WorldWideScience

Sample records for a 285 steel

  1. Gamma spectrometry of 285-04 ILAS gamma scan wires

    International Nuclear Information System (INIS)

    Dassel, G.; Buurveld, H.A.; Plakman, J.C.

    1996-12-01

    In the frame work of their on-going sustain programme for the material development and characterization of fusion reactors, ECN is investigating the irradiation behaviour of ferritic/martensitic steels. In the fourth irradiation experiment 285-04, 55 steel tensile samples have been irradiated up to 2.5 dpa. Four gamma scan wires from this experiment have been examined by gamma scanning. The results of the measurements have been described in this report. (orig.)

  2. Gamma spectrometry of 285-03 ILAS gamma scan wires

    International Nuclear Information System (INIS)

    Dassel, G.; Buurveld, H.A.; Plakman, J.C.

    1996-12-01

    In the frame work of their on-going sustain programme for the material development and characterization of fusion reactors, ECN is investigating the irradiation behaviour of ferritic/martensitic steels. In the third irradiation experiment 285-03, 55 vanadium (V-4Cr-4Ti) tensile samples have been irradiated up to 6 dpa. Four gamma scan wires from this experiment have been examined by gamma scanning. The results of the measurements have been described in this report. (orig.)

  3. Corrosion of carbon steel in neutral water

    International Nuclear Information System (INIS)

    Kawai, Noboru; Iwahori, Toru; Kurosawa, Tatsuo

    1983-01-01

    The initial corrosion behavior of materials used in the construction of heat exchanger and piping system of BWR nuclear power plants and thermal power plants have been examined in neutral water at 30, 50, 100, 160, 200, and 285 deg C with two concentrations of dissolved oxygen in the water. In air-saturated water, the corrosion rate of carbon steel was so higher than those in deaerated conditions and the maximum corrosion rate was observed at 200 deg C. The corrosion rate in deaerated water gradually increased with increasing the water temperature. Low alloy steel (2.25 Cr, 1Mo) exhibited good corrosion resistance compared with the corrosion of carbon steel under similar testing conditions. Oxide films grown on carbon steel in deaerated water at 50, 100, 160, 200, and 285 deg C for 48 and 240 hrs were attacked by dissolved oxygen in room temperature water respectively. However the oxide films formed higher than about 160 deg C showed more protective. The electrochemical behavior of carbon steel with oxide films was also similar to the effect of temperature on the stability of oxide films. (author)

  4. Dicty_cDB: SLH285 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLH285 (Link to dictyBase) - - - Contig-U16287-1 SLH285F (Link to Original site) SLH2...85F 326 - - - - - - Show SLH285 Library SL (Link to library) Clone ID SLH285 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-D/SLH285Q.Seq.d/ Representative seq. ID SLH28...5F (Link to Original site) Representative DNA sequence >SLH285 (SLH285Q) /CSM/SL/SLH2-D/SLH285Q.Seq.d/ AAAAA...ue SSF805 (SSF805Q) /CSM/SS/SSF8-A/SSF805Q.Seq.d/ 617 e-176 SLH288 (SLH288Q) /CSM/SL/SLH2-D/SLH288Q.Seq.d/ 617 e-176 SLH285 (SLH2

  5. Dicty_cDB: VHK285 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHK285 (Link to dictyBase) - - - - - (Link to Original site) VHK2...85F 531 - - - - - - Show VHK285 Library VH (Link to library) Clone ID VHK285 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-D/VHK2...85Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >VHK2...85 (VHK285Q) /CSM/VH/VHK2-D/VHK285Q.Seq.d/ AACTCTCGAGTGCAAAAAAAGTAAAGTACAAAATGGTTAATTTCA

  6. 32 CFR 285.5 - Information requirements.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Information requirements. 285.5 Section 285.5 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) FREEDOM OF INFORMATION ACT PROGRAM DOD FREEDOM OF INFORMATION ACT (FOIA) PROGRAM § 285.5 Information...

  7. 30 CFR 285.706 - How do I nominate a CVA for MMS approval?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How do I nominate a CVA for MMS approval? 285..., Fabrication, and Installation Certified Verification Agent § 285.706 How do I nominate a CVA for MMS approval... (§ 285.610(a)(9)) or GAP (§ 285.645(c)(5)), you must nominate a CVA for MMS approval. You must specify...

  8. 49 CFR 40.285 - When is a SAP evaluation required?

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false When is a SAP evaluation required? 40.285 Section... § 40.285 When is a SAP evaluation required? (a) As an employee, when you have violated DOT drug and... unless you complete the SAP evaluation, referral, and education/treatment process set forth in this...

  9. 30 CFR 285.201 - How will MMS issue leases?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will MMS issue leases? 285.201 Section 285... Energy Leases General Lease Information § 285.201 How will MMS issue leases? The MMS will issue leases on... noncompetitively, as provided under §§ 285.230 and 285.232. We will issue leases on forms approved by MMS and will...

  10. 7 CFR 285.1 - General purpose and scope.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false General purpose and scope. 285.1 Section 285.1... COMMONWEALTH OF PUERTO RICO § 285.1 General purpose and scope. This part describes the general terms and... government of the Commonwealth of Puerto Rico for the purpose of designing and conducting a nutrition...

  11. 7 CFR 285.4 - Audits.

    Science.gov (United States)

    2010-01-01

    ... such audit shall be reported to FNS no later than 120 days from the end of each fiscal year in which the audit is made. (b) Within 120 days of the end of each fiscal year, the Commonwealth of Puerto Rico... 7 Agriculture 4 2010-01-01 2010-01-01 false Audits. 285.4 Section 285.4 Agriculture Regulations of...

  12. 30 CFR 285.231 - How will MMS process my unsolicited request for a noncompetitive lease?

    Science.gov (United States)

    2010-07-01

    ... a noncompetitive lease? 285.231 Section 285.231 Mineral Resources MINERALS MANAGEMENT SERVICE... described in §§ 285.640 through 285.648. (e) The MMS will coordinate and consult with affected Federal.... (1) Within 10 business days after you receive the lease copies you must: (i) Execute the lease; (ii...

  13. PERAN BUDAYA ORGANISASI TERHADAP DISIPLIN KERJA KARYAWAN DIREKTORAT PRODUKSI PT KRAKATAU STEEL (PERSERO TBK CILEGON

    Directory of Open Access Journals (Sweden)

    Muhammad Luhung Pribadi

    2016-12-01

    Full Text Available This research aims to study the effect of organizational culture toward  employee work discipline at Directorate Production PT Krakatau Steel (Persero Tbk Cilegon. The subjects of this research are 115 employees from several divisions at Directorate Production of PT Krakatau Steel (Persero Tbk Cilegon. The data were collected through cluster sampling technique. Instrument used are  organizational culture scale, and work discipline scale. Data were  analized using correlational test regression analysis technique. The result show that there is significant correlation of organizational culture for employee work discipline at Directorate Production PT Krakatau Steel (Persero Tbk Cilegon. It is shown by correlation coefficient of regression analysis as R=0,534, with effective contribution R square (R2= 0,285 or 28,5%, and significance level p = 0,000. Thus, it proves the hypothesis in this research is accepted.

  14. 30 CFR 285.607 - How do I submit my SAP?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How do I submit my SAP? 285.607 Section 285.607... Assessment Plan and Information Requirements for Commercial Leases § 285.607 How do I submit my SAP? You must submit one paper copy and one electronic version of your SAP to MMS at the address listed in § 285.110(a). ...

  15. Dicty_cDB: VHI285 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHI285 (Link to dictyBase) - - - Contig-U16073-1 - (Link to Or...iginal site) VHI285F 136 - - - - - - Show VHI285 Library VH (Link to library) Clone ID VHI285 (Link to dicty...Base) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U16073-1 Original site URL http://dictycdb.b... DNA Score E Sequences producing significant alignments: (bits) Value N ( BJ423035 ) Dict...yostelium discoideum cDNA clone:ddv47i22, 5' ... 72 2e-27 3 ( BJ419916 ) Dictyostelium discoideum cD

  16. Annealing effect on restoration of irradiation steel properties

    International Nuclear Information System (INIS)

    Vishkarev, O.M.; Kolesova, T.N.; Myasnikova, K.P.; Pecherin, A.M.; Shamardin, V.K.

    1986-01-01

    The effect of temperature and annealing time on the restoration of properties of the 15Kh2NMFAA and 15Kh2MFA steels after irradiation at 285 deg with the fluence of 6x10 23 neutr/m 2 (E>0.5 MeV) is studied. Microhardness (H μ ) restoration in the irradiated 15Kh2NMFAA steel is shown to start from 350 deg C annealing temperature. The complete microhardness restoration is observed at the annealing temperature of 500 deg C for 10 hours

  17. 30 CFR 285.1000 - What activities does this subpart regulate?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What activities does this subpart regulate? 285.1000 Section 285.1000 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR... Activities § 285.1000 What activities does this subpart regulate? (a) This subpart provides the general...

  18. 30 CFR 285.613 - How will MMS process my SAP?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will MMS process my SAP? 285.613 Section... Requirements Contents of the Site Assessment Plan § 285.613 How will MMS process my SAP? (a) The MMS will review your submitted SAP, and additional information provided pursuant to § 285.611, to determine if it...

  19. 30 CFR 285.628 - How will MMS process my COP?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will MMS process my COP? 285.628 Section... Requirements Contents of the Construction and Operations Plan § 285.628 How will MMS process my COP? (a) The MMS will review your submitted COP, and the information provided pursuant to § 285.627, to determine...

  20. 30 CFR 285.907 - How will MMS process my decommissioning application?

    Science.gov (United States)

    2010-07-01

    ... application? 285.907 Section 285.907 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY ALTERNATE USES OF EXISTING FACILITIES ON THE OUTER CONTINENTAL SHELF Decommissioning Decommissioning Applications § 285.907 How will MMS process my decommissioning application? (a...

  1. 30 CFR 285.534 - When may MMS cancel my bond?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false When may MMS cancel my bond? 285.534 Section 285.534 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE... Assurance Requirements Changes in Financial Assurance § 285.534 When may MMS cancel my bond? When your lease...

  2. 30 CFR 285.905 - When must I submit my decommissioning application?

    Science.gov (United States)

    2010-07-01

    ... application? 285.905 Section 285.905 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY ALTERNATE USES OF EXISTING FACILITIES ON THE OUTER CONTINENTAL SHELF Decommissioning Decommissioning Applications § 285.905 When must I submit my decommissioning application? You must...

  3. 21 CFR 137.285 - Degerminated yellow corn meal.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Degerminated yellow corn meal. 137.285 Section 137... Cereal Flours and Related Products § 137.285 Degerminated yellow corn meal. Degerminated yellow corn meal, degermed yellow corn meal, conforms to the definition and standard of identity prescribed by § 137.265 for...

  4. 18 CFR 284.285 - Pregrant of abandonment of unbundled sales services.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Pregrant of abandonment of unbundled sales services. 284.285 Section 284.285 Conservation of Power and Water Resources... Sales by Interstate Pipelines § 284.285 Pregrant of abandonment of unbundled sales services. Abandonment...

  5. 30 CFR 285.202 - What types of leases will MMS issue?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What types of leases will MMS issue? 285.202 Section 285.202 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE... Renewable Energy Leases General Lease Information § 285.202 What types of leases will MMS issue? The MMS may...

  6. 30 CFR 285.543 - Example of how the inverse distance formula works.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Example of how the inverse distance formula works. 285.543 Section 285.543 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR... Financial Assurance Requirements Revenue Sharing with States § 285.543 Example of how the inverse distance...

  7. 30 CFR 285.1016 - When will an Alternate Use RUE be cancelled?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false When will an Alternate Use RUE be cancelled? 285.1016 Section 285.1016 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR... Rue Administration § 285.1016 When will an Alternate Use RUE be cancelled? The Secretary may cancel an...

  8. 41 CFR 102-117.285 - What are my choices if a TSP's performance is not satisfactory?

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false What are my choices if a TSP's performance is not satisfactory? 102-117.285 Section 102-117.285 Public Contracts and Property... are my choices if a TSP's performance is not satisfactory? You may choose to place a TSP in temporary...

  9. 30 CFR 285.614 - When may I begin conducting activities under my approved SAP?

    Science.gov (United States)

    2010-07-01

    ... approved SAP? 285.614 Section 285.614 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE... Plans and Information Requirements Activities Under An Approved Sap § 285.614 When may I begin conducting activities under my approved SAP? (a) You may begin conducting the activities approved in your SAP...

  10. 30 CFR 285.606 - What must I demonstrate in my SAP?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What must I demonstrate in my SAP? 285.606 Section 285.606 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE... demonstrate in my SAP? (a) Your SAP must demonstrate that you have planned and are prepared to conduct the...

  11. 30 CFR 285.222 - What does MMS do with my bid?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What does MMS do with my bid? 285.222 Section... Energy Leases Competitive Lease Award Process § 285.222 What does MMS do with my bid? (a) If sealed... any proposal submitted will be made by a panel composed of members selected by MMS. The details of the...

  12. 30 CFR 285.810 - What must I include in my Safety Management System?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What must I include in my Safety Management System? 285.810 Section 285.810 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR..., COPs and GAPs Safety Management Systems § 285.810 What must I include in my Safety Management System...

  13. 30 CFR 285.224 - What happens if MMS accepts my bid?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What happens if MMS accepts my bid? 285.224... Renewable Energy Leases Competitive Lease Award Process § 285.224 What happens if MMS accepts my bid? If we... withdraw an OCS area in which we have held a lease sale before you and MMS execute the lease in that area...

  14. 30 CFR 285.605 - What is a Site Assessment Plan (SAP)?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What is a Site Assessment Plan (SAP)? 285.605... Assessment Plan (SAP)? (a) A SAP describes the activities (e.g., installation of meteorological towers... project easement, or to test technology devices. (1) Your SAP must describe how you will conduct your...

  15. 30 CFR 285.436 - Can MMS require lease or grant contraction?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Can MMS require lease or grant contraction? 285... Administration Lease Or Grant Contraction § 285.436 Can MMS require lease or grant contraction? At an interval no more frequent than every 5 years, the MMS may review your lease or grant area to determine whether the...

  16. 30 CFR 285.437 - When can my lease or grant be canceled?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false When can my lease or grant be canceled? 285.437... Administration Lease Or Grant Cancellation § 285.437 When can my lease or grant be canceled? (a) The Secretary will cancel any lease or grant issued under this part upon proof that it was obtained by fraud or...

  17. 30 CFR 285.620 - What is a Construction and Operations Plan (COP)?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What is a Construction and Operations Plan (COP... Information Requirements Construction and Operations Plan for Commercial Leases § 285.620 What is a Construction and Operations Plan (COP)? The COP describes your construction, operations, and conceptual...

  18. 30 CFR 285.610 - What must I include in my SAP?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What must I include in my SAP? 285.610 Section... Requirements Contents of the Site Assessment Plan § 285.610 What must I include in my SAP? Your SAP must... SAP, you must provide the following information: ER29AP09.115 (b) You must provide the results of...

  19. 24 CFR 234.285 - Waived title objections.

    Science.gov (United States)

    2010-04-01

    ... have not been violated to a material extent. (f) Federal tax liens and rights of redemption arising... Commissioner will not object to an outstanding right of redemption in IRS if: (1) The Federal tax lien was... CONDOMINIUM OWNERSHIP MORTGAGE INSURANCE Contract Rights and Obligations-Individually Owned Units § 234.285...

  20. 30 CFR 285.700 - What reports must I submit to MMS before installing facilities described in my approved SAP, COP...

    Science.gov (United States)

    2010-07-01

    ... installing facilities described in my approved SAP, COP, or GAP? 285.700 Section 285.700 Mineral Resources... § 285.700 What reports must I submit to MMS before installing facilities described in my approved SAP... in your approved COP (§ 285.632(a)) and, when required by this part, your SAP (§ 285.614(b)) or GAP...

  1. 30 CFR 285.913 - What happens if I fail to comply with my approved decommissioning application?

    Science.gov (United States)

    2010-07-01

    ... approved decommissioning application? 285.913 Section 285.913 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY ALTERNATE USES OF EXISTING FACILITIES ON THE OUTER CONTINENTAL SHELF Decommissioning Compliance with An Approved Decommissioning Application § 285.913 What...

  2. 31 CFR 285.1 - Collection of past-due support by administrative offset.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Collection of past-due support by administrative offset. 285.1 Section 285.1 Money and Finance: Treasury Regulations Relating to Money and Finance... include current basic pay, special pay, incentive pay, retainer pay, overtime, or in the case of an...

  3. The Effects of Shallow Cryogenic Process On The Mechanical Properties of AISI 4140 Steel

    Directory of Open Access Journals (Sweden)

    Eşref KIZILKAYA

    2018-03-01

    Full Text Available In this study, shallow cryogenic treatments were carried out for various holding time to AISI 4140 steel and the effects of heat treatment parameters on wear behavior, impact strength and tensile strength were investigated. Three different holding times were used for cryogenic heat treatments. After the cryogenic process, single tempering was applied. In addition, the abrasion tests were carried out at three different forces (5N, 10N and 15N at a constant slip speed (3.16 m / s and at three different slip distances (95 m, 190 m, 285 m. It has been determined that the shallow cryogenic process parameters significantly influence the mechanical properties of the AISI 4140 steel as a result of experimental studies., Low heat treatment times in cryogenic heat treatment have been found to have a positive effect on many mechanical properties, especially wear. The mechanical properties of the AISI 4140 steel can be optimized by controlling the shallow cryogenic heat treatment parameters.

  4. 30 CFR 285.617 - What activities require a revision to my SAP, and when will MMS approve the revision?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What activities require a revision to my SAP, and when will MMS approve the revision? 285.617 Section 285.617 Mineral Resources MINERALS MANAGEMENT...: (1) Designed not to cause undue harm or damage to natural resources; life (including human and...

  5. 14 CFR 125.285 - Pilot qualifications: Recent experience.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Pilot qualifications: Recent experience... Requirements § 125.285 Pilot qualifications: Recent experience. (a) No certificate holder may use any person, nor may any person serve, as a required pilot flight crewmember unless within the preceding 90...

  6. 30 CFR 285.902 - What are the general requirements for decommissioning for facilities authorized under my SAP, COP...

    Science.gov (United States)

    2010-07-01

    ... decommissioning for facilities authorized under my SAP, COP, or GAP? 285.902 Section 285.902 Mineral Resources... SAP, COP, or GAP? (a) Except as otherwise authorized by MMS under § 285.909, within 2 years following... under your SAP, COP, or GAP, you must submit a decommissioning application and receive approval from the...

  7. 30 CFR 285.615 - What other reports or notices must I submit to MMS under my approved SAP?

    Science.gov (United States)

    2010-07-01

    ... MMS under my approved SAP? 285.615 Section 285.615 Mineral Resources MINERALS MANAGEMENT SERVICE... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 285.615 What other reports or notices must I submit to MMS under my approved SAP? (a) You must notify MMS in writing within...

  8. Genotyping of Global Yersinia Pestis Isolates by Using IS285

    National Research Council Canada - National Science Library

    Bobrov, A. G; Huang, X.-Z; Garcia, E; Lindler, L. E; Filippov, A. A

    2006-01-01

    .... We come to conclusion that a mobile genetic element, IS285, is one of the most powerful molecular tools allowing to trace the circulation of epidemic clones and to detect their geographical/animal origin.

  9. Thermoelectric Properties of Cu-Doped n-Type Bi2Te2.85Se0.15 Prepared by Liquid Phase Growth Using a Sliding Boat

    Science.gov (United States)

    Kitagawa, Hiroyuki; Matsuura, Tsukasa; Kato, Toshihito; Kamata, Kin-ya

    2015-06-01

    N-type Bi2Te2.85Se0.15 thermoelectric materials were prepared by liquid phase growth (LPG) using a sliding boat, a simple and short fabrication process for Bi2Te3-related materials. Cu was selected as a donor dopant, and its effect on thermoelectric properties was investigated. Thick sheets and bars of Cu x Bi2 Te2.85Se0.15 ( x=0-0.25) of 1-2mm in thickness were obtained using the process. X-ray diffraction patterns and scanning electron micrographs showed that the in-plane direction tended to correspond to the hexagonal c-plane, which is the preferred direction for thermoelectric conversion. Cu-doping was effective in controlling conduction type and carrier (electron) concentration. The conduction type was p-type for undoped Bi2Te2.85Se0.15 and became n-type after Cu-doping. The Hall carrier concentration was increased by Cu-doping. Small resistivity was achieved in Cu0.02Bi2Te2.85Se0.15 owing to an optimized amount of Cu-doping and high crystal orientation. As a result, the maximum power factor near 310K for Cu0.02Bi2Te2.85Se0.15 was approximately 4×10-3W/K2m and had good reproducibility. Furthermore, the thermal stability of Cu0.02Bi2Te2.85Se0.15 was also confirmed by thermal cycling measurements of electrical resistivity. Thus, n-type Bi2Te2.85Se0.15 with a large power factor was prepared using the present LPG process.

  10. The miRNA Pull Out Assay as a Method to Validate the miR-28-5p Targets Identified in Other Tumor Contexts in Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Milena Rizzo

    2017-01-01

    Full Text Available miR-28-5p is an intragenic miRNA which is underexpressed in several tumor types showing a tumor suppressor (TS activity. Routinely, the known miR-28-5p targets are validated in specific tumor contexts but it is unclear whether these targets are also being regulated in other tumor types. To this end, we adopted the miRNA pull out assay to capture the miR-28-5p targets in DU-145 prostate cancer (PCa cells. Firstly, we demonstrated that miR-28-5p acts as a TS-miRNA in PCa, affecting cell proliferation, survival, and apoptosis. Secondly, we evaluated the enrichment of the 10 validated miR-28-5p targets in the pull out sample. We showed that E2F6, TEX-261, MAPK1, MPL, N4BP1, and RAP1B but not BAG1, OTUB1, MAD2L1, and p21 were significantly enriched, suggesting that not all the miR-28-5p targets are regulated by this miRNA in PCa. We then verified whether the miR-28-5p-interacting targets were regulated by this miRNA. We selected E2F6, the most enriched target in the pull out sample, and demonstrated that miR-28-5p downregulated E2F6 at the protein level suggesting that our approach was effective. In general terms, these findings support the miRNA pull out assay as a useful method to identify context-specific miRNA targets.

  11. 30 CFR 285.116 - Requests for information on the state of the offshore renewable energy industry.

    Science.gov (United States)

    2010-07-01

    ... offshore renewable energy industry. 285.116 Section 285.116 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY ALTERNATE USES OF EXISTING FACILITIES ON THE OUTER... the state of the offshore renewable energy industry, including the identification of potential...

  12. 30 CFR 285.612 - How will my SAP be processed for Federal consistency under the Coastal Zone Management Act?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will my SAP be processed for Federal consistency under the Coastal Zone Management Act? 285.612 Section 285.612 Mineral Resources MINERALS... Plan § 285.612 How will my SAP be processed for Federal consistency under the Coastal Zone Management...

  13. 30 CFR 285.647 - How will my GAP be processed for Federal consistency under the Coastal Zone Management Act?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will my GAP be processed for Federal consistency under the Coastal Zone Management Act? 285.647 Section 285.647 Mineral Resources MINERALS... Activities Plan § 285.647 How will my GAP be processed for Federal consistency under the Coastal Zone...

  14. 27 CFR 25.285 - Refund of beer tax excessively paid.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Refund of beer tax... TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS BEER Refund or Adjustment of Tax or Relief From Liability § 25.285 Refund of beer tax excessively paid. (a) Eligibility. A brewer who, under the provisions...

  15. MiR-285 targets P450 (CYP6N23) to regulate pyrethroid resistance in Culex pipiens pallens.

    Science.gov (United States)

    Tian, Mengmeng; Liu, Bingqian; Hu, Hongxia; Li, Xixi; Guo, Qin; Zou, Feifei; Liu, Xianmiao; Hu, Mengxue; Guo, Juxin; Ma, Lei; Zhou, Dan; Sun, Yan; Shen, Bo; Zhu, Changliang

    2016-12-01

    MicroRNAs play critical roles in post-transcriptional regulation of gene expression, which participate in the modulation of almost all of the cellular processes. Although emerging evidence indicates that microRNAs are related with antineoplastic drugs resistance, whether microRNAs are responsible for insecticide resistance in mosquitos is poorly understood. In this paper, we found that miR-285 was significantly upregulated in the deltamethrin-resistant strain of Culex pipiens pallens, and overexpression miR-285 through microinjection increased mosquito survival rate against deltamethrin treatement. Using bioinformatic software, quantitative reverse transcription PCR, luciferase reporter assay and microinjection approaches, we conformed that CYP6N23 was the target of miR-285. Lower expression of CYP6N23 was observed in the deltamethrin-resistant strain. While, mosquito mortality rate was decreased after downregulating expression of CYP6N23 by dsRNA against CYP6N23 or miR-285 mimic microinjection. These findings revealed that miR-285 could target CYP6N23 to regulate pyrethroid resistance, providing new insights into mosquito insecticide resistance surveillance and control.

  16. 30 CFR 285.906 - What must my decommissioning application include?

    Science.gov (United States)

    2010-07-01

    ... OFFSHORE RENEWABLE ENERGY ALTERNATE USES OF EXISTING FACILITIES ON THE OUTER CONTINENTAL SHELF Decommissioning Decommissioning Applications § 285.906 What must my decommissioning application include? You must... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What must my decommissioning application...

  17. 21 CFR 1.285 - What happens to food that is imported or offered for import from unregistered facilities that are...

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false What happens to food that is imported or offered....285 Section 1.285 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL GENERAL ENFORCEMENT REGULATIONS Prior Notice of Imported Food Consequences § 1.285 What happens to...

  18. 30 CFR 285.508 - What rent payments must I pay on ROW grants or RUE grants associated with renewable energy projects?

    Science.gov (United States)

    2010-07-01

    ... RUE grants associated with renewable energy projects? 285.508 Section 285.508 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY ALTERNATE USES OF... § 285.508 What rent payments must I pay on ROW grants or RUE grants associated with renewable energy...

  19. 30 CFR 285.710 - When conducting onsite installation inspections, what must the CVA or project engineer do?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false When conducting onsite installation inspections, what must the CVA or project engineer do? 285.710 Section 285.710 Mineral Resources MINERALS MANAGEMENT...: (1) Loadout and initial flotation procedures; (2) Towing operation procedures to the specified...

  20. MDM2 SNP309 and SNP285 Act as Negative Prognostic Markers for Non-small Cell Lung Cancer Adenocarcinoma Patients

    Science.gov (United States)

    Deben, Christophe; Op de Beeck, Ken; Van den Bossche, Jolien; Jacobs, Julie; Lardon, Filip; Wouters, An; Peeters, Marc; Van Camp, Guy; Rolfo, Christian; Deschoolmeester, Vanessa; Pauwels, Patrick

    2017-01-01

    Objectives: Two functional polymorphisms in the MDM2 promoter region, SNP309T>G and SNP285G>C, have been shown to impact MDM2 expression and cancer risk. Currently available data on the prognostic value of MDM2 SNP309 in non-small cell lung cancer (NSCLC) is contradictory and unavailable for SNP285. The goal of this study was to clarify the role of these MDM2 SNPs in the outcome of NSCLC patients. Materials and Methods: In this study we genotyped SNP309 and SNP285 in 98 NSCLC adenocarcinoma patients and determined MDM2 mRNA and protein levels. In addition, we assessed the prognostic value of these common SNPs on overall and progression free survival, taking into account the TP53 status of the tumor. Results and Conclusion: We found that the SNP285C allele, but not the SNP309G allele, was significantly associated with increased MDM2 mRNA expression levels (p = 0.025). However, we did not observe an association with MDM2 protein levels for SNP285. The SNP309G allele was significantly associated with the presence of wild type TP53 (p = 0.047) and showed a strong trend towards increased MDM2 protein levels (p = 0.068). In addition, patients harboring the SNP309G allele showed a worse overall survival, but only in the presence of wild type TP53. The SNP285C allele was significantly associated with an early age of diagnosis and metastasis. Additionally, the SNP285C allele acted as an independent predictor for worse progression free survival (HR = 3.97; 95% CI = 1.51 - 10.42; p = 0.005). Our data showed that both SNP309 (in the presence of wild type TP53) and SNP285 act as negative prognostic markers for NSCLC patients, implicating a prominent role for these variants in the outcome of these patients. PMID:28819417

  1. 30 CFR 285.659 - What requirements must I include in my SAP, COP, or GAP regarding air quality?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What requirements must I include in my SAP, COP, or GAP regarding air quality? 285.659 Section 285.659 Mineral Resources MINERALS MANAGEMENT SERVICE... must I include in my SAP, COP, or GAP regarding air quality? (a) You must comply with the Clean Air Act...

  2. 49 CFR 192.285 - Plastic pipe: Qualifying persons to make joints.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 3 2010-10-01 2010-10-01 false Plastic pipe: Qualifying persons to make joints... Materials Other Than by Welding § 192.285 Plastic pipe: Qualifying persons to make joints. (a) No person may make a plastic pipe joint unless that person has been qualified under the applicable joining procedure...

  3. Ergonomic assessment of brake and accelerator mechanisms of MF285 and MF399 tractors using electromyography method

    Directory of Open Access Journals (Sweden)

    A Nikkhah

    2016-04-01

    Full Text Available Introduction: Too many people are working in the agricultural sector and therefore, pay more attention to the safety and health at work in the agricultural sector is important. This issue is more important in developing industrial countries where the level of the ergonomic working condition is less than that of developed countries. Attention to ergonomic condition of agricultural machinery drivers is one of the goals of agricultural mechanization. Therefore, in this study the ergonomic conditions of brake and accelerator mechanisms for MF285 and MF399 tractor's drivers were investigated using a new method. Materials and Methods: 25 people were selected for experiment. The electrical activity of Medialis gastrocnemius, Lateralis gastrocnemius, Vastus medialis, Vastus lateralis, Quadratus Lumborum and Trapezius muscles of drivers before and during pressing the pedal and after rest time were recorded using Biovision device. Measurements were performed for each person on each muscle 30 seconds before pressing the pedal, 60 seconds after pressing the pedal and after 60 seconds of rest. For all drivers, the muscles on the right side (brake and accelerator side have been selected and tested. The measurements were performed in compliance with appropriate time intervals between the measurements. Results and Discussion: Ergonomic assessment of brake pedal: The results showed that the RMS electrical activity of muscles of Vastus medialis and Medial gastrocnemius, during 60 seconds braking were 2.47 and 1.97. So, Vastus medialis and Medial gastrocnemius had the highest stress during pressing the MF399 tractor's brake pedal. Moreover, the Medial gastrocnemius and Lateral gastrocnemius with RMS electrical activity ratio of 2.47 and 1.74 had the highest RMS electrical activity ratio respectively, during 60 seconds braking compared to before braking of MF285 tractor. The comparison of results showed that the Vastus medialis and Trapezius had the higher stress

  4. Fabrication and Thermoelectric Properties of n-Type CoSb2.85Te0.15 Using Selective Laser Melting.

    Science.gov (United States)

    Yan, Yonggao; Ke, Hongquan; Yang, Jihui; Uher, Ctirad; Tang, Xinfeng

    2018-04-25

    We report a nonequilibrium fabrication method of n-type CoSb 2.85 Te 0.15 skutterudites using selective laser melting (SLM) technology. A powder of CoSb 2.85 Te 0.15 was prepared by self-propagating high-temperature synthesis (SHS) and served as the raw material for the SLM process. The effect of SLM processing parameters such as the laser power and scanning speed on the quality of the forming CoSb 2.85 Te 0.15 thin layers was systematically analyzed, and the optimal processing window for SLM was determined. A brief postannealing at 450 °C for 4 h, following the SLM process, has resulted in a phase-pure CoSb 2.85 Te 0.15 bulk material deposited on a Ti substrate. The Seebeck coefficient of the annealed SLM prepared bulk material is close to that of the sample prepared by the traditional sintering method, and its maximum ZT value reached 0.56 at 823 K. Moreover, a Ti-Co-Sb ternary compound transition layer of about 70 μm in thickness was found at a dense interface between CoSb 2.85 Te 0.15 and the Ti substrate. The contact resistivity was measured as 37.1 μΩcm 2 . The results demonstrate that SLM, coupled with postannealing, can be used for fabrication of incongruently melting skutterudite compounds on heterogeneous substrates. This lays an important foundation for the follow-up research utilizing energy efficient SHS and SLM processes in rapid printing of thermoelectric modules.

  5. 30 CFR 285.102 - What are MMS's responsibilities under this part?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What are MMS's responsibilities under this part... Provisions § 285.102 What are MMS's responsibilities under this part? (a) The MMS will ensure that any..., monitoring, and enforcement of activities authorized by a lease or grant under this part. (b) The MMS will...

  6. 30 CFR 285.821 - Will MMS conduct scheduled and unscheduled inspections?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Will MMS conduct scheduled and unscheduled..., COPs and GAPs Inspections and Assessments § 285.821 Will MMS conduct scheduled and unscheduled inspections? The MMS will conduct both scheduled and unscheduled inspections. ...

  7. Ergonomic assessment of drivers in MF285 and MF399 tractors during clutching using algometer

    Directory of Open Access Journals (Sweden)

    Hossein Fallahi

    2016-03-01

    The results showed that the clutching forces for MF285 and MF399 tractors were 340 N and 290 N, respectively. The knee angle of the drivers of the two tractors was statistically different at the one percent level of significance. The reduction of pain threshold after 30 and 60 s clutching and also 60 s rest after clutching in MF285 tractor, for all three muscles, were more than those of MF399 tractor. The impact of clutching on the average decreases of pain threshold, for all drivers and all clutching periods, during and after clutching, in the Quadratus lumborum muscle was more than the other two muscles, in both tractors. In order to reduce the clutching force for MF285 tractor some modifications is suggested. In this regard the force transfer joint between the pedal and the clutch release linkage may be replaced with one made of cast iron.

  8. 30 CFR 285.109 - When must I notify MMS of mergers, name changes, or changes of business form?

    Science.gov (United States)

    2010-07-01

    ... business form? You must notify MMS in writing of any merger, name change, or change of business form. You must notify MMS as soon as practicable following the merger, name change, or change in business form..., or changes of business form? 285.109 Section 285.109 Mineral Resources MINERALS MANAGEMENT SERVICE...

  9. 30 CFR 285.540 - How will MMS equitably distribute revenues to States?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will MMS equitably distribute revenues to... Financial Assurance Requirements Revenue Sharing with States § 285.540 How will MMS equitably distribute revenues to States? (a) The MMS will distribute among the eligible coastal States 27 percent of the...

  10. 30 CFR 285.210 - How does MMS initiate the competitive leasing process?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How does MMS initiate the competitive leasing... OCS Renewable Energy Leases Competitive Lease Process § 285.210 How does MMS initiate the competitive leasing process? The MMS may publish in the Federal Register a public notice of Request for Interest to...

  11. Heat treatments in a conventional steel to reproduce the microstructure of a nuclear grade steel

    International Nuclear Information System (INIS)

    Rosalio G, M.

    2014-01-01

    The ferritic steels used in the manufacture of pressurized vessels of Boiling Water Reactors (BWR) suffer degradation in their mechanical properties due to damage caused by the neutron fluxes of high energy bigger to a Mega electron volt (E> 1 MeV) generated in the reactor core. The materials with which the pressurized vessels of nuclear reactors cooled by light water are built correspond to low alloy ferritic steels. The effect of neutron irradiation on these steels is manifested as an increase in hardness, mechanical strength, with the consequent decrease in ductility, fracture toughness and an increase in temperature of ductile-brittle transition. The life of a BWR is 40 years, its design must be considered sufficient margin of safety because pressure forces experienced during operation, maintenance and testing of postulated accident conditions. It is necessary that under these conditions the vessel to behave ductile and likely to propagate a fracture is minimized. The vessels of light water nuclear reactors have a bainite microstructure. Specifically, the reactor vessels of the nuclear power plant of Laguna Verde (Veracruz, Mexico) are made of a steel Astm A-533, Grade B Class 1. At present they are carrying out some welding tests for the construction of a model of a BWR, however, to use nuclear grade steel such as Astm A-533 to carry out some of the welding tests, is very expensive; perform these in a conventional material provides basic information. Although the microstructure present in the conventional material does not correspond exactly to the degree of nuclear material, it can take of reference. Therefore, it is proposed to conduct a pilot study to establish the thermal treatment that reproduces the microstructure of nuclear grade steel, in conventional steel. The resulting properties of the conventional steel samples will be compared to a JRQ steel, that is a steel Astm A-533, Grade B Class 1, provided by IAEA. (Author)

  12. A comparison of the iraddiated tensile properties of a high-manganese austenitic steel and type 316 stainless steel

    International Nuclear Information System (INIS)

    Klueh, R.L.; Grossbeck, M.L.

    1984-01-01

    The USSR steel EP-838 is a high-manganese, low-nickel steel that also has lower chromium and molybdenum than type 316 stainless steel. Tensile specimens of 20%-cold-worked EP-838 and type 316 stainless steel were irradiated in the High Flux Isotope Reactor (HFIR) at the coolant temperature (approx.=50 0 C). A displacement damage level of 5.2 dpa was reached for the EP-838 and up to 9.5 dpa for the type 316 stainless steel. Tensile tests at room temperature and 300 0 C on the two steels indicated that the irradiation led to increased strength and decreased ductility compared to the unirradiated steels. Although the 0.2% yield stress of the type 316 stainless steel in the unirradiated condition was greater than that for the EP-838, after irradiation there was essentially no difference between the strength or ductility of the two steels. The results indicate that the replacement of the majority of the nickel by manganese and a reduction of chromium and molybdenum in an austenitic stainless steel of composition near that for type 316 stainless steel has little effect on the irradiated and unirradiated tensile properties at low temperatures. (orig.)

  13. STEFINS: a steel freezing integral simulation program

    International Nuclear Information System (INIS)

    Frank, M.V.

    1980-09-01

    STEFINS (STEel Freezing INtegral Simulation) is a computer program for the calculation of the rate of solidification of molten steel on solid steel. Such computations arize when investigating core melt accidents in fast reactors. In principle this problem involves a coupled two-dimensional thermal and hydraulic approach. However, by physically reasonable assumptions a decoupled approach has been developed. The transient solidification of molten steel on a cold wall is solved in the direction normal to the molten steel flow and independent from the solution for the molten steel temperature and Nusselt number along the direction of flow. The solutions to the applicable energy equations have been programmed in cylindrical and slab geometries. Internal gamma heating of steel is included

  14. Anodic Protection performance of Steels ASTM A 516-60 And JIS G 3131 SPHC In Concentrated Sulfuric Acid

    International Nuclear Information System (INIS)

    Harsisto; Ginting, Immanuel; Eddy, D.C

    2001-01-01

    One of the methods to protect a carbon steel material from corrosion attack of sulfuric acid environment is with anodic protection. This research was intended to investigate the effect of anodic protection quickened with potential polarization, The material under investigation were ASTM A 516 and JIS G 3131-SPHC in highly concentrated H 2 SO 4 solution. The results showed that potential that was effective for anodic protection in ASTM A 516-60 were at 236-436 mV for 75%, 276-476 mV for 80%, 264-514 mV for 85%,285-485 mV for 90%, and 231-431 mV for 97% H 2 SO 4 so that in JlS G 3131-SPHC were at 303 -503 mV for 75%, 290-490 mV for 80%, 269- 516 mV for 85%, 264-514 mV for 90%, and 287 -487 mV for 97% H 2 SO 4

  15. 30 CFR 285.103 - When may MMS prescribe or approve departures from these regulations?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false When may MMS prescribe or approve departures... CONTINENTAL SHELF General Provisions § 285.103 When may MMS prescribe or approve departures from these regulations? (a) The MMS may prescribe or approve departures from these regulations when departures are...

  16. Data for a steel industry model

    OpenAIRE

    Mæstad, Ottar

    2000-01-01

    SNF has recently developed a new model of the steel market and some of the major factor markets connected to the steel industry. The aim of the model has been to study how regulations of the emissions of carbon dioxide (CO2) in the steel industry might affect the structure of the industry. It has also been an objective to investigate how structural changes in the steel industry might influence on the industry’s demand for transport services. This paper outlines the details about the data that...

  17. The miRNA Pull Out Assay as a Method to Validate the miR-28-5p Targets Identified in Other Tumor Contexts in Prostate Cancer

    DEFF Research Database (Denmark)

    Rizzo, Milena; Berti, Gabriele; Russo, Francesco

    2017-01-01

    targets in the pull out sample. We showed that E2F6, TEX-261, MAPK1, MPL, N4BP1, and RAP1B but not BAG1, OTUB1, MAD2L1, and p21 were significantly enriched, suggesting that not all the miR-28-5p targets are regulated by this miRNA in PCa. We then verified whether the miR-28-5p-interacting targets were...

  18. DETERMINANTS OF RETAINED EARNINGS IN PROFITABLE STEEL COMPANIES IN INDIA: A STUDY OF STEEL SECTOR

    OpenAIRE

    Dr. Sohaib Masood

    2018-01-01

    In this paper an attempt has been made to identify the important determinants of retained earnings in profitable steel companies in steel sector of India and which have impact on the retention of earnings of steel companies under study. Multiple linear regression is used to identify the determinants of retained earnings for a period of sixteen years. Also the importance of retained earnings as a source of finance for steel sector companies is also studied in the paper.

  19. A Tale of Wootz Steel

    Indian Academy of Sciences (India)

    manufacture of steel in south India by a crucible process at ... indicates that the production of wootz steel was almost on an industrial scale in ... in an Age of Design marked by ... The Russian Anasoff also studied the process of manufacturing.

  20. Steel making

    CERN Document Server

    Chakrabarti, A K

    2014-01-01

    "Steel Making" is designed to give students a strong grounding in the theory and state-of-the-art practice of production of steels. This book is primarily focused to meet the needs of undergraduate metallurgical students and candidates for associate membership examinations of professional bodies (AMIIM, AMIE). Besides, for all engineering professionals working in steel plants who need to understand the basic principles of steel making, the text provides a sound introduction to the subject.Beginning with a brief introduction to the historical perspective and current status of steel making together with the reasons for obsolescence of Bessemer converter and open hearth processes, the book moves on to: elaborate the physiochemical principles involved in steel making; explain the operational principles and practices of the modern processes of primary steel making (LD converter, Q-BOP process, and electric furnace process); provide a summary of the developments in secondary refining of steels; discuss principles a...

  1. Laser cutting of thick steel plates and simulated steel components using a 30 kW fiber laser

    International Nuclear Information System (INIS)

    Tamura, Koji; Ishigami, Ryoya; Yamagishi, Ryuichiro

    2016-01-01

    Laser cutting of thick steel plates and simulated steel components using a 30 kW fiber laser was studied for application to nuclear decommissioning. Successful cutting of carbon steel and stainless steel plates up to 300 mm in thickness was demonstrated, as was that of thick steel components such as simulated reactor vessel walls, a large pipe, and a gate valve. The results indicate that laser cutting applied to nuclear decommissioning is a promising technology. (author)

  2. Aircraft Steels

    Science.gov (United States)

    2009-02-19

    component usage. PH 13-8Mo is a precipitation-hardenable martensitic stainless steel combining excellent corrosion resistance with strength. Custom 465 is...a martensitic , age-hardenable stainless steel capable of about 1,724 MPa (250 ksi) UTS when peak-aged (H900 condition). Especially, this steel can...NOTES 14. ABSTRACT Five high strength steels (4340, 300M, AerMet 100, Ferrium S53, and Hy-Tuf) and four stainless steels (High Nitrogen, 13

  3. 30 CFR 285.510 - May MMS reduce or waive my lease or grant payments?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false May MMS reduce or waive my lease or grant... Financial Assurance Requirements Payments § 285.510 May MMS reduce or waive my lease or grant payments? (a) The MMS Director may reduce or waive the rent or operating fee or components of the operating fee...

  4. A model for TRIP steel constitutive behaviour

    NARCIS (Netherlands)

    Perdahcioglu, Emin Semih; Geijselaers, Hubertus J.M.; Menari, G

    2011-01-01

    A constitutive model is developed for TRIP steel. This is a steel which contains three or four different phases in its microstructure. One of the phases in TRIP steels is metastable austenite (Retained Austenite) which transforms to martensite upon deformation. The accompanying transformation strain

  5. Microbial-Influenced Corrosion of Corten Steel Compared with Carbon Steel and Stainless Steel in Oily Wastewater by Pseudomonas aeruginosa

    Science.gov (United States)

    Mansouri, Hamidreza; Alavi, Seyed Abolhasan; Fotovat, Meysam

    2015-07-01

    The microbial corrosion behavior of three important steels (carbon steel, stainless steel, and Corten steel) was investigated in semi petroleum medium. This work was done in modified nutrient broth (2 g nutrient broth in 1 L oily wastewater) in the presence of Pseudomonas aeruginosa and mixed culture (as a biotic media) and an abiotic medium for 2 weeks. The behavior of corrosion was analyzed by spectrophotometric and electrochemical methods and at the end was confirmed by scanning electron microscopy. The results show that the degree of corrosion of Corten steel in mixed culture, unlike carbon steel and stainless steel, is less than P. aeruginosa inoculated medium because some bacteria affect Corten steel less than other steels. According to the experiments, carbon steel had less resistance than Corten steel and stainless steel. Furthermore, biofilm inhibits separated particles of those steels to spread to the medium; in other words, particles get trapped between biofilm and steel.

  6. 30 CFR 285.823 - Will MMS reimburse me for my expenses related to inspections?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Will MMS reimburse me for my expenses related... Conducted Under SAPs, COPs and GAPs Inspections and Assessments § 285.823 Will MMS reimburse me for my expenses related to inspections? Upon request, MMS will reimburse you for food, quarters, and...

  7. Observation of a meson X → 2γ, with mass 2.85 GeV/c2, produced in the charge-exchange reaction π-p→Xn at 40 Gev/c

    International Nuclear Information System (INIS)

    Apel, W.D.; Augenstein, K.H.; Bertolucci, E.; Donskov, S.V.; Inyakin, A.V.; Kachanov, V.A.; Krasnokutsky, R.N.; Kruger, M.; Leder, G.; Lednev, A.A.; Mannelli, I.; Mikhailov, Yu.V.; Mueller, H.; Pierazzini, G.M.; Prokoshkin, Yu.D.; Quaglia, M.; Schneider, H.; Scribano, A.; Sergiampietri, F.; Shuvalov, R.S.; Sigurdsson, G.; Toropin, A.N.; Vincelli, M.L.

    1978-01-01

    The invariant mass spectrum of neutral final states produced in π - p charge-exchange scattering at 40 GeV/c has been studied, searching for heavy particles decaying into 2γ. A peak is observed around 2.85 GeV/c 2 . The cross section of the reaction π - p→X(2.85)+n, times the branching ratio of the X→2γ decay, is measured to be sigma X BR approximately =2X10 -34 cm 2 . (Auth.)

  8. Observation and study of centrally produced pion clusters in 28.5-GeV/c p-p interactions

    International Nuclear Information System (INIS)

    Erwin, A.R.; Harvey, E.H.; Larson, G.P.; Collins, G.B.; Ficenec, J.R.; Stringfellow, B.C.; Trower, W.P.; Gutay, L.J.; Laasanen, A.; Willmann, R.B.; Anderson, E.W.; Fisher, G.P.; Lazuras, E.; von Lindern, L.; Ramanauskas, A.; Schubelin, P.; Thorndike, A.M.; Turkot, F.

    1976-01-01

    A double-arm spectrometer is used to identify a pion cluster produced in central p-p collisions at 28.5 GeV/c. Cluster properties studied are angular momentum, quantum statistics, multiplicity, and effective mass. There is some speculation on the production mechanism

  9. 42 CFR 137.285 - Are Self-Governance Tribes required to accept Federal environmental responsibilities to enter...

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Are Self-Governance Tribes required to accept..., DEPARTMENT OF HEALTH AND HUMAN SERVICES TRIBAL SELF-GOVERNANCE Construction Nepa Process § 137.285 Are Self-Governance Tribes required to accept Federal environmental responsibilities to enter into a construction...

  10. The Study on Weldability of Boron Steel and Hot-Stamped Steel by Using Laser Heat Source (Ⅲ) - Comparison on Laser Weldability of Boron Steel and Hot -Stamped Steel-

    Energy Technology Data Exchange (ETDEWEB)

    Choi, So Young; Kim, Jong Do [Korea Maritime and Ocean University, Busan (Korea, Republic of); Kim, Jong Su [Korea Institute of Machinery and Materials, Daejeon (Korea, Republic of)

    2015-01-15

    This study was conducted to compare the laser weldability of boron steel and hot-stamped steel. In general, boron steel is used in the hot-stamping process. Hot-stamping is a method for simultaneously forming and cooling boron steel in a press die after heating it to the austenitizing temperature. Hot-stamped steel has a strength of 1500 MPa or more. Thus, in this study, the laser weldability of boron steel and that of hot-stamped steel were investigated and compared. A continuous wave disk laser was used to produce butt and lap joints. In the butt welding, the critical cooling speed at which full penetration was obtained in the hot-stamped steel was lower than that of boron steel. In the lap welding, the joint widths were similar regardless of the welding speed when full penetration was obtained.

  11. The Study on Weldability of Boron Steel and Hot-Stamped Steel by Using Laser Heat Source (Ⅲ) - Comparison on Laser Weldability of Boron Steel and Hot -Stamped Steel-

    International Nuclear Information System (INIS)

    Choi, So Young; Kim, Jong Do; Kim, Jong Su

    2015-01-01

    This study was conducted to compare the laser weldability of boron steel and hot-stamped steel. In general, boron steel is used in the hot-stamping process. Hot-stamping is a method for simultaneously forming and cooling boron steel in a press die after heating it to the austenitizing temperature. Hot-stamped steel has a strength of 1500 MPa or more. Thus, in this study, the laser weldability of boron steel and that of hot-stamped steel were investigated and compared. A continuous wave disk laser was used to produce butt and lap joints. In the butt welding, the critical cooling speed at which full penetration was obtained in the hot-stamped steel was lower than that of boron steel. In the lap welding, the joint widths were similar regardless of the welding speed when full penetration was obtained

  12. 30 CFR 285.601 - When am I required to submit my plans to MMS?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false When am I required to submit my plans to MMS... Information Requirements § 285.601 When am I required to submit my plans to MMS? Your plan submission...) You must provide sufficient data and information with your COP for MMS to complete the needed reviews...

  13. Connections: Superplasticity, Damascus Steels, Laminated Steels, and Carbon Dating

    Science.gov (United States)

    Wadsworth, Jeffrey

    2016-12-01

    In this paper, a description is given of the connections that evolved from the initial development of a family of superplastic plain carbon steels that came to be known as Ultra-High Carbon Steels (UHCS). It was observed that their very high carbon contents were similar, if not identical, to those of Damascus steels. There followed a series of attempts to rediscover how the famous patterns found on Damascus steels blades were formed. At the same time, in order to improve the toughness at room temperature of the newly-developed UHCS, laminated composites were made of alternating layers of UHCS and mild steel (and subsequently other steels and other metals). This led to a study of ancient laminated composites, the motives for their manufacture, and the plausibility of some of the claims relating to the number of layers in the final blades. One apparently ancient laminated composite, recovered in 1837 from the great pyramid of Giza which was constructed in about 2750 B.C., stimulated a carbon dating study of ancient steels. The modern interest in "Bladesmithing" has connections back to many of these ancient weapons.

  14. Corrosion resistant steel

    International Nuclear Information System (INIS)

    Zubchenko, A.S.; Borisov, V.P.; Latyshev, V.B.

    1980-01-01

    Corrosion resistant steel for production of sheets and tubes containing C, Mn, Cr, Si, Fe is suggested. It is alloyed with vanadium and cerium for improving tensile properties and ductility. The steel can be melted by a conventional method in electric-arc or induction furnaces. The mentioned steel is intended to be used as a substitute for nickel-bearing austenitic steels

  15. Compactibility of atomized high-speed steel and steel 3 powders

    International Nuclear Information System (INIS)

    Kulak, L.D.; Gavrilenko, A.P.; Pikozh, A.P.; Kuz'menko, N.N.

    1985-01-01

    Spherical powders and powders of lammellar-scaly shape of high-speed R6M5K5 steel and steel 3 produced by the method of centrifugal atomization of a rotating billet under conditions of cold pressing in steel moulds are studied for thier compactability. Compacting pressure dependnences are establsihed for density of cold-pressed compacts of spherical and scaly powders. The powders of lammellar-scaly shape both of high-speed steel and steel 3 are found to possess better compactibility within a wide range of pressures as compared to powders of spherical shape. Compacts of the lammellar-scaly powders possess also higher mechanical strength

  16. Behavior of the elements in the mechanically alloyed and cast ferritic steels and a type 316 stainless steel in a flowing sodium environment

    International Nuclear Information System (INIS)

    Suzuki, T.; Mutoh, I.

    1988-01-01

    Sodium corrosion behavior of a mechanically alloyed ferritic steel, dispersion-strengthened with addition of Y 2 0 3 and Ti, two kinds of melted/cast ferritic steels and a Type 316 stainless steel was examined by using a non-isothermal sodium loop system, constructed of another Type 316 stainless steel, with a direct resistance electrical heater. The sodium conditions were 675 0 C, 4.0 m/s in velocity and 1-2 ppm oxygen concentration and a cumulative exposure time of the specimens was about 3000 h. The absorption of Ni and selective dissolution of Cr played an important role in the corrosion of the mechanically alloyed ferritic steel as in the case of the cast ferritic steels. However, the region of Ni absorption and Cr diminution was deeper than that of the cast ferritic steels. Peculiar finding for the mechanically alloyed ferritic steel was the corroded surface with irregularly shaped protuberance, that might be related with formation of sodium titanate, and the absorption of carbon and nitrogen to form carbide and nitride of titanium. It seems that these facts resulted in the irregular weight loss of the specimens, which depended on the downstream position and the cumulative exposure time. However, the tensile properties of the mechanically alloyed ferritic steel did not noticeably change by the sodium exposure

  17. Endolymphatic radiotherapy in malignant lymphomas. A clinical evaluation of 285 patients

    International Nuclear Information System (INIS)

    Bonadonna, G.; Chiappa, S.; Musumeci, R.; Uslenghi, C.

    1968-01-01

    The authors report treatment of inguinal and retroperitoneal lymph nodes of 285 malignant lymphomas (143 Hodgkin's disease and 142 lymphoreticular sarcomas) with Lipiodol Fluide 131 I (endolymphatic radiotherapy). From 1961 to 1966 the radioactive contrast material was injected in doses ranging from 0.2 to 2.5 mc/cc (10 cc each foot). Adequately opacified nodes responded promptly with marked and progressive reduction in size. When indicated, a second administration of Lipiodol 131 I in a dose of 2.5 mc/cc was always feasible. Several factors prevented a homogeneous and satisfactory distribution of radioactive contrast material throughout the iliac and the para-aortic nodes in one third of the cases. Therefore, in many instances patients had to be treated with external radiation therapy. Histopathologic examination of lymph nodes removed at exploratory laparotomy (four cases) or at autopsy (ten cases) confirmed that Lipiodol 131 I did not fill all the iliac and para-aortic nodes and that destruction of lymphomatous tissue was often incomplete. Recurrences were seen mostly in abnormal adequately filled nodes opacified with high doses of Lipiodol 131 I. In Hodgkin's disease they occurred particularly in the para-aortic area and in lymphoreticular sarcomas in the inguinal and iliac chains. Side effects were minimal. They included amenorrhea, pulmonary insufficiency, hepatic failure and hemolytic anemia. Clinical and histologic signs of pulmonary and hepatic fibrosis were not seen

  18. A methodology for replacement of conventional steel by microalloyed steel in bus tubular structures

    International Nuclear Information System (INIS)

    Cruz, Magnus G.H.; Viecelli, Alexandre

    2008-01-01

    The aim of this article is to show the use of a methodology that allows, in a trustful way and without the need to build up a complete physical model, the replacement of conventional steel by structural microalloyed steel (HSLA) in tubular structure, concerning passengers transport in vehicles with capacity of more than 20 people. The validation of the methodology is based on the ECE R66-00 regulation and on the Brazilian CONTRAN 811/96 resolution, which regulate minimal conditions of safety for this kind of vehicle. The methodology has four sequential and dependent stages, where the main focus is related to the experimental tests through the models that are simplified initially for later calibration using finite element method. Modular structures made of two different materials were tested and analyzed to confirm the present methodology, first the structure made of steel that is used by the bus industry in Brazil was tested and then it was compared with the new microalloyed steel. Experimental values are compared with calculated ones, foreseeing parametric optimisation and keeping the security levels according to legislation

  19. A methodology for replacement of conventional steel by microalloyed steel in bus tubular structures

    Energy Technology Data Exchange (ETDEWEB)

    Cruz, Magnus G.H. [Marcopolo S.A., Unidade Ana Rech, Av. Rio Branco, 4889, Ana Rach, 95060-650 Caxias do Sul (Brazil)], E-mail: magnus@verbonet.com.br; Viecelli, Alexandre [Mechanical Engineering Department, Universidade de Caxias do Sul, Rua Francisco Getulio Vargas, 1130, 95070-560 Caxias do Sul, RS (Brazil)], E-mail: avieceli@ucs.br

    2008-07-01

    The aim of this article is to show the use of a methodology that allows, in a trustful way and without the need to build up a complete physical model, the replacement of conventional steel by structural microalloyed steel (HSLA) in tubular structure, concerning passengers transport in vehicles with capacity of more than 20 people. The validation of the methodology is based on the ECE R66-00 regulation and on the Brazilian CONTRAN 811/96 resolution, which regulate minimal conditions of safety for this kind of vehicle. The methodology has four sequential and dependent stages, where the main focus is related to the experimental tests through the models that are simplified initially for later calibration using finite element method. Modular structures made of two different materials were tested and analyzed to confirm the present methodology, first the structure made of steel that is used by the bus industry in Brazil was tested and then it was compared with the new microalloyed steel. Experimental values are compared with calculated ones, foreseeing parametric optimisation and keeping the security levels according to legislation.

  20. [Factors influencing electrocardiogram results in workers exposed to noise in steel-making and steel-rolling workshops of an iron and steel plant].

    Science.gov (United States)

    Li, Y H; Yu, S F; Gu, G Z; Chen, G S; Zhou, W H; Wu, H; Jiao, J

    2016-02-20

    To investigate the factors influencing the electrocardiogram results in the workers exposed to noise in steel-making and steel rolling workshops of an iron and steel plant. From September to December, 2013, cluster sampling was used to select 3 150 workers exposed to noise in the steel-making and steel-rolling workshops of an iron and steel plant, and a questionnaire survey and physical examinations were performed. The number of valid workers was 2 915, consisting of 1 606 workers in the steel-rolling workshop and 1 309 in the steel-making workshop. The electrocardiogram results of the workers in steel-making and steel-rolling workshops were analyzed. The overall abnormal rate of electrocardiogram was 26.35%, and the workers in the steel-making workshop had a significantly higher abnormal rate of electrocardiogram than those in the steel-rolling workshop(32.24% vs 21.54%, Pelectrocardiogram than female workers(27.59% vs 18.61%, Pelectrocardiogram than those who did not drink(28.17% vs 23.75%, Pelectrocardiogram than those who were not exposed to high temperature(29.43% vs 20.14%, Pelectrocardiogram in the workers with cumulative noise exposure levels of electrocardiogram results. High cumulative noise exposure, alcohol consumption, and high temperature may affect the abnormal rate of electrocardiogram in the workers exposed to noise in steel-making and steel-rolling workshops.

  1. Steel and biodiversity: a promising alliance

    Science.gov (United States)

    Peters, Klaus; Colla, Valentina; Moonen, Anna Camilla; Branca, Teresa Annunziata; Moretto, Deny Del; Ragaglini, Giorgio; Delmiro, Vanesa Maria Menendez; Romaniello, Lea; Carler, Sophie; Hodges, Jennifer; Bullock, Matthew; Malfa, Enrico

    2018-06-01

    The term "Biodiversity" derives from a contraction of "biological diversity" and commonly refers to a measure of the variety of organisms, which are present in different ecosystems, by considering genetic variation, ecosystem variation, or species variation within an area, biome, or planet. Biodiversity is receiving an ever-increasing attention at many levels of European society as well as from many industrial sectors, and a variety of actions are being put in place in order to protect, preserve and increase it. The present paper provides examples of the capabilities and potentials of the steel sector with respect to biodiversity. In effect, steel is a valuable and fundamental structural material in order to develop measures and systems for protection of biodiversity. On the other hand, biodiversity can represent for the steel industry not only a heritage to preserve, but, through its functional traits, it can become an opportunity, offering an ecosystem's perspective to all industrial companies. In the paper, steel relevant topics and applications are analyzed leading to the conclusion that biodiversity should be exploited and can play a role with potentially relevant benefits both for the company and for local communities. Sustainability and Ecodesign of processes, products and services

  2. Bond characteristics of steel fiber and deformed reinforcing steel bar embedded in steel fiber reinforced self-compacting concrete (SFRSCC)

    Science.gov (United States)

    Aslani, Farhad; Nejadi, Shami

    2012-09-01

    Steel fiber reinforced self-compacting concrete (SFRSCC) is a relatively new composite material which congregates the benefits of the self-compacting concrete (SCC) technology with the profits derived from the fiber addition to a brittle cementitious matrix. Steel fibers improve many of the properties of SCC elements including tensile strength, ductility, toughness, energy absorption capacity, fracture toughness and cracking. Although the available research regarding the influence of steel fibers on the properties of SFRSCC is limited, this paper investigates the bond characteristics between steel fiber and SCC firstly. Based on the available experimental results, the current analytical steel fiber pullout model (Dubey 1999) is modified by considering the different SCC properties and different fiber types (smooth, hooked) and inclination. In order to take into account the effect of fiber inclination in the pullout model, apparent shear strengths ( τ ( app)) and slip coefficient ( β) are incorporated to express the variation of pullout peak load and the augmentation of peak slip as the inclined angle increases. These variables are expressed as functions of the inclined angle ( ϕ). Furthurmore, steel-concrete composite floors, reinforced concrete floors supported by columns or walls and floors on an elastic foundations belong to the category of structural elements in which the conventional steel reinforcement can be partially replaced by the use of steel fibers. When discussing deformation capacity of structural elements or civil engineering structures manufactured using SFRSCC, one must be able to describe thoroughly both the behavior of the concrete matrix reinforced with steel fibers and the interaction between this composite matrix and discrete steel reinforcement of the conventional type. However, even though the knowledge on bond behavior is essential for evaluating the overall behavior of structural components containing reinforcement and steel fibers

  3. Formability Characterization of a New Generation High Strength Steels

    Energy Technology Data Exchange (ETDEWEB)

    Sriram Sadagopan; Dennis Urban; Chris Wong; Mai Huang; Benda Yan

    2003-05-16

    Advanced high strength steels (AHSS) are being progressively explored by the automotive industry all around the world for cost-effective solutions to accomplish vehicle lightweighting, improve fuel economy, and consequently reduce greenhouse emissions. Because of their inherent high strength, attractive crash energy management properties, and good formability, the effective use of AHSS such as Duel Phase and TRIP (Transformation Induced Plasticity) steels, will significantly contribute to vehicle lightweighting and fuel economy. To further the application of these steels in automotive body and structural parts, a good knowledge and experience base must be developed regarding the press formability of these materials. This project provides data on relevant intrinsic mechanical behavior, splitting limits, and springback behavior of several lots of mild steel, conventional high strength steel (HSS), advanced high strength steel (AHSS) and ultra-high strength steel (UHSS), supplied by the member companies of the Automotive Applications Committee (AAC) of the American Iron and Steel Institute (AISI). Two lots of TRIP600, which were supplied by ThyssenKrupp Stahl, were also included in the study. Since sheet metal forming encompasses a very diverse range of forming processes and deformation modes, a number of simulative tests were used to characterize the forming behavior of these steel grades. In general, it was found that formability, as determined by the different tests, decreased with increased tensile strength. Consistant with previous findings, the formability of TRIP600 was found to be exceptionally good for its tensile strength.

  4. Development of a new dual phase steel with laminated microstructural morphology

    Energy Technology Data Exchange (ETDEWEB)

    Saeidi, N., E-mail: navidsae@gmail.com [Department of Materials Engineering, Isfahan University of Technology, Isfahan, 4156–83111 (Iran, Islamic Republic of); Karimi, M. [Department of Materials Science and Engineering, Shahrood University of Technology, Shahrood, 3619995161 (Iran, Islamic Republic of); Toroghinejad, M.R. [Department of Materials Engineering, Isfahan University of Technology, Isfahan, 4156–83111 (Iran, Islamic Republic of)

    2017-05-01

    The development of dual phase steels to meet the current world demands, for the purpose of decreasing the fuel consumption with increasing the strength to weight ratio, requires certain microstructural modifications. In the present research, a new morphology of DP steel, known as Laminated–DP steel, as well as its unique production method has been introduced. The new process developed involved properly selecting low carbon steels, stacking them in a laminated manner and performing a roll bonding process followed by short austenitization treatment. The martensite volume fraction was designed and obtained to be 24%. Scanning electron microscopy (SEM) was employed for microstructural examination. Moreover, deformation and tensile behavior of the newly developed steel were studied and compared with those of some ordinary DP steel (ODP). Room temperature uniaxial tensile tests also revealed mechanical properties comparable with those of the commercial DP600 steel, a kind of structural automotive steel. - Highlights: • A new method for producing dual phase steels was introduced. • Employing a new thermo-mechanical process a laminated microstructure was obtained. • Mechanical properties of the new laminated DP steel were studied. • Tensile properties of the new DP steel were comparable with those of the commercial DP600 steel.

  5. 31 CFR 285.5 - Centralized offset of Federal payments to collect nontax debts owed to the United States.

    Science.gov (United States)

    2010-07-01

    ... offset of certain types of Federal payments, including tax refunds (31 CFR 285.2), Federal benefit... certified payment vouchers or other similar forms, to a disbursing official for disbursement. Payment record means information contained on a payment request, in the form of a certified payment voucher or other...

  6. An Experimental Study on the Shear Hysteresis and Energy Dissipation of the Steel Frame with a Trapezoidal-Corrugated Steel Plate.

    Science.gov (United States)

    Shon, Sudeok; Yoo, Mina; Lee, Seungjae

    2017-03-06

    The steel frame reinforced with steel shear wall is a lateral load resisting system and has higher strength and shear performance than the concrete shear wall system. Especially, using corrugated steel plates in these shear wall systems improves out-of-plane stiffness and flexibility in the deformation along the corrugation. In this paper, a cyclic loading test of this steel frame reinforced with trapezoidal-corrugated steel plate was performed to evaluate the structural performance. The hysteresis behavior and the energy dissipation capacity of the steel frame were also compared according to the corrugated direction of the plate. For the test, one simple frame model without the wall and two frame models reinforced with the plate are considered and designed. The test results showed that the model reinforced with the corrugated steel plate had a greater accumulated energy dissipation capacity than the experimental result of the non-reinforced model. Furthermore, the energy dissipation curves of two reinforced frame models, which have different corrugated directions, produced similar results.

  7. The steel scrap age.

    Science.gov (United States)

    Pauliuk, Stefan; Milford, Rachel L; Müller, Daniel B; Allwood, Julian M

    2013-04-02

    Steel production accounts for 25% of industrial carbon emissions. Long-term forecasts of steel demand and scrap supply are needed to develop strategies for how the steel industry could respond to industrialization and urbanization in the developing world while simultaneously reducing its environmental impact, and in particular, its carbon footprint. We developed a dynamic stock model to estimate future final demand for steel and the available scrap for 10 world regions. Based on evidence from developed countries, we assumed that per capita in-use stocks will saturate eventually. We determined the response of the entire steel cycle to stock saturation, in particular the future split between primary and secondary steel production. During the 21st century, steel demand may peak in the developed world, China, the Middle East, Latin America, and India. As China completes its industrialization, global primary steel production may peak between 2020 and 2030 and decline thereafter. We developed a capacity model to show how extensive trade of finished steel could prolong the lifetime of the Chinese steelmaking assets. Secondary steel production will more than double by 2050, and it may surpass primary production between 2050 and 2060: the late 21st century can become the steel scrap age.

  8. Compatibility of graphite with a martensitic-ferritic steel, an austenitic stainless steel and a Ni-base alloy up to 1250 C

    International Nuclear Information System (INIS)

    Hofmann, P.

    1994-08-01

    To study the chemical interactions between graphite and a martensitic-ferritic steel (1.4914), an austenitic stainless steel (1.4919; AISI 316), and a Ni-base alloy (Hastelloy X) isothermal reaction experiments were performed in the temperature range between 900 and 1250 C. At higher temperatures a rapid and complete liquefaction of the components occurred as a result of eutectic interactions. The chemical interactions are diffusion-controlled processes and can be described by parabolic rate laws. The reaction behavior of the two steels is very similar. The chemical interactions of the steels with graphite are much faster above 1100 C than those for the Ni-base alloy. Below 1000 C the effect is opposite. (orig.) [de

  9. Tool steels

    DEFF Research Database (Denmark)

    Højerslev, C.

    2001-01-01

    On designing a tool steel, its composition and heat treatment parameters are chosen to provide a hardened and tempered martensitic matrix in which carbides are evenly distributed. In this condition the matrix has an optimum combination of hardness andtoughness, the primary carbides provide...... resistance against abrasive wear and secondary carbides (if any) increase the resistance against plastic deformation. Tool steels are alloyed with carbide forming elements (Typically: vanadium, tungsten, molybdenumand chromium) furthermore some steel types contains cobalt. Addition of alloying elements...... serves primarily two purpose (i) to improve the hardenabillity and (ii) to provide harder and thermally more stable carbides than cementite. Assuming proper heattreatment, the properties of a tool steel depends on the which alloying elements are added and their respective concentrations....

  10. Preparation and characterization of 304 stainless steel/Q235 carbon steel composite material

    Directory of Open Access Journals (Sweden)

    Wenning Shen

    Full Text Available The composite material of 304 stainless steel reinforced Q235 carbon steel has been prepared by modified hot-rolling process. The resulted material was characterized by scanning electron microscope, three-electrode method, fault current impact method, electrochemical potentiodynamic polarization curve measurement and electrochemical impedance spectroscopy. The results showed that metallurgical bond between the stainless steel layer and carbon steel substrate has been formed. The composite material exhibited good electrical conductivity and thermal stability. The average grounding resistance of the composite material was about 13/20 of dip galvanized steel. There has no surface crack and bubbling formed after fault current impact. The composite material led to a significant decrease in the corrosion current density in soil solution, compared with that of hot dip galvanized steel and bare carbon steel. On the basis polarization curve and EIS analyses, it can be concluded that the composite material showed improved anti-corrosion property than hot-dip galvanized steel. Keywords: Stainless steel, Carbon steel, Anti-corrosion, Conductivity, Electrochemical, EIS

  11. Rigidity spectrum of z greater than or equal to 3 cosmic-ray nuclei in the range 4-285 GV and a search for cosmic antimatter

    Science.gov (United States)

    Golden, R. L.; Adams, J. H., Jr.; Marar, T. M. K.; Deney, C. L.; Badhwar, G. D.; Heckman, H. H.; Lindstrom, P. J.

    1974-01-01

    A measurement, using the magnetic emulsion spectrometer system, of the differential rigidity spectrum of Z greater than or equal to 3 nuclei of the galactic cosmic radiation is presented. The system was flown on Aug. 22, 1969, from Palestine, Texas. The instrument floated above 125,000 feet for eight hours. The data in the rigidity range 8-285 GV can be represented by a power-law spectrum in rigidity, J(rho) = A rho to the minus gamma power, with the exponent gamma = 2.6 plus or minus 0.10. The spectrum in the range 15-285 GV is also described by the same exponent, gamma = 2.6 plus or minus 0.25. The data below 8 GV cannot be described by the same power law without invoking solar modulation. A set of nonunique parameters for modulation are given. Upper limit for the fraction of antimatter in the rigidity range 4-125 GV is .005 with 95% confidence limit.

  12. Endolymphatic radiotherapy in malignant lymphomas. A clinical evaluation of 285 patients

    Energy Technology Data Exchange (ETDEWEB)

    Bonadonna, G.; Chiappa, S.; Musumeci, R.; Uslenghi, C.

    1968-10-01

    The authors report treatment of inguinal and retroperitoneal lymph nodes of 285 malignant lymphomas (143 Hodgkin's disease and 142 lymphoreticular sarcomas) with Lipiodol Fluide /sup 131/I (endolymphatic radiotherapy). From 1961 to 1966 the radioactive contrast material was injected in doses ranging from 0.2 to 2.5 mc/cc (10 cc each foot). Adequately opacified nodes responded promptly with marked and progressive reduction in size. When indicated, a second administration of Lipiodol /sup 131/I in a dose of 2.5 mc/cc was always feasible. Several factors prevented a homogeneous and satisfactory distribution of radioactive contrast material throughout the iliac and the para-aortic nodes in one third of the cases. Therefore, in many instances patients had to be treated with external radiation therapy. Histopathologic examination of lymph nodes removed at exploratory laparotomy (four cases) or at autopsy (ten cases) confirmed that Lipiodol /sup 131/I did not fill all the iliac and para-aortic nodes and that destruction of lymphomatous tissue was often incomplete. Recurrences were seen mostly in abnormal adequately filled nodes opacified with high doses of Lipiodol /sup 131/I. In Hodgkin's disease they occurred particularly in the para-aortic area and in lymphoreticular sarcomas in the inguinal and iliac chains. Side effects were minimal. They included amenorrhea, pulmonary insufficiency, hepatic failure and hemolytic anemia. Clinical and histologic signs of pulmonary and hepatic fibrosis were not seen.

  13. Current status of stainless steel industry and development of stainless steel

    International Nuclear Information System (INIS)

    Lee, Yong Deuk; Lee, Chan Soo; Kim Kwang Tae

    2000-01-01

    Stainless steel is not only clean and smooth in its surface, but also it is superior in quality in terms of corrosion resistance and strength. So that, it is widely in use in the field of construction, chemical installations, and other industries. Growth of stainless steel industry started since the steel technology was developed for mass production in 1960s. Since then stainless steel industry grew rapidly on account of diversified development in this field and growth rate went up to 5.8% per year comparable to 2.3% of steel growth. The rapid growth is attributed to significant industry developments in Europe and Japan in the years of 1970s and 1980s. In addition to these the expansion of stainless steel industry in Korea and Taiwan. Presently Korea produces about 120,000 tons of stainless steel and occupies about 8% of international market. This means Korea become the second largest single country in world in stainless steel production. Moreover Korea is to reinforce its domestic production line by affiliating production companies, increasing of production capability, and specializing in types of stainless steel. This paper is to describe activity of material development, and types of stainless steel for industry use. (Hong, J. S.)

  14. Compresibility and sinterability of HCx PM steel diluted with stainless steels

    Directory of Open Access Journals (Sweden)

    Elena Gordo

    2003-12-01

    Full Text Available HCx powder metallurgy steel contains in its composition high contents of Cr and C, and significant quantities of alloy elements typical of tool steels (Mo, V, W, to provide the corrosion resistance of stainless steel with wear resistance of tool steels. HCx appears to be a suitable material for applications in aggressive environments, as valve seat inserts in automotive engines. However, this steel presents a low compressibility leading to high production costs. In this work, some results carried out to improve the compressibility of HCx are presented. The way to attempt this improvement is the dilution of base material with two stainless steels, the ferritic 430LHC and the austenitic 316L. The powder mixes prepared were uniaxially pressed to study the compressibility. The sinterability was study by determining of density, hardness, transverse rupture strength (TRS and microstructural evolution after vacuum sintering at different temperatures. As a result, better compressibility is observed in the mixes although not all of them present the properties required.

  15. Fabrication and characterization of a Spanish RAFM steel

    International Nuclear Information System (INIS)

    Rodriguez, D.; Serrano, M.; Moran, A.; Artimez, J. M.

    2009-01-01

    One of the main challenges for the realization of the future fusion reactor is the development and qualification of structural materials for first wall and breeding blanket. The fusion reactor application requires materials resistant to radiation damage, with excellent mechanical properties at high temperatures, good corrosion behaviour and reduced activation potential. Reduced Activation (RAFM) 9Cr Ferritic/Martenistic steels are the main candidates for first wall and blanket of fusion reactors, due to their resistance to swelling and excellent structural and thermal properties. These steels are based on the classical Cr-Mo steel grades but with a chemical composition modified in order to fulfil the low activation requirements, substituting the alloying elements with long decay times due to high activation by neutron irradiation. For this purpose the Mo is replaced by W, the Nb by Ta and Ni is removed. A summary of the activities related to the evaluation of the microstructural and mechanical properties of a reduced activation ferritic/martensitic steel fabricated at a semi-industrial scale in Spain will be presented in this paper. The steel chemical composition fulfils or is very close to the compositional specifications and metallurgical properties of the EUROFER steel. This activity corresponds to the ITMA and CIEMAT participation on Task 4 of the CONSOLIDER TECNO F US INGENIO 2010, financed by the Spanish Ministry of Science and Innovation. (author)

  16. Substitution of modified 9 Cr-1 Mo steel for austentic stainless steels

    International Nuclear Information System (INIS)

    Sikka, V.K.

    1982-04-01

    This report describes the current program to develop a high-strength ferritic-martensitic steel. The alloy is essentially Fe-9% Cr-1% Mo with small additions of V and Nb and is known as modifed 9 Cr-1 Mo steel. Its elevated-temperature properties and design allowable stresses match those of type 304 stainless steel for temperatures up to 600 0 C and exceed those of other ferritic steels by factors of 2 to 3. The improved strength of this alloy permits its use in place of stainless steels for many applications

  17. Development of a lean duplex stainless steel

    Energy Technology Data Exchange (ETDEWEB)

    Liljas, M.; Johansson, P.; Liu Hui-Ping; Olsson, C.O.A. [Avesta Research Centre, Avesta (Sweden). Outokumpu Stainless

    2008-06-15

    The classic series of duplex stainless steels shows very high corrosion resistance and can be used for very demanding applications. A new lean duplex steel, LDX 2101 {sup registered} (EN 1.4162, UNS S32101), has been developed with corrosion resistance on a par with standard austenitic grades. Application areas include: structural components, chemical industry, tanks and containers. The steel was designed to have equal amounts of ferrite and austenite in annealed condition and with an austenite that is stable against strain-induced martensite. Thanks to its high nitrogen content, the steel has a fast austenite reformation when subjected to thermal cycling, e.g. welding. Unlike conventional duplex grades, the formation of intermetallic phase is very sluggish, although precipitation of nitrides and carbides has a certain impact on material properties after exposure in the temperature range 600 to 800 C. The precipitation behaviour after different isothermal treatments is described and its influence on different product properties is shown. A good agreement was found between impact toughness and corrosion resistance for a wide range of thermal treatments. (orig.)

  18. Crystal structure and electronic states of Co and Gd ions in a Gd0.4Sr0.6CoO2.85 single crystal

    Science.gov (United States)

    Platunov, M. S.; Dudnikov, V. A.; Orlov, Yu. S.; Kazak, N. V.; Solovyov, L. A.; Zubavichus, Ya. V.; Veligzhanin, A. A.; Dorovatovskii, P. V.; Vereshchagin, S. N.; Shaykhutdinov, K. A.; Ovchinnikov, S. G.

    2016-02-01

    X-ray diffraction and X-ray absorption near edge structure (XANES) spectra have been measured at the Co K-edge and Gd L 3-edge in GdCoO3 and Gd0.4Sr0.6CoO2.85 cobaltites. The effect of Sr substitution on the crystal structure and electronic and magnetic states of Co3+ ions in a Gd0.4Sr0.6CoO2.85 single crystal has been analyzed. The XANES measurements at the Co K-edge have not showed a noticeable shift of the absorption edge with an increase in the concentration of Sr. This indicates that the effective valence of cobalt does not change. An increase in the intensity of absorption at the Gd L 3-edge is due to an increase in the degree of hybridization of the Gd(5 d) and O(2 p) states. The effect of hole doping on the magnetic properties results in the appearance of the ferromagnetic component and in a significant increase in the magnetic moment.

  19. Moessbauer spectroscopic study of rust formed on a weathering steel and a mild steel exposed for a long term in an industrial environment

    International Nuclear Information System (INIS)

    Kamimura, Takayuki; Nasu, Saburo; Tazaki, Takashi; Kuzushita, Kaori; Morimoto, Shotaro

    2002-01-01

    The rusts formed on mild steel (15-year exposure) and weathering steel (32-year exposure) exposed to an industrial environment have been characterized by means of X-ray diffraction technique and 57 Fe Moessbauer spectroscopy. By using an X-ray diffraction method, it is suggested that the rusts formed on both steels consist of the crystalline α-FeOOH, γ-FeOOH and an X-ray amorphous phase, which gives no peak to X-ray diffraction pattern. The amount of the X-ray amorphous phase exceeds 50% of the total amount of the rust. The 57 Fe Moessbauer spectra observed at 10K indicate that the rust contains only α-FeOOH, γ-FeOOH and Fe 3-δ O 4 (γ-Fe 2 O 3 ) for mild steel, and only α-FeOOH and γ-FeOOH for weathering steel. The X-ray amorphous substance in the rust payer formed on mild steel possesses the structures of mainly α-FeOOH showing superparamagnetism owing to its small particle size, and Fe 3-δ O 4 (γ-Fe 2 O 3 ). They are contained both in the inner rust layer and in the outer rust layer. The X-ray amorphous phase in the rust layer formed on weathering steel is mainly α-FeOOH. (author)

  20. Lung cancer mortality in stainless steel and mild steel welders: a nested case-referent study

    DEFF Research Database (Denmark)

    Lauritsen, Jens; Hansen, K S

    1996-01-01

    . Analysis was based on 439 deceased referents and 94 deceased cases. There was a 70% excess of lung cancer associated with "welding exposure ever" (OR +/- 95% C.I.: 1.68, 1.02-2.78). Overall OR for "mild steel (MS) welding ever" was 1.64, 0.99-2.72. The risk estimates for welding exposures showed...... an increasing tendency up to 15 years of exposure. The pattern of stainless steel (SS) welding resembles that of mild steel with an estimated OR of 1.65, 0.88-3.0. The general conclusion is that MS welding as well as SS welding seems to be associated with an increased risk of lung cancer. Further followup...

  1. Deformation mechanism maps for pure iron, corrosion resistant austenitic steels and a low-alloy carbon steel

    International Nuclear Information System (INIS)

    Frost, H.Y.; Ashby, M.F.

    1980-01-01

    Principles of construction of deformation mechanisms charts for iron base alloys are presented. Deformation mechanisms charts for pure iron, 316 and 314 stainless steels, a ferritic steel with 1% Cr, Mo, V are given, examples of the charts application being provided. The charts construction is based, when it is possible, on the state equations, deduced from theoretical models and satisfying experimental data. The charts presented should be considered as an attempt to unite the main regularities of the theory of dislocations and diffusion with the observed experimental picture of plastic deformation and creep of commercial steels [ru

  2. Preparation and characterization of 304 stainless steel/Q235 carbon steel composite material

    Science.gov (United States)

    Shen, Wenning; Feng, Lajun; Feng, Hui; Cao, Ying; Liu, Lei; Cao, Mo; Ge, Yanfeng

    The composite material of 304 stainless steel reinforced Q235 carbon steel has been prepared by modified hot-rolling process. The resulted material was characterized by scanning electron microscope, three-electrode method, fault current impact method, electrochemical potentiodynamic polarization curve measurement and electrochemical impedance spectroscopy. The results showed that metallurgical bond between the stainless steel layer and carbon steel substrate has been formed. The composite material exhibited good electrical conductivity and thermal stability. The average grounding resistance of the composite material was about 13/20 of dip galvanized steel. There has no surface crack and bubbling formed after fault current impact. The composite material led to a significant decrease in the corrosion current density in soil solution, compared with that of hot dip galvanized steel and bare carbon steel. On the basis polarization curve and EIS analyses, it can be concluded that the composite material showed improved anti-corrosion property than hot-dip galvanized steel.

  3. The Climate for Steel. Actions for, and conditions to, a Copenhagen climate agreement from the perspective of the EU steel sector

    International Nuclear Information System (INIS)

    Slingerland, S.; Werring, L.; De Bruijn, S.; Korteland, M.

    2009-02-01

    A position paper discussing the relationship between climate change policies and competitiveness in the global steel sector. Question is how the need for effective action to confront global climate change can be combined with a level playing field for competition in the global steel sector, taking into account the position of Corus Netherlands as a European steel producer. More specifically; what conditions in an international agreement could provide such a level playing field? Chapter 2 of this paper briefly outlines some essential characteristics of the global and European steel sector. Chapter 3 outlines the present status quo of the multilateral climate change negotiation process towards the December 2009 Copenhagen conference. Chapter 4 gives a view on climate and competitiveness for the EU steel sector. Chapter 5 finally provides conclusions and recommendations for provisions in an international agreement that could provide for a competitive level playing field in the steel sector

  4. Advanced metallic structural materials and a new role for microalloyed steels

    International Nuclear Information System (INIS)

    Korchynsky, M.

    2004-01-01

    The recent worldwide surge of steel consumption, mainly of low-strength carbon grades, has created raw-materials shortages and price increases. These supply-demand strains could be relaxed by satisfying engineering needs with less steel. However, materials used for such a substitution must combine high weight reducing potential with low cost. Microalloyed (MA) steels are cost-effective substitutes, since their high strength is the result of grain refinement and precipitation hardening. These two strengthening mechanisms are developed by the interaction of micro-additives: niobium or vanadium with the deformation occurring during hot rolling followed by cooling. The physical metallurgy of these phenomena is discussed in the paper. The optimum alloy design of MA steels combines superior properties with lowest processing cost. In many applications, the versatility and adaptability of vanadium steels provides an economic advantage. The monetary value of weight production is sufficient to increase the profitability of steel makers and to lower the material cost to steel users. This 'win-win' situation is financed by the elimination of efforts spent in producing inefficient steel, yielding an increase in wealth formation. The gain acceptance of substitution by the consumer, a long-term strategic plan is needed to be implemented by the beneficiaries - both steel producers and steel users. The successful substitution is of importance to the national economy, resources and energy conservation, and the environment. Since microalloyed steels, used as a replacement for carbon steels, offer low cost weight savings, they deserve to be classified as advanced structural materials. (author)

  5. Age-hardening susceptibility of high-Cr ODS ferritic steels and SUS430 ferritic steel

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Dongsheng, E-mail: chen.dongsheng85@gmail.com [Graduate School of Energy Science, Kyoto University, Gokasho, Uji, Kyoto 611-0011 (Japan); Kimura, Akihiko; Han, Wentuo; Je, Hwanil [Institute of Advanced Energy, Kyoto University, Gokasho, Uji, Kyoto 611-0011 (Japan)

    2015-10-15

    Highlights: • The role of oxide particles in α/α′ phase decomposition behavior; microstructure of phase decomposition observed by TEM. • The characteristics of ductility loss caused by age-hardening. • Correlation of phase decomposition and age-hardening explained by dispersion strengthened models. • Age-hardening susceptibility of ODS steels and SUS430 steel. - Abstract: The effect of aging on high-Cr ferritic steels was investigated with focusing on the role of oxide particles in α/α′ phase decomposition behavior. 12Cr-oxide dispersion strengthened (ODS) steel, 15Cr-ODS steel and commercial SUS430 steel were isothermally aged at 475 °C for up to 10,000 h. Thermal aging caused a larger hardening in SUS430 than 15Cr-ODS, while 12Cr-ODS showed almost no hardening. A characteristic of the ODS steels is that the hardening was not accompanied by the significant loss of ductility that was observed in SUS430 steel. After aging for 2000 h, SUS430 steel shows a larger ductile–brittle transition temperature (DBTT) shift than 15Cr-ODS steel, which suggests that the age-hardening susceptibility is lower in 15Cr-ODS steel than in conventional SUS430 steel. Thermal aging leaded to a large number of Cr-rich α′ precipitates, which were confirmed by transmission electron microscopy (TEM). Correlation of age-hardening and phase decomposition was interpreted by Orowan type strengthening model. Results indicate that oxide particles cannot only suppress ductility loss, but also may influence α/α′ phase decomposition kinetics.

  6. Steel. A handbook for materials research and engineering. Vol. 1. Fundamentals

    Energy Technology Data Exchange (ETDEWEB)

    1992-01-01

    This STEEL Textbook is the outcome of reflections within the Materials Committee of the German Iron and Steel Institute on whether to republish the Manual of Special Steels, the highly commendable work by E. Houdremont. Discussions came to the conclusion, however, that for various reasons it was neither possible nor expedient simply to publish a follow-up edition of the famed Houdremont. To begin with and from today's vantage point, there no longer seemed to be any justification for restricting the work to special steels in the sense of the term as understood by E. Houdremont. The term ''special steel'' has never gained acceptance in official circles or standards. If we replace it by the term ''high-grade steel'', which is nowadays defined in standards, and this would appear permissible with certain qualifications, and if we bear in mind that the boundaries between high-grade steels and non-high-grade steels, the commercial and quality steels, although defined in standards (see part A), nonetheless in terms of engineering parameters are quite blurred, so it would seem only fitting for such as work to cover all the various grades of steel, also in view of the great significance of the non-high-grade steels. Because of the very many different grades of steel, this approach necessarily involves the collaboration of very many experts, in other words it entails a joint effort. Moreover, the vast, barely manageable quantity of literature in this field all of which can hardly be analysed by just one person, inevitably leads to the conclusion that there is a need to produce the new work as a joint effort. (orig.).

  7. Redemption of asthma pharmaceuticals among stainless steel and mild steel welders

    DEFF Research Database (Denmark)

    Kristiansen, Pernille; Jørgensen, Kristian Tore; Hansen, Johnni

    2015-01-01

    PURPOSE: The purpose was to examine bronchial asthma according to cumulative exposure to fume particulates conferred by stainless steel and mild steel welding through a proxy of redeemed prescribed asthma pharmaceuticals. METHODS: A Danish national company-based historical cohort of 5,303 male ever...... was estimated by combining questionnaire data on welding work with a welding exposure matrix. The estimated exposure accounted for calendar time, welding intermittence, type of steel, welding methods, local exhaustion and welding in confined spaces. Hazard ratios (HRs) with 95 % confidence intervals (CIs) were...... nonsignificant increased rate of redemption of asthma medicine was observed among high-level exposed stainless steel welders in comparison with low-level exposed welders (HR 1.54, 95 % CI 0.76-3.13). This risk increase was driven by an increase risk among non-smoking stainless steel welders (HR 1.46, 95 % CI 1...

  8. Nitrogen-alloyed martensitic steels

    International Nuclear Information System (INIS)

    Berns, H.

    1988-01-01

    A report is presented on initial results with pressure-nitrided martensitic steels. In heat-resistant steels, thermal stability and toughness are raised by nitrogen. In cold work steel, there is a more favourable corrosion behaviour. (orig./MM) [de

  9. Creep of A508/533 Pressure Vessel Steel

    Energy Technology Data Exchange (ETDEWEB)

    Richard Wright

    2014-08-01

    ABSTRACT Evaluation of potential Reactor Pressure Vessel (RPV) steels has been carried out as part of the pre-conceptual Very High Temperature Reactor (VHTR) design studies. These design studies have generally focused on American Society of Mechanical Engineers (ASME) Code status of the steels, temperature limits, and allowable stresses. Initially, three candidate materials were identified by this process: conventional light water reactor (LWR) RPV steels A508 and A533, 2¼Cr-1Mo in the annealed condition, and Grade 91 steel. The low strength of 2¼Cr-1Mo at elevated temperature has eliminated this steel from serious consideration as the VHTR RPV candidate material. Discussions with the very few vendors that can potentially produce large forgings for nuclear pressure vessels indicate a strong preference for conventional LWR steels. This preference is based in part on extensive experience with forging these steels for nuclear components. It is also based on the inability to cast large ingots of the Grade 91 steel due to segregation during ingot solidification, thus restricting the possible mass of forging components and increasing the amount of welding required for completion of the RPV. Grade 91 steel is also prone to weld cracking and must be post-weld heat treated to ensure adequate high-temperature strength. There are also questions about the ability to produce, and very importantly, verify the through thickness properties of thick sections of Grade 91 material. The availability of large components, ease of fabrication, and nuclear service experience with the A508 and A533 steels strongly favor their use in the RPV for the VHTR. Lowering the gas outlet temperature for the VHTR to 750°C from 950 to 1000°C, proposed in early concept studies, further strengthens the justification for this material selection. This steel is allowed in the ASME Boiler and Pressure Vessel Code for nuclear service up to 371°C (700°F); certain excursions above that temperature are

  10. Steel-reinforced concrete-filled steel tubular columns under axial and lateral cyclic loading

    Science.gov (United States)

    Farajpourbonab, Ebrahim; Kute, Sunil Y.; Inamdar, Vilas M.

    2018-03-01

    SRCFT columns are formed by inserting a steel section into a concrete-filled steel tube. These types of columns are named steel-reinforced concrete-filled steel tubular (SRCFT) columns. The current study aims at investigating the various types of reinforcing steel section to improve the strength and hysteresis behavior of SRCFT columns under axial and lateral cyclic loading. To attain this objective, a numerical study has been conducted on a series of composite columns. First, FEM procedure has been verified by the use of available experimental studies. Next, eight composite columns having different types of cross sections were analyzed. For comparison purpose, the base model was a CFT column used as a benchmark specimen. Nevertheless, the other specimens were SRCFT types. The results indicate that reinforcement of a CFT column through this method leads to enhancement in load-carrying capacity, enhancement in lateral drift ratio, ductility, preventing of local buckling in steel shell, and enhancement in energy absorption capacity. Under cyclic displacement history, it was observed that the use of cross-shaped reinforcing steel section causes a higher level of energy dissipation and the moment of inertia of the reinforcing steel sections was found to be the most significant parameter affecting the hysteresis behavior of SRCFT columns.

  11. MICROALLOYED STEELS FOR THE AUTOMOTIVE INDUSTRY

    Directory of Open Access Journals (Sweden)

    Debanshu Bhattacharya

    2014-12-01

    Full Text Available Two major drivers for the use of newer steels in the automotive industry are fuel efficiency and increased safety performance. Fuel efficiency is mainly a function of weight of steel parts, which in turn, is controlled by gauge and design. Safety is determined by the energy absorbing capacity of the steel used to make the part. All of these factors are incentives for the U.S. automakers to use both Highly Formable and Advanced High Strength Steels (AHSS to replace the conventional steels used to manufacture automotive parts in the past. AHSS is a general term used to describe various families of steels. The most common AHSS is the dual-phase steel that consists of a ferrite-martensite microstructure. These steels are characterized by high strength, good ductility, low tensile to yield strength ratio and high bake hardenability. Another class of AHSS is the complex-phase or multi-phase steel which has a complex microstructure consisting of various phase constituents and a high yield to tensile strength ratio. Transformation Induced Plasticity (TRIP steels is another class of AHSS steels finding interest among the U.S. automakers. These steels consist of a ferrite-bainite microstructure with significant amount of retained austenite phase and show the highest combination of strength and elongation, so far, among the AHSS in use. High level of energy absorbing capacity combined with a sustained level of high n value up to the limit of uniform elongation as well as high bake hardenability make these steels particularly attractive for safety critical parts and parts needing complex forming. A relatively new class of AHSS is the Quenching and Partitioning (Q&P steels. These steels seem to offer higher ductility than the dual-phase steels of similar strengths or similar ductility as the TRIP steels at higher strengths. Finally, martensitic steels with very high strengths are also in use for certain parts. The most recent initiative in the area of AHSS

  12. Forming of High-strength Steels Using a Hot-melt Dry Lubricant

    DEFF Research Database (Denmark)

    Hörnström, Sven-Erik; Karlsson, Erik; Olsson, Mikael

    2008-01-01

    during forming resulting in seizure of the tool/steel sheet contact and extensive scratching of the steel sheet surface. As a result, a number of concepts have been developed in order to reduce the tendency to galling in metal forming, including the development of new dry lubricants, new forming tool...... steel grades and improved surface engineering treatments such as the deposition of low friction CVD and PVD coatings. In the present study the performance of a hot-melt dry lubricant in the forming of hot and cold rolled and hot-dip galvanized high strength steel has been evaluated and compared...... with a conventional rust protection oil using four different tests methods, i.e. a strip reduction test, a bending under tension test, a stretch-forming test and a pin-on disc test. In the tests, two different cold work tool steels, a conventional steel grade and a nitrogen alloyed PM steel grade were evaluated...

  13. Requirements for a cleanable steel HEPA filter derived from a systems analysis

    International Nuclear Information System (INIS)

    Bergman, W.

    1996-06-01

    A systems analysis was conducted to determine customer requirements for a cleanable high efficiency particulate air (HEPA) filter in DOE Environmental Management (EM) facilities. The three principal drivers for cleanable steel HEPA are large cost savings, improved filter reliability, and new regulations; they produce a strong incentive to DOE customers to use cleanable steel HEPA filters. Input for customer requirements were obtained from field trips to EM sites and from discussions. Most existing applications require that cleanable steel HEPA filters meet size/performance requirements of standard glass HEPA filters; applications in new facilities can relax size/weight/pressure drop requirements on a case-by-case basis. We then obtained input from commercial firms on availability of cleanable steel HEPA filters. Systems analysis then showed that currently available technology was only able to meet customer needs in a limited number of cases. Further development is needed to meet requirements of EM customers. For cleanable steel HEPA to be retrofitted into existing systems, pressure drop and weight must be reduced. Pressure drop can be reduced by developing steel fiber media from 0.5 μm dia steel fibers. Weight can be reduced by packaging the steel fiber media in one of the standard HEPA configurations. Although most applications will be able to use standard 304 or 316L alloys, an acid resistant alloy such as Hastelloy or Inconel will be needed for incinerator and other thermal processes

  14. Fracture toughness of welded joints of ASTM A543 steel plate

    International Nuclear Information System (INIS)

    Susukida, H.; Uebayashi, T.; Yoshida, K.; Ando, Y.

    1977-01-01

    Fracture toughness and weldability tests have been performed on a high strength steel which is a modification of ASTM A543 Grade B Class 1 steel, with a view to using it for nuclear reactor containment vessels. The results showed that fracture toughness of welded joints of ASTM A543 modified high strength steel is superior and the steel is suitable for manufacturing the containment vessels

  15. Fracture assessment of Savannah River Reactor carbon steel piping

    International Nuclear Information System (INIS)

    Mertz, G.E.; Stoner, K.J.; Caskey, G.R.; Begley, J.A.

    1991-01-01

    The Savannah River Site (SRS) production reactors have been in operation since the mid-1950's. One postulated failure mechanism for the reactor piping is brittle fracture of the original A285 and A53 carbon steel piping. Material testing of archival piping determined (1) the static and dynamic tensile properties; (2) Charpy impact toughness; and (3) the static and dynamic compact tension fracture toughness properties. The nil-ductility transition temperature (NDTT), determined by Charpy impact test, is above the minimum operating temperature for some of the piping materials. A fracture assessment was performed to demonstrate that potential flaws are stable under upset loading conditions and minimum operating temperatures. A review of potential degradation mechanisms and plant operating history identified weld defects as the most likely crack initiation site for brittle fracture. Piping weld defects, as characterized by radiographic and metallographic examination, and low fracture toughness material properties were postulated at high stress locations in the piping. Normal operating loads, upset loads, and residual stresses were assumed to act on the postulated flaws. Calculated allowable flaw lengths exceed the size of observed weld defects, indicating adequate margins of safety against brittle fracture. Thus, a detailed fracture assessment was able to demonstrate that the piping systems will not fail by brittle fracture, even though the NDTT for some of the piping is above the minimum system operating temperature

  16. Hot ductility and fracture mechanisms of a structural steel

    International Nuclear Information System (INIS)

    Calvo, J.; Cabrera, J. M.; Prado, J. M.

    2006-01-01

    The hot ductility of a structural steel produced from scrap recycling has been studied to determine the origin of the transverse cracks in the corners that appeared in some billets. Samples extracted both from a billet with transverse cracks and from a billet with no external damage were tested. To evaluate the influence of residual elements and inclusions, the steel was compared to another one impurity free. Reduction in area of the samples tensile tested to the fracture was taken as a measure of the hot ductility. The tests were carried out at temperatures ranging from 1000 degree centigree to 650 degree centigree and at a strain rate of 1.10-3 s-1. The fracture surfaces of the tested samples were observed by scanning electron microscopy in order to determine the embrittling mechanisms that could be acting. The steel with residuals and impurities exhibited lower ductility values for a wider temperature range than the clean steel. The embrittling mechanisms also changed as compared to the impurity free steel. (Author)

  17. Plasma nitriding of steels

    CERN Document Server

    Aghajani, Hossein

    2017-01-01

    This book focuses on the effect of plasma nitriding on the properties of steels. Parameters of different grades of steels are considered, such as structural and constructional steels, stainless steels and tools steels. The reader will find within the text an introduction to nitriding treatment, the basis of plasma and its roll in nitriding. The authors also address the advantages and disadvantages of plasma nitriding in comparison with other nitriding methods. .

  18. Micro-Abrasion Wear Resistance of Borided 316L Stainless Steel and AISI 1018 Steel

    Science.gov (United States)

    Reséndiz-Calderon, C. D.; Rodríguez-Castro, G. A.; Meneses-Amador, A.; Campos-Silva, I. E.; Andraca-Adame, J.; Palomar-Pardavé, M. E.; Gallardo-Hernández, E. A.

    2017-11-01

    The 316L stainless steel has high corrosion resistance but low tribological performance. In different industrial sectors (biomedical, chemical, petrochemical, and nuclear engineering), improvement upon wear resistance of 316L stainless steel components using accessible and inexpensive methods is critical. The AISI 1018 steel is widely used in industry, but its tribological performance is not the best among steels. Therefore, in this study the behavior of the borided 316L stainless steel and 1018 steel is evaluated under micro-abrasion wear. The boriding was carried out at 1223 K over 6 h of exposure time, resulting in a biphase layer composed of FeB/Fe2B phases. In order to evaluate Fe2B phase with no influence from FeB phase, AISI 1018 steel samples were borided at 1273 K for over 20 min and then diffusion annealed at 1273 K over 2 h to obtain a Fe2B mono-phase layer. Micro-abrasion wear resistance was evaluated by a commercial micro-abrasion testing rig using a mix of F-1200 SiC particles with deionized water as abrasive slurry. The obtained wear rates for FeB and Fe2B phases and for the 316L stainless steel were compared. Wear resistance of 316L stainless steel increases after boriding. The wear mechanisms for both phases and for the stainless steel were identified. Also, transient conditions for rolling and grooving abrasion were determined for the FeB and Fe2B phases.

  19. Methods of making bainitic steel materials

    Science.gov (United States)

    Bakas, Michael Paul; Chu, Henry Shiu-Hung; Zagula, Thomas Andrew; Langhorst, Benjamin Robert

    2018-01-16

    Methods of making bainitic steels may involve austenitizing a quantity of steel by exposing the quantity of steel to a first temperature. A composition of the quantity of steel may be configured to impede formation of non-bainite ferrite, pearlite, and Widmanstatten ferrite. The quantity of steel may be heat-treated to form bainite by exposing the quantity of steel to a second, lower temperature. The second, lower temperature may be stabilized by exposing the quantity of steel to the second, lower temperature in the presence of a thermal ballast.

  20. Microstructure of a high boron 9-12% chromium steel

    Energy Technology Data Exchange (ETDEWEB)

    Andren, H.O. [Chalmers Univ. of Technology, Goeteborg (Sweden). Dept. of Applied Physics

    2008-07-01

    Additions of small amounts of boron (10-100 ppm) to 9-12% chromium steels are often made since they have been found to be beneficial for the creep strength up to and above 600 C. The effect of boron is to restrict the coarsening of M{sub 23}C{sub 6} precipitates during service. It was found that increasing the boron content from 9 to 40 ppm gave a decrease in coarsening constant at 600 C by a factor of 2. The present understanding of boron solution, non-equilibrium grain boundary segregation, incorporation into M{sub 23}C{sub 6}, and diffusion is reviewed in the paper. A very high boron addition (300 ppm) was made in the trial TAF steel already in the 1950'ies. The microstructure of a similar trial steel, FT3B, has been studied detail. In this steel large Mo, Cr, Fe and V containing metal borides are formed rather than the expected BN, with the crystal structure M{sub 2}B{sub 2}. Nitrogen is therefore still available for the formation of VN. Due to tempering at a low temperature (690 C) to a high strength (830 MPa), this steel contained a dense distribution of very small VN precipitates, 5-15 nm in size. A similar VN distribution is probably the cause of the still unsurpassed creep strength of the TAF steel. (orig.)

  1. A review of temperature measurement in the steel reheat furnace

    International Nuclear Information System (INIS)

    Martocci, A.P.; Mihalow, F.A.

    1985-01-01

    The incentive for conducting research and development on reheat furnaces is substantial; the domestic steel industry spent approximately one billion dollars on fuel in reheat furnaces in 1981. Bethlehem Steel Corp. spent /145 million of that total, and neither figure includes fuel consumed in soaking pits or annealing furnaces. If the authors set a goal to save 10% of these annual fuel costs, that translates into /100 million for the domestic steel industry and /14.5 million for Bethlehem Steel. These large sums of money are significant incentives. The purpose of this paper is to review the historical heating practices and equipment at steel reheat furnaces along with current practices and instrumentation

  2. Steel

    International Nuclear Information System (INIS)

    Zorev, N.N.; Astafiev, A.A.; Loboda, A.S.; Savukov, V.P.; Runov, A.E.; Belov, V.A.; Sobolev, J.V.; Sobolev, V.V.; Pavlov, N.M.; Paton, B.E.

    1977-01-01

    Steels also containing Al, N and arsenic, are suitable for the construction of large components for high-power nuclear reactors due to their good mechanical properties such as good through-hardening, sufficiently low brittleness conversion temperature and slight displacement of the latter with neutron irradiation. Defined steels and their properties are described. (IHOE) [de

  3. A comprehensive review on cold work of AISI D2 tool steel

    Science.gov (United States)

    Abdul Rahim, Mohd Aidil Shah bin; Minhat, Mohamad bin; Hussein, Nur Izan Syahriah Binti; Salleh, Mohd Shukor bin

    2017-11-01

    As a common material in mould and die application, AISI D2 cold work tool steel has proven to be a promising chosen material in the industries. However, challenges remain in using AISI D2 through a modified version with a considerable progress having been made in recent years. This paper provides a critical review of the original as-cast AISI D2 cold work tool steel up to the modified version. The main purpose is to develop an understanding of current modified tool steel trend; the machinability of AISI D2 (drilling, milling, turning, grinding and EDM/WEDM; and the microstructure evolution and mechanical properties of these cold work tool steels due to the presence of alloy materials in the steel matrix. The doping of rare earth alloy element, new steel fabrication processes, significant process parameter in machinability and surface treatment shows that there have been few empirical investigations into these cold work tool steel alloys. This study has discovered that cold work tool steel will remain to be explored in order to survive in the steel industries.

  4. A technique for predicting steel corrosion resistance

    Science.gov (United States)

    Novikov, V. F.; Sokolov, R. A.; Neradovskiy, D. F.; Muratov, K. R.

    2018-01-01

    Research works were carried out to develop a technique with the aim to increase the lifetime of steel items used in corrosive media. The possibility to monitor corrosion parameters of steel samples is analyzed on the basis of magnetic properties obtained by means of a magnetic structuroscope DIUS-1.15M designed by the Institute of Metal Physics of the Ural Branch of the Russian Academy of Sciences (IMP UB RAS).

  5. Comparison of Corrosion Behavior of Low-Alloy Steel Containing Copper and Antimony with 409L Stainless Steel for a Flue Gas Desulfurization System

    Energy Technology Data Exchange (ETDEWEB)

    Park, Sun-Ah; Shin, Su-Bin; Kim, Jung-Gu [Sungkyunkwan University, Suwon (Korea, Republic of)

    2016-07-15

    The corrosion behavior of low alloy steel containing Cu, Sb and 409L stainless steel was investigated for application in the low-temperature section of a flue gas desulfurization (FGD) system. The electrochemical properties were evaluated by potentiodynamic polarization testing and electrochemical impedance spectroscopy (EIS) in 16.9 vol% H{sub 2}SO{sub 4} + 0.35 vol% HCl at 60 ℃. The inclusions in these steels ere identified by electron probe microanalyzer (EPMA). The corrosion products of the steels were analyzed using scanning electron microscope (SEM) with energy dispersive spectroscopy (EDS) and transmission electron microscopy (TEM). The corrosion rate of the low alloy steel containing Cu, Sb was about 100 times lower than that of 409L stainless steel. For stainless steel without passivation, active corrosion behavior was shown. In contrast, in the low alloy steel, the Cu, Sb compounds accumulated on the surface improved the corrosion resistance by suppressing the anodic dissolution reaction.

  6. Weldability of Stainless Steels

    International Nuclear Information System (INIS)

    Saida, Kazuyoshi

    2010-01-01

    It gives an outline of metallographic properties of welding zone of stainless steels, generation and mechanisms of welding crack and decreasing of corrosion resistance of welding zone. It consists of seven chapters such as introduction, some kinds of stainless steels and properties, metallographic properties of welding zone, weld crack, toughness of welding zone, corrosion resistance and summary. The solidification modes of stainless steels, each solidification mode on the cross section of Fe-Cr-Ni alloy phase diagram, each solidification mode of weld stainless steels metal by electron beam welding, segregation state of alloy elements at each solidification mode, Schaeffler diagram, Delong diagram, effects of (P + S) mass content in % and Cr/Ni equivalent on solidification cracking of weld stainless steels metal, solidification crack susceptibility of weld high purity stainless steels metal, effects of trace impurity elements on solidification crack susceptibility of weld high purity stainless steels metal, ductile fracture susceptibility of weld austenitic stainless steels metal, effects of H2 and ferrite content on generation of crack of weld 25Cr-5N duplex stainless steels, effects of O and N content on toughness of weld SUS 447J1 metals, effect of ferrite content on aging toughness of weld austenitic stainless steel metal, corrosion morphology of welding zone of stainless steels, generation mechanism of knife line attack phenomenon, and corrosion potential of some kinds of metals in seawater at room temperature are illustrated. (S.Y.)

  7. Efficient Disinfection of Tap and Surface Water with Single High Power 285 nm LED and Square Quartz Tube

    Directory of Open Access Journals (Sweden)

    Martin Hessling

    2016-01-01

    Full Text Available A small water disinfection system based on the combination of a strong single 25 mW LED with a wavelength of 285 nm and a short quartz tube with an outer rectangular cross section is presented. For the disinfection tests clear tap water and slightly turbid and yellow pond water are contaminated with high concentrations of Escherichia coli bacteria. These water samples are exposed to the germicidal 285 nm LED radiation while they flow through the quartz tube. The portion of surviving germs is determined by membrane filtration for different water qualities and flow rates. For clear tap water the bacteria concentration can be reduced by at least three orders of magnitude up to flow rates of about 20 L/h. In pond water the maximum flow rate for such a reduction is less than 3 L/h. These high disinfection capabilities and the small size of this system, allow its integration in medical systems for point of use disinfection or even its application in the Third World for decentralized water disinfection powered by small solar cells, because this disinfection capacity should be sufficient for small groups or families.

  8. A new generation of ultra high strength steel pipelines

    International Nuclear Information System (INIS)

    Brozda, J.; Zeman, M.; Weglowski, M.

    2008-01-01

    For many years an increased demand for natural gas can be observed. Ultra high-strength pipelines with higher operating pressures and/or reduced wall thickness are a means to reduce transmission costs. Motivated by reduced investment costs (overcharge a few billion of dollars), tend towards the development of a new grade of pipeline steel with microalloying element for example Nb, that potentially lowers the total cost of long-distance gas pipelines by 5 - 15%. New long distance pipelines have budgets in excess of several billion dollars. This paper describes mechanical properties of new generation of pipelines steel with higher content of niobium and the influence the welding thermal cycles on the microstructure and brittle fracture resistance. The resistance to cold cracking has also been determined. It was found that the new steel has close properties to API X70 grade steels, but is cheaper in manufacturing and installation. The steel has been covered by the amended EN 10028-5 standard and proper modifications will also be made in other European standards. (author)

  9. Microstructural characterisation and corrosion performance of old railway girder bridge steel and modern weathering structural steel

    International Nuclear Information System (INIS)

    Tewary, N.K.; Kundu, A.; Nandi, R.; Saha, J.K.; Ghosh, S.K.

    2016-01-01

    Highlights: • Microstructure and corrosion performance are compared for two structural steels. • Microstructure evolution shows primarily ferrite-pearlite in both the steels. • Steels show higher corrosion rate in 1% HCl solution than in 3.5% NaCl solution. • The corrosion products show the presence of oxide, hydroxide and oxy-hydroxides. • The corroded surface reveals morphologies like flowery, cotton balls and rosette. - Abstract: A comparison on microstructure and corrosion performance has been made between the two structural steels used in old railway girder bridge (Sample A) and modern grades of weathering structural steel (Sample B). The microstructures, viewed under optical microscope and scanning electron microscope (SEM), show mainly ferrite-pearlite phase constituents in both the steels, A and B. The phase fraction analysis shows higher amount of pearlite in steel A compared to that of steel B. The grain size of steel A is larger than that of steel B under identical processing condition. The immersion corrosion test in 3.5% NaCl shows that the corrosion rate of steel A increases with time, while the same for steel B decreases with time. On the other hand, corrosion test in 1% HCl shows that the corrosion rate of both steel A and B is higher as compared to that of NaCl which always decreases with time. The XRD analysis of corrosion products show the presence of many oxides, hydroxide and oxy-hydroxide like Lepidocrocite (γ-FeOOH), Goethite (α-FeOOH), Akaganeite (β-FeOOH), Magnetite (Fe_3O_4) and Maghemite (γ-Fe_2O_3) in both the steels. The SEM images of corroded surfaces reveal different morphologies like flowery, cotton balls and rosette etc. which indicate that the corrosion products primarily contain Lepidocrocite (γ-FeOOH), Goethite (α-FeOOH) and Akaganeite (β-FeOOH).

  10. Structural amorphous steels

    International Nuclear Information System (INIS)

    Lu, Z.P.; Liu, C.T.; Porter, W.D.; Thompson, J.R.

    2004-01-01

    Recent advancement in bulk metallic glasses, whose properties are usually superior to their crystalline counterparts, has stimulated great interest in fabricating bulk amorphous steels. While a great deal of effort has been devoted to this field, the fabrication of structural amorphous steels with large cross sections has remained an alchemist's dream because of the limited glass-forming ability (GFA) of these materials. Here we report the discovery of structural amorphous steels that can be cast into glasses with large cross-section sizes using conventional drop-casting methods. These new steels showed interesting physical, magnetic, and mechanical properties, along with high thermal stability. The underlying mechanisms for the superior GFA of these materials are discussed

  11. Characterization of D2 tool steel friction surfaced coatings over low carbon steel

    International Nuclear Information System (INIS)

    Sekharbabu, R.; Rafi, H. Khalid; Rao, K. Prasad

    2013-01-01

    Highlights: • Solid state coating by friction surfacing method. • D2 tool steel is coated over relatively softer low carbon steel. • Defect free interface between tool steel coating and low carbon steel substrate. • D2 coatings exhibited higher hardness and good wear resistance. • Highly refined martensitic microstructure in the coating. - Abstract: In this work D2 tool steel coating is produced over a low carbon steel substrate using friction surfacing process. The process parameters are optimized to get a defect free coating. Microstructural characterization is carried out using optical microscopy, scanning electron microscopy and X-ray diffraction. Infrared thermography is used to measure the thermal profile during friction surfacing of D2 steel. Wear performance of the coating is studied using Pin-on-Disk wear tests. A lower rotational speed of the consumable rod and higher translational speed of the substrate is found to result in thinner coatings. Friction surfaced D2 steel coating showed fine-grained martensitic microstructure compared to the as-received consumable rod which showed predominantly ferrite microstructure. Refinement of carbides in the coating is observed due to the stirring action of the process. The infrared thermography studies showed the peak temperature attained by the D2 coating to be about 1200 °C. The combined effect of martensitic microstructure and refined carbides resulted in higher hardness and wear resistance of the coating

  12. ballistic performance of a quenched and tempered steel against

    African Journals Online (AJOL)

    eobe

    was investigated. Low alloy steel ... obliquity obliquity with a projectile velocity with a projectile velocity with a projectile .... quenching on low carbon and alloyed steel [5, 15]. Several studies .... Mars 190, Mars 240, Mars 270, Creusot-Loire,.

  13. Corrosion characteristics of DMR-1700 steel and comparison with different steels in marine environment

    International Nuclear Information System (INIS)

    Gurrappa, I.; Malakondaiah, G.

    2005-01-01

    In the present paper, a systematic corrosion study has been carried out on DMR-1700 steel to understand the protective nature of oxide scale that forms on its surface under marine environmental conditions. Further, the studies related to oxide scales as well as pitting and crevice corrosion resistance of both stainless steels and widely used low alloy steel EN24 in marine environment have been studied for comparison purpose. The surface morphologies of corroded steels have been observed under scanning electron microscope (SEM) in order to understand the nature of corrosion. A high performance protective coating that has been developed for protection of low alloy steels DMR-1700 and EN24 against corrosion is presented after stressing the importance of surface engineering in enhancing the life of steels. Based on the studies with different techniques, DMR-1700 steel has been recommended for manufacture of components used in aerospace systems in association with appropriate protective coating for improving their efficiency

  14. A sustainability assessment system for Chinese iron and steel firms

    DEFF Research Database (Denmark)

    Long, Yunguang; Pan, Jieyi; Farooq, Sami

    2016-01-01

    from financial and sustainability reports of four leading Chinese iron and steel firms. The proposed sustainable assessment system is envisaged to help Chinese iron and steel firms to objectively investigate their sustainability performance, provide clear and effective information to decision makers......The environmental impact of the Chinese iron and steel industry is huge due to its high consumption of ore, coal and energy, and water and air pollution. It is important not only for China but also for the rest of the world that the Chinese iron and steel industry becomes more sustainable....... A sustainable assessment indicator system is an important tool to support that development. Currently, however, a sustainable assessment system, specifically designed to match the characteristics of Chinese iron and steel firms, is not available. In this paper such a system is proposed and evaluated using data...

  15. Plane strain forging of a niobium micro-alloyed steel

    International Nuclear Information System (INIS)

    Balancin, O.; Ferran L, G.; Rio de Janeiro Univ.

    1984-01-01

    Various termomechanical treatments were carried out on a niobium micro-alloyed steel and a low carbon steel as reference material, using an apparatus for hot phane strain forging. Control of processing variables and the presence of niobium strongly modify the austenite microstructure, which upon decomposition produces various phases such as polygonal and acicular ferrite and martensite, alone or together in variable proportions. Corresponding to this diversity of structures there is a wide variation in mechanical properties at room temperature: the initial yield point varies from 310 to 650 MPa and the reduction of area in uniaxial tension from 82 to 57% for the niobium steel. These results show that hot forging a niobium micro-alloyed steel may be a suitable manufacturing process for satisfying a wide range of specifications in a final product with low equivalent carbon. (Author) [pt

  16. Notch aspects of RSP steel microstructure

    Directory of Open Access Journals (Sweden)

    Michal Černý

    2012-01-01

    Full Text Available For a rather long time, basic research projects have been focused on examinations of mechanical properties for Rapid Solidification Powder (RSP steels. These state-of-art steels are commonly known as “powdered steels“. In fact, they combine distinctive attributes of conventional steel alloys with unusual resistance of construction material manufactured by so called “pseudo-powdered” metallurgy.Choice of suitable materials for experimental verification was carried out based on characteristic application of so called “modern steel”. First, groups of stainless and tool steel types (steel grades ČSN 17 and 19 were selected. These provided representative specimens for the actual comparison experiment. For stainless steel type, two steel types were chosen: hardenable X47Cr14 (ČSN 17 029 stainless steel and non-hardenable X2CrNiMo18-14-3 (ČSN 17 350 steel. They are suitable e.g. for surgical tools and replacements (respectively. For tooling materials, C80U (ČSN 19 152 carbon steel and American D2 highly-alloyed steel (ČSN “equivalent” being 19 572 steel were chosen for the project. Finally, the M390 Böhler steel was chosen as representative of powdered (atomized steels. The goal of this paper is to discuss structural aspects of modern stainless and tool steel types and to compare them against the steel made by the RSP method. Based on the paper's results, impact of powdered steel structural characteristics on the resistance to crack initiation shall be evaluated.

  17. Boron Steel: An Alternative for Costlier Nickel and Molybdenum Alloyed Steel for Transmission Gears

    Directory of Open Access Journals (Sweden)

    A. Verma

    2010-06-01

    Full Text Available Case Carburized (CC low carbon steels containing Ni, Cr and Mo alloying elements are widely used for transmission gears in automobile, as it possesses desired mechanical properties. In order to cut cost and save scarce materials like Ni and Mo for strategic applications, steel alloyed with Boron has been developed, which gives properties comparable to Ni-Cr-Mo alloyed steel. In the process of steel development, care was taken to ensure precipitation of boron which results in precipitation hardening. The characterization of the developed boron steel had exhibited properties comparable to Ni-Cr-Mo alloyed steel and superior to conventional boron steel.

  18. A liquid aluminum corrosion resistance surface on steel substrate

    International Nuclear Information System (INIS)

    Wang Deqing; Shi Ziyuan; Zou Longjiang

    2003-01-01

    The process of hot dipping pure aluminum on a steel substrate followed by oxidation was studied to form a surface layer of aluminum oxide resistant to the corrosion of aluminum melt. The thickness of the pure aluminum layer on the steel substrate is reduced with the increase in temperature and time in initial aluminizing, and the thickness of the aluminum layer does not increase with time at given temperature when identical temperature and complete wetting occur between liquid aluminum and the substrate surface. The thickness of the Fe-Al intermetallic layer on the steel base is increased with increasing bath temperature and time. Based on the experimental data and the mathematics model developed by the study, a maximum exists in the thickness of the Fe-Al intermetallic at certain dipping temperature. X-ray diffraction (XRD) and energy dispersive X-ray (EDX) analysis reveals that the top portion of the steel substrate is composed of a thin layer of α-Al 2 O 3 , followed by a thinner layer of FeAl 3 , and then a much thicker one of Fe 2 Al 5 on the steel base side. In addition, there is a carbon enrichment zone in diffusion front. The aluminum oxide surface formed on the steel substrate is in perfect condition after corrosion test in liquid aluminum at 750 deg. C for 240 h, showing extremely good resistance to aluminum melt corrosion

  19. Hydrogen embrittlement property of a 1700-MPa-class ultrahigh-strength tempered martensitic steel

    Energy Technology Data Exchange (ETDEWEB)

    Li Songjie; Zhang Boping [School of Materials Science and Engineering, University of Science and Technology Beijing, No. 30 Xueyuan Road, Hidian Zone, Beijing 100083 (China); Akiyama, Eiji; Yuuji, Kimura; Tsuzaki, Kaneaki [Structural Metals Center, National Institute for Materials Science, 1-2-1 Sengen, Tsukuba, Ibaraki 305-0047 (Japan); Uno, Nobuyoshi, E-mail: AKIYAMA.Eiji@nims.go.j [Nippon Steel and Sumikin Metal Products Co, Ltd, SA Bldg., 17-12 Kiba 2-chome, Koto-ku, Tokyo (Japan)

    2010-04-15

    The hydrogen embrittlement property of a prototype 1700-MPa-class ultrahigh-strength steel (NIMS17) containing hydrogen traps was evaluated using a slow strain rate test (SSRT) after cathodic hydrogen precharging, cyclic corrosion test (CCT) and atmospheric exposure. The hydrogen content in a fractured specimen was measured after SSRT by thermal desorption spectroscopy (TDS). The relationship between fracture stress and hydrogen content for the hydrogen-precharged specimens showed that the fracture stress of NIMS17 steel was higher, at a given hydrogen content, than that of conventional AISI 4135 steels with tensile strengths of 1300 and 1500 MPa. This suggests better resistance of NIMS17 steel to hydrogen embrittlement. However, hydrogen uptake to NIMS17 steel under CCT and atmospheric exposure decreased the fracture stress. This is because of the stronger hydrogen uptake to the steel containing hydrogen traps than to the AISI 4135 steels. Although NIMS17 steel has a higher strength level than AISI 4135 steel with a tensile strength of 1500 MPa, the decrease in fracture stress is similar between these steels.

  20. Hydrogen embrittlement property of a 1700-MPa-class ultrahigh-strength tempered martensitic steel

    Directory of Open Access Journals (Sweden)

    Songjie Li, Eiji Akiyama, Kimura Yuuji, Kaneaki Tsuzaki, Nobuyoshi Uno and Boping Zhang

    2010-01-01

    Full Text Available The hydrogen embrittlement property of a prototype 1700-MPa-class ultrahigh-strength steel (NIMS17 containing hydrogen traps was evaluated using a slow strain rate test (SSRT after cathodic hydrogen precharging, cyclic corrosion test (CCT and atmospheric exposure. The hydrogen content in a fractured specimen was measured after SSRT by thermal desorption spectroscopy (TDS. The relationship between fracture stress and hydrogen content for the hydrogen-precharged specimens showed that the fracture stress of NIMS17 steel was higher, at a given hydrogen content, than that of conventional AISI 4135 steels with tensile strengths of 1300 and 1500 MPa. This suggests better resistance of NIMS17 steel to hydrogen embrittlement. However, hydrogen uptake to NIMS17 steel under CCT and atmospheric exposure decreased the fracture stress. This is because of the stronger hydrogen uptake to the steel containing hydrogen traps than to the AISI 4135 steels. Although NIMS17 steel has a higher strength level than AISI 4135 steel with a tensile strength of 1500 MPa, the decrease in fracture stress is similar between these steels.

  1. Hydrogen embrittlement property of a 1700-MPa-class ultrahigh-strength tempered martensitic steel

    International Nuclear Information System (INIS)

    Li Songjie; Zhang Boping; Akiyama, Eiji; Yuuji, Kimura; Tsuzaki, Kaneaki; Uno, Nobuyoshi

    2010-01-01

    The hydrogen embrittlement property of a prototype 1700-MPa-class ultrahigh-strength steel (NIMS17) containing hydrogen traps was evaluated using a slow strain rate test (SSRT) after cathodic hydrogen precharging, cyclic corrosion test (CCT) and atmospheric exposure. The hydrogen content in a fractured specimen was measured after SSRT by thermal desorption spectroscopy (TDS). The relationship between fracture stress and hydrogen content for the hydrogen-precharged specimens showed that the fracture stress of NIMS17 steel was higher, at a given hydrogen content, than that of conventional AISI 4135 steels with tensile strengths of 1300 and 1500 MPa. This suggests better resistance of NIMS17 steel to hydrogen embrittlement. However, hydrogen uptake to NIMS17 steel under CCT and atmospheric exposure decreased the fracture stress. This is because of the stronger hydrogen uptake to the steel containing hydrogen traps than to the AISI 4135 steels. Although NIMS17 steel has a higher strength level than AISI 4135 steel with a tensile strength of 1500 MPa, the decrease in fracture stress is similar between these steels.

  2. Value Chain Model for Steel Manufacturing Sector: A Case Study

    OpenAIRE

    S G Acharyulu; K Venkata Subbaiah; K Narayana Rao

    2018-01-01

    Michael E Porter developed a value chain model for manufacturing sector with five primary activities and four supporting activities. The value chain model developed by Porter is extended to a steel manufacturing sector due to expansions of steel plants has become a continual process for their growth and survival. In this paper a value chain model for steel manufacturing sector is developed considering five primary activities and six support activities.

  3. Damascus steel ledeburite class

    Science.gov (United States)

    Sukhanov, D. A.; Arkhangelsky, L. B.; Plotnikova, N. V.

    2017-02-01

    Discovered that some of blades Damascus steel has an unusual nature of origin of the excess cementite, which different from the redundant phases of secondary cementite, cementite of ledeburite and primary cementite in iron-carbon alloys. It is revealed that the morphological features of separate particles of cementite in Damascus steels lies in the abnormal size of excess carbides having the shape of irregular prisms. Considered three hypotheses for the formation of excess cementite in the form of faceted prismatic of excess carbides. The first hypothesis is based on thermal fission of cementite of a few isolated grains. The second hypothesis is based on the process of fragmentation cementite during deformation to the separate the pieces. The third hypothesis is based on the transformation of metastable cementite in the stable of angular eutectic carbide. It is shown that the angular carbides are formed within the original metastable colony ledeburite, so they are called “eutectic carbide”. It is established that high-purity white cast iron is converted into of Damascus steel during isothermal soaking at the annealing. It was revealed that some of blades Damascus steel ledeburite class do not contain in its microstructure of crushed ledeburite. It is shown that the pattern of carbide heterogeneity of Damascus steel consists entirely of angular eutectic carbides. Believe that Damascus steel refers to non-heat-resistant steel of ledeburite class, which have similar structural characteristics with semi-heat-resistant die steel or heat-resistant high speed steel, differing from them only in the nature of excess carbide phase.

  4. Interaction model of steel ladle of continuous caster in steel works

    Directory of Open Access Journals (Sweden)

    Huang Bang Fu

    2016-01-01

    Full Text Available For further research on the precondition and interoperability model of interaction ladles among continuous caster, this article takes steel ladle of Y steel works as the object of research. On the basis of turnover number calculation model of single cast steel ladle, the relationship between cast number and the turnover number and turnover times and last turnover number are further analyzed. The simulation of steel ladle turnover rules was taken on the 2 continuous casters with Gantt chart. After that, the relationships between turnover number and last turnover number and non-turnover number are researched deeply. Combining with the Gantt chart, the expressions of start casting time and empty ladle ending time and heavy ladle starting time were put forward. The precondition of steel ladle interaction is obtained, which means the exchange ladle should not undertaking transport task in first stop continuous caster, and the empty ladle end time of exchange ladle of first stop continuous caster should early than the heavy ladle start time of last stop continuous caster. After applying the model to practice, 3 steel ladles of No.2 continuous caster can be reduced. This research results is supplying theoretical basis for steel ladle controlling and production organization optimization, and enriches the theory and method of metallurgical process integration.

  5. Microstructural characterization in dissimilar friction stir welding between 304 stainless steel and st37 steel

    International Nuclear Information System (INIS)

    Jafarzadegan, M.; Feng, A.H.; Abdollah-zadeh, A.; Saeid, T.; Shen, J.; Assadi, H.

    2012-01-01

    In the present study, 3 mm-thick plates of 304 stainless steel and st37 steel were welded together by friction stir welding at a welding speed of 50 mm/min and tool rotational speed of 400 and 800 rpm. X-ray diffraction test was carried out to study the phases which might be formed in the welds. Metallographic examinations, and tensile and microhardness tests were used to analyze the microstructure and mechanical properties of the joint. Four different zones were found in the weld area except the base metals. In the stir zone of the 304 stainless steel, a refined grain structure with some features of dynamic recrystallization was evidenced. A thermomechanically-affected zone was characterized on the 304 steel side with features of dynamic recovery. In the other side of the stir zone, the hot deformation of the st37 steel in the austenite region produced small austenite grains and these grains transformed to fine ferrite and pearlite and some products of displacive transformations such as Widmanstatten ferrite and martensite by cooling the material after friction stir welding. The heat-affected zone in the st37 steel side showed partially and fully refined microstructures like fusion welding processes. The recrystallization in the 304 steel and the transformations in the st37 steel enhanced the hardness of the weld area and therefore, improved the tensile properties of the joint. - Highlights: ► FSW produced sound welds between st37 low carbon steel and 304 stainless steel. ► The SZ of the st37 steel contained some products of allotropic transformation. ► The material in the SZ of the 304 steel showed features of dynamic recrystallization. ► The finer microstructure in the SZ increased the hardness and tensile strength.

  6. Comparison of the performance of concrete-filled steel tubular and hollow steel diagrid buildings

    Science.gov (United States)

    Peter, Minu Ann; S, Sajith A.; Nagarajan, Praveen

    2018-03-01

    In the recent construction scenario, diagrid structures are becoming a popular high-rise building structural system. Diagrid structures consist of diagonals in the perimeter and an interior core. The corner and interior vertical columns are not required due to the structural efficiency of diagrid structural systems. Steel and concrete are commonly used material for diagrid. An alternate material for diagrid is concrete-filled steel tube (CFST). CFST incorporates the advantages of both steel and concrete. In CFST, the inward buckling of the steel tube is effectively prevented by the filled concrete. The compressive strength of concrete increases due to the tri-axial state of stress in concrete induced by the steel tube. The longitudinal as well as lateral reinforcement to the concrete core is also provided by the steel tube. This paper compares the performance of CFST and steel diagrid buildings using linear static analysis. For this purpose, a 12 storey and 36 storey building are analysed using finite element method and CFST diagrid building is found to perform better.

  7. Steel Industry Wastes.

    Science.gov (United States)

    Schmidtke, N. W.; Averill, D. W.

    1978-01-01

    Presents a literature review of wastes from steel industry, covering publications of 1976-77. This review covers: (1) coke production; (2) iron and steel production; (3) rolling operations; and (4) surface treatment. A list of 133 references is also presented. (NM)

  8. A Goal Programming Optimization Model for The Allocation of Liquid Steel Production

    Science.gov (United States)

    Hapsari, S. N.; Rosyidi, C. N.

    2018-03-01

    This research was conducted in one of the largest steel companies in Indonesia which has several production units and produces a wide range of steel products. One of the important products in the company is billet steel. The company has four Electric Arc Furnace (EAF) which produces liquid steel which must be procesed further to be billet steel. The billet steel plant needs to make their production process more efficient to increase the productvity. The management has four goals to be achieved and hence the optimal allocation of the liquid steel production is needed to achieve those goals. In this paper, a goal programming optimization model is developed to determine optimal allocation of liquid steel production in each EAF, to satisfy demand in 3 periods and the company goals, namely maximizing the volume of production, minimizing the cost of raw materials, minimizing maintenance costs, maximizing sales revenues, and maximizing production capacity. From the results of optimization, only maximizing production capacity goal can not achieve the target. However, the model developed in this papare can optimally allocate liquid steel so the allocation of production does not exceed the maximum capacity of the machine work hours and maximum production capacity.

  9. The Study for Recycling NORM - Contaminated Steel Scraps from Steel Industry

    International Nuclear Information System (INIS)

    Tsai, K. F.; Lee, Y. S.; Chao, H. E.

    2003-01-01

    Since 1994, most of the major steel industries in Taiwan have installed portal monitor to detect the abnormal radiation in metal scrap feed. As a result, the discovery of NORM (Naturally Occurring Radioactive Material) has increased in recent years. In order to save the natural resources and promote radiation protection, an experimental melting process for the NORM contaminated steel scraps was carried out by the Institute of Nuclear Energy Research (INER) Taiwan, ROC. The experimental melting process has a pretreatment step that includes a series of cutting and removal of scales, sludge, as well as combustible and volatile materials on/in the steel scraps. After pretreatment the surface of the steel scraps are relatively clean. Then the scraps are melted by a pilot-type induction furnace. This experiment finally produced seven ingots with a total weight of 2,849 kg and 96.8% recovery. All of the surface dose rates are of the background values. The activity concentrations of these ingots are also below the regulatory criteria. Thus, these NORM-bearing steel scraps are ready for recycling. This study has been granted by the regulatory authority

  10. On choice of tempered steels

    International Nuclear Information System (INIS)

    Govorov, A.A.; Pan'shin, I.F.; Rakhmanov, V.I.

    1978-01-01

    For the purpose of developing a graphical method for choosing structural steels, a change in the propagation work of a crack and in the critical temperature of brittleness of 40, 40Kh, 40KhN, and 40KhNM steels, was examined depending on the hardness after hardening and tempering. A diagram enabling to choose the grade of steel for making an article of known dimensions according to the preset values of its mechanical properties has been plotted. The developed selection scheme takes into account the hardenability of steels and the influence of the hardness after thermal treatment on the cold-shortness of steel

  11. Hydrogen gas embrittlement of stainless steels mainly austenitic steels. Volumes 1 and 2

    International Nuclear Information System (INIS)

    Azou, P.

    1988-01-01

    Steel behavior in regard to hydrogen is examined especially austenitic steels. Gamma steels are studied particularly the series 300 with various stabilities and gamma steels with improved elasticity limit for intermetallic phase precipitation and nitrogen additions. A two-phase structure γ + α' is also studied. All the samples are tested for mechanical behavior in gaseous hydrogen. Influence of metallurgical effects and of testing conditions on hydrogen embrittlement are evidenced. Microstructure resulting from mechanical or heat treatments, dislocation motion during plastic deformation and influence of deformation rate are studied in detail [fr

  12. Effect of cooling rate on the phase structure and magnetic properties of Fe{sub 26.7}Co{sub 28.5}Ni{sub 28.5}Si{sub 4.6}B{sub 8.7}P{sub 3} high entropy alloy

    Energy Technology Data Exchange (ETDEWEB)

    Wei, Ran; Sun, Huan; Chen, Chen [School of Materials Science and Engineering, Zhengzhou University, Zhengzhou 450001 (China); Han, Zhenhua [School of Materials Science and Engineering, Xi’an University of Technology, Xi’an 710068 (China); Li, Fushan, E-mail: fsli@zzu.edu.cn [School of Materials Science and Engineering, Zhengzhou University, Zhengzhou 450001 (China)

    2017-08-01

    Highlights: • High entropy alloy with amorphous phase and FCC solid solution phase are successfully developed respectively. • The amorphous phase exhibits better soft magnetic properties than that of the solid solution phase. • The BCC phase transformed into FCC phase, and then into BCC phase was found in this HEA. - Abstract: The effect of cooling rate on phase structure and magnetic properties of the Fe{sub 26.7}Co{sub 28.5}Ni{sub 28.5}Si{sub 4.6}B{sub 8.7}P{sub 3} high entropy alloy (HEA) was investigated. The HEA forms into amorphous phase by melt spinning method at high cooling rate and FCC solid solution phase at low cooling rate. The soft magnetic properties of the amorphous phase (saturation magnetization B{sub s} of 1.07T and coercivity H{sub c} of 4 A/m) are better than that of the solid solution phase (B{sub s} of 1.0 T and H{sub c} of 168 A/m). In order to study the phase evolution of the present HEA, anneal experiments were conducted. It is found that crystallization products of amorphous phase are solid solution phase which constitute much of FCC and a small amount of BCC. BCC phase transforms into FCC phase, and then into BCC phase with the increase of annealing temperature.

  13. Optimization of the A-TIG welding for stainless steels

    Science.gov (United States)

    Jurica, M.; Kožuh, Z.; Garašić, I.; Bušić, M.

    2018-03-01

    The paper presents the influence of the activation flux and shielding gas on tungsten inert gas (A-TIG) welding of the stainless steel. In introduction part, duplex stainless steel was analysed. The A-TIG process was explained and the possibility of welding stainless steels using the A-TIG process to maximize productivity and the cost-effectiveness of welded structures was presented. In the experimental part duplex, 7 mm thick stainless steel has been welded in butt joint. The influence of activation flux chemical composition upon the weld penetration has been investigated prior the welding. The welding process was performed by a robot with TIG equipment. With selected A-TIG welding technology preparation of plates and consumption of filler material (containing Cr, Ni and Mn) have been avoided. Specimens sectioned from the produced welds have been subjected to tensile strength test, macrostructure analysis and corrosion resistance analysis. The results have confirmed that this type of stainless steel can be welded without edge preparation and addition of filler material containing critical raw materials as Cr, Ni and Mn when the following welding parameters are set: current 200 A, welding speed 9,1 cm/min, heat input 1,2 kJ/mm and specific activation flux is used.

  14. Nanoscale microstructural characterization of a nanobainitic steel

    Energy Technology Data Exchange (ETDEWEB)

    Timokhina, I.B., E-mail: ilana.timokhina@eng.monash.edu.au [Centre for Material and Fibre Innovation, Deakin University, Victoria 3216 (Australia); Beladi, H. [Centre for Material and Fibre Innovation, Deakin University, Victoria 3216 (Australia); Xiong, X.Y. [Monash Centre for Electron Microscopy, Monash University, Victoria 3800 (Australia); Adachi, Y. [National Institute for Materials Science, 1-2-1 Sengen, Tsukuba 305-0047 (Japan); Hodgson, P.D. [Centre for Material and Fibre Innovation, Deakin University, Victoria 3216 (Australia)

    2011-08-15

    A 0.79 C-1.5 Si-1.98 Mn-0.98 Cr-0.24 Mo-1.06 Al-1.58 Co (wt.%) steel was isothermally heat treated at 200 deg. C for 10 days and 350 deg. C for 1 day to form a nanoscale bainitic microstructure consisting of nanobainitic ferrite laths with high dislocation density and retained austenite films. The microstructures of the samples were characterized by transmission electron microscopy and atom probe tomography. Despite the formation of nanoscale bainite with a high volume fraction of retained austenite in both steels, the ductility of both steels was surprisingly low. It is believed that this was associated with the formation of carbon-depleted retained austenite after isothermal transformation at 200 deg. C due to the formation of high number of Fe-C clusters and particles in the bainitic ferrite laths and carbon-enriched austenite after isothermal transformation at 350 deg. C.

  15. Ductile fracture of two-phase welds under 77K. [Steel-EhP810, steel-EhP666, steel-08Kh18N10T, steel-EhP659-VI, steel-chP810

    Energy Technology Data Exchange (ETDEWEB)

    Yushchenko, K.A.; Voronin, S.A.; Pustovit, A.I.; Shavel' , A.V.

    The effect of the type of welding and fillers on crack resistance of welded joints high-strength steel EhP810 and its various compounds with steels EhP666, 08Kh18N10T has been studied. For the welding of steel EhP810 with steels EhP810, EhP666, 08Kh18N10T electron-beam, automatic, argon tungsten arc with non-consumable electrode with various fillers, as well as argon metal-arc welding with consumable electrode, were used. It is shown, that for a joint, made by electron-beam welding, parameters sigmasub(u), Ksub(IcJ), KCV are higher than for a joint of a similar phase structure made using filler wire EhP659-VI. It is explained by the fact, that during electron-beam welding joint metal refining takes place, which removes gases. In welded joints of chP810 steel, having joints with austenitic structure, characteristic of crack resistance Ssub(c) increases by more than 0.2 mm in contrast to two-phase joints, which conventional yield strength at 77 K exceeds 1000 MPa. It is worth mentioning, that for other classes of steels formation of two-phase structure of joint increases welded joint resistance to brittle fracture. It is possible to obtain the required structure of joint with assigned level of resistance to brittle fracture by means of the use of different fillers, optimum and welding procedure, regulating the part of the basic metal in joint content.

  16. Radiation embrittlement of WWER 440 pressure vessel steel and of some improved steels by western producers

    International Nuclear Information System (INIS)

    Koutsky, J.; Vacek, M.; Stoces, B.; Pav, T.; Otruba, J.; Novosad, P.; Brumovsky, M.

    1982-01-01

    The resistance was studied of Cr-Mo-V type steel 15Kh2MFA to radiation embrittlement at an irradiation temperature of around 288 degC. Studied was the steel used for the manufacture of the pressure vessel of the Paks nuclear reactor in Hungary. The obtained results of radiation embrittlement and hardening of steel 15Kh2MFA were compared with similar values of Mn-Ni-Mo type steels A 533-B and A 508 manufactured by leading western manufacturers within the international research programme coordinated by the IAEA. It was found that the resistance of steel 15Kh2MFA to radiation embrittlement is comparable with steels A 533-B and A 508 by western manufacturers. (author)

  17. A Stress Measurement Method for Steel Strands Based on LC Oscillation

    Directory of Open Access Journals (Sweden)

    Dongjun Chen

    2018-01-01

    Full Text Available The prestress loss is one of the main factors affecting the safety of prestressed concrete structure. While the detecting signals like sound and light are difficult to spread in steel strands, there is no effective method for prestress detection of the bonded prestressed steel strands in existing structures yet. In this paper, taking into consideration that the electromagnetic oscillation characteristic can make the signal propagate effectively on the bonded prestressed steel strands, a nondestructive prestress detection method based on the electromagnetic effect to detect oscillation frequency is proposed. In a detection circuit, the steel strands are simulated as an inductance component, in which an induced electromagnetic signal passes through the steel strands to form resonance. And then, a frequency meter is used to detect the oscillation frequency of the resonant circuit. The oscillation frequency is supposed to have relationship with the prestress loading on the steel strands. A section of steel strands with a length of 1.2 m is adopted to test the correlation of stress and oscillation frequency. Both the theoretical and experimental results show that the resonant frequency of the circuit decreases with the increase of the stress of the strand and is linear in a certain range.

  18. Characterization of oxide films formed on steels in a BWR environment

    International Nuclear Information System (INIS)

    Honda, Takashi; Ohashi, Kenya; Kashimura, Eiji; Furutani, Yasumasa

    1988-01-01

    Environmental effects on corrosion bahaviors and properties of oxide films were evaluated for austenitic stainless and carbon steels in high-temperature water simulating a Boiling Water Reactor condition. The existence ratios of Cr and OH - in oxide films formed on stainless steel decreased and those of Fe, Ni and O 2- increased with increases of temperature and dissolved oxygen concentration. Changes of pH in the test region did not affect the composition of these species. These results indicated that Cr tended to combine with OH - , i.e., Cr existed as hydroxides or oxyhydroxides. Further, Fe and Ni tended to form spinel type oxides, which were indentified by XRD. In addition, the corrosion resistance of stainless steel was higher than that of carbon steel in all environments. The protectivity of magnetite films on carbon steel increased with temperature, dissolved oxygen concentration and pH. However, Ni ferrite, formed on stainless steel, further improved the corrosion resistance under such conditions. On the other hand, as the solubility of magnetite increased with decreases in the above mentioned factors, the corrosion resistance of carbon steel decreased. But, even under such conditions Cr, contained in stainless steel, tended to form stable films and suppressed corrosion. (author)

  19. Evolution of dislocations and twins in a strong and ductile nanotwinned steel

    International Nuclear Information System (INIS)

    Zhou, P.; Liang, Z.Y.; Liu, R.D.; Huang, M.X.

    2016-01-01

    A twinning-induced plasticity (TWIP) steel was subjected to a simple processing route (i.e. cold rolling followed by a recovery heat treatment) suitable for large-scale industrial production, resulting in the production of a strong and ductile nanotwinned steel. This nanotwinned steel combines high yield strength (1450 MPa), high ultimate tensile strength (1600 MPa) and good ductility (25% total elongation). Detailed transmission electron microscopy observation reveals that the twin volume fraction of the nanotwinned steel remains constant during tensile deformation. This is different to the deformation behaviour of recrystallized TWIP steels whose twin volume fraction increase continuously with strain during tensile deformation. The constant twin volume fraction indicates that a maximum twin volume fraction has been reached during the cold rolling process. In contrast, the dislocation density of the nanotwinned steel increases with strain as measured by the synchrotron X-ray diffraction experiments. In other words, the plastic deformation of the nanotwinned steel is mainly accommodated by glide and multiplication of dislocations. Based on the experimental results, an analytical model was developed to capture the respective effects of dislocations and twins on the strength and ductility of the present nanotwinned steel. The modelling results indicate that the strength is contributed by both twins and dislocations while the ductility is mainly attributed to dislocation multiplication. -- Graphical abstract: (a) TEM bright field image showing intensive nanotwins in the nanotwinned steel. Selected area diffraction pattern obtained within the red circle. (b) The engineering stress–stain curve of the nanotwinned steel. Display Omitted

  20. Risk of lung cancer according to mild steel and stainless steel welding

    DEFF Research Database (Denmark)

    Sørensen, Anita Rath; Thulstrup, Ane Marie; Hansen, Johnni

    2007-01-01

    OBJECTIVES: Whether the elevated risk of lung cancer observed among welders is caused by welding emissions or by confounding from smoking or asbestos exposure is still not resolved. This question was addressed in a cohort with a long follow-up and quantified estimates of individual exposure.......06-1.70)]. Among the stainless steel welders, the risk increased significantly with increasing accumulative welding particulate exposure, while no exposure-response relation was found for mild steel welders, even after adjustment for tobacco smoking and asbestos exposure. CONCLUSIONS: The study corroborates...... earlier findings that welders have an increased risk of lung cancer. While exposure-response relations indicate carcinogenic effects related to stainless steel welding, it is still unresolved whether the mild steel welding process carries a carcinogenic risk....

  1. Production of Green Steel from Red Mud: A Novel Concept

    Science.gov (United States)

    Bhoi, Bhagyadhar; Behera, Pravas Ranjan; Mishra, Chitta Ranjan

    Red mud of Indian origin contains around 55% plus of Fe2O3 and is considered as a hazardous waste for the alumina industry. For production of one tone of alumina employing the Bayer's Process, around two tones of red mud is generated from three tones of Bauxite. Conventional process of steel making is not devoid of environmental pollution. In the present investigation, efforts have been made to produce steel from red mud by adopting reduction roasting, magnetic separation and hydrogen plasma smelting route. Magnetic fraction, containing enriched iron oxide and minimal content of alumina, is produced following the first two stages which is then subjected to hydrogen plasma smelting process for production of steel. This novel concept follows a green path way for production of steel free from pollution and is termed as green steel. Further, the only by-product that is produced in the process, is water, which is eco-friendly and recyclable.

  2. Corrosion of mild steel and stainless steel by marine Vibrio sp.

    Digital Repository Service at National Institute of Oceanography (India)

    PrabhaDevi; Wagh, A.B.

    Microbially induced corrosion (MIC) of stainless steel and mild steel coupons exposed to media with and without a bacterial culture Vibrio sp. was studied using Scanning Electron Microscope (SEM). Pitting type of corrosion was noticed which was more...

  3. Steel: Price and Policy Issues

    National Research Council Canada - National Science Library

    Cooney, Stephen

    2006-01-01

    Steel prices remain at historically elevated levels. The rapid growth of steel production and demand in China is widely considered as a major cause of the increases in both steel prices and the prices of steelmaking inputs...

  4. Vibrational Based Inspection Of A Steel Mast

    DEFF Research Database (Denmark)

    Kirkegaard, Poul Henning; Rytter, A.

    1994-01-01

    The aim of this paper is to present the results from a research project concerning vibrational based inspection of a 20 meter high steel mast containing well defined damages. Introductory analyses dealing with among other things evaluation of potential damage indicators and determination of accep......The aim of this paper is to present the results from a research project concerning vibrational based inspection of a 20 meter high steel mast containing well defined damages. Introductory analyses dealing with among other things evaluation of potential damage indicators and determination...

  5. Analysis of the Behaviour of Composite Steel and Steel Fiber Reinforced Concrete Slabs

    Directory of Open Access Journals (Sweden)

    Mindaugas Petkevičius

    2011-04-01

    Full Text Available There was a pending influence of steel fiber on the strength and stiffness of composite steel–concrete slabs under statical short–time load. Steel profiled sheeting and steel fiber reinforced concrete were used for specimens. Four composite slabs were made. Experimental investigations into the behaviour and influence of steel fiber reinforced concrete in composite slabs were conducted. Transverse, longitudinal, shear deformation and deflection of the slab were measured. The results indicated that the use of steel fiber in composite slabs was effective: strength was 20–24 % higher and the meanings of deflections under the action of the bending moment were 0,6MR (where MR is the bending moment at failure of the slabs and were 16–18 % lower for slabs with usual concrete. Article in Lithuanian

  6. A comparison of the tribological behaviour of steel/steel, steel/DLC and DLC/DLC contact when lubricated with mineral and biodegradable oils

    OpenAIRE

    Kalin, Mitjan; Vižintin, Jože

    2015-01-01

    Diamond-like carbon (DLC) coatings, which can nowadays be applied to many highly loaded mechanical components, sometimes need to operate under lubricated conditions. It is reasonable to expect that in steel/DLC contacts, at least the steel counter body will behave according to conventional lubrication mechanisms and will interact with lubricants and additives in the contact. However, in DLC/DLC contacts, such mechanisms are still unclear. For example, the "inertness" of DLC coatings raises se...

  7. Challenges in Special Steel Making

    Science.gov (United States)

    Balachandran, G.

    2018-02-01

    Special bar quality [SBQ] is a long steel product where an assured quality is delivered by the steel mill to its customer. The bars have enhanced tolerance to higher stress application and it is demanded for specialised component making. The SBQ bars are sought for component making processing units such as closed die hot forging, hot extrusion, cold forging, machining, heat treatment, welding operations. The final component quality of the secondary processing units depends on the quality maintained at the steel maker end along with quality maintained at the fabricator end. Thus, quality control is ensured at every unit process stages. The various market segments catered to by SBQ steel segment is ever growing and is reviewed. Steel mills need adequate infrastructure and technological capability to make these higher quality steels. Some of the critical stages of processing SBQ and the critical quality maintenance parameters at the steel mill in the manufacture has been brought out.

  8. Fracture Mechanisms in Steel Castings

    Directory of Open Access Journals (Sweden)

    Stradomski Z.

    2013-09-01

    Full Text Available The investigations were inspired with the problem of cracking of steel castings during the production process. A single mechanism of decohesion - the intergranular one - occurs in the case of hot cracking, while a variety of structural factors is decisive for hot cracking initiation, depending on chemical composition of the cast steel. The low-carbon and low-alloyed steel castings crack due to the presence of the type II sulphides, the cause of cracking of the high-carbon tool cast steels is the net of secondary cementite and/or ledeburite precipitated along the boundaries of solidified grains. Also the brittle phosphor and carbide eutectics precipitated in the final stage solidification are responsible for cracking of castings made of Hadfield steel. The examination of mechanical properties at 1050°C revealed low or very low strength of high-carbon cast steels.

  9. In situ 3D monitoring of corrosion on carbon steel and ferritic stainless steel embedded in cement paste

    International Nuclear Information System (INIS)

    Itty, Pierre-Adrien; Serdar, Marijana; Meral, Cagla; Parkinson, Dula; MacDowell, Alastair A.; Bjegović, Dubravka; Monteiro, Paulo J.M.

    2014-01-01

    Highlights: • The morphology of the corrosion of steel in cement paste was studied in situ. • During galvanostatic corrosion, carbon steel reinforcement corroded homogeneously. • On ferritic stainless steel, deep corrosion pits formed and caused wider cracks. • The measured rate of steel loss correlated well with Faraday’s law of electrolysis. - Abstract: In a X-ray microcomputed tomography study, active corrosion was induced by galvanostatically corroding steel embedded in cement paste. The results give insight into corrosion product build up, crack formation, leaching of products into the cracks and voids, and differences in morphology of corrosion attack in the case of carbon steel or stainless steel reinforcement. Carbon steel was homogeneously etched away with a homogeneous layer of corrosion products forming at the steel/cement paste interface. For ferritic stainless steel, pits were forming, concentrating the corrosion products locally, which led to more extensive damage on the cement paste cover

  10. The hot working characteristics of a boron bearing and a conventional low carbon steel

    International Nuclear Information System (INIS)

    Stumpf, Waldo; Banks, Kevin

    2006-01-01

    Constitutive hot working constants were determined for an 11 ppm boron low carbon strip steel and compared from 875 to 1140 deg. C and strain rates of 0.001-2.5 s -1 to a high nitrogen low carbon strip steel. The boron steel showed a different hot working behaviour than the conventional steel with the steady state flow stress about 50-60% higher, the peak strain more than 50% higher and the eventual ferrite grain size about 40% smaller, if compared at the same temperature compensated strain rates or Z values. This difference persisted where the soaking temperature before compression was varied between 1140 and 1250 deg. C, proving that undissolved AlN in the boron-bearing steel was not responsible. With systematically varied linear cooling rates after hot working, the final ferrite grain size in the boron steel is finer and is independent of the two Z values applied during hot working. Retarded softening by dynamic recrystallisation during hot working in the boron containing steel is probably caused by boron solute drag of moving grain boundaries

  11. Ductility of high chromium stainless steels

    International Nuclear Information System (INIS)

    Peretyat'ko, V.N.; Kazantsev, A.A.

    1997-01-01

    Aimed to optimize the hot working conditions for high chromium stainless steels the experiments were carried in the temperature range of 800-1300 deg C using hot torsion tests and cylindrical specimens of ferritic and ferritic-martensitic steels 08Kh13, 12Kh13, 20Kh13, 30Kh13 and 40Kh13. Testing results showed that steel plasticity varies in a wide range depending on carbon content. Steels of lesser carbon concentration (08Kh13 and 12Kh13) exhibit a sharp increase in plasticity with a temperature rise, especially in the interval of 1200-1250 deg C. Steels 20Kh13 and 30Kh13 display insignificant plasticity increasing, whereas plastic properties of steel 40Kh13 increase noticeably in the range of 1000-1300 deg C. It is shown that optimal hot working conditions for specific steel must be selected with account of steel phase composition at high temperatures

  12. Application of Response Surface Methodology for Modeling of Postweld Heat Treatment Process in a Pressure Vessel Steel ASTM A516 Grade 70.

    Science.gov (United States)

    Peasura, Prachya

    2015-01-01

    This research studied the application of the response surface methodology (RSM) and central composite design (CCD) experiment in mathematical model and optimizes postweld heat treatment (PWHT). The material of study is a pressure vessel steel ASTM A516 grade 70 that is used for gas metal arc welding. PWHT parameters examined in this study included PWHT temperatures and time. The resulting materials were examined using CCD experiment and the RSM to determine the resulting material tensile strength test, observed with optical microscopy and scanning electron microscopy. The experimental results show that using a full quadratic model with the proposed mathematical model is YTS = -285.521 + 15.706X1 + 2.514X2 - 0.004X1(2) - 0.001X2(2) - 0.029X1X2. Tensile strength parameters of PWHT were optimized PWHT time of 5.00 hr and PWHT temperature of 645.75°C. The results show that the PWHT time is the dominant mechanism used to modify the tensile strength compared to the PWHT temperatures. This phenomenon could be explained by the fact that pearlite can contribute to higher tensile strength. Pearlite has an intensity, which results in increased material tensile strength. The research described here can be used as material data on PWHT parameters for an ASTM A516 grade 70 weld.

  13. Effects of nitrogen on corrosion of stainless steels in a liquid sodium environment

    International Nuclear Information System (INIS)

    Suzuki, Tadashi; Mutoh, Isao

    1990-01-01

    The corrosion of ferritic stainless steels using sodium at 650degC in a maximum isothermal region contained in a non-isothermal sodium loop constructed of a Type 316 stainless steel has been examined. Also, previous results on corrosion of austenitic stainless steels in sodium at 700degC in the same loop have been reproduced. The selective dissolution and absorption of nickel, the selective dissolution of chromium, and the resultant increase in iron in the surface of stainless steels in the loop mainly determine the corrosion loss of the stainless steel specimens. The austenitic steels hardly decarburize, but denitride. The ferritic steels decarburize and denitride and the denitriding is more remarkable than the decarburizing. The vanadium and niobium, carbide and nitride formers, in the ferritic steels inhibit the decarburizing to some extent, but barely inhibit the denitriding. The nitrogen in the steels rapidly diffuses to the grain boundaries, and rapidly dissolves into sodium, which will lower surface energy of the steels to enhance the dissolution of other elements. The dissolved N in sodium would then be transported to the free surface of the sodium adjacent to the argon cover gas of sodium and easily be released into the cover gas. This mechanism would cause the rapid dissolution of nitrogen into sodium and the enhancement of the corrosion rate of the steels containing nitrogen. (orig.)

  14. Superplasticity in a lean Fe-Mn-Al steel.

    Science.gov (United States)

    Han, Jeongho; Kang, Seok-Hyeon; Lee, Seung-Joon; Kawasaki, Megumi; Lee, Han-Joo; Ponge, Dirk; Raabe, Dierk; Lee, Young-Kook

    2017-09-29

    Superplastic alloys exhibit extremely high ductility (>300%) without cracks when tensile-strained at temperatures above half of their melting point. Superplasticity, which resembles the flow behavior of honey, is caused by grain boundary sliding in metals. Although several non-ferrous and ferrous superplastic alloys are reported, their practical applications are limited due to high material cost, low strength after forming, high deformation temperature, and complicated fabrication process. Here we introduce a new compositionally lean (Fe-6.6Mn-2.3Al, wt.%) superplastic medium Mn steel that resolves these limitations. The medium Mn steel is characterized by ultrafine grains, low material costs, simple fabrication, i.e., conventional hot and cold rolling, low deformation temperature (ca. 650 °C) and superior ductility above 1300% at 850 °C. We suggest that this ultrafine-grained medium Mn steel may accelerate the commercialization of superplastic ferrous alloys.Research in new alloy compositions and treatments may allow the increased strength of mass-produced, intricately shaped parts. Here authors introduce a superplastic medium manganese steel which has an inexpensive lean chemical composition and which is suited for conventional manufacturing processes.

  15. The industrial ecology of steel

    Energy Technology Data Exchange (ETDEWEB)

    Considine, Timothy J.; Jablonowski, Christopher; Considine, Donita M.M.; Rao, Prasad G.

    2001-03-26

    This study performs an integrated assessment of new technology adoption in the steel industry. New coke, iron, and steel production technologies are discussed, and their economic and environmental characteristics are compared. Based upon detailed plant level data on cost and physical input-output relations by process, this study develops a simple mathematical optimization model of steel process choice. This model is then expanded to a life cycle context, accounting for environmental emissions generated during the production and transportation of energy and material inputs into steelmaking. This life-cycle optimization model provides a basis for evaluating the environmental impacts of existing and new iron and steel technologies. Five different plant configurations are examined, from conventional integrated steel production to completely scrap-based operations. Two cost criteria are used to evaluate technology choice: private and social cost, with the latter including the environmental damages associated with emissions. While scrap-based technologies clearly generate lower emissions in mass terms, their emissions of sulfur dioxide and nitrogen oxides are significantly higher. Using conventional damage cost estimates reported in the literature suggests that the social costs associated with scrap-based steel production are slightly higher than with integrated steel production. This suggests that adopting a life-cycle viewpoint can substantially affect environmental assessment of new technologies. Finally, this study also examines the impacts of carbon taxes on steel production costs and technology choice.

  16. Critical cleavage fracture stress characterization of A508 nuclear pressure vessel steels

    International Nuclear Information System (INIS)

    Wu, Sujun; Jin, Huijin; Sun, Yanbin; Cao, Luowei

    2014-01-01

    The critical cleavage fracture stress of SA508 Gr.4N and SA508 Gr.3 low alloy reactor pressure vessel (RPV) steels was studied through the combination of experiments and finite element method (FEM) analysis. The results showed that the value of the local cleavage fracture stress, σ F , of SA508 Gr.4N steel was significantly higher than that of SA508 Gr.3 steel. Detailed microstructural analysis was carried out using FEGSEM which revealed much smaller grains, finer and more homogenous carbide particles formed in SA508 Gr.4N steel. Compared with the SA508 Gr.3 steel currently used in the nuclear industry, the SA508 Gr.4N steel possesses higher strength and notch toughness as well as improved cleavage fracture behavior, and is considered a better candidate RPV steel for the next generation nuclear reactors. - Highlights: • Critical cleavage fracture stress was calculated through experiments and FEM. • Effects of both grain and carbide particle sizes on σ F were discussed. • The SA508 Gr.4N steel is a better candidate for the next generation nuclear reactors

  17. Additive manufacturing for steels: a review

    Science.gov (United States)

    Zadi-Maad, A.; Rohib, R.; Irawan, A.

    2018-01-01

    Additive manufacturing (AM) of steels involves the layer by layer consolidation of powder or wire feedstock using a heating beam to form near net shape products. For the past decades, the AM technique reaches the maturation of both research grade and commercial production due to significant research work from academic, government and industrial research organization worldwide. AM process has been implemented to replace the conventional process of steel fabrication due to its potentially lower cost and flexibility manufacturing. This paper provides a review of previous research related to the AM methods followed by current challenges issues. The relationship between microstructure, mechanical properties, and process parameters will be discussed. Future trends and recommendation for further works are also provided.

  18. Magnetic anisotropy of textured Nnsub(2,85)Nisub(0,15)Bsub(4)

    International Nuclear Information System (INIS)

    Vlasov, K.B.; Timoshchuk, V.I.; Sesekin, P.N.

    1975-01-01

    Magnetic measurements on Mnsub(2.85)Nisub(0.15)Bsub(4) alloy powder oriented in magnetic field were carried out. The alloy was made by sintering briquetted magnesium, boron, and nickel powders in an evacuated quartz ampule at a temperature of 1150 deg C for 40 h. The average particle size obtained was of an order of 30 μm. The sintered alloy was desintegrated to a particle size below 10 μm and resultant powder placed in a spirit-of-wine filled ampule. The orientation effect was caused by suspension cooling in a magnetic field, of 25 kOe to temperatures below the ferromagnetic transition point and was fixed by further cooling below alcohol freezing temperature. The research indicated that the pattern of magnetizing curves of the alloy in fields of an order of tens of kilooersteds was largely due to the crystallographic magnetic anisotropy energy

  19. Prospects of structural steels

    International Nuclear Information System (INIS)

    Bannykh, O.A.

    2012-01-01

    The current state of world steel production is considered as well as the development strategy of metallurgy industry in the Russian Federation through to 2020. The main factors determining the conservation of steel as perspective material for industry are given: energy expenses on production, the well-proven recirculation technology, the capability of changing steel properties in wide range, temperature range of operation. The conclusion is made that in the immediate future steel will not lose its importance [ru

  20. Machinability of a Stainless Steel by Electrochemical Discharge Microdrilling

    International Nuclear Information System (INIS)

    Coteata, Margareta; Pop, Nicolae; Slatineanu, Laurentiu; Schulze, Hans-Peter; Besliu, Irina

    2011-01-01

    Due to the chemical elements included in their structure for ensuring an increased resistance to the environment action, the stainless steels are characterized by a low machinability when classical machining methods are applied. For this reason, sometimes non-traditional machining methods are applied, one of these being the electrochemical discharge machining. To obtain microholes and to evaluate the machinability by electrochemical discharge microdrilling, test pieces of stainless steel were used for experimental research. The electrolyte was an aqueous solution of sodium silicate with different densities. A complete factorial plan was designed to highlight the influence of some input variables on the sizes of the considered machinability indexes (electrode tool wear, material removal rate, depth of the machined hole). By mathematically processing of experimental data, empirical functions were established both for stainless steel and carbon steel. Graphical representations were used to obtain more suggestive vision concerning the influence exerted by the considered input variables on the size of the machinability indexes.

  1. Steel alloys

    International Nuclear Information System (INIS)

    Bloom, E.E.; Stiegler, J.O.; Rowcliffe, A.F.; Leitnaker, J.M.

    1977-01-01

    The invention deals with a fuel element for fast breeder reactors. It consits essentially of a uranium oxide, nitride, or carbide or a mixture of these fuels with a plutonium or thorium oxide, nitride, or carbide. The fuel elements are coated with an austenitic stainless steel alloy. Inside the fuel elements, vacancies or small cavities are produced by neutron effects which causes the steel coating to swell. According to the invention, swelling is prevented by a modification of type 304, 316, 321, or 12 K 72HV commercial steels. They consist mainly of Fe, Cr, and Ni in a ratio determined by a temary diagram. They may also contain 1.8 to 2.3% by weight of Mo and a fraction of Si (0.7 to 2% by weight) and Ti(0.10 to 0.5% by weight) to prevent cavity formation. They are structurally modified by cold working. (IHOE) [de

  2. Mechanical properties and fatigue strength of high manganese non-magnetic steel/carbon steel welded joints

    International Nuclear Information System (INIS)

    Nakaji, Eiji; Ikeda, Soichi; Kim, You-Chul; Nakatsuji, Yoshihiro; Horikawa, Kosuke.

    1997-01-01

    The dissimilar materials welded joints of high manganese non-magnetic steel/carbon steel (hereafter referred to as DMW joints), in which weld defects such as hot crack or blowhole are not found, were the good quality. Tensile strength of DMW joints was 10% higher than that of the base metal of carbon steel. In the bend tests, the DMW joints showed the good ductility without crack. Charpy absorbed energy at 0(degC) of the DMW joints was over 120(J) in the bond where it seems to be the lowest. Large hardening or softening was not detected in the heat affected zone. Fatigue strength of the DMW joints is almost the same with that of the welded joints of carbon steel/carbon steel. As the fatigue strength of the DMW joints exceeds the fatigue design standard curve of JSSC for carbon steel welded joints, the DMW joints can be treated the same as the welded joints of carbon steel/carbon steel of which strength is lower than that of high manganese non-magnetic steel, from the viewpoint of the fatigue design. (author)

  3. Vibration Properties of a Steel-PMMA Composite Beam

    OpenAIRE

    He, Yuyang; Jin, Xiaoxiong

    2015-01-01

    A steel-polymethyl methacrylate (steel-PMMA) beam was fabricated to investigate the vibration properties of a one-dimensional phononic crystal structure. The experimental system included an excitation system, a signal acquisition system, and a data analysis and processing system. When an excitation signal was exerted on one end of the beam, the signals of six response points were collected with acceleration sensors. Subsequent signal analysis showed that the beam was attenuated in certain fre...

  4. Electrochemical Corrosion Behavior of Carbon Steel and Hot Dip Galvanized Steel in Simulated Concrete Solution with Different pH Values

    Directory of Open Access Journals (Sweden)

    Wanchen XIE

    2017-08-01

    Full Text Available Hot dip galvanizing technology is now widely used as a method of protection for steel rebars. The corrosion behaviors of Q235 carbon steel and hot galvanized steel in a Ca(OH2 solution with a pH from 10 to 13 was investigated by electrode potential and polarization curves testing. The results indicated that carbon steel and hot galvanized steel were all passivated in a strong alkaline solution. The electrode potential of hot dip galvanized steel was lower than that of carbon steel; thus, hot dip galvanized steel can provide very good anodic protection for carbon steel. However, when the pH value reached 12.5, a polarity reversal occurred under the condition of a certain potential. Hot dip galvanized coating became a cathode, and the corrosion of carbon steel accelerated. The electrochemical behaviors and passivation abilities of hot dip galvanized steel and carbon steel were affected by pH. The higher the pH value was, the more easily they were passivated.DOI: http://dx.doi.org/10.5755/j01.ms.23.3.16675

  5. Steels for nuclear power. I

    International Nuclear Information System (INIS)

    Bohusova, O.; Brumovsky, M.; Cukr, B.; Hatle, Z.; Protiva, K.; Stefec, R.; Urban, A.; Zidek, M.

    1976-01-01

    The principles are listed of nuclear reactor operation and the reactors are classified by neutron energy, fuel and moderator designs, purpose and type of moderator. The trend and the development of light-water reactor applications are described. The fundamental operating parameters of the WWER type reactors are indicated. The effect is discussed of neutron radiation on reactor structural materials. The characteristics are described of steel corrosion due to the contact of the steel with steam or sodium in the primary coolant circuit. The reasons for stress corrosion are given and the effects of radiation on corrosion are listed. The requirements and criteria are given for the choice of low-alloy steel for the manufacture of pressure vessels, volume compensators, steam generators, cooling conduits and containment. A survey is given of most frequently used steels for pressure vessels and of the mechanical and structural properties thereof. The basic requirements for the properties of steel used in the primary coolant circuit are as follows: sufficient strength in operating temperature, toughness, good weldability, resistance to corrosion and low brittleness following neutron irradiation. The materials are listed used for the components of light-water and breeder reactors. The production of corrosion-resistant steels is discussed with a view to raw materials, technology, steel-making processes, melting processes, induction furnace steel-making, and to selected special problems of the chemical composition of steels. The effects are mainly discussed of lead, bismuth and tin as well as of some other elements on hot working of high-alloy steels and on their structure. The problems of corrosion-resistant steel welding and of pressure vessel cladding are summed up. Also discussed is the question of the concept and safeguards of the safety of nuclear installation operation and a list is presented of most commonly used nondestructive materials testing methods. The current

  6. Structure and creep of Russian reactor steels with a BCC structure

    Science.gov (United States)

    Sagaradze, V. V.; Kochetkova, T. N.; Kataeva, N. V.; Kozlov, K. A.; Zavalishin, V. A.; Vil'danova, N. F.; Ageev, V. S.; Leont'eva-Smirnova, M. V.; Nikitina, A. A.

    2017-05-01

    The structural phase transformations have been revealed and the characteristics of the creep and long-term strength at 650, 670, and 700°C and 60-140 MPa have been determined in six Russian reactor steels with a bcc structure after quenching and high-temperature tempering. Creep tests were carried out using specially designed longitudinal and transverse microsamples, which were fabricated from the shells of the fuel elements used in the BN-600 fast neutron reactor. It has been found that the creep rate of the reactor bcc steels is determined by the stability of the lath martensitic and ferritic structures in relation to the diffusion processes of recovery and recrystallization. The highest-temperature oxide-free steel contains the maximum amount of the refractory elements and carbides. The steel strengthened by the thermally stable Y-Ti nanooxides has a record high-temperature strength. The creep rate at 700°C and 100 MPa in the samples of this steel is lower by an order of magnitude and the time to fracture is 100 times greater than that in the oxide-free reactor steels.

  7. STRENGTHENING OF A REINFORCED CONCRETE BRIDGE WITH PRESTRESSED STEEL WIRE ROPES

    Directory of Open Access Journals (Sweden)

    Kexin Zhang

    2017-10-01

    Full Text Available This paper describes prestressed steel wire ropes as a way to strengthen a 20-year-old RC T-beam bridge. High strength, low relaxation steel wire ropes with minor radius, high tensile strain and good corrosion resistance were used in this reinforcement. The construction process for strengthening with prestressed steel wire ropes—including wire rope measuring, extruding anchor heads making, anchorage installing, tensioning steel wire ropes and pouring mortar was described. Ultimate bearing capacity of the bridge after strengthening was discussed based on the concrete structure theory. The flexural strength of RC T-beam bridges strengthened with prestressed steel wire ropes was governed by the failure of concrete crushing. To investigate effectiveness of the strengthening method, fielding-load tests were carried out before and after strengthening. The results of concrete strain and deflection show that the flexural strength and stiffness of the strengthened beam are improved. The crack width measurement also indicates that this technique could increase the durability of the bridge. Thus, this strengthened way with prestressed steel wire rope is feasible and effective.

  8. Effect of residual stress on fatigue crack propagation at 200 C in a welded joint austenitic stainless steel - ferritic steel

    International Nuclear Information System (INIS)

    Zahouane, A.I.; Gauthier, J.P.; Petrequin, P.

    1988-01-01

    Fatigue resistance of heterogeneous welded joints between austenitic stainless steels and ferritic steels is evaluated for reactor components and more particularly effect of residual stress on fatigue crack propagation in a heterogeneous welded joint. Residual stress is measured by the hole method in which a hole is drilled through the center of a strain gage glued the surface of the materials. In the non uniform stress field a transmissibility function is used for residual stress calculation. High compression residual stress in the ferritic metal near the interface ferritic steel/weld slow down fatigue crack propagation. 5 tabs., 15 figs., 19 refs [fr

  9. Martensitic transformation in Eurofer-97 and ODS-Eurofer steels: A comparative study

    International Nuclear Information System (INIS)

    Zilnyk, K.D.; Oliveira, V.B.; Sandim, H.R.Z.; Möslang, A.; Raabe, D.

    2015-01-01

    Highlights: • Martensitic transformation of RAFM steels promotes significant grain fragmentation. • Austenite grain growth occurs in Eurofer-97 steel but not in ODS-Eurofer steel. • Boundary misorientation distribution of the as-quenched steels show two maxima peaks. • The amount of retained austenite varies from one steel to another. - Abstract: Reduced-activation ferritic–martensitic Eurofer-97 and ODS-Eurofer steels are potential candidates for structural applications in advanced nuclear reactors. Samples of both steel grades in the as-tempered condition were austenitized in vacuum for 1 h from 900 °C to 1300 °C followed by air cooling to room temperature. The microstructure was characterized by dilatometry, electron backscatter diffraction (EBSD), and X-ray diffraction (XRD). Thermodynamic calculations provided by Thermo-Calc software were used to determine their transformation temperatures. Even having similar chemical composition, important changes were observed after martensitic transformation in these steels. Significant austenitic grain growth was observed in Eurofer-97 steel leading to the development of coarser martensitic packets. Contrastingly, austenitic grain growth was prevented in ODS-Eurofer steel due to fine and stable dispersion of Y-based particles

  10. Stahlschüssel key to steel

    CERN Document Server

    Wegst, W S

    2016-01-01

    The Key to Steel (Stahlschlüssel/Stahlschluessel) cross reference book will help you to decode / decipher steel designations and find equivalent materials worldwide. The 2016 edition includes more than 70,000 standard designations and trade names from approximately 300 steelmakers and suppliers. Presentation is trilingual: English, French, and German. Materials covered include structural steels, tool steels, valve steels, high temperature steels and alloys, stainless and heat-resisting steels, and more. Standards and designations from 25 countries are cross-referenced.

  11. Methods of forging steel

    OpenAIRE

    Pečoler, Primož

    2014-01-01

    The following work presents processes of steel forming, challenges when forging steel, forming machines suitable for forging and which choice of machine is most suitable for forging. We can separate steel forming to free forging and drop forging. Free forging can be divided to hand forging and machine forging. The correct choice of furnaces is also very important. We must reach correct temperature in the furnace for raw steel to melt with less scalings. In diploma I mentioned some machine...

  12. Clean steels for fusion

    International Nuclear Information System (INIS)

    Gelles, D.S.

    1995-03-01

    Fusion energy production has an inherent advantage over fission: a fuel supply with reduced long term radioactivity. One of the leading candidate materials for structural applications in a fusion reactor is a tungsten stabilized 9% chromium Martensitic steel. This alloy class is being considered because it offers the opportunity to maintain that advantage in the reactor structure as well as provide good high temperature strength and radiation induced swelling and embrittlement resistance. However, calculations indicate that to obtain acceptable radioactivity levels within 500 years after service, clean steel will be required because the niobium impurity levels must be kept below about 2 appm and nickel, molybdenum, nitrogen, copper, and aluminum must be intentionally restricted. International efforts are addressing the problems of clean steel production. Recently, a 5,000 kg heat was vacuum induction melted in Japan using high purity commercial raw materials giving niobium levels less than 0.7 appm. This paper reviews the need for reduced long term radioactivity, defines the advantageous properties of the tungsten stabilized Martensitic steel class, and describes the international efforts to produce acceptable clean steels

  13. Thermal stability of manganese-stabilized stainless steels

    International Nuclear Information System (INIS)

    Klueh, R.L.; Kenik, E.A.

    1993-01-01

    Previous work on a series of experimental high-manganese reduced-activation austenitic stainless steels demonstrated that they have improved tensile properties relative to type 316 stainless steel in both the annealed and 20% cold-worked conditions. Steels were tested with an Fe-20Mn-12Cr-0.25C (in weight percent) base composition, to which various combinations of Ti, W, V, P, and B were added. Tensile tests have now been completed on these steels after thermal aging at 600 degrees C. Thermal stability varied with composition, but the alloys were as stable or more stable than type 316 stainless steel. the strength of the annealed steels increased slightly after aging to 5000 h, while a strength decrease occurred for the cold worked steel. In both conditions, a steel containing a combination of all the alloying elements was most stable and had the best strength after thermal aging 5000 h at 600 degrees C. Despite having much higher strength than 316 stainless steel after aging, the ductility of the strongest experimental alloy was still as good as that of 316 stainless steel

  14. A Numerical Investigation of CFRP-Steel Interfacial Failure with Material Point Method

    International Nuclear Information System (INIS)

    Shen Luming; Faleh, Haydar; Al-Mahaidi, Riadh

    2010-01-01

    The success of retrofitting steel structures by using the Carbon Fibre Reinforced Polymers (CFRP) significantly depends on the performance and integrity of CFRP-steel joint and the effectiveness of the adhesive used. Many of the previous numerical studies focused on the design and structural performance of the CFRP-steel system and neglected the mechanical responses of adhesive layer, which results in the lack of understanding in how the adhesive layer between the CFRP and steel performs during the loading and failure stages. Based on the recent observation on the failure of CFRP-steel bond in the double lap shear tests, a numerical approach is proposed in this study to simulate the delamination process of CFRP sheet from steel plate using the Material Point Method (MPM). In the proposed approach, an elastoplasticity model with a linear hardening and softening law is used to model the epoxy layer. The MPM, which does not employ fixed mesh-connectivity, is employed as a robust spatial discretization method to accommodate the multi-scale discontinuities involved in the CFRP-steel bond failure process. To demonstrate the potential of the proposed approach, a parametric study is conducted to investigate the effects of bond length and loading rates on the capacity and failure modes of CFRP-steel system. The evolution of the CFRP-steel bond failure and the distribution of stress and strain along bond length direction will be presented. The simulation results not only well match the available experimental data but also provide a better understanding on the physics behind the CFRP sheet delamination process.

  15. A friction model for cold forging of aluminum, steel and stainless steel provided with conversion coating and solid film lubricant

    DEFF Research Database (Denmark)

    Bay, Niels; Eriksen, Morten; Tan, Xincai

    2011-01-01

    Adopting a simulative tribology test system for cold forging the friction stress for aluminum, steel and stainless steel provided with typical lubricants for cold forging has been determined for varying normal pressure, surface expansion, sliding length and tool/work piece interface temperature...

  16. Irradiation embrittlement of pressure vessel steels

    International Nuclear Information System (INIS)

    Brumovsky, M.; Vacek, M.

    1975-01-01

    A Standard Research Programme on Irradiation Embrittlement of Pressure Vessel Steels was approved by the Coordinating Meeting on the 12th May 1972 at the Working Group on Engineering Aspects of Irradiation Embrittlement of Pressure Vessel Steels. This Working Group was set up by the International Atomic Energy Agency in Vienna. Seven countries with their research institutes agreed on doing irradiation experiments according to the approved programme on steel A533 B from the U.S. HSST Programme. The Czechoslovak contribution covering tensile and impact testing of non-irradiated steel and steel irradiated at 280degC to 1.3 x 10 23 n/m 2 (E above 1 MeV) is presented in this report. As an additional part the same set of experiments was carried out on two additional steels - A 542 and A 543, made in SKODA Works for comparison of their irradiation embrittlement and hardening with A533 B steel. (author)

  17. Small-angle p--p elastic scattering at energies between 285 and 572 MeV

    International Nuclear Information System (INIS)

    Aebischer, D.; Favier, B.; Greeniaus, L.G.; Hess, R.; Junod, A.; Lechanoine, C.; Nikles, J.C.; Rapin, D.; Richard-Serre, C.; Werren, D.W.

    1976-01-01

    Differential cross sections for elastic p--p scattering have been measured at 285, 348, 398, 414, 455, 497, 530, and 572 MeV kinetic energy. The experiment was performed at the CERN synchrocyclotron, using multiwire proportional chambers placed directly in a proton beam. Scattering was observed for theta between approx. 15 and 10 0 in the laboratory system. The ratio α/sub p/ of the real and imaginary parts of the non-spin-flip nuclear forward amplitude was derived from the interference between the Coulomb and nuclear amplitudes. The values obtained are model dependent, but in this energy range α/sub p/ is positive and decreases with energy. Qualitatively good agreement with dispersion-relation predictions is observed

  18. Processing and refinement of steel microstructure images for assisting in computerized heat treatment of plain carbon steel

    Science.gov (United States)

    Gupta, Shubhank; Panda, Aditi; Naskar, Ruchira; Mishra, Dinesh Kumar; Pal, Snehanshu

    2017-11-01

    Steels are alloys of iron and carbon, widely used in construction and other applications. The evolution of steel microstructure through various heat treatment processes is an important factor in controlling properties and performance of steel. Extensive experimentations have been performed to enhance the properties of steel by customizing heat treatment processes. However, experimental analyses are always associated with high resource requirements in terms of cost and time. As an alternative solution, we propose an image processing-based technique for refinement of raw plain carbon steel microstructure images, into a digital form, usable in experiments related to heat treatment processes of steel in diverse applications. The proposed work follows the conventional steps practiced by materials engineers in manual refinement of steel images; and it appropriately utilizes basic image processing techniques (including filtering, segmentation, opening, and clustering) to automate the whole process. The proposed refinement of steel microstructure images is aimed to enable computer-aided simulations of heat treatment of plain carbon steel, in a timely and cost-efficient manner; hence it is beneficial for the materials and metallurgy industry. Our experimental results prove the efficiency and effectiveness of the proposed technique.

  19. Larson-Miller Constant of Heat-Resistant Steel

    Science.gov (United States)

    Tamura, Manabu; Abe, Fujio; Shiba, Kiyoyuki; Sakasegawa, Hideo; Tanigawa, Hiroyasu

    2013-06-01

    Long-term rupture data for 79 types of heat-resistant steels including carbon steel, low-alloy steel, high-alloy steel, austenitic stainless steel, and superalloy were analyzed, and a constant for the Larson-Miller (LM) parameter was obtained in the current study for each material. The calculated LM constant, C, is approximately 20 for heat-resistant steels and alloys except for high-alloy martensitic steels with high creep resistance, for which C ≈ 30 . The apparent activation energy was also calculated, and the LM constant was found to be proportional to the apparent activation energy with a high correlation coefficient, which suggests that the LM constant is a material constant possessing intrinsic physical meaning. The contribution of the entropy change to the LM constant is not small, especially for several martensitic steels with large values of C. Deformation of such martensitic steels should accompany a large entropy change of 10 times the gas constant at least, besides the entropy change due to self-diffusion.

  20. Dynamic recrystallization behavior of a medium carbon vanadium microalloyed steel

    International Nuclear Information System (INIS)

    Wei, Hai-lian; Liu, Guo-quan; Xiao, Xiang; Zhang, Ming-he

    2013-01-01

    The dynamic recrystallization behavior of a medium carbon vanadium microalloyed steel was systematically investigated at the temperatures from 900 °C to 1100 °C and strain rates from 0.01 s −1 to 10 s −1 on a Gleeble-1500 thermo-simulation machine. The flow stress constitutive equation of hot deformation for this steel was developed with the activation energy Q being about 273 kJ/mol, which is in reasonable agreement with those reported before. Activation energy analysis showed that vanadium addition in microalloyed steels seemed not to affect the activation energy much. The effect of Zener–Hollomon parameter on the characteristic points of flow curves was studied using the power law relation, and the dependence of critical strain (stress) on peak strain (stress) obeyed a linear equation. Dynamic recrystallization is the most important softening mechanism for the experimental steel during hot compression. The dynamic recrystallization kinetics model of this steel was established based on flow stress and a frequently-used dynamic recrystallization kinetics equation. Dynamic recrystallization microstructure under different deformation conditions was also observed and the dependence of steady-state grain size on the Zener–Hollomon parameter was plotted

  1. Milled Die Steel Surface Roughness Correlation with Steel Sheet Friction

    DEFF Research Database (Denmark)

    Berglund, J.; Brown, C.A.; Rosén, B.-G.

    2010-01-01

    This work investigates correlations between the surface topography ofmilled steel dies and friction with steel sheet. Several die surfaces were prepared by milling. Friction was measured in bending under tension testing. Linear regression coefficients (R2) between the friction and texture...

  2. Ballistic Characterization Of A Typical Military Steel Helmet

    Directory of Open Access Journals (Sweden)

    Mohamed Ali Maher

    2017-08-01

    Full Text Available In this study the ballistic limit of a steel helmet against a FMJ 919 mm caliber bullet is estimated. The helmet model is the typical polish helmet wz.31.The helmet material showed high strength low alloy steel material of 0.28 carbon content and 9.125 kgm2 areal density. The tensile test according to ASTM E8 showed a tensile strength of 1236.4 MPa .The average hardness value was about HV550. First shooting experiment has been executed using a 9 mm pistol based on 350 ms muzzle velocity at 5m against the simply supported helmet complete penetrations rose in this test were in the form of cracks on the helmet surface and partial penetrations were in the form of craters on the surface whose largest diameter and depth were 43 mm and 20.2 mm consequently .The second experiment was on a rifled gun arrangement 13 bullets of 919 mm caliber were shot on the examined simply supported steel helmet at a zero obliquity angle at different velocities to determine the ballistic limit velocity V50 according to MIL-STD-662F. Three major outcomes were revealed 1 the value V50 which found to be about 390 ms is higher than the one found in literature 360 ms German steel helmet model 1A1. 2 The smallest the standard deviation of the mixed results zone data the most accurate the ballistic limit is. 3Similar to the performance of blunt-ended projectiles impacting overmatching targets tD near 11 or larger It was found that the dominating failure mode of the steel helmet stuck by a hemispherical-nose projectile was plugging mode despite of having tD ratio of about 19 undermatching.

  3. A review of hot cracking in austenitic stainless steel weldments

    International Nuclear Information System (INIS)

    Shankar, V.; Gill, T.P.S.; Mannan, S.L.; Rodriguez, P.

    1991-01-01

    The occurrence of hot cracking in austenitic stainless steel weldments is discussed with respect to its origin and metallurgical contributory factors. Of the three types of hot cracking, namely solidification cracking, liquation and ductility dip cracking, solidification cracking occurs in the interdendritic regions in weld metal while liquation and ductility dip cracking occur intergranularly in the heat-affected zone (HAZ). Segregation of impurity and minor elements such as sulphur, phosphorous, silicon, niobium, boron etc to form low melting eutectic phases has been found to be the major cause of hot cracking. Control of HAZ cracking requires minimisation of impurity elements in the base metal. In stabilized stainless steels containing niobium, higher amounts of delta-ferrite have been found necessary to prevent cracking than in unstabilized compositions. Titanium compounds have been found to cause liquation cracking in maraging steels and titanium containing stainless steels and superalloys. In nitrogen added stainless steels, cracking resistance decreases when the solidification mode changes to primary austenitic due to nitrogen addition. A review of the test methods to evaluate hot cracking behaviour showed that several external restraint and semi-self-restraint tests are available. The finger Test, WRC Fissure Bend Test, the PVR test and the Varestraint Test are described along with typical test results. Hot ductility testing to reveal HAZ cracking tendency during welding is described, which is of particular importance to stabilized stainless steels. Based on the literature, recommendations are made for welding stabilized and nitrogen added steels, indicating areas of further work. (author). 81 refs., 30 figs., 1 tab

  4. Steels from materials science to structural engineering

    CERN Document Server

    Sha, Wei

    2013-01-01

    Steels and computer-based modelling are fast growing fields in materials science as well as structural engineering, demonstrated by the large amount of recent literature. Steels: From Materials Science to Structural Engineering combines steels research and model development, including the application of modelling techniques in steels.  The latest research includes structural engineering modelling, and novel, prototype alloy steels such as heat-resistant steel, nitride-strengthened ferritic/martensitic steel and low nickel maraging steel.  Researchers studying steels will find the topics vital to their work.  Materials experts will be able to learn about steels used in structural engineering as well as modelling and apply this increasingly important technique in their steel materials research and development. 

  5. Controlling DC permeability in cast steels

    Energy Technology Data Exchange (ETDEWEB)

    Sumner, Aaran, E-mail: aaran.sumner@nottingham.ac.uk [University of Nottingham, Nottingham University Park Campus, Nottingham NG7 2RD, England (United Kingdom); Gerada, Chris, E-mail: chris.gerada@nottingham.ac.uk [Electrical Machines, University of Nottingham, Tower Building, Nottingham NG7 2RD, England (United Kingdom); Brown, Neil, E-mail: neil.brown@cummins.com [Advanced Electrical Machines Research and Technology at Cummins Power Generation, Peterborough PE2 6FZ, England (United Kingdom); Clare, Adam, E-mail: adam.clare@nottingham.ac.uk [Advanced Manufacturing, University of Nottingham, University Park Campus, Nottingham NG7 2RD, England (United Kingdom)

    2017-05-01

    Annealing (at multiple cooling rates) and quenching (with tempering) was performed on specimens of cast steel of varying composition. The aim was to devise a method for selecting the steel with the highest permeability, from any given range of steels, and then increasing the permeability by heat treatment. Metallographic samples were imaged using optical microscopy to show the effect of the applied heat treatments on the microstructure. Commonly cast steels can have DC permeability altered by the careful selection of a heat treatment. Increases of up to 381% were achieved by annealing using a cooling rate of 6.0 °C/min. Annealing was found to cause the carbon present in the steel to migrate from grain boundaries and from within ferrite crystals into adjacent pearlite crystals. The migration of the carbon resulted in less carbon at grain boundaries and within ferrite crystals reducing the number of pinning sites between magnetic domains. This gives rise to a higher permeability. Quenching then tempering was found to cause the formation of small ferrite crystals with the carbon content of the steel predominately held in the martensitic crystal structures. The results show that with any given range of steel compositions the highest baseline DC permeability will be found with the steel that has the highest iron content and the lowest carbon content. For the samples tested in this paper a cooling rate of 4.5 °C/min resulted in the relative permeability of the sample with the highest baseline permeability, AS4, increasing from 783 to 1479 at 0.5 T. This paper shows how heat treatments commonly applied to hypoeutectoid cast steels, to improve their mechanical performance, can be used to also enhance electromagnetic properties of these alloys. The use of cast steels allows the creation of DC components for electrical machines not possible by the widely used method of stacking of electrical grade sheet steels. - Highlights: • A range of structural steels had their

  6. Controlling DC permeability in cast steels

    International Nuclear Information System (INIS)

    Sumner, Aaran; Gerada, Chris; Brown, Neil; Clare, Adam

    2017-01-01

    Annealing (at multiple cooling rates) and quenching (with tempering) was performed on specimens of cast steel of varying composition. The aim was to devise a method for selecting the steel with the highest permeability, from any given range of steels, and then increasing the permeability by heat treatment. Metallographic samples were imaged using optical microscopy to show the effect of the applied heat treatments on the microstructure. Commonly cast steels can have DC permeability altered by the careful selection of a heat treatment. Increases of up to 381% were achieved by annealing using a cooling rate of 6.0 °C/min. Annealing was found to cause the carbon present in the steel to migrate from grain boundaries and from within ferrite crystals into adjacent pearlite crystals. The migration of the carbon resulted in less carbon at grain boundaries and within ferrite crystals reducing the number of pinning sites between magnetic domains. This gives rise to a higher permeability. Quenching then tempering was found to cause the formation of small ferrite crystals with the carbon content of the steel predominately held in the martensitic crystal structures. The results show that with any given range of steel compositions the highest baseline DC permeability will be found with the steel that has the highest iron content and the lowest carbon content. For the samples tested in this paper a cooling rate of 4.5 °C/min resulted in the relative permeability of the sample with the highest baseline permeability, AS4, increasing from 783 to 1479 at 0.5 T. This paper shows how heat treatments commonly applied to hypoeutectoid cast steels, to improve their mechanical performance, can be used to also enhance electromagnetic properties of these alloys. The use of cast steels allows the creation of DC components for electrical machines not possible by the widely used method of stacking of electrical grade sheet steels. - Highlights: • A range of structural steels had their

  7. In situ 3D monitoring of corrosion on carbon steel and ferritic stainless steel embedded in cement paste

    KAUST Repository

    Itty, Pierre-Adrien

    2014-06-01

    In a X-ray microcomputed tomography study, active corrosion was induced by galvanostatically corroding steel embedded in cement paste. The results give insight into corrosion product build up, crack formation, leaching of products into the cracks and voids, and differences in morphology of corrosion attack in the case of carbon steel or stainless steel reinforcement. Carbon steel was homogeneously etched away with a homogeneous layer of corrosion products forming at the steel/cement paste interface. For ferritic stainless steel, pits were forming, concentrating the corrosion products locally, which led to more extensive damage on the cement paste cover. © 2014 Elsevier Ltd.

  8. In situ 3D monitoring of corrosion on carbon steel and ferritic stainless steel embedded in cement paste

    KAUST Repository

    Itty, Pierre-Adrien; Serdar, Marijana; Meral, Cagla; Parkinson, Dula; MacDowell, Alastair A.; Bjegović, Dubravka; Monteiro, Paulo J.M.

    2014-01-01

    In a X-ray microcomputed tomography study, active corrosion was induced by galvanostatically corroding steel embedded in cement paste. The results give insight into corrosion product build up, crack formation, leaching of products into the cracks and voids, and differences in morphology of corrosion attack in the case of carbon steel or stainless steel reinforcement. Carbon steel was homogeneously etched away with a homogeneous layer of corrosion products forming at the steel/cement paste interface. For ferritic stainless steel, pits were forming, concentrating the corrosion products locally, which led to more extensive damage on the cement paste cover. © 2014 Elsevier Ltd.

  9. Advanced cold rolled steels for automotive applications

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, Harald; Mattissen, Dorothea; Schaumann, Thomas Wilhelm [ThyssenKrupp Steel AG, Center of Materials Excellence, Dortmund (Germany)

    2009-01-15

    Advanced high-strength steels offer a great potential for the further development of automobile bodies-in-white due to their combined mechanical properties of high formability and strength. They represent the first choice in material selection for strength and crash-relevant parts with challenging geometries. The intensive development of multiphase steels by ThyssenKrupp Steel has led to hot dip galvanizing concepts with an outstanding forming potential. Hot rolled, hot dip galvanized complex-phase steels are currently produced in addition to cold rolled dual phase (DP) and retained austenite (RA) or transformation induced plasticity (TRIP) steels. New continuously annealed grades of steel are being developed with tensile strength levels of up to 1000 MPa in combination with sufficient ductility for the high demands of structural automobile components. These steels make use of the classic advantages of microalloying as well as the principles of DP steels and RA / TRIP steels. Further improvement of properties will be reached by the new class of high manganese alloyed steels. (orig.)

  10. Corrosion resistance of steel fibre reinforced concrete - A literature review

    DEFF Research Database (Denmark)

    Marcos Meson, Victor; Michel, Alexander; Solgaard, Anders

    2017-01-01

    Steel fibre reinforced concrete (SFRC) is increasingly being used in the construction of civil infrastructure. However, there are inconsistencies among international standards and guidelines regarding the consideration of carbon-steel fibres for the structural verification of SFRC exposed...... of the mechanisms governing the corrosion of carbon-steel fibres in cracks and its effects on the fracture behaviour of SFRC are not fully understood....

  11. Life after Steel

    Science.gov (United States)

    Mangan, Katherine

    2013-01-01

    Bobby Curran grew up in a working-class neighborhood in Baltimore, finished high school, and followed his grandfather's steel-toed bootprints straight to Sparrows Point, a 3,000-acre sprawl of industry on the Chesapeake Bay. College was not part of the plan. A gritty but well-paying job at the RG Steel plant was Mr. Curran's ticket to a secure…

  12. Marble waste characterization as a desulfurizing slag component for steel

    International Nuclear Information System (INIS)

    Coleti, J.L.; Grillo, F.F.; Tenorio, J.A.S.; De Oliveira, J.R.

    2014-01-01

    The current steel market requires from steel plants better quality of its products. As a result, steel plants need to search for improvements and costs reduction in its process. Hence, the residue of marble containing significant quantities of calcium and magnesium carbonates, raw materials of steel refining slag, was characterized in order to replace the conventional lime used. Therefore, it will be possible to reduce the cost and volume of waste produced by the ornamental rock industry. The following methods were applied to test the waste potential: SEM with EDS, x-ray diffraction, x-ray fluorescence (EDX), Thermogravimetry (TG) and analysis of surface area and particle size by the BET method using dispersion leisure. The results indicated the feasibility of waste as raw material in the composition of desulfurizing slags. (author)

  13. Corrosion Inhibition of AISI/SAE Steel in a Marine Environment

    Directory of Open Access Journals (Sweden)

    Fatai Olufemi ARAMIDE

    2009-12-01

    Full Text Available Effect of Sodium nitrite as a corrosion inhibitor of mild steel in sea water wasinvestigated, using the conventional weight loss method. Differentpercentages of sodium nitrite were used from 0% to 10% in sea water.Samples of mild steel were exposed to these corrosive media and the weightloss was calculated at intervals of 120 hours, 168 hours, 208 hours, 256 hours,304 hours and 352 hours. It was observed that corrosion rate increases withtime of exposure to the corrosive medium (inhibited or non-inhibited and thatsodium nitrite can be used to retards the corrosion rate of mild steel if theappropriate concentration is used in sea water. It was concluded that theoptimum percentage of sodium nitrate in sea water that gives the optimumcorrosion inhibition of mild steel is 4%.

  14. Automated Steel Cleanliness Analysis Tool (ASCAT)

    Energy Technology Data Exchange (ETDEWEB)

    Gary Casuccio (RJ Lee Group); Michael Potter (RJ Lee Group); Fred Schwerer (RJ Lee Group); Dr. Richard J. Fruehan (Carnegie Mellon University); Dr. Scott Story (US Steel)

    2005-12-30

    The objective of this study was to develop the Automated Steel Cleanliness Analysis Tool (ASCATTM) to permit steelmakers to evaluate the quality of the steel through the analysis of individual inclusions. By characterizing individual inclusions, determinations can be made as to the cleanliness of the steel. Understanding the complicating effects of inclusions in the steelmaking process and on the resulting properties of steel allows the steel producer to increase throughput, better control the process, reduce remelts, and improve the quality of the product. The ASCAT (Figure 1) is a steel-smart inclusion analysis tool developed around a customized next-generation computer controlled scanning electron microscopy (NG-CCSEM) hardware platform that permits acquisition of inclusion size and composition data at a rate never before possible in SEM-based instruments. With built-in customized ''intelligent'' software, the inclusion data is automatically sorted into clusters representing different inclusion types to define the characteristics of a particular heat (Figure 2). The ASCAT represents an innovative new tool for the collection of statistically meaningful data on inclusions, and provides a means of understanding the complicated effects of inclusions in the steel making process and on the resulting properties of steel. Research conducted by RJLG with AISI (American Iron and Steel Institute) and SMA (Steel Manufactures of America) members indicates that the ASCAT has application in high-grade bar, sheet, plate, tin products, pipes, SBQ, tire cord, welding rod, and specialty steels and alloys where control of inclusions, whether natural or engineered, are crucial to their specification for a given end-use. Example applications include castability of calcium treated steel; interstitial free (IF) degasser grade slag conditioning practice; tundish clogging and erosion minimization; degasser circulation and optimization; quality assessment/steel

  15. Automated Steel Cleanliness Analysis Tool (ASCAT)

    International Nuclear Information System (INIS)

    Gary Casuccio; Michael Potter; Fred Schwerer; Richard J. Fruehan; Dr. Scott Story

    2005-01-01

    The objective of this study was to develop the Automated Steel Cleanliness Analysis Tool (ASCATTM) to permit steelmakers to evaluate the quality of the steel through the analysis of individual inclusions. By characterizing individual inclusions, determinations can be made as to the cleanliness of the steel. Understanding the complicating effects of inclusions in the steelmaking process and on the resulting properties of steel allows the steel producer to increase throughput, better control the process, reduce remelts, and improve the quality of the product. The ASCAT (Figure 1) is a steel-smart inclusion analysis tool developed around a customized next-generation computer controlled scanning electron microscopy (NG-CCSEM) hardware platform that permits acquisition of inclusion size and composition data at a rate never before possible in SEM-based instruments. With built-in customized ''intelligent'' software, the inclusion data is automatically sorted into clusters representing different inclusion types to define the characteristics of a particular heat (Figure 2). The ASCAT represents an innovative new tool for the collection of statistically meaningful data on inclusions, and provides a means of understanding the complicated effects of inclusions in the steel making process and on the resulting properties of steel. Research conducted by RJLG with AISI (American Iron and Steel Institute) and SMA (Steel Manufactures of America) members indicates that the ASCAT has application in high-grade bar, sheet, plate, tin products, pipes, SBQ, tire cord, welding rod, and specialty steels and alloys where control of inclusions, whether natural or engineered, are crucial to their specification for a given end-use. Example applications include castability of calcium treated steel; interstitial free (IF) degasser grade slag conditioning practice; tundish clogging and erosion minimization; degasser circulation and optimization; quality assessment/steel cleanliness; slab, billet

  16. Properties of hot rolled steels for enamelling

    International Nuclear Information System (INIS)

    Gavrilovski, Dragica; Gavrilovski, Milorad

    2003-01-01

    The results of an investigation of the structure and properties of experimental produced hot rolled steels suitable for enamelling are presented in the paper. Hot rolled steels for enamelling represent a special group of the steels for conventional enamelling. Their quality has to be adapted to the method and conditions of enamelling. Therefore, these steels should meet some specific requirements. In addition to usual investigation of the chemical composition and mechanical properties, microstructure and quality of the steel surface also were investigated. The basic aim was to examine steels capability for enamelling, i. e. steels resistance to the fish scales phenomena, by trial enamelling, as well as quality of the steel - enamel contact surface, to evaluate the binding. Also, the changes of the mechanical properties, especially the yield point, during thermal treatment, as a very specific requirement, were investigated, by simplified method. Good results were obtained confirming the steels capability for enamelling. (Original)

  17. Evaluation criteria of structural steel reliability

    International Nuclear Information System (INIS)

    Zav'yalov, A.S.

    1980-01-01

    Different low-carbon and medium-carbon structural steels are investigated. It is stated that steel reliability evaluation criteria depend on the fracture mode, steel suffering from the brittle fracture under the influence of the stresses (despite their great variety) arising in articles during the production and operation. Fibrous steel fracture at the given temperature and article thickness says about its high ductility and toughness and brittle fractures are impossible. Brittle fractures take place in case of a crystalline and mixed fracture with a predominant crystalline component. Evaluation methods of article and sample steel structural strength differing greatly from real articles in a thickness (diameter) or used at temperatures higher than possible operation temperatures cannot be reliability evaluation criteria because at a great thickness (diameter) and lower operation temperatures steel fracture and its strain mode can change resulting in a sharp reliability degradation

  18. Some comments about the situation of the Steel Industry in the Arab Countries (Arab Steel Summit)

    International Nuclear Information System (INIS)

    Haidar, Y.; Astier, J.

    2009-01-01

    The Arab Steel Summit, that convened in Abu Dhabi in April, gave us another opportunity to review the situation of the Arab Iron and Steel Industry, with regard to the present World economic context. We will address: - the World situation of steel production, focusing on the Arab Countries; - the related situation of steel consumption; - the steel trade, including imports, exports and prices; - the consequences for technology and economy. (authors)

  19. Reduced-activation steels: present status and future development

    International Nuclear Information System (INIS)

    Klueh, R.L.

    2007-01-01

    Full text of publication follows: Reduced-activation steels for fusion reactor applications were developed in the 1980's to replace the commercial elevated- temperature steels first considered. In the United States, this involved replacing Sandvik HT9 and modified 9Cr-1Mo steels. Reduced-activation steels, which were developed for more rapid radioactivity decay following exposure in a fusion neutron environment, were patterned after the commercial steels they were to replace. The objective for the reduced-activation steels was that they have strengths (yield stress and ultimate tensile strength from room temperature to 600 deg. C) and impact toughness (measured in a Charpy test) comparable to or better than the steels they were replacing. That objective was achieved in reduced-activation steels developed in Japan, Europe, and the United States. Since the reduced-activation steels were developed in the 1980's, reactor designers have been interested designs for increased efficiency of future fusion plants. This means reactors will need to operate at higher temperatures-above 550 deg. C, which is the upper-temperature limit for the reduced-activation steels. Although the tensile and impact toughness of the reduced-activation steels exceed those of the commercial steels they were patterned after, their creep-rupture properties are inferior to some of the commercial steels they replaced. furthermore, they are much inferior to commercial steels that have been developed since the 1980's. Reasons for why the creep-rupture properties for the new commercial ferritic/martensitic steels are superior to the earlier commercial steels and the reduced-activation steels were examined. The reasons involve compositional changes that were made in the earlier commercial steels to give the new commercial steels their superior properties. Computational thermodynamics calculations were carried out to compare the expected equilibrium phases. It appears that similar changes in composition

  20. Trends in steel technology

    International Nuclear Information System (INIS)

    Anon.

    1980-01-01

    Dual phase steels, composite products, and microalloyed steels are making inroads in the automotive industry applications for bumpers, automotive parts, bodies, mechanical parts, suspension and steering equipment and truck bumpers. New steels are also used to support solar mirrors and cells, in corrosive environments in the oil and gas industry, fusion reactors, and pressure vessels in nuclear power plants

  1. Heterogeneities in local plastic flow behavior in a dissimilar weld between low-alloy steel and stainless steel

    Energy Technology Data Exchange (ETDEWEB)

    Mas, Fanny [Université Grenoble Alpes, SIMAP, 38000 Grenoble (France); CNRS, SIMAP, 38000 Grenoble (France); Martin, Guilhem, E-mail: guilhem.martin@simap.grenoble-inp.fr [Université Grenoble Alpes, SIMAP, 38000 Grenoble (France); CNRS, SIMAP, 38000 Grenoble (France); Lhuissier, Pierre; Bréchet, Yves; Tassin, Catherine [Université Grenoble Alpes, SIMAP, 38000 Grenoble (France); CNRS, SIMAP, 38000 Grenoble (France); Roch, François [Areva NP, Tour Areva, 92084 Paris La Défense (France); Todeschini, Patrick [EDF R& D, Avenue des Renardières, 77250 Moret-sur-Loing (France); Simar, Aude [Institute of Mechanics, Materials and Civil Engineering (iMMC), Université catholique de Louvain, 1348 Louvain-la-Neuve (Belgium)

    2016-06-14

    In dissimilar welds between low-alloy steel and stainless steel, the post-weld heat-treatment results in a high variety of microstructures coexisting around the fusion line, due to carbon diffusion and carbides dissolution/precipitation. The local constitutive laws in the vicinity of the fusion zone were identified by micro tensile specimens for the sub-millimeter sized zones, equivalent bulk materials representing the decarburized layer using both wet H{sub 2} atmosphere and diffusion couple, and nano-indentation for the carburized regions (i.e. the martensitic band and the austenitic region). The decarburized zone presents only 50% of the yield strength of the low-alloy steel heat affected zone and a ductility doubled. The carburized zones have a yield strength 3–5 times higher than that of the low-alloy steel heat affected zone and have almost no strain hardening capacity. These properties result in heterogeneous plastic deformation happening over only millimeters when the weld is loaded perpendicularly to the weld line, affecting its overall behavior. The constitutive laws experimentally identified were introduced as inputs into a finite elements model of the transverse tensile test performed on the whole dissimilar weld. A good agreement between experiments and simulations was achieved on the global stress-strain curve. The model also well predicts the local strain field measured by microscale DIC. A large out-of-plane deformation due to the hard carburized regions has also been identified.

  2. Development of nuclear grade stainless steels at KCSSL

    International Nuclear Information System (INIS)

    Balachandran, G.; Dhere, M.; Mahadik, A.; Hinge, N.M.; Balasubramanian, V.

    2011-01-01

    Kalyani Carpenter Special Steels Ltd is an alloy steel plant, where a variety of alloy steel grades are produced for automotive, defence, nuclear and aerospace applications. The plant has developed expertise in processing of several alloy steel grades of superior quality that meets stringent specifications. Primary steel is processed through a combination of electric arc furnace, ladle furnace and vacuum degassing where stringent control over dephosphorisation, desulphurization, deoxidation is effected to get a refined high quality steel. The molten steel is cast through continuous casting of slabs or ingot casting. In grades specific to nuclear application, the primary cast products are further subjected to electroslag remelting to achieve further freedom from inclusions and to achieve a favourable solidification grain structure, which ultimately improve the hot workability of the alloy steel. Appropriate choice of slag and operating parameters are needed for realising the required ingot quality. The present study would examine the processing and quality aspects of some important grades of steels used in nuclear industry namely ferritic 9Cr-1Mo steel, martensitic stainless steels 403, 410, precipitation hardenable 17-4 PH stainless steel and austenitic 321, 316LN stainless steel, which were made and supplied for applications to Indian nuclear industry. The expertise developed in processing the steels in terms of melting, heat treatment and their relationship to structural features and mechanical properties would be highlighted. (author)

  3. Behavior of Equipment Support Beam Joint Directly Connected to A Steel-plate Concrete(SC) Wall

    International Nuclear Information System (INIS)

    Kim, K. S.; Kwon, K. J.

    2008-01-01

    To decrease the time for building nuclear power plants, a modular construction method, 'Steel-plate Concrete(SC)', has been investigated for over a decade. To construct a SC wall, a pair of steel plates are placed in parallel similar to a form-work in conventional reinforced concrete (RC) structures, and concrete is filled between the steel plates. Instead of removing the steel plates after the concrete has cured, the steel plates serve as components of the structural member. The exposed steel plate of SC structures serves as the base plate for the equipment support, and the headed studs welded to the steel plates are used as anchor bolts. Then, a support beam can be directly welded to the surface of the steel plate in any preferred position. In this study, we discuss the behavior and evaluation method of the equipment support joint directly connected to exposed steel plate of SC wall

  4. Precipitation-hardening stainless steels with a shape-memory effect

    Science.gov (United States)

    Sagaradze, V. V.; Afanasiev, S. V.; Volkova, E. G.; Zavalishin, V. A.

    2016-02-01

    The possibility of obtaining the shape-memory effect as a result of the γ → ɛ → γ transformations in aging stainless steels strengthened by VC carbides has been investigated. Regimes are given for strengthening aging (at 650 and 720°C) for stainless steels that predominantly contain (in wt %) 0.06-0.45C, 1-2V, 2-5Si, 9 and 13-14Cr. The values of reversible deformation e (amount of shape-memory effect) determined after heating to 400°C in samples preliminarily deformed to 3.5-4% vary from 0.15 to 2.7%, depending on the composition of the steels and regimes of stabilizing and destabilizing aging.

  5. The heat treatment of steel. A mathematical control problem

    Energy Technology Data Exchange (ETDEWEB)

    Hoemberg, Dietmar; Kern, Daniela

    2009-07-21

    The goal of this paper is to show how the heat treatment of steel can be modelled in terms of a mathematical optimal control problem. The approach is applied to laser surface hardening and the cooling of a steel slab including mechanical effects. Finally, it is shown how the results can be utilized in industrial practice by a coupling with machine-based control. (orig.)

  6. 30 CFR 285.611 - What information must I submit with my SAP to assist MMS in complying with NEPA and other...

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What information must I submit with my SAP to... Assessment Plan § 285.611 What information must I submit with my SAP to assist MMS in complying with NEPA and other relevant laws? (a) You must submit with your SAP detailed information to assist MMS in complying...

  7. [Prevalence and correlation factors of carotid atherosclerosis among the middle and old aged workers in an iron and steel corporation, Chongqing].

    Science.gov (United States)

    Zhang, Dong-ping; Li, Jin-fang; Hu, Chang-lin; Huang, Hui

    2009-04-01

    To investigate the prevalence and correlation factors of carotid atherosclerosis (CAS) among workers of Chongqing Iron and Steel Corporation, and to offer information for the development of prevention program for cerebro-vascular disease. 512 asymptomatic individuals (mean age 56.8 years, ranged from 45 to 80) from the subsidiary workshop of Chongqing Iron and Steel Corporation were recruited. Demographic data and serum were collected and the internal-media thickness (IMT) of the CAS and the extent of plaque formation were evaluated by B-mode ultrasound. Logistic regression analysis was used to estimate the correlation factors of CAS. Results (1) The overall prevalence of carotid atherosclerosis among the iron and steel workers was 37.6%. IMT was found as 10.2% , with the prevalence rates of nonstenotic plaque and stenotic plaque were 25.0% and 2.4% respectively. (2) It was shown by logistic regression analysis that age (OR = 1.289, 95% CI: 1.014-1.568, P < 0.001), smoking (OR = 1.420, 95% CI: 0.802-3.872, P < 0.001), hypertension (OR= 4.530, 95% CI: 3.952-6.753, P < 0.001) , diabetes mellitus (OR = 2.285, 95% CI: 1.008-5.057, P < 0.001), HsCRP (OR = 1.273, 95% CI: 0.479-2.889, P = 0.037), TC (OR = 1.032, 95% CI: 0.320-1.882, P = 0.047) and LDL-C (OR = 2.313, 95% CI: 1.237-4.331, P = 0.008) were significantly associated with the severity of CAS. (3) Prevalence of the CAS increased with the increasing number of correlation factors. The prevalence of CAS among the iron and steel workers was higher than those in ordinary people of the same age. Age, smoking, hypertension, diabetes mellitus, HsCRP, TC and LDL-C were independent risk factors related to CAS. The prevalence of CAS was increasing parallel to the number of correlation factors.

  8. A comparison of low-chromium and high-chromium reduced-activation steels for fusion applications

    International Nuclear Information System (INIS)

    Klueh, R.L.; Maziasz, P.J.; Alexander, D.J.

    1996-01-01

    Ferritic steels have been considered candidate structural materials for first wall and blanket structures for fusion power plants since the late 1970s. The first steels considered in the United States were the conventional Cr-Mo steels Sandvik HT9 (nominally 12Cr-1Mo-0.25V-0.5W-0.5Ni-0.2C, here designated l2Cr-1MoVW), modified 9Cr-1Mo steel (9Cr-1Mo-0.2V-0.06Nb-0. IC, designated 9Cr-1MoVNb) and, to a lesser extent, 2 1/4Cr-1Mo steel (2.25Cr-Mo-0.1C). All compositions are in wt. %. The normalized-and-tempered 9 and 12Cr steels had a tempered martensite microstructure, and the normalized-and-tempered 2 1/4 Cr steel had a tempered bainite microstructure. This report describes chromium steels tested in normalized and tempered conditions. Miniature tensile and Charpy specimens were tested

  9. Statistical evaluation of unobserved nonuniform corrosion in A216 steel

    International Nuclear Information System (INIS)

    Pulsipher, B.A.

    1988-07-01

    Tests designed to promote nonuniform corrosion have been conducted at PNL on A216 steel. In all of the tests performed to date, there have been no manifestations of significant nonuniform corrosion. Although this may suggest that nonuniform corrosion in A216 steel may not be a significant problem in the nuclear waste repository, a question arises as to whether enough tests have been conducted for a sufficient length of time to rule out nonuniform corrosion of A216 steel. In this report, a method for determining the required number of tests is examined for two of the mechanisms of nonuniform corrosion: pitting and crevice corrosion

  10. Fatigue behaviour of friction welded medium carbon steel and austenitic stainless steel dissimilar joints

    International Nuclear Information System (INIS)

    Paventhan, R.; Lakshminarayanan, P.R.; Balasubramanian, V.

    2011-01-01

    Research highlights: → Fusion welding of dissimilar metals is a problem due to difference in properties. → Solid state welding process such as friction welding is a solution for the above problem. → Fatigue life of friction welded carbon steel and stainless steel joints are evaluated. → Effect of notch on the fatigue life of friction welded dissimilar joints is reported. → Formation of intermetallic is responsible for reduction in fatigue life of dissimilar joints. -- Abstract: This paper reports the fatigue behaviour of friction welded medium carbon steel-austenitic stainless steel (MCS-ASS) dissimilar joints. Commercial grade medium carbon steel rods of 12 mm diameter and AISI 304 grade austenitic stainless steel rods of 12 mm diameter were used to fabricate the joints. A constant speed, continuous drive friction welding machine was used to fabricate the joints. Fatigue life of the joints was evaluated conducting the experiments using rotary bending fatigue testing machine (R = -1). Applied stress vs. number of cycles to failure (S-N) curve was plotted for unnotched and notched specimens. Basquin constants, fatigue strength, fatigue notch factor and notch sensitivity factor were evaluated for the dissimilar joints. Fatigue strength of the joints is correlated with microstructure, microhardness and tensile properties of the joints.

  11. Fragmentation of armor piercing steel projectiles upon oblique perforation of steel plates

    Directory of Open Access Journals (Sweden)

    Aizik F.

    2012-08-01

    Full Text Available In this study, a constitutive strength and failure model for a steel core of a14.5 mm API projectile was developed. Dynamic response of a projectile steel core was described by the Johnson-Cook constitutive model combined with principal tensile stress spall model. In order to obtain the parameters required for numerical description of projectile core material behavior, a series of planar impact experiments was done. The parameters of the Johnson-Cook constitutive model were extracted by matching simulated and experimental velocity profiles of planar impact. A series of oblique ballistic experiments with x-ray monitoring was carried out to study the effect of obliquity angle and armor steel plate thickness on shattering behavior of the 14.5 mm API projectile. According to analysis of x-ray images the fragmentation level increases with both steel plate thickness and angle of inclination. The numerical modeling of the ballistic experiments was done using commercial finite element code, LS-DYNA. Dynamic response of high hardness (HH armor steel was described using a modified Johnson-Cook strength and failure model. A series of simulations with various values of maximal principal tensile stress was run in order to capture the overall fracture behavior of the projectile’s core. Reasonable agreement between simulated and x-ray failure pattern of projectile core has been observed.

  12. A review on nickel-free nitrogen containing austenitic stainless steels for biomedical applications.

    Science.gov (United States)

    Talha, Mohd; Behera, C K; Sinha, O P

    2013-10-01

    The field of biomaterials has become a vital area, as these materials can enhance the quality and longevity of human life. Metallic materials are often used as biomaterials to replace structural components of the human body. Stainless steels, cobalt-chromium alloys, commercially pure titanium and its alloys are typical metallic biomaterials that are being used for implant devices. Stainless steels have been widely used as biomaterials because of their very low cost as compared to other metallic materials, good mechanical and corrosion resistant properties and adequate biocompatibility. However, the adverse effects of nickel ions being released into the human body have promoted the development of "nickel-free nitrogen containing austenitic stainless steels" for medical applications. Nitrogen not only replaces nickel for austenitic structure stability but also much improves steel properties. Here we review the harmful effects associated with nickel and emphatically the advantages of nitrogen in stainless steel, as well as the development of nickel-free nitrogen containing stainless steels for medical applications. By combining the benefits of stable austenitic structure, high strength, better corrosion and wear resistance and superior biocompatibility in comparison to the currently used austenitic stainless steel (e.g. 316L), the newly developed nickel-free high nitrogen austenitic stainless steel is a reliable substitute for the conventionally used medical stainless steels. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Corrosion behavior of 2205 duplex stainless steel.

    Science.gov (United States)

    Platt, J A; Guzman, A; Zuccari, A; Thornburg, D W; Rhodes, B F; Oshida, Y; Moore, B K

    1997-07-01

    The corrosion of 2205 duplex stainless steel was compared with that of AISI type 316L stainless steel. The 2205 stainless steel is a potential orthodontic bracket material with low nickel content (4 to 6 wt%), whereas the 316L stainless steel (nickel content: 10 to 14 wt%) is a currently used bracket material. Both stainless steels were subjected to electrochemical and immersion (crevice) corrosion tests in 37 degrees C, 0.9 wt% sodium chloride solution. Electrochemical testing indicates that 2205 has a longer passivation range than 316L. The corrosion rate of 2205 was 0.416 MPY (milli-inch per year), whereas 316L exhibited 0.647 MPY. When 2205 was coupled to 316L with equal surface area ratio, the corrosion rate of 2205 reduced to 0.260 MPY, indicating that 316L stainless steel behaved like a sacrificial anode. When 316L is coupled with NiTi, TMA, or stainless steel arch wire and was subjected to the immersion corrosion test, it was found that 316L suffered from crevice corrosion. On the other hand, 2205 stainless steel did not show any localized crevice corrosion, although the surface of 2205 was covered with corrosion products, formed when coupled to NiTi and stainless steel wires. This study indicates that considering corrosion resistance, 2205 duplex stainless steel is an improved alternative to 316L for orthodontic bracket fabrication when used in conjunction with titanium, its alloys, or stainless steel arch wires.

  14. Fatigue damage of steel components

    DEFF Research Database (Denmark)

    Fæster, Søren; Zhang, Xiaodan; Huang, Xiaoxu

    2014-01-01

    Railway rails and the inner ring in roller bearings in wind turbines are both experiencing steel-to-steel contact in small areas with huge loads resulting in extremely high stresses in the base materials......Railway rails and the inner ring in roller bearings in wind turbines are both experiencing steel-to-steel contact in small areas with huge loads resulting in extremely high stresses in the base materials...

  15. Ferritic/martensitic steels: Promises and problems

    International Nuclear Information System (INIS)

    Klueh, R.L.; Ehrlich, K.; Abe, F.

    1992-01-01

    Ferritic/martensitic steels are candidate structural materials for fusion reactors because of their higher swelling resistance, higher thermal conductivity, lower thermal expansion, and better liquid-metal compatibility than austenitic steels. Irradiation effects will ultimately determine the applicability of these steels, and the effects of irradiation on microstructure and swelling, and on the tensile, fatigue, and impact properties of the ferritic/martensitic steels are discussed. Most irradiation studies have been carried out in fast reactors, where little transmutation helium forms. Helium has been shown to enhance swelling and affect tensile and fracture behavior, making helium a critical issue, since high helium concentrations will be generated in conjunction with displacement damage in a fusion reactor. These issues are reviewed to evaluate the status of ferritic/martensitic steels and to assess the research required to insure that such steels are viable candidates for fusion applications

  16. Inclusion control in high-performance steels

    International Nuclear Information System (INIS)

    Holappa, L.E.K.; Helle, A.S.

    1995-01-01

    Progress of clean steel production, fundamentals of oxide and sulphide inclusions as well as inclusion morphology in normal and calcium treated steels are described. Effects of cleanliness and inclusion control on steel properties are discussed. In many damaging constructional and engineering applications the nonmetallic inclusions have a quite decisive role in steel performance. An example of combination of good mechanical properties and superior machinability by applying inclusion control is presented. (author)

  17. Sliding wear characteristics of carburized steels and thermally refined steels implanted with nitrogen ions

    International Nuclear Information System (INIS)

    Terashima, Keiichi; Koda, Hiroyuki; Takeuchi, Eiichi.

    1995-01-01

    In order to concretely examine the application of surface reforming by ion implantation, nitrogen ion implantation was applied to the thermally refined steels S45C and SCM440 and the carburized steel SCM415, which are high versatile steels for mechanical structures, and their friction and wear characteristics were examined. The results are summarized as follows. In the surface-reformed material, in which nitrogen was implanted for the purpose of improving the seizure durability of the carburized steel, the load-frictional coefficient curve in lubricated sliding friction was similar to that of the material without implantation, but it was recognized that the load at which seizure occurred reached 2000 kgf or more, and as the amount of implantation was more, the material withstood higher load. In the lubricated sliding friction using a pin-ring type wear testing machine of the thermally refined steels and those to which implantation was applied, it was recognized that the specific wear amount was less in the implanted steels than in those without implantation. The results of the analysis of the implanted surface layers and the friction surfaces are reported. (K.I.)

  18. Nucleonic gauging: a tool for process and quality control at Tata Steel

    International Nuclear Information System (INIS)

    Pandey, J.C.; Manish Raj; Panda, B.N.

    1998-01-01

    In recent years, there has been much progress in utilizing nuclear sources for process and quality control in Integrated Steel Plants. Tata Steel has also taken interest in implementing these gauging techniques and at present 92 such gauges are in use for measuring level, thickness, density, moisture and ash content at various locations of Tata Steel. These gauges function on line and non contact with the material to be inspected and are designed to withstand the hostile Steel Plant Environment. The paper highlights use of different gauges at Tata Steel. (author)

  19. Study on cementitious properties of steel slag

    Directory of Open Access Journals (Sweden)

    Zhu G.

    2013-01-01

    Full Text Available The converter steel slag chemical and mineral components in China’s main steel plants have been analysed in the present paper. The electronic microscope, energy spectrum analysis, X-ray diffraction analysis confirmed the main mineral compositions in the converter slag. Converter slag of different components were grounded to obtain a powder with specific surface area over 400m2/kg, making them to take place some part of the cement in the concrete as the admixture and carry out the standard tests. The results indicate that the converter slag can be used as cementitious materials for construction. Furthermore, physical mechanic and durability tests on the concrete that certain amount of cement be substituted by converter steel slag powder from different steel plants are carried out, the results show that the concrete with partial substitution of steel slag powder has the advantages of higher later period strength, better frost resistance, good wear resistance and lower hydration heat, etc. This study can be used as the technical basis for “Steel Slag Powder Used For Cement And Concrete”, “Steel Slag Portland Cement”, “Low Heat Portland Steel Slag Cement”, “Steel Slag Road Cement” in China, as well as a driving force to the works of steel slag utilization with high-value addition, circular economy, energy conservation and discharge reduction in the iron and steel industry.

  20. A novel Mo-W interlayer approach for CVD diamond deposition on steel

    Science.gov (United States)

    Kundrát, Vojtěch; Zhang, Xiaoling; Cooke, Kevin; Sun, Hailin; Sullivan, John; Ye, Haitao

    2015-04-01

    Steel is the most widely used material in engineering for its cost/performance ratio and coatings are routinely applied on its surface to further improve its properties. Diamond coated steel parts are an option for many demanding industrial applications through prolonging the lifetime of steel parts, enhancement of tool performance as well as the reduction of wear rates. Direct deposition of diamond on steel using conventional chemical vapour deposition (CVD) processes is known to give poor results due to the preferential formation of amorphous carbon on iron, nickel and other elements as well as stresses induced from the significant difference in the thermal expansion coefficients of those materials. This article reports a novel approach of deposition of nanocrystalline diamond coatings on high-speed steel (M42) substrates using a multi-structured molybdenum (Mo) - tungsten (W) interlayer to form steel/Mo/Mo-W/W/diamond sandwich structures which overcome the adhesion problem related to direct magnetron sputtering deposition of pure tungsten. Surface, interface and tribology properties were evaluated to understand the role of such an interlayer structure. The multi-structured Mo-W interlayer has been proven to improve the adhesion between diamond films and steel substrates by acting as an effective diffusion barrier during the CVD diamond deposition.

  1. A novel Mo-W interlayer approach for CVD diamond deposition on steel

    Energy Technology Data Exchange (ETDEWEB)

    Kundrát, Vojtěch; Sullivan, John; Ye, Haitao, E-mail: h.ye@aston.ac.uk [School of Engineering and Applied Science, Aston University, Birmingham, B4 7ET (United Kingdom); Zhang, Xiaoling; Cooke, Kevin; Sun, Hailin [Miba Coating Group: Teer Coatings Ltd, West-Stone-House, West-Stone, Berry-Hill-Industrial-Estate, WR9 9AS, Droitwich (United Kingdom)

    2015-04-15

    Steel is the most widely used material in engineering for its cost/performance ratio and coatings are routinely applied on its surface to further improve its properties. Diamond coated steel parts are an option for many demanding industrial applications through prolonging the lifetime of steel parts, enhancement of tool performance as well as the reduction of wear rates. Direct deposition of diamond on steel using conventional chemical vapour deposition (CVD) processes is known to give poor results due to the preferential formation of amorphous carbon on iron, nickel and other elements as well as stresses induced from the significant difference in the thermal expansion coefficients of those materials. This article reports a novel approach of deposition of nanocrystalline diamond coatings on high-speed steel (M42) substrates using a multi-structured molybdenum (Mo) – tungsten (W) interlayer to form steel/Mo/Mo-W/W/diamond sandwich structures which overcome the adhesion problem related to direct magnetron sputtering deposition of pure tungsten. Surface, interface and tribology properties were evaluated to understand the role of such an interlayer structure. The multi-structured Mo-W interlayer has been proven to improve the adhesion between diamond films and steel substrates by acting as an effective diffusion barrier during the CVD diamond deposition.

  2. A novel Mo-W interlayer approach for CVD diamond deposition on steel

    Directory of Open Access Journals (Sweden)

    Vojtěch Kundrát

    2015-04-01

    Full Text Available Steel is the most widely used material in engineering for its cost/performance ratio and coatings are routinely applied on its surface to further improve its properties. Diamond coated steel parts are an option for many demanding industrial applications through prolonging the lifetime of steel parts, enhancement of tool performance as well as the reduction of wear rates. Direct deposition of diamond on steel using conventional chemical vapour deposition (CVD processes is known to give poor results due to the preferential formation of amorphous carbon on iron, nickel and other elements as well as stresses induced from the significant difference in the thermal expansion coefficients of those materials. This article reports a novel approach of deposition of nanocrystalline diamond coatings on high-speed steel (M42 substrates using a multi-structured molybdenum (Mo – tungsten (W interlayer to form steel/Mo/Mo-W/W/diamond sandwich structures which overcome the adhesion problem related to direct magnetron sputtering deposition of pure tungsten. Surface, interface and tribology properties were evaluated to understand the role of such an interlayer structure. The multi-structured Mo-W interlayer has been proven to improve the adhesion between diamond films and steel substrates by acting as an effective diffusion barrier during the CVD diamond deposition.

  3. A Steel Ball Surface Quality Inspection Method Based on a Circumferential Eddy Current Array Sensor.

    Science.gov (United States)

    Zhang, Huayu; Xie, Fengqin; Cao, Maoyong; Zhong, Mingming

    2017-07-01

    To efficiently inspect surface defects on steel ball bearings, a new method based on a circumferential eddy current array (CECA) sensor was proposed here. The best probe configuration, in terms of the coil quality factor (Q-factor), magnetic field intensity, and induced eddy current density on the surface of a sample steel ball, was determined using 3-, 4-, 5-, and 6-coil probes, for analysis and comparison. The optimal lift-off from the measured steel ball, the number of probe coils, and the frequency of excitation current suitable for steel ball inspection were obtained. Using the resulting CECA sensor to inspect 46,126 steel balls showed a miss rate of ~0.02%. The sensor was inspected for surface defects as small as 0.05 mm in width and 0.1 mm in depth.

  4. Nitrogen-containing steels and thermomechanical treatment

    International Nuclear Information System (INIS)

    Kaputkina, L.; Prokoshkina, V.G.; Svyazhin, G.

    2004-01-01

    The strengthening of nitrogen-containing corrosion-resistant steels resulting from alloying and thermomechanical treatment have been investigated using X-ray diffraction analysis, light microscopy, hardness measurements and tensile testing. Combined data have been obtained for nitrogen interaction with alloying elements , peculiarities of deformed structure and short-range of nitrogen-containing steels of various structural classes. The higher nitrogen and total alloying element contents, the higher deformation strengthening. Prospects of use the steels with not high nitrogen content and methods of their thermomechanical strengthening are shown. High temperature thermomechanical treatment (HTMT) is very effective for obtaining high and thermally stable constructional strength of nitrogen-containing steels of all classes. The HTMT is most effective if used in a combination with dispersion hardening for aging steels or in the case of mechanically unstable austenitic steels. (author)

  5. A new 12% chromium steel strengthened by Z-phase precipitates

    DEFF Research Database (Denmark)

    Liu, Fang; Rashidi, Masoud; Johansson, Lennart

    2016-01-01

    In order to increase the corrosion resistance and simultaneously maintain the creep resistance of 9-12% Cr steels at 650 degrees C, a new alloy design concept was proposed, using thermodynamically stable Z-phase (CrTaN) precipitates to strengthen the steel. A new trial Z-phase strengthened 12% Cr...

  6. Volatilization from PCA steel alloy

    Energy Technology Data Exchange (ETDEWEB)

    Hagrman, D.L.; Smolik, G.R.; McCarthy, K.A.; Petti, D.A.

    1996-08-01

    The mobilizations of key components from Primary Candidate Alloy (PCA) steel alloy have been measured with laboratory-scale experiments. The experiments indicate most of the mobilization from PCA steel is due to oxide formation and spalling but that the spalled particles are large enough to settle rapidly. Based on the experiments, models for the volatization of iron, manganese, and cobalt from PCA steel in steam and molybdenum from PCA steel in air have been derived.

  7. Aerosol measurements from plasma torch cuts on stainless steel, carbon steel, and aluminum

    International Nuclear Information System (INIS)

    Novick, V.J.; Brodrick, C.J.; Crawford, S.; Nasiatka, J.; Pierucci, K.; Reyes, V.; Sambrook, J.; Wrobel, S.; Yeary, J.

    1996-01-01

    The main purpose of this project is to quantify aerosol particle size and generation rates produced by a plasma torch whencutting stainless steel, carbon steel and aluminum. the plasma torch is a common cutting tool used in the dismantling of nuclear facilities. Eventually, other cutting tools will be characterized and the information will be compiled in a user guide to aid in theplanning of both D ampersand D and other cutting operations. The data will be taken from controlled laboratory experiments on uncontaminated metals and field samples taken during D ampersand D operations at ANL nuclear facilities. The plasma torch data was collected from laboratory cutting tests conducted inside of a closed, filtered chamber. The particle size distributions were determined by isokinetically sampling the exhaust duct using a cascade impactor. Cuts on different thicknesses showed there was no observable dependence of the aerosol quantity produced as a function of material thickness for carbon steel. However, data for both stainless steel and aluminum revealed that the aerosol mass produced for these materials appear to have some dependance on thickness, with thinner materials producing tmore aerosols. The results of the laboratory cutting tests show that most measured particle size distributions are bimodal with one mode at about 0.2 μm and the other at about 10 μm. The average Mass Median Aerodynamic Diameters (MMAD's) for these tests are 0.36 ±0.08 μm for stainless steel, 0.48 ±0.17μm for aluminum and 0.52±0.12 μm for carbon steel

  8. Review on Cold-Formed Steel Connections

    Science.gov (United States)

    Tan, Cher Siang; Mohammad, Shahrin; Md Tahir, Mahmood; Shek, Poi Ngian

    2014-01-01

    The concept of cold-formed light steel framing construction has been widespread after understanding its structural characteristics with massive research works over the years. Connection serves as one of the important elements for light steel framing in order to achieve its structural stability. Compared to hot-rolled steel sections, cold-formed steel connections perform dissimilarity due to the thin-walled behaviour. This paper aims to review current researches on cold-formed steel connections, particularly for screw connections, storage rack connections, welded connections, and bolted connections. The performance of these connections in the design of cold-formed steel structures is discussed. PMID:24688448

  9. China’s steel industry as a driving force for economic growth and international competitiveness

    OpenAIRE

    Popescu, Gh. H.; Nica, E.; Nicolăescu, E.; Lăzăroiu, G.

    2016-01-01

    The theory that we shall seek to elaborate here puts considerable emphasis on technological features of China’s steel production, its emergence as the world’s most significant steel producer and main manufacturing base, and the transitory decline in steel demand related to the international financial crisis. The purpose of this article is to gain a deeper understanding of the global incorporation of China’s steel enterprises, its portion of worldwide steel consumption, and its industrial poli...

  10. Corrosion fatigue of pressure vessel steels in PWR environments--influence of steel sulfur content

    International Nuclear Information System (INIS)

    Scott, P.M.; Druce, S.G.; Truswell, A.E.

    1984-01-01

    Large effects of simulated light water reactor environments at 288 C on fatigue crack growth in low alloy pressure vessel steels are observed only when specific mechanical, metallurgical, and electrochemical conditions are satisfied simultaneously. In this paper, the relative importance of three key variables--steel impurity content, water chemistry, and flow rate--and their interaction with loading rate or strain rate are examined. In particular, the results of a systematic examination of the influence of a steel's sulfur content are described

  11. Corrosion fatigue of pressure vessel steels in PWR environments--influence of steel sulfur content

    Energy Technology Data Exchange (ETDEWEB)

    Scott, P.M.; Druce, S.G.; Truswell, A.E.

    1984-07-01

    Large effects of simulated light water reactor environments at 288 C on fatigue crack growth in low alloy pressure vessel steels are observed only when specific mechanical, metallurgical, and electrochemical conditions are satisfied simultaneously. In this paper, the relative importance of three key variables--steel impurity content, water chemistry, and flow rate--and their interaction with loading rate or strain rate are examined. In particular, the results of a systematic examination of the influence of a steel's sulfur content are described.

  12. Generation of 99-mW continuous-wave 285-nm radiation for magneto-optical trapping of Mg atoms

    DEFF Research Database (Denmark)

    Madsen, Dorte Nørgaard; Yu, Ping; Balslev, Søren

    2002-01-01

    We have developed a tunable intense narrow-band 285 nm light source based on frequency doubling of 570 nm light in BBO. At input powers of 840 mW (including 130 mW used for locking purposes) we generate 99 mW UV radiation with an intensity profile suitable for laser-cooling experiments. The light...... is used for laser cooling of neutral magnesium atoms in a magneto-optical trap (MOT). We capture about 5 x 10(6) atoms directly from a thermal beam and find that the major loss mechanism of the magnesium MOT is a near-resonant two-photon ionization process....

  13. Recent developments in turning hardened steels - A review

    Science.gov (United States)

    Sivaraman, V.; Prakash, S.

    2017-05-01

    Hard materials ranging from HRC 45 - 68 such as hardened AISI H13, AISI 4340, AISI 52100, D2 STL, D3 STEEL Steel etc., need super hard tool materials to machine. Turning of these hard materials is termed as hard turning. Hard turning makes possible direct machining of the hard materials and also eliminates the lubricant requirement and thus favoring dry machining. Hard turning is a finish turning process and hence conventional grinding is not required. Development of the new advanced super hard tool materials such as ceramic inserts, Cubic Boron Nitride, Polycrystalline Cubic Boron Nitride etc. enabled the turning of these materials. PVD and CVD methods of coating have made easier the production of single and multi layered coated tool inserts. Coatings of TiN, TiAlN, TiC, Al2O3, AlCrN over cemented carbide inserts has lead to the machining of difficult to machine materials. Advancement in the process of hard machining paved way for better surface finish, long tool life, reduced tool wear, cutting force and cutting temperatures. Micro and Nano coated carbide inserts, nanocomposite coated PCBN inserts, micro and nano CBN coated carbide inserts and similar developments have made machining of hardened steels much easier and economical. In this paper, broad literature review on turning of hardened steels including optimizing process parameters, cooling requirements, different tool materials etc., are done.

  14. ABOUT RATIONING MAXIMUM ALLOWABLE DEFECT DEPTH ON THE SURFACE OF STEEL BILLETS IN PRODUCTION OF HOT-ROLLED STEEL

    Directory of Open Access Journals (Sweden)

    PARUSOV E. V.

    2017-01-01

    Full Text Available Formulation of the problem. Significant influence on the quality of rolled steel have various defects on its surface, which in its turn inherited from surface defects of billet and possible damage to the surface of rolled steel in the rolling mill line. One of the criteria for assessing the quality indicators of rolled steel is rationing of surface defects [1; 2; 3; 6; 7]. Current status of the issue. Analyzing the different requirements of regulations to the surface quality of the rolled high-carbon steels, we can conclude that the maximum allowable depth of defects on the surface of billet should be in the range of 2.0...5.0 mm (depending on the section of the billet, method of its production and further the destination Purpose. Develop a methodology for calculating the maximum allowable depth of defects on the steel billet surface depending on the requirements placed on the surface quality of hot-rolled steel. Results. A simplified method of calculation, allowing at the rated depth of defects on the surface of the hot-rolled steel to make operatively calculation of the maximum allowable depth of surface defects of steel billets before heating the metal in the heat deformation was developed. The findings shows that the maximum allowable depth of surface defects is reduced with increasing diameter rolled steel, reducing the initial section steel billet and degrees of oxidation of the metal in the heating furnace.

  15. A Steel Ball Surface Quality Inspection Method Based on a Circumferential Eddy Current Array Sensor

    Directory of Open Access Journals (Sweden)

    Huayu Zhang

    2017-07-01

    Full Text Available To efficiently inspect surface defects on steel ball bearings, a new method based on a circumferential eddy current array (CECA sensor was proposed here. The best probe configuration, in terms of the coil quality factor (Q-factor, magnetic field intensity, and induced eddy current density on the surface of a sample steel ball, was determined using 3-, 4-, 5-, and 6-coil probes, for analysis and comparison. The optimal lift-off from the measured steel ball, the number of probe coils, and the frequency of excitation current suitable for steel ball inspection were obtained. Using the resulting CECA sensor to inspect 46,126 steel balls showed a miss rate of ~0.02%. The sensor was inspected for surface defects as small as 0.05 mm in width and 0.1 mm in depth.

  16. Corrosion resistance of steel fibre reinforced concrete – a literature review

    DEFF Research Database (Denmark)

    Marcos Meson, Victor; Michel, Alexander; Solgaard, Anders

    2016-01-01

    Steel fibre reinforced concrete (SFRC) is increasingly being used in the construction of prefabricated segmental linings for bored tunnels, since it entails simplified production processes and higher quality standards. However, international standards and guidelines are not consistent regarding...... the consideration of steel fibres for the structural verification of SFRC elements exposed to corrosive environments, hampering the development of civil infrastructure built of SFRC. In particular, the long-term effect of exposure to chlorides is in focus and under discussion. This paper reviews the existing...... the existence of a critical crack width, below 0.20 mm, where corrosion of carbon-steel fibres is not critical and the structural integrity of the exposed SFRC can be ensured over the long-term. A doctoral project investigating chloride-induced corrosion of steel fibres on cracked SFRC has been initiated...

  17. Material characterization of a novel new armour steel

    Science.gov (United States)

    Bester, J. N.; Stumpf, W. E.

    2012-08-01

    The material characterization of a novel new armour steel with comparison to a leading commercial benchmark alloy is presented. Direct ballistic and experimental comparison is drawn. The 5.56 × 45 mm [M193] and 7.62 × 51 mm [NATO Ball] projectiles were used in a cartridge type high pressure barrel configuration to evaluate the superior plugging resistance of the new steel over a range of plate thicknesses. To characterize the dynamic plasticity of the materials, quasi-static, notched and high temperature tensile tests as well as Split Hopkinson Pressure Bar tests in tension and compression were performed. The open source explicit solver, IMPACT (sourceforge.net) is used in an ongoing numerical and sensitivity analysis of ballistic impact. A simultaneous multi variable fitting algorithm is planned to evaluate several selected numerical material models and show their relative correlation to experimental data. This study as well as micro-metallurgical investigation of adiabatic shear bands and localized deformation zones should result in new insights in to the underlying metallurgical and physical behavior of armour plate steels during ballistic perforation.

  18. Material characterization of a novel new armour steel

    Directory of Open Access Journals (Sweden)

    Stumpf W.E.

    2012-08-01

    Full Text Available The material characterization of a novel new armour steel with comparison to a leading commercial benchmark alloy is presented. Direct ballistic and experimental comparison is drawn. The 5.56 × 45 mm [M193] and 7.62 × 51 mm [NATO Ball] projectiles were used in a cartridge type high pressure barrel configuration to evaluate the superior plugging resistance of the new steel over a range of plate thicknesses. To characterize the dynamic plasticity of the materials, quasi-static, notched and high temperature tensile tests as well as Split Hopkinson Pressure Bar tests in tension and compression were performed. The open source explicit solver, IMPACT (sourceforge.net is used in an ongoing numerical and sensitivity analysis of ballistic impact. A simultaneous multi variable fitting algorithm is planned to evaluate several selected numerical material models and show their relative correlation to experimental data. This study as well as micro-metallurgical investigation of adiabatic shear bands and localized deformation zones should result in new insights in to the underlying metallurgical and physical behavior of armour plate steels during ballistic perforation.

  19. Steel fiber reinforced concrete

    International Nuclear Information System (INIS)

    Baloch, S.U.

    2005-01-01

    Steel-Fiber Reinforced Concrete is constructed by adding short fibers of small cross-sectional size .to the fresh concrete. These fibers reinforce the concrete in all directions, as they are randomly oriented. The improved mechanical properties of concrete include ductility, impact-resistance, compressive, tensile and flexural strength and abrasion-resistance. These uniqlte properties of the fiber- reinforcement can be exploited to great advantage in concrete structural members containing both conventional bar-reinforcement and steel fibers. The improvements in mechanical properties of cementitious materials resulting from steel-fiber reinforcement depend on the type, geometry, volume fraction and material-properties of fibers, the matrix mix proportions and the fiber-matrix interfacial bond characteristics. Effects of steel fibers on the mechanical properties of concrete have been investigated in this paper through a comprehensive testing-programme, by varying the fiber volume fraction and the aspect-ratio (Lid) of fibers. Significant improvements are observed in compressive, tensile, flexural strength and impact-resistance of concrete, accompanied by marked improvement in ductility. optimum fiber-volume fraction and aspect-ratio of steel fibers is identified. Test results are analyzed in details and relevant conclusions drawn. The research is finally concluded with future research needs. (author)

  20. Technical features of steel structure construction by Kawasaki Steel; Kawasaki Seitetsu no kokozo gijutsu no tokucho

    Energy Technology Data Exchange (ETDEWEB)

    Kaneko, T.; Urata, I.; Okata, S. [Kawasaki Steel Corp., Tokyo (Japan)

    1996-03-01

    In the steel structure technology of Kawasaki Steel, the joint technique (e.g., welding) is added to them while developing or improving the products that meet the social needs as a material supplier. Moreover, the execution technique that manufactures materials or constructs them as an integrated structure, the structural analysis that conforms to the function and application of a structure, and the design technique on dynamic properties or durability such as earthquake resistance, fatigue, and corrosion resistance are synthetically expanded for engineering. In this paper, a building steel frame, non-residence building, bridge, and harbor structure as steel structure in the building and construction fields were described for each structure genre. The structural technology of a building steel frame is summarized to the products of pillar materials. An earthquake brace, using a dead soft steel, with high earthquake energy absorption capability and a damping wall were also developed. The design and execution technique of a large roof was systematized. The exchange technique of a road bridge RC floor and the technique of an unstiffened suspension bridge for pipeline were developed. A new technique was also developed for a suspension monorail track and offshore structure. 30 refs., 5 figs.

  1. Study of copper precipitation behavior in a Cu-bearing austenitic antibacterial stainless steel

    International Nuclear Information System (INIS)

    Ren, Ling; Nan, Li; Yang, Ke

    2011-01-01

    Copper (Cu) precipitation behavior in a type 304 Cu-bearing austenitic antibacterial stainless steel was studied by analyses of variations in micro-hardness, electrical resistivity, electrochemical impedance and lattice constant of the steel, complemented with transmission electron microscopy (TEM) observation, showing more or less changes on these properties of the steel with different aging time. It was found that both micro-hardness and electrical resistivity measurements were relatively sensitive and accurate to reflect the Cu precipitation behavior in the experimental steel, indicating the beginning and finishing points of the precipitation, which are more simple and effective to be used for development of the new type of antibacterial stainless steels.

  2. Corrosion behaviour of laser clad stainless steels

    International Nuclear Information System (INIS)

    Damborenea, J.J. de; Weerasinghe, V.M.; West, D.R.F.

    1993-01-01

    The present paper is focussed in the study of the properties of a clad layer of stainless steel on a mild steel. By blowing powder of the alloy into a melt pool generated by a laser of 2 KW, an homogeneous layer of 316 stainless steel can be obtained. Structure, composition and corrosion behaviour are similar to those of a stainless steel in as-received condition. (Author)

  3. Influence of steel-making process and heat-treatment temperature on the fatigue and fracture properties of pressure vessel steels

    International Nuclear Information System (INIS)

    Koh, S. K.; Na, E. G.; Baek, T. H.; Won, S. Y.; Park, S. J.; Lee, S. W.

    2001-01-01

    In this paper, high strength pressure vessel steels having the same chemical compositions were manufactured by the two different steel-making processes, such as Vacuum Degassing(VD) and Electro-Slag Remelting(ESR) methods. After the steel-making process, they were normalized at 955 deg. C, quenched at 843 .deg. C, and finally tempered at 550 .deg. C or 450 deg. C, resulting in tempered martensitic microstructures with different yielding strengths depending on the tempering conditions. Low-Cycle Fatigue(LCF) tests, Fatigue Crack Growth Rate(FCGR) tests, and fracture toughness tests were performed to investigate the fatigue and fracture behaviors of the pressure vessel steels. In contrast to very similar monotonic, LCF, and FCGR behaviors between VD and ESR steels, a quite difference was noticed in the fracture toughness. Fracture toughness of ESR steel was higher than that of VD steel, being attributed to the removal of impurities in steel-making process

  4. Electrochemical characterisation of a martensitic stainless steel in a neutral chloride solution

    International Nuclear Information System (INIS)

    Marcelin, Sabrina; Pébère, Nadine; Régnier, Sophie

    2013-01-01

    Highlights: ► A better knowledge of the electrochemical behaviour of a martensitic stainless steel in bulk electrolyte was obtained. ► Quantitative parameters were obtained from impedance measurements. ► The study will be used as reference to investigate crevice corrosion using a thin layer cell. - Abstract: This paper focuses on the characterisation of the electrochemical behaviour of a martensitic stainless steel in 0.1 M NaCl + 0.04 M Na 2 SO 4 solution and is a part of a study devoted to crevice corrosion resistance of stainless steels. Polarisation curves and electrochemical impedance measurements were obtained for different experimental conditions in bulk electrolyte. X-ray photoelectron spectroscopy (XPS) was used to analyse the passive films. At the corrosion potential, the stainless steel was in the passive state and the corrosion process was controlled by the properties of the passive film formed during air exposure. During immersion in the deaerated solution, the passive film was only slightly modified, whereas it was altered both in composition and thickness during immersion in the aerated solution. After cathodic polarisation of the stainless steel electrode surface, the oxide film was almost totally removed and the surface appeared to be uniformly active for oxygen reduction. The new passive film, formed at the corrosion potential, was enriched with iron species and less protective. Impedance diagrams allowed the characterisation of both the oxide film (high-frequency range) and the charge transfer process (low-frequency range).

  5. Low-temperature nitriding of austenitic steel in a vibrofluidized bed

    Science.gov (United States)

    Baraz, V. R.; Grachev, S. V.

    1999-11-01

    The prospects for use of a vibrofluidized bed (VFB) for low-temperature nitrogen saturation of high-strength austenitic steel based on Cr-Ni-Mn (12Kh17N8G2S2MF) are considered. The positive effect of preliminary plastic deformation on the intensity of nitriding is described. The temperature and time parameters of nitriding in a VFB for strain-aging austenitic steel 12Kh17N8G2S2MF are shown to be adequate for the regimes of the final heat-treatment operation of aging. This creates the possibility of combining the operations of surface alloying and strain aging into a single cycle. This combined treatment increases substantially the resistance of the steel to cyclic loads while preserving the strength parameters. It is shown that the presented method of low-temperature nitriding in a VFB is expedient for improving the service characteristics of austenitic steel 12Kh17N8G2S2MF used for production of force springs of automobile brake systems.

  6. High temperature oxidation behavior of ODS steels

    Science.gov (United States)

    Kaito, T.; Narita, T.; Ukai, S.; Matsuda, Y.

    2004-08-01

    Oxide dispersion strengthened (ODS) steels are being developing for application as advanced fast reactor cladding and fusion blanket materials, in order to allow increased operation temperature. Oxidation testing of ODS steel was conducted under a controlled dry air atmosphere to evaluate the high temperature oxidation behavior. This showed that 9Cr-ODS martensitic steels and 12Cr-ODS ferritic steels have superior high temperature oxidation resistance compared to 11 mass% Cr PNC-FMS and 17 mass% Cr ferritic stainless steel. This high temperature resistance is attributed to earlier formation of the protective α-Cr 2O 3 on the outer surface of ODS steels.

  7. Performance of Retrofitted Self-Compacting Concrete-Filled Steel Tube Beams Using External Steel Plates

    Directory of Open Access Journals (Sweden)

    Ahmed A. M. AL-Shaar

    2018-01-01

    Full Text Available Self-compacting concrete-filled steel tube (SCCFST beams, similar to other structural members, necessitate retrofitting for many causes. However, research on SCCFST beams externally retrofitted by bolted steel plates has seldom been explored in the literature. This paper aims at experimentally investigating the retrofitting performance of square self-compacting concrete-filled steel tube (SCCFST beams using bolted steel plates with three different retrofitting schemes including varied configurations and two different steel plate lengths under flexure. A total of 18 specimens which consist of 12 retrofitted SCCFST beams, three unretrofitted (control SCCFST beams, and three hollow steel tubes were used. The flexural behaviour of the retrofitted SCCFST beams was examined regarding flexural strength, failure modes, and moment versus deflection curves, energy absorption, and ductility. Experimental results revealed that the implemented retrofitting schemes efficiently improve the moment carrying capacity and stiffness of the retrofitted SCCFST beams compared to the control beams. The increment in flexural strength ranged from 1% to 46%. Furthermore, the adopted retrofitting schemes were able to restore the energy absorption and ductility of the damaged beams in the range of 35% to 75% of the original beam ductility. Furthermore, a theoretical model was suggested to predict the moment capacity of the retrofitted SCCFST beams. The theoretical model results were in good agreement with the test results.

  8. Kawasaki Steel Giho, Vol. 27, No. 4, 1995. Special issue on steel structure

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-12-31

    ;Contents (Partial): Vertical Gust Prediction of Cable-Stayed Bridges in Yawed Wind; Design and Construction of a Super Platform Structure Made of Steel; Prefabricated Steel Deck of Battledeck Floor Type for Redecking; Aesthetic Design of Structures; and Lift-up Construction Method for Multi-layer Building.

  9. Development of ferritic steels for fusion reactor applications

    Energy Technology Data Exchange (ETDEWEB)

    Klueh, R.L.; Maziasz, P.J.; Corwin, W.R.

    1988-08-01

    Chromium-molybdenum ferritic (martensitic) steels are leading candidates for the structural components for future fusion reactors. However, irradiation of such steels in a fusion environment will produce long-lived radioactive isotopes that will lead to difficult waste-disposal problems. Such problems could be reduced by replacing the elements in the steels (i.e., Mo, Nb, Ni, N, and Cu) that lead to long-lived radioactive isotopes. We have proposed the development of ferritic steels analogous to conventional Cr-Mo steels, which contain molybdenum and niobium. It is proposed that molybdenum be replaced by tungsten and niobium be replaced by tantalum. Eight experimental steels were produced. Chromium concentrations of 2.25, 5, 9, and 12% were used (all concentrations are in wt %). Steels with these chromium compositions, each containing 2% W and 0.25% V, were produced. To determine the effect of tungsten and vanadium, 2.25 Cr steels were produced with 2% W and no vanadium and with 0.25% V and O and 1% W. A 9Cr steel containing 2% W, 0.25 V, and 0.07% Ta was also studied. For all alloys, carbon was maintained at 0.1%. Tempering studies on the normalized steels indicated that the tempering behavior of the new Cr-W steels was similar to that of the analogous Cr-Mo steels. Microscopy studies indicated that 2% tungsten was required in the 2.25 Cr steels to produce 100% bainite in 15.9-mm-thick plate during normalization. The 5Cr and 9Cr steels were 100% martensite, but the 12 Cr steel contained about 75% martensite with the balance delta-ferrite. 33 refs., 35 figs., 5 tabs.

  10. Development of ferritic steels for fusion reactor applications

    International Nuclear Information System (INIS)

    Klueh, R.L.; Maziasz, P.J.; Corwin, W.R.

    1988-08-01

    Chromium-molybdenum ferritic (martensitic) steels are leading candidates for the structural components for future fusion reactors. However, irradiation of such steels in a fusion environment will produce long-lived radioactive isotopes that will lead to difficult waste-disposal problems. Such problems could be reduced by replacing the elements in the steels (i.e., Mo, Nb, Ni, N, and Cu) that lead to long-lived radioactive isotopes. We have proposed the development of ferritic steels analogous to conventional Cr-Mo steels, which contain molybdenum and niobium. It is proposed that molybdenum be replaced by tungsten and niobium be replaced by tantalum. Eight experimental steels were produced. Chromium concentrations of 2.25, 5, 9, and 12% were used (all concentrations are in wt %). Steels with these chromium compositions, each containing 2% W and 0.25% V, were produced. To determine the effect of tungsten and vanadium, 2.25 Cr steels were produced with 2% W and no vanadium and with 0.25% V and O and 1% W. A 9Cr steel containing 2% W, 0.25 V, and 0.07% Ta was also studied. For all alloys, carbon was maintained at 0.1%. Tempering studies on the normalized steels indicated that the tempering behavior of the new Cr-W steels was similar to that of the analogous Cr-Mo steels. Microscopy studies indicated that 2% tungsten was required in the 2.25 Cr steels to produce 100% bainite in 15.9-mm-thick plate during normalization. The 5Cr and 9Cr steels were 100% martensite, but the 12 Cr steel contained about 75% martensite with the balance delta-ferrite. 33 refs., 35 figs., 5 tabs

  11. Aluminide Coating on Stainless Steel for Nuclear Reactor Application: A Preliminary Study

    International Nuclear Information System (INIS)

    Hishamuddin Husain; Zaifol Samsu; Yusof Abdullah; Muhamad Daud

    2015-01-01

    Stainless steels have been used as structural materials in the nuclear reactor since its first generation. Stainless steels type 304 and 316 are commonly used in structural components. Since the first generation materials, improvements were made on Stainless steels. This includes addition of stabilizing elements and by modification of metallurgical structure. This study investigates the formation of aluminide coating on Stainless steels by diffusion to help improve corrosion resistance. Stainless steels type 304 and 316 substrates were immersed in molten aluminium at 750 degree Celsius for 5 minutes. Interaction between molten aluminium and solid to form the outer aluminide coating by hot dipped aluminizing is studied. (Author)

  12. Ion-nitriding of austenitic stainless steels

    International Nuclear Information System (INIS)

    Pacheco, O.; Hertz, D.; Lebrun, J.P.; Michel, H.

    1995-01-01

    Although ion-nitriding is an extensively industrialized process enabling steel surfaces to be hardened by nitrogen diffusion, with a resulting increase in wear, seizure and fatigue resistance, its direct application to stainless steels, while enhancing their mechanical properties, also causes a marked degradation in their oxidation resistance. However, by adaption of the nitriding process, it is possible to maintain the improved wear resistant properties while retaining the oxidation resistance of the stainless steel. The controlled diffusion permits the growth of a nitrogen supersaturated austenite layer on parts made of stainless steel (AISI 304L and 316L) without chromium nitride precipitation. The diffusion layer remains stable during post heat treatments up to 650 F for 5,000 hrs and maintains a hardness of 900 HV. A very low and stable friction coefficient is achieved which provides good wear resistance against stainless steels under diverse conditions. Electrochemical and chemical tests in various media confirm the preservation of the stainless steel characteristics. An example of the application of this process is the treatment of Reactor Control Rod Cluster Assemblies (RCCAs) for Pressurized Water Nuclear Reactors

  13. Studies on the causes of failures in titanium tube condensers of nuclear power plants

    International Nuclear Information System (INIS)

    Kim, Uh Chul; Kim, Joung Soo; Jang, Soon Sik; Park, Su Hoon; Chung, Han Sub; Hwang, Seong Sik

    1990-03-01

    All condenser tubes in domestic nuclear power plants using sea water as condenser coolant are Ti material, while water boxes and tubesheets are, respectively, made of carbon steel and Cu-alloys. In this case, to prevent galvanic corrosion occuring between these materials, cathodic protection by an impressed direct current method is being used. Under inappropriate conditions, however, over-protection can generate hydrogen gas on Ti-tube surfaces, which may cause hydrogen embrittlement to the Ti tubes. Therefore, proper conditions for appropriate cathodic protection must be obtained through experiments. Galvanic corrosion between these three different materials was investigated, first. When SA 285 is coupled with Cu or Ti in sea water, under the same surface area, galvanic corrosion rate of SA 285 significantly increases (For example, corrosion rate increment, 2 x 10 -1 → 8 ma for SA 285 coupled with Cu). It was also affected by Cu more than by Ti. In addition, as the surface area ratio of SA 285 to Ti decreases, the corrosion rate of SA 285 increases. This is similar to SA 285-Cu couple. In this case, corrosion rate of SA 285 is higher than that of SA 285-Ti system. For Cu-Ti coulpe, as the surface area ratio of Cu to Ti increases, current density increases slightly up to 1.5 μA/cm 2 , which is very low. (author)

  14. Symbolic aesthetics in steel structural systems

    Directory of Open Access Journals (Sweden)

    Usama Abdul-Mun'em Khuraibet

    2015-02-01

    Full Text Available The aesthetic expression and its orders are important for steel structures forming. Steel structures are a compilation of structural elements, where its shapes have standard dimensions and pre-fabricated. As the steel construction systems not only aim to achieve the functional requirements for users, but must also have the symbolic aesthetics which provides visually and cognitive expression for viewers. In this sense the research interested in expressional aesthetics in these systems and highlights the importance of attention as structural items. Therefore the visual items which related with steel structures contain some of the most powerful forms of modern architecture, steel structures with a glass cladding, agility and accuracy in manufacture of structural elements as visual items, structural interest in the forms of spaces which have long span systems or in high buildings are different forms of expression and influence. So the research focuses on the study of those expressive patterns related with the steel construction properties, including the advantages of these systems at the level of strength and firmness, flexibility and economy as well as aesthetic and expression. Accordingly, the research problem concentrated on educational shortage in the study of the structural steel system aspects concerning constructional characteristic, expressive and aesthetic features, and how to deal with them as a language bearing the symbols and meanings which have clear structural style, because it the best ways to make those systems as communication means with users, by premise that the use of expressional symbol in steel construction increases the aesthetic value. Therefore the research aims to reveal the most structural and expressive patterns by analysis the expressional means and steel structural aesthetics.

  15. Precipitation evolution in a Ti-free and Ti-containing stainless maraging steel

    International Nuclear Information System (INIS)

    Schober, M.; Schnitzer, R.; Leitner, H.

    2009-01-01

    Stainless maraging steels have a Cr content higher than 12 wt% and show a excellent combination of high strength and ductility, which make them attractive for use in machinery fields and aircraft applications. The massive increase of strength during ageing treatment of maraging steels is related to a precipitation sequence of various nm-scaled intermetallic phases. The peak hardness especially in Ti-containing maraging steels can be reached after short-time ageing at temperatures around 500 o C. However, precipitation reactions in different stainless maraging steels are not fully understood, especially the evolution from clustering over growing to coarsening. In the present work a commercial maraging steel and a Ti-containing model alloy are investigated and compared to each other. The steels were isothermally heat treated at 525 o C for a range of times. Special emphasis was laid on the correlation of hardness to the formation and presence of different kinds of precipitates. The isothermal aged samples were investigated by using two advanced three-dimensional energy compensated atom probes (LEAP TM and 3DAP TM ) both in voltage mode and in laser mode. The atom probe data were correlated to standard hardness measurements. The results show that the partial substitution of Al by Ti results in a different precipitation behaviour. While the Ti-free maraging steel exhibit only one type of precipitate, the Ti-containing grade shows a change in the type of precipitates during ageing. However, this change leads to an accelerated coarsening and thus to a faster drop in hardness.

  16. Precipitation evolution in a Ti-free and Ti-containing stainless maraging steel.

    Science.gov (United States)

    Schober, M; Schnitzer, R; Leitner, H

    2009-04-01

    Stainless maraging steels have a Cr content higher than 12wt% and show a excellent combination of high strength and ductility, which make them attractive for use in machinery fields and aircraft applications. The massive increase of strength during ageing treatment of maraging steels is related to a precipitation sequence of various nm-scaled intermetallic phases. The peak hardness especially in Ti-containing maraging steels can be reached after short-time ageing at temperatures around 500 degrees C. However, precipitation reactions in different stainless maraging steels are not fully understood, especially the evolution from clustering over growing to coarsening. In the present work a commercial maraging steel and a Ti-containing model alloy are investigated and compared to each other. The steels were isothermally heat treated at 525 degrees C for a range of times. Special emphasis was laid on the correlation of hardness to the formation and presence of different kinds of precipitates. The isothermal aged samples were investigated by using two advanced three-dimensional energy compensated atom probes (LEAP and 3DAP) both in voltage mode and in laser mode. The atom probe data were correlated to standard hardness measurements. The results show that the partial substitution of Al by Ti results in a different precipitation behaviour. While the Ti-free maraging steel exhibit only one type of precipitate, the Ti-containing grade shows a change in the type of precipitates during ageing. However, this change leads to an accelerated coarsening and thus to a faster drop in hardness.

  17. Development of commercial nitrogen-rich stainless steels

    International Nuclear Information System (INIS)

    Liljas, M.

    1999-01-01

    This paper reviews the development of nitrogen alloyed stainless steels. Nitrogen alloying of austenitic stainless steels started at an early stage and was to a large extent caused by nickel shortage. However, direct technical advantages such as increased strength of the nitrogen alloyed steels made them attractive alternatives to the current steels. It was not until the advent of the AOD (argon oxygen decarburisation) process in the late 1960s that nitrogen alloying could be controlled to such accuracy that it became successful commercially on a broader scale. The paper describes production aspects and how nitrogen addition influences microstructure and the resulting properties of austenitic and duplex stainless steels. For austenitic steels there are several reasons for nitrogen alloying. Apart from increasing strength nitrogen also improves structural stability, work hardening and corrosion resistance. For duplex steels nitrogen also has a decisive effect in controlling the microstructure during thermal cycles such as welding. (orig.)

  18. A Study of the Effect of Interrupted Quenches on a Thermomechanically Processed High Carbon Steel.

    Science.gov (United States)

    1982-10-01

    steel . Successful martempering requires a cooling rate sufficient to avoid the nose of the C- curve and thus prevent significant bainite formation. When...STUDY OF THE EFFECT OF INTERRUPTED QUENCHES ON A THERMONECHANICALLY PROCESSED HIGH CARBON STEEL by Steven A. Barton October 1982 Thesis Advisor: T.R...unlimited. A Study of the Effect of Interrupted Quenches on a Thermomechanically Processed High Carbon Steel by Steven A. Barton Lieutenant, United

  19. A discussion on improving hydration activity of steel slag by altering its mineral compositions.

    Science.gov (United States)

    Wang, Qiang; Yan, Peiyu; Feng, Jianwen

    2011-02-28

    This study aims to investigate the ways to improve the cementitious properties of steel slag. The results show that the cementitious phase of steel slag is composed of silicate and aluminate, but the large particles of these phases make a very small contribution to the cementitious properties of steel slag. RO phase (CaO-FeO-MnO-MgO solid solution), Fe(3)O(4), C(2)F and f-CaO make no contribution to the cementitious properties of steel slag. A new kind of steel slag with more cementitious phase and less RO phase can be obtained by removing some large particles. This new steel slag possesses better cementitious properties than the original steel slag. The large particles can be used as fine aggregates for concrete. Adding regulating agent high in CaO and SiO(2) during manufacturing process of steel slag to increase the cementitious phase to inert phase ratio is another way to improve its cementitious properties. The regulating agent should be selected to adapt to the specific steel slag and the alkalinity should be increased as high as possible on the premise that the f-CaO content does not increase. The cooling rate should be enhanced to improve the hydration activity of the cementitious phase at the early ages and the grindability of steel slag. Copyright © 2010 Elsevier B.V. All rights reserved.

  20. Structure of three Zlatoust bulats (Damascus-steel blades)

    Science.gov (United States)

    Schastlivtsev, V. M.; Gerasimov, V. Yu.; Rodionov, D. P.

    2008-08-01

    Chemical composition, structure, and hardness of samples of three Zlatoust bulats (Damascus steels), namely, an Anosov bulat blade (1841), Obukhov bulat blade (1859), and a Shvetsov forged bulat-steel blank (crucible steel) have been investigated. The Anosov bulat possesses all signs of the classical Damascus steel; this is a hypereutectoid carbon steel with a structure formed from chains of carbides against the background of fine pearlite (troostite). A banded pattern is revealed on the surface of the blade. The Obukhov blade cannot be referred to classical Damascus steel. The pattern on the surface of the blade is absent, despite the fact that the initial steel is hypereutectoid. The structure of the blade does not correspond to the structure of classical Damascus steel; this is bainite with numerous cementite particles. The Shvetsov sample cannot be regarded as Damascus steel since it is made from a hypereutectoid steel alloyed by managanese and tungsten. The pattern on the surface of the metal is a consequence of the dendritic structure of the ingot which is developed during forging. The structure of this pattern differs from classical damascene pattern, since the latter is formed due to a specific arrangement of a variety of carbide particles against the pearlitic or some other background obtained during heat treatment.

  1. Characterization of friction stir welded joint of low nickel austenitic stainless steel and modified ferritic stainless steel

    Science.gov (United States)

    Mondal, Mounarik; Das, Hrishikesh; Ahn, Eun Yeong; Hong, Sung Tae; Kim, Moon-Jo; Han, Heung Nam; Pal, Tapan Kumar

    2017-09-01

    Friction stir welding (FSW) of dissimilar stainless steels, low nickel austenitic stainless steel and 409M ferritic stainless steel, is experimentally investigated. Process responses during FSW and the microstructures of the resultant dissimilar joints are evaluated. Material flow in the stir zone is investigated in detail by elemental mapping. Elemental mapping of the dissimilar joints clearly indicates that the material flow pattern during FSW depends on the process parameter combination. Dynamic recrystallization and recovery are also observed in the dissimilar joints. Among the two different stainless steels selected in the present study, the ferritic stainless steels shows more severe dynamic recrystallization, resulting in a very fine microstructure, probably due to the higher stacking fault energy.

  2. Damascus steels: history, processing, properties and carbon dating

    International Nuclear Information System (INIS)

    Wadsworth, J.

    2007-01-01

    In the mid-1970s, a class of steels containing high levels of carbon (∼ 1-2 wt% C) was developed for superplastic characteristics - that is, the ability to plastically deform to an extraordinary degree in tension at intermediate temperatures. Because these steels also had excellent room temperature properties, they were developed for their commercial potential. In the late 1970s, we became aware of the striking compositional similarities between these modern steels and the ancient steels of Damascus. This observation led us to revisit the history and metallurgy of Damascus steels and related steels. The legends and origins of Damascus steel date back to the time of Alexander the Great (323 BC) and the medieval Crusades (11th and 12th century AD), and this material has also been the subject of scrutiny by famous scientist in Europe, including Michael Faraday. Modern attempts to reproduce the legendary surface patterns which famously characterized Damascus steels are described. The extend to which the characteristics of Damascus steels are unusual is discussed. Finally, a program on radiocarbon dating was initiated to directly determine the age of about 50 ancient steels, including a Damascus knife, and the results are summarized. (author)

  3. Analysis of Microstructure Refinement During Single-Pass and Multi-Pass Friction Stir Processing of Nial Propeller Bronze

    Science.gov (United States)

    2010-09-01

    material. For example, tool steel can be used in aluminum, but tungsten-based alloys should be used in copper and titanium based alloys. The material...many other alloys such as copper, nickel, titanium, magnesium, and steels . In addition, each processed alloy had other material characteristics that... bainitic transformation is also possible. The martencite is a B2 structure with a lattice parameter of 2.85±0.03Å [8]. The B2 structure is a BCC structure

  4. Nanostructures in a ferritic and an oxide dispersion strengthened steel induced by dynamic plastic deformation

    DEFF Research Database (Denmark)

    Zhang, Zhenbo

    fission and fusion reactors. In this study, two candidate steels for nuclear reactors, namely a ferritic/martensitic steel (modified 9Cr-1Mo steel) and an oxide dispersion strengthened (ODS) ferritic steel (PM2000), were nanostructured by dynamic plastic deformation (DPD). The resulting microstructure...

  5. High - speed steel for precise cased tools

    International Nuclear Information System (INIS)

    Karwiarz, J.; Mazur, A.

    2001-01-01

    The test results of high-vanadium high - speed steel (SWV9) for precise casted tools are presented. The face -milling cutters of NFCa80A type have been tested in industrial operating conditions. An average life - time of SWV9 steel tools was 3-10 times longer compare to the conventional high - speed milling cutters. Metallography of SWB9 precise casted steel revealed beneficial for tool properties distribution of primary vanadium carbides in the steel matrix. Presented results should be a good argument for wide application of high - vanadium high - speed steel for precise casted tools. (author)

  6. Productivity Improvement in a Steel Industry using Supply Chain Management Technique

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Soltani

    2013-06-01

    Full Text Available Cost reduction is one of the methods applied for improving the productivity of organizations. In productivity literature, particularly in nonparametric methods, cost reduction related methods are regarded as input oriented models. This paper presents a Supply Chain Management (SCM model in which purchasing iron ore and coke from different resources, along with production and distribution of steel products were investigated to improve the productivity of a steel making plant in Iran. The model was designed based on a single objective concept with a focus on total cost minimization. The constraints of the model consisted principal restriction concerning mines, coke plant and products. The model was implemented in steel factories (blast furnace affiliated with Iranian Mines and Mining Industries Development and Renovation Organization (IMIDRO.The results showed that the priority for providing iron ore should be given to Iran Central Iron Ore Company (ICIOC which has enough production capacity to satisfy the required ores. The results further suggested that at the best productivity condition, Isfahan steel plant should focus on the beam and bar production. The other plants, i.e. Zagros plant, should focus on L-beam and slab and finally Meibod steel plant should concentrate on slab production. It was also showed that the coke production plants cannot supply the required tonnage of the steel plants. Therefore, some new plants should be established to achieve self-sufficiency in this industry. This model can be used as a support tool for decision-makers at strategic and tactical decision levels.

  7. Mechanical properties of irradiated 9Cr-2WVTa steel

    International Nuclear Information System (INIS)

    Klueh, R.L.; Alexander, D.J.; Rieth, M.

    1998-01-01

    An Fe-9Cr-2W-0.25V-0.07Ta-0.1C (9Cr-2WVTa) steel has excellent strength and impact toughness before and after irradiation in the Fast Flux Test Facility and the High Flux Reactor (HFR). The ductile-brittle transition temperature (DBTT) increased only 32 C after 28 dpa at 365 C in FFTF, compared to a shift of ∼60 C for a 9Cr-2WV steel--the same as the 9Cr-2WVTa steel but without tantalum. This difference occurred despite the two steels having similar tensile but without tantalum. This difference occurred despite the two steels having similar tensile properties before and after irradiation. The 9Cr-2WVTa steel has a smaller prior-austenite grain size, but otherwise microstructures are similar before irradiation and show similar changes during irradiation. The irradiation behavior of the 9Cr-2WVTa steel differs from the 9Cr-2WV steel and other similar steels in two ways: (1) the shift in DBTT of the 9Cr-2WVTa steel irradiated in FFTF does not saturate with fluence by ∼28 dpa, whereas for the 9Cr-2WV steel and most similar steels, saturation occurs at <10 dpa, and (2) the shift in DBTT for 9Cr-2WVTa steel irradiated in FFTF and HFR increased with irradiation temperature, whereas it decreased for the 9Cr-2WV steel, as it does for most similar steels. The improved properties of the 9Cr-2WVTa steel and the differences with other steels were attributed to tantalum in solution

  8. National steel tries wheeling

    International Nuclear Information System (INIS)

    Dudak, J.R.

    1992-01-01

    In 1989, National Steel felt the need to take the next step to make its Detroit-based division, Great Lakes Steel, more competitive in the world flat-rolled steel market. In 1988, Great Lakes Steel started flowing natural gas through the first fully litigated bypass (Competitive Sourcing Option) of a local distribution company. In 1989, the second connection with the new supply route for gas transportation, Panhandle Eastern had started flowing and the LDC, Michigan Consolidated Gas Co. (MichCon) had pulled out their piping previously serving the plants. Since we had been able to structure a fully reliable supply route, storage and balancing program for gas in the face of such strong opposition by the LDC, the author felt it was time to attack the next singularly sourced major commodity, electricity. Electricity, at this major integrated steel plant, represented approximately 7% of plant cost yearly. Yet being monopolized, Great Lakes Division (GLD) could not multiple source this commodity like it does with its other 93% of costs, except for labor (25% of the 93%). Multiple sourcing is done to bring competitive pressure to suppliers and to diversify supplies and protect plant operation in the event of failure by one supplier. This paper describes National Steel's strategy to reduce the cost of power, at the minimum of capital costs, the most expedient way possible, that does not sacrifice any major long-term potential cost improvements. The results show that competitively priced power is available across the mid-west, at prices well below many state regulated electric utilities, for at least 5 to 15 years, but with major obstacles in obtaining transmission access

  9. High yttria ferritic ODS steels through powder forging

    Science.gov (United States)

    Kumar, Deepak; Prakash, Ujjwal; Dabhade, Vikram V.; Laha, K.; Sakthivel, T.

    2017-05-01

    Oxide dispersion strengthened (ODS) steels are being developed for future nuclear reactors. ODS Fe-18%Cr-2%W-0.2%Ti steels with 0, 0.35, 0.5, 1 and 1.5% Y2O3 (all compositions in weight%) dispersion were fabricated by mechanical alloying of elemental powders. The powders were placed in a mild steel can and forged in a stream of hydrogen gas at 1473 K. The steels were forged again to final density. The strength of ODS steel increased with yttria content. Though this was accompanied by a decrease in tensile elongation, all the steels showed significant ductility. The ductility in high yttria alloys may be attributed to improved inter-particle bonding between milled powders due to reduction of surface oxides by hydrogen. This may permit development of ODS steels with yttria contents higher than the conventional limit of 0.5%. It is suggested that powder forging is a promising route to fabricate ODS steels with high yttria contents and improved ductility.

  10. Thermochemical surface engineering of steels

    DEFF Research Database (Denmark)

    Thermochemical Surface Engineering of Steels provides a comprehensive scientific overview of the principles and different techniques involved in thermochemical surface engineering, including thermodynamics, kinetics principles, process technologies and techniques for enhanced performance of steels...

  11. Scientific and Technological Principles of Development of New Cold-Resistant Arc-Steels (Steels for Arctic Applications)

    Science.gov (United States)

    Sych, O. V.; Khlusova, E. I.; Yashin, E. A.

    2017-12-01

    The paper presents the results of quantitative analysis of C, Mn, Ni and Cu content on strength and cold-resistance of rolled plates. Relations between the ferritic-bainitic structure morphology and anisotropy and steel performance characteristics have been established. Influence of thermal and deformation rolling patterns on steel structure has been studied. The steel chemical composition has been improved and precision thermomechanical processing conditions for production of cold-resistant Arc-steel plates have been developed.

  12. Anodized Steel Electrodes for Supercapacitors.

    Science.gov (United States)

    Sagu, Jagdeep S; Wijayantha, K G Upul; Bohm, Mallika; Bohm, Siva; Kumar Rout, Tapan

    2016-03-09

    Steel was anodized in 10 M NaOH to enhance its surface texture and internal surface area for application as an electrode in supercapacitors. A mechanism was proposed for the anodization process. Field-emission gun scanning electron microscopy (FEGSEM) studies of anodized steel revealed that it contains a highly porous sponge like structure ideal for supercapacitor electrodes. X-ray photoelectron spectroscopy (XPS) measurements showed that the surface of the anodized steel was Fe2O3, whereas X-ray diffraction (XRD) measurements indicated that the bulk remained as metallic Fe. The supercapacitor performance of the anodized steel was tested in 1 M NaOH and a capacitance of 18 mF cm(-2) was obtained. Cyclic voltammetry measurements showed that there was a large psueudocapacitive contribution which was due to oxidation of Fe to Fe(OH)2 and then further oxidation to FeOOH, and the respective reduction of these species back to metallic Fe. These redox processes were found to be remarkably reversible as the electrode showed no loss in capacitance after 10000 cycles. The results demonstrate that anodization of steel is a suitable method to produce high-surface-area electrodes for supercapacitors with excellent cycling lifetime.

  13. Corrosion of steel in concrete

    International Nuclear Information System (INIS)

    Preece, C.M.

    1982-10-01

    A comparative study has been made of those properties of Massiv and Standard cements which are considered to determine their ability to protect steel reinforcement from corroding. Saturated Massiv cement has a higher evaporabel water content, but a significantly finer pore structure than has saturated Standard cement. This fine structure resulted in an electrical resistivity ten times higher and chloride diffusivity ten times lower than those of Standard cement. Electrochemical measurements have shown that the passive current density of steel in Massiv mortar is higher than that of steel in Standard mortar, but the higher current should lead to a more rapid decrease in potential to a level at which neither chloride attack of hydrogen evolution will occur. Whereas steel in Standard mortar was found to be highly susceptible to crevice corrosion, no such attack has been observed in Massiv mortar. Moreover, the initiation of chloride induced corrosion and the subsequent rates of corrosion were both lower in Massiv mortar than in Standard mortar. Thus, it may be predicted that Massiv cement would provide greater protection for steel reinforcement in underground structures exposed to chloride containing ground water than would Standard cement. (author)

  14. The low-temperature aging embrittlement in a 2205 duplex stainless steel

    International Nuclear Information System (INIS)

    Weng, K.L.; Chen, H.R.; Yang, J.R.

    2004-01-01

    The effect of isothermal treatment (at temperatures ranging between 400 and 500 deg. C) on the embrittlement of a 2205 duplex stainless steel (with 45 ferrite-55 austenite, vol.%) has been investigated. The impact toughness and hardness of the aged specimens were measured, while the corresponding fractography was studied. The results show that the steel is susceptible to severe embrittlement when exposed at 475 deg. C; this aging embrittlement is analogous with that of the ferritic stainless steels, which is ascribed to the degenerated ferrite phase. High-resolution transmission electron microscopy reveals that an isotropic spinodal decomposition occurred during aging at 475 deg. C in the steel studied; the original δ-ferrite decomposed into a nanometer-scaled modulated structure with a complex interconnected network, which contained an iron-rich BCC phase (α) and a chromium-enriched BCC phase (α'). It is suggested that the locking of dislocations in the modulated structure leads to the severe embrittlement

  15. Steel slag carbonation in a flow-through reactor system: the role of fluid-flux.

    Science.gov (United States)

    Berryman, Eleanor J; Williams-Jones, Anthony E; Migdisov, Artashes A

    2015-01-01

    Steel production is currently the largest industrial source of atmospheric CO2. As annual steel production continues to grow, the need for effective methods of reducing its carbon footprint increases correspondingly. The carbonation of the calcium-bearing phases in steel slag generated during basic oxygen furnace (BOF) steel production, in particular its major constituent, larnite {Ca2SiO4}, which is a structural analogue of olivine {(MgFe)2SiO4}, the main mineral subjected to natural carbonation in peridotites, offers the potential to offset some of these emissions. However, the controls on the nature and efficiency of steel slag carbonation are yet to be completely understood. Experiments were conducted exposing steel slag grains to a CO2-H2O mixture in both batch and flow-through reactors to investigate the impact of temperature, fluid flux, and reaction gradient on the dissolution and carbonation of steel slag. The results of these experiments show that dissolution and carbonation of BOF steel slag are more efficient in a flow-through reactor than in the batch reactors used in most previous studies. Moreover, they show that fluid flux needs to be optimized in addition to grain size, pressure, and temperature, in order to maximize the efficiency of carbonation. Based on these results, a two-stage reactor consisting of a high and a low fluid-flux chamber is proposed for CO2 sequestration by steel slag carbonation, allowing dissolution of the slag and precipitation of calcium carbonate to occur within a single flow-through system. Copyright © 2014. Published by Elsevier B.V.

  16. Small-angle p-p elastic scattering at energies between 285 and 572 Me V

    CERN Document Server

    Aebischer, D; Greeniaus, L G; Hess, R; Junod, A; Lechanoine-Leluc, C; Nikles, J C; Rapin, D; Serre, Claude; Werren, D W

    1976-01-01

    Low energy proton-proton elastic scattering has been studied using an arrangement of multiwire proportional chambers at the CERN synchrocyclotron. Accurate measurements of the angular distribution for laboratory scattering angles in the range 1.5 to 10 degrees have been made at eight incident kinetic energies between 285 and 572 MeV. The interferences between the Coulomb and nuclear scattering amplitudes is used to determine the ratio alpha /sub p/=Re phi /sup N //sub +/(o)/Im phi /sup N//sub +/(o), where phi /sup N//sub +/(o) is the non-flip nuclear forward amplitude. alpha p is found to be positive and falling with energy, but is sensitive to the type of parameterization used. Reasonable consistency with dispersion relation calculations is obtained. (21 refs).

  17. Push-Pull Ventilation in a Painting Shop for Large Steel Constructions

    DEFF Research Database (Denmark)

    Svidt, Kjeld; Heiselberg, Per

    This paper describes the analysis of a push-pull ventilation system for a painting shop that is used for painting steel chimneys and windmill towers.......This paper describes the analysis of a push-pull ventilation system for a painting shop that is used for painting steel chimneys and windmill towers....

  18. Stress corrosion cracking of austenitic stainless steels in high temperature water and alternative stainless steel

    International Nuclear Information System (INIS)

    Yonezawa, T.

    2015-01-01

    In order to clarify the effect of SFE on SCC resistance of austenitic stainless steels and to develop the alternative material of Type 316LN stainless steel for BWR application, the effect of chemical composition and heat treatment on SFE value and SCCGR in oxygenated high temperature water were studied. The correlation factors between SFE values for 54 heats of materials and their chemical compositions for nickel, molybdenum, chromium, manganese, nitrogen, silicon and carbon were obtained. From these correlation factors, original formulae for SFE values calculation of austenitic stainless steels in the SHTWC, SHTFC and AGG conditions were established. The maximum crack length, average crack length and cracked area of the IGSCC for 33 heats were evaluated as IGSCC resistance in oxygenated high temperature water. The IGSCC resistance of strain hardened nonsensitized austenitic stainless steels in oxygenated high temperature water increases with increasing of nickel contents and SFE values. From this study, it is suggested that the SFE value is a key parameter for the IGSCC resistance of non-sensitized strain hardened austenitic stainless steels. As an alternative material of Type 316LN stainless steel, increased SFE value material, which is high nickel, high chromium, low silicon and low nitrogen material, is recommendable. (author)

  19. Metadynamic recrystallization in C steels

    Indian Academy of Sciences (India)

    Unknown

    EN24 and EN2 steels, a drop from 4000 s to 6 s for similar temperature rise was observed. Metadynamic ... carbon–manganese or silicon–manganese steels, but stops after a reduction at ... growth by strain-induced grain boundary migration;.

  20. Carbon-14 speciation during anoxic corrosion of activated steel in a repository environment

    Energy Technology Data Exchange (ETDEWEB)

    Wieland, E.; Cvetkovic, B.Z.; Kunz, D. [Paul Scherrer Institute, Villigen (Switzerland). Lab. for Waste Management; Salazar, G.; Szidat, S. [Bern Univ. (Switzerland). Dept. of Chemistry and Biochemistry and Oeschger Centre for Climate Change Research

    2018-01-15

    Radioactive waste contains significant amounts of {sup 14}C which has been identified a key radionuclide in safety assessments. In Switzerland, the {sup 14}C inventory of a cement-based repository for low- and intermediate-level radioactive waste (L/ILW) is mainly associated with activated steel (∝85 %). {sup 14}C is produced by {sup 14}N activation in steel parts exposed to thermal neutron flux in light water reactors. Release of {sup 14}C occurs in the near field of a deep geological repository due to anoxic corrosion of activated steel. Although the {sup 14}C inventory of the L/ILW repository and the sources of {sup 14}C are well known, the formation of {sup 14}C species during steel corrosion is only poorly understood. The aim of the present study was to identify and quantify the {sup 14}C-bearing carbon species formed during the anoxic corrosion of iron and steel and further to determine the {sup 14}C speciation in a corrosion experiment with activated steel. All experiments were conducted in conditions similar to those anticipated in the near field of a cement-based repository.

  1. Possible consequences of changing to a more environmental-friendly steel production in China

    International Nuclear Information System (INIS)

    Kolstad, Julie Riise

    2005-01-01

    China is the world's biggest steel producer, the world's biggest steel consumer and the world's biggest polluter. The superpower is forced to change its steel production in a more environmental-friendly way, but necessary measures will be expensive; moreover, they will have consequences far past China's borders. The possible effects are elaborated in the article (ml)

  2. Corrosion of carbon steel and low-alloy steel in diluted seawater containing hydrazine under gamma-rays irradiation

    International Nuclear Information System (INIS)

    Nakano, Junichi; Yamamoto, Masahiro; Tsukada, Takashi

    2014-01-01

    Seawater was injected into reactor cores of Units 1, 2, and 3 in the Fukushima Daiichi nuclear power station as an urgent coolant. It is considered that the injected seawater causes corrosion of steels of the reactor pressure vessel and primary containment vessel. To investigate the effects of gamma-rays irradiation on weight loss in carbon steel and low-alloy steel, corrosion tests were performed in diluted seawater at 50°C under gamma-rays irradiation. Specimens were irradiated with dose rates of 4.4 kGy/h and 0.2 kGy/h. To evaluate the effects of hydrazine (N 2 H 4 ) on the reduction of oxygen and hydrogen peroxide, N 2 H 4 was added to the diluted seawater. In the diluted seawater without N 2 H 4 , weight loss in the steels irradiated with 0.2 kGy/h was similar to that in the unirradiated steels, and weight loss in the steels irradiated with 4.4 kGy/h increased to approximate 1.7 times of those in the unirradiated steels. Weight loss in the steels irradiated in the diluted seawater containing N 2 H 4 was similar to that in the diluted seawater without N 2 H 4 . When N 2 was introduced into the gas phase in the flasks during gamma-rays irradiation, weight loss in the steels decreased. (author)

  3. Thermoelectric System Absorbing Waste Heat from a Steel Ladle

    Science.gov (United States)

    Lu, Baiyi; Meng, Xiangning; Zhu, Miaoyong; Suzuki, Ryosuke O.

    2018-06-01

    China's iron and steel industry has made great progress in energy savings and emission reductions with the application of many waste heat recovery technologies. However, most of the medium and low temperature waste heat and radiant waste heat has not been effectively utilized. This paper proposes a thermoelectric system that generates electricity by absorbing the radiant heat from the surface of steel ladles in a steel plant. The thermoelectric behavior of modules in this system is analyzed by a numerical simulation method. The effects of external resistance and module structure on thermoelectric performance are also discussed in the temperature range of the wall surface of a steel ladle. The results show that the wall temperature has a significant influence on the thermoelectric behavior of the module, so its uniformity and stability should be considered in practical application. The ratio of the optimum external resistance to the internal resistance of the thermoelectric module is in the range of 1.6-2.0, which indicates the importance of external load optimization for a given thermoelectric system. In addition, the output power and the conversion efficiency of the module can be significantly improved by increasing the length of the thermoelectric legs and adopting a double-layer structure. Finally, through the optimization of external resistance and structure, the power output can reach 83-304 W/m2. This system is shown to be a promising approach for energy recovery.

  4. Simple Heat Treatment for Production of Hot-Dip Galvanized Dual Phase Steel Using Si-Al Steels

    Science.gov (United States)

    Equihua-Guillén, F.; García-Lara, A. M.; Muñíz-Valdes, C. R.; Ortíz-Cuellar, J. C.; Camporredondo-Saucedo, J. E.

    2014-01-01

    This work presents relevant metallurgical considerations to produce galvanized dual phase steels from low cost aluminum-silicon steels which are produced by continuous strip processing. Two steels with different contents of Si and Al were austenized in the two-phase field ferrite + austenite (α + γ) in a fast manner to obtain dual phase steels, suitable for hot-dip galvanizing process, under typical parameters of continuous annealing processing line. Tensile dual phase properties were obtained from specimens cooled from temperature below Ar3, held during 3 min, intermediate cooling at temperature above Ar1 and quenching in Zn bath at 465 °C. The results have shown typical microstructure and tensile properties of galvanized dual phase steels. Finally, the synergistic effect of aluminum, silicon, and residual chromium on martensite start temperature ( M s), critical cooling rate ( C R), volume fraction of martensite, and tensile properties has been studied.

  5. A new effect of retained austenite on ductility enhancement in high strength bainitic steel

    Energy Technology Data Exchange (ETDEWEB)

    Wang Ying; Zhang Ke; Guo Zhenghong; Chen Nailu [School of Materials Science and Engineering, Shanghai Jiao Tong University, Shanghai 200240 (China); Rong Yonghua, E-mail: yhrong@sjtu.edu.cn [School of Materials Science and Engineering, Shanghai Jiao Tong University, Shanghai 200240 (China)

    2012-08-30

    Highlights: Black-Right-Pointing-Pointer A new DARA effect in the bainitic steel is proposed. Black-Right-Pointing-Pointer The conditions of DARA effect are proposed. Black-Right-Pointing-Pointer The mechanism of retained austenite on ductility enhancement is clarified. - Abstract: A designed high strength bainitic steel with considerable amount of retained austenite is presented in order to study the effect of retained austenite on the ductility enhancement in bainitic steels. Transformation induced plasticity (TRIP) effect is verified by both X-ray diffraction (XRD) measurement of retained austenite fraction in various deformation stages and transmission electron microscopy observation of the deformed twin-type martensite. Results from XRD line profile analysis reveal that the average dislocation density in bainite during the deformation is lower than that before deformation, and such a phenomenon can be explained by a new effect, dislocations absorption by retained austenite (DARA) effect, based on our previous investigation of martensitic steels. DARA effect availably enhances the compatibility of deformation ability of bainite with retained austenite. In view of microstructure similarity of bainitic steels with martensitic steels, the conditions of DARA effect are proposed. The effects of retained austenite on the ductility enhancement in bainitic steels are clarified.

  6. Investigation of Steel Surfaces Treated by a Hybrid Ion Implantation Technique

    International Nuclear Information System (INIS)

    Reuther, H.; Richter, E.; Prokert, F.; Ueda, M.; Beloto, A. F.; Gomes, G. F.

    2004-01-01

    Implantation of nitrogen ions into stainless steel in combination with oxidation often results in a decrease or even complete removal of the chromium in the nitrogen containing outermost surface layer. While iron nitrides can be formed easily by this method, due to the absence of chromium, the formation of chromium nitrides is impossible and the beneficial influence of chromium in the steel for corrosion resistance cannot be used. To overcome this problem we use the following hybrid technique. A thin chromium layer is deposited on steel and subsequently implanted with nitrogen ions. Chromium can be implanted by recoil into the steel surface and thus the formation of iron/chromium nitrides should be possible. Both beam line ion implantation and plasma immersion ion implantation are used. Due to the variation of the process parameters, different implantation profiles and different compounds are produced. The produced layers are characterized by Auger electron spectroscopy, conversion electron Moessbauer spectroscopy and X-ray diffraction. The obtained results show that due to the variation of the implantation parameters, the formation of iron/chromium nitrides can be achieved and that plasma immersion ion implantation is the most suitable technique for the enrichment of chromium in the outermost surface layer of the steel when compared to the beam line implantation.

  7. Modern steels for light automobiles (review)

    Science.gov (United States)

    Tikhonov, A. K.

    1994-10-01

    The article considers the directions of work at VAZ together with metallurgists of the CIS for creating highly efficient economically-alloyed and microalloyed steels; highly ductile forged steels with improved corrosion resistance coated with zinc and with good stamping, welding, and painting capacity. Steels are created for petrol tanks with aluminum-zinc coatings instead of lead, and new heat and corrosion-resistant steels are developed for automobile exhaust gas systems.

  8. Residual stresses and fatigue in a duplex stainless steel

    International Nuclear Information System (INIS)

    Johansson, Johan

    1999-01-01

    Duplex stainless steels, consisting of approximately equal amounts of austenite and ferrite, often combine the best features of austenitic and ferritic stainless steels. They generally have good mechanical properties, including high strength and ductility, and the corrosion resistance is often better than conventional austenitic grades. This has lead to a growing use of duplex stainless steels as a material in mechanically loaded constructions. However, detailed knowledge regarding its mechanical properties and deformation mechanisms are still lacking. In this thesis special emphasis has been placed on the residual stresses and their influence on mechanical behaviour of duplex stainless steels. Due to the difference in coefficient of thermal expansion between the two phases, tensile microstresses are found in the austenitic phase and balancing compressive microstresses in the ferritic phase. The first part of this thesis is a literature survey, which will give an introduction to duplex stainless steels and review the fatigue properties of duplex stainless steels and the influence of residual stresses in two-phase material. The second part concerns the evolution of the residual stress state during uniaxial loading. Initial residual stresses were found to be almost two times higher in the transverse direction compared to the rolling direction. During loading the absolute value of the microstresses increased in the macroscopic elastic regime but started to decrease with increasing load in the macroscopic plastic regime. A significant increase of the microstresses was also found to occur during unloading. Finite element simulations also show stress variation within one phase and a strong influence of both the elastic and plastic anisotropy of the individual phases on the simulated stress state. In the third part, the load sharing between the phases during cyclic loading is studied. X-ray diffraction stress analysis and transmission electron microscopy show that even if

  9. Residual stresses and fatigue in a duplex stainless steel

    Energy Technology Data Exchange (ETDEWEB)

    Johansson, Johan

    1999-05-01

    Duplex stainless steels, consisting of approximately equal amounts of austenite and ferrite, often combine the best features of austenitic and ferritic stainless steels. They generally have good mechanical properties, including high strength and ductility, and the corrosion resistance is often better than conventional austenitic grades. This has lead to a growing use of duplex stainless steels as a material in mechanically loaded constructions. However, detailed knowledge regarding its mechanical properties and deformation mechanisms are still lacking. In this thesis special emphasis has been placed on the residual stresses and their influence on mechanical behaviour of duplex stainless steels. Due to the difference in coefficient of thermal expansion between the two phases, tensile microstresses are found in the austenitic phase and balancing compressive microstresses in the ferritic phase. The first part of this thesis is a literature survey, which will give an introduction to duplex stainless steels and review the fatigue properties of duplex stainless steels and the influence of residual stresses in two-phase material. The second part concerns the evolution of the residual stress state during uniaxial loading. Initial residual stresses were found to be almost two times higher in the transverse direction compared to the rolling direction. During loading the absolute value of the microstresses increased in the macroscopic elastic regime but started to decrease with increasing load in the macroscopic plastic regime. A significant increase of the microstresses was also found to occur during unloading. Finite element simulations also show stress variation within one phase and a strong influence of both the elastic and plastic anisotropy of the individual phases on the simulated stress state. In the third part, the load sharing between the phases during cyclic loading is studied. X-ray diffraction stress analysis and transmission electron microscopy show that even if

  10. Inhibition of nitrate stress corrosion cracking of mild steel in nuclear process wastes

    International Nuclear Information System (INIS)

    Donovan, J.A.

    1975-01-01

    The concentration of hydroxide and nitrite ions necessary to prevent crack growth in A-285-B steel exposed to waste solutions was determined by the systematic testing of solutions within the ranges of hydroxide, nitrate, and nitrite concentrations found in waste tanks. The relative susceptibility to SCC was assumed to be dependent on the concentrations of nitrate, nitrite, and hydroxyl ions; the other components were assumed to have little effect on cracking. All of the tests were done at 97 0 C, with specimens loaded initially to an effective stress intensity of 45 ksi √in. Both the temperature of exposure and the initial stress intensity create conditions more severe than would normally be found in the waste tanks. All specimens were exposed for a minimum of 1000 hours. Results showed that the aggressiveness of the solutions increased with increasing nitrate ion concentration. For example, cracks grew in 5M NO 3 - + 0.3M NO 2 - , but not in 1.5M NO 3 - + 0.3M NO 2 - . Also, the solutions causing crack growth within the range of compositions found in the waste tank were concentrated in the high nitrate--low nitrite, hydroxyl ion region. Most of the results were obtained with solutions containing 5M NO 3 - and various amounts of nitrite and hydroxyl ion concentrations. (U.S.)

  11. Low cycle fatigue behavior of a ferritic reactor pressure vessel steel

    Energy Technology Data Exchange (ETDEWEB)

    Sarkar, Apu, E-mail: asarkar@barc.gov.in; Kumawat, Bhupendra K.; Chakravartty, J.K.

    2015-07-15

    The cyclic stress–strain response and the low cycle fatigue (LCF) behavior of 20MnMoNi55 pressure vessel steel were studied. Tensile strength and LCF properties were examined at room temperature (RT) using specimens cut from rolling direction of a rolled block. The fully reversed strain-controlled LCF tests were conducted at a constant total strain rate with different axial strain amplitude levels. The cyclic strain–stress relationships and the strain–life relationships were obtained through the test results, and related LCF parameters of the steel were calculated. The studied steel exhibits cyclic softening behavior. Furthermore, analysis of stabilized hysteresis loops showed that the steel exhibits non-Masing behavior. Complementary scanning electron microscopy examinations were also carried out on fracture surfaces to reveal dominant damage mechanisms during crack initiation, propagation and fracture. Multiple crack initiation sites were observed on the fracture surface. The investigated LCF behavior can provide reference for pressure vessel life assessment and fracture mechanisms analysis.

  12. From the TRIP effect and Quenching and Partitioning steels concepts to the development of new high-performance, lean powder metallurgy steels

    International Nuclear Information System (INIS)

    Torralba, José M.; Navarro, Alfonso; Campos, Mónica

    2013-01-01

    A new method of developing lean powder metallurgy steel is proposed. The microstructure of the steel is tailored by combining two different prealloyed steel grades. These materials open a new niche in steel grades for high-performance applications by using a low-cost method of production. Moreover, an alternative route to developing microstructures suitable for manufacturing TRIP and/or Q and P steels is proposed avoiding some of the complex steps that must otherwise be taken to obtain the proper starting microstructure

  13. From the TRIP effect and Quenching and Partitioning steels concepts to the development of new high-performance, lean powder metallurgy steels

    Energy Technology Data Exchange (ETDEWEB)

    Torralba, José M., E-mail: josemanuel.torralba@imdea.org [IMDEA Materials Institute, C/Eric Kandel 2, 28906 - Getafe, Madrid (Spain); Department of Materials Science and Engineering, Universidad Carlos III Av. Universidad, 30, Leganés (Spain); Navarro, Alfonso; Campos, Mónica [Department of Materials Science and Engineering, Universidad Carlos III Av. Universidad, 30, Leganés (Spain)

    2013-06-20

    A new method of developing lean powder metallurgy steel is proposed. The microstructure of the steel is tailored by combining two different prealloyed steel grades. These materials open a new niche in steel grades for high-performance applications by using a low-cost method of production. Moreover, an alternative route to developing microstructures suitable for manufacturing TRIP and/or Q and P steels is proposed avoiding some of the complex steps that must otherwise be taken to obtain the proper starting microstructure.

  14. Cyclic fatigue of a high-strength corrosion-resistant sheet TRIP steel

    Science.gov (United States)

    Terent'ev, V. F.; Alekseeva, L. E.; Korableva, S. A.; Prosvirnin, D. V.; Pankova, M. N.; Filippov, G. A.

    2014-04-01

    The mechanical properties of 0.3- and 0.8-mm-thick high-strength corrosion-resistant TRIP steel having various levels of strength properties are studied during static and cyclic loading in the high-cycle fatigue range. The fatigue fracture surface is analyzed by fractography, and the obtained results demonstrate ductile and quasi-brittle fracture mechanisms of this steel depending on the strength properties of the steel and the content of deformation martensite in it.

  15. Corrosion fatigue crack growth in clad low-alloy steels: Part 1, medium-sulfur forging steel

    International Nuclear Information System (INIS)

    James, L.A.; Poskie, T.J.; Auten, T.A.; Cullen, W.H.

    1996-01-01

    Corrosion fatigue crack propagation tests were conducted on a medium- sulfur ASTM A508-2 forging steel overlaid with weld-deposited Alloy EN82H cladding. The specimens featured semi-elliptical surface cracks penetrating approximately 6.3 mm of cladding into the underlying steel. The initial crack sizes were relatively large with surface lengths of 30.3--38.3 mm, and depths of 13.1--16.8 mm. The experiments were conducted in a quasi-stagnant low-oxygen (O 2 < 10 ppb) aqueous environment at 243 degrees C, under loading conditions (ΔK, R, and cyclic frequency) conductive to environmentally-assisted cracking (EAC) in higher-sulfur steels under quasi-stagnant conditions. Earlier experiments on unclad compact tension specimens of this heat of steel did not exhibit EAC, and the present experiments on semi-elliptical surface cracks penetrating cladding also did not exhibit EAC

  16. Magnetic property variation in carbon steel and chrome-molybdenum steel as a function of uniaxial stress noncoaxial with the magnetic field (abstract)

    International Nuclear Information System (INIS)

    Sablik, M.J.; Kaminski, D.A.; Jiles, D.C.; Biner, S.B.

    1993-01-01

    Magnescope 1 magnetic measurements were made on carbon steel specimens ranging from 0.1--0.8 wt %C and on chrome-molybdenum steel specimens cut from electric power plant pipes previously in service. The carbon steel specimens were heat-treated using three procedures: (1) spheroidization, (2) quenching, and (3) quench and tempering. The specimens were subjected to uniaxial tension up to 40 ksi. The inspection head was aligned so that the magnetic field was oriented at different angles with respect to the stress axis. Magnetic properties (such as coercivity and maximum differential permeability) were extracted from digitized magnetic hysteresis loop measurements. Magnetic properties were studied as a function of stress at each angle of stress-field orientation. To our knowledge, such a comprehensive study of noncoaxial stress and field effects has never been accomplished before for such a wide variety of steel specimens. Results for the various materials are presented for different orientation angles and compared to numerical results from the noncoaxial magnetomechanical hysteresis model of Sablik et al. 2

  17. Reinforcement steel corrosion in passive state and by carbonation: Consideration of galvanic currents and interface steel - concrete defaults

    International Nuclear Information System (INIS)

    Nasser, A.

    2010-01-01

    This thesis aims to study the durability of nuclear waste deep storage structures. The work carried out is essentially an experimental study, and focuses on the corrosion of steel in the passive state with aerated or non-aerated conditions on the one hand, and the corrosion of steel in carbonated concrete during the propagation phase on the other hand. Indeed, the pore solution of concrete in contact with the metal is alkaline (pH between 12 and 13). Under these conditions, steel reinforced concrete remains passive by forming a stable and protective oxide layer (corrosion of steel in the passive state). This passive layer limits the steel corrosion rate at very low values (negligible on a short life time) but not null. For the nuclear waste storage structures due to a very long life time (up to several hundred years), this low corrosion rate can become a risk. Therefore, it is necessary to study the evolution of the oxide layer growth over time. The objectives of the thesis are to study the influence of the steel-concrete interface quality on reinforcement corrosion in passive and active state, and the possible occurrence of galvanic corrosion currents between different reinforcement steel areas. (author)

  18. Tribological Response of Heat Treated AISI 52100 Steels Against Steel and Ceramic Counterparts

    Directory of Open Access Journals (Sweden)

    Türedi E.

    2017-09-01

    Full Text Available AISI 52100 bearing steels are commonly used in applications requiring high hardness and abrasion resistance. The bearing steels are working under dynamic loads in service conditions and their toughness properties become important. In order to provide the desired mechanical properties, various heat treatments (austenizing, quenching and tempering are usually applied. In this study, AISI 52100 bearing steel samples were austenized at 900°C for ½ h and water quenched to room temperature. Then tempering was carried out at 795°C, 400°C and 200°C for ½ h. In order to investigate the effect of heat treatment conditions on wear behavior, dry friction tests were performed according to ASTM G99-05 Standard with a ‘ball-on-disk’ type tribometer. The samples were tested against steel and ceramic counterparts using the parameters of 100 m distance and 30 N load and 0.063 m/s rotational speed. After wear test, the surface characterization was carried out using microscopy. Wear loss values were calculated using a novel optical method on both flat and counterpart specimens.

  19. Austenitic stainless steels with cryogenic resistance

    International Nuclear Information System (INIS)

    Tarata, Daniela Florentina

    1999-01-01

    The most used austenitic stainless steels are alloyed with chromium and nickel and have a reduced carbon content, usually lower than 0.1 % what ensures corresponding properties for processing by plastic deformation at welding, corrosion resistance in aggressive environment and toughness at low temperatures. Steels of this kind alloyed with manganese are also used to reduce the nickel content. By alloying with manganese which is a gammageneous element one ensures the stability of austenites. Being cheaper these steels may be used extensively for components and equipment used in cryogenics field. The best results were obtained with steels of second group, AMnNi, in which the designed chemical composition was achieved, i.e. the partial replacement of nickel by manganese ensured the toughness at cryogenic temperatures. If these steels are supplementary alloyed, their strength properties may increase to the detriment of plasticity and toughness, although the cryogenic character is preserved

  20. Impurity content of reduced-activation ferritic steels and a vanadium alloy

    International Nuclear Information System (INIS)

    Klueh, R.L.; Grossbeck, M.L.; Bloom, E.E.

    1997-01-01

    Inductively coupled plasma mass spectrometry was used to analyze a reduced-activation ferritic/martensitic steel and a vanadium alloy for low-level impurities that would compromise the reduced-activation characteristics of these materials. The ferritic steel was from the 5-ton IEA heat of modified F82H, and the vanadium alloy was from a 500-kg heat of V-4Cr-4Ti. To compare techniques for analysis of low concentrations of impurities, the vanadium alloy was also examined by glow discharge mass spectrometry. Two other reduced-activation steels and two commercial ferritic steels were also analyzed to determine the difference in the level of the detrimental impurities in the IEA heat and steels for which no extra effort was made to restrict some of the tramp impurities. Silver, cobalt, molybdenum, and niobium proved to be the tramp impurities of most importance. The levels observed in these two materials produced with present technology exceeded the limits for low activation for either shallow land burial or recycling. The chemical analyses provide a benchmark for the improvement in production technology required to achieve reduced activation; they also provide a set of concentrations for calculating decay characteristics for reduced-activation materials. The results indicate the progress that has been made and give an indication of what must still be done before the reduced-activation criteria can be achieved

  1. 46 CFR 56.60-5 - Steel (High temperature applications).

    Science.gov (United States)

    2010-10-01

    ....A.) Upon prolonged exposure to temperatures above 775 °F (412 °C), the carbide phase of plain carbon steel, plain nickel-alloy steel, carbon-manganese-alloy steel, manganese-vanadium-alloy steel, and carbon-silicon steel may convert to graphite. (b) (Reproduces 124.2.B.) Upon prolonged exposure to...

  2. Effect of aging on the tribological and mechanical properties of a high-nitrogen stainless austenitic steel

    International Nuclear Information System (INIS)

    Korshunov, L.G.; Chernenko, N.L.; Tereshchenko, N.A.; Uvarov, A.I.

    2005-01-01

    The effect of aging, associated with predominant precipitation of vanadium nitrides (VN), on tribological and mechanical properties of austenitic steel 10Kh18AG18N5MF hardened from 1100 Deg C is studied. Metallographic, X-ray diffraction and electron microscopical methods are used to study structural transformations proceeding in the steel on aging as well as on friction loading under conditions of dry slipping friction in steel-abrasive and steel-steel pairs. It is shown that the aging at temperatures of 600-700 Deg C resulting in a considerable increase of strength properties of the steel demonstrates a relatively weak positive effect on steel resistance to abrasive and adhesive wear. It is stated that the use of aging by continuous mechanism permits attaining favourable mechanical and tribological properties in vanadium-alloying nitrogen-bearing austenitic steels [ru

  3. Water requirements of the iron and steel industry

    Science.gov (United States)

    Walling, Faulkner B.; Otts, Louis Ethelbert

    1967-01-01

    Twenty-nine steel plants surveyed during 1957 and 1958 withdrew from various sources about 1,400 billion gallons of water annually and produced 40.8 million tons of ingot steel. This is equivalent to about 34,000 gallons of water per ton of steel. Fifteen iron ore mines and fifteen ore concentration plants together withdrew annually about 89,000 million gallons to produce 15 million tons of iron ore concentrate, or 5,900 gallons per ton of concentrate. About 97 percent of the water used in the steel plants came from surface sources, 2.2 percent was reclaimed sewage, and 1.2 percent was ground water. Steel plants supplied about 96 percent of their own water requirements, although only three plants used self-supplied water exclusively. Water used by the iron ore mines and concentration plants was also predominantly self supplied from surface source. Water use in the iron and steel industry varied widely and depended on the availability of water, age and condition of plants and equipment, kinds of processes, and plant operating procedures. Gross water use in integrated steel plants ranged from 11,200 to 110,000 gallons per ton of steel ingots, and in steel processing plants it ranged from 4,180 to 26,700 gallons per ton. Water reuse also varied widely from 0 to 18 times in integrated steel plants and from 0 to 44 times in steel processing plants. Availability of water seemed to be the principal factor in determining the rate of reuse. Of the units within steel plants, a typical (median) blast furnace required 20,500 gallons of water per ton of pig iron. At the 1956-60 average rate of pig iron consumption, this amounts to about 13,000 gallons per ton of steel ingots or about 40 percent of that required by a typical integrated steel plant 33,200 gallons per ton. Different processes of iron ore concentration are devised specifically for the various kinds of ore. These processes result in a wide range of water use from 124 to 11,300 gallons of water per ton of iron ore

  4. Development of new high-performance stainless steels

    International Nuclear Information System (INIS)

    Park, Yong Soo

    2002-01-01

    This paper focused on high-performance stainless steels and their development status. Effect of nitrogen addition on super-stainless steel was discussed. Research activities at Yonsei University, on austenitic and martensitic high-performance stainless, steels, and the next-generation duplex stainless steels were introduced

  5. Development of a facility for fabricating nuclear waste canisters from radioactively contaminated steel

    International Nuclear Information System (INIS)

    Logan, J.A.; Larsen, M.M.

    1986-01-01

    This paper describes design of a facility and processes capable of using radioactively contaminated waste steel as the principal raw material for fabricating stainless steel canisters to be used for disposal of nuclear high-level waste. By such action, expenditure (i.e., permanent loss to society) of thousands of tons of uncontaminated chromium and nickel to fabricate such canisters can be avoided. Moreover, the cost and risks involved in disposing of large accumulations of radioactively contaminated steel as low-level radioactive waste (LLRW), that would otherwise be necessary, can also be avoided. The canister fabrication processes (involving centrifugal casting) described herein have been tested and proven for this application. The performance characteristics of stainless steel canisters so fabricated have been tested and agreed to by the organizations that have been involved in this development work (Battelle Memorial Institute, DuPont, EGandG and the Savannah River Laboratory) as equivalent to the performance characteristics of canisters fabricated of uncontaminated wrought stainless steel. It is estimated that the production cost for fabricating canisters by the methods described will not differ greatly from the production cost using uncontaminated wrought steel, and the other costs avoided by not having to dispose of the contaminated steel as LLRW could cause this method to produce the lowest ultimate overall costs

  6. Cold formability of steels

    International Nuclear Information System (INIS)

    Lafond, G.; Leclerq, G.; Moliexe, F.; Namdar, R.; Roesch, L.; Sanz, G.

    1977-01-01

    This work was essentially aimed to the study of the following three questions. Is it possible to assess the cold formability of steels using simple material properties as criteria. What values of mechanical properties can one expect to reach in cold formed parts. Are there simple ways of characterizing the speroidization treatments carried out on steels before cold forming operations. The present report describes the results obtained during this investigation. It is logically divided into three separate parts. Experimental study of cold formability in wire drawing. Influence of metallurgical variables on mechanical properties of high carbon cold drawn wires. Contribution to the study of characterization methods of cold forming steels subjected to a spheroidization heat treatment

  7. Effect of laser absorption on picosecond laser ablation of Cr12MoV mold steel, 9Cr18 stainless steel and H13A cemented carbide

    Science.gov (United States)

    Wu, Baoye; Liu, Peng; Wang, Xizhao; Zhang, Fei; Deng, Leimin; Duan, Jun; Zeng, Xiaoyan

    2018-05-01

    Due to excellent properties, Cr12MoV mold steel, 9Cr18 stainless steel and H13A cemented carbide are widely used in industry. In this paper, the effect of absorption of laser light on ablation efficiency and roughness have been studied using a picosecond pulse Nd:YVO4 laser. The experimental results reveal that laser wavelength, original surface roughness and chemical composition play an important role in controlling ablation efficiency and roughness. Firstly, higher ablation efficiency with lower surface roughness is achieved on the ablation of 9Cr18 at 532, comparing with 1064 nm. Secondly, the ablation efficiency increases while the Ra of the ablated region decreases with the decrease of original surface roughness on ablation of Cr12MoV mold steel at 532 nm. Thirdly, the ablation efficiency of H13A cemented carbide is much higher than 9Cr18 stainless steel and Cr12MoV mold steel at 1064 nm. Scanning electron microscopy images reveals the formation of pores on the surface of 9Cr18 stainless steel and Cr12MoV mold steel at 532 nm while no pores are formed at 1064 nm. As to H13A cemented carbide, worm-like structure is formed at 1064 nm. The synergetic effects of the heat accumulation, plasma shielding and ablation threshold on laser ablation efficiency and machining quality were analyzed and discussed systematically in this paper.

  8. Development of PWR pressure vessel steels

    International Nuclear Information System (INIS)

    Druce, S.; Edwards, B.

    1982-01-01

    Requirements to be met by vessel steels for pressurized water reactors are analyzed. Chemicat composition of low-alloyed steels, mechanical properties of sheets and forgings made of these steels and changes in the composition and properties over the wall thickness of the reactor vessel are presented. Problems of the vessel manufacturing including welding and heat treatment processes of sheets and forgings are considered. Special attention is paid to steel embrittlement during vessel fabrication and operation (radiation embrittlement, thermal embrittlement). The role of non-metal inclusions and their effect on anisotropy of fracture toughness is discussed. Possible developments of vessel steels and procedures for producing reactor vessels are reviewed

  9. Development of PWR pressure vessel steels

    Energy Technology Data Exchange (ETDEWEB)

    Druce, S.; Edwards, B.

    1982-01-01

    Requirements to be met by vessel steels for pressurized water reactors are analyzed. Chemicat composition of low-alloyed steels, mechanical properties of sheets and forgings made of these steels and changes in the composition and properties over the wall thickness of the reactor vessel are presented. Problems of the vessel manufacturing including welding and heat treatment processes of sheets and forgings are considered. Special attention is paid to steel embrittlement during vessel fabrication and operation (radiation embrittlement, thermal embrittlement). The role of non-metal inclusions and their effect on anisotropy of fracture toughness is discussed. Possible developments of vessel steels and procedures for producing reactor vessels are reviewed.

  10. 77 FR 14445 - Application for a License To Export Steel Forging

    Science.gov (United States)

    2012-03-09

    ... NUCLEAR REGULATORY COMMISSION Application for a License To Export Steel Forging Pursuant to 10 CFR 110.70(b) ``Public Notice of Receipt of an Application,'' please take notice that the Nuclear... head steel February 7, 2012 forging. forging will be XR175 machined into the 11005983 finished vessel...

  11. Spark Plasma Co-Sintering of Mechanically Milled Tool Steel and High Speed Steel Powders.

    Science.gov (United States)

    Pellizzari, Massimo; Fedrizzi, Anna; Zadra, Mario

    2016-06-16

    Hot work tool steel (AISI H13) and high speed steel (AISI M3:2) powders were successfully co-sintered to produce hybrid tool steels that have properties and microstructures that can be modulated for specific applications. To promote co-sintering, which is made difficult by the various densification kinetics of the two steels, the particle sizes and structures were refined by mechanical milling (MM). Near full density samples (>99.5%) showing very fine and homogeneous microstructure were obtained using spark plasma sintering (SPS). The density of the blends (20, 40, 60, 80 wt % H13) was in agreement with the linear rule of mixtures. Their hardness showed a positive deviation, which could be ascribed to the strengthening effect of the secondary particles altering the stress distribution during indentation. A toughening of the M3:2-rich blends could be explained in view of the crack deviation and crack arrest exerted by the H13 particles.

  12. Spark Plasma Co-Sintering of Mechanically Milled Tool Steel and High Speed Steel Powders

    Directory of Open Access Journals (Sweden)

    Massimo Pellizzari

    2016-06-01

    Full Text Available Hot work tool steel (AISI H13 and high speed steel (AISI M3:2 powders were successfully co-sintered to produce hybrid tool steels that have properties and microstructures that can be modulated for specific applications. To promote co-sintering, which is made difficult by the various densification kinetics of the two steels, the particle sizes and structures were refined by mechanical milling (MM. Near full density samples (>99.5% showing very fine and homogeneous microstructure were obtained using spark plasma sintering (SPS. The density of the blends (20, 40, 60, 80 wt % H13 was in agreement with the linear rule of mixtures. Their hardness showed a positive deviation, which could be ascribed to the strengthening effect of the secondary particles altering the stress distribution during indentation. A toughening of the M3:2-rich blends could be explained in view of the crack deviation and crack arrest exerted by the H13 particles.

  13. Development of High Heat Input Welding High Strength Steel Plate for Oil Storage Tank in Xinyu Steel Company

    Science.gov (United States)

    Zhao, Hemin; Dong, Fujun; Liu, Xiaolin; Xiong, Xiong

    This essay introduces the developed high-heat input welding quenched and tempered pressure vessel steel 12MnNiVR for oil storage tank by Xinyu Steel, which passed the review by the Boiler and Pressure Vessel Standards Technical Committee in 2009. The review comments that compared to the domestic and foreign similar steel standard, the key technical index of enterprise standard were in advanced level. After the heat input of 100kJ/cm electro-gas welding, welded points were still with excellent low temperature toughness at -20°C. The steel plate may be constructed for oil storage tank, which has been permitted by thickness range from 10 to 40mm, and design temperature among -20°C-100°C. It studied microstructure genetic effects mechanical properties of the steel. Many production practices indicated that the mechanical properties of products and the steel by stress relief heat treatment of steel were excellent, with pretreatment of hot metal, converter refining, external refining, protective casting, TMCP and heat treatment process measurements. The stability of performance and matured technology of Xinyu Steel support the products could completely service the demand of steel constructed for 10-15 million cubic meters large oil storage tank.

  14. Tensile-property characterization of thermally aged cast stainless steels

    International Nuclear Information System (INIS)

    Michaud, W.F.; Toben, P.T.; Soppet, W.K.; Chopra, O.K.

    1994-02-01

    The effect of thermal aging on tensile properties of cast stainless steels during service in light water reactors has been evaluated. Tensile data for several experimental and commercial heats of cast stainless steels are presented. Thermal aging increases the tensile strength of these steels. The high-C Mo-bearing CF-8M steels are more susceptible to thermal aging than the Mo-free CF-3 or CF-8 steels. A procedure and correlations are presented for predicting the change in tensile flow and yield stresses and engineering stress-vs.-strain curve of cast stainless steel as a function of time and temperature of service. The tensile properties of aged cast stainless steel are estimated from known material information, i.e., chemical composition and the initial tensile strength of the steel. The correlations described in this report may be used for assessing thermal embrittlement of cast stainless steel components

  15. Micropurity in stainless steel making

    International Nuclear Information System (INIS)

    Motloch, Z.

    1981-01-01

    New technologies were developed by the Vitkovice research institutes in response to high requirements for the quality of high-alloy steels for nuclear power, viz., duplex technology with double vacuum degassing at the DH unit and oxidation vacuum degassing using the VAKUVIT equipment. The steel produced shows low contents of impurities and high micropurity. A study was conducted into changes in carbon content and the formation of titanium nitrides and carbonitrides in austenitic steels during their production, and optimum technological parameters were found for eliminating their formation in forgings. (author)

  16. Quenching and partitioning treatment of a low-carbon martensitic stainless steel

    International Nuclear Information System (INIS)

    Tsuchiyama, Toshihiro; Tobata, Junya; Tao, Teruyuki; Nakada, Nobuo; Takaki, Setsuo

    2012-01-01

    Highlights: ► The amount of retained austenite was increased by Q and P treatment in 12Cr–0.1C steel. ► Ideal carbon concentrations in austenite and ferrite were calculated assuming CCE condition. ► The optimum partitioning treatment condition for 12Cr–0.1C steel was found. ► The strength–ductility balance of 12Cr–0.1C steel was improved by TRIP effect. - Abstract: Quenching and partitioning (Q and P) treatment was applied to a commercial low-carbon martensitic stainless steel, AISI Type 410 (Fe–12Cr–0.1C). The quench interruption temperature was optimized with consideration of the ideal carbon concentration in untransformed austenite after partitioning to lower the Ms temperature to room temperature. After partitioning at an appropriate temperature, a significant fraction of austenite was retained through the enrichment of carbon into the untransformed austenite. It was also suggested that the addition of silicon is not necessarily required for the Q and P treatment of 12Cr steel because of the retardation of carbide precipitation at the partitioning temperature owing to the large amount of chromium. Tensile testing revealed that the Q and P-treated material exhibited a significantly improved strength–ductility balance compared with conventional quench-and-tempered materials due to the transformation-induced plasticity (TRIP) effect by the retained austenite.

  17. Quenching and partitioning treatment of a low-carbon martensitic stainless steel

    Energy Technology Data Exchange (ETDEWEB)

    Tsuchiyama, Toshihiro, E-mail: toshi@zaiko.kyushu-u.ac.jp [Department of Materials Science and Engineering, Graduate School of Engineering, Kyushu University, 744 Motooka, Nishi-ku, Fukuoka 819-0395 (Japan); Tobata, Junya; Tao, Teruyuki [Graduate School of Engineering, Kyushu University, 744 Motooka, Nishi-ku, Fukuoka 819-0395 (Japan); Nakada, Nobuo; Takaki, Setsuo [Department of Materials Science and Engineering, Graduate School of Engineering, Kyushu University, 744 Motooka, Nishi-ku, Fukuoka 819-0395 (Japan)

    2012-01-15

    Highlights: Black-Right-Pointing-Pointer The amount of retained austenite was increased by Q and P treatment in 12Cr-0.1C steel. Black-Right-Pointing-Pointer Ideal carbon concentrations in austenite and ferrite were calculated assuming CCE condition. Black-Right-Pointing-Pointer The optimum partitioning treatment condition for 12Cr-0.1C steel was found. Black-Right-Pointing-Pointer The strength-ductility balance of 12Cr-0.1C steel was improved by TRIP effect. - Abstract: Quenching and partitioning (Q and P) treatment was applied to a commercial low-carbon martensitic stainless steel, AISI Type 410 (Fe-12Cr-0.1C). The quench interruption temperature was optimized with consideration of the ideal carbon concentration in untransformed austenite after partitioning to lower the Ms temperature to room temperature. After partitioning at an appropriate temperature, a significant fraction of austenite was retained through the enrichment of carbon into the untransformed austenite. It was also suggested that the addition of silicon is not necessarily required for the Q and P treatment of 12Cr steel because of the retardation of carbide precipitation at the partitioning temperature owing to the large amount of chromium. Tensile testing revealed that the Q and P-treated material exhibited a significantly improved strength-ductility balance compared with conventional quench-and-tempered materials due to the transformation-induced plasticity (TRIP) effect by the retained austenite.

  18. The efficiency of a corrosion inhibitor on steel in a simulated concrete environment

    Energy Technology Data Exchange (ETDEWEB)

    Gartner, Nina; Kosec, Tadeja, E-mail: tadeja.kosec@zag.si; Legat, Andraž

    2016-12-01

    The aim of the present work was to characterize the efficiency of a corrosion inhibitor on steel in a simulated concrete pore solution. Laboratory measurements were performed at various chloride and inhibitor concentrations in order to simulate different applications of the inhibitor when used for the protection or rehabilitation of steel reinforcement in concrete. Two electrochemical techniques, i.e. potentiodynamic polarization scans and electrochemical impedance spectroscopy, were used for this study. The exposed surfaces of the steel specimens were subsequently investigated by Raman spectroscopy and scanning electron microscopy. It was found that the inhibitor can efficiently retard the corrosion of steel in a simulated concrete pore solution at concentrations of the inhibitor >2.0% and of chlorides <0.3% at a pH 10.5. On the other hand, when these conditions are not fulfilled, localized corrosion was observed. The results of the Raman and SEM/EDS analysis showed various morphologies of corrosion products and different types of corrosion attack depending on the pH of the pore solution, and the applied concentrations of the chlorides and the inhibitor. - Highlights: • Electrochemical studies performed at various Cl{sup −} and inhibitor concentrations. • Exposed steel surfaces investigated by Raman spectroscopy and SEM. • Cl{sup −}/inhibitor ratio is important parameter for the inhibitor's efficiency. • The corrosion can re-occur if the concentration of the inhibitor is reduced. • Different corrosion behaviour and oxides in the presence of inhibitor and/or Cl{sup −}.

  19. The reactor vessel steels

    International Nuclear Information System (INIS)

    Bilous, W.; Hajewska, E.; Szteke, W.; Przyborska, M.; Wasiak, J.; Wieczorkowski, M.

    2005-01-01

    In the paper the fundamental steels using in the construction of pressure vessel water reactor are discussed. The properties of these steels as well as the influence of neutron irradiation on its degradation in the time of exploitation are also done. (authors)

  20. Heat Treatment and Properties of Iron and Steel

    National Research Council Canada - National Science Library

    Digges, Thomas

    1966-01-01

    .... Chemical compositions, heat treatments, and some properties and uses are presented for structural steels, tool steels, stainless and heat-resisting steels, precipitation-hardenable stainless steels...

  1. Fire-induced collapses of steel structures

    DEFF Research Database (Denmark)

    Dondera, Alexandru; Giuliani, Luisa

    Single-story steel buildings such as car parks and industrial halls are often characterised by stiff beams and flexible columns and may experience an outward (sway) collapse during a fire, endangering people and properties outside the building. It is therefore a current interest of the research...... to investigate the collapse behaviour of single-story steel frames and identify relevant structural characteristics that influence the collapse mode. In this paper, a parametric study on the collapse a steel beam-column assembly with beam hinged connection and fixed column support is carried out under...... on the beam. By means of those tables, a simple method for the assessment and the countermeasure of unsafe collapse mode of single-story steel buildings can be derived....

  2. Chemical analysis of steel by optical emission spectrometry

    International Nuclear Information System (INIS)

    Hayakawa, M.O.; Kajita, T.; Jeszensky, G.

    1981-01-01

    The development of the chemical analysis for special steels by optical emission spectrometry direct reading method with computer, at the Siderurgica N.S. Aparecida S.A. is presented. Results are presented for the low alloy steels and high speed steel. Also, the contribution of this method to the special steel preparation is commented. (Author) [pt

  3. Inclusive prompt muon and dimuon production by 28.5 GeV protons

    International Nuclear Information System (INIS)

    Grannan, D.M.

    1978-01-01

    The inclusive production of single prompt muons and muon pairs from the interaction of 28.5 GeV protons with nuclear targets has been investigated at Brookhaven National Laboratory. The ratio of single prompt muons to mesons produced in the fragmentation region was compared with data at 400 GeV and found to be independent of the proton energy. The dimuon differential cross section dsigma/dx was observed to be equal within errors to that observed at 150 GeV and 400 GeV incident proton energies. The average invariant mass of the dimuons increased with x to a mean mass of about 700 MeV/c 2 at x = 0.56. Measurements of the intensity of muon pairs generated in Wolfram, iron, and carbon targets established the A-dependence of the production. The dimuon production was found to vary with the target nucleous as A/sup 2/3/ in an x-region where meson production varies as A 0 54 . A high resolution measurement of the low mass dimuon spectrum yielded a continuum similar to that observed at 150 GeV, demonstrating the scaling of the differential cross section dsigma/dxdM in dimuon production

  4. Diode Laser Welding/Brazing of Aluminum Alloy to Steel Using a Nickel Coating

    Directory of Open Access Journals (Sweden)

    Jin Yang

    2018-06-01

    Full Text Available Joining Al alloy to steel is of great interest for application in the automotive industry. Although a vast number of studies have been conducted to join Al to steel, the joining of Al to steel is still challenging due to the formation of brittle Fe–Al intermetallic compounds. In this work, the microstructure and mechanical properties of the dissimilar Al/steel joints with and without a nickel coating are comparatively investigated. A homogenous reaction layer composed of FeZn10 and Fe2Al5 is formed at the interface in the joints without Ni coating, and the joint facture load is only 743 N. To prevent the formation of brittle Fe2Al5, Ni electroplated coating is applied onto a steel surface. It has been shown that a nonhomogeneous reaction layer is observed at the interfacial region: Ni5Zn21 is formed at the direct irradiation zone, while Al3Ni is formed at the fusion zone root. The microhardness of the interfacial layer is reduced, which leads to the improvement of the joint mechanical properties. The average fracture load of the Al/Ni-coated steel joints reaches 930 N. In all of the cases, failure occurs at the Ni coating/fusion zone interface.

  5. Steamside Oxidation Behavior of Experimental 9%Cr Steels

    Energy Technology Data Exchange (ETDEWEB)

    Dogan, O.N.; Holcomb, G.R.; Alman, D.E.; Jablonski, P.D.

    2007-10-01

    Reducing emissions and increasing economic competitiveness require more efficient steam power plants that utilize fossil fuels. One of the major challenges in designing these plants is the availability of materials that can stand the supercritical and ultra-supercritical steam conditions at a competitive cost. There are several programs around the world developing new ferritic and austenitic steels for superheater and reheater tubes exposed to the advanced steam conditions. The new steels must possess properties better than current steels in terms of creep strength, steamside oxidation resistance, fireside corrosion resistance, and thermal fatigue resistance. This paper introduces a series of experimental 9%Cr steels containing Cu, Co, and Ti. Stability of the phases in the new steels is discussed and compared to the phases in the commercially available materials. The steels were tested under both the dry and moist conditions at 650ºC for their cyclical oxidation resistance. Results of oxidation tests are presented. Under the moist conditions, the experimental steels exhibited significantly less mass gain compared to the commercial P91 steel. Microstructural characterization of the scale revealed different oxide compositions.

  6. Studies on A-TIG welding of Low Activation Ferritic/Martensitic (LAFM) steel

    International Nuclear Information System (INIS)

    Vasantharaja, P.; Vasudevan, M.

    2012-01-01

    Low Activation Ferritic–Martensitic steels (LAFM) are chosen as the candidate material for structural components in fusion reactors. The structural components are generally fabricated by welding processes. Activated Tungsten Inert Gas (A-TIG) welding is an emerging process for welding of thicker components. In the present work, attempt was made to develop A-TIG welding technology for LAFM steel plates of 10 mm thick. Activated flux was developed for LAFM steel by carrying out various bead-on-plate TIG welds without flux and with flux. The optimum flux was identified as one which gave maximum depth of penetration at minimum heat input values. With the optimized flux composition, LAFM steel plate of 10 mm thickness was welded in square butt weld joint configuration using double side welding technique. Optical and Scanning Electron Microscopy was used for characterizing the microstructures. Microhardness measurements were made across the weld cross section for as welded and post weld heat treated samples. Tensile and impact toughness properties were determined. The mechanical properties values obtained in A-TIG weld joint were comparable to that obtained in weld joints of LAFM steel made by Electron beam welding process.

  7. Studies on A-TIG welding of Low Activation Ferritic/Martensitic (LAFM) steel

    Science.gov (United States)

    Vasantharaja, P.; Vasudevan, M.

    2012-02-01

    Low Activation Ferritic-Martensitic steels (LAFM) are chosen as the candidate material for structural components in fusion reactors. The structural components are generally fabricated by welding processes. Activated Tungsten Inert Gas (A-TIG) welding is an emerging process for welding of thicker components. In the present work, attempt was made to develop A-TIG welding technology for LAFM steel plates of 10 mm thick. Activated flux was developed for LAFM steel by carrying out various bead-on-plate TIG welds without flux and with flux. The optimum flux was identified as one which gave maximum depth of penetration at minimum heat input values. With the optimized flux composition, LAFM steel plate of 10 mm thickness was welded in square butt weld joint configuration using double side welding technique. Optical and Scanning Electron Microscopy was used for characterizing the microstructures. Microhardness measurements were made across the weld cross section for as welded and post weld heat treated samples. Tensile and impact toughness properties were determined. The mechanical properties values obtained in A-TIG weld joint were comparable to that obtained in weld joints of LAFM steel made by Electron beam welding process.

  8. A STUDY OF IRON AND STEEL SECTOR IN INDIA

    OpenAIRE

    Chand, Sumit

    2008-01-01

    ABSTRACT The iron and steel manufacturing sector is one of the largest sectors in the world in terms of financial volume of trade, employment potential, development of ancillary and allied industries and geographical spread. Added to this is the fact that iron and steel is used as an input in almost all the industrial and manufacturing sectors and goods produced by them. As a result this sector attracts the maximum attention of almost all the countries of the world, whether being one of t...

  9. Performance Steel Castings

    Science.gov (United States)

    2012-09-30

    system components to be built. Figure la shows the machine design . PSC-2012 Page 94 Glue Application Sheet Transfer Feed Elevator Figure la...Department of Defense such as cleats, ejection chutes , control arms, muzzle brakes, mortar components, clevises, tow bar clamps, ammo conveyor elements...Foundry and the members of Steel Founders’ Society of America. Abstract Weapon system designers and builders need advanced steel casting technology

  10. Comparison of the hot-stamped boron-alloyed steel and the warm-stamped medium-Mn steel on microstructure and mechanical properties

    International Nuclear Information System (INIS)

    Li, Xiaodong; Chang, Ying; Wang, Cunyu; Hu, Ping; Dong, Han

    2017-01-01

    The application of high strength steels (HSS) for automotive structural parts is an effective way to realize lightweight and enhance safety. Therefore, improvements in mechanical properties of HSS are needed. In the present study, the warm stamping process of the third generation automotive medium-Mn steel was discussed, the characteristics of martensitic transformation were investigated, as well as the microstructure and mechanical properties were analyzed, compared to the popular hot-stamped 22MnB5 steel in the automotive industry. The results are indicated as follows. Firstly, the quenching rate of the medium-Mn steel can be selected in a wide range based on its CCT curves, which is beneficial to the control of forming process. Secondly, the influence of stamping temperature and pressure on the M s temperature of the medium-Mn steel is not obvious and can be neglected, which is favorable to the even distribution of martensitic microstructure and mechanical properties. Thirdly, the phenomenon of decarbonization is hardly found on the surface of the warm-stamped medium-Mn steel, and the ultra-fine-grained microstructure is found inside the medium-Mn steel after warm stamping. Besides, the warm-stamped medium-Mn steel holds the better comprehensive properties, such as a lower yield ratio, higher total elongation and higher tear toughness than the hot-stamped 22MnB5 steel. Furthermore, an actual warm-stamped B-pillar of medium-Mn steel is stamped and ultra-fine-grained martensitic microstructure is obtained. The mechanical properties are evenly distributed. As a result, this paper proves that the warm-stamped medium-Mn steel part can meet the requirements of lightweight and crash safety, and is promising for the industrial production of automotive structural parts.

  11. Comparison of the hot-stamped boron-alloyed steel and the warm-stamped medium-Mn steel on microstructure and mechanical properties

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiaodong [School of Automotive Engineering, State Key Lab of Structural Analysis for Industrial Equipment, Dalian University of Technology, Dalian 116024 (China); Chang, Ying, E-mail: yingc@dlut.edu.cn [School of Automotive Engineering, State Key Lab of Structural Analysis for Industrial Equipment, Dalian University of Technology, Dalian 116024 (China); Wang, Cunyu [East China Branch of Central Iron & Steel Research Institute (CISRI), Beijing 100081 (China); Hu, Ping [School of Automotive Engineering, State Key Lab of Structural Analysis for Industrial Equipment, Dalian University of Technology, Dalian 116024 (China); Dong, Han [East China Branch of Central Iron & Steel Research Institute (CISRI), Beijing 100081 (China)

    2017-01-02

    The application of high strength steels (HSS) for automotive structural parts is an effective way to realize lightweight and enhance safety. Therefore, improvements in mechanical properties of HSS are needed. In the present study, the warm stamping process of the third generation automotive medium-Mn steel was discussed, the characteristics of martensitic transformation were investigated, as well as the microstructure and mechanical properties were analyzed, compared to the popular hot-stamped 22MnB5 steel in the automotive industry. The results are indicated as follows. Firstly, the quenching rate of the medium-Mn steel can be selected in a wide range based on its CCT curves, which is beneficial to the control of forming process. Secondly, the influence of stamping temperature and pressure on the M{sub s} temperature of the medium-Mn steel is not obvious and can be neglected, which is favorable to the even distribution of martensitic microstructure and mechanical properties. Thirdly, the phenomenon of decarbonization is hardly found on the surface of the warm-stamped medium-Mn steel, and the ultra-fine-grained microstructure is found inside the medium-Mn steel after warm stamping. Besides, the warm-stamped medium-Mn steel holds the better comprehensive properties, such as a lower yield ratio, higher total elongation and higher tear toughness than the hot-stamped 22MnB5 steel. Furthermore, an actual warm-stamped B-pillar of medium-Mn steel is stamped and ultra-fine-grained martensitic microstructure is obtained. The mechanical properties are evenly distributed. As a result, this paper proves that the warm-stamped medium-Mn steel part can meet the requirements of lightweight and crash safety, and is promising for the industrial production of automotive structural parts.

  12. Influence of refining time on nonmetallic inclusions in a low-carbon, silicon-killed steel

    International Nuclear Information System (INIS)

    Fernandes, Marcolino; Pires, Jose Carlos; Cheung, Noe; Garcia, Amauri

    2003-01-01

    Nonmetallic inclusions are harmful to the mechanical properties of every kind of steel produced worldwide. The greater the size of the inclusion present in the structure of a determined kind of steel, the greater its negative effect on the quality of the steel. Therefore, the objective of this work was to investigate the size, the quantity, the shape and the chemical composition of nonmetallic inclusions formed throughout the refining process of silicon-killed, low-carbon steel, as a function of the treatment time in a ladle furnace, trying to ensure the flotation of inclusions bigger than 25 μm. This investigation was carried out using a scanning electron microscope (SEM), with an analysis system using energy dispersive spectometry (EDS). Based on this work, it was possible to know more precisely the nature of the inclusions, the necessary time to ensure flotation of large inclusions, the efficiency of the slag to capture the inclusions, and the inclusion level of the steel throughout its refining process to try to obtain a higher quality steel product

  13. Enhanced hot ductility of a Cr–Mo low alloy steel by rare earth cerium

    International Nuclear Information System (INIS)

    Jiang, X.; Song, S.-H.

    2014-01-01

    The hot ductility of a 1Cr–0.5Mo low alloy steel is investigated over a temperature range of 700–1050 °C using a Gleeble thermomechanical simulator in conjunction with various characterization techniques. The steel samples undoped and doped with cerium are heated at 1300 °C for 3 min and then cooled with a rate of 5 K s −1 down to different test temperatures, followed by tensile deformation until fracture. The results show that the hot ductility of the steel, evaluated by the reduction in area, can be substantially enhanced by a minor addition of cerium, especially in the range 800–1000 °C. In the austenite–ferrite dual-phase region, cerium may delay the formation of proeutectoid ferrite layers along austenite grain boundaries, thereby increasing the hot ductility of the steel. In the single austenite region, grain boundary segregation of cerium may increase the grain boundary cohesion, toughening the steel and thus raising the resistance to grain boundary sliding as well as promoting dynamic recrystallization. Consequently, the hot ductility of the steel is enhanced

  14. Parallel between steels alloyed with chrome-nickel and Fe-Mn-Al-C steels, in their response to fracture and wear (Review)

    International Nuclear Information System (INIS)

    Ramos, J; Perez, G.A

    2008-01-01

    The big worldwide demand for chrome-nickel alloy steels ('conventional steel') leads to the need for advanced materials for applications in different engineering systems that operate at high temperatures and in aggressive environmental conditions, favoring research and development in alternate alloys. In this technological race in search of these new materials, the FeMnAlC alloys ('new steels') have attracted attention for their excellent mechanical and tribological properties as well as for their good performance in corrosive-oxide environments, which make them similar to conventional steel. There are two important similarities between these two steels. First, an agent that causes the passive film to become stainless appears in both steels: chrome in the conventional steel, and aluminum in the FeMnAl alloy. The second similarity is that a stabilizing agent of the austenitic phase (FCC) appears in both, so that excellent mechanical properties can be obtained: nickel in the conventional steel, and manganese in the FeMnAl alloy. In certain sectors, such as aeronautics, conventional steel is rarely used because it is a very heavy material. This conventional steel is almost three times heavier that aluminum (7.85/2.7). Two advantages that the new FeMnAIC steels have compared to the conventional steels are that they are about 13% lighter in weight and they are less expensive. The FeMnAl also have excellent mechanical properties and good corrosion-oxidation resistance, which generates big expectations for their application in a broad scientific spectrum. This work reports the state of the information currently available about FeMnAlC alloys, comparing the mechanical and tribological behaviors of conventional alloy steels with chrome and nickel alloys, specifying the scopes of their application. A condition that favors the steels' fragility is the high speed of deformation and impact, where the FCC crystalline structure materials do not have a fragile ductile transition

  15. On high temperature strength of carbon steels

    International Nuclear Information System (INIS)

    Ichinose, Hiroyuki; Tamura, Manabu; Kanero, Takahiro; Ihara, Yoshihito

    1977-01-01

    In the steels for high temperature use, the oxidation resistance is regarded as important, but carbon steels show enough oxidation resistance to be used continuously at the temperature up to 500 deg. C if the strength is left out of consideration, and up to 450 deg. C even when the strength is taken into account. Moreover, the production is easy, the workability and weldability are good, and the price is cheap in carbon steels as compared with alloy steels. In the boilers for large thermal power stations, 0.15-0.30% C steels are used for reheater tubes, main feed water tubes, steam headers, wall water tubes, economizer tubes, bypass pipings and others, and they account for 70% of all steel materials used for the boilers of 350 MW class and 30% in 1000 MW class. The JIS standard for the carbon steels for high temperature use and the related standards in foreign countries are shown. The high temperature strength of carbon steels changes according to the trace elements, melting and heat treatment as well as the main compositions of C, Si and Mn. Al and N affect the high temperature strength largely. The characteristics of carbon steels after the heating for hours, the factors controlling the microstructure and high temperature strength, and the measures to improve the high temperature strength of carbon steels are explained. (Kako, I.)

  16. East/west steels for reactor pressure vessels

    International Nuclear Information System (INIS)

    Davies, M.; Kryukov, A.; Nikolaev, Y.; English, C.

    1997-01-01

    The report consist of three parts dealing with comparison of the irradiation behaviour of 'Eastern' and 'Western' steels, mechanisms of irradiation embrittlement and the role of compositional variations on the irradiation sensitivity of pressure vessels. Nickel, copper and phosphorus are the elements rendering the most essential influence on behaviour of pressure vessel steels under irradiation and subsequent thermal annealing. For WWER-440 reactor pressure vessel (RPV) steels in which nickel content does nor exceed 0.3% the main affecting factors are phosphorous and copper. For WWER-1000 RPV welds in which nickel content generally exceed 1.5% the role of nickel in radiation embrittlement is decisive. In 'Western' type steels main influencing elements are nickel and copper. The secondary role of phosphorus in radiation embrittlement of 'Western' steels is caused by lower relative content compared to 'Eastern' steels. The process of how copper, phosphorus and nickel contents affect the irradiation sensitivity of both types of steel seem to be similar. Some distinctions between the observed radiation effects is apparently caused by differences in the irradiation conditions and ratios of the contents of above mentioned elements in both types of steel. For 'Eastern' RPV steels the dependence of the recovery degree of irradiated steels due to postirradiation thermal annealing id obviously dependent on phosphorus contents and the influence of nickel contents on this process is detectable

  17. High yttria ferritic ODS steels through powder forging

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Deepak [Department of Metallurgical and Materials Engineering, I.I.T-Roorkee, Uttarakhand 247667 (India); Prakash, Ujjwal, E-mail: ujwalfmt@iitr.ac.in [Department of Metallurgical and Materials Engineering, I.I.T-Roorkee, Uttarakhand 247667 (India); Dabhade, Vikram V. [Department of Metallurgical and Materials Engineering, I.I.T-Roorkee, Uttarakhand 247667 (India); Laha, K.; Sakthivel, T. [Mechanical Metallurgy Group, IGCAR, Kalpakkam, Tamilnadu 603102 (India)

    2017-05-15

    Oxide dispersion strengthened (ODS) steels are being developed for future nuclear reactors. ODS Fe-18%Cr-2%W-0.2%Ti steels with 0, 0.35, 0.5, 1 and 1.5% Y{sub 2}O{sub 3} (all compositions in weight%) dispersion were fabricated by mechanical alloying of elemental powders. The powders were placed in a mild steel can and forged in a stream of hydrogen gas at 1473 K. The steels were forged again to final density. The strength of ODS steel increased with yttria content. Though this was accompanied by a decrease in tensile elongation, all the steels showed significant ductility. The ductility in high yttria alloys may be attributed to improved inter-particle bonding between milled powders due to reduction of surface oxides by hydrogen. This may permit development of ODS steels with yttria contents higher than the conventional limit of 0.5%. It is suggested that powder forging is a promising route to fabricate ODS steels with high yttria contents and improved ductility. - Highlights: •ODS steels with yttria contents beyond the conventional limit of 0.5 wt% were fabricated by powder forging in a hydrogen atmosphere. •All the alloys exhibited significant ductility. •This may be attributed to improved inter-particle bonding due to reduction of surface oxides by hydrogen. •Strength in excess of 300 MPa was obtained at 973 K for 0.5%, 1% and 1.5% yttria ODS alloys. •Powder forging is a promising route to fabricate ODS steels and permits development of compositions with up to 1.5% yttria.

  18. Overload effects on a ferritic-baintic steel and a cast aluminium alloy: two very different behaviours

    Energy Technology Data Exchange (ETDEWEB)

    Saintier, N. [Arts et Metiers Paris Tech, I2M, UMR CNRS, Universite Bordeaux 1, Talene Cedex (France); El Dsoki, C.; Kaufmann, H.; Sonsino, C.M. [Fraunhofer-Institute for Structural Durability and System Reliability LBF, Darmstadt (Germany); Dumas, C. [RENAULT, Technocentre, Guyancourt Cedex (France); Voellmecke, F.J. [BORBET GmbH, Hallenberg-Hesborn (Germany); Palin-Luc, T.; Bidonard, H.

    2011-10-15

    Load controlled fatigue tests were performed up to 10{sup 7} cycles on flat notched specimens (K{sub t} = 2.5) under constant amplitude and variable amplitude loadings with and without periodical overloads. Two materials are studied: a ferritic-bainitic steel (HE400M steel) and a cast aluminium alloy (AlSi7Mg0.3). These materials have a very different cyclic behaviour: the steel exhibits cyclic strain softening whereas the Al alloy shows cyclic strain hardening. The fatigue tests show that, for the steel, periodical overload applications reduce significantly the fatigue life for fully reversed load ratio (R{sub {sigma}} = -1), while they have no influence under pulsating loading (R{sub {sigma}} = 0). For the Al alloy overloads have an effect (fatigue life decreasing) only for variable amplitude loadings. The detrimental effect of overloads on the steel is due to ratcheting at the notch root which evolution is overload's dependent. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  19. Hydrogen effects in stainless steel

    International Nuclear Information System (INIS)

    Caskey, G.R. Jr.

    1983-01-01

    The effects of hydrogen on stainless steels have been reviewed and are summarized in this paper. Discussion covers hydrogen solution and transport in stainless steels as well as the effects of hydrogen on deformation and fracture under various loading conditions. Damage is caused also by helium that arises from decay of the hydrogen isotope tritium. Austenitic, ferritic, martensite, and precipitation-hardenable stainless steels are included in the discussion. 200 references

  20. Failure Mechanism of a Stellite Coating on Heat-Resistant Steel

    Science.gov (United States)

    Wang, Dong; Zhao, Haixing; Wang, Huang; Li, Yuyan; Liu, Xia; He, Guo

    2017-09-01

    The Stellite 21 coating on the heat-resistant steel X12CrMoWVNbN10-1-1 (so-called COSTE) used in a steam turbine valve was found to be fatigue broken after service at around 873 K (600 °C) for about 8 years. In order to investigate the failure mechanism, a fresh Stellite 21 coating was also prepared on the same COSTE steel substrate by using the similar deposition parameters for comparison. It was found that the Stellite 21 coating was significantly diluted by the steel, resulting in a thin Fe-rich layer in the coating close to the fusion line. Such high Fe concentration together with the incessant Fe diffusion from the steel substrate to the coating during the service condition (about 873 K (600 °C) for long time) induced the eutectoid decomposition of the fcc α-Co(Fe,Cr,Mo) solid solution, forming an irregular eutectoid microstructure that was composed of the primitive cubic α'-FeCo(Cr,Mo) phase and the tetragonal σ-CrCo(Fe,Mo) phase. The brittle nature of such α'/ σ eutectoid microstructure contributed to the fatigue fracture of the Stellite 21 coating, resulting in an intergranular rupture mode.

  1. Filler metal selection for welding a high nitrogen stainless steel

    Science.gov (United States)

    Du Toit, Madeleine

    2002-06-01

    Cromanite is a high-strength austenitic stainless steel that contains approximately 19% chromium, 10% manganese, and 0.5% nitrogen. It can be welded successfully, but due to the high nitrogen content of the base metal, precautions have to be taken to ensure sound welds with the desired combination of properties. Although no matching filler metals are currently available, Cromanite can be welded using a range of commercially available stainless steel welding consumables. E307 stainless steel, the filler metal currently recommended for joining Cromanite, produces welds with mechanical properties that are generally inferior to those of the base metal. In wear applications, these lower strength welds would probably be acceptable, but in applications where full use is made of the high strength of Cromanite, welds with matching strength levels would be required. In this investigation, two welding consumables, ER2209 (a duplex austenitic-ferritic stainless steel) and 15CrMn (an austenitic-manganese hardfacing wire), were evaluated as substitutes for E307. When used to join Cromanite, 15CrMn produced welds displaying severe nitrogen-induced porosity, and this consumable is therefore not recommended. ER2209, however, outperformed E307, producing sound porosity-free welds with excellent mechanical properties, including high ductility and strength levels exceeding the minimum limits specified for Cromanite.

  2. Welding zinc coated steel with a CO/sub 2/ laser

    International Nuclear Information System (INIS)

    Akhter, R.; Steen, W.M.

    1993-01-01

    Welding of zinc coated steel has been studied using a high power CO/sub 2/ laser. This process is of great interest to the manufactures of car, washing machines and other components made from sheet steel and subject to corrosion. The problem associated with the welding of zinc coated steel is the low boiling point of zinc (906C) relative to the high melting point of steel (1500C). The problem is particularly important in lap welding where the zinc layer is between the lapped sheets. Under these conditions the laser 'keyhole' will generate very high vapour pressure in the zinc layer with a consequent severe risk of vapour eruption destroying the continuity of the weld bead. Several techniques are presented for the removal of zinc vapours from the interface between the two sheets. It is shown that this problem solved by suitable gap between the sheets during lap welding. Hence full penetration welds without deterioration of the weld bead can be obtained. A theory has been presented which predicted an exact gap size needed to exhaust the zinc vapour. The gap depends upon the welding speed, zinc coating thickness and thickness of the sheet. The theory predicts the weld quality satisfactorily. (author)

  3. Japan steel mill perspective

    Energy Technology Data Exchange (ETDEWEB)

    Murase, K. [Kobe Steel Ltd., Tokyo (Japan)

    2004-07-01

    The international and Japan's steel industry, the coking coal market, and Japan's expectations from Canada's coal industry are discussed. Japan's steel mills are operating at full capacity. Crude steel production for the first half of 2004 was 55.8 million tons. The steel mills are profitable, but costs are high, and there are difficulties with procuring raw materials. Japan is trying to enhance the quality of coke, in order to achieve higher productivity in the production of pig iron. Economic growth is rising disproportionately in the BRICs (Brazil, Russia, India, and China), with a large increase in coking coal demand from China. On the supply side, there are several projects underway in Australia and Canada to increase production. These include new developments by Elk Valley Coal Corporation, Grande Cache Coal, Western Canadian Coal, and Northern Energy and Mining in Canada. The Elga Mine in the far eastern part of Russia is under development. But the market is expected to remain tight for some time. Japan envisions Canadian coal producers will provide a stable coal supply, expansion of production and infrastructure capabilities, and stabilization of price. 16 slides/overheads are included.

  4. Acute changes in lung function associated with proximity to a steel plant: a randomized study.

    Science.gov (United States)

    Dales, Robert; Kauri, Lisa Marie; Cakmak, Sabit; Mahmud, Mamun; Weichenthal, Scott A; Van Ryswyk, Keith; Kumarathasan, Premkumari; Thomson, Errol; Vincent, Renaud; Broad, Gayle; Liu, Ling

    2013-05-01

    Steel production is a major industry worldwide yet there is relatively little information on the pulmonary effects of air quality near steel manufacturing plants. The aim of this study was to examine how lung function changes acutely when healthy subjects are situated near a steel plant which is adjacent to a residential area. Sixty-one subjects were randomly assigned to spend 5 consecutive, 8-hour days in a residential neighborhood approximately 0.9km from a steel plant, or approximately 4.5km away at a college campus. Subjects crossed-over between sites after a nine-day washout period. Lung function was measured daily at both sites along with air pollutants including SO2, NO2, O3, PM2.5, and ultrafine particles. Diffusion capacity and pulse oximetry were also examined. Compared with the college site, the forced expiratory volume in 1-second/forced vital capacity, forced expiratory flow between 25% and 75% of the FVC, total lung capacity, functional residual capacity, and residual volume were lower near the steel plant by 0.67% (95% CI: 0.28, 1.06),1.62% (95% CI: 0.50, 2.75), 1.54% (95% CI: 0.68, 2.39), 3.54% (95% CI: 1.95, 5.13) and 11.3% (95% CI: 4.92, 17.75), respectively. Diffusion capacity, forced expiratory volume in 1s, and pulse oximetry were also lower near the plant but these effects were not statistically significant. Sulfur dioxide, ultrafine particulates, and oxides of nitrogen were greater near the steel plant site compared to the college site. Spending short periods of time near a steel plant is associated with a decrease in lung function. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  5. Occupational Profiles in the European Steel Industry.

    Science.gov (United States)

    Franz, Hans-Werner; And Others

    The steel industry in Europe has faced great changes, with resulting layoffs and restructuring. Now that the most basic changes seem to be over, it has become evident that the remaining steel industry requires more highly trained workers than was the case previously. Although steel maintenance employees were always highly skilled, steel production…

  6. Localized corrosion of carbon steel in a CO{sub 2}-saturated oilfield formation water

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, G.A. [Department of Mechanical and Manufacturing Engineering, University of Calgary, Calgary, AB, T2N 1N4 (Canada); Cheng, Y.F., E-mail: fcheng@ucalgary.c [Department of Mechanical and Manufacturing Engineering, University of Calgary, Calgary, AB, T2N 1N4 (Canada)

    2011-01-01

    In this work, corrosion and localized corrosion behavior of X65 pipeline steel were studied in a simulated, CO{sub 2}-saturated oilfield formation water by various electrochemical measurement techniques, including electrochemical impedance spectroscopy (EIS), potentiodynamic polarization curves, galvanic current and localized EIS (LEIS). The morphology and composition of the formed corrosion scale were characterized by scanning electron microscopy and energy-dispersive X-ray analysis. A conceptual model was developed to illustrate the occurrence of localized corrosion of the steel under scale. Both galvanic current and LEIS measurements showed that a galvanic effect existed between the bare steel and the scale-covered region. The scale-covered region served as cathode and the bare steel site as the anode. The big cathode vs. small anode geometry accelerated the local corrosion reaction. At an elevated temperature, a compact, crystalline scale was formed on the steel surface, enhancing the galvanic effect. Moreover, the stability of the scale was increased with time, and localized corrosion of the steel under scale experienced mechanistic changes with time.

  7. Thermo-mechanical behaviour during encapsulation of glass in a steel vessel

    International Nuclear Information System (INIS)

    Nakhodchi, S.; Smith, D.J.; Thomas, B.G.

    2016-01-01

    Quantitative numerical simulations and qualitative evaluations are conducted to elucidate thermo-mechanical behaviour during pouring and solidification of molten glass into a stainless-steel cylindrical container. Residual stress and structural integrity in this casting/vitrification process is important because it can be used for long-term storage of high-level nuclear wastes. The predicted temperature and stress distributions in the glass and container agree well with previous measurements of the temperature histories and residual stresses. Three different thermal-stress models are developed using the finite-element method and compared. Two simple slice models were developed based on the generalized plane strain assumption as well as a detailed two-dimensional axi-symmetric model that adds elements according to the stages of pouring glass into the stainless steel container. The results reveal that mechanical interaction between the glass and the wall of the stainless steel container generates residual tensile stresses that approach the yield strength of the steel. Together, these results reveal important insights into the mechanism of stress generation in the process, the structural integrity of the product, and accuracy of the modelling-tool predictions. - Highlights: • Source of residual stresses in glass and stainless steel containers (canisters) is discussed. • Final residual stresses in both glass and container is quantified. • Simple models presented for simulation of complicated casting process. • Comparison between detailed and simple FE modeling.

  8. Cold-formed steel design

    CERN Document Server

    Yu, Wei-Wen

    2010-01-01

    The definitive text in the field, thoroughly updated and expanded Hailed by professionals around the world as the definitive text on the subject, Cold-Formed Steel Design is an indispensable resource for all who design for and work with cold-formed steel. No other book provides such exhaustive coverage of both the theory and practice of cold-formed steel construction. Updated and expanded to reflect all the important developments that have occurred in the field over the past decade, this Fourth Edition of the classic text provides you with more of the detailed, up-to-the-minute techni

  9. Effect of free Cr content on corrosion behavior of 3Cr steels in a CO2 environment

    Science.gov (United States)

    Li, Wei; Xu, Lining; Qiao, Lijie; Li, Jinxu

    2017-12-01

    The corrosion behavior of 3Cr steels with three microstructures (martensite, bainite, combined ferrite and pearlite) in simulated oil field formation water with a CO2 partial pressure of 0.8 MPa was investigated. The relationships between Cr concentrations in corrosion scales and corrosion rates were studied. The precipitated phases that contained Cr were observed in steels of different microstructures, and free Cr content levels were compared. The results showed that steel with the martensite microstructure had the highest free Cr content, and thus had the highest corrosion resistance. The free Cr content of bainite steel was lower than that of martensite steel, and the corrosion rate of bainite steel was higher than that of martensite steel. Because large masses of Cr were combined in ferrite and pearlite steel, the corrosion rates of ferrite and pearlite steel were the highest. Free Cr content in steel affects its corrosion behavior greatly.

  10. Metallurgy of steels for PWR pressure vessels

    International Nuclear Information System (INIS)

    Kepka, M.; Mocek, J.; Barackova, L.

    1980-01-01

    A survey and the chemical compositions are presented of reactor pressure vessel steels. The metallurgy is described of steel making for pressure vessels in Japan and the USSR. Both acidic and alkaline open-hearth steel is used for the manufacture of ingots. The leading world manufacturers of forging ingots for pressure vessels, however, exclusively use electric steel. Vacuum casting techniques are exclusively used. Experience is shown gained with the introduction of the manufacture of forging ingots for pressure vessels at SKODA, Plzen. The metallurgical procedure was tested utilizing alkaline open hearths, electric arc furnaces and facilities for vacuum casting of steel. Pure charge raw materials should be used for securing high steel purity. Prior to forging pressure vessel rings, not only should sufficiently big bottoms and heads be removed but also the ingot middle part should be scrapped showing higher contents of impurities and nonhomogeneous structure. (B.S.)

  11. Metallurgy of steels for PWR pressure vessels

    Energy Technology Data Exchange (ETDEWEB)

    Kepka, M; Mocek, J; Barackova, L [Skoda, Plzen (Czechoslovakia)

    1980-09-01

    A survey and the chemical compositions are presented of reactor pressure vessel steels. The metallurgy is described of steel making for pressure vessels in Japan and the USSR. Both acidic and alkaline open-hearth steel is used for the manufacture of ingots. The leading world manufacturers of forging ingots for pressure vessels, however, exclusively use electric steel. Vacuum casting techniques are exclusively used. Experience is shown gained with the introduction of the manufacture of forging ingots for pressure vessels at SKODA, Plzen. The metallurgical procedure was tested utilizing alkaline open hearths, electric arc furnaces and facilities for vacuum casting of steel. Pure charge raw materials should be used for securing high steel purity. Prior to forging pressure vessel rings, not only should sufficiently big bottoms and heads be removed but also the ingot middle part should be scrapped showing higher contents of impurities and nonhomogeneous structure.

  12. ESF GROUND SUPPORT - STRUCTURAL STEEL ANALYSIS

    Energy Technology Data Exchange (ETDEWEB)

    T. Misiak

    1996-06-26

    The purpose and objective of this analysis are to expand the level of detail and confirm member sizes for steel sets included in the Ground Support Design Analysis, Reference 5.20. This analysis also provides bounding values and details and defines critical design attributes for alternative configurations of the steel set. One possible configuration for the steel set is presented. This analysis covers the steel set design for the Exploratory Studies Facility (ESF) entire Main Loop 25-foot diameter tunnel.

  13. Optimum conditions for aging of stainless maraging steels

    International Nuclear Information System (INIS)

    Mironenko, P.A.; Krasnikova, S.I.; Drobot, A.V.

    1980-01-01

    Aging kinetics of two 0Kh11N10M2T type steels in which 3 % Mo (steel 1), and 3 % Mo and 11 % Co (steel 2) had been additionally introduced instead of titanium were investigated. Electron microscopy and X-ray methods were used. It was ascertained that the process of steel aging proceeded in 3 stages. Steel 2 was hardened more intensively during the aging, had a higher degree of hardness and strength after the aging, weakened more slowly if overaged than steel 1. The intermetallide hcp-phase Fe 2 Mo was the hardening phase on steels extended aging. Optimum combination of impact strength and strength was was achieved using two-stage aging: the first stage - maximum strength aging was achieved, the second stage - aging at minimum temperatures of two-phase α+γ region

  14. Assessing the national steel-making problem: the demand for steel products in Brazil (1901-1940

    Directory of Open Access Journals (Sweden)

    Gustavo Barros

    2017-12-01

    Full Text Available This paper examines the demand for steel products inBrazil between 1901 and 1940, considering its dimension, its composition and its evolution, as well as the contemporaries’ perception on the issue. In order to do this, a wide array of primary sources is used, including original disaggregated foreign exchange data. Based on these sources, it is observed that the dimension of the potential domestic market exhibited a certain stability along the more than three decades during which the steel-making debate took place, and that this reflected on the contemporary estimates of the size of the market. This relative stability of the market size was accompanied by a diversification process of the demand for steel products. Furthermore, the share of iron and steel products on the value of imports showed a growth trend along the period, highlighting the importance the external constraint had in the shaping of this market in the country.

  15. Utilization of structural steel in buildings.

    Science.gov (United States)

    Moynihan, Muiris C; Allwood, Julian M

    2014-08-08

    Over one-quarter of steel produced annually is used in the construction of buildings. Making this steel causes carbon dioxide emissions, which climate change experts recommend be reduced by half in the next 37 years. One option to achieve this is to design and build more efficiently, still delivering the same service from buildings but using less steel to do so. To estimate how much steel could be saved from this option, 23 steel-framed building designs are studied, sourced from leading UK engineering firms. The utilization of each beam is found and buildings are analysed to find patterns. The results for over 10 000 beams show that average utilization is below 50% of their capacity. The primary reason for this low value is 'rationalization'-providing extra material to reduce labour costs. By designing for minimum material rather than minimum cost, steel use in buildings could be drastically reduced, leading to an equivalent reduction in 'embodied' carbon emissions.

  16. Electrochemical corrosion response of a low carbon heat treated steel in a NaCl solution

    Energy Technology Data Exchange (ETDEWEB)

    Osorio, W.R.; Peixoto, L.C.; Garcia, L.R.; Garcia, A. [Department of Materials Engineering, State University of Campinas, SP (Brazil)

    2009-10-15

    Dual-phase (DP) steels are produced from a specific heat treatment procedure and have recently emerged as a potential class of engineering materials for a number of structural and automobile applications. Such steels have high strength-to-weight ratio and reasonable formability. The present study aims to investigate the effects of four different and conventional heat treatments (i.e., hot rolling, normalizing, annealing, and intercritical annealing) on the resulting microstructural patterns and on the electrochemical corrosion behavior. Electrochemical impedance spectroscopy (EIS) and Tafel plots were carried out on heat treated steel samples in a 0.5 M NaCl solution at 25 C with neutral pH. An equivalent circuit analysis was also used to provide quantitative support for the discussions. The normalizing and the annealing heat treatments have provided the highest and the lowest corrosion resistances, respectively. The intercritical annealing and as-received (hot rolled) low carbon steel samples have shown similar corrosion behavior. Although a deleterious effect on the corrosion resistance has been verified for DP steel due to the residual stress from the martensite formation, it combines good mechanical properties with intermediate electrochemical corrosion resistance. (Abstract Copyright [2009], Wiley Periodicals, Inc.)

  17. Clean Cast Steel Technology, Phase IV

    Energy Technology Data Exchange (ETDEWEB)

    Charles E. Bates

    2003-02-24

    The objective of the Clean Cast Steel Technology Program was to improve casting product quality by removing or minimizing oxide defects and to allow the production of higher integrity castings for high speed machining lines. Previous research has concentrated on macro-inclusions that break, chip, or crack machine tool cutters and drills and cause immediate shutdown of the machining lines. The overall goal of the project is to reduce the amount of surface macro-inclusions and improve the machinability of steel castings. Macro-inclusions and improve the machinability of steel castings. Macro-inclusions have been identified by industrial sponsors as a major barrier to improving the quality and marketability of steel castings.

  18. Stainless steel electrochemical behaviour - application to the decontamination of steel parts contaminated by tritium

    International Nuclear Information System (INIS)

    Bellanger, G.

    1991-01-01

    This purpose of this work is the study of an electrochemical decontamination process of stainless steel in which tritium is present on the surface of the metal, in the oxide layer and in the metal. We have first investigated the behaviour of the oxide layer. Then we have studied the hydrogen evolution, its diffusion and retrodiffusion in the metal. The results are applied to the decontamination of steel parts contamined by tritium. Part of the tritium can be eliminated by reducing the oxyde layer, which contains large amounts of tritium. However, it is more beneficial to electrolyse at the potential at which the H + ions are reduced. The hydrogen on the steel surface enters in the metal and displaces most of tritium located in the metallic layers near the surface. The tritium surface elimination rate is about 95%. The tritium eliminated through electrolysis is only a small fraction of all the tritium contained in the metal. However, according to conservation experiments of parts after electrolysis, it can be concluded that hydrogen, probably more strongly bound than tritium to steel, forms near the surface a barrier that prevents tritium retrodiffusion. Electrolysis appears as a satisfactory process for the surface decontamination of slightly tritiated steel parts. A decontamination automaton based on the preceding results is described using a pad electrolyser. This type of decontamination is little polluting, and the parts can be recycled after the in situ treatment [fr

  19. The development of EUROFER reduced activation steel

    Energy Technology Data Exchange (ETDEWEB)

    Schaaf, B. van der E-mail: vanderschaaf@nrg-nl.com; Tavassoli, F.; Fazio, C.; Rigal, E.; Diegele, E.; Lindau, R.; LeMarois, G

    2003-09-01

    Ferritic martensitic steels show limited swelling and susceptibility to helium effects and can be made with low activation chemical compositions. These properties make them the reference steel for the development of breeding blankets in fusion power plants. EUROFER97 is the European implementation of such a steel, where experience gained from an IEA co-operation with Japan and the US is also implemented. Results obtained so far show that EUROFER steel has attractive mechanical properties even after long ageing times. Compatibility tests in water and PbLi17 are in progress. Oxidised aluminium is the most effective protective layer in PbLi17. The displacement damage and helium formation strongly influence the hydrogen transport in the steel. Present experiments should be backed by tests in a more fusion relevant environment, e.g. IFMIF. The 2.5 dpa neutron irradiations at low temperatures result in a higher DBTT. High dose irradiations, up to 80 dpa, are underway. The early results of ODS grades with EUROFER steel composition show potential of these grades for increasing the operating temperature with 100-150 K.

  20. Elevated temperature mechanical properties of line pipe steels

    Science.gov (United States)

    Jacobs, Taylor Roth

    The effects of test temperature on the tensile properties of four line pipe steels were evaluated. The four materials include a ferrite-pearlite line pipe steel with a yield strength specification of 359 MPa (52 ksi) and three 485 MPa (70 ksi) yield strength acicular ferrite line pipe steels. Deformation behavior, ductility, strength, strain hardening rate, strain rate sensitivity, and fracture behavior were characterized at room temperature and in the temperature range of 200--350 °C, the potential operating range for steels used in oil production by the steam assisted gravity drainage process. Elevated temperature tensile testing was conducted on commercially produced as-received plates at engineering strain rates of 1.67 x 10 -4, 8.33 x 10-4, and 1.67 x 10-3 s-1. The acicular ferrite (X70) line pipe steels were also tested at elevated temperatures after aging at 200, 275, and 350 °C for 100 h under a tensile load of 419 MPa. The presence of serrated yielding depended on temperature and strain rate, and the upper bound of the temperature range where serrated yielding was observed was independent of microstructure between the ferrite-pearlite (X52) steel and the X70 steels. Serrated yielding was observed at intermediate temperatures and continuous plastic deformation was observed at room temperature and high temperatures. All steels exhibited a minimum in ductility as a function of temperature at testing conditions where serrated yielding was observed. At the higher temperatures (>275 °C) the X52 steel exhibited an increase in ductility with an increase in temperature and the X70 steels exhibited a maximum in ductility as a function of temperature. All steels exhibited a maximum in flow strength and average strain hardening rate as a function of temperature. The X52 steel exhibited maxima in flow strength and average strain hardening rate at lower temperatures than observed for the X70 steels. For all steels, the temperature where the maximum in both flow

  1. MERGER FOR MONOPOLY: THE FORMATION OF U.S. STEEL

    Directory of Open Access Journals (Sweden)

    Charles S. Reback

    2007-01-01

    Full Text Available Scholars have posited three reasons as to why U.S. Steel Corporation was formed: to swindle the public, to monopolize the steel industry, or to become a more efficient firm. The evidence from a stock market event study shows that from its inception, U.S. Steel was viewed as a monopolistic competitor. The stock prices of component and competing firms reacted positively to the announcement of the company’s formation. This is consistent with the theory that U.S. Steel was formed to monopolize the domestic steel industry, inconsistent with the theory that U.S. Steel was formed to become a more efficient firm, and inconsistent with the theory that US. Steel was formed in order to sell overpriced stock to an unsuspecting public. These results confirm Stigler’s conclusions in his classic paper “The Dominant Firm and the Inverted Umbrella,” despite that paper’s empirical flaws. Further, this conclusion is supported by much of the recent literature on U:S. Steel.

  2. A LOW TEMPERATURE ALUMINIZING TREATMENT OF HOT WORK TOOL STEEL

    OpenAIRE

    Matijević, Božidar

    2013-01-01

    Conventional aluminizing processes by pack cementation are typically carried out at elevated temperatures. A low temperature powder aluminizing technology was applied to the X40CrMoV5-1 hot tool steel. The aluminizing temperature was from 550 °C to 620 °C. Effects of temperature and time on the microstructure and phase evolution were investigated. Also, the intermetallic layer thickness was measured in the aluminized layer of a steel substrate. The cross-sectional microstructures, the alumini...

  3. A sustainability assessment system for Chinese iron and steel firms

    OpenAIRE

    Long, Yunguang; Pan, Jieyi; Farooq, Sami; Boer, Harry

    2016-01-01

    The environmental impact of the Chinese iron and steel industry is huge due to its high consumption of ore, coal and energy, and water and air pollution. It is important not only for China but also for the rest of the world that the Chinese iron and steel industry becomes more sustainable. A sustainable assessment indicator system is an important tool to support that development. Currently, however, a sustainable assessment system, specifically designed to match the characteristics of Chinese...

  4. Comparison of SA508 Gr.3 and SA508 Gr.4N Low Alloy Steels for Reactor Pressure Vessel Steel

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Min Chul; Lee, B. S

    2009-12-15

    The microstructural characteristics and mechanical properties of SA508 Gr.3 Mn-Mo-Ni low alloy steel and SA508 Gr.4N Ni-Mo-Cr low alloy steel were investigated. The differences in the stable phases between these two low alloy steels were evaluated by means of a thermodynamic calculation using ThermoCalc. They were then compared to microstructural features and correlated with mechanical properties. Mn-Mo-Ni low alloy steel shows the upper bainite structure which has the coarse cementite in the lath boundaries. However, Ni-Mo-Cr low alloy steel shows the mixture of lower bainite and tempered martensite structure that homogeneously precipitates the small carbides such as M{sub 23}C{sub 6} and M{sub 7}C{sub 3} due to an increase of hardenability and Cr addition. In the mechanical properties, Ni-Mo-Cr low alloy steel has higher strength and toughness than Mn-Mo-Ni low alloy steel. Ni and Cr additions increase the strength by solid solution hardening. Besides, microstructural changes from upper bainite to tempered martensite improve the strength of the low alloy steel by grain refining effect. And the changes in the precipitation behavior by Cr addition improve the ductile-brittle transition behavior along with a toughening effect of Ni addition.

  5. TiC reinforced cast Cr steels

    Energy Technology Data Exchange (ETDEWEB)

    Dogan, O.N.; Hawk, J.A.; Schrems, K.K.

    2006-06-01

    A new class of materials, namely TiC-reinforced cast chromium (Cr) steels, was developed for applications requiring high abrasion resistance and good fracture toughness. The research approach was to modify the carbide structure of commercial AISI 440C steel for better fracture resistance while maintaining the already high abrasion resistance. The new alloys contained 12Cr, 2.5–4.5Ti, and 1–1.5C (wt.%) and were melted in a vacuum induction furnace. Their microstructure was composed primarily of a martensitic matrix with a dispersion of TiC precipitates. Modification of TiC morphology was accomplished through changing the cooling rate during solidification. Wear rates of the TiC-reinforced Cr steels were comparable to that of AISI 440C steel, but the impact resistance was much improved.

  6. TiC-reinforced cast Cr steels

    Science.gov (United States)

    Doğan, Ö. N.; Hawk, J. A.; Schrems, K. K.

    2006-06-01

    A new class of materials, namely TiC-reinforced cast chromium (Cr) steels, was developed for applications requiring high abrasion resistance and good fracture toughness. The research approach was to modify the carbide structure of commercial AISI 440C steel for better fracture resistance while maintaining the already high abrasion resistance. The new alloys contained 12Cr, 2.5-4.5Ti, and 1-1.5C (wt.%) and were melted in a vacuum induction furnace. Their microstructure was composed primarily of a martensitic matrix with a dispersion of TiC precipitates. Modification of TiC morphology was accomplished through changing the cooling rate during solidification. Wear rates of the TiC-reinforced Cr steels were comparable to that of AISI 440C steel, but the impact resistance was much improved.

  7. Modelling hydrogen permeation in a hydrogen effusion probe for monitoring corrosion of carbon steels

    International Nuclear Information System (INIS)

    Santiwiparat, P.; Rirksomboon, T.; Steward, F.R.; Lister, D.H.; Cook, W.G.

    2015-01-01

    Hydrogen accumulation inside carbon steel and stainless steel devices shaped like cylindrical cups attached to a pipe containing hydrogen gas was modelled with MATLAB software. Hydrogen transfer around the bottom of the cups (edge effect) and diffusion through the cup walls (material effect) were accounted for. The variation of hydrogen pressure with time was similar for both materials, but the hydrogen plateau pressures in stainless steel cups were significantly higher than those in carbon steel cups. The geometry of the cup also affected the plateau pressure inside the cup. (author)

  8. Future directions for ferritic/martensitic steels for nuclear applications

    International Nuclear Information System (INIS)

    Klueh, R.L.; Swindeman, R.W.

    2000-01-01

    High-chromium (7-12% Cr) ferritic/martensitic steels are being considered for nuclear applications for both fission and fusion reactors. Conventional 9-12Cr Cr-Mo steels were the first candidates for these applications. For fusion reactors, reduced-activation steels were developed that were patterned on the conventional steels but with molybdenum replaced by tungsten and niobium replaced by tantalum. Both the conventional and reduced-activation steels are considered to have an upper operating temperature limit of about 550degC. For improved reactor efficiency, higher operating temperatures are required. For ferritic/martensitic steels that could meet such requirements, oxide dispersion-strengthened (ODS) steels are being considered. In this paper, the ferritic/martensitic steels that are candidate steels for nuclear applications will be reviewed, the prospect for ODS steel development and the development of steels produced by conventional processes will be discussed. (author)

  9. Nondestructive characterization of embrittlement in reactor pressure vessel steels -- A feasibility study

    International Nuclear Information System (INIS)

    McHenry, H.I.; Alers, G.A.

    1998-01-01

    The Nuclear Regulatory Commission recently initiated a study by NIST to assess the feasibility of using physical-property measurements for evaluating radiation embrittlement in reactor pressure vessel (RPV) steels. Ultrasonic and magnetic measurements provide the most promising approaches for nondestructive characterization of RPV steels because elastic waves and magnetic fields can sense the microstructural changes that embrittle materials. The microstructural changes of particular interest are copper precipitation hardening, which is the likely cause of radiation embrittlement in RPV steels, and the loss of dislocation mobility that is an attribute of the ductile-to-brittle transition. Measurements were made on a 1% copper steel, ASTM grade A710, in the annealed, peak-aged and overaged conditions, and on an RPV steel, ASTM grade A533B. Nonlinear ultrasonic and micromagnetic techniques were the most promising measures of precipitation hardening. Ultrasonic velocity measurements and the magnetic properties associated with hysteresis-loop measurements were not particularly sensitive to either precipitation hardening or the ductile-to-brittle transition. Measurements of internal friction using trapped ultrasonic resonance modes detected energy losses due to the motion of pinned dislocations; however, the ultrasonic attenuation associated with these measurements was small compared to the attenuation caused by beam spreading that would occur in conventional ultrasonic testing of RPVs

  10. Selected properties of new „duplex” cast steel

    Directory of Open Access Journals (Sweden)

    S. Pietrowski

    2011-10-01

    Full Text Available In this paper selected properties of new „duplex” cast steel are presented. The new cast steel was devised in HYDRO-VACUUM company in Grudziądz, where “duplex” cast steel for pump elements is smelted. The goal was to devise a new grade of “duplex” cast steel of better physicochemical properties and cheaper than now applied. It was demonstrated, that there is the possibility of devising the new grade of “duplex” cast steel. It is characterized by higher mechanical properties, similar wear resistance and greater corrosion resistance in 15% water solution of H2SO4 in comparison to now applied “duplex” cast steel. The chemical composition was selected to obtain in microstructure about of 50% ferrite and 50% austenite. It guarantee the highest properties and the lowest costs of its smelting.In the paper results of: the microstructure, Rm, Rp0,2, A5, HB, wear resistance and corrosion resistance in water solution of 15% HCl and H2SO4 acids of new cast steel was presented. They were compared with now applied in HYDRO-VACUUM company “duplex” cast steel.

  11. Impact of a nickel-reduced stainless steel implant on striated muscle microcirculation: a comparative in vivo study.

    Science.gov (United States)

    Kraft, C N; Burian, B; Perlick, L; Wimmer, M A; Wallny, T; Schmitt, O; Diedrich, O

    2001-12-05

    The impairment of skeletal muscle microcirculation by a biomaterial may have profound consequences. With moderately good physical and corrosion characteristics, implant-quality stainless steel is particularly popular in orthopedic surgery. However, due to the presence of a considerable amount of nickel in the alloy, concern has been voiced in respect to local tissue responses. More recently a stainless steel alloy with a significant reduction of nickel has become commercially available. We, therefore, studied in vivo nutritive perfusion and leukocytic response of striated muscle to this nickel-reduced alloy, and compared these results with those of the materials conventional stainless steel and titanium. Using the hamster dorsal skinfold chamber preparation and intravital microscopy, we could demonstrate that reduction of the nickel quantity in a stainless steel implant has a positive effect on local microvascular parameters. Although the implantation of a conventional stainless steel sample led to a distinct and persistent activation of leukocytes combined with disruption of the microvascular endothelial integrity, marked leukocyte extravasation, and considerable venular dilation, animals with a nickel-reduced stainless steel implant showed only a moderate increase of these parameters, with a clear tendency of recuperation. Titanium implants merely caused a transient increase of leukocyte-endothelial cell interaction within the first 120 min, and no significant change in macromolecular leakage, leukocyte extravasation, or venular diameter. Pending biomechanical and corrosion testing, nickel-reduced stainless steel may be a viable alternative to conventional implant-quality stainless steel for biomedical applications. Concerning tolerance by the local vascular system, titanium currently remains unsurpassed. Copyright 2001 John Wiley & Sons, Inc. J Biomed Mater Res 57: 404-412, 2001

  12. On the formation of the L-centre in silicon during heat treatment in the temperature range 205-285 deg. C

    International Nuclear Information System (INIS)

    Mikelsen, M; Monakhov, E V; Avset, B S; Svensson, B G

    2006-01-01

    Annealing kinetics of electron-irradiation induced defects in n-type diffusion oxygenated float-zone silicon has been studied in the temperature-range 205-285 deg. C. Previous deep level transient spectroscopy (DLTS) reports have established that an observed shift in the positions of two peaks related to the divacancy (V 2 ), is due to the annealing of the divacancy and the formation of the divacancy-oxygen complex (V 2 O). In parallel to this transformation from V 2 to V 2 O, a new defect of unknown identity, the so-called L-centre, forms with a level located at 0.36 eV below the conduction band edge. The L-level has a first order formation-kinetics in the temperature region studied; at 245-285 deg. C the formation rate is very similar to the annealing rate of V 2 , while at lower temperatures the formation rate becomes lower with a relative difference by a factor two at 205 deg. C. The Arrhenius plot for the L-level formation rate is not a straight line, indicating that the formation is controlled by at least two different processes. Kinetic modelling shows that the experimental data can be reproduced by a sequence of defect dissociation and migration, where the former limits at low temperatures (activation energy ∼1.75 eV) and the latter at high temperatures (E a ∼1.0 eV). Based on these results and other findings, the identity of the L-centre is discussed

  13. Investigation of the hot ductility of a high-strength boron steel

    International Nuclear Information System (INIS)

    Güler, Hande; Ertan, Rukiye; Özcan, Reşat

    2014-01-01

    In this study, the high-temperature ductility behaviour of an Al–Si-coated 22MnB5 sheet was investigated. The mechanical properties of Al–Si-coated 22MnB5 boron steel were examined via hot tensile tests performed at temperatures ranging from 400 to 900 °C at a strain rate of 0.083 s −1 . The deformation and fracture mechanisms under hot tensile testing were considered in relation to the testing data and to the fracture-surface observations performed via SEM. The hot ductility of the tested boron steel was observed as a function of increasing temperature and the Al–Si-coated 22MnB5 boron steel exhibited a ductility loss at 700 °C

  14. Chemical decontamination of stainless steel

    International Nuclear Information System (INIS)

    Onuma, Tsutomu; Akimoto, Hidetoshi

    1991-01-01

    The present invention concerns a method for chemical decontamination of radioactive metal waste materials contaminated with radioactive materials on the surface, generated in radioactive materials-handling facilities. The invention is comprised of a method of chemical decontamination of stainless steel, characterized by comprising a first process of immersing a stainless steel-based metal waste material contaminated by radioactive materials on the surface in a sulfuric acid solution and second process of immersing in an aqueous solution of sulfuric acid and oxidizing metal salt, in which a portion of the surface of the stainless steel to be decontaminated is polished mechanically to expose a portion of the base material before the above first and second processes. 1 figs., 2 tabs

  15. Spreading of lithium on a stainless steel surface at room temperature

    Energy Technology Data Exchange (ETDEWEB)

    Skinner, C.H., E-mail: cskinner@pppl.gov [Princeton Plasma Physics Laboratory, Princeton, NJ 08543 (United States); Capece, A.M. [Princeton Plasma Physics Laboratory, Princeton, NJ 08543 (United States); Roszell, J.P.; Koel, B.E. [Department of Chemical and Biological Engineering, Princeton University, NJ 08540 (United States)

    2016-01-15

    Lithium conditioned plasma facing surfaces have lowered recycling and enhanced plasma performance on many fusion devices and liquid lithium plasma facing components are under consideration for future machines. A key factor in the performance of liquid lithium components is the wetting by lithium of its container. We have observed the surface spreading of lithium from a mm-scale particle to adjacent stainless steel surfaces using a scanning Auger microprobe that has elemental discrimination. The spreading of lithium occurred at room temperature (when lithium is a solid) from one location at a speed of 0.62 μm/day under ultrahigh vacuum conditions. Separate experiments using temperature programmed desorption (TPD) investigated bonding energetics between monolayer-scale films of lithium and stainless steel. While multilayer lithium desorption from stainless steel begins to occur just above 500 K (E{sub des} = 1.54 eV), sub-monolayer Li desorption occurred in a TPD peak at 942 K (E{sub des} = 2.52 eV) indicating more energetically favorable lithium-stainless steel bonding (in the absence of an oxidation layer) than lithium–lithium bonding.

  16. 78 FR 11090 - Steel Import Monitoring and Analysis System

    Science.gov (United States)

    2013-02-15

    ... tariffs on these steel imports and providing the steel industry time to restructure. The monitoring system... submissions were received from a coalition of eight steel trade groups (referred to as the ``industry''), a... that helps the industry to closely monitor steel imports. The comments are summarized below. The three...

  17. Electrochemical Determination of Hydrogen Entry to HSLA Steel during Pickling

    Directory of Open Access Journals (Sweden)

    Jari Aromaa

    2018-01-01

    Full Text Available Pickling with hydrochloric acid is a standard method to clean steel surfaces before hot-dip galvanizing. When normal low strength steels are pickled, hydrogen formed in pickling reactions does not have any significant harmful effect on the mechanical properties of steel. However, in pickling of steels with higher strength, the penetration of hydrogen into the steel may cause severe damages. The effect of pickling of high-strength low-alloy (HSLA steels was investigated using a cell construction based on the Devanathan-Stachurski method with modified anodic surface treatment and hydrogen production using acid. The penetration and the permeability of hydrogen were measured using an electrochemical cell with hydrochloric acid on the one side of the steel sample and a solution of NaOH on the other side. No protective coating, for example, palladium on the anodic side of the sample, is needed. The penetration rate of hydrogen into the steel and exit rate from the steel were lower for higher strength steel.

  18. Welding Metallurgy and Weldability of Stainless Steels

    Science.gov (United States)

    Lippold, John C.; Kotecki, Damian J.

    2005-03-01

    Welding Metallurgy and Weldability of Stainless Steels, the first book in over twenty years to address welding metallurgy and weldability issues associated with stainless steel, offers the most up-to-date and comprehensive treatment of these topics currently available. The authors emphasize fundamental metallurgical principles governing microstructure evolution and property development of stainless steels, including martensistic, ferric, austenitic, duplex, and precipitation hardening grades. They present a logical and well-organized look at the history, evolution, and primary uses of each stainless steel, including detailed descriptions of the associated weldability issues.

  19. Auburn Steel Company radioactive contamination incident

    International Nuclear Information System (INIS)

    Bradley, F.J.; Cabasino, L.; Kelly, R.; Awai, A.; Kasyk, G.

    1986-04-01

    On February 21, 1983, workers at the Auburn Steel Company, Auburn, New York discovered that about 120 tons of steel poured that day had become contaminated with 60 Co. In addition to the steel, the air cleaning system and portions of the mill used in casting the steel were contaminated. Approximately 25 curies of 60 Co were involved. Decontamination and disposal of the contamination cost in excess of $2,200,000. This report details the discovery of the contamination, decontamination of the plant and disposal of the contamination

  20. Marine corrosion of mild steel at Lumut, Perak

    Science.gov (United States)

    Ting, Ong Shiou; Potty, Narayanan Sambu; Liew, Mohd. Shahir

    2012-09-01

    The corrosion rate of structural steels in the adverse marine and offshore environments affects the economic interest of offshore structures since the loss of steel may have significant impact on structural safety and performance. With more emphasis to maintain existing structures in service for longer time and hence to defer replacement costs, there is increasing interest in predicting corrosion rate at a given location for a given period of exposure once the protection coating or cathodic protection is lost. The immersion depth, salinity, steel composition and water pollution will be taken into account. Various corrosion allowances are prescribed for structural members by different standards. There are no studies to determine the appropriate corrosion allowance for steel structures in marine environment in Malaysia. The objectives of the research are to determine the nature and rate of corrosion in mm/year for steel structures in marine environment. It also tries to identify whether the corrosion rate is affected by differences in the chemical composition of the steels, and microalgae. Two sets of corrosion coupons of Type 3 Steel consisting of mild steel were fabricated and immersed in seawater using steel frames. The corrosion rate of the coupon in mm/ per year is estimated based on the material weight loss with time in service. The results are compared with recommendations of the code.

  1. Ultrahigh Ductility, High-Carbon Martensitic Steel

    Science.gov (United States)

    Qin, Shengwei; Liu, Yu; Hao, Qingguo; Zuo, Xunwei; Rong, Yonghua; Chen, Nailu

    2016-10-01

    Based on the proposed design idea of the anti-transformation-induced plasticity effect, both the additions of the Nb element and pretreatment of the normalization process as a novel quenching-partitioning-tempering (Q-P-T) were designed for Fe-0.63C-1.52Mn-1.49Si-0.62Cr-0.036Nb hot-rolled steel. This high-carbon Q-P-T martensitic steel exhibits a tensile strength of 1890 MPa and elongation of 29 pct accompanied by the excellent product of tensile and elongation of 55 GPa pct. The origin of ultrahigh ductility for high-carbon Q-P-T martensitic steel is revealed from two aspects: one is the softening of martensitic matrix due to both the depletion of carbon in the matensitic matrix during the Q-P-T process by partitioning of carbon from supersaturated martensite to retained austenite and the reduction of the dislocation density in a martensitic matrix by dislocation absorption by retained austenite effect during deformation, which significantly enhances the deformation ability of martensitic matrix; another is the high mechanical stability of considerable carbon-enriched retained austenite, which effectively reduces the formation of brittle twin-type martensite. This work verifies the correctness of the design idea of the anti-TRIP effect and makes the third-generation advanced high-strength steels extend to the field of high-carbon steels from low- and medium-carbon steels.

  2. Steeling and Resilience in Art Education

    Science.gov (United States)

    Heise, Donalyn

    2014-01-01

    Steel is an incredibly strong alloy of iron and carbon. Due to its incredible strength and durability, this resilient material is commonly used for constructing buildings. The transitive verb "steeling" is defined in Miriam-Webster dictionary as "to fill with resolution or determination, as in, she 'steeled herself to face the…

  3. Aging degradation of cast stainless steel

    International Nuclear Information System (INIS)

    Chopra, O.K.; Chung, H.M.

    1985-10-01

    A program is being conducted to investigate the significance of in-service embrittlement of cast-duplex stainless steels under light-water reactor operating conditions. Data from room-temperature Charpy-impact tests for several heats of cast stainless steel aged up to 10,000 h at 350, 400, and 450 0 C are presented and compared with results from other studies. Microstructures of cast-duplex stainless steels subjected to long-term aging either in the laboratory or in reactor service have been characterized. The results indicate that at least two processes contribute to the low-temperature embrittleent of duplex stainless steels, viz., weakening of the ferrite/austenite phase boundary by carbide precipitation and embrittlement of ferrite matrix by the formation of additional phases such as G-phase, Type X, or the α' phase. Carbide precipitation has a significant effect on the onset of embrittlement of CF-8 and -8M grades of stainless steels aged at 400 or 450 0 C. The existing correlations do not accurately represent the embrittlement behavior over the temperature range 300 to 450 0 C. 18 refs., 13 figs

  4. Reproducing crucible steel: a practical guide and a comparative analysis to persian manuscripts

    Directory of Open Access Journals (Sweden)

    Moshtagh Khorasani, Manouchehr

    2013-12-01

    Full Text Available Different terms are used in old Persian manuscripts, such as Ta’id Besârat, to define and refer to crucible or watered steel and different types of swords. However, there are few manuscripts that describe the way crucible steel cakes and blades were made such as the manuscript Gŏharnâme. The present article deals with the making of crucible steel as described in Persian manuscripts and also with a new reproduction process of making crucible steel as conducted by the Finnish smith Niko Hynninen.Los antiguos manuscritos persas, tales como Ta’id Besârat, emplean diversos términos para definir y referirse al acero de crisol o acero de Damasco y a diversos tipos de espada. Sin embargo, existen pocos manuscritos que describan el modo en que se elaboraban los lingotes y hojas de acero de crisol, entre ellos el manuscrito Gŏharnâme. El presente artículo describe el proceso de elaboración del acero de crisol tal y como lo refieren los manuscritos persas, así como una moderna reproducción del mismo realizada por el forjador finlandés Niko Hynninen.

  5. Prospects of weldable steels for nuclear power engineering

    International Nuclear Information System (INIS)

    Pilous, V.

    1985-01-01

    In nuclear power plants with WWER reactors a medium-alloyed CrNiMoV steel is considered for the pressure vessel and a MnNiMoV steel for the primary pipes, the pressurizer and other systems. The chemical composition of both steels is given and briefly discussed are the results of tests carried out within a study of the weldability of the steels. Attention is also devoted to the causes of cracks under austenite-based overlays occurring when medium-alloyed CrNiMoV steels are overlaid with strip electrodes using high thermal input submerged arc welding, and in the process of heat treatment. It appears that austenitic overlays reduce the life span by 5 to 15% as compared with the basic steel. If, however, the overlay is not part of the cross section critical with regard to strength, the reduced life span need not be considered and both types of steel will be suitable for primary circuits of nuclear power plants because they guarantee the required mechanical and physical properties of the welded joints. (Z.M.)

  6. Evaluation of Flash Bainite in 4130 Steel

    Science.gov (United States)

    2011-07-01

    Technical Report ARWSB-TR-11011 Evaluation of Flash Bainite in 4130 Steel G. Vigilante M. Hespos S. Bartolucci...4. TITLE AND SUBTITLE Evaluation of Flash Bainite in 4130 Steel 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT...need to be addressed, the Flash Bainite processing of 4130 steel demonstrates promise for applications needing a combination of high strength with

  7. The effect of intermediate stop and ball size in fabrication of recycled steel powder using ball milling from machining steel chips

    International Nuclear Information System (INIS)

    Fitri, M.W.M.; Shun, C.H.; Rizam, S.S.; Shamsul, J.B.

    2007-01-01

    A feasibility study for producing recycled steel powder from steel scrap by ball milling was carried out. Steel scrap from machining was used as a raw material and was milled using planetary ball milling. Three samples were prepared in order to study the effect of intermediate stop and ball size. Sample with intermediate stop during milling process showed finer particle size compared to the sample with continuous milling. Decrease in the temperature of the vial during the intermediate stop milling gives less ductile behaviour to the steel powder, which is then easily work-hardened and fragmented to fine powder. Mixed small and big size ball give the best production of recycled steel powder where it gives higher impact force to the scrap and accelerate the fragmentation of the steel scrap into powder. (author)

  8. Corrosion behaviour of dissimilar welds between martensitic stainless steel and carbon steel from secondary circuit of candu npp

    International Nuclear Information System (INIS)

    Popa, L.; Fulger, M.; Tunaru, M.; Velciu, L.; Lazar, M.

    2015-01-01

    Corrosion damages of welds occur in spite of the fact that the proper base metal and filler metal have been correctly selected, industry codes and standards have been followed and welds have been realized with full weld penetration and have proper shape and contour. It is not unusual to find that, although the base metal or alloy is resistant to corrosion in a particular environment, the welded counterpart is not resistant. In secondary circuit of a Nuclear Power Station there are some components which have dissimilar welds. Our experiments were performed in chloride environmental on two types of samples: non-welded (420 martensitic steel and 52.2k carbon steel) and dissimilar welds (dissimilar metal welds: joints beetween 420 martensitic steel and 52.2k carbon steel). To evaluate corrosion susceptibility of dissimilar welds was used electrochemical method (potentiodynamic method) and metallography microscopy (microstructural analysis). The present paper follows the localized corrosion behaviour of dissimilar welds between austenitic stainless steel and carbon steel in solutions containing chloride ions. We have been evaluated the corrosion rates of samples (welded and non-welded) by electrochemically. (authors)

  9. Experimental studies of Steel Corrugated Constructions

    Directory of Open Access Journals (Sweden)

    Lazarev Yuriy

    2016-01-01

    Full Text Available The purpose of this particular article is to assess existing calculations of steel corrugated constructions. Steel Corrugated Construction is a perspective type of constructions, which is exhibiting numerous advantages in comparison with one that currently applied in automobile and railroad networks (reinforced concrete water-throughput pipes, reinforced concrete frame bridges. The evaluation of experimental data on models of constructions of this particular type has been carried out in order to improve calculations of Steel Corrugated Constructions.

  10. Stability of ferritic steel to higher doses: Survey of reactor pressure vessel steel data and comparison with candidate materials for future nuclear systems

    International Nuclear Information System (INIS)

    Blagoeva, D.T.; Debarberis, L.; Jong, M.; Pierick, P. ten

    2014-01-01

    This paper is illustrating the potential of the well-known low alloyed clean steels, extensively used for the current light water Reactor Pressure Vessels (RPV) steels, for a likely use as a structural material also for the new generation nuclear systems. This option would provide, especially for large components, affordable, easily accessible and a technically more convenient solution in terms of manufacturing and joining techniques. A comprehensive comparison between several sets of surveillance and research data available for a number of RPV clean steels for doses up to 1.5 dpa, and up to 12 dpa for 9%Cr steels, is carried out in order to evaluate radiation stability of the currently used RPV clean steels even at higher doses. Based on the numerous data available, positive preliminary conclusions are drawn regarding the eventual use of clean RPV steels for the massive structural components of the new reactor systems. - Highlights: • Common embrittlement trend between RPV and advanced steels till intermediate doses. • For doses >1.5 dpa, damage rate saturation tendency is observed for RPV steels. • RPV steels might be conveniently utilised also outside their foreseen dose range

  11. Steel Housing - The Reinvention of the Square Wheel?

    NARCIS (Netherlands)

    Willems, M.H.P.M.

    2002-01-01

    Steel housing has some remarkable resemblance with a square wheel. Both combine a simple concept, uncommon appearance and lack of appreciation. The title furthermore refers to the repeated stubborn efforts over the last decennia to develop prefabricated steel-based housing systems. Steel has

  12. Quest for steel quality: the role of metallurgical chemistry

    Energy Technology Data Exchange (ETDEWEB)

    McLean, A. [Toronto Univ., ON (Canada). Dept. of Metallurgy and Materials Science

    2000-10-01

    Improvements in the quality of steels and the role played by metallurgical chemistry to bring about those improvements are discussed. The particular emphasis is on the chemical behaviour of solutes in molten steel and the reaction between steel, slag and refractory materials and the manner in which they influence the physical properties and performance of the steel product. As an illustration of the contribution of chemistry to steel making the case of the steel plates used in the construction of the Titanic is cited. In 1911 when the Titanic was constructed by Harland and Wolff at their Belfast shipyard, the steel plates used in the hull met all then current specifications. In 1992 when a number of steel samples recovered from the Titanic were examined, it was found that the hull of the vessel was constructed of low carbon, semi-killed steel, produced in the open-hearth process. Microstructural analysis showed extensive carbon banding, typical of hot rolled 0.2 per cent carbon steel. Also found were long manganese sulphide inclusions elongated in the rolling direction, some of which exceeded 25 mm in length. It was determined that as a consequence of these inclusions, at a seawater temperature of 0 degree C, the hull plates of the Titanic had essentially no resistance to fracture. Today's high quality steels used in applications such as Arctic pipelines, offshore platforms, icebreakers and ships for the transportation of natural gas, oxygen and sulphur concentrations are frequently less than 10 ppm. These elements have a profound influence of the quality of the final steel products by virtue of their effect of hindering the formation of inclusions. 2 refs., 3 figs.

  13. Designing of the chemical composition of steels basing on the hardenability of constructional steels

    International Nuclear Information System (INIS)

    Dobrzanski, L.A.; Sitek, W.

    2003-01-01

    The paper presents the original method of modelling of the relationships between chemical composition of alloy constructional steel and its hardenability, employing neural networks. Basing on the experimental results of the hardenability investigations, which employed Jominy method, the model of the neural networks was developed and fully verified experimentally. The model makes it possible to obtain Jominy hardenability curves basing on the steel chemical composition. The model of neural networks, making it possible to design the steel chemical composition, basing on the known Jominy hardenability curve shape, was developed also and fully verified numerically. (author)

  14. The structure of the alphinizing coat on alloy steels

    Directory of Open Access Journals (Sweden)

    S. Pietrowski

    2008-12-01

    Full Text Available In this paper results of the structure of the coat alphinizing in AlSi5 silumin on alloy steels: acid-proof 1H18N9T (X6CrNiTi18-10 and high speed SW18 (HS18-0-1 were presented. The temperature of the alphinizing bath was amounts to750±5°C, and immersion time of the element τ = 180s. It was shown, that there is the different “g” coat thickness on testing steels. On the 1H18N9T steel it amounts to g = 52μm, and on the SW18 steel – g = 203μm. Regardless of a grade of testing alloy steels the coat consist of three layers with diversified phasic structure. There is different chemical composition of coat layers on testing steels. The first layer from the base consist of AlFe phase containing alloy addictions of steels: Cr and Ni (1H18N9T and W, V and Cr (SW18. On this layer crystallize the second layer of intermetallic phases. It is the phase containing the main alloy addiction of steels: AlFeCr (1H18N9T and AlFeW (SW18. The last, outside layer consist of silumin containing AlFeNi intermetallic phases on the 1H18N9T steel and AlFeW on the SW18 steel. Regardless of the grade of testing steels there is Si element in all layers of the coat. There are morphological differences in tested layers. The second layer (AlFeW phase inside the coat on the SW18 steel consist of faced crystals growing into in outside silumin layer. On the 1H18N9T steel a boundary between transient and outside layer is more uniform. Free separations of intermetallic phases inside silumin layer on the 1H18N9T steel have lamellar and on the SW18 steel – faced form.

  15. Metadynamic and static recrystallization softening behavior of a bainite steel

    Science.gov (United States)

    Li, Lixin; Zheng, Liangyu; Ye, Ben; Tong, Zeqiong

    2018-01-01

    The metadynamic recrystallization (MDRX) and static recrystallization (SRX) softening behavior of a bainite steel was investigated by two-pass isothermal compression experiments at temperatures of 1173, 1273, 1373, and 1473 K and strain rates of 0.01, 0.1, 1, and 10 s-1 with inter-pass times of 1, 5, 10, and 30 s on a Gleeble-1500 thermo-mechanical simulator. Kinetic equations were developed to evaluate the softening fractions caused by MDRX and SRX. A comparison between the experimental and predicted softening fractions showed that the proposed kinetic equations can provide a precise estimation of the MDRX and SRX behavior of the studied steel. The results based on the kinetic equations indicated that the MDRX and SRX softening fraction increases with the increase in strain rate, deformation temperature, inter-pass time, and pre-strain; the activation energy of MDRX is much smaller than that of SRX; and the no-recrystallization temperature of the investigated steel is 1179.4 K.

  16. Atmospheric Corrosion Behavior and Mechanism of a Ni-Advanced Weathering Steel in Simulated Tropical Marine Environment

    Science.gov (United States)

    Wu, Wei; Zeng, Zhongping; Cheng, Xuequn; Li, Xiaogang; Liu, Bo

    2017-12-01

    Corrosion behavior of Ni-advanced weathering steel, as well as carbon steel and conventional weathering steel, in a simulated tropical marine atmosphere was studied by field exposure and indoor simulation tests. Meanwhile, morphology and composition of corrosion products formed on the exposed steels were surveyed through scanning electron microscopy, energy-dispersive x-ray spectroscopy and x-ray diffraction. Results indicated that the additive Ni in weathering steel played an important role during the corrosion process, which took part in the formation of corrosion products, enriched in the inner rust layer and promoted the transformation from loose γ-FeOOH to dense α-FeOOH. As a result, the main aggressive ion, i.e., Cl-, was effectively separated in the outer rust layer which leads to the lowest corrosion rate among these tested steels. Thus, the resistance of Ni-advanced weathering steel to atmospheric corrosion was significantly improved in a simulated tropical marine environment.

  17. Preliminary studies on steel slag as a substitute for coarse aggregate on concrete

    Directory of Open Access Journals (Sweden)

    Karolina Rahmi

    2017-01-01

    Full Text Available The development of science and technology in the field of construction that is rapidly increasing, is always followed by the growing community needs for infrastructure facilities, such as buildings, bridges and other construction. One of the key element in that development is concrete. Due to the rapid development of science and technology in the field of construction, it’s required a building material which has better advantage than the materials of the existing building. To obtain a better building materials, one alternative is the use of waste as aggregate in concrete mixture. In this study the authors using waste steel waste (steel slag as a substitute for coarse aggregate. Steel slag used is steel waste from PT. Growth Sumatra Industry. The gravel substitution variations is 0%, 15%, and 25% and the testing was done by the slump test, compressive strength and flexural strength of concrete. From the test results obtained optimum compressive strength variation occurs in 25% substitution of steel slag gravel amounted to 40.481 MPa, whereas for the optimum bending capacity contained in variations of 25% substitution of steel slag gravel amounted to 19.592 N / mm2. And for optimum slump value obtained on the variation of normal concrete. This shows the workability of the concrete normally higher than the other variation.

  18. A Metallurgical Evaluation of the Powder-Bed Laser Additive Manufactured 4140 Steel Material

    Science.gov (United States)

    Wang, Wesley; Kelly, Shawn

    2016-03-01

    Using laser powder bed fusion (PBF-L) additive manufacturing (AM) process for steel or iron powder has been attempted for decades. This work used a medium carbon steel (AISI 4140) powder to explore the feasibility of AM. The high carbon equivalent of 4140 steel (CEIIW ≈ 0.83) has a strong tendency toward cold cracking. As such, the process parameters must be carefully controlled to ensure the AM build quality. Through an orthogonally designed experimental matrix, a laser-welding procedure was successfully developed to produce 4140 steel AM builds with no welding defects. In addition, the microstructure and micro-cleanliness of the as-welded PBF-L AM builds were also examined. The results showed an ultra-fine martensite lath structure and an ultra-clean internal quality with minimal oxide inclusion distribution. After optimizing the PBF-L AM process parameters, including the laser power and scan speed, the as-welded AM builds yielded an average tensile strength higher than 1482 MPa and an average 33 J Charpy V-notch impact toughness at -18°C. The surface quality, tensile strength, and Charpy V-notch impact toughness of AM builds were comparable to the wrought 4140 steel. The excellent mechanical properties of 4140 steel builds created by the PBF-L AM AM process make industrial production more feasible, which shows great potential for application in the aerospace, automobile, and machinery industries.

  19. Enhancement of mechanical properties of a TRIP-aided austenitic stainless steel by controlled reversion annealing

    Energy Technology Data Exchange (ETDEWEB)

    Hamada, A.S., E-mail: atef.hamada@suezuniv.edu.eg [Centre for Advanced Steels Research, Box 4200, University of Oulu, 90014 Oulu (Finland); Metallurgical and Materials Engineering Department, Faculty of Petroleum & Mining Engineering, Suez University, Box 43721, Suez (Egypt); Kisko, A.P. [Centre for Advanced Steels Research, Box 4200, University of Oulu, 90014 Oulu (Finland); Sahu, P. [Department of Physics, Jadavpur University, Kolkata 700032 (India); Karjalainen, L.P. [Centre for Advanced Steels Research, Box 4200, University of Oulu, 90014 Oulu (Finland)

    2015-03-25

    Controlled martensitic reversion annealing was applied to a heavily cold-worked metastable austenitic low-Ni Cr–Mn austenitic stainless steel (Type 201) to obtain different ultrafine austenite grain sizes to enhance the mechanical properties, which were then compared with the conventional coarse-grained steel. Characterization of the deformed and reversion annealed microstructures was performed by electron back scattered diffraction (EBSD), X-ray diffraction (XRD) and light and transmission electron microscopy (TEM). The steel with a reverted grain size ~1.5 μm due to annealing at 800 °C for 10 s showed significant improvements in the mechanical properties with yield stress ~800 MPa and tensile strength ~1100 MPa, while the corresponding properties of its coarse grained counterpart were ~450 MPa and ~900 MPa, respectively. However, the fracture elongation of the reversion annealed steel was ~50% as compared to ~70% in the coarse grained steel. A further advantage is that the anisotropy of mechanical properties present in work-hardened steels also disappears during reversion annealing.

  20. Stainless Steel to Titanium Bimetallic Transitions

    Energy Technology Data Exchange (ETDEWEB)

    Kaluzny, J. A. [Fermilab; Grimm, C. [Fermilab; Passarelli, D. [Fermilab

    2015-01-01

    In order to use stainless steel piping in an LCLS-II (Linac Coherent Light Source Upgrade) cryomodule, stainless steel to titanium bimetallic transitions are needed to connect the stainless steel piping to the titanium cavity helium vessel. Explosion bonded stainless steel to titanium transition pieces and bimetallic transition material samples have been tested. A sample transition tube was subjected to tests and x-ray examinations between tests. Samples of the bonded joint material were impact and tensile tested at room temperature as well as liquid helium temperature. The joint has been used successfully in horizontal tests of LCLS-II cavity helium vessels and is planned to be used in LCLS-II cryomodules. Results of material sample and transition tube tests will be presented.

  1. Nanostructuring steel for injection molding tools

    International Nuclear Information System (INIS)

    Al-Azawi, A; Smistrup, K; Kristensen, A

    2014-01-01

    The production of nanostructured plastic items by injection molding with ridges down to 400 nm in width, which is the smallest line width replicated from nanostructured steel shims, is presented. Here we detail a micro-fabrication method where electron beam lithography, nano-imprint lithography and ion beam etching are combined to nanostructure the planar surface of a steel wafer. Injection molded plastic parts with enhanced surface properties, like anti-reflective, superhydrophobic and structural colors can be achieved by micro- and nanostructuring the surface of the steel molds. We investigate the minimum line width that can be realized by our fabrication method and the influence of etching angle on the structure profile during the ion beam etching process. Trenches down to 400 nm in width have been successfully fabricated into a 316 type electro-polished steel wafer. Afterward a plastic replica has been produced by injection molding with good structure transfer fidelity. Thus we have demonstrated that by utilizing well-established fabrication techniques, nanostructured steel shims that are used in injection molding, a technique that allows low cost mass fabrication of plastic items, are produced. (paper)

  2. A system dynamics analysis of energy consumption and corrective policies in Iranian iron and steel industry

    International Nuclear Information System (INIS)

    Ansari, Nastaran; Seifi, Abbas

    2012-01-01

    Iron and steel industry is the most energy intensive industrial sector in Iran. Long time subsidized energy has led to low energy efficiency in this industry. The sudden subsidy reform of energy prices in Iran is expected to have a great impact on steel production and energy consumption. A system dynamics model is presented in this paper to analyze steel demand, production and energy consumption in an integrated framework. A co-flow structure is used to show how subsidy reform affects energy consumption in the long run. The main focus of this paper is on direct and indirect natural gas consumption in the steel industry. Scrap based Electric Arc Furnace technology has been evaluated as an energy efficient way for steel making. The energy consumption in steel industry is estimated under various steel production and export scenarios while taking into account new energy prices to see the outlook of possible energy demand in steel industry over next 20 years. For example it is shown that under reference production scenario, potential reduction in gas consumption forced by complete removal of energy subsidy and utilizing scrap could lead to 85 billion cubic meters of gas saving over the next 20 years. -- Highlights: ► We develop a system dynamics model to analyze steel demand, production and energy consumption in Iran. ► Various scenarios have been simulated to see the energy demand of Iranian steel industry over the next 20 years. ► A co-flow structure is used to show how subsidy reform would affect energy consumption in the long run. ► A co-flow structure has been built into the SD model to formulate consumers' behavior in response to energy prices. ► Scrap based Electric Arc Furnace technology has been evaluated as an energy efficient alternative for steel making.

  3. Nanostructuring steel for injection molding tools

    DEFF Research Database (Denmark)

    Al-Azawi, A.; Smistrup, Kristian; Kristensen, Anders

    2014-01-01

    The production of nanostructured plastic items by injection molding with ridges down to 400 nm in width, which is the smallest line width replicated from nanostructured steel shims, is presented. Here we detail a micro-fabrication method where electron beam lithography, nano-imprint lithography...... and ion beam etching are combined to nanostructure the planar surface of a steel wafer. Injection molded plastic parts with enhanced surface properties, like anti-reflective, superhydrophobic and structural colors can be achieved by micro-and nanostructuring the surface of the steel molds. We investigate...... the minimum line width that can be realized by our fabrication method and the influence of etching angle on the structure profile during the ion beam etching process. Trenches down to 400 nm in width have been successfully fabricated into a 316 type electro-polished steel wafer. Afterward a plastic replica...

  4. Austenitic stainless steel-to-ferritic steel transition joint welding for elevated temperature service

    International Nuclear Information System (INIS)

    King, J.F.; Goodwin, G.M.; Slaughter, G.M.

    1978-01-01

    Transition weld joints between ferritic steels and austenitic stainless steels are required for fossil-fired power plants and proposed nuclear plants. The experience with these dissimilar-metal transition joints has been generally satisfactory, but an increasing number of failures of these joints is occurring prematurely in service. These concerns with transition joint service history prompted a program to develop more reliable joints for application in proposed nuclear power plants

  5. Thermal stability study for candidate stainless steels of GEN IV reactors

    International Nuclear Information System (INIS)

    Simeg Veternikova, J.; Degmova, J.; Pekarcikova, M.; Simko, F.; Petriska, M.; Skarba, M.; Mikula, P.; Pupala, M.

    2016-01-01

    Highlights: • Thermal resistance of advanced stainless steels were observed at 1000 °C. • GEN IV candidate steels were confronted to classic AISI steels. • ODS AISI 316 has weaker thermal resistance than classic AISI steel. • Ferritic ODS steels and NF 709 has better thermal resistance than AISI steels. - Abstract: Candidate stainless steels for GEN IV reactors were investigated in term of thermal and corrosion stability at high temperatures. New austenitic steel (NF 709), austenitic ODS steel (ODS 316) and two ferritic ODS steels (MA 956 and MA 957) were exposed to around 1000 °C in inert argon atmosphere at pressure of ∼8 MPa. The steels were further studied in a light of vacancy defects presence by positron annihilation spectroscopy and their thermal resistance was confronted to classic AISI steels. The thermal strain supported a creation of oxide layers observed by scanning electron microscopy (SEM).

  6. Thermal stability study for candidate stainless steels of GEN IV reactors

    Energy Technology Data Exchange (ETDEWEB)

    Simeg Veternikova, J., E-mail: jana.veternikova@stuba.sk [Institute of Nuclear and Physical Engineering, Faculty of Electrical and Information Technology, Slovak University of Technology, Ilkovicova 3, 812 19 Bratislava (Slovakia); Degmova, J. [Institute of Nuclear and Physical Engineering, Faculty of Electrical and Information Technology, Slovak University of Technology, Ilkovicova 3, 812 19 Bratislava (Slovakia); Pekarcikova, M. [Institute of Materials Science, Faculty of Materials Science and Technology, Slovak University of Technology, Paulinska 16, 917 24 Trnava (Slovakia); Simko, F. [Department of Molten Salts, Institute of Inorganic Chemistry, Slovak Academy of Sciences, Dubravska cesta 9, 845 36 Bratislava (Slovakia); Petriska, M. [Institute of Nuclear and Physical Engineering, Faculty of Electrical and Information Technology, Slovak University of Technology, Ilkovicova 3, 812 19 Bratislava (Slovakia); Skarba, M. [Slovak University of Technology, Vazovova 5, 812 43 Bratislava (Slovakia); Mikula, P. [Institute of Nuclear and Physical Engineering, Faculty of Electrical and Information Technology, Slovak University of Technology, Ilkovicova 3, 812 19 Bratislava (Slovakia); Pupala, M. [Department of Molten Salts, Institute of Inorganic Chemistry, Slovak Academy of Sciences, Dubravska cesta 9, 845 36 Bratislava (Slovakia)

    2016-11-30

    Highlights: • Thermal resistance of advanced stainless steels were observed at 1000 °C. • GEN IV candidate steels were confronted to classic AISI steels. • ODS AISI 316 has weaker thermal resistance than classic AISI steel. • Ferritic ODS steels and NF 709 has better thermal resistance than AISI steels. - Abstract: Candidate stainless steels for GEN IV reactors were investigated in term of thermal and corrosion stability at high temperatures. New austenitic steel (NF 709), austenitic ODS steel (ODS 316) and two ferritic ODS steels (MA 956 and MA 957) were exposed to around 1000 °C in inert argon atmosphere at pressure of ∼8 MPa. The steels were further studied in a light of vacancy defects presence by positron annihilation spectroscopy and their thermal resistance was confronted to classic AISI steels. The thermal strain supported a creation of oxide layers observed by scanning electron microscopy (SEM).

  7. A Method for Monitoring Iron and Steel Factory Economic Activity Based on Satellites

    Directory of Open Access Journals (Sweden)

    Yi Zhou

    2018-06-01

    Full Text Available The Chinese government has promulgated a de-capacity policy for economic growth and environmental sustainability, especially for the iron and steel industry. With these policies, this study aimed to monitor the economic activities and evaluate the production conditions of an iron and steel factory based on satellites via Landsat-8 Thermal Infrared Sensor (TIRS data and high-resolution images from January 2013 to October 2017, and propel next economic adjustment and environmental protection. Our methods included the construction of a heat island intensity index for an iron and steel factory (ISHII, a heat island radio index for an iron and steel factory (ISHRI and a dense classifying approach to monitor the spatiotemporal changes of the internal heat field of an iron and steel factory. Additionally, we used GF-2 and Google Earth images to identify the main production area, detect facility changes to a factory that alters its heat field and verify the accuracy of thermal analysis in a specific time span. Finally, these methods were used together to evaluate economic activity. Based on five iron and steel factories in the Beijing-Tianjin-Hebei region, when the ISHII curve is higher than the seasonal changes in a time series, production is normal; otherwise, there is a shut-down or cut-back. In the spatial pattern analyses, the ISHRI is large in normal production and decreases when cut-back or shut-down occurs. The density classifying images and high-resolution images give powerful evidence to the above-mentioned results. Finally, three types of economic activities of normal production, shut-down or cut-back were monitored for these samples. The study provides a new perspective and method for monitoring the economic activity of an iron and steel factory and provides supports for sustainable development in China.

  8. A wireless embedded passive sensor for monitoring the corrosion potential of reinforcing steel

    International Nuclear Information System (INIS)

    Bhadra, Sharmistha; Thomson, Douglas J; Bridges, Greg E

    2013-01-01

    Corrosion of reinforcing steel, which results in premature deterioration of reinforced concrete structures, is a worldwide problem. Most corrosion sensing techniques require some type of wired connection between the sensor and monitoring electronics. This causes significant problems in their installation and long-term use. In this paper we describe a new type of passive embeddable wireless sensor that is based on an LC coil resonator where the resonant frequency is changed by the corrosion potential of the reinforcing steel. The resonant frequency can be monitored remotely by an interrogator coil inductively coupled to the sensor coil. The sensor unit comprises an inductive coil connected in parallel with a voltage dependent capacitor (varactor) and a pair of corrosion electrodes consisting of a reinforcing steel sensing electrode and a stainless steel reference electrode. Change of potential difference between the electrodes due to variation of the corrosion potential of the reinforcing steel changes the capacitance of the varactor and shifts the resonant frequency of the sensor. A time-domain gating method was used for the interrogation of the inductively coupled corrosion sensor. Results of an accelerated corrosion test using the sensor indicate that the corrosion potential can be monitored with a resolution of less than 10 mV. The sensor is simple in design and requires no power source, making it an inexpensive option for long-term remote monitoring of the corrosion state of reinforcing steel. (paper)

  9. Interphase and intergranular stress generation in carbon steels

    International Nuclear Information System (INIS)

    Oliver, E.C.; Daymond, M.R.; Withers, P.J.

    2004-01-01

    Neutron diffraction spectra have been acquired during tensile straining of high and low carbon steels, in order to compare the evolution of internal stress in ferritic steel with and without a reinforcing phase. In low carbon steel, the generation of intergranular stresses predominates, while in high carbon steel similar intergranular stresses among ferrite grain families are superposed upon a large redistribution of stress between phases. Comparison is made to calculations using elastoplastic self-consistent and finite element methods

  10. Stainless steels low temperature nitriding

    International Nuclear Information System (INIS)

    Roux, T.; Darbeida, A.; Von Stebut, J.; Michel, H.; Lebrun, J.P.; Hertz, D.

    1995-01-01

    Nitrogen ions implantation of 316L stainless steel leads to monophasic diffusion layers, which are constituted of a solid solution (γ N ) fcc, metastable, nitrogen sur-saturated, and without order. This article shows that for 316L stainless steels,these layers improve the tribological properties without degradation of the corrosion resistance. (A.B.). 13 refs. 6 figs

  11. A new steel with good low-temperature sulfuric acid dew point corrosion resistance

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, X.Q.; Li, X.G. [Corrosion and Protection Center, University of Science and Technology Beijing (China); Key Laboratory of Corrosion and Protection (Ministry of Education), Beijing (China); Sun, F.L. [Corrosion and Protection Center, University of Science and Technology Beijing (China); Lv, S.J. [Corrosion and Protection Center, University of Science and Technology Beijing (China); Equipment and Power Department, Shijiazhuang Refine and Chemical Company Limited, SINOPEC, Shijiazhuang (China)

    2012-07-15

    In this work, new steels (1, 2, and 3) were developed for low-temperature sulfuric acid dew point corrosion. The mass loss rate, macro- and micro-morphologies and compositions of corrosion products of new steels in 10, 30, and 50% H{sub 2}SO{sub 4} solutions at its corresponding dew points were investigated by immersion test, scanning electron microscopy (SEM) and energy-dispersive spectrometry (EDS). The results indicated that mass loss rate of all the tested steels first strongly increased and then decreased as H{sub 2}SO{sub 4} concentration increased, which reached maximum at 30%. Corrosion resistance of 2 steel is the best among all specimens due to its fine and homogeneous morphologies of corrosion products. The electrochemical corrosion properties of new steels in 10 and 30% H{sub 2}SO{sub 4} solutions at its corresponding dew points were studied by potentiodynamic polarization and electrochemical impedance spectroscopy (EIS) techniques. The results demonstrated that corrosion resistance of 2 steel is the best among all the experimental samples due to its lowest corrosion current density and highest charge transfer resistance, which is consistent with the results obtained from immersion tests. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  12. The creep properties of a low alloy ferritic steel containing an intermetallic precipitate dispersion

    International Nuclear Information System (INIS)

    Batte, A.D.; Murphy, M.C.; Edmonds, D.V.

    1976-01-01

    A good combination of creep rupture ductility and strength together with excellent long term thermal stability, has been obtained from a dispersion of intermetallic Laves phase precipitate in a non-transforming ferritic low alloy steel. The steel is without many of the problems currently associated with the heat affected zone microstructures of low alloy transformable ferritic steels, and can be used as a weld metal. Following suitable development to optimize the composition and heat treatment, such alloys may provide a useful range of weldable creep resistant steels for steam turbine and other high temperature applications. They would offer the unique possibility of easily achievable microstructural uniformity, giving good long term strength and ductility across the entire welded joint

  13. Mechanism of creep in stainless steel

    International Nuclear Information System (INIS)

    Monteiro, S.N.; Silveira, T.L.

    In the present work the creep criterions to identify the deformation mechanisms through the exponent of the strain rate versus stress relationship are presented. When applied to several stainless steels these criterions show an apparent contradiction for the proper mechanism acting at Σ/D above 10 9 /cm 2 . Microstructural aspects interfering in different manners with the fracture of these steels could be a reason for rationalizing the contradictory behavior. This is discussed in suggested deformation maps for the steels investigated [pt

  14. Consequences of Globalisation for the Belgian Steel Industry

    OpenAIRE

    DE GROOTE, Patrick

    2008-01-01

    Since a few years the worldwide steel industry has been under the spell of a great consolidation wave and enhanced competition. 2006 was a peak year with the merger of the European group Arcellor Mittal Steel to ArcellorMittal. With this merger, ArcellorMittal became the greatest steel group in the world with a market share of more than 10%. Thanks to the consolidation trend, the steel industry has changed from an obsolete and loss-making industry to a modern, attractive and profitable busine...

  15. Manufacture of Damascus steel: Metallographic study

    International Nuclear Information System (INIS)

    Criado, A.J.; Martinez, J.A.; Calabres, R.; Arias, D.

    1997-01-01

    Damascus Steel is the denomination that the Europeans gave to the material with which the musulman swords were manufactured during the Era of the Crusades. This hypereutectoid steel presents a high content in carbon more than 0.8%, and in some cases up to 2% in weight. The secret of its good mechanical characteristics is based in the hot forging process in the temperatures interval between 650 and 850 degree centigree. The final quenching in water brine or other aqueous solutions, confers to the swords manufactured with this steel a good resistance to its cutting edge and a high toughness. In the present investigation, the manufacture processes of this type of steel are studied. Electronic scanning microscopy has been applied to the study of materials manufactured by the authors following the ancient craftsmen methods of forging and quenching. (Author) 16 refs

  16. Comparative Research of Extra-large-span Cable-stayed Bridge with Steel Truss Girder and Steel Box Girder

    Directory of Open Access Journals (Sweden)

    Tan Manjiang

    2015-01-01

    Full Text Available To research structural performance of extra-large-span cable-stayed bridge under different section forms, with the engineering background of a 800m main-span cable-stayed bridge with steel truss girder, the cable-stayed bridge with steel box girder is designed according to the current bridge regulations when two bridges are designed in an ultimate state of the carrying capacity, so the maximum stress and minimum stress of the stress envelope diagram are substantially the same. A comprehensive comparison is given to two types of bridge on the aspect of static force, natural vibration frequency, stability, economic performance and so on. Analysis results provide future reference for the large-span cable-stayed bridge to select between the steel truss girder and the steel box girder.

  17. Simulation of a Local Collision of SC Wall Using High Energy Absorbing Steel

    Energy Technology Data Exchange (ETDEWEB)

    Yoo, H. K.; Chung, C. H.; Park, J.; Lee, J. W. [Dankook University, Yongin (Korea, Republic of); Kim, S. Y. [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)

    2011-05-15

    Local damage evaluations for nuclear power plant(NPP) design are performed against turbine impact, tornado impact, airplane engine impact, etc., where turbine is a internal source of impact, whereas tornado and airplane engine are external sources of impact. The thickness of NPP wall structure is determined at initial design stage not to be penetrated by local impacts. This study investigated the local damage of NPP substructure against internal turbine impact. Simulation of local collisions of SC wall in NPP structure, which consists of two models: one using general steel and the other using high energy absorbing steel, were performed. The performance of SC wall using ductile high energy absorbing steel can be greatly improved on local collisions when compared with that of general steel

  18. Simulation of a Local Collision of SC Wall Using High Energy Absorbing Steel

    International Nuclear Information System (INIS)

    Yoo, H. K.; Chung, C. H.; Park, J.; Lee, J. W.; Kim, S. Y.

    2011-01-01

    Local damage evaluations for nuclear power plant(NPP) design are performed against turbine impact, tornado impact, airplane engine impact, etc., where turbine is a internal source of impact, whereas tornado and airplane engine are external sources of impact. The thickness of NPP wall structure is determined at initial design stage not to be penetrated by local impacts. This study investigated the local damage of NPP substructure against internal turbine impact. Simulation of local collisions of SC wall in NPP structure, which consists of two models: one using general steel and the other using high energy absorbing steel, were performed. The performance of SC wall using ductile high energy absorbing steel can be greatly improved on local collisions when compared with that of general steel

  19. Tribological behaviour of line hardening of steel U13A with Nd: TAG laser

    International Nuclear Information System (INIS)

    Sagaro, R.; Ceballos, J. S.; Mascarell, J.; Blanco, A.

    1999-01-01

    To diminish wear in tribological systems is frequently to harden locally the load carrying areas, which are subjected to wear. A Nd: YAG laser was for the improvement of hardness and wear resistance of steel U13A. The friction and wear characteristics of steel U13A in sliding contact against steel 65MN4 under unlubricated conditions were evaluated for conventional treatments and after laser irradiation. In addition the transformations occurring during laser treatments and the influence of laser parameters for quenching on tribological characteristics are presented. The experimental work indicates that wear resistance of steel U13A (AISI W 112) is several times higher then that for conventional heat treatments

  20. The problems of high-nitrogen steels production

    International Nuclear Information System (INIS)

    Svyazhin, A.G.; Kaputkina, L.M.; Efimenko, S.P.

    1999-01-01

    Analysis of existing technologies of high-nitrogen steel production shows that rational nitrogen content in mass production corresponds to moderate high values. Such steels can be smelted under normal or slightly elevated pressure in steelmaking units, using processes of mass- and special metallurgy. High-nitrogen steels with ''overequilibrium'' nitrogen content are promising, but technology and equipment for production of them are complicated, and production of such steels is therefore limited. (orig.)

  1. Advanced high strength steels for automotive industry

    Energy Technology Data Exchange (ETDEWEB)

    Galan, J.; Samek, L.; Verleysen, P.; Verbeken, K.; Houbert, Y.

    2012-11-01

    The car industry is facing pressure because of the growing demand for more fuel-efficient passenger cars. In order to limit energy consumption and air pollution the weight of the car body has to be reduced. At the same time, high levels of safety have to be guaranteed. In this situation, the choice of material becomes a key decision in car design. As a response to the requirements of the automotive sector, high strength steels and advanced high strength steels have been developed by the steel industry. These modern steel grades offer an excellent balance of low cost, light weight and mechanical properties. (Author) 48 refs.

  2. Material physical properties of 12 chromium ferritic steel

    International Nuclear Information System (INIS)

    Ando, Masanori; Wakai, Takashi; Aoto, Kazumi

    2003-09-01

    High chromium ferritic steel is an attractive candidate for structural material of the next Fast Breeder Reactor, since both of thermal properties and high temperature strength of the steel are superior to those of conventional austenitic stainless steels. In this study, physical properties of 12Cr steels are measured and compared to those obtained in the previous studies to discuss about stochastic dispersions. The effect of measurement technique on Young's modulus and the influence of the specimen size on coefficient of thermal expansion are also investigated. The following conclusions are obtained. (1) Young's modulus of 12Cr steels obtained in this study tends to larger than those obtained in the previous studies especially in high temperature. Such a discrepancy is resulted from the difference in measurement technique. It was clarified that Young's modulus obtained by free vibration method is more adequate those obtained by the cantilever characteristic vibration method. Therefore, the authors recommend using the values obtained by free vibration method as Young's modulus of 12Cr steels. (2) Both instant and mean coefficient of thermal expansion of 12Cr steels obtained in this study is in a good agreement with those obtained in the previous studies. However, the obviously different values are obtained from the measurement by large size specimens. Such a discrepancy is resulted from heterogeneous during heating process of the specimens. Therefore, the authors recommend using the values obtained by φ4 x 20 mm specimens as instant and mean coefficient of thermal expansion of 12Cr steels. (3) Specific heat of 12Cr steels obtained in this study agree with those obtained in the previous studies with a few exceptions. (4)Thermal conductivity of 12Cr steels obtained in this study agree with those obtained in the previous studies. (5) It was confirmed that instant and mean coefficient of thermal expansion, density, specific heat and thermal conductivity of 12Cr steels

  3. CHARACTERIZATION OF NEW TOOL STEEL FOR ALUMINUM EXTRUSION DIES

    OpenAIRE

    José Britti Bacalhau; Fernanda Moreno Rodrigues; Rafael Agnelli Mesquita

    2014-01-01

    Aluminum extrusion dies are an important segment of application on industrial tools steels, which are manufactured in steels based on AISI H13 steel. The main properties of steels applied to extrusion dies are: wear resistance, impact resistance and tempering resistance. The present work discusses the characteristics of a newly developed hot work steel to be used on aluminum extrusion dies. The effects of Cr and Mo contents with respect to tempering resistance and the Al addition ...

  4. Validation of constitutive equations for steel

    International Nuclear Information System (INIS)

    Valentin, T.; Magain, P.; Quik, M.; Labibes, K.; Albertini, C.

    1997-01-01

    High strain rate mechanical properties are a major concern for each steel manufacturer, especially with respect to thin sheet steel used in the automotive branch. We began to study this topic by starting a project with the following goals: acquiring reliable experimental data, understanding in depth the energy absorption in thin sheet steel and finding the right constitutive material equation. The first part of the project has been presented in. In this paper we present data computation and comparison with the existing material model theories to exploit the experimental data. (orig.)

  5. Behaviour of steels in natural environments: focus on stainless steels in natural sea water

    International Nuclear Information System (INIS)

    Feron, D.

    2005-01-01

    Corrosion behaviour of steels and alloys in natural environments is not only dependent to material parameters and environmental chemistry, but also to micro-organisms which may be there. The global approach used to investigate the behaviour of alloys in natural environments is illustrated by the work done on stainless steels in seawater. In aerated seawater, studies led to the proposal of an 'enzymatic model' based on the enzymatic catalyze of the cathodic reaction and which allows reproducing the electrochemical behaviour of stainless steels in natural seawater and the crevice corrosion phenomena observed in natural sea waters. Coupling areas under aerobic and anaerobic conditions leads to the worst situation for stainless steel behaviour: the catalysis of the cathodic reaction on aerobic exposed surfaces and the decrease of the corrosion resistance of anaerobic surfaces due to sulphides. These results lead to the concept of electro-active bio-films. (author)

  6. Iron and steel research at CENIM

    International Nuclear Information System (INIS)

    Medina, S. F.; Lopez, F.; Morcillo, M.

    2003-01-01

    In 2002 the National Centre for Metallurgical Research (CENIM) celebrated its 39th anniversary. During this time, steel has been the most studied material of all the metals and alloys researched in the different projects funded by national science and technology plans, European metallurgical research programmes, and by the iron and steel making companies who over the years have placed their trust in the research work undertaken at CENIM. Two generations of researchers have dedicated their careers to studying the different aspects of steel, from primary metallurgy considering iron ores and enrichment processes, the thermodynamics of reactions in the blast furnace and in the ladle, thermal and thermomechanical treatments, the physical metallurgy of steels, their mechanical properties, and finally their deterioration in a wide range of media of different aggressivities. CENIM maintains its commitment to iron and steel research, drawing attention to the vast amount of research work undertaken and financed within the framework of the ECSC programme since Spain joined the European Community in January 1986. (Author) 3 refs

  7. Tribology of steel/steel interaction in oil-in-water emulsion; a rationale for lubricity.

    Science.gov (United States)

    Kumar, Deepak; Daniel, Jency; Biswas, S K

    2010-05-15

    Oil droplets are dispersed in water by an anionic surfactant to form an emulsion. The lubricity of this emulsion in steel/steel interaction is explored in a ball on flat nanotribometer. The droplet size and charge are measured using dynamic light scattering, while the substrate charge density is estimated using the pH titration method. These data are combined to calculate the DLVO forces for the droplets generated for a range of surfactant concentration and two oil to water volume ratios. The droplets have a clear bi-modal size distribution. The study shows that the smaller droplets which experience weak repulsion are situated (at the highest DLVO barrier) much closer to the substrate than the bigger droplets, which experience the same DLVO force, are. We suggest that the smaller droplets thus play a more important role in lubricity than what the bigger droplets do. The largest volume of such small droplets occurs in the 0.5 mM-1 mM range of surfactant concentration and 1% oil to water volume ratio, where the coefficient of friction is also observed to be the least. Copyright © 2010 Elsevier Inc. All rights reserved.

  8. Compatibility tests of steels in flowing liquid lead-bismuth

    International Nuclear Information System (INIS)

    Barbier, F.; Benamati, G.; Fazio, C.; Rusanov, A.

    2001-01-01

    The behaviour of steels exposed to flowing Pb-55Bi was evaluated. The materials tested are the two austenitic steels AISI 316L and 1.4970, and the six martensitic steels Optifer IVc, T91, Batman 27, Batman 28, EP823 and EM10 which were exposed to flowing Pb-55Bi for 1000, 2000 and 3000 h and at two temperatures (573 and 743 K). The corrosion tests were conducted in the non-isothermal loop of IPPE-Obninsk under a controlled oxygen level (10 -6 wt%). The compatibility study showed that at a lower temperature, a very thin oxide layer (<1 μm) was formed on the steels. At higher temperature, austenitic steels also exhibited a thin oxide layer sufficient to prevent their dissolution in the melt. A thicker oxide, which grew according to a parabolic law, was observed on the surface of the martensitic steels. The oxidation resistance behaviour of the martensitic steels was correlated with their alloying elements

  9. AES and SIMS analysis of non-metallic inclusions in a low-carbon chromium-steel.

    Science.gov (United States)

    Gammer, Katharina; Rosner, M; Poeckl, G; Hutter, H

    2003-05-01

    In the final step of secondary metallurgical steel processing, calcium is added. Besides Mg, Ca is the most powerful deoxidiser and desulfurisation agent. It reacts with dissolved oxygen and sulfur and reduces oxides and sulfides thereby forming non-metallic inclusions. Within this paper we present the analysis of such inclusions in a low-carbon chromium-steel. Depending on the time of quenching of the steel sample, different structures were revealed by REM, Auger and SIMS: If the steel was quenched immediately after Ca-addition, non-metallic inclusions that appeared to have "cavities" could be detected with SEM. SIMS investigations of these particles showed ring-shaped structures and revealed that the ring is made up of Al, Ca, Mg, O and S. No secondary ions however could be retrieved from the core inside the ring, thus leaving the nature of the "cavities" unclear. If the steel sample was quenched 3 min after Ca addition, inclusions did not have a ring-shaped structure but a compact one.

  10. Study of Irradiation Effects on the Fracture Properties of A533-Series Ferritic Steels

    International Nuclear Information System (INIS)

    Lee, Yong Bok; Lee, Gyeong Geun; Kwon, Jun Hyun

    2011-01-01

    Since the Kori nuclear power plant unit 3 (Kori-3) was founded in 1986, the surveillance tests have been conducted five times. One of the primary objectives of the surveillance test is to determine the effects of irradiation on reactor pressure vessel (RPV) steel embrittlement. The RPV is made out of ferritic steels such as SA533 type B class 1, which were used for early nuclear power plants industry including Kori-2, 3, 4 and Yonggwang-1, 2 units in Korea. The Westinghouse supplied Kori-3 with the RPV steels ASTM A533 grade B class 1, which is equivalent to SA533 type B class 1. The irradiation effects on tensile properties in ASTM A533 grade B class 1 steel had been studied by Steichen and Williams. They experimentally determined the effect of strain rate and temperature on the tensile properties of unirradiated and irradiated A533 grade B steel 1. The effects of neutron irradiation on ferritic steels could be determined from tensile properties, as well as the fracture strength and toughness measurements. Hunter and Williams have reported that the strength and ductility for unirradiated material at a low strain rate increase with decreasing test temperature. Also, neutron irradiation increases strength and decreases ductility. Crosley and Ripling revealed that the yield strength of unirradiated material rapidly increases with the strain rate. Therefore, yield strength for unirradiated and irradiated materials should be determined by test parameters along with strain rate and temperature. In this study we compare ASTM A533 grad B class 1 steel obtained from several papers with SA533 type B class 1 steel taken from the surveillance data of Kori-3 unit, whose mechanical property of unirradiated and irradiated materials was correlated with the rate-temperature parameter

  11. Distribution of Stress in Deformation Zone of Niobium Microalloyed Steel

    Science.gov (United States)

    Jandrlić, Ivan; Rešković, Stoja; Brlić, Tin

    2018-07-01

    Microalloyed steels today represent a significant part of total world production and processing of steel. Although widely used, there are scarce data on the stress distribution in the deformation zone of these steels. Research was carried out on two steel grades, both low-carbon structural steels with the same basic chemical composition, with one of them additionally microalloyed with niobium. Differences in the stress distribution in the deformation zone between two tested steels were continuously observed and measured using the methods of digital image correlation and thermography. It has been found out that niobium microalloyed steel has significantly more complex material flow and stress distribution in the deformation zone when compared to the plain low carbon steel.

  12. Distribution of Stress in Deformation Zone of Niobium Microalloyed Steel

    Science.gov (United States)

    Jandrlić, Ivan; Rešković, Stoja; Brlić, Tin

    2018-03-01

    Microalloyed steels today represent a significant part of total world production and processing of steel. Although widely used, there are scarce data on the stress distribution in the deformation zone of these steels. Research was carried out on two steel grades, both low-carbon structural steels with the same basic chemical composition, with one of them additionally microalloyed with niobium. Differences in the stress distribution in the deformation zone between two tested steels were continuously observed and measured using the methods of digital image correlation and thermography. It has been found out that niobium microalloyed steel has significantly more complex material flow and stress distribution in the deformation zone when compared to the plain low carbon steel.

  13. The Vibration Based Fatigue Damage Assessment of Steel and Steel Fiber Reinforced Concrete (SFRC Composite Girder

    Directory of Open Access Journals (Sweden)

    Xu Chen

    2015-01-01

    Full Text Available The steel-concrete composite girder has been usually applied in the bridge and building structures, mostly consisting of concrete slab, steel girder, and shear connector. The current fatigue damage assessment for the composite girder is largely based on the strain values and concrete crack features, which is time consuming and not stable. Hence the vibration-based fatigue damage assessment has been considered in this study. In detail, a steel-steel fiber reinforced concrete (SFRC composite girder was tested. The steel fiber reinforced concrete is usually considered for dealing with the concrete cracks in engineering practice. The composite girder was 3.3m long and 0.45m high. The fatigue load and impact excitation were applied on the specimen sequentially. According to the test results, the concrete crack development and global stiffness degradation during the fatigue test were relatively slow due to the favourable performance of SFRC in tension. But on the other hand, the vibration features varied significantly during the fatigue damage development. Generally, it confirmed the feasibility of executing fatigue damage assessment of composite bridge based on vibration method.

  14. Prevention of Crevice Corrosion of STS 304 Stainless Steel by a Mg-alloy Galvanic Anode

    International Nuclear Information System (INIS)

    Lim, U. J.; Yun, B. D.; Kim, J. J.

    2006-01-01

    Prevention of crevice corrosion was studied for STS 304 stainless steel using a Mg-alloy galvanic anode in solutions with various specific resistivity. The crevice corrosion and corrosion protection characteristics of the steel was investigated by the electrochemical polarization and galvanic corrosion tests. Experimental results show that the crevice corrosion of STS 304 stainless steel does not occur in solutions of high specific resistivity, but it occurs in solutions of low specific resistivity like in solutions with resistivities of 30, 60 and 115 Ω · m. With decreasing specific resistivity of the solution, the electrode potential of STS 304 stainless steel in the crevice is lowered. The potential of STS 304 stainless steel in the crevice after coupling is cathodically polarized more by decreasing specific resistivity indicating that the crevice corrosion of STS 304 stainless steel is prevented by the Mg-alloy galvanic anode

  15. Corrosion-resistant coating technique for oxide-dispersion-strengthened ferritic/martensitic steel

    International Nuclear Information System (INIS)

    Sakasegawa, Hideo; Tanigawa, Hiroyasu; Ando, Masami

    2014-01-01

    Oxide-dispersion-strengthened (ODS) steels are attractive materials for application as fuel cladding in fast reactors and first-wall material of fusion blanket. Recent studies have focused more on high-chromium ferritic (12-18 wt% Cr) ODS steels with attractive corrosion resistance properties. However, they have poor material workability, require complicated heat treatments for recrystallization, and possess anisotropic microstructures and mechanical properties. On the other hand, low-chromium ferritic/martensitic (8-9 wt% Cr) ODS steels have no such limitations; nonetheless, they have poor corrosion resistance properties. In our work, we developed a corrosion-resistant coating technique for a low-chromium ferritic/martensitic ODS steel. The ODS steel was coated with the 304 or 430 stainless steel, which has better corrosion resistances than the low-chromium ferritic/martensitic ODS steels. The 304 or 430 stainless steel was coated by changing the canning material from mild steel to stainless steel in the conventional material processing procedure for ODS steels. Microstructural observations and micro-hardness tests proved that the stainless steels were successfully coated without causing a deterioration in the mechanical property of the low-chromium ferritic/martensitic ODS steel. (author)

  16. A preliminary bending fatigue spectrum for steel monostrand cables

    DEFF Research Database (Denmark)

    Winkler, Jan; Fischer, Gregor; Georgakis, Christos T.

    2011-01-01

    This paper presents the results of the experimental study on the bending fatigue resistance of high-strength steel monostrand cables. From the conducted fatigue tests in the high-stress, low-cycle region, a preliminary bending fatigue spectrum is derived for the estimation of monostrand cable...... service life expectancy. The presented preliminary bending fatigue spectrum of high-strength monostrands is currently unavailable in the published literature. The presented results provide relevant information on the bending mechanism and fatigue characteristics of monostrand steel cables in tension...... and flexure and show that localized cable bending has a pronounced influence on the fatigue resistance of cables under dynamic excitations....

  17. Plastic deformation and fracture behaviors of nitrogen-alloyed austenitic stainless steels

    International Nuclear Information System (INIS)

    Wang Songtao; Yang Ke; Shan Yiyin; Li Laifeng

    2008-01-01

    The plastic deformation and fracture behaviors of two nitrogen-alloyed austenitic stainless steels, 316LN and a high nitrogen steel (Fe-Cr-Mn-0.66% N), were investigated by tensile test and Charpy impact test in a temperature range from 77 to 293 K. The Fe-Cr-Mn-N steel showed ductile-to-brittle transition (DBT) behavior, but not for the 316LN steel. X-ray diffraction (XRD) confirmed that the strain-induced martensite occurred in the 316LN steel, but no such transformation in the Fe-Cr-Mn-N steel. Tensile tests showed that the temperature dependences of the yield strength for the two steels were almost the same. The ultimate tensile strength of the Fe-Cr-Mn-N steel displayed less significant temperature dependence than that of the 316LN steel. The strain-hardening exponent increased for the 316LN steel, but decreased for the Fe-Cr-Mn-N steel, with decreasing temperature. Based on the experimental results and the analyses, a modified scheme was proposed to explain the fracture behaviors of austenitic stainless steels

  18. Water corrosion resistance of ODS ferritic-martensitic steel tubes

    International Nuclear Information System (INIS)

    Narita, Takeshi; Ukai, Shigeharu; Kaito, Takeji; Ohtsuka, Satoshi; Matsuda, Yasuji

    2008-01-01

    Oxide dispersion strengthened (ODS) ferritic-martensitic steels have superior radiation resistance; it is possible to achieve a service temperature of up to around 973 K because of their superior creep strength. These advantages of ODS steels facilities their application to long-life cladding tubes in advanced fast reactor fuel elements. In addition to neutron radiation resistance, sufficient general corrosion resistance to maintain the strength of the cladding, and the stress corrosion cracking (SCC) resistance for spent-fuel-pool cooling systems and high-temperature oxidation for the fuel-clad chemical interaction (FCCI) of ODS ferritic steel are required. Although the addition of Cr to ODS is effective in preventing water corrosion and high-temperature oxidation, an excessively high amount of Cr leads to embrittlement due to the formation of a Cr-rich α' precipitate. The Cr content in 9Cr-ODS martensite and 12Cr-ODS ferrite, the ODS steels developed by the Japan Atomic Energy Agency (JAEA), is controlled. In a previous paper, it has been demonstrated that the resistances of 9Cr- and 12Cr-ODS ferritic-martensitic steels for high-temperature oxidation are superior to those of conventional 12Cr ferritic steel. However, the water corrosion data of ODS ferritic-martensitic steels are very limited. In this study, a water corrosion test was conducted on ODS steels in consideration of the spent-fuel-pool cooling condition, and the results were compared with those of conventional austenitic stainless steel and ferritic-martensitic stainless steel. (author)

  19. A quality approach to maintain the properties of S235 JR structural carbon steel in Lebanon

    International Nuclear Information System (INIS)

    Sidawi, J.A.; Al Khatib, H.

    2004-01-01

    Full text.S235JR carbon steel is one of the most popular steels used in Lebanon. It is imported by steel dealers and is widely used by all fabricators and manufacturers of steels for many structural purposes and applications. This kind of steel has good ductile properties as well as excellent weldability. It is still known by its previous designation St 37-2 or E 24-2. S235JR is produced in many shapes and thicknesses such as steel plates, sheets, angles and different other geometric shapes. Standard chemical and mechanical tests were conducted and reported on S235JR hot-rolled structural low-carbon mild steel specimens collected from Lebanese steel market. The main objective of this work is to assure the compliance of these properties with those set by the steel manufacturer. The above mentioned tests were performed at the laboratories of the Industrial Research Institute (IR) in Lebanon to assure the quality and credibility of the results. related European and American standards were presented as references and compared with the achieved results. Discussion was presented to show the similarities and differences between S235JR steel samples and standard requirements. Some of the reasons for such differences were discussed. Sufficient data was furnished through this work for the public and mainly for the Lebanese Standard Organization LIBNOR to easily adopt and implement the EN 10025:1993 European standard that can be applied in Lebanon concerning the most commonly used hot rolled low carbon structural steel. A follow up concerning adopting and implementing EN 10025:1993 will be briefed

  20. Superheat effect on bainite steel hardenability

    International Nuclear Information System (INIS)

    Kubachek, V.V.; Sklyuev, P.V.

    1978-01-01

    The bainite hardenability of 34KhN1M and 35 KhN1M2Ph steels has been investigated by the end-face hardening technique. It is established that, as the temperature of austenitization rises from 900 to 1280 deg C, the temperature of bainite transformation increases and bainite hardenability of the steels falls off. A repeated slow heating to 900 deg C of previously overheated 34KhN1M steel breaks up grain, lowers the temperature of the bainite transformation and raises the hardenability to values obtained with ordinary hardening from 900 deg C. A similar heating of previously overheated 35KhN1M2Ph steel is accompanied by restoration of initial coarse grains and maintenance of both the elevated bainite transformation temperature and to lower hardenability corresponding to hardening from the temperature of previous overheating

  1. Tensile behavior of borated stainless steels

    International Nuclear Information System (INIS)

    Stephens, J.J. Jr.; Sorenson, K.B.

    1991-01-01

    Borated stainless steel tensile testing is being conducted at Sandia National Laboratories (SNL). The goal of the test program is to provide data to support a code case inquiry to the ASME Boiler and Pressure Vessel Code, Section III. The adoption by ASME facilitates a material's qualification for structural use in transport cask applications. For transport cask basket applications, the potential advantage to using borated stainless steel arises from the fact that the structural and criticality control functions can be combined into one material. This can result in a decrease in net section thickness of the basket web (increased payload capacity) and eliminates the fabrication process and cost of attaching a discrete boron poison material to the basket web. In addition, adding borate stainless steel to the inventory of acceptable structural material provides the Department of Energy (DOE) and its cask contractors an alternative to current proposed materials which have not been qualified for structural service. The test program at SNL involves procuring material, machining test specimens, and conducting the tensile tests. From test measurements obtained so far, general trends indicate that tensile properties (yield strength and ultimate strength) increase with boron content and are in all cases superior to the minimum required properties established in A-240, Type 304, a typical grade of austenitic stainless steel. Therefore, in a designed basket, web thicknesses using borated stainless steel would be comparable to or thinner tan an equivalent basket manufactured from a typical stainless steel without boron additions. General trends from test results indicate that ductilities decrease with increasing boron content

  2. Detection of Interfacial Debonding in a Rubber-Steel-Layered Structure Using Active Sensing Enabled by Embedded Piezoceramic Transducers.

    Science.gov (United States)

    Feng, Qian; Kong, Qingzhao; Jiang, Jian; Liang, Yabin; Song, Gangbing

    2017-09-01

    Rubber-steel-layered structures are used in many engineering applications. Laminated rubber-steel bearing, as a type of seismic isolation device, is one of the most important applications of the rubber-steel-layered structures. Interfacial debonding in rubber-steel-layered structures is a typical failure mode, which can severely reduce their load-bearing capacity. In this paper, the authors developed a simple but effective active sensing approach using embedded piezoceramic transducers to provide an in-situ detection of the interfacial debonding between the rubber layers and steel plates. A sandwiched rubber-steel-layered specimen, consisting of one rubber layer and two steel plates, was fabricated as the test specimen. A novel installation technique, which allows the piezoceramic transducers to be fully embedded into the steel plates without changing the geometry and the surface conditions of the plates, was also developed in this research. The active sensing approach, in which designed stress waves can propagate between a pair of the embedded piezoceramic transducers (one as an actuator and the other one as a sensor), was employed to detect the steel-rubber debonding. When the rubber-steel debonding occurs, the debonded interfaces will attenuate the propagating stress wave, so that the amplitude of the received signal will decrease. The rubber-steel debonding was generated by pulling the two steel plates in opposite directions in a material-testing machine. The changes of the received signal before and after the debonding were characterized in a time domain and further quantified by using a wavelet packet-based energy index. Experiments on the healthy rubber-steel-layered specimen reveal that the piezoceramic-induced stress wave can propagate through the rubber layer. The destructive test on the specimen demonstrates that the piezoceramic-based active sensing approach can effectively detect the rubber-steel debonding failure in real time. The active sensing

  3. Volatility Spillover in Chinese Steel Markets

    Science.gov (United States)

    Fang, Wen

    2018-03-01

    This paper examines volatility spillover in Chinese steel markets by comparing spillover effects before and after steel futures market established and finds some interesting change. Volatility spillover method based on multi-GARCH model are proposed. The results show that there is significant proof for spillover effects from B2B electronic market to spot market, and two-way effects between futures and spot market. Market policy planners and practitioners could make decisions according to the master of spillovers. We also find that B2B e-market and futures market can both provide efficient protection against steel price volatility risk, B2B e-market offer a broad-based platform for trading steel commodities over time and space since e-market role in information flow process is dominant.

  4. Thermal embrittlement of reactor vessel steels

    International Nuclear Information System (INIS)

    Corwin, W.R.; Nanstad, R.K.; Alexander, D.J.; Stoller, R.E.; Wang, J.A.; Odette, G.R.

    1995-01-01

    As a result of observations of possible thermal embrittlement from recent studies with welds removed from retired steam generators of the Palisades Nuclear Plant (PNP), an assessment was made of thermal aging of reactor pressure vessel (RPV) steels under nominal reactor operating conditions. Discussions are presented on (1) data from the literature regarding relatively low-temperature thermal embrittlement of RPV steels; (2)relevant data from the US power reactor-embrittlement data base (PR-EDB); and (3)potential mechanisms of thermal embrittlement in low-alloy steels

  5. A study of the condition for the passivation of carbon steel in bentonite

    International Nuclear Information System (INIS)

    Taniguchi, Naoki; Morimoto, Masataka; Honda, Akira

    1999-01-01

    It is important to study the corrosion behavior of materials to be used for overpack for high-level radioactive waste disposal. Carbon steel is one of the candidate materials. The type of corrosion on carbon steel depends on whether the carbon steel is passivated or not. In this study, the condition for the passivation of carbon steel was studied using bentonite as the buffer material. Anodic polarization in bentonite and the measurements of pH of porewater in bentonite was measured. The results of these experiments showed that the possibility of passivation is small in highly compacted bentonite in groundwater in Japan. Therefore, localized corrosion on carbon steel due to the breakdown of passive film is unlikely in bentonite. In other words, general corrosion seems to be the most probable type of corrosion under repository condition in Japan. (author)

  6. Behaviour of carbon steel and chromium steels in CO2 environments

    International Nuclear Information System (INIS)

    Lefebvre, B.; Bounie, P.; Guntz, G.; Prouheze, J.C.; Renault, J.J.

    1984-01-01

    The behavior in aqueous CO 2 environments of steel with chromium content between 0 and 22% has been studied by autoclave tests. The influence of chromium and molybdenum contents has been investigated particularly on 13 Cr steel. Conventional electrochemical test results are related to the CO 2 autoclave test results. The influence of the environment: temperature, chloride concentration, partial pressure of CO 2 and some amount of H 2 S on the corrosion resistance are discussed

  7. Study of the distribution of alloying elements between the phases of a heat treated steel

    International Nuclear Information System (INIS)

    Lambert, N.; Greday, T.

    1977-01-01

    The behavior of some low-alloy steels during industrial heat treatments is systematically studied. Firstly, the influence of the chemical analysis of the steel, the shape and size of carbides on the kinetics of the dissolution of these carbides at high temperature is pointed out in the case of steels with a relatively simple chemical analysis. Secondly, the effect of tempering treatments on the mechanical properties and characteristic parameters of the microstructure is studied in the case of three low-alloy steels. Bainitic microstructure appears to be the less disturbed one after a tempering treatment. Against, martensitic microstructures undergo an important softening and the mechanical properties of the pearlite lie as a very low level whatever their heat treatment. Peculiar conditions of tempering promotes a fine precipitation and its combined secondary hardening. These conditions are related to both chemical analysis and initial microstructure of the steel. Besides, some chemical identifications were performed in the scanning electron microscope on alloyed carbides precipitated in the steel during very long time tempering treatments

  8. Enhanced Inclusion Removal from Steel in the Tundish

    Energy Technology Data Exchange (ETDEWEB)

    R. C. Bradt; M.A.R. Sharif

    2009-09-25

    The objective of this project was to develop an effective chemical filtering system for significantly reducing the content of inclusion particles in the steel melts exiting the tundish for continuous casting. This project combined a multi-process approach that aimed to make significant progress towards an "inclusion free" steel by incorporating several interdependent concepts to reduce the content of inclusions in the molten steel exiting the tundish for the caster. The goal is to produce "cleaner" steel.

  9. Enhanced Incluison Removal from Steel in the Tundish

    Energy Technology Data Exchange (ETDEWEB)

    R.C. Bradt; M.A.R. Sharif

    2009-09-25

    The objective of this project was to develop an effective chemical filtering system for significantly reducing the content of inclusion particles in the steel melts exiting the tundish for continuous casting. This project combined a multi-process approach that aimed to make significant progress towards an "inclusion free" steel by incorporating several interdependent concepts to reduce the content of inclusions in the molten steel exiting the tundish for the caster. The goal is to produce "cleaner" steel.

  10. Durability of light steel framing in residential applications

    OpenAIRE

    Lawson, RM; Popo-Ola, S.O.; Way, A.; Heatley, T; Pedreschi, Remo

    2010-01-01

    This paper presents a summary and analysis of research findings on the durability of galvanised cold-formed steel sections used in housing in order to deduce their design life. These cold-formed sections are produced from pre-galvanised strip steel. It reviews reports and publications from research projects carried out by Corus and the Steel Construction Institute on zinc-coated, cold-formed steel products. New data have also been gathered from measurements on houses and similar buildings tha...

  11. Interlayers Applied to CVD Diamond Deposition on Steel Substrate: A Review

    Directory of Open Access Journals (Sweden)

    Djoille Denner Damm

    2017-09-01

    Full Text Available Academics and industry have sought after combining the exceptional properties of diamonds with the toughness of steel. Since the early 1990s several partial solutions have been found but chemical vapor deposition (CVD diamond deposition on steel substrate continues to be a persistent problem. The main drawbacks are the high carbon diffusion from gas phase into substrate, the transition metals on the material surface that catalyze sp2 bond formation, instead of sp3 bonds, and the high thermal expansion coefficient (TEC mismatch between diamond and steels. An intermediate layer has been found necessary to increase diamond adhesion. Literature has proposed many efficient intermediate layers as a diffusion barrier for both, carbon and iron, but most intermediate layers shown have not solved TEC mismatch. In this review, we briefly discuss the solutions that exclusively work as diffusion barrier and discuss in a broader way the ones that also solve, or may potentially solve, the TEC mismatch problem. We examine some multilayers, the iron borides, the chromium carbides, and vanadium carbides. We go through the most relevant results of the last two and a half decades, including recent advances in our group. Vanadium carbide looks promising since it has shown excellent diffusion barrier properties, its TEC is intermediary between diamond and steel and, it has been thickened to manage thermal stress relief. We also review a new deposition technique to set up intermediate layers: laser cladding. It is promising because of its versatility in mixing different materials and fusing and/or sintering them on a steel surface. We conclude by remarking on new perspectives.

  12. Microstructural Development during Welding of TRIP steels

    NARCIS (Netherlands)

    Amirthalingam, M.

    2010-01-01

    The Advanced High Strength Steels (AHSS) are promising solutions for the production of lighter automobiles which reduce fuel consumption and increase passenger safety by improving crash-worthiness. Transformation Induced Plasticity Steel (TRIP) are part of the advanced high strength steels which

  13. Precaution against radioactive contamination of steel products in Germany

    International Nuclear Information System (INIS)

    Ewers, E.; Schulz-Klemp, V.; Steffen, R.

    1999-01-01

    Regulations for handling of radioactive materials in Germany. Engagement of the Germany Iron and Steel Institute (VDEh) since the end of the eighties and measures taken. Level of radioactivity in uncontaminated steel products. Agreements between steel industry and scrap supplying industry as well as terms of delivery. Actual status of equipment for detection of radioactivity in the German steel plants. Demands of steel users for clean steel. (author)

  14. Joining uranium to steel

    International Nuclear Information System (INIS)

    Perkins, M.A.

    1976-05-01

    A method has been devised which will allow the joining of uranium to steel by fusion welding through the use of an intermediate material. Uranium-0.5 titanium was joined to AISI 304L stainless steel by using a vanadium insert. Also, a method is now available for selecting possible filler metals when two entirely dissimilar metals need to be joined. This method allows a quantitative ranking to be made of the possible filler metals and thus the most likely candidate can be selected

  15. Influence of Steel Fibers on the Structural Performance of a Prestressed Concrete Containment Building

    International Nuclear Information System (INIS)

    Choun, Youngsun; Hahm, Daegi; Park, Junhee

    2013-01-01

    A large number of previous experimental investigations indicate that the use of steel fibers in conventional reinforced concrete (RC) can enhance the structural and functional performance of prestressed concrete containment buildings (PCCBs) in nuclear power plants. A prevention of through-wall cracks and an increase of the post-cracking ductility will improve the ultimate internal pressure capacity, and a high shear resistance under cyclic loadings will increase the seismic resisting capacity. In this study, the effects of steel fiber reinforced concrete (SFRC) on the ultimate pressure and seismic capacities of a PCCB are investigated. The effects of steel fibers on the ultimate pressure and shear resisting capacities of a PCCB are investigated. It is revealed that both of the ultimate pressure capacity and the shear resisting capacity of a PCCB can be greatly enhanced by introducing steel fibers in a conventional RC. Estimation results indicate that the ultimate pressure capacity and maximum lateral displacement of a PCCB can be improved by 16% and 64%, respectively, if a conventional RC contains hooked steel fibers in a volume fraction of 1.0%

  16. Influence of Steel Fibers on the Structural Performance of a Prestressed Concrete Containment Building

    Energy Technology Data Exchange (ETDEWEB)

    Choun, Youngsun; Hahm, Daegi; Park, Junhee [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2013-05-15

    A large number of previous experimental investigations indicate that the use of steel fibers in conventional reinforced concrete (RC) can enhance the structural and functional performance of prestressed concrete containment buildings (PCCBs) in nuclear power plants. A prevention of through-wall cracks and an increase of the post-cracking ductility will improve the ultimate internal pressure capacity, and a high shear resistance under cyclic loadings will increase the seismic resisting capacity. In this study, the effects of steel fiber reinforced concrete (SFRC) on the ultimate pressure and seismic capacities of a PCCB are investigated. The effects of steel fibers on the ultimate pressure and shear resisting capacities of a PCCB are investigated. It is revealed that both of the ultimate pressure capacity and the shear resisting capacity of a PCCB can be greatly enhanced by introducing steel fibers in a conventional RC. Estimation results indicate that the ultimate pressure capacity and maximum lateral displacement of a PCCB can be improved by 16% and 64%, respectively, if a conventional RC contains hooked steel fibers in a volume fraction of 1.0%.

  17. A morphological evaluation of a duplex stainless steel processed by high energy Ball Mill

    International Nuclear Information System (INIS)

    Yonekubo, Ariane Emi; Cintho, Osvaldo Mitsuyuki; Aguiar, Denilson Jose Marcolino de; Capocchi, Jose Deodoro Trani

    2009-01-01

    The duplex stainless steels are formed by a ferrite and austenite mixture, giving them a combination of properties. Commercially, these steels are hot rolled, developing an anisotropic, alternated ferrite and austenite elongated lamellae microstructure. In this work, a duplex stainless steel was produced by the mixture of elementary powders with the composition Fe-19.5Cr-5Ni processed in an ATTRITOR ball mill during periods up to 15 hours. The powders obtained were compressed in specimens and were heat treated in the temperatures of 900, 1050 and 1200 °C during 1 hour and analysed by x ray diffraction, optic microscopy, scanning electron microscopy and energy dispersion spectroscopy. An optimized microstructure with ultrafine, equiaxial and regular duplex microstructure was obtained in the 15 hour milling and 1200 °C heat treatment. Afterwards, a commercially super duplex stainless steel UNS S32520 was aged at 800 °C aiming the precipitation of σ phase in order to reduce its toughness and then, milled in SPEX mill. The resulting microstructure was a very fine duplex type with irregular grain boundary morphology duo to the grain growth barrier promoted by the renascent σ phase particles during sintering process. (author)

  18. Numerical simulation of convection and inclusion distribution during solidification in a heavy steel ingot

    International Nuclear Information System (INIS)

    Lin, Rui; Shen, Houfa

    2015-01-01

    Inclusions content in the steel ingot is an important index for homogeneity, and it becomes more serious for heavy steel ingots which are used for major equipment. However, knowledge about the formation of inclusion in steel ingot is limited, and modeling of inclusion distribution is still challenging, so it is of great significance to research the behavior of inclusion. In this paper, fluid flow during solidification is numerically simulated based on the equilibrium equations of mass, momentum and energy, and then inclusion distribution is modeled according to the Lagrangian Stokes trajectory method. The Results show that the inclusion distribution in the steel ingot is influenced by the flow pattern which is affected by the solidification pattern. Therefore, inclusion distribution could be controlled by the solidification front with the optimization of heat transfer condition such as the hot top design of steel ingot for the high quality steel production. (paper)

  19. 49 CFR 192.55 - Steel pipe.

    Science.gov (United States)

    2010-10-01

    ... Other Regulations Relating to Transportation (Continued) PIPELINE AND HAZARDOUS MATERIALS SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) PIPELINE SAFETY TRANSPORTATION OF NATURAL AND OTHER GAS BY PIPELINE: MINIMUM FEDERAL SAFETY STANDARDS Materials § 192.55 Steel pipe. (a) New steel pipe is...

  20. Radioisotope methods of investigations of phenomenons at phases border of steel - atmosphere in gaseous processes of thermochemical treatment of steel

    International Nuclear Information System (INIS)

    L'utse-Birk, A.; Bel'ski, V.; Vez'ranovski, Eh.; Valis', L.

    1979-01-01

    Radioisotope methods of investigations of the processes of thermochemical treatment of steels are valuable, and in some cases, the only means for analysis of complicated mechanisms of diffusion, absorption and chemical reactions, going on in some technological processes. New specific methods are stated for investigation of processes on the border between steel and gaseous atmosphere. Quantative method nas been developed for investigation of the kinetics of carbon transfere (labelled by carbon-14) from steel into gases. Hydrocarbons and their derivatives are adsorbed selectivelly and beta-activity of the compound is measured in the presence of liquid scintillators. Limiting detectable amount of carbon equals to 0.5μg. Application of labelled (by radioisotope iron-59) iron in steel has ensured a possibility to determine its participation in reactions with chromium and titanum coating atmospheres. Application of hydrocarbons labelled by carbon-14 in the composition of titanum coating atmosphere has permitted to determine, in comparison with investigation of carbon diffusion in steel, participation of two different carbon sources in the forming of the TiC layer on steel and has led to the optimization of processes, especially for low-carbon steels [ru