some difficult topics in her welcome, including yesterdays tragedy in Orlando. Shereiteratedthe AASs support fortheCommittee for Sexual-Orientation and Gender Minorities in Astronomy (SGMA). She also reminded meeting attendees about the importance ofkeeping conference interactions professional, and pointed to the meetings anti-harassment policy.Partnership Announcement (by Michael Zevin)This morning, the American Astronomical Society announced the new partnership that it will have with Astrobites! We are beyond excited to embark on this new partnership with the

  14. The Strica Homolog AaCASPS16 Is Involved in Apoptosis in the Yellow Fever Vector, Aedes albopictus

    Science.gov (United States)

    Meng, Kun; Li, Xiaomei; Wang, Shengya; Zhong, Chunyan; Yang, Zhouning; Feng, Lingyan; Liu, Qingzhen

    2016-01-01

    Caspases are a family of cysteine proteases playing essential roles during apoptosis. Seven caspases identified in Drosophila were Dronc, Dredd, Strica, Dcp-1, Decay, Drice and Damm. Among them, Strica is an insect-specific caspase containing a long serine- and threonine- rich prodomain, of which function is not yet well studied. Here we identified a homolog of strica from Aedes albopictus, named as Aacasps16. Aacasps16 encoded a protein containing a putative serine- and threonine-rich prodomain and a well conserved caspase catalytic domain. AaCASPS16 shared high identity with dipteran insects Strica homologs. Alignment showed that the closest relative of AaCASPS16 was Aedes aegypti AeCASPS16. The expression profiles of Aacasps16 during developmental and adult stages were analyzed. Purified recombinant AaCASPS16 exhibited the highest caspase activity to WEHD, which is the substrate preferred by human caspase-9. AaCASPS16 induced apoptosis when over-expressed in C6/36 cells. AaCASPS16 was processed during apoptosis induced by actinomycin D and ultraviolet irradiation treatment, whereas partial silencing of Aacasps16 reduced actinomycin D- and ultraviolet irradiation-triggered apoptosis in C6/36 cells. Taken together, our study identified AaCASPS16 as a novel apoptotic caspase in Aedes albopictus. PMID:27351972

  15. The Strica Homolog AaCASPS16 Is Involved in Apoptosis in the Yellow Fever Vector, Aedes albopictus.

    Directory of Open Access Journals (Sweden)

    Kun Meng

    Full Text Available Caspases are a family of cysteine proteases playing essential roles during apoptosis. Seven caspases identified in Drosophila were Dronc, Dredd, Strica, Dcp-1, Decay, Drice and Damm. Among them, Strica is an insect-specific caspase containing a long serine- and threonine- rich prodomain, of which function is not yet well studied. Here we identified a homolog of strica from Aedes albopictus, named as Aacasps16. Aacasps16 encoded a protein containing a putative serine- and threonine-rich prodomain and a well conserved caspase catalytic domain. AaCASPS16 shared high identity with dipteran insects Strica homologs. Alignment showed that the closest relative of AaCASPS16 was Aedes aegypti AeCASPS16. The expression profiles of Aacasps16 during developmental and adult stages were analyzed. Purified recombinant AaCASPS16 exhibited the highest caspase activity to WEHD, which is the substrate preferred by human caspase-9. AaCASPS16 induced apoptosis when over-expressed in C6/36 cells. AaCASPS16 was processed during apoptosis induced by actinomycin D and ultraviolet irradiation treatment, whereas partial silencing of Aacasps16 reduced actinomycin D- and ultraviolet irradiation-triggered apoptosis in C6/36 cells. Taken together, our study identified AaCASPS16 as a novel apoptotic caspase in Aedes albopictus.

  16. First circulating beam in the AA

    CERN Multimedia

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.56 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are too numerous to name them all, but the 3 most prominent ones are at the centre (left to right): Roy Billinge (Joint AA Project Leader, with his hand on the control box), Eifionydd Jones (white shirt), Simon van der Meer (spiritus rector and Joint AA Project Leader). The first antiprotons were injected, made to circulate and cooled soon after, on 14 July 1980.

  17. Effect of supplementation of arachidonic acid (AA) or a combination of AA plus docosahexaenoic acid on breastmilk fatty acid composition

    NARCIS (Netherlands)

    Smit, EN; Koopmann, M; Boersma, ER; Muskiet, FAJ

    2000-01-01

    We investigated whether supplementation with arachidonic acid (20:4 omega 6; AA), ora combination of AA and docosahexaenoic acid (22:6 omega 3; DHA) would affect human milk polyunsaturated fatty acid (PUFA) composition. Ten women were daily supplemented with 300 mg AA, eight with 300 mg AA, 110 mg e

  18. Characterization of Aquifex aeolicus ribonuclease III and the reactivity epitopes of its pre-ribosomal RNA substrates

    OpenAIRE

    Shi, Zhongjie; Nicholson, Rhonda H.; Jaggi, Ritu; Nicholson, Allen W.

    2010-01-01

    Ribonuclease III cleaves double-stranded (ds) structures in bacterial RNAs and participates in diverse RNA maturation and decay pathways. Essential insight on the RNase III mechanism of dsRNA cleavage has been provided by crystallographic studies of the enzyme from the hyperthermophilic bacterium, Aquifex aeolicus. However, the biochemical properties of A. aeolicus (Aa)-RNase III and the reactivity epitopes of its substrates are not known. The catalytic activity of purified recombinant Aa-RNa...

  19. Friction Stir Weldabilities of AA1050-H24 and AA6061-T6 Aluminum Alloys

    Institute of Scientific and Technical Information of China (English)

    Huijie LIU; Hidetoshi FUJIN; Masakatsu MAEDA; Kiyoshi NOGI

    2005-01-01

    The friction stir weldabilities of the strain-hardened AA1050-H24 and precipitate-hardened AA6061-T6 aluminum alloys were examined to reveal the effects of material properties on the friction stir welding behavior. The experimental results are obtlained. (1) For AA1050-H24, the weld can possess smoother surface ripples; there is no elliptical weld nugget in the weld; there is no discernible interface between the stir zone and the thermomechanically affected zone;and the internal defect of the weld looks like a long crack and is located in the lower part of the weld. (2) For AA6061-T6, the weld usually possesses slightly rougher surface ripples; an elliptical weld nugget clearly exists in the weld; there are discernible interfaces among the weld nugget, thermomechanically affected zone and heat affected zone; and the internal defect of the weld is similar to that of the AA1050-H24 weld. (3) The effective range of welding parameters for AA1050-H24 is narrow, while the one for AA6061-T6 is very wide. (4) The maximum tensile strength efficiency of the AA1050-H24 joints is similar to that of the AA6061-T6 joints, i.e. 79% and 77%, respectively.

  20. The power of alternative assessments (AAs)

    Institute of Scientific and Technical Information of China (English)

    张千茜

    2013-01-01

    This article starts by discussing the potential disadvantages of traditional assessment towards young English as a Second Language (ESL) learners within the American public school education system. In response to such disadvantages, researchers ’call for the implementation of alternative assessments (AAs) is therefore introduced along with the various benefits of AAs. However, the current mainstream education policy in the US, namely No Child Left Behind (NCLB) Policy, is still largely based on the tra-ditional ways of testing, making policy-oriented implementation of AAs on large scales remarkably difficult. After careful analysis, the author points out several implications concerning how, under such an existing policy of NCLB, can practitioners effectively accommodate young ESL learners by applying the power of AAs.

  1. Dicty_cDB: FCL-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA03 (Link to dictyBase) - - - Contig-U15092-1 FCL-AA03E ...(Link to Original site) - - - - - - FCL-AA03E 627 Show FCL-AA03 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA03Q.Seq.d/ Representative seq. ID FCL-AA...03E (Link to Original site) Representative DNA sequence >FCL-AA03 (FCL-AA03Q) /CSM/FCL/FCL-AA/FCL-AA...03Q.Seq.d/ ACATAATGTTCCAAAAGAAAGCAATTGTTATTGATGGCAAAGGTCATTTGTTAGGTCGTT TAGCCTCCGTTGTTGCTAAATCCCTCCTCTCTGGTCAAAA

  2. Dicty_cDB: FCL-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA02 (Link to dictyBase) - - - Contig-U16560-1 FCL-AA02F ...(Link to Original site) FCL-AA02F 620 - - - - - - Show FCL-AA02 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ Representative seq. ID FCL-AA...02F (Link to Original site) Representative DNA sequence >FCL-AA02 (FCL-AA02Q) /CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ ATTAA...ATACAAAATACAAATACAAATAACAAATACTTTACTATAGCTTTTTTTTCTTATT TATTTCTCCAAATAATTTTTTAATATGCAAATCTTTGTTAAAA

  3. Dicty_cDB: FCL-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA09 (Link to dictyBase) - - - Contig-U16453-1 FCL-AA09F ...(Link to Original site) FCL-AA09F 485 - - - - - - Show FCL-AA09 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ Representative seq. ID FCL-AA...09F (Link to Original site) Representative DNA sequence >FCL-AA09 (FCL-AA09Q) /CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ GACAA...AAGTAAATAAAACATGTCCGCAAGTAATAAAGATGACCAACTCATGAAAAATGAG TTCGAAAGTACCTACGACAAAATTGTCGATTCATTCGACAA

  4. Dicty_cDB: FCL-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA08 (Link to dictyBase) - - - Contig-U16200-1 FCL-AA08Z ...(Link to Original site) - - FCL-AA08Z 574 - - - - Show FCL-AA08 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA08Q.Seq.d/ Representative seq. ID FCL-AA...08Z (Link to Original site) Representative DNA sequence >FCL-AA08 (FCL-AA08Q) /CSM/FCL/FCL-AA/FCL-AA...08Q.Seq.d/ XXXXXXXXXXTCGAAGCCAAAGGTCGTCTCGAAGAAGAATTCCATCGCTCGTACCAACTC TGATCGTTCAAGAAAGAGACTCGAAGCTGAAA

  5. Dicty_cDB: FC-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA09 (Link to dictyBase) - - - Contig-U15086-1 FC-AA09E (Li...nk to Original site) - - - - - - FC-AA09E 562 Show FC-AA09 Library FC (Link to library) Clone ID FC-AA09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA09Q.Seq.d/ Representative seq. ID FC-AA...09E (Link to Original site) Representative DNA sequence >FC-AA09 (FC-AA09Q) /CSM/FC/FC-AA/FC-AA09Q.Seq....d/ GATACATTATCACCATGGCAGGAAAAAAAGTCAAATCTAACACACCAAAACAAGACTTAT CTGTCTCTAAATCAAAGCTCACCAGCATTAAAGCCCCAGCTGCTGCCATCAAAGCTAAA

  6. Dicty_cDB: FC-AA14 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA14 (Link to dictyBase) - - - Contig-U15088-1 FC-AA14E (Li...nk to Original site) - - - - - - FC-AA14E 431 Show FC-AA14 Library FC (Link to library) Clone ID FC-AA14 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA14Q.Seq.d/ Representative seq. ID FC-AA...14E (Link to Original site) Representative DNA sequence >FC-AA14 (FC-AA14Q) /CSM/FC/FC-AA/FC-AA14Q.Seq.d/ CTATGTCTGAAATCAAAA...CTGAAGAACTCGCTTGCATCTACTCCGGTCTTTTATTACAAG ATGACGGTATTGAAATCACCGCTGATAAAATCAAAACCTTATTAGAAGCTGCCAA

  7. Dicty_cDB: FCL-AA04 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA04 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA04Z ...(Link to Original site) - - FCL-AA04Z 530 - - - - Show FCL-AA04 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA04Q.Seq.d/ Representative seq. ID FCL-AA...04Z (Link to Original site) Representative DNA sequence >FCL-AA04 (FCL-AA04Q) /CSM/FCL/FCL-AA/FCL-AA...04Q.Seq.d/ XXXXXXXXXXCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTTCAGTCAAAGAAATT AAAAGAGGTATGGTCGCTGGTGACTCCAAAAACGATCCACCACAAGAAA

  8. Dicty_cDB: FC-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA20 (Link to dictyBase) - - - Contig-U16455-1 FC-AA20Z (Li...nk to Original site) - - FC-AA20Z 607 - - - - Show FC-AA20 Library FC (Link to library) Clone ID FC-AA20 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA20Q.Seq.d/ Representative seq. ID FC-AA...20Z (Link to Original site) Representative DNA sequence >FC-AA20 (FC-AA20Q) /CSM/FC/FC-AA/FC-AA20Q.Seq....d/ XXXXXXXXXXCTTTGCCCCAGCTGGTCTCTCAACTGAAGTCAAATCAGTCGAAATGCATC ACGAACAACTCCCAGAAGCCCGTCCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTT CAGTCAA

  9. Dicty_cDB: FCL-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA15 (Link to dictyBase) - - - Contig-U16011-1 FCL-AA15Z ...(Link to Original site) - - FCL-AA15Z 442 - - - - Show FCL-AA15 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA15Q.Seq.d/ Representative seq. ID FCL-AA...15Z (Link to Original site) Representative DNA sequence >FCL-AA15 (FCL-AA15Q) /CSM/FCL/FCL-AA/FCL-AA...15Q.Seq.d/ XXXXXXXXXXCCATTCATCTGTCCAATCGATTGTCGTCGTGGTCTCTACAAGAATATCGT CTTATCTGGTGGTTCAACCATGTTTAAAGATTTTGGTAAACGTCTTCAA

  10. Dicty_cDB: FC-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA13 (Link to dictyBase) - - - Contig-U15674-1 FC-AA13Z (Li...nk to Original site) - - FC-AA13Z 528 - - - - Show FC-AA13 Library FC (Link to library) Clone ID FC-AA13 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA13Q.Seq.d/ Representative seq. ID FC-AA...13Z (Link to Original site) Representative DNA sequence >FC-AA13 (FC-AA13Q) /CSM/FC/FC-AA/FC-AA13Q.Seq.d/ XXXXXXXXXXAAAGCAAA...CTCGTGCTGGTCAACGTACCCGTTTCAAGGCTTTCGTCGTTG TTGGTGATCACAACGGTCATGTAGGTCTCGGTGTTAAATGCGCTAAGGAA

  11. Dicty_cDB: FCL-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA20 (Link to dictyBase) - - - Contig-U15052-1 FCL-AA20E ...(Link to Original site) - - - - - - FCL-AA20E 1159 Show FCL-AA20 Library FCL (Link to library) Clone ID FCL-AA...L http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ Representative seq. ID FCL-AA...20E (Link to Original site) Representative DNA sequence >FCL-AA20 (FCL-AA20Q) /CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ AAAA...CATTTACAAATGATGACCACAGAAGATGTACAACCAATTGAAACTACCAAAGATGG TGTAGTAGTATTAAATTATAGCGATTTAATTGCAGGTAAA

  12. Dicty_cDB: FC-AA23 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA23 (Link to dictyBase) - - - Contig-U16090-1 FC-AA23E (Li...nk to Original site) - - - - - - FC-AA23E 387 Show FC-AA23 Library FC (Link to library) Clone ID FC-AA23 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA23Q.Seq.d/ Representative seq. ID FC-AA...23E (Link to Original site) Representative DNA sequence >FC-AA23 (FC-AA23Q) /CSM/FC/FC-AA/FC-AA23Q.Seq.d/ AAACTCGATTATATTCTTAA...TCTTAAAGTTCAAGATTTCATGGAAAGACGTCTCCAAACT TTAGTCTTCAAAAATGGTCTTGCCAAATCAATCCATCACGCTCGTGTTTTAATCAAA

  13. Dicty_cDB: FC-AA12 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA12 (Link to dictyBase) - - - Contig-U15087-1 FC-AA12E (Li...nk to Original site) - - - - - - FC-AA12E 454 Show FC-AA12 Library FC (Link to library) Clone ID FC-AA12 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA12Q.Seq.d/ Representative seq. ID FC-AA...12E (Link to Original site) Representative DNA sequence >FC-AA12 (FC-AA12Q) /CSM/FC/FC-AA/FC-AA12Q.Seq.d/ AAATAATAATAATATAAAAA...TGGAAATTAAAGTTTTAGCTAAAAGAAAAGTATCAGCAAA ACGTGCAAATGAAATATTAGGAAAATTTATTTTAGAAAGAAAAGCAAATGAAGAAAA

  14. Dicty_cDB: FC-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA01 (Link to dictyBase) - - - Contig-U15084-1 FC-AA01E (Li...nk to Original site) - - - - - - FC-AA01E 701 Show FC-AA01 Library FC (Link to library) Clone ID FC-AA01 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA01Q.Seq.d/ Representative seq. ID FC-AA...01E (Link to Original site) Representative DNA sequence >FC-AA01 (FC-AA01Q) /CSM/FC/FC-AA/FC-AA01Q.Seq.d/ GAGAAATATTTCTTATTAA...CAATTGCATGCGTTGTATTCAACCCAACATGGTGGAATATT ACAGCAAGAATGGAATATAATGCTAATAAATAACAACCATTTTCTTTACTTCCACAAA

  15. Dicty_cDB: FCL-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA10 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA10Z ...(Link to Original site) - - FCL-AA10Z 627 - - - - Show FCL-AA10 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA10Q.Seq.d/ Representative seq. ID FCL-AA...10Z (Link to Original site) Representative DNA sequence >FCL-AA10 (FCL-AA10Q) /CSM/FCL/FCL-AA/FCL-AA...10Q.Seq.d/ XXXXXXXXXXTAAACCAGGTATGGTCGTCACCTTTTGCCCCAGCTGGTCTCTCAACTGAA GTCAAATCAGTCGAAATGCATCACGAACAACTCCCAGAA

  16. Dicty_cDB: FC-AA19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA19 (Link to dictyBase) - - - Contig-U16072-1 FC-AA19F (Li...nk to Original site) FC-AA19F 539 - - - - - - Show FC-AA19 Library FC (Link to library) Clone ID FC-AA19 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA19Q.Seq.d/ Representative seq. ID FC-AA...19F (Link to Original site) Representative DNA sequence >FC-AA19 (FC-AA19Q) /CSM/FC/FC-AA/FC-AA19Q.Seq.d/ CAGAAA...TCACTGGTTTTTCATTCCAATTATTTAATATTATCAGTATTTGGAATGTTGATC AAACATCATTCAATAGCTACAGTCTTCCAATTTGGTTACCAGCCATTCAA

  17. Dicty_cDB: FC-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA02 (Link to dictyBase) - - - Contig-U16527-1 FC-AA02Z (Li...nk to Original site) - - FC-AA02Z 458 - - - - Show FC-AA02 Library FC (Link to library) Clone ID FC-AA02 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA02Q.Seq.d/ Representative seq. ID FC-AA...02Z (Link to Original site) Representative DNA sequence >FC-AA02 (FC-AA02Q) /CSM/FC/FC-AA/FC-AA02Q.Seq.d/ XXXXXXXXXXCAAAAA...GGCTCCTGGTCCGGAAGGATTGGGTAATCATTTGAATTTCCTAC GTAACTGGGCTTGATCTTTGTAATTATTGATCATAAACGAGGAATTCCTTGTAAGCGTAA

  18. Dicty_cDB: FCL-AA24 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA24 (Link to dictyBase) - - - Contig-U16467-1 FCL-AA24E ...(Link to Original site) - - - - - - FCL-AA24E 779 Show FCL-AA24 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA24Q.Seq.d/ Representative seq. ID FCL-AA...24E (Link to Original site) Representative DNA sequence >FCL-AA24 (FCL-AA24Q) /CSM/FCL/FCL-AA/FCL-AA...24Q.Seq.d/ CTAGAAATTTCTAAACAATTATTTATTTGAAGAGGTTTTTTAAAAAAAGAAAAAAATCAG AGCATCCAAATAATAACCGCAGTAAGGGGGGGATGGTTGTTAA

  19. Dicty_cDB: FCL-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA05 (Link to dictyBase) - - - Contig-U16473-1 FCL-AA05Z ...(Link to Original site) - - FCL-AA05Z 603 - - - - Show FCL-AA05 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA05Q.Seq.d/ Representative seq. ID FCL-AA...05Z (Link to Original site) Representative DNA sequence >FCL-AA05 (FCL-AA05Q) /CSM/FCL/FCL-AA/FCL-AA...05Q.Seq.d/ XXXXXXXXXXTGGCGCCATCATTACTGGTGGAGGTGGTGTTGCTATCACTCAAGCTCAAC CATCATACCAAGCTGATGCCGTTGCCACTTACATCAAAA

  20. Magnetic horn of the Antiproton Accumulator (AA)

    CERN Multimedia

    Photographic Service

    1988-01-01

    In the 1960s, the invention of this "current sheet lens" has helped to greatly improve the flux of neutrino beams. It was used again at the AA, collecting antiprotons from the production target at angles too large to fit into the acceptance of the AA. It was machined from aluminium to a thickness of 1.4 mm and pulsed at 400 kA for 15 microseconds (half-sine).

  1. Investigation of photocatalytic activity of titanium dioxide deposited on metallic substrates by DC magnetron sputtering

    DEFF Research Database (Denmark)

    Daviðsdóttir, Svava; Canulescu, Stela; Dirscherl, Kai;

    2013-01-01

    The photocatalytic properties of titanium dioxide (TiO2) coating in the anatase crystalline structure deposited on aluminium AA1050 alloy and stainless steel S316L substrates were investigated. The coating was prepared by DC magnetron sputtering. The microstructure and surface morphology...

  2. AAS 228: Day 3 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session 2015 Newton Lacy Pierce Prize Lecture: The Elephant in the Room: Effects of Distant, Massive Companions on Planetary System Architectures (by Leonardo dos Santos)The first session on Wednesday at 228th AAS Meeting was the Newton Lacy Pierce Prize Lecture by Heather Knutson (California Institute of Technology). This talk featured a broad range of research efforts on exoplanets, with the main focus on how we study the composition of their atmospheres, and how multi-body interactions carve the structure of the planetary systems we observe.One of her first points is the well-known idea that the Solar System is an oddball, compared to the exoplanet systems we have found so far: most of these systems contain hot Jupiters and mini-Neptunes at very close-in orbits around their host stars. Moreover, even when studying their transmission spectra, it is difficult to know the exact composition of their atmospheres.Knutson: it is difficult to constrain atmospheric composition of exoplanets (H-poor or H-rich+clouds?) #aas228pic.twitter.com/LdyN4o9RC7 astrobites (@astrobites) June 15, 2016The main proposal on how these systems formed is the migration scenario. In order to validate this idea, Dr. Knutson and her group The Friends of Hot Jupiters study systems with close-in gas giants and their frequency of binary companions, which are supposed to be the main culprits causing gas-giant migration. They found that approximately half of the observed systems have long-distance companions, providing strong validation of the migration scenario. Moreover, Dr. Knutson speculates that wide binaries have more

  3. AAS 228: Day 1 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session: From Space Archeology to Serving the World Today: A 20-year Journey from the Jungles of Guatemala to a Network of Satellite Remote Sensing Facilities Around the World(by Michael Zevin)In the conferences second plenary session, NASAs Daniel Irwin turned the eyes of the conference back to Earth by highlighting the huge impact that NASA missions play in protecting and developing our own planet.Daniel Irwin: using satellite imagery to detect differences in vegetation and find ancient Mayan cities. #aas228 pic.twitter.com/9LFPQdCHTM astrobites (@astrobites) June 13, 2016Irwin came to be involved in NASA through his work mapping Guatemalan jungles, where he would spend 22 days at a time exploring the treacherous jungles on foot armed with a 1st generation GPS, a compass, and a machete. A colleague introduced Irwin to the satellite imagery thathe was exploring, demonstratinghow these images are a strong complement to field work. The sharing of this satellite data with nearby villages helped to show the encroachment of agriculture and the necessity of connecting space to the village. Satellite imagery also played a role in archeological endeavors, uncovering dozens of Mayan cities that have been buried for over a millennia by vegetation, and it provided evidence that the fall of the Mayan civilization may have been due to massive deforestation that ledto drought.Glacial retreat in Chile imaged by ISERV.Irwin displayed the constellation of NASAs Earth-monitoring satellites that have played an integral role in conserving our planet and alerting the world of natural disasters. He also showed

  4. The AA disappearing under concrete shielding

    CERN Multimedia

    1982-01-01

    When the AA started up in July 1980, the machine stood freely in its hall, providing visitors with a view through the large window in the AA Control Room. The target area, in which the high-intensity 26 GeV/c proton beam from the PS hit the production target, was heavily shielded, not only towards the outside but also towards the AA-Hall. However, electrons and pions emanating from the target with the same momentum as the antiprotons, but much more numerous, accompanied these through the injection line into the AA ring. The pions decayed with a half-time corresponding to approximately a revolution period (540 ns), whereas the electrons lost energy through synchrotron radiation and ended up on the vacuum chamber wall. Electrons and pions produced the dominant component of the radiation level in the hall and the control room. With operation times far exceeding original expectations, the AA had to be buried under concrete shielding in order to reduce the radiation level by an order of magnitude.

  5. Poly(2,5-bis(N-Methyl-N-HexylaminoPhenylene Vinylene (BAM-PPV as Pretreatment Coating for Aerospace Applications: Laboratory and Field Studies

    Directory of Open Access Journals (Sweden)

    Peter Zarras

    2014-12-01

    Full Text Available In this study, an electroactive polymer (EAP, poly(2,5-bis(N-methyl-N-hexylaminophenylene vinylene (BAM-PPV was investigated as a potential alternative surface pretreatment for hexavalent chromium (Cr(VI-based aerospace coatings. BAM-PPV was tested as a pretreatment coating on an aerospace aluminum alloy (AA2024-T3 substrate in combination with a non-Cr(VI epoxy primer and a polyurethane Advanced Performance Coating (APC topcoat. This testing was undertaken to determine BAM-PPV’s adhesion, corrosion-inhibition, compatibility and survivability in laboratory testing and during outdoor field-testing. BAM-PPV showed excellent adhesion and acceptable corrosion performance in laboratory testing. The BAM-PPV aerospace coating system (BAM-PPV, non-Cr(VI epoxy primer and polyurethane APC topcoat was field tested for one year on the rear hatch door of the United States Air Force C-5 cargo plane. After one year of field testing there was no evidence of delamination or corrosion of the BAM-PPV aerospace coating system.

  6. A Nacreous Self-Assembled Nanolaminate for Corrosion Resistance on 2024-Al Alloy

    OpenAIRE

    Gordon, Matthew

    2001-01-01

    Nanometer thick layers of clay and polymer were formed on mica, silicon, and aluminum 2024-T3 alloy using alternating solutions of positively and negatively charged polymer and clay, respectively. Atomic force microscopy was used to observe the morphology of the composite films on mica and silicon. It was found that solution concentrations of clay above 0.02 weight percent lead to the uncontrolled deposition of clay platelets on the substrateâ s surface. By using solution concentrations o...

  7. AAS Nova and Astrobites: Making current astronomy research accessible

    Science.gov (United States)

    Kohler, Susanna; Astrobites Team

    2016-10-01

    AAS Nova and Astrobites are two resources available for astronomers, astronomy students, and astronomy enthusiasts to keep up with some of the most recent research published across the field of astronomy. Both supported by the AAS, these two daily astrophysical literature blogs provide accessible summaries of recent publications on the arXiv and in AAS journals. We present the goals, content, and readership of AAS Nova and Astrobites, and discuss how they might be used as tools in the undergraduate classroom.

  8. Dicty_cDB: FC-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA03 (Link to dictyBase) - - - Contig-U15331-1 FC-AA03P (Li...nk to Original site) FC-AA03F 595 FC-AA03Z 546 FC-AA03P 1141 - - Show FC-AA03 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA03Q.Seq.d/ Representative seq. ID FC-AA...03P (Link to Original site) Representative DNA sequence >FC-AA03 (FC-AA03Q) /CSM/FC/FC-AA/FC-AA03Q.Seq.d/ AA...AATGTCATCTTATTTATTCACTAGTGAATCCGTCACCGAAGTCATCCAGATAAAATCT GTGATCAAGTATCAGATGCTGTTCTCGATGCTTGTTTAGCTCAA

  9. Dicty_cDB: FC-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA10 (Link to dictyBase) - - - Contig-U16358-1 FC-AA10P (Li...nk to Original site) FC-AA10F 659 FC-AA10Z 544 FC-AA10P 1203 - - Show FC-AA10 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA10Q.Seq.d/ Representative seq. ID FC-AA...10P (Link to Original site) Representative DNA sequence >FC-AA10 (FC-AA10Q) /CSM/FC/FC-AA/FC-AA10Q.Seq.d/ AA...ATGACTACCTTTAACGAATATCCATTCTTGGCTGAATTAGGCATTAAAGCTGAAAATA ATGATGGAGTCTTCAATGGAAAATGGGGAGGTGCTGGTGAAATCATCAA

  10. Chromium-free conversion coatings based on inorganic salts (Zr/Ti/Mn/Mo) for aluminum alloys used in aircraft applications

    Energy Technology Data Exchange (ETDEWEB)

    Santa Coloma, P., E-mail: patricia.santacoloma@tecnalia.com [TECNALIA Research & Innovation, Parque Tecnológico de San Sebastián, Mikeletegi Pasealekua 2, E-20009 Donostia-San Sebastián, Gipuzkoa (Spain); Izagirre, U.; Belaustegi, Y.; Jorcin, J.B.; Cano, F.J. [TECNALIA Research & Innovation, Parque Tecnológico de San Sebastián, Mikeletegi Pasealekua 2, E-20009 Donostia-San Sebastián, Gipuzkoa (Spain); Lapeña, N. [Boeing Research & Technology Europe, S.L.U., Avenida Sur del Aeropuerto de Barajas 38, Building 4 – 3rd Floor, E-28042 Madrid (Spain)

    2015-08-01

    Highlights: • Chromium-free conversion coatings for corrosion protection of aluminum alloys. • Salt spray and potentiodynamic sweep tests to study the corrosion behavior. • Local deposits on Cu-rich intermetallic particles enhanced corrosion resistance. • Surface characterization to relate bath's composition and corrosion resistance. • Best corrosion protection with conversion baths without titanium salts. - Abstract: Novel chromium-free conversion coatings based on Zr/Ti/Mn/Mo compounds were developed at a pilot scale to improve the corrosion resistance of the AA2024-T3 and AA7075-T6 aluminum alloys for aircraft applications. The influence of the presence of Zr and Ti in the Zr/Ti/Mn/Mo conversion bath's formulation on the corrosion resistance of the coated alloys was investigated. The corrosion resistance provided by the conversion coatings was evaluated by salt spray exposure and potentiodynamic sweeps. Optical and scanning electron microscopy coupled with energy dispersive spectroscopy (SEM/EDS) and atomic force microscopy (AFM) operating in the Kelvin Probe mode (SKPFM) were used to provide microstructural information of the coated samples that achieved the best results in the corrosion tests. The salt spray test evidenced the higher corrosion resistance of the coated samples compared to the bare surfaces for both alloys. The potentiodynamic tests showed that the corrosion current density decreased for coated AA7075-T6 and AA2024-T3 alloys, which indicated an obvious improvement of the corrosion resistance with all the processes for both alloys. Although the corrosion resistance of the coated samples appeared to be higher for the alloy AA7075-T6 than for the alloy AA2024-T3, both alloys achieved the best corrosion protection with the coatings deposited from conversion bath formulations containing no titanium salts. The microscopy analysis on the coated AA7075-T6 samples revealed that a local deposition of Zr compounds and, possibly, an

  11. Chromium-free conversion coatings based on inorganic salts (Zr/Ti/Mn/Mo) for aluminum alloys used in aircraft applications

    Science.gov (United States)

    Santa Coloma, P.; Izagirre, U.; Belaustegi, Y.; Jorcin, J. B.; Cano, F. J.; Lapeña, N.

    2015-08-01

    Novel chromium-free conversion coatings based on Zr/Ti/Mn/Mo compounds were developed at a pilot scale to improve the corrosion resistance of the AA2024-T3 and AA7075-T6 aluminum alloys for aircraft applications. The influence of the presence of Zr and Ti in the Zr/Ti/Mn/Mo conversion bath's formulation on the corrosion resistance of the coated alloys was investigated. The corrosion resistance provided by the conversion coatings was evaluated by salt spray exposure and potentiodynamic sweeps. Optical and scanning electron microscopy coupled with energy dispersive spectroscopy (SEM/EDS) and atomic force microscopy (AFM) operating in the Kelvin Probe mode (SKPFM) were used to provide microstructural information of the coated samples that achieved the best results in the corrosion tests. The salt spray test evidenced the higher corrosion resistance of the coated samples compared to the bare surfaces for both alloys. The potentiodynamic tests showed that the corrosion current density decreased for coated AA7075-T6 and AA2024-T3 alloys, which indicated an obvious improvement of the corrosion resistance with all the processes for both alloys. Although the corrosion resistance of the coated samples appeared to be higher for the alloy AA7075-T6 than for the alloy AA2024-T3, both alloys achieved the best corrosion protection with the coatings deposited from conversion bath formulations containing no titanium salts. The microscopy analysis on the coated AA7075-T6 samples revealed that a local deposition of Zr compounds and, possibly, an oxidation process occurred in the vicinity of the alloy's intermetallic particles. The amount of the Zr deposits at these locations increased with coating's formulations without Ti, which provided the best corrosion resistance. The Cr-free conversion coatings developed in this study for the AA7075-T6 and AA2024-T3 alloys do not meet yet the strict requirements of the aircraft industry. However, they significantly improved the corrosion

  12. Flow Injection and Atomic Absorption Spectrometry (FI-AAS) -

    DEFF Research Database (Denmark)

    Hansen, Elo Harald

    1996-01-01

    of (especially HG- forming) elements. In the words of the one of the authorities of AAS and foremost pioneers of FI-AAS - Professor Z. L. Fang, who is the author on two recently published monographs on this hyphenated technique - the impact of FI on AAS is "so dramatic" that it has brought "new vitality...

  13. AAS 228: Day 2 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  14. AAS 228: Day 2 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  15. AAS 228: Day 2 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  16. Robust plasmonic substrates

    DEFF Research Database (Denmark)

    Kostiučenko, Oksana; Fiutowski, Jacek; Tamulevicius, Tomas;

    2014-01-01

    substrates is presented, which relies on the coverage of gold nanostructures with diamond-like carbon (DLC) thin films of thicknesses 25, 55 and 105 nm. DLC thin films were grown by direct hydrocarbon ion beam deposition. In order to find the optimum balance between optical and mechanical properties...... and breaking. DLC coating with thicknesses between 25 and 105 nm is found to considerably increase the mechanical strength of the substrates while at the same time ensuring conservation of sufficient field enhancements of the gold plasmonic substrates....

  17. AAS 228: Day 2 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  18. AA, vacuum tank for stochastic precooling

    CERN Multimedia

    1979-01-01

    The vaccum tank in which the fast stochastic precooling kicker was installed. It is clad with heating jackets for bake-out to 200 deg C, indispensable for reaching the operational vacuum of 7E-11 Torr. Alain Poncet, responsible for AA vacuum, is looking on. See also 7910268, 8002234.

  19. AA, mating of BST magnet halves

    CERN Multimedia

    1980-01-01

    The AA had 2 types of bending magnets: BLG (window-frame,long and narrow) and BST (H-type, short and wide). The BST had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the mating of two BST halves.

  20. EValuation of the thixoformability of AA7004 and AA7075 alloys

    Directory of Open Access Journals (Sweden)

    Eugenio José Zoqui

    2010-09-01

    Full Text Available This study involved a complete evaluation of the thixoformability of AA7004 and AA7075 alloys, from their microstructural characterization to their viscous behavior. The alloys were subjected to globularization heat treatments for 0, 30, 90 and 210 seconds in two conditions of solid fractions, 45 and 60%, and to viscosity assays under the same conditions. Heat treatments promote the globularization of primary phase particles; hence, the best viscosity results were achieved for alloys with low solid fractions heat-treated for 210 seconds. Alloys AA7004 and AA7075 showed an apparent viscosity of 10(4 to 10(5 (Pa.s. The behavior of materials in this range is similar to that of molten glass and they show high formability. However, the AA7075 alloy showed a better performance than the AA7004 due to the smaller size of its primary particles and original grains, their lower growth during reheating, and depending on the condition, their viscosity of 10(4 Pa.s, which is extremely low for thixoforming standards.

  1. Processing and Optimization of Dissimilar Friction Stir Welding of AA 2219 and AA 7039 Alloys

    Science.gov (United States)

    Venkateswarlu, D.; Nageswara rao, P.; Mahapatra, M. M.; Harsha, S. P.; Mandal, N. R.

    2015-12-01

    The present paper discusses the optimization of dissimilar friction stir welding of AA 2219 and AA 7039 alloys with respect to tool design issues including microstructural study of weld. The optimized ultimate tensile strength was ~280 MPa, and % elongation was ~11.5. It was observed that the extent of tool shoulder flat surface and tool rotational speed influenced the weld quality significantly. A mathematical model was also developed using response surface regression analysis to predict the effects of tool geometry and process variables on dissimilar AA 2219 and AA 7039 alloys welds. The microstructure evolution and mechanical properties were investigated by employing electron backscatter diffraction technique, Vickers microhardness, and tensile testing, respectively. The microstructural observations indicated that the grain size obtained at advancing side (AA 2219 alloy side) was much finer compared to the retreating side (AA 7039 alloy side). Hardness distribution in the stir zone was inhomogeneous, which might be due to inadequate mixing of weld zone material. The hardness values observed at the weld zone were lower than that in the base materials.

  2. Dicty_cDB: FC-AA11 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA11 (Link to dictyBase) - - - Contig-U16273-1 FC-AA11P (Li...nk to Original site) FC-AA11F 631 FC-AA11Z 502 FC-AA11P 1133 - - Show FC-AA11 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA11Q.Seq.d/ Representative seq. ID FC-AA...11P (Link to Original site) Representative DNA sequence >FC-AA11 (FC-AA11Q) /CSM/FC/FC-AA/FC-AA...11Q.Seq.d/ GGTGAATTAATTGTTGAACCAGTTGATCAAAAATATATTTTCAAGACTGAACGTAAAGTT CCAAGAATGGGTGTTATGATTGTTGGTTTATGTGGTAACAATGGTACAA

  3. Dicty_cDB: FC-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA18 (Link to dictyBase) - - - Contig-U15943-1 FC-AA18P (Li...nk to Original site) FC-AA18F 506 FC-AA18Z 293 FC-AA18P 799 - - Show FC-AA18 Library FC (Link to library) Clone ID FC-AA...al site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA18Q.Seq.d/ Representative seq. ID FC-AA...18P (Link to Original site) Representative DNA sequence >FC-AA18 (FC-AA18Q) /CSM/FC/FC-AA/FC-AA18Q.Seq.d/ AAA...AGATAGAGAAGAAAGAAAACTTGAACGTGAGAAGGAACTTGAACGTGAACGTGAGAA AGAACTTGAGCGTGAGCGTGAACGTGAACAACGTCGTCTTGAAA

  4. Dicty_cDB: FCL-AA07 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA07 (Link to dictyBase) - - - Contig-U14973-1 FCL-AA07P ...(Link to Original site) FCL-AA07F 527 FCL-AA07Z 253 FCL-AA07P 780 - - Show FCL-AA07 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA07Q....Seq.d/ Representative seq. ID FCL-AA07P (Link to Original site) Representative DNA sequence >FCL-AA07 (FCL-AA07Q) /CSM/FCL/FCL-AA.../FCL-AA07Q.Seq.d/ CAAAATAAAAAATGTTATCAAATTTTTTAAAAGTCAACAGTAAAGCACTAGGACATATAA GAACTTTTGCCTCAAAGAGTGGTGAAATTAAA

  5. Dicty_cDB: FCL-AA12 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA12 (Link to dictyBase) - - - Contig-U16034-1 FCL-AA12P ...(Link to Original site) FCL-AA12F 629 FCL-AA12Z 540 FCL-AA12P 1169 - - Show FCL-AA12 Library FCL (Link to library) Clone ID FCL-AA...4-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA12Q....Seq.d/ Representative seq. ID FCL-AA12P (Link to Original site) Representative DNA sequence >FCL-AA12 (FCL-AA12Q) /CSM/FCL/FCL-AA.../FCL-AA12Q.Seq.d/ ATCAAATGTTTATTCAACAACAACCATCAGATTCAATTGTTTGTAATCGTTATATTCATC CAGCCATTGTTGTTTTGGTTGACCAA

  6. Dicty_cDB: FCL-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA21 (Link to dictyBase) - - - Contig-U14936-1 FCL-AA21P ...(Link to Original site) FCL-AA21F 520 FCL-AA21Z 356 FCL-AA21P 876 - - Show FCL-AA21 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA21Q....Seq.d/ Representative seq. ID FCL-AA21P (Link to Original site) Representative DNA sequence >FCL-AA21 (FCL-AA21Q) /CSM/FCL/FCL-AA.../FCL-AA21Q.Seq.d/ ATCATAATCATATATTTTTAATAGATATTGATATATATATTTAAAAAAATAAAATAAAAT AAAATAAAAAATGTCAACAGAGGAAACAAAAA

  7. Dicty_cDB: FCL-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA01 (Link to dictyBase) - - - Contig-U16033-1 FCL-AA01P ...(Link to Original site) FCL-AA01F 603 FCL-AA01Z 411 FCL-AA01P 1014 - - Show FCL-AA01 Library FCL (Link to library) Clone ID FCL-AA...3-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA01Q....Seq.d/ Representative seq. ID FCL-AA01P (Link to Original site) Representative DNA sequence >FCL-AA01 (FCL-AA01Q) /CSM/FCL/FCL-AA.../FCL-AA01Q.Seq.d/ GCAAATAATAATATTATGGGTATTGACTTTGGTACACATTTCGCATGTGTTGGTATTTTC AAGAATGAAAGAATTGAAATCTGTCCAAA

  8. Dicty_cDB: FCL-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA13 (Link to dictyBase) - - - - FCL-AA13P (Link to Original site) FCL-AA...13F 635 FCL-AA13Z 350 FCL-AA13P 985 - - Show FCL-AA13 Library FCL (Link to library) Clone ID FCL-AA...dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ Representative seq. ID FCL-AA...13P (Link to Original site) Representative DNA sequence >FCL-AA13 (FCL-AA13Q) /CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ CATATTTATAA...TTATATCTTTTTTGTTTAATAAAAAAGAAAGAATACCAACATGAGACTT TTATTGTGTTTAATTTTCTTAGTTTTTGTTTTCAATTTTGCATTATCAA

  9. Dicty_cDB: FC-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA06 (Link to dictyBase) - - - Contig-U15909-1 FC-AA06P (Li...nk to Original site) FC-AA06F 532 FC-AA06Z 501 FC-AA06P 1033 - - Show FC-AA06 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA06Q.Seq.d/ Representative seq. ID FC-AA...06P (Link to Original site) Representative DNA sequence >FC-AA06 (FC-AA06Q) /CSM/FC/FC-AA/FC-AA...06Q.Seq.d/ GTGAATATAACGATTTAGATTTAGTGTATGATAAAGATGTTTATCAAAAATTAATAGAGA ATGGTGTAGATTCATTATTATCAAAA

  10. Dicty_cDB: FC-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA08 (Link to dictyBase) - - - Contig-U15942-1 FC-AA08P (Li...nk to Original site) FC-AA08F 620 FC-AA08Z 510 FC-AA08P 1130 - - Show FC-AA08 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA08Q.Seq.d/ Representative seq. ID FC-AA...08P (Link to Original site) Representative DNA sequence >FC-AA08 (FC-AA08Q) /CSM/FC/FC-AA/FC-AA...08Q.Seq.d/ ATCAGTTACATGTACTGCACCAGTTAATATTGCAGTTATCAAATATTGGGGAAAGAGAGA TGAAAATATTATTTTACCATTAAATTCATCACTCAGTGGAA

  11. Rare earth conversion coatings grown on AA6061 aluminum alloys. Corrosion studies

    Energy Technology Data Exchange (ETDEWEB)

    Brachetti S, S. B. [Instituto Tecnologico de Ciudad Madero, Av. 1o. de Mayo y Sor Juana I. de la Cruz, Col. Los Mangos, 89440 Ciudad Madero, Tanaulipas (Mexico); Dominguez C, M. A.; Torres H, A. M.; Onofre B, E. [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada - Altamira, Carretera Tampico-Puerto Industrial Altamira Km. 14.5, 89600 Altamira, Tamaulipas (Mexico); De la Cruz H, W., E-mail: mdominguezc@ipn.mx [UNAM, Centro de Nanociencias y Nanotecnologia, Apdo. Postal 2681, 22800 Ensenada, Baja California (Mexico)

    2014-07-01

    The present work is aimed to investigate the corrosion resistance of rare earth protective coatings deposited by spontaneous deposition on AA6061 aluminum alloy substrates. Coatings were deposited from water-based Ce(NO{sub 3}){sub 3} and La(NO{sub 3}){sub 3} solutions by varing parameters such as rare earth solution concentration, bath temperature and immersion time. The values of the Tafel slopes indicate that the cathodic process is favored by concentration polarization rather than activation polarization. Chemical and morphological characterizations of the surface before and after electrochemical evaluations were performed by X-ray photoelectron spectroscopy and scanning electron microscopy. (Author)

  12. Rare earth conversion coatings grown on AA6061 aluminum alloys. Corrosion studies

    International Nuclear Information System (INIS)

    The present work is aimed to investigate the corrosion resistance of rare earth protective coatings deposited by spontaneous deposition on AA6061 aluminum alloy substrates. Coatings were deposited from water-based Ce(NO3)3 and La(NO3)3 solutions by varing parameters such as rare earth solution concentration, bath temperature and immersion time. The values of the Tafel slopes indicate that the cathodic process is favored by concentration polarization rather than activation polarization. Chemical and morphological characterizations of the surface before and after electrochemical evaluations were performed by X-ray photoelectron spectroscopy and scanning electron microscopy. (Author)

  13. Microstructure analysis of aluminum extrusion: grain size distribution in AA6060, AA6082 and AA7075 alloys

    Energy Technology Data Exchange (ETDEWEB)

    Schikorra, M.; Tekkaya, A. E. [Institute of Forming Technology and Lightweight Construction, Dortmund (Germany); Donate, L.; Iomesani, L. [University of Bologna, Bologna (Italy)

    2007-10-15

    Microstructure and material flow of aluminum alloys have a significant influence on the mechanical properties and surface quality. In extrusion of aluminum billets at high temperatures the microstructure is dependent on the alloy and the forming and temperature history. A prediction of grain size and precipitation is of increasing importance in order to design the process by adjustment of parameters such as punch speed, temperatures, and quenching. To give references for microstructure prediction based on material flow, and with it strain and strain rate history, this paper deals with the microstructure during the extrusion process of AA6060, AA6082, and AA7075 alloys. Billets have been partly extruded to axisymmetric round profiles and the microstructure of the press rests consisting of the billet rests in container and die has been considered. Furthermore, these rests have been analyzed to show the material flow, dynamic and static recrystallization based on macro etchings and visible microstructure under different conditions, e.g. as in the area of high strain rate near the container wall, or in dead zones. To allow an accurate simulation of the extrusion process, punch force and temperature conditions during the tests have been measured and are presented in this paper, too.

  14. Absorption spectra of AA-stacked graphite

    Energy Technology Data Exchange (ETDEWEB)

    Chiu, C W; Lee, S H; Chen, S C; Lin, M F [Department of Physics, National Cheng Kung University, Taiwan (China); Shyu, F L, E-mail: fl.shyu@msa.hinet.ne, E-mail: mflin@mail.ncku.edu.t [Department of Physics, ROC Military Academy, 830 Kaohsiung, Taiwan (China)

    2010-08-15

    AA-stacked graphite shows strong anisotropy in geometric structures and velocity matrix elements. However, the absorption spectra are isotropic for the polarization vector on the graphene plane. The spectra exhibit one prominent plateau at middle energy and one shoulder structure at lower energy. These structures directly reflect the unique geometric and band structures and provide sufficient information for experimental fitting of the intralayer and interlayer atomic interactions. On the other hand, monolayer graphene shows a sharp absorption peak but no shoulder structure; AA-stacked bilayer graphene has two absorption peaks at middle energy and abruptly vanishes at lower energy. Furthermore, the isotropic features are expected to exist in other graphene-related systems. The calculated results and the predicted atomic interactions could be verified by optical measurements.

  15. Biaxially textured composite substrates

    Energy Technology Data Exchange (ETDEWEB)

    Groves, James R.; Foltyn, Stephen R.; Arendt, Paul N.

    2005-04-26

    An article including a substrate, a layer of a metal phosphate material such as an aluminum phosphate material upon the surface of the substrate, and a layer of an oriented cubic oxide material having a rock-salt-like structure upon the metal phosphate material layer is provided together with additional layers such as a HTS top-layer of YBCO directly upon a layer of a buffer material such as a SrTi.sub.x Ru.sub.1-x O.sub.3 layer.

  16. AA, inner conductor of a magnetic horn

    CERN Multimedia

    CERN PhotoLab

    1981-01-01

    At the start-up of the AA and during its initial operation, magnetic horns focused the antiprotons emanating from the production target. These "current-sheet lenses" had a thin inner conductor (for minimum absorption of antiprotons), machined from aluminium to wall thicknesses of 0.7 or 1 mm. The half-sine pulses rose to 150 kA in 8 microsec. The angular acceptance was 50 mrad.

  17. Research in development: the approach of AAS

    OpenAIRE

    Dugan, P.; Apgar, M.; Douthwaite, B.

    2013-01-01

    The CGIAR Research Program on Aquatic Agricultural Systems (AAS) is pursuing a Research in Development approach that emphasizes the importance of embedding research in the development context. Reflecting this emphasis the six elements of this approach are a commitment to people and place, participatory action research, gender transformative research, learning and networking, partnerships, and capacity building. It is through the careful pursuit of these six elements that we believe that the p...

  18. First circulating beam in the AA

    CERN Multimedia

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.5 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are to numerous to name them all. Heribert Koziol, apparently asleep, is answering the call from an impatient director. See also 8007094.

  19. AA Prototype-Quadrupole on Measurement Stand

    CERN Multimedia

    1979-01-01

    The very particular lattice of the AA required 2 types of quadrupoles: narrow ones (QFN, QDN) and wide ones (QFW, QDW). The wide ones, although rather short (steel length 0.54 m), had an unusually large aperture of 0.75 m in width, 0.68 m "good field". A prototype was built at CERN in 1978. Here we see it on its test stand, with a measurement coil inserted, Brian Pincott taking readings.

  20. AA, assembly of wide bending magnet

    CERN Multimedia

    1980-01-01

    The very particular lattice of the AA required 2 types of dipoles (bending magnets; BST, short and wide; BLG, long and narrow). The wide ones had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the copper coils being hoisted onto the lower half of a BST. See also 7811105, 8006050. For a BLG, see 8001044.

  1. AA Prototype-Quadrupole on Measurement Stand

    CERN Multimedia

    1978-01-01

    The very particular lattice of the AA required 2 types of quadrupoles: narrow ones (QFN, QDN) and wide ones (QFW, QDW). The wide ones, although not very long (steel length 0.54 m), had an unusually large aperture of 0.75 m in width, 0.68 m "good field". A prototype was built in 1978. Here we see it on its test stand, with Ray Brown positioning the measurement coil.

  2. Introducing the AAS Astronomy Ambassadors Program

    Science.gov (United States)

    Gurton, S.; Fienberg, R. T.; Fraknoi, A.; Prather, E. E.

    2013-04-01

    Newly established by the American Astronomical Society (AAS), the Astronomy Ambassadors program is designed to support early-career AAS members with training in resources and techniques for effective outreach to students and/or the public. A pilot Astronomy Ambassadors workshop will be held at the January 2013 AAS meeting. Workshop participants will learn to communicate effectively with public and school audiences; find outreach opportunities and establish ongoing partnerships with local schools, science centers, museums, parks, and/or community centers; reach audiences with personal stories, hands-on activities, and jargon-free language; identify strategies and techniques to improve their presentation skills; gain access to a menu of outreach resources that work in a variety of settings; and become part of an active community of astronomers who do outreach. Applications are welcome from advanced undergraduates (those doing research and committed to continuing in astronomy), graduate students, and postdocs and new faculty in their first two years after receipt of the PhD. We especially encourage applications from members of groups that are presently underrepresented in science.

  3. AAS Publishing News: Astronomical Software Citation Workshop

    Science.gov (United States)

    Kohler, Susanna

    2015-07-01

    Do you write code for your research? Use astronomical software? Do you wish there were a better way of citing, sharing, archiving, or discovering software for astronomy research? You're not alone! In April 2015, AAS's publishing team joined other leaders in the astronomical software community in a meeting funded by the Sloan Foundation, with the purpose of discussing these issues and potential solutions. In attendance were representatives from academic astronomy, publishing, libraries, for-profit software sharing platforms, telescope facilities, and grantmaking institutions. The goal of the group was to establish “protocols, policies, and platforms for astronomical software citation, sharing, and archiving,” in the hopes of encouraging a set of normalized standards across the field. The AAS is now collaborating with leaders at GitHub to write grant proposals for a project to develop strategies for software discoverability and citation, in astronomy and beyond. If this topic interests you, you can find more details in this document released by the group after the meeting: http://astronomy-software-index.github.io/2015-workshop/ The group hopes to move this project forward with input and support from the broader community. Please share the above document, discuss it on social media using the hashtag #astroware (so that your conversations can be found!), or send private comments to julie.steffen@aas.org.

  4. Multiple alternative substrate kinetics.

    Science.gov (United States)

    Anderson, Vernon E

    2015-11-01

    The specificity of enzymes for their respective substrates has been a focal point of enzyme kinetics since the initial characterization of metabolic chemistry. Various processes to quantify an enzyme's specificity using kinetics have been utilized over the decades. Fersht's definition of the ratio kcat/Km for two different substrates as the "specificity constant" (ref [7]), based on the premise that the important specificity existed when the substrates were competing in the same reaction, has become a consensus standard for enzymes obeying Michaelis-Menten kinetics. The expansion of the theory for the determination of the relative specificity constants for a very large number of competing substrates, e.g. those present in a combinatorial library, in a single reaction mixture has been developed in this contribution. The ratio of kcat/Km for isotopologs has also become a standard in mechanistic enzymology where kinetic isotope effects have been measured by the development of internal competition experiments with extreme precision. This contribution extends the theory of kinetic isotope effects to internal competition between three isotopologs present at non-tracer concentrations in the same reaction mix. This article is part of a special issue titled: Enzyme Transition States from Theory and Experiment.

  5. Comparison between ARB and CARB processes on an AA5754/AA6061 composite

    Science.gov (United States)

    Verstraete, K.; Helbert, A.-L.; Brisset, F.; Baudin, T.

    2014-08-01

    The present work aims to compare two processes: Accumulative Roll Bonding and Cross Accumulative Roll Bonding (CARB). Both processes consist in the repetition of rolling but the second technique adds a 90° rotation of the sheet around its normal direction between each rolling. Microstructure, mechanical properties and texture were compared for both processes on an AA5754/AA6061 composite. As a result a thinner and less elongated microstructure was obtained in the CARB process leading to an isotropy and an improvement of the mechanical properties. Besides, the texture was characterized by the rotated Cube component for both processes but for CARB it is of less strength.

  6. Simon van der Meer in the AA Control Room

    CERN Multimedia

    1984-01-01

    Simon van der Meer, spiritus rector of the Antiproton Accumulator, in the AA Control Room. Inventor of stochastic cooling, on which the AA was based, and of the magnetic horn, with which the antiprotons were focused, he also wrote most of the software with which the AA was controlled, and spent uncountable numbers of hours in this chair to tickle the AA to top performance. 8 months after this picture was taken, he received, in October 1984, the Nobel prize, together with Carlo Rubbia, the moving force behind the whole Proton-Antiproton Collider project that led to the discovery, in 1983, of the W and Z intermediate bosons.

  7. Dicty_cDB: FC-AA22 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA22 (Link to dictyBase) - - - Contig-U14948-1 FC-AA22E (Li...nk to Original site) - - - - - - FC-AA22E 576 Show FC-AA22 Library FC (Link to library) Clone ID FC-AA22 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA22Q.Seq.d/ Representative seq. ID FC-AA...22E (Link to Original site) Representative DNA sequence >FC-AA22 (FC-AA22Q) /CSM/FC/FC-AA/FC-AA22Q.Seq.d/ ATGAA...TACGATGATAGTGATTCAGACTTTTGACCAATTGAAAAAACCAGCAACAGAAATG GTACTGGTTTGGTCTCCTCCACTTTTAAGGTTGCCCCTTCCTTCTCTACCATTCAAAAAC AACAA

  8. Dicty_cDB: FC-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA15 (Link to dictyBase) - G01144 DDB0204372 Contig-U15089-1 FC-AA...15E (Link to Original site) - - - - - - FC-AA15E 522 Show FC-AA15 Library FC (Link to library) Clone ID FC-AA...9-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA15Q.Se...q.d/ Representative seq. ID FC-AA15E (Link to Original site) Representative DNA sequence >FC-AA15 (FC-AA15Q) /CSM/FC/FC-AA/FC-AA...15Q.Seq.d/ CAAATCACACATAAAAGTTTAATATAAAAATGGGTACACCAATTAAAAAGATTAGTACAG TAATTATTAAAATGGTTTCATCAGCCAA

  9. Dicty_cDB: FC-AA17 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA17 (Link to dictyBase) - - - Contig-U15091-1 FC-AA17E (Li...nk to Original site) - - - - - - FC-AA17E 347 Show FC-AA17 Library FC (Link to library) Clone ID FC-AA17 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA17Q.Seq.d/ Representative seq. ID FC-AA...17E (Link to Original site) Representative DNA sequence >FC-AA17 (FC-AA17Q) /CSM/FC/FC-AA/FC-AA17Q.Seq.d/ CCCAAAAGCCCGTAA...GACTCACTGTGTCAAGTGCAACAAACACACCCCACACAAGGTTAC CCAATACAAAGCTGGTAAACCAAGTCTTTTCGCACAAGGTAAAAGACGTTACGATCGTAA ACAA

  10. Dicty_cDB: FC-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA05 (Link to dictyBase) - G01143 DDB0190243 Contig-U15085-1 FC-AA...05E (Link to Original site) - - - - - - FC-AA05E 675 Show FC-AA05 Library FC (Link to library) Clone ID FC-AA...5-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA05Q.Se...q.d/ Representative seq. ID FC-AA05E (Link to Original site) Representative DNA sequence >FC-AA05 (FC-AA05Q) /CSM/FC/FC-AA/FC-AA...05Q.Seq.d/ AAACAAAAAAAAAAGGTATGGAAATTTTTGCATTTGTACCATTAGCAGTGTTAACAGCAT TATGTGTTGTTATTTCACTCTTTGTTAAAAGAGAGAAA

  11. Dicty_cDB: FCL-AA23 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA23 (Link to dictyBase) - G01759 DDB0201558 Contig-U15118-1 FCL-AA...23E (Link to Original site) - - - - - - FCL-AA23E 1045 Show FCL-AA23 Library FCL (Link to library) Clone ID FCL-AA...ig-U15118-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...23Q.Seq.d/ Representative seq. ID FCL-AA23E (Link to Original site) Representative DNA sequence >FCL-AA23 (FCL-AA...23Q) /CSM/FCL/FCL-AA/FCL-AA23Q.Seq.d/ ATAACTATATAACTATGTCTAACCAAAAGAAAAACGACGTATCTTCATTTGTTAAAGATT CTTTAA

  12. Dicty_cDB: FC-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA21 (Link to dictyBase) - - - Contig-U15450-1 FC-AA21E (Li...nk to Original site) - - - - - - FC-AA21E 839 Show FC-AA21 Library FC (Link to library) Clone ID FC-AA21 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA21Q.Seq.d/ Representative seq. ID FC-AA...21E (Link to Original site) Representative DNA sequence >FC-AA21 (FC-AA21Q) /CSM/FC/FC-AA/FC-AA21Q.Seq.d/ AATTATTTTCATTAA...TTTTAGCTTTATTCCTTGTCAACTCCGCTGTTGTCTCTTCACTCG ACTCATGTAGTATTTGTGTTGATTTTGTTGGTAACTCACTCAATGATCTTTTAAATATTA TCCTTAA

  13. Dicty_cDB: FCL-AA22 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA22 (Link to dictyBase) - G01758 DDB0229949 Contig-U15119-1 FCL-AA...22E (Link to Original site) - - - - - - FCL-AA22E 840 Show FCL-AA22 Library FCL (Link to library) Clone ID FCL-AA...g-U15119-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...22Q.Seq.d/ Representative seq. ID FCL-AA22E (Link to Original site) Representative DNA sequence >FCL-AA22 (FCL-AA...22Q) /CSM/FCL/FCL-AA/FCL-AA22Q.Seq.d/ AAAATGAGCAAAATCTCAAGCGACCAAGTTAGATCAATCGTCTCCCAACTTTTCAAAGAA GCACAAGAATCCAAAA

  14. Dicty_cDB: FCL-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA06 (Link to dictyBase) - G24322 DDB0216974 Contig-U15228-1 FCL-AA...06E (Link to Original site) - - - - - - FCL-AA06E 791 Show FCL-AA06 Library FCL (Link to library) Clone ID FCL-AA...g-U15228-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...06Q.Seq.d/ Representative seq. ID FCL-AA06E (Link to Original site) Representative DNA sequence >FCL-AA06 (FCL-AA...06Q) /CSM/FCL/FCL-AA/FCL-AA06Q.Seq.d/ AAAATCCCAATTTCATTAGCAGTGGAAGTAACGGAATGAATTGGGGTGGTTCTTTGAACA CTTGTGACTCTGGAGGATTCAA

  15. Dicty_cDB: FCL-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA18 (Link to dictyBase) - G24323 DDB0191144 Contig-U15229-1 FCL-AA...18Z (Link to Original site) - - FCL-AA18Z 623 - - - - Show FCL-AA18 Library FCL (Link to library) Clone ID FCL-AA...g-U15229-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...18Q.Seq.d/ Representative seq. ID FCL-AA18Z (Link to Original site) Representative DNA sequence >FCL-AA18 (FCL-AA...18Q) /CSM/FCL/FCL-AA/FCL-AA18Q.Seq.d/ XXXXXXXXXXGTCAATGTCATTATTGGTGAACAATCTGATGGTTCGTTGGAACAAATCGC TAGAAATCCACAACCAA

  16. Dicty_cDB: FC-AA16 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA16 (Link to dictyBase) - G22556 DDB0204121 Contig-U15090-1 FC-AA...16E (Link to Original site) - - - - - - FC-AA16E 933 Show FC-AA16 Library FC (Link to library) Clone ID FC-AA...0-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA16Q.Se...q.d/ Representative seq. ID FC-AA16E (Link to Original site) Representative DNA sequence >FC-AA16 (FC-AA16Q) /CSM/FC/FC-AA/FC-AA...16Q.Seq.d/ GGGCAGGATCATCATTTAATACTAAAGATTCAACAATAATTGCAAAAACTCAATTTTATC AAAAAAATATTCAAATTTATAAAGGTGATCAA

  17. Study on Fabrication of AA4032/AA6069 Cladding Billet Using Direct Chill Casting Process

    Science.gov (United States)

    Han, Xing; Zhang, Haitao; Shao, Bo; Li, Lei; Liu, Xuan; Cui, Jianzhong

    2016-04-01

    AA4032/AA6069 cladding billet in size of φ130 mm/φ110 mm was prepared by the modified direct chill casting process, and the parametric effect on casting performance was investigated using numerical simulation. Microstructures, elements distribution, and mechanical properties of the bonding interface were examined. The results show that metallurgical bonding interface can be obtained with the optimal parameters: the casting speed of 130 to 140 mm/min, the internal liquid level height of 50 to 60 mm, and the contact height of 40 to 50 mm. The metallurgical bonding interface is free of any discontinuities due to the fact that the alloying elements diffused across the interface and formed Ni-containing phase. Tensile strength of the cladding billet reaches 225.3 MPa, and the fracture position was located in AA6069 side, suggesting that the interface bonding strength is higher than the strength of AA6069. The interfacial shearing strength is 159.3 MPa, indicating excellent metallurgical bonding.

  18. Species differences in alternative substrate utilization by the antibacterial target undecaprenyl pyrophosphate synthase.

    Science.gov (United States)

    Dodbele, Samantha; Martinez, Christina D; Troutman, Jerry M

    2014-08-01

    Undecaprenyl pyrophosphate synthase (UPPS) is a critical enzyme required for the biosynthesis of polysaccharides essential for bacterial survival. In this report, we have tested the substrate selectivity of UPPS derived from the mammalian symbiont Bacteroides fragilis, the human pathogen Vibrio vulnificus, and the typically benign but opportunistic pathogen Escherichia coli. An anthranilamide-containing substrate, 2-amideanilinogeranyl diphosphate (2AA-GPP), was an effective substrate for only the B. fragilis UPPS protein, yet replacing the amide with a nitrile [2-nitrileanilinogeranyl diphosphate (2CNA-GPP)] led to a compound that was fully functional for UPPS from all three target organisms. These fluorescent substrate analogues were also found to undergo increases in fluorescence upon isoprenoid chain elongation, and this increase in fluorescence can be utilized to monitor the activity and inhibition of UPPS in 96-well plate assays. The fluorescence of 2CNA-GPP increased by a factor of 2.5-fold upon chain elongation, while that of 2AA-GPP increased only 1.2-fold. The 2CNA-GPP compound was therefore more versatile for screening the activity of UPPS from multiple species of bacteria and underwent a larger increase in fluorescence that improved its ability to detect increases in chain length. Overall, this work describes the development of new assay methods for UPPS and demonstrates the difference in substrate utilization between forms of UPPS from different species, which has major implications for UPPS inhibitor development, assay construction, and the development of polysaccharide biosynthesis probes. PMID:25020247

  19. AAS Special Session: Policy Making in Astronomy

    Science.gov (United States)

    Cardelli, J. A.; Massa, D.

    1995-12-01

    The professional astronomical community today is more diverse than at any time in its history. Individuals participating in creative research programs can be found in a wide range of positions. This type of diversity, which mixes research, education, and service (e.g. contract) work, represents the strength of contemporary astronomy. While recognizing the unavoidable reductions in funding and restructuring of organizations like NASA, it is imperative that the significance of the current diversity be considered during these processes. Creative ideas are one of the cornerstones of quality research, and they can originate anywhere. Consequently, it is essential that adequate research resources remain available for free and open competition by all astronomers. Our goal in this session is to bring together officials from the AAS, NASA, and the NSF to discuss how the policy and decision making process operates and whether it should be changed to better serve the general needs of the professional astronomical community. Examples of the issues we believe are important include: In establishing new policy, how can the needs of the average research astronomer be better addressed? How could input from such astronomers be provided to those who craft NASA/NSF policy? How can/should the AAS serve as an interface between policy/decision making bodies and its membership? Should the AAS membership become more actively/effectively involved in the decision making process and, if so, how? More information on this session and related issues can be found at the Association of Research Astronomers Home Page: http://www.phy.vill.edu/astro/faculty/ara/ara_home.htm

  20. AA, Inner Conductor of Magnetic Horn

    CERN Multimedia

    1979-01-01

    Antiprotons emerging at large angles from the production target (hit by an intense 26 GeV proton beam from the PS), were focused into the acceptance of the injection line of the AA by means of a "magnetic horn" (current-sheet lens). Here we see an early protype of the horn's inner conductor, machined from solid aluminium to a thickness of less than 1 mm. The 1st version had to withstand pulses of 150 kA, 15 us long, every 2.4 s. See 8801040 for a later version.

  1. Wooden Model of Wide AA Bending Magnet

    CERN Multimedia

    1978-01-01

    The very particular lattice of the AA required 2 types of dipoles (bending magnets: BLG, long and narrow; BST, short and wide). A wide one had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. A wooden model was build in 1978, to gain dimensional experience. Here, Peter Zettwoch, one of the largest men at CERN at that time, is putting a hand in the mouth of the wooden BST monster.

  2. Atlas of Vega: 3850 -- 6860 \\AA

    CERN Document Server

    Kim, Hyun-Sook; Valyavin, G; Lee, Byeong-Cheol; Shimansky, V; Galazutdinov, G A

    2009-01-01

    We present a high resolving power ($\\lambda$ / $\\Delta\\lambda$ = 90,000) and high signal-to-noise ratio ($\\sim$700) spectral atlas of Vega covering the 3850 -- 6860 \\AA wavelength range. The atlas is a result of averaging of spectra recorded with the aid of the echelle spectrograph BOES fed by the 1.8-m telescope at Bohyunsan observatory (Korea). The atlas is provided only in machine-readable form (electronic data file) and will be available in the SIMBAD database upon publication.

  3. Enhancement of wear and ballistic resistance of armour grade AA7075 aluminium alloy using friction stir processing

    Directory of Open Access Journals (Sweden)

    I. Sudhakar

    2015-03-01

    Full Text Available Industrial applications of aluminium and its alloys are restricted because of their poor tribological properties. Thermal spraying, laser surfacing, electron beam welding are the most widely used techniques to alter the surface morphology of base metal. Preliminary studies reveal that the coating and layering of aluminium alloys with ceramic particles enhance the ballistic resistance. Furthermore, among aluminium alloys, 7075 aluminium alloy exhibits high strength which can be compared to that of steels and has profound applications in the designing of lightweight fortification structures and integrated protection systems. Having limitations such as poor bond integrity, formation of detrimental phases and interfacial reaction between reinforcement and substrate using fusion route to deposit hard particles paves the way to adopt friction stir processing for fabricating surface composites using different sizes of boron carbide particles as reinforcement on armour grade 7075 aluminium alloy as matrix in the present investigation. Wear and ballistic tests were carried out to assess the performance of friction stir processed AA7075 alloy. Significant improvement in wear resistance of friction stir processed surface composites is attributed to the change in wear mechanism from abrasion to adhesion. It has also been observed that the surface metal matrix composites have shown better ballistic resistance compared to the substrate AA7075 alloy. Addition of solid lubricant MoS2 has reduced the depth of penetration of the projectile to half that of base metal AA7075 alloy. For the first time, the friction stir processing technique was successfully used to improve the wear and ballistic resistances of armour grade high strength AA7075 alloy.

  4. Investigation of decolorization of textile wastewater in an anaerobic/aerobic biological activated carbon system (A/A BAC).

    Science.gov (United States)

    Pasukphun, N; Vinitnantharat, S; Gheewala, S

    2010-04-01

    The aim of this study is to investigate the decolorization in anaerobic/aerobic biological activated carbon (A/A BAC) system. The experiment was divided into 2 stages; stage I is batch test for preliminary study of dye removal equilibrium time. The preliminary experiment (stage I) provided the optimal data for experimental design of A/A BAC system in SBR (stage II). Stage II is A/A BAC system imitated Sequencing Batch Reactor (SBR) which consist of 5 main periods; fill, react, settle, draw and idle. React period include anaerobic phase followed by aerobic phase. The BAC main media; Granular Activated Carbon (GAC), Mixed Cultures (MC) and Biological Activated Carbon (BAC) were used for dye and organic substances removal in three different solutions; Desizing Agent Solution (DAS), dye Solution (DS) and Synthetic Textile Wastewater (STW). Results indicate that GAC adsorption plays role in dye removal followed by BAC and MC activities, respectively. In the presence desizing agent, decolorization by MC was improved because desizing agent acts as co-substrates for microorganisms. It was found that 50% of dye removal efficiency was achieved in Fill period by MC. GC/MS analysis was used to identify dye intermediate from decolorization. Dye intermediate containing amine group was found in the solution and on BAC surfaces. The results demonstrated that combination of MC and BAC in the system promotes decolorization and dye intermediate removal. In order to improve dye removal efficiency in an A/A BAC system, replacement of virgin GAC, sufficient co-substrates supply and the appropriate anaerobic: aerobic period should be considered.

  5. Enhancement of wear and ballistic resistance of armour grade AA7075 aluminium alloy using friction stir processing

    Institute of Scientific and Technical Information of China (English)

    I. SUDHAKAR; V. MADHU; G. MADHUSUDHAN REDDY; K. SRINIVASA RAO

    2015-01-01

    Industrial applications of aluminium and its alloys are restricted because of their poor tribological properties. Thermal spraying, laser surfacing, electron beam welding are the most widely used techniques to alter the surface morphology of base metal. Preliminary studies reveal that the coating and layering of aluminium alloys with ceramic particles enhance the ballistic resistance. Furthermore, among aluminium alloys, 7075 aluminium alloy exhibits high strength which can be compared to that of steels and has profound applications in the designing of lightweight fortification structures and integrated protection systems. Having limitations such as poor bond integrity, formation of detrimental phases and interfacial reaction between reinforcement and substrate using fusion route to deposit hard particles paves the way to adopt friction stir processing for fabricating surface composites using different sizes of boron carbide particles as reinforcement on armour grade 7075 aluminium alloy as matrix in the present investigation. Wear and ballistic tests were carried out to assess the performance of friction stir processed AA7075 alloy. Significant improvement in wear resistance of friction stir processed surface composites is attributed to the change in wear mechanism from abrasion to adhesion. It has also been observed that the surface metal matrix composites have shown better ballistic resistance compared to the substrate AA7075 alloy. Addition of solid lubricant MoS2 has reduced the depth of penetration of the projectile to half that of base metal AA7075 alloy. For the first time, the friction stir processing technique was successfully used to improve the wear and ballistic resistances of armour grade high strength AA7075 alloy.

  6. Partially melted zone cracking in AA6061 welds

    Energy Technology Data Exchange (ETDEWEB)

    Prasad Rao, K. [Department of Metallurgical and Materials Engineering, Indian Institute of Technology Madras, Chennai (India)], E-mail: kpr@iitm.ac.in; Ramanaiah, N. [Sri Kalahasteeswara Institute of Technology, Srikalahasti (India); Viswanathan, N. [Defence Research and Development Laboratory, Hyderabad (India)

    2008-07-01

    Partially melted zone (PMZ) cracking susceptibility in AA6061 alloy was studied. Role of prior thermal history, gas tungsten arc welding techniques such as continuous current (CC) and pulsed current (PC) and use of different fillers (AA4043 and AA5356) were studied. Role of different grain refiners such as scandium, zirconium and Tibor in the above fillers was studied. Varestraint test was used to study the PMZ cracking susceptibility. Metallurgical analysis was done to corroborate the results. PMZ cracking was severe in T6 temper than in T4 irrespective of filler material. PMZ cracking susceptibility was more with AA5356 than in AA4043. It was less with pulsed current GTAW. PMZ cracking susceptibility was reduced with addition of grain refiners. Out of all, lowest PMZ cracking susceptibility was observed with 0.5%Sc addition to fusion zone through AA4043 filler and PC technique. The concentrations of magnesium and silicon were reduced at the PMZ grain boundaries with grain refiner additions to fusion zone through AA5356 or AA4043.

  7. The existence of an insulin-stimulated glucose and non-essential but not essential amino acid substrate interaction in diabetic pigs

    Directory of Open Access Journals (Sweden)

    Wijdenes Jan

    2011-05-01

    Full Text Available Abstract Background The generation of energy from glucose is impaired in diabetes and can be compensated by other substrates like fatty acids (Randle cycle. Little information is available on amino acids (AA as alternative energy-source in diabetes. To study the interaction between insulin-stimulated glucose and AA utilization in normal and diabetic subjects, intraportal hyperinsulinaemic euglycaemic euaminoacidaemic clamp studies were performed in normal (n = 8 and streptozotocin (120 mg/kg induced diabetic (n = 7 pigs of ~40-45 kg. Results Diabetic vs normal pigs showed basal hyperglycaemia (19.0 ± 2.0 vs 4.7 ± 0.1 mmol/L, P P P P P P P . Essential AA clearance was largely unchanged (72.9 ± 8.5 vs 63.3 ± 8.5 mL/kg· min, however clearances of threonine (P P Conclusions The ratio of insulin-stimulated glucose versus AA clearance was decreased 5.4-fold in diabetic pigs, which was caused by a 3.6-fold decrease in glucose clearance and a 2.0-fold increase in non-essential AA clearance. In parallel with the Randle concept (glucose - fatty acid cycle, the present data suggest the existence of a glucose and non-essential AA substrate interaction in diabetic pigs whereby reduced insulin-stimulated glucose clearance seems to be partly compensated by an increase in non-essential AA clearance whereas essential AA are preferentially spared from an increase in clearance.

  8. Dicty_cDB: FCL-AA17 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA17 (Link to dictyBase) - G03264 DDB0191099 Contig-U15602-1 FCL-AA...17P (Link to Original site) FCL-AA17F 547 FCL-AA17Z 610 FCL-AA17P 1157 - - Show FCL-AA17 Library F...CL (Link to library) Clone ID FCL-AA17 (Link to dictyBase) Atlas ID - NBRP ID G03264 dictyBase ID DDB0191099... Link to Contig Contig-U15602-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA.../FCL-AA17Q.Seq.d/ Representative seq. ID FCL-AA17P (Link to Original site) Representative DNA sequence >FCL-AA

  9. Dicty_cDB: FCL-AA14 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA14 (Link to dictyBase) - G03263 DDB0218474 Contig-U16035-1 FCL-AA...14P (Link to Original site) FCL-AA14F 647 FCL-AA14Z 550 FCL-AA14P 1197 - - Show FCL-AA14 Library F...CL (Link to library) Clone ID FCL-AA14 (Link to dictyBase) Atlas ID - NBRP ID G03263 dictyBase ID DDB0218474... Link to Contig Contig-U16035-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA.../FCL-AA14Q.Seq.d/ Representative seq. ID FCL-AA14P (Link to Original site) Representative DNA sequence >FCL-AA

  10. Dicty_cDB: FCL-AA19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA19 (Link to dictyBase) - G01757 DDB0230128 Contig-U16036-1 FCL-AA...19P (Link to Original site) FCL-AA19F 246 FCL-AA19Z 568 FCL-AA19P 814 - - Show FCL-AA19 Library FC...L (Link to library) Clone ID FCL-AA19 (Link to dictyBase) Atlas ID - NBRP ID G01757 dictyBase ID DDB0230128 ...Link to Contig Contig-U16036-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...19Q.Seq.d/ Representative seq. ID FCL-AA19P (Link to Original site) Representative DNA sequence >FCL-AA

  11. Nitrification in a zeoponic substrate

    Science.gov (United States)

    McGilloway, R. L.; Weaver, R. W.; Ming, D. W.; Gruener, J. E.

    2003-01-01

    Clinoptilolite is a zeolite mineral with high cation exchange capacity used in zeoponic substrates that have been proposed as a solid medium for growing plants or as a fertilizer material. The kinetics of nitrification has not been measured for NH4+ saturated zeoponic substrate. Experiments were conducted to evaluate the production of NO2- and NO3-, and nitrifier populations in zeoponic substrates. Small columns were filled with zeoponic substrate inoculated with a commercial inoculum or soil enrichment culture of nitrifying bacteria. In addition to column studies, a growth chamber study was conducted to evaluate the kinetics of nitrification in zeoponic substrates used to grow radishes (Raphanus sativus L.). The zeoponic substrate provided a readily available source of NH4+, and nitrifying bacteria were active in the substrate. Ammonium oxidation rates in column studies ranged from 5 to 10 micrograms N g-1 substrate h-1, and NO2- oxidation rates were 2 to 9.5 micrograms N g-1 substrate h-1. Rates determined from the growth chamber study were approximately 1.2 micrograms N g-1 substrate h-1. Quantities of NH4+ oxidized to NO2- and NO3- in inoculated zeoponic substrate were in excess of plant up-take. Acidification as a result of NH4+ oxidation resulted in a pH decline, and the zeoponic substrate showed limited buffering capacity.

  12. Fatigue crack growth behavior and AE signal recognition from a composite patch repaired Ai thein plate

    International Nuclear Information System (INIS)

    The fatigue crack growth behavior of a fatigue-cracked and patch-repaired AA2024-T3 plate has been monitored. It was found that the overall crack growth rate was reduced and the crack propagation into the adjacent hole was also retarded. Signals due to crack growth after patch-repair and those due to debonding of the plate-patch interface were discriminated each other by using principal component analysis. The former showed higher center frequency and lower amplitude, whereas the latter showed longer rise time, lower frequency and higher amplitude.

  13. Experimental investigation of hardness of FSW and TIG joints of Aluminium alloys of AA7075 and AA6061

    Directory of Open Access Journals (Sweden)

    Chetan Patil

    2016-07-01

    Full Text Available This paper reports hardness testing conducted on welded butt joints by FSW and TIG welding process on similar and dissimilar aluminium alloys. FSW joints were produced for similar alloys of AA7075T651 and dissimilar alloys of AA7075T651- AA6061T6. The Friction stir welds of AA7075 & AA6061 aluminium alloy were produced at different tool rotational speeds of 650,700, 800, 900, 1000 and transverse speed of 30, 35, 40 mm/min. TIG welding was conducted along the rolling direction of similar and dissimilar aluminium plates. The Brinell hardness testing techniques were employed to conduct the tests; these tests were conducted on the welds to ascertain the joint integrity before characterization to have an idea of the quality of the welds

  14. Maintainable substrate carrier for electroplating

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Chen-An; Abas, Emmanuel Chua; Divino, Edmundo Anida; Ermita, Jake Randal G.; Capulong, Jose Francisco S.; Castillo, Arnold Villamor; Ma, Diana Xiaobing

    2016-08-02

    One embodiment relates to a substrate carrier for use in electroplating a plurality of substrates. The carrier includes a non-conductive carrier body on which the substrates are placed and conductive lines embedded within the carrier body. A plurality of conductive clip attachment parts are attached in a permanent manner to the conductive lines embedded within the carrier body. A plurality of contact clips are attached in a removable manner to the clip attachment parts. The contact clips hold the substrates in place and conductively connecting the substrates with the conductive lines. Other embodiments, aspects and features are also disclosed.

  15. Failure analysis of fusion clad alloy system AA3003/AA6xxx sheet under bending

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Y., E-mail: shiyh@mcmaster.ca [Department of Mechanical Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada); Jin, H. [Novelis Global Technology Center, P.O. Box 8400, Kingston, Ontario, Canada K7L 5L9 (Canada); Wu, P.D. [Department of Mechanical Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada); Lloyd, D.J. [Aluminum Materials Consultants, 106 Nicholsons Point Road, Bath, Ontario, Canada K0H 1G0 (Canada); Embury, D. [Department of Mechanical Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada)

    2014-07-29

    An ingot of AA6xxx Al–Si–Mg–Cu alloy clad with AA3003 Al–Mn alloy was co-cast by Fusion technology. Bending tests and numerical modeling were performed to investigate the potential for sub-surface cracking for this laminate system. To simulate particle-induced crack initiation and growth, both random and stringer particles have been selected to mimic the particle distribution in the tested samples. The morphology of cracking in the model was similar to that observed in clad sheet tested in the Cantilever bend test. The crack initiated in the core close to the clad-core interface where the strain in the core is highest, between particles or near particles and propagates along local shear bands in the core, while the clad layer experiences extreme thinning before failure.

  16. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis

    Science.gov (United States)

    Gueutin, Victor; Langlois, Anne-Lyse; Shehwaro, Nathalie; Elharraqui, Ryme; Rouvier, Philippe; Izzedine, Hassane

    2013-01-01

    Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported. PMID:24558629

  17. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis

    OpenAIRE

    Victor Gueutin; Anne-Lyse Langlois; Nathalie Shehwaro; Ryme Elharraqui; Philippe Rouvier; Hassane Izzedine

    2013-01-01

    Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported.

  18. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis

    Directory of Open Access Journals (Sweden)

    Victor Gueutin

    2013-01-01

    Full Text Available Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported.

  19. NCBI nr-aa BLAST: CBRC-PTRO-27-0055 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PTRO-27-0055 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus... influenzae PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 8e-09 53% ...

  20. NCBI nr-aa BLAST: CBRC-HSAP-02-0029 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-HSAP-02-0029 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus... influenzae PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 5e-11 48% ...

  1. NCBI nr-aa BLAST: CBRC-PTRO-02-0026 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PTRO-02-0026 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus... influenzae PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 8e-09 50% ...

  2. NCBI nr-aa BLAST: CBRC-GGAL-35-0091 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0091 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus... influenzae PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 2e-08 34% ...

  3. NCBI nr-aa BLAST: CBRC-OLAT-13-0071 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OLAT-13-0071 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus... influenzae PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 0.14 37% ...

  4. NCBI nr-aa BLAST: CBRC-ACAR-01-0367 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0367 ref|ZP_01790024.1| hypothetical protein CGSHiAA_05974 [Haemophilus... influenzae PittAA] gb|EDK08288.1| hypothetical protein CGSHiAA_05974 [Haemophilus influenzae PittAA] ZP_01790024.1 4.0 29% ...

  5. NCBI nr-aa BLAST: CBRC-HSAP-02-0031 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-HSAP-02-0031 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus... influenzae PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 6e-09 52% ...

  6. NCBI nr-aa BLAST: CBRC-RNOR-08-0315 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RNOR-08-0315 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus... influenzae PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 8e-25 73% ...

  7. NCBI nr-aa BLAST: CBRC-RNOR-15-0027 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RNOR-15-0027 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus... influenzae PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 2e-30 98% ...

  8. NCBI nr-aa BLAST: CBRC-AGAM-07-0022 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0022 ref|ZP_01789747.1| hypothetical protein CGSHiAA_08330 [Haemophilus... influenzae PittAA] gb|EDK08473.1| hypothetical protein CGSHiAA_08330 [Haemophilus influenzae PittAA] ZP_01789747.1 2e-14 23% ...

  9. AA, shims and washers on quadrupole ends

    CERN Multimedia

    CERN PhotoLab

    1981-01-01

    Due to the fact that much of the field of the quadrupoles was outside the iron (in particular with the wide quadrupoles) and that thus the fields of quadrupoles and bending magnets interacted, the lattice properties of the AA could not be predicted with the required accuracy. After a first running period in 1980, during which detailed measurements were made with proton test beams, corrections to the quadrupoles were made in 1981, in the form of laminated shims at the ends of the poles, and with steel washers. With the latter ones, further refinements were made in an iterative procedure with measurements on the circulating beam. This eventually resulted, amongst other things, in a very low chromaticity, with the Q-values being constant to within +- 0.001 over the total momentum range of 6 %. Here we see the shims and washers on a narrow qudrupole (QFN, QDN). See also 8103203, 8103204, 8103205, 8103206.

  10. Effect of pressurized steam on AA1050 aluminium

    DEFF Research Database (Denmark)

    Jariyaboon, Manthana; Møller, Per; Ambat, Rajan

    2012-01-01

    Purpose - The purpose of this paper is to understand the effect of pressurized steam on surface changes, structures of intermetallic particles and corrosion behavior of AA1050 aluminium. Design/methodology/approach - Industrially pure aluminium (AA1050, 99.5 per cent) surfaces were exposed...... reactivities was observed due to the formation of the compact oxide layer. Originality/value - This paper reveals a detailed investigation of how pressurized steam can affect the corrosion behaviour of AA1050 aluminium and the structure of Fe-containing intermetallic particles....

  11. Corrosion issues of powder coated AA6060 aluminium profiles

    DEFF Research Database (Denmark)

    Din, Rameez Ud; Valgarðsson, Smári; Jellesen, Morten Stendahl;

    2015-01-01

    In this study detailed microstructural investigation of the reason for unexpected corrosion of powder coated aluminium alloy AA6060 windows profiles has been performed. The results from this study reveals that the failure of the window profiles was originated from the surface defects present...... on the extruded AA6060 aluminium profile after metallurgical process prior to powder coating. Surface defects are produced due to intermetallic particles in the alloy, which disturb the flow during the extrusion process. The corrosion mechanism leading to the failure of the powder coated AA6060 aluminium profiles...

  12. The A&A Experience With Impact Factors

    CERN Document Server

    Sandqvist, A

    2004-01-01

    There is a widespread impression that the scientific journal "Astronomy & Astrophysics" (A&A) has a smaller impact, as measured by citations to articles, than some of the other major astronomy journals. This impression was apparently supported - and probably created - by the Journal Citation Report (JCR), which is prepared annually by the Institute of Scientific Information (ISI) Web of Knowledge. The published poor impact factor of A&A was in fact wrong and was due to a serious flaw in the method used by ISI Web of Knowledge to determine it. The resulting damage inflicted upon A&A by the JCR is incalculable.

  13. PLZT capacitor on glass substrate

    Energy Technology Data Exchange (ETDEWEB)

    Fairchild, Manuel Ray; Taylor, Ralph S.; Berlin, Carl W.; Wong, Celine Wk; Ma, Beihai; Balachandran, Uthamalingam

    2016-03-29

    A lead-lanthanum-zirconium-titanate (PLZT) capacitor on a substrate formed of glass. The first metallization layer is deposited on a top side of the substrate to form a first electrode. The dielectric layer of PLZT is deposited over the first metallization layer. The second metallization layer deposited over the dielectric layer to form a second electrode. The glass substrate is advantageous as glass is compatible with an annealing process used to form the capacitor.

  14. Pedestal substrate for coated optics

    Science.gov (United States)

    Hale, Layton C.; Malsbury, Terry N.; Patterson, Steven R.

    2001-01-01

    A pedestal optical substrate that simultaneously provides high substrate dynamic stiffness, provides low surface figure sensitivity to mechanical mounting hardware inputs, and constrains surface figure changes caused by optical coatings to be primarily spherical in nature. The pedestal optical substrate includes a disk-like optic or substrate section having a top surface that is coated, a disk-like base section that provides location at which the substrate can be mounted, and a connecting cylindrical section between the base and optics or substrate sections. The connecting cylindrical section may be attached via three spaced legs or members. However, the pedestal optical substrate can be manufactured from a solid piece of material to form a monolith, thus avoiding joints between the sections, or the disk-like base can be formed separately and connected to the connecting section. By way of example, the pedestal optical substrate may be utilized in the fabrication of optics for an extreme ultraviolet (EUV) lithography imaging system, or in any optical system requiring coated optics and substrates with reduced sensitivity to mechanical mounts.

  15. SERS substrate and a method of providing a SERS substrate

    DEFF Research Database (Denmark)

    2011-01-01

    Source: US2011116089A A substrate primarily for SERS determination, the substrate has a number of elongate elements with a density of at least 1x108 elongate elements per cm2 and having metal coated tips. When the elements may be made to lean toward each other, such as by providing a drop...

  16. [Secondary amyloidosis (AA-type) due to localized cutaneous vasculitis].

    Science.gov (United States)

    Esteve, V; Ribera, L; Ponz, E; Almirall, J; López, T; Martínez Ocaña, J C; Ibeas, J; Rodríguez Jornet, A; Andreu, X; García, M

    2007-01-01

    We report a case of a 49 year old man, diagnosed soon after the outcome of casual proteinuria, of AA-type amyloidosis in relation to small and medium vessel cutaneous vasculitis without systemic involvement. This combination is a rare entity and only two cases of cutaneous hypersensibility vasculitis complicated with AA-type amyloidosis had been reported. We describe the results of the use of several immunosuppressive drugs during four years follow up with temporally total remission of the disease. PMID:18045042

  17. Systemic AA amyloidosis induced by liver cell adenoma.

    OpenAIRE

    Fievet, P; Sevestre, H; Boudjelal, M; Noel, L H; Kemeny, F; D. Franco; Delamarre, J; Capron, J.P.

    1990-01-01

    Systemic AA amyloidosis is a rare complication of benign tumours. This report describes a patient with hepatocellular adenoma associated with reactive AA amyloidosis. He had a nephrotic syndrome with deteriorating renal function and an increase of serum concentrations of acute phase proteins, mainly C-reactive protein. Resection of the tumour was followed by improvement in renal function and a marked decrease of the serum concentrations of acute phase proteins.

  18. AA amyloidosis as a complication of primary lymphedema.

    Science.gov (United States)

    Beloncle, François; Sayegh, Johnny; Eymerit-Morin, Caroline; Duveau, Agnès; Augusto, Jean-François

    2014-03-01

    Primary lymphedema is a rare disease caused by a disorder of lymphangiogenesis. Clinical presentation and age at onset are variable. AA amyloidosis is usually due to chronic inflammatory diseases, malignant tumors or less frequently chronic infectious diseases. We report here the first two cases of AA amyloidosis present with renal failure and nephrotic syndrome in patients with primary lymphedema-induced chronic leg ulcers. The first patient was a 62-year-old female who presented with chronic untreated leg ulcers for 8 years secondary to primary lymphedema. A kidney biopsy done for nephrotic syndrome allowed the diagnosis of AA amyloidosis. The second patient was a 54-year-old male who presented with hereditary lymphedema and elephantiasis since the age of 12. A salivary gland biopsy allowed the diagnosis of AA amyloidosis. Renal function deteriorated progressively needing chronic haemodialysis. Chronic leg ulcers have been rarely reported to induce AA amyloidosis. Only five other cases have been reported in the literature, but none of them with chronic lymphedema. We believe that the relation between lymphedema, chronic leg ulcers and AA amyloidosis is underestimated. PMID:23964754

  19. Interaction of Lysinibacillus sphaericus Cry48Aa/Cry49Aa toxin with midgut brush-border membrane fractions from Culex quinquefasciatus larvae.

    Science.gov (United States)

    Guo, Q-Y; Hu, X-M; Cai, Q-X; Yan, J-P; Yuan, Z-M

    2016-04-01

    The Cry48Aa/Cry49Aa mosquitocidal toxin from Lysinibacillus sphaericus was uniquely composed of a three-domain (Cry) toxin and binary (Bin) toxin-like protein, with high toxicity against Culex spp. However, its mode of action against the target mosquitoes is still unknown. In this study, Cry48Aa, Cry49Aa and its N- and C-terminal truncated proteins were expressed and purified, and the binding affinities of the purified proteins with midgut brush-border membrane fractions (BBMFs) from Culex quin-quefasciatus larvae were performed. The results showed that both Cry48Aa and Cry49Aa have specific and high binding affinity to BBMFs, with dissociation constants of 9.5 ± 1.8 and 25.4 ± 3.8 nM, respectively. Competition assays demonstrated that Cry49Aa C-terminal derivatives were able to bind to the BBMFs, whereas Far-Western dot blot analysis revealed that its N-terminal constructs interacted with Cry48Aa. Nevertheless, larvicidal activity was almost lost when Cry49Aa truncated proteins, either individually or in pairs, combined with Cry48Aa. It is concluded that Cry49Aa is responsible for receptor binding and interaction with Cry48Aa and plays an important role in the mechanism of action of these two-component toxins. PMID:26748768

  20. The OIV 1407.3\\AA /1401.1\\AA\\ emission-line ratio in a plasma

    CERN Document Server

    Nessib, Nabil Ben; Qindeel, Rabia; Sahal-Bréchot, Sylvie; Dimitrijević, Milan S

    2013-01-01

    Line ratio of O IV 1407.3 \\AA/1401.1 \\AA\\- is calculated using mostly our own atomic and collisional data. Energy levels and oscillator strengths needed for this calculation have been calculated using a Hartree-Fock relativistic (HFR) approach. The electron collision strengths introduced in the statistic equilibrium equations are fitted by Line ratio of O IV 1407.3 \\AA/1401.1 \\AA\\- is calculated using mostly our own atomic and collisional data. Energy levels and oscillator strengths needed for this calculation have been calculated using a Hartree-Fock relativistic (HFR) approach. The electron collision strengths introduced in the statistic equilibrium equations are fitted by polynomials for different energies. Comparison has also been made with available theoretical results. The provided line ratio has been obtained for a set of electron densities from $10^{8}$ cm$^{-3}$ to $10^{13}$ cm$^{-3}$ and for a fixed temperature of 50 000 K.

  1. A Novel Radiative Substrate Heater

    OpenAIRE

    CEYLAN, Abdullah; Kaynak, Erdal; ÖZCAN, Şadan; Firat, Tezer

    2004-01-01

    In this work, we have developed a new low cost radiative substrate heater for deposition of high-Tc superconducting thin films. It has all the features required for the preparation of high quality superconducting thin films. It is possible to reach ~ 800 °C substrate temperature with it by using only one 250 W halogen projector bulb.

  2. Soft substrates suppress droplet splashing

    CERN Document Server

    Howland, Christopher J; Style, Robert W; Castrejón-Pita, A A

    2015-01-01

    Droplets splash when they impact dry, flat substrates above a critical velocity that depends on parameters such as droplet size, viscosity and air pressure. We show that substrate stiffness also impacts the splashing threshold by imaging ethanol drops impacting silicone gels of different stiffnesses. Splashing is significantly suppressed: droplets on the softest substrates need over 70% more kinetic energy to splash than they do on rigid substrates. We show that splash suppression is likely to be due to energy losses caused by deformations of soft substrates during the first few microseconds of impact. We find that solids with Youngs modulus $\\lesssim O(10^5)$Pa suppress splashing, in agreement with simple scaling arguments. Thus materials like soft gels and elastomers can be used as simple coatings for effective splash prevention.

  3. Rupture locations of friction stir welded joints of AA2017-T351 and AA6061-T6 aluminum alloys

    Institute of Scientific and Technical Information of China (English)

    LIU Hui-jie; FENG Ji-cai; H. Fujii; M. Maeda; K. Nogi

    2005-01-01

    The tensile rupture locations of friction stir welded joints of AA2017-T351 and AA6061-T6 aluminum alloys were examined. The experiments show that the rupture locations of the joints are different for the two aluminum alloys, which are influenced by the welding parameters. When the joints are free of welding defects, the AA2017-T351 joints are ruptured in the weld nugget adjacent to the thermo-mechanically affected zone on the advancing side and the rupture surfaces appear as oval contours of the weld nugget, while the AA6061-T6 joints are ruptured in the heat affected zone on the retreating side and the rupture surfaces are inclined at a certain degree to the bottom surfaces of the joints. When welding defects are present in the joints, the AA2017-T351 joints are ruptured in the weld center, while the AA6061-T6 joints are ruptured on the retreating side near the weld center. The rupture locations of the joints are dependent on the internal structures of the joints and can be explained through them.

  4. A synergistic combination of tetraethylorthosilicate and multiphosphonic acid offers excellent corrosion protection to AA1100 aluminum alloy

    Energy Technology Data Exchange (ETDEWEB)

    Dalmoro, Viviane [Instituto de Química, Universidade Federal do Rio Grande do Sul (UFRGS) Av. Bento Gonçalves 9500 - CEP 91501-970, Porto Alegre, RS (Brazil); Departament d’Enginyeria Química, ETSEIB, Universitat Politècnica de Catalunya (UPC), Avda. Diagonal 647, Barcelona E-08028 (Spain); Center for Research in Nano-Engineering (CRnE), Universitat Politècnica de Catalunya (UPC), Campus Sud, Edifici C’, C/Pasqual i Vila s/n, Barcelona E-08028 (Spain); Santos, João H.Z. dos [Instituto de Química, Universidade Federal do Rio Grande do Sul (UFRGS) Av. Bento Gonçalves 9500 - CEP 91501-970, Porto Alegre, RS (Brazil); Armelin, Elaine, E-mail: elaine.armelin@upc.edu [Departament d’Enginyeria Química, ETSEIB, Universitat Politècnica de Catalunya (UPC), Avda. Diagonal 647, Barcelona E-08028 (Spain); Center for Research in Nano-Engineering (CRnE), Universitat Politècnica de Catalunya (UPC), Campus Sud, Edifici C’, C/Pasqual i Vila s/n, Barcelona E-08028 (Spain); Alemán, Carlos, E-mail: carlos.aleman@upc.edu [Departament d’Enginyeria Química, ETSEIB, Universitat Politècnica de Catalunya (UPC), Avda. Diagonal 647, Barcelona E-08028 (Spain); Center for Research in Nano-Engineering (CRnE), Universitat Politècnica de Catalunya (UPC), Campus Sud, Edifici C’, C/Pasqual i Vila s/n, Barcelona E-08028 (Spain); and others

    2013-05-15

    This work describes a new mechanism for the incorporation of organophosphonic acid into silane self-assembly monolayers, which has been used to protect AA1100 aluminum alloy. The protection improvement has been attributed to the fact that phosphonic structures promote the formation of strongly bonded and densely packed monolayer films, which show higher surface coverage and better adhesion than conventional silane systems. In order to evaluate the linking chemistry offered by phosphonic groups, two functionalized organophosphonic groups have been employed, 1,2-diaminoethanetetrakis methylenephosphonic acid (EDTPO) and aminotrimethylenephosphonic acid (ATMP), and combined with tetraethylorthosilicate (TEOS) films prepared by sol–gel synthesis. Results suggest that phosphonic acids may interact with the surface through a monodentate and bidentate coordination mode and, in addition, form one or more strong and stable linkages with silicon through non-hydrolysable bonds. Therefore, the incorporation of a very low concentration of phosphonic acids on TEOS solutions favors the complete coverage of the aluminum substrate during the silanization process, which is not possible using TEOS alone. The linking capacity of phosphonic acid has been investigated by FTIR-RA spectroscopy, SEM and EDX analysis, X-ray photoelectron spectroscopy (XPS), and quantum mechanical calculations. Finally, electrochemical impedance spectroscopy has been used to study the corrosion protection revealing that EDTPO-containing films afforded more protection to the AA1100 substrate than ATMP-containing films.

  5. AAS Committee on Employment Panel Introduction

    Science.gov (United States)

    Borne, Kirk; Fanelli, M. N.; Storrie-Lombardi, L. J.; Krishnamurthi, A.

    2006-12-01

    Many younger astronomers are unaware of the dangers and pitfalls that await them in the job market. Issues related to fringe benefits (if any), moving expenses, medical coverage for family members, teaching versus research expectations, etc. can lead to misunderstandings and to serious difficulties if these are not addressed early in the job interview process. The AAS Committee on Employment has often received letters from concerned junior members of the society, who feel that they needed more guidance and assistance in entering the job market for the first time. The major areas of concern have included those just listed, but there may be others. The session is structured as a panel presentation, whose members are asked to prepare in advance their top 10 questions that job applicants should ask, and we will instruct our panel members not to discuss their list at all with the other panel members prior to their presentations. This will ensure independent viewpoints and novel responses. The panel will consist of astronomers who have different perspectives on this issue, including old and young, postdoc and beyond, academic and non-academic. To kick off the session, we will invite a brief humorous presentation of the Top Ten List, in the style of The Night Show host David Letterman.

  6. Substrate-Sensitive Graphene Oxidation.

    Science.gov (United States)

    Zhang, Zhuhua; Yin, Jun; Liu, Xiaofei; Li, Jidong; Zhang, Jiahuan; Guo, Wanlin

    2016-03-01

    The inertness of graphene toward reaction with ambient molecules is essential for realizing durable devices with stable performance. Many device applications require graphene to contact with substrates, but whose impact on the chemical property of graphene has been largely overlooked. Here, we combine comprehensive first-principles analyses with experiments to show that graphene oxidation is highly sensitive to substrates. Graphene remains inert on SiO2 and hexagonal boron nitride but becomes increasingly weak against oxidation on metal substrates because of enhanced charge transfer and chemical interaction between them. In particular, Ni and Co substrates lead to spontaneous oxidation of graphene, while a Cu substrate maximally promotes the oxygen diffusion on graphene, with an estimated diffusivity 13 orders of magnitude higher than that on freestanding graphene. Bilayer graphene is revealed to have high oxidation resistance independent of substrate and thus is a better choice for high-performance nanoelectronics. Our findings should be extendable to a wide spectrum of chemical functionalizations of two-dimensional materials mediated by substrates. PMID:26884318

  7. Substrate integrated antennas and arrays

    CERN Document Server

    Cheng, Yu Jian

    2015-01-01

    Substrate Integrated Antennas and Arrays provides a single source for cutting-edge information on substrate integrated circuits (SICs), substrate integrated waveguide (SIW) feeding networks, SIW slot array antennas, SIC traveling-wave antennas, SIW feeding antennas, SIW monopulse antennas, and SIW multibeam antennas. Inspired by the author's extensive research, this comprehensive book:Describes a revolutionary SIC-based antenna technique with the potential to replace existing antenna technologiesExamines theoretical and experimental results connected to electrical and mechanical performanceExp

  8. Direct cooled power electronics substrate

    Science.gov (United States)

    Wiles, Randy H [Powell, TN; Wereszczak, Andrew A [Oak Ridge, TN; Ayers, Curtis W [Kingston, TN; Lowe, Kirk T [Knoxville, TN

    2010-09-14

    The disclosure describes directly cooling a three-dimensional, direct metallization (DM) layer in a power electronics device. To enable sufficient cooling, coolant flow channels are formed within the ceramic substrate. The direct metallization layer (typically copper) may be bonded to the ceramic substrate, and semiconductor chips (such as IGBT and diodes) may be soldered or sintered onto the direct metallization layer to form a power electronics module. Multiple modules may be attached to cooling headers that provide in-flow and out-flow of coolant through the channels in the ceramic substrate. The modules and cooling header assembly are preferably sized to fit inside the core of a toroidal shaped capacitor.

  9. Substrate noise coupling in RFICs

    CERN Document Server

    Helmy, Ahmed

    2008-01-01

    Substrate Noise Coupling in RFICs addresses substrate noise coupling in RF and mixed signal ICs when used in a system on chip (SoC) containing digital ICs as well. This trend of integrating RF, mixed signal ICs with large digital ICs is found in many of today's commercial ICs such as single chip Wi-Fi or Bluetooth solutions and is expected to grow rapidly in the future. The book reports modeling and simulation techniques for substrate noise coupling effects in RFICs and introduces isolation structures and design guides to mitigate such effects with the ultimate goal of enhancing the yield of R

  10. Droplet dynamics on patterned substrates

    Indian Academy of Sciences (India)

    A Dupuis; J M Yeomans

    2005-06-01

    We present a lattice Boltzmann algorithm which can be used to explore the spreading of droplets on chemically and topologically patterned substrates. As an example we use the method to show that the final configuration of a drop on a substrate comprising hydrophobic and hydrophilic stripes can depend sensitively on the dynamical pathway by which the state is reached. We also consider a substrate covered with micron-scale posts and investigate how this can lead to superhydrophobic behaviour. Finally we model how a Namibian desert beetle collects water from the wind.

  11. The Pasadena Recommendations: Five Years After AAS Endorsement

    Science.gov (United States)

    Knezek, Patricia; Frattare, L.; Ulvestad, J.

    2010-01-01

    It has been five years since the AAS Council unanimously endorsed the document, known as "Equity Now: The Pasadena Recommendations for Gender Equality in Astronomy," in January 2005. This document was the main product of the conference entitled "Women in Astronomy II: Ten Years After” (WIA II), held in June 2003 in Pasadena, CA. Participants of that 2003 meeting assessed the progress for women in science, offering insights into causes of the slower advancement of women, and discussed strategies to accelerate the achievement of equality. These insights and strategies were then incorporated into the "Pasadena Recommendations" by the CSWA. It was subsequently released to the entire AAS community for review and comments prior to its endorsement by the AAS. We will discuss the Recommendations and their impact since the endorsement by the AAS, including the process that is in place for organizations and departments to formally endorse the Pasadena Recommendations, thus making an organizational commitment to their implementation (see http://www.aas.org/cswa/pasadena_endorse.html).

  12. Film Growth on Nanoporous Substrate

    Science.gov (United States)

    Zhang, Xue; Joy, James; Zhao, Chenwei; Xu, J. M.; Valles, James

    Self-ordered nanoporous anodic aluminum oxide (AAO) provides an easy way to fabricate nano structured material, such as nano wires and nano particles. We employ AAO as substrates and focus on the thermally evaporated film growth on the surface of the substrate. With various materials deposited onto the substrate, we find the films show different structures, e,g. ordered array of nano particles for Lead and nanohoneycomb structure for Silver. We relate the differing behaviors to the difference of surface energy and diffusion constant. To verify this, the effect of substrate temperature on the film growth has been explored and the structure of the film has been successfully changed through the process. We are grateful for the support of NSF Grants No. DMR-1307290.

  13. Publication Characteristics of Members of the AAS

    Science.gov (United States)

    Abt, Helmut A.

    1990-10-01

    For each of the 4995 persons listed in the 1989 American Astronomical Society Membership Directory, we noted their total 1984-88 publications as listed in the Author Index of Astronomy and Astrophysics Abstracts. The members are subdivided as retired (mean of 0.61 paper/yr), foreign (3.89), Full (3.34), Division Affiliates (1.76), Associate (1.48), and Junior (0.79) members. For Full members the frequencies of various publication rates are listed; the median is 2.28 papers/yr. The Full members are subdivided by affiliations, namely private institutions (mean of 4.71 papers/yr), university (3.89), government-funded (3.46), commercial company (1.81), and unknown affiliations (0.84). We looked up the listed publications for four high producers who each average 25.7 papers/yr. We found that 55% of those are preprints, abstracts, conference papers, and other secondary material. Furthermore, they average 4.2 authors per original research paper. If we divide each original research paper by the number of authors, these four average only the equivalent of 4.0 single-author research papers/yr. A sample of moderate producers also have 53% of their publications as abstracts, conference papers, etc., and they average 4.2 authors per original research paper. We conclude that the average Full AAS member produces the equivalent of 1/2 single-author original-research paper/yr and 23% of them produce more than 1 such paper/yr.

  14. Microstrip antenna on tunable substrate

    Science.gov (United States)

    Jose, K. A.; Varadan, Vijay K.; Varadan, Vasundara V.; Mohanan, P.

    1995-05-01

    The tunable patch antenna configurations are becoming popular and attractive in many aspects. This was mainly due to the advent of ferrite thin film technology and tunable substrate materials. The integration of monolithic microwave circuits and antennas are becoming easy today. In the development of magnetic tuning of microstrip patch on ferrite substrate is presented by Rainville and Harackewiez. Radiation characteristics of such antennas are presented by Pozer. Band width and radiation characteristics of such tunable antennas are measured and compared. Usually the substrate losses are considered in the analysis and metallization losses are assumed to be ideal. The analysis of magnetic tunable radiator including metallization and ferrite substrate losses are presented. However, all such tuning and integration of circuits and antennas are mainly on ferrite substrate due to magnetic tuning. Recently, Varadan et al. established that the BaxSr1-xTiO3 series ferroelectric materials such as Barium Strontium Titanate (BST) are well suited for microwave phase shifter applications. It could be possible to change the dielectric constant of these materials more than 50% depending on the BST composition, by changing the applied bias voltage. Also, the porosity of BST can be controlled during processing to produce dielectric constants in the range of 15 to 1500, with some trade off in tunability. In this paper, we are presenting the possibility of designing a microstrip patch antenna on such tunable substrate. Such antennas are having the major advantage of electronic tunability and compact size.

  15. The Effect of Composite Patches on the Failure of Adhesively-Bonded Joints Under Bending Moment

    Science.gov (United States)

    Akpinar, Salih

    2013-12-01

    In this study, it was aimed to compare mechanical behavior of double-strap joints with aluminum (AA2024-T3) or 16-ply laminate of carbon/epoxy composite (T300/934) patches of different orientation angles at their overlap area subjected to bending moment. For this purpose, AA2024-T3 aluminum was used as adherend, while the adhesive was a two-part paste (DP 460). Six different types of joint samples were subjected to bending moment. The effect of patch material on failure load and stress distribution was examined experimentally and numerically. In the numerical analysis, the composite patches were assumed to behave linearly elastic, while adherend and adhesive layers were assumed to be nonlinear. It was found that the data obtained from 3-D finite element analysis were coherent with experimental results. Meanwhile, experiments showed that fiber orientation angles of the patches markedly affected the failure load of joints, failure mode and stress distributions appeared in adhesive and composite.

  16. NCBI nr-aa BLAST: CBRC-PTRO-07-0067 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  17. NCBI nr-aa BLAST: CBRC-TBEL-01-1883 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  18. NCBI nr-aa BLAST: CBRC-TNIG-14-0023 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  19. NCBI nr-aa BLAST: CBRC-FRUB-02-0074 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  20. NCBI nr-aa BLAST: CBRC-LAFR-01-1734 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  1. NCBI nr-aa BLAST: CBRC-OLAT-24-0009 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  2. NCBI nr-aa BLAST: CBRC-TNIG-10-0006 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  3. NCBI nr-aa BLAST: CBRC-ACAR-01-0845 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  4. NCBI nr-aa BLAST: CBRC-RNOR-05-0081 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0195 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  6. NCBI nr-aa BLAST: CBRC-ETEL-01-1516 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  7. NCBI nr-aa BLAST: CBRC-RMAC-04-0050 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  8. NCBI nr-aa BLAST: CBRC-PABE-07-0058 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  9. The 9aaTAD Transactivation Domains: From Gal4 to p53.

    Science.gov (United States)

    Piskacek, Martin; Havelka, Marek; Rezacova, Martina; Knight, Andrea

    2016-01-01

    The family of the Nine amino acid Transactivation Domain, 9aaTAD family, comprises currently over 40 members. The 9aaTAD domains are universally recognized by the transcriptional machinery from yeast to man. We had identified the 9aaTAD domains in the p53, Msn2, Pdr1 and B42 activators by our prediction algorithm. In this study, their competence to activate transcription as small peptides was proven. Not surprisingly, we elicited immense 9aaTAD divergence in hundreds of identified orthologs and numerous examples of the 9aaTAD species' convergence. We found unforeseen similarity of the mammalian p53 with yeast Gal4 9aaTAD domains. Furthermore, we identified artificial 9aaTAD domains generated accidentally by others. From an evolutionary perspective, the observed easiness to generate 9aaTAD transactivation domains indicates the natural advantage for spontaneous generation of transcription factors from DNA binding precursors. PMID:27618436

  10. Flexibility Analysis of Bacillus thuringiensis Cry1Aa

    Institute of Scientific and Technical Information of China (English)

    ZHAO Xin Min; XIA Li Qiu; YANG Xiao Ping; PENG Xiao Yun

    2015-01-01

    Objective To investigate the flexibility and mobility of the Bacillus thuringiensis toxin Cry1Aa. Methods The graph theory-based program Constraint Network Analysis and normal mode-based program NMsim were used to analyze the global and local flexibility indices as well as the fluctuation of individual residues in detail. Results The decrease in Cry1Aa network rigidity with the increase of temperature was evident. Two phase transition points in which the Cry1Aa structure lost rigidity during the thermal simulation were identified. Two rigid clusters were found in domains I and II. Weak spots were found in C-terminal domain III. Several flexible regions were found in all three domains;the largest residue fluctuation was present in the apical loop2 of domain II. Conclusion Although several flexible regions could be found in all the three domains, the most flexible regions were in the apical loops of domain II.

  11. Outcomes From AAS Hack Day at the 227th AAS Meeting

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This is a final post from the 227th AAS Meeting in Kissimmee, FL. This special summary of AAS Hack Day, a meeting of AAS members to collaboratively work on various small projects, was written by Meredith Rawls (@Merrdiff) and was originally posted on astrobites.com.As the 227thAmerican Astronomical Society meeting drew to a close (see highlights from Day 1, Day 2, Day 3, and Day 4), a group of at least 50 attendees spent Day 4working on small projects fondly called hacks. Thanks to sponsorship from LSST and Northrup Grumman, the industrious hackers werewell-caffeinated and fed so we could devote time and energy toworking in groups on one-day projects.TheHack Day beganat 10am with pitches. Anybody with a project idea was welcome to briefly speak and try to convince others to work with them. Only someideas panned out, but the enthusiasm was palpable. Its not every day you get a full room of astronomers and affiliates eager to spend hours working on fun and useful projects to benefit the community.#hackAAS is getting underway! #aas227 pic.twitter.com/yX7jlOnSCK James R A Davenport (@jradavenport) January 8, 2016Here is a rundown of what we accomplished. Pretty impressive for a single day! Many thanks to fellow astrobiter Erika Nesvold (now at Carnegie DTM; @erikanesvold) whose hack was live-documenting all the other hacks. Her tweets as @astrobites appeared with the #hackaas hashtag, and her notes made this recap post infinitely easier to write.Interested in joining the fun? Sign up for Hack Day at the 2017 JanuaryAAS meeting (its free with meeting registration), and consider applying for the .Astronomy conference this summer.Towards Optimal Session Scheduling:Adrian Price-Whelan (Columbia), David Hogg (NYU), and Scott Idem (AAS) began writing a program to take all submitted abstracts to a conference like AAS and sort them using keywords to avoid scheduling similar talks in parallel sessions. Its impossible to make everyone happy, but minimizing conflicts

  12. Injektointimassan kehittäminen AA-tiiviysluokan tunnelialueille

    OpenAIRE

    Parkkonen, Ilari

    2012-01-01

    Tutkimuksen tarkoituksena oli kehittää uusi kallioinjektointimassa AA-luokan tiiviysalueille, koska ennen käytetty injektointimassa sitoutui sekä kovettui liian hitaasti, mikä puolestaan hidasti louhintaa merkittävästi. Tutkimuksessa keskityttiin uuden injektointireseptin kehittämiseen uudella sementtivalmisteella. Kehittämisellä pyrittiin korvaamaan BB-sementti AA-sementillä, koska uusi sementti sitoutuu nopeammin kuin ennestään käytetty. Tutkimusmenetelmänä käytettiin Kalliotilojen inje...

  13. Precipitation hardening and hydrogen embrittlement of aluminum alloy AA7020

    Indian Academy of Sciences (India)

    Santosh Kumar; T K G Namboodhiri

    2011-04-01

    AA7020 Al–Mg–Zn, a medium strength aluminium alloy, is used in welded structures in military and aerospace applications. As it may be subjected to extremes of environmental exposures, including high pressure liquid hydrogen, it could suffer hydrogen embrittlement. Hydrogen susceptibility of alloy AA7020 was evaluated by slow strain-rate tensile testing, and delayed failure testing of hydrogen-charged specimens of air-cooled, duplexaged, and water-quenched duplex agedmaterials. The resistance to hydrogen embrittlement of the alloy was found to be in the order of air-cooled duplex aged alloy > as-received (T6 condition) > water quenched duplex aged material.

  14. Numerical semigroups II: pseudo-symmetric AA-Semigroups

    OpenAIRE

    García-Marco, Ignacio; Ramirez Alfonsin, Jorge; Rodseth, Oystein J.

    2016-01-01

    This paper is a continuation of the paper " Numerical Semigroups: Apéry Sets and Hilbert Series". We consider the general numerical AA-semigroup, i.e., semigroups consisting of all non-negative integer linear combinations of relatively prime positive integers of the form $a, a+d, a+2d,. .. , a+kd, c$. We first prove that, in contrast to arbitrary numerical semigroups, there exists an upper bound for the type of AA-semigroups that only depends on the number of generators of the semigroup. We t...

  15. Diagnostic performance of amyloid A protein quantification in fat tissue of patients with clinical AA amyloidosis

    NARCIS (Netherlands)

    Hazenberg, Bouke P. C.; Bijzet, Johannes; Limburg, Pieter C.; Skinner, Martha; Hawkins, Philip N.; Butrimiene, Irena; Livneh, Avi; Lesnyak, Olga; Nasonov, Evgeney L.; Filipowicz-Sosnowska, Anna; Guel, Ahmet; Merlini, Giampaolo; Wiland, Piotr; Oezdogan, Huri; Gorevic, Peter D.; Ben Maiz, Hedi; Benson, Merrill D.; Direskeneli, Haner; Kaarela, Kalevi; Garceau, Denis; Hauck, Wendy; van Rijswijk, Martin

    2007-01-01

    Objective. Amyloid A protein quantification in fat tissue is a new immunochemical method for detecting AA amyloidosis, a rare but serious disease. The objective was to assess diagnostic performance in clinical AA amyloidosis. Methods. Abdominal subcutaneous fat tissue of patients with AA amyloidosis

  16. Porous substrates filled with nanomaterials

    Science.gov (United States)

    Worsley, Marcus A.; Baumann, Theodore F.; Satcher, Jr., Joe H.; Stadermann, Michael

    2014-08-19

    A composition comprising: at least one porous carbon monolith, such as a carbon aerogel, comprising internal pores, and at least one nanomaterial, such as carbon nanotubes, disposed uniformly throughout the internal pores. The nanomaterial can be disposed in the middle of the monolith. In addition, a method for making a monolithic solid with both high surface area and good bulk electrical conductivity is provided. A porous substrate having a thickness of 100 microns or more and comprising macropores throughout its thickness is prepared. At least one catalyst is deposited inside the porous substrate. Subsequently, chemical vapor deposition is used to uniformly deposit a nanomaterial in the macropores throughout the thickness of the porous substrate. Applications include electrical energy storage, such as batteries and capacitors, and hydrogen storage.

  17. Lead induced intergranular fracture in aluminum alloy AA6262

    NARCIS (Netherlands)

    De Hosson, JTM

    2003-01-01

    The influence of lead on the fracture behavior of aluminum alloy AA6262 is investigated. Under certain conditions, the mode of fracture changes from transgranular microvoid coalescence to an intergranular mechanism. Three different intergranular fracture mechanisms are observed: liquid metal embritt

  18. Backend solutions for AA in the MUSE network supporting FMC

    NARCIS (Netherlands)

    Neerbos, A.N.R. van; Prins, M.; Melander, B.; Pimilla Larrucea, I.; Thakur, M.J.; Fredricx, F.

    2007-01-01

    The European MUSE project investigated fixed-mobile convergence from the perspective of an unbundled fixed network. A major part of the work consisted of finding solutions for the authentication and authorisation of users who roam from their home network to a visited network. This paper shows how AA

  19. Semiconductor films on flexible iridium substrates

    Science.gov (United States)

    Goyal, Amit

    2005-03-29

    A laminate semiconductor article includes a flexible substrate, an optional biaxially textured oxide buffer system on the flexible substrate, a biaxially textured Ir-based buffer layer on the substrate or the buffer system, and an epitaxial layer of a semiconductor. Ir can serve as a substrate with an epitaxial layer of a semiconductor thereon.

  20. Phonon scattering in graphene over substrate steps

    DEFF Research Database (Denmark)

    Sevincli, Haldun; Brandbyge, Mads

    2014-01-01

    We calculate the effect on phonon transport of substrate-induced bends in graphene. We consider bending induced by an abrupt kink in the substrate, and provide results for different step-heights and substrate interaction strengths. We find that individual substrate steps reduce thermal conductance...

  1. Sensor Technologies on Flexible Substrates

    Science.gov (United States)

    Koehne, Jessica

    2016-01-01

    NASA Ames has developed sensor technologies on flexible substrates integrated into textiles for personalized environment monitoring and human performance evaluation. Current technologies include chemical sensing for gas leak and event monitoring and biological sensors for human health and performance monitoring. Targeted integration include next generation EVA suits and flexible habitats.

  2. Modeling graphene-substrate interactions

    NARCIS (Netherlands)

    Amlaki, Taher

    2016-01-01

    In this thesis I focussed on the interactions between graphene-like materials (grapheme and germanene) and various substrates. The attractive properties of graphene like a high carrier mobility, its single-atomic thickness and its theoretical magic have made graphene a very popular and promising can

  3. Substrate preferences in laying hens

    NARCIS (Netherlands)

    Jong, de I.C.; Reenen, van K.

    2005-01-01

    We investigated the substrate preference of laying hens with respect to dustbathing and foraging behaviour, in order to determine which resources should be provided in laying hen housing systems for the expression of these behaviours. The consumer demand approach was used to study the strength of pr

  4. Neurobiological Substrates of Tourette's Disorder

    NARCIS (Netherlands)

    Leckman, James F.; Bloch, Michael H.; Smith, Megan E.; Larabi, Daouia; Hampson, Michelle

    2010-01-01

    Objective: This article reviews the available scientific literature concerning the neurobiological substrates of Tourette's disorder (TD). Methods: The electronic databases of PubMed, ScienceDirect, and PsycINFO were searched for relevant studies using relevant search terms. Results: Neuropathologic

  5. A Status Report on the AAS Astronomy Ambassadors Program

    Science.gov (United States)

    Fienberg, Richard Tresch; Fraknoi, Andrew; Gurton, Suzanne; Hurst, Anna; Schatz, Dennis L.

    2014-06-01

    The American Astronomical Society, in partnership with the Astronomical Society of the Pacific (ASP), has launched a series of professional-development workshops and a community of practice designed to improve early-career astronomers’ ability to communicate effectively with students and the public. Called AAS Astronomy Ambassadors, the program provides training and mentoring for young astronomers, from advanced undergraduates to beginning faculty; it also provides them access to resources and a network of contacts within the astronomy education and public outreach (EPO) community. Ambassadors are provided with a library of outreach activities and resource materials suitable for a range of venues and audiences. For much of this library we are using resources developed by organizations such as the ASP, the Pacific Science Center, and the Center for Astronomy Education for other outreach programs, though some resources have been created by one of us (AF) specifically for this program. After a period of evaluation and revision, the program’s “Menu of Outreach Opportunities for Science Education” (MOOSE) is now posted on the AAS website at http://aas.org/outreach/moose-menu-outreach-opportunities-science-education.The first two Astronomy Ambassadors workshops were held at AAS meetings in January 2013 and January 2014; each served 30 young astronomers chosen from about twice that many applicants. Web-based follow-up activities are being provided through a website at the ASP designed to keep cohorts of educators trained in their programs in touch with one another. The AAS is exploring ways to fund additional workshops at future winter meetings; suggestions are most welcome. Meanwhile, the Astronomy Ambassadors trained to date have logged more than 150 outreach events, reaching many thousands of children and adults across the U.S. and Canada.

  6. Serum amyloid A and protein AA: molecular mechanisms of a transmissible amyloidosis.

    Science.gov (United States)

    Westermark, Gunilla T; Westermark, Per

    2009-08-20

    Systemic AA-amyloidosis is a complication of chronic inflammatory diseases and the fibril protein AA derives from the acute phase reactant serum AA. AA-amyloidosis can be induced in mice by an inflammatory challenge. The lag phase before amyloid develops can be dramatically shortened by administration of a small amount of amyloid fibrils. Systemic AA-amyloidosis is transmissible in mice and may be so in humans. Since transmission can cross species barriers it is possible that AA-amyloidosis can be induced by amyloid in food, e.g. foie gras. In mice, development of AA-amyloidosis can also be accelerated by other components with amyloid-like properties. A new possible risk factor may appear with synthetically made fibrils from short peptides, constructed for tissue repair.

  7. Identification of Eps15 as antigen recognized by the monoclonal antibodies aa2 and ab52 of the Wuerzburg Hybridoma Library against Drosophila brain.

    Directory of Open Access Journals (Sweden)

    Partho Halder

    Full Text Available The Wuerzburg Hybridoma Library against the Drosophila brain represents a collection of around 200 monoclonal antibodies that bind to specific structures in the Drosophila brain. Here we describe the immunohistochemical staining patterns, the Western blot signals of one- and two-dimensional electrophoretic separation, and the mass spectrometric characterization of the target protein candidates recognized by the monoclonal antibodies aa2 and ab52 from the library. Analysis of a mutant of a candidate gene identified the Drosophila homolog of the Epidermal growth factor receptor Pathway Substrate clone 15 (Eps15 as the antigen for these two antibodies.

  8. A Profile Analysis of Raman-scattered O VI Bands at 6825 \\AA\\ and 7082 \\AA\\ in Sanduleak's Star

    CERN Document Server

    Heo, Jeong-Eun; Di Mille, Francesco; Palma, Tali; Lee, Hee-Won

    2016-01-01

    We present a detailed modeling of the two broad bands observed at 6825 \\AA\\ and 7082 \\AA\\ in Sanduleak's star, a controversial object in the Large Magellanic Cloud. These bands are known to originate from Raman-scattering of O VI $\\lambda\\lambda$ 1032 and 1038 photons with atomic hydrogen and are only observed in bona fide symbiotic stars. Our high-resolution spectrum obtained with the Magellan Inamori Kyocera Echelle (MIKE) spectrograph at the Magellan-Clay Telescope reveals, quite surprisingly, that the profiles of the two bands look very different: while the Raman 6825 \\AA\\ band shows a single broad profile with a redward extended bump, the Raman 7082 \\AA\\ band exhibits a distinct triple-peak profile. Our model suggests that the O VI emission nebula can be decomposed into a red, blue and central emission regions from an accretion disk, a bipolar outflow and a further compact, optically thick region. We also perform Monte Carlo simulations with the aim of fitting the observed flux ratio $F(6825)/F(7082) \\si...

  9. PREFACE: Cell-substrate interactions Cell-substrate interactions

    Science.gov (United States)

    Gardel, Margaret; Schwarz, Ulrich

    2010-05-01

    One of the most striking achievements of evolution is the ability to build cellular systems that are both robust and dynamic. Taken by themselves, both properties are obvious requirements: robustness reflects the fact that cells are there to survive, and dynamics is required to adapt to changing environments. However, it is by no means trivial to understand how these two requirements can be implemented simultaneously in a physical system. The long and difficult quest to build adaptive materials is testimony to the inherent difficulty of this goal. Here materials science can learn a lot from nature, because cellular systems show that robustness and dynamics can be achieved in a synergetic fashion. For example, the capabilities of tissues to repair and regenerate are still unsurpassed in the world of synthetic materials. One of the most important aspects of the way biological cells adapt to their environment is their adhesive interaction with the substrate. Numerous aspects of the physiology of metazoan cells, including survival, proliferation, differentiation and migration, require the formation of adhesions to the cell substrate, typically an extracellular matrix protein. Adhesions guide these diverse processes both by mediating force transmission from the cell to the substrate and by controlling biochemical signaling pathways. While the study of cell-substrate adhesions is a mature field in cell biology, a quantitative biophysical understanding of how the interactions of the individual molecular components give rise to the rich dynamics and mechanical behaviors observed for cell-substrate adhesions has started to emerge only over the last decade or so. The recent growth of research activities on cell-substrate interactions was strongly driven by the introduction of new physical techniques for surface engineering into traditional cell biological work with cell culture. For example, microcontact printing of adhesive patterns was used to show that cell fate depends

  10. Methods of repairing a substrate

    Science.gov (United States)

    Riedell, James A. (Inventor); Easler, Timothy E. (Inventor)

    2011-01-01

    A precursor of a ceramic adhesive suitable for use in a vacuum, thermal, and microgravity environment. The precursor of the ceramic adhesive includes a silicon-based, preceramic polymer and at least one ceramic powder selected from the group consisting of aluminum oxide, aluminum nitride, boron carbide, boron oxide, boron nitride, hafnium boride, hafnium carbide, hafnium oxide, lithium aluminate, molybdenum silicide, niobium carbide, niobium nitride, silicon boride, silicon carbide, silicon oxide, silicon nitride, tin oxide, tantalum boride, tantalum carbide, tantalum oxide, tantalum nitride, titanium boride, titanium carbide, titanium oxide, titanium nitride, yttrium oxide, zirconium boride, zirconium carbide, zirconium oxide, and zirconium silicate. Methods of forming the ceramic adhesive and of repairing a substrate in a vacuum and microgravity environment are also disclosed, as is a substrate repaired with the ceramic adhesive.

  11. Polymer Adsorption on Disordered Substrate

    OpenAIRE

    Hwa, T; Cule, D.

    1997-01-01

    We analyze the recently proposed "pattern-matching" phase of a Gaussian random heteropolymer adsorbed on a disordered substrate [S. Srebnik, A.K. Chakraborty and E.I. Shakhnovich, Phys. Rev. Lett. 77, 3157 (1996)]. By mapping the problem to that of a directed homopolymer in higher-dimensional random media, we show that the pattern-matching phase is asymptotically weakly unstable, and the large scale properties of the system are given by that of an adsorbed homopolymer.

  12. Lubricated friction between incommensurate substrates

    OpenAIRE

    Vanossi, Andrea; Santoro, Giuseppe E.; Manini, Nicola; Tosatti, Erio; Braun, O. M.

    2007-01-01

    This paper is part of a study of the frictional dynamics of a confined solid lubricant film - modelled as a one-dimensional chain of interacting particles confined between two ideally incommensurate substrates, one of which is driven relative to the other through an attached spring moving at constant velocity. This model system is characterized by three inherent length scales; depending on the precise choice of incommensurability among them it displays a strikingly different tribological beha...

  13. Promoters of AaGL2 and AaMIXTA-Like1 genes of Artemisia annua direct reporter gene expression in glandular and non-glandular trichomes.

    Science.gov (United States)

    Jindal, Sunita; Longchar, Bendangchuchang; Singh, Alka; Gupta, Vikrant

    2015-01-01

    Herein, we report cloning and analysis of promoters of GLABRA2 (AaGL2) homolog and a MIXTA-Like (AaMIXTA-Like1) gene from Artemisia annua. The upstream regulatory regions of AaGL2 and AaMIXTA-Like1 showed the presence of several crucial cis-acting elements. Arabidopsis and A. annua seedlings were transiently transfected with the promoter-GUS constructs using a robust agro-infiltration method. Both AaGL2 and AaMIXTA-Like1 promoters showed GUS expression preferentially in Arabidopsis single-celled trichomes and glandular as well as T-shaped trichomes of A. annua. Transgenic Arabidopsis harboring constructs in which AaGL2 or AaMIXTA-Like1 promoters would control GFP expression, showed fluorescence emanating specifically from trichome cells. Our study provides a fast and efficient method to study trichome-specific expression, and 2 promoters that have potential for targeted metabolic engineering in plants.

  14. Promoters of AaGL2 and AaMIXTA-Like1 genes of Artemisia annua direct reporter gene expression in glandular and non-glandular trichomes.

    Science.gov (United States)

    Jindal, Sunita; Longchar, Bendangchuchang; Singh, Alka; Gupta, Vikrant

    2015-01-01

    Herein, we report cloning and analysis of promoters of GLABRA2 (AaGL2) homolog and a MIXTA-Like (AaMIXTA-Like1) gene from Artemisia annua. The upstream regulatory regions of AaGL2 and AaMIXTA-Like1 showed the presence of several crucial cis-acting elements. Arabidopsis and A. annua seedlings were transiently transfected with the promoter-GUS constructs using a robust agro-infiltration method. Both AaGL2 and AaMIXTA-Like1 promoters showed GUS expression preferentially in Arabidopsis single-celled trichomes and glandular as well as T-shaped trichomes of A. annua. Transgenic Arabidopsis harboring constructs in which AaGL2 or AaMIXTA-Like1 promoters would control GFP expression, showed fluorescence emanating specifically from trichome cells. Our study provides a fast and efficient method to study trichome-specific expression, and 2 promoters that have potential for targeted metabolic engineering in plants. PMID:26340695

  15. Influence of environment and substrate quality on the decomposition of wetland plant root in the Sanjiang Plain, Northeast China

    Institute of Scientific and Technical Information of China (English)

    GUO Xuelian; LU Xianguo; TONG Shouzheng; DAI Guohua

    2008-01-01

    The litterbag method was used to study the decomposition of wetland plant root in three wetlands along a water level gradient in the Sanjiang Plain, Northeast China. These wetlands are Calamagrostis angustifolia ( C.aa), Carex meyeriana (C.ma) and Carex lasiocarpa (C.la). The objective of our study is to evaluate the influence of environment and substrate quality on decomposition rates in the three wetlands. Calico material was used as a standard substrate to evaluate environmental influences. Roots native to each wetland were used to evaluate decomposition dynamics and substrate quality influences. Calico mass loss was statistically different among the three wetlands in the upper soil profile (0-10 cm) and in the lower depth range (10-20 cm). Hydrology, temperature and pH all influence calico decomposition rates in different ways at different depths of the soil profiles. The decomposition rates of native roots declined differentially with the increase of depth in the soil profiles. The mass loss of native roots showed a statistical decrease among the three wetlands in the upper soil profile (0-10 cm) and in the lower depth range (10-20 cm) as C.ma wetland C.aa wetland C.la wetland. Both the C:P ratio and N:P ratio were positively interrelated with decomposition rates. Decomposition rates were negatively related to initial P concentration in all three wetlands, indicating that P concentration seems to be an important factor controlling the fitter loss.

  16. AA amyloidosis associated with systemic-onset juvenile idiopathic arthritis.

    Science.gov (United States)

    Saha, Abhijeet; Chopra, Yogiraj; Theis, Jason D; Vrana, Julie A; Sethi, Sanjeev

    2013-10-01

    We report a 12-year-old boy with nephrotic syndrome due to renal AA amyloidosis. The AA amyloidosis was associated with a 3-year history of systemic-onset juvenile idiopathic arthritis. The presence of serum amyloid A protein was confirmed by laser microdissection of Congo Red-positive glomeruli and vessels followed by liquid chromatography and tandem mass spectrometry; this analysis excluded hereditary and familial amyloidosis. Aggressive management of the systemic-onset juvenile idiopathic arthritis resulted in improvement in clinical and laboratory parameters. The case represents an unusual cause of nephrotic syndrome in children. Early diagnosis of renal amyloidosis and management of systemic-onset juvenile idiopathic arthritis is paramount to preventing progression of kidney disease.

  17. Wooden models of an AA quadrupole between bending magnets

    CERN Multimedia

    1978-01-01

    At two points in the AA lattice, a quadrupole (QDN, defocusing, narrow) was tightly wedged between two bending magnets (BST, short, wide). This picture of wooden models lets one imagine the strong interaction between their magnetic fields. There was no way one could calculate with the necessary accuracy the magnetic effects and their consequences for the machine optics. The necessary corrections were made after measurements with a circulating beam, in a tedious iterative procedure, with corrrection coils and shims.

  18. AAS Oral History Project – Seeking Planetary Scientist

    Science.gov (United States)

    Buxner, Sanlyn; Holbrook, Jarita

    2016-10-01

    Now in its fourth year, the AAS Oral History Project has interviewed over 100 space scientists from all over the world. Led by the AAS Historical Astronomy Division (HAD) and partially funded by the American Institute of Physics Niels Bohr Library and ongoing support from the AAS, volunteers have collected oral histories from space scientists at professional meetings starting in 2015, including AAS, DPS, and the IAU general assembly. Each interview lasts one and a half to two hours and focuses on interviewees' personal and professional lives. Questions include those about one's family, childhood, strong influences on one's scientific career, career path, successes and challenges, perspectives on how astronomy is changing as a field, and advice to the next generation. Each interview is audio recorded and transcribed, the content of which is checked with each interviewee. Once complete, interview transcripts are posted online as part of a larger oral history library at https://www.aip.org/history-programs/niels-bohr-library/oral-histories. We will present preliminary analysis of those interviewed including characterizing career status, age range, nationality, and primary field. Additionally, we will discuss trends beginning to emerge in analysis of participants' responses about data driven science and advice to the next generation. Future analysis will reveal a rich story of space scientists and will help the community address issues of diversity, controversies, and the changing landscape of science. We are actively recruiting individuals to be interviewed at this meeting from all stages of career from undergraduate students to retired and emeritus astronomers. We are especially interested in interviewing 40+E members of DPS. Contact Sanlyn Buxner to schedule an interview or to find out more information about the project (buxner@psi.edu). Contact Jarita Holbrook if you would like to become an interviewer for the project (astroholbrook@gmail.com).

  19. AAS, growth hormone, and insulin abuse: psychological and neuroendocrine effects

    OpenAIRE

    Graham, Michael R; Peter Evans; Bruce Davies; Baker, Julien S.

    2008-01-01

    Michael R Graham1, Peter Evans2, Bruce Davies1, Julien S Baker11Health and Exercise Science Research Unit, Faculty of Health Sport and Science, University of Glamorgan, Pontypridd, Wales, United Kingdom; 2Royal Gwent Hospital, Newport, Gwent, United KingdomAbstract: The nontherapeutic use of prescription medicines by individuals involved in sport is increasing. Anabolic-androgenic steroids (AAS) are the most widely abused drug. Much of our knowledge of the psychological and physiological effe...

  20. Slot-type pickup/kicker for AA stochastic cooling

    CERN Multimedia

    1979-01-01

    A "slotted transmission line" was used for both pickups and kickers of the cooling systems of the AA. They served for the cooling of the high-density antiproton stack, in momentum and both transverse planes. In the beginning in a single band, 1-2 GHz, later in 2 bands, 2-4 and 4-8 GHz. Here we see the slotted electrodes partly pulled out of the outer casing. See also 7906189, 7906581X, 7896193.

  1. Effective corrosion protection of AA6061 aluminum alloy by sputtered Al-Ce coatings

    Energy Technology Data Exchange (ETDEWEB)

    Dominguez-Crespo, M.A., E-mail: mdominguezc@ipn.m [Instituto Politecnico Nacional, GIPMAT CICATA-Altamira, km 14.5, Carretera Tampico-Puerto Industrial Altamira, C.P. 89600 Altamira, Tamps (Mexico); Torres-Huerta, A.M. [Instituto Politecnico Nacional, GIPMAT CICATA-Altamira, km 14.5, Carretera Tampico-Puerto Industrial Altamira, C.P. 89600 Altamira, Tamps (Mexico); Rodil, S.E. [Instituto de Investigacion en Materiales, Universidad Nacional Autonoma de Mexico, Circuito Exterior s/n, Ciudad Universitaria, Del. Coyoacan, C.P. 04510 Mexico, D.F. (Mexico); Ramirez-Meneses, E. [Instituto Politecnico Nacional, GIPMAT CICATA-Altamira, km 14.5, Carretera Tampico-Puerto Industrial Altamira, C.P. 89600 Altamira, Tamps (Mexico); Suarez-Velazquez, G.G. [Alumna del PTA del CICATA-Altamira IPN, km 14.5, Carretera Tampico-Puerto Industrial Altamira, C.P. 89600 Altamira, Tamps (Mexico); Hernandez-Perez, M.A. [Instituto Politecnico Nacional, ESIQIE, C.P. 07738 Mexico, D.F. (Mexico)

    2009-12-30

    Al-Ce coatings were deposited on silicon and AA6061 aluminum alloy substrates by DC magnetron sputtering using aluminum in combination with pure cerium targets. The materials were characterized by X-ray diffraction (XRD), atomic force microscopy (AFM), scanning electron microscopy (SEM), high resolution transmission electron microscopy (HRTEM) and electrochemical impedance spectroscopy (EIS) in order to consider their application as high corrosion resistance coatings. The corrosion behavior of the films was studied using a NaCl aqueous solution (3.5 wt%). As for the characterization results, an apparent amorphous phase of aluminum oxide with small cerium compounds embedded in the matrix was detected by the X-ray diffraction patterns and HRTEM on the deposited films at 200 W and 4 Pa. At these conditions, AFM and SEM images evidenced crack-free coatings with low-roughness nanometric structures and columnar growth. EIS and Tafel results converged to indicate an inhibition of the corrosion reactions. The film displayed good stability in the aggressive medium and after 1 day of exposure underwent very little degradation. The variations in the impedance and Tafel characteristics were found to occur as a function of cerium content, which provokes important changes in the film protective properties.

  2. Effective corrosion protection of AA6061 aluminum alloy by sputtered Al-Ce coatings

    International Nuclear Information System (INIS)

    Al-Ce coatings were deposited on silicon and AA6061 aluminum alloy substrates by DC magnetron sputtering using aluminum in combination with pure cerium targets. The materials were characterized by X-ray diffraction (XRD), atomic force microscopy (AFM), scanning electron microscopy (SEM), high resolution transmission electron microscopy (HRTEM) and electrochemical impedance spectroscopy (EIS) in order to consider their application as high corrosion resistance coatings. The corrosion behavior of the films was studied using a NaCl aqueous solution (3.5 wt%). As for the characterization results, an apparent amorphous phase of aluminum oxide with small cerium compounds embedded in the matrix was detected by the X-ray diffraction patterns and HRTEM on the deposited films at 200 W and 4 Pa. At these conditions, AFM and SEM images evidenced crack-free coatings with low-roughness nanometric structures and columnar growth. EIS and Tafel results converged to indicate an inhibition of the corrosion reactions. The film displayed good stability in the aggressive medium and after 1 day of exposure underwent very little degradation. The variations in the impedance and Tafel characteristics were found to occur as a function of cerium content, which provokes important changes in the film protective properties.

  3. 184AA3: a xenograft model of ER+ breast adenocarcinoma.

    Science.gov (United States)

    Hines, William C; Kuhn, Irene; Thi, Kate; Chu, Berbie; Stanford-Moore, Gaelen; Sampayo, Rocío; Garbe, James C; Stampfer, Martha; Borowsky, Alexander D; Bissell, Mina J

    2016-01-01

    Despite the prevalence and significant morbidity resulting from estrogen receptor positive (ER(+)) breast adenocarcinomas, there are only a few models of this cancer subtype available for drug development and arguably none for studying etiology. Those models that do exist have questionable clinical relevance. Given our goal of developing luminal models, we focused on six cell lines derived by minimal mutagenesis from normal human breast cells, and asked if any could generate clinically relevant xenografts, which we then extensively characterized. Xenografts of one cell line, 184AA3, consistently formed ER(+) adenocarcinomas that had a high proliferative rate and other features consistent with "luminal B" intrinsic subtype. Squamous and spindle cell/mesenchymal differentiation was absent, in stark contrast to other cell lines that we examined or others have reported. We explored intratumoral heterogeneity produced by 184AA3 by immunophenotyping xenograft tumors and cultured cells, and characterized marker expression by immunofluorescence and flow cytometry. A CD44(High) subpopulation was discovered, yet their tumor forming ability was far less than CD44(Low) cells. Single cell cloning revealed the phenotypic plasticity of 184AA3, consistent with the intratumoral heterogeneity observed in xenografts. Characterization of ER expression in cultures revealed ER protein and signaling is intact, yet when estrogen was depleted in culture, and in vivo, it did not impact cell or tumor growth, analogous to therapeutically resistant ER(+) cancers. This model is appropriate for studies of the etiology of ovarian hormone independent adenocarcinomas, for identification of therapeutic targets, predictive testing, and drug development. PMID:26661596

  4. The trajectory and atmospheric impact of asteroid 2014 AA

    Science.gov (United States)

    Farnocchia, Davide; Chesley, Steven R.; Brown, Peter G.; Chodas, Paul W.

    2016-08-01

    Near-Earth asteroid 2014 AA entered the Earth's atmosphere on 2014 January 2, only 21 h after being discovered by the Catalina Sky Survey. In this paper we compute the trajectory of 2014 AA by combining the available optical astrometry, seven ground-based observations over 69 min, and the International Monitoring System detection of the atmospheric impact infrasonic airwaves in a least-squares orbit estimation filter. The combination of these two sources of observations results in a tremendous improvement in the orbit uncertainties. The impact time is 3:05 UT with a 1σ uncertainty of 6 min, while the impact location corresponds to a west longitude of 44.2° and a latitude of 13.1° with a 1σ uncertainty of 140 km. The minimum impact energy estimated from the infrasound data and the impact velocity result in an estimated minimum mass of 22.6 t. By propagating the trajectory of 2014 AA backwards we find that the only window for finding precovery observations is for the three days before its discovery.

  5. The atmospheric impact trajectory of asteroid 2014 AA

    CERN Document Server

    Farnocchia, D; Brown, P G; Chodas, P W

    2016-01-01

    Near-Earth asteroid 2014 AA entered the Earth's atmosphere on 2014 January 2, only 21 hours after being discovered by the Catalina Sky Survey. In this paper we compute the trajectory of 2014 AA by combining the available optical astrometry, seven ground-based observations over 69 minutes, and the International Monitoring system detection of the atmospheric impact infrasonic airwaves in a least-squares orbit estimation filter. The combination of these two sources of observations results in a tremendous improvement in the orbit uncertainties. The impact time is 3:05 UT with a 1-sigma uncertainty of 6 min, while the impact location corresponds to a west longitude of 44.7 deg and a latitude of 13.1 deg with a 1-sigma uncertainty of 140 km. The minimum impact energy estimated from the infrasound data and the impact velocity result in an estimated minimum mass of 22.6 t. By propagating the trajectory of 2014 AA backwards we find that the only window for finding precovery observations is for the three days before it...

  6. Effects of Friction Stir Welding Speed on AA2195 alloy

    Directory of Open Access Journals (Sweden)

    Lee Ho-Sung

    2016-01-01

    Full Text Available The application of friction stir welding (FSW to aerospace has grown rapidly due to the high efficiency and environmental friendly nature of the process. FSW is achieved by plastic flow of frictionally heated material in solid state and offers many advantages of avoiding hot cracking and limiting component distortion. Recently low density, high modulus and high strength AA2195 are used as substitute for conventional aluminum alloys since the weight saving is critical in aerospace applications. One of the problems for this alloy is weld metal porosity formation leading to hot cracking. Combination of FSW and AA2195 provides synergy effect to improve mechanical properties and weight saving of aerospace structure such as cryogenic fuel tanks for launch systems. The objective of this paper is to investigate the effect of friction stir welding speed on mechanical and microstructural properties of AA2195. The friction stir welded materials were joined with four different tool rotation speeds (350~800 rpm and five welding speeds (120~360 mm/min, which are the two prime welding parameters in this process.

  7. Carbon Nanotube Patterning on a Metal Substrate

    Science.gov (United States)

    Nguyen, Cattien V. (Inventor)

    2016-01-01

    A CNT electron source, a method of manufacturing a CNT electron source, and a solar cell utilizing a CNT patterned sculptured substrate are disclosed. Embodiments utilize a metal substrate which enables CNTs to be grown directly from the substrate. An inhibitor may be applied to the metal substrate to inhibit growth of CNTs from the metal substrate. The inhibitor may be precisely applied to the metal substrate in any pattern, thereby enabling the positioning of the CNT groupings to be more precisely controlled. The surface roughness of the metal substrate may be varied to control the density of the CNTs within each CNT grouping. Further, an absorber layer and an acceptor layer may be applied to the CNT electron source to form a solar cell, where a voltage potential may be generated between the acceptor layer and the metal substrate in response to sunlight exposure.

  8. NCBI nr-aa BLAST: CBRC-GGOR-01-0919 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGOR-01-0919 pdb|2QW9|A Chain A, Crystal Structure Of Bovine Hsc70 (1-394aa)in... The Apo State pdb|2QW9|B Chain B, Crystal Structure Of Bovine Hsc70 (1-394aa)in The Apo State pdb|2QWL|A Chain A, Crystal Structure... Of Bovine Hsc70 (1-394aa)in The Adp State pdb|2QWL|B Chain B, Crystal Structure Of ...Bovine Hsc70 (1-394aa)in The Adp State pdb|2QWM|A Chain A, Crystal Structure Of B...ovine Hsc70 (1-394aa)in The AdpVi State pdb|2QWM|B Chain B, Crystal Structure Of Bovine Hsc70 (1-394aa)in The AdpVi State 2QW9 1e-155 89% ...

  9. NCBI nr-aa BLAST: CBRC-MEUG-01-0807 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-0807 pdb|2QW9|A Chain A, Crystal Structure Of Bovine Hsc70 (1-394aa)in... The Apo State pdb|2QW9|B Chain B, Crystal Structure Of Bovine Hsc70 (1-394aa)in The Apo State pdb|2QWL|A Chain A, Crystal Structure... Of Bovine Hsc70 (1-394aa)in The Adp State pdb|2QWL|B Chain B, Crystal Structure Of ...Bovine Hsc70 (1-394aa)in The Adp State pdb|2QWM|A Chain A, Crystal Structure Of B...ovine Hsc70 (1-394aa)in The AdpVi State pdb|2QWM|B Chain B, Crystal Structure Of Bovine Hsc70 (1-394aa)in The AdpVi State 2QW9 1e-139 85% ...

  10. NCBI nr-aa BLAST: CBRC-MEUG-01-0749 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-0749 pdb|2QW9|A Chain A, Crystal Structure Of Bovine Hsc70 (1-394aa)in... The Apo State pdb|2QW9|B Chain B, Crystal Structure Of Bovine Hsc70 (1-394aa)in The Apo State pdb|2QWL|A Chain A, Crystal Structure... Of Bovine Hsc70 (1-394aa)in The Adp State pdb|2QWL|B Chain B, Crystal Structure Of ...Bovine Hsc70 (1-394aa)in The Adp State pdb|2QWM|A Chain A, Crystal Structure Of B...ovine Hsc70 (1-394aa)in The AdpVi State pdb|2QWM|B Chain B, Crystal Structure Of Bovine Hsc70 (1-394aa)in The AdpVi State 2QW9 1e-116 83% ...

  11. NCBI nr-aa BLAST: CBRC-TSYR-01-0154 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TSYR-01-0154 pdb|2QW9|A Chain A, Crystal Structure Of Bovine Hsc70 (1-394aa)in... The Apo State pdb|2QW9|B Chain B, Crystal Structure Of Bovine Hsc70 (1-394aa)in The Apo State pdb|2QWL|A Chain A, Crystal Structure... Of Bovine Hsc70 (1-394aa)in The Adp State pdb|2QWL|B Chain B, Crystal Structure Of ...Bovine Hsc70 (1-394aa)in The Adp State pdb|2QWM|A Chain A, Crystal Structure Of B...ovine Hsc70 (1-394aa)in The AdpVi State pdb|2QWM|B Chain B, Crystal Structure Of Bovine Hsc70 (1-394aa)in The AdpVi State 2QW9 0.0 94% ...

  12. NCBI nr-aa BLAST: CBRC-TTRU-01-0305 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TTRU-01-0305 pdb|2QW9|A Chain A, Crystal Structure Of Bovine Hsc70 (1-394aa)in The Apo State... pdb|2QW9|B Chain B, Crystal Structure Of Bovine Hsc70 (1-394aa)in The Apo State pdb|2QWL|A Ch...ain A, Crystal Structure Of Bovine Hsc70 (1-394aa)in The Adp State pdb|2QWL|B Chain B, Crystal Structure Of ...Bovine Hsc70 (1-394aa)in The Adp State pdb|2QWM|A Chain A, Crystal Structure Of B...ovine Hsc70 (1-394aa)in The AdpVi State pdb|2QWM|B Chain B, Crystal Structure Of Bovine Hsc70 (1-394aa)in The AdpVi State 2QW9 1e-117 91% ...

  13. Bacillus thuringiensis Cry1Aa toxin-binding region of Bombyx mori aminopeptidase N.

    Science.gov (United States)

    Yaoi, K; Nakanishi, K; Kadotani, T; Imamura, M; Koizumi, N; Iwahana, H; Sato, R

    1999-12-17

    The Bacillus thuringiensis Cry1Aa toxin-binding region of Bombyx mori aminopeptidase N (APN) was analyzed, to better understand the molecular mechanism of susceptibility to the toxin and the development of resistance in insects. APN was digested with lysylendopeptidase and the ability of the resulting fragments to bind to Cry1Aa and 1Ac toxins was examined. The binding abilities of the two toxins to these fragments were different. The Cry1Aa toxin bound to the fragment containing 40-Asp to 313-Lys, suggesting that the Cry1Aa toxin-binding site is located in the region between 40-Asp and 313-Lys, while Cry1Ac toxin bound exclusively to mature APN. Next, recombinant APN of various lengths was expressed in Escherichia coli cells and its ability to bind to Cry1Aa toxin was examined. The results localized the Cry1Aa toxin binding to the region between 135-Ile and 198-Pro. PMID:10606725

  14. Interactive paper as security substrate

    Science.gov (United States)

    Robillard, Jean J.

    1997-08-01

    The threat of counterfeiting Bank Notes and other security documents is steadily increasing with the continuous improvement of printing and copying technologies. The perfect reproduction of a document is indeed reachable with the right combination of technique and economics. Our only protection is to make it difficult by introducing artifacts which appear only through the counterfeiting process or reduce significantly the efficiency of that process. A number of methods are available to defeat counterfeiting none of which are completely satisfactory. The difficulty is not as much the prevention of the duplication than doing it while safeguarding the intrinsic properties (durability) of the documents as far as permanent readability, resistance to wear, etc. Basic approaches are: (1) The light switch: a transparent coating which becomes opaque during any attempt of duplication. (2) An alternative to this first approach is an ink which becomes transparent at the time of duplication. (3) The use of a substrate (paper stock) whose optical density will rise to that of the printed graphic on the bill at the time of copying. This would be a true interactive paper. (4) Luminescent materials that would blind the photoreceptor during exposure. Such material could be in the substrate or in the printing ink. (5) Introduction of an artefact in the printed copy through a hologram hidden in a transparent coating or embossed in the substrate. All approaches have been investigated to a certain extent with variable success. We report hereafter the results of investigations made by the author on alternatives (1) and (2) in this laboratory and at the University of Texas at El Paso under contract from the National Bank of Belgium and with the collaboration of the CNRS in Paris and the University of Marseille France.

  15. Applications of Hyperbolic Metamaterial Substrates

    Directory of Open Access Journals (Sweden)

    Yu Guo

    2012-01-01

    Full Text Available We review the properties of hyperbolic metamaterials and show that they are promising candidates as substrates for nanoimaging, nanosensing, fluorescence engineering, and controlling thermal emission. Hyperbolic metamaterials can support unique bulk modes, tunable surface plasmon polaritons, and surface hyperbolic states (Dyakonov plasmons that can be used for a variety of applications. We compare the effective medium predictions with practical realizations of hyperbolic metamaterials to show their potential for radiative decay engineering, bioimaging, subsurface sensing, metaplasmonics, and super-Planckian thermal emission.

  16. Depletion of Spleen Macrophages Delays AA Amyloid Development: A Study Performed in the Rapid Mouse Model of AA Amyloidosis

    OpenAIRE

    Katarzyna Lundmark; Aida Vahdat Shariatpanahi; Westermark, Gunilla T.

    2013-01-01

    AA amyloidosis is a systemic disease that develops secondary to chronic inflammatory diseases Macrophages are often found in the vicinity of amyloid deposits and considered to play a role in both formation and degradation of amyloid fibrils. In spleen reside at least three types of macrophages, red pulp macrophages (RPM), marginal zone macrophages (MZM), metallophilic marginal zone macrophages (MMZM). MMZM and MZM are located in the marginal zone and express a unique collection of scavenger r...

  17. Single-sided laser beam welding of a dissimilar AA2024–AA7050 T-joint

    International Nuclear Information System (INIS)

    Highlights: • Single-sided laser beam welding of a dissimilar AA2024–AA7050 T-joint was realised. • For this purpose a fibre laser with high power and a large beam diameter was used. • Porosity-free weld seams with low penetration into the skin material were achieved. • The mechanical properties are comparable to that of double-sided welded T-joints. - Abstract: In the aircraft industry double-sided laser beam welding of skin–stringer joints is an approved method for producing defect-free welds. But due to limited accessibility – as for the welding of skin–clip joints – the applicability of this method is limited. Therefore single-sided laser beam welding of T-joints becomes necessary. This also implies a reduction of the manufacturing effort. However, the main obstacle for the use of single-sided welding of T-joints is the occurrence of weld defects. An additional complexity represents the combination of dissimilar and hard-to-weld aluminium alloys – like Al–Cu and Al–Zn alloys. These alloys offer a high strength-to-density ratio, but are also associated with distinct weldability problems especially for fusion welding techniques like laser beam welding. The present study demonstrates how to overcome the weldability problems during single-sided laser beam welding of a dissimilar T-joint made of AA2024 and AA7050. For this purpose a high-power fibre laser with a large beam diameter is used. Important welding parameters are identified and adjusted for achieving defect-free welds. The obtained joints are compared to double-sided welded joints made of typical aircraft aluminium alloys. In this regard single-sided welded joints showed the expected differing weld seam appearance, but comparable mechanical properties

  18. Through-thickness recrystallization characteristics of a laminated AA3xxx–AA6xxx aluminum alloy system

    Energy Technology Data Exchange (ETDEWEB)

    Liao, L.H., E-mail: l2liao@uwaterloo.ca [Department of Mechanical and Mechatronics Engineering, University of Waterloo, 200 University Ave. West, Waterloo, ON N2L 3G1 (Canada); Jin, H.; Gallerneault, M. [Formerly Novelis Research and Technology Centre, 945 Princess Street, Kingston, ON K7L 5L9 (Canada); Esmaeili, S., E-mail: shahrzad@uwaterloo.ca [Department of Mechanical and Mechatronics Engineering, University of Waterloo, 200 University Ave. West, Waterloo, ON N2L 3G1 (Canada)

    2015-03-15

    The through-thickness annealing behavior of a laminated AA3xxx–AA6xxx alloy system at 300 °C has been studied by scanning electron microscopy, electron backscatter diffraction analysis, electron probe micro-analysis, differential scanning calorimetry, and hardness measurement. Results show that the recrystallization process starts at the interface region between the AA3xxx (clad) and AA6xxx (core) layers. Subsequently, the recrystallization process front progresses into the core layer, while the clad layer is the last region to recrystallize. It is also found that precipitation precedes recrystallization in the entire laminate at the investigated temperature. The preferential onset of recrystallization at the interface region is attributed to the net driving pressure being the highest in this region. The factors that lead to such enhanced net driving pressure are (a) deformation incompatibility between the two alloy layers, (b) lower solute content of the interface, which also leads to lower volume fraction of precipitates, and (c) an accelerated rate of precipitate coarsening due to the presence of a higher density of dislocations. The gradual progress of recrystallization from the interface towards the core layer is dictated by precipitate coarsening and the dependence of its rate on the density of deformation-induced dislocations. The lower driving pressure due to lower work hardening capacity, high solute drag pressure due to Mn, and additional Zener drag from precipitates that form due to solute redistribution during annealing explain the late initiation of recrystallization in the clad layer. - Highlights: • The through-thickness recrystallization of a laminated system is investigated. • The early onset of recrystallization at the interface is discussed. • The effects of precipitation and coarsening on recrystallization are analyzed.

  19. Aedes cadherin mediates the in vivo toxicity of the Cry11Aa toxin to Aedes aegypti.

    Science.gov (United States)

    Lee, Su-Bum; Chen, Jianwu; Aimanova, Karlygash G; Gill, Sarjeet S

    2015-06-01

    Cadherin plays an important role in the toxicity of Bacillus thuringiensis Cry proteins. We previously cloned a full-length cadherin from Aedes aegypti larvae and reported this protein binds Cry11Aa toxin from B. thuringiensis subsp. israelensis with high affinity, ≈16.7nM. Based on these results, we investigated if Aedes cadherin is involved in the in vivo toxicity of Cry11Aa toxin to Ae. aegypti. We established a mosquito cell line stably expressing the full-length Aedes cadherin and transgenic mosquitoes with silenced Aedes cadherin expression. Cells expressing the Aedes cadherin showed increased sensitivity to Cry11Aa toxin. Cry11Aa toxin at 400nM killed approximately 37% of the cells in 3h. Otherwise, transgenic mosquitoes with silenced Aedes cadherin expression showed increased tolerance to Cry11Aa toxin. Furthermore, cells expressing Aedes cadherin triggered Cry11Aa oligomerization. These results show the Aedes cadherin plays a pivotal role in Cry11Aa toxicity to Ae. aegypti larvae by mediating Cry11Aa oligomerization. However, since high toxicity was not obtained in cadherin-expressing cells, an additional receptor may be needed for manifestation of full toxicity. Moreover, cells expressing Aedes cadherin were sensitive to Cry4Aa and Cry11Ba, but not Cry4Ba. However transgenic mosquitoes with silenced Aedes cadherin expression showed no tolerance to Cry4Aa, Cry4Ba, and Cry11Ba toxins. These results suggest that while Aedes cadherin may mediate Cry4Aa and Cry11Ba toxicity, this cadherin but is not the main receptor of Cry4Aa, Cry4Ba and Cry11Ba toxin in Ae. aegypti.

  20. Substrate preparation by contactless mechanochemical polish

    Science.gov (United States)

    Rotter, S.; Lachish, U.; El-Hanany, U.

    1985-10-01

    A simple, yet effective, polishing technique for substrate preparation is presented. It is contactless chemical polish which does not introduce any defects into the substrate during the process. The method can be readily adopted in all cases where chemical polishing is practical for substrate preparation. Results similar to those obtained by the more sophisticated hydroplaning method can be achieved.

  1. Galvanic compatibility of corrosion protective coatings with AA7075 aluminum alloy

    Energy Technology Data Exchange (ETDEWEB)

    Lodhi, Z.F.; Hamer, W.J. [Netherlands Institute for Metals Research (NIMR), Mekelweg 2, 2628 CD Delft (Netherlands); Mol, J.M.C.; Wit, J.H.W. de [Delft University of Technology, Department of Materials Science and Engineering, Mekelweg 2, 2628 CD Delft (Netherlands); Terryn, H. [Netherlands Institute for Metals Research (NIMR), Mekelweg 2, 2628 CD Delft (Netherlands); Department of Metallurgy, Electrochemistry and Materials Science, Vrije Universiteit Brussel, Pleinlaan 2, B-1050 Brussels (Belgium)

    2008-04-15

    The galvanic compatibility of aerospace aluminum alloy AA7075 with cadmium (Cd), zinc (Zn), and zinc-cobalt-iron (Zn-Co-Fe, 32-37%Co and 1%Fe) alloys was investigated. A comparison of open circuit potential [OCP vs. saturated calomel electrode (SCE)] measurements in 0.6 mM NaCl showed that all coatings would act anodically to AA7075 with an exception of Zn-Co-Fe (37%Co + 1%Fe) alloy which was electropositive to AA7075. During the zero resistance ammetry (ZRA) measurement in 0.6 M NaCl electrolyte the coupled OCP and current density were measured during 7 days of immersion and both Zn and Cd acted anodic and thus sacrificial to AA7075. Galvanic coupling of AA7075 with (37%Co + 1%Fe) Zn-Co-Fe alloy resulted in the consequent dissolution of the AA7075 aluminum alloy. In contrast, Zn-Co-Fe (32%Co + 1%Fe) alloy was found to be anodic to AA7075 during the first 26 h of immersion but after dezincification and cobalt enrichment at the surface became cathodic to the AA7075 aluminum alloy. During coupling with Zn, some pitting was also observed on AA7075. (Abstract Copyright [2008], Wiley Periodicals, Inc.)

  2. Overexpression of AaWRKY1 Leads to an Enhanced Content of Artemisinin in Artemisia annua.

    Science.gov (United States)

    Jiang, Weimin; Fu, Xueqing; Pan, Qifang; Tang, Yueli; Shen, Qian; Lv, Zongyou; Yan, Tingxiang; Shi, Pu; Li, Ling; Zhang, Lida; Wang, Guofeng; Sun, Xiaofen; Tang, Kexuan

    2016-01-01

    Artemisinin is an effective component of drugs against malaria. The regulation of artemisinin biosynthesis is at the forefront of artemisinin research. Previous studies showed that AaWRKY1 can regulate the expression of ADS, which is the first key enzyme in artemisinin biosynthetic pathway. In this study, AaWRKY1 was cloned, and it activated ADSpro and CYPpro in tobacco using dual-LUC assay. To further study the function of AaWRKY1, pCAMBIA2300-AaWRKY1 construct under 35S promoter was generated. Transgenic plants containing AaWRKY1 were obtained, and four independent lines with high expression of AaWRKY1 were analyzed. The expression of ADS and CYP, the key enzymes in artemisinin biosynthetic pathway, was dramatically increased in AaWRKY1-overexpressing A. annua plants. Furthermore, the artemisinin yield increased significantly in AaWRKY1-overexpressing A. annua plants. These results showed that AaWRKY1 increased the content of artemisinin by regulating the expression of both ADS and CYP. It provides a new insight into the mechanism of regulation on artemisinin biosynthesis via transcription factors in the future. PMID:27064403

  3. AA amyloidosis in the renal allograft: a report of two cases and review of the literature.

    Science.gov (United States)

    Rojas, Rebecca; Josephson, Michelle A; Chang, Anthony; Meehan, Shane M

    2012-04-01

    AA amyloidosis is a disorder characterized by the abnormal formation, accumulation and systemic deposition of fibrillary material that frequently involves the kidney. Recurrent AA amyloidosis in the renal allograft has been documented in patients with tuberculosis, familial Mediterranean fever, ankylosing spondylitis, chronic pyelonephritis and rheumatoid arthritis. De novo AA amyloidosis is rarely described. We report two cases of AA amyloidosis in the renal allograft. Our first case is a 47-year-old male with a history of ankylosing spondylitis who developed end-stage renal disease reportedly from tubulointerstitial nephritis from non-steroidal anti-inflammatory agent use. A biopsy was never performed. One year after transplantation, AA amyloidosis was identified in the femoral head and 8 years post-transplantation, AA amyloidosis was identified in the renal allograft. He was treated with colchicine and adalimumab and has stable renal function at 1 year-follow-up. Our second case is a 57-year-old male with a long history of intravenous drug use and hepatitis C infection who developed end-stage kidney disease due to AA amyloidosis. Our second patient's course was complicated by renal adenovirus, pulmonary aspergillosis and hepatitis C with AA amyloidosis subsequently being identified in the allograft 2.5 years post-transplantation. Renal allograft function remains stable 4-years post-transplantation. These reports describe clinical and pathologic features of two cases of AA amyloidosis presenting with proteinuria and focal involvement of the renal allograft.

  4. Crack patterns over uneven substrates.

    Science.gov (United States)

    Nandakishore, Pawan; Goehring, Lucas

    2016-02-28

    Cracks in thin layers are influenced by what lies beneath them. From buried craters to crocodile skin, crack patterns are found over an enormous range of length scales. Regardless of absolute size, their substrates can dramatically influence how cracks form, guiding them in some cases, or shielding regions from them in others. Here we investigate how a substrate's shape affects the appearance of cracks above it, by preparing mud cracks over sinusoidally varying surfaces. We find that as the thickness of the cracking layer increases, the observed crack patterns change from wavy to ladder-like to isotropic. Two order parameters are introduced to measure the relative alignment of these crack networks, and, along with Fourier methods, are used to characterise the transitions between crack pattern types. Finally, we explain these results with a model, based on the Griffith criteria of fracture, that identifies the conditions for which straight or wavy cracks will be seen, and predicts how well-ordered the cracks will be. Our metrics and results can be applied to any situation where connected networks of cracks are expected, or found. PMID:26762761

  5. Substrate mediated enzyme prodrug therapy.

    Directory of Open Access Journals (Sweden)

    Betina Fejerskov

    Full Text Available In this report, we detail Substrate Mediated Enzyme Prodrug Therapy (SMEPT as a novel approach in drug delivery which relies on enzyme-functionalized cell culture substrates to achieve a localized conversion of benign prodrug(s into active therapeutics with subsequent delivery to adhering cells or adjacent tissues. For proof-of-concept SMEPT, we use surface adhered micro-structured physical hydrogels based on poly(vinyl alcohol, β-glucuronidase enzyme and glucuronide prodrugs. We demonstrate enzymatic activity mediated by the assembled hydrogel samples and illustrate arms of control over rate of release of model fluorescent cargo. SMEPT was not impaired by adhering cells and afforded facile time - and dose - dependent uptake of the in situ generated fluorescent cargo by hepatic cells, HepG2. With the use of a glucuronide derivative of an anticancer drug, SN-38, SMEPT afforded a decrease in cell viability to a level similar to that achieved using parent drug. Finally, dose response was achieved using SMEPT and administration of judiciously chosen concentration of SN-38 glucuronide prodrug thus revealing external control over drug delivery using drug eluting surface. We believe that this highly adaptable concept will find use in diverse biomedical applications, specifically surface mediated drug delivery and tissue engineering.

  6. Phonon scattering in graphene over substrate steps

    Energy Technology Data Exchange (ETDEWEB)

    Sevinçli, H., E-mail: haldunsevincli@iyte.edu.tr [Department of Materials Science and Engineering, Izmir Institute of Technology, Gülbahçe Kampüsü, 35430 Urla, Izmir (Turkey); Department of Micro- and Nano-technology (DTU Nanotech), Technical University of Denmark, DK-2800 Kongens Lyngby (Denmark); Brandbyge, M., E-mail: mads.brandbyge@nanotech.dtu.dk [Department of Micro- and Nano-technology (DTU Nanotech), Technical University of Denmark, DK-2800 Kongens Lyngby (Denmark); Center for Nanostructured Graphene(CNG), Department of Micro- and Nano-technology, Technical University of Denmark, DK-2800 Kongens Lyngby (Denmark)

    2014-10-13

    We calculate the effect on phonon transport of substrate-induced bends in graphene. We consider bending induced by an abrupt kink in the substrate, and provide results for different step-heights and substrate interaction strengths. We find that individual substrate steps reduce thermal conductance in the range between 5% and 47%. We also consider the transmission across linear kinks formed by adsorption of atomic hydrogen at the bends and find that individual kinks suppress thermal conduction substantially, especially at high temperatures. Our analysis show that substrate irregularities can be detrimental for thermal conduction even for small step heights.

  7. Method For Producing Mechanically Flexible Silicon Substrate

    KAUST Repository

    Hussain, Muhammad Mustafa

    2014-08-28

    A method for making a mechanically flexible silicon substrate is disclosed. In one embodiment, the method includes providing a silicon substrate. The method further includes forming a first etch stop layer in the silicon substrate and forming a second etch stop layer in the silicon substrate. The method also includes forming one or more trenches over the first etch stop layer and the second etch stop layer. The method further includes removing the silicon substrate between the first etch stop layer and the second etch stop layer.

  8. Electrosynthesis of hydrogel films on metal substrates for the development of coatings with tunable drug delivery performances.

    Science.gov (United States)

    De Giglio, E; Cometa, S; Satriano, C; Sabbatini, L; Zambonin, P G

    2009-03-15

    Novel polyacrylates-based hydrogel thin films were prepared by electrochemical polymerization, a new method to obtain hydrogels directly onto metal substrates. 2-Hydroxy-ethyl-methacrylate (HEMA), a macromer poly (ethylene-glycol diacrylate) (PEGDA) and PEGDA copolymerized with acrylic acid (AA) were used to obtain hydrogels. The electrosynthesized coatings were characterized by X-ray photoelectron spectroscopy, to assess their surface chemical composition, and by water content determination measurements, to characterize the swelling behavior. In particular, quartz crystal microbalance with dissipation monitoring was used to evaluate the pH-dependency of the swelling for AA-containing hydrogels. Moreover, a model protein (bovine serum albumin) and a model drug (caffeine) were entrapped within the hydrogel coatings during electrosynthesis, to examine the release performances and mechanisms of the electrosynthesized hydrogels. It was observed that all the examined polymers showed significant release properties and, in particular, AA-containing hydrogel films confirmed a strong pH-dependence as expected. These coatings seem to be promising in orthopedic field for in situ drug delivery applications. PMID:18404708

  9. Electrosynthesis of hydrogel films on metal substrates for the development of coatings with tunable drug delivery performances.

    Science.gov (United States)

    De Giglio, E; Cometa, S; Satriano, C; Sabbatini, L; Zambonin, P G

    2009-03-15

    Novel polyacrylates-based hydrogel thin films were prepared by electrochemical polymerization, a new method to obtain hydrogels directly onto metal substrates. 2-Hydroxy-ethyl-methacrylate (HEMA), a macromer poly (ethylene-glycol diacrylate) (PEGDA) and PEGDA copolymerized with acrylic acid (AA) were used to obtain hydrogels. The electrosynthesized coatings were characterized by X-ray photoelectron spectroscopy, to assess their surface chemical composition, and by water content determination measurements, to characterize the swelling behavior. In particular, quartz crystal microbalance with dissipation monitoring was used to evaluate the pH-dependency of the swelling for AA-containing hydrogels. Moreover, a model protein (bovine serum albumin) and a model drug (caffeine) were entrapped within the hydrogel coatings during electrosynthesis, to examine the release performances and mechanisms of the electrosynthesized hydrogels. It was observed that all the examined polymers showed significant release properties and, in particular, AA-containing hydrogel films confirmed a strong pH-dependence as expected. These coatings seem to be promising in orthopedic field for in situ drug delivery applications.

  10. Automated cassette-to-cassette substrate handling system

    Science.gov (United States)

    Kraus, Joseph Arthur; Boyer, Jeremy James; Mack, Joseph; DeChellis, Michael; Koo, Michael

    2014-03-18

    An automated cassette-to-cassette substrate handling system includes a cassette storage module for storing a plurality of substrates in cassettes before and after processing. A substrate carrier storage module stores a plurality of substrate carriers. A substrate carrier loading/unloading module loads substrates from the cassette storage module onto the plurality of substrate carriers and unloads substrates from the plurality of substrate carriers to the cassette storage module. A transport mechanism transports the plurality of substrates between the cassette storage module and the plurality of substrate carriers and transports the plurality of substrate carriers between the substrate carrier loading/unloading module and a processing chamber. A vision system recognizes recesses in the plurality of substrate carriers corresponding to empty substrate positions in the substrate carrier. A processor receives data from the vision system and instructs the transport mechanism to transport substrates to positions on the substrate carrier in response to the received data.

  11. How substrate rigidity regulates the cellular motility

    Science.gov (United States)

    Sarvestani, Alireza

    2011-03-01

    Mechanical stiffness of bio-adhesive substrates has been recognized as a major regulator of cell motility. We present a simple physical model to study the crawling locomotion of a contractile cell on a soft elastic substrate. The mechanism of rigidity sensing is accounted for using Schwarz's two spring model (Schwarz et al. (2006) BioSystems 83, 225-232). The predicted dependency between the speed of motility and substrate stiffness is qualitatively consistent with experimental observations. The model demonstrates that the rigidity dependent motility of cells is rooted in the regulation of actomyosin contractile forces by substrate deformation at each anchorage point. On stiffer substrates, the traction forces required for cell translocation acquire larger magnitude but show weaker asymmetry which leads to slower cell motility. On very soft substrates, the model predicts a biphasic relationship between the substrate rigidity and the speed of locomotion, over a narrow stiffness range, which has been observed experimentally for some cell types.

  12. AaERF1 positively regulates the resistance to Botrytis cinerea in Artemisia annua.

    Directory of Open Access Journals (Sweden)

    Xu Lu

    Full Text Available Plants are sessile organisms, and they can not move away under abiotic or biotic stresses. Thus plants have evolved a set of genes that response to adverse environment to modulate gene expression. In this study, we characterized and functionally studied an ERF transcription factor from Artemisia annua, AaERF1, which plays an important role in biotic stress responses. The AaERF1 promoter had been cloned and GUS staining results of AaERF1 promoter-GUS transgenic A. annua showed that AaERF1 is expressed ubiquitiously in all organs. Several putative cis-acting elements such as W-box, TGA-box and Py-rich element, which are involved in defense responsiveness, are present in the promoter. The expression of AaERF1 can be induced vigorously by methyl jasmonate as well as by ethephon and wounding, implying that AaERF1 may activate some of the defense genes via the jasmonic acid and ethylene signaling pathways of A. annua. The results of electrophoretic mobility shift assay (EMSA and yeast one-hybrid experiments showed that AaERF1 was able to bind to the GCC box cis-acting element in vitro and in yeast. Ectopic expression of AaERF1 could enhance the expression levels of the defense marker genes PLANT DEFENSIN1.2 (PDF1.2 and BASIC CHITINASE (ChiB, and increase the resistance to Botrytis cinerea in the 35S::AaERF1 transgenic Arabidopsis. The down-regulated expression level of AaERF1 evidently reduced the resistance to B. cinerea in A. annua. The overall results showed that AaERF1 positively regulated the resistance to B. cinerea in A. annua.

  13. Probing protein phosphatase substrate binding

    DEFF Research Database (Denmark)

    Højlys-Larsen, Kim B.; Sørensen, Kasper Kildegaard; Jensen, Knud Jørgen;

    2012-01-01

    profile of the integrin-linked kinase associated phosphatase (ILKAP), a member of the protein phosphatase 2C (PP2C) family. Phosphatases can potentially dephosphorylate these phosphopeptide substrates but, interestingly, performing the binding studies at 4 °C allowed efficient binding to phosphopeptides...... around the phosphorylated residue are important for the binding affinity of ILKAP. We conclude that solid-phase affinity pull-down of proteins from complex mixtures can be applied in phosphoproteomics and systems biology.......Proteomics and high throughput analysis for systems biology can benefit significantly from solid-phase chemical tools for affinity pull-down of proteins from complex mixtures. Here we report the application of solid-phase synthesis of phosphopeptides for pull-down and analysis of the affinity...

  14. Mosaic of Commemorative Microscope Substrate

    Science.gov (United States)

    2008-01-01

    Written by electron beam lithography in the Microdevices Laboratory of NASA's Jet Propulsion Laboratory, this Optical Microscope substrate helps the Phoenix Mars Mission science team learn how to assemble individual microscope images into a mosaic by aligning rows of text. Each line is about 0.1 millimeter tall, the average thickness of a human hair. Except for the Mogensen twins, the names are of babies born and team members lost during the original development of MECA (the Microscopy, Electrochemistry and Conductivity Analyzer) for the canceled 2001 Mars lander mission. The plaque also acknowledges the MECA 2001 principal investigator, now retired. This image was taken by the MECA Optical Microscope on Sol 111, or the 111th day of the Phoenix mission (Sept. 16, 2008). The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by JPL, Pasadena, Calif. Spacecraft development was by Lockheed Martin Space Systems, Denver.

  15. Immunological evaluation of OMV(PagL)+Bap(1-487aa) and AbOmpA(8-346aa)+Bap(1-487aa) as vaccine candidates against Acinetobacter baumannii sepsis infection.

    Science.gov (United States)

    Badmasti, Farzad; Ajdary, Soheila; Bouzari, Saeid; Fooladi, Abbas Ali Imani; Shahcheraghi, Fereshteh; Siadat, Seyed Davar

    2015-10-01

    Acinetobacter baumannii is an important nosocomial pathogen that causes a high morbidity and mortality rate in infected patients with sepsis form. The surface exposed virulence proteins and serum resistance factors helping to dissemination of this bacterium to bloodstream are the most promising vaccine candidates against this microorganism. In this project we immunologically evaluated OMV(PagL)+Bap(1-487aa) and AbOmpA (8-346aa)+Bap(1-487aa) as combination forms as well as Bap(1-487aa), AbOmpA(8-346aa) and OMV(PagL) singly, with addition of alum adjuvant as vaccine candidates. The titers of total IgG, IgG1 and IgG2c as well as concentration of IL-4 and IFN-γ and survival rates were measured in a C57BL/6 murine model with disseminated sepsis. The ratio of IgG1/IgG2c and profile of IL-4/IFN-γ in OMV (PagL)+Bap (1-487aa) formulation shows the humoral and cellular immune responses have been induced robustly and have created a full protection against A. baumannii ATCC 19606 and MDR AB-44 strains. We found that the two combination vaccine candidates were protective and induced both Th1 and Th2 responses.

  16. ZnO homoepitaxy on the O polar face of hydrothermal and melt-grown substrates by pulsed laser deposition

    Energy Technology Data Exchange (ETDEWEB)

    Rogers, D.J. [Nanovation SARL, Orsay (France); Technical Univ. of Troyes (France); CNRS, Troyes (France); Hosseini Teherani, F. [Nanovation SARL, Orsay (France); Largeteau, A.; Demazeau, G. [ICMCB-CNRS, Bordeaux 1 University (Science and Technology), Pessac (France); Moisson, C.; Turover, D. [Novasic, Savoie Technolac, Arche Bat. 4, BP 267, Le Bourget du Lac (France); Nause, J. [Cermet Inc., Atlanta, GA (United States); Garry, G. [Thales Research, Domaine de Corbeville, Orsay (France); Kling, R.; Gruber, T. [Ulm University, Department of Semiconductor Physics, Ulm (Germany); Waag, A. [Braunschweig Technical University, Institute of Semiconductor Technology, Braunschweig (Germany); Jomard, F.; Galtier, P.; Lusson, A. [LPSC-CNRS, Meudon (France); Monteiro, T.; Soares, M.J.; Neves, A.; Carmo, M.C.; Peres, M. [University of Aveiro, Physics Department, Aveiro (Portugal); Lerondel, G.; Hubert, C. [Technical University of Troyes-CNRS (FRE2671), 12 rue Marie Curie, BP 2060, Troyes (France)

    2007-07-15

    2 cm diameter hydrothermal ZnO crystals were grown and then made into substrates using both mechanical and chemical-mechanical polishing (CMP). CMP polishing showed superior results with an (0002) {omega} scan full width half maximum (FWHM) of 67 arcsec and an root mean square (RMS) roughness of 2 Aa. In comparison, commercial melt-grown substrates exhibited broader X-ray diffraction (XRD) linewidths with evidence of sub-surface crystal damage due to polishing, including a downward shift of c-lattice parameter. Secondary ion mass spectroscopy revealed strong Li, Fe, Co, Al and Si contamination in the hydrothermal crystals as opposed to the melt-grown substrates, for which glow discharge mass spectroscopy studies had reported high levels of Pb, Fe, Cd and Si. Low temperature photoluminescence (PL) studies indicated that the hydrothermal crystal had high defect and/or impurity concentrations compared with the melt-grown substrate. The dominant bound exciton for the melt-grown substrate was indexed to Al. ZnO films were grown using pulsed laser deposition. The melt-grown substrates gave superior results with XRD (0002) {omega} and 2{theta}/{omega} WHM of 124 and 34 arcsec, respectively. Atomic force microscope measurements indicated a low RMS roughness (1.9 nm) as confirmed by fringes in the XRD 2{theta}/{omega} scan. It was suggested that the improvement in XRD response relative to the substrate might be due to ''healing'' of sub-surface polishing damage due to the elevated T{sub s} used for the growth. Indeed the c-lattice parameter for the homoepitaxial layer on the melt-grown substrate had become that which would be expected for strain-free ZnO. Furthermore, the stability of the PL peak positions relative to bulk ZnO, confirmed that the films appear practically strain free. (orig.)

  17. Introducing the AAS Working Group on Astroinformatics and Astrostatistics

    Science.gov (United States)

    Ivezic, Zeljko

    2014-01-01

    In response to two White Papers submitted to the Astro2010 Decadal Survey (1,2), a new AAS Working Group on Astroinformatics and Astrostatistics (WGAA) has been approved by the AAS Council at the 220th Meeting, June 2012, in Anchorage. The motivation for this WG is the growing importance of the interface between astronomy and various branches of applied mathematics, computer science and the emerging field of data science. With the new data-intensive projects envisioned for the coming decade, the need for advice derived from the focused attention of a group of AAS members who work in these areas is bound to increase. The Working Group is charged with spreading awareness of rapidly advancing computational techniques, sophsticated statistical methods, and highly capble software to further the goals of astronomical and astrophysical research. The three main strategic goals adopted by the WGAA Steering Committee for the next few years are to: (i) develop, organize and maintain methodological resources (such as software tools, papers, books, and lectures); (ii) enhance human resources (such as foster the creation of career paths, establish a Speakers' Bureau, establish and maintain an archived discussion forum, enable periodic news distribution); and (iii) organize topical meetings. The WGAA Steering Committee at this time includes twelve members: Kirk Borne, George Djorgovski, Eric Feigelson, Eric Ford, Alyssa Goodman, Joe Hilbe, Zeljko Ivezic (chair), Ashish Mahabal, Aneta Siemiginowska, Alex Szalay, Rick White, and Padma Yanamandra-Fisher. I will summarize our accomplishments since July 2012. (1) Astroinformatics: A 21st Century Approach to Astronomy (Borne & 90 coauthors), (2) The Astronomical Information Sciences: A Keystone for 21st-Century Astronomy (Loredo & 72 coauthors)

  18. Comparison of recrystallization and recrystallization textures in cold-rolled DC and CC AA 5182 aluminum alloys

    International Nuclear Information System (INIS)

    The recrystallization and recrystallization textures in cold-rolled direct chill cast (DC) and continuous cast (CC) AA 5182 aluminum alloys were investigated. The recrystallization behavior of cold-rolled DC and CC AA 5182 aluminum alloys was evaluated by tensile properties. The evolution of recrystallization textures in cold-rolled DC and CC AA 5182 aluminum alloys was determined by X-ray diffraction. The results showed that the recrystallization temperature of cold-rolled DC AA 5182 aluminum alloy was somewhat lower than that of cold-rolled CC AA 5182 aluminum alloy. The resulting recrystallization textures of cold-rolled AA 5182 aluminum alloy were characterized by the strong R orientation and the cube orientation with strong scattering about the rolling direction towards the Goss orientation. CC AA 5182 aluminum alloy showed slightly weaker recrystallization textures than DC AA 5182 aluminum alloy

  19. Professional Ethics in Astronomy: The AAS Ethics Statement

    Science.gov (United States)

    Marvel, Kevin B.

    2013-01-01

    It is fundamental to the advancement of science that practicing scientists adhere to a consistent set of professional ethical principles. Recent violations of these principles have led a decreased trust in the process of science and scientific results. Although astronomy is less in the spotlight on these issues than medical science or climate change research, it is still incumbent on the field to follow sound scientific process guided by basic ethical guidelines. The American Astronomical Society, developed a set of such guidelines in 2010. This contribution summarizes the motivation and process by which the AAS Ethics Statement was produced.

  20. Understanding the photometric variability of {\\zeta} Ori Aa

    CERN Document Server

    Buysschaert, B; Ramiaramanantsoa, T; Richardson, N D; David-Uraz, A; Moffat, A F J

    2016-01-01

    We studied the variability of the magnetic O-type supergiant $\\zeta$ Ori Aa using multi-colour BRITE photometry. We confirmed the known rotation frequency $f_{\\rm rot} = 0.15 \\pm 0.02$ c/d, and detected some of its higher harmonics, of which $4f_{\\rm rot}$ is compatible with the known DAC recurrence timescale. Thanks to simultaneous high-resolution CHIRON spectroscopy, we could identify another frequency $f_{\\rm env} = 0.10 \\pm 0.02$ c/d, caused by the circumstellar environment. Variations in the circumstellar environment are believed to cause the observed difference between the BRITE lightcurves.

  1. Measurement of deformation gradients in hot rolling of AA3004

    OpenAIRE

    C. Boldetti; Pinna, C.; Howard, I. C.; Gutierrez, G.

    2005-01-01

    In this paper we describe an experimental technique developed to measure the deformation gradients and temperature in a single hot rolling pass of an AA3004 sample that was fitted with an insert. The insert had been previously hand engraved with a 1 × 1 mm grid pitch, and the analysis of the data digitally captured from the image of the deformed grid enabled the calculation of the components of the deformation gradient tensor. Four steel pins prevented relative motion between the insert and ...

  2. The effect of atmospheric corona treatment on AA1050 aluminium

    DEFF Research Database (Denmark)

    Jariyaboon, Manthana; Møller, Per; Dunin-Borkowski, Rafal E.;

    2010-01-01

    The effect of atmospheric corona discharge on AM 050 aluminium surface was investigated using electrochemical polarization, SEM-EDX, FIB-SEM. and XPS. The corona treatment was performed with varying time (1, 5, and 15 min) in atmospheric air. A 200 nm oxide layer was generated on AA1050 after...... the 15 min air corona treatment. A significant reduction in anodic and cathodic reactivities was observed starting from 1 min exposure, which further decreased with prolonged exposure (15 min) and after delayed testing (after 30 days). The reduction in surface reactivity is due to the formation...

  3. Slot-type kicker for the AA stochastic cooling

    CERN Multimedia

    Photographic Service

    1979-01-01

    A "slotted transmission line" structure was used for both pickups and the kicker of one of the stochastic cooling systems of the Antiproton Accumulator (AA). They served for the cooling of the high-density stack, in momentum and in both transverse planes. In the beginning in a single band, 1-2 GHz, later in 3 bands, 1-2, 2-4 and 4-8 GHz. The kicker of the first generation, shown here, was located where the dispersion was zero and the beam size small, and thus had a quadratic cross-section. The pickups were rectangular and wider in the horizontal plane. See also 7906193

  4. Rescue of Drosophila Melanogaster l(2)35Aa lethality is only mediated by polypeptide GalNAc-transferase pgant35A, but not by the evolutionary conserved human ortholog GalNAc-transferase-T11.

    Science.gov (United States)

    Bennett, Eric P; Chen, Ya-Wen; Schwientek, Tilo; Mandel, Ulla; Schjoldager, Katrine ter-Borch Gram; Cohen, Stephen M; Clausen, Henrik

    2010-05-01

    The Drosophila l(2)35Aa gene encodes a UDP-N-acetylgalactosamine: Polypeptide N-acetylgalactosaminyltransferase, essential for embryogenesis and development (J. Biol. Chem. 277, 22623-22638; J. Biol. Chem. 277, 22616-22). l(2)35Aa, also known as pgant35A, is a member of a large evolutionarily conserved family of genes encoding polypeptide GalNAc-transferases. Phylogenetic and functional analyses have proposed that subfamilies of orthologous GalNAc-transferase genes are conserved in species, suggesting that they serve distinct functions in vivo. Based on sequence alignments, pgant35A and human GALNT11 are thought to belong to a distinct subfamily. Recent in vitro studies have shown that pgant35A and pgant7, encoding enzymes from different subfamilies, prefer different acceptor substrates, whereas the orthologous pgant35A and human GALNT11 gene products possess, 1) conserved substrate preferences and 2) similar acceptor site preferences in vitro. In line with the in vitro pgant7 studies, we show that l(2)35Aa lethality is not rescued by ectopic pgant7 expression. Remarkably and in contrast to this observation, the human pgant35A ortholog, GALNT11, was shown not to support rescue of the l(2)35Aa lethality. By use of genetic "domain swapping" experiments we demonstrate, that lack of rescue was not caused by inappropriate sub-cellular targeting of functionally active GalNAc-T11. Collectively our results show, that fly embryogenesis specifically requires functional pgant35A, and that the presence of this gene product during fly embryogenesis is functionally distinct from other Drosophila GalNAc-transferase isoforms and from the proposed human ortholog GALNT11.

  5. Raadioteatril elu sees. Elu sees? / Mart Aas, Tõnis Leemets ; interv. Kutt Kommel

    Index Scriptorium Estoniae

    Aas, Mart

    2007-01-01

    Eesti Raadio raadioteatri 78. sünnipäeval esietendus Vikerraadios dokumentaalkuuldemäng "Elu sees" Aleksander Alleni (hilisema nimega Aleksander Aas) mälestuste põhjal. Theatrumi lavastuse on raadiole seadnud Mart Aas, Marius Peterson, Toomas Lõhmuste ja Tõnis Leemets

  6. Effect of cryogenic cooling on corrosion of friction stir welded AA7010-T7651

    DEFF Research Database (Denmark)

    Jariyaboon, Manthana; Davenport, A. J.; Ambat, Rajan;

    2010-01-01

    Purpose - The purpose of this paper is to study how cryogenic CO2 cooling during the welding process affects corrosion behaviour of friction stir welding (FSW) AA7010-T7651. Design/methodology/approach - Friction stir welded AA7010-17651 was produced with a rotation speed of 288 rpm and a travel ...

  7. NCBI nr-aa BLAST: CBRC-STRI-01-2565 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto...r type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid receptor type 1 protein [Mus musculus] g

  8. NCBI nr-aa BLAST: CBRC-OPRI-01-0982 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto...r type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid receptor type 1 protein [Mus musculus] g

  9. NCBI nr-aa BLAST: CBRC-GGOR-01-1297 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto...r type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid receptor type 1 protein [Mus musculus] g

  10. NCBI nr-aa BLAST: CBRC-TSYR-01-1316 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto...r type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid receptor type 1 protein [Mus musculus] g

  11. NCBI nr-aa BLAST: CBRC-MDOM-02-0334 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto...r type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid receptor type 1 protein [Mus musculus] g

  12. NCBI nr-aa BLAST: CBRC-PVAM-01-1403 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto...r type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid receptor type 1 protein [Mus musculus] g

  13. NCBI nr-aa BLAST: CBRC-PHAM-01-1594 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto...r type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid receptor type 1 protein [Mus musculus] g

  14. NCBI nr-aa BLAST: CBRC-MMUR-01-1494 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto...r type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid receptor type 1 protein [Mus musculus] g

  15. NCBI nr-aa BLAST: CBRC-PCAP-01-1368 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto...r type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid receptor type 1 protein [Mus musculus] g

  16. Bacterial cellulose based hydrogel (BC-g-AA) and preliminary result of swelling behavior

    Energy Technology Data Exchange (ETDEWEB)

    Hakam, Adil; Lazim, Azwan Mat [UKM-MIMOS Laboratory, School of Chemical Sciences and Food Technology, National University of Malaysia (UKM) (Malaysia); Abdul Rahman, I. Irman [Laboratory of Gamma Radiation Instrument, Science Nuclear Program, School of Applied Physics, National University of Malaysia (UKM) (Malaysia)

    2013-11-27

    In this study, hydrogel based on Bacterial cellulose (BC) or local known as Nata de Coco, which grafted with monomer: Acrylic acid (AA) is synthesis by using gamma radiation technique. These hydrogel (BC-g-AA) has unique characteristic whereby responsive to pH buffer solution.

  17. NCBI nr-aa BLAST: CBRC-MMUR-01-0065 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUR-01-0065 ref|ZP_03493196.1| hypothetical protein AaLAA1DRAFT_0782 [Alicycl...obacillus acidocaldarius LAA1] gb|EED08211.1| hypothetical protein AaLAA1DRAFT_0782 [Alicyclobacillus acidocaldarius LAA1] ZP_03493196.1 2.4 30% ...

  18. Intrauterine, postpartum and adult relationships between arachidonic acid (AA) and docosahexaenoic acid (DHA)

    NARCIS (Netherlands)

    Kuipers, Remko S.; Luxwolda, Martine F.; Dijck-Brouwer, D. A. Janneke; Muskiet, Frits A. J.

    2011-01-01

    Erythrocyte (RBC) fatty acid compositions from populations with stable dietary habits but large variations in RBC-arachidonic (AA) and RBC-docosahexaenoic acid (DHA) provided us with insight into relationships between DHA and AA. It also enabled us to estimate the maternal RBC-DHA (mRBC-DHA) status

  19. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01789776.1| multidrug resistance protein [Haemophilus infl...uenzae PittAA] gb|EDK08502.1| multidrug resistance protein [Haemophilus influenzae PittAA] ZP_01789776.1 0.22 27% ...

  20. RADIATION SYNTHESIS AND CHARACTERIZATION OF POLY (AA-CO-NVP)/CLAY HYDROGELS

    Institute of Scientific and Technical Information of China (English)

    Hong-yan Song; Wen-tao Liu; Su-qin He; Ming-cheng Yang; Ya Gao; Cheng-shen Zhu; Liu-suo Wu

    2008-01-01

    The pH-sensitive P(AA-co-NVP)Iclay hydrogels were prepared with the monomers of acrylic acid (AA) andN-vinyl-2-pyrrolidone (NVP) based on γ-ray irradiation technique. The influence of pH values of buffer solutions andcontents of clay and NVP on the equilibrium swelling ratio (SR) and compressive properties of the hydrogels wasinvestigated in detail. The results of swelling property tests showed that, with the increase of clay content, the SR ofhydrogels increases in the same buffer solution, and the SR of hydrogels with different contents of HTMAB-clay is higherthan that of P(A.A-co-NVP) hydrogels without clay. When the content of clay is 15%, the SR of P(AA-co-NVP)/clayhydrogel is 201 at pH=9.8, which is 1.23 times of that of the P(AA-co-NVP) hydrogel (164). In addition, the SR ofP(AA-co-NVP)/clay hydrogel is higher than that of PAA/clay hydrogel in the same solution. The compressive properties ofthe hydrogel were also examined. The results showed that the compressive properties of the P(AA-co-NVP)/clay hydrogelswere improved distinctly as compared to those of the conventional hydrogels without clay. When the content of clay is 15%,the compression strength of the P(AA-co-NVP)/clay hydrogel is 23 times of that of the P(AA-co-NVP) hydrogel.

  1. Bacterial cellulose based hydrogel (BC-g-AA) and preliminary result of swelling behavior

    Science.gov (United States)

    Hakam, Adil; Lazim, Azwan Mat; Abdul Rahman, I. Irman

    2013-11-01

    In this study, hydrogel based on Bacterial cellulose (BC) or local known as Nata de Coco, which grafted with monomer: Acrylic acid (AA) is synthesis by using gamma radiation technique. These hydrogel (BC-g-AA) has unique characteristic whereby responsive to pH buffer solution.

  2. Influence of Reaction-Induced Phase Decomposition to Dispersion of Samariam Acrylic Acid (Sm (AA)3 ) in Rubber and Shielding Property of Sm(AA) 3/NR Composites

    Institute of Scientific and Technical Information of China (English)

    Liu Li; He Lei; Zhang Wan; Yang Cheng; Liu Yandong; Jin Riguang; Zhang Liqun

    2004-01-01

    According to radiation protection theory, the radiation shielding properties of composites are closely related to dispersion condition of radiation absorbing materials in matrix. The more equably radiation-shielding materials dispersed in the matrix, the better the composites' shielding properties are. Rare earth ions have preferably absorbing ability for radiation due to their special electronic structures. From our early work, we know Sm(AA) 3 has good radiationabsorbing ability and excellent compatibility with polymer matrix. Furthermore, Sm (AA) 3 has double key structures which can in-situ react with polymer matrix in vulcanization process. This in-situ reaction can also help Sm(AA) 3 disperse better in the matrix. Based on these, we studied a new method to prepare Sm( AA)3/NR( nature rubber) composites( NR used as matrix), in which Sm(AA)3 dispersed very equably with tiny particle size. Both sulfur and peroxide exist in the system as crosslinking agent. The vulcanization process occurred at the temperature of 110℃ first and a certain degree crosslinking network formed in this stage, which we called pre-vulcanization process in this paper. In this stage sulfur was used as the crosslinking agent. Then continued the vulcanization process at higher temperature(170℃). The peroxide was used as crosslinking agent in this stage. According to reaction-induced phase decomposition mechanism, we studied the phase decomposition changing mode of Sm(AA) 3 in NR matrix of different crosslinking degrees. We also studied the influence of different degrees of pre-vulcanization to the dispersion condition of Sm (AA) 3 in NR matrix. The crystal-fusion status of both Sm(AA) 3 powder and Sm(AA) 3 in cured rubber were observed by DSC (Differential Scanning Calorimetry) and XRD (X-rays Diffraction). The dispersion condition of Sm(AA) 3 in cured rubber was observed by SEM (Scanning Electron Microscopy) and TEM (Transmission Electron Microscope).The studyresults show different

  3. Quality Of Electrophotographic Prints On Foil Substrates

    Directory of Open Access Journals (Sweden)

    Rozália Szentgyörgyvölgyi

    2011-05-01

    Full Text Available Electrophotographic printing uses many types of substrates, our study focuses on plastic substrates. Six types ofregular and self-adhesive foil substrates were chosen to be printed using two electrophotographic presses: XeroxColour 1000 Press and Canon imagePress C7000VP. A test chart containing tone value scales and a set of samplesfor profiling was created, spectrophotomety and densitometry was applied to obtain the optical and colorimetricproperties of the substrates investigated. Xerox Color 1000 Press produced larger densities and tone value increaseon every type of substrate. The largest TVI values and reproducible colour gamut was observed on the smoothestfoil in case of both presses. Large colour differences were found between patches of full tone process colors on thedifferent substrates investigated.

  4. The Jasmonate-Responsive AP2/ERF Transcription Factors AaERF1 and AaERF2 Positively Regulate Artemisinin Biosynthesis in Artemisia annua L.

    Institute of Scientific and Technical Information of China (English)

    Zong-Xia YU; Jian-Xu Li; Chang-Qing Yang; Wen-Li Hu; Ling-Jian Wang; Xiao-Ya Chen

    2012-01-01

    Plants of Artemisia annua produce artemisinin,a sesquiterpene lactone widely used in malaria treatment.Amorpha-4,11-diene synthase (ADS),a sesquiterpene synthase,and CYP71AV1,a P450 monooxygenase,are two key enzymes of the artemisinin biosynthesis pathway.Accumulation of artemisinin can be induced by the phytohormone jasmonate (JA).Here,we report the characterization of two JA-responsive AP2 family transcription factors-AaERF1 and AaERF2-from A.annua L.Both genes were highly expressed in inflorescences and strongly induced by JA.Yeast one-hybrid and electrophoretic mobility shift assay (EMSA) showed that they were able to bind to the CRTDREHVCBF2 (CBF2) and RAV1AAT (RAA) motifs present in both ADS and CYP71AV1 promoters.Transient expression of either AaERF1 or AaERF2 in tobacco induced the promoter activities of ADS or CYP71AV1,and the transgenic A.annua plants overexpressing either transcription factor showed elevated transcript levels of both ADS and CYP71AV1,resulting in increased accumulation of artemisinin and artemisinic acid.By contrast,the contents of these two metabolites were reduced in the RNAi transgenic lines in which expression of AaERF1 or AaERF2 was suppressed.These results demonstrate that AaERF1 and AaERF2 are two positive regulators of artemisinin biosynthesis and are of great value in genetic engineering of artemisinin production.

  5. Changes of Grain Sizes and Flow Stresses of AA2014 and AA6063 Aluminum Alloys at High Temperatures in Various Strain Rates

    OpenAIRE

    ALNIAK, M. Oktay

    2003-01-01

    Changes in the grain sizes and flow stresses of AA2014 and AA6063 aluminum alloys subjected to compression tests at high temperatures in various constant compression head speeds were investigated. When assessing the test results, constant strain rates were considered instead of compression head speeds of the uniaxial compression testing system after making the necessary mathematical transformation. Specimens used in the test were prepared in cylindrical form and deformed until 0.7 tr...

  6. Characterization And Study of Friction Stir Welding of AA6101 Aluminum Alloy

    Directory of Open Access Journals (Sweden)

    S. K. Aditya

    2016-05-01

    Full Text Available Friction stir welding (FSW combines two plates by frictional heating at the interface with the localized plastic deformation within the material. In friction stir welding heat is generated by the friction between rotating tool shoulder and the plates to be welded. The heat thus generated results in thermal softening of the material. The softened material is then forced to flow by the translation of the tool from the front to the back of the pin. There it cools, consolidates and results in joint formation. In the process, strength of the joint and percentage elongation varies from the parent material. AA6101 is equivalent to AA 6061 and AA6063. At present AA6101 is used by the electrical industries only. A detailed experimental study has been done on AA 6101 to its utility as an Aluminum alloy for structural fabrication

  7. Diatomite: a new substrate for hydroponics

    OpenAIRE

    Yıldız, Nesrin

    2008-01-01

    Many different substrates are used for plant support in hydroponic culture, but one of the unique requirements for research is that the media be easily separated from the roots. Peat, perlite, and vermiculite are good substrates but roots and root hairs grow into these substrates, so they are unsuitable for studies of root size and morphology. Sand can easily be removed from roots, but roots grown in sand are shorter and thicker than hydroponic roots because the sand particles are...

  8. Expression and prognostic value of platelet-derived growth factor-AA and its receptor alpha in nephroblastoma

    NARCIS (Netherlands)

    Ghanem, Mazen; Nijman, Rien; Safan, Manal; van der Kwast, Theodorus; Vansteenbrugge, Gert

    2010-01-01

    OBJECTIVE To investigate the potential role of platelet-derived growth factor-AA (PDGF-AA) and the PDGF-alpha receptor as prognostic markers in Wilms' tumour. PATIENTS AND METHODS The expression of PDGF-AA and PDGF-alpha were investigated using immunohistochemical analysis of 62 Wilms' tumours. Pati

  9. Casimir Forces between Nanoparticles and Substrates

    CERN Document Server

    Román-Velázquez, C E; Villarreal, C; Esquivel-Sirvent, R; Noguez, Cecilia

    2002-01-01

    We study the Casimir force between a nanoparticle and a substrate. We consider the interaction of metal nanoparticles with different substrates within the dipolar approximation. We study the force as a function of the distance for gold and potassium spheres, which are over a substrate of titanium dioxide, sapphire and a perfect conductor. We show that Casimir force is important in systems at the nanometer scale. We study the force as a function of the material properties, radii of the spheres, and the distance between the sphere and the substrate.

  10. Nanowires and nanoneedles nucleation on vicinal substrate

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xu, E-mail: zhangxubetter@gmail.com [Henan Key Laboratory of Laser and Opto-electric Information Technology, School of Information Engineering, Zhengzhou University, Zhengzhou 450052 (China); Xie, Dan; Huang, Genling [Zhengzhou Railway Vocational and Technical College, Zhengzhou 450052 (China); Sun, Xiao-Hong [Henan Key Laboratory of Laser and Opto-electric Information Technology, School of Information Engineering, Zhengzhou University, Zhengzhou 450052 (China)

    2015-01-01

    An analytic stress-driven nucleation model of nanowires (NWs) and nanoneedles (NNs) growing on a mismatched vicinal substrate is proposed. It is demonstrated that the formation enthalpy of NWs and NNs is a function of three independent variables, the base radius, aspect ratio and miscut angle of the vicinal surface. Theoretical analysis shows that the minimum nucleation barrier of an island decreases with increment of substrate misorientation, which means the nucleation of islands on a vicinal substrate is more favorable than that on a flat substrate.

  11. Alternative substrates for higher mushrooms mycelia cultivation

    OpenAIRE

    TETIANA KRUPODOROVA; VICTOR BARSHTEYN

    2015-01-01

    Cultivation of 29 species of higher mushroom mycelia on alternative substrates – wastes of Ukrainian oil-fat industry, has been investigated. The amount of mushroom mycelia obtaining on 12 investigated substrates varied significantly, from 1.0 g/L to 22.9 g/L on the 14th day of cultivation. The superficial cultivation adopted in this study allows for easy to choose appropriate medium (substrate) for mycelia production. Alternative substrates (compared to glucose-peptone-yeast medium) were sel...

  12. Photovoltaic cell with nano-patterned substrate

    Energy Technology Data Exchange (ETDEWEB)

    Cruz-Campa, Jose Luis; Zhou, Xiaowang; Zubia, David

    2016-10-18

    A photovoltaic solar cell comprises a nano-patterned substrate layer. A plurality of nano-windows are etched into an intermediate substrate layer to form the nano-patterned substrate layer. The nano-patterned substrate layer is positioned between an n-type semiconductor layer composed of an n-type semiconductor material and a p-type semiconductor layer composed of a p-type semiconductor material. Semiconductor material accumulates in the plurality of nano-windows, causing a plurality of heterojunctions to form between the n-type semiconductor layer and the p-type semiconductor layer.

  13. Adhesion of rhodium films on metallic substrates

    Energy Technology Data Exchange (ETDEWEB)

    Marot, L. [Department of Physics, University of Basel, Klingelbergstrasse 82, CH-4056 Basel (Switzerland)], E-mail: laurent.marot@unibas.ch; Covarel, G.; Tuilier, M.-H. [Laboratoire Mecanique, Materiaux et Procedes de Fabrication, Pole STIC-SPI-Math 61 rue Albert Camus, Universite de Haute-Alsace, F-68093 - Mulhouse Cedex (France); Steiner, R.; Oelhafen, P. [Department of Physics, University of Basel, Klingelbergstrasse 82, CH-4056 Basel (Switzerland)

    2008-09-01

    Rhodium coated metallic films were prepared by magnetron sputtering on metallic substrates. All films were elaborated in same conditions on copper, molybdenum and stainless steel. Adhesion strength tests were carried out by scratch test. The results reveal that the adhesion strength between the film and the substrate is influenced by the hardness of the substrate. Increase of deposition temperature improves the adhesion of the coating. In addition, pre-treatment of substrates by a filtered cathodic vacuum arc and the layer thickness have has some effects on the final adhesion strength.

  14. Substrate tolerant direct block copolymer nanolithography

    DEFF Research Database (Denmark)

    Li, Tao; Wang, Zhongli; Schulte, Lars;

    2016-01-01

    Block copolymer (BC) self-assembly constitutes a powerful platform for nanolithography. However, there is a need for a general approach to BC lithography that critically considers all the steps from substrate preparation to the final pattern transfer. We present a procedure that significantly sim...... plasma treatment enables formation of the oxidized PDMS hard mask, PS block removal and polymer or graphene substrate patterning....... simplifies the main stream BC lithography process, showing a broad substrate tolerance and allowing for efficient pattern transfer over wafer scale. PDMS-rich poly(styrene-b-dimethylsiloxane) (PS-b-PDMS) copolymers are directly applied on substrates including polymers, silicon and graphene. A single oxygen...

  15. Solving the $R_{AA}\\otimes v_2$ puzzle

    CERN Document Server

    Noronha-Hostler, Jacquelyn

    2016-01-01

    For the past ten years $R_{AA}(p_T)$, the nuclear modification factor that encodes the suppression of high $p_T$ particles due to energy loss within the medium was fairly well described by many theoretical models. However, the same models systematically under-predicted the high $p_T$ elliptic flow, $v_2$, which is experimentally measured as the correlation between soft and hard hadrons. All previous calculations neglected the effect of event-by-event fluctuations of an expanding viscous hydrodynamical background as well as the soft-hard flow harmonic correlations in the experimentally measured $v_2$. In this talk I show how event-by-event viscous hydrodynamics (computed using the v-USPhydro code) coupled to an energy loss model (BBMG) is able to simultaneously describe soft physics observables as well as the high-$p_T$ $R_{AA}$ and $v_2$. Suggestions for future more differential calculations at the LHC run2 are made to explore soft-hard flow correlations.

  16. Astronomy Career Profiles from the AAS Newsletter Archives

    CERN Document Server

    Metcalfe, Travis; McDaid, Liam; Bullock, Blake; Pulliam, Christine; Williams, Peter; Roth, Joshua; Whitney, Barb; Olsen, Knut; Howell, Andy; Keller, Luke

    2011-01-01

    This is a collection of articles that were originally published in the Newsletter of the American Astronomical Society (AAS) between May 2008 and September 2011 by the Committee on Employment. Authors representing a wide range of career paths tell their stories and provide insight and advice that is relevant to success in various job sectors. Although all of these articles are available individually from the AAS archives, we are posting the complete collection here to make them more accessible as a resource for the astronomy community. The collection includes the following articles: (1) Changing Priorities: the Hard Money Wild Card, (2) Beyond Ivory Towers, (3) Astronomers Working in Public Outreach, (4) Bush-Whacking a Career Trail, (5) Science Communication as a Press Officer, (6) Jobs in Industry, (7) Back to School: A Ph.D. Enters the Classroom, (8) Working at a Soft-Money Institute, (9) Balancing Research and Service at NOAO, (10) Succeeding in a Large Research Collaboration, and (11) Preparing for the C...

  17. AAS Publishing News: Preparing Your Manuscript Just Got Easier

    Science.gov (United States)

    Kohler, Susanna

    2016-03-01

    Watermarking using the command watermark{DRAFT, v2}.Are you an astronomer considering submitting a paper to an AAS journal (i.e., AJ, ApJ, ApJ Letters, or ApJ Supplements)? If so, this post is for you! Read on to find out about the exciting new things you can do with the AASs newest LaTeX class file, available for download now.Why the Update?AAS publishing has maintained a consistent class file for LaTeX manuscript preparation for the past decade. But academic publishing is changing rapidly in todays era of electronic journals! Since its journals went fully electronic, the AAS has been continuously adding new publishing capabilities based on the recommendations of the Journals Task Force and the needs and requests of AAS authors. The AASs manuscript preparation tools are now being updated accordingly.Whats New in AASTex 6.0?There are many exciting new features and capabilities in AASTex 6.0. Here are just a few:Tracking options for author revisions include added{text}, deleted{text}, replaced{old}{new}, and explain{text}.Based on emulateapjDo you use the popular class file emulateapj to prepare your manuscripts? AASTex 6.0 is based on emulateapj, rather than on the older AASTex 5.2 (though 5.2 is still supported). This means that it is easy to produce a double-columned, single-spaced, and astro-ph-ready manuscript. Since two thirds of the AAS journals authors use emulateapj, this transition was designed to make manuscript preparation and sharing an easier and more seamless process.Tools for collaborationsDo you work in a large collaboration? AASTex now includes new tools to make preparing a manuscript within a collaboration easier. Drafts can now be watermarked to differentiate between versions. New markup for large author lists streamlines the display so that readers can access article information immediately, yet they can still access the full author list and affiliations at the end of the paper. And author revision markup allows members of a collaboration to

  18. AAS, growth hormone, and insulin abuse: psychological and neuroendocrine effects

    Directory of Open Access Journals (Sweden)

    Michael R Graham

    2008-06-01

    Full Text Available Michael R Graham1, Peter Evans2, Bruce Davies1, Julien S Baker11Health and Exercise Science Research Unit, Faculty of Health Sport and Science, University of Glamorgan, Pontypridd, Wales, United Kingdom; 2Royal Gwent Hospital, Newport, Gwent, United KingdomAbstract: The nontherapeutic use of prescription medicines by individuals involved in sport is increasing. Anabolic-androgenic steroids (AAS are the most widely abused drug. Much of our knowledge of the psychological and physiological effects of human growth hormone (hGH and insulin has been learned from deficiency states. As a consequence of the Internet revolution, previously unobtainable and expensive designer drugs, particularly recombinant human growth hormone (rhGH and insulin, have become freely available at ridiculously discounted prices from countries such as China and are being abused. These drugs have various physiological and psychological effects and medical personnel must become aware that such prescription medicine abuse appears to be used not only for performance and cosmetic reasons, but as a consequence of psychological pre-morbidity.Keywords: AAS, cosmesis, growth hormone, insulin, performance, strength

  19. Carnosinases, Their Substrates and Diseases

    Directory of Open Access Journals (Sweden)

    Francesco Bellia

    2014-02-01

    Full Text Available Carnosinases are Xaa-His dipeptidases that play diverse functions throughout all kingdoms of life. Human isoforms of carnosinase (CN1 and CN2 under appropriate conditions catalyze the hydrolysis of the dipeptides carnosine (β-alanyl-L-histidine and homocarnosine (γ-aminobutyryl-L-histidine. Alterations of serum carnosinase (CN1 activity has been associated with several pathological conditions, such as neurological disorders, chronic diseases and cancer. For this reason the use of carnosinase levels as a biomarker in cerebrospinal fluid (CSF has been questioned. The hydrolysis of imidazole-related dipeptides in prokaryotes and eukaryotes is also catalyzed by aminoacyl-histidine dipeptidases like PepD (EC 3.4.13.3, PepV (EC 3.4.13.19 and anserinase (EC 3.4.13.5. The review deals with the structure and function of this class of enzymes in physiological and pathological conditions. The main substrates of these enzymes, i.e., carnosine, homocarnosine and anserine (β-alanyl-3-methyl-L-histidine will also be described.

  20. Carnosinases, their substrates and diseases.

    Science.gov (United States)

    Bellia, Francesco; Vecchio, Graziella; Rizzarelli, Enrico

    2014-01-01

    Carnosinases are Xaa-His dipeptidases that play diverse functions throughout all kingdoms of life. Human isoforms of carnosinase (CN1 and CN2) under appropriate conditions catalyze the hydrolysis of the dipeptides carnosine (β-alanyl-L-histidine) and homocarnosine (γ-aminobutyryl-L-histidine). Alterations of serum carnosinase (CN1) activity has been associated with several pathological conditions, such as neurological disorders, chronic diseases and cancer. For this reason the use of carnosinase levels as a biomarker in cerebrospinal fluid (CSF) has been questioned. The hydrolysis of imidazole-related dipeptides in prokaryotes and eukaryotes is also catalyzed by aminoacyl-histidine dipeptidases like PepD (EC 3.4.13.3), PepV (EC 3.4.13.19) and anserinase (EC 3.4.13.5). The review deals with the structure and function of this class of enzymes in physiological and pathological conditions. The main substrates of these enzymes, i.e., carnosine, homocarnosine and anserine (β-alanyl-3-methyl-L-histidine) will also be described. PMID:24566305

  1. Depletion of spleen macrophages delays AA amyloid development: a study performed in the rapid mouse model of AA amyloidosis.

    Directory of Open Access Journals (Sweden)

    Katarzyna Lundmark

    Full Text Available AA amyloidosis is a systemic disease that develops secondary to chronic inflammatory diseases Macrophages are often found in the vicinity of amyloid deposits and considered to play a role in both formation and degradation of amyloid fibrils. In spleen reside at least three types of macrophages, red pulp macrophages (RPM, marginal zone macrophages (MZM, metallophilic marginal zone macrophages (MMZM. MMZM and MZM are located in the marginal zone and express a unique collection of scavenger receptors that are involved in the uptake of blood-born particles. The murine AA amyloid model that resembles the human form of the disease has been used to study amyloid effects on different macrophage populations. Amyloid was induced by intravenous injection of amyloid enhancing factor and subcutaneous injections of silver nitrate and macrophages were identified with specific antibodies. We show that MZMs are highly sensitive to amyloid and decrease in number progressively with increasing amyloid load. Total area of MMZMs is unaffected by amyloid but cells are activated and migrate into the white pulp. In a group of mice spleen macrophages were depleted by an intravenous injection of clodronate filled liposomes. Subsequent injections of AEF and silver nitrate showed a sustained amyloid development. RPMs that constitute the majority of macrophages in spleen, appear insensitive to amyloid and do not participate in amyloid formation.

  2. Surface Modification of Nanocellulose Substrates

    Science.gov (United States)

    Zoppe, Justin Orazio

    Cellulose fibers constitute an important renewable raw material that is utilized in many commercial applications in non-food, paper, textiles and composite materials. Chemical functionalization is an important approach for improving the properties of cellulose based materials. Different approaches are used to graft polymeric chains onto cellulose substrates, which can be classified by two principal routes, namely 'grafting onto' or 'grafting from' methods. Never-dried cellulose nanocrystals (CNCs) or nanowhiskers produced from sulfuric acid hydrolysis of ramie fibers were used as substrates for surface chemical functionalization with various macromolecules. In addition, the use of cellulose nanocrystals to reinforce poly(epsilon-caprolactone) (PCL) nanofibers was studied. Chemical grafting with low molecular weight polycaprolactone diol onto cellulose nanocrystals was carried out in an attempt to improve the interfacial adhesion with the fiber matrix. Significant improvements in the mechanical properties of the nanofibers after reinforcement with unmodified cellulose nanocrystals were confirmed. Fiber webs from PCL reinforced with 2.5% unmodified CNCs showed ca. 1.5-fold increase in Young's modulus and ultimate strength compared to PCL webs. The CNCs were also grafted with poly(N-isopropylacrylamide) (poly(NiPAAm)) brushes via surface-initiated single-electron transfer living radical polymerization (SI-SETLRP) under various conditions at room temperature. The grafting process depended on the initiator and/or monomer concentrations used. No observable damage occurred to the CNCs after grafting, as determined by X-ray diffraction. Size exclusion chromatography analyses of polymer chains cleaved from the cellulose nanocrystals indicated that a higher degree of polymerization was achieved by increasing initiator or monomer loading, most likely caused by local heterogeneities yielding higher rates of polymerization. In addition, the colloidal stability and thermo

  3. Surface Modification of Nanocellulose Substrates

    Science.gov (United States)

    Zoppe, Justin Orazio

    Cellulose fibers constitute an important renewable raw material that is utilized in many commercial applications in non-food, paper, textiles and composite materials. Chemical functionalization is an important approach for improving the properties of cellulose based materials. Different approaches are used to graft polymeric chains onto cellulose substrates, which can be classified by two principal routes, namely 'grafting onto' or 'grafting from' methods. Never-dried cellulose nanocrystals (CNCs) or nanowhiskers produced from sulfuric acid hydrolysis of ramie fibers were used as substrates for surface chemical functionalization with various macromolecules. In addition, the use of cellulose nanocrystals to reinforce poly(epsilon-caprolactone) (PCL) nanofibers was studied. Chemical grafting with low molecular weight polycaprolactone diol onto cellulose nanocrystals was carried out in an attempt to improve the interfacial adhesion with the fiber matrix. Significant improvements in the mechanical properties of the nanofibers after reinforcement with unmodified cellulose nanocrystals were confirmed. Fiber webs from PCL reinforced with 2.5% unmodified CNCs showed ca. 1.5-fold increase in Young's modulus and ultimate strength compared to PCL webs. The CNCs were also grafted with poly(N-isopropylacrylamide) (poly(NiPAAm)) brushes via surface-initiated single-electron transfer living radical polymerization (SI-SETLRP) under various conditions at room temperature. The grafting process depended on the initiator and/or monomer concentrations used. No observable damage occurred to the CNCs after grafting, as determined by X-ray diffraction. Size exclusion chromatography analyses of polymer chains cleaved from the cellulose nanocrystals indicated that a higher degree of polymerization was achieved by increasing initiator or monomer loading, most likely caused by local heterogeneities yielding higher rates of polymerization. In addition, the colloidal stability and thermo

  4. Direct transfer of graphene onto flexible substrates

    Science.gov (United States)

    Pimenta, Luiz Gustavo; Song, Yi; Zeng, Tingying; Dresselhaus, Mildred; Kong, Jing; Araujo, Paulo

    2014-03-01

    We explore the direct transfer via lamination of chemical vapor deposition graphene onto different flexible substrates. The transfer method investigated here is fast, simple, and does not require an intermediate transfer membrane, such as polymethylmethacrylate. Various substrates of general interest in research and industry were studied including polytetrafluoroethylene filter membranes, PVC, cellulose nitrate/cellulose acetate filter membranes, polycarbonate, paraffin, polyethylene terephthalate, paper, and cloth. By comparing the properties of these substrates, two critical factors to ensure a successful transfer on bare substrates were identified: the substrate's hydrophobicity and good contact between the substrate and graphene. For substrates that do not satisfy those requirements, polymethylmethacrylate can be used as a surface modifier or glue to ensure successful transfer. Our results can be applied to facilitate present processes and open up directions for applications of chemical vapor deposition (CVD) graphene on flexible substrates. A broad range of applications of CVD graphene can be envisioned, including fabrication of graphene devices for opto/organic electronics, graphene membranes for gas/liquid separation, and ubiquitous electronics with graphene.

  5. Phytotoxic evaluation of whole pine tree substrates

    Science.gov (United States)

    Decreased availability and increased cost of quality substrates are issues facing many horticulture crop producers. Peat moss and pine bark are the most widely used substrate components, yet producers have become more aware of acceptable alternative components. Processed whole pine trees have been i...

  6. A signal-substrate match in the substrate-borne component of a multimodal courtship display

    Directory of Open Access Journals (Sweden)

    Damian O. ELIAS, Andrew C. MASON, Eileen A. HEBETS

    2010-06-01

    Full Text Available The environment can impose strong limitations on the efficacy of signal transmission. In particular, for vibratory communication, the signaling environment is often extremely heterogeneous at very small scales. Nevertheless, natural selection is expected to select for signals well-suited to effective transmission. Here, we test for substrate-dependent signal efficacy in the wolf spider Schizocosa stridulans Stratton 1991. We first explore the transmission characteristics of this important signaling modality by playing recorded substrate-borne signals through three different substrates (leaf litter, pine litter, and red clay and measuring the propagated signal. We found that the substrate-borne signal of S. stridulans attenuates the least on leaf litter, the substrate upon which the species is naturally found. Next, by assessing mating success with artificially muted and non-muted males across different signaling substrates (leaf litter, pine litter, and sand, we explored the relationship between substrate-borne signaling and substrate for mating success. We found that muted males were unsuccessful in obtaining copulations regardless of substrate, while mating success was dependent on the signaling substrate for non-muted males. For non-muted males, more males copulated on leaf litter than any other substrate. Taken together, these results confirm the importance of substrate-borne signaling in S. stridulans and suggest a match between signal properties and signal efficacy – leaf litter transmits the signal most effectively and males are most successful in obtaining copulations on leaf litter [Current Zoology 56 (3: 370–378, 2010].

  7. Precipitation in an AA6111 aluminium alloy and cosmetic corrosion

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Y. [Corrosion and Protection Centre, School of Materials, University of Manchester, Manchester M60 1QD (United Kingdom); Zhou, X. [Corrosion and Protection Centre, School of Materials, University of Manchester, Manchester M60 1QD (United Kingdom)]. E-mail: xiaorong.zhou@manchester.ac.uk; Thompson, G.E. [Corrosion and Protection Centre, School of Materials, University of Manchester, Manchester M60 1QD (United Kingdom); Hashimoto, T. [Corrosion and Protection Centre, School of Materials, University of Manchester, Manchester M60 1QD (United Kingdom); Scamans, G.M. [Innoval Technology, Beaumont Close, Banbury, Oxon OX16 1TQ (United Kingdom); Afseth, A. [Novelis Technology and Management, 8212 Neuhausen (Switzerland)

    2007-01-15

    The near-surface deformed layer on AA6111 automotive closure sheet alloy, generated by mechanical grinding during rectification, has an ultrafine grain microstructure, of 50-150 nm diameter, and a sharp transition with the underlying bulk alloy microstructure. Grinding and heat treatment to simulate rectification and paint baking processes result in the nucleation and growth of {approx}20 nm diameter precipitates at grain boundaries within the near-surface deformed layer. High-resolution transmission electron microscopy has shown Q phase precipitates in the deformed layer, giving dramatically increased corrosion susceptibility compared with the bulk microstructure, and this is responsible for the rapid-onset filiform corrosion. Transmission electron microscopy of the corrosion attack showed directly that the mode of corrosion was intergranular and that the Q phase precipitates were preserved after the passage of the corrosion front.

  8. Multicomponent He I 10830 {\\AA} profiles in an active filament

    CERN Document Server

    Sasso, C; Solanki, S K

    2011-01-01

    We present new spectropolarimetric observations of the chromospheric He I 10830 {\\AA} multiplet observed in a filament during its phase of activity. The data were recorded with the new Tenerife Infrared Polarimeter (TIP-II) at the German Vacuum Tower Telescope (VTT) on 2005 May 18. We inverted the He Stokes profiles using multiple atmospheric components. The observed He Stokes profiles display a remarkably wide variety of shapes. Most of the profiles show very broad Stokes I absorptions and complex and spatially variable Stokes V signatures. The inversion of the profiles shows evidence of different atmospheric blue- and redshifted components of the He I lines within the resolution element (1 arcsec), with supersonic velocities of up to 100 km/s. Up to five different atmospheric components are found in the same profile. We show that even these complex profiles can be reliably inverted.

  9. Precipitation in an AA6111 aluminium alloy and cosmetic corrosion

    International Nuclear Information System (INIS)

    The near-surface deformed layer on AA6111 automotive closure sheet alloy, generated by mechanical grinding during rectification, has an ultrafine grain microstructure, of 50-150 nm diameter, and a sharp transition with the underlying bulk alloy microstructure. Grinding and heat treatment to simulate rectification and paint baking processes result in the nucleation and growth of ∼20 nm diameter precipitates at grain boundaries within the near-surface deformed layer. High-resolution transmission electron microscopy has shown Q phase precipitates in the deformed layer, giving dramatically increased corrosion susceptibility compared with the bulk microstructure, and this is responsible for the rapid-onset filiform corrosion. Transmission electron microscopy of the corrosion attack showed directly that the mode of corrosion was intergranular and that the Q phase precipitates were preserved after the passage of the corrosion front

  10. AA, radiation shielding curtain along the target area

    CERN Multimedia

    1980-01-01

    At the far left is the beam tube for the high-intensity proton beam from the 26 GeV PS. The tube ends in a thin window and the proton beam continues in air through a hole in the shielding blocks (see also 8010308), behind which the target (see 7905091, 7905094)was located. After the target followed the magnetic horn, focusing the antiprotons, and the first part of the injection line with a proton dump. The antiprotons, deflected by a magnet, left the target area through another shielding wall, to make their way to the AA ring. Laterally, this sequence of components was shielded with movable, suspended, concrete blocks: the "curtain". Balasz Szeless, who had constructed it, is standing at its side.

  11. Newer trace elements measured by RNAA and AAS

    International Nuclear Information System (INIS)

    Very recently, quite attention has been made on a few more trace elements in foodstuff as essential for animal and human health in certain ranges of concentration or intake. These traces are: aluminum, nickel, vanadium and tin. Al and Ni have been measured by atomic absorption spectroscopy (AAS), and the two latter ones measured by radiochemical neutron activation analysis (RNAA) in few references laboratories. Here, scandium was also analysed by instrumental neutron activation analysis (INAA). These measurements were made for the most of the Iranian diets and other participant countries' diets under the framework of a co-ordinated research project (CRP) of the IAEA during the period 1986-1994, but practically it took more years. Here in this work the daily dietary intakes of above mentioned trace elements are given and discussed while the results of 20 other nutritionally important trace elements appeared somewhere else. (author)

  12. Ultrasonic inspection of AA6013 laser welded joints

    Directory of Open Access Journals (Sweden)

    Adriano Passini

    2011-09-01

    Full Text Available Interest in laser beam welding for aerospace applications is continuously growing, mainly for aluminum alloys. The joints quality is usually assessed by non-destructive inspection (NDI. In this work, bead on plate laser welds on 1.6 mm thick AA6013 alloy sheets, using a 2 kW Yb-fiber laser were obtained and inspected by pulse/echo ultrasonic phased-array technique. Good and poor quality welds were inspected in order to verify the limits of inspection, comparing also to X-ray radiography and metallographic inspections. The results showed that ultrasonic phased array technique was able to identify the presence of grouped porosity, through the attenuation of the amplitude of the echo signal. This attenuation is attributed to the scattering of the waves caused by micro pores, with individual size below the resolution limit of the equipment, but when grouped, can cause a perceptive effect on the reflection spectra.

  13. Renal AA amyloidosis in a patient with hereditary complete complement C4 deficiency

    Directory of Open Access Journals (Sweden)

    Imed Helal

    2011-01-01

    Full Text Available Hereditary complete C4 deficiency has until now been reported in 30 cases only. A disturbed clearance of immune- complexes probably predisposes these individuals to systemic lupus erythematosus, other immune- complex diseases and recurrent microbial infections. We present here a 20- year- old female with hereditary complete C4 deficiency. Renal biopsy demonstrated renal AA amyloidosis. This unique case further substantiates that deficiency of classical pathway components predisposes to the development of recurrent microbial infections and that the patients may develop AA amyloidosis. Furthermore, in clinical practice, the nephrotic syndrome occurring in a patient with hereditary complete complement C4 deficiency should lead to the suspicion of renal AA amyloidosis.

  14. Lu AA21004, a novel multimodal antidepressantwith activity exerted through serotonergic targets

    DEFF Research Database (Denmark)

    Mork, A.; Pehrson, A.; Montezinho, L. C. P.;

    2012-01-01

    increased extracellular levels of 5-HT, NA, DA, ACh and Hist in the brain. Lu AA21004 counteracted the immobility of FSL rats in the forced swim test and enhanced memory of the rats in the cognition models. Conclusions: Lu AA21004 in vivo engages relevant targets and affects several neurotransmitter systems...... (5-HT), noradrenaline (NA), dopamine (DA), acetylcholine (ACh), histamine (Hist)] were measured by microdialysis. Antidepressant potential was assessed in the forced swim test using Flinders Sensitive Line (FSL) rats. Moreover, effects of Lu AA21004 on acquisition, consolidation and recall...

  15. Design of the MsAa-4 Moessbauer Spectrometer

    International Nuclear Information System (INIS)

    An entirely new Moessbauer spectrometer MsAa-4 is currently being under design and construction. New features as compared to the basic features of the previous generation MsAa-3 spectrometer could be summarized as follows. Completely digital processing of the γ-ray detector signal beyond the Gaussian shape filter/amplifier is to be implemented. The spectrometer is going to be able to accommodate external multiple detector heads. Up to 128 γ-ray spectra in 16384 channels of 32-bit each and up to 512 Moessbauer spectra in 4096 channels of 32-bit each could be collected simultaneously, provided the proper external multiple detector head is used. The count-rate per single detector is limited to about 105 counts per second in total. Improved precision of the reference function from 12-bit to 16-bit is to be provided. The reference function is stored in 8192 channels per a complete cycle. Addition of the random noise to the reference corner prism of the Michelson-Morley calibration interferometer is to be introduced to avoid spurious fringes due to the phase lock-up. An integrated universal temperature controller being able to use a variety of the temperature sensors is to be interconnected properly with the spectrometer. The spectrometer is now a stand-alone network device as it is equipped with the Ethernet connection to the outside world. Fast and high precision digital oscilloscope is to be incorporated to the spectrometer as the intrinsic unit. This oscilloscope could monitor signals at various crucial points of the internal spectrometer electronics. Modular design and use of the strict standards allows easy reconfiguration for other applications than Moessbauer spectroscopy.

  16. An Update on the AAS Astronomy Ambassadors Program

    Science.gov (United States)

    Fienberg, Richard T.; Gurton, S.; Fraknoi, A.; Prather, E. E.; Hurst, A.; Schatz, D. L.

    2013-06-01

    The American Astronomical Society, partnering with organizations active in science education and public outreach (EPO), has launched a series of professional-development workshops and a community of practice designed to help improve early-career astronomers’ ability to effectively communicate with students and the public. Called Astronomy Ambassadors, the program provides mentoring and training experiences for young astronomers, from advanced undergraduates to beginning faculty; it also provides access to resources and a network of contacts within the astronomy EPO community. By learning how to implement effective education and outreach strategies, Astronomy Ambassadors become better teachers, better presenters at meetings, and better representatives of our science to the public and to government. And because young astronomers are a more diverse group than those who currently do the majority of outreach, they help the astronomical community present a more multicultural and gender-balanced face to the public, enabling members of underserved groups to see themselves as scientists. Ambassadors are provided with a large library of outreach activities and materials that are suitable for a range of venues and audiences and that will grow with time. For much of this library we are using resources developed by organizations such as the Astronomical Society of the Pacific, the Pacific Science Center, and the Center for Astronomy Education for other outreach programs, though some resources have been created by one of us (AF) specifically for this program. The first Astronomy Ambassadors workshop was held at the 221st meeting of the AAS in January 2013 and served 30 young astronomers chosen from more than 75 applicants. Incorporating feedback from workshop participants and lessons learned from the reports they’ve submitted after conducting their own outreach events, we are now planning the second annual workshop to be held 4-5 January 2014 at the 223rd AAS meeting in

  17. Nanocrystalline diamond growth on different substrates

    International Nuclear Information System (INIS)

    Nanocomposite films consisting of diamond nanoparticles of 3-5 nm diameter embedded in an amorphous carbon matrix have been deposited by means of microwave plasma chemical vapour deposition (MWCVD) from CH4/N2 gas mixtures. Si wafers, Si coated with TiN, polycrystalline diamond (PCD) and cubic boron nitride films, and Ti-6Al-4V alloy have been used as substrates. Some of the substrates have been pretreated ultrasonically with diamond powder in order to enhance the nucleation density n nuc. It turned out that n nuc depends critically on the chemical nature of the substrate, its smoothness and the pretreatment applied. No differences to the nucleation behaviour of CVD PCD films were observed. On the other hand, the growth process seems to be not affected by the substrate material. The crystallinity (studied by X-ray diffraction) and the bonding environment (investigated by Raman spectroscopy) show no significant differences for the various substrates. The mechanical and tribological properties, finally, reflect again the influence of the substrate material: on TiN, a lower hardness was measured as compared to Si, PCD and c-BN, whereas the adhesion of c-BN/nanocrystalline diamond (NCD) system was determined by that of the c-BN film on the underlying Si substrate

  18. Electron mobility calculation for graphene on substrates

    Energy Technology Data Exchange (ETDEWEB)

    Hirai, Hideki; Ogawa, Matsuto [Department of Electrical and Electronic Engineering, Graduate School of Engineering, Kobe University, 1-1, Rokko-dai, Nada-ku, Kobe 657-8501 (Japan); Tsuchiya, Hideaki, E-mail: tsuchiya@eedept.kobe-u.ac.jp [Department of Electrical and Electronic Engineering, Graduate School of Engineering, Kobe University, 1-1, Rokko-dai, Nada-ku, Kobe 657-8501 (Japan); Japan Science and Technology Agency, CREST, Chiyoda, Tokyo 102-0075 (Japan); Kamakura, Yoshinari; Mori, Nobuya [Japan Science and Technology Agency, CREST, Chiyoda, Tokyo 102-0075 (Japan); Division of Electrical, Electronic and Information Engineering, Graduate School of Engineering, Osaka University, Suita, Osaka 565-0871 (Japan)

    2014-08-28

    By a semiclassical Monte Carlo method, the electron mobility in graphene is calculated for three different substrates: SiO{sub 2}, HfO{sub 2}, and hexagonal boron nitride (h-BN). The calculations account for polar and non-polar surface optical phonon (OP) scatterings induced by the substrates and charged impurity (CI) scattering, in addition to intrinsic phonon scattering in pristine graphene. It is found that HfO{sub 2} is unsuitable as a substrate, because the surface OP scattering of the substrate significantly degrades the electron mobility. The mobility on the SiO{sub 2} and h-BN substrates decreases due to CI scattering. However, the mobility on the h-BN substrate exhibits a high electron mobility of 170 000 cm{sup 2}/(V·s) for electron densities less than 10{sup 12 }cm{sup −2}. Therefore, h-BN should be an appealing substrate for graphene devices, as confirmed experimentally.

  19. Modelling substrate specificity and enantioselectivity for lipases and esterases by substrate-imprinted docking

    Directory of Open Access Journals (Sweden)

    Tyagi Sadhna

    2009-06-01

    Full Text Available Abstract Background Previously, ways to adapt docking programs that were developed for modelling inhibitor-receptor interaction have been explored. Two main issues were discussed. First, when trying to model catalysis a reaction intermediate of the substrate is expected to provide more valid information than the ground state of the substrate. Second, the incorporation of protein flexibility is essential for reliable predictions. Results Here we present a predictive and robust method to model substrate specificity and enantioselectivity of lipases and esterases that uses reaction intermediates and incorporates protein flexibility. Substrate-imprinted docking starts with covalent docking of reaction intermediates, followed by geometry optimisation of the resulting enzyme-substrate complex. After a second round of docking the same substrate into the geometry-optimised structures, productive poses are identified by geometric filter criteria and ranked by their docking scores. Substrate-imprinted docking was applied in order to model (i enantioselectivity of Candida antarctica lipase B and a W104A mutant, (ii enantioselectivity and substrate specificity of Candida rugosa lipase and Burkholderia cepacia lipase, and (iii substrate specificity of an acetyl- and a butyrylcholine esterase toward the substrates acetyl- and butyrylcholine. Conclusion The experimentally observed differences in selectivity and specificity of the enzymes were reproduced with an accuracy of 81%. The method was robust toward small differences in initial structures (different crystallisation conditions or a co-crystallised ligand, although large displacements of catalytic residues often resulted in substrate poses that did not pass the geometric filter criteria.

  20. Metallic coatings on silicon substrates, and methods of forming metallic coatings on silicon substrates

    Science.gov (United States)

    Branagan, Daniel J.; Hyde, Timothy A.; Fincke, James R.

    2008-03-11

    The invention includes methods of forming a metallic coating on a substrate which contains silicon. A metallic glass layer is formed over a silicon surface of the substrate. The invention includes methods of protecting a silicon substrate. The substrate is provided within a deposition chamber along with a deposition target. Material from the deposition target is deposited over at least a portion of the silicon substrate to form a protective layer or structure which contains metallic glass. The metallic glass comprises iron and one or more of B, Si, P and C. The invention includes structures which have a substrate containing silicon and a metallic layer over the substrate. The metallic layer contains less than or equal to about 2 weight % carbon and has a hardness of at least 9.2 GPa. The metallic layer can have an amorphous microstructure or can be devitrified to have a nanocrystalline microstructure.

  1. Compliance of bio-adhesive substrates controls the kinetics of membrane-substrate association.

    Science.gov (United States)

    Sarvestani, Alireza S

    2010-10-21

    Mechanical stiffness of bio-adhesive substrates is one of the major regulators of the cell adhesion and migration. In this study, we propose a theoretical model for the spontaneous growth of focal adhesion (FA) sites, on compliant elastic substrates, at the early stages of cellular adhesion. Using a purely thermodynamic approach, we demonstrate that the rate of membrane-substrate association decreases with increasing the compliance of the substrate. This can be considered as a reason for smaller spread area of the FA points after the stabilization of adhesion on compliant substrates, as reported by experiments. We also show that the extent to which the compliance of the substrate modulates the growth rate of adhesion site depends on the areal density of cell-adhesive ligands on the substrate. PMID:20655930

  2. Determination of trace glucose and forecast of human diseases by affinity adsorption solid substrate room temperature phosphorimetry based on Triticum valgaris lectin labeled with 4.0-generation dendrimers

    Science.gov (United States)

    Li, Zhiming; Zhu, Guohui; Liu, Jiaming; Lu, Qiaomei; Yang, Minlan; Wu, Hong; Shi, Xiumei; Chen, Xinhua

    2007-08-01

    A new phosphorescence labeling reagent Triton-100X-4.0G-D (4.0G-D refers to 4.0-generation dendrimers) was found. Quantitative specific affinity adsorption (AA) reaction between Triton-100X-4.0G-D-WGA and glucose (G) was carried out on the surface of nitrocellulose membrane (NCM), and the Δ Ip of the product of AA reaction was linear correlation to the content of G. Based on the facts above, a new method for the determination of trace G was established by WGA labeled with Triton-100X-4.0G-D affinity adsorption solid substrate room temperature phosphorimetry (Triton-100X-4.0G-D-WGA-AA-SS-RTP). This research showed that AA-SS-RTP for either direct method or sandwich method could combine very well the characteristics of both the high sensitivity of SS-RTP and the specificity of the AA reaction. Detection limits (LD) were 0.24 fg spot -1 for direct method and 0.18 fg spot -1 for sandwich method, indicating both of them were of high sensitivity. The method has been applied to the determination of the content of G in human serum, and the results were coincided with those obtained by glucose oxidize enzyme method. It can also be applied to forecast accurately some human diseases, such as primary hepatic carcinoma, cirrhosis, acute and chronic hepatitis, transfer hepatocellular, etc. Meanwhile, the mechanism for the determination of G with AA-SS-RTP was discussed.

  3. Ultrabarrier Flexible Substrates for Flat Panel Displays

    Energy Technology Data Exchange (ETDEWEB)

    Burrows, Paul E.; Graff, Gordon L.; Gross, Mark E.; Martin, Peter M.; Shi, Ming-Kun; Hall, Michael G.; Mast, Eric S.; Bonham, Charles C.; Bennett, Wendy D.; Sullivan, Michael B.

    2001-05-01

    We describe a flexible, transparent plastic substrate for flat panel display applications. Using roll-coating techniques, we apply a composite thin film barrier to commercially available polymers, which restricts moisture and oxygen permeation to undetectable levels. The barrier film can be capped with a thin film of transparent conductive oxide in the same roll-coater, yielding an engineered substrate (Barix™) for next generation, rugged, lightweight or flexible displays. The substrate is sufficiently impermeable to moisture and oxygen for application to moisture-sensitive display applications, such as organic light emitting displays (OLEDs). This enables, for the first time, lightweight and flexible emissive organic displays.

  4. Study of Carbon Nanotube-Substrate Interaction

    Directory of Open Access Journals (Sweden)

    Jaqueline S. Soares

    2012-01-01

    Full Text Available Environmental effects are very important in nanoscience and nanotechnology. This work reviews the importance of the substrate in single-wall carbon nanotube properties. Contact with a substrate can modify the nanotube properties, and such interactions have been broadly studied as either a negative aspect or a solution for developing carbon nanotube-based nanotechnologies. This paper discusses both theoretical and experimental studies where the interaction between the carbon nanotubes and the substrate affects the structural, electronic, and vibrational properties of the tubes.

  5. Implantable biomedical devices on bioresorbable substrates

    Science.gov (United States)

    Rogers, John A; Kim, Dae-Hyeong; Omenetto, Fiorenzo; Kaplan, David L; Litt, Brian; Viventi, Jonathan; Huang, Yonggang; Amsden, Jason

    2014-03-04

    Provided herein are implantable biomedical devices, methods of administering implantable biomedical devices, methods of making implantable biomedical devices, and methods of using implantable biomedical devices to actuate a target tissue or sense a parameter associated with the target tissue in a biological environment. Each implantable biomedical device comprises a bioresorbable substrate, an electronic device having a plurality of inorganic semiconductor components supported by the bioresorbable substrate, and a barrier layer encapsulating at least a portion of the inorganic semiconductor components. Upon contact with a biological environment the bioresorbable substrate is at least partially resorbed, thereby establishing conformal contact between the implantable biomedical device and the target tissue in the biological environment.

  6. Characterization of AA7050 aluminium alloy processed by ECAP; Caracterizacao da liga de aluminio AA7050 processada por ECAP

    Energy Technology Data Exchange (ETDEWEB)

    Cardoso, K.R.; Guido, V. [Universidade do Vale do Paraiba (UNIVAP), Sao Jose dos Campos, SP (Brazil). Inst. de Pesquisa e Desenvolvimento; Travessa, D.N. [Empresa Brasileira de Aeronautica (EMBRAER), Sao Jose dos Campos, SP (Brazil); Jorge Junior, A.M. [Universidade Federal de Sao Carlos (DEMa/UFSCar), SP (Brazil). Dept. de Engenharia de Materiais

    2010-07-01

    The commercial AA7050 aluminium alloy in the solution heat treated condition (W) was processed by ECAP through route A. Two pressing temperatures (room and 150 deg C and velocities (5 and 30mm/min) were used, as well as different number of passes. The effect of such variables on the microstructure evolution was evaluated using optical and transmission electron microscopy with EDX microanalysis, and xray diffraction. It was found that the microstructure has been refined by ECAP, as a result of subgrains formed within deformation bands. ECAP at 150 deg C resulted in intense precipitation of plate like {eta} phase, which evolves to equiaxial morphology as the number of passes increases. (author)

  7. Effect of chelating agent acetylacetone on corrosion protection properties of silane-zirconium sol-gel coatings

    Science.gov (United States)

    Yu, Mei; Liang, Min; Liu, Jianhua; Li, Songmei; Xue, Bing; Zhao, Hao

    2016-02-01

    The hybrid sol-gel coatings on AA2024-T3 were prepared with a silane coupling agent 3-glycidoxypropyltrimethoxysilane (GPTMS) and a metal alkoxide tetra-n-propoxyzirconium (TPOZ) as precursors. The effect of acetylacetone (AcAc) as a chelating agent on the corrosion protection properties of sol-gel coatings were evaluated and the optimal AcAc/TPOZ molar ratio was obtained. The sol-gel coatings were characterized by atomic force microscopy (AFM), scanning electron microscopy (SEM) and energy dispersive spectroscopy (EDS). The corrosion protection properties of the coatings were evaluated by means of potentiodynamic polarization study (PDS) and electrochemical impedance spectroscopy (EIS). It is demonstrated that AcAc avoids fast hydrolysis of TPOZ and benefits to form stable sols. The coating with AcAc/TPOZ molar ratio of 3 shows the best corrosion protection performance in 0.05 M NaCl solution.

  8. Controlled Release from Core-Shell Nanoporous Silica Particles for Corrosion Inhibition of Aluminum Alloys

    Directory of Open Access Journals (Sweden)

    Xingmao Jiang

    2011-01-01

    Full Text Available Cerium (Ce corrosion inhibitors were encapsulated into hexagonally ordered nanoporous silica particles via single-step aerosol-assisted self-assembly. The core/shell structured particles are effective for corrosion inhibition of aluminum alloy AA2024-T3. Numerical simulation proved that the core-shell nanostructure delays the release process. The effective diffusion coefficient elucidated from release data for monodisperse particles in water was 1.0×10−14 m2s for Ce3+ compared to 2.5×10−13 m2s for NaCl. The pore size, pore surface chemistry, and the inhibitor solubility are crucial factors for the application. Microporous hydrophobic particles encapsulating a less soluble corrosion inhibitor are desirable for long-term corrosion inhibition.

  9. 铬酸盐化

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    [ 篇名] Chromate-free conversion coatings for aluminum, [篇名 ] Chrome-Free Conversion Coating for in Service Repair of Aircraft Components, [ 篇名 ] Chromium remediation or release: effect of iron (Ⅱ)sulfate addition on chromium (Ⅵ) leaching from columns of chromite ore processing residue, [篇名] Coating steel wires by polymers in hydrodynamic drawing, [篇名 ] Composition of chromate conversion coatings formed on multi-layered thin films of AA2024-T3 matrix and Al{sub}2Cu, Al{sub}CuMg and Al{sub}20Cu {sub }2(MnFe){ sub } 3, [篇名] Conversion coating science and technology: is it evolving or is it stuck? [篇名] Corrosion and biofouling control in refinery cooling water system using sewage water as a makeup.

  10. Modelling the Thermomechanical Conditions in Friction Stir Welding

    DEFF Research Database (Denmark)

    Schmidt, Henrik Nikolaj Blich

    Friction Stir Welding is a solid-state welding process invented by TWI in 1991. The FSW process is unique in the sense that joining of un-weldable alloys readily can be made. The thermomechanical conditions present in the workpiece during the welding process are of great interest since...... these control the properties of the weld. In the present work, a set of experimental, analytical and numerical analyses are carried out in order to evaluate the thermomechanical conditions descriptive for welding of aluminium, in this case AA2024-T3, under a specific set of welding parameters. Despite...... these specific data, the developed models can be applied for other alloys and welding parameters as well. A detailed experiment is carried out which constitutes the basis for the development and validation of the numerical and analytical models presented in this work. The contact condition at the tool...

  11. Quantification of recrystallization texture evolution in cold rolled AA 5182 aluminum alloy

    International Nuclear Information System (INIS)

    The evolution of recrystallization textures in cold rolled AA 5182 aluminum alloy was investigated by X-ray diffraction. The transformation kinetics of recrystallization textures during isothermal annealing was quantified by using an Avrami type equation

  12. Quantification of recrystallization texture evolution in cold rolled AA 5182 aluminum alloy

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.C.; Zhai, T.; Man, C.-S.; Morris, J.G

    2003-09-15

    The evolution of recrystallization textures in cold rolled AA 5182 aluminum alloy was investigated by X-ray diffraction. The transformation kinetics of recrystallization textures during isothermal annealing was quantified by using an Avrami type equation.

  13. Siim Kallas seab Lumani argumendid kahtluse alla / Kadri Paas ; kommenteerinud Norman Aas, Juhan Põldroos

    Index Scriptorium Estoniae

    Paas, Kadri, 1982-

    2009-01-01

    Seaduseelnõust, mille eesmärgiks on tõhustada võitlust kartellidega ja muude raskete konkurentsiõiguse rikkumistega nn leebusprogrammi abil. Kommenteerivad peaprokurör Norman Aas ja Juhan Põldroos

  14. Peaprokurör: kaevake kartellide peale! / Kadri Paas ; kommenteerinud Norman Aas ; Indrek, Kaju

    Index Scriptorium Estoniae

    Paas, Kadri, 1982-

    2009-01-01

    Seaduseelnõust, mille kohaselt salajasest kartellileppest esimesena võimudele teatanud ettevõte pääseb vastutasuks karistusest. Kommenteerivad peaprokurör Norman Aas ning Neste Eesti peadirektor Indrek Kaju

  15. Catalytic irreversible inhibition of bacterial and plant arginine decarboxylase activities by novel substrate and product analogues.

    Science.gov (United States)

    Bitonti, A J; Casara, P J; McCann, P P; Bey, P

    1987-02-15

    Arginine decarboxylase (ADC) activity from Escherichia coli and two plant species (oats and barley) was inhibited by five new substrate (arginine) and product (agmatine) analogues. The five compounds, (E)-alpha-monofluoromethyldehydroarginine (delta-MFMA), alpha-monofluoromethylarginine (MFMA), alpha-monofluoromethylagatine (FMA), alpha-ethynylagmatine (EA) and alpha-allenylagmatine (AA), were all more potent inhibitors of ADC activity than was alpha-difluoromethylarginine (DFMA), the only irreversible inhibitor of this enzyme described previously. The inhibition caused by the five compounds was apparently enzyme-activated and irreversible, since the loss of enzyme activity followed pseudo-first-order kinetics, was time-dependent, the natural substrate of ADC (arginine) blocked the effects of the inhibitors, and the inhibition remained after chromatography of inhibited ADC on Sephadex G-25 or on overnight dialysis of the enzyme. DFMA, FMA, delta-MFMA and MFMA were effective at very low concentrations (10 nM-10 microM) at inhibiting ADC activity in growing E. coli. FMA was also shown to deplete putrescine effectively in E. coli, particularly when combined with an inhibitor of ornithine decarboxylase, alpha-monofluoromethyl-putrescine. The potential uses of the compounds for the study of the role of polyamine biosynthesis in bacteria and plants is discussed.

  16. Substrate Curvature Gradient Drives Rapid Droplet Motion

    Science.gov (United States)

    Lv, Cunjing; Chen, Chao; Chuang, Yin-Chuan; Tseng, Fan-Gang; Yin, Yajun; Grey, Francois; Zheng, Quanshui

    2014-07-01

    Making small liquid droplets move spontaneously on solid surfaces is a key challenge in lab-on-chip and heat exchanger technologies. Here, we report that a substrate curvature gradient can accelerate micro- and nanodroplets to high speeds on both hydrophilic and hydrophobic substrates. Experiments for microscale water droplets on tapered surfaces show a maximum speed of 0.42 m/s, 2 orders of magnitude higher than with a wettability gradient. We show that the total free energy and driving force exerted on a droplet are determined by the substrate curvature and substrate curvature gradient, respectively. Using molecular dynamics simulations, we predict nanoscale droplets moving spontaneously at over 100 m/s on tapered surfaces.

  17. Wet etching methods for perovskite substrates

    NARCIS (Netherlands)

    Leca, Victor; Rijnders, Guus; Koster, Gertjan; Blank, Dave H.A.; Rogalla, Horst

    2000-01-01

    In oxide electronics substrates with atomically flat terraces are a request for growing high-quality epitaxial thin films. In this paper results on chemical etching of some substrates with perovskite, ABO3, structure (e.g., SrTiO3, LSAT - the (LaAlO3)0.3(Sr2AlTaO6)0.35 solid solution, and NdGaO3) ar

  18. Substrates and method for determining enzymes

    Science.gov (United States)

    Smith, Robert E.; Bissell, Eugene R.

    1981-01-01

    A method is disclosed for determining the presence of an enzyme in a biological fluid, which includes the steps of contacting the fluid with a synthetic chromogenic substrate, which is an amino acid derivative of 7-amino-4-trifluoromethylcoumarin; incubating the substrate-containing fluid to effect enzymatic hydrolysis; and fluorometrically determining the presence of the free 7-amino-4-trifluoromethylcoumarin chromophore in the hydrolyzate.

  19. Substrate Integrated Evanescent Filters Employing Coaxial Stubs

    OpenAIRE

    Zhurbenko, Vitaliy

    2015-01-01

    Evanescent mode substrate integrated waveguide (SIW) is one of the promising technologies for design of light-weight low-cost microwave components. Traditional realization methods used in the standard evanescent waveguide technology are often not directly applicable to SIW due to dielectric filling and small height of the waveguide. In this work, one of the realization methods of evanescent mode waveguides using a single layer substrate is considered. The method is based on the use of coaxial...

  20. Biochemicalmethane potential (BMP) of solid organic substrates

    DEFF Research Database (Denmark)

    Raposo, F.; Fernández-Cegrí, V.; de la Rubia, M.A.;

    2011-01-01

    BACKGROUND: This paper describes results obtained for different participating research groups in an interlaboratory study related to biochemical methane potential (BMP). In this research work, all experimental conditions influencing the test such as inoculum, substrate characteristics and experim......BACKGROUND: This paper describes results obtained for different participating research groups in an interlaboratory study related to biochemical methane potential (BMP). In this research work, all experimental conditions influencing the test such as inoculum, substrate characteristics...

  1. Fermentative hydrogen production from agroindustrial lignocellulosic substrates

    Science.gov (United States)

    Reginatto, Valeria; Antônio, Regina Vasconcellos

    2015-01-01

    To achieve economically competitive biological hydrogen production, it is crucial to consider inexpensive materials such as lignocellulosic substrate residues derived from agroindustrial activities. It is possible to use (1) lignocellulosic materials without any type of pretreatment, (2) lignocellulosic materials after a pretreatment step, and (3) lignocellulosic materials hydrolysates originating from a pretreatment step followed by enzymatic hydrolysis. According to the current literature data on fermentative H2 production presented in this review, thermophilic conditions produce H2 in yields approximately 75% higher than those obtained in mesophilic conditions using untreated lignocellulosic substrates. The average H2 production from pretreated material is 3.17 ± 1.79 mmol of H2/g of substrate, which is approximately 50% higher compared with the average yield achieved using untreated materials (2.17 ± 1.84 mmol of H2/g of substrate). Biological pretreatment affords the highest average yield 4.54 ± 1.78 mmol of H2/g of substrate compared with the acid and basic pretreatment - average yields of 2.94 ± 1.85 and 2.41 ± 1.52 mmol of H2/g of substrate, respectively. The average H2 yield from hydrolysates, obtained from a pretreatment step and enzymatic hydrolysis (3.78 ± 1.92 mmol of H2/g), was lower compared with the yield of substrates pretreated by biological methods only, demonstrating that it is important to avoid the formation of inhibitors generated by chemical pretreatments. Based on this review, exploring other microorganisms and optimizing the pretreatment and hydrolysis conditions can make the use of lignocellulosic substrates a sustainable way to produce H2. PMID:26273246

  2. Biaxially oriented film on flexible polymeric substrate

    Science.gov (United States)

    Finkikoglu, Alp T.; Matias, Vladimir

    2009-10-13

    A flexible polymer-based template having a biaxially oriented film grown on the surface of a polymeric substrate. The template having the biaxially oriented film can be used for further epitaxial growth of films of interest for applications such as photovoltaic cells, light emitting diodes, and the like. Methods of forming such a flexible template and providing the polymeric substrate with a biaxially oriented film deposited thereon are also described.

  3. Gaia16aas, Gaia16ade and Gaia16adz transients confirmed by Euler imaging

    Science.gov (United States)

    Blanco-Cuaresma, S.; Roelens, M.; Semaan, T.; Palaversa, L.; Mowlavi, N.; Eyer, L.

    2016-02-01

    We report confirmation of Gaia Science Alerts transients Gaia16aas, Gaia16ade and Gaia16adz. Images were obtained through modified Gunn R band filter of the ECAM instrument installed on the Swiss 1.2m Euler telescope at La Silla, on 2016 February 18 - 24 UT. These new sources are cataclysmic variable star candidates and they are not visible in archival 2MASS and DSS images: Gaia16aas, Gaia16ade and Gaia16adz.

  4. Development of Nanostructured AA3103 by Equal Channel Angular Pressing and Thermal Treatments

    OpenAIRE

    Luis, C. J.; Luri, R.; León, J.; Puertas, I.; Salcedo, D.; Pérez, I.

    2014-01-01

    This work presents a study related to the achievement of a nanometric structure in AA3103, employing severe plastic deformation processes (SPD), in this case equal channel angular pressing (ECAP). The changes in the mechanical properties and in the microstructure of AA3103 were studied after being processed by ECAP. Subsequently, scanning electron microscopy was used to determine the evolution of the microstructure after different thermal treatments on the material processed by this severe pl...

  5. Corrosion Behaviour of Friction Stir Welded AA5xxx Aluminium Alloys

    OpenAIRE

    Abuaisha, Ramadan R

    2013-01-01

    Friction stir welding (FSW) is a well recognised method for joining aluminium alloys and other engineering materials at a temperature below their melting point. However, the microstructure of the alloys may be modified during the welding process due to frictional heat and severe plastic deformation.In this study, the microstructures of friction stir welded AA5754-H111 and AA5083-O aluminium alloys have been investigated using optical microscopy, transmission and scanning electron microscopy e...

  6. Indexing Anatomical Phrases in Neuro-Radiology Reports to the UMLS 2005AA

    OpenAIRE

    Bashyam, Vijayaraghavan; Taira, Ricky K.

    2005-01-01

    This work describes a methodology to index anatomical phrases to the 2005AA release of the Unified Medical Language System (UMLS). A phrase chunking tool based on Natural Language Processing (NLP) was developed to identify semantically coherent phrases within medical reports. Using this phrase chunker, a set of 2,551 unique anatomical phrases was extracted from brain radiology reports. These phrases were mapped to the 2005AA release of the UMLS using a vector space model. Pr...

  7. Overall view of the AA hall dominated by the 50 ton crane (Donges).

    CERN Multimedia

    1980-01-01

    A 50 ton, 32 metre span overhead travelling cranre was mounted in one of the bays of Hall 193 (AA). An identical crane was mounted on the other bay. See also photo 8004261. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  8. Optimization of friction stir welding parameters for improved corrosion resistance of AA2219 aluminum alloy joints

    OpenAIRE

    G. Rambabu; D. Balaji Naik; C.H. Venkata Rao; K. Srinivasa Rao; G. Madhusudan Reddy

    2015-01-01

    The aluminium alloy AA2219 (Al–Cu–Mg alloy) is widely used in the fabrication of lightweight structures with high strength-to-weight ratio and good corrosion resistance. Welding is main fabrication method of AA2219 alloy for manufacturing various engineering components. Friction stir welding (FSW) is a recently developed solid state welding process to overcome the problems encountered in fusion welding. This process uses a non-consumable tool to generate frictional heat on the abutting surfac...

  9. Nanomodeling of Nonlinear Thermoelastic Behavior of AA5454/ Silicon Nitride Nanoparticulate Metal Matrix Composites

    Directory of Open Access Journals (Sweden)

    Chennakesava R Alavala

    2016-01-01

    Full Text Available The aim of the present work was to estimate non-linear thermoelastic behavior of three-phase AA5454/silicon nitride nanoparticle metal matrix composites. The thermal loading was varied from subzero temperature to under recrystallization temperature. The RVE models were used to analyze thermo-elastic behavior. The AA5454/silicon nitride nanoparticle metal matrix composites have gained the elastic modulus below 0oC and lost at high temperatures.

  10. Direct Printing of Graphene onto Plastic Substrates.

    Science.gov (United States)

    Hines, Daniel; Lock, Evgeniya; Walton, Scott; Baraket, Mira; Laskoski, Matthew; Mulvaney, Shawn; Sheehan, Paul; Lee, Woo; Robinson, Jeremy

    2011-03-01

    Graphene films have been synthesized on metal foils using CVD growth and have the potential to be compatible with roll-to-roll printing. To be usable in electronic devices, these films need to be removed from the metallic substrate. Currently this is accomplished by spin coating a polymer film over the graphene and chemically etching away the metal substrate. We have developed a direct printing method that allows graphene films to be printed off the metal substrate onto a polymer substrate. This printing process does not generate chemical waste, is compatible with roll-to-toll processing and renders the metal foil reusable. Adhesion of the graphene film to the polymer substrate is established by attaching perfluorophenylazides (PFPA) azide linker molecules to a plasma activated polymer surface. The transfer printing was performed by placing the PFPA treated polymer surface in contact with a graphene covered Cu foil and heating under pressure. Graphene films successfully printed onto a polystyrene substrate have been characterized by Raman spectroscopy and electrical measurements revealed the presence of Gr on the polymer surface. Details of the printing process along with characteristics of the graphene film after printing will be presented.

  11. Alternative substrates for higher mushrooms mycelia cultivation

    Directory of Open Access Journals (Sweden)

    TETIANA KRUPODOROVA

    2015-12-01

    Full Text Available Cultivation of 29 species of higher mushroom mycelia on alternative substrates – wastes of Ukrainian oil-fat industry, has been investigated. The amount of mushroom mycelia obtaining on 12 investigated substrates varied significantly, from 1.0 g/L to 22.9 g/L on the 14th day of cultivation. The superficial cultivation adopted in this study allows for easy to choose appropriate medium (substrate for mycelia production. Alternative substrates (compared to glucose-peptone-yeast medium were selected for all studied species, from soybean cake – most suitable for the mycelial growth of 24 species, to walnut cake − suitable only for 2 species. The utilization of substrates has been evaluated by biological efficiency. The best index of biological efficiency varied from 19.0% to 41.6% depending on the mushroom species. It was established high biological efficiency of mycelia cultivation on substrates: wheat seed cake – Pleurotus djamor, Lyophyllum shimeji, Crinipellis schevczenkovi, Phellinus igniarius, Spongipellis litschaueri; oat seed cake – Ganoderma applanatum and G. lucidum; soybean cake – Hohenbuehelia myxotricha, Trametes versicolor, Morchella esculenta, Cordyceps sinensis, C. militaris, and Agrocybe aegerita; rape seed cake – Auriporia aurea; camelina seed cake – Fomes fomentarius. The cultivation of these species are perspective as a biotechnological process of agricultural wastes converted into mycelia, which could be used in different forms of products with therapeutic action: powder or tablets nutraceuticals or ingredients for functional foods.

  12. Palladium clusters deposited on the heterogeneous substrates

    Science.gov (United States)

    Wang, Kun; Liu, Juanfang; Chen, Qinghua

    2016-07-01

    To improve the performance of the Pd composite membrane prepared by the cold spraying technology, it is extremely essential to give insights into the deposition process of the cluster and the heterogeneous deposition of the big Pd cluster at the different incident velocities on the atomic level. The deposition behavior, morphologies, energetic and interfacial configuration were examined by the molecular dynamic simulation and characterized by the cluster flattening ratio, the substrate maximum local temperature, the atom-embedded layer number and the surface-alloy formation. According to the morphology evolution, three deposition stages and the corresponding structural and energy evolution were clearly identified. The cluster deformation and penetrating depth increased with the enhancement of the incident velocity, but the increase degree also depended on the substrate hardness. The interfacial interaction between the cluster and the substrate can be improved by the higher substrate local temperature. Furthermore, it is found that the surface alloys were formed by exchanging sites between the cluster and substrate atoms, and the cluster atoms rearranged following as the substrate lattice arrangement from bottom to up in the deposition course. The ability and scope of the structural reconstruction are largely determined by both the size and incident energy of the impacted cluster.

  13. Nanomechanics of hard films on compliant substrates.

    Energy Technology Data Exchange (ETDEWEB)

    Reedy, Earl David, Jr. (Sandia National Laboratories, Albuquerque, NM); Emerson, John Allen (Sandia National Laboratories, Albuquerque, NM); Bahr, David F. (Washington State University, Pullman, WA); Moody, Neville Reid; Zhou, Xiao Wang; Hales, Lucas (University of Minnesota, Minneapolis, MN); Adams, David Price (Sandia National Laboratories, Albuquerque, NM); Yeager,John (Washington State University, Pullman, WA); Nyugen, Thao D. (Johns Hopkins University, Baltimore, MD); Corona, Edmundo (Sandia National Laboratories, Albuquerque, NM); Kennedy, Marian S. (Clemson University, Clemson, SC); Cordill, Megan J. (Erich Schmid Institute, Leoben, Austria)

    2009-09-01

    Development of flexible thin film systems for biomedical, homeland security and environmental sensing applications has increased dramatically in recent years [1,2,3,4]. These systems typically combine traditional semiconductor technology with new flexible substrates, allowing for both the high electron mobility of semiconductors and the flexibility of polymers. The devices have the ability to be easily integrated into components and show promise for advanced design concepts, ranging from innovative microelectronics to MEMS and NEMS devices. These devices often contain layers of thin polymer, ceramic and metallic films where differing properties can lead to large residual stresses [5]. As long as the films remain substrate-bonded, they may deform far beyond their freestanding counterpart. Once debonded, substrate constraint disappears leading to film failure where compressive stresses can lead to wrinkling, delamination, and buckling [6,7,8] while tensile stresses can lead to film fracture and decohesion [9,10,11]. In all cases, performance depends on film adhesion. Experimentally it is difficult to measure adhesion. It is often studied using tape [12], pull off [13,14,15], and peel tests [16,17]. More recent techniques for measuring adhesion include scratch testing [18,19,20,21], four point bending [22,23,24], indentation [25,26,27], spontaneous blisters [28,29] and stressed overlayers [7,26,30,31,32,33]. Nevertheless, sample design and test techniques must be tailored for each system. There is a large body of elastic thin film fracture and elastic contact mechanics solutions for elastic films on rigid substrates in the published literature [5,7,34,35,36]. More recent work has extended these solutions to films on compliant substrates and show that increasing compliance markedly changes fracture energies compared with rigid elastic solution results [37,38]. However, the introduction of inelastic substrate response significantly complicates the problem [10,39,40]. As

  14. Optimization of process parameters for friction Stir welding of dissimilar Aluminum alloys (AA2024 -T6 and AA6351-T6 by using Taguchi method

    Directory of Open Access Journals (Sweden)

    N. Ramanaiah

    2013-01-01

    Full Text Available The present study focused on the Taguchi experimental design technique of Friction Stir Welds of dissimilar aluminum alloys (AA2024-T6 and AA6351-T6 for tensile properties. Effect of process parameters, rotational speed, Traverse speed and axial force, on tensile strength was evaluated. Optimized welding conditions for maximize tensile strength were estimated in order to improve the productivity, weld quality. Non-linear regression mathematical model was developed to correlate the process parameters to tensile strength. The results were verified by conducting the confirmation tests at identified optimum conditions.

  15. AA/12-lipoxygenase signaling contributes to inhibitory learning in Hermissenda Type B photoreceptors

    Directory of Open Access Journals (Sweden)

    Tony L Walker

    2010-08-01

    Full Text Available Conditioned inhibition (CI is a major category of associative learning that occurs when an organism learns that one stimulus predicts the absence of another. In addition to being important in its own right, CI is interesting because its occurrence implies that the organism has formed an association between stimuli that are non-coincident. In contrast to other categories of associative learning that are dependent upon temporal contiguity (pairings of stimuli, the neurobiology of CI is virtually unexplored. We have previously described a simple form of CI learning in Hermissenda, whereby animals’ phototactic behavior is increased by repeated exposures to explicitly unpaired (EU presentations of light and rotation. EU conditioning also produces characteristic reductions in the excitability and light response, and increases several somatic K+ currents in Type B photoreceptors. Type B photoreceptors are a major site of plasticity for classical conditioning in Hermissenda. Because arachidonic acid (AA and/or its metabolites open diverse K+ channels in many cell types, we examined the potential contribution of AA to CI. Our results indicate that AA contributes to one of the major effects of EU-conditioning on Type B photoreceptors: decreases in light-evoked spike activity. We find that AA increases the transient (IA somatic K+ current in Type B photoreceptors, further mimicking CI training. In addition, our results indicate that metabolism of AA by a 12-lipoxygenase enzyme is critical for these effects of AA, and further that 12-lipoxygenase metabolites are apparently generated during CI training.

  16. Inert gas a-A differences: a direct reflection of V/Q distribution.

    Science.gov (United States)

    Neufeld, G R; Williams, J J; Klineberg, P L; Marshall, B E

    1978-02-01

    A computer model was developed to study the relationship between ventilation-to-perfusion (V/Q) mismatch and the development of inert gas arterial-to-alveolar partial pressure differences (a-A differences). Increasing inhomogeneity of V/Q ratio is revealed directly as an increase in the a-A difference of each gas. The quantitative relationships between the Q vs. V/Q distribution and the fractional a-A difference solubility plot (a-A difference plot) were studied and described. These studies demonstrated that for log normally distributed V/Q ratios, the area under the a-A difference plot is linearly related to the log variance of the V/Q distribution and can be estimated directly from the values obtained from six gases. The maximum a-A difference occurs for a gas whose solubility is numerically equal to the mean V/Q. The effects of departure from log normality and multimodality are discussed. We conclude from these studies that quantitative information regarding the degree of inhomogeneity of V/Q for log normal distribution is available from direct calculations of inert gas retention and excretion data. Qualitative information is also available indicating the departure from log normality and the region toward which the distribution is skewed. PMID:204618

  17. Doping with anabolic androgenic steroids (AAS): Adverse effects on non-reproductive organs and functions.

    Science.gov (United States)

    Nieschlag, Eberhard; Vorona, Elena

    2015-09-01

    Since the 1970s anabolic androgenic steroids (AAS) have been abused at ever increasing rates in competitive athletics, in recreational sports and in bodybuilding. Exceedingly high doses are often consumed over long periods, in particular by bodybuilders, causing acute or chronic adverse side effects frequently complicated by additional polypharmacy. This review summarizes side effects on non-reproductive organs and functions; effects on male and female reproduction have been recently reviewed in a parallel paper. Among the most striking AAS side effects are increases in haematocrit and coagulation causing thromboembolism, intracardiac thrombosis and stroke as well as other cardiac disturbances including arrhythmias, cardiomyopathies and possibly sudden death. 17α-alkylated AAS are liver toxic leading to cholestasis, peliosis, adenomas and carcinomas. Hyperbilirubinaemia can cause cholemic nephrosis and kidney failure. AAS abuse may induce exaggerated self-confidence, reckless behavior, aggressiveness and psychotic symptoms. AAS withdrawal may be accompanied by depression and suicidal intentions. Since AAS abuse is not or only reluctantly admitted physicians should be aware of the multitude of serious side effects when confronted with unclear symptoms. PMID:26373946

  18. [Exposure degree of important non-target arthropods to Cry2Aa in Bt rice fields].

    Science.gov (United States)

    Zhang, Qing-Ling; Li, Yun-He; Hua, Hong-Xia; Yang, Chang-Ju; Wu, Hong-Jin; Peng, Yu-Fa

    2013-06-01

    Based on the principle of "risk = hazard x exposure", the selected representative nontarget organisms in the assessment of the potential effects of insect-resistant genetically modified (GM) crops on non-target arthropods in laboratory are generally the arthropod species highly exposed to the insecticidal proteins expressed by the GM crops in farmland ecosystem. In order to understand the exposure degree of the important arthropod species to Cry proteins in Bt rice fields, and to select the appropriate non-target arthropods in the risk assessment of insect-resistant GM crops, the enzyme-linked immunosorbent assay (ELISA) was conducted to measure the Cry2Aa protein concentration in the arthropods collected from the cry2Aa rice fields at different rice growth stages. The results showed that there was a significant difference in the Cry2Aa content protein concentration in different arthropod species. Some species did not contain Cry2Aa protein, while some species contained larger amounts of Cry2Aa protein. Relative to the arthropods colleted after rice anthesis, the arthropods colleted in rice anthesis contained relative higher concentrations of Cry2Aa protein, especially for the predacious arthropods. No Cry proteins were detected in parasitic arthropods. This study provided references for the laboratory assessment of the effects of GM rice on nontarget arthropods.

  19. Doping with anabolic androgenic steroids (AAS): Adverse effects on non-reproductive organs and functions.

    Science.gov (United States)

    Nieschlag, Eberhard; Vorona, Elena

    2015-09-01

    Since the 1970s anabolic androgenic steroids (AAS) have been abused at ever increasing rates in competitive athletics, in recreational sports and in bodybuilding. Exceedingly high doses are often consumed over long periods, in particular by bodybuilders, causing acute or chronic adverse side effects frequently complicated by additional polypharmacy. This review summarizes side effects on non-reproductive organs and functions; effects on male and female reproduction have been recently reviewed in a parallel paper. Among the most striking AAS side effects are increases in haematocrit and coagulation causing thromboembolism, intracardiac thrombosis and stroke as well as other cardiac disturbances including arrhythmias, cardiomyopathies and possibly sudden death. 17α-alkylated AAS are liver toxic leading to cholestasis, peliosis, adenomas and carcinomas. Hyperbilirubinaemia can cause cholemic nephrosis and kidney failure. AAS abuse may induce exaggerated self-confidence, reckless behavior, aggressiveness and psychotic symptoms. AAS withdrawal may be accompanied by depression and suicidal intentions. Since AAS abuse is not or only reluctantly admitted physicians should be aware of the multitude of serious side effects when confronted with unclear symptoms.

  20. Determination of Glucose by Affinity Adsorption Solid Substrate-room Temperature Phosphorimetry Based on Triticum Vulgare Lectin Labeled with Silicon Dioxide Nanoparticle Containing Fiuorescein Isothiocyanate

    Institute of Scientific and Technical Information of China (English)

    LIU Jia-Ming; LIU Zhen-Bo; LI Zhi-Ming; HE Hang-Xia; LIN Wei-Nü; HUANG Ya-Hong; WANG Fang-Mei

    2008-01-01

    In the presence of heavy atom perturber Pb2+,silicon dioxide nanoparticle containing fluorescein isothiocyanate (FITC-SiO2) could emit a strong and stable room temperature phosphorescence (RTP) signal on the surface of acetyl cellulose membrane (ACM).It was found in the research that a quantitative specific affinity adsorption (AA) reaction between triticum vulgare lectin (WGA) labeled with luminescent nanoparticle and glucose (g)could be carried on the surface of ACM.The product (WGA-G-WGA-FITC-SiO2) of the reaction could emit a stronger RTP signal,and the △Ip had linear correlation to the content of G.According to the facts above,a new method to determine G by affinity adsorption solid substrate room temperature phosphorimetry (AA-SS-RTP) was established,based on WGA labeled with FITC-SiO2.The detection limit (LD) of this method calculated by 3Sb/k was 0.47 pg·spot-1 (corresponding to a concentration value 1.2 × 10-9 g·mL-1,namely 5.3 × 10-9 mol·L-1),the sensitivity was high.Meanwhile,the mechanism for the determination of G by AA-SS-RTP was discussed.

  1. Microstructure controlled bending response in AA6016 Al alloys

    International Nuclear Information System (INIS)

    Highlights: → The hemmability of two AA6016-type aluminium alloys in T4P temper state is studied. → High Mg content and long solutionizing times increase the precipitation potential. → Inhomogeneous grain boundary particles form by precipitation of alloying elements. → Large amount of particles combined with high matrix strength reduce the hemmability. → Intergranular fracture is promoted by grain boundary debonding and voids formation. - Abstract: A contemporary approach in the car weight reduction is the use of low weight and high strength Al alloys sheets for hang-on body panels production. The final step in the forming route of such panels is the attachment of the outer skin to the inner part of the panel by applying a hemming operation. This joining method is cheap, easy to perform and environment-friendly, but requires severe 180 deg. bending of the edges of the outer skin which quite often results in cracking or complete tearing of the bend surface. Such kind of failure restricts the further application of the hemmed products. The microstructures after solution heat treatment and pre-aging (T4P temper state) of two grades age-hardening AA6016-type aluminium alloy sheets were studied in this work by means of optical microscopy, scanning electron microscopy and electron backscatter diffraction. The obtained results were related to the hemming response of the grades. It was found that the alloy composition is one of the main parameters controlling the bendability of these grades through the amount of the formed strengthening phases. However, the applied thermal treatment remains the key factor responsible for the favorable distribution of these phases into the microstructure. The grain size and the volume fraction of the constituent particles were found to play secondary role in forming the material bending properties and can be only used for their fine tuning. The presence of Mg2Si (β-phase) and/or Al1.9CuMg4.1Si3.3 (Q-phase) particles in the grain

  2. Structural basis for substrate specificities of cellular deoxyribonucleoside kinases

    DEFF Research Database (Denmark)

    Johansson, K.; Ramaswamy, S.; Ljungcrantz, C.;

    2001-01-01

    kinase with ATP at the nucleoside substrate binding site. Compared to the human kinase, the Drosophila kinase has a wider substrate cleft, which may be responsible for the broad substrate specificity of this enzyme. The human deoxyguanosine kinase is highly specific for purine substrates......; this is apparently due to the presence of Arg 118, which provides favorable hydrogen bonding interactions with the substrate. The two new structures provide an explanation for the substrate specificity of cellular deoxyribonucleoside kinases....

  3. Molecular Characteristic, Protein Distribution and Potential Regulation of HSP90AA1 in the Anadromous Fish Coilia nasus

    OpenAIRE

    Di-An Fang; Jin-Rong Duan; Yan-Feng Zhou; Min-Ying Zhang; Dong-Po Xu; Kai Liu; Pao Xu

    2016-01-01

    Heat shock proteins play essential roles in basic cellular events. Spawning migration is a complex process, with significant structural and biochemical changes taking place in the adult gonad. To date, the molecular mechanisms underlying migration reproductive biology remain undetermined. In this regard, a full length HSP90AA1 comprising 2608 nucleotides from the anadromous fish Coilia nasus was characterized, encoding 742 amino acid (aa) residues with potential phosphorylation sites. HSP90AA...

  4. Determination of elements in ayurvedic medicinal plants by AAS

    Energy Technology Data Exchange (ETDEWEB)

    Teerthe, Santoshkumar S.; Kerur, B. R., E-mail: kerurbrk@yahoo.com [Department of Physics, Gulbarga University, Gulbarga, and Karnataka, India – 585106 (India)

    2015-08-28

    India has a rich country for the uses of Ayurvedic medicinal plants for treatment and also the north- Karnataka boasts an unparallel diversity of medicinal plants. The present study attempts to estimate and compare the level of trace and heavy metals in some selected leaves and root samples of Ayurvedic medicinal plants such as Mg, Al, K, Cr, Mn, Fe, Cu, Zn, and Cd. The samples are collected from different places of North-Karnataka regions and sample solutions prepared as the ratio of 1:25:25+950ml=1000ppm.the trace and heavy elemental concentration was estimated using Atomic Absorption Spectrometric (AAS) Method. The average concentrations of Mg, Mn, Fe and Zn, are ranging from 2ppm to 5250.2ppm and potassium (K) has more concentration as compare to all other. The other elements likes Al, Cr, Cu, and Cd were also estimed and presented in the table. Therefore, these medicinal plants are rich in some essential minerals, especially K, Mg, Mn, Fe and Zn which are essential for human health.

  5. Determination of elements in ayurvedic medicinal plants by AAS

    Science.gov (United States)

    Teerthe, Santoshkumar S.; Kerur, B. R.

    2015-08-01

    India has a rich country for the uses of Ayurvedic medicinal plants for treatment and also the north- Karnataka boasts an unparallel diversity of medicinal plants. The present study attempts to estimate and compare the level of trace and heavy metals in some selected leaves and root samples of Ayurvedic medicinal plants such as Mg, Al, K, Cr, Mn, Fe, Cu, Zn, and Cd. The samples are collected from different places of North-Karnataka regions and sample solutions prepared as the ratio of 1:25:25+950ml=1000ppm.the trace and heavy elemental concentration was estimated using Atomic Absorption Spectrometric (AAS) Method. The average concentrations of Mg, Mn, Fe and Zn, are ranging from 2ppm to 5250.2ppm and potassium (K) has more concentration as compare to all other. The other elements likes Al, Cr, Cu, and Cd were also estimed and presented in the table. Therefore, these medicinal plants are rich in some essential minerals, especially K, Mg, Mn, Fe and Zn which are essential for human health

  6. Investigation of PLC band nucleation in AA5754

    International Nuclear Information System (INIS)

    Highlights: ► Simultaneous propagation of bands in transverse and longitudinal directions. ► PLC band nucleation at the back front of Lüders bands. ► Characteristic time of critical strain decreases with strain rate. ► Simultaneous existence of two type-B bands at specimen shoulder. - Abstract: The purpose of the present work is the experimental investigation of the nucleation of PLC deformation bands in the aluminium alloy AA5754. The PLC bands are investigated using both mechanical methods and infrared (IR) thermography. The latter employs a high-speed IR camera which captures local changes of radiated power resulting from mechanical dissipation and heating due to the nucleation of PLC bands. The resulting IR images are used to determine spatio-temporal power field variations via image subtraction. Furthermore, band trajectories obtained from the IR images are used to study possible correlations between the spatio-temporal evolution of stress and radiated power in the specimens and PLC band development.

  7. Fully Digital: Policy and Process Implications for the AAS

    CERN Document Server

    Biemesderfer, Chris

    2012-01-01

    Over the past two decades, every scholarly publisher has migrated at least the mechanical aspects of their journal publishing so that they utilize digital means. The academy was comfortable with that for a while, but publishers are under increasing pressure to adapt further. At the American Astronomical Society (AAS), we think that means bringing our publishing program to the point of being fully digital, by establishing procedures and policies that regard the digital objects of publication primarily. We have always thought about our electronic journals as databases of digital articles, from which we can publish and syndicate articles one at a time, and we must now put flesh on those bones by developing practices that are consistent with the realities of article at a time publication online. As a learned society that holds the long-term rights to the literature, we have actively taken responsibility for the preservation of the digital assets that constitute our journals, and in so doing we have not forsaken t...

  8. Cylindrical diffractive lenses recorded on PVA/AA photopolymers

    Science.gov (United States)

    Fernández, R.; Gallego, S.; Márquez, A.; Navarro-Fuster, V.; Francés, J.; Neipp, C.; Beléndez, A.; Pascual, I.

    2016-04-01

    Photopolymers are optical recording materials appealing for many different applications such as holography, data storage, interconnectors, solar concentrations, or wave-guides fabrication. Recently the capacity of photopolymers to record diffractive optical elements (DOE's) has been investigated. Different authors have reported proposes to record DOE like fork gratings, photonics structures, lenses, sinusoidal, blazed or fork gratings. In these experiments there are different experimental set-ups and different photopolymers. In this work due to the improvement in the spatial light modulation technology together with the photopolymer science we propose a recording experimental system of DOE using a Liquid Cristal based on Silicon (LCoS) display as a master to store complex DOE like cylindrical lenses. This technology permits us an accurate control of the phase and the amplitude of the recording beam, with a very small pixel size. The main advantage of this display is that permit us to modify the DOE automatically, we use the software of the LCoS to send the voltage to each pixel In this work we use a photopolymer composed by acrylamide (AA) as polymerizable monomer and polyvinyl alcohol (PVA). We use a coverplated and index matched photopolymer to avoid the influence of the thickness variation on the transmitted light. In order to reproduce the material behaviour during polymerization, we have designed our model to simulate cylindrical lenses and used Fresnel propagation to simulate the light propagation through the DOE and analyze the focal plane and the properties of the recorded lenses.

  9. Process model to predict yield strength of AA6063 alloy

    Energy Technology Data Exchange (ETDEWEB)

    Nandy, Supriya [Department of Metallurgy and Materials Engineering, Bengal Engineering and Science University, Shibpur, Howrah 711103 (India); Department of Metallurgical and Materials Engineering, Indian Institute of Technology, Kharagpur 721302 (India); Kumar Ray, Kalyan [Department of Metallurgical and Materials Engineering, Indian Institute of Technology, Kharagpur 721302 (India); Das, Debdulal, E-mail: debdulal_das@metal.iiests.ac.in [Department of Metallurgy and Materials Engineering, Bengal Engineering and Science University, Shibpur, Howrah 711103 (India)

    2015-09-17

    In the present study, an attempt has been made to examine the appropriateness of the models for predicting yield strength of age hardenable 6063 Al–Mg–Si alloy. Two physical models have been considered: one is classical dislocation-particle interaction model which incorporates both cutting and by-pass mechanisms around spherical shaped precipitates; and the other is based on only dislocation by-pass of the rod shaped precipitates as per modified Orowan equation. The prediction of yield strength using these models has been compared with experimentally generated yield strength data of the selected Al-alloy subjected to different combinations of time and temperature of ageing. The microstructural variations due to ageing have been simulated using the well established thermodynamic and kinetic relationships. Comparison of the experimental and the simulated results assists to conclude that modified Orowan mechanism predicts yield strength better than that by the classical model up to the peak aged conditions. The generated results have been successfully used to develop thermal processing maps that can be considered as a convenient tool for selection of age hardening parameters to achieve any desired level of yield strength for AA6063 alloy.

  10. Graphene substrate for inducing neurite outgrowth.

    Science.gov (United States)

    Lee, Jeong Soon; Lipatov, Alexey; Ha, Ligyeom; Shekhirev, Mikhail; Andalib, Mohammad Nahid; Sinitskii, Alexander; Lim, Jung Yul

    2015-05-01

    A few recent studies demonstrated that graphene may have cytocompatibility with several cell types. However, when assessing cell behavior on graphene, there has been no precise control over the quality of graphene, number of graphene layers, and substrate surface coverage by graphene. In this study, using well-controlled monolayer graphene film substrates we tested the cytocompatibility of graphene for human neuroblastoma (SH-SY5Y) cell culture. A large-scale monolayer graphene film grown on Cu foils by chemical vapor deposition (CVD) could be successfully transferred onto glass substrates by wet transfer technique. We observed that graphene substrate could induce enhanced neurite outgrowth, both in neurite length and number, compared with control glass substrate. Interestingly, the positive stimulatory effect by graphene was achieved even in the absence of soluble neurogenic factor, retinoic acid (RA). Key genes relevant to cell neurogenesis, e.g., neurofilament light chain (NFL), were also upregulated on graphene. Inhibitor studies suggested that the graphene stimulation of cellular neurogenesis may be achieved through focal adhesion kinase (FAK) and p38 mitogen-activated protein kinase (MAPK) cascades. Our data indicate that graphene may be exploited as a platform for neural regenerative medicine, and the suggested molecular mechanism may provide an insight into the graphene control of neural cells. PMID:25778866

  11. Multistructural biomimetic substrates for controlled cellular differentiation

    International Nuclear Information System (INIS)

    Multidimensional scaffolds are considered to be ideal candidates for regenerative medicine and tissue engineering based on their potential to provide an excellent microenvironment and direct the fate of the cultured cells. More recently, the use of stem cells in medicine has opened a new technological opportunity for controlled tissue formation. However, the mechanism through which the substrate directs the differentiation of stem cells is still rather unclear. Data concerning its specific surface chemistry, topology, and its signaling ability need to be further understood and analyzed. In our study, atomic force microscopy was used to study the stiffness, roughness, and topology of the collagen (Coll) and metallized collagen (MC) substrates, proposed as an excellent substrate for regenerative medicine. The importance of signaling molecules was studied by constructing a new hybrid signaling substrate that contains both collagen and laminin extracellular matrix (ECM) proteins. The cellular response—such as attachment capability, proliferation and cardiac and neuronal phenotype expression on the metallized and non-metallized hybrid substrates (collagen + laminin)—was studied using MTT viability assay and immunohistochemistry studies. Our findings indicate that such hybrid materials could play an important role in the regeneration of complex tissues. (paper)

  12. Nanobubble formation on a warmer substrate.

    Science.gov (United States)

    Xu, Chenglong; Peng, Shuhua; Qiao, Greg G; Gutowski, Voytek; Lohse, Detlef; Zhang, Xuehua

    2014-10-21

    The solvent exchange procedure is an often-used protocol to produce surface nanobubbles. In this procedure, the substrate is exposed to a good solvent for gas which is then mixed and rinsed with a poor solvent for gas and the nanobubbles form on the solid-liquid interface. Here we study the effects of temperatures of the substrate and the first solvent on nanobubble formation. Atomic force microscopy with temperature control was used to examine the formation of nanobubbles at temperatures between 37 °C and 54 °C. It was found that the probability of nanobubble formation was larger on substrates at higher temperatures. Moreover, on warmer substrates we found nanobubbles with lateral extensions up to 8 μm. A morphologic analysis shows that all nanobubbles, including giant nanobubbles, have a similar aspect ratio, independent of the substrate temperature, and that this aspect ratio corresponds to a contact angle between 13° and 22° (on the gas side), much smaller than the macroscopic counterparts. We finally discuss the implications of our results for various theories on nanobubble stability. PMID:25156822

  13. Maternal and fetal brain contents of docosahexaenoic acid (DHA) and arachidonic acid (AA) at various essential fatty acid (EFA), DHA and AA dietary intakes during pregnancy in mice

    NARCIS (Netherlands)

    van Goor, Saskia A; Dijck-Brouwer, D A Janneke; Fokkema, M Rebecca; van der Iest, Theo Hans; Muskiet, Frits A J

    2008-01-01

    We investigated essential fatty acids (EFA) and long-chain polyunsaturated fatty acids (LCP) in maternal and fetal brain as a function of EFA/LCP availability to the feto-maternal unit in mice. Diets varying in parent EFA, arachidonic acid (AA), and docosahexaenoic acid (DHA) were administered from

  14. Carboxy-terminal mutations of bile acid CoA:N-acyltransferase alter activity and substrate specificity.

    Science.gov (United States)

    Styles, Nathan A; Shonsey, Erin M; Falany, Josie L; Guidry, Amber L; Barnes, Stephen; Falany, Charles N

    2016-07-01

    Bile acid CoA:amino acid N-acyltransferase (BAAT) is the terminal enzyme in the synthesis of bile salts from cholesterol and catalyzes the conjugation of taurine or glycine to bile acid CoA thioesters to form bile acid N-acylamidates. BAAT has a dual localization to the cytosol and peroxisomes, possibly due to an inefficient carboxy-terminal peroxisomal targeting signal (PTS), -serine-glutamine-leucine (-SQL). Mutational analysis was used to define the role of the carboxy terminus in peroxisomal localization and kinetic activity. Amidation activity of BAAT and BAAT lacking the final two amino acids (AAs) (BAAT-S) were similar, whereas the activity of BAAT with a canonical PTS sequence (BAAT-SKL) was increased >2.5-fold. Kinetic analysis of BAAT and BAAT-SKL showed that BAAT-SKL had a lower Km for taurine and glycine as well as a greater Vmax There was no difference in the affinity for cholyl-CoA. In contrast to BAAT, BAAT-SKL forms bile acid N-acylamidates with β-alanine. BAAT-S immunoprecipitated when incubated with peroxisomal biogenesis factor 5 (Pex5) and rabbit anti-Pex5 antibodies; however, deleting the final 12 AAs prevented coimmunoprecipitation with Pex5, indicating the Pex5 interaction involves more than the -SQL sequence. These results indicate that even small changes in the carboxy terminus of BAAT can have significant effects on activity and substrate specificity. PMID:27230263

  15. The thioacetate-ω(γ-lactam carboxamide) HDAC inhibitor ST7612AA1 as HIV-1 latency reactivation agent.

    Science.gov (United States)

    Badia, Roger; Grau, Judith; Riveira-Muñoz, Eva; Ballana, Ester; Giannini, Giuseppe; Esté, José A

    2015-11-01

    Antiretroviral therapy (ART) is unable to cure HIV infection. The ability of HIV to establish a subset of latent infected CD4(+) T cells, which remain undetectable to the immune system, becomes a major roadblock to achieve viral eradication. Histone deacetylase inhibitors (HDACi) have been shown to potently induce the reactivation of latent HIV. Here, we show that a new thiol-based HDACi, the thioacetate-ω(γ-lactam carboxamide) derivative ST7612AA1, is a potent inducer of HIV reactivation. We evaluated HIV reactivation activity of ST7612AA1 compared to panobinostat (PNB), romidepsin (RMD) and vorinostat (VOR) in cell culture models of HIV-1 latency, in latently infected primary CD4(+) T lymphocytes and in PBMCs from HIV(+) patients. ST7612AA1 potently induced HIV-1 reactivation at submicromolar concentrations with comparable potency to panobinostat or superior to vorinostat. The presence of known antiretrovirals did not affect ST7612AA1-induced reactivation and their activity was not affected by ST7612AA1. Cell proliferation and cell activation were not affected by ST7612AA1, or any other HDACi used. In conclusion, our results indicate that ST7612AA1 is a potent activator of latent HIV and that reactivation activity of ST7612AA1 is exerted without activation or proliferation of CD4(+) T cells. ST7612AA1 is a suitable candidate for further studies of HIV reactivation strategies and potential new therapies to eradicate the viral reservoirs. PMID:26348004

  16. Expression and function of anew angiogenic factor AA98 target molecule at the maternal-embryonic boundary ofrhesus monkey

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    The target molecule of monoclonal antibody AA98 (AA for short) is a new vascular endothelial cell related factor and plays a role in angiogenesis as indicated by the previous data. To investigate its role in angiogenesis and placentation in primate, we examined its expression in the implantation sites on D17, 19, 28 and 34 of gestation in rhesus monkey by immunohistochemistry and Western immunoblot. Western blot analysis showed that the primary antibody used in this study was specific for its epitope. AA protein was mainly expressed in small blood vessels and in some cytotrophoblast cells. The AA staining was found mainly in the endothelial cells and vascular small muscle.This observation supported the AA's role in angiogenesis. AA was spatio-temporarily expressed in cytotrophoblasts: weak in proliferating trophoblast within cell column and endovascular trophoblast, strong in trophoblastic subpopulation within the basal plate and vascular trophoblast; AA staining within the basal plate was down-regulated during early placentation. The shift of AA98 expression in extravillous trophoblasts suggestes a role of this new factor during the course of cytotrophoblast metastasis and spiral artery remodeling. The spatio-temporarily expression indicats that AA98 could be also used as a trophoblast cellular marker to characterize the acquisition of a vascular endothelial and invasive phenotype.

  17. A New 4.0-Generation Dendrimer Phosphorescence Labeling Reagent and Its Application to Determination of Trace Alkaline Phosphatase by Affinity Adsorption Solid Substrate-room Temperature Phosphorimetry

    Institute of Scientific and Technical Information of China (English)

    LI, Zhi-Ming; LIU, Jia-Ming; CHEN, Xiao-Hua; YANG, Min-Lan; CHEN, Xin-Hua; SHI, Xiu-Mei

    2007-01-01

    A Triton X-100-4.0G-D (4.0G-D refers to a 4.0-generation dendrimer) was brought forward as a new phosphorescence labeling reagent. Two types of specific affinity adsorption (AA) reactions (direct method and sandwich method) were carried out between the labeling product of Triton X-100-4.0G-D-Wheat germ agglutinin (WGA) and alkaline phosphatase (ALP), the product of AA reaction preserved the good characteristics of room temperature phosphorescence (RTP) of 4.0G-D and △Ip of the product was proportional to the content of ALP. According to the fact stated above, a new method for the determination of trace ALP by affinity adsorption solid substrate-room temperature phosphorimetry (AA-SS-RTP) was established on the basis of WGA labeled with the Triton X-100-4.0G-D. The detection limits were 0.20 ag·spot-1 (corresponding concentration: 5.0 × 10-16 g·mL-1, namely 5.0× 10-18 mol·L-1) for a direct method and 0.14 ag·spot-1 (corresponding concentration: 3.5× 10-16 g·mL-1,namely 3.5 × 10-18 mol·L-1) for a sandwich method, respectively. For their high sensitivity, good repeatability and high accuracy, the direct method and sandwich method have been successfully applied to determine the content of ALP in human serum, and the results were coincided with the clinical detection results of the enzyme-linked immunosorbent assay method by the Zhangzhou Hospital of Traditional Chinese Medicine. Meanwhile, the mechanism for the determination of trace ALP by AA-SS-RTP was discussed.

  18. Intrauterine, postpartum and adult relationships between arachidonic acid (AA) and docosahexaenoic acid (DHA).

    Science.gov (United States)

    Kuipers, Remko S; Luxwolda, Martine F; Janneke Dijck-Brouwer, D A; Muskiet, Frits A J

    2011-11-01

    Erythrocyte (RBC) fatty acid compositions from populations with stable dietary habits but large variations in RBC-arachidonic (AA) and RBC-docosahexaenoic acid (DHA) provided us with insight into relationships between DHA and AA. It also enabled us to estimate the maternal RBC-DHA (mRBC-DHA) status that corresponded with no decrease in mRBC-DHA during pregnancy, or in infant (i) RBC-DHA or mRBC-DHA during the first 3 months postpartum (DHA-equilibrium) while exclusively breastfeeding. At delivery, iRBC-AA is uniformly high and independent of mRBC-AA. Infants born to mothers with low RBC-DHA exhibit higher, but infants born to mothers with high RBC-DHA exhibit lower RBC-DHA than their mothers. This switch from 'biomagnification' into 'bioattenuation' occurs at 6g% mRBC-DHA. At 6g%, mRBC-DHA is stable throughout pregnancy, corresponds with postpartum infant DHA-equilibrium of 6 and 0.4g% DHA in mature milk, but results in postpartum depletion of mRBC-DHA to 5g%. Postpartum maternal DHA-equilibrium is reached at 8g% mRBC-DHA, corresponding with 1g% DHA in mature milk and 7g% iRBC-DHA at delivery that increases to 8g% during lactation. This 8g% RBC-DHA concurs with the lowest risks of cardiovascular and psychiatric diseases in adults. RBC-data from 1866 infants, males and (non-)pregnant females indicated AA vs. DHA synergism at low RBC-DHA, but antagonism at high RBC-DHA. These data, together with high intakes of AA and DHA from our Paleolithic diet, suggest that bioattenuation of DHA during pregnancy and postnatal antagonism between AA and DHA are the physiological standard for humans across the life cycle. PMID:21561751

  19. Effects of Culture Substrate Made of Poly(N-isopropylacrylamide-co-acrylic acid) Microgels on Osteogenic Differentiation of Mesenchymal Stem Cells.

    Science.gov (United States)

    Dai, Zhuojun; Shu, Yinglan; Wan, Chao; Wu, Chi

    2016-01-01

    Poly(N-isopropylacrylamide) (PNIPAM)-based polymers and gels are widely known and studied for their thermoresponsive property. In the biomaterials category, they are regarded as a potential cell culture substrate, not only because of their biocompatibility, but also their special character of allowing controlled detachment of cells via temperature stimulus. Previous research about PNIPAM-based substrates mostly concentrated on their effects in cell adhesion and proliferation. In this study, however, we investigate the influence of the PNIPAM-based substrate on the differentiation capacity of stem cells. Especially, we choose P(NIPAM-AA) microgels as a culture dish coating and mesenchymal stem cells (MSCs) are cultured on top of the microgels. Interestingly, we find that the morphology of MSCs changes remarkably on a microgel-coated surface, from the original spindle form to a more stretched and elongated cell shape. Accompanied by the alternation in morphology, the expression of several osteogenesis-related genes is elevated even without inducing factors. In the presence of full osteogenic medium, MSCs on a microgel substrate show an enhancement in the expression level of osteopontin and alizarin red staining signals, indicating the physical property of substrate has a direct effect on MSCs differentiation. PMID:27618001

  20. Diamond deposition on thin cylindrical substrates

    Directory of Open Access Journals (Sweden)

    GORDANA S. RISTIĆ

    2011-03-01

    Full Text Available Diamond coatings were deposited onto different cylindrical substrates (Cu, SiC, W and Mo by the hot filament chemical vapor deposition (CVD method. Continuous, adhered and well-faceted crystalline coatings of diamond were obtained on Cu-wire using a special pretreatment with a mixture of diamond and metal powders as well as carefully controlled deposition at lower power. Diamond deposition on SiC-fiber gave continuous and uniform coatings when only the filament power was properly selected. Uniform, homogeneous, euchedral diamond coatings on W- and Mo-wires, attained at a higher filament power, confirmed once more the convenience of refractory metals as substrates for diamond deposition by the CVD technique. Characterization of the obtained coatings was realized using scanning electron microscopy (SEM. The obtained results are compared with the literature data. Differences are discussed with regard to the chemical nature of the substrates as well as their thermophysical characteristics.

  1. Thermal Oxidation of Silicon Carbide Substrates

    Institute of Scientific and Technical Information of China (English)

    Xiufang Chen; Li'na Ning; Yingmin Wang; Juan Li; Xiangang Xu; Xiaobo Hu; Minhua Jiang

    2009-01-01

    Thermal oxidation was used to remove the subsurface damage of silicon carbide (SiC) surfaces. The anisotrow of oxidation and the composition of oxide layers on Si and C faces were analyzed. Regular pits were observed on the surface after the removal of the oxide layers, which were detrimental to the growth of high quality epitaxial layers. The thickness and composition of the oxide layers were characterized by Rutherford backscat-tering spectrometry (RBS) and X-ray photoelectron spectroscopy (XPS), respectively. Epitaxial growth was performed in a metal organic chemical vapor deposition (MOCVD) system. The substrate surface morphol-ogy after removing the oxide layer and gallium nitride (GaN) epilayer surface were observed by atomic force microscopy (AFM). The results showed that the GaN epilayer grown on the oxidized substrates was superior to that on the unoxidized substrates.

  2. Methods of selectively incorporating metals onto substrates

    Energy Technology Data Exchange (ETDEWEB)

    Ernst; Richard D. (Salt Lake City, UT), Eyring; Edward M. (Salt Lake City, UT), Turpin; Gregory C. (Salt Lake City, UT), Dunn; Brian C. (Salt Lake City, UT)

    2008-09-30

    A method for forming multi-metallic sites on a substrate is disclosed and described. A substrate including active groups such as hydroxyl can be reacted with a pretarget metal complex. The target metal attached to the active group can then be reacted with a secondary metal complex such that an oxidation-reduction (redox) reaction occurs to form a multi-metallic species. The substrate can be a highly porous material such as aerogels, xerogels, zeolites, and similar materials. Additional metal complexes can be reacted to increase catalyst loading or control co-catalyst content. The resulting compounds can be oxidized to form oxides or reduced to form metals in the ground state which are suitable for practical use.

  3. Plasma jet printing for flexible substrates

    Science.gov (United States)

    Gandhiraman, Ram P.; Singh, Eric; Diaz-Cartagena, Diana C.; Nordlund, Dennis; Koehne, Jessica; Meyyappan, M.

    2016-03-01

    Recent interest in flexible electronics and wearable devices has created a demand for fast and highly repeatable printing processes suitable for device manufacturing. Robust printing technology is critical for the integration of sensors and other devices on flexible substrates such as paper and textile. An atmospheric pressure plasma-based printing process has been developed to deposit different types of nanomaterials on flexible substrates. Multiwalled carbon nanotubes were deposited on paper to demonstrate site-selective deposition as well as direct printing without any type of patterning. Plasma-printed nanotubes were compared with non-plasma-printed samples under similar gas flow and other experimental conditions and found to be denser with higher conductivity. The utility of the nanotubes on the paper substrate as a biosensor and chemical sensor was demonstrated by the detection of dopamine, a neurotransmitter, and ammonia, respectively.

  4. Printed electronic on flexible and glass substrates

    Science.gov (United States)

    Futera, Konrad; Jakubowska, Małgorzata; Kozioł, Grażyna

    2010-09-01

    Organic electronics is a platform technology that enables multiple applications based on organic electronics but varied in specifications. Organic electronics is based on the combination of new materials and cost-effective, large area production processes that provide new fields of application. Organic electronic by its size, weight, flexibility and environmental friendliness electronics enables low cost production of numerous electrical components and provides for such promising fields of application as: intelligent packaging, low cost RFID, flexible solar cells, disposable diagnostic devices or games, and printed batteries [1]. The paper presents results of inkjetted electronics elements on flexible and glass substrates. The investigations was target on characterizing shape, surface and geometry of printed structures. Variety of substrates were investigated, within some, low cost, non specialized substrate, design for other purposes than organic electronic.

  5. Integration substrate with a ultra-high-density capacitor and a through-substrate via

    NARCIS (Netherlands)

    Klootwijk, J.H.; Roozeboom, F.; Ruigrok, J.J.M.; Reefman, D.

    2014-01-01

    An integration substrate for a system in package comprises a through-substrate via and a trench capacitor wherein with a trench filling that includes at least four electrically conductive capacitor-electrode layers in an alternating arrangement with dielectric layers. --The capacitor-electrode layer

  6. Direct-Cooled Power Electronics Substrate

    Energy Technology Data Exchange (ETDEWEB)

    Wiles, R.; Ayers, C.; Wereszczak, A.

    2008-12-23

    The goal of the Direct-Cooled Power Electronics Substrate project is to reduce the size and weight of the heat sink for power electronics used in hybrid electric vehicles (HEVs) and plug-in hybrid electric vehicles (PHEVs). The concept proposed in this project was to develop an innovative power electronics mounting structure, model it, and perform both thermal and mechanical finite-element analysis (FEA). This concept involved integrating cooling channels within the direct-bonded copper (DBC) substrate and strategically locating these channels underneath the power electronic devices. This arrangement would then be directly cooled by water-ethylene glycol (WEG), essentially eliminating the conventional heat sink and associated heat flow path. The concept was evaluated to determine its manufacturability, its compatibility with WEG, and the potential to reduce size and weight while directly cooling the DBC and associated electronics with a coolant temperature of 105 C. This concept does not provide direct cooling to the electronics, only direct cooling inside the DBC substrate itself. These designs will take into account issues such as containment of the fluid (separation from the electronics) and synergy with the whole power inverter design architecture. In FY 2008, mechanical modeling of substrate and inverter core designs as well as thermal and mechanical stress FEA modeling of the substrate designs was performed, along with research into manufacturing capabilities and methods that will support the substrate designs. In FY 2009, a preferred design(s) will be fabricated and laboratory validation testing will be completed. In FY 2010, based on the previous years laboratory testing, the mechanical design will be modified and the next generation will be built and tested in an operating inverter prototype.

  7. Substrate reduction therapy for Krabbe's disease.

    Science.gov (United States)

    Sands, Scott A; LeVine, Steven M

    2016-11-01

    Krabbe's disease (KD) is a lysosomal storage disorder in which galactosylceramide, a major glycosphingolipid of myelin, and psychosine (galactose-sphingosine) cannot be adequately metabolized because of a deficiency in galactosylceramidase. Substrate reduction therapy (SRT) has been tested in preclinical studies. The premise of SRT is to reduce the synthesis of substrates that are not adequately digested so that the substrate burden is lowered, resulting in less accumulation of unmetabolized material. SRT is used for Gaucher's disease, in which inhibitors of the terminal biosynthetic step are used. Unfortunately, an inhibitor for the final step of galactosylceramide biosynthesis, i.e., UDP glycosyltransferase 8 (a.k.a. UDP-galactose ceramide galactosyltransferase), has not been found. Approaches that inhibit an earlier biosynthetic step or that lessen the substrate burden by other means, such as genetic manipulations, have been tested in the twitcher mouse model of KD. Either as a stand-alone therapy or in combination with other approaches, SRT slowed the disease course, indicating that this approach has potential therapeutic value. For instance, in individuals with adult-onset disease, SRT theoretically could lessen the production of substrates so that residual enzymatic activity could adequately manage the lower substrate burden. In more severe forms of disease, SRT theoretically could be part of a combination therapy. However, SRT has the potential to impair normal function by reducing the synthesis of galactosylceramide to levels that impede myelin function, or SRT could have other deleterious effects. Thus, multiple issues need to be resolved before this approach is ready for testing in humans. © 2016 Wiley Periodicals, Inc. PMID:27638608

  8. Flexible, light trapping substrates for organic photovoltaics

    Science.gov (United States)

    Park, Yoonseok; Berger, Jana; Tang, Zheng; Müller-Meskamp, Lars; Lasagni, Andrés Fabián; Vandewal, Koen; Leo, Karl

    2016-08-01

    Micro-structured organic photovoltaic (OPV) devices on polyethylene terephthalate substrates are produced using direct laser interference patterning (DLIP). The performance of organic solar cells on these substrates is improved by a factor of 1.16, and a power conversion efficiency of 7.70% is achieved. We show that a shorter spatial period of the pattern allows for a stronger light trapping effect in solar cell, as it leads to a longer light path. Moreover, since the patterned structures are located on the outside of the fully encapsulated OPV devices, there are no problems with the roughness induced shunts.

  9. Liquid Crystal Cells Based on Photovoltaic Substrates

    Science.gov (United States)

    Lucchetti, L.; Kushnir, K.; Zaltron, A.; Simoni, F.

    2016-02-01

    Liquid crystal cells with LiNbO3:Fe crystals as substrates, are described. The photovoltaic field generated by the substrates is able to reorient the liquid crystal director thus giving rise to a phase shift on the light propagating through the cell, as in liquid crystal light valves. The process does not require the application of an external electric field, thus being potentially useful for applications requiring a high degree of compactness. An efficient optical switch with a high transmission contrast, based on the described optically-induced electric field, is also proposed.

  10. Transferring substrates to the 26S proteasome

    DEFF Research Database (Denmark)

    Hartmann-Petersen, Rasmus; Seeger, Michael; Gordon, Colin

    2003-01-01

    Ubiquitin-dependent protein degradation is not only involved in the recycling of amino acids from damaged or misfolded proteins but also represents an essential and deftly controlled mechanism for modulating the levels of key regulatory proteins. Chains of ubiquitin conjugated to a substrate...... protein specifically target it for degradation by the 26S proteasome, a huge multi-subunit protein complex found in all eukaryotic cells. Recent reports have clarified some of the molecular mechanisms involved in the transfer of ubiquitinated substrates from the ubiquitination machinery to the proteasome...

  11. Substrates for clinical applicability of stem cells

    Institute of Scientific and Technical Information of China (English)

    Sanjar Enam; Sha Jin

    2015-01-01

    The capability of human pluripotent stem cells (hPSCs)to differentiate into a variety of cells in the human bodyholds great promise for regenerative medicine. Manysubstrates exist on which hPSCs can be self-renewed,maintained and expanded to further the goal of clinicalapplication of stem cells. In this review, we highlightnumerous extracellular matrix proteins, peptide andpolymer based substrates, scaffolds and hydrogelsthat have been pioneered. We discuss their benefitsand shortcomings and offer future directions as well asemphasize commercially available synthetic peptidesas a type of substrate that can bring the benefits ofregenerative medicine to clinical settings.

  12. Microstructure evolution and mechanical properties of dissimilar friction stir welded joints between AA1100-B{sub 4}C MMC and AA6063 alloy

    Energy Technology Data Exchange (ETDEWEB)

    Guo, J. [Department of Applied Science, University of Quebec at Chicoutimi, Saguenay (QC) G7H 2B1 (Canada); Aluminium Technology Centre, National Research Council Canada, Saguenay (QC) G7H 8C3 (Canada); Gougeon, P. [Aluminium Technology Centre, National Research Council Canada, Saguenay (QC) G7H 8C3 (Canada); Chen, X.-G., E-mail: xgrant_chen@uqac.ca [Department of Applied Science, University of Quebec at Chicoutimi, Saguenay (QC) G7H 2B1 (Canada)

    2012-09-15

    Highlights: Black-Right-Pointing-Pointer Microstructures and mechanical properties of dissimilar FSW between AA1100-B{sub 4}C and AA6063 alloy. Black-Right-Pointing-Pointer Effect of the welding parameters on the interface bonding, joint microstructure and mechanical properties. Black-Right-Pointing-Pointer Microstructural evolution of dissimilar joints revealed by the electron backscatter diffraction analysis. Black-Right-Pointing-Pointer Good material mixing and seamless bonding around the interfaces between Al-B{sub 4}C and the AA6063 alloy. Black-Right-Pointing-Pointer 100% joint efficiencies (UTS) achieved by all dissimilar joints. - Abstract: The feasibility of dissimilar friction stir welding (FSW) between the AA1100-16 vol.% B{sub 4}C metal matrix composite and the AA6063 alloy has been evaluated. The effect of the welding parameters on the interface bonding, joint microstructure and mechanical properties was investigated. The results revealed that all dissimilar joints produced under welding conditions investigated were stronger than the base materials of the Al-B{sub 4}C composite. Analysis of the Mg concentration and the B{sub 4}C particle distribution indicates that good material mixing and seamless bonding was achieved around the interface between the Al-B{sub 4}C composite and the Al 6063 alloy during FSW. The electron backscatter diffraction analysis (EBSD) shows that during dissimilar FSW, there was a gradual microstructural evolution on both material sides, resulting in a variety of grain structures in the different weld zones. In the weld zones of FSW joints, the materials underwent dynamic recovery and recrystallization to different extents depending on their thermal mechanical history. The grain refinement of both materials in the nugget zone was observed. It is recommended that the 6063 aluminum alloy should be fixed on the advancing side and the use of an appropriate offset to the 6063 aluminum side is preferred.

  13. Substrate quality alters the microbial mineralization of added substrate and soil organic carbon

    Science.gov (United States)

    Jagadamma, S.; Mayes, M. A.; Steinweg, J. M.; Schaeffer, S. M.

    2014-09-01

    The rate and extent of decomposition of soil organic carbon (SOC) is dependent, among other factors, on substrate chemistry and microbial dynamics. Our objectives were to understand the influence of substrate chemistry on microbial decomposition of carbon (C), and to use model fitting to quantify differences in pool sizes and mineralization rates. We conducted an incubation experiment for 270 days using four uniformly labeled 14C substrates (glucose, starch, cinnamic acid and stearic acid) on four different soils (a temperate Mollisol, a tropical Ultisol, a sub-arctic Andisol, and an arctic Gelisol). The 14C labeling enabled us to separate CO2 respired from added substrates and from native SOC. Microbial gene copy numbers were quantified at days 4, 30 and 270 using quantitative polymerase chain reaction (qPCR). Substrate C respiration was always higher for glucose than other substrates. Soils with cinnamic and stearic acid lost more native SOC than glucose- and starch-amended soils. Cinnamic and stearic acid amendments also exhibited higher fungal gene copy numbers at the end of incubation compared to unamended soils. We found that 270 days were sufficient to model the decomposition of simple substrates (glucose and starch) with three pools, but were insufficient for more complex substrates (cinnamic and stearic acid) and native SOC. This study reveals that substrate quality exerts considerable control on the microbial decomposition of newly added and native SOC, and demonstrates the need for multi-year incubation experiments to constrain decomposition parameters for the most recalcitrant fractions of SOC and complex substrates.

  14. The boron absorption line at 2089.6 AA in HD 140283 ?

    CERN Document Server

    Thoren, P H

    2000-01-01

    We have observed the B I line at 2089.6 AA in the metal poor star HD 140283 with HST/STIS. The observation was an attempt to confirm the B abundances derived from the 2497 AA B I line in earlier works in general, and for for this star in particular (Edvardsson et al. 1994 A&A 290, 176; Kiselman & Carlsson 1996, A&A 311, 680). The resulting spectrum gained from 8 orbits of observations is hardly consistent with the boron abundance derived in the earlier works. A pure 10^B line could produce the feature observed but no reasonable process can produce such a ratio between 10^B and 11^B. More likely the analysed feature is affected by a statistical fluctuation. A conservative upper limit estimate of the NLTE corrected boron abundance gives a value marginally consistent with that derived from the 2497 AA line. We are proposing further observations to derive a more definite abundance from the line.

  15. Preparation and Characteristics of Corn Straw-Co-AMPS-Co-AA Superabsorbent Hydrogel

    Directory of Open Access Journals (Sweden)

    Wei-Min Cheng

    2015-11-01

    Full Text Available In this study, the corn straw after removing the lignin was grafted with 2-acrylamido-2-methylpropanesulfonic acid (AMPS to prepare sulfonated cellulose. The grafting copolymerization between the sulfonated cellulose and acrylic acid (AA was performed using potassium persulfate and N,N′-methylenebisacrylamide as the initiator and crosslinking agent, respectively, to prepare corn straw-co-AMPS-co-AA hydrogels. The structure and properties of the resulting hydrogels were characterized by Fourier transform infrared spectroscopy, X-ray diffraction, scanning electron microscopy, thermogravimetric analysis, and dynamic rheometry. The effects of initiator, crosslinker, monomer neutralization degree, and temperature on the swelling ratio of the hydrogels were studied. The water retention, salt resistance, and recyclability of the corn straw-co-AMPS-co-AA hydrogels were also investigated. The optimum water absorptivity of the corn straw hydrogels was obtained at a polymerization temperature of 50 °C with 1.2% crosslinker, 1:7 ratio of the pretreated corn straw and AA, 2% initiator, and 50% neutralized AA.

  16. Multi-Line Quiet Sun Spectro-Polarimetry at 5250 and 6302 \\AA

    CERN Document Server

    Socas-Navarro, H; Ramos, A Asensio; Collados, M; Cerdeña, I Domínguez; Khomenko, E V; González, M J Martínez; Pillet, V Martínez; Cobo, B Ruiz; Almeida, J Sánchez

    2007-01-01

    The reliability of quiet Sun magnetic field diagnostics based on the \\ion{Fe}{1} lines at 6302 \\AA has been questioned by recent work. We present here the results of a thorough study of high-resolution multi-line observations taken with the new spectro-polarimeter SPINOR, comprising the 5250 and 6302 \\AA spectral domains. The observations were analyzed using several inversion algorithms, including Milne-Eddington, LTE with 1 and 2 components, and MISMA codes. We find that the line-ratio technique applied to the 5250 \\AA lines is not sufficiently reliable to provide a direct magnetic diagnostic in the presence of thermal fluctuations and variable line broadening. In general, one needs to resort to inversion algorithms, ideally with realistic magneto-hydrodynamical constrains. When this is done, the 5250 \\AA lines do not seem to provide any significant advantage over those at 6302 \\AA . In fact, our results point towards a better performance with the latter (in the presence of turbulent line broadening). In any...

  17. A Flare Observed in Coronal, Transition Region and Helium I 10830 \\AA\\ Emissions

    CERN Document Server

    Zeng, Zhicheng; Cao, Wenda; Judge, Philip G

    2014-01-01

    On June 17, 2012, we observed the evolution of a C-class flare associated with the eruption of a filament near a large sunspot in the active region NOAA 11504. We obtained high spatial resolution filtergrams using the 1.6 m New Solar Telescope at the Big Bear Solar Observatory in broad-band TiO at 706 nm (bandpass:10 \\AA) and He I 10830 \\AA\\ narrow-band (bandpass: 0.5 \\AA, centered 0.25 \\AA\\ to the blue). We analyze the spatio-temporal behavior of the He I 10830 \\AA\\ data, which were obtained over a 90" X 90" field of view with a cadence of 10 sec. We also analyze simultaneous data from the Atmospheric Imaging Assembly and Extreme Ultraviolet Variability Experiment instruments on board the Solar Dynamics Observatory spacecraft, and data from Reuven Ramaty High Energy Solar Spectroscopic Imager and GOES spacecrafts. Non-thermal effects are ignored in this analysis. Several quantitative aspects of the data, as well as models derived using the "0D" Enthalpy-Based Thermal Evolution of Loops model (EBTEL: Klimchuk...

  18. Synthesis and characterization of polycaprolactone/acrylic acid (PCL/AA) hydrogel for controlled drug delivery

    Indian Academy of Sciences (India)

    Nazar Mohammad Ranjha; Jahanzeb Mudassir; Sajid Majeed

    2011-12-01

    In the present work biodegradable pH-sensitive polycaprolactone/acrylic acid (PCL/AA) hydrogels have been developed using ethylene glycol dimethacrylate (EGDMA) as a cross-linker and benzoyl peroxide as initiator. For these prepared hydrogels swelling studies, sol–gel fraction analysis and porosity measurements were performed. Results show that swelling of the hydrogels decreases on increasing the concentration of PCL and EGDMA, however swelling of hydrogels increases on increasing the concentration of AA. Results of sol–gel fraction analysis show that gel fraction increases on increasing concentration of monomer AA, polymer PCL as well as cross-linker EGDMA. As far as porosity is concerned, it increases on increasing the concentration of AA and PCL while porosity decreases on increasing the concentration of EGDMA. Hydrogels were characterized by measuring diffusion coefficient () and equilibrium water content (EWC). Network formation, morphology and crystallinity of PCL/AA hydrogels were investigated using FTIR, SEM and XRD, respectively. Tramadol hydrochloride was loaded as model drug and its release pattern was analysed using various kinetic models like zero order, first order, Higuchi and Peppas. Results indicated that most of the samples followed non-Fickian release mechanism.

  19. Bicarbonate is a recycling substrate for cyanase

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, W.V.; Anderson, P.M.

    1987-05-01

    Cyanase catalyzes HCO/sub 3//sup -/-dependent decomposition of cyanate to NH/sub 4//sup +/ and HCO/sub 3//sup -/. Previous studies provided evidence that carbamate is an initial product and that the kinetic mechanism is rapid equilibrium random (HCO/sub 3//sup -/ serving as substrate as opposed to activator). Direct evidence for this mechanism was obtained in this study by (1) identifying the products formed from (/sup 14/C)HCO/sub 3//sup -/ or (/sup 14/C)OCN/sup -/, (2) identifying the products formed from (/sup 13/C)HCO/sub 3//sup -/ in the presence of (/sup 18/O)H/sub 2/O, and (3) determining whether CO/sub 2/ or HCO/sub 3//sup -/ serve as substrate and are formed as product. Carbon dioxide (not HCO/sub 3//sup -/) is produced in stoichiometric amounts from both HCO/sub 3//sup -/ and OCN/sup -/. Bicarbonate (not CO/sub 2/) is the substrate. Oxygen-18 from (/sup 18/O)H/sub 2/O is not incorporated into CO/sub 2/ formed from either HCO/sub 3//sup -/ or OCN/sup -/. These results indicate that decomposition of cyanate is not a hydrolysis reaction and that HCO/sub 3//sup -/ functions as a substrate.

  20. Bicarbonate is a recycling substrate for cyanase.

    Science.gov (United States)

    Johnson, W V; Anderson, P M

    1987-07-01

    Cyanase is an inducible enzyme in Escherichia coli that catalyzes bicarbonate-dependent decomposition of cyanate to ammonia and bicarbonate. Previous studies provided evidence that carbamate is an initial product and that the kinetic mechanism is rapid equilibrium random (bicarbonate serving as substrate as opposed to activator); the following mechanism was proposed (Anderson, P. M. (1980) Biochemistry 19, 2282-2888; Anderson, P. M., and Little, R. M. (1986) Biochemistry 25, 1621-1626). (formula; see text) Direct evidence for this mechanism was obtained in this study by 1) determining whether CO2 or HCO3- serves as substrate and is formed as product, 2) identifying the products formed from [14C]HCO3- and [14C] OCN-, 3) identifying the products formed from [13C] HCO3- and [12C]OCN- in the presence of [18O]H2O, and 4) determining whether 18O from [18O]HCO3- is incorporated into CO2 derived from OCN-. Bicarbonate (not CO2) is the substrate. Carbon dioxide (not HCO3-) is produced in stoichiometric amounts from both HCO3- and OCN-. 18O from [18O]H2O is not incorporated into CO2 formed from either HCO3- or OCN-. Oxygen-18 from [18O]HCO3- is incorporated into CO2 derived from OCN-. These results support the above mechanism, indicating that decomposition of cyanate catalyzed by cyanase is not a hydrolysis reaction and that bicarbonate functions as a recycling substrate.

  1. Robust fabric substrates for photonic textile applications

    NARCIS (Netherlands)

    Van Pieterson, L.; Bouten, P.C.P.; Kriege, J.C.; Bhattacharya, R.

    2010-01-01

    A fabric substrate is described for electronic textile with robust interwoven connections between the conductive yarns in it. The fabric's robustness, as a function of the electrical reliability of its conductive yarn connections, is shown to hold over large deformations.This fabric is then used to

  2. MIXED SUBSTRATES IN ENVIRONMENT AND BIOTECHNOLOGICAL PROCESSES

    Directory of Open Access Journals (Sweden)

    T. P. Pirog

    2013-12-01

    Full Text Available The modern literature and own experimental data on the use of substrates’ mixtures for intensification of microbial synthesis technologies of practically valuable fermentation products (ethanol, lactic acid, butanediol, primary (amino acids, n-hydroxybenzoate, triglycerides and secondary (lovastatin, surfactants metabolites as well as for intensification of biodegradation of aromatic xenobiotics (benzene, cresols, phenols, toluene and pesticides (dimethoate are presented. Special attention is paid on the molecular mechanisms that were established in recent years and underlying the phenomenon catabolic repression in Gram-positive (Bacillus subtilis and Gram-negative (Pseudomonas, Escherichia coli bacteria and yeast Saccharomyces cerevisiae, and on the use of these data to develop technologies for utilization of plant biomass to produce industrially important metabolites. The survival strategies of heterotrophic microorganisms in natural oligotrophic environments are considered, including the simultaneous use of multiple substrates, allowing improved kinetic characteristics that give them a competitive advantage, also provided significant metabolic/physiological flexibility. The own experimental data on the use of mixtures of growth substrates for the intensification of surfactants’ synthesis of Rhodococcus erythropolis IMV Ac-5017 and Acinetobacter calcoaceticus IMV B-7241 are summarized. The dependence of the synthesis of surfactants in a mixture of energy excess (hexadecane and energy deficient (glycerol, ethanol substrates on the way of inoculum preparation, concentration of mono-substrates in the mixture, and their molar ratio were determined.

  3. Drying of Pigment-Cellulose Nanofibril Substrates

    Directory of Open Access Journals (Sweden)

    Oleg Timofeev

    2014-10-01

    Full Text Available A new substrate containing cellulose nanofibrils and inorganic pigment particles has been developed for printed electronics applications. The studied composite structure contains 80% fillers and is mechanically stable and flexible. Before drying, the solids content can be as low as 20% due to the high water binding capacity of the cellulose nanofibrils. We have studied several drying methods and their effects on the substrate properties. The aim is to achieve a tight, smooth surface keeping the drying efficiency simultaneously at a high level. The methods studied include: (1 drying on a hot metal surface; (2 air impingement drying; and (3 hot pressing. Somewhat surprisingly, drying rates measured for the pigment-cellulose nanofibril substrates were quite similar to those for the reference board sheets. Very high dewatering rates were observed for the hot pressing at high moisture contents. The drying method had significant effects on the final substrate properties, especially on short-range surface smoothness. The best smoothness was obtained with a combination of impingement and contact drying. The mechanical properties of the sheets were also affected by the drying method and associated temperature.

  4. Nanobubble formation on a warmer substrate

    NARCIS (Netherlands)

    Xu, Chenglong; Peng, Shuhua; Ciao, Greg G.; Gutowski, Voytek; Lohse, Detlef; Zhang, Xuehua

    2014-01-01

    The solvent exchange procedure is an often-used protocol to produce surface nanobubbles. In this procedure, the substrate is exposed to a good solvent for gas which is then mixed and rinsed with a poor solvent for gas and the nanobubbles form on the solid–liquid interface. Here we study the effects

  5. Macro algae as substrate for biogas production

    DEFF Research Database (Denmark)

    Møller, Henrik; Sarker, Shiplu; Gautam, Dhan Prasad;

    Algae as a substrate for biogas is superior to other crops since it has a much higher yield of biomass per unit area and since algae grows in the seawater there will be no competition with food production on agricultural lands. So far, the progress in treating different groups of algae as a sourc...

  6. Cathodoluminescence Microscopy of nanostructures on glass substrates

    NARCIS (Netherlands)

    Narvaez, A.C.; Weppelman, I.G.C.; Moerland, R.J.; Liv, N.; Zonnevylle, A.C.; Kruit, P.; Hoogenboom, J.P.

    2013-01-01

    Cathodoluminescence (CL) microscopy is an emerging analysis technique in the fields of biology and photonics, where it is used for the characterization of nanometer sized structures. For these applications, the use of transparent substrates might be highly preferred, but the detection of CL from nan

  7. Biofunctional Micropatterning of Thermoformed 3D Substrates

    NARCIS (Netherlands)

    Waterkotte, B.; Bally, F.; Nikolov, P.M.; Waldbaur, A.; Rapp, B.E.; Truckenmuller, R.K.; Lahann, J.; Schmitz, K.; Giselbrecht, S.

    2014-01-01

    Mimicking the in vivo microenvironment of cells is a challenging task in engineering in vitro cell models. Surface functionalization is one of the key components providing biochemical cues to regulate the interaction between cells and their substrate. In this study, two different approaches yield bi

  8. Mass spectrometry-assisted protease substrate screening

    DEFF Research Database (Denmark)

    Schlüter, Hartmut; Rykl, Jana; Thiemann, Joachim;

    2007-01-01

    -phase chromatography they are analyzed by tandem mass spectrometry and the substrates identified by database searching. The proof of principle in this study is demonstrated by incubating immobilized human plasma proteins with thrombin and by identifying by tandem mass spectrometry the fibrinopeptides, released...

  9. The Impact of Reclassification from Division II to DI-AA and from Division I-AA to I-A on NCAA Member Institutions from 1993 to 2003

    Science.gov (United States)

    Frieder, Laura L., Comp.; Fulks, Daniel L., Comp.

    2007-01-01

    Recent years have seen a number of National Collegiate Athletic Association (NCAA) Division II institutions seeking reclassification to Division I-AA and Division I-AA institutions moving to Division I-A. Yet, other schools that seem like natural candidates to reclassify have resisted. The purpose of this study is to investigate the impact of the…

  10. Observations of the forward scattering Hanle effect in the Ca i 4227 {\\AA} line

    CERN Document Server

    Bianda, M; Anusha, L S; Stenflo, J O; Nagendra, K N; Holzreuter, R; Sampoorna, M; Frisch, H; Smitha, H N

    2011-01-01

    Chromospheric magnetic fields are notoriously diffcult to measure. The chromospheric lines are broad, while the fields are producing a minuscule Zeeman-effect polarization. A promising diagnostic alternative is provided by the forward-scattering Hanle effect, which can be recorded in chromospheric lines such as the He i 10830 {\\AA} and the Ca i 4227 {\\AA} lines. We present a set of spectropolarimetric observations of the full Stokes vector obtained near the center of the solar disk in the Ca i 4227 {\\AA} line with the ZIMPOL polarimeter at the IRSOL observatory.We detect a number of interesting forward-scattering Hanle effect signatures, which we model successfully using polarized radiative transfer. Here we focus on the observational aspects, while a separate companion paper deals with the theoretical modeling.

  11. Uncertainty Estimation of Analysis of Hg in Fish and Shrimp Sample by SS-AAS Method

    International Nuclear Information System (INIS)

    An uncertainty estimation of analysis of Hg in Fish and Shrimp sample by SS-AAS method has been done. Samples preparation have been done by using freeze drying. They were then homogenized and sieved, so their grain size of 100 mesh were obtained. The content of Hg in the samples and SRM 1566a has been analyzed by using SS-AAS (solid sampling - atomic absorption spectrometer) AAS 5 EA, ZEISS. The experimental result shows that expanded uncertainty value of fish sample is 4.3636, whereas expanded uncertainty value of shrimp’s sample = 2.638. Precision value is = 98.46 % and accuracy value = 97.0 % and limit of detection = 0.0154 ng/g. (author)

  12. Crystal structure determination of alkaline haemorrhagin AaHⅢ from snake venom of Agkistrodon acutus

    Institute of Scientific and Technical Information of China (English)

    龚为民; 滕脉坤; 牛立文

    1997-01-01

    The haemorrhagin AaH Ⅲ isolated from the snake venom of Agkistrodon acutus is one of the few al-kaline ones in snake venoms. Its crystals belong to space group P212121 with a = 9. 573 4 nm, b = 4. 996 7 nm and c = 4. 728 8 nm. Its crystal structure was determined by the molecular replacement method according to the model of metalloproteinase Adamalysin n from eastern rattlesnake venom. The AaHⅢ structure has been refined by PROLSQ. The final R factor was 0.254 and the RMS deviations of bond lengths and angles were 0. 001 8 nm and 1.5°. The structure comparison suggested that AaHⅢ has a similar structure to other snake venom zinc-metalloproteinases. They all belong to matrix metalloproteinases super-family.

  13. Hα Line as An indicator Of Envelope Presence Around the Cepheid Polaris Aa (α UMi)

    Science.gov (United States)

    Usenko, I. A.; Miroshnichenko, A. S.; Klochkova, V. G.; Tavolzhanskaya, N. S.

    We present the results of the radial velocity (RV) measurements of metallic lines as well as Hα (Hβ ) obtained in 55 high-resolution spectra of the Cepheid α UMi (Polaris Aa) in 1994-2010. While the RV amplitudes of these lines are roughly equal, their mean RV begin to differ essentially with growth of the Polaris Aa pulsational activity. This difference is accompanied by the Hα core asymmetries on the red side mainly (so-called knifelike profiles) and reaches the value of 8-12 km/s in 2003 with subsequent decrease to 1.5-2 km/s. We interpret so unusual behaviour of the Hα line core as dynamical changes in the envelope around Polaris Aa.

  14. Toward a simultaneous description of $R_{AA}$ and $v_2$ for heavy quarks

    CERN Document Server

    Das, Santosh K; Plumari, Salvatore; Greco, Vincenzo

    2016-01-01

    The two key observables related to heavy quarks that have been measured in RHIC and LHC energies are the nuclear suppression factor $R_{AA}$ and the elliptic flow $v_2$. Simultaneous description of these two observables is a top challenge for all the existing models. We have highlighted how a consistent combination of four ingredients i.e the temperature dependence of the energy loss, full solution of the Boltzmann collision integral for the momentum evolution of heavy quark, hadronization by coalescence, then the hadronic rescattering, responsible to address a large part of such a puzzle. We have considered four different models to evaluate the temperature dependence of drag coefficients of the heavy quark in QGP. All these four different models are set to reproduce the same $R_{AA}$ as of the experiments. We have shown that for the same $R_{AA}$, the $v_2$ could be quite different depending on the interaction dynamics as well as other ingredients.

  15. Comparison of corrosion behaviour of friction stir processed and laser melted AA 2219 aluminium alloy

    International Nuclear Information System (INIS)

    Highlights: → Poor corrosion resistance of AA 2219 can be improved by surface treatments. → FSP and LM leads to dissolution of second phase particles. → No literature available on comparison of corrosion behaviour after FSP and LM. → The study implies FSP is as good as LM in improving the corrosion resistance of AA 2219. -- Abstract: Dissolution of second phase particles (CuAl2) present in AA 2219 aluminium improves the corrosion resistance of the alloy. Two surface treatment techniques, viz., solid state friction stir processing and fusion based laser melting lead to the reduction in CuAl2 content and the effect of these processes on the corrosion behaviour of the alloy is compared in this study. Potentiodynamic polarization and electrochemical impedance spectroscopy tests were carried out to compare corrosion behaviour. The corrosion resistance achieved by friction stir processing is comparable to that obtained by the laser melting technique.

  16. PERVAPORATION SEPARATION OF WATER-ACETIC ACID MIXTURES THROUGH AN-co-AA MEMBRANES TREATED WITH RARE EARTH METAL IONS

    Institute of Scientific and Technical Information of China (English)

    SHEN Zhiquan; ZHANG Fuyao; ZHANG Yifeng

    1995-01-01

    Pervaporation separation of water-acetic acid mixtures through Poly (AN-co-AA)membranes and rare earth metal ions treated Poly(AN-co-AA)membranes was investigated for the first time. The results showed that the treatment with rare earth metal ions could greatly improve the characteristics of the separation of water-acetic acid mixtures.

  17. ORBITAL AND PHYSICAL PROPERTIES OF THE σ Ori Aa, Ab, B TRIPLE SYSTEM

    Energy Technology Data Exchange (ETDEWEB)

    Simón-Díaz, S. [Instituto de Astrofísica de Canarias, E-38200 La Laguna, Tenerife (Spain); Caballero, J. A.; Apellániz, J. Maíz [Centro de Astrobiología (CSIC-INTA), ESAC Campus, P.O. Box 78, E-28691 Villanueva de la Cañada, Madrid (Spain); Lorenzo, J.; Negueruela, I.; Dorda, R.; Marco, A. [Departamento de Física, Ingeniería de Sistemas y Teoría de la Señal, Escuela Politécnica Superior, University of Alicante, Apdo. 99, E-03080 Alicante (Spain); Schneider, F. R. N. [Argelander-Institut für Astronomie der Universität Bonn, Auf dem Hügel 71, D-53121 Bonn (Germany); Barbá, R. H. [Departamento de Física, Universidad de La Serena, Benavente 980, La Serena (Chile); Montes, D. [Departamento Astrofísica, Facultad de Ciencias Físicas, Universidad Complutense de Madrid, E-28040 Madrid (Spain); Pellerin, A. [Department of Physics and Astronomy, State University of New York at Geneseo, 1 College Circle, Geneseo, NY 14454 (United States); Sanchez-Bermudez, J.; Sota, A. [Instituto de Astrofísica de Andalucía (CSIC), Glorieta de la Astronomía s/n, E-18008 Granada (Spain); Sódor, Á., E-mail: ssimon@iac.es [Konkoly Observatory, Research Centre for Astronomy and Earth Sciences, Hungarian Academy of Sciences, H-01121 Budapest (Hungary)

    2015-02-01

    We provide a complete characterization of the astrophysical properties of the σ Ori Aa, Ab, B hierarchical triple system and an improved set of orbital parameters for the highly eccentric σ Ori Aa, Ab spectroscopic binary. We compiled a spectroscopic data set comprising 90 high-resolution spectra covering a total time span of 1963 days. We applied the Lehman-Filhés method for a detailed orbital analysis of the radial velocity curves and performed a combined quantitative spectroscopic analysis of the σ Ori Aa, Ab, B system by means of the stellar atmosphere code FASTWIND. We used our own plus other available information on photometry and distance to the system for measuring the radii, luminosities, and spectroscopic masses of the three components. We also inferred evolutionary masses and stellar ages using the Bayesian code BONNSAI. The orbital analysis of the new radial velocity curves led to a very accurate orbital solution of the σ Ori Aa, Ab pair. We provided indirect arguments indicating that σ Ori B is a fast-rotating early B dwarf. The FASTWIND+BONNSAI analysis showed that the Aa, Ab pair contains the hottest and most massive components of the triple system while σ Ori B is a bit cooler and less massive. The derived stellar ages of the inner pair are intriguingly younger than the one widely accepted for the σ Orionis cluster, at 3 ± 1 Ma. The outcome of this study will be of key importance for a precise determination of the distance to the σ Orionis cluster, the interpretation of the strong X-ray emission detected for σ Ori Aa, Ab, B, and the investigation of the formation and evolution of multiple massive stellar systems and substellar objects.

  18. Multifunctional epitaxial systems on silicon substrates

    Science.gov (United States)

    Singamaneni, Srinivasa Rao; Prater, John Thomas; Narayan, Jagdish

    2016-09-01

    Multifunctional heterostructures can exhibit a wide range of functional properties, including colossal magneto-resistance, magnetocaloric, and multiferroic behavior, and can display interesting physical phenomena including spin and charge ordering and strong spin-orbit coupling. However, putting this functionality to work remains a challenge. To date, most of the work reported in the literature has dealt with heterostructures deposited onto closely lattice matched insulating substrates such as DyScO3, SrTiO3 (STO), or STO buffered Si(100) using concepts of lattice matching epitaxy (LME). However, strain in heterostructures grown by LME is typically not fully relaxed and the layers contain detrimental defects such as threading dislocations that can significantly degrade the physical properties of the films and adversely affect the device characteristics. In addition, most of the substrates are incompatible with existing CMOS-based technology, where Si (100) substrates dominate. This review discusses recent advances in the integration of multifunctional oxide and non-oxide materials onto silicon substrates. An alternative thin film growth approach, called "domain matching epitaxy," is presented which identifies approaches for minimizing lattice strain and unwanted defects in large misfit systems (7%-25% and higher). This approach broadly allows for the integration of multifunctional materials onto silicon substrates, such that sensing, computation, and response functions can be combined to produce next generation "smart" devices. In general, pulsed laser deposition has been used to epitaxially grow these materials, although the concepts developed here can be extended to other deposition techniques, as well. It will be shown that TiN and yttria-stabilized zirconia template layers provide promising platforms for the integration of new functionality into silicon-based computer chips. This review paper reports on a number of thin-film heterostructure systems that span a

  19. Fracture and strain rate behavior of airplane fuselage materials under blast loading

    NARCIS (Netherlands)

    Mediavilla Varas, J.; Soetens, F.; Kroon, E.; Aanhold, J.E. van; Meulen, O.R. van der; Sagimon, M.

    2010-01-01

    The dynamic behavior of three commonly used airplane fuselage materials is investigated, namely of Al2024-T3, Glare-3 and CFRP. Dynamic tensile tests using a servo-hydraulic and a light weight shock testing machine (LSM) have been performed. The results showed no strain rate effect on Al2024-T3 and a

  20. Lability of the pAA Virulence Plasmid in Escherichia coli O104:H4: Implications for Virulence in Humans.

    Directory of Open Access Journals (Sweden)

    Wenlan Zhang

    Full Text Available Escherichia coli O104:H4 that caused the large German outbreak in 2011 is a highly virulent hybrid of enterohemorrhagic (EHEC and enteroaggregative (EAEC E. coli. The strain displays "stacked-brick" aggregative adherence to human intestinal epithelial cells mediated by aggregative adherence fimbriae I (AAF/I encoded on the pAA plasmid. The AAF/I-mediated augmented intestinal adherence might facilitate systemic absorption of Shiga toxin, the major virulence factor of EHEC, presumably enhancing virulence of the outbreak strain. However, the stability of pAA in the outbreak strain is unknown. We therefore tested outbreak isolates for pAA, monitored pAA loss during infection, and determined the impact of pAA loss on adherence and clinical outcome of infection.E. coli O104:H4 outbreak isolates from 170 patients (128 with hemolytic uremic syndrome [HUS] and 42 with diarrhea without HUS were tested for pAA using polymerase chain reaction and plasmid profiling. pAA-harboring bacteria in stool samples were quantified using colony blot hybridization, and adherence to HCT-8 cells was determined. Isolates from 12 (7.1% patients lacked pAA. Analyses of sequential stool samples demonstrated that the percentages of pAA-positive populations in the initial stools were significantly higher than those in the follow-up stools collected two to eight days later in disease (P≤0.01. This indicates a rapid loss of pAA during infections of humans. The pAA loss was associated with loss of the aggregative adherence phenotype and significantly reduced correlation with HUS (P  = 0.001.The pAA plasmid can be lost by E. coli O104:H4 outbreak strain in the human gut in the course of disease. pAA loss might attenuate virulence and diminish the ability to cause HUS. The pAA instability has clinical, diagnostic, epidemiologic, and evolutionary implications.

  1. Self-Assembled Local Artificial Substrates of GaAs on Si Substrate

    Directory of Open Access Journals (Sweden)

    Frigeri C

    2010-01-01

    Full Text Available Abstract We propose a self-assembling procedure for the fabrication of GaAs islands by Droplet Epitaxy on silicon substrate. Controlling substrate temperature and amount of supplied gallium is possible to tune the base size of the islands from 70 up to 250 nm and the density from 107 to 109 cm−2. The islands show a standard deviation of base size distribution below 10% and their shape evolves changing the aspect ratio from 0.3 to 0.5 as size increases. Due to their characteristics, these islands are suitable to be used as local artificial substrates for the integration of III–V quantum nanostructures directly on silicon substrate.

  2. Influencia de los parámetros de la soldadura metálica fría en las aleaciones AA5083 y AA6061//Influence of the colt metal welding parameters on the AA5083 and AA6061 aluminum

    Directory of Open Access Journals (Sweden)

    René Eduardo de‐Luna‐Alanís

    2015-01-01

    Full Text Available El trabajo tuvo como objetivo evaluar la influencia de la velocidad de la soldadura y de las correcciones del arco y pulso en el proceso de Transferencia Metálica Fría sobre las propiedades mecánicas de las aleaciones AA5083 y AA6061. Se desarrolló un diseño experimental de tipo factorial multinivel, con 4 factores independientes (Corrección de Arco, Pulso, Velocidad de Soldadura y Aleación. Los parámetros fundamentales fueron: Corriente de base 250 A; Voltaje de arco 21 V y Polaridad (Direct current electrode positive, DCEP. La evaluación se realizó a través de un ensayo de tracción transversal sobre probetas planas obtenidas de los cupones soldados. Se demuestra que el modelo aplicado es adecuado, revelándose en los experimentos diferencias sustanciales en las propiedades Tensión de fluencia 29,56 %, Módulo de elasticidad 51,16 % y Trabajo específico de deformación elástica 42,30 %, el cual no posee una dependencia lineal con elresto de las propiedades anteriores.Palabras claves: transferencia metálica fría, aleación AA5083, aleación AA6061, propiedades mecánicas._______________________________________________________________________________AbstractThe work objective was to evaluatethe influence of Cold Metal Transfer process arc and pulse corrections and welding speed on the mechanical properties of AA5083 and AA6061 aluminum alloys. For it, a Factorial Multilevel experimental design whit 4 independent factor (arc correction, pulse correction, welding speed and alloy was developed. The essential welding parameters employed were: base current 250 A; arc voltage 21 V and polarity (DCEP. The evaluation was made whit a transverse traction test of plate welded coupons. The experimental model applied wasadequate and substantial differences was showed between yield tensile strength 29,56 %, elasticity module (51,16 % and specific work of elastic deformation 42,30 %, which it does not possess a lineal dependence whit the rest

  3. Multi-Response Optimization of Friction-Stir-Welded AA1100 Aluminum Alloy Joints

    Science.gov (United States)

    Rajakumar, S.; Balasubramanian, V.

    2012-06-01

    AA1100 aluminum alloy has gathered wide acceptance in the fabrication of light weight structures. Friction stir welding process (FSW) is an emerging solid state joining process in which the material that is being welded does not melt and recast. The process and tool parameters of FSW play a major role in deciding the joint characteristics. In this research, the relationships between the FSW parameters (rotational speed, welding speed, axial force, shoulder diameter, pin diameter, and tool hardness) and the responses (tensile strength, hardness, and corrosion rate) were established. The optimal welding conditions to maximize the tensile strength and minimize the corrosion rate were identified for AA1100 aluminum alloy and reported here.

  4. The Effects of Welding Parameters on the Mechanical Properties on Laser Welding of AA2024

    OpenAIRE

    Adnan Akkurt; Aydın Şık; İsmail Ovalı

    2012-01-01

    In this study, the effects of laser welding parameters on the mechanical properties of AA2024 aluminum parts jointed with laser welding were investigated in the laser welding process this has been started using on joint of aluminum alloy. The reason preferring of AA2024 is that aluminum material has been widely used in aerospace and manufacturing industry. Laser power (kW), laser intensity (kW/mm2) and Pulse energy (j) were selectedas process parameters. For this reason, all samples were clas...

  5. Alkaline phosphatases and aminopeptidases are altered in a Cry11Aa resistant strain of Aedes aegypti.

    Science.gov (United States)

    Lee, Su-Bum; Aimanova, Karlygash G; Gill, Sarjeet S

    2014-11-01

    Bacillus thuringiensis subsp. israelensis (Bti) is widely used for the biological control of mosquito populations. However, the mechanism of Bti toxins is still not fully understood. To further elucidate the mechanism of Bti toxins, we developed an Aedes aegypti resistant strain that shows high-level resistance to Cry11Aa toxin. After 27 selections with Cry11Aa toxin, the larvae showed a 124-fold resistance ratio for Cry11Aa (strain G30). G30 larvae showed cross-resistance to Cry4Aa (66-fold resistance), less to Cry4Ba (13-fold), but not to Cry11Ba (2-fold). Midguts from these resistant larvae did not show detectable difference in the processing of the Cry11Aa toxin compared to that in susceptible larvae (WT). Brush border membrane vesicles (BBMV) from resistant larvae bound slightly less Cry11Aa compared to WT BBMV. To identify potential proteins associated with Cry11A resistance, not only transcript changes in the larval midgut were analyzed using Illumina sequencing and qPCR, but alterations of previously identified receptor proteins were investigated using immunoblots. The transcripts of 375 genes were significantly increased and those of 208 genes were down regulated in the resistant larvae midgut compared to the WT. None of the transcripts for previously identified receptors of Cry11Aa (Aedes cadherin, ALP1, APN1, and APN2) were altered in these analyses. The genes for the identified functional receptors in resistant larvae midgut did not contain any mutation in their sequences nor was there any change in their transcript expression levels compared to WT. However, ALP proteins were expressed at reduced levels (∼ 40%) in the resistant strain BBMV. APN proteins and their activity were also slightly reduced in resistance strain. The transcript levels of ALPs (AAEL013330 and AAEL015070) and APNs (AAEL008158, AAEL008162) were significantly reduced. These results strongly suggest that ALPs and APNs could be associated with Cry11Aa resistance in Ae. aegypti. PMID

  6. Numerical investigation on friction welding of alumina / AA 6063 T6 joints

    Science.gov (United States)

    Hynes, N. Rajesh Jesudoss; Velu, P. Shenbaga; Tharmaraj, R.; Kumar, R.

    2016-05-01

    Friction welding is the most suitable candidate for joining the dissimilar materials such as AA 6063 T6 alloy/Alumina for critical situations in high temperature and high corrosion resistance applications. In the present work, the numerical simulation was carried out to understand the mechanism of joining of AA 6063 T6 alloy/ Alumina rod by friction welding process. The developed thermo mechanical model is a highly nonlinear due to the interaction between the temperature fields and time dependent of the material properties. The developed numerical tool could be used to predict the temperature distribution, stress, strain and deformation of the dissimilar joints.

  7. Transition of basaltic lava from pahoehoe to aa, Kilauea Volcano, Hawaii: Field observations and key factors

    Science.gov (United States)

    Peterson, D.W.; Tilling, R.I.

    1980-01-01

    Nearly all Hawaiian basaltic lava erupts as pahoehoe, and some changes to aa during flowage and cooling; factors governing the transition involve certain critical relations between viscosity and rate of shear strain. If the lava slows, cools, and stops in direct response to concomitant increase in viscosity before these critical relations are reached, it remains pahoehoe. But, if flow mechanics (flow rate, flow dimensions, slope, momentum, etc.) impel the lava to continue to move and deform even after it has become highly viscous, the critical relations may be reached and the lava changes to aa. Typical modes of transition from pahoehoe to aa include: (1) spontaneous formation of relatively stiff clots in parts of the flowing lava where shear rate is highest; these clots grow into discrete, rough, sticky masses to which the remaining fluid lava incrementally adheres; (2) fragmentation and immersion of solid or semi-solid surface crusts of pahoehoe by roiling movements of the flow, forming cores of discrete, tacky masses; (3) sudden renewed movement of lava stored and cooled within surface reservoirs to form clots. The masses, fragments, and clots in these transition modes are characterized by spinose, granulated surfaces; as flow movement continues, the masses and fragments aggregate, fracture, and grind together, completing the transition to aa. Observations show that the critical relation between viscosity and rate of shear strain is inverse: if viscosity is low, a high rate of shear is required to begin the transition to aa; conversely, if viscosity is high, a much lower rate of shear will induce the transition. These relations can be demonstrated qualitatively with simple graphs, which can be used to examine the flow history of any selected finite lava element by tracing the path represented by its changing viscosity and shear rate. A broad, diffuse "transition threshold zone" in these graphs portrays the inverse critical relation between viscosity and shear

  8. Simulation on friction taper plug welding of AA6063-20Gr metal matrix composite

    Science.gov (United States)

    Hynes, N. Rajesh Jesudoss; Nithin, Abeyram M.

    2016-05-01

    Friction taper plug welding a variant of friction welding is useful in welding of similar and dissimilar materials. It could be used for joining of composites to metals in sophisticated aerospace applications. In the present work numerical simulation of friction taper plug welding process is carried out using finite element based software. Graphite reinforced AA6063 is modelled using the software ANSYS 15.0 and temperature distribution is predicted. Effect of friction time on temperature distribution is numerically investigated. When the friction time is increased to 30 seconds, the tapered part of plug gets detached and fills the hole in the AA6063 plate perfectly.

  9. Comparative Study for determination of iron content in soils by AAS and calorimetry. Estudio comparativo de la determinacion por AAS y colorimetria del contenido de hierro en suelos

    Energy Technology Data Exchange (ETDEWEB)

    Manuel-Vez, M.P.; Garcia-Vargas, M. (Universidad de Cadiz. Departamento de Qumica Analitica. Cadiz (Spain))

    1992-12-01

    In order to evaluate the accuracy and reliability of a new calorimetric method for the determination of iron in soils, a comparative study with atomic absorption spectrometry (AAS) was conducted. the first method results very selective and is based in the formation of a complex between the reactant picolinoilhidrazone of 2.2 dipiridilketone and Fe (II), of green color and stechiometry 2:1 (nm, and ''alpha''=7.0 x 10''3 1 mol''-4 cm''-1 in water ethanol solution). Soil samples were analysed by means of a AAS standard method. after data processing of the results obtained it could be concluded that both method led to results statistically equivalent. (Author).

  10. Fungal and bacterial utilization of organic substrates depends on substrate complexity and N availability.

    Science.gov (United States)

    Koranda, Marianne; Kaiser, Christina; Fuchslueger, Lucia; Kitzler, Barbara; Sessitsch, Angela; Zechmeister-Boltenstern, Sophie; Richter, Andreas

    2014-01-01

    There is growing evidence of a direct relationship between microbial community composition and function, which implies that distinct microbial communities vary in their functional properties. The aim of this study was to determine whether differences in initial substrate utilization between distinct microbial communities are due to the activities of certain microbial groups. We performed a short-term experiment with beech forest soils characterized by three different microbial communities (winter and summer community, and a community from a tree-girdling plot). We incubated these soils with different (13) C-labelled substrates with or without inorganic N addition and analyzed microbial substrate utilization by (13) C-phospholipid fatty acid (PLFA) analysis. Our results revealed that the fate of labile C (glucose) was similar in the three microbial communities, despite differences in absolute substrate incorporation between the summer and winter community. The active microbial community involved in degradation of complex C substrates (cellulose, plant cell walls), however, differed between girdling and control plots and was strongly affected by inorganic N addition. Enhanced N availability strongly increased fungal degradation of cellulose and plant cell walls. Our results indicate that fungi, at least in the presence of a high N supply, are the main decomposers of polymeric C substrates.

  11. Carbon nanotube substrates and catalyzed hot stamp for polishing and patterning the substrates

    Science.gov (United States)

    Wang, Yuhuang; Hauge, Robert H.; Schmidt, Howard K.; Kim, Myung Jong; Kittrell, W. Carter

    2009-09-08

    The present invention is generally directed to catalyzed hot stamp methods for polishing and/or patterning carbon nanotube-containing substrates. In some embodiments, the substrate, as a carbon nanotube fiber end, is brought into contact with a hot stamp (typically at 200-800.degree. C.), and is kept in contact with the hot stamp until the morphology/patterns on the hot stamp have been transferred to the substrate. In some embodiments, the hot stamp is made of material comprising one or more transition metals (Fe, Ni, Co, Pt, Ag, Au, etc.), which can catalyze the etching reaction of carbon with H.sub.2, CO.sub.2, H.sub.2O, and/or O.sub.2. Such methods can (1) polish the carbon nanotube-containing substrate with a microscopically smooth finish, and/or (2) transfer pre-defined patterns from the hot stamp to the substrate. Such polished or patterned carbon nanotube substrates can find application as carbon nanotube electrodes, field emitters, and field emitter arrays for displays and electron sources.

  12. Anisotropic artificial substrates for microwave applications

    Science.gov (United States)

    Shahvarpour, Attieh

    ) with very low-beam squint, which makes it particularly appropriate for applications in wide band point-to-point communication and radar systems. The antenna is constituted of a mushroom type anisotropic magneto-dielectric artificial grounded slab with uniaxially anisotropic permittivity and permeability tensors. A spectral transmission-line model based on Green functions approach is chosen for the analysis of the structure. A rigorous comparison between the isotropic and anisotropic leaky-wave antennas is performed which reveals that as opposed to anisotropic slabs, isotropic slabs show weak performance in leaky-wave antennas. The properties of planar antennas such as low profile, low cost, compatibility with integrated circuits and their conformal nature have made them appropriate antennas for communications systems. In parallel, bandwidth and miniaturization requirements have increased the demand for millimeter-wave wireless systems, such as radar, remote sensors and highspeed local area networks. However, as frequency increases towards millimeter-wave regime, the radiation efficiency of planar antennas becomes an important issue. This is due to the increased electrical thickness of the substrate and therefore increased number of the excited surface modes which carry part of the energy of the system in the substrate without any efficient contribution to radiation. Therefore, these antennas suffer from low radiation efficiency. This has motivated the third contribution of the thesis which is the interpretation and analysis of the radiation efficiency behavior of the planar antennas on electrically thick substrates. A novel substrate dipole approach is introduced for the explanation of the efficiency behavior. This dipole models the substrate and reduces the problem of the horizontal electric source on the substrate to an equivalent dipole radiating in the free-space. In addition, in this work, some efficiency enhancement solutions at the electrical thicknesses where

  13. New imaging technologies to characterize arrhythmic substrate.

    Directory of Open Access Journals (Sweden)

    Antonio Dello Russo, MD, PhD; Sergio Conti, MD; Ghaliah Al-Mohani, MD, Phd; Michela Casella, MD, PhD; Francesca Pizzamiglio, MD; Corrado Carbucicchio, MD; Stefania Riva, MD; Gaetano Fassini, MD; Massimo Moltrasio, MD; Fabrizio Tundo, MD, PhD; Martina Zucchetti, MD; Benedetta Majocchi, MD; Eleonora Russo, MD; Vittoria Marino, MD; Maria Antonietta Dessanai MD; Fabrizio Bologna, MD; Luigi Di Biase, MD, PhD; Andrea Natale, MD; Claudio Tondo , MD, PhD.

    2014-12-01

    Full Text Available Abstract The cornerstone of the new imaging technologies to treat complex arrhythmias is the electroanatomic (EAM mapping. It is based on tissue characterization and in particular on determination of low potential region and dense scar definition. Recently, the identification of fractionated isolated late potentials increased the specificity of the information derived from EAM. In addition, non-invasive tools and their integration with EAM, such as cardiac magnetic resonance imaging and computed tomography scanning, have been shown to be helpful to characterize the arrhythmic substrate and to guide the mapping and the ablation. Finally, intracardiac echocardiography, known to be useful for several practical uses in the setting of electrophysiological procedures, it has been also demonstrated to provide important informations about the anatomical substrate and may have potential to identify areas of scarred myocardium.

  14. Evaluation of substrates for butanol production

    Energy Technology Data Exchange (ETDEWEB)

    Compere, A.L.; Griffith, W.L.

    1979-01-01

    The production was evaluated of ethanol, acetone, and butanol from several different carbohydrate materials by five strains of Clostridia and two mixed cultures. The substrates, which were tested at concn ranging between 2.5 and 10% w/v, included pentoses, hexoses, disaccharides, and polysaccharides. The organisms used were Clostridium acetobutylicum strains NRRL B527 and NRRL B3179; Clostridium butylicum strains NRRL B592 and NRRL B593; and Clostridium pasteurianum strain NRRL B598. The mixed cultures contained all of these organisms. Mixed culture 1 contained in addition to the Clostridia, Klebsiella pneumoniae strain NRRL B427. Mixed culture 2 contained mixed culture 1 plus a yeast isolated from kefir culture. Where possible, maxima were found for the conversion of different substrates. 7 tables.

  15. Standard method for characterizing SERS substrates

    Science.gov (United States)

    Guicheteau, Jason A.; Hankus, Mikella E.; Christesen, Steven D.; Fountain, Augustus W., III; Pellegrino, Paul M.; Emmons, Erik D.; Tripathi, Ashish; Wilcox, Phillip; Emge, Darren

    2012-06-01

    We present the methodology and results of a standard assessment protocol to evaluate disparate SERS substrates that were developed for the Defense Advanced Research Programs Agency (DARPA) SERS Science and Technology Fundamentals Program. The results presented are a snapshot of a collaborative effort between the US Army Edgewood Chemical Biological Center, and the US Army Research Laboratory-Aldelphi Laboratory Center to develop a quantitative analytical method with spectroscopic figures of merit to unambiguously compare the sensitivity and reproducibility of various SERS substrates submitted by the program participants. We present the design of a common assessment protocol and the definition of a SERS enhancement value (SEV) in order to effectively compare SERS active surfaces.

  16. Lithographically patterned silicon nanostructures on silicon substrates

    Energy Technology Data Exchange (ETDEWEB)

    Megouda, Nacera [Institut de Recherche Interdisciplinaire (IRI, USR 3078), Universite Lille1, Parc de la Haute Borne, 50 Avenue de Halley-BP 70478, 59658 Villeneuve d' Ascq and Institut d' Electronique, de Microelectronique et de Nanotechnologie (IEMN, CNRS-8520), Cite Scientifique, Avenue Poincare-B.P. 60069, 59652 Villeneuve d' Ascq (France); Faculte des Sciences, Universite Mouloud Mammeri, Tizi-Ouzou (Algeria); Unite de Developpement de la Technologie du Silicium (UDTS), 2 Bd. Frantz Fanon, B.P. 140 Alger-7 merveilles, Alger (Algeria); Piret, Gaeelle; Galopin, Elisabeth; Coffinier, Yannick [Institut de Recherche Interdisciplinaire (IRI, USR 3078), Universite Lille1, Parc de la Haute Borne, 50 Avenue de Halley-BP 70478, 59658 Villeneuve d' Ascq and Institut d' Electronique, de Microelectronique et de Nanotechnologie (IEMN, CNRS-8520), Cite Scientifique, Avenue Poincare-B.P. 60069, 59652 Villeneuve d' Ascq (France); Hadjersi, Toufik, E-mail: hadjersi@yahoo.com [Unite de Developpement de la Technologie du Silicium (UDTS), 2 Bd. Frantz Fanon, B.P. 140 Alger-7 merveilles, Alger (Algeria); Elkechai, Omar [Faculte des Sciences, Universite Mouloud Mammeri, Tizi-Ouzou (Algeria); and others

    2012-06-01

    The paper reports on controlled formation of silicon nanostructures patterns by the combination of optical lithography and metal-assisted chemical dissolution of crystalline silicon. First, a 20 nm-thick gold film was deposited onto hydrogen-terminated silicon substrate by thermal evaporation. Gold patterns (50 {mu}m Multiplication-Sign 50 {mu}m spaced by 20 {mu}m) were transferred onto the silicon wafer by means of photolithography. The etching process of crystalline silicon in HF/AgNO{sub 3} aqueous solution was studied as a function of the silicon resistivity, etching time and temperature. Controlled formation of silicon nanowire arrays in the unprotected areas was demonstrated for highly resistive silicon substrate, while silicon etching was observed on both gold protected and unprotected areas for moderately doped silicon. The resulting layers were characterized using scanning electron microscopy (SEM).

  17. On field emission from a semiconducting substrate

    Science.gov (United States)

    Waters, Richard; Van Zeghbroeck, Bart

    1999-10-01

    A theoretical examination of field emission from the conduction band of a semiconducting substrate is reported. The analysis includes a comparison with Fowler-Nordheim theory, and it is concluded that the formalism of the Fowler-Nordheim theory is incorrect when applied to carriers originating from a semiconducting substrate. The use of a Fowler-Nordheim analysis results in an error in the extraction of the barrier height that is dependent upon the applied electric field across the oxide, conduction band offset, and temperature. A lower limit of the error was calculated to be between 5% and 15%. An analytical expression is developed to describe the field emission of electrons from the conduction band of a semiconductor.

  18. Optical substrate materials for synchrotron radiation beamlines

    International Nuclear Information System (INIS)

    The authors consider the materials choices available for making optical substrates for synchrotron radiation beam lines. They find that currently the optical surfaces can only be polished to the required finish in fused silica and other glasses, silicon, CVD silicon carbide, electroless nickel and 17-4 PH stainless steel. Substrates must therefore be made of one of these materials or of a metal that can be coated with electroless nickel. In the context of material choices for mirrors they explore the issues of dimensional stability, polishing, bending, cooling, and manufacturing strategy. They conclude that metals are best from an engineering and cost standpoint while the ceramics are best from a polishing standpoint. They then give discussions of specific materials as follows: silicon carbide, silicon, electroless nickel, Glidcop trademark, aluminum, precipitation-hardening stainless steel, mild steel, invar and superinvar. Finally they summarize conclusions and propose ideas for further research

  19. A cellular glass substrate solar concentrator

    Science.gov (United States)

    Bedard, R.; Bell, D.

    1980-01-01

    The design of a second generation point focusing solar concentration is discussed. The design is based on reflective gores fabricated of thin glass mirror bonded continuously to a contoured substrate of cellular glass. The concentrator aperture and structural stiffness was optimized for minimum concentrator cost given the performance requirement of delivering 56 kWth to a 22 cm diameter receiver aperture with a direct normal insolation of 845 watts sq m and an operating wind of 50 kmph. The reflective panel, support structure, drives, foundation and instrumentation and control subsystem designs, optimized for minimum cost, are summarized. The use of cellular glass as a reflective panel substrate material is shown to offer significant weight and cost advantages compared to existing technology materials.

  20. Polarimetric characterization of optically anisotropic flexible substrates

    Energy Technology Data Exchange (ETDEWEB)

    Stchakovsky, M. [HORIBA Jobin-Yvon SAS, Z.A. de la Vigne aux Loups, 5 Avenue Arago, 91380 Chilly-Mazarin (France)], E-mail: michel.stchakovsky@jobinyvon.fr; Caillaud, C. [HORIBA Jobin-Yvon SAS, Z.A. de la Vigne aux Loups, 5 Avenue Arago, 91380 Chilly-Mazarin (France); Foldyna, M.; Ossikovski, R.; Garcia-Caurel, E. [Laboratoire de Physique des Interfaces et des Couches Minces, Ecole Polytechnique, 91128 Palaiseau (France)

    2008-02-15

    Phase Modulated Spectroscopic Ellipsometry as well as Liquid Crystal Mueller Matrix Polarimetry in reflection and in transmission configurations were used to systematically study five types of anisotropic polymer sheets: polyethylene-terephtalate (PET), polyethylene-naphtalate (PEN), polycarbonate (PC), polypropylene (PP) and triacetylcellulose (TAC). The measurements were performed at different sample azimuths in two ellipsometric configurations giving access to both standard ellipsometric data as well as to the entire Mueller matrix. Biaxial anisotropy, a common characteristic to all polymer types, as well as the in-depth optical properties, inhomogeneity present in the sheets were clearly evidenced. The data were interpreted in terms of a model consisting of a thick substrate (several microns) coated with a simple layer. Both, substrate and layer were anisotropic and characterized by a triplet of principal refractive indexes. The orientation of the principal indexes of the bulk and the layer were different revealing the in-depth inhomogeniety of the samples.