
Sample records for aa 2024-t3 substrate

  1. Corrosion of AA2024-T3 Part III: Propagation

    International Nuclear Information System (INIS)

    Research highlights: → Corrosion of AA2024 in 0.1 M NaCl was examined for immersion times up to 120 min. → Rings of corrosion product with H2 evolution developed after 5 min immersion. → Intergranular attack penetrated up to 60 μm below the rings within 120 min. → After 240 min mixed intergranular attack and grain etchout were observed. - Abstract: Optical and electron microscopies and EBSD were used to study the early stages of corrosion propagation during stable pit formation on AA2024-T3. Polished AA2024-T3 developed large scale rings of corrosion product, typically a few hundred microns in diameter, within 2 h of exposure to 0.1 M NaCl at room temperature. These features were sectioned using diamond ultramicrotomy and substantial subsurface attack, in the form of intergranular corrosion was observed beneath these sites with virtually no grain etchout. A model is proposed for the mechanism of stable pit progression which involves extensive grain boundary attack, followed by grain etchout leading to open pit formation.

  2. Corrosion protection of AA 2024-T3 by bis-[3-(triethoxysilyl)propyl]tetrasulfide in neutral sodium chloride solution. Part 1: corrosion of AA 2024-T3

    International Nuclear Information System (INIS)

    This study consists of two parts. In the first part, the corrosion of 2024-T3 aluminum alloy (AA 2024-T3) was studied using scanning electron microscopy and energy-dispersive X-ray spectroscopy. The results showed that the anodic S phase (Al2CuMg) particles dealloyed Al and Mg during the 3.5 h of immersion in a neutral 0.6 M sodium chloride (NaCl) solution; with the dealloying of Mg being the most severe. Simultaneously, a heavy dissolution was also observed for the surrounding Al matrix of the S phase particles. This Al dissolution is likely to be caused by a local alkalization resulting from the coupled cathodic reaction (water and/or oxygen reduction). Such corrosion in AA 2024-T3, however, can be inhibited efficiently after the treatment of bis-[3-(triethoxysilyl)propyl]tetrasulfide (bis-sulfur silane). The associated studies on bis-sulfur silane treated AA 2024-T3 will be presented in the second part

  3. Corrosion protection of AA 2024-T3 by bis-[3-(triethoxysilyl)propyl]tetrasulfide in neutral sodium chloride solution. Part 1: corrosion of AA 2024-T3

    Energy Technology Data Exchange (ETDEWEB)

    Zhu Danqing; Ooij, Wim J. van


    This study consists of two parts. In the first part, the corrosion of 2024-T3 aluminum alloy (AA 2024-T3) was studied using scanning electron microscopy and energy-dispersive X-ray spectroscopy. The results showed that the anodic S phase (Al{sub 2}CuMg) particles dealloyed Al and Mg during the 3.5 h of immersion in a neutral 0.6 M sodium chloride (NaCl) solution; with the dealloying of Mg being the most severe. Simultaneously, a heavy dissolution was also observed for the surrounding Al matrix of the S phase particles. This Al dissolution is likely to be caused by a local alkalization resulting from the coupled cathodic reaction (water and/or oxygen reduction). Such corrosion in AA 2024-T3, however, can be inhibited efficiently after the treatment of bis-[3-(triethoxysilyl)propyl]tetrasulfide (bis-sulfur silane). The associated studies on bis-sulfur silane treated AA 2024-T3 will be presented in the second part.

  4. Cerium tartrate as a corrosion inhibitor for AA 2024-T3

    International Nuclear Information System (INIS)

    Highlights: • Cerium tartrate was found to be an effective inhibitor for AA 2024-T3. • Both anodic and cathodic inhibitions were present during the corrosion process. • The corrosion of Al2CuMg phase was well inhibited by cerium tartrate. - Abstract: A new corrosion inhibitor, cerium tartrate, was synthetized. The inhibition behavior of cerium tartrate for 2024-T3 aluminum alloy was investigated in 0.05 M NaCl solution. The immersion tests indicate that the corrosion of Al2CuMg phase was well inhibited. The electrochemical results show that both anodic and cathodic inhibitions are present during the corrosion process. The surface characterizations reveal that the protective film of cerium tartrate inhibits the dealloying of Al2CuMg phase in the initial stage, and then cerium ions transform to cerium oxide/hydroxides and appear at the Al2CuMg phase, blocking the further corrosion at those corrosion sites

  5. Blister Test for Measurements of Adhesion and Adhesion Degradation of Organic Polymers on AA2024-T3 (United States)

    Rincon Troconis, Brendy Carolina

    A key parameter for the performance of corrosion protective coatings applied to metals is adhesion. Surface preparation prior to coating application is known to be critical, but there is a lack of understanding of what controls adhesion. Numerous techniques have been developed in the last decades to measure the adhesion strength of coatings to metals. Nonetheless, they are generally non-quantitative, non-reproducible, performed in dry conditions, or overestimate adhesion. In this study, a quantitative and reproducible technique, the Blister Test (BT), is used. The BT offers the ability to study the effects of a range of parameters, including the presence or absence of a wetting liquid, and simulates the stress situation in the coating/substrate interface. The effects of roughness and surface topography were studied by the BT and Optical Profilometry, using AA2024-T3 substrates coated with polyvinyl butyral (PVB). Random abrasion generated a surface with lower average roughness than aligned abrasion due to the continual cross abrasion of the grooves. The BT could discern the effects of different mechanical treatments. An adhesion strength indicator was defined and found to be a useful parameter. The effectiveness of standard adhesion techniques such as ASTM D4541 (Pull-off Test) and ASTM D3359 (Tape Test) was compared to the BT. Also, different attempts to measure adhesion and adhesion degradation of organic polymers to AA2024-T3 were tested. The pull-off test does not produce adhesive failure across the entire interface, while the tape test is a very qualitative technique and does not discern between the effects of different coating systems on the adhesion performance. The BT produces adhesive failure of the primer studied, is very reproducible, and is able to rank different coating systems. Therefore, it was found to be superior to the others. The approaches tested for adhesion degradation were not aggressive enough to have a measurable effect. The effects of

  6. The corrosion protection of AA2024-T3 aluminium alloy by leaching of lithium-containing salts from organic coatings. (United States)

    Visser, Peter; Liu, Yanwen; Zhou, Xiaorong; Hashimoto, Teruo; Thompson, George E; Lyon, Stuart B; van der Ven, Leendert G J; Mol, Arjan J M C; Terryn, Herman A


    Lithium carbonate and lithium oxalate were incorporated as leachable corrosion inhibitors in model organic coatings for the protection of AA2024-T3. The coated samples were artificially damaged with a scribe. It was found that the lithium-salts are able to leach from the organic coating and form a protective layer in the scribe on AA2024-T3 under neutral salt spray conditions. The present paper shows the first observation and analysis of these corrosion protective layers, generated from lithium-salt loaded organic coatings. The scribed areas were examined by scanning and transmission electron microscopy before and after neutral salt spray exposure (ASTM-B117). The protective layers typically consist of three different layered regions, including a relatively dense layer near the alloy substrate, a porous middle layer and a flake-shaped outer layer, with lithium uniformly distributed throughout all three layers. Scanning electron microscopy and white light interferometry surface roughness measurements demonstrate that the formation of the layer occurs rapidly and, therefore provides an effective inhibition mechanism. Based on the observation of this work, a mechanism is proposed for the formation of these protective layers. PMID:25927079

  7. Growth of PEO ceramic coatings on AA 2024-T3 aluminium alloy (United States)

    Forero Sotomonte, S.; Blanco Pinzon, C.; García Vergara, S.


    The growth of PEO ceramic coatings on AA 2024-T3 aluminium alloy in an aqueous Na2SiO3 (10.5g/l), KOH (2.8g/l) solution at 310 and 400V for 500 and 710s, was investigated. The morphology, roughness and thickness of the coatings were determined by SEM, digital microscopy, XRD diffraction analysis and thickness measuring instrument. The results show that thicker coatings are produced with longer process times and high applied voltages. Due to the nature of the PEO process, the roughness of the surface coatings increases as the coating become thicker, due to the development of sparks. The coatings are porous, with a crater like morphology and they are mainly amorphous.

  8. Integrated FEM-DBEM simulation of crack propagation in AA2024-T3 FSW butt joints considering manufacturing effects

    DEFF Research Database (Denmark)

    Sonne, Mads Rostgaard; Carlone, P.; Citarella, R.;


    This paper deals with a numerical and experimental investigation on the influence of residual stresses on fatigue crack growth in AA2024-T3 friction stir welded butt joints. An integrated FEM-DBEM procedure for the simulation of crack propagation is proposed and discussed. A numerical FEM model of...... the welding process of precipitation hardenable AA2024-T3 aluminum alloy is employed to infer the process induced residual stress field. The reliability of the FEM simulations with respect to the induced residual stresses is assessed comparing numerical outcomes with experimental data obtained by...... means of the contour method. The computed stress field is transferred to a DBEM environment and superimposed to the stress field produced by a remote fatigue traction load applied on a friction stir welded cracked specimen. Numerical results are compared with experimental data showing good agreement and...

  9. The influence of rare earth mercaptoacetate on the initiation of corrosion on AA2024-T3 Part II: The influence of intermetallic compositions within heavily attacked sites

    International Nuclear Information System (INIS)

    Highlights: • Effect of intermetallic clustering was investigated on the surface of AA2024-T3. • Both rare earth mercaptoacetate inhibitors stifled the corrosion ring formation. • Surface area and the number of domains were critical for severely corroded sites. • Most clustered sites were not always the most severely attacked sites. - Abstract: Localised corrosion is typical on AA2024-T3 due to intermetallic particles embedded in the alloy. The effect of intermetallic compositions on corrosion are not yet fully understood. EPMA data on AA2024-T3 surfaces before and after a 16 min immersion, analyses the influence of intermetallic clustering on the severity attack at local sites. While sites with a high number of domains and a large S-phase surface area typically lead to severe attack, maximising these features did not always lead to severe corrosion attack. Cerium or praseodymium mercaptoacetate inhibited corrosion ring formation. The common trends observed from such attack sites was also discussed

  10. Evolution of the corrosion process of AA 2024-T3 in an alkaline NaCl solution with sodium dodecylbenzenesulfonate and lanthanum chloride inhibitors (United States)

    Zhou, Biner; Wang, Yishan; Zuo, Yu


    The evolution of the corrosion process of AA 2024-T3 in 0.58 g L-1 NaCl solution (pH 10) with sodium dodecylbenzenesulfonate (SDBS) and lanthanum chloride inhibitors was studied with electrochemical and surface analysis methods. With the addition of the compounded LaCl3 and SDBS inhibitors, in the early stage the polarization behavior of AA 2024-T3 changed from active corrosion to passivation, and both the general corrosion and pitting corrosion were inhibited. However, with the immersion time extended, the passive behavior gradually disappeared and pitting happened at the Cu-rich phases. After 24 h immersion, the compounded inhibitors still showed good inhibition for general corrosion, but the polarization curve again presented the characteristic similar to active polarization. The compounded inhibitors also inhibited the pitting corrosion to some extent. The acting mechanism of the inhibitors SDBS and La3Cl on the corrosion process of AA 2024-T3 in the test solution was discussed.

  11. The influence of rare earth mercaptoacetate on the initiation of corrosion on AA2024-T3 Part I: Average statistics of each intermetallic composition

    International Nuclear Information System (INIS)

    Highlights: • The effect of intermetallic clustering was investigated on the surface of AA2024-T3. • Both rare earth mercaptoacetate inhibitors stifled the de-alloying process of S-phase. • Each intermetallic particle type appeared to participate in local corrosion reactions. • There was some level of clustering between S-phase and other intermetallic particle types within a 25 μm radius. - Abstract: De-alloying of S-phase in AA2024-T3 in the presence chlorides, is well-known. However, it is unclear how rare earth mercaptoacetate inhibitors affect this process when immersed in a 0.1 M NaCl solution. This paper analyses data obtained using EPMA on AA2024-T3 surfaces before and after a 16 min immersion period. Cerium and praseodymium mercaptoacetate inhibited the de-alloying process of S-phase particles. Although no significant change in composition was observed for cathodic intermetallics, each appeared to participate in local corrosion reactions as evidenced by the development of surface oxides. Clustering between S-phase and one of the Cu-containing intermetallic domains was also evident

  12. Electro-assisted preparation of dodecyltrimethoxysilane/TiO{sub 2} composite films for corrosion protection of AA2024-T3 (aluminum alloy)

    Energy Technology Data Exchange (ETDEWEB)

    Li Mei; Yang Yaqin; Liu Liang [Department of Chemistry, Zhejiang University, Hangzhou 310027 (China); Hu Jiming, E-mail: [Department of Chemistry, Zhejiang University, Hangzhou 310027 (China); Zhang Jianqing [Department of Chemistry, Zhejiang University, Hangzhou 310027 (China)


    Thin films of organosilanes have been successfully used as the alternative to toxic chromate coatings for surface pretreatment of metals and alloys. To further improve their corrosion performance, in the present work nano-scaled TiO{sub 2} particles were added to the dodecyltrimethoxysilane (DTMS) films coated onto AA2024-T3 substrates, by using either the dip-coating or the cathodically electro-assisted deposition process. The obtained composite films were investigated by scanning electron microscopy (SEM), atomic force microscopy (AFM), water contact angle measurements, Fourier transform reflection-absorption IR (FTRA-IR) and electrochemical impedance spectroscopy (EIS). The results show that these two techniques (nanoparticles incorporation and the electro-assisted deposition) both facilitate the deposition process of silane films, giving thicker deposit and higher coverage surface along with higher roughness and hydrophobicity, and thereby improve their corrosion resistance. Moreover, the corrosion performance of silane films is further improved by the combined use of nanoparticles modification and electro-assisted deposition.

  13. Electro-assisted preparation of dodecyltrimethoxysilane/TiO2 composite films for corrosion protection of AA2024-T3 (aluminum alloy)

    International Nuclear Information System (INIS)

    Thin films of organosilanes have been successfully used as the alternative to toxic chromate coatings for surface pretreatment of metals and alloys. To further improve their corrosion performance, in the present work nano-scaled TiO2 particles were added to the dodecyltrimethoxysilane (DTMS) films coated onto AA2024-T3 substrates, by using either the dip-coating or the cathodically electro-assisted deposition process. The obtained composite films were investigated by scanning electron microscopy (SEM), atomic force microscopy (AFM), water contact angle measurements, Fourier transform reflection-absorption IR (FTRA-IR) and electrochemical impedance spectroscopy (EIS). The results show that these two techniques (nanoparticles incorporation and the electro-assisted deposition) both facilitate the deposition process of silane films, giving thicker deposit and higher coverage surface along with higher roughness and hydrophobicity, and thereby improve their corrosion resistance. Moreover, the corrosion performance of silane films is further improved by the combined use of nanoparticles modification and electro-assisted deposition.

  14. A combinatorial matrix of rare earth chloride mixtures as corrosion inhibitors of AA2024-T3: Optimisation using potentiodynamic polarisation and EIS

    International Nuclear Information System (INIS)

    A combinatorial matrix of four rare earth chlorides has been evaluated for the corrosion inhibition of aluminium alloy AA2024-T3 in aqueous solution. Two electrochemical techniques, potentiodynamic polarisation (PP) and electrochemical impedance spectroscopy (EIS), were used to evaluate AA2024-T3 corrosion in 0.1 M NaCl with the addition of 10−3 M of rare earth chloride mixtures at time periods up to 18 h. PP experiments showed rare earth inhibition of up to 98% within the first hour and thereafter corrosion rates were steadily decreased. The open-circuit potential (OCP) of AA2024-T3 decreased as a function of time for all solutions indicating predominantly cathodic inhibition. However, differing trends in the OCP were observed during PP and EIS experiments and are discussed in terms of likely time-dependent mechanisms. A comparative study of optimisation models indicated the best mixture at 10−3 M total inhibitor concentration was predicted to be 72% cerium (Ce) and 28% (praseodymium (Pr)/lanthanum (La)) ions. As the amount of Ce is decreased from this level the corrosion inhibition is predicted to decrease also, regardless of what other rare earths (La, Pr and Nd) are added alone or in combination. Individually, La, Pr and Nd show varying levels of corrosion inhibition activity, all of which are inferior to that of Ce. If Ce is absent entirely, then a mixture of approximately 50% Pr and 50% Nd is predicted to be preferred. This is one of the first applications of combinatorial design for the optimisation of corrosion inhibitor mixtures.

  15. The role of Mg2+ ions in the corrosion behaviour of AA2024-T3 aluminium alloys immersed in chloride-containing environments

    International Nuclear Information System (INIS)

    It is well-known the harmful impact of chloride ions in the corrosion behaviour of aluminium and its alloys. The present work investigates the use of Mg2+ ions as corrosion inhibitors of AA2024-T3 samples immersed in chloride-containing electrolytes. AA2024-T3 samples were immersed into an electrolyte containing chloride ions, in absence or presence of Mg2+. The electrochemical behaviour was studied by potentiondynamic polarization and electrochemical impedance spectroscopy techniques. The results showed the beneficial effects afforded by the Mg2+ ions. First, the open circuit potential was shifted towards more cathodic values and, on the other hand, the impedance values obtained for samples tested in presence of Mg2+ were higher, suggesting a slowdown of the corrosion rate. The morphological characterization was performed using scanning electron microscopy and energy dispersive X-ray spectroscopy. The results demonstrated that the presence Mg2+ hinders Mg dealloying of the S phase particles, which delays their change from anodic to cathodic behaviour, so delaying the subsequent Al matrix galvanic attack. An additional protection mechanism is related to the blockage of cathodic areas by the precipitation of Mg(OH)2 in alkaline environments

  16. Protective film formation on AA2024-T3 aluminum alloy by leaching of lithium carbonate from an organic coating

    NARCIS (Netherlands)

    Liu, Y.; Visser, P.; Zhou, X.; Lyon, S.B.; Hashimoto, T.; Curioni, M.; Gholinia, A.; Thompson, G.E.; Smyth, G.; Gibbon, S.R.; Graham, D.; Mol, J.M.C.; Terryn, H.A.


    An investigation into corrosion inhibition properties of a primer coating containing lithium carbonate as corrosion inhibitive pigment for AA2024 aluminum alloy was conducted. It was found that, during neutral salt spray exposure, a protective film of about 0.2 to 1.5 μm thickness formed within the

  17. Protective film formation on AA2024-T3 aluminum alloy by leaching of lithium carbonate from an organic coating


    Liu, Y.; Visser, P; Zhou, X.; Lyon, S B; Hashimoto, T; Curioni, M.; Gholinia, A.; Thompson, G. E.; Smyth, G.; Gibbon, S.R.; Graham, D; Mol, J.M.C.; Terryn, H.A.


    An investigation into corrosion inhibition properties of a primer coating containing lithium carbonate as corrosion inhibitive pigment for AA2024 aluminum alloy was conducted. It was found that, during neutral salt spray exposure, a protective film of about 0.2 to 1.5 μm thickness formed within the area where an artificial defect was introduced by scribing through the coating to the base alloy. This film showed a multilayered structure consisting of a relatively compact layer near the alloy s...

  18. Protective Film Formation on AA2024-T3 Aluminum Alloy by Leaching of Lithium Carbonate from an Organic Coating


    Yanwen Liu, Peter Visser, Xiaorong Zhou, Stuart B. Lyon, Teruo Hashimoto, Michele Curioni, Ali Gholinia, George E. Thompson, Gerard Smyth, Simon R. Gibbon, Derek Graham, Johannes M. C. Mol, and Herman Terryn


    An investigation into corrosion inhibition properties of a primer coating containing lithium carbonate as corrosion inhibitive pigment for AA2024 aluminum alloy was conducted. It was found that, during neutral salt spray exposure, a protective film of about 0.2 to 1.5 μm thickness formed within the area where an artificial defect was introduced by scribing through the coating to the base alloy. This film showed a multilayered structure consisting of a relatively compact layer near the alloy ...

  19. Análisis numérico de la conformabilidad de chapas de AA2024 - T3 en procesos de conformado incremental mono - punto usando DEFORM - 3D


    Candel Carreras, Zoila


    El método de los elementos finitos es un método numérico muy usado en ingeniería para la resolución de problemas complejos . DEFORM™ - 3D es un software de elementos finitos de carácter robusto y basado en cálculo implícito, que tiene además una gran aplicación industrial. En este Trabajo de Fin de Grado se ha modelado en DEFORM™ - 3D un proceso de conformado incremental mono - punto o SPIF (del inglés Single Point Incremental Forming ) para chapas de aleación de aluminio AA2024 - T3, con obj...

  20. On the coupling between precipitation and plastic deformation in relation with friction stir welding of AA2024 T3 aluminium alloy

    Energy Technology Data Exchange (ETDEWEB)

    Genevois, Cecile [LTPCM, CNRS UMR 5614, Institut National Polytechnique de Grenoble, BP 75, 38 402 St. Martin d' Heres Cedex (France); Fabregue, Damien [LTPCM, CNRS UMR 5614, Institut National Polytechnique de Grenoble, BP 75, 38 402 St. Martin d' Heres Cedex (France); Deschamps, Alexis [LTPCM, CNRS UMR 5614, Institut National Polytechnique de Grenoble, BP 75, 38 402 St. Martin d' Heres Cedex (France)]. E-mail:; Poole, Warren J. [Department of Metals and Materials Engineering, University of British Columbia, Vancouver (Canada)


    We have investigated the influence of plastic deformation on the precipitation kinetics of the S'(S) phase in the AA2024 aluminium alloy, with the objective of understanding the microstructures found in friction stir welds of the same alloy. Different types of thermo-mechanical treatments have been investigated, where plastic deformation has been carried out either before heating in a salt bath, or concurrently with the thermal treatment in a Gleeble compression apparatus. The volume fraction of precipitates has been measured by differential scanning calorimetry and the precipitate morphology has been observed by transmission electron microscopy. It is observed that plastic deformation increases the precipitation kinetics in the temperature range below 300 deg. C. This can be attributed both to the increase in the number of nucleation sites and to the increase in the effective diffusion coefficient. At higher temperatures the influence of plasticity on the volume fraction is negligible, however, in the presence of deformation during the heat treatment, the precipitate morphology is profoundly modified. The effect of plastic deformation is observed to be similar, whether plastic deformation is carried out before or during the heat treatment. These results are shown to be valuable tools in understanding the microstructures of friction stir welds of the same material. It is shown that taking into account the effect of plastic deformation is not absolutely necessary in the thermo-mechanically affected zone. However, we show that the precipitate microstructure in some parts of the heat-affected zone is strongly influenced by a small amount of plasticity.

  1. On the coupling between precipitation and plastic deformation in relation with friction stir welding of AA2024 T3 aluminium alloy

    International Nuclear Information System (INIS)

    We have investigated the influence of plastic deformation on the precipitation kinetics of the S'(S) phase in the AA2024 aluminium alloy, with the objective of understanding the microstructures found in friction stir welds of the same alloy. Different types of thermo-mechanical treatments have been investigated, where plastic deformation has been carried out either before heating in a salt bath, or concurrently with the thermal treatment in a Gleeble compression apparatus. The volume fraction of precipitates has been measured by differential scanning calorimetry and the precipitate morphology has been observed by transmission electron microscopy. It is observed that plastic deformation increases the precipitation kinetics in the temperature range below 300 deg. C. This can be attributed both to the increase in the number of nucleation sites and to the increase in the effective diffusion coefficient. At higher temperatures the influence of plasticity on the volume fraction is negligible, however, in the presence of deformation during the heat treatment, the precipitate morphology is profoundly modified. The effect of plastic deformation is observed to be similar, whether plastic deformation is carried out before or during the heat treatment. These results are shown to be valuable tools in understanding the microstructures of friction stir welds of the same material. It is shown that taking into account the effect of plastic deformation is not absolutely necessary in the thermo-mechanically affected zone. However, we show that the precipitate microstructure in some parts of the heat-affected zone is strongly influenced by a small amount of plasticity

  2. Characterization of 2024-T3: An aerospace aluminum alloy

    International Nuclear Information System (INIS)

    The 2024-T3 aerospace aluminum alloy, reported in this investigation, was acquired from a local aerospace industry: Royal Malaysian Air Force (RMAF). The heat treatable 2024-T3 aluminum alloy has been characterized by use of modern metallographic and material characterization techniques (e.g. EPMA, SEM). The microstructural characterization of the metallographic specimen involved use of an optical microscope linked with a computerized imaging system using MSQ software. The use of EPMA and electron microprobe elemental maps enabled us to detect three types of inclusions: Al-Cu, Al-Cu-Fe-Mn, and Al-Cu-Fe-Si-Mn enriched regions. In particular, the presence of Al2CuMg (S-phase) and the CuAl2 (θ') phases indicated precipitation strengthening in the aluminum alloy


    Institute of Scientific and Technical Information of China (English)

    Tang Chak-yin; Fan Jianping; Tsui Chi-pong; Lee Tai-chiu; Chan Luen-chow; Rao Bin


    Shear damage may occur in the process of metal machining such as blanking and cutting, where localized shear deformation is developed. Experimental findings indicate that microscopic shear damage evolution in aluminium alloy 2024T3 (Al 2024T3) is a multi-stage mechanism, including particle cracking, micro-shear banding, matrix microcracking and coalescence of microcracks. This study is an attempt to use a set of equations to describe the multi-stage shear damage evolution in Al 2024T3. The shear damage variables in terms of multi-couple parameters of a power-law hardening material have been defined. An evolution curve of shearing damage has been calculated from experimental data. The values of the shear damage variable at different stages of damage have also been calculated. By making use of the findings, the relation between the microscopic shear damage evolution and the macroscopic shear response of the material has been discussed.

  4. Corrosion behaviour of sol-gel coatings doped with cerium salts on 2024-T3 aluminum alloy

    Energy Technology Data Exchange (ETDEWEB)

    Shi Hongwei; Liu Fuchun [State Key Laboratory for Corrosion and Protection, Institute of Metal Research, Chinese Academy of Sciences, Shenyang 110016 (China); Han Enhou, E-mail: [State Key Laboratory for Corrosion and Protection, Institute of Metal Research, Chinese Academy of Sciences, Shenyang 110016 (China)


    The corrosion behaviour of the sol-gel coatings doped with cerium chloride or cerium nitrate on 2024-T3 aluminum alloy was investigated by using electrochemical impedance spectroscopy (EIS) and immersion tests. The sol-gel matrix was obtained through hydrolysis, condensation of 3-glycidoxypropyltrimethoxysilane (GPTMS) and tetramethoxysilane (TMOS), using diethylentriamine as curing agent. The results indicated that cerium nitrate with concentration of 1 x 10{sup -3} mol L{sup -1} in the silane solution was excellent on self-healing for the sol-gel coating, while cerium chloride had no obvious effect. This result suggested that the introduction of Cl{sup -} promoted the under-film pitting of 2024-T3 substrate. It was found that Ce(OH){sub 3} and Ce(OH){sub 2}{sup 2+} simultaneously existed in the silane solution by X-ray diffraction (XRD) analysis. Ce(OH){sub 2}{sup 2+} transformed to CeO{sub 2} due to high-temperature curing of sol-gel matrix demonstrated by X-ray photoelectron spectroscopy (XPS) analysis. Therefore, it can be considered that Ce(OH){sub 3} and CeO{sub 2} played inhibition roles in the corrosion process of the sol-gel coatings.

  5. A room temperature cured sol-gel anticorrosion pre-treatment for Al 2024-T3 alloys

    International Nuclear Information System (INIS)

    The inherent reactivity of the Al-Cu alloys is such that their use for structural, marine, and aerospace components and structures would not be possible without prior application of a corrosion protection system. Historically these corrosion protection systems have been based upon the use of chemicals containing Cr(VI) compounds. Organic-inorganic hybrid silane coatings are of increasing interest in industry due to their potential application for the replacement of current toxic hexavalent chromate based treatments. In the present study, a hybrid epoxy-silica-alumina coating with or without doped cerium nitrate has been prepared using a sol-gel method. The hybrid coatings were applied by a dip-technique to an Al-Cu alloy, Al 2024-T3, and subsequently cured at room temperature. The anticorrosion properties of the coatings within 3.5% NaCl were studied using electrochemical impedance spectroscopy (EIS), and conventional DC polarisation. An exfoliation test method involving immersion in a solution of 4 M NaCl, 0.5 M KNO3 and 0.1 M HNO3 was also used. The cerium nitrate doped sol-gel coating exhibited excellent anticorrosion properties providing an adherent protection film on the Al 2024-T3 substrate. The resistance to corrosion of the sol-gel coating was also evaluated by analysing the morphology of the coating before and after corrosion testing using scanning electron microscopy

  6. Etude du soudage TIG de l'alliage d'aluminium 2024-T3


    OUALLAM, Seddik; MASSE, Jean-Eric; DJEGHLAL, Lamine; Barrallier, Laurent; KABBA, L


    Recent programs of aircraft design are characterized in terms of materials, by introducing weldable alloys as alternatives to the traditional technique of riveting, open the way to reduce weight and allow cost reductions in production and maintenance. Understanding the influence of various parameters of TIG welding process applied to the alloy 2024-T3 aluminum should help us to take into account the behavior in service of assemblies, from the design of structures. This work deals with the def...

  7. Effect of aging time and temperature on exfoliation corrosion of aluminum alloys 2024-T3 and 7075-T6

    Energy Technology Data Exchange (ETDEWEB)

    Khoshnaw, F.M.; Gardi, R.H. [Wolfson School of Mechanical and Manufacturing Engineering Loughborough University, Loughborough, LE11 3TU Leicestershire (United Kingdom)


    Two types of aluminum alloys, 2024-T3 and 7075-T6, have been selected in this study to investigate the effect of metallurgical aspects on exfoliation corrosion. To determine and evaluate the metallurgical effects of heat treatments on corrosion behaviour of these alloys, G34 ASTM test was selected to investigate the exfoliation corrosion behaviour. The results showed that with increasing the aging time for the aluminum alloy type 2024-T3 the susceptibility to exfoliation corrosion increases, while for type 7075-T6 decreased. These results refer to precipitation of the intermetallic compound phases such as CuAl{sub 2}, and MgZn{sub 2}, in 2024-T3 and 7075-T6 respectively. The amount of these phases increases with increasing the aging time for both alloys. The investigations showed the phases that initiate in 2024-T3 act as anode sites while in 7075-T6 they act as cathode sites. (Abstract Copyright [2007], Wiley Periodicals, Inc.)

  8. Determination of anisotropy in impact toughness of aluminium alloy 2024 T3 plate (United States)

    Siddiqui, M. H.; Hashmi, F.; Junaid, A.

    The research was aimed to quantify the existence of anisotropy in fracture toughness of aluminium alloy 2024 T3 plate (used in aircraft structural members). It was further needed to establish the direction in which the fracture toughness of aluminium alloy 2024 T3 plate is maximum and minimum. This could help ascertain the structural integrity of aircraft structural components; also while designing new components, the knowledge of variation in toughness with respect to direction helps in economizing dead weight of the aircraft. In this research, pursued at the College of Aeronautical Engineering, the anisotropy in toughness of aluminium alloy 2024 T3 plate was analysed using the Charpy V-notch impact toughness test. The effect of specimen orientation on the impact toughness values of the alloy was investigated and compared with known results to verify the reliability of the work and to ascertain the extent of anisotropy in fracture toughness of the said alloy. Charpy impact tests were carried out on ASTM E 23 standard specimens machined at a reference laboratory at room temperature (23° C +/- 2° C). Four different specimen orientations analysed for the purpose of this study were L-S, L-T, T-S and T-L directions. Subsequently, the results obtained at the research centre were then analysed and correlated with morphology of microstructure of the material to establish the reliability of the experimental results. Moreover, an analysis was also done to cater for the possible errors that could affect the fracture toughness values obtained from experimental results. It was concluded that the T-S orientation of the plate had maximum toughness, whereas, minimum toughness was observed in L-T direction.

  9. Adherence of electrodeposited Zn-Ni coatings on EN AW2024 T3 aluminium alloy


    Alexis, Joël; Adrian, Denise; Masri, Talal; Petit, Jacques-Alain


    The use of hexavalent chromium in surface treatments will be reduced in the future, as it is suspected to be carcinogenic. Electrodeposition of Zn-Ni, which is currently used on steel, represents a non-chromate alternative surface treatment for the corrosion protection of aluminium alloys. Zn-Ni coatings were electrodeposited onto an EN AW2024 T3 aluminium alloy sheet in a laboratory flow cell. To obtain several percentages of Ni in the coatings, solutions with different Ni2+ concentrations w...

  10. Protection of 2024-T3 aluminium alloy by corrosion resistant phytic acid conversion coating (United States)

    Shi, Hongwei; Han, En-Hou; Liu, Fuchun; Kallip, Silvar


    The corrosion protection properties of environmentally friendly phytic acid conversion coatings were studied on 2024-T3 aluminium alloy. The films were prepared under acidic conditions with various pH values and characterised by SEM, EDS, ATR-FTIR and electrochemical techniques. The results indicate that the conversion coatings obtained by immersing the alloy in phytic acid solutions at pH from 3 to 5.5 provide excellent corrosion resistance. ATR-FTIR confirms that the film is formed by deposition of reaction products between Al3+ and phosphate groups in phytic acid molecules. The conformation models of the deposition film are proposed.

  11. Friction stir spot welding of 2024-T3 aluminum alloy with SiC nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Paidar, Moslem; Sarab, Mahsa Laali [Islamic Azad University, Tehran (Iran, Islamic Republic of)


    In this study, the Friction stir spot welding (FSSW) of 2024-T3 aluminum alloy with 1.6 mm thickness was investigated. The effects of the silicon carbide (SiC) nanoparticles on the metallurgical and mechanical properties were discussed. The effects of particles on tension shear and wear tests were also investigated. The process was conducted at a constant rotational speed of 1000 rpm. Results showed that adding SiC nanoparticles to the weld during FSSW had a major effect on the mechanical properties. In fact, the addition of nanoparticles as barriers prevented grain growth in the Stir zone (SZ). The data obtained in the tensile-shear and wear tests showed that tensile-shear load and wear resistance increased with the addition of SiC nanoparticles, which was attributed to the fine grain size produced in the SZ.

  12. Friction stir spot welding of 2024-T3 aluminum alloy with SiC nanoparticles

    International Nuclear Information System (INIS)

    In this study, the Friction stir spot welding (FSSW) of 2024-T3 aluminum alloy with 1.6 mm thickness was investigated. The effects of the silicon carbide (SiC) nanoparticles on the metallurgical and mechanical properties were discussed. The effects of particles on tension shear and wear tests were also investigated. The process was conducted at a constant rotational speed of 1000 rpm. Results showed that adding SiC nanoparticles to the weld during FSSW had a major effect on the mechanical properties. In fact, the addition of nanoparticles as barriers prevented grain growth in the Stir zone (SZ). The data obtained in the tensile-shear and wear tests showed that tensile-shear load and wear resistance increased with the addition of SiC nanoparticles, which was attributed to the fine grain size produced in the SZ

  13. Analysis of the tool plunge in friction stir welding - comparison of aluminium alloys 2024 T3 and 2024 T351

    Directory of Open Access Journals (Sweden)

    Veljić Darko


    Full Text Available Temperature, plastic strain and heat generation during the plunge stage of the friction stir welding (FSW of high-strength aluminium alloys 2024 T3 and 2024 T351 are considered in this work. The plunging of the tool into the material is done at different rotating speeds. A three-dimensional finite element (FE model for thermomechanical simulation is developed. It is based on arbitrary Lagrangian-Eulerian formulation, and Johnson-Cook material law is used for modelling of material behaviour. From comparison of the numerical results for alloys 2024 T3 and 2024 T351, it can be seen that the former has more intensive heat generation from the plastic deformation, due to its higher strength. Friction heat generation is only slightly different for the two alloys. Therefore, temperatures in the working plate are higher in the alloy 2024 T3 for the same parameters of the plunge stage. Equivalent plastic strain is higher for 2024 T351 alloy, and the highest values are determined under the tool shoulder and around the tool pin. For the alloy 2024 T3, equivalent plastic strain is the highest in the influence zone of the tool pin. [Projekat Ministarstva nauke Republike Srbije, br. TR 34016 i br. TR 35006

  14. Review and study of physics driven pitting corrosion modeling in 2024-T3 aluminum alloys (United States)

    Yu, Lingyu; Jata, Kumar V.


    Material degradation due to corrosion and corrosion fatigue has been recognized to significantly affect the airworthiness of civilian and military aircraft, especially for the current fleet of airplanes that have served beyond their initial design life. The ability to predict the corrosion damage development in aircraft components and structures, therefore, is of great importance in managing timely maintenance for the aging aircraft vehicles and in assisting the design of new ones. The assessment of aircraft corrosion and its influence on fatigue life relies on appropriate quantitative models that can evaluate the initiation of the corrosion as well as the accumulation during the period of operation. Beyond the aircraft regime, corrosion has also affected the maintenance, safety and reliability of other systems such as nuclear power systems, steam and gas turbines, marine structures and so on. In the work presented in this paper, we reviewed and studied several physics based pitting corrosion models that have been reported in the literature. The classic work of particle induced pitting corrosion by Wei and Harlow is reviewed in detail. Two types of modeling, a power law based simplified model and a microstructure based model, are compared for 2024-T3 alloy. Data from literatures are used as model inputs. The paper ends with conclusions and recommendations for future work.

  15. Investigation on a Sol-gel Coating Containing Inhibitors on 2024-T3 Aluminum Alloy

    Institute of Scientific and Technical Information of China (English)

    SHI Hong-wei; LIU Fu-chun; HAN En-hou; SUN Ming-cheng


    For a long time, chromate incorporated conversion coatings have been drawn special attention in corrosion protection of aircraft-used aluminum alloys. However,ever-increasing environmental pressures requires that non-chromate conversion coatings be developed because of the detrimental carcinogenic effects of the chromate compounds. In recent years, the sol-gel coatings doped with inhibitors were developed to replace chromate conversion coatings, and showed real promise. A sol-gel coating was prepared and its anti-corrosion behavior was investigated using the potentiodynamic scanning (PDS) and the electrochemical impedance spectroscopy (EIS). It is found that the sol-gel coating obtained by the hydrolysis and condensation of 3-glycidoxypropyltrimethoxysilane (GPTMS) and tetramethoxysilane (TMOS) is prone to form defects if cured at the room temperature, whereas if cured at a higher temperature (100 ℃), these flaws can be avoided. Furthermore, it can be seen that addition of anti-foam agents and surfactants will reduce the faults if cured at the room temperature. Effects of the corrosion inhibitors, CeCl3 and mercaptobenzothiazole (MBT), in the sol-gel coatings on 2024-T3 aluminum alloy were also investigated. Results show that the corrosion resistance of the sol-gel coatings containing CeCl3 proves to be better than that of the pure and MBT added sol-gel coatings by the electrochemical methods.

  16. Evaluating protection systems against marine corrosion of aeronautic alloy Alclad 2024-T3

    Directory of Open Access Journals (Sweden)

    William Aperador Chaparro


    Full Text Available  This paper shows how two coating systems were obtained as an alternative for protection against corrosion of al clad 2024-T3which is used in battery compartment manufacture for T-41 aircraft. Such systems consist of three types of organic resin: a first layer of P-115 polyester resin as the first coating on both systems, and a second layer of Hetron 197-3 polyester resin in the first system and vinyl-ester resin in the second one. Scanning electron microscopy (SEM was used for surface morphology analysis, showing the roughness produced by surface treatment. The coatings were electrochemically characterised by electro chemical impedance spectroscopy (EIS and Tafel polarization curves; it was found that both systems had good performance against corrosion in a marine environment and the chemical surface preparation system had a superior protective pattern for Alodine5700 + 197-3 Hetron, a 1.42x10-12mpycorrosion rate being obtained while substratum rate was 1.59x10-7 mpy. 

  17. Organosilane self-assembled layers (SAMs) and hybrid silicate magnesium-rich primers for the corrosion protection of aluminum alloy 2024 T3 (United States)

    Wang, Duhua

    Although current chromate coatings function very well in corrosion protection for aircraft alloys, such as aluminum alloy 2024 T3, the U.S. Environmental Protection Agency is planning to totally ban the use of chromates as coating materials in the next decade or so because of their extremely toxic effect. For this purpose, both self-assembled layers and silicate magnesium-rich primers were tested to provide the corrosion protection for aluminum alloy. The long-term goal of this research is to develop a coating system to replace the current chromate coating for aircraft corrosion protection. Aluminum alloy 2024 T3 substrates were modified with self-assembled monolayer or multilayer thin films from different alkylsilane compounds. Mono-functional silanes, such as octadecyltrichlorosilane (C18SiCl3), can form a mixed hydrophobic monolayer or multilayer thin film on the aluminum oxide surface to provide a barrier to water and other electrolytes, so the corrosion resistance of the SAMs modified surface was increased significantly. On the other hand, the bi-functional silane self-assembly could attach the aluminum surface through the silicon headgroup while using its functional tailgroup to chemically bond the polymer coating, thus improving the adhesion between the aluminum substrate and coating substantially, and seems to contribute more to corrosion protection of aluminum substrate. Organosilanes were also combined with tetraethyl orthosilicate (TEOS) in propel ratios to form a sol-gel binder to make silicate magnesium-rich primers. Analogue to the inorganic zinc-rich coatings, the silicate magnesium-rich primers also showed excellent adhesion and solvent resistance. The sacrificial magnesium pigments and the chemically inert silicate binder both contribute to the anti-corrosion properties. Future studies will be focused on the formula optimization for better toughness, chemical resistance and anticorrosion performance.

  18. Characterization of fracture behavior of 2024-O and 2024-T3 aluminum alloys; Caracterizacion de la respuesta a fractura de las aleaciones de aluminio 2024-O y 2024-T3

    Energy Technology Data Exchange (ETDEWEB)

    Monsalve, A.; Morales, R.


    The fracture behavior of 2024-O (annealed) and 2024-T3 (precipitation hardened) aluminum alloys used in aeronautical applications have been characterized. The study of the annealed alloy was carried out through the concept of Essential Specific Work of Fracture, using the ESIS protocol. DENT (Double Edge Notch Tension) samples were used, varying the ligament length in order to determine the relationship between the essential specific work of fracture and the thickness of the material. In the case of 2024-T3 alloy, the essential specific work of fracture was determined only for low thicknesses, where the predominant conditions are plane stress. However, for this alloy, the results were not conclusive because of the high fracture toughness of these hardened alloys. Finally, the fracture surface of these alloys was characterized finding a ductile mechanism in the case of the annealed alloy and ductile-brittle mechanism in the case of the hardened alloy. (Author) 9 refs.

  19. Localized coating failure of epoxy-coated aluminium alloy 2024-T3 in 0.5 M NaCl solutions: Correlation between coating degradation, blister formation and local chemistry within blisters

    International Nuclear Information System (INIS)

    The role of pH on the nature and rate of the degradation of epoxy coatings on AA2024-T3 panels and subsequent corrosion of the substrate during immersion in NaCl solutions was investigated. In acidic solutions both blister formation and growth are rapid. Blisters become very large (∼1 cm) and new blisters appear to form for a certain time after exposure. Often very small (∼0.1 mm) clear blisters surround these large blisters. Enhanced blister formation is due to irreversibly increased permeability of the coating for chloride ions and protons, the formation of more defect sites within the coating, and the weakening/dissolution of the oxide layer in low pH environments. In neutral pH solutions, coatings fail by forming one, or at most two, active blisters (red in color) within a few days of immersion with the time-to-failure dependent upon coating quality and thickness. Blister growth is a very slow process, and blister diameters rarely exceed a few millimeters even after several weeks. The accumulation of corrosion product within the blister slows down the corrosion rate and blister growth. The chloride concentration in the occluded solutions within the blister is significantly increased over the bulk concentration, and the pH is often in the acidic range. From electrochemical measurements it can be concluded that the anodic and cathodic reactions are confined to the blister and its immediate surroundings, rather than involving more of the surface over which the coating is intact. Based on corrosion morphology it is concluded that replated copper contributes to the overall cathodic reaction

  20. Investigation on the corrosion behaviour and microstructure of 2024-T3 Al alloy treated via plasma electrolytic oxidation

    Energy Technology Data Exchange (ETDEWEB)

    Fadaee, Hossein; Javidi, Mehdi, E-mail:


    Highlights: • Plasma electrolytic oxidation used to improve corrosion resistance of 2024-T3 alloy. • A conventional DC source with low applied voltage was considered for PEO. • Use of glycerin was effective in enhancement of corrosion resistance. • The surface morphology indicated coatings have a dense structure without cracking. • Degradation of coatings with immersion time was investigated. - Abstract: Plasma electrolytic oxidation treatment was performed on 2024-T3 aluminium alloy in a simple and inexpensive electrolyte. It was found that treatment time of 30 min resulted in the most noble corrosion potential and lowest corrosion current density. The surface and cross-sectional morphology indicated that the coating has a dense structure without any cracking. Furthermore, the result of X-ray diffraction analysis indicated that the coating was formed mainly from α-Al{sub 2}O{sub 3}, γ-Al{sub 2}O{sub 3}, Al{sub 3.21}Si{sub 0.47} and small amounts of amorphous phases. The presence of glycerine in the electrolyte composition resulted in not only stabilising the solution but also improving the corrosion resistance.


    Directory of Open Access Journals (Sweden)

    Waleed J. Ali


    Full Text Available           The strain path for sheet metal may be changed during forming , this may be affect the forming limit curve (FLC . In this work the FLC before and after prestraining was determined for aluminum alloy (2024 T3 to study the effect of this type of prestraining and in different values on the FLC. This alloy was chosen because it is used widely , specially in aircraft structures .It was shown that the using of uniaxial tension prestrain affects the FLC . The major strain in right side is increased with the increasing in the prestrain , while in the left side the effect is small .  

  2. The effect of hardening laws and thermal softening on modeling residual stresses in FSW of aluminum alloy 2024-T3

    DEFF Research Database (Denmark)

    Sonne, Mads Rostgaard; Tutum, Cem Celal; Hattel, Jesper Henri;


    and kinematic rules of hardening were used in order to study the effect of the hardening law on the residual stresses as well as on the final yield stress. This numerical model was then applied in two different cases. Firstly, a very simple 1D Satoh test was modeled. Different combinations of either isotropic...... or kinematic hardening together with the metallurgical softening model were applied in order to give a first impression of the tendencies in residual stresses in friction stir welds when choosing different hardening and softening behaviors. Secondly, real friction stir butt welding of aluminum alloy 2024-T3...... conditions toward the choice of hardening rules and especially whether including the softening model or not. --------------------------------------------------------------------------------...

  3. Aplicação de SAM em liga de alumínio AA 2024-T3 com desengraxe alcalino Application of SAM in AA 2024-T3 aluminum alloy with alkaline degrease


    Aline Viomar; André Lazarin Gallina; Isolda Costa; Maico Taras da Cunha; Paulo Rogério Pinto Rodrigues; Everson do Prado Banckzek


    As moléculas auto-organizáveis (SAM - Self Assembly Monolayer) são inibidoras de corrosão, devido à capacidade de se organizarem sobre superfícies formando filmes finos. A SAM apresenta elevada afinidade pelo óxido formado sobre o alumínio, porém as interações entre a camada de óxido e as SAM nem sempre são satisfatórias, pois o óxido formado na superfície apresenta heterogeneidades, que interferem na formação do filme de SAM. O objetivo desse trabalho foi estudar a proteção à corrosão do alu...

  4. Effect of Multipath Laser Shock Processing on Microhardness, Surface Roughness, and Wear Resistance of 2024-T3 Al Alloy

    Directory of Open Access Journals (Sweden)

    Abdulhadi Kadhim


    Full Text Available Laser shock processing (LSP is an innovative surface treatment technique with high peak power, short pulse, and cold hardening for strengthening metal materials. LSP is based on the application of a high intensity pulsed laser beam (I>1 GW/cm2;  t<50 ns at the interface between the metallic target and the surrounding medium (a transparent confining material, normally water forcing a sudden vaporization of the metallic surface into a high temperature and density plasma that immediately develops inducing a shock wave propagating into the material. The shock wave induces plastic deformation and a residual stress distribution in the target material. In this paper we study the increase of microhardness and surface roughness with the increase of laser pulse energy in 2024-T3 Al alloy. The influence of the thickness of the confining layer (water on microhardness and surface roughness is also studied. In addition, the effect of LSP treatment with best conditions on wear behaviors of the alloy was investigated.

  5. A bottom-up approach for optimization of friction stir processing parameters; a study on aluminium 2024-T3 alloy

    International Nuclear Information System (INIS)

    Highlights: • An experimental bottom-up approach has been developed for optimizing the process parameters for friction stir processing. • Optimum parameter processed samples were tested and characterized in detail. • Ultimate tensile strength of 1.3 times the base metal strength was obtained. • Residual stresses on the processed surface were only 10% of the yield strength of base metal. • Microstructure observations revealed fine equi-axed grains with precipitate particles at the grain boundaries. - Abstract: Friction stir processing (FSP) is emerging as one of the most competent severe plastic deformation (SPD) method for producing bulk ultra-fine grained materials with improved properties. Optimizing the process parameters for a defect free process is one of the challenging aspects of FSP to mark its commercial use. For the commercial aluminium alloy 2024-T3 plate of 6 mm thickness, a bottom-up approach has been attempted to optimize major independent parameters of the process such as plunge depth, tool rotation speed and traverse speed. Tensile properties of the optimum friction stir processed sample were correlated with the microstructural characterization done using Scanning Electron Microscope (SEM) and Electron Back-Scattered Diffraction (EBSD). Optimum parameters from the bottom-up approach have led to a defect free FSP having a maximum strength of 93% the base material strength. Micro tensile testing of the samples taken from the center of processed zone has shown an increased strength of 1.3 times the base material. Measured maximum longitudinal residual stress on the processed surface was only 30 MPa which was attributed to the solid state nature of FSP. Microstructural observation reveals significant grain refinement with less variation in the grain size across the thickness and a large amount of grain boundary precipitation compared to the base metal. The proposed experimental bottom-up approach can be applied as an effective method for

  6. The Effect of the Solution Heat Treatment on the Mechanical Properties of Aluminum-Copper Alloy (2024-T3 Using Rolling Process

    Directory of Open Access Journals (Sweden)

    Khairia Salman Hassan


    Full Text Available The effect of solution heat treatment on the mechanical properties of Aluminum-Copper alloy. (2024-T3 by the rolling process is investigated. The solution heat treatment was implemented by heating the sheets to 480 C° and quenching them by water; then forming by rolling for many passes. And then natural aging is done for one month. Mechanical properties (tensile strength and hardness are evaluated and the results are compared with the metal without treatment during the rolling process. ANSYS analysis is used to show the stresses distribution in the sheet during the rolling process. It has been seen that good mechanical properties are evident in the alloy without heat treatment due to the strain hardening and also the mechanical properties are improved after heat treatment and rolling process but with lower forces and stresses when compared with the untreated.

  7. Investigation of the corrosion behaviour of a bilayer cerium-silane pre-treatment on Al 2024-T3 in 0.1 M NaCl

    International Nuclear Information System (INIS)

    In the last few years great efforts have been made in order to find environmentally friendly substitutes for Cr6+ pre-treatments applied to aluminium alloys used in the aircraft industry. In this work we have investigated the electrochemical response of a bilayer pre-treatment consisting of a Ce conversion bottom layer and a non-functional silane (bis-1,2-(triethoxysilyl) ethane (BTSE)) top layer applied on Al 2024-T3, and compared its behaviour with monolayer coated samples. The investigation was carried out in 0.1 M NaCl solution, and the electrochemical techniques employed were anodic polarization curves and electrochemical impedance spectroscopy (EIS). EIS experiments performed with bilayer coated samples have shown a continuous increase of the impedance response during the whole test period, which was interpreted on the basis of a pore blocking mechanism supported by scanning electron microscopy (SEM) images and equivalent circuit fitting. Moreover, the impedance of the bilayer coated samples was approximately one order of magnitude higher than that presented by monolayer coated ones. On the other hand, mechanical tests have evidenced the good adhesion of the silane layer to the Ce conversion layer, which can be likely attributed to a better linking between the silane molecules and the cerium bottom layer

  8. Corrosion behavior of aluminum alloy 2024-T3 by 8-hydroxy-quinoline and its derivative in 3.5% chloride solution

    Institute of Scientific and Technical Information of China (English)

    LI Song-mei; ZHANG Hong-rui; LIU Jian-hua


    The corrosion behavior of aluminum alloy 2024-T3 was studied in 3.5% NaCl solution with two fluorescence quinoline compounds named 8-hydroxy-quinoline(8HQ) and 8-hydroxy-quinoline-5-sulfonic acid(HQS). The open circuit potential(OCP) test result indicates that both compounds change the alloy corrosion potential by adsorbing on the electrode surface. Polarization measurements show that 8HQ is a mixed type inhibitor by blocking the active sites of the metal surface, while HQS is a corrosion accelerator by activating the cathodic reaction. Changes of the impedance parameters in the electrochemical impedance spectroscopy(EIS) are related to the adsorption of 8HQ on the metal surface, which leads to the formation of a protective layer. The impedance diagram in the solution with HQS is similar to the one without additional organic compounds. The morphology and composition of the protective layer were studied by using SEM/EDS. The result confirms the function of the additions that the effect of 8HQ is due to the insoluble aluminum chelate, Al(HQ)3, to prevent adsorption of chloride ion, while the effect of HQS is to break down the oxide film.

  9. Microstructural and electrochemical characterization of Ce conversion layers formed on Al alloy 2024-T3 covered with Cu-rich smut

    International Nuclear Information System (INIS)

    In the present work the microstructure of Ce conversion layers formed on Al alloy 2024-T3 covered with a Cu-rich smut was characterized by scanning electron microscopy (SEM), and its electrochemical behaviour in 0.5 M NaCl solution was investigated by open circuit potential (OCP) measurements, anodic polarization curves and electrochemical impedance spectroscopy (EIS). The results of the microstructural characterization have shown that the presence of Cu cathodic particles uniformly deposited on the electrode surface favours the homogeneous nucleation of the conversion layer, apparently reducing the role of intermetallics in the layer precipitation mechanism. Electrochemical measurements have shown that, during the first hour of immersion in the test electrolyte, the samples covered with the conversion layer exhibit a high interfacial activity, characterized by an active anodic behaviour, which was ascribed to an intense electrochemical activity associated with Al-Cu-Mg intermetallics not covered with the conversion layer. However, as the experiment proceeds an improvement on the corrosion behaviour of the sample was observed, which was interpreted on the basis of self-healing properties of the Ce conversion layer as well as on the blocking of the defective sites of the conversion coating by corrosion products. The electrochemical results have also evidenced the beneficial effect of the pre-treatment with benzotriazole in the corrosion response of Ce-coated samples

  10. Electrochemical techniques for practical evaluation of corrosion inhibitor effectiveness. Performance of cerium nitrate as corrosion inhibitor for AA2024T3 alloy

    International Nuclear Information System (INIS)

    In this work, a split-cell technique and image-assisted electrochemical noise analysis, which provide minimal perturbation of the freely corroding system and good time resolution, are proposed as a tool for simultaneous investigation of the corrosion inhibition mechanism and assessment of performance. The results obtained are compared with results from traditional electrochemical impedance spectroscopy, disclosing the advantages of these techniques in the evaluation of inhibitor performance. Specific attention is also given to the investigation of corrosion inhibition by cerium nitrate.

  11. Integrated Modelling of Crack Propagation in AA2024-T3 FSW Butt Joints Considering The Residual Stresses from the Manufacturing Process

    DEFF Research Database (Denmark)

    Sonne, M. R.; Carlone, P.; Citarella, R.;


    conducted to investigate the effect of shunting on nugget size in spot welding of HSLA steel sheets. Different cases with different spacing between weld spots have been examined. The nugget sizes have been measured by metallographic examination and have been compared with 3D finite element simulations. The...

  12. Effect of welding heat input and post-welded heat treatment on hardness of stir zone for friction stir-welded 2024-T3 aluminum alloy%焊接热输入和焊后热处理对搅拌摩擦焊2024-T3铝合金焊核区硬度的影响

    Institute of Scientific and Technical Information of China (English)

    陈雨; 丁桦; 李继忠; 赵敬伟; 付明杰; 李晓华


    在不同焊接热输入条件下对2024-T3铝合金进行搅拌摩擦焊接,并利用透射电镜、差热分析和维氏硬度测试对焊核区的组织和硬度进行分析检测。研究表明,焊核区的硬度受到焊接热输入的影响。在高焊接热输入条件下,焊接速度的提升有利于提升焊核区硬度。而在低焊接热输入条件下,焊核区硬度随着旋转速度的增加而增加。焊后热处理导致组织过时效,焊核区硬度降低。相比于其他参数下获得的焊核区,旋转速度为500 r/min,焊接速度为100 mm/min条件下获得的焊核区拥有较高的抗过时效性能,硬度下降仅为3.8%,而其他焊核区的硬度下降超过10%。焊核区硬度主要受到强化相形态的影响。%The microstructure and hardness of the stir zone (SZ) with different welding heat inputs were investigated for friction stir-welded 2024-T3 aluminum by transmission electron microscopy, differential scanning calorimeter and Vickers micro-hardness test. The results show that welding heat input has a significant effect on the hardness of the SZ. Under high welding heat input condition, a higher welding speed is beneficial for improving the hardness of the SZ. However, when the welding heat input is low, the hardness of the SZ elevates with increasing the rotation speed. The hardness of the SZ decreases after post-welded heat treatment due to overaging. The joints welded at 500 r/min and 100 mm/min show a high resistance to overaging. The reduction of hardness in the SZ is only 3.8%, while in other joints, the reduction is more than 10%. The morphology of strengthening precipitates plays important roles for the improvement of hardness.

  13. Evaluación de diferentes sistemas de protección contra la corrosión marina en la aleación de aplicación aeronáutica Alclad 2024-T3 Evaluating protection systems against marine corrosion of aeronautic alloy Alclad 2024-T3

    Directory of Open Access Journals (Sweden)

    Pérez Londoño Fabian Andrés


    Full Text Available  

    Se muestra la obtención de dos sistemas de recubrimientos protectores como una alternativa de protección contra la corrosión de la aleación de aluminio Alclad 2024-T3, que es utilizada en la fabricación del compartimiento de la batería de los aviones T-41. Dichos sistemas constan de tres tipos de resinas orgánicas: una primera capa de resina poliéster P-115, a manera de imprimante en ambos sistemas de recubrimientos, y una segunda capa de resina de poliéster Hetron 197-3 en el primer caso, o de resina vinil-éster F-010 en el segundo. El análisis de la morfología superficial se realizó mediante microscopía electrónica de barrido (SEM, observando la rugosidad generada por el tratamiento superficial. El estudio electroquímico de los recubrimientos se desarrolló mediante la técnica de espectroscopía de impedancia electroquímica (EIS y curvas de polarización Tafel; de esta manera se encontró que todos los sistemas presentan un buen desempeño frente a la corrosión en un medio marino, y que el sistema con preparación superficial química muestra un comportamiento protector superior para el Alodine 5700 + Hetron 197-3; se obtuvo una velocidad de corrosión 1,42 x 10-12 mpy, mientras que para el sustrato la velocidad fue de 1,59 x 10-7 mpy.



  14. Acoustic emission monitoring of tensile testing of corroded and un-corroded clad aluminum 2024-T3 and characterization of effects of corrosion on AE source events and material tensile properties (United States)

    Okafor, A. Chukwujekwu; Natarajan, Shridhar


    Corrosion damage affects structural integrity and deteriorates material properties of aluminum alloys in aircraft structures. Acoustic Emission (AE) is an effective nondestructive evaluation (NDE) technique for monitoring such damages and predicting failure in large structures of an aircraft. For successful interpretation of data from AE monitoring, sources of AE and factors affecting it need to be identified. This paper presents results of AE monitoring of tensile testing of corroded and un-corroded clad Aluminum 2024-T3 test specimens, and characterization of the effects of strain-rate and corrosion damage on material tensile properties and AE source events. Effect of corrosion was studied by inducing corrosion in the test specimens by accelerated corrosion testing in a Q-Fog accelerated corrosion chamber for 12 weeks. Eight (8) masked dog-bone shaped specimens were placed in the accelerated corrosion chamber at the beginning of the test. Two (2) dog-bone shaped specimens were removed from the corrosion chamber after exposure time of 3, 6, 9, and 12 weeks respectively, and subjected to tension testing till specimen failure along with AE monitoring, as well as two (2) reference samples not exposed to corrosion. Material tensile properties (yield strength, ultimate tensile strength, toughness, and elongation) obtained from tension test and AE parameters obtained from AE monitoring were analyzed and characterized. AE parameters increase with increase in exposure period of the specimens in the corrosive environment. Aluminum 2024-T3 is an acoustically silent material during tensile deformation without any damage. Acoustic emission events increase with increase of corrosion damage and with increase in strain rate above a certain value. Thus AE is suitable for structural health monitoring of corrosion damage. Ultimate tensile strength, toughness and elongation values decrease with increase of exposure period in corrosion chamber.

  15. Corrosion Control of Friction Stir Welded AA2024-T351 Aluminium Alloys


    Younes, Yousif Younes Abo


    Friction stir welding (FSW) is a modern solid state welding technique developed at thewelding institute (TWI) in 1991. The joining is achieved by heat generation, materialsoftening and plastic deformation following the travelling of non-consumable pin throughthe gap between the two workpieces to be joined.In present study, joining of AA 2024-T3 aluminium alloy, is achieved by FSW. Theinfluence of the FSW on the alloy microstructure and corrosion behaviour is determined.The effect of laser sur...

  16. Self-assembled monolayer of 3-aminopropyltrimethoxysilane for improved adhesion between aluminum alloy substrate and polyurethane coating

    International Nuclear Information System (INIS)

    A good adhesion between a polymer coating and a metal or metal alloy substrate such as Al 2024-T3 plays a critical role in corrosion protection of metal substrates. In our study, a self-assembled monolayer film of 3-aminopropyltrimethoxysilane was formed on Al 2024-T3 substrate by covalent bonding. The adhesion property of a self-priming polyurethane coating was evaluated by pull-off adhesion test, wet tape test and thermal cycling test. All the testing results indicate that both dry and wet adhesion properties of the polyurethane coating were improved significantly after APS treatment of Al 2024-T3 in polar solvents such as methanol and acetone. In nonpolar solvents such as hexane, the APS treatment led to inconsistent improvement or sometime decreased adhesion of polyurethane coating. X-ray photoelectron spectroscopic study revealed that while a monolayer film was formed on the aluminum alloy surface after treating the substrate with APS in methanol and acetone, a multilayer film was formed on the substrate surface when the treatment was conducted in hexane. The APS monolayer film served as a covalent bond linkage between polymer coating and aluminum alloy substrates, which led to the increased adhesion property of polymer coating and corrosion resistance of the metal alloy substrate

  17. “SMART” protective ability of water based epoxy coatings loaded with CaCO3 microbeads impregnated with corrosion inhibitors applied on AA2024 substrates

    International Nuclear Information System (INIS)

    Highlights: ► CaCO3 microbeads were used as pH-sensitive reservoirs for corrosion inhibitors. ► The barrier properties of the coating with CaCO3/inhibitors were improved. ► The corrosion inhibitors were released as a result of dissolution of pH sensitive CaCO3. ► LEIS demonstrated the local corrosion inhibition provided by the CaCO3/Ce over localised defect formed in the coating. - Abstract: Corrosion protection of aluminium alloys often relies on the application of a coating on the metallic surface. The coating normally combines a barrier effect that restricts the ingress of corrosive species, with an inhibitive role induced by corrosion inhibitor pigments added to the coating formulation. However, the direct addition of corrosion inhibitors to the coating can cause some detrimental interactions between components, as well as formation of preferential electrolyte pathways, compromising the barrier properties. Moreover, electrolyte uptake and ageing may result in leaching of those corrosion inhibitors. In order to extend the corrosion inhibition ability of organic coatings one possible solution is to store the inhibitors inside nano or microreservoirs compatible with the coating matrix and able to sense the local changes induced by the corrosion process. This strategy has led to the development of a new generation of “smart” coatings for anti-corrosion purposes. The aim of this work is to study the anti-corrosion properties of water-based epoxy coatings loaded with pH sensitive particles, acting as feedback active containers for corrosion inhibitors and applied on the aluminium alloy AA2024-T3. For this purpose micron size calcium carbonate beads were modified with different corrosion inhibitors: cerium nitrate, salicylaldoxime and 2,5-dimercapto-1,3,4-thiadiazolate. These particles act as pH sensitive reservoirs because they dissolve at acidic pH, releasing the corrosion inhibitor, which then suppresses the corrosion activity of the bare metal

  18. Influência da Espessura do Filme Polimérico Intermediário na Resistência Mecânica de Juntas Híbridas de Alumínio 2024-T3 e CF-PPS Produzidas por União Pontual por Fricção

    Directory of Open Access Journals (Sweden)

    Natália M. André


    Full Text Available Resumo A União Pontual por Fricção (FSpJ é uma técnica inovadora para união de estruturas híbridas metal-polímero e baseia-se na geração de calor por fricção. Juntas de alumínio 2024-T3 e compósito laminado de poli(sulfeto de fenileno com fibra de carbono (CF-PPS foram produzidas com filme intermediário de PPS. Duas espessuras de filme foram investigadas: 100 e 500 µm. Ensaios de cisalhamento sob tração demonstraram que as juntas com filmes de 100 µm são mais resistentes (2093 ± 180 N em relação às juntas com filme de 500 µm (708 ± 69 N. Adicionalmente, as superfícies de fratura das juntas revelaram áreas de união maiores para as juntas com filmes de 100 µm (53 ± 2 contra 40 ± 1 mm2. Para o filme mais fino, a extensão do amolecimento devido ao calor friccional é maior. Consequentemente, a baixa viscosidade atingida com a fusão do polímero favorece a molhabilidade das superfícies dos componentes da junta pelo PPS amolecido, resultando em melhor adesão entre as partes. Ademais, análises microestruturais demonstraram que a formação do cerne metálico e a interdifusão das moléculas de PPS entre compósito e filme também são favorecidas. Portanto, concluiu-se que a adição do filme mais fino produziu juntas mais resistentes.

  19. Preparation of thin film nanofibrous composite NF membrane based on EDC/NHS modified PAN-AA nanofibrous substrate (United States)

    Yang, Y.; Wang, X.; Hsiao, B. S.


    A novel kind of thin-film nanofibrous composite (TFNC) nanofiltration (NF) membranes consisting of a polyamide (PA) barrier layer were successfully fabricated by interfacial polymerization (IFP) based on electrospun double-layer nanofibrous substrates, which have an ultrathin poly (acrylonitrile-co-acrylic acid) (PAN-AA) nanofibrous layer as top layer and a thicker polyacrylonitrile (PAN) nanofiber layer as bottom porous support layer. Immersing PAN/PAN-AA nanofibrous substrates into 1-ethyl-(3-3-dimethylaminopropyl) carbodiimide hydrochloride/N-hydroxysuccinimide (EDC/NHS) aqueous solution and piperazine (PIP) aqueous solution (0.20 wt%) sequentially for a period of time, the carboxyl groups on PAN-AA nanofibers were activated by carbodiimide and then reacted with the amide groups. The as prepared composite membrane has an integrated structure with high rejection rate (98.0%); high permeate flux (40.4 L/m2h) for MgSO4 aqueous solution (2 g/L).

  20. Sol-gel hybrid films based on organosilane and montmorillonite for corrosion inhibition of AA2024. (United States)

    Dalmoro, V; dos Santos, J H Z; Armelin, E; Alemán, C; Azambuja, D S


    The present work reports the production of films on AA2024-T3 composed of vinyltrimethoxysilane (VTMS)/tetraethylorthosilicate (TEOS) with incorporation of montmorillonite (sodium montmorillonite and montmorillonite modified with quaternary ammonium salt, abbreviated Na and 30B, respectively), generated by the sol-gel process. According to FT-IR analyses the incorporation of montmorillonite does not affect silica network. Electrochemical characterization was performed by electrochemical impedance spectroscopy measurement in 0.05 mol L(-1) NaCl solution. Results indicate that montmorillonite incorporation improves the corrosion protection compared to the non-modified system. Scanning electron microscopy micrographs reveal that high concentrations of montmorillonite provide agglomerations on the metallic surface, which is in detriment of the anticorrosive performance. The VTMS/TEOS/30B films with the lowest concentration (22 mg L(-1)) of embedded clay provide the highest corrosion protection. PMID:24863798

  1. Microstructure and anisotropic mechanical behavior of friction stir welded AA2024 alloy sheets

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Zhihan [State Key Laboratory of Solidification Processing, Shaanxi Key Laboratory of Friction Welding Technologies, Northwestern Polytechnical University, Xi' an 710072, Shaanxi (China); Li, Wenya, E-mail: [State Key Laboratory of Solidification Processing, Shaanxi Key Laboratory of Friction Welding Technologies, Northwestern Polytechnical University, Xi' an 710072, Shaanxi (China); Li, Jinglong [State Key Laboratory of Solidification Processing, Shaanxi Key Laboratory of Friction Welding Technologies, Northwestern Polytechnical University, Xi' an 710072, Shaanxi (China); Chao, Y.J. [Department of Mechanical Engineering, University of South Carolina, Columbia, SC 29208 (United States); Vairis, A. [Mechanical Engineering Department, TEI of Crete, Heraklion, Crete 71004 (Greece)


    The anisotropic mechanical properties of friction stir welded (FSW) AA2024-T3 alloy joints were investigated based on the uniaxial tensile tests. The joint microstructure was examined by using electron back-scattered diffraction and transmission electron microscope. Results show that the evident anisotropic failure and yielding are present in the FSW joints. With the increase of loading angle from 0° to 90° the ultimate tensile strength and elongation of the specimens consistently decrease, or at first decrease and then increase, depending on the FSW process parameters. The specimen cut from the weld direction, i.e. a loading angle of 0°, exhibits the highest strength and elongation. - Highlights: • Microstructure and anisotropy of friction stir welded joints were studied. • The evident anisotropic failure and yielding are present in joints. • The lowest yield stress and UTS are at 45° and 60° loadings, respectively. • Rotation speed heavily impact on the anisotropy of joints.

  2. Microstructure and anisotropic mechanical behavior of friction stir welded AA2024 alloy sheets

    International Nuclear Information System (INIS)

    The anisotropic mechanical properties of friction stir welded (FSW) AA2024-T3 alloy joints were investigated based on the uniaxial tensile tests. The joint microstructure was examined by using electron back-scattered diffraction and transmission electron microscope. Results show that the evident anisotropic failure and yielding are present in the FSW joints. With the increase of loading angle from 0° to 90° the ultimate tensile strength and elongation of the specimens consistently decrease, or at first decrease and then increase, depending on the FSW process parameters. The specimen cut from the weld direction, i.e. a loading angle of 0°, exhibits the highest strength and elongation. - Highlights: • Microstructure and anisotropy of friction stir welded joints were studied. • The evident anisotropic failure and yielding are present in joints. • The lowest yield stress and UTS are at 45° and 60° loadings, respectively. • Rotation speed heavily impact on the anisotropy of joints

  3. Localised corrosion in aluminium alloy 2024-T3 using in situ TEM. (United States)

    Malladi, Sairam; Shen, Chenggang; Xu, Qiang; de Kruijff, Tom; Yücelen, Emrah; Tichelaar, Frans; Zandbergen, Henny


    An approach to carry out chemical reactions using aggressive gases in situ in a transmission electron microscope (TEM), at ambient pressures of 1.5 bar using a windowed environmental cell, called a nanoreactor, is presented here. The nanoreactor coupled with a specially developed holder with platinum tubing permits the usage of aggressive chemicals like hydrochloric acid (HCl). PMID:24127075

  4. Localised corrosion in aluminium alloy 2024-T3 using in situ TEM


    Malladi, S.; Shen, C.; Xu, Q.; De Kruijff, T.; Yücelen, E.; Tichelaar, F.; Zandbergen, H.


    An approach to carry out chemical reactions using aggressive gases in situ in a transmission electron microscope (TEM), at ambient pressures of 1.5 bar using a windowed environmental cell, called a nanoreactor, is presented here. The nanoreactor coupled with a specially developed holder with platinum tubing permits the usage of aggressive chemicals like hydrochloric acid (HCl).

  5. An evaluation of the pressure proof test concept for 2024-T3 aluminium alloy sheet (United States)

    Dawicke, D. S.; Poe, C. C., Jr.; Newman, J. C.; Harris, C. E.


    The concept of pressure proof testing of fuselage structures with fatigue cracks to insure structural integrity was evaluated from a fracture mechanics viewpoint. A generic analytical and experimental investigation was conducted on uniaxially loaded flat panels with crack configurations and stress levels typical of longitudinal lap splice joints in commercial transport aircraft fuselages. The results revealed that the remaining fatigue life after a proof cycle was longer than that without the proof cycle because of crack growth retardation due to increased crack closure. However, based on a crack length that is slightly less than the critical value at the maximum proof stress, the minimum assured life or proof test interval must be no more than 550 pressure cycles for a 1.33 proof factor and 1530 pressure cycles for a 1.5 proof factor to prevent in-flight failures.

  6. Effect of substrate surface roughening and cold spray coating on the fatigue life of AA2024 specimens

    International Nuclear Information System (INIS)

    Highlights: • Investigated effect of CP-Al coatings cold sprayed onto roughened Al2024 substrate. • CP-Al coating improved rotating-bend fatigue strength up to 50% on average. • CP-Al coating diminished stress raisers caused by the surface roughening. • Glass-bead blasting plus coating offered most significant fatigue life improvement. - Abstract: The effects of cold spray coating and substrate surface preparation on crack initiation under cyclic loading have been studied on Al2024 alloy specimens. Commercially pure (CP) aluminum feedstock powder has been deposited on Al2024-T351 samples using a cold-spray coating technique known as high velocity particle consolidation. Substrate specimens were prepared by surface grit blasting or shot peening prior to coating. The fatigue behavior of both coated and uncoated specimens was then tested under rotating bend conditions at two stress levels, 180 MPa and 210 MPa. Scanning electron microscopy was used to analyze failure surfaces and identify failure mechanisms. The results indicate that the fatigue strength was significantly improved on average, up to 50% at 180 MPa and up to 38% at 210 MPa, by the deposition of the cold-sprayed CP-Al coatings. Coated specimens first prepared by glass bead grit blasting experienced the largest average increase in fatigue life over bare specimens. The results display a strong dependency of the fatigue strength on the surface preparation and cold spray parameters

  7. Lamb wave ultrasonic evaluation of welded AA2024 specimens at tensile static and fatigue testing (United States)

    Burkov, M. V.; Byakov, A. V.; Shah, R. T.; Lyubutin, P. S.; Panin, S. V.


    The paper deals with the investigation of Lamb waves ultrasonic testing technique applied for evaluation of different stress-strain and damaged state of aluminum specimens at static and fatigue loading in order to develop a Structural Health Monitoring (SHM) approach. The experimental results of tensile testing of AA2024T3 specimens with welded joints are presented. Piezoelectric transducers used as actuators and sensors were adhesively bonded to the specimen's surface using two component epoxy. The set of static and cyclic tensile tests with two frequencies of acoustic testing (50 kHz and 335 kHz) were performed. The recorded signals were processed to calculate the maximum envelope in order to evaluate the changes of the stress-strain state of the specimen and its microstructure during static tension. The registered data are analyzed and discussed in terms of signal attenuation due to the formation of fatigue defects during cyclic loading. Understanding the relations between acoustic signal features and fatigue damages will provide us the ability to determine the damage state of the structure and its residual lifetime in order to design a robust SHM system.

  8. Mineralogical Transformation and Electrochemical Nature of Magnesium-Rich Primers during Natural Weathering

    Directory of Open Access Journals (Sweden)

    Shashi S. Pathak


    Full Text Available Magnesium-rich primers (MgRP have generated great interest as a promising alternative to chromium-based primers for the protection of aluminum substrates but their performance during exterior exposure has not been well documented. This paper focuses on the evaluation of MgRP during natural weathering to gain insight into its mineralogical phase transformation and electrochemical nature. Control studies were conducted on Mg and AA2024-T3 coupons. The results indicate that Mg particles in MgRP transform into a variety of hydroxide, carbonate, and hydroxy carbonates. During natural weathering, CO2 inhibited the dissolution of both Mg and AA2024-T3 as a result of protective carbonate layer formation in the coating.

  9. AA Index (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa index provides a long climatology of global geomagnetic activity using 2 antipodal observatories at Greenwich and Melbourne- IAGA Bulletin 37,...

  10. Caractérisation d'un alliage 2024-T3 assemblé par friction-malaxage


    JEMAL, Nejah; MASSE, Jean-Eric; LANGLOIS, Laurent; TCHERNIAEFF, Serge; GIROT, Franck


    Le procédé Friction Stir Welding qui peut se traduire en français par friction malaxage a été inventé par le TWI de Cambridge en 1991. La soudure est réalisée par apport de chaleur provoqué par le frottement d'un outil en rotation et mis en pression sur la pièce. Ce procédé intéresse les utilisateurs d'alliages légers car, sans passer par la fusion, il permet le soudage d'alliages à haute résistance, jusque là inutilisables en raison de leur soudabilité difficile avec les procédés traditionne...

  11. Caractérisation d'un alliage 2024-T3 assemblé par friction-malaxage


    JEMAL, Nejah; MASSE, Jean-Eric; LANGLOIS, Laurent; TCHERNIAEFF, Serge; GIROT, Franck


    Le procédé Friction Stir Welding qui peut se traduire en français par friction malaxage a été inventé par le TWI de Cambridge en 1991. La soudure est réalisée par apport de chaleur provoqué par le frottement d’un outil en rotation et mis en pression sur la pièce. Ce procédé intéresse les utilisateurs d’alliages légers car, sans passer par la fusion, il permet le soudage d’alliages à haute résistance, jusque là inutilisables en raison de leur soudabilité difficile avec les procédés traditionne...

  12. Rating AAs. (United States)

    Carter, Susan J.


    Why alternative investments? In a word: performance. Many higher education endowment and foundation managers are making increasing commitments to alternative investments, or AAs, in order to obtain higher returns and broader diversification for their investment portfolios than public securities instruments can usually provide. Learn how to handle…

  13. Microstructure of AA 2024 fixed joints formed by friction stir welding (United States)

    Eliseev, A. A.; Kalashnikova, T. A.; Tarasov, S. Yu.; Rubtsov, V. E.; Fortuna, S. V.; Kolubaev, E. A.


    Friction stir welded butt joints on 2024T3 alloy have been obtained using different process parameters. The microstructures of all the weld joint zones have been examined and such structural parameters as grain size, particle size and volume content of particles have been determined in order to find correlations with the microhardness of the corresponding zones of the weld.

  14. Embedded reference electrodes for corrosion potential monitoring, electrochemical characterization, and controlled-potential cathodic protection (United States)

    Merten, Bobbi Jo Elizabeth

    A thin wire Ag/AgCl reference electrode was prepared using 50 mum Ag wire in dilute FeCl3. The wire was embedded beneath the polyurethane topcoat of two sacrificial coating systems to monitor their corrosion potential. This is the first report of a reference electrode embedded between organic coating layers to monitor substrate health. The embedded reference electrode (ERE) successfully monitored the corrosion potential of Mg primer on AA 2024-T3 for 800 days of constant immersion in dilute Harrison's solution. Zn primer on steel had low accuracy in comparison. This is in part due to short circuiting by Zn oxidation products, which are much more conductive than Mg corrosion products. Data interpretation was improved through statistical analysis. On average, ERE corrosion potentials are 0.1 to 0.2 V and 0.2 to 0.3 V more positive than a saturated calomel electrode (SCE) in solution for AA 2024-T3 and steel coating systems, respectively. Further research may confirm that ERE obtains corrosion potential information not possible by an exterior, conventional reference electrode. The ERE is stable under polarization. AA 2024-T3 was polarized to -0.95 V vs ERE to emulate controlled potential cathodic protection (CPCP) applications. Polarizations of -0.75 V vs ERE are recommended for future experiments to minimize cathodic delamination. The ERE was utilized to analyze coating mixtures of lithium carbonate, magnesium nitrate, and Mg metal on AA2024-T3. Corrosion potential, low frequency impedance by electrochemical impedance spectroscopy (EIS), and noise resistance by electrochemical noise method (ENM) were reported. Coating performance ranking is consistent with standard electrochemical characterization and visual analyses. The results suggest anti-corrosion resistance superior to a standard Mg primer following 1600 hours of B117 salt spray. Both lithium carbonate and magnesium nitrate are necessary to achieve corrosion protection. Unique corrosion protective coatings for

  15. Antiproton Accumulator (AA)

    CERN Multimedia

    Photographic Service


    The AA in its final stage of construction, before it disappeared from view under concrete shielding. Antiprotons were first injected, stochastically cooled and accumulated in July 1980. From 1981 on, the AA provided antiprotons for collisions with protons, first in the ISR, then in the SPS Collider. From 1983 on, it also sent antiprotons, via the PS, to the Low-Energy Antiproton Ring (LEAR). The AA was dismantled in 1997 and shipped to Japan.

  16. The effect of polymer morphology on the performance of a corrosion inhibiting polypyrrole/aluminum flake composite pigment

    International Nuclear Information System (INIS)

    Two different morphologies of polypyrrole (PPy) aluminum flake composites, namely spherical PPy/Al flake composites and wire PPy/Al flake composites, were synthesized by chemical oxidative polymerization. These composites were characterized by Fourier transform infrared spectroscopy (FT-IR), four point probe conductivity, conductive atomic force microscopy (C-AFM), scanning electron microscopy (SEM), and X-ray photoelectron spectroscopy (XPS). These composites were incorporated into an epoxy primer and coatings were applied on an aluminum alloy (AA 2024-T3) substrate. The coatings were exposed to salt spray according to ASTM B117 and prohesion conditions according to ASTM G85-A5. The corrosion resistance properties were monitored via electrochemical impedance spectroscopy (EIS). The current produced by corrosion reactions on the surface of the substrate was mapped using the scanning vibrating electrode technique (SVET). Galvanic coupling experiments were performed for measurement of galvanic current and mixed potential in controlled environment. It was observed that the morphology of PPy on the surface of aluminum flake has an effect on the conductivity and anticorrosion performance of the pigment. The wire PPy/Al flake composite coatings exhibited better anticorrosion performance than the spherical PPy/Al flake composite coatings and as received aluminum flake coatings. The enhancement in anticorrosion performance was attributed to the unique morphology and electrochemical activity of the PPy on the surface of aluminum flakes. It was also revealed that the wire PPy/Al flake composite coating was sacrificially protecting the AA 2024-T3 substrate in larger defects

  17. AA magnet measurement team

    CERN Multimedia


    Quickly improvised measurement equipment for the AA (Antiproton Accumulator) was all the tight schedule permitted, but the high motivation of the team made up for the lack of convenience. From left to right: Roy Billinge (Joint AA Project Leader, the other one was Simon van der Meer); Bruno Autin, Brian Pincott, Colin Johnson.

  18. Effect of finite edge radius on ductile fracture ahead of the cutting tool edge in micro-cutting of Al2024-T3

    Energy Technology Data Exchange (ETDEWEB)

    Subbiah, Sathyan [George W. Woodruff School of Mechanical Engineering, Georgia Institute of Technology, Atlanta, GA 30332 (United States); Melkote, Shreyes N. [George W. Woodruff School of Mechanical Engineering, Georgia Institute of Technology, Atlanta, GA 30332 (United States)], E-mail:


    Evidence of ductile fracture leading to material separation has been reported recently in ductile metal cutting [S. Subbiah, S.N. Melkote, ASME J. Manuf. Sci. Eng. 28(3) (2006)]. This paper investigates the effect of finite edge radius on such ductile fracture. The basic question of whether such ductile fracture occurs in the presence of a finite edge radius is explored by performing a series of experiments with inserts of different edge radii at various uncut chip thickness values ranging from 15 to 105 {mu}m. Chip-roots are obtained in these experiments using a quick-stop device and examined in a scanning electron microscope. Clear evidence of material separation is seen at the interface zone between the chip and machined surface even when the edge radius is large compared to the uncut chip thickness. Failure is seen to occur at the upper, middle, and/or the lower edges of the interface zone. Based on these observations, a hypothesis is presented for the events leading to the occurrence of this failure when cutting with an edge radius tool. Finite element simulations are performed to study the nature of stress state ahead of the tool edge with and without edge radius. Hydrostatic stress is seen to be tensile in front of the tool and hence favors the occurrence of ductile fracture leading to material separation. The stress components are, however lower than those seen with a sharp tool.

  19. AAS 227: Welcome! (United States)

    Kohler, Susanna


    Greetings from the 227th American Astronomical Society meeting in Kissimmee, Florida! This week, along with several fellow authors from astrobites, Iwill bewritingupdates on selectedevents at themeeting and posting at the end of each day. You can follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.If youre an author or referee (or plan to be!) and youre here at the meeting, consider joining us at our Author and Referee Workshop on Wednesday in the Tallahassee room, where well be sharingsome of the exciting new features of the AAS journals. You can drop intoeither of the two-hour sessions(10 AM 12 PM or 1 PM 3 PM), and there will be afree buffet lunch at noon.Heres the agenda:Morning SessionTopic Speaker10:00 am 10:05 amIntroductionsJulie Steffen10:05 am 10:35 amChanges at AAS Journals; How to Be a Successful AAS AuthorEthan Vishniac10:35 am 11:00 amThe Peer Review ProcessButler Burton11:00 am 11:15 amAAS Nova: Sharing AAS Authors Research with the Broader CommunitySusanna Kohler11:15 am 11:30 amFixing Software and Instrumentation Publishing: New Paper Styles in AAS JournalsChris Lintott11:30 am 11:45 amMaking Article Writing Easier with the New AASTeX v6.0Greg Schwarz11:45 am 12:00 pmBringing JavaScript and Interactivity to Your AAS Journal FiguresGus MuenchLunch SessionTopic Speaker12:00 pm 12:15 pmUnified Astronomy ThesaurusKatie Frey12:15 pm 12:30 pmAAS/ADS ORCID Integration ToolAlberto Accomazzi12:30 pm 12:45 pmWorldWide Telescope and Video AbstractsJosh Peek12:45 pm 01:00 pmArizona Astronomical Data Hub (AADH)Bryan HeidornAfternoon SessionTopic Speaker01:00 pm 01:05 pmIntroductionsJulie Steffen01:05 pm 01:35 pmChanges at AAS Journals; How to Be a Successful AAS AuthorEthan Vishniac01:35 pm 02:00 pmThe Peer Review ProcessButler Burton02:00 pm 02:15 pmAAS Nova: Sharing AAS Authors Research with the Broader CommunitySusanna Kohler02:15 pm 02:30 pm

  20. Geomagnetic aa Indices (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa indices are the continuation of the series beginning in the year 1868. A full description of these indices is given in the International...

  1. AAS Career Services (United States)

    Marvel, Kevin B.


    The American Astronomical Society provides substantial programs in the area of Career Services.Motivated by the Society's mission to enhance and share humanity's understanding of the Universe, the AAS provides a central resource for advertising positions, interviewing opportunities at its annual winter meeting and information, workshops and networks to enable astronomers to find employment.The programs of the Society in this area are overseen by an active committee on employment and the AAS Council itself.Additional resources that help characterize the field, its growth and facts about employment such as salaries and type of jobs available are regularly summarized and reported on by the American Institute of Physics.

  2. AAS Oral History Project (United States)

    Buxner, Sanlyn; Holbrook, Jarita; AAS Oral History Team


    Now in its fourth year, the AAS Oral History Project has interviewed over 80 astronomers from all over the world. Led by the AAS Historical Astronomy Division (HAD) and partially funded by the American Institute of Physics Niels Bohr Library and ongoing support from the AAS, volunteers have collected oral histories from astronomers at professional meetings starting in 2015, including AAS, DPS, and the IAU general assembly. Each interview lasts one and a half to two hours and focuses on interviewees’ personal and professional lives. Questions include those about one’s family, childhood, strong influences on one’s scientific career, career path, successes and challenges, perspectives on how astronomy is changing as a field, and advice to the next generation. Each interview is audio recorded and transcribed, the content of which is checked with each interviewee. Once complete, interview transcripts are posted online as part of a larger oral history library at Future analysis will reveal a rich story of astronomers and will help the community address issues of diversity, controversies, and the changing landscape of science. We are still recruiting individuals to be interviewed from all stages of career from undergraduate students to retired and emeritus astronomers. Contact Jarita Holbrook to schedule an interview or to find out more information about the project ( Also, contact Jarita Holbrook if you would like to become an interviewer for the project.

  3. The Antiproton Accumulator (AA)

    CERN Multimedia


    Section 06 - 08*) of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A vacuum-tank, two bending magnets (BST06 and BST07 in blue) with a quadrupole (QDN07, in red) in between, another vacuum-tank, a wide quadrupole (QFW08) and a further tank . The tanks are covered with heating tape for bake-out. The tank left of BST06 contained the stack core pickup for stochastic cooling (see 7906193, 7906190, 8005051), the two other tanks served mainly as vacuum chambers in the region where the beam was large. Peter Zettwoch works on BST06. *) see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984)

  4. AA, bending magnet, BLG

    CERN Multimedia


    The very particular lattice of the AA required 2 types of dipole (bending magnets; BLG, long and narrow; BST, short and wide). The BLG had a steel length of 4.70 m, a good field width of 0.24 m, and a weight of about 70 t. Jean-Claude Brunet inspects the lower half of a BLG. For the BST magnets see 7811105 and 8006036.

  5. The Antiproton Accumulator (AA)

    CERN Multimedia


    A section of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A large vacuum-tank, a quadrupole (QDN09*), a bending magnet (BST08), another vacuum-tank, a wide quadrupole (QFW08) and (in the background) a further bending magnet (BST08). The tanks are covered with heating tape for bake-out. The tank left of QDN09 contained the kickers for stochastic pre-cooling (see 790621, 8002234, 8002637X), the other one served mainly as vacuum chamber in the region where the beam was large. Peter Zettwoch works on QFW08. * see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984) See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  6. Integrated Precipitate Simulation for Friction Stir Welding of Age Hardening Aluminium Alloys


    Hersent, Emmanuel


    Friction stir welding (FSW) is a recent welding process invented by The Welding Institute (TWI). It is particularly interesting for the aeronautical sector due to its capacity to weld 2XXX and 7XXX age-hardening aluminium alloys, which were previously considered unweldable. This relatively new process is currently the subject of active research. This work aims to simulate the hardness profile of an AA2024-T3 friction stir weld. AA2024-T3 is an age hardening aluminium alloy, so it is necessary...

  7. AAS 227: Day 2 (United States)

    Kohler, Susanna


    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  8. Incorporation of arachidonic acid (AA) into phosphatidylcholine molecular species of the human neutrophil (PMN)

    International Nuclear Information System (INIS)

    Recently the authors proposed that the initial incorporation of AA into 1,2 diacylphosphatidylcholine (PC) was mediated by AA-CoA transferase(s) while the subsequent transfer of AA from 1,2-diacyl- into alkyl, acyl-PC was mediated by a CoA-independent transacylase. Studies here provide further evidence for such a two-step mechanism. PMNs were pulse labeled for 5 min with 3H-AA (.07μM) which was rapidly incorporated into 1,2-diacyl-PC. However, incorporation of AA into 1,2-diacyl-PC was inhibited by incubation with high levels of AA (30 μM). Similarly PMNs were pulsed labeled with 3H-AA for 5 min followed by a 120 min incubation. In these cells, 3H-AA was rapidly transferred from 1,2-diacyl-PC into alkyl, acyl-PC. In the presence of 30 μM AA redistribution of 3H-AA from diacyl to alkyl, acyl-PC was observed. This result implied that the initial incorporation of 3H-AA proceeds via a free acid intermediate while the transfer of 3H-AA from diacyl to alkyl, acyl-PC does not. Using a cell free system, 14C-AACoA was incubated for 5 min and found to be incorporated into 1,2-diacyl-PC containing 16:0, 18:0, and 18:1 at the sn-1 position. Furthermore 14C-AACoA and various 1-radyl, 2-lyso-PC were added to a PMN membrane preparation. The arachidonyl-transferase(s) preferred the 1-acyl, 2-lyso-PC substrate to 1-alkyl, 2-lyso-PC. Thus these studies provide further evidence that AA is initially incorporated into 1,2-diacyl-PC through arachidonyl-CoA transferases

  9. AAS 227: Day 2 (United States)

    Kohler, Susanna


    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  10. AAS 227: Day 1 (United States)

    Kohler, Susanna


    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or at, or catch ourlive-tweeted updates from the @astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto have so many people tell us that they already know about and useastrobites, and we were excited to introduce a new cohort of students at AAS to astrobites for the first time.Tuesday morning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended today.Opening Address (by Becky Smethurst)The President of the AAS, aka our fearless leader Meg Urry kicked off the meeting this morning at the purely coffee powered hour of 8am this morning. She spoke about the importance of young astronomers at the meeting (heres looking at you reader!) and also the importance of the new Working Group for Accessibility and Disabilities (aka WGAD pronounced like wicked) at the AAS. The Society has made extra effort this year to make the conference accessible to all,a message which was very well received by everyone in attendance.Kavli Lecture: New Horizons Alan Stern (by Becky Smethurst)We were definitely spoilt with the first Plenary lecture at this years conference Alan Stern gave us a a review of the New Horizons mission of the Pluto Fly By (astrobites covered the mission back in July with this post). We were treated to beautiful images, wonderful results and a foray into geology.Before (Hubble) and after #NewHorizons. #thatisall #science #astro alanstern #aas227 Science News (@topsciencething) January 5, 2016Some awesome facts from the lecture that blew my mind:New Horizons is now 2AU (!) beyond Pluto

  11. AAS 227: Day 3 (United States)

    Kohler, Susanna


    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 3 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Henry Norris Russell Lecture: Viewing the Universe with Infrared Eyes: The Spitzer Space Telescope (by Erika Nesvold)The Henry Norris Russell Award is the highest honor given by the AAS, for a lifetime of eminence in astronomy research. This years award went to Giovanni Fazio of the Harvard-Smithsonian Center for Astrophysics. Fazio became a leader in gamma ray astronomy before switching mid-career to the study of infrared astronomy, and he gave his award lecture on the latter subject, specifically on the Spitzer Space Telescope, one of the most successful infrared telescopes of all time.Artists rendering of the Spitzer space telescope. [NASA/JPL-Caltech]Spitzer has been operating for more than twelve years, and has resulted in over six thousand papers in refereed journals in that time. The telescope sits in an Earth-trailing orbit around the Sun, and is now farther from the Earth (1.4 AU) than the Earth is from the Sun. Fazio gave the audience a fascinating overview of the science done by Spitzer over more than a decade. One of the most productive areas of research for Spitzer is the study of exoplanets, which hadnt even been discovered when the Spitzer Telescope was first conceived. Spitzers high sensitivity and ability to observe exoplanets over

  12. AAS 228: Day 4 (United States)

    Kohler, Susanna


    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  13. The Drentsche Aa valley system

    International Nuclear Information System (INIS)

    This thesis is composed of five papers concerned with Late Quaternary geology and geomorphology of the Aa valley system. The correlation and chronostratigraphic position of the layers have been established by radiocarbon dating. (Auth.)

  14. AAS 227: Day 4 (United States)

    Kohler, Susanna


    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  15. AAS 228: Day 4 (United States)

    Kohler, Susanna


    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or



    Witkowska, Malgorzata Danuta


    The aluminium AA1050 alloy, known as commercially pure aluminium, contains 99.5% Al, together with Fe and Si as major alloying elements. During fabrication of aluminium substrates for lithographic printing plates in Bridgnorth Aluminium Ltd, the AA 1050 aluminium alloy proceeds through various stages of thermomechanical processing, with the conditions at each processing stage influencing the microstructure of the final coil. Because of its specific gravity, tensile strength, surface performa...

  17. AAS 227: Day 4 (United States)

    Kohler, Susanna


    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  18. Transformation from AA to AB-Stacked Bilayer Graphene on α-SiO2 under an Electric Field

    Institute of Scientific and Technical Information of China (English)

    LIU Yan; AO Zhi-Min; WANG Tao; WANG Wen-Bo; SHENG Kuang; YU Bin


    @@ The energetic and electronic structure of bilayered graphene(BLG) with AA stacking arrangement on a SiO2 substrate is investigated in the presence of an electric field F of different intensities by ab initio density functional calculations.The AA-stacked bilayer graphene is stable on the SiO2 substrate in the absence of an electric field.However, as F increases, the AA-stacked bilayer graphenes are gradually shifted with each other and finally transfers into AB-stacked bilayer graphenes.The bandgap is accordingly changed.

  19. Is amyloid A (AA) amyloidosis always secondary?


    Maury, C P; Törnroth, T; Wegelius, O


    The case is reported of a patient with systemic AA amyloidosis associated with non-specific mesenteric lymphadenitis and chronic sideropenia. Renal, small bowel, and rectal biopsies showed amyloid deposits containing AA protein, as defined by potassium permanganate sensitivity and by reactivity with AA antiserum. Reversal of the nephrotic syndrome occurred during steroid-azathioprine therapy.

  20. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor


    Pérez, Claudia; Fernandez, Luisa E.; Sun, Jianguang; Folch, Jorge Luis; Gill, Sarjeet S.; Soberón, Mario; Bravo, Alejandra


    Bacillus thuringiensis subsp. israelensis produces crystal proteins, Cry (4Aa, 4Ba, 10Aa, and 11Aa) and Cyt (1Aa and 2Ba) proteins, toxic to mosquito vectors of human diseases. Cyt1Aa overcomes insect resistance to Cry11Aa and Cry4 toxins and synergizes the toxicity of these toxins. However, the molecular mechanism of synergism remains unsolved. Here, we provide evidence that Cyt1Aa functions as a receptor of Cry11Aa. Sequential-binding analysis of Cyt1Aa and Cry11Aa revealed that Cyt1Aa bind...

  1. Laboratory Astrophysics Division of the AAS (LAD) (United States)

    Salama, Farid; Drake, R. P.; Federman, S. R.; Haxton, W. C.; Savin, D. W.


    The purpose of the Laboratory Astrophysics Division (LAD) is to advance our understanding of the Universe through the promotion of fundamental theoretical and experimental research into the underlying processes that drive the Cosmos. LAD represents all areas of astrophysics and planetary sciences. The first new AAS Division in more than 30 years, the LAD traces its history back to the recommendation from the scientific community via the White Paper from the 2006 NASA-sponsored Laboratory Astrophysics Workshop. This recommendation was endorsed by the Astronomy and Astrophysics Advisory Committee (AAAC), which advises the National Science Foundation (NSF), the National Aeronautics and Space Administration (NASA), and the U.S. Department of Energy (DOE) on selected issues within the fields of astronomy and astrophysics that are of mutual interest and concern to the agencies. In January 2007, at the 209th AAS meeting, the AAS Council set up a Steering Committee to formulate Bylaws for a Working Group on Laboratory Astrophysics (WGLA). The AAS Council formally established the WGLA with a five-year mandate in May 2007, at the 210th AAS meeting. From 2008 through 2012, the WGLA annually sponsored Meetings in-a-Meeting at the AAS Summer Meetings. In May 2011, at the 218th AAS meeting, the AAS Council voted to convert the WGLA, at the end of its mandate, into a Division of the AAS and requested draft Bylaws from the Steering Committee. In January 2012, at the 219th AAS Meeting, the AAS Council formally approved the Bylaws and the creation of the LAD. The inaugural gathering and the first business meeting of the LAD were held at the 220th AAS meeting in Anchorage in June 2012. You can learn more about LAD by visiting its website at and by subscribing to its mailing list.

  2. Langevin dynamics of A+A reactions in one dimension

    International Nuclear Information System (INIS)

    We propose a set of Langevin equations of motion together with a reaction rule for the study of binary reactions. Our scheme is designed to address this problem for arbitrary friction γ and temperature T. It easily accommodates the inclusion of a substrate potential, and it lends itself to straightforward numerical integration. We test this approach on diffusion-limited (γ → ∞) as well as ballistic (γ = 0) A+A → P reactions for which there are extensive exact and approximate theoretical results as well as extensive Monte Carlo results. We reproduce the known results using our integration scheme, and also present new results for the ballistic reactions

  3. AAS 228: Day 1 morning (United States)

    Kohler, Susanna


    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Come visit astrobites at the AAS booth we have swag!Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto hear from undergrads who already know and love the site, educators who want to use it in their classrooms, and students who had not yet been introduced to astrobites and were excited about a new resource!For the rest of the meeting we will be stationed at theAAS booth in the exhibit hall (booth #211-213), so drop by if you want to learn more (or pick up swag: weve got lots of stickers and sunglasses)!Mondaymorning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended this morning.Opening Address(by Susanna Kohler)AAS President Meg Urry kicked off the meeting this morning at 8am with an overview of some of the great endeavors AAS is supporting. We astrobiters had personal motivation to drag ourselves out of bed that early: during this session, Urryannounced the new partnership between AAS and astrobites!Urry touched on some difficult topics in her welcome, including yesterdays tragedy in Orlando. Shereiteratedthe AASs support fortheCommittee for Sexual-Orientation and Gender Minorities in Astronomy (SGMA). She also reminded meeting attendees about the importance ofkeeping conference interactions professional, and pointed to the meetings anti-harassment policy.Partnership Announcement (by Michael Zevin)This morning, the American Astronomical Society announced the new partnership that it will have with Astrobites! We are beyond excited to embark on this new partnership with the

  4. AA, closed orbit observation pickup

    CERN Multimedia


    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. Werner Sax contemplates his achievement. See also 8001383, 8010042, 8010045.

  5. AA, closed orbit observation pickup

    CERN Multimedia


    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles QFW, at maximum dispersion. See also 8001372, 8001383, 8010045

  6. AA, closed orbit observation pickup

    CERN Multimedia


    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. See also 8001372, 8010042, 8010045

  7. AA, closed orbit observation pickup

    CERN Multimedia


    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles, QFW, at maximum dispersion. See also 8001372,8001383, 8010042

  8. AAS 228: Day 3 afternoon (United States)

    Kohler, Susanna


    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  9. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor. (United States)

    Pérez, Claudia; Fernandez, Luisa E; Sun, Jianguang; Folch, Jorge Luis; Gill, Sarjeet S; Soberón, Mario; Bravo, Alejandra


    Bacillus thuringiensis subsp. israelensis produces crystal proteins, Cry (4Aa, 4Ba, 10Aa, and 11Aa) and Cyt (1Aa and 2Ba) proteins, toxic to mosquito vectors of human diseases. Cyt1Aa overcomes insect resistance to Cry11Aa and Cry4 toxins and synergizes the toxicity of these toxins. However, the molecular mechanism of synergism remains unsolved. Here, we provide evidence that Cyt1Aa functions as a receptor of Cry11Aa. Sequential-binding analysis of Cyt1Aa and Cry11Aa revealed that Cyt1Aa binding to Aedes aegypti brush border membrane vesicles enhanced the binding of biotinylated-Cry11Aa. The Cyt1Aa- and Cry11Aa-binding epitopes were mapped by means of the yeast two-hybrid system, peptide arrays, and heterologous competition assays with synthetic peptides. Two exposed regions in Cyt1Aa, loop beta6-alphaE and part of beta7, bind Cry11Aa. On the other side, Cry11Aa binds Cyt1Aa proteins by means of domain II-loop alpha8 and beta-4, which are also involved in midgut receptor interaction. Characterization of single-point mutations in Cry11Aa and Cyt1Aa revealed key Cry11Aa (S259 and E266) and Cyt1Aa (K198, E204 and K225) residues involved in the interaction of both proteins and in synergism. Additionally, a Cyt1Aa loop beta6-alphaE mutant (K198A) with enhanced synergism to Cry11Aa was isolated. Data provided here strongly indicates that Cyt1Aa synergizes or suppresses resistance to Cry11Aa toxin by functioning as a membrane-bound receptor. Bacillus thuringiensis subsp. israelensis is a highly effective pathogenic bacterium because it produces a toxin and also its functional receptor, promoting toxin binding to the target membrane and causing toxicity. PMID:16339907

  10. AAS 228: Day 3 afternoon (United States)

    Kohler, Susanna


    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  11. Lamination sheet of AA BST magnet

    CERN Multimedia


    The AA had 2 types of bending magnets: BLG (window-frame, long and narrow)and BST (H-type, short and wide). The BST had a very wide aperture, 0.564 m of "good field". To demonstrate the size, the petite AA secretary, Val Mansfield, poses with a lamination sheet. See also 7811105, 7906163, 8006050.

  12. AAS 228: Day 1 morning (United States)

    Kohler, Susanna


    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Come visit astrobites at the AAS booth we have swag!Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto hear from undergrads who already know and love the site, educators who want to use it in their classrooms, and students who had not yet been introduced to astrobites and were excited about a new resource!For the rest of the meeting we will be stationed at theAAS booth in the exhibit hall (booth #211-213), so drop by if you want to learn more (or pick up swag: weve got lots of stickers and sunglasses)!Mondaymorning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended this morning.Opening Address(by Susanna Kohler)AAS President Meg Urry kicked off the meeting this morning at 8am with an overview of some of the great endeavors AAS is supporting. We astrobiters had personal motivation to drag ourselves out of bed that early: during this session, Urryannounced the new partnership between AAS and astrobites!Urry touched on some difficult topics in her welcome, including yesterdays tragedy in Orlando. Shereiteratedthe AASs support fortheCommittee for Sexual-Orientation and Gender Minorities in Astronomy (SGMA). She also reminded meeting attendees about the importance ofkeeping conference interactions professional, and pointed to the meetings anti-harassment policy.Partnership Announcement (by Michael Zevin)This morning, the American Astronomical Society announced the new partnership that it will have with Astrobites! We are beyond excited to embark on this new partnership with the

  13. The power of alternative assessments (AAs)

    Institute of Scientific and Technical Information of China (English)



    This article starts by discussing the potential disadvantages of traditional assessment towards young English as a Second Language (ESL) learners within the American public school education system. In response to such disadvantages, researchers ’call for the implementation of alternative assessments (AAs) is therefore introduced along with the various benefits of AAs. However, the current mainstream education policy in the US, namely No Child Left Behind (NCLB) Policy, is still largely based on the tra-ditional ways of testing, making policy-oriented implementation of AAs on large scales remarkably difficult. After careful analysis, the author points out several implications concerning how, under such an existing policy of NCLB, can practitioners effectively accommodate young ESL learners by applying the power of AAs.

  14. Friction Stir Weldabilities of AA1050-H24 and AA6061-T6 Aluminum Alloys

    Institute of Scientific and Technical Information of China (English)

    Huijie LIU; Hidetoshi FUJIN; Masakatsu MAEDA; Kiyoshi NOGI


    The friction stir weldabilities of the strain-hardened AA1050-H24 and precipitate-hardened AA6061-T6 aluminum alloys were examined to reveal the effects of material properties on the friction stir welding behavior. The experimental results are obtlained. (1) For AA1050-H24, the weld can possess smoother surface ripples; there is no elliptical weld nugget in the weld; there is no discernible interface between the stir zone and the thermomechanically affected zone;and the internal defect of the weld looks like a long crack and is located in the lower part of the weld. (2) For AA6061-T6, the weld usually possesses slightly rougher surface ripples; an elliptical weld nugget clearly exists in the weld; there are discernible interfaces among the weld nugget, thermomechanically affected zone and heat affected zone; and the internal defect of the weld is similar to that of the AA1050-H24 weld. (3) The effective range of welding parameters for AA1050-H24 is narrow, while the one for AA6061-T6 is very wide. (4) The maximum tensile strength efficiency of the AA1050-H24 joints is similar to that of the AA6061-T6 joints, i.e. 79% and 77%, respectively.

  15. AAS 228: Day 3 morning (United States)

    Kohler, Susanna


    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session 2015 Newton Lacy Pierce Prize Lecture: The Elephant in the Room: Effects of Distant, Massive Companions on Planetary System Architectures (by Leonardo dos Santos)The first session on Wednesday at 228th AAS Meeting was the Newton Lacy Pierce Prize Lecture by Heather Knutson (California Institute of Technology). This talk featured a broad range of research efforts on exoplanets, with the main focus on how we study the composition of their atmospheres, and how multi-body interactions carve the structure of the planetary systems we observe.One of her first points is the well-known idea that the Solar System is an oddball, compared to the exoplanet systems we have found so far: most of these systems contain hot Jupiters and mini-Neptunes at very close-in orbits around their host stars. Moreover, even when studying their transmission spectra, it is difficult to know the exact composition of their atmospheres.Knutson: it is difficult to constrain atmospheric composition of exoplanets (H-poor or H-rich+clouds?) astrobites (@astrobites) June 15, 2016The main proposal on how these systems formed is the migration scenario. In order to validate this idea, Dr. Knutson and her group The Friends of Hot Jupiters study systems with close-in gas giants and their frequency of binary companions, which are supposed to be the main culprits causing gas-giant migration. They found that approximately half of the observed systems have long-distance companions, providing strong validation of the migration scenario. Moreover, Dr. Knutson speculates that wide binaries have more

  16. Magnetic horn of the Antiproton Accumulator (AA)

    CERN Multimedia

    Photographic Service


    In the 1960s, the invention of this "current sheet lens" has helped to greatly improve the flux of neutrino beams. It was used again at the AA, collecting antiprotons from the production target at angles too large to fit into the acceptance of the AA. It was machined from aluminium to a thickness of 1.4 mm and pulsed at 400 kA for 15 microseconds (half-sine).

  17. Effect of supplementation of arachidonic acid (AA) or a combination of AA plus docosahexaenoic acid on breastmilk fatty acid composition

    NARCIS (Netherlands)

    Smit, EN; Koopmann, M; Boersma, ER; Muskiet, FAJ


    We investigated whether supplementation with arachidonic acid (20:4 omega 6; AA), ora combination of AA and docosahexaenoic acid (22:6 omega 3; DHA) would affect human milk polyunsaturated fatty acid (PUFA) composition. Ten women were daily supplemented with 300 mg AA, eight with 300 mg AA, 110 mg e

  18. AAS 228: Day 1 afternoon (United States)

    Kohler, Susanna


    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session: From Space Archeology to Serving the World Today: A 20-year Journey from the Jungles of Guatemala to a Network of Satellite Remote Sensing Facilities Around the World(by Michael Zevin)In the conferences second plenary session, NASAs Daniel Irwin turned the eyes of the conference back to Earth by highlighting the huge impact that NASA missions play in protecting and developing our own planet.Daniel Irwin: using satellite imagery to detect differences in vegetation and find ancient Mayan cities. #aas228 astrobites (@astrobites) June 13, 2016Irwin came to be involved in NASA through his work mapping Guatemalan jungles, where he would spend 22 days at a time exploring the treacherous jungles on foot armed with a 1st generation GPS, a compass, and a machete. A colleague introduced Irwin to the satellite imagery thathe was exploring, demonstratinghow these images are a strong complement to field work. The sharing of this satellite data with nearby villages helped to show the encroachment of agriculture and the necessity of connecting space to the village. Satellite imagery also played a role in archeological endeavors, uncovering dozens of Mayan cities that have been buried for over a millennia by vegetation, and it provided evidence that the fall of the Mayan civilization may have been due to massive deforestation that ledto drought.Glacial retreat in Chile imaged by ISERV.Irwin displayed the constellation of NASAs Earth-monitoring satellites that have played an integral role in conserving our planet and alerting the world of natural disasters. He also showed

  19. Mechanism of corrosion inhibition of AA2024 by rare-earth compounds. (United States)

    Yasakau, Kiryl A; Zheludkevich, Mikhail L; Lamaka, Sviatlana V; Ferreira, Mario G S


    The mechanism of corrosion protection of the widely used 2024-T3 aluminum alloy by cerium and lanthanum inhibitors in chloride media is described in detail in the present work. The corrosion process was investigated by means of scanning Kelvin probe force microscopy (SKPFM), in situ atomic force microscopy, and scanning electron microscopy coupled with energy dispersive spectroscopy. Employment of the high-resolution and in situ techniques results in a deep understanding of the details of the physical chemistry and mechanisms of the corrosion processes. The applicability of the SKPFM for mechanistic analysis of the effect of different corrosion inhibitors is demonstrated for the first time. The inhibitors under study show sufficient hindering of the localized corrosion processes especially in the case of pitting formation located around the intermetallic S-phase particles. The main role of Ce(3+) and La(3+) in the corrosion protection is formation of hydroxide deposits on S-phase inclusions buffering the local increase of pH, which is responsible for the acceleration of the intermetallics dealloying. The formed hydroxide precipitates can also act as a diffusion barrier hindering the corrosion processes in active zones. Cerium nitrate exhibits higher inhibition efficiency in comparison with lanthanum nitrate. The higher effect in the case of cerium is obtained due to lower solubility of the respective hydroxide. A detailed mechanism of the corrosion process and its inhibition is proposed based on thermodynamic analysis. PMID:16539491

  20. The AA disappearing under concrete shielding

    CERN Multimedia


    When the AA started up in July 1980, the machine stood freely in its hall, providing visitors with a view through the large window in the AA Control Room. The target area, in which the high-intensity 26 GeV/c proton beam from the PS hit the production target, was heavily shielded, not only towards the outside but also towards the AA-Hall. However, electrons and pions emanating from the target with the same momentum as the antiprotons, but much more numerous, accompanied these through the injection line into the AA ring. The pions decayed with a half-time corresponding to approximately a revolution period (540 ns), whereas the electrons lost energy through synchrotron radiation and ended up on the vacuum chamber wall. Electrons and pions produced the dominant component of the radiation level in the hall and the control room. With operation times far exceeding original expectations, the AA had to be buried under concrete shielding in order to reduce the radiation level by an order of magnitude.

  1. MDCT evaluation of acute aortic syndrome (AAS). (United States)

    Valente, Tullio; Rossi, Giovanni; Lassandro, Francesco; Rea, Gaetano; Marino, Maurizio; Muto, Maurizio; Molino, Antonio; Scaglione, Mariano


    Non-traumatic acute thoracic aortic syndromes (AAS) describe a spectrum of life-threatening aortic pathologies with significant implications on diagnosis, therapy and management. There is a common pathway for the various manifestations of AAS that eventually leads to a breakdown of the aortic intima and media. Improvements in biology and health policy and diffusion of technology into the community resulted in an associated decrease in mortality and morbidity related to aortic therapeutic interventions. Hybrid procedures, branched and fenestrated endografts, and percutaneous aortic valves have emerged as potent and viable alternatives to traditional surgeries. In this context, current state-of-the art multidetector CT (MDCT) is actually the gold standard in the emergency setting because of its intrinsic diagnostic value. Management of acute aortic disease has changed with the increasing realization that endovascular therapies may offer distinct advantages in these situations. This article provides a summary of AAS, focusing especially on the MDCT technique, typical and atypical findings and common pitfalls of AAS, as well as recent concepts regarding the subtypes of AAS, consisting of aortic dissection, intramural haematoma, penetrating atherosclerotic ulcer and unstable aortic aneurysm or contained aortic rupture. MDCT findings will be related to pathophysiology, timing and management options to achieve a definite and timely diagnostic and therapeutic definition. In the present article, we review the aetiology, pathophysiology, clinical presentation, outcomes and therapeutic approaches to acute aortic syndromes. PMID:27033344

  2. Dicty_cDB: FCL-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA03 (Link to dictyBase) - - - Contig-U15092-1 FCL-AA03E ...(Link to Original site) - - - - - - FCL-AA03E 627 Show FCL-AA03 Library FCL (Link to library) Clone ID FCL-AA... Representative seq. ID FCL-AA...03E (Link to Original site) Representative DNA sequence >FCL-AA03 (FCL-AA03Q) /CSM/FCL/FCL-AA/FCL-AA...03Q.Seq.d/ ACATAATGTTCCAAAAGAAAGCAATTGTTATTGATGGCAAAGGTCATTTGTTAGGTCGTT TAGCCTCCGTTGTTGCTAAATCCCTCCTCTCTGGTCAAAA

  3. Dicty_cDB: FCL-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA02 (Link to dictyBase) - - - Contig-U16560-1 FCL-AA02F ...(Link to Original site) FCL-AA02F 620 - - - - - - Show FCL-AA02 Library FCL (Link to library) Clone ID FCL-AA... Representative seq. ID FCL-AA...02F (Link to Original site) Representative DNA sequence >FCL-AA02 (FCL-AA02Q) /CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ ATTAA...ATACAAAATACAAATACAAATAACAAATACTTTACTATAGCTTTTTTTTCTTATT TATTTCTCCAAATAATTTTTTAATATGCAAATCTTTGTTAAAA

  4. Dicty_cDB: FCL-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA09 (Link to dictyBase) - - - Contig-U16453-1 FCL-AA09F ...(Link to Original site) FCL-AA09F 485 - - - - - - Show FCL-AA09 Library FCL (Link to library) Clone ID FCL-AA... Representative seq. ID FCL-AA...09F (Link to Original site) Representative DNA sequence >FCL-AA09 (FCL-AA09Q) /CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ GACAA...AAGTAAATAAAACATGTCCGCAAGTAATAAAGATGACCAACTCATGAAAAATGAG TTCGAAAGTACCTACGACAAAATTGTCGATTCATTCGACAA

  5. Dicty_cDB: FCL-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA08 (Link to dictyBase) - - - Contig-U16200-1 FCL-AA08Z ...(Link to Original site) - - FCL-AA08Z 574 - - - - Show FCL-AA08 Library FCL (Link to library) Clone ID FCL-AA... Representative seq. ID FCL-AA...08Z (Link to Original site) Representative DNA sequence >FCL-AA08 (FCL-AA08Q) /CSM/FCL/FCL-AA/FCL-AA...08Q.Seq.d/ XXXXXXXXXXTCGAAGCCAAAGGTCGTCTCGAAGAAGAATTCCATCGCTCGTACCAACTC TGATCGTTCAAGAAAGAGACTCGAAGCTGAAA

  6. Dicty_cDB: FC-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA09 (Link to dictyBase) - - - Contig-U15086-1 FC-AA09E (Li...nk to Original site) - - - - - - FC-AA09E 562 Show FC-AA09 Library FC (Link to library) Clone ID FC-AA09 (Li.../ Representative seq. ID FC-AA...09E (Link to Original site) Representative DNA sequence >FC-AA09 (FC-AA09Q) /CSM/FC/FC-AA/FC-AA09Q.Seq....d/ GATACATTATCACCATGGCAGGAAAAAAAGTCAAATCTAACACACCAAAACAAGACTTAT CTGTCTCTAAATCAAAGCTCACCAGCATTAAAGCCCCAGCTGCTGCCATCAAAGCTAAA

  7. Dicty_cDB: FC-AA14 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA14 (Link to dictyBase) - - - Contig-U15088-1 FC-AA14E (Li...nk to Original site) - - - - - - FC-AA14E 431 Show FC-AA14 Library FC (Link to library) Clone ID FC-AA14 (Li.../ Representative seq. ID FC-AA...14E (Link to Original site) Representative DNA sequence >FC-AA14 (FC-AA14Q) /CSM/FC/FC-AA/FC-AA14Q.Seq.d/ CTATGTCTGAAATCAAAA...CTGAAGAACTCGCTTGCATCTACTCCGGTCTTTTATTACAAG ATGACGGTATTGAAATCACCGCTGATAAAATCAAAACCTTATTAGAAGCTGCCAA

  8. Dicty_cDB: FCL-AA04 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA04 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA04Z ...(Link to Original site) - - FCL-AA04Z 530 - - - - Show FCL-AA04 Library FCL (Link to library) Clone ID FCL-AA... Representative seq. ID FCL-AA...04Z (Link to Original site) Representative DNA sequence >FCL-AA04 (FCL-AA04Q) /CSM/FCL/FCL-AA/FCL-AA...04Q.Seq.d/ XXXXXXXXXXCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTTCAGTCAAAGAAATT AAAAGAGGTATGGTCGCTGGTGACTCCAAAAACGATCCACCACAAGAAA

  9. Dicty_cDB: FC-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA20 (Link to dictyBase) - - - Contig-U16455-1 FC-AA20Z (Li...nk to Original site) - - FC-AA20Z 607 - - - - Show FC-AA20 Library FC (Link to library) Clone ID FC-AA20 (Li.../ Representative seq. ID FC-AA...20Z (Link to Original site) Representative DNA sequence >FC-AA20 (FC-AA20Q) /CSM/FC/FC-AA/FC-AA20Q.Seq....d/ XXXXXXXXXXCTTTGCCCCAGCTGGTCTCTCAACTGAAGTCAAATCAGTCGAAATGCATC ACGAACAACTCCCAGAAGCCCGTCCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTT CAGTCAA

  10. Dicty_cDB: FCL-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA15 (Link to dictyBase) - - - Contig-U16011-1 FCL-AA15Z ...(Link to Original site) - - FCL-AA15Z 442 - - - - Show FCL-AA15 Library FCL (Link to library) Clone ID FCL-AA... Representative seq. ID FCL-AA...15Z (Link to Original site) Representative DNA sequence >FCL-AA15 (FCL-AA15Q) /CSM/FCL/FCL-AA/FCL-AA...15Q.Seq.d/ XXXXXXXXXXCCATTCATCTGTCCAATCGATTGTCGTCGTGGTCTCTACAAGAATATCGT CTTATCTGGTGGTTCAACCATGTTTAAAGATTTTGGTAAACGTCTTCAA

  11. Dicty_cDB: FC-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA13 (Link to dictyBase) - - - Contig-U15674-1 FC-AA13Z (Li...nk to Original site) - - FC-AA13Z 528 - - - - Show FC-AA13 Library FC (Link to library) Clone ID FC-AA13 (Li.../ Representative seq. ID FC-AA...13Z (Link to Original site) Representative DNA sequence >FC-AA13 (FC-AA13Q) /CSM/FC/FC-AA/FC-AA13Q.Seq.d/ XXXXXXXXXXAAAGCAAA...CTCGTGCTGGTCAACGTACCCGTTTCAAGGCTTTCGTCGTTG TTGGTGATCACAACGGTCATGTAGGTCTCGGTGTTAAATGCGCTAAGGAA

  12. Dicty_cDB: FCL-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA20 (Link to dictyBase) - - - Contig-U15052-1 FCL-AA20E ...(Link to Original site) - - - - - - FCL-AA20E 1159 Show FCL-AA20 Library FCL (Link to library) Clone ID FCL-AA...L Representative seq. ID FCL-AA...20E (Link to Original site) Representative DNA sequence >FCL-AA20 (FCL-AA20Q) /CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ AAAA...CATTTACAAATGATGACCACAGAAGATGTACAACCAATTGAAACTACCAAAGATGG TGTAGTAGTATTAAATTATAGCGATTTAATTGCAGGTAAA

  13. Dicty_cDB: FC-AA23 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA23 (Link to dictyBase) - - - Contig-U16090-1 FC-AA23E (Li...nk to Original site) - - - - - - FC-AA23E 387 Show FC-AA23 Library FC (Link to library) Clone ID FC-AA23 (Li.../ Representative seq. ID FC-AA...23E (Link to Original site) Representative DNA sequence >FC-AA23 (FC-AA23Q) /CSM/FC/FC-AA/FC-AA23Q.Seq.d/ AAACTCGATTATATTCTTAA...TCTTAAAGTTCAAGATTTCATGGAAAGACGTCTCCAAACT TTAGTCTTCAAAAATGGTCTTGCCAAATCAATCCATCACGCTCGTGTTTTAATCAAA

  14. Dicty_cDB: FC-AA12 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA12 (Link to dictyBase) - - - Contig-U15087-1 FC-AA12E (Li...nk to Original site) - - - - - - FC-AA12E 454 Show FC-AA12 Library FC (Link to library) Clone ID FC-AA12 (Li.../ Representative seq. ID FC-AA...12E (Link to Original site) Representative DNA sequence >FC-AA12 (FC-AA12Q) /CSM/FC/FC-AA/FC-AA12Q.Seq.d/ AAATAATAATAATATAAAAA...TGGAAATTAAAGTTTTAGCTAAAAGAAAAGTATCAGCAAA ACGTGCAAATGAAATATTAGGAAAATTTATTTTAGAAAGAAAAGCAAATGAAGAAAA

  15. Dicty_cDB: FC-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA01 (Link to dictyBase) - - - Contig-U15084-1 FC-AA01E (Li...nk to Original site) - - - - - - FC-AA01E 701 Show FC-AA01 Library FC (Link to library) Clone ID FC-AA01 (Li.../ Representative seq. ID FC-AA...01E (Link to Original site) Representative DNA sequence >FC-AA01 (FC-AA01Q) /CSM/FC/FC-AA/FC-AA01Q.Seq.d/ GAGAAATATTTCTTATTAA...CAATTGCATGCGTTGTATTCAACCCAACATGGTGGAATATT ACAGCAAGAATGGAATATAATGCTAATAAATAACAACCATTTTCTTTACTTCCACAAA

  16. Dicty_cDB: FCL-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA10 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA10Z ...(Link to Original site) - - FCL-AA10Z 627 - - - - Show FCL-AA10 Library FCL (Link to library) Clone ID FCL-AA... Representative seq. ID FCL-AA...10Z (Link to Original site) Representative DNA sequence >FCL-AA10 (FCL-AA10Q) /CSM/FCL/FCL-AA/FCL-AA...10Q.Seq.d/ XXXXXXXXXXTAAACCAGGTATGGTCGTCACCTTTTGCCCCAGCTGGTCTCTCAACTGAA GTCAAATCAGTCGAAATGCATCACGAACAACTCCCAGAA

  17. Dicty_cDB: FC-AA19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA19 (Link to dictyBase) - - - Contig-U16072-1 FC-AA19F (Li...nk to Original site) FC-AA19F 539 - - - - - - Show FC-AA19 Library FC (Link to library) Clone ID FC-AA19 (Li.../ Representative seq. ID FC-AA...19F (Link to Original site) Representative DNA sequence >FC-AA19 (FC-AA19Q) /CSM/FC/FC-AA/FC-AA19Q.Seq.d/ CAGAAA...TCACTGGTTTTTCATTCCAATTATTTAATATTATCAGTATTTGGAATGTTGATC AAACATCATTCAATAGCTACAGTCTTCCAATTTGGTTACCAGCCATTCAA

  18. Dicty_cDB: FC-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA02 (Link to dictyBase) - - - Contig-U16527-1 FC-AA02Z (Li...nk to Original site) - - FC-AA02Z 458 - - - - Show FC-AA02 Library FC (Link to library) Clone ID FC-AA02 (Li.../ Representative seq. ID FC-AA...02Z (Link to Original site) Representative DNA sequence >FC-AA02 (FC-AA02Q) /CSM/FC/FC-AA/FC-AA02Q.Seq.d/ XXXXXXXXXXCAAAAA...GGCTCCTGGTCCGGAAGGATTGGGTAATCATTTGAATTTCCTAC GTAACTGGGCTTGATCTTTGTAATTATTGATCATAAACGAGGAATTCCTTGTAAGCGTAA

  19. Dicty_cDB: FCL-AA24 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA24 (Link to dictyBase) - - - Contig-U16467-1 FCL-AA24E ...(Link to Original site) - - - - - - FCL-AA24E 779 Show FCL-AA24 Library FCL (Link to library) Clone ID FCL-AA... Representative seq. ID FCL-AA...24E (Link to Original site) Representative DNA sequence >FCL-AA24 (FCL-AA24Q) /CSM/FCL/FCL-AA/FCL-AA...24Q.Seq.d/ CTAGAAATTTCTAAACAATTATTTATTTGAAGAGGTTTTTTAAAAAAAGAAAAAAATCAG AGCATCCAAATAATAACCGCAGTAAGGGGGGGATGGTTGTTAA

  20. Dicty_cDB: FCL-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA05 (Link to dictyBase) - - - Contig-U16473-1 FCL-AA05Z ...(Link to Original site) - - FCL-AA05Z 603 - - - - Show FCL-AA05 Library FCL (Link to library) Clone ID FCL-AA... Representative seq. ID FCL-AA...05Z (Link to Original site) Representative DNA sequence >FCL-AA05 (FCL-AA05Q) /CSM/FCL/FCL-AA/FCL-AA...05Q.Seq.d/ XXXXXXXXXXTGGCGCCATCATTACTGGTGGAGGTGGTGTTGCTATCACTCAAGCTCAAC CATCATACCAAGCTGATGCCGTTGCCACTTACATCAAAA

  1. AAS 228: Day 2 afternoon (United States)

    Kohler, Susanna


    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  2. AAS 228: Day 2 morning (United States)

    Kohler, Susanna


    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  3. AAS 228: Day 2 afternoon (United States)

    Kohler, Susanna


    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  4. AAS 228: Day 2 morning (United States)

    Kohler, Susanna


    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  5. Power electronics substrate for direct substrate cooling (United States)

    Le, Khiet; Ward, Terence G.; Mann, Brooks S.; Yankoski, Edward P.; Smith, Gregory S.


    Systems and apparatus are provided for power electronics substrates adapted for direct substrate cooling. A power electronics substrate comprises a first surface configured to have electrical circuitry disposed thereon, a second surface, and a plurality of physical features on the second surface. The physical features are configured to promote a turbulent boundary layer in a coolant impinged upon the second surface.

  6. AA, vacuum tank for stochastic precooling

    CERN Multimedia


    The vaccum tank in which the fast stochastic precooling kicker was installed. It is clad with heating jackets for bake-out to 200 deg C, indispensable for reaching the operational vacuum of 7E-11 Torr. Alain Poncet, responsible for AA vacuum, is looking on. See also 7910268, 8002234.

  7. AA, mating of BST magnet halves

    CERN Multimedia


    The AA had 2 types of bending magnets: BLG (window-frame,long and narrow) and BST (H-type, short and wide). The BST had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the mating of two BST halves.

  8. 7 CFR 51.596 - U.S. Grade AA. (United States)


    ... 7 Agriculture 2 2010-01-01 2010-01-01 false U.S. Grade AA. 51.596 Section 51.596 Agriculture... Consumer Standards for Celery Stalks Grades § 51.596 U.S. Grade AA. U.S. Grade AA shall consist of stalks of celery of similar varietal characteristics, which are well developed, and have good...

  9. EValuation of the thixoformability of AA7004 and AA7075 alloys

    Directory of Open Access Journals (Sweden)

    Eugenio José Zoqui


    Full Text Available This study involved a complete evaluation of the thixoformability of AA7004 and AA7075 alloys, from their microstructural characterization to their viscous behavior. The alloys were subjected to globularization heat treatments for 0, 30, 90 and 210 seconds in two conditions of solid fractions, 45 and 60%, and to viscosity assays under the same conditions. Heat treatments promote the globularization of primary phase particles; hence, the best viscosity results were achieved for alloys with low solid fractions heat-treated for 210 seconds. Alloys AA7004 and AA7075 showed an apparent viscosity of 10(4 to 10(5 (Pa.s. The behavior of materials in this range is similar to that of molten glass and they show high formability. However, the AA7075 alloy showed a better performance than the AA7004 due to the smaller size of its primary particles and original grains, their lower growth during reheating, and depending on the condition, their viscosity of 10(4 Pa.s, which is extremely low for thixoforming standards.

  10. Processing and Optimization of Dissimilar Friction Stir Welding of AA 2219 and AA 7039 Alloys (United States)

    Venkateswarlu, D.; Nageswara rao, P.; Mahapatra, M. M.; Harsha, S. P.; Mandal, N. R.


    The present paper discusses the optimization of dissimilar friction stir welding of AA 2219 and AA 7039 alloys with respect to tool design issues including microstructural study of weld. The optimized ultimate tensile strength was ~280 MPa, and % elongation was ~11.5. It was observed that the extent of tool shoulder flat surface and tool rotational speed influenced the weld quality significantly. A mathematical model was also developed using response surface regression analysis to predict the effects of tool geometry and process variables on dissimilar AA 2219 and AA 7039 alloys welds. The microstructure evolution and mechanical properties were investigated by employing electron backscatter diffraction technique, Vickers microhardness, and tensile testing, respectively. The microstructural observations indicated that the grain size obtained at advancing side (AA 2219 alloy side) was much finer compared to the retreating side (AA 7039 alloy side). Hardness distribution in the stir zone was inhomogeneous, which might be due to inadequate mixing of weld zone material. The hardness values observed at the weld zone were lower than that in the base materials.

  11. Evolution of geomagnetic aa index near sunspot minimum


    Kane, R. P.


    The smoothed values of the minima of sunspot number Rz and the geomagnetic index aa were compared for sunspot cycles 12–23. In one cycle, aa(min) occurred earlier than Rz(min), but remained at that low from a few months before Rz(min) to a few months after Rz(min). In two cycles, Rz(min) and aa(min) coincided within a month or two. In nine cycles, aa(min) occurred more than three months later than Rz(min). The aa(min) coincided with the minima of some solar radio e...

  12. Dicty_cDB: FC-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA03 (Link to dictyBase) - - - Contig-U15331-1 FC-AA03P (Li...nk to Original site) FC-AA03F 595 FC-AA03Z 546 FC-AA03P 1141 - - Show FC-AA03 Library FC (Link to library) Clone ID FC-AA...nal site URL Representative seq. ID FC-AA...03P (Link to Original site) Representative DNA sequence >FC-AA03 (FC-AA03Q) /CSM/FC/FC-AA/FC-AA03Q.Seq.d/ AA...AATGTCATCTTATTTATTCACTAGTGAATCCGTCACCGAAGTCATCCAGATAAAATCT GTGATCAAGTATCAGATGCTGTTCTCGATGCTTGTTTAGCTCAA

  13. Dicty_cDB: FC-AA04 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA04 (Link to dictyBase) - - - Contig-U15354-1 FC-AA04P (Li...nk to Original site) FC-AA04F 546 FC-AA04Z 484 FC-AA04P 1030 - - Show FC-AA04 Library FC (Link to library) Clone ID FC-AA...nal site URL Representative seq. ID FC-AA...04P (Link to Original site) Representative DNA sequence >FC-AA04 (FC-AA04Q) /CSM/FC/FC-AA/FC-AA04Q.Seq.d/ AA...TAATACACATAAAAAATTTATTAAATAAAAATGACTACAACAACAACAAATGAAGTTT ATATAGTTGATTGTATTCGTACACCAATTGGTAGAGGATATAGTAA

  14. Dicty_cDB: FC-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA10 (Link to dictyBase) - - - Contig-U16358-1 FC-AA10P (Li...nk to Original site) FC-AA10F 659 FC-AA10Z 544 FC-AA10P 1203 - - Show FC-AA10 Library FC (Link to library) Clone ID FC-AA...nal site URL Representative seq. ID FC-AA...10P (Link to Original site) Representative DNA sequence >FC-AA10 (FC-AA10Q) /CSM/FC/FC-AA/FC-AA10Q.Seq.d/ AA...ATGACTACCTTTAACGAATATCCATTCTTGGCTGAATTAGGCATTAAAGCTGAAAATA ATGATGGAGTCTTCAATGGAAAATGGGGAGGTGCTGGTGAAATCATCAA

  15. AA, inner conductor of a magnetic horn

    CERN Multimedia


    At the start-up of the AA and during its initial operation, magnetic horns focused the antiprotons emanating from the production target. These "current-sheet lenses" had a thin inner conductor (for minimum absorption of antiprotons), machined from aluminium to wall thicknesses of 0.7 or 1 mm. The half-sine pulses rose to 150 kA in 8 microsec. The angular acceptance was 50 mrad.

  16. AA Prototype-Quadrupole on Measurement Stand

    CERN Multimedia


    The very particular lattice of the AA required 2 types of quadrupoles: narrow ones (QFN, QDN) and wide ones (QFW, QDW). The wide ones, although not very long (steel length 0.54 m), had an unusually large aperture of 0.75 m in width, 0.68 m "good field". A prototype was built in 1978. Here we see it on its test stand, with Ray Brown positioning the measurement coil.

  17. AA Prototype-Quadrupole on Measurement Stand

    CERN Multimedia


    The very particular lattice of the AA required 2 types of quadrupoles: narrow ones (QFN, QDN) and wide ones (QFW, QDW). The wide ones, although rather short (steel length 0.54 m), had an unusually large aperture of 0.75 m in width, 0.68 m "good field". A prototype was built at CERN in 1978. Here we see it on its test stand, with a measurement coil inserted, Brian Pincott taking readings.

  18. Research in development: the approach of AAS


    Dugan, P.; Apgar, M.; Douthwaite, B.


    The CGIAR Research Program on Aquatic Agricultural Systems (AAS) is pursuing a Research in Development approach that emphasizes the importance of embedding research in the development context. Reflecting this emphasis the six elements of this approach are a commitment to people and place, participatory action research, gender transformative research, learning and networking, partnerships, and capacity building. It is through the careful pursuit of these six elements that we believe that the p...

  19. AA, assembly of wide bending magnet

    CERN Multimedia


    The very particular lattice of the AA required 2 types of dipoles (bending magnets; BST, short and wide; BLG, long and narrow). The wide ones had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the copper coils being hoisted onto the lower half of a BST. See also 7811105, 8006050. For a BLG, see 8001044.

  20. AAS Publishing News: Astronomical Software Citation Workshop (United States)

    Kohler, Susanna


    Do you write code for your research? Use astronomical software? Do you wish there were a better way of citing, sharing, archiving, or discovering software for astronomy research? You're not alone! In April 2015, AAS's publishing team joined other leaders in the astronomical software community in a meeting funded by the Sloan Foundation, with the purpose of discussing these issues and potential solutions. In attendance were representatives from academic astronomy, publishing, libraries, for-profit software sharing platforms, telescope facilities, and grantmaking institutions. The goal of the group was to establish “protocols, policies, and platforms for astronomical software citation, sharing, and archiving,” in the hopes of encouraging a set of normalized standards across the field. The AAS is now collaborating with leaders at GitHub to write grant proposals for a project to develop strategies for software discoverability and citation, in astronomy and beyond. If this topic interests you, you can find more details in this document released by the group after the meeting: The group hopes to move this project forward with input and support from the broader community. Please share the above document, discuss it on social media using the hashtag #astroware (so that your conversations can be found!), or send private comments to

  1. Dicty_cDB: FC-AA11 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA11 (Link to dictyBase) - - - Contig-U16273-1 FC-AA11P (Li...nk to Original site) FC-AA11F 631 FC-AA11Z 502 FC-AA11P 1133 - - Show FC-AA11 Library FC (Link to library) Clone ID FC-AA...nal site URL Representative seq. ID FC-AA...11P (Link to Original site) Representative DNA sequence >FC-AA11 (FC-AA11Q) /CSM/FC/FC-AA/FC-AA...11Q.Seq.d/ GGTGAATTAATTGTTGAACCAGTTGATCAAAAATATATTTTCAAGACTGAACGTAAAGTT CCAAGAATGGGTGTTATGATTGTTGGTTTATGTGGTAACAATGGTACAA

  2. Dicty_cDB: FC-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA18 (Link to dictyBase) - - - Contig-U15943-1 FC-AA18P (Li...nk to Original site) FC-AA18F 506 FC-AA18Z 293 FC-AA18P 799 - - Show FC-AA18 Library FC (Link to library) Clone ID site URL Representative seq. ID FC-AA...18P (Link to Original site) Representative DNA sequence >FC-AA18 (FC-AA18Q) /CSM/FC/FC-AA/FC-AA18Q.Seq.d/ AAA...AGATAGAGAAGAAAGAAAACTTGAACGTGAGAAGGAACTTGAACGTGAACGTGAGAA AGAACTTGAGCGTGAGCGTGAACGTGAACAACGTCGTCTTGAAA

  3. Dicty_cDB: FCL-AA07 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA07 (Link to dictyBase) - - - Contig-U14973-1 FCL-AA07P ...(Link to Original site) FCL-AA07F 527 FCL-AA07Z 253 FCL-AA07P 780 - - Show FCL-AA07 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL Representative seq. ID FCL-AA07P (Link to Original site) Representative DNA sequence >FCL-AA07 (FCL-AA07Q) /CSM/FCL/FCL-AA.../FCL-AA07Q.Seq.d/ CAAAATAAAAAATGTTATCAAATTTTTTAAAAGTCAACAGTAAAGCACTAGGACATATAA GAACTTTTGCCTCAAAGAGTGGTGAAATTAAA

  4. Dicty_cDB: FCL-AA12 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA12 (Link to dictyBase) - - - Contig-U16034-1 FCL-AA12P ...(Link to Original site) FCL-AA12F 629 FCL-AA12Z 540 FCL-AA12P 1169 - - Show FCL-AA12 Library FCL (Link to library) Clone ID FCL-AA...4-1 Original site URL Representative seq. ID FCL-AA12P (Link to Original site) Representative DNA sequence >FCL-AA12 (FCL-AA12Q) /CSM/FCL/FCL-AA.../FCL-AA12Q.Seq.d/ ATCAAATGTTTATTCAACAACAACCATCAGATTCAATTGTTTGTAATCGTTATATTCATC CAGCCATTGTTGTTTTGGTTGACCAA

  5. Dicty_cDB: FCL-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA21 (Link to dictyBase) - - - Contig-U14936-1 FCL-AA21P ...(Link to Original site) FCL-AA21F 520 FCL-AA21Z 356 FCL-AA21P 876 - - Show FCL-AA21 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL Representative seq. ID FCL-AA21P (Link to Original site) Representative DNA sequence >FCL-AA21 (FCL-AA21Q) /CSM/FCL/FCL-AA.../FCL-AA21Q.Seq.d/ ATCATAATCATATATTTTTAATAGATATTGATATATATATTTAAAAAAATAAAATAAAAT AAAATAAAAAATGTCAACAGAGGAAACAAAAA

  6. Dicty_cDB: FCL-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA01 (Link to dictyBase) - - - Contig-U16033-1 FCL-AA01P ...(Link to Original site) FCL-AA01F 603 FCL-AA01Z 411 FCL-AA01P 1014 - - Show FCL-AA01 Library FCL (Link to library) Clone ID FCL-AA...3-1 Original site URL Representative seq. ID FCL-AA01P (Link to Original site) Representative DNA sequence >FCL-AA01 (FCL-AA01Q) /CSM/FCL/FCL-AA.../FCL-AA01Q.Seq.d/ GCAAATAATAATATTATGGGTATTGACTTTGGTACACATTTCGCATGTGTTGGTATTTTC AAGAATGAAAGAATTGAAATCTGTCCAAA

  7. Dicty_cDB: FCL-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA13 (Link to dictyBase) - - - - FCL-AA13P (Link to Original site) FCL-AA...13F 635 FCL-AA13Z 350 FCL-AA13P 985 - - Show FCL-AA13 Library FCL (Link to library) Clone ID Representative seq. ID FCL-AA...13P (Link to Original site) Representative DNA sequence >FCL-AA13 (FCL-AA13Q) /CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ CATATTTATAA...TTATATCTTTTTTGTTTAATAAAAAAGAAAGAATACCAACATGAGACTT TTATTGTGTTTAATTTTCTTAGTTTTTGTTTTCAATTTTGCATTATCAA

  8. Dicty_cDB: FC-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA06 (Link to dictyBase) - - - Contig-U15909-1 FC-AA06P (Li...nk to Original site) FC-AA06F 532 FC-AA06Z 501 FC-AA06P 1033 - - Show FC-AA06 Library FC (Link to library) Clone ID FC-AA...nal site URL Representative seq. ID FC-AA...06P (Link to Original site) Representative DNA sequence >FC-AA06 (FC-AA06Q) /CSM/FC/FC-AA/FC-AA...06Q.Seq.d/ GTGAATATAACGATTTAGATTTAGTGTATGATAAAGATGTTTATCAAAAATTAATAGAGA ATGGTGTAGATTCATTATTATCAAAA

  9. Dicty_cDB: FC-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA08 (Link to dictyBase) - - - Contig-U15942-1 FC-AA08P (Li...nk to Original site) FC-AA08F 620 FC-AA08Z 510 FC-AA08P 1130 - - Show FC-AA08 Library FC (Link to library) Clone ID FC-AA...nal site URL Representative seq. ID FC-AA...08P (Link to Original site) Representative DNA sequence >FC-AA08 (FC-AA08Q) /CSM/FC/FC-AA/FC-AA...08Q.Seq.d/ ATCAGTTACATGTACTGCACCAGTTAATATTGCAGTTATCAAATATTGGGGAAAGAGAGA TGAAAATATTATTTTACCATTAAATTCATCACTCAGTGGAA

  10. Characterization of Aquifex aeolicus ribonuclease III and the reactivity epitopes of its pre-ribosomal RNA substrates


    Shi, Zhongjie; Nicholson, Rhonda H.; Jaggi, Ritu; Nicholson, Allen W.


    Ribonuclease III cleaves double-stranded (ds) structures in bacterial RNAs and participates in diverse RNA maturation and decay pathways. Essential insight on the RNase III mechanism of dsRNA cleavage has been provided by crystallographic studies of the enzyme from the hyperthermophilic bacterium, Aquifex aeolicus. However, the biochemical properties of A. aeolicus (Aa)-RNase III and the reactivity epitopes of its substrates are not known. The catalytic activity of purified recombinant Aa-RNa...

  11. Rare earth conversion coatings grown on AA6061 aluminum alloys. Corrosion studies

    International Nuclear Information System (INIS)

    The present work is aimed to investigate the corrosion resistance of rare earth protective coatings deposited by spontaneous deposition on AA6061 aluminum alloy substrates. Coatings were deposited from water-based Ce(NO3)3 and La(NO3)3 solutions by varing parameters such as rare earth solution concentration, bath temperature and immersion time. The values of the Tafel slopes indicate that the cathodic process is favored by concentration polarization rather than activation polarization. Chemical and morphological characterizations of the surface before and after electrochemical evaluations were performed by X-ray photoelectron spectroscopy and scanning electron microscopy. (Author)

  12. Aluminium Alloy AA6060 surface treatment with high temperature steam containing chemical additives

    DEFF Research Database (Denmark)

    Din, Rameez Ud; Tabrizian, Naja; Jellesen, Morten S.;


    The steam treatment process was employed to produce a conversion coating on aluminium alloy AA6060. The changes in microstructure and its effect on corrosion resistance properties were investigated. Various concentrations of KMnO4 containing Ce(NO3)3 was injected into the steam and its effect on...... the formation of steam-based conversion coating was evaluated. The use of Mn-Ce into the steam resulted in incorporation of these species into the conversion coating, which resulted in improved corrosion resistance of the alloy substrate....

  13. Rare earth conversion coatings grown on AA6061 aluminum alloys. Corrosion studies

    Energy Technology Data Exchange (ETDEWEB)

    Brachetti S, S. B. [Instituto Tecnologico de Ciudad Madero, Av. 1o. de Mayo y Sor Juana I. de la Cruz, Col. Los Mangos, 89440 Ciudad Madero, Tanaulipas (Mexico); Dominguez C, M. A.; Torres H, A. M.; Onofre B, E. [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada - Altamira, Carretera Tampico-Puerto Industrial Altamira Km. 14.5, 89600 Altamira, Tamaulipas (Mexico); De la Cruz H, W., E-mail: [UNAM, Centro de Nanociencias y Nanotecnologia, Apdo. Postal 2681, 22800 Ensenada, Baja California (Mexico)


    The present work is aimed to investigate the corrosion resistance of rare earth protective coatings deposited by spontaneous deposition on AA6061 aluminum alloy substrates. Coatings were deposited from water-based Ce(NO{sub 3}){sub 3} and La(NO{sub 3}){sub 3} solutions by varing parameters such as rare earth solution concentration, bath temperature and immersion time. The values of the Tafel slopes indicate that the cathodic process is favored by concentration polarization rather than activation polarization. Chemical and morphological characterizations of the surface before and after electrochemical evaluations were performed by X-ray photoelectron spectroscopy and scanning electron microscopy. (Author)

  14. Comparison between ARB and CARB processes on an AA5754/AA6061 composite (United States)

    Verstraete, K.; Helbert, A.-L.; Brisset, F.; Baudin, T.


    The present work aims to compare two processes: Accumulative Roll Bonding and Cross Accumulative Roll Bonding (CARB). Both processes consist in the repetition of rolling but the second technique adds a 90° rotation of the sheet around its normal direction between each rolling. Microstructure, mechanical properties and texture were compared for both processes on an AA5754/AA6061 composite. As a result a thinner and less elongated microstructure was obtained in the CARB process leading to an isotropy and an improvement of the mechanical properties. Besides, the texture was characterized by the rotated Cube component for both processes but for CARB it is of less strength.

  15. Investigation of photocatalytic activity of titanium dioxide deposited on metallic substrates by DC magnetron sputtering

    DEFF Research Database (Denmark)

    Daviðsdóttir, Svava; Canulescu, Stela; Dirscherl, Kai;


    The photocatalytic properties of titanium dioxide (TiO2) coating in the anatase crystalline structure deposited on aluminium AA1050 alloy and stainless steel S316L substrates were investigated. The coating was prepared by DC magnetron sputtering. The microstructure and surface morphology of the...

  16. AAS Special Session: Policy Making in Astronomy (United States)

    Cardelli, J. A.; Massa, D.


    The professional astronomical community today is more diverse than at any time in its history. Individuals participating in creative research programs can be found in a wide range of positions. This type of diversity, which mixes research, education, and service (e.g. contract) work, represents the strength of contemporary astronomy. While recognizing the unavoidable reductions in funding and restructuring of organizations like NASA, it is imperative that the significance of the current diversity be considered during these processes. Creative ideas are one of the cornerstones of quality research, and they can originate anywhere. Consequently, it is essential that adequate research resources remain available for free and open competition by all astronomers. Our goal in this session is to bring together officials from the AAS, NASA, and the NSF to discuss how the policy and decision making process operates and whether it should be changed to better serve the general needs of the professional astronomical community. Examples of the issues we believe are important include: In establishing new policy, how can the needs of the average research astronomer be better addressed? How could input from such astronomers be provided to those who craft NASA/NSF policy? How can/should the AAS serve as an interface between policy/decision making bodies and its membership? Should the AAS membership become more actively/effectively involved in the decision making process and, if so, how? More information on this session and related issues can be found at the Association of Research Astronomers Home Page:

  17. Simon van der Meer in the AA Control Room

    CERN Multimedia


    Simon van der Meer, spiritus rector of the Antiproton Accumulator, in the AA Control Room. Inventor of stochastic cooling, on which the AA was based, and of the magnetic horn, with which the antiprotons were focused, he also wrote most of the software with which the AA was controlled, and spent uncountable numbers of hours in this chair to tickle the AA to top performance. 8 months after this picture was taken, he received, in October 1984, the Nobel prize, together with Carlo Rubbia, the moving force behind the whole Proton-Antiproton Collider project that led to the discovery, in 1983, of the W and Z intermediate bosons.

  18. Flow Injection and Atomic Absorption Spectrometry (FI-AAS) -

    DEFF Research Database (Denmark)

    Hansen, Elo Harald


    absorption spectrometry (AAS). Initially with flame-AAS (fAAS) procedures, later for hydride generation (HG) techniques, and most recently in combination with electrothermal AAS (ETAAS). The common denominator for all these procedures is the inherently precise and strictly reproducible timing in FI from the......One of the advantages of the flow injection (FI) concept is that it is compatible with virtually all detection techniques. Being a versatile vehicle for enhancing the performance of the individual detection devices, the most spectacular results have possibly been obtained in conjunction with atomic...

  19. AA, Inner Conductor of Magnetic Horn

    CERN Multimedia


    Antiprotons emerging at large angles from the production target (hit by an intense 26 GeV proton beam from the PS), were focused into the acceptance of the injection line of the AA by means of a "magnetic horn" (current-sheet lens). Here we see an early protype of the horn's inner conductor, machined from solid aluminium to a thickness of less than 1 mm. The 1st version had to withstand pulses of 150 kA, 15 us long, every 2.4 s. See 8801040 for a later version.

  20. Wooden Model of Wide AA Bending Magnet

    CERN Multimedia


    The very particular lattice of the AA required 2 types of dipoles (bending magnets: BLG, long and narrow; BST, short and wide). A wide one had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. A wooden model was build in 1978, to gain dimensional experience. Here, Peter Zettwoch, one of the largest men at CERN at that time, is putting a hand in the mouth of the wooden BST monster.

  1. Atlas of Vega: 3850 -- 6860 \\AA

    CERN Document Server

    Kim, Hyun-Sook; Valyavin, G; Lee, Byeong-Cheol; Shimansky, V; Galazutdinov, G A


    We present a high resolving power ($\\lambda$ / $\\Delta\\lambda$ = 90,000) and high signal-to-noise ratio ($\\sim$700) spectral atlas of Vega covering the 3850 -- 6860 \\AA wavelength range. The atlas is a result of averaging of spectra recorded with the aid of the echelle spectrograph BOES fed by the 1.8-m telescope at Bohyunsan observatory (Korea). The atlas is provided only in machine-readable form (electronic data file) and will be available in the SIMBAD database upon publication.

  2. Experimental immunologically mediated aplastic anemia (AA) in mice: cyclosporin A fails to protect against AA

    International Nuclear Information System (INIS)

    Immunologically mediated aplastic anemia (AA) in mice was induced by the i.v. injection of 10(7) lymph node cells (LNC) from H-2k identical but Mls mismatched CBA/J donor mice into previously irradiated (600 rad total body gamma) C3H/HeJ mice. Cyclosporin A (CsA), 25 mg/kg, was administered subcutaneously from day -1 to day 30. Control mice included C3H/HeJ mice which received 600 rad alone, C3H/HeJ mice which received 600 rad plus CsA as above, and C3H/HeJ mice which received 600 rad total body irradiation followed by 10(7) LNC from CBA/J donors. CsA failed to prevent lethal AA. These results suggest that the pathogenetic mechanisms operating in immunologically mediated AA differ from the mechanisms operating in rodents transplanted with allogeneically mismatched marrow or spleen cells which develop graft-versus-host disease. The results are consistent with a non-T cell-dependent mechanism causing the AA

  3. Study on Fabrication of AA4032/AA6069 Cladding Billet Using Direct Chill Casting Process (United States)

    Han, Xing; Zhang, Haitao; Shao, Bo; Li, Lei; Liu, Xuan; Cui, Jianzhong


    AA4032/AA6069 cladding billet in size of φ130 mm/φ110 mm was prepared by the modified direct chill casting process, and the parametric effect on casting performance was investigated using numerical simulation. Microstructures, elements distribution, and mechanical properties of the bonding interface were examined. The results show that metallurgical bonding interface can be obtained with the optimal parameters: the casting speed of 130 to 140 mm/min, the internal liquid level height of 50 to 60 mm, and the contact height of 40 to 50 mm. The metallurgical bonding interface is free of any discontinuities due to the fact that the alloying elements diffused across the interface and formed Ni-containing phase. Tensile strength of the cladding billet reaches 225.3 MPa, and the fracture position was located in AA6069 side, suggesting that the interface bonding strength is higher than the strength of AA6069. The interfacial shearing strength is 159.3 MPa, indicating excellent metallurgical bonding.

  4. Dicty_cDB: FC-AA22 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA22 (Link to dictyBase) - - - Contig-U14948-1 FC-AA22E (Li...nk to Original site) - - - - - - FC-AA22E 576 Show FC-AA22 Library FC (Link to library) Clone ID FC-AA22 (Li.../ Representative seq. ID FC-AA...22E (Link to Original site) Representative DNA sequence >FC-AA22 (FC-AA22Q) /CSM/FC/FC-AA/FC-AA22Q.Seq.d/ ATGAA...TACGATGATAGTGATTCAGACTTTTGACCAATTGAAAAAACCAGCAACAGAAATG GTACTGGTTTGGTCTCCTCCACTTTTAAGGTTGCCCCTTCCTTCTCTACCATTCAAAAAC AACAA

  5. Dicty_cDB: FC-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA15 (Link to dictyBase) - G01144 DDB0204372 Contig-U15089-1 FC-AA...15E (Link to Original site) - - - - - - FC-AA15E 522 Show FC-AA15 Library FC (Link to library) Clone ID FC-AA...9-1 Original site URL Representative seq. ID FC-AA15E (Link to Original site) Representative DNA sequence >FC-AA15 (FC-AA15Q) /CSM/FC/FC-AA/FC-AA...15Q.Seq.d/ CAAATCACACATAAAAGTTTAATATAAAAATGGGTACACCAATTAAAAAGATTAGTACAG TAATTATTAAAATGGTTTCATCAGCCAA

  6. Dicty_cDB: FC-AA17 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA17 (Link to dictyBase) - - - Contig-U15091-1 FC-AA17E (Li...nk to Original site) - - - - - - FC-AA17E 347 Show FC-AA17 Library FC (Link to library) Clone ID FC-AA17 (Li.../ Representative seq. ID FC-AA...17E (Link to Original site) Representative DNA sequence >FC-AA17 (FC-AA17Q) /CSM/FC/FC-AA/FC-AA17Q.Seq.d/ CCCAAAAGCCCGTAA...GACTCACTGTGTCAAGTGCAACAAACACACCCCACACAAGGTTAC CCAATACAAAGCTGGTAAACCAAGTCTTTTCGCACAAGGTAAAAGACGTTACGATCGTAA ACAA

  7. Dicty_cDB: FC-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA05 (Link to dictyBase) - G01143 DDB0190243 Contig-U15085-1 FC-AA...05E (Link to Original site) - - - - - - FC-AA05E 675 Show FC-AA05 Library FC (Link to library) Clone ID FC-AA...5-1 Original site URL Representative seq. ID FC-AA05E (Link to Original site) Representative DNA sequence >FC-AA05 (FC-AA05Q) /CSM/FC/FC-AA/FC-AA...05Q.Seq.d/ AAACAAAAAAAAAAGGTATGGAAATTTTTGCATTTGTACCATTAGCAGTGTTAACAGCAT TATGTGTTGTTATTTCACTCTTTGTTAAAAGAGAGAAA

  8. Dicty_cDB: FCL-AA23 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA23 (Link to dictyBase) - G01759 DDB0201558 Contig-U15118-1 FCL-AA...23E (Link to Original site) - - - - - - FCL-AA23E 1045 Show FCL-AA23 Library FCL (Link to library) Clone ID FCL-AA...ig-U15118-1 Original site URL Representative seq. ID FCL-AA23E (Link to Original site) Representative DNA sequence >FCL-AA23 (FCL-AA...23Q) /CSM/FCL/FCL-AA/FCL-AA23Q.Seq.d/ ATAACTATATAACTATGTCTAACCAAAAGAAAAACGACGTATCTTCATTTGTTAAAGATT CTTTAA

  9. Dicty_cDB: FC-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA21 (Link to dictyBase) - - - Contig-U15450-1 FC-AA21E (Li...nk to Original site) - - - - - - FC-AA21E 839 Show FC-AA21 Library FC (Link to library) Clone ID FC-AA21 (Li.../ Representative seq. ID FC-AA...21E (Link to Original site) Representative DNA sequence >FC-AA21 (FC-AA21Q) /CSM/FC/FC-AA/FC-AA21Q.Seq.d/ AATTATTTTCATTAA...TTTTAGCTTTATTCCTTGTCAACTCCGCTGTTGTCTCTTCACTCG ACTCATGTAGTATTTGTGTTGATTTTGTTGGTAACTCACTCAATGATCTTTTAAATATTA TCCTTAA

  10. Dicty_cDB: FCL-AA22 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA22 (Link to dictyBase) - G01758 DDB0229949 Contig-U15119-1 FCL-AA...22E (Link to Original site) - - - - - - FCL-AA22E 840 Show FCL-AA22 Library FCL (Link to library) Clone ID FCL-AA...g-U15119-1 Original site URL Representative seq. ID FCL-AA22E (Link to Original site) Representative DNA sequence >FCL-AA22 (FCL-AA...22Q) /CSM/FCL/FCL-AA/FCL-AA22Q.Seq.d/ AAAATGAGCAAAATCTCAAGCGACCAAGTTAGATCAATCGTCTCCCAACTTTTCAAAGAA GCACAAGAATCCAAAA

  11. Dicty_cDB: FCL-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA06 (Link to dictyBase) - G24322 DDB0216974 Contig-U15228-1 FCL-AA...06E (Link to Original site) - - - - - - FCL-AA06E 791 Show FCL-AA06 Library FCL (Link to library) Clone ID FCL-AA...g-U15228-1 Original site URL Representative seq. ID FCL-AA06E (Link to Original site) Representative DNA sequence >FCL-AA06 (FCL-AA...06Q) /CSM/FCL/FCL-AA/FCL-AA06Q.Seq.d/ AAAATCCCAATTTCATTAGCAGTGGAAGTAACGGAATGAATTGGGGTGGTTCTTTGAACA CTTGTGACTCTGGAGGATTCAA

  12. Dicty_cDB: FCL-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA18 (Link to dictyBase) - G24323 DDB0191144 Contig-U15229-1 FCL-AA...18Z (Link to Original site) - - FCL-AA18Z 623 - - - - Show FCL-AA18 Library FCL (Link to library) Clone ID FCL-AA...g-U15229-1 Original site URL Representative seq. ID FCL-AA18Z (Link to Original site) Representative DNA sequence >FCL-AA18 (FCL-AA...18Q) /CSM/FCL/FCL-AA/FCL-AA18Q.Seq.d/ XXXXXXXXXXGTCAATGTCATTATTGGTGAACAATCTGATGGTTCGTTGGAACAAATCGC TAGAAATCCACAACCAA

  13. Dicty_cDB: FC-AA16 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA16 (Link to dictyBase) - G22556 DDB0204121 Contig-U15090-1 FC-AA...16E (Link to Original site) - - - - - - FC-AA16E 933 Show FC-AA16 Library FC (Link to library) Clone ID FC-AA...0-1 Original site URL Representative seq. ID FC-AA16E (Link to Original site) Representative DNA sequence >FC-AA16 (FC-AA16Q) /CSM/FC/FC-AA/FC-AA...16Q.Seq.d/ GGGCAGGATCATCATTTAATACTAAAGATTCAACAATAATTGCAAAAACTCAATTTTATC AAAAAAATATTCAAATTTATAAAGGTGATCAA

  14. Poly(2,5-bis(N-Methyl-N-HexylaminoPhenylene Vinylene (BAM-PPV as Pretreatment Coating for Aerospace Applications: Laboratory and Field Studies

    Directory of Open Access Journals (Sweden)

    Peter Zarras


    Full Text Available In this study, an electroactive polymer (EAP, poly(2,5-bis(N-methyl-N-hexylaminophenylene vinylene (BAM-PPV was investigated as a potential alternative surface pretreatment for hexavalent chromium (Cr(VI-based aerospace coatings. BAM-PPV was tested as a pretreatment coating on an aerospace aluminum alloy (AA2024-T3 substrate in combination with a non-Cr(VI epoxy primer and a polyurethane Advanced Performance Coating (APC topcoat. This testing was undertaken to determine BAM-PPV’s adhesion, corrosion-inhibition, compatibility and survivability in laboratory testing and during outdoor field-testing. BAM-PPV showed excellent adhesion and acceptable corrosion performance in laboratory testing. The BAM-PPV aerospace coating system (BAM-PPV, non-Cr(VI epoxy primer and polyurethane APC topcoat was field tested for one year on the rear hatch door of the United States Air Force C-5 cargo plane. After one year of field testing there was no evidence of delamination or corrosion of the BAM-PPV aerospace coating system.

  15. Evolution of geomagnetic aa index near sunspot minimum

    Directory of Open Access Journals (Sweden)

    R. P. Kane

    Full Text Available The smoothed values of the minima of sunspot number Rz and the geomagnetic index aa were compared for sunspot cycles 12–23. In one cycle, aa(min occurred earlier than Rz(min, but remained at that low from a few months before Rz(min to a few months after Rz(min. In two cycles, Rz(min and aa(min coincided within a month or two. In nine cycles, aa(min occurred more than three months later than Rz(min. The aa(min coincided with the minima of some solar radio emission indices originating in the solar corona. For sunspot cycles 21, 22, 23, the minimum of solar wind velocity V occurred 0–9 months later than the aa(min. The minimum of solar wind total magnetic field B occurred near Rz(min. The solar wind ion density N had maxima (instead of minima near Rz(min, and again near Rz(max, indicating a  ~5-year periodicity, instead of an 11-year periodicity. The maxima of aa, V and B occurred near Rz(max and/or later in the declining phase of Rz. The aa index was very well correlated with the functions BV and BV 2.Key words. Geomagnetism and paleomagnetism (time variations, diurnal to secular – time variations, secular and long term Interplanetary physics (interplanetary magnetic field

  16. A Nacreous Self-Assembled Nanolaminate for Corrosion Resistance on 2024-Al Alloy


    Gordon, Matthew


    Nanometer thick layers of clay and polymer were formed on mica, silicon, and aluminum 2024-T3 alloy using alternating solutions of positively and negatively charged polymer and clay, respectively. Atomic force microscopy was used to observe the morphology of the composite films on mica and silicon. It was found that solution concentrations of clay above 0.02 weight percent lead to the uncontrolled deposition of clay platelets on the substrateâ s surface. By using solution concentrations o...

  17. Chromium-free conversion coatings based on inorganic salts (Zr/Ti/Mn/Mo) for aluminum alloys used in aircraft applications

    Energy Technology Data Exchange (ETDEWEB)

    Santa Coloma, P., E-mail: [TECNALIA Research & Innovation, Parque Tecnológico de San Sebastián, Mikeletegi Pasealekua 2, E-20009 Donostia-San Sebastián, Gipuzkoa (Spain); Izagirre, U.; Belaustegi, Y.; Jorcin, J.B.; Cano, F.J. [TECNALIA Research & Innovation, Parque Tecnológico de San Sebastián, Mikeletegi Pasealekua 2, E-20009 Donostia-San Sebastián, Gipuzkoa (Spain); Lapeña, N. [Boeing Research & Technology Europe, S.L.U., Avenida Sur del Aeropuerto de Barajas 38, Building 4 – 3rd Floor, E-28042 Madrid (Spain)


    Highlights: • Chromium-free conversion coatings for corrosion protection of aluminum alloys. • Salt spray and potentiodynamic sweep tests to study the corrosion behavior. • Local deposits on Cu-rich intermetallic particles enhanced corrosion resistance. • Surface characterization to relate bath's composition and corrosion resistance. • Best corrosion protection with conversion baths without titanium salts. - Abstract: Novel chromium-free conversion coatings based on Zr/Ti/Mn/Mo compounds were developed at a pilot scale to improve the corrosion resistance of the AA2024-T3 and AA7075-T6 aluminum alloys for aircraft applications. The influence of the presence of Zr and Ti in the Zr/Ti/Mn/Mo conversion bath's formulation on the corrosion resistance of the coated alloys was investigated. The corrosion resistance provided by the conversion coatings was evaluated by salt spray exposure and potentiodynamic sweeps. Optical and scanning electron microscopy coupled with energy dispersive spectroscopy (SEM/EDS) and atomic force microscopy (AFM) operating in the Kelvin Probe mode (SKPFM) were used to provide microstructural information of the coated samples that achieved the best results in the corrosion tests. The salt spray test evidenced the higher corrosion resistance of the coated samples compared to the bare surfaces for both alloys. The potentiodynamic tests showed that the corrosion current density decreased for coated AA7075-T6 and AA2024-T3 alloys, which indicated an obvious improvement of the corrosion resistance with all the processes for both alloys. Although the corrosion resistance of the coated samples appeared to be higher for the alloy AA7075-T6 than for the alloy AA2024-T3, both alloys achieved the best corrosion protection with the coatings deposited from conversion bath formulations containing no titanium salts. The microscopy analysis on the coated AA7075-T6 samples revealed that a local deposition of Zr compounds and, possibly, an

  18. Chromium-free conversion coatings based on inorganic salts (Zr/Ti/Mn/Mo) for aluminum alloys used in aircraft applications

    International Nuclear Information System (INIS)

    Highlights: • Chromium-free conversion coatings for corrosion protection of aluminum alloys. • Salt spray and potentiodynamic sweep tests to study the corrosion behavior. • Local deposits on Cu-rich intermetallic particles enhanced corrosion resistance. • Surface characterization to relate bath's composition and corrosion resistance. • Best corrosion protection with conversion baths without titanium salts. - Abstract: Novel chromium-free conversion coatings based on Zr/Ti/Mn/Mo compounds were developed at a pilot scale to improve the corrosion resistance of the AA2024-T3 and AA7075-T6 aluminum alloys for aircraft applications. The influence of the presence of Zr and Ti in the Zr/Ti/Mn/Mo conversion bath's formulation on the corrosion resistance of the coated alloys was investigated. The corrosion resistance provided by the conversion coatings was evaluated by salt spray exposure and potentiodynamic sweeps. Optical and scanning electron microscopy coupled with energy dispersive spectroscopy (SEM/EDS) and atomic force microscopy (AFM) operating in the Kelvin Probe mode (SKPFM) were used to provide microstructural information of the coated samples that achieved the best results in the corrosion tests. The salt spray test evidenced the higher corrosion resistance of the coated samples compared to the bare surfaces for both alloys. The potentiodynamic tests showed that the corrosion current density decreased for coated AA7075-T6 and AA2024-T3 alloys, which indicated an obvious improvement of the corrosion resistance with all the processes for both alloys. Although the corrosion resistance of the coated samples appeared to be higher for the alloy AA7075-T6 than for the alloy AA2024-T3, both alloys achieved the best corrosion protection with the coatings deposited from conversion bath formulations containing no titanium salts. The microscopy analysis on the coated AA7075-T6 samples revealed that a local deposition of Zr compounds and, possibly, an

  19. Chromium-free conversion coatings based on inorganic salts (Zr/Ti/Mn/Mo) for aluminum alloys used in aircraft applications (United States)

    Santa Coloma, P.; Izagirre, U.; Belaustegi, Y.; Jorcin, J. B.; Cano, F. J.; Lapeña, N.


    Novel chromium-free conversion coatings based on Zr/Ti/Mn/Mo compounds were developed at a pilot scale to improve the corrosion resistance of the AA2024-T3 and AA7075-T6 aluminum alloys for aircraft applications. The influence of the presence of Zr and Ti in the Zr/Ti/Mn/Mo conversion bath's formulation on the corrosion resistance of the coated alloys was investigated. The corrosion resistance provided by the conversion coatings was evaluated by salt spray exposure and potentiodynamic sweeps. Optical and scanning electron microscopy coupled with energy dispersive spectroscopy (SEM/EDS) and atomic force microscopy (AFM) operating in the Kelvin Probe mode (SKPFM) were used to provide microstructural information of the coated samples that achieved the best results in the corrosion tests. The salt spray test evidenced the higher corrosion resistance of the coated samples compared to the bare surfaces for both alloys. The potentiodynamic tests showed that the corrosion current density decreased for coated AA7075-T6 and AA2024-T3 alloys, which indicated an obvious improvement of the corrosion resistance with all the processes for both alloys. Although the corrosion resistance of the coated samples appeared to be higher for the alloy AA7075-T6 than for the alloy AA2024-T3, both alloys achieved the best corrosion protection with the coatings deposited from conversion bath formulations containing no titanium salts. The microscopy analysis on the coated AA7075-T6 samples revealed that a local deposition of Zr compounds and, possibly, an oxidation process occurred in the vicinity of the alloy's intermetallic particles. The amount of the Zr deposits at these locations increased with coating's formulations without Ti, which provided the best corrosion resistance. The Cr-free conversion coatings developed in this study for the AA7075-T6 and AA2024-T3 alloys do not meet yet the strict requirements of the aircraft industry. However, they significantly improved the corrosion

  20. Failure analysis of fusion clad alloy system AA3003/AA6xxx sheet under bending

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Y., E-mail: [Department of Mechanical Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada); Jin, H. [Novelis Global Technology Center, P.O. Box 8400, Kingston, Ontario, Canada K7L 5L9 (Canada); Wu, P.D. [Department of Mechanical Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada); Lloyd, D.J. [Aluminum Materials Consultants, 106 Nicholsons Point Road, Bath, Ontario, Canada K0H 1G0 (Canada); Embury, D. [Department of Mechanical Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada)


    An ingot of AA6xxx Al–Si–Mg–Cu alloy clad with AA3003 Al–Mn alloy was co-cast by Fusion technology. Bending tests and numerical modeling were performed to investigate the potential for sub-surface cracking for this laminate system. To simulate particle-induced crack initiation and growth, both random and stringer particles have been selected to mimic the particle distribution in the tested samples. The morphology of cracking in the model was similar to that observed in clad sheet tested in the Cantilever bend test. The crack initiated in the core close to the clad-core interface where the strain in the core is highest, between particles or near particles and propagates along local shear bands in the core, while the clad layer experiences extreme thinning before failure.

  1. AA, shims and washers on quadrupole ends

    CERN Multimedia

    CERN PhotoLab


    Due to the fact that much of the field of the quadrupoles was outside the iron (in particular with the wide quadrupoles) and that thus the fields of quadrupoles and bending magnets interacted, the lattice properties of the AA could not be predicted with the required accuracy. After a first running period in 1980, during which detailed measurements were made with proton test beams, corrections to the quadrupoles were made in 1981, in the form of laminated shims at the ends of the poles, and with steel washers. With the latter ones, further refinements were made in an iterative procedure with measurements on the circulating beam. This eventually resulted, amongst other things, in a very low chromaticity, with the Q-values being constant to within +- 0.001 over the total momentum range of 6 %. Here we see the shims and washers on a narrow qudrupole (QFN, QDN). See also 8103203, 8103204, 8103205, 8103206.

  2. Electrochemical characterisation of aluminium AA7075-T6 and solution heat treated AA7075 using a micro-capillary cell

    International Nuclear Information System (INIS)

    Localised corrosion of 7xxx aluminium alloys initiates at cathodic intermetallics containing Cu and Fe due to a strong galvanic coupling with the matrix. In order to study this galvanic coupling, the electrochemical behaviour of AA7075-T6 and solution heat treated AA7075 has been investigated by means of complementary techniques: micro-capillary cell, scanning Kelvin probe force microscopy (SKPFM) and scanning electron microscopy (SEM). Characterisation with the micro-capillary cell showed that the intermetallics cause a more cathodic breakdown potential in the solution heat treated AA7075 compared with the AA7075-T6. This is associated with a higher Volta potential difference between the intermetallics and the matrix in the solution heat treated AA7075, indicating a stronger galvanic coupling for this temper. From these results, it is concluded that the breakdown potential of areas containing the intermetallics is related to the Volta potential difference between the intermetallics and the matrix

  3. Robust plasmonic substrates

    DEFF Research Database (Denmark)

    Kostiučenko, Oksana; Fiutowski, Jacek; Tamulevicius, Tomas; Tamulevicius, Sigitas; Silbernagl, Dorothee; Sturm, Heinz; Rubahn, Horst-Günter


    Robustness is a key issue for the applications of plasmonic substrates such as tip-enhanced Raman spectroscopy, surface-enhanced spectroscopies, enhanced optical biosensing, optical and optoelectronic plasmonic nanosensors and others. A novel approach for the fabrication of robust plasmonic...... considered robust plasmonic substrates, nanoindentation and wear resistance experiments as well as ablation experiment were performed. The mechanical properties of the layered substrates are tested via atomic force microscopy, evaluating spatially resolved threshold loads both for plastic deformation and...... breaking. DLC coating with thicknesses between 25 and 105 nm is found to considerably increase the mechanical strength of the substrates while at the same time ensuring conservation of sufficient field enhancements of the gold plasmonic substrates....

  4. Dicty_cDB: FCL-AA17 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA17 (Link to dictyBase) - G03264 DDB0191099 Contig-U15602-1 FCL-AA...17P (Link to Original site) FCL-AA17F 547 FCL-AA17Z 610 FCL-AA17P 1157 - - Show FCL-AA17 Library F...CL (Link to library) Clone ID FCL-AA17 (Link to dictyBase) Atlas ID - NBRP ID G03264 dictyBase ID DDB0191099... Link to Contig Contig-U15602-1 Original site URL Representative seq. ID FCL-AA17P (Link to Original site) Representative DNA sequence >FCL-AA

  5. Dicty_cDB: FCL-AA14 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA14 (Link to dictyBase) - G03263 DDB0218474 Contig-U16035-1 FCL-AA...14P (Link to Original site) FCL-AA14F 647 FCL-AA14Z 550 FCL-AA14P 1197 - - Show FCL-AA14 Library F...CL (Link to library) Clone ID FCL-AA14 (Link to dictyBase) Atlas ID - NBRP ID G03263 dictyBase ID DDB0218474... Link to Contig Contig-U16035-1 Original site URL Representative seq. ID FCL-AA14P (Link to Original site) Representative DNA sequence >FCL-AA

  6. Dicty_cDB: FCL-AA19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA19 (Link to dictyBase) - G01757 DDB0230128 Contig-U16036-1 FCL-AA...19P (Link to Original site) FCL-AA19F 246 FCL-AA19Z 568 FCL-AA19P 814 - - Show FCL-AA19 Library FC...L (Link to library) Clone ID FCL-AA19 (Link to dictyBase) Atlas ID - NBRP ID G01757 dictyBase ID DDB0230128 ...Link to Contig Contig-U16036-1 Original site URL Representative seq. ID FCL-AA19P (Link to Original site) Representative DNA sequence >FCL-AA

  7. Enhancement of wear and ballistic resistance of armour grade AA7075 aluminium alloy using friction stir processing

    Directory of Open Access Journals (Sweden)

    I. Sudhakar


    Full Text Available Industrial applications of aluminium and its alloys are restricted because of their poor tribological properties. Thermal spraying, laser surfacing, electron beam welding are the most widely used techniques to alter the surface morphology of base metal. Preliminary studies reveal that the coating and layering of aluminium alloys with ceramic particles enhance the ballistic resistance. Furthermore, among aluminium alloys, 7075 aluminium alloy exhibits high strength which can be compared to that of steels and has profound applications in the designing of lightweight fortification structures and integrated protection systems. Having limitations such as poor bond integrity, formation of detrimental phases and interfacial reaction between reinforcement and substrate using fusion route to deposit hard particles paves the way to adopt friction stir processing for fabricating surface composites using different sizes of boron carbide particles as reinforcement on armour grade 7075 aluminium alloy as matrix in the present investigation. Wear and ballistic tests were carried out to assess the performance of friction stir processed AA7075 alloy. Significant improvement in wear resistance of friction stir processed surface composites is attributed to the change in wear mechanism from abrasion to adhesion. It has also been observed that the surface metal matrix composites have shown better ballistic resistance compared to the substrate AA7075 alloy. Addition of solid lubricant MoS2 has reduced the depth of penetration of the projectile to half that of base metal AA7075 alloy. For the first time, the friction stir processing technique was successfully used to improve the wear and ballistic resistances of armour grade high strength AA7075 alloy.

  8. Enhancement of wear and ballistic resistance of armour grade AA7075 aluminium alloy using friction stir processing

    Institute of Scientific and Technical Information of China (English)



    Industrial applications of aluminium and its alloys are restricted because of their poor tribological properties. Thermal spraying, laser surfacing, electron beam welding are the most widely used techniques to alter the surface morphology of base metal. Preliminary studies reveal that the coating and layering of aluminium alloys with ceramic particles enhance the ballistic resistance. Furthermore, among aluminium alloys, 7075 aluminium alloy exhibits high strength which can be compared to that of steels and has profound applications in the designing of lightweight fortification structures and integrated protection systems. Having limitations such as poor bond integrity, formation of detrimental phases and interfacial reaction between reinforcement and substrate using fusion route to deposit hard particles paves the way to adopt friction stir processing for fabricating surface composites using different sizes of boron carbide particles as reinforcement on armour grade 7075 aluminium alloy as matrix in the present investigation. Wear and ballistic tests were carried out to assess the performance of friction stir processed AA7075 alloy. Significant improvement in wear resistance of friction stir processed surface composites is attributed to the change in wear mechanism from abrasion to adhesion. It has also been observed that the surface metal matrix composites have shown better ballistic resistance compared to the substrate AA7075 alloy. Addition of solid lubricant MoS2 has reduced the depth of penetration of the projectile to half that of base metal AA7075 alloy. For the first time, the friction stir processing technique was successfully used to improve the wear and ballistic resistances of armour grade high strength AA7075 alloy.

  9. The A&A Experience With Impact Factors

    CERN Document Server

    Sandqvist, A


    There is a widespread impression that the scientific journal "Astronomy & Astrophysics" (A&A) has a smaller impact, as measured by citations to articles, than some of the other major astronomy journals. This impression was apparently supported - and probably created - by the Journal Citation Report (JCR), which is prepared annually by the Institute of Scientific Information (ISI) Web of Knowledge. The published poor impact factor of A&A was in fact wrong and was due to a serious flaw in the method used by ISI Web of Knowledge to determine it. The resulting damage inflicted upon A&A by the JCR is incalculable.

  10. Corrosion issues of powder coated AA6060 aluminium profiles

    DEFF Research Database (Denmark)

    Din, Rameez Ud; Valgarðsson, Smári; Jellesen, Morten Stendahl;


    In this study detailed microstructural investigation of the reason for unexpected corrosion of powder coated aluminium alloy AA6060 windows profiles has been performed. The results from this study reveals that the failure of the window profiles was originated from the surface defects present...... on the extruded AA6060 aluminium profile after metallurgical process prior to powder coating. Surface defects are produced due to intermetallic particles in the alloy, which disturb the flow during the extrusion process. The corrosion mechanism leading to the failure of the powder coated AA6060 aluminium profiles...

  11. NCBI nr-aa BLAST: CBRC-RNOR-15-0027 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RNOR-15-0027 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 2e-30 98% ...

  12. NCBI nr-aa BLAST: CBRC-AGAM-07-0022 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0022 ref|ZP_01789747.1| hypothetical protein CGSHiAA_08330 [Haemophilus influenza...e PittAA] gb|EDK08473.1| hypothetical protein CGSHiAA_08330 [Haemophilus influenzae PittAA] ZP_01789747.1 2e-14 23% ...

  13. NCBI nr-aa BLAST: CBRC-HSAP-02-0031 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-HSAP-02-0031 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 6e-09 52% ...

  14. NCBI nr-aa BLAST: CBRC-OLAT-13-0071 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OLAT-13-0071 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 0.14 37% ...

  15. NCBI nr-aa BLAST: CBRC-PTRO-02-0026 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PTRO-02-0026 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 8e-09 50% ...

  16. NCBI nr-aa BLAST: CBRC-HSAP-02-0029 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-HSAP-02-0029 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 5e-11 48% ...

  17. NCBI nr-aa BLAST: CBRC-RNOR-08-0315 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RNOR-08-0315 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 8e-25 73% ...

  18. NCBI nr-aa BLAST: CBRC-GGAL-35-0091 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0091 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 2e-08 34% ...

  19. NCBI nr-aa BLAST: CBRC-PTRO-27-0055 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PTRO-27-0055 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 8e-09 53% ...

  20. NCBI nr-aa BLAST: CBRC-ACAR-01-0367 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0367 ref|ZP_01790024.1| hypothetical protein CGSHiAA_05974 [Haemophilus influenza...e PittAA] gb|EDK08288.1| hypothetical protein CGSHiAA_05974 [Haemophilus influenzae PittAA] ZP_01790024.1 4.0 29% ...

  1. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis (United States)

    Gueutin, Victor; Langlois, Anne-Lyse; Shehwaro, Nathalie; Elharraqui, Ryme; Rouvier, Philippe; Izzedine, Hassane


    Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported. PMID:24558629

  2. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis


    Victor Gueutin; Anne-Lyse Langlois; Nathalie Shehwaro; Ryme Elharraqui; Philippe Rouvier; Hassane Izzedine


    Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported.

  3. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis

    Directory of Open Access Journals (Sweden)

    Victor Gueutin


    Full Text Available Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported.

  4. Lightweight Substrates For Mirrors (United States)

    Brown, D. Kyle


    New substrate uses conventional quasi-isotropic fabric laminate with surfacing layer of carbon-fiber paper consisting of randomly oriented chopped carbon fibers. Layered structure of fabric and paper relatively easy to manufacture. When impregnated with carbon, structure rigid and stable. Substrates of this type made quite thin, thus keeping areal weights to minimum. Mirrors of this type made faster, and cost less, than predecessors.

  5. AAS Committee on Employment Panel Introduction (United States)

    Borne, Kirk; Fanelli, M. N.; Storrie-Lombardi, L. J.; Krishnamurthi, A.


    Many younger astronomers are unaware of the dangers and pitfalls that await them in the job market. Issues related to fringe benefits (if any), moving expenses, medical coverage for family members, teaching versus research expectations, etc. can lead to misunderstandings and to serious difficulties if these are not addressed early in the job interview process. The AAS Committee on Employment has often received letters from concerned junior members of the society, who feel that they needed more guidance and assistance in entering the job market for the first time. The major areas of concern have included those just listed, but there may be others. The session is structured as a panel presentation, whose members are asked to prepare in advance their top 10 questions that job applicants should ask, and we will instruct our panel members not to discuss their list at all with the other panel members prior to their presentations. This will ensure independent viewpoints and novel responses. The panel will consist of astronomers who have different perspectives on this issue, including old and young, postdoc and beyond, academic and non-academic. To kick off the session, we will invite a brief humorous presentation of the Top Ten List, in the style of The Night Show host David Letterman.

  6. Outcomes From AAS Hack Day at the 227th AAS Meeting (United States)

    Kohler, Susanna


    Editors Note:This is a final post from the 227th AAS Meeting in Kissimmee, FL. This special summary of AAS Hack Day, a meeting of AAS members to collaboratively work on various small projects, was written by Meredith Rawls (@Merrdiff) and was originally posted on the 227thAmerican Astronomical Society meeting drew to a close (see highlights from Day 1, Day 2, Day 3, and Day 4), a group of at least 50 attendees spent Day 4working on small projects fondly called hacks. Thanks to sponsorship from LSST and Northrup Grumman, the industrious hackers werewell-caffeinated and fed so we could devote time and energy toworking in groups on one-day projects.TheHack Day beganat 10am with pitches. Anybody with a project idea was welcome to briefly speak and try to convince others to work with them. Only someideas panned out, but the enthusiasm was palpable. Its not every day you get a full room of astronomers and affiliates eager to spend hours working on fun and useful projects to benefit the community.#hackAAS is getting underway! #aas227 James R A Davenport (@jradavenport) January 8, 2016Here is a rundown of what we accomplished. Pretty impressive for a single day! Many thanks to fellow astrobiter Erika Nesvold (now at Carnegie DTM; @erikanesvold) whose hack was live-documenting all the other hacks. Her tweets as @astrobites appeared with the #hackaas hashtag, and her notes made this recap post infinitely easier to write.Interested in joining the fun? Sign up for Hack Day at the 2017 JanuaryAAS meeting (its free with meeting registration), and consider applying for the .Astronomy conference this summer.Towards Optimal Session Scheduling:Adrian Price-Whelan (Columbia), David Hogg (NYU), and Scott Idem (AAS) began writing a program to take all submitted abstracts to a conference like AAS and sort them using keywords to avoid scheduling similar talks in parallel sessions. Its impossible to make everyone happy, but minimizing conflicts

  7. Astronomy Career Profiles from the AAS Newsletter Archives


    Metcalfe, Travis; Belkora, Leila; McDaid, Liam; Bullock, Blake; Pulliam, Christine; Williams, Peter; Roth, Joshua; Whitney, Barb; Olsen, Knut; Howell, Andy; Keller, Luke


    This is a collection of articles that were originally published in the Newsletter of the American Astronomical Society (AAS) between May 2008 and September 2011 by the Committee on Employment. Authors representing a wide range of career paths tell their stories and provide insight and advice that is relevant to success in various job sectors. Although all of these articles are available individually from the AAS archives, we are posting the complete collection here to make them more accessibl...

  8. Systemic AA amyloidosis induced by liver cell adenoma.


    Fievet, P; Sevestre, H; Boudjelal, M; Noel, L H; Kemeny, F; D. Franco; Delamarre, J; Capron, J.P.


    Systemic AA amyloidosis is a rare complication of benign tumours. This report describes a patient with hepatocellular adenoma associated with reactive AA amyloidosis. He had a nephrotic syndrome with deteriorating renal function and an increase of serum concentrations of acute phase proteins, mainly C-reactive protein. Resection of the tumour was followed by improvement in renal function and a marked decrease of the serum concentrations of acute phase proteins.

  9. AA amyloidosis as a complication of primary lymphedema. (United States)

    Beloncle, François; Sayegh, Johnny; Eymerit-Morin, Caroline; Duveau, Agnès; Augusto, Jean-François


    Primary lymphedema is a rare disease caused by a disorder of lymphangiogenesis. Clinical presentation and age at onset are variable. AA amyloidosis is usually due to chronic inflammatory diseases, malignant tumors or less frequently chronic infectious diseases. We report here the first two cases of AA amyloidosis present with renal failure and nephrotic syndrome in patients with primary lymphedema-induced chronic leg ulcers. The first patient was a 62-year-old female who presented with chronic untreated leg ulcers for 8 years secondary to primary lymphedema. A kidney biopsy done for nephrotic syndrome allowed the diagnosis of AA amyloidosis. The second patient was a 54-year-old male who presented with hereditary lymphedema and elephantiasis since the age of 12. A salivary gland biopsy allowed the diagnosis of AA amyloidosis. Renal function deteriorated progressively needing chronic haemodialysis. Chronic leg ulcers have been rarely reported to induce AA amyloidosis. Only five other cases have been reported in the literature, but none of them with chronic lymphedema. We believe that the relation between lymphedema, chronic leg ulcers and AA amyloidosis is underestimated. PMID:23964754

  10. The OIV 1407.3\\AA /1401.1\\AA\\ emission-line ratio in a plasma

    CERN Document Server

    Nessib, Nabil Ben; Qindeel, Rabia; Sahal-Bréchot, Sylvie; Dimitrijević, Milan S


    Line ratio of O IV 1407.3 \\AA/1401.1 \\AA\\- is calculated using mostly our own atomic and collisional data. Energy levels and oscillator strengths needed for this calculation have been calculated using a Hartree-Fock relativistic (HFR) approach. The electron collision strengths introduced in the statistic equilibrium equations are fitted by Line ratio of O IV 1407.3 \\AA/1401.1 \\AA\\- is calculated using mostly our own atomic and collisional data. Energy levels and oscillator strengths needed for this calculation have been calculated using a Hartree-Fock relativistic (HFR) approach. The electron collision strengths introduced in the statistic equilibrium equations are fitted by polynomials for different energies. Comparison has also been made with available theoretical results. The provided line ratio has been obtained for a set of electron densities from $10^{8}$ cm$^{-3}$ to $10^{13}$ cm$^{-3}$ and for a fixed temperature of 50 000 K.

  11. Carbon Nanotube Addition to Simultaneously Enhance Strength and Ductility of Hybrid AZ31/AA5083 Alloy


    Muralidharan Paramsothy; Manoj Gupta; Jimmy Chan; Richard Kwok


    AZ31/AA5083 hybrid alloy nanocomposite containing CNT nanoparticle reinforcement was fabricated using solidification processing followed by hot extrusion. The AZ31/AA5083 hybrid alloy nanocomposite exhibited similar grain size to monolithic AZ31/AA5083 hybrid alloy, reasonable CNT nanoparticle distribution, non-dominant (0 0 0 2) texture in the longitudinal direction, and 20% higher hardness than monolithic AZ31/AA5083 hybrid alloy. Compared to monolithic AZ31/AA5083 hybrid alloy (in tension)...

  12. Preparation of Substrate for Flavorant from Chicken Bone Residue with Hot-Pressure Process. (United States)

    Wang, Jin-Zhi; Dong, Xian-Bing; Yue, Jian-Ying; Zhang, Chun-Hui; Jia, Wei; Li, Xia


    Hot-pressure extraction (HPE), which is regarded as a "green" technology, was applied to extract nutrients (protein, collagen, and minerals) from chicken bone residue (CBR). Amino acids (AA), color, and volatile flavor compounds of chicken bone extract (CBE) were also investigated. Results showed that contents of protein, total soluble solids, minerals, and collagen of CBE were positively correlated with extraction time and temperature. High ratios of protein (83.51%) and collagen (96.81%) were obtained with 135 °C and 120 min. Essential AA accounted for 31.03% to 47.73% of total AA in CBE. The percentage of bitter AA in TAA decreased from 28.94% to 25.02% at 0 min to 20.19% and 21.41% at 120 min, although fresh AA increased from 46.35% to 50.84% (0 min) to 53.14% (120 min) at 130 and 135 °C, respectively, indicating CBE was nutritionally beneficial with good flavor. Color and volatile flavor of CBE improved significantly after extraction, although calcium in CBE (4.2 to 4.8 mg/100 g) was relatively low compared with that of CBR (1078 mg/100 g). It can be concluded that HPE is a promising way to transform CBR into a nutritious flavorant substrate, but it is not an efficient way to extract calcium. PMID:26809140

  13. The OIV 1407.3\\AA /1401.1\\AA\\ emission-line ratio in a plasma


    Nessib, Nabil Ben; Alonizan, Norah; Qindeel, Rabia; Sahal-Bréchot, Sylvie; Dimitrijević, Milan S


    Line ratio of O IV 1407.3 \\AA/1401.1 \\AA\\- is calculated using mostly our own atomic and collisional data. Energy levels and oscillator strengths needed for this calculation have been calculated using a Hartree-Fock relativistic (HFR) approach. The electron collision strengths introduced in the statistic equilibrium equations are fitted by polynomials for different energies. Comparison has also been made with available theoretical results. The provided line ratio has been obtained for a set o...

  14. Rupture locations of friction stir welded joints of AA2017-T351 and AA6061-T6 aluminum alloys

    Institute of Scientific and Technical Information of China (English)

    LIU Hui-jie; FENG Ji-cai; H. Fujii; M. Maeda; K. Nogi


    The tensile rupture locations of friction stir welded joints of AA2017-T351 and AA6061-T6 aluminum alloys were examined. The experiments show that the rupture locations of the joints are different for the two aluminum alloys, which are influenced by the welding parameters. When the joints are free of welding defects, the AA2017-T351 joints are ruptured in the weld nugget adjacent to the thermo-mechanically affected zone on the advancing side and the rupture surfaces appear as oval contours of the weld nugget, while the AA6061-T6 joints are ruptured in the heat affected zone on the retreating side and the rupture surfaces are inclined at a certain degree to the bottom surfaces of the joints. When welding defects are present in the joints, the AA2017-T351 joints are ruptured in the weld center, while the AA6061-T6 joints are ruptured on the retreating side near the weld center. The rupture locations of the joints are dependent on the internal structures of the joints and can be explained through them.

  15. Triazole and thiazole derivatives as corrosion inhibitors for AA2024 aluminium alloy

    International Nuclear Information System (INIS)

    The 1,2,4-triazole, 3-amino-1,2,4-triazole, benzotriazole and 2-mercaptobenzothiazole were evaluated in the present work as corrosion inhibitors for protection of the 2024 aluminium alloy in neutral chloride solutions. The corrosion protection performance was investigated by means of DC polarization and electrochemical impedance spectroscopy (EIS). Scanning Kelvin probe force microscopy (SKPFM) and atomic force microscopy (AFM) were used to study the evolution of the Volta potential distribution and the surface topography during corrosion tests. The results show that all inhibitors under study confer corrosion protection to the AA2024 alloy forming a thin organic layer on the substrate surface. Benzotriazole and 2-mercaptobenzothiazole offer better corrosion protection in comparison with the other two. The inhibitors studied act decreasing the rate of both the anodic and cathodic processes. In the latter case the dealloying of the copper-reach particles is hindered, slowing down the oxygen reduction

  16. Biaxially textured composite substrates

    Energy Technology Data Exchange (ETDEWEB)

    Groves, James R.; Foltyn, Stephen R.; Arendt, Paul N.


    An article including a substrate, a layer of a metal phosphate material such as an aluminum phosphate material upon the surface of the substrate, and a layer of an oriented cubic oxide material having a rock-salt-like structure upon the metal phosphate material layer is provided together with additional layers such as a HTS top-layer of YBCO directly upon a layer of a buffer material such as a SrTi.sub.x Ru.sub.1-x O.sub.3 layer.

  17. The Pasadena Recommendations: Five Years After AAS Endorsement (United States)

    Knezek, Patricia; Frattare, L.; Ulvestad, J.


    It has been five years since the AAS Council unanimously endorsed the document, known as "Equity Now: The Pasadena Recommendations for Gender Equality in Astronomy," in January 2005. This document was the main product of the conference entitled "Women in Astronomy II: Ten Years After” (WIA II), held in June 2003 in Pasadena, CA. Participants of that 2003 meeting assessed the progress for women in science, offering insights into causes of the slower advancement of women, and discussed strategies to accelerate the achievement of equality. These insights and strategies were then incorporated into the "Pasadena Recommendations" by the CSWA. It was subsequently released to the entire AAS community for review and comments prior to its endorsement by the AAS. We will discuss the Recommendations and their impact since the endorsement by the AAS, including the process that is in place for organizations and departments to formally endorse the Pasadena Recommendations, thus making an organizational commitment to their implementation (see

  18. Effect of pressurized steam on AA1050 aluminium

    DEFF Research Database (Denmark)

    Jariyaboon, Manthana; Møller, Per; Ambat, Rajan


    measurements were used to study corrosion behavior. Findings - A 590?nm boehmite oxide layer was generated on AA1050 associated with partially dissolved and/or fallen off Fe-containing intermetallic particles after exposure to pressurized steam. A significant reduction (25 times) in anodic and cathodic......Purpose - The purpose of this paper is to understand the effect of pressurized steam on surface changes, structures of intermetallic particles and corrosion behavior of AA1050 aluminium. Design/methodology/approach - Industrially pure aluminium (AA1050, 99.5 per cent) surfaces were exposed to...... pressurized steam produced from a commercial pressure cooker at the maximum temperature of 116oC for 10?min. Surface morphology was observed using SEM-EDX and FIB-SEM. Phase identification and compositional depth profiling were investigated using XRD and GDOES, respectively. Potentiodynamic polarization...

  19. Flexibility Analysis of Bacillus thuringiensis Cry1Aa

    Institute of Scientific and Technical Information of China (English)

    ZHAO Xin Min; XIA Li Qiu; YANG Xiao Ping; PENG Xiao Yun


    Objective To investigate the flexibility and mobility of the Bacillus thuringiensis toxin Cry1Aa. Methods The graph theory-based program Constraint Network Analysis and normal mode-based program NMsim were used to analyze the global and local flexibility indices as well as the fluctuation of individual residues in detail. Results The decrease in Cry1Aa network rigidity with the increase of temperature was evident. Two phase transition points in which the Cry1Aa structure lost rigidity during the thermal simulation were identified. Two rigid clusters were found in domains I and II. Weak spots were found in C-terminal domain III. Several flexible regions were found in all three domains;the largest residue fluctuation was present in the apical loop2 of domain II. Conclusion Although several flexible regions could be found in all the three domains, the most flexible regions were in the apical loops of domain II.

  20. A synergistic combination of tetraethylorthosilicate and multiphosphonic acid offers excellent corrosion protection to AA1100 aluminum alloy

    International Nuclear Information System (INIS)

    This work describes a new mechanism for the incorporation of organophosphonic acid into silane self-assembly monolayers, which has been used to protect AA1100 aluminum alloy. The protection improvement has been attributed to the fact that phosphonic structures promote the formation of strongly bonded and densely packed monolayer films, which show higher surface coverage and better adhesion than conventional silane systems. In order to evaluate the linking chemistry offered by phosphonic groups, two functionalized organophosphonic groups have been employed, 1,2-diaminoethanetetrakis methylenephosphonic acid (EDTPO) and aminotrimethylenephosphonic acid (ATMP), and combined with tetraethylorthosilicate (TEOS) films prepared by sol–gel synthesis. Results suggest that phosphonic acids may interact with the surface through a monodentate and bidentate coordination mode and, in addition, form one or more strong and stable linkages with silicon through non-hydrolysable bonds. Therefore, the incorporation of a very low concentration of phosphonic acids on TEOS solutions favors the complete coverage of the aluminum substrate during the silanization process, which is not possible using TEOS alone. The linking capacity of phosphonic acid has been investigated by FTIR-RA spectroscopy, SEM and EDX analysis, X-ray photoelectron spectroscopy (XPS), and quantum mechanical calculations. Finally, electrochemical impedance spectroscopy has been used to study the corrosion protection revealing that EDTPO-containing films afforded more protection to the AA1100 substrate than ATMP-containing films.

  1. A synergistic combination of tetraethylorthosilicate and multiphosphonic acid offers excellent corrosion protection to AA1100 aluminum alloy

    Energy Technology Data Exchange (ETDEWEB)

    Dalmoro, Viviane [Instituto de Química, Universidade Federal do Rio Grande do Sul (UFRGS) Av. Bento Gonçalves 9500 - CEP 91501-970, Porto Alegre, RS (Brazil); Departament d’Enginyeria Química, ETSEIB, Universitat Politècnica de Catalunya (UPC), Avda. Diagonal 647, Barcelona E-08028 (Spain); Center for Research in Nano-Engineering (CRnE), Universitat Politècnica de Catalunya (UPC), Campus Sud, Edifici C’, C/Pasqual i Vila s/n, Barcelona E-08028 (Spain); Santos, João H.Z. dos [Instituto de Química, Universidade Federal do Rio Grande do Sul (UFRGS) Av. Bento Gonçalves 9500 - CEP 91501-970, Porto Alegre, RS (Brazil); Armelin, Elaine, E-mail: [Departament d’Enginyeria Química, ETSEIB, Universitat Politècnica de Catalunya (UPC), Avda. Diagonal 647, Barcelona E-08028 (Spain); Center for Research in Nano-Engineering (CRnE), Universitat Politècnica de Catalunya (UPC), Campus Sud, Edifici C’, C/Pasqual i Vila s/n, Barcelona E-08028 (Spain); Alemán, Carlos, E-mail: [Departament d’Enginyeria Química, ETSEIB, Universitat Politècnica de Catalunya (UPC), Avda. Diagonal 647, Barcelona E-08028 (Spain); Center for Research in Nano-Engineering (CRnE), Universitat Politècnica de Catalunya (UPC), Campus Sud, Edifici C’, C/Pasqual i Vila s/n, Barcelona E-08028 (Spain); and others


    This work describes a new mechanism for the incorporation of organophosphonic acid into silane self-assembly monolayers, which has been used to protect AA1100 aluminum alloy. The protection improvement has been attributed to the fact that phosphonic structures promote the formation of strongly bonded and densely packed monolayer films, which show higher surface coverage and better adhesion than conventional silane systems. In order to evaluate the linking chemistry offered by phosphonic groups, two functionalized organophosphonic groups have been employed, 1,2-diaminoethanetetrakis methylenephosphonic acid (EDTPO) and aminotrimethylenephosphonic acid (ATMP), and combined with tetraethylorthosilicate (TEOS) films prepared by sol–gel synthesis. Results suggest that phosphonic acids may interact with the surface through a monodentate and bidentate coordination mode and, in addition, form one or more strong and stable linkages with silicon through non-hydrolysable bonds. Therefore, the incorporation of a very low concentration of phosphonic acids on TEOS solutions favors the complete coverage of the aluminum substrate during the silanization process, which is not possible using TEOS alone. The linking capacity of phosphonic acid has been investigated by FTIR-RA spectroscopy, SEM and EDX analysis, X-ray photoelectron spectroscopy (XPS), and quantum mechanical calculations. Finally, electrochemical impedance spectroscopy has been used to study the corrosion protection revealing that EDTPO-containing films afforded more protection to the AA1100 substrate than ATMP-containing films.

  2. Numerical semigroups II: pseudo-symmetric AA-Semigroups


    García-Marco, Ignacio; Ramirez Alfonsin, Jorge; Rodseth, Oystein J.


    This paper is a continuation of the paper " Numerical Semigroups: Apéry Sets and Hilbert Series". We consider the general numerical AA-semigroup, i.e., semigroups consisting of all non-negative integer linear combinations of relatively prime positive integers of the form $a, a+d, a+2d,. .. , a+kd, c$. We first prove that, in contrast to arbitrary numerical semigroups, there exists an upper bound for the type of AA-semigroups that only depends on the number of generators of the semigroup. We t...

  3. Injektointimassan kehittäminen AA-tiiviysluokan tunnelialueille


    Parkkonen, Ilari


    Tutkimuksen tarkoituksena oli kehittää uusi kallioinjektointimassa AA-luokan tiiviysalueille, koska ennen käytetty injektointimassa sitoutui sekä kovettui liian hitaasti, mikä puolestaan hidasti louhintaa merkittävästi. Tutkimuksessa keskityttiin uuden injektointireseptin kehittämiseen uudella sementtivalmisteella. Kehittämisellä pyrittiin korvaamaan BB-sementti AA-sementillä, koska uusi sementti sitoutuu nopeammin kuin ennestään käytetty. Tutkimusmenetelmänä käytettiin Kalliotilojen inje...

  4. Precipitation hardening and hydrogen embrittlement of aluminum alloy AA7020

    Indian Academy of Sciences (India)

    Santosh Kumar; T K G Namboodhiri


    AA7020 Al–Mg–Zn, a medium strength aluminium alloy, is used in welded structures in military and aerospace applications. As it may be subjected to extremes of environmental exposures, including high pressure liquid hydrogen, it could suffer hydrogen embrittlement. Hydrogen susceptibility of alloy AA7020 was evaluated by slow strain-rate tensile testing, and delayed failure testing of hydrogen-charged specimens of air-cooled, duplexaged, and water-quenched duplex agedmaterials. The resistance to hydrogen embrittlement of the alloy was found to be in the order of air-cooled duplex aged alloy > as-received (T6 condition) > water quenched duplex aged material.

  5. The existence of an insulin-stimulated glucose and non-essential but not essential amino acid substrate interaction in diabetic pigs

    Directory of Open Access Journals (Sweden)

    Wijdenes Jan


    Full Text Available Abstract Background The generation of energy from glucose is impaired in diabetes and can be compensated by other substrates like fatty acids (Randle cycle. Little information is available on amino acids (AA as alternative energy-source in diabetes. To study the interaction between insulin-stimulated glucose and AA utilization in normal and diabetic subjects, intraportal hyperinsulinaemic euglycaemic euaminoacidaemic clamp studies were performed in normal (n = 8 and streptozotocin (120 mg/kg induced diabetic (n = 7 pigs of ~40-45 kg. Results Diabetic vs normal pigs showed basal hyperglycaemia (19.0 ± 2.0 vs 4.7 ± 0.1 mmol/L, P P P P P P P . Essential AA clearance was largely unchanged (72.9 ± 8.5 vs 63.3 ± 8.5 mL/kg· min, however clearances of threonine (P P Conclusions The ratio of insulin-stimulated glucose versus AA clearance was decreased 5.4-fold in diabetic pigs, which was caused by a 3.6-fold decrease in glucose clearance and a 2.0-fold increase in non-essential AA clearance. In parallel with the Randle concept (glucose - fatty acid cycle, the present data suggest the existence of a glucose and non-essential AA substrate interaction in diabetic pigs whereby reduced insulin-stimulated glucose clearance seems to be partly compensated by an increase in non-essential AA clearance whereas essential AA are preferentially spared from an increase in clearance.

  6. The 9aaTAD Transactivation Domains: From Gal4 to p53. (United States)

    Piskacek, Martin; Havelka, Marek; Rezacova, Martina; Knight, Andrea


    The family of the Nine amino acid Transactivation Domain, 9aaTAD family, comprises currently over 40 members. The 9aaTAD domains are universally recognized by the transcriptional machinery from yeast to man. We had identified the 9aaTAD domains in the p53, Msn2, Pdr1 and B42 activators by our prediction algorithm. In this study, their competence to activate transcription as small peptides was proven. Not surprisingly, we elicited immense 9aaTAD divergence in hundreds of identified orthologs and numerous examples of the 9aaTAD species' convergence. We found unforeseen similarity of the mammalian p53 with yeast Gal4 9aaTAD domains. Furthermore, we identified artificial 9aaTAD domains generated accidentally by others. From an evolutionary perspective, the observed easiness to generate 9aaTAD transactivation domains indicates the natural advantage for spontaneous generation of transcription factors from DNA binding precursors. PMID:27618436

  7. NCBI nr-aa BLAST: CBRC-PTRO-07-0067 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  8. NCBI nr-aa BLAST: CBRC-TGUT-05-0032 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  9. NCBI nr-aa BLAST: CBRC-DRER-20-0002 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  10. NCBI nr-aa BLAST: CBRC-TBEL-01-1883 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  11. NCBI nr-aa BLAST: CBRC-TNIG-14-0023 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  12. NCBI nr-aa BLAST: CBRC-GACU-18-0022 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  13. NCBI nr-aa BLAST: CBRC-FRUB-02-0074 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  14. NCBI nr-aa BLAST: CBRC-LAFR-01-1734 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  15. NCBI nr-aa BLAST: CBRC-CJAC-01-1332 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  16. NCBI nr-aa BLAST: CBRC-OLAT-24-0009 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  17. NCBI nr-aa BLAST: CBRC-TNIG-10-0006 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  18. NCBI nr-aa BLAST: CBRC-MMUS-04-0013 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  19. NCBI nr-aa BLAST: CBRC-OANA-01-2200 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  20. NCBI nr-aa BLAST: CBRC-ACAR-01-0845 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  1. NCBI nr-aa BLAST: CBRC-RNOR-05-0081 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  2. NCBI nr-aa BLAST: CBRC-DNOV-01-3023 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  3. NCBI nr-aa BLAST: CBRC-SARA-01-0195 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  4. NCBI nr-aa BLAST: CBRC-HSAP-06-0074 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  5. NCBI nr-aa BLAST: CBRC-EEUR-01-1648 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  6. NCBI nr-aa BLAST: CBRC-OCUN-01-1522 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  7. NCBI nr-aa BLAST: CBRC-ETEL-01-1516 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  8. NCBI nr-aa BLAST: CBRC-RMAC-04-0050 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  9. NCBI nr-aa BLAST: CBRC-CFAM-12-0016 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  10. NCBI nr-aa BLAST: CBRC-FCAT-01-1020 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  11. NCBI nr-aa BLAST: CBRC-PABE-07-0058 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  12. Experimental induction and oral transmission of avian AA amyloidosis in vaccinated white hens. (United States)

    Murakami, Tomoaki; Muhammad, Naeem; Inoshima, Yasuo; Yanai, Tokuma; Goryo, Masanobu; Ishiguro, Naotaka


    Avian AA amyloidosis is commonly observed in adult birds afflicted with bacterial infections or chronic inflammatory disorders. Experimental AA amyloidosis in birds can be induced by repeated inflammatory stimulation, such as injection with casein or vaccination with oil-emulsified bacterins. However, the transmission of amyloidosis among avian species has not been studied well to date. In the present study, we confirm the potential induction of avian AA amyloidosis by inoculation of Salmonella enteritidis (SE) vaccine or Mycoplasma gallisepticum vaccine. To determine the transmission of chicken AA amyloidosis among white hens, we induced experimental AA amyloidosis in vaccinated chickens by intravenous or oral administration of chicken AA fibrils. Amyloid deposits were observed in chickens injected with SE and inoculated with chicken AA fibrils intravenously (21/26: 81%) and orally (8/12: 67%). These results suggest that chicken AA amyloidosis can be induced by vaccinations, and may be transmitted among like species by oral administration. PMID:23548152

  13. Fatigue crack growth behavior and AE signal recognition from a composite patch repaired Ai thein plate

    International Nuclear Information System (INIS)

    The fatigue crack growth behavior of a fatigue-cracked and patch-repaired AA2024-T3 plate has been monitored. It was found that the overall crack growth rate was reduced and the crack propagation into the adjacent hole was also retarded. Signals due to crack growth after patch-repair and those due to debonding of the plate-patch interface were discriminated each other by using principal component analysis. The former showed higher center frequency and lower amplitude, whereas the latter showed longer rise time, lower frequency and higher amplitude.

  14. Species-specific toxicity of aristolochic acid (AA) in vitro. (United States)

    Huljic, S; Bruske, E I; Pfitzenmaier, N; O'Brien, E; Dietrich, D R


    Differences in toxicity and carcinogenicity of the nephrotoxic compound aristolochic acid between rodents and humans suggest a species-dependent mechanism of action. The goal of this study was to investigate constitutive differences in the susceptibility of renal cortex cells originating from human, rat and porcine origin in vitro. Effects of 24 and 48 h AA exposure on cell number and MTT reduction were studied. Furthermore, using the effective concentrations causing 20 and 50% reduction (cell number), cell cycle, 3H-thymidine incorporation and DNA damage analyses were conducted. AA cytotoxicity was observed in all cell types in a time- and concentration dependent manner with species-specific differences, with porcine cells being the most sensitive. AA had a comparable effect on the cell cycle in primary human and porcine cells and the rat NRK-52E cell line following 48 h exposure, also corroborated by the reduced 3H-thymidine incorporation in NRK-52E cells. In addition, DNA unwinding, suggestive of enhanced DNA damage, was observed in primary porcine cells. These results provide an initial insight into the sensitivity and suitability of different in vitro-systems and suggest that primary porcine renal cortex cells could be a valuable in vitro-system to study AA toxicity. PMID:18499390

  15. Slot-type pickup/kicker for AA stochastic cooling

    CERN Multimedia


    A "slotted transmission line" was used for both pickups and kickers of the stochastic cooling systems of the AA. They served for the cooling of the high-density antiproton stack, in momentum and both transverse planes. In the beginning in a single band, 1-2 GHz, later in 2 bands, 2-4 and 4-8 GHz. See also 7906190, 7906193.

  16. Lead induced intergranular fracture in aluminum alloy AA6262

    NARCIS (Netherlands)

    De Hosson, JTM


    The influence of lead on the fracture behavior of aluminum alloy AA6262 is investigated. Under certain conditions, the mode of fracture changes from transgranular microvoid coalescence to an intergranular mechanism. Three different intergranular fracture mechanisms are observed: liquid metal embritt

  17. Backend solutions for AA in the MUSE network supporting FMC

    NARCIS (Netherlands)

    Neerbos, A.N.R. van; Prins, M.; Melander, B.; Pimilla Larrucea, I.; Thakur, M.J.; Fredricx, F.


    The European MUSE project investigated fixed-mobile convergence from the perspective of an unbundled fixed network. A major part of the work consisted of finding solutions for the authentication and authorisation of users who roam from their home network to a visited network. This paper shows how AA

  18. Diagnostic performance of amyloid A protein quantification in fat tissue of patients with clinical AA amyloidosis

    NARCIS (Netherlands)

    Hazenberg, Bouke P. C.; Bijzet, Johannes; Limburg, Pieter C.; Skinner, Martha; Hawkins, Philip N.; Butrimiene, Irena; Livneh, Avi; Lesnyak, Olga; Nasonov, Evgeney L.; Filipowicz-Sosnowska, Anna; Guel, Ahmet; Merlini, Giampaolo; Wiland, Piotr; Oezdogan, Huri; Gorevic, Peter D.; Ben Maiz, Hedi; Benson, Merrill D.; Direskeneli, Haner; Kaarela, Kalevi; Garceau, Denis; Hauck, Wendy; van Rijswijk, Martin


    Objective. Amyloid A protein quantification in fat tissue is a new immunochemical method for detecting AA amyloidosis, a rare but serious disease. The objective was to assess diagnostic performance in clinical AA amyloidosis. Methods. Abdominal subcutaneous fat tissue of patients with AA amyloidosis

  19. NCBI nr-aa BLAST: CBRC-DRER-16-0004 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-151 77% ...

  20. NCBI nr-aa BLAST: CBRC-MEUG-01-0507 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 3e-64 69% ...

  1. NCBI nr-aa BLAST: CBRC-FRUB-02-0462 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 3e-65 50% ...

  2. NCBI nr-aa BLAST: CBRC-MEUG-01-2097 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-54 61% ...

  3. NCBI nr-aa BLAST: CBRC-PHAM-01-0260 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-111 55% ...

  4. NCBI nr-aa BLAST: CBRC-PHAM-01-0937 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 3e-76 39% ...

  5. NCBI nr-aa BLAST: CBRC-DRER-23-0030 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-161 56% ...

  6. NCBI nr-aa BLAST: CBRC-GGAL-35-0346 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-97 52% ...

  7. NCBI nr-aa BLAST: CBRC-MDOM-02-0208 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-67 40% ...

  8. NCBI nr-aa BLAST: CBRC-PHAM-01-1761 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-47 62% ...

  9. NCBI nr-aa BLAST: CBRC-MDOM-01-0434 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-78 89% ...

  10. NCBI nr-aa BLAST: CBRC-MDOM-01-0045 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 4e-68 81% ...

  11. NCBI nr-aa BLAST: CBRC-GGOR-01-1471 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 5e-69 49% ...

  12. NCBI nr-aa BLAST: CBRC-GGOR-01-1505 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-72 85% ...

  13. NCBI nr-aa BLAST: CBRC-FRUB-02-0378 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 5e-47 36% ...

  14. NCBI nr-aa BLAST: CBRC-DRER-24-0040 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-65 43% ...

  15. NCBI nr-aa BLAST: CBRC-DRER-26-0240 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-120 58% ...

  16. NCBI nr-aa BLAST: CBRC-DRER-26-0003 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-129 67% ...

  17. NCBI nr-aa BLAST: CBRC-OPRI-01-0928 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 9e-41 30% ...

  18. NCBI nr-aa BLAST: CBRC-MDOM-01-0559 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-100 54% ...

  19. NCBI nr-aa BLAST: CBRC-MDOM-04-0486 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 4e-75 60% ...

  20. NCBI nr-aa BLAST: CBRC-MDOM-05-0082 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-84 90% ...

  1. NCBI nr-aa BLAST: CBRC-DRER-26-0272 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-121 61% ...

  2. NCBI nr-aa BLAST: CBRC-PHAM-01-0191 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-72 42% ...

  3. NCBI nr-aa BLAST: CBRC-PHAM-01-0989 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-83 37% ...

  4. NCBI nr-aa BLAST: CBRC-HSAP-19-0022 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 3e-41 48% ...

  5. NCBI nr-aa BLAST: CBRC-PHAM-01-0701 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 5e-93 49% ...

  6. NCBI nr-aa BLAST: CBRC-PVAM-01-1393 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-45 32% ...

  7. NCBI nr-aa BLAST: CBRC-HSAP-16-0043 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-40 49% ...

  8. NCBI nr-aa BLAST: CBRC-MDOM-01-0427 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-126 87% ...

  9. NCBI nr-aa BLAST: CBRC-PMAR-01-0034 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-32 35% ...

  10. NCBI nr-aa BLAST: CBRC-PMAR-01-0589 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-74 53% ...

  11. NCBI nr-aa BLAST: CBRC-MDOM-02-0443 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-57 61% ...

  12. NCBI nr-aa BLAST: CBRC-MMUS-03-0022 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-27 40% ...

  13. NCBI nr-aa BLAST: CBRC-DMEL-04-0079 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 0.0 91% ...

  14. NCBI nr-aa BLAST: CBRC-MDOM-01-0492 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 6e-80 72% ...

  15. NCBI nr-aa BLAST: CBRC-MEUG-01-1306 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-100 79% ...

  16. NCBI nr-aa BLAST: CBRC-PHAM-01-1384 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-94 74% ...

  17. NCBI nr-aa BLAST: CBRC-DRER-08-0065 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-116 57% ...

  18. NCBI nr-aa BLAST: CBRC-MEUG-01-0364 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-38 26% ...

  19. NCBI nr-aa BLAST: CBRC-FRUB-02-0544 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-68 58% ...

  20. NCBI nr-aa BLAST: CBRC-MDOM-01-0071 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 3e-87 63% ...

  1. NCBI nr-aa BLAST: CBRC-PHAM-01-0263 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-113 75% ...

  2. NCBI nr-aa BLAST: CBRC-MDOM-03-0307 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-67 83% ...

  3. NCBI nr-aa BLAST: CBRC-DRER-10-0037 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 3e-60 57% ...

  4. NCBI nr-aa BLAST: CBRC-GGOR-01-0143 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-151 86% ...

  5. NCBI nr-aa BLAST: CBRC-RNOR-04-0296 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-29 39% ...

  6. NCBI nr-aa BLAST: CBRC-MDOM-11-0080 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 3e-65 58% ...

  7. NCBI nr-aa BLAST: CBRC-MEUG-01-1910 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-46 53% ...

  8. NCBI nr-aa BLAST: CBRC-PHAM-01-1203 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-58 53% ...

  9. NCBI nr-aa BLAST: CBRC-PHAM-01-1688 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 4e-83 46% ...

  10. NCBI nr-aa BLAST: CBRC-PHAM-01-1722 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 5e-52 60% ...

  11. NCBI nr-aa BLAST: CBRC-OLAT-26-0203 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 4e-58 36% ...

  12. NCBI nr-aa BLAST: CBRC-MDOM-01-0268 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-116 60% ...

  13. NCBI nr-aa BLAST: CBRC-HSAP-20-0022 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 3e-72 50% ...

  14. NCBI nr-aa BLAST: CBRC-PVAM-01-0087 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-69 50% ...

  15. NCBI nr-aa BLAST: CBRC-MEUG-01-1181 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-100 81% ...

  16. NCBI nr-aa BLAST: CBRC-PHAM-01-1765 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-76 59% ...

  17. NCBI nr-aa BLAST: CBRC-DRER-26-0018 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-149 76% ...

  18. NCBI nr-aa BLAST: CBRC-DDIS-02-0038 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-24 22% ...

  19. Nitrification in a zeoponic substrate (United States)

    McGilloway, R. L.; Weaver, R. W.; Ming, D. W.; Gruener, J. E.


    Clinoptilolite is a zeolite mineral with high cation exchange capacity used in zeoponic substrates that have been proposed as a solid medium for growing plants or as a fertilizer material. The kinetics of nitrification has not been measured for NH4+ saturated zeoponic substrate. Experiments were conducted to evaluate the production of NO2- and NO3-, and nitrifier populations in zeoponic substrates. Small columns were filled with zeoponic substrate inoculated with a commercial inoculum or soil enrichment culture of nitrifying bacteria. In addition to column studies, a growth chamber study was conducted to evaluate the kinetics of nitrification in zeoponic substrates used to grow radishes (Raphanus sativus L.). The zeoponic substrate provided a readily available source of NH4+, and nitrifying bacteria were active in the substrate. Ammonium oxidation rates in column studies ranged from 5 to 10 micrograms N g-1 substrate h-1, and NO2- oxidation rates were 2 to 9.5 micrograms N g-1 substrate h-1. Rates determined from the growth chamber study were approximately 1.2 micrograms N g-1 substrate h-1. Quantities of NH4+ oxidized to NO2- and NO3- in inoculated zeoponic substrate were in excess of plant up-take. Acidification as a result of NH4+ oxidation resulted in a pH decline, and the zeoponic substrate showed limited buffering capacity.

  20. A Status Report on the AAS Astronomy Ambassadors Program (United States)

    Fienberg, Richard Tresch; Fraknoi, Andrew; Gurton, Suzanne; Hurst, Anna; Schatz, Dennis L.


    The American Astronomical Society, in partnership with the Astronomical Society of the Pacific (ASP), has launched a series of professional-development workshops and a community of practice designed to improve early-career astronomers’ ability to communicate effectively with students and the public. Called AAS Astronomy Ambassadors, the program provides training and mentoring for young astronomers, from advanced undergraduates to beginning faculty; it also provides them access to resources and a network of contacts within the astronomy education and public outreach (EPO) community. Ambassadors are provided with a library of outreach activities and resource materials suitable for a range of venues and audiences. For much of this library we are using resources developed by organizations such as the ASP, the Pacific Science Center, and the Center for Astronomy Education for other outreach programs, though some resources have been created by one of us (AF) specifically for this program. After a period of evaluation and revision, the program’s “Menu of Outreach Opportunities for Science Education” (MOOSE) is now posted on the AAS website at first two Astronomy Ambassadors workshops were held at AAS meetings in January 2013 and January 2014; each served 30 young astronomers chosen from about twice that many applicants. Web-based follow-up activities are being provided through a website at the ASP designed to keep cohorts of educators trained in their programs in touch with one another. The AAS is exploring ways to fund additional workshops at future winter meetings; suggestions are most welcome. Meanwhile, the Astronomy Ambassadors trained to date have logged more than 150 outreach events, reaching many thousands of children and adults across the U.S. and Canada.

  1. Maintainable substrate carrier for electroplating

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Chen-An; Abas, Emmanuel Chua; Divino, Edmundo Anida; Ermita, Jake Randal G.; Capulong, Jose Francisco S.; Castillo, Arnold Villamor; Ma, Diana Xiaobing


    One embodiment relates to a substrate carrier for use in electroplating a plurality of substrates. The carrier includes a non-conductive carrier body on which the substrates are placed and conductive lines embedded within the carrier body. A plurality of conductive clip attachment parts are attached in a permanent manner to the conductive lines embedded within the carrier body. A plurality of contact clips are attached in a removable manner to the clip attachment parts. The contact clips hold the substrates in place and conductively connecting the substrates with the conductive lines. Other embodiments, aspects and features are also disclosed.

  2. Frictional conditions between alloy AA6060 aluminium and tool steel (United States)

    Widerøe, Fredrik; Welo, Torgeir


    The frictional conditions in the new process of screw extrusion of aluminium have been investigated. The contact behaviour between the aluminum alloy and the tool steel in the extruder is vital for understanding the extrusion process. Using a compressive-rotational method for frictional measurements the conditions for unlubricated sticking friction between aluminum alloy AA6060 and tool steel at different combinations of temperatures and pressures have been investigated. In this method the samples in the form of disks are put under hydrostatic pressure while simultaneously being rotated at one end. Pins made from contrast material have been inserted into the samples to measure the deformation introduced. This approach along with 3D simulations form a method for determining the frictional conditions. The paper describes the test method and the results. It was found that the necessary pressure for sticking to occur between the aluminum AA6060 and the different parts of the extruder is heavily influenced by the temperature.

  3. Frictional conditions between alloy AA6060 aluminium and tool steel

    International Nuclear Information System (INIS)

    The frictional conditions in the new process of screw extrusion of aluminium have been investigated. The contact behaviour between the aluminum alloy and the tool steel in the extruder is vital for understanding the extrusion process. Using a compressive-rotational method for frictional measurements the conditions for unlubricated sticking friction between aluminum alloy AA6060 and tool steel at different combinations of temperatures and pressures have been investigated. In this method the samples in the form of disks are put under hydrostatic pressure while simultaneously being rotated at one end. Pins made from contrast material have been inserted into the samples to measure the deformation introduced. This approach along with 3D simulations form a method for determining the frictional conditions. The paper describes the test method and the results. It was found that the necessary pressure for sticking to occur between the aluminum AA6060 and the different parts of the extruder is heavily influenced by the temperature.

  4. Species-specific Toxicity of Aristolochic Acid (AA) in vitro


    Huljic, Susanne; Bruske, Ellen Inga; Pfitzenmaier, Norbert; O'Brien, Evelyn; Dietrich, Daniel R


    Differences in toxicity and carcinogenicity of the nephrotoxic compound aristolochic acid between rodents and humans suggest a species-dependent mechanism of action. The goal of this study was to investigate constitutive differences in the susceptibility of renal cortex cells originating from human, rat and porcine origin in vitro. Effects of 24 and 48 h AA exposure on cell number and MTT reduction were studied. Furthermore, using the effective concentrations causing 20 and 50 % reduction (ce...

  5. AAS, growth hormone, and insulin abuse: psychological and neuroendocrine effects


    Graham, Michael R; Peter Evans; Bruce Davies; Baker, Julien S.


    Michael R Graham1, Peter Evans2, Bruce Davies1, Julien S Baker11Health and Exercise Science Research Unit, Faculty of Health Sport and Science, University of Glamorgan, Pontypridd, Wales, United Kingdom; 2Royal Gwent Hospital, Newport, Gwent, United KingdomAbstract: The nontherapeutic use of prescription medicines by individuals involved in sport is increasing. Anabolic-androgenic steroids (AAS) are the most widely abused drug. Much of our knowledge of the psychological and physiological effe...

  6. Slot-type pickup/kicker for AA stochastic cooling

    CERN Multimedia


    A "slotted transmission line" was used for both pickups and kickers of the stochastic cooling systems of the AA. They served for the cooling of the high-density antiproton stack, in momentum and both transverse planes. In the beginning, in a single band, 1-2 GHz, later in 2 bands, 2-4 and 4-8 GHz. View down the centre of a pickup or kicker. See also 7906189, 7906190, 7906583.

  7. Slot-type pickup/kicker for AA stochastic cooling

    CERN Multimedia


    A "slotted transmission line" was used for both pickups and kickers of the cooling systems of the AA. They served for the cooling of the high-density antiproton stack, in momentum and both transverse planes. In the beginning in a single band, 1-2 GHz, later in 2 bands, 2-4 and 4-8 GHz. Here we see the slotted electrodes partly pulled out of the outer casing. See also 7906189, 7906581X, 7896193.





    For the first time in the world, A.A. Zhuchenko has carried a system analysis of the adaptive potential in cultivated plants, identified crucial features and qualitatively new mechanisms of adaptive responses of plants during ontogeny and phylogeny, substantiated and formulated the key concepts of plant genetics, ecological genetics of cultivated plants, ecological and genetic foundations of the adaptive system of plant breeding, adaptive crop production, and the strategy for adaptive intensi...

  9. Evolutionary status of AA Doradus: still an enigma?

    International Nuclear Information System (INIS)

    The evolutionary scenarios for AA Dor are reconsidered using new contraction times for degenerate red dwarfs. It is found that both types of models considered by Paczynski (1980) with the primary being either an hydrogen shell burning helium white dwarf or a double shell burning carbon-oxygen white dwarf are consistent with the available data. The second model requires a very narrow range of the initial parameters of the binary system. 26 refs. (author)

  10. Wooden models of an AA quadrupole between bending magnets

    CERN Multimedia


    At two points in the AA lattice, a quadrupole (QDN, defocusing, narrow) was tightly wedged between two bending magnets (BST, short, wide). This picture of wooden models lets one imagine the strong interaction between their magnetic fields. There was no way one could calculate with the necessary accuracy the magnetic effects and their consequences for the machine optics. The necessary corrections were made after measurements with a circulating beam, in a tedious iterative procedure, with corrrection coils and shims.

  11. 184AA3: a xenograft model of ER+ breast adenocarcinoma. (United States)

    Hines, William C; Kuhn, Irene; Thi, Kate; Chu, Berbie; Stanford-Moore, Gaelen; Sampayo, Rocío; Garbe, James C; Stampfer, Martha; Borowsky, Alexander D; Bissell, Mina J


    Despite the prevalence and significant morbidity resulting from estrogen receptor positive (ER(+)) breast adenocarcinomas, there are only a few models of this cancer subtype available for drug development and arguably none for studying etiology. Those models that do exist have questionable clinical relevance. Given our goal of developing luminal models, we focused on six cell lines derived by minimal mutagenesis from normal human breast cells, and asked if any could generate clinically relevant xenografts, which we then extensively characterized. Xenografts of one cell line, 184AA3, consistently formed ER(+) adenocarcinomas that had a high proliferative rate and other features consistent with "luminal B" intrinsic subtype. Squamous and spindle cell/mesenchymal differentiation was absent, in stark contrast to other cell lines that we examined or others have reported. We explored intratumoral heterogeneity produced by 184AA3 by immunophenotyping xenograft tumors and cultured cells, and characterized marker expression by immunofluorescence and flow cytometry. A CD44(High) subpopulation was discovered, yet their tumor forming ability was far less than CD44(Low) cells. Single cell cloning revealed the phenotypic plasticity of 184AA3, consistent with the intratumoral heterogeneity observed in xenografts. Characterization of ER expression in cultures revealed ER protein and signaling is intact, yet when estrogen was depleted in culture, and in vivo, it did not impact cell or tumor growth, analogous to therapeutically resistant ER(+) cancers. This model is appropriate for studies of the etiology of ovarian hormone independent adenocarcinomas, for identification of therapeutic targets, predictive testing, and drug development. PMID:26661596

  12. The trajectory and atmospheric impact of asteroid 2014 AA (United States)

    Farnocchia, Davide; Chesley, Steven R.; Brown, Peter G.; Chodas, Paul W.


    Near-Earth asteroid 2014 AA entered the Earth's atmosphere on 2014 January 2, only 21 h after being discovered by the Catalina Sky Survey. In this paper we compute the trajectory of 2014 AA by combining the available optical astrometry, seven ground-based observations over 69 min, and the International Monitoring System detection of the atmospheric impact infrasonic airwaves in a least-squares orbit estimation filter. The combination of these two sources of observations results in a tremendous improvement in the orbit uncertainties. The impact time is 3:05 UT with a 1σ uncertainty of 6 min, while the impact location corresponds to a west longitude of 44.2° and a latitude of 13.1° with a 1σ uncertainty of 140 km. The minimum impact energy estimated from the infrasound data and the impact velocity result in an estimated minimum mass of 22.6 t. By propagating the trajectory of 2014 AA backwards we find that the only window for finding precovery observations is for the three days before its discovery.

  13. The atmospheric impact trajectory of asteroid 2014 AA

    CERN Document Server

    Farnocchia, D; Brown, P G; Chodas, P W


    Near-Earth asteroid 2014 AA entered the Earth's atmosphere on 2014 January 2, only 21 hours after being discovered by the Catalina Sky Survey. In this paper we compute the trajectory of 2014 AA by combining the available optical astrometry, seven ground-based observations over 69 minutes, and the International Monitoring system detection of the atmospheric impact infrasonic airwaves in a least-squares orbit estimation filter. The combination of these two sources of observations results in a tremendous improvement in the orbit uncertainties. The impact time is 3:05 UT with a 1-sigma uncertainty of 6 min, while the impact location corresponds to a west longitude of 44.7 deg and a latitude of 13.1 deg with a 1-sigma uncertainty of 140 km. The minimum impact energy estimated from the infrasound data and the impact velocity result in an estimated minimum mass of 22.6 t. By propagating the trajectory of 2014 AA backwards we find that the only window for finding precovery observations is for the three days before it...

  14. Effects of Friction Stir Welding Speed on AA2195 alloy

    Directory of Open Access Journals (Sweden)

    Lee Ho-Sung


    Full Text Available The application of friction stir welding (FSW to aerospace has grown rapidly due to the high efficiency and environmental friendly nature of the process. FSW is achieved by plastic flow of frictionally heated material in solid state and offers many advantages of avoiding hot cracking and limiting component distortion. Recently low density, high modulus and high strength AA2195 are used as substitute for conventional aluminum alloys since the weight saving is critical in aerospace applications. One of the problems for this alloy is weld metal porosity formation leading to hot cracking. Combination of FSW and AA2195 provides synergy effect to improve mechanical properties and weight saving of aerospace structure such as cryogenic fuel tanks for launch systems. The objective of this paper is to investigate the effect of friction stir welding speed on mechanical and microstructural properties of AA2195. The friction stir welded materials were joined with four different tool rotation speeds (350~800 rpm and five welding speeds (120~360 mm/min, which are the two prime welding parameters in this process.

  15. PLZT capacitor on glass substrate

    Energy Technology Data Exchange (ETDEWEB)

    Fairchild, Manuel Ray; Taylor, Ralph S.; Berlin, Carl W.; Wong, Celine Wk; Ma, Beihai; Balachandran, Uthamalingam


    A lead-lanthanum-zirconium-titanate (PLZT) capacitor on a substrate formed of glass. The first metallization layer is deposited on a top side of the substrate to form a first electrode. The dielectric layer of PLZT is deposited over the first metallization layer. The second metallization layer deposited over the dielectric layer to form a second electrode. The glass substrate is advantageous as glass is compatible with an annealing process used to form the capacitor.

  16. Pedestal substrate for coated optics (United States)

    Hale, Layton C.; Malsbury, Terry N.; Patterson, Steven R.


    A pedestal optical substrate that simultaneously provides high substrate dynamic stiffness, provides low surface figure sensitivity to mechanical mounting hardware inputs, and constrains surface figure changes caused by optical coatings to be primarily spherical in nature. The pedestal optical substrate includes a disk-like optic or substrate section having a top surface that is coated, a disk-like base section that provides location at which the substrate can be mounted, and a connecting cylindrical section between the base and optics or substrate sections. The connecting cylindrical section may be attached via three spaced legs or members. However, the pedestal optical substrate can be manufactured from a solid piece of material to form a monolith, thus avoiding joints between the sections, or the disk-like base can be formed separately and connected to the connecting section. By way of example, the pedestal optical substrate may be utilized in the fabrication of optics for an extreme ultraviolet (EUV) lithography imaging system, or in any optical system requiring coated optics and substrates with reduced sensitivity to mechanical mounts.

  17. Co-expression of AaPMT and AaTRI effectively enhances the yields of tropane alkaloids in Anisodus acutangulus hairy roots

    Directory of Open Access Journals (Sweden)

    Zhang Ang


    Full Text Available Abstract Background Tropane alkaloids (TA including anisodamine, anisodine, hyoscyamine and scopolamine are a group of important anticholinergic drugs with rapidly increasing market demand, so it is significant to improve TA production by biotechnological approaches. Putrescine N-methyltransferase (PMT was considered as the first rate-limiting upstream enzyme while tropinone reductase I (TRI was an important branch-controlling enzyme involved in TA biosynthesis. However, there is no report on simultaneous introduction of PMT and TRI genes into any TA-producing plant including Anisodus acutangulus (A. acutangulus, which is a Solanaceous perennial plant that is endemic to China and is an attractive resource plant for production of TA. Results In this study, 21 AaPMT and AaTRI double gene transformed lines (PT lines, 9 AaPMT single gene transformed lines (P lines and 5 AaTRI single gene transformed lines (T lines were generated. RT-PCR and real-time fluorescence quantitative analysis results revealed that total AaPMT (AaPMT T and total AaTRI (AaTRI T gene transcripts in transgenic PT, P and T lines showed higher expression levels than native AaPMT (AaPMT E and AaTRI (AaTRI E gene transcripts. As compared to the control and single gene transformed lines (P or T lines, PT transgenic hairy root lines produced significantly higher levels of TA. The highest yield of TA was detected as 8.104 mg/g dw in line PT18, which was 8.66, 4.04, and 3.11-times higher than those of the control (0.935 mg/g dw, P3 (highest in P lines, 2.004 mg/g dw and T12 (highest in T lines, 2.604 mg/g dw, respectively. All the tested samples were found to possess strong radical scavenging capacity, which were similar to control. Conclusion In the present study, the co-expression of AaPMT and AaTRI genes in A. acutangulus hairy roots significantly improved the yields of TA and showed higher antioxidant activity than control because of higher total TA content, which is the first

  18. Depletion of Spleen Macrophages Delays AA Amyloid Development: A Study Performed in the Rapid Mouse Model of AA Amyloidosis


    Katarzyna Lundmark; Aida Vahdat Shariatpanahi; Westermark, Gunilla T.


    AA amyloidosis is a systemic disease that develops secondary to chronic inflammatory diseases Macrophages are often found in the vicinity of amyloid deposits and considered to play a role in both formation and degradation of amyloid fibrils. In spleen reside at least three types of macrophages, red pulp macrophages (RPM), marginal zone macrophages (MZM), metallophilic marginal zone macrophages (MMZM). MMZM and MZM are located in the marginal zone and express a unique collection of scavenger r...

  19. Through-thickness recrystallization characteristics of a laminated AA3xxx–AA6xxx aluminum alloy system

    Energy Technology Data Exchange (ETDEWEB)

    Liao, L.H., E-mail: [Department of Mechanical and Mechatronics Engineering, University of Waterloo, 200 University Ave. West, Waterloo, ON N2L 3G1 (Canada); Jin, H.; Gallerneault, M. [Formerly Novelis Research and Technology Centre, 945 Princess Street, Kingston, ON K7L 5L9 (Canada); Esmaeili, S., E-mail: [Department of Mechanical and Mechatronics Engineering, University of Waterloo, 200 University Ave. West, Waterloo, ON N2L 3G1 (Canada)


    The through-thickness annealing behavior of a laminated AA3xxx–AA6xxx alloy system at 300 °C has been studied by scanning electron microscopy, electron backscatter diffraction analysis, electron probe micro-analysis, differential scanning calorimetry, and hardness measurement. Results show that the recrystallization process starts at the interface region between the AA3xxx (clad) and AA6xxx (core) layers. Subsequently, the recrystallization process front progresses into the core layer, while the clad layer is the last region to recrystallize. It is also found that precipitation precedes recrystallization in the entire laminate at the investigated temperature. The preferential onset of recrystallization at the interface region is attributed to the net driving pressure being the highest in this region. The factors that lead to such enhanced net driving pressure are (a) deformation incompatibility between the two alloy layers, (b) lower solute content of the interface, which also leads to lower volume fraction of precipitates, and (c) an accelerated rate of precipitate coarsening due to the presence of a higher density of dislocations. The gradual progress of recrystallization from the interface towards the core layer is dictated by precipitate coarsening and the dependence of its rate on the density of deformation-induced dislocations. The lower driving pressure due to lower work hardening capacity, high solute drag pressure due to Mn, and additional Zener drag from precipitates that form due to solute redistribution during annealing explain the late initiation of recrystallization in the clad layer. - Highlights: • The through-thickness recrystallization of a laminated system is investigated. • The early onset of recrystallization at the interface is discussed. • The effects of precipitation and coarsening on recrystallization are analyzed.

  20. Through-thickness recrystallization characteristics of a laminated AA3xxx–AA6xxx aluminum alloy system

    International Nuclear Information System (INIS)

    The through-thickness annealing behavior of a laminated AA3xxx–AA6xxx alloy system at 300 °C has been studied by scanning electron microscopy, electron backscatter diffraction analysis, electron probe micro-analysis, differential scanning calorimetry, and hardness measurement. Results show that the recrystallization process starts at the interface region between the AA3xxx (clad) and AA6xxx (core) layers. Subsequently, the recrystallization process front progresses into the core layer, while the clad layer is the last region to recrystallize. It is also found that precipitation precedes recrystallization in the entire laminate at the investigated temperature. The preferential onset of recrystallization at the interface region is attributed to the net driving pressure being the highest in this region. The factors that lead to such enhanced net driving pressure are (a) deformation incompatibility between the two alloy layers, (b) lower solute content of the interface, which also leads to lower volume fraction of precipitates, and (c) an accelerated rate of precipitate coarsening due to the presence of a higher density of dislocations. The gradual progress of recrystallization from the interface towards the core layer is dictated by precipitate coarsening and the dependence of its rate on the density of deformation-induced dislocations. The lower driving pressure due to lower work hardening capacity, high solute drag pressure due to Mn, and additional Zener drag from precipitates that form due to solute redistribution during annealing explain the late initiation of recrystallization in the clad layer. - Highlights: • The through-thickness recrystallization of a laminated system is investigated. • The early onset of recrystallization at the interface is discussed. • The effects of precipitation and coarsening on recrystallization are analyzed

  1. Single-sided laser beam welding of a dissimilar AA2024–AA7050 T-joint

    International Nuclear Information System (INIS)

    Highlights: • Single-sided laser beam welding of a dissimilar AA2024–AA7050 T-joint was realised. • For this purpose a fibre laser with high power and a large beam diameter was used. • Porosity-free weld seams with low penetration into the skin material were achieved. • The mechanical properties are comparable to that of double-sided welded T-joints. - Abstract: In the aircraft industry double-sided laser beam welding of skin–stringer joints is an approved method for producing defect-free welds. But due to limited accessibility – as for the welding of skin–clip joints – the applicability of this method is limited. Therefore single-sided laser beam welding of T-joints becomes necessary. This also implies a reduction of the manufacturing effort. However, the main obstacle for the use of single-sided welding of T-joints is the occurrence of weld defects. An additional complexity represents the combination of dissimilar and hard-to-weld aluminium alloys – like Al–Cu and Al–Zn alloys. These alloys offer a high strength-to-density ratio, but are also associated with distinct weldability problems especially for fusion welding techniques like laser beam welding. The present study demonstrates how to overcome the weldability problems during single-sided laser beam welding of a dissimilar T-joint made of AA2024 and AA7050. For this purpose a high-power fibre laser with a large beam diameter is used. Important welding parameters are identified and adjusted for achieving defect-free welds. The obtained joints are compared to double-sided welded joints made of typical aircraft aluminium alloys. In this regard single-sided welded joints showed the expected differing weld seam appearance, but comparable mechanical properties

  2. Microstructure, mechanical properties and texture of an AA6061/AA5754 composite fabricated by cross accumulative roll bonding

    Energy Technology Data Exchange (ETDEWEB)

    Verstraete, K., E-mail: [Université Paris-Sud, SP2M, ICMMO, UMR CNRS 8182, 91405 Orsay Cedex (France); Helbert, A.L. [Université Paris-Sud, SP2M, ICMMO, UMR CNRS 8182, 91405 Orsay Cedex (France); Brisset, F. [Université Paris-Sud, ICMMO, UMR CNRS 8182, 91405 Orsay Cedex (France); Benoit, A.; Paillard, P. [Institut des Matériaux Jean Rouxel (IMN), UMR 6502, Polytech’Nantes, Nantes Cedex (France); Baudin, T. [Université Paris-Sud, SP2M, ICMMO, UMR CNRS 8182, 91405 Orsay Cedex (France)


    AA6061 alloy is a widely used material in the automotive and aerospace industries, but is prone to hot cracking, which limits its weldability. To prevent this phenomenon, the AA6061/AA5754 composite was formed using a severe plastic deformation technique, Cross Accumulative Roll Bonding (CARB), at an elevated temperature (350 °C) to ensure good bonding between layers. This technique was efficient to maintain a small grain size, even under the process temperature conditions, and consequently, preserve good mechanical properties. The composite had better mechanical properties than the initial aluminium alloys. Microstructure and texture remained stable after two cycles and yield stress tended towards an equal value in the rolling and the transverse directions. After two cycles, the main component was the {001}〈110〉 rotated Cube, which was maintained for up to 10 cycles. Diffusion was more effective as the strain increased. Finally, a tungsten inert gas (TIG) welding process was performed on the composite and confirmed resistance to hot cracking.

  3. Identification of Eps15 as antigen recognized by the monoclonal antibodies aa2 and ab52 of the Wuerzburg Hybridoma Library against Drosophila brain.

    Directory of Open Access Journals (Sweden)

    Partho Halder

    Full Text Available The Wuerzburg Hybridoma Library against the Drosophila brain represents a collection of around 200 monoclonal antibodies that bind to specific structures in the Drosophila brain. Here we describe the immunohistochemical staining patterns, the Western blot signals of one- and two-dimensional electrophoretic separation, and the mass spectrometric characterization of the target protein candidates recognized by the monoclonal antibodies aa2 and ab52 from the library. Analysis of a mutant of a candidate gene identified the Drosophila homolog of the Epidermal growth factor receptor Pathway Substrate clone 15 (Eps15 as the antigen for these two antibodies.

  4. Effective corrosion protection of AA6061 aluminum alloy by sputtered Al-Ce coatings

    International Nuclear Information System (INIS)

    Al-Ce coatings were deposited on silicon and AA6061 aluminum alloy substrates by DC magnetron sputtering using aluminum in combination with pure cerium targets. The materials were characterized by X-ray diffraction (XRD), atomic force microscopy (AFM), scanning electron microscopy (SEM), high resolution transmission electron microscopy (HRTEM) and electrochemical impedance spectroscopy (EIS) in order to consider their application as high corrosion resistance coatings. The corrosion behavior of the films was studied using a NaCl aqueous solution (3.5 wt%). As for the characterization results, an apparent amorphous phase of aluminum oxide with small cerium compounds embedded in the matrix was detected by the X-ray diffraction patterns and HRTEM on the deposited films at 200 W and 4 Pa. At these conditions, AFM and SEM images evidenced crack-free coatings with low-roughness nanometric structures and columnar growth. EIS and Tafel results converged to indicate an inhibition of the corrosion reactions. The film displayed good stability in the aggressive medium and after 1 day of exposure underwent very little degradation. The variations in the impedance and Tafel characteristics were found to occur as a function of cerium content, which provokes important changes in the film protective properties.

  5. Effective corrosion protection of AA6061 aluminum alloy by sputtered Al-Ce coatings

    Energy Technology Data Exchange (ETDEWEB)

    Dominguez-Crespo, M.A., E-mail: mdominguezc@ipn.m [Instituto Politecnico Nacional, GIPMAT CICATA-Altamira, km 14.5, Carretera Tampico-Puerto Industrial Altamira, C.P. 89600 Altamira, Tamps (Mexico); Torres-Huerta, A.M. [Instituto Politecnico Nacional, GIPMAT CICATA-Altamira, km 14.5, Carretera Tampico-Puerto Industrial Altamira, C.P. 89600 Altamira, Tamps (Mexico); Rodil, S.E. [Instituto de Investigacion en Materiales, Universidad Nacional Autonoma de Mexico, Circuito Exterior s/n, Ciudad Universitaria, Del. Coyoacan, C.P. 04510 Mexico, D.F. (Mexico); Ramirez-Meneses, E. [Instituto Politecnico Nacional, GIPMAT CICATA-Altamira, km 14.5, Carretera Tampico-Puerto Industrial Altamira, C.P. 89600 Altamira, Tamps (Mexico); Suarez-Velazquez, G.G. [Alumna del PTA del CICATA-Altamira IPN, km 14.5, Carretera Tampico-Puerto Industrial Altamira, C.P. 89600 Altamira, Tamps (Mexico); Hernandez-Perez, M.A. [Instituto Politecnico Nacional, ESIQIE, C.P. 07738 Mexico, D.F. (Mexico)


    Al-Ce coatings were deposited on silicon and AA6061 aluminum alloy substrates by DC magnetron sputtering using aluminum in combination with pure cerium targets. The materials were characterized by X-ray diffraction (XRD), atomic force microscopy (AFM), scanning electron microscopy (SEM), high resolution transmission electron microscopy (HRTEM) and electrochemical impedance spectroscopy (EIS) in order to consider their application as high corrosion resistance coatings. The corrosion behavior of the films was studied using a NaCl aqueous solution (3.5 wt%). As for the characterization results, an apparent amorphous phase of aluminum oxide with small cerium compounds embedded in the matrix was detected by the X-ray diffraction patterns and HRTEM on the deposited films at 200 W and 4 Pa. At these conditions, AFM and SEM images evidenced crack-free coatings with low-roughness nanometric structures and columnar growth. EIS and Tafel results converged to indicate an inhibition of the corrosion reactions. The film displayed good stability in the aggressive medium and after 1 day of exposure underwent very little degradation. The variations in the impedance and Tafel characteristics were found to occur as a function of cerium content, which provokes important changes in the film protective properties.

  6. Soft substrates suppress droplet splashing

    CERN Document Server

    Howland, Christopher J; Style, Robert W; Castrejón-Pita, A A


    Droplets splash when they impact dry, flat substrates above a critical velocity that depends on parameters such as droplet size, viscosity and air pressure. We show that substrate stiffness also impacts the splashing threshold by imaging ethanol drops impacting silicone gels of different stiffnesses. Splashing is significantly suppressed: droplets on the softest substrates need over 70% more kinetic energy to splash than they do on rigid substrates. We show that splash suppression is likely to be due to energy losses caused by deformations of soft substrates during the first few microseconds of impact. We find that solids with Youngs modulus $\\lesssim O(10^5)$Pa suppress splashing, in agreement with simple scaling arguments. Thus materials like soft gels and elastomers can be used as simple coatings for effective splash prevention.

  7. NCBI nr-aa BLAST: CBRC-MEUG-01-0749 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-0749 pdb|2QW9|A Chain A, Crystal Structure Of Bovine Hsc70 (1-394aa)in... The Apo State pdb|2QW9|B Chain B, Crystal Structure Of Bovine Hsc70 (1-394aa)in The Apo State pdb|2QWL|A Chain A, Crystal Structure... Of Bovine Hsc70 (1-394aa)in The Adp State pdb|2QWL|B Chain B, Crystal Structure Of ...Bovine Hsc70 (1-394aa)in The Adp State pdb|2QWM|A Chain A, Crystal Structure Of B...ovine Hsc70 (1-394aa)in The AdpVi State pdb|2QWM|B Chain B, Crystal Structure Of Bovine Hsc70 (1-394aa)in The AdpVi State 2QW9 1e-116 83% ...

  8. NCBI nr-aa BLAST: CBRC-MEUG-01-0807 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-0807 pdb|2QW9|A Chain A, Crystal Structure Of Bovine Hsc70 (1-394aa)in... The Apo State pdb|2QW9|B Chain B, Crystal Structure Of Bovine Hsc70 (1-394aa)in The Apo State pdb|2QWL|A Chain A, Crystal Structure... Of Bovine Hsc70 (1-394aa)in The Adp State pdb|2QWL|B Chain B, Crystal Structure Of ...Bovine Hsc70 (1-394aa)in The Adp State pdb|2QWM|A Chain A, Crystal Structure Of B...ovine Hsc70 (1-394aa)in The AdpVi State pdb|2QWM|B Chain B, Crystal Structure Of Bovine Hsc70 (1-394aa)in The AdpVi State 2QW9 1e-139 85% ...

  9. NCBI nr-aa BLAST: CBRC-TSYR-01-0154 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TSYR-01-0154 pdb|2QW9|A Chain A, Crystal Structure Of Bovine Hsc70 (1-394aa)in... The Apo State pdb|2QW9|B Chain B, Crystal Structure Of Bovine Hsc70 (1-394aa)in The Apo State pdb|2QWL|A Chain A, Crystal Structure... Of Bovine Hsc70 (1-394aa)in The Adp State pdb|2QWL|B Chain B, Crystal Structure Of ...Bovine Hsc70 (1-394aa)in The Adp State pdb|2QWM|A Chain A, Crystal Structure Of B...ovine Hsc70 (1-394aa)in The AdpVi State pdb|2QWM|B Chain B, Crystal Structure Of Bovine Hsc70 (1-394aa)in The AdpVi State 2QW9 0.0 94% ...

  10. NCBI nr-aa BLAST: CBRC-GGOR-01-0919 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGOR-01-0919 pdb|2QW9|A Chain A, Crystal Structure Of Bovine Hsc70 (1-394aa)in... The Apo State pdb|2QW9|B Chain B, Crystal Structure Of Bovine Hsc70 (1-394aa)in The Apo State pdb|2QWL|A Chain A, Crystal Structure... Of Bovine Hsc70 (1-394aa)in The Adp State pdb|2QWL|B Chain B, Crystal Structure Of ...Bovine Hsc70 (1-394aa)in The Adp State pdb|2QWM|A Chain A, Crystal Structure Of B...ovine Hsc70 (1-394aa)in The AdpVi State pdb|2QWM|B Chain B, Crystal Structure Of Bovine Hsc70 (1-394aa)in The AdpVi State 2QW9 1e-155 89% ...

  11. Bacillus thuringiensis Cry1Aa toxin-binding region of Bombyx mori aminopeptidase N. (United States)

    Yaoi, K; Nakanishi, K; Kadotani, T; Imamura, M; Koizumi, N; Iwahana, H; Sato, R


    The Bacillus thuringiensis Cry1Aa toxin-binding region of Bombyx mori aminopeptidase N (APN) was analyzed, to better understand the molecular mechanism of susceptibility to the toxin and the development of resistance in insects. APN was digested with lysylendopeptidase and the ability of the resulting fragments to bind to Cry1Aa and 1Ac toxins was examined. The binding abilities of the two toxins to these fragments were different. The Cry1Aa toxin bound to the fragment containing 40-Asp to 313-Lys, suggesting that the Cry1Aa toxin-binding site is located in the region between 40-Asp and 313-Lys, while Cry1Ac toxin bound exclusively to mature APN. Next, recombinant APN of various lengths was expressed in Escherichia coli cells and its ability to bind to Cry1Aa toxin was examined. The results localized the Cry1Aa toxin binding to the region between 135-Ile and 198-Pro. PMID:10606725

  12. Introducing the AAS Working Group on Astroinformatics and Astrostatistics (United States)

    Ivezic, Zeljko


    In response to two White Papers submitted to the Astro2010 Decadal Survey (1,2), a new AAS Working Group on Astroinformatics and Astrostatistics (WGAA) has been approved by the AAS Council at the 220th Meeting, June 2012, in Anchorage. The motivation for this WG is the growing importance of the interface between astronomy and various branches of applied mathematics, computer science and the emerging field of data science. With the new data-intensive projects envisioned for the coming decade, the need for advice derived from the focused attention of a group of AAS members who work in these areas is bound to increase. The Working Group is charged with spreading awareness of rapidly advancing computational techniques, sophsticated statistical methods, and highly capble software to further the goals of astronomical and astrophysical research. The three main strategic goals adopted by the WGAA Steering Committee for the next few years are to: (i) develop, organize and maintain methodological resources (such as software tools, papers, books, and lectures); (ii) enhance human resources (such as foster the creation of career paths, establish a Speakers' Bureau, establish and maintain an archived discussion forum, enable periodic news distribution); and (iii) organize topical meetings. The WGAA Steering Committee at this time includes twelve members: Kirk Borne, George Djorgovski, Eric Feigelson, Eric Ford, Alyssa Goodman, Joe Hilbe, Zeljko Ivezic (chair), Ashish Mahabal, Aneta Siemiginowska, Alex Szalay, Rick White, and Padma Yanamandra-Fisher. I will summarize our accomplishments since July 2012. (1) Astroinformatics: A 21st Century Approach to Astronomy (Borne & 90 coauthors), (2) The Astronomical Information Sciences: A Keystone for 21st-Century Astronomy (Loredo & 72 coauthors)

  13. Substrate-Sensitive Graphene Oxidation. (United States)

    Zhang, Zhuhua; Yin, Jun; Liu, Xiaofei; Li, Jidong; Zhang, Jiahuan; Guo, Wanlin


    The inertness of graphene toward reaction with ambient molecules is essential for realizing durable devices with stable performance. Many device applications require graphene to contact with substrates, but whose impact on the chemical property of graphene has been largely overlooked. Here, we combine comprehensive first-principles analyses with experiments to show that graphene oxidation is highly sensitive to substrates. Graphene remains inert on SiO2 and hexagonal boron nitride but becomes increasingly weak against oxidation on metal substrates because of enhanced charge transfer and chemical interaction between them. In particular, Ni and Co substrates lead to spontaneous oxidation of graphene, while a Cu substrate maximally promotes the oxygen diffusion on graphene, with an estimated diffusivity 13 orders of magnitude higher than that on freestanding graphene. Bilayer graphene is revealed to have high oxidation resistance independent of substrate and thus is a better choice for high-performance nanoelectronics. Our findings should be extendable to a wide spectrum of chemical functionalizations of two-dimensional materials mediated by substrates. PMID:26884318

  14. Galvanic compatibility of corrosion protective coatings with AA7075 aluminum alloy

    Energy Technology Data Exchange (ETDEWEB)

    Lodhi, Z.F.; Hamer, W.J. [Netherlands Institute for Metals Research (NIMR), Mekelweg 2, 2628 CD Delft (Netherlands); Mol, J.M.C.; Wit, J.H.W. de [Delft University of Technology, Department of Materials Science and Engineering, Mekelweg 2, 2628 CD Delft (Netherlands); Terryn, H. [Netherlands Institute for Metals Research (NIMR), Mekelweg 2, 2628 CD Delft (Netherlands); Department of Metallurgy, Electrochemistry and Materials Science, Vrije Universiteit Brussel, Pleinlaan 2, B-1050 Brussels (Belgium)


    The galvanic compatibility of aerospace aluminum alloy AA7075 with cadmium (Cd), zinc (Zn), and zinc-cobalt-iron (Zn-Co-Fe, 32-37%Co and 1%Fe) alloys was investigated. A comparison of open circuit potential [OCP vs. saturated calomel electrode (SCE)] measurements in 0.6 mM NaCl showed that all coatings would act anodically to AA7075 with an exception of Zn-Co-Fe (37%Co + 1%Fe) alloy which was electropositive to AA7075. During the zero resistance ammetry (ZRA) measurement in 0.6 M NaCl electrolyte the coupled OCP and current density were measured during 7 days of immersion and both Zn and Cd acted anodic and thus sacrificial to AA7075. Galvanic coupling of AA7075 with (37%Co + 1%Fe) Zn-Co-Fe alloy resulted in the consequent dissolution of the AA7075 aluminum alloy. In contrast, Zn-Co-Fe (32%Co + 1%Fe) alloy was found to be anodic to AA7075 during the first 26 h of immersion but after dezincification and cobalt enrichment at the surface became cathodic to the AA7075 aluminum alloy. During coupling with Zn, some pitting was also observed on AA7075. (Abstract Copyright [2008], Wiley Periodicals, Inc.)

  15. Ruthenium determination in synthetic Purex waste solutions by AAS

    International Nuclear Information System (INIS)

    A method for the determination of ruthenium in synthetic Purex waste solutions by flame AAS is described. With the usual flames and a lanthanum buffer, only cerium interference in the air-acetylene flame need be considered under the conditions applied. Ruthenium nitrosyl nitrate, ruthenium(IV) hydroxychloride and alkaline ruthenate samples gave identical results, showing that the extraordinarily stable Ru-NO bond does not hinder atomization. The preparation and standardization of the ruthenium nitrosyl solutions, and the alkaline fusion, are briefly described. (author)

  16. Measurement of deformation gradients in hot rolling of AA3004


    C. Boldetti; Pinna, C.; Howard, I. C.; Gutierrez, G.


    In this paper we describe an experimental technique developed to measure the deformation gradients and temperature in a single hot rolling pass of an AA3004 sample that was fitted with an insert. The insert had been previously hand engraved with a 1 × 1 mm grid pitch, and the analysis of the data digitally captured from the image of the deformed grid enabled the calculation of the components of the deformation gradient tensor. Four steel pins prevented relative motion between the insert and ...

  17. Slot-type kicker for the AA stochastic cooling

    CERN Multimedia

    Photographic Service


    A "slotted transmission line" structure was used for both pickups and the kicker of one of the stochastic cooling systems of the Antiproton Accumulator (AA). They served for the cooling of the high-density stack, in momentum and in both transverse planes. In the beginning in a single band, 1-2 GHz, later in 3 bands, 1-2, 2-4 and 4-8 GHz. The kicker of the first generation, shown here, was located where the dispersion was zero and the beam size small, and thus had a quadratic cross-section. The pickups were rectangular and wider in the horizontal plane. See also 7906193

  18. Professional Ethics in Astronomy: The AAS Ethics Statement (United States)

    Marvel, Kevin B.


    It is fundamental to the advancement of science that practicing scientists adhere to a consistent set of professional ethical principles. Recent violations of these principles have led a decreased trust in the process of science and scientific results. Although astronomy is less in the spotlight on these issues than medical science or climate change research, it is still incumbent on the field to follow sound scientific process guided by basic ethical guidelines. The American Astronomical Society, developed a set of such guidelines in 2010. This contribution summarizes the motivation and process by which the AAS Ethics Statement was produced.

  19. The effect of atmospheric corona treatment on AA1050 aluminium

    DEFF Research Database (Denmark)

    Jariyaboon, Manthana; Møller, Per; Dunin-Borkowski, Rafal E.;


    The effect of atmospheric corona discharge on AM 050 aluminium surface was investigated using electrochemical polarization, SEM-EDX, FIB-SEM. and XPS. The corona treatment was performed with varying time (1, 5, and 15 min) in atmospheric air. A 200 nm oxide layer was generated on AA1050 after the...... 15 min air corona treatment. A significant reduction in anodic and cathodic reactivities was observed starting from 1 min exposure, which further decreased with prolonged exposure (15 min) and after delayed testing (after 30 days). The reduction in surface reactivity is due to the formation of...

  20. Plastic deformation in relation to microstructure and texture evolution in AA 2017-T451 and AA 2624-T351 aluminum alloys under dynamic impact loading

    International Nuclear Information System (INIS)

    Mechanical and microstructural responses of AA 2017-T451 and AA 2624-T351 aluminum alloys to dynamic impact loading were investigated using the split Hopkinson pressure bar (SHPB) and electron backscattered diffraction (EBSD) analysis. Although both alloys were subjected to the same impact loads, the strain rate developed in the AA 2017 alloy was higher and the peak stress in the dynamic stress–strain curve is observed to be higher for the AA 2624 alloy. The higher deformation resistance observed in the AA 2624 alloy under dynamic impact loading is a consequence of its higher capacity for strain hardening that effectively overcomes the effects of thermal softening and dynamic recovery during impact loading. Strain hardening is quickly dominated by thermal softening in AA 2017-T451 alloy leading to a lower resistance to deformation and a higher tendency to form transformed adiabatic shear bands consisting of dynamic recrystallized (DRX) grains as observed in the EBSD measurements. Although shear bands were also observed in the AA 2624 alloy, EBSD analyses suggest that the shear band region consist of deformed grains with high intensity of localized strains and dislocation accumulation. Whereas both alloys exhibited nearly the same high angle grain boundary fractions before dynamic impact loading, a higher in-grain (kernel) misorientation were observed in the AA 2624 alloy after impact. Larger fraction of high angle grain boundaries (HAGBs) was observed in the impacted AA 2017 alloy. The results of the EBSD measurements on both the as-received alloys and the impacted specimens such as grain boundary fractions, area fractions of selected fibers as well as Schmid factor and the corresponding Schmid factor distribution are discussed. The study provides a consolidated understanding of the microstructure developments during deformation and its relation to the mechanical response of the alloys to dynamic impact loading

  1. Influence of graphite on the hardness and wear behavior of AA6061-B4C composite: Vpliv grafita na trdoto in vedenje kompozita AA6061-B4C pri obrabi:


    Chandramohan, Govindarajulu; Prabagaran, Subramaniam; Shanmughasundaram, Palanisamy


    Dry-sliding-wear behavior of AA6061, AA6061-B4C composite and AA6061-B4C-Gr hybrid composite was investigated by employing a pin-on-disc wear-test rig. Hardness tests were also carried out. Graphite was used as a solid lubricant since it is a soft, slippery and greyish-black substance. Because of the cleavage (crystal) loose interlamellar coupling, graphite has good lubricating properties. A comparative analysis was made on the hardness and wear behavior of AA6061, AA6061-B4C composite and AA...

  2. Substrate noise coupling in RFICs

    CERN Document Server

    Helmy, Ahmed


    Substrate Noise Coupling in RFICs addresses substrate noise coupling in RF and mixed signal ICs when used in a system on chip (SoC) containing digital ICs as well. This trend of integrating RF, mixed signal ICs with large digital ICs is found in many of today's commercial ICs such as single chip Wi-Fi or Bluetooth solutions and is expected to grow rapidly in the future. The book reports modeling and simulation techniques for substrate noise coupling effects in RFICs and introduces isolation structures and design guides to mitigate such effects with the ultimate goal of enhancing the yield of R

  3. Substrate integrated antennas and arrays

    CERN Document Server

    Cheng, Yu Jian


    Substrate Integrated Antennas and Arrays provides a single source for cutting-edge information on substrate integrated circuits (SICs), substrate integrated waveguide (SIW) feeding networks, SIW slot array antennas, SIC traveling-wave antennas, SIW feeding antennas, SIW monopulse antennas, and SIW multibeam antennas. Inspired by the author's extensive research, this comprehensive book:Describes a revolutionary SIC-based antenna technique with the potential to replace existing antenna technologiesExamines theoretical and experimental results connected to electrical and mechanical performanceExp

  4. Droplet dynamics on patterned substrates

    Indian Academy of Sciences (India)

    A Dupuis; J M Yeomans


    We present a lattice Boltzmann algorithm which can be used to explore the spreading of droplets on chemically and topologically patterned substrates. As an example we use the method to show that the final configuration of a drop on a substrate comprising hydrophobic and hydrophilic stripes can depend sensitively on the dynamical pathway by which the state is reached. We also consider a substrate covered with micron-scale posts and investigate how this can lead to superhydrophobic behaviour. Finally we model how a Namibian desert beetle collects water from the wind.

  5. Direct cooled power electronics substrate (United States)

    Wiles, Randy H [Powell, TN; Wereszczak, Andrew A [Oak Ridge, TN; Ayers, Curtis W [Kingston, TN; Lowe, Kirk T [Knoxville, TN


    The disclosure describes directly cooling a three-dimensional, direct metallization (DM) layer in a power electronics device. To enable sufficient cooling, coolant flow channels are formed within the ceramic substrate. The direct metallization layer (typically copper) may be bonded to the ceramic substrate, and semiconductor chips (such as IGBT and diodes) may be soldered or sintered onto the direct metallization layer to form a power electronics module. Multiple modules may be attached to cooling headers that provide in-flow and out-flow of coolant through the channels in the ceramic substrate. The modules and cooling header assembly are preferably sized to fit inside the core of a toroidal shaped capacitor.

  6. A substrate dependent biological containment systems for Pseudomonas putida based on the Escherichia coli gef gene

    DEFF Research Database (Denmark)

    Jensen, Lars Bogø; Ramos, J. L.; Kaneva, Z.;


    operon (Pm) and the lacI gene, encoding the Lac repressor, plus xylS2, coding for a positive regulator of Pm. In liquid culture under optimal growth conditions and in sterile and nonsterile soil microcosms, P. putida KT2440 (pWWO) bearing the containment system behaves as designed. In the presence of a......A model substrate-dependent suicide system to biologically contain Pseudomonas putida KT2440 is reported. The system consists of two elements. One element carries a fusion between a synthetic lac promoter (PA1-04/03) and the gef gene, which encodes a killing function. This element is contained...

  7. The Effect of Composite Patches on the Failure of Adhesively-Bonded Joints Under Bending Moment (United States)

    Akpinar, Salih


    In this study, it was aimed to compare mechanical behavior of double-strap joints with aluminum (AA2024-T3) or 16-ply laminate of carbon/epoxy composite (T300/934) patches of different orientation angles at their overlap area subjected to bending moment. For this purpose, AA2024-T3 aluminum was used as adherend, while the adhesive was a two-part paste (DP 460). Six different types of joint samples were subjected to bending moment. The effect of patch material on failure load and stress distribution was examined experimentally and numerically. In the numerical analysis, the composite patches were assumed to behave linearly elastic, while adherend and adhesive layers were assumed to be nonlinear. It was found that the data obtained from 3-D finite element analysis were coherent with experimental results. Meanwhile, experiments showed that fiber orientation angles of the patches markedly affected the failure load of joints, failure mode and stress distributions appeared in adhesive and composite.

  8. Scratch Cell Test: A Simple, Cost Effective Screening Tool to Evaluate Self-Healing in Anti-Corrosion Coatings (United States)

    Rani, Amitha; Somaiah, Durga; Megha; Poddar, Mitalee


    A quick and simple scratch cell set up to evaluate the self-healing of an hybrid sol-gel (ormosil) coating was fabricated. This methacrylate-based anti-corrosion coating was applied on the aerospace aluminium alloy AA2024-T3, and cured at room temperature. This technique of evaluation requires minimum instrumentation. The inhibitors cerium nitrate, benzotriazole and 8-hydroxy quinoline (8-HQ) were used in the study. The self-healing ability of the inhibitors decreased in the following order: 8-HQ, BTZ and Ce. 8-HQ showed the highest self-healing ability and was comparable to the commercial hexavalent chromium conversion coating—Alodine. Spectroscopic analysis of the electrolyte and EDX of the coatings indicated the movement of the inhibitor from the coating to the site of damage, thereby effecting self-healing. It was observed that an increased inhibitor concentration in the coatings did not accelerate the healing process. Inhibitor release was slower in the coatings doped with inhibitor-loaded nano-containers, when compared to inhibitor-spiked coatings. This property of controlled release is desirable in self-healing coatings. Electro impedance studies further confirmed self-healing efficiency of the coatings. The scratch cell study reported here is the first of its kind with the ormosil under study on AA2024-T3 aluminium alloy. The results are encouraging and warranty a quick and simple qualitative screening of the self-healing potential of the inhibitors with minimum instrumentation.

  9. Film Growth on Nanoporous Substrate (United States)

    Zhang, Xue; Joy, James; Zhao, Chenwei; Xu, J. M.; Valles, James

    Self-ordered nanoporous anodic aluminum oxide (AAO) provides an easy way to fabricate nano structured material, such as nano wires and nano particles. We employ AAO as substrates and focus on the thermally evaporated film growth on the surface of the substrate. With various materials deposited onto the substrate, we find the films show different structures, e,g. ordered array of nano particles for Lead and nanohoneycomb structure for Silver. We relate the differing behaviors to the difference of surface energy and diffusion constant. To verify this, the effect of substrate temperature on the film growth has been explored and the structure of the film has been successfully changed through the process. We are grateful for the support of NSF Grants No. DMR-1307290.

  10. Probing protein phosphatase substrate binding

    DEFF Research Database (Denmark)

    Højlys-Larsen, Kim B.; Sørensen, Kasper Kildegaard; Jensen, Knud Jørgen; Gammeltoft, Steen


    Proteomics and high throughput analysis for systems biology can benefit significantly from solid-phase chemical tools for affinity pull-down of proteins from complex mixtures. Here we report the application of solid-phase synthesis of phosphopeptides for pull-down and analysis of the affinity...... profile of the integrin-linked kinase associated phosphatase (ILKAP), a member of the protein phosphatase 2C (PP2C) family. Phosphatases can potentially dephosphorylate these phosphopeptide substrates but, interestingly, performing the binding studies at 4 °C allowed efficient binding to phosphopeptides......, without the need for phosphopeptide mimics or phosphatase inhibitors. As no proven ILKAP substrates were available, we selected phosphopeptide substrates among known PP2Cδ substrates including the protein kinases: p38, ATM, Chk1, Chk2 and RSK2 and synthesized directly on PEGA solid supports through a BAL...

  11. Active Matter on Asymmetric Substrates


    Reichhardt, C. J. Olson; Drocco, J.; Mai, T.; Wan, M. B.; Reichhardt, C.


    For collections of particles in a thermal bath interacting with an asymmetric substrate, it is possible for a ratchet effect to occur where the particles undergo a net dc motion in response to an ac forcing. Ratchet effects have been demonstrated in a variety of systems including colloids as well as magnetic vortices in type-II superconductors. Here we examine the case of active matter or self-driven particles interacting with asymmetric substrates. Active matter systems include self-motile c...

  12. AAS Publishing News: Preparing Your Manuscript Just Got Easier (United States)

    Kohler, Susanna


    Watermarking using the command watermark{DRAFT, v2}.Are you an astronomer considering submitting a paper to an AAS journal (i.e., AJ, ApJ, ApJ Letters, or ApJ Supplements)? If so, this post is for you! Read on to find out about the exciting new things you can do with the AASs newest LaTeX class file, available for download now.Why the Update?AAS publishing has maintained a consistent class file for LaTeX manuscript preparation for the past decade. But academic publishing is changing rapidly in todays era of electronic journals! Since its journals went fully electronic, the AAS has been continuously adding new publishing capabilities based on the recommendations of the Journals Task Force and the needs and requests of AAS authors. The AASs manuscript preparation tools are now being updated accordingly.Whats New in AASTex 6.0?There are many exciting new features and capabilities in AASTex 6.0. Here are just a few:Tracking options for author revisions include added{text}, deleted{text}, replaced{old}{new}, and explain{text}.Based on emulateapjDo you use the popular class file emulateapj to prepare your manuscripts? AASTex 6.0 is based on emulateapj, rather than on the older AASTex 5.2 (though 5.2 is still supported). This means that it is easy to produce a double-columned, single-spaced, and astro-ph-ready manuscript. Since two thirds of the AAS journals authors use emulateapj, this transition was designed to make manuscript preparation and sharing an easier and more seamless process.Tools for collaborationsDo you work in a large collaboration? AASTex now includes new tools to make preparing a manuscript within a collaboration easier. Drafts can now be watermarked to differentiate between versions. New markup for large author lists streamlines the display so that readers can access article information immediately, yet they can still access the full author list and affiliations at the end of the paper. And author revision markup allows members of a collaboration to

  13. Solving the $R_{AA}\\otimes v_2$ puzzle

    CERN Document Server

    Noronha-Hostler, Jacquelyn


    For the past ten years $R_{AA}(p_T)$, the nuclear modification factor that encodes the suppression of high $p_T$ particles due to energy loss within the medium was fairly well described by many theoretical models. However, the same models systematically under-predicted the high $p_T$ elliptic flow, $v_2$, which is experimentally measured as the correlation between soft and hard hadrons. All previous calculations neglected the effect of event-by-event fluctuations of an expanding viscous hydrodynamical background as well as the soft-hard flow harmonic correlations in the experimentally measured $v_2$. In this talk I show how event-by-event viscous hydrodynamics (computed using the v-USPhydro code) coupled to an energy loss model (BBMG) is able to simultaneously describe soft physics observables as well as the high-$p_T$ $R_{AA}$ and $v_2$. Suggestions for future more differential calculations at the LHC run2 are made to explore soft-hard flow correlations.

  14. Astronomy Career Profiles from the AAS Newsletter Archives

    CERN Document Server

    Metcalfe, Travis; McDaid, Liam; Bullock, Blake; Pulliam, Christine; Williams, Peter; Roth, Joshua; Whitney, Barb; Olsen, Knut; Howell, Andy; Keller, Luke


    This is a collection of articles that were originally published in the Newsletter of the American Astronomical Society (AAS) between May 2008 and September 2011 by the Committee on Employment. Authors representing a wide range of career paths tell their stories and provide insight and advice that is relevant to success in various job sectors. Although all of these articles are available individually from the AAS archives, we are posting the complete collection here to make them more accessible as a resource for the astronomy community. The collection includes the following articles: (1) Changing Priorities: the Hard Money Wild Card, (2) Beyond Ivory Towers, (3) Astronomers Working in Public Outreach, (4) Bush-Whacking a Career Trail, (5) Science Communication as a Press Officer, (6) Jobs in Industry, (7) Back to School: A Ph.D. Enters the Classroom, (8) Working at a Soft-Money Institute, (9) Balancing Research and Service at NOAO, (10) Succeeding in a Large Research Collaboration, and (11) Preparing for the C...

  15. Heavy flavours in AA collisions: production, transport and final spectra

    CERN Document Server

    Alberico, WW M; De Pace, A; Molinari, A; Monteno, M; Nardi, M; Prino, F; Sitta, M


    A multi-step setup for heavy-flavour studies in high-energy nucleus-nucleus (AA) collisions --- addressing within a comprehensive framework the initial Q-Qbar production, the propagation in the hot medium until decoupling and the final hadronization and decays --- is presented. The initial hard production of Q-Qbar pairs is simulated using the POWHEG pQCD event generator, interfaced with the PYTHIA parton shower. Outcomes of the calculations are compared to experimental data in pp collisions and are used as a validated benchmark for the study of medium effects. In the AA case, the propagation of the heavy quarks in the medium is described in a framework provided by the relativistic Langevin equation. For the latter, different choices of transport coefficients are explored (either provided by a perturbative calculation or extracted from lattice-QCD simulations) and the corresponding numerical results are compared to experimental data from RHIC and the LHC. In particular, outcomes for the nuclear modification f...

  16. AAS, growth hormone, and insulin abuse: psychological and neuroendocrine effects

    Directory of Open Access Journals (Sweden)

    Michael R Graham


    Full Text Available Michael R Graham1, Peter Evans2, Bruce Davies1, Julien S Baker11Health and Exercise Science Research Unit, Faculty of Health Sport and Science, University of Glamorgan, Pontypridd, Wales, United Kingdom; 2Royal Gwent Hospital, Newport, Gwent, United KingdomAbstract: The nontherapeutic use of prescription medicines by individuals involved in sport is increasing. Anabolic-androgenic steroids (AAS are the most widely abused drug. Much of our knowledge of the psychological and physiological effects of human growth hormone (hGH and insulin has been learned from deficiency states. As a consequence of the Internet revolution, previously unobtainable and expensive designer drugs, particularly recombinant human growth hormone (rhGH and insulin, have become freely available at ridiculously discounted prices from countries such as China and are being abused. These drugs have various physiological and psychological effects and medical personnel must become aware that such prescription medicine abuse appears to be used not only for performance and cosmetic reasons, but as a consequence of psychological pre-morbidity.Keywords: AAS, cosmesis, growth hormone, insulin, performance, strength

  17. Immobilization of glucose isomerase onto radiation synthesized P(AA-co-AMPS hydrogel and its application

    Directory of Open Access Journals (Sweden)

    H. Kamal


    Full Text Available Isomerization of glucose to fructose was carried out using Glucose isomerase (GI that immobilized by entrapment into Poly(acrylic acid P(AA and Poly(acrylic acid-co-2-Acrylamido 2-methyl Propane sulfonic acid P(AA-co-AMPS polymer networks, the enzyme carriers were prepared by radiation induced copolymerization in the presence of (Methylene-bisacrylamide (MBAA as a crosslinking agent. The maximum gel fraction of pure P(AA and P(AA-co-AMPS hydrogel was found to be 95.2% and 89.6% for P(AA and P(AA-co-AMPS, respectively at a total dose of 20 kGy. Effects of immobilization conditions such as radiation dose, MBAA concentration, comonomer composition and amount of GI were investigated. The influence of reaction conditions on the activity of immobilized GI were studied, the optimum pH value of the reaction solution is 7.5 and reaction temperature is 65 °C. The immobilized GI into P(AA-co-AMPS and P(AA polymer networks retained 81% and 69%, respectively of its initial activity after recycled for 15 times while it retained 87% and 71%, respectively of its initial activity after stored at 4 °C for 48 days. The Km values of free and immobilized GI onto P(AA-co-AMPS and onto P(AA matrices were found to be 34, 29.2 and 14.5 mg/mL, respectively while the Vmax Values calculated to be 3.87, 1.6 and 0.79 mg/mL min, respectively. GI entrapped into P(AA-co-AMPS hydrogel show promising behavior that may be useful as the newly glucose isomerase reactor in biomedical applications.

  18. Application of a europium complex, Eu(AA){sub 3}phen (AA = acrylic acid, phen = 1,10-phenanthroline) as a spectroscopic probe and cleaving reagent of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ling; Pan, Quan; Song, Gong Wu, E-mail:


    A complex Eu(AA){sub 3}phen was synthesized and characterized by elemental analysis, IR spectroscopy and {sup 1}H NMR. Interaction between Eu(AA){sub 3}phen and DNA was studied by UV/visible absorption spectroscopy, fluorescence spectrophotometer, circular-dichroism (CD) spectra and gel-electrophoresis measurements. Absorption spectral indicated that Eu(AA){sub 3}phen binding to DNA was an electrostatic mode, which was authenticated by the effect of ionic strength, thermal denaturation and fluorescence quenching experiments. The intrinsic binding constant K{sub b} of Eu(AA){sub 3}phen was calculated to be 1.6 × 10{sup 4} L mol{sup −1}. - Highlights: ► A novel complex was synthesized. ► The interaction between the complex and DNA was discussed. ► The complex was hoped to sense for DNA.

  19. The Jasmonate-Responsive AP2/ERF Transcription Factors AaERF1 and AaERF2 Positively Regulate Artemisinin Biosynthesis in Artemisia annua L.

    Institute of Scientific and Technical Information of China (English)

    Zong-Xia YU; Jian-Xu Li; Chang-Qing Yang; Wen-Li Hu; Ling-Jian Wang; Xiao-Ya Chen


    Plants of Artemisia annua produce artemisinin,a sesquiterpene lactone widely used in malaria treatment.Amorpha-4,11-diene synthase (ADS),a sesquiterpene synthase,and CYP71AV1,a P450 monooxygenase,are two key enzymes of the artemisinin biosynthesis pathway.Accumulation of artemisinin can be induced by the phytohormone jasmonate (JA).Here,we report the characterization of two JA-responsive AP2 family transcription factors-AaERF1 and AaERF2-from A.annua L.Both genes were highly expressed in inflorescences and strongly induced by JA.Yeast one-hybrid and electrophoretic mobility shift assay (EMSA) showed that they were able to bind to the CRTDREHVCBF2 (CBF2) and RAV1AAT (RAA) motifs present in both ADS and CYP71AV1 promoters.Transient expression of either AaERF1 or AaERF2 in tobacco induced the promoter activities of ADS or CYP71AV1,and the transgenic A.annua plants overexpressing either transcription factor showed elevated transcript levels of both ADS and CYP71AV1,resulting in increased accumulation of artemisinin and artemisinic acid.By contrast,the contents of these two metabolites were reduced in the RNAi transgenic lines in which expression of AaERF1 or AaERF2 was suppressed.These results demonstrate that AaERF1 and AaERF2 are two positive regulators of artemisinin biosynthesis and are of great value in genetic engineering of artemisinin production.

  20. Changes of Grain Sizes and Flow Stresses of AA2014 and AA6063 Aluminum Alloys at High Temperatures in Various Strain Rates


    ALNIAK, M. Oktay


    Changes in the grain sizes and flow stresses of AA2014 and AA6063 aluminum alloys subjected to compression tests at high temperatures in various constant compression head speeds were investigated. When assessing the test results, constant strain rates were considered instead of compression head speeds of the uniaxial compression testing system after making the necessary mathematical transformation. Specimens used in the test were prepared in cylindrical form and deformed until 0.7 tr...

  1. Depletion of spleen macrophages delays AA amyloid development: a study performed in the rapid mouse model of AA amyloidosis.

    Directory of Open Access Journals (Sweden)

    Katarzyna Lundmark

    Full Text Available AA amyloidosis is a systemic disease that develops secondary to chronic inflammatory diseases Macrophages are often found in the vicinity of amyloid deposits and considered to play a role in both formation and degradation of amyloid fibrils. In spleen reside at least three types of macrophages, red pulp macrophages (RPM, marginal zone macrophages (MZM, metallophilic marginal zone macrophages (MMZM. MMZM and MZM are located in the marginal zone and express a unique collection of scavenger receptors that are involved in the uptake of blood-born particles. The murine AA amyloid model that resembles the human form of the disease has been used to study amyloid effects on different macrophage populations. Amyloid was induced by intravenous injection of amyloid enhancing factor and subcutaneous injections of silver nitrate and macrophages were identified with specific antibodies. We show that MZMs are highly sensitive to amyloid and decrease in number progressively with increasing amyloid load. Total area of MMZMs is unaffected by amyloid but cells are activated and migrate into the white pulp. In a group of mice spleen macrophages were depleted by an intravenous injection of clodronate filled liposomes. Subsequent injections of AEF and silver nitrate showed a sustained amyloid development. RPMs that constitute the majority of macrophages in spleen, appear insensitive to amyloid and do not participate in amyloid formation.

  2. Bacterial cellulose based hydrogel (BC-g-AA) and preliminary result of swelling behavior

    International Nuclear Information System (INIS)

    In this study, hydrogel based on Bacterial cellulose (BC) or local known as Nata de Coco, which grafted with monomer: Acrylic acid (AA) is synthesis by using gamma radiation technique. These hydrogel (BC-g-AA) has unique characteristic whereby responsive to pH buffer solution

  3. Intrauterine, postpartum and adult relationships between arachidonic acid (AA) and docosahexaenoic acid (DHA)

    NARCIS (Netherlands)

    Kuipers, Remko S.; Luxwolda, Martine F.; Dijck-Brouwer, D. A. Janneke; Muskiet, Frits A. J.


    Erythrocyte (RBC) fatty acid compositions from populations with stable dietary habits but large variations in RBC-arachidonic (AA) and RBC-docosahexaenoic acid (DHA) provided us with insight into relationships between DHA and AA. It also enabled us to estimate the maternal RBC-DHA (mRBC-DHA) status

  4. 7 CFR 51.1176 - U.S. Grade AA Juice (Double A). (United States)


    ... of Common Sweet Oranges (citrus Sinensis (l) Osbeck) § 51.1176 U.S. Grade AA Juice (Double A). Any lot of oranges, the juice content of which meets the following requirements, may be designated “U.S... 7 Agriculture 2 2010-01-01 2010-01-01 false U.S. Grade AA Juice (Double A). 51.1176 Section...

  5. Reframing Spirituality: AA, the 12 Steps, and the Mental Health Counselor. (United States)

    Hanna, Fred J.


    Surveys literature and explores ways to understand spirituality in Alcoholics Anonymous (AA). Topics explored range from Jungian and Jamesian psychology, to Stoicism, the work of Bateson, and transpersonal psychology and therapy. Speculates that difficulty some mental health counselors have in accepting AA as therapy could be a result of…

  6. Raadioteatril elu sees. Elu sees? / Mart Aas, Tõnis Leemets ; interv. Kutt Kommel

    Index Scriptorium Estoniae

    Aas, Mart


    Eesti Raadio raadioteatri 78. sünnipäeval esietendus Vikerraadios dokumentaalkuuldemäng "Elu sees" Aleksander Alleni (hilisema nimega Aleksander Aas) mälestuste põhjal. Theatrumi lavastuse on raadiole seadnud Mart Aas, Marius Peterson, Toomas Lõhmuste ja Tõnis Leemets

  7. NCBI nr-aa BLAST: CBRC-MMUR-01-0065 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUR-01-0065 ref|ZP_03493196.1| hypothetical protein AaLAA1DRAFT_0782 [Alicycl...obacillus acidocaldarius LAA1] gb|EED08211.1| hypothetical protein AaLAA1DRAFT_0782 [Alicyclobacillus acidocaldarius LAA1] ZP_03493196.1 2.4 30% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01789776.1| multidrug resistance protein [Haemophilus influenza...e PittAA] gb|EDK08502.1| multidrug resistance protein [Haemophilus influenzae PittAA] ZP_01789776.1 0.22 27% ...

  9. NCBI nr-aa BLAST: CBRC-STRI-01-2565 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto...r type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid receptor type 1 protein [Mus musculus] g

  10. NCBI nr-aa BLAST: CBRC-OPRI-01-0982 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto...r type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid receptor type 1 protein [Mus musculus] g

  11. NCBI nr-aa BLAST: CBRC-VPAC-01-1554 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto...r type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid receptor type 1 protein [Mus musculus] g

  12. NCBI nr-aa BLAST: CBRC-GGOR-01-1297 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto...r type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid receptor type 1 protein [Mus musculus] g

  13. NCBI nr-aa BLAST: CBRC-TTRU-01-0117 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto...r type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid receptor type 1 protein [Mus musculus] g

  14. NCBI nr-aa BLAST: CBRC-TSYR-01-1316 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto...r type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid receptor type 1 protein [Mus musculus] g

  15. NCBI nr-aa BLAST: CBRC-MDOM-02-0334 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto...r type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid receptor type 1 protein [Mus musculus] g

  16. NCBI nr-aa BLAST: CBRC-PVAM-01-1403 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto...r type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid receptor type 1 protein [Mus musculus] g

  17. NCBI nr-aa BLAST: CBRC-MLUC-01-1112 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto...r type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid receptor type 1 protein [Mus musculus] g

  18. NCBI nr-aa BLAST: CBRC-PHAM-01-1594 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto...r type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid receptor type 1 protein [Mus musculus] g

  19. NCBI nr-aa BLAST: CBRC-MMUR-01-1494 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto...r type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid receptor type 1 protein [Mus musculus] g

  20. NCBI nr-aa BLAST: CBRC-PCAP-01-1368 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available usculus] emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal cannabinoid recepto...r type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid receptor type 1 protein [Mus musculus] g

  1. Bacterial cellulose based hydrogel (BC-g-AA) and preliminary result of swelling behavior

    Energy Technology Data Exchange (ETDEWEB)

    Hakam, Adil; Lazim, Azwan Mat [UKM-MIMOS Laboratory, School of Chemical Sciences and Food Technology, National University of Malaysia (UKM) (Malaysia); Abdul Rahman, I. Irman [Laboratory of Gamma Radiation Instrument, Science Nuclear Program, School of Applied Physics, National University of Malaysia (UKM) (Malaysia)


    In this study, hydrogel based on Bacterial cellulose (BC) or local known as Nata de Coco, which grafted with monomer: Acrylic acid (AA) is synthesis by using gamma radiation technique. These hydrogel (BC-g-AA) has unique characteristic whereby responsive to pH buffer solution.

  2. Study on the interaction between a new radioresistance-related protein AA12 and CHK1

    International Nuclear Information System (INIS)

    Objective: To study the interaction between AA12 and CHK1 proteins. Methods: Polyclonal antibody was made using expressed and purified AA12 (LG21) protein in E. coli. The specificity of antibody was identified by Western blot and the immunoprecipitations in Al-5 and B4 cells were done by AA12 antibody and CHK1 antibody. Meanwhile, AA12 and Chk1 genes were subcloned into the vectors of two-hybrid system, and the recombinant plasmids were transformed into yeast cell AH109. The expression of reporter genes were tested. Results: Western blot result showed that this antibody could bind with AA12 protein specifically; then in order to identify the interaction between two proteins in mammalian cells, the interaction between AA12 and CHK1 was identified in vivo by immunoprecipitation. On the other hand, the interaction between two proteins was identified in yeast by using two-hybrid system. The results of both α- and β-galactosidase assays were positive. Conclusion: The results showed that AA12 and CHK1 proteins could interact with each other, this would be important for studying a new function of AA12 gene


    Institute of Scientific and Technical Information of China (English)

    Hong-yan Song; Wen-tao Liu; Su-qin He; Ming-cheng Yang; Ya Gao; Cheng-shen Zhu; Liu-suo Wu


    The pH-sensitive P(AA-co-NVP)Iclay hydrogels were prepared with the monomers of acrylic acid (AA) andN-vinyl-2-pyrrolidone (NVP) based on γ-ray irradiation technique. The influence of pH values of buffer solutions andcontents of clay and NVP on the equilibrium swelling ratio (SR) and compressive properties of the hydrogels wasinvestigated in detail. The results of swelling property tests showed that, with the increase of clay content, the SR ofhydrogels increases in the same buffer solution, and the SR of hydrogels with different contents of HTMAB-clay is higherthan that of P(A.A-co-NVP) hydrogels without clay. When the content of clay is 15%, the SR of P(AA-co-NVP)/clayhydrogel is 201 at pH=9.8, which is 1.23 times of that of the P(AA-co-NVP) hydrogel (164). In addition, the SR ofP(AA-co-NVP)/clay hydrogel is higher than that of PAA/clay hydrogel in the same solution. The compressive properties ofthe hydrogel were also examined. The results showed that the compressive properties of the P(AA-co-NVP)/clay hydrogelswere improved distinctly as compared to those of the conventional hydrogels without clay. When the content of clay is 15%,the compression strength of the P(AA-co-NVP)/clay hydrogel is 23 times of that of the P(AA-co-NVP) hydrogel.

  4. Bacterial cellulose based hydrogel (BC-g-AA) and preliminary result of swelling behavior (United States)

    Hakam, Adil; Lazim, Azwan Mat; Abdul Rahman, I. Irman


    In this study, hydrogel based on Bacterial cellulose (BC) or local known as Nata de Coco, which grafted with monomer: Acrylic acid (AA) is synthesis by using gamma radiation technique. These hydrogel (BC-g-AA) has unique characteristic whereby responsive to pH buffer solution.

  5. Lu AA21004, a novel multimodal antidepressantwith activity exerted through serotonergic targets

    DEFF Research Database (Denmark)

    Mork, A.; Pehrson, A.; Montezinho, L. C. P.;


    levels [serotonin (5-HT), noradrenaline (NA), dopamine (DA), acetylcholine (ACh), histamine (Hist)] were measured by microdialysis. Antidepressant potential was assessed in the forced swim test using Flinders Sensitive Line (FSL) rats. Moreover, effects of Lu AA21004 on acquisition, consolidation and...... recall of contextual memory in rats were studied in the fear conditioning paradigm, and episodic memory was evaluated in the novel object recognition test. Results: Administration of Lu AA21004 (0.1-10 mg/kg, sc) demonstrated that the compound dose-dependently occupied the studied targets. Moreover, Lu...... AA21004 increased extracellular levels of 5-HT, NA, DA, ACh and Hist in the brain. Lu AA21004 counteracted the immobility of FSL rats in the forced swim test and enhanced memory of the rats in the cognition models. Conclusions: Lu AA21004 in vivo engages relevant targets and affects several...

  6. Characterization And Study of Friction Stir Welding of AA6101 Aluminum Alloy

    Directory of Open Access Journals (Sweden)

    S. K. Aditya


    Full Text Available Friction stir welding (FSW combines two plates by frictional heating at the interface with the localized plastic deformation within the material. In friction stir welding heat is generated by the friction between rotating tool shoulder and the plates to be welded. The heat thus generated results in thermal softening of the material. The softened material is then forced to flow by the translation of the tool from the front to the back of the pin. There it cools, consolidates and results in joint formation. In the process, strength of the joint and percentage elongation varies from the parent material. AA6101 is equivalent to AA 6061 and AA6063. At present AA6101 is used by the electrical industries only. A detailed experimental study has been done on AA 6101 to its utility as an Aluminum alloy for structural fabrication

  7. Comparison of recrystallization and recrystallization textures in cold-rolled DC and CC AA 5182 aluminum alloys

    International Nuclear Information System (INIS)

    The recrystallization and recrystallization textures in cold-rolled direct chill cast (DC) and continuous cast (CC) AA 5182 aluminum alloys were investigated. The recrystallization behavior of cold-rolled DC and CC AA 5182 aluminum alloys was evaluated by tensile properties. The evolution of recrystallization textures in cold-rolled DC and CC AA 5182 aluminum alloys was determined by X-ray diffraction. The results showed that the recrystallization temperature of cold-rolled DC AA 5182 aluminum alloy was somewhat lower than that of cold-rolled CC AA 5182 aluminum alloy. The resulting recrystallization textures of cold-rolled AA 5182 aluminum alloy were characterized by the strong R orientation and the cube orientation with strong scattering about the rolling direction towards the Goss orientation. CC AA 5182 aluminum alloy showed slightly weaker recrystallization textures than DC AA 5182 aluminum alloy

  8. Precipitation in an AA6111 aluminium alloy and cosmetic corrosion

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Y. [Corrosion and Protection Centre, School of Materials, University of Manchester, Manchester M60 1QD (United Kingdom); Zhou, X. [Corrosion and Protection Centre, School of Materials, University of Manchester, Manchester M60 1QD (United Kingdom)]. E-mail:; Thompson, G.E. [Corrosion and Protection Centre, School of Materials, University of Manchester, Manchester M60 1QD (United Kingdom); Hashimoto, T. [Corrosion and Protection Centre, School of Materials, University of Manchester, Manchester M60 1QD (United Kingdom); Scamans, G.M. [Innoval Technology, Beaumont Close, Banbury, Oxon OX16 1TQ (United Kingdom); Afseth, A. [Novelis Technology and Management, 8212 Neuhausen (Switzerland)


    The near-surface deformed layer on AA6111 automotive closure sheet alloy, generated by mechanical grinding during rectification, has an ultrafine grain microstructure, of 50-150 nm diameter, and a sharp transition with the underlying bulk alloy microstructure. Grinding and heat treatment to simulate rectification and paint baking processes result in the nucleation and growth of {approx}20 nm diameter precipitates at grain boundaries within the near-surface deformed layer. High-resolution transmission electron microscopy has shown Q phase precipitates in the deformed layer, giving dramatically increased corrosion susceptibility compared with the bulk microstructure, and this is responsible for the rapid-onset filiform corrosion. Transmission electron microscopy of the corrosion attack showed directly that the mode of corrosion was intergranular and that the Q phase precipitates were preserved after the passage of the corrosion front.

  9. Multicomponent He I 10830 {\\AA} profiles in an active filament

    CERN Document Server

    Sasso, C; Solanki, S K


    We present new spectropolarimetric observations of the chromospheric He I 10830 {\\AA} multiplet observed in a filament during its phase of activity. The data were recorded with the new Tenerife Infrared Polarimeter (TIP-II) at the German Vacuum Tower Telescope (VTT) on 2005 May 18. We inverted the He Stokes profiles using multiple atmospheric components. The observed He Stokes profiles display a remarkably wide variety of shapes. Most of the profiles show very broad Stokes I absorptions and complex and spatially variable Stokes V signatures. The inversion of the profiles shows evidence of different atmospheric blue- and redshifted components of the He I lines within the resolution element (1 arcsec), with supersonic velocities of up to 100 km/s. Up to five different atmospheric components are found in the same profile. We show that even these complex profiles can be reliably inverted.

  10. AA, radiation shielding curtain along the target area

    CERN Multimedia


    At the far left is the beam tube for the high-intensity proton beam from the 26 GeV PS. The tube ends in a thin window and the proton beam continues in air through a hole in the shielding blocks (see also 8010308), behind which the target (see 7905091, 7905094)was located. After the target followed the magnetic horn, focusing the antiprotons, and the first part of the injection line with a proton dump. The antiprotons, deflected by a magnet, left the target area through another shielding wall, to make their way to the AA ring. Laterally, this sequence of components was shielded with movable, suspended, concrete blocks: the "curtain". Balasz Szeless, who had constructed it, is standing at its side.

  11. Newer trace elements measured by RNAA and AAS

    International Nuclear Information System (INIS)

    Very recently, quite attention has been made on a few more trace elements in foodstuff as essential for animal and human health in certain ranges of concentration or intake. These traces are: aluminum, nickel, vanadium and tin. Al and Ni have been measured by atomic absorption spectroscopy (AAS), and the two latter ones measured by radiochemical neutron activation analysis (RNAA) in few references laboratories. Here, scandium was also analysed by instrumental neutron activation analysis (INAA). These measurements were made for the most of the Iranian diets and other participant countries' diets under the framework of a co-ordinated research project (CRP) of the IAEA during the period 1986-1994, but practically it took more years. Here in this work the daily dietary intakes of above mentioned trace elements are given and discussed while the results of 20 other nutritionally important trace elements appeared somewhere else. (author)

  12. Precipitation in an AA6111 aluminium alloy and cosmetic corrosion

    International Nuclear Information System (INIS)

    The near-surface deformed layer on AA6111 automotive closure sheet alloy, generated by mechanical grinding during rectification, has an ultrafine grain microstructure, of 50-150 nm diameter, and a sharp transition with the underlying bulk alloy microstructure. Grinding and heat treatment to simulate rectification and paint baking processes result in the nucleation and growth of ∼20 nm diameter precipitates at grain boundaries within the near-surface deformed layer. High-resolution transmission electron microscopy has shown Q phase precipitates in the deformed layer, giving dramatically increased corrosion susceptibility compared with the bulk microstructure, and this is responsible for the rapid-onset filiform corrosion. Transmission electron microscopy of the corrosion attack showed directly that the mode of corrosion was intergranular and that the Q phase precipitates were preserved after the passage of the corrosion front

  13. Ultrasonic inspection of AA6013 laser welded joints

    Directory of Open Access Journals (Sweden)

    Adriano Passini


    Full Text Available Interest in laser beam welding for aerospace applications is continuously growing, mainly for aluminum alloys. The joints quality is usually assessed by non-destructive inspection (NDI. In this work, bead on plate laser welds on 1.6 mm thick AA6013 alloy sheets, using a 2 kW Yb-fiber laser were obtained and inspected by pulse/echo ultrasonic phased-array technique. Good and poor quality welds were inspected in order to verify the limits of inspection, comparing also to X-ray radiography and metallographic inspections. The results showed that ultrasonic phased array technique was able to identify the presence of grouped porosity, through the attenuation of the amplitude of the echo signal. This attenuation is attributed to the scattering of the waves caused by micro pores, with individual size below the resolution limit of the equipment, but when grouped, can cause a perceptive effect on the reflection spectra.

  14. Porous substrates filled with nanomaterials (United States)

    Worsley, Marcus A.; Baumann, Theodore F.; Satcher, Jr., Joe H.; Stadermann, Michael


    A composition comprising: at least one porous carbon monolith, such as a carbon aerogel, comprising internal pores, and at least one nanomaterial, such as carbon nanotubes, disposed uniformly throughout the internal pores. The nanomaterial can be disposed in the middle of the monolith. In addition, a method for making a monolithic solid with both high surface area and good bulk electrical conductivity is provided. A porous substrate having a thickness of 100 microns or more and comprising macropores throughout its thickness is prepared. At least one catalyst is deposited inside the porous substrate. Subsequently, chemical vapor deposition is used to uniformly deposit a nanomaterial in the macropores throughout the thickness of the porous substrate. Applications include electrical energy storage, such as batteries and capacitors, and hydrogen storage.

  15. Design of the MsAa-4 Moessbauer Spectrometer

    International Nuclear Information System (INIS)

    An entirely new Moessbauer spectrometer MsAa-4 is currently being under design and construction. New features as compared to the basic features of the previous generation MsAa-3 spectrometer could be summarized as follows. Completely digital processing of the γ-ray detector signal beyond the Gaussian shape filter/amplifier is to be implemented. The spectrometer is going to be able to accommodate external multiple detector heads. Up to 128 γ-ray spectra in 16384 channels of 32-bit each and up to 512 Moessbauer spectra in 4096 channels of 32-bit each could be collected simultaneously, provided the proper external multiple detector head is used. The count-rate per single detector is limited to about 105 counts per second in total. Improved precision of the reference function from 12-bit to 16-bit is to be provided. The reference function is stored in 8192 channels per a complete cycle. Addition of the random noise to the reference corner prism of the Michelson-Morley calibration interferometer is to be introduced to avoid spurious fringes due to the phase lock-up. An integrated universal temperature controller being able to use a variety of the temperature sensors is to be interconnected properly with the spectrometer. The spectrometer is now a stand-alone network device as it is equipped with the Ethernet connection to the outside world. Fast and high precision digital oscilloscope is to be incorporated to the spectrometer as the intrinsic unit. This oscilloscope could monitor signals at various crucial points of the internal spectrometer electronics. Modular design and use of the strict standards allows easy reconfiguration for other applications than Moessbauer spectroscopy.

  16. An Update on the AAS Astronomy Ambassadors Program (United States)

    Fienberg, Richard T.; Gurton, S.; Fraknoi, A.; Prather, E. E.; Hurst, A.; Schatz, D. L.


    The American Astronomical Society, partnering with organizations active in science education and public outreach (EPO), has launched a series of professional-development workshops and a community of practice designed to help improve early-career astronomers’ ability to effectively communicate with students and the public. Called Astronomy Ambassadors, the program provides mentoring and training experiences for young astronomers, from advanced undergraduates to beginning faculty; it also provides access to resources and a network of contacts within the astronomy EPO community. By learning how to implement effective education and outreach strategies, Astronomy Ambassadors become better teachers, better presenters at meetings, and better representatives of our science to the public and to government. And because young astronomers are a more diverse group than those who currently do the majority of outreach, they help the astronomical community present a more multicultural and gender-balanced face to the public, enabling members of underserved groups to see themselves as scientists. Ambassadors are provided with a large library of outreach activities and materials that are suitable for a range of venues and audiences and that will grow with time. For much of this library we are using resources developed by organizations such as the Astronomical Society of the Pacific, the Pacific Science Center, and the Center for Astronomy Education for other outreach programs, though some resources have been created by one of us (AF) specifically for this program. The first Astronomy Ambassadors workshop was held at the 221st meeting of the AAS in January 2013 and served 30 young astronomers chosen from more than 75 applicants. Incorporating feedback from workshop participants and lessons learned from the reports they’ve submitted after conducting their own outreach events, we are now planning the second annual workshop to be held 4-5 January 2014 at the 223rd AAS meeting in

  17. Expression and prognostic value of platelet-derived growth factor-AA and its receptor alpha in nephroblastoma

    NARCIS (Netherlands)

    Ghanem, Mazen; Nijman, Rien; Safan, Manal; van der Kwast, Theodorus; Vansteenbrugge, Gert


    OBJECTIVE To investigate the potential role of platelet-derived growth factor-AA (PDGF-AA) and the PDGF-alpha receptor as prognostic markers in Wilms' tumour. PATIENTS AND METHODS The expression of PDGF-AA and PDGF-alpha were investigated using immunohistochemical analysis of 62 Wilms' tumours. Pati

  18. Phonon scattering in graphene over substrate steps

    DEFF Research Database (Denmark)

    Sevincli, Haldun; Brandbyge, Mads


    We calculate the effect on phonon transport of substrate-induced bends in graphene. We consider bending induced by an abrupt kink in the substrate, and provide results for different step-heights and substrate interaction strengths. We find that individual substrate steps reduce thermal conductance...

  19. Semiconductor films on flexible iridium substrates (United States)

    Goyal, Amit


    A laminate semiconductor article includes a flexible substrate, an optional biaxially textured oxide buffer system on the flexible substrate, a biaxially textured Ir-based buffer layer on the substrate or the buffer system, and an epitaxial layer of a semiconductor. Ir can serve as a substrate with an epitaxial layer of a semiconductor thereon.

  20. Characterization of AA7050 aluminium alloy processed by ECAP; Caracterizacao da liga de aluminio AA7050 processada por ECAP

    Energy Technology Data Exchange (ETDEWEB)

    Cardoso, K.R.; Guido, V. [Universidade do Vale do Paraiba (UNIVAP), Sao Jose dos Campos, SP (Brazil). Inst. de Pesquisa e Desenvolvimento; Travessa, D.N. [Empresa Brasileira de Aeronautica (EMBRAER), Sao Jose dos Campos, SP (Brazil); Jorge Junior, A.M. [Universidade Federal de Sao Carlos (DEMa/UFSCar), SP (Brazil). Dept. de Engenharia de Materiais


    The commercial AA7050 aluminium alloy in the solution heat treated condition (W) was processed by ECAP through route A. Two pressing temperatures (room and 150 deg C and velocities (5 and 30mm/min) were used, as well as different number of passes. The effect of such variables on the microstructure evolution was evaluated using optical and transmission electron microscopy with EDX microanalysis, and xray diffraction. It was found that the microstructure has been refined by ECAP, as a result of subgrains formed within deformation bands. ECAP at 150 deg C resulted in intense precipitation of plate like {eta} phase, which evolves to equiaxial morphology as the number of passes increases. (author)

  1. Substrate preferences in laying hens

    NARCIS (Netherlands)

    Jong, de I.C.; Reenen, van K.


    We investigated the substrate preference of laying hens with respect to dustbathing and foraging behaviour, in order to determine which resources should be provided in laying hen housing systems for the expression of these behaviours. The consumer demand approach was used to study the strength of pr

  2. Neurobiological Substrates of Tourette's Disorder

    NARCIS (Netherlands)

    Leckman, James F.; Bloch, Michael H.; Smith, Megan E.; Larabi, Daouia; Hampson, Michelle


    Objective: This article reviews the available scientific literature concerning the neurobiological substrates of Tourette's disorder (TD). Methods: The electronic databases of PubMed, ScienceDirect, and PsycINFO were searched for relevant studies using relevant search terms. Results: Neuropathologic

  3. Renal AA amyloidosis in a patient with hereditary complete complement C4 deficiency

    Directory of Open Access Journals (Sweden)

    Imed Helal


    Full Text Available Hereditary complete C4 deficiency has until now been reported in 30 cases only. A disturbed clearance of immune- complexes probably predisposes these individuals to systemic lupus erythematosus, other immune- complex diseases and recurrent microbial infections. We present here a 20- year- old female with hereditary complete C4 deficiency. Renal biopsy demonstrated renal AA amyloidosis. This unique case further substantiates that deficiency of classical pathway components predisposes to the development of recurrent microbial infections and that the patients may develop AA amyloidosis. Furthermore, in clinical practice, the nephrotic syndrome occurring in a patient with hereditary complete complement C4 deficiency should lead to the suspicion of renal AA amyloidosis.

  4. Microstructure controlled bending response in AA6016 Al alloys

    International Nuclear Information System (INIS)

    Highlights: → The hemmability of two AA6016-type aluminium alloys in T4P temper state is studied. → High Mg content and long solutionizing times increase the precipitation potential. → Inhomogeneous grain boundary particles form by precipitation of alloying elements. → Large amount of particles combined with high matrix strength reduce the hemmability. → Intergranular fracture is promoted by grain boundary debonding and voids formation. - Abstract: A contemporary approach in the car weight reduction is the use of low weight and high strength Al alloys sheets for hang-on body panels production. The final step in the forming route of such panels is the attachment of the outer skin to the inner part of the panel by applying a hemming operation. This joining method is cheap, easy to perform and environment-friendly, but requires severe 180 deg. bending of the edges of the outer skin which quite often results in cracking or complete tearing of the bend surface. Such kind of failure restricts the further application of the hemmed products. The microstructures after solution heat treatment and pre-aging (T4P temper state) of two grades age-hardening AA6016-type aluminium alloy sheets were studied in this work by means of optical microscopy, scanning electron microscopy and electron backscatter diffraction. The obtained results were related to the hemming response of the grades. It was found that the alloy composition is one of the main parameters controlling the bendability of these grades through the amount of the formed strengthening phases. However, the applied thermal treatment remains the key factor responsible for the favorable distribution of these phases into the microstructure. The grain size and the volume fraction of the constituent particles were found to play secondary role in forming the material bending properties and can be only used for their fine tuning. The presence of Mg2Si (β-phase) and/or Al1.9CuMg4.1Si3.3 (Q-phase) particles in the grain

  5. Butanol formation from gaseous substrates. (United States)

    Dürre, Peter


    Mostly, butanol is formed as a product by saccharolytic anaerobes, employing the so-called ABE fermentation (for acetone-butanol-ethanol). However, this alcohol can also be produced from gaseous substrates such as syn(thesis) gas (major components are carbon monoxide and hydrogen) by autotrophic acetogens. In view of economic considerations, a biotechnological process based on cheap and abundant gases such as CO and CO2 as a carbon source is preferable to more expensive sugar or starch fermentation. In addition, any conflict for use of substrates that can also serve as human nutrition is avoided. Natural formation of butanol has been found with, e.g. Clostridium carboxidivorans, while metabolic engineering for butanol production was successful using, e.g. C. ljungdahlii. Production of butanol from CO2 under photoautotrophic conditions was also possible by recombinant DNA construction of a respective cyanobacterial Synechococcus sp. PCC 7942 strain. PMID:26903012

  6. Methods of repairing a substrate (United States)

    Riedell, James A. (Inventor); Easler, Timothy E. (Inventor)


    A precursor of a ceramic adhesive suitable for use in a vacuum, thermal, and microgravity environment. The precursor of the ceramic adhesive includes a silicon-based, preceramic polymer and at least one ceramic powder selected from the group consisting of aluminum oxide, aluminum nitride, boron carbide, boron oxide, boron nitride, hafnium boride, hafnium carbide, hafnium oxide, lithium aluminate, molybdenum silicide, niobium carbide, niobium nitride, silicon boride, silicon carbide, silicon oxide, silicon nitride, tin oxide, tantalum boride, tantalum carbide, tantalum oxide, tantalum nitride, titanium boride, titanium carbide, titanium oxide, titanium nitride, yttrium oxide, zirconium boride, zirconium carbide, zirconium oxide, and zirconium silicate. Methods of forming the ceramic adhesive and of repairing a substrate in a vacuum and microgravity environment are also disclosed, as is a substrate repaired with the ceramic adhesive.

  7. Influence of environment and substrate quality on the decomposition of wetland plant root in the Sanjiang Plain, Northeast China

    Institute of Scientific and Technical Information of China (English)

    GUO Xuelian; LU Xianguo; TONG Shouzheng; DAI Guohua


    The litterbag method was used to study the decomposition of wetland plant root in three wetlands along a water level gradient in the Sanjiang Plain, Northeast China. These wetlands are Calamagrostis angustifolia ( C.aa), Carex meyeriana ( and Carex lasiocarpa ( The objective of our study is to evaluate the influence of environment and substrate quality on decomposition rates in the three wetlands. Calico material was used as a standard substrate to evaluate environmental influences. Roots native to each wetland were used to evaluate decomposition dynamics and substrate quality influences. Calico mass loss was statistically different among the three wetlands in the upper soil profile (0-10 cm) and in the lower depth range (10-20 cm). Hydrology, temperature and pH all influence calico decomposition rates in different ways at different depths of the soil profiles. The decomposition rates of native roots declined differentially with the increase of depth in the soil profiles. The mass loss of native roots showed a statistical decrease among the three wetlands in the upper soil profile (0-10 cm) and in the lower depth range (10-20 cm) as wetland C.aa wetland wetland. Both the C:P ratio and N:P ratio were positively interrelated with decomposition rates. Decomposition rates were negatively related to initial P concentration in all three wetlands, indicating that P concentration seems to be an important factor controlling the fitter loss.

  8. Nanostructured Substrates for Optical Sensing


    Kemling, Jonathan W.; Qavi, Abraham J.; Bailey, Ryan C.; Suslick, Kenneth S.


    Sensors that change color have the advantages of versatility, ease of use, high sensitivity, and low cost. The recent development of optically based chemical sensing platforms has increasingly employed substrates manufactured with advanced processing or fabrication techniques to provide precise control over shape and morphology of the sensor micro- and nano-structure. New sensors have resulted with improved capabilities for a number of sensing applications, including the detection of biomolec...

  9. Polymer Adsorption on Disordered Substrate


    Hwa, T; Cule, D.


    We analyze the recently proposed "pattern-matching" phase of a Gaussian random heteropolymer adsorbed on a disordered substrate [S. Srebnik, A.K. Chakraborty and E.I. Shakhnovich, Phys. Rev. Lett. 77, 3157 (1996)]. By mapping the problem to that of a directed homopolymer in higher-dimensional random media, we show that the pattern-matching phase is asymptotically weakly unstable, and the large scale properties of the system are given by that of an adsorbed homopolymer.

  10. Substrate Integrated Waveguide Antenna Applications


    Wu, Liang


    The research objective of this thesis is to provide a better solution for signal interference and reduce the size of waveguide antenna. The background investigations of different waveguide fabrication technologies and switch control methods are detailed in the introductory part of this thesis. Several novel substrate integrated waveguide (SIW) antennas for different purpose are demonstrated in the body of the thesis. The designs are mainly divided into two kinds. The first focuses on the ...

  11. Lubricated friction between incommensurate substrates


    Vanossi, Andrea; Santoro, Giuseppe E.; Manini, Nicola; Tosatti, Erio; Braun, O. M.


    This paper is part of a study of the frictional dynamics of a confined solid lubricant film - modelled as a one-dimensional chain of interacting particles confined between two ideally incommensurate substrates, one of which is driven relative to the other through an attached spring moving at constant velocity. This model system is characterized by three inherent length scales; depending on the precise choice of incommensurability among them it displays a strikingly different tribological beha...

  12. Modelling and Pareto optimization of mechanical properties of friction stir welded AA7075/AA5083 butt joints using neural network and particle swarm algorithm

    International Nuclear Information System (INIS)

    Highlights: ► Defect-free friction stir welds have been produced for AA5083-O/AA7075-O. ► Back-propagation was sufficient for predicting hardness and tensile strength. ► A hybrid multi-objective algorithm is proposed to deal with this MOP. ► Multi-objective particle swarm optimization was used to find the Pareto solutions. ► TOPSIS is used to rank the given alternatives of the Pareto solutions. -- Abstract: Friction Stir Welding (FSW) has been successfully used to weld similar and dissimilar cast and wrought aluminium alloys, especially for aircraft aluminium alloys, that generally present with low weldability by the traditional fusion welding process. This paper focuses on the microstructural and mechanical properties of the Friction Stir Welding (FSW) of AA7075-O to AA5083-O aluminium alloys. Weld microstructures, hardness and tensile properties were evaluated in as-welded condition. Tensile tests indicated that mechanical properties of the joint were better than in the base metals. An Artificial Neural Network (ANN) model was developed to simulate the correlation between the Friction Stir Welding parameters and mechanical properties. Performance of the ANN model was excellent and the model was employed to predict the ultimate tensile strength and hardness of butt joint of AA7075–AA5083 as functions of weld and rotational speeds. The multi-objective particle swarm optimization was used to obtain the Pareto-optimal set. Finally, the Technique for Order Preference by Similarity to the Ideal Solution (TOPSIS) was applied to determine the best compromised solution.

  13. Active matter on asymmetric substrates (United States)

    Olson Reichhardt, C. J.; Drocco, J.; Mai, T.; Wan, M. B.; Reichhardt, C.


    For collections of particles in a thermal bath interacting with an asymmetric substrate, it is possible for a ratchet effect to occur where the particles undergo a net dc motion in response to an ac forcing. Ratchet effects have been demonstrated in a variety of systems including colloids as well as magnetic vortices in type-II superconductors. Here we examine the case of active matter or self-driven particles interacting with asymmetric substrates. Active matter systems include self-motile colloidal particles undergoing catalysis, swimming bacteria, artificial swimmers, crawling cells, and motor proteins. We show that a ratchet effect can arise in this type of system even in the absence of ac forcing. The directed motion occurs for certain particle-substrate interaction rules and its magnitude depends on the amount of time the particles spend swimming in one direction before turning and swimming in a new direction. For strictly Brownian particles there is no ratchet effect. If the particles reflect off the barriers or scatter from the barriers according to Snell's law there is no ratchet effect; however, if the particles can align with the barriers or move along the barriers, directed motion arises. We also find that under certain motion rules, particles accumulate along the walls of the container in agreement with experiment. We also examine pattern formation for synchronized particle motion. We discuss possible applications of this system for self-assembly, extracting work, and sorting as well as future directions such as considering collective interactions and flocking models.

  14. Siim Kallas seab Lumani argumendid kahtluse alla / Kadri Paas ; kommenteerinud Norman Aas, Juhan Põldroos

    Index Scriptorium Estoniae

    Paas, Kadri, 1982-


    Seaduseelnõust, mille eesmärgiks on tõhustada võitlust kartellidega ja muude raskete konkurentsiõiguse rikkumistega nn leebusprogrammi abil. Kommenteerivad peaprokurör Norman Aas ja Juhan Põldroos

  15. Peaprokurör: kaevake kartellide peale! / Kadri Paas ; kommenteerinud Norman Aas ; Indrek, Kaju

    Index Scriptorium Estoniae

    Paas, Kadri, 1982-


    Seaduseelnõust, mille kohaselt salajasest kartellileppest esimesena võimudele teatanud ettevõte pääseb vastutasuks karistusest. Kommenteerivad peaprokurör Norman Aas ning Neste Eesti peadirektor Indrek Kaju

  16. Magnetism of an adatom on biased AA-stacked bilayer graphene

    Energy Technology Data Exchange (ETDEWEB)

    Mohammadi, Yawar, E-mail: [Department of Physics, Islamic Azad University, Kermanshah Branch, Kermanshah (Iran, Islamic Republic of); Moradian, Rostam [Department of Physics, Razi University, Kermanshah (Iran, Islamic Republic of); Nano Science and Nano Technology Research Center, Razi University, Kermanshah (Iran, Islamic Republic of)


    We study the magnetism of an adatom adsorbed on AA-stacked bilayer graphene (BLG) in both unbiased and biased cases using the Anderson impurity model. We find different magnetic phase diagrams for the adatom, depending on its energy level. The magnetic phase of the adatom varies from that in normal metals to that in graphene. This is because of the individual energy dependence of the density of states (DOS) of AA-stacked BLG and anomalous broadening of the adatom energy level. We also investigate the effect of a bias voltage on the DOS of AA-stacked BLG and show that adatom magnetization can be controlled by applying a bias voltage. This allows the possibility of using AA-stacked BLG in spintronic devices.

  17. Quantification of recrystallization texture evolution in cold rolled AA 5182 aluminum alloy

    International Nuclear Information System (INIS)

    The evolution of recrystallization textures in cold rolled AA 5182 aluminum alloy was investigated by X-ray diffraction. The transformation kinetics of recrystallization textures during isothermal annealing was quantified by using an Avrami type equation

  18. Quantification of recrystallization texture evolution in cold rolled AA 5182 aluminum alloy

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.C.; Zhai, T.; Man, C.-S.; Morris, J.G


    The evolution of recrystallization textures in cold rolled AA 5182 aluminum alloy was investigated by X-ray diffraction. The transformation kinetics of recrystallization textures during isothermal annealing was quantified by using an Avrami type equation.

  19. Determination of elements in ayurvedic medicinal plants by AAS

    Energy Technology Data Exchange (ETDEWEB)

    Teerthe, Santoshkumar S.; Kerur, B. R., E-mail: [Department of Physics, Gulbarga University, Gulbarga, and Karnataka, India – 585106 (India)


    India has a rich country for the uses of Ayurvedic medicinal plants for treatment and also the north- Karnataka boasts an unparallel diversity of medicinal plants. The present study attempts to estimate and compare the level of trace and heavy metals in some selected leaves and root samples of Ayurvedic medicinal plants such as Mg, Al, K, Cr, Mn, Fe, Cu, Zn, and Cd. The samples are collected from different places of North-Karnataka regions and sample solutions prepared as the ratio of 1:25:25+950ml=1000ppm.the trace and heavy elemental concentration was estimated using Atomic Absorption Spectrometric (AAS) Method. The average concentrations of Mg, Mn, Fe and Zn, are ranging from 2ppm to 5250.2ppm and potassium (K) has more concentration as compare to all other. The other elements likes Al, Cr, Cu, and Cd were also estimed and presented in the table. Therefore, these medicinal plants are rich in some essential minerals, especially K, Mg, Mn, Fe and Zn which are essential for human health.

  20. Determination of elements in ayurvedic medicinal plants by AAS (United States)

    Teerthe, Santoshkumar S.; Kerur, B. R.


    India has a rich country for the uses of Ayurvedic medicinal plants for treatment and also the north- Karnataka boasts an unparallel diversity of medicinal plants. The present study attempts to estimate and compare the level of trace and heavy metals in some selected leaves and root samples of Ayurvedic medicinal plants such as Mg, Al, K, Cr, Mn, Fe, Cu, Zn, and Cd. The samples are collected from different places of North-Karnataka regions and sample solutions prepared as the ratio of 1:25:25+950ml=1000ppm.the trace and heavy elemental concentration was estimated using Atomic Absorption Spectrometric (AAS) Method. The average concentrations of Mg, Mn, Fe and Zn, are ranging from 2ppm to 5250.2ppm and potassium (K) has more concentration as compare to all other. The other elements likes Al, Cr, Cu, and Cd were also estimed and presented in the table. Therefore, these medicinal plants are rich in some essential minerals, especially K, Mg, Mn, Fe and Zn which are essential for human health

  1. Investigation of PLC band nucleation in AA5754

    International Nuclear Information System (INIS)

    Highlights: ► Simultaneous propagation of bands in transverse and longitudinal directions. ► PLC band nucleation at the back front of Lüders bands. ► Characteristic time of critical strain decreases with strain rate. ► Simultaneous existence of two type-B bands at specimen shoulder. - Abstract: The purpose of the present work is the experimental investigation of the nucleation of PLC deformation bands in the aluminium alloy AA5754. The PLC bands are investigated using both mechanical methods and infrared (IR) thermography. The latter employs a high-speed IR camera which captures local changes of radiated power resulting from mechanical dissipation and heating due to the nucleation of PLC bands. The resulting IR images are used to determine spatio-temporal power field variations via image subtraction. Furthermore, band trajectories obtained from the IR images are used to study possible correlations between the spatio-temporal evolution of stress and radiated power in the specimens and PLC band development.

  2. Process model to predict yield strength of AA6063 alloy

    International Nuclear Information System (INIS)

    In the present study, an attempt has been made to examine the appropriateness of the models for predicting yield strength of age hardenable 6063 Al–Mg–Si alloy. Two physical models have been considered: one is classical dislocation-particle interaction model which incorporates both cutting and by-pass mechanisms around spherical shaped precipitates; and the other is based on only dislocation by-pass of the rod shaped precipitates as per modified Orowan equation. The prediction of yield strength using these models has been compared with experimentally generated yield strength data of the selected Al-alloy subjected to different combinations of time and temperature of ageing. The microstructural variations due to ageing have been simulated using the well established thermodynamic and kinetic relationships. Comparison of the experimental and the simulated results assists to conclude that modified Orowan mechanism predicts yield strength better than that by the classical model up to the peak aged conditions. The generated results have been successfully used to develop thermal processing maps that can be considered as a convenient tool for selection of age hardening parameters to achieve any desired level of yield strength for AA6063 alloy

  3. Application Of NAA And AAS In Environmental Research In Slovakia

    International Nuclear Information System (INIS)

    The concentrations of 41 chemical elements (heavy metals, rare earths, and actinides) were determined in atmospheric aerosol using nuclear and related analytical techniques. The sampling location was in Bratislava (Slovak Republic). The main goal of this study is the quantification of the atmospheric pollution and its trend. The elemental content in filters was measured using instrumental neutron activation analysis (NAA) at IBR-2 reactor in JINR Dubna and by atomic absorption spectrometry (AAS) in Bratislava. The obtained results confirm the decreasing trend of pollution by most of the heavy metals in Bratislava atmosphere, and they are compared with the contents of pollutants in atmosphere of other cities, including Cairo. We determined also the composition of clear filter materials. Results on atmospheric deposition of heavy metals and other trace elements in the whole territory Slovakia using the moss bio monitoring technique are presented, too. The level of the elements found in the bryophytes reflects the relative atmospheric deposition loads of the elements at the investigated sites. Factor analysis was applied to determine possible sources of trace element deposition in the Slovakian moss. The marginal hot spots were revealed near nonferrous ores processing and factories and dumps of stone chips. The trans-boundary contamination by Hg through dry and wet deposition from Czech Republic and Polish is evident in the bordering territory in the north-west part of Slovakia (The Small Black Triangle), known for metallurgical works, coal processing and chemical industries

  4. Fully Digital: Policy and Process Implications for the AAS

    CERN Document Server

    Biemesderfer, Chris


    Over the past two decades, every scholarly publisher has migrated at least the mechanical aspects of their journal publishing so that they utilize digital means. The academy was comfortable with that for a while, but publishers are under increasing pressure to adapt further. At the American Astronomical Society (AAS), we think that means bringing our publishing program to the point of being fully digital, by establishing procedures and policies that regard the digital objects of publication primarily. We have always thought about our electronic journals as databases of digital articles, from which we can publish and syndicate articles one at a time, and we must now put flesh on those bones by developing practices that are consistent with the realities of article at a time publication online. As a learned society that holds the long-term rights to the literature, we have actively taken responsibility for the preservation of the digital assets that constitute our journals, and in so doing we have not forsaken t...

  5. Determination of elements in ayurvedic medicinal plants by AAS

    International Nuclear Information System (INIS)

    India has a rich country for the uses of Ayurvedic medicinal plants for treatment and also the north- Karnataka boasts an unparallel diversity of medicinal plants. The present study attempts to estimate and compare the level of trace and heavy metals in some selected leaves and root samples of Ayurvedic medicinal plants such as Mg, Al, K, Cr, Mn, Fe, Cu, Zn, and Cd. The samples are collected from different places of North-Karnataka regions and sample solutions prepared as the ratio of 1:25:25+950ml=1000ppm.the trace and heavy elemental concentration was estimated using Atomic Absorption Spectrometric (AAS) Method. The average concentrations of Mg, Mn, Fe and Zn, are ranging from 2ppm to 5250.2ppm and potassium (K) has more concentration as compare to all other. The other elements likes Al, Cr, Cu, and Cd were also estimed and presented in the table. Therefore, these medicinal plants are rich in some essential minerals, especially K, Mg, Mn, Fe and Zn which are essential for human health

  6. AA-stacked bilayer graphene quantum dots in magnetic field (United States)

    Belouad, Abdelhadi; Zahidi, Youness; Jellal, Ahmed


    By applying the infinite-mass boundary condition, we analytically calculate the confined states and the corresponding wave functions of AA-stacked bilayer graphene (BLG) quantum dots (QDs) in the presence of an uniform magnetic field B. It is found that the energy spectrum shows two set of levels, which are the double copies of the energy spectrum for single layer graphene, shifted up–down by +γ and -γ , respectively. However, the obtained spectrum exhibits different symmetries between the electron and hole states as well as the intervalley symmetries. It is noticed that, the applied magnetic field breaks all symmetries, except one related to the intervalley electron–hole symmetry, i.e. {E}{{e}}(τ ,m)=-{E}{{h}}(τ ,m). Two different regimes of confinement are found: the first one is due to the infinite-mass barrier at weak B and the second is dominated by the magnetic field as long as B is large. We numerically investigated the basics features of the energy spectrum to show the main similarities and differences with respect to monolayer graphene, AB-stacked BLG and semiconductor QDs. Dedicated to Professor Dr Hachim A Yamani on the occasion of his 70th birthday.

  7. Process model to predict yield strength of AA6063 alloy

    Energy Technology Data Exchange (ETDEWEB)

    Nandy, Supriya [Department of Metallurgy and Materials Engineering, Bengal Engineering and Science University, Shibpur, Howrah 711103 (India); Department of Metallurgical and Materials Engineering, Indian Institute of Technology, Kharagpur 721302 (India); Kumar Ray, Kalyan [Department of Metallurgical and Materials Engineering, Indian Institute of Technology, Kharagpur 721302 (India); Das, Debdulal, E-mail: [Department of Metallurgy and Materials Engineering, Bengal Engineering and Science University, Shibpur, Howrah 711103 (India)


    In the present study, an attempt has been made to examine the appropriateness of the models for predicting yield strength of age hardenable 6063 Al–Mg–Si alloy. Two physical models have been considered: one is classical dislocation-particle interaction model which incorporates both cutting and by-pass mechanisms around spherical shaped precipitates; and the other is based on only dislocation by-pass of the rod shaped precipitates as per modified Orowan equation. The prediction of yield strength using these models has been compared with experimentally generated yield strength data of the selected Al-alloy subjected to different combinations of time and temperature of ageing. The microstructural variations due to ageing have been simulated using the well established thermodynamic and kinetic relationships. Comparison of the experimental and the simulated results assists to conclude that modified Orowan mechanism predicts yield strength better than that by the classical model up to the peak aged conditions. The generated results have been successfully used to develop thermal processing maps that can be considered as a convenient tool for selection of age hardening parameters to achieve any desired level of yield strength for AA6063 alloy.

  8. Deformation inhomogeneity in large-grained AA5754 sheets

    International Nuclear Information System (INIS)

    Research highlights: → Microstructure and strain relationship at individual grain level was studied. → 'Hot spots' nucleate early and most keep growing throughout deformation stages. → 'Hot spots' are correlated with 'soft' grains and soft-evolution grains. → Grains with high Schmid factors tend to be 'soft' grains. → Grains with the direction close to tensile axis tend to become softer. - Abstract: Models for deformation and strain localization in polycrystals that incorporate microstructural features including particles are computationally intensive due to the large variation in scale in going from particles to grains to a specimen. As a result such models are generally 2-D in nature. This is an issue for experimental validation. We have therefore studied deformation heterogeneities and strain localization behavior of coarse-grained alloys with only two grains across the sample thickness, therefore mimicking 2-D behavior. Aluminum alloy sheets (AA5754) have been investigated by a number of surface techniques, including digital image correlation, slip trace analysis and electron backscattered diffraction, at the individual grain level. Local strain concentration zones appear from the very beginning of deformation, which then maintain sustained growth and lead, in one of these regions, to localization and final fracture. These 'hot spots' occur in areas with locally soft grains (i.e. grains with or close to the tensile direction) and soft-evolution orientations (i.e. grains with close to the tensile direction). These grains can be correlated with Taylor and/or Schmid factors.

  9. Immunoprecipitation of membrane proteins from rat basophilic leukemia cells by the antiganglioside monoclonal antibody AA4

    International Nuclear Information System (INIS)

    In previous studies, mAb AA4 inhibited IgE binding, induced rapid morphologic changes, and blocked histamine release in rat basophilic leukemia (RBL-2H3) cells. It bound to two novel derivatives of ganglioside GD1b (Ag I and Ag II) that appear to be present only in rat mast cells. The present study demonstrates the importance of gangliosides Ag I and Ag II for binding of mAb AA4 to intact cells. We also investigated the presence of gangliosides Ag I and Ag II and proteins immunoprecipitated with mAb AA4 in the parental and four variant cell lines. In comparison with the parental RBL-2H3, two variant cell lines had very low (0.5% and 2.0%) and two others had intermediate levels (9% and 18%) of 125I-AA4 binding. mAb AA4 inhibited 125I-IgE binding to the parental RBL-2H3 cells and to only one variant with intermediate amounts of gangliosides Ag I and Ag II. Therefore, there are variations in the proximity of these gangliosides to the high affinity IgE receptor (Fc epsilon RI) among different cell lines. mAb AA4 immunoprecipitated proteins of 50 to 60, 120, and 135 kDa from 125I-surface labeled cells. These were different from the subunits of Fc epsilon RI. The amount of gangliosides Ag I and Ag II in cell extracts correlated with the number of mAb AA4 binding sites on the cell surface and with the quantity of proteins precipitated from the different cell lines. Thus, these membrane proteins appear to be associated with gangliosides Ag I and Ag II. The binding of mAb AA4 to the surface gangliosides could induce intracellular changes through transmembrane signaling by these proteins

  10. Development of Nanostructured AA3103 by Equal Channel Angular Pressing and Thermal Treatments


    Luis, C. J.; Luri, R.; León, J.; Puertas, I.; Salcedo, D.; Pérez, I.


    This work presents a study related to the achievement of a nanometric structure in AA3103, employing severe plastic deformation processes (SPD), in this case equal channel angular pressing (ECAP). The changes in the mechanical properties and in the microstructure of AA3103 were studied after being processed by ECAP. Subsequently, scanning electron microscopy was used to determine the evolution of the microstructure after different thermal treatments on the material processed by this severe pl...

  11. Preparation and Characteristics of Corn Straw-Co-AMPS-Co-AA Superabsorbent Hydrogel


    Wei-Min Cheng; Xiang-Ming Hu; De-Ming Wang; Guo-Hua Liu


    In this study, the corn straw after removing the lignin was grafted with 2-acrylamido-2-methylpropanesulfonic acid (AMPS) to prepare sulfonated cellulose. The grafting copolymerization between the sulfonated cellulose and acrylic acid (AA) was performed using potassium persulfate and N,N′-methylenebisacrylamide as the initiator and crosslinking agent, respectively, to prepare corn straw-co-AMPS-co-AA hydrogels. The structure and properties of the resulting hydrogels were characterized by Four...

  12. Nanomodeling of Nonlinear Thermoelastic Behavior of AA5454/ Silicon Nitride Nanoparticulate Metal Matrix Composites

    Directory of Open Access Journals (Sweden)

    Chennakesava R Alavala


    Full Text Available The aim of the present work was to estimate non-linear thermoelastic behavior of three-phase AA5454/silicon nitride nanoparticle metal matrix composites. The thermal loading was varied from subzero temperature to under recrystallization temperature. The RVE models were used to analyze thermo-elastic behavior. The AA5454/silicon nitride nanoparticle metal matrix composites have gained the elastic modulus below 0oC and lost at high temperatures.

  13. Overall view of the AA hall dominated by the 50 ton crane (Donges).

    CERN Multimedia


    A 50 ton, 32 metre span overhead travelling cranre was mounted in one of the bays of Hall 193 (AA). An identical crane was mounted on the other bay. See also photo 8004261. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  14. Corrosion Behaviour of Friction Stir Welded AA5xxx Aluminium Alloys


    Abuaisha, Ramadan R


    Friction stir welding (FSW) is a well recognised method for joining aluminium alloys and other engineering materials at a temperature below their melting point. However, the microstructure of the alloys may be modified during the welding process due to frictional heat and severe plastic deformation.In this study, the microstructures of friction stir welded AA5754-H111 and AA5083-O aluminium alloys have been investigated using optical microscopy, transmission and scanning electron microscopy e...

  15. Substantial enhancement in the anticorrosivity of AA6061 by Doxycycline hydrochloride drug


    Mudigere Krishnegowda Pavithra; Thimmappa Venkatarangaiah Venkatesha; Mudigere Krishnegowda Punith Kumar; Nanjanagudu Subba Rao Anantha


    The significant anticorrosive property of the antibiotic drug doxycycline hydrochloride (DCH) was investigated by electrochemical techniques such as potentiodynamic polarization, electrochemical impedance and chronoamperometric techniques. DCH inhibited the pitting corrosion of aluminium alloy 6061 (AA6061) in 3.5% NaCl media with 90% efficiency. The adsorption of DCH on AA6061 conform Langmuir isotherm by means of physisorption.  Quantum chemical calculations were evaluated to ascertain the ...

  16. Optimization of friction stir welding parameters for improved corrosion resistance of AA2219 aluminum alloy joints


    G. Rambabu; D. Balaji Naik; C.H. Venkata Rao; K. Srinivasa Rao; G. Madhusudan Reddy


    The aluminium alloy AA2219 (Al–Cu–Mg alloy) is widely used in the fabrication of lightweight structures with high strength-to-weight ratio and good corrosion resistance. Welding is main fabrication method of AA2219 alloy for manufacturing various engineering components. Friction stir welding (FSW) is a recently developed solid state welding process to overcome the problems encountered in fusion welding. This process uses a non-consumable tool to generate frictional heat on the abutting surfac...

  17. Doping with anabolic androgenic steroids (AAS): Adverse effects on non-reproductive organs and functions. (United States)

    Nieschlag, Eberhard; Vorona, Elena


    Since the 1970s anabolic androgenic steroids (AAS) have been abused at ever increasing rates in competitive athletics, in recreational sports and in bodybuilding. Exceedingly high doses are often consumed over long periods, in particular by bodybuilders, causing acute or chronic adverse side effects frequently complicated by additional polypharmacy. This review summarizes side effects on non-reproductive organs and functions; effects on male and female reproduction have been recently reviewed in a parallel paper. Among the most striking AAS side effects are increases in haematocrit and coagulation causing thromboembolism, intracardiac thrombosis and stroke as well as other cardiac disturbances including arrhythmias, cardiomyopathies and possibly sudden death. 17α-alkylated AAS are liver toxic leading to cholestasis, peliosis, adenomas and carcinomas. Hyperbilirubinaemia can cause cholemic nephrosis and kidney failure. AAS abuse may induce exaggerated self-confidence, reckless behavior, aggressiveness and psychotic symptoms. AAS withdrawal may be accompanied by depression and suicidal intentions. Since AAS abuse is not or only reluctantly admitted physicians should be aware of the multitude of serious side effects when confronted with unclear symptoms. PMID:26373946

  18. Inert gas a-A differences: a direct reflection of V/Q distribution. (United States)

    Neufeld, G R; Williams, J J; Klineberg, P L; Marshall, B E


    A computer model was developed to study the relationship between ventilation-to-perfusion (V/Q) mismatch and the development of inert gas arterial-to-alveolar partial pressure differences (a-A differences). Increasing inhomogeneity of V/Q ratio is revealed directly as an increase in the a-A difference of each gas. The quantitative relationships between the Q vs. V/Q distribution and the fractional a-A difference solubility plot (a-A difference plot) were studied and described. These studies demonstrated that for log normally distributed V/Q ratios, the area under the a-A difference plot is linearly related to the log variance of the V/Q distribution and can be estimated directly from the values obtained from six gases. The maximum a-A difference occurs for a gas whose solubility is numerically equal to the mean V/Q. The effects of departure from log normality and multimodality are discussed. We conclude from these studies that quantitative information regarding the degree of inhomogeneity of V/Q for log normal distribution is available from direct calculations of inert gas retention and excretion data. Qualitative information is also available indicating the departure from log normality and the region toward which the distribution is skewed. PMID:204618

  19. Investigating the Turing conditions for diffusion-driven instability in the presence of a binding immobile substrate

    Czech Academy of Sciences Publication Activity Database

    Korvasová, K.; Gaffney, E. A.; Maini, P.K.; Ferreira, M.A.; Klika, Václav


    Roč. 367, February (2015), s. 286-295. ISSN 0022-5193 Institutional support: RVO:61388998 Keywords : turing instability * non-diffusive substrate * pattern formation Subject RIV: BJ - Thermodynamics Impact factor: 2.116, year: 2014

  20. Substrate influence on the frying process.

    Directory of Open Access Journals (Sweden)

    Pokorny, J.


    Full Text Available The substrate affects frying oil in different ways during the frying. Water is released from the substrate, which is converted into steam and participates in hydrolytical processes of frying fats. The transfer of fat into the substrate and from the substrate into frying fat depends on the fat content in the substrate and on the frying conditions. Other, more polar substances than triacylglycerols, including pigments and their precursors, pass in frying oil. Oxidation processes in frying oil are inhibited by the substrate, especially by proteins, starch or phenolic substances. Mutagenic polycyclic aromatic heterocycles are produced during the interaction of frying fat and protein. Oxidation products are bound to proteins and other components of the substrate. Flavour substances are produced by reactions of oxidized frying oil with proteins and other sulphur and nitrogen substances in the substrate.

  1. Carbon Nanotube Patterning on a Metal Substrate (United States)

    Nguyen, Cattien V. (Inventor)


    A CNT electron source, a method of manufacturing a CNT electron source, and a solar cell utilizing a CNT patterned sculptured substrate are disclosed. Embodiments utilize a metal substrate which enables CNTs to be grown directly from the substrate. An inhibitor may be applied to the metal substrate to inhibit growth of CNTs from the metal substrate. The inhibitor may be precisely applied to the metal substrate in any pattern, thereby enabling the positioning of the CNT groupings to be more precisely controlled. The surface roughness of the metal substrate may be varied to control the density of the CNTs within each CNT grouping. Further, an absorber layer and an acceptor layer may be applied to the CNT electron source to form a solar cell, where a voltage potential may be generated between the acceptor layer and the metal substrate in response to sunlight exposure.

  2. Interactive paper as security substrate (United States)

    Robillard, Jean J.


    The threat of counterfeiting Bank Notes and other security documents is steadily increasing with the continuous improvement of printing and copying technologies. The perfect reproduction of a document is indeed reachable with the right combination of technique and economics. Our only protection is to make it difficult by introducing artifacts which appear only through the counterfeiting process or reduce significantly the efficiency of that process. A number of methods are available to defeat counterfeiting none of which are completely satisfactory. The difficulty is not as much the prevention of the duplication than doing it while safeguarding the intrinsic properties (durability) of the documents as far as permanent readability, resistance to wear, etc. Basic approaches are: (1) The light switch: a transparent coating which becomes opaque during any attempt of duplication. (2) An alternative to this first approach is an ink which becomes transparent at the time of duplication. (3) The use of a substrate (paper stock) whose optical density will rise to that of the printed graphic on the bill at the time of copying. This would be a true interactive paper. (4) Luminescent materials that would blind the photoreceptor during exposure. Such material could be in the substrate or in the printing ink. (5) Introduction of an artefact in the printed copy through a hologram hidden in a transparent coating or embossed in the substrate. All approaches have been investigated to a certain extent with variable success. We report hereafter the results of investigations made by the author on alternatives (1) and (2) in this laboratory and at the University of Texas at El Paso under contract from the National Bank of Belgium and with the collaboration of the CNRS in Paris and the University of Marseille France.

  3. Small satellite solar array substrate (United States)

    Fiore, John N.; Rosanova, Giulio


    The SMall EXplorer (SMEX) Fast Auroral SnapshoT (FAST) spacecraft was developed to investigate plasma physics of auroral phenomena at high orbital altitude. The FAST satellite comprises a variety of deployable booms with sensors on the ends, and instruments that protrude from the main body of the spacecraft to obtain the plasma and electromagnetic fields data. This required the plasma disturbance around the satellite to be kept to a minimum. A non deployable, body mounted solar array was implemented. This led to the design of a light weight solar array substrate with a high degree of structural integrity.

  4. Electrosynthesis of hydrogel films on metal substrates for the development of coatings with tunable drug delivery performances. (United States)

    De Giglio, E; Cometa, S; Satriano, C; Sabbatini, L; Zambonin, P G


    Novel polyacrylates-based hydrogel thin films were prepared by electrochemical polymerization, a new method to obtain hydrogels directly onto metal substrates. 2-Hydroxy-ethyl-methacrylate (HEMA), a macromer poly (ethylene-glycol diacrylate) (PEGDA) and PEGDA copolymerized with acrylic acid (AA) were used to obtain hydrogels. The electrosynthesized coatings were characterized by X-ray photoelectron spectroscopy, to assess their surface chemical composition, and by water content determination measurements, to characterize the swelling behavior. In particular, quartz crystal microbalance with dissipation monitoring was used to evaluate the pH-dependency of the swelling for AA-containing hydrogels. Moreover, a model protein (bovine serum albumin) and a model drug (caffeine) were entrapped within the hydrogel coatings during electrosynthesis, to examine the release performances and mechanisms of the electrosynthesized hydrogels. It was observed that all the examined polymers showed significant release properties and, in particular, AA-containing hydrogel films confirmed a strong pH-dependence as expected. These coatings seem to be promising in orthopedic field for in situ drug delivery applications. PMID:18404708

  5. Printed supercapacitors on paperboard substrate

    International Nuclear Information System (INIS)

    Highlights: ► Inexpensive supercapacitors on paperboard substrate. ► Manufacturing by printing using non-toxic materials. ► Supercapacitors provide current peaks of 10–50 mA. ► Efficiency typically 90–95%. - Abstract: Printed supercapacitors were prepared to be applied as a part of a hybrid power source in printed electronics applications. The use of non-toxic materials was preferred. The supercapacitor structure consisting of current collectors and activated carbon electrodes was applied on paperboard substrate using silver, graphite and activated carbon inks. Aqueous electrolytes with NaCl salt limit the maximum potential to about 1.2 V but are environmentally friendly and provide low equivalent series resistance (ESR). The capacitance values of our printed supercapacitors were typically 0.1–0.5 F. With 2 cm2 geometrical active area the ESR was below 1 Ω which is acceptable for 50 mA current output. The efficiency with 50 mA charge and discharge current was typically about 90% and with 10 mA about 95%.

  6. Crack patterns over uneven substrates. (United States)

    Nandakishore, Pawan; Goehring, Lucas


    Cracks in thin layers are influenced by what lies beneath them. From buried craters to crocodile skin, crack patterns are found over an enormous range of length scales. Regardless of absolute size, their substrates can dramatically influence how cracks form, guiding them in some cases, or shielding regions from them in others. Here we investigate how a substrate's shape affects the appearance of cracks above it, by preparing mud cracks over sinusoidally varying surfaces. We find that as the thickness of the cracking layer increases, the observed crack patterns change from wavy to ladder-like to isotropic. Two order parameters are introduced to measure the relative alignment of these crack networks, and, along with Fourier methods, are used to characterise the transitions between crack pattern types. Finally, we explain these results with a model, based on the Griffith criteria of fracture, that identifies the conditions for which straight or wavy cracks will be seen, and predicts how well-ordered the cracks will be. Our metrics and results can be applied to any situation where connected networks of cracks are expected, or found. PMID:26762761

  7. Substrate mediated enzyme prodrug therapy.

    Directory of Open Access Journals (Sweden)

    Betina Fejerskov

    Full Text Available In this report, we detail Substrate Mediated Enzyme Prodrug Therapy (SMEPT as a novel approach in drug delivery which relies on enzyme-functionalized cell culture substrates to achieve a localized conversion of benign prodrug(s into active therapeutics with subsequent delivery to adhering cells or adjacent tissues. For proof-of-concept SMEPT, we use surface adhered micro-structured physical hydrogels based on poly(vinyl alcohol, β-glucuronidase enzyme and glucuronide prodrugs. We demonstrate enzymatic activity mediated by the assembled hydrogel samples and illustrate arms of control over rate of release of model fluorescent cargo. SMEPT was not impaired by adhering cells and afforded facile time - and dose - dependent uptake of the in situ generated fluorescent cargo by hepatic cells, HepG2. With the use of a glucuronide derivative of an anticancer drug, SN-38, SMEPT afforded a decrease in cell viability to a level similar to that achieved using parent drug. Finally, dose response was achieved using SMEPT and administration of judiciously chosen concentration of SN-38 glucuronide prodrug thus revealing external control over drug delivery using drug eluting surface. We believe that this highly adaptable concept will find use in diverse biomedical applications, specifically surface mediated drug delivery and tissue engineering.

  8. Intrauterine, postpartum and adult relationships between arachidonic acid (AA) and docosahexaenoic acid (DHA). (United States)

    Kuipers, Remko S; Luxwolda, Martine F; Janneke Dijck-Brouwer, D A; Muskiet, Frits A J


    Erythrocyte (RBC) fatty acid compositions from populations with stable dietary habits but large variations in RBC-arachidonic (AA) and RBC-docosahexaenoic acid (DHA) provided us with insight into relationships between DHA and AA. It also enabled us to estimate the maternal RBC-DHA (mRBC-DHA) status that corresponded with no decrease in mRBC-DHA during pregnancy, or in infant (i) RBC-DHA or mRBC-DHA during the first 3 months postpartum (DHA-equilibrium) while exclusively breastfeeding. At delivery, iRBC-AA is uniformly high and independent of mRBC-AA. Infants born to mothers with low RBC-DHA exhibit higher, but infants born to mothers with high RBC-DHA exhibit lower RBC-DHA than their mothers. This switch from 'biomagnification' into 'bioattenuation' occurs at 6g% mRBC-DHA. At 6g%, mRBC-DHA is stable throughout pregnancy, corresponds with postpartum infant DHA-equilibrium of 6 and 0.4g% DHA in mature milk, but results in postpartum depletion of mRBC-DHA to 5g%. Postpartum maternal DHA-equilibrium is reached at 8g% mRBC-DHA, corresponding with 1g% DHA in mature milk and 7g% iRBC-DHA at delivery that increases to 8g% during lactation. This 8g% RBC-DHA concurs with the lowest risks of cardiovascular and psychiatric diseases in adults. RBC-data from 1866 infants, males and (non-)pregnant females indicated AA vs. DHA synergism at low RBC-DHA, but antagonism at high RBC-DHA. These data, together with high intakes of AA and DHA from our Paleolithic diet, suggest that bioattenuation of DHA during pregnancy and postnatal antagonism between AA and DHA are the physiological standard for humans across the life cycle. PMID:21561751

  9. Textured substrate tape and devices thereof (United States)

    Goyal, Amit


    A method for forming a sharply biaxially textured substrate, such as a single crystal substrate, includes the steps of providing a deformed metal substrate, followed by heating above the secondary recrystallization temperature of the deformed substrate, and controlling the secondary recrystallization texture by either using thermal gradients and/or seeding. The seed is selected to shave a stable texture below a predetermined temperature. The sharply biaxially textured substrate can be formed as a tape having a length of 1 km, or more. Epitaxial articles can be formed from the tapes to include an epitaxial electromagnetically active layer. The electromagnetically active layer can be a superconducting layer.

  10. Phonon scattering in graphene over substrate steps

    Energy Technology Data Exchange (ETDEWEB)

    Sevinçli, H., E-mail: [Department of Materials Science and Engineering, Izmir Institute of Technology, Gülbahçe Kampüsü, 35430 Urla, Izmir (Turkey); Department of Micro- and Nano-technology (DTU Nanotech), Technical University of Denmark, DK-2800 Kongens Lyngby (Denmark); Brandbyge, M., E-mail: [Department of Micro- and Nano-technology (DTU Nanotech), Technical University of Denmark, DK-2800 Kongens Lyngby (Denmark); Center for Nanostructured Graphene(CNG), Department of Micro- and Nano-technology, Technical University of Denmark, DK-2800 Kongens Lyngby (Denmark)


    We calculate the effect on phonon transport of substrate-induced bends in graphene. We consider bending induced by an abrupt kink in the substrate, and provide results for different step-heights and substrate interaction strengths. We find that individual substrate steps reduce thermal conductance in the range between 5% and 47%. We also consider the transmission across linear kinks formed by adsorption of atomic hydrogen at the bends and find that individual kinks suppress thermal conduction substantially, especially at high temperatures. Our analysis show that substrate irregularities can be detrimental for thermal conduction even for small step heights.

  11. Phonon scattering in graphene over substrate steps

    International Nuclear Information System (INIS)

    We calculate the effect on phonon transport of substrate-induced bends in graphene. We consider bending induced by an abrupt kink in the substrate, and provide results for different step-heights and substrate interaction strengths. We find that individual substrate steps reduce thermal conductance in the range between 5% and 47%. We also consider the transmission across linear kinks formed by adsorption of atomic hydrogen at the bends and find that individual kinks suppress thermal conduction substantially, especially at high temperatures. Our analysis show that substrate irregularities can be detrimental for thermal conduction even for small step heights.

  12. Method For Producing Mechanically Flexible Silicon Substrate

    KAUST Repository

    Hussain, Muhammad Mustafa


    A method for making a mechanically flexible silicon substrate is disclosed. In one embodiment, the method includes providing a silicon substrate. The method further includes forming a first etch stop layer in the silicon substrate and forming a second etch stop layer in the silicon substrate. The method also includes forming one or more trenches over the first etch stop layer and the second etch stop layer. The method further includes removing the silicon substrate between the first etch stop layer and the second etch stop layer.

  13. Thermally Stable, Piezoelectric and Pyroelectric Polymeric Substrates (United States)

    Simpson, Joycely O. (Inventor); St.Clair, Terry L. (Inventor)


    A thermally stable, piezoelectric and pyroelectric polymeric substrate was prepared. This thermally stable, piezoelectric and pyroelectric polymeric substrate may be used to prepare electromechanical transducers, thermomechanical transducers, accelerometers. acoustic sensors, infrared sensors, pressure sensors, vibration sensors, impact sensors, in-situ temperature sensors, in-situ stress/strain sensors, micro actuators, switches, adjustable fresnel lenses, speakers, tactile sensors. weather sensors, micro positioners, ultrasonic devices, power generators, tunable reflectors, microphones, and hydrophones. The process for preparing these polymeric substrates includes: providing a polymeric substrate having a softening temperature greater than 1000 C; depositing a metal electrode material onto the polymer film; attaching a plurality of electrical leads to the metal electrode coated polymeric substrate; heating the metal electrode coated polymeric substrate in a low dielectric medium; applying a voltage to the heated metal electrode coated polymeric substrate to induce polarization; and cooling the polarized metal electrode coated polymeric electrode while maintaining a constant voltage.

  14. Molecular Characteristic, Protein Distribution and Potential Regulation of HSP90AA1 in the Anadromous Fish Coilia nasus


    Di-An Fang; Jin-Rong Duan; Yan-Feng Zhou; Min-Ying Zhang; Dong-Po Xu; Kai Liu; Pao Xu


    Heat shock proteins play essential roles in basic cellular events. Spawning migration is a complex process, with significant structural and biochemical changes taking place in the adult gonad. To date, the molecular mechanisms underlying migration reproductive biology remain undetermined. In this regard, a full length HSP90AA1 comprising 2608 nucleotides from the anadromous fish Coilia nasus was characterized, encoding 742 amino acid (aa) residues with potential phosphorylation sites. HSP90AA...

  15. Expression and function of anew angiogenic factor AA98 target molecule at the maternal-embryonic boundary ofrhesus monkey

    Institute of Scientific and Technical Information of China (English)


    The target molecule of monoclonal antibody AA98 (AA for short) is a new vascular endothelial cell related factor and plays a role in angiogenesis as indicated by the previous data. To investigate its role in angiogenesis and placentation in primate, we examined its expression in the implantation sites on D17, 19, 28 and 34 of gestation in rhesus monkey by immunohistochemistry and Western immunoblot. Western blot analysis showed that the primary antibody used in this study was specific for its epitope. AA protein was mainly expressed in small blood vessels and in some cytotrophoblast cells. The AA staining was found mainly in the endothelial cells and vascular small muscle.This observation supported the AA's role in angiogenesis. AA was spatio-temporarily expressed in cytotrophoblasts: weak in proliferating trophoblast within cell column and endovascular trophoblast, strong in trophoblastic subpopulation within the basal plate and vascular trophoblast; AA staining within the basal plate was down-regulated during early placentation. The shift of AA98 expression in extravillous trophoblasts suggestes a role of this new factor during the course of cytotrophoblast metastasis and spiral artery remodeling. The spatio-temporarily expression indicats that AA98 could be also used as a trophoblast cellular marker to characterize the acquisition of a vascular endothelial and invasive phenotype.

  16. The thioacetate-ω(γ-lactam carboxamide) HDAC inhibitor ST7612AA1 as HIV-1 latency reactivation agent. (United States)

    Badia, Roger; Grau, Judith; Riveira-Muñoz, Eva; Ballana, Ester; Giannini, Giuseppe; Esté, José A


    Antiretroviral therapy (ART) is unable to cure HIV infection. The ability of HIV to establish a subset of latent infected CD4(+) T cells, which remain undetectable to the immune system, becomes a major roadblock to achieve viral eradication. Histone deacetylase inhibitors (HDACi) have been shown to potently induce the reactivation of latent HIV. Here, we show that a new thiol-based HDACi, the thioacetate-ω(γ-lactam carboxamide) derivative ST7612AA1, is a potent inducer of HIV reactivation. We evaluated HIV reactivation activity of ST7612AA1 compared to panobinostat (PNB), romidepsin (RMD) and vorinostat (VOR) in cell culture models of HIV-1 latency, in latently infected primary CD4(+) T lymphocytes and in PBMCs from HIV(+) patients. ST7612AA1 potently induced HIV-1 reactivation at submicromolar concentrations with comparable potency to panobinostat or superior to vorinostat. The presence of known antiretrovirals did not affect ST7612AA1-induced reactivation and their activity was not affected by ST7612AA1. Cell proliferation and cell activation were not affected by ST7612AA1, or any other HDACi used. In conclusion, our results indicate that ST7612AA1 is a potent activator of latent HIV and that reactivation activity of ST7612AA1 is exerted without activation or proliferation of CD4(+) T cells. ST7612AA1 is a suitable candidate for further studies of HIV reactivation strategies and potential new therapies to eradicate the viral reservoirs. PMID:26348004

  17. Multi-Line Quiet Sun Spectro-Polarimetry at 5250 and 6302 \\AA

    CERN Document Server

    Socas-Navarro, H; Ramos, A Asensio; Collados, M; Cerdeña, I Domínguez; Khomenko, E V; González, M J Martínez; Pillet, V Martínez; Cobo, B Ruiz; Almeida, J Sánchez


    The reliability of quiet Sun magnetic field diagnostics based on the \\ion{Fe}{1} lines at 6302 \\AA has been questioned by recent work. We present here the results of a thorough study of high-resolution multi-line observations taken with the new spectro-polarimeter SPINOR, comprising the 5250 and 6302 \\AA spectral domains. The observations were analyzed using several inversion algorithms, including Milne-Eddington, LTE with 1 and 2 components, and MISMA codes. We find that the line-ratio technique applied to the 5250 \\AA lines is not sufficiently reliable to provide a direct magnetic diagnostic in the presence of thermal fluctuations and variable line broadening. In general, one needs to resort to inversion algorithms, ideally with realistic magneto-hydrodynamical constrains. When this is done, the 5250 \\AA lines do not seem to provide any significant advantage over those at 6302 \\AA . In fact, our results point towards a better performance with the latter (in the presence of turbulent line broadening). In any...

  18. A Flare Observed in Coronal, Transition Region and Helium I 10830 \\AA\\ Emissions

    CERN Document Server

    Zeng, Zhicheng; Cao, Wenda; Judge, Philip G


    On June 17, 2012, we observed the evolution of a C-class flare associated with the eruption of a filament near a large sunspot in the active region NOAA 11504. We obtained high spatial resolution filtergrams using the 1.6 m New Solar Telescope at the Big Bear Solar Observatory in broad-band TiO at 706 nm (bandpass:10 \\AA) and He I 10830 \\AA\\ narrow-band (bandpass: 0.5 \\AA, centered 0.25 \\AA\\ to the blue). We analyze the spatio-temporal behavior of the He I 10830 \\AA\\ data, which were obtained over a 90" X 90" field of view with a cadence of 10 sec. We also analyze simultaneous data from the Atmospheric Imaging Assembly and Extreme Ultraviolet Variability Experiment instruments on board the Solar Dynamics Observatory spacecraft, and data from Reuven Ramaty High Energy Solar Spectroscopic Imager and GOES spacecrafts. Non-thermal effects are ignored in this analysis. Several quantitative aspects of the data, as well as models derived using the "0D" Enthalpy-Based Thermal Evolution of Loops model (EBTEL: Klimchuk...

  19. Synthesis and characterization of polycaprolactone/acrylic acid (PCL/AA) hydrogel for controlled drug delivery

    Indian Academy of Sciences (India)

    Nazar Mohammad Ranjha; Jahanzeb Mudassir; Sajid Majeed


    In the present work biodegradable pH-sensitive polycaprolactone/acrylic acid (PCL/AA) hydrogels have been developed using ethylene glycol dimethacrylate (EGDMA) as a cross-linker and benzoyl peroxide as initiator. For these prepared hydrogels swelling studies, sol–gel fraction analysis and porosity measurements were performed. Results show that swelling of the hydrogels decreases on increasing the concentration of PCL and EGDMA, however swelling of hydrogels increases on increasing the concentration of AA. Results of sol–gel fraction analysis show that gel fraction increases on increasing concentration of monomer AA, polymer PCL as well as cross-linker EGDMA. As far as porosity is concerned, it increases on increasing the concentration of AA and PCL while porosity decreases on increasing the concentration of EGDMA. Hydrogels were characterized by measuring diffusion coefficient () and equilibrium water content (EWC). Network formation, morphology and crystallinity of PCL/AA hydrogels were investigated using FTIR, SEM and XRD, respectively. Tramadol hydrochloride was loaded as model drug and its release pattern was analysed using various kinetic models like zero order, first order, Higuchi and Peppas. Results indicated that most of the samples followed non-Fickian release mechanism.

  20. Preparation and Characteristics of Corn Straw-Co-AMPS-Co-AA Superabsorbent Hydrogel

    Directory of Open Access Journals (Sweden)

    Wei-Min Cheng


    Full Text Available In this study, the corn straw after removing the lignin was grafted with 2-acrylamido-2-methylpropanesulfonic acid (AMPS to prepare sulfonated cellulose. The grafting copolymerization between the sulfonated cellulose and acrylic acid (AA was performed using potassium persulfate and N,N′-methylenebisacrylamide as the initiator and crosslinking agent, respectively, to prepare corn straw-co-AMPS-co-AA hydrogels. The structure and properties of the resulting hydrogels were characterized by Fourier transform infrared spectroscopy, X-ray diffraction, scanning electron microscopy, thermogravimetric analysis, and dynamic rheometry. The effects of initiator, crosslinker, monomer neutralization degree, and temperature on the swelling ratio of the hydrogels were studied. The water retention, salt resistance, and recyclability of the corn straw-co-AMPS-co-AA hydrogels were also investigated. The optimum water absorptivity of the corn straw hydrogels was obtained at a polymerization temperature of 50 °C with 1.2% crosslinker, 1:7 ratio of the pretreated corn straw and AA, 2% initiator, and 50% neutralized AA.