WorldWideScience

Sample records for a 285 steel

  1. 30 CFR 285.231 - How will MMS process my unsolicited request for a noncompetitive lease?

    Science.gov (United States)

    2010-07-01

    ... a noncompetitive lease? 285.231 Section 285.231 Mineral Resources MINERALS MANAGEMENT SERVICE... described in §§ 285.640 through 285.648. (e) The MMS will coordinate and consult with affected Federal.... (1) Within 10 business days after you receive the lease copies you must: (i) Execute the lease; (ii...

  2. 30 CFR 285.706 - How do I nominate a CVA for MMS approval?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How do I nominate a CVA for MMS approval? 285..., Fabrication, and Installation Certified Verification Agent § 285.706 How do I nominate a CVA for MMS approval... (§ 285.610(a)(9)) or GAP (§ 285.645(c)(5)), you must nominate a CVA for MMS approval. You must specify...

  3. 49 CFR 40.285 - When is a SAP evaluation required?

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false When is a SAP evaluation required? 40.285 Section... § 40.285 When is a SAP evaluation required? (a) As an employee, when you have violated DOT drug and... unless you complete the SAP evaluation, referral, and education/treatment process set forth in this...

  4. 30 CFR 285.605 - What is a Site Assessment Plan (SAP)?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What is a Site Assessment Plan (SAP)? 285.605... Assessment Plan (SAP)? (a) A SAP describes the activities (e.g., installation of meteorological towers... project easement, or to test technology devices. (1) Your SAP must describe how you will conduct your...

  5. 30 CFR 285.620 - What is a Construction and Operations Plan (COP)?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What is a Construction and Operations Plan (COP... Information Requirements Construction and Operations Plan for Commercial Leases § 285.620 What is a Construction and Operations Plan (COP)? The COP describes your construction, operations, and conceptual...

  6. 41 CFR 102-117.285 - What are my choices if a TSP's performance is not satisfactory?

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false What are my choices if a TSP's performance is not satisfactory? 102-117.285 Section 102-117.285 Public Contracts and Property... are my choices if a TSP's performance is not satisfactory? You may choose to place a TSP in temporary...

  7. 30 CFR 285.617 - What activities require a revision to my SAP, and when will MMS approve the revision?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What activities require a revision to my SAP, and when will MMS approve the revision? 285.617 Section 285.617 Mineral Resources MINERALS MANAGEMENT...: (1) Designed not to cause undue harm or damage to natural resources; life (including human and...

  8. Endolymphatic radiotherapy in malignant lymphomas. A clinical evaluation of 285 patients

    Energy Technology Data Exchange (ETDEWEB)

    Bonadonna, G.; Chiappa, S.; Musumeci, R.; Uslenghi, C.

    1968-10-01

    The authors report treatment of inguinal and retroperitoneal lymph nodes of 285 malignant lymphomas (143 Hodgkin's disease and 142 lymphoreticular sarcomas) with Lipiodol Fluide /sup 131/I (endolymphatic radiotherapy). From 1961 to 1966 the radioactive contrast material was injected in doses ranging from 0.2 to 2.5 mc/cc (10 cc each foot). Adequately opacified nodes responded promptly with marked and progressive reduction in size. When indicated, a second administration of Lipiodol /sup 131/I in a dose of 2.5 mc/cc was always feasible. Several factors prevented a homogeneous and satisfactory distribution of radioactive contrast material throughout the iliac and the para-aortic nodes in one third of the cases. Therefore, in many instances patients had to be treated with external radiation therapy. Histopathologic examination of lymph nodes removed at exploratory laparotomy (four cases) or at autopsy (ten cases) confirmed that Lipiodol /sup 131/I did not fill all the iliac and para-aortic nodes and that destruction of lymphomatous tissue was often incomplete. Recurrences were seen mostly in abnormal adequately filled nodes opacified with high doses of Lipiodol /sup 131/I. In Hodgkin's disease they occurred particularly in the para-aortic area and in lymphoreticular sarcomas in the inguinal and iliac chains. Side effects were minimal. They included amenorrhea, pulmonary insufficiency, hepatic failure and hemolytic anemia. Clinical and histologic signs of pulmonary and hepatic fibrosis were not seen.

  9. Endolymphatic radiotherapy in malignant lymphomas. A clinical evaluation of 285 patients

    International Nuclear Information System (INIS)

    Bonadonna, G.; Chiappa, S.; Musumeci, R.; Uslenghi, C.

    1968-01-01

    The authors report treatment of inguinal and retroperitoneal lymph nodes of 285 malignant lymphomas (143 Hodgkin's disease and 142 lymphoreticular sarcomas) with Lipiodol Fluide 131 I (endolymphatic radiotherapy). From 1961 to 1966 the radioactive contrast material was injected in doses ranging from 0.2 to 2.5 mc/cc (10 cc each foot). Adequately opacified nodes responded promptly with marked and progressive reduction in size. When indicated, a second administration of Lipiodol 131 I in a dose of 2.5 mc/cc was always feasible. Several factors prevented a homogeneous and satisfactory distribution of radioactive contrast material throughout the iliac and the para-aortic nodes in one third of the cases. Therefore, in many instances patients had to be treated with external radiation therapy. Histopathologic examination of lymph nodes removed at exploratory laparotomy (four cases) or at autopsy (ten cases) confirmed that Lipiodol 131 I did not fill all the iliac and para-aortic nodes and that destruction of lymphomatous tissue was often incomplete. Recurrences were seen mostly in abnormal adequately filled nodes opacified with high doses of Lipiodol 131 I. In Hodgkin's disease they occurred particularly in the para-aortic area and in lymphoreticular sarcomas in the inguinal and iliac chains. Side effects were minimal. They included amenorrhea, pulmonary insufficiency, hepatic failure and hemolytic anemia. Clinical and histologic signs of pulmonary and hepatic fibrosis were not seen

  10. Dicty_cDB: SLH285 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLH285 (Link to dictyBase) - - - Contig-U16287-1 SLH285F (Link to Original site) SLH2...85F 326 - - - - - - Show SLH285 Library SL (Link to library) Clone ID SLH285 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-D/SLH285Q.Seq.d/ Representative seq. ID SLH28...5F (Link to Original site) Representative DNA sequence >SLH285 (SLH285Q) /CSM/SL/SLH2-D/SLH285Q.Seq.d/ AAAAA...ue SSF805 (SSF805Q) /CSM/SS/SSF8-A/SSF805Q.Seq.d/ 617 e-176 SLH288 (SLH288Q) /CSM/SL/SLH2-D/SLH288Q.Seq.d/ 617 e-176 SLH285 (SLH2

  11. Thermoelectric Properties of Cu-Doped n-Type Bi2Te2.85Se0.15 Prepared by Liquid Phase Growth Using a Sliding Boat

    Science.gov (United States)

    Kitagawa, Hiroyuki; Matsuura, Tsukasa; Kato, Toshihito; Kamata, Kin-ya

    2015-06-01

    N-type Bi2Te2.85Se0.15 thermoelectric materials were prepared by liquid phase growth (LPG) using a sliding boat, a simple and short fabrication process for Bi2Te3-related materials. Cu was selected as a donor dopant, and its effect on thermoelectric properties was investigated. Thick sheets and bars of Cu x Bi2 Te2.85Se0.15 ( x=0-0.25) of 1-2mm in thickness were obtained using the process. X-ray diffraction patterns and scanning electron micrographs showed that the in-plane direction tended to correspond to the hexagonal c-plane, which is the preferred direction for thermoelectric conversion. Cu-doping was effective in controlling conduction type and carrier (electron) concentration. The conduction type was p-type for undoped Bi2Te2.85Se0.15 and became n-type after Cu-doping. The Hall carrier concentration was increased by Cu-doping. Small resistivity was achieved in Cu0.02Bi2Te2.85Se0.15 owing to an optimized amount of Cu-doping and high crystal orientation. As a result, the maximum power factor near 310K for Cu0.02Bi2Te2.85Se0.15 was approximately 4×10-3W/K2m and had good reproducibility. Furthermore, the thermal stability of Cu0.02Bi2Te2.85Se0.15 was also confirmed by thermal cycling measurements of electrical resistivity. Thus, n-type Bi2Te2.85Se0.15 with a large power factor was prepared using the present LPG process.

  12. A Tale of Wootz Steel

    Indian Academy of Sciences (India)

    manufacture of steel in south India by a crucible process at ... indicates that the production of wootz steel was almost on an industrial scale in ... in an Age of Design marked by ... The Russian Anasoff also studied the process of manufacturing.

  13. 7 CFR 285.1 - General purpose and scope.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false General purpose and scope. 285.1 Section 285.1... COMMONWEALTH OF PUERTO RICO § 285.1 General purpose and scope. This part describes the general terms and... government of the Commonwealth of Puerto Rico for the purpose of designing and conducting a nutrition...

  14. Gamma spectrometry of 285-04 ILAS gamma scan wires

    International Nuclear Information System (INIS)

    Dassel, G.; Buurveld, H.A.; Plakman, J.C.

    1996-12-01

    In the frame work of their on-going sustain programme for the material development and characterization of fusion reactors, ECN is investigating the irradiation behaviour of ferritic/martensitic steels. In the fourth irradiation experiment 285-04, 55 steel tensile samples have been irradiated up to 2.5 dpa. Four gamma scan wires from this experiment have been examined by gamma scanning. The results of the measurements have been described in this report. (orig.)

  15. 30 CFR 285.525 - What general requirements must a financial assurance instrument meet?

    Science.gov (United States)

    2010-07-01

    ... terminate a surety's obligation under State law. (g) Your surety must notify you and MMS within 5 business... authorized corporate officer must sign the bond and attest to it over the corporate seal. (f) You may not...

  16. SU-F-T-285: Evaluation of a Patient DVH-Based IMRT QA System

    Energy Technology Data Exchange (ETDEWEB)

    Zhen, H; Redler, G; Chu, J; Turian, J [Rush University Medical Center, Chicago, IL (United States)

    2016-06-15

    Purpose: To evaluate the clinical performance of a patient DVH-based QA system for prostate VMAT QA. Methods: Mobius3D(M3D) is a QA software with an independent beam model and dose engine. The MobiusFX(MFX) add-on predicts patient dose using treatment machine log files. We commissioned the Mobius beam model in two steps. First, the stock beam model was customized using machine commissioning data, then verified against the TPS with 12 simple phantom plans and 7 clinical 3D plans. Secondly, the Dosimetric Leaf Gap(DLG) in the Mobius model was fine-tuned for VMAT treatment based on ion chamber measurements for 6 clinical VMAT plans. Upon successful commissioning, we retrospectively performed IMRT QA for 12 VMAT plans with the Mobius system as well as the ArcCHECK-3DVH system. Selected patient DVH values (PTV D95, D50; Bladder D2cc, Dmean; Rectum D2cc) were compared between TPS, M3D, MFX, and 3DVH. Results: During the first commissioning step, TPS and M3D calculated target Dmean for 3D plans agree within 0.7%±0.7%, with 3D gamma passing rates of 98%±2%. In the second commissioning step, the Mobius DLG was adjusted by 1.2mm from the stock value, reducing the average difference between MFX calculation and ion chamber measurement from 3.2% to 0.1%. In retrospective prostate VMAT QA, 5 of 60 MFX calculated DVH values have a deviation greater than 5% compared to TPS. One large deviation at high dose level was identified as a potential QA failure. This echoes the 3DVH QA result, which identified 2 instances of large DVH deviation on the same structure. For all DVH’s evaluated, M3D and MFX show high level of agreement (0.1%±0.2%), indicating that the observed deviation is likely from beam modelling differences rather than delivery errors. Conclusion: Mobius system provides a viable solution for DVH based VMAT QA, with the capability of separating TPS and delivery errors.

  17. SU-F-T-285: Evaluation of a Patient DVH-Based IMRT QA System

    International Nuclear Information System (INIS)

    Zhen, H; Redler, G; Chu, J; Turian, J

    2016-01-01

    Purpose: To evaluate the clinical performance of a patient DVH-based QA system for prostate VMAT QA. Methods: Mobius3D(M3D) is a QA software with an independent beam model and dose engine. The MobiusFX(MFX) add-on predicts patient dose using treatment machine log files. We commissioned the Mobius beam model in two steps. First, the stock beam model was customized using machine commissioning data, then verified against the TPS with 12 simple phantom plans and 7 clinical 3D plans. Secondly, the Dosimetric Leaf Gap(DLG) in the Mobius model was fine-tuned for VMAT treatment based on ion chamber measurements for 6 clinical VMAT plans. Upon successful commissioning, we retrospectively performed IMRT QA for 12 VMAT plans with the Mobius system as well as the ArcCHECK-3DVH system. Selected patient DVH values (PTV D95, D50; Bladder D2cc, Dmean; Rectum D2cc) were compared between TPS, M3D, MFX, and 3DVH. Results: During the first commissioning step, TPS and M3D calculated target Dmean for 3D plans agree within 0.7%±0.7%, with 3D gamma passing rates of 98%±2%. In the second commissioning step, the Mobius DLG was adjusted by 1.2mm from the stock value, reducing the average difference between MFX calculation and ion chamber measurement from 3.2% to 0.1%. In retrospective prostate VMAT QA, 5 of 60 MFX calculated DVH values have a deviation greater than 5% compared to TPS. One large deviation at high dose level was identified as a potential QA failure. This echoes the 3DVH QA result, which identified 2 instances of large DVH deviation on the same structure. For all DVH’s evaluated, M3D and MFX show high level of agreement (0.1%±0.2%), indicating that the observed deviation is likely from beam modelling differences rather than delivery errors. Conclusion: Mobius system provides a viable solution for DVH based VMAT QA, with the capability of separating TPS and delivery errors.

  18. A model for TRIP steel constitutive behaviour

    NARCIS (Netherlands)

    Perdahcioglu, Emin Semih; Geijselaers, Hubertus J.M.; Menari, G

    2011-01-01

    A constitutive model is developed for TRIP steel. This is a steel which contains three or four different phases in its microstructure. One of the phases in TRIP steels is metastable austenite (Retained Austenite) which transforms to martensite upon deformation. The accompanying transformation strain

  19. STEFINS: a steel freezing integral simulation program

    International Nuclear Information System (INIS)

    Frank, M.V.

    1980-09-01

    STEFINS (STEel Freezing INtegral Simulation) is a computer program for the calculation of the rate of solidification of molten steel on solid steel. Such computations arize when investigating core melt accidents in fast reactors. In principle this problem involves a coupled two-dimensional thermal and hydraulic approach. However, by physically reasonable assumptions a decoupled approach has been developed. The transient solidification of molten steel on a cold wall is solved in the direction normal to the molten steel flow and independent from the solution for the molten steel temperature and Nusselt number along the direction of flow. The solutions to the applicable energy equations have been programmed in cylindrical and slab geometries. Internal gamma heating of steel is included

  20. Gamma spectrometry of 285-03 ILAS gamma scan wires

    International Nuclear Information System (INIS)

    Dassel, G.; Buurveld, H.A.; Plakman, J.C.

    1996-12-01

    In the frame work of their on-going sustain programme for the material development and characterization of fusion reactors, ECN is investigating the irradiation behaviour of ferritic/martensitic steels. In the third irradiation experiment 285-03, 55 vanadium (V-4Cr-4Ti) tensile samples have been irradiated up to 6 dpa. Four gamma scan wires from this experiment have been examined by gamma scanning. The results of the measurements have been described in this report. (orig.)

  1. The miRNA Pull Out Assay as a Method to Validate the miR-28-5p Targets Identified in Other Tumor Contexts in Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Milena Rizzo

    2017-01-01

    Full Text Available miR-28-5p is an intragenic miRNA which is underexpressed in several tumor types showing a tumor suppressor (TS activity. Routinely, the known miR-28-5p targets are validated in specific tumor contexts but it is unclear whether these targets are also being regulated in other tumor types. To this end, we adopted the miRNA pull out assay to capture the miR-28-5p targets in DU-145 prostate cancer (PCa cells. Firstly, we demonstrated that miR-28-5p acts as a TS-miRNA in PCa, affecting cell proliferation, survival, and apoptosis. Secondly, we evaluated the enrichment of the 10 validated miR-28-5p targets in the pull out sample. We showed that E2F6, TEX-261, MAPK1, MPL, N4BP1, and RAP1B but not BAG1, OTUB1, MAD2L1, and p21 were significantly enriched, suggesting that not all the miR-28-5p targets are regulated by this miRNA in PCa. We then verified whether the miR-28-5p-interacting targets were regulated by this miRNA. We selected E2F6, the most enriched target in the pull out sample, and demonstrated that miR-28-5p downregulated E2F6 at the protein level suggesting that our approach was effective. In general terms, these findings support the miRNA pull out assay as a useful method to identify context-specific miRNA targets.

  2. Data for a steel industry model

    OpenAIRE

    Mæstad, Ottar

    2000-01-01

    SNF has recently developed a new model of the steel market and some of the major factor markets connected to the steel industry. The aim of the model has been to study how regulations of the emissions of carbon dioxide (CO2) in the steel industry might affect the structure of the industry. It has also been an objective to investigate how structural changes in the steel industry might influence on the industry’s demand for transport services. This paper outlines the details about the data that...

  3. Steel

    International Nuclear Information System (INIS)

    Zorev, N.N.; Astafiev, A.A.; Loboda, A.S.; Savukov, V.P.; Runov, A.E.; Belov, V.A.; Sobolev, J.V.; Sobolev, V.V.; Pavlov, N.M.; Paton, B.E.

    1977-01-01

    Steels also containing Al, N and arsenic, are suitable for the construction of large components for high-power nuclear reactors due to their good mechanical properties such as good through-hardening, sufficiently low brittleness conversion temperature and slight displacement of the latter with neutron irradiation. Defined steels and their properties are described. (IHOE) [de

  4. Rigidity spectrum of z greater than or equal to 3 cosmic-ray nuclei in the range 4-285 GV and a search for cosmic antimatter

    Science.gov (United States)

    Golden, R. L.; Adams, J. H., Jr.; Marar, T. M. K.; Deney, C. L.; Badhwar, G. D.; Heckman, H. H.; Lindstrom, P. J.

    1974-01-01

    A measurement, using the magnetic emulsion spectrometer system, of the differential rigidity spectrum of Z greater than or equal to 3 nuclei of the galactic cosmic radiation is presented. The system was flown on Aug. 22, 1969, from Palestine, Texas. The instrument floated above 125,000 feet for eight hours. The data in the rigidity range 8-285 GV can be represented by a power-law spectrum in rigidity, J(rho) = A rho to the minus gamma power, with the exponent gamma = 2.6 plus or minus 0.10. The spectrum in the range 15-285 GV is also described by the same exponent, gamma = 2.6 plus or minus 0.25. The data below 8 GV cannot be described by the same power law without invoking solar modulation. A set of nonunique parameters for modulation are given. Upper limit for the fraction of antimatter in the rigidity range 4-125 GV is .005 with 95% confidence limit.

  5. Crystal structure and electronic states of Co and Gd ions in a Gd0.4Sr0.6CoO2.85 single crystal

    Science.gov (United States)

    Platunov, M. S.; Dudnikov, V. A.; Orlov, Yu. S.; Kazak, N. V.; Solovyov, L. A.; Zubavichus, Ya. V.; Veligzhanin, A. A.; Dorovatovskii, P. V.; Vereshchagin, S. N.; Shaykhutdinov, K. A.; Ovchinnikov, S. G.

    2016-02-01

    X-ray diffraction and X-ray absorption near edge structure (XANES) spectra have been measured at the Co K-edge and Gd L 3-edge in GdCoO3 and Gd0.4Sr0.6CoO2.85 cobaltites. The effect of Sr substitution on the crystal structure and electronic and magnetic states of Co3+ ions in a Gd0.4Sr0.6CoO2.85 single crystal has been analyzed. The XANES measurements at the Co K-edge have not showed a noticeable shift of the absorption edge with an increase in the concentration of Sr. This indicates that the effective valence of cobalt does not change. An increase in the intensity of absorption at the Gd L 3-edge is due to an increase in the degree of hybridization of the Gd(5 d) and O(2 p) states. The effect of hole doping on the magnetic properties results in the appearance of the ferromagnetic component and in a significant increase in the magnetic moment.

  6. 30 CFR 285.700 - What reports must I submit to MMS before installing facilities described in my approved SAP, COP...

    Science.gov (United States)

    2010-07-01

    ... installing facilities described in my approved SAP, COP, or GAP? 285.700 Section 285.700 Mineral Resources... § 285.700 What reports must I submit to MMS before installing facilities described in my approved SAP... in your approved COP (§ 285.632(a)) and, when required by this part, your SAP (§ 285.614(b)) or GAP...

  7. 32 CFR 285.5 - Information requirements.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Information requirements. 285.5 Section 285.5 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) FREEDOM OF INFORMATION ACT PROGRAM DOD FREEDOM OF INFORMATION ACT (FOIA) PROGRAM § 285.5 Information...

  8. 30 CFR 285.607 - How do I submit my SAP?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How do I submit my SAP? 285.607 Section 285.607... Assessment Plan and Information Requirements for Commercial Leases § 285.607 How do I submit my SAP? You must submit one paper copy and one electronic version of your SAP to MMS at the address listed in § 285.110(a). ...

  9. DETERMINANTS OF RETAINED EARNINGS IN PROFITABLE STEEL COMPANIES IN INDIA: A STUDY OF STEEL SECTOR

    OpenAIRE

    Dr. Sohaib Masood

    2018-01-01

    In this paper an attempt has been made to identify the important determinants of retained earnings in profitable steel companies in steel sector of India and which have impact on the retention of earnings of steel companies under study. Multiple linear regression is used to identify the determinants of retained earnings for a period of sixteen years. Also the importance of retained earnings as a source of finance for steel sector companies is also studied in the paper.

  10. 30 CFR 285.907 - How will MMS process my decommissioning application?

    Science.gov (United States)

    2010-07-01

    ... application? 285.907 Section 285.907 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY ALTERNATE USES OF EXISTING FACILITIES ON THE OUTER CONTINENTAL SHELF Decommissioning Decommissioning Applications § 285.907 How will MMS process my decommissioning application? (a...

  11. 30 CFR 285.1000 - What activities does this subpart regulate?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What activities does this subpart regulate? 285.1000 Section 285.1000 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR... Activities § 285.1000 What activities does this subpart regulate? (a) This subpart provides the general...

  12. 30 CFR 285.613 - How will MMS process my SAP?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will MMS process my SAP? 285.613 Section... Requirements Contents of the Site Assessment Plan § 285.613 How will MMS process my SAP? (a) The MMS will review your submitted SAP, and additional information provided pursuant to § 285.611, to determine if it...

  13. 30 CFR 285.614 - When may I begin conducting activities under my approved SAP?

    Science.gov (United States)

    2010-07-01

    ... approved SAP? 285.614 Section 285.614 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE... Plans and Information Requirements Activities Under An Approved Sap § 285.614 When may I begin conducting activities under my approved SAP? (a) You may begin conducting the activities approved in your SAP...

  14. 30 CFR 285.628 - How will MMS process my COP?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will MMS process my COP? 285.628 Section... Requirements Contents of the Construction and Operations Plan § 285.628 How will MMS process my COP? (a) The MMS will review your submitted COP, and the information provided pursuant to § 285.627, to determine...

  15. Genotyping of Global Yersinia Pestis Isolates by Using IS285

    National Research Council Canada - National Science Library

    Bobrov, A. G; Huang, X.-Z; Garcia, E; Lindler, L. E; Filippov, A. A

    2006-01-01

    .... We come to conclusion that a mobile genetic element, IS285, is one of the most powerful molecular tools allowing to trace the circulation of epidemic clones and to detect their geographical/animal origin.

  16. A technique for predicting steel corrosion resistance

    Science.gov (United States)

    Novikov, V. F.; Sokolov, R. A.; Neradovskiy, D. F.; Muratov, K. R.

    2018-01-01

    Research works were carried out to develop a technique with the aim to increase the lifetime of steel items used in corrosive media. The possibility to monitor corrosion parameters of steel samples is analyzed on the basis of magnetic properties obtained by means of a magnetic structuroscope DIUS-1.15M designed by the Institute of Metal Physics of the Ural Branch of the Russian Academy of Sciences (IMP UB RAS).

  17. Management and outcome of fractures of the distal phalanx: a retrospective study of 285 horses with a long term outcome in 223 cases.

    Science.gov (United States)

    Rijkenhuizen, Astrid B M; de Graaf, Kim; Hak, Annelieke; Fürst, Anton; ter Braake, Frerik; Stanek, Christian; Greet, Tim R C

    2012-05-01

    A multicentre study of 285 cases was performed to enhance the management of distal phalangeal fractures on the basis of clinical evidence. The outcome after treatment was available for 223 of the cases. Horses with a non-articular type I fracture had a better prognosis (91.7%) for return to original or expected level of use than horses with an articular type II or III fracture (69.6% and 74.1%, respectively). The prognosis for types IV and V fractures was fair (57.7% and 57.1%, respectively) and for type VI good (80%). Horses with a hindlimb fracture had a significantly greater chance of a successful outcome. No significant association between age or time to start treatment and success rate was noted. The best treatment option for types I-III fractures was a conservative approach (box rest). Type IV fractures were best treated by arthroscopic removal of the fragment. Immobilisation of the hoof did not seem to influence outcome. Radiological findings and clinical healing were not accurately correlated and the re-commencement of training should be based on clinical rather than radiological findings. Complete osseous union of the fracture was not essential for a successful return to athletic activity. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. Observation of a meson X → 2γ, with mass 2.85 GeV/c2, produced in the charge-exchange reaction π-p→Xn at 40 Gev/c

    International Nuclear Information System (INIS)

    Apel, W.D.; Augenstein, K.H.; Bertolucci, E.; Donskov, S.V.; Inyakin, A.V.; Kachanov, V.A.; Krasnokutsky, R.N.; Kruger, M.; Leder, G.; Lednev, A.A.; Mannelli, I.; Mikhailov, Yu.V.; Mueller, H.; Pierazzini, G.M.; Prokoshkin, Yu.D.; Quaglia, M.; Schneider, H.; Scribano, A.; Sergiampietri, F.; Shuvalov, R.S.; Sigurdsson, G.; Toropin, A.N.; Vincelli, M.L.

    1978-01-01

    The invariant mass spectrum of neutral final states produced in π - p charge-exchange scattering at 40 GeV/c has been studied, searching for heavy particles decaying into 2γ. A peak is observed around 2.85 GeV/c 2 . The cross section of the reaction π - p→X(2.85)+n, times the branching ratio of the X→2γ decay, is measured to be sigma X BR approximately =2X10 -34 cm 2 . (Auth.)

  19. Heat treatments in a conventional steel to reproduce the microstructure of a nuclear grade steel

    International Nuclear Information System (INIS)

    Rosalio G, M.

    2014-01-01

    The ferritic steels used in the manufacture of pressurized vessels of Boiling Water Reactors (BWR) suffer degradation in their mechanical properties due to damage caused by the neutron fluxes of high energy bigger to a Mega electron volt (E> 1 MeV) generated in the reactor core. The materials with which the pressurized vessels of nuclear reactors cooled by light water are built correspond to low alloy ferritic steels. The effect of neutron irradiation on these steels is manifested as an increase in hardness, mechanical strength, with the consequent decrease in ductility, fracture toughness and an increase in temperature of ductile-brittle transition. The life of a BWR is 40 years, its design must be considered sufficient margin of safety because pressure forces experienced during operation, maintenance and testing of postulated accident conditions. It is necessary that under these conditions the vessel to behave ductile and likely to propagate a fracture is minimized. The vessels of light water nuclear reactors have a bainite microstructure. Specifically, the reactor vessels of the nuclear power plant of Laguna Verde (Veracruz, Mexico) are made of a steel Astm A-533, Grade B Class 1. At present they are carrying out some welding tests for the construction of a model of a BWR, however, to use nuclear grade steel such as Astm A-533 to carry out some of the welding tests, is very expensive; perform these in a conventional material provides basic information. Although the microstructure present in the conventional material does not correspond exactly to the degree of nuclear material, it can take of reference. Therefore, it is proposed to conduct a pilot study to establish the thermal treatment that reproduces the microstructure of nuclear grade steel, in conventional steel. The resulting properties of the conventional steel samples will be compared to a JRQ steel, that is a steel Astm A-533, Grade B Class 1, provided by IAEA. (Author)

  20. 7 CFR 285.4 - Audits.

    Science.gov (United States)

    2010-01-01

    ... such audit shall be reported to FNS no later than 120 days from the end of each fiscal year in which the audit is made. (b) Within 120 days of the end of each fiscal year, the Commonwealth of Puerto Rico... 7 Agriculture 4 2010-01-01 2010-01-01 false Audits. 285.4 Section 285.4 Agriculture Regulations of...

  1. Nanoscale microstructural characterization of a nanobainitic steel

    Energy Technology Data Exchange (ETDEWEB)

    Timokhina, I.B., E-mail: ilana.timokhina@eng.monash.edu.au [Centre for Material and Fibre Innovation, Deakin University, Victoria 3216 (Australia); Beladi, H. [Centre for Material and Fibre Innovation, Deakin University, Victoria 3216 (Australia); Xiong, X.Y. [Monash Centre for Electron Microscopy, Monash University, Victoria 3800 (Australia); Adachi, Y. [National Institute for Materials Science, 1-2-1 Sengen, Tsukuba 305-0047 (Japan); Hodgson, P.D. [Centre for Material and Fibre Innovation, Deakin University, Victoria 3216 (Australia)

    2011-08-15

    A 0.79 C-1.5 Si-1.98 Mn-0.98 Cr-0.24 Mo-1.06 Al-1.58 Co (wt.%) steel was isothermally heat treated at 200 deg. C for 10 days and 350 deg. C for 1 day to form a nanoscale bainitic microstructure consisting of nanobainitic ferrite laths with high dislocation density and retained austenite films. The microstructures of the samples were characterized by transmission electron microscopy and atom probe tomography. Despite the formation of nanoscale bainite with a high volume fraction of retained austenite in both steels, the ductility of both steels was surprisingly low. It is believed that this was associated with the formation of carbon-depleted retained austenite after isothermal transformation at 200 deg. C due to the formation of high number of Fe-C clusters and particles in the bainitic ferrite laths and carbon-enriched austenite after isothermal transformation at 350 deg. C.

  2. Vibrational Based Inspection Of A Steel Mast

    DEFF Research Database (Denmark)

    Kirkegaard, Poul Henning; Rytter, A.

    1994-01-01

    The aim of this paper is to present the results from a research project concerning vibrational based inspection of a 20 meter high steel mast containing well defined damages. Introductory analyses dealing with among other things evaluation of potential damage indicators and determination of accep......The aim of this paper is to present the results from a research project concerning vibrational based inspection of a 20 meter high steel mast containing well defined damages. Introductory analyses dealing with among other things evaluation of potential damage indicators and determination...

  3. Laser cutting of thick steel plates and simulated steel components using a 30 kW fiber laser

    International Nuclear Information System (INIS)

    Tamura, Koji; Ishigami, Ryoya; Yamagishi, Ryuichiro

    2016-01-01

    Laser cutting of thick steel plates and simulated steel components using a 30 kW fiber laser was studied for application to nuclear decommissioning. Successful cutting of carbon steel and stainless steel plates up to 300 mm in thickness was demonstrated, as was that of thick steel components such as simulated reactor vessel walls, a large pipe, and a gate valve. The results indicate that laser cutting applied to nuclear decommissioning is a promising technology. (author)

  4. ballistic performance of a quenched and tempered steel against

    African Journals Online (AJOL)

    eobe

    was investigated. Low alloy steel ... obliquity obliquity with a projectile velocity with a projectile velocity with a projectile .... quenching on low carbon and alloyed steel [5, 15]. Several studies .... Mars 190, Mars 240, Mars 270, Creusot-Loire,.

  5. Impact of a Checklist on Principal-Teacher Feedback Conferences Following Classroom Observations. REL 2018-285

    Science.gov (United States)

    Mihaly, Kata; Schwartz, Heather L.; Opper, Isaac M.; Grimm, Geoffrey; Rodriguez, Luis; Mariano, Louis T.

    2018-01-01

    Most states' teacher evaluation systems have changed substantially in the past decade. New evaluation systems typically require school leaders to observe teachers' classrooms two to three times a school year instead of once (Doherty & Jacobs, 2015). The feedback that school leaders provide to teachers after these observations is a key but…

  6. A Theory of Electromagnetic Shielding with Applications to MIL-STD-285, IEEE-299, and EMP Simulation

    Science.gov (United States)

    1985-02-01

    in a building sized enclosure slot-like discontinuities may not all be small compar- ed to all wavelengths in the incident field, and slot resonan ...OFFICE OF RESEARCH/ NPP US AIR FORCE SPACE COMMAND ATTN STATE & LOCAL PROG SUPPORT O ATTN KKO 500 C STREET, SW ATTN KRQ WASHINGTON, DC 20472 ATTN XPOW

  7. Steel and biodiversity: a promising alliance

    Science.gov (United States)

    Peters, Klaus; Colla, Valentina; Moonen, Anna Camilla; Branca, Teresa Annunziata; Moretto, Deny Del; Ragaglini, Giorgio; Delmiro, Vanesa Maria Menendez; Romaniello, Lea; Carler, Sophie; Hodges, Jennifer; Bullock, Matthew; Malfa, Enrico

    2018-06-01

    The term "Biodiversity" derives from a contraction of "biological diversity" and commonly refers to a measure of the variety of organisms, which are present in different ecosystems, by considering genetic variation, ecosystem variation, or species variation within an area, biome, or planet. Biodiversity is receiving an ever-increasing attention at many levels of European society as well as from many industrial sectors, and a variety of actions are being put in place in order to protect, preserve and increase it. The present paper provides examples of the capabilities and potentials of the steel sector with respect to biodiversity. In effect, steel is a valuable and fundamental structural material in order to develop measures and systems for protection of biodiversity. On the other hand, biodiversity can represent for the steel industry not only a heritage to preserve, but, through its functional traits, it can become an opportunity, offering an ecosystem's perspective to all industrial companies. In the paper, steel relevant topics and applications are analyzed leading to the conclusion that biodiversity should be exploited and can play a role with potentially relevant benefits both for the company and for local communities. Sustainability and Ecodesign of processes, products and services

  8. Development of a lean duplex stainless steel

    Energy Technology Data Exchange (ETDEWEB)

    Liljas, M.; Johansson, P.; Liu Hui-Ping; Olsson, C.O.A. [Avesta Research Centre, Avesta (Sweden). Outokumpu Stainless

    2008-06-15

    The classic series of duplex stainless steels shows very high corrosion resistance and can be used for very demanding applications. A new lean duplex steel, LDX 2101 {sup registered} (EN 1.4162, UNS S32101), has been developed with corrosion resistance on a par with standard austenitic grades. Application areas include: structural components, chemical industry, tanks and containers. The steel was designed to have equal amounts of ferrite and austenite in annealed condition and with an austenite that is stable against strain-induced martensite. Thanks to its high nitrogen content, the steel has a fast austenite reformation when subjected to thermal cycling, e.g. welding. Unlike conventional duplex grades, the formation of intermetallic phase is very sluggish, although precipitation of nitrides and carbides has a certain impact on material properties after exposure in the temperature range 600 to 800 C. The precipitation behaviour after different isothermal treatments is described and its influence on different product properties is shown. A good agreement was found between impact toughness and corrosion resistance for a wide range of thermal treatments. (orig.)

  9. 30 CFR 285.902 - What are the general requirements for decommissioning for facilities authorized under my SAP, COP...

    Science.gov (United States)

    2010-07-01

    ... decommissioning for facilities authorized under my SAP, COP, or GAP? 285.902 Section 285.902 Mineral Resources... SAP, COP, or GAP? (a) Except as otherwise authorized by MMS under § 285.909, within 2 years following... under your SAP, COP, or GAP, you must submit a decommissioning application and receive approval from the...

  10. 30 CFR 285.615 - What other reports or notices must I submit to MMS under my approved SAP?

    Science.gov (United States)

    2010-07-01

    ... MMS under my approved SAP? 285.615 Section 285.615 Mineral Resources MINERALS MANAGEMENT SERVICE... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 285.615 What other reports or notices must I submit to MMS under my approved SAP? (a) You must notify MMS in writing within...

  11. Dicty_cDB: VHK285 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHK285 (Link to dictyBase) - - - - - (Link to Original site) VHK2...85F 531 - - - - - - Show VHK285 Library VH (Link to library) Clone ID VHK285 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-D/VHK2...85Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >VHK2...85 (VHK285Q) /CSM/VH/VHK2-D/VHK285Q.Seq.d/ AACTCTCGAGTGCAAAAAAAGTAAAGTACAAAATGGTTAATTTCA

  12. 14 CFR 125.285 - Pilot qualifications: Recent experience.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Pilot qualifications: Recent experience... Requirements § 125.285 Pilot qualifications: Recent experience. (a) No certificate holder may use any person, nor may any person serve, as a required pilot flight crewmember unless within the preceding 90...

  13. A review of temperature measurement in the steel reheat furnace

    International Nuclear Information System (INIS)

    Martocci, A.P.; Mihalow, F.A.

    1985-01-01

    The incentive for conducting research and development on reheat furnaces is substantial; the domestic steel industry spent approximately one billion dollars on fuel in reheat furnaces in 1981. Bethlehem Steel Corp. spent /145 million of that total, and neither figure includes fuel consumed in soaking pits or annealing furnaces. If the authors set a goal to save 10% of these annual fuel costs, that translates into /100 million for the domestic steel industry and /14.5 million for Bethlehem Steel. These large sums of money are significant incentives. The purpose of this paper is to review the historical heating practices and equipment at steel reheat furnaces along with current practices and instrumentation

  14. Fatigue fracture modes of a stainless steel

    International Nuclear Information System (INIS)

    Pacheco, D.J.; Souza e Silva, A.S. de; Monteiro, S.N.

    1977-01-01

    The influence of strain hardening and martensite phase transformation on the fatigue fracture regions (pulsative tension) of a Stainless Steel type AISI 316 was investigated. This lead to the conclusion that the greater austenite strain hardening level only favours the occurrence of a brittle fracture. Also, in as much as the static induced martensite is concerned, a direct influence on the failure process was not observed, whereas, apparently, the one transformed under cyclic loading has no contribution to the rupture mechanisms. (author) [pt

  15. 24 CFR 234.285 - Waived title objections.

    Science.gov (United States)

    2010-04-01

    ... have not been violated to a material extent. (f) Federal tax liens and rights of redemption arising... Commissioner will not object to an outstanding right of redemption in IRS if: (1) The Federal tax lien was... CONDOMINIUM OWNERSHIP MORTGAGE INSURANCE Contract Rights and Obligations-Individually Owned Units § 234.285...

  16. Additive manufacturing for steels: a review

    Science.gov (United States)

    Zadi-Maad, A.; Rohib, R.; Irawan, A.

    2018-01-01

    Additive manufacturing (AM) of steels involves the layer by layer consolidation of powder or wire feedstock using a heating beam to form near net shape products. For the past decades, the AM technique reaches the maturation of both research grade and commercial production due to significant research work from academic, government and industrial research organization worldwide. AM process has been implemented to replace the conventional process of steel fabrication due to its potentially lower cost and flexibility manufacturing. This paper provides a review of previous research related to the AM methods followed by current challenges issues. The relationship between microstructure, mechanical properties, and process parameters will be discussed. Future trends and recommendation for further works are also provided.

  17. A comparison of the iraddiated tensile properties of a high-manganese austenitic steel and type 316 stainless steel

    International Nuclear Information System (INIS)

    Klueh, R.L.; Grossbeck, M.L.

    1984-01-01

    The USSR steel EP-838 is a high-manganese, low-nickel steel that also has lower chromium and molybdenum than type 316 stainless steel. Tensile specimens of 20%-cold-worked EP-838 and type 316 stainless steel were irradiated in the High Flux Isotope Reactor (HFIR) at the coolant temperature (approx.=50 0 C). A displacement damage level of 5.2 dpa was reached for the EP-838 and up to 9.5 dpa for the type 316 stainless steel. Tensile tests at room temperature and 300 0 C on the two steels indicated that the irradiation led to increased strength and decreased ductility compared to the unirradiated steels. Although the 0.2% yield stress of the type 316 stainless steel in the unirradiated condition was greater than that for the EP-838, after irradiation there was essentially no difference between the strength or ductility of the two steels. The results indicate that the replacement of the majority of the nickel by manganese and a reduction of chromium and molybdenum in an austenitic stainless steel of composition near that for type 316 stainless steel has little effect on the irradiated and unirradiated tensile properties at low temperatures. (orig.)

  18. 30 CFR 285.222 - What does MMS do with my bid?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What does MMS do with my bid? 285.222 Section... Energy Leases Competitive Lease Award Process § 285.222 What does MMS do with my bid? (a) If sealed... any proposal submitted will be made by a panel composed of members selected by MMS. The details of the...

  19. 30 CFR 285.437 - When can my lease or grant be canceled?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false When can my lease or grant be canceled? 285.437... Administration Lease Or Grant Cancellation § 285.437 When can my lease or grant be canceled? (a) The Secretary will cancel any lease or grant issued under this part upon proof that it was obtained by fraud or...

  20. 30 CFR 285.606 - What must I demonstrate in my SAP?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What must I demonstrate in my SAP? 285.606 Section 285.606 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE... demonstrate in my SAP? (a) Your SAP must demonstrate that you have planned and are prepared to conduct the...

  1. 30 CFR 285.201 - How will MMS issue leases?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will MMS issue leases? 285.201 Section 285... Energy Leases General Lease Information § 285.201 How will MMS issue leases? The MMS will issue leases on... noncompetitively, as provided under §§ 285.230 and 285.232. We will issue leases on forms approved by MMS and will...

  2. Value Chain Model for Steel Manufacturing Sector: A Case Study

    OpenAIRE

    S G Acharyulu; K Venkata Subbaiah; K Narayana Rao

    2018-01-01

    Michael E Porter developed a value chain model for manufacturing sector with five primary activities and four supporting activities. The value chain model developed by Porter is extended to a steel manufacturing sector due to expansions of steel plants has become a continual process for their growth and survival. In this paper a value chain model for steel manufacturing sector is developed considering five primary activities and six support activities.

  3. Aircraft Steels

    Science.gov (United States)

    2009-02-19

    component usage. PH 13-8Mo is a precipitation-hardenable martensitic stainless steel combining excellent corrosion resistance with strength. Custom 465 is...a martensitic , age-hardenable stainless steel capable of about 1,724 MPa (250 ksi) UTS when peak-aged (H900 condition). Especially, this steel can...NOTES 14. ABSTRACT Five high strength steels (4340, 300M, AerMet 100, Ferrium S53, and Hy-Tuf) and four stainless steels (High Nitrogen, 13

  4. Formability Characterization of a New Generation High Strength Steels

    Energy Technology Data Exchange (ETDEWEB)

    Sriram Sadagopan; Dennis Urban; Chris Wong; Mai Huang; Benda Yan

    2003-05-16

    Advanced high strength steels (AHSS) are being progressively explored by the automotive industry all around the world for cost-effective solutions to accomplish vehicle lightweighting, improve fuel economy, and consequently reduce greenhouse emissions. Because of their inherent high strength, attractive crash energy management properties, and good formability, the effective use of AHSS such as Duel Phase and TRIP (Transformation Induced Plasticity) steels, will significantly contribute to vehicle lightweighting and fuel economy. To further the application of these steels in automotive body and structural parts, a good knowledge and experience base must be developed regarding the press formability of these materials. This project provides data on relevant intrinsic mechanical behavior, splitting limits, and springback behavior of several lots of mild steel, conventional high strength steel (HSS), advanced high strength steel (AHSS) and ultra-high strength steel (UHSS), supplied by the member companies of the Automotive Applications Committee (AAC) of the American Iron and Steel Institute (AISI). Two lots of TRIP600, which were supplied by ThyssenKrupp Stahl, were also included in the study. Since sheet metal forming encompasses a very diverse range of forming processes and deformation modes, a number of simulative tests were used to characterize the forming behavior of these steel grades. In general, it was found that formability, as determined by the different tests, decreased with increased tensile strength. Consistant with previous findings, the formability of TRIP600 was found to be exceptionally good for its tensile strength.

  5. Lung cancer mortality in stainless steel and mild steel welders: a nested case-referent study

    DEFF Research Database (Denmark)

    Lauritsen, Jens; Hansen, K S

    1996-01-01

    . Analysis was based on 439 deceased referents and 94 deceased cases. There was a 70% excess of lung cancer associated with "welding exposure ever" (OR +/- 95% C.I.: 1.68, 1.02-2.78). Overall OR for "mild steel (MS) welding ever" was 1.64, 0.99-2.72. The risk estimates for welding exposures showed...... an increasing tendency up to 15 years of exposure. The pattern of stainless steel (SS) welding resembles that of mild steel with an estimated OR of 1.65, 0.88-3.0. The general conclusion is that MS welding as well as SS welding seems to be associated with an increased risk of lung cancer. Further followup...

  6. Simulation of a stainless steel multipass weldment

    Energy Technology Data Exchange (ETDEWEB)

    Lejeail, Y.; Cabrillat, M.T. [CEA Centre d`Etudes de Cadarache, 13 - Saint-Paul-lez-Durance (France)

    1995-12-31

    Several problems in nuclear power plants are due to shrinkage and distortion of welded structures and the associated residual stresses. In this context, a stainless steel multipass weldment realized in a H type constrained specimen has been calculated by means of finite element method. The temperatures obtained from a 3 D modified Rosenthal equation are compared with the experimental ones, and are then used for the 2 D simulation in which a linear Kinematic hardening is assumed in relation to a Von Mises plasticity criteria. Materials data are well known up to very high temperatures (1200{sup 0} C) and are introduced in the model. Experimental and calculated displacements after the first pass are compared and a discussion points out what improvements should be made for a better agreement. (author). 3 refs., 8 figs, 1 tab.

  7. A sustainability assessment system for Chinese iron and steel firms

    DEFF Research Database (Denmark)

    Long, Yunguang; Pan, Jieyi; Farooq, Sami

    2016-01-01

    from financial and sustainability reports of four leading Chinese iron and steel firms. The proposed sustainable assessment system is envisaged to help Chinese iron and steel firms to objectively investigate their sustainability performance, provide clear and effective information to decision makers......The environmental impact of the Chinese iron and steel industry is huge due to its high consumption of ore, coal and energy, and water and air pollution. It is important not only for China but also for the rest of the world that the Chinese iron and steel industry becomes more sustainable....... A sustainable assessment indicator system is an important tool to support that development. Currently, however, a sustainable assessment system, specifically designed to match the characteristics of Chinese iron and steel firms, is not available. In this paper such a system is proposed and evaluated using data...

  8. Production of Green Steel from Red Mud: A Novel Concept

    Science.gov (United States)

    Bhoi, Bhagyadhar; Behera, Pravas Ranjan; Mishra, Chitta Ranjan

    Red mud of Indian origin contains around 55% plus of Fe2O3 and is considered as a hazardous waste for the alumina industry. For production of one tone of alumina employing the Bayer's Process, around two tones of red mud is generated from three tones of Bauxite. Conventional process of steel making is not devoid of environmental pollution. In the present investigation, efforts have been made to produce steel from red mud by adopting reduction roasting, magnetic separation and hydrogen plasma smelting route. Magnetic fraction, containing enriched iron oxide and minimal content of alumina, is produced following the first two stages which is then subjected to hydrogen plasma smelting process for production of steel. This novel concept follows a green path way for production of steel free from pollution and is termed as green steel. Further, the only by-product that is produced in the process, is water, which is eco-friendly and recyclable.

  9. Lathlike upper bainite in a silicon steel

    International Nuclear Information System (INIS)

    Liu Cheng; Zhao Zhenbo; Bhole, S.D.

    2006-01-01

    The morphology and mechanical properties of upper bainite formed isothermally at 400 deg. C for different holding times in a 1.83 wt.% silicon steel have been investigated by optical metallograph, X-ray diffraction and transmission electron microscopy (TEM). In the early stage of upper bainitic transformation, lathlike bainite whose individual lath ferrite is separated by the thin film type of retained austenite is obtained. As the isothermal holding times are increased, the blocky region consisting of retained austenite and martensite is also found. The stability of retained austenite in lathlike upper bainite is studied in relation to the isothermal treatment times, and the heat treatment conditions. The results show that an optimum combination of strength and ductility is attributed to the formation of bainitic ferrite (BF) and a large amount of thin film carbon-enriched retained austenite in the upper bainite

  10. Micromechanics of twinning in a TWIP steel

    International Nuclear Information System (INIS)

    Rahman, K.M.; Jones, N.G.; Dye, D.

    2015-01-01

    The deformation behaviour of a TWinning Induced Plasticity (TWIP) steel was studied at quasi-static strain rates using synchrotron X-ray diffraction. A {111} RD and {200} RD texture developed from the earliest stages of deformation, which could be reproduced using an elasto-plastic self consistent (EPSC) model. Evidence is found from multiple sources to suggest that twinning was occurring before macroscopic yielding. This included small deviations in the lattice strains, {111} intensity changes and peak width broadening all occurring below the macroscopic yield point. The accumulation of permanent deformation on sub-yield mechanical cycling of the material was found, which further supports the diffraction data. TEM revealed that fine deformation twins similar to those observed in heavily deformed samples formed during sub-yield cycling. It is concluded that twinning had occurred before macroscopic plastic deformation began, unlike the behaviour traditionally expected from hexagonal metals such as Mg

  11. Micromechanics of twinning in a TWIP steel

    Energy Technology Data Exchange (ETDEWEB)

    Rahman, K.M., E-mail: khandaker.rahman05@imperial.ac.uk [Department of Materials, Royal School of Mines, Imperial College London, Prince Consort Road, London SW7 2BP (United Kingdom); Jones, N.G. [Department of Materials Science and Metallurgy, University of Cambridge, 27 Charles Babbage Road, Cambridge CB3 0FS (United Kingdom); Dye, D. [Department of Materials, Royal School of Mines, Imperial College London, Prince Consort Road, London SW7 2BP (United Kingdom)

    2015-05-21

    The deformation behaviour of a TWinning Induced Plasticity (TWIP) steel was studied at quasi-static strain rates using synchrotron X-ray diffraction. A {111} RD and {200} RD texture developed from the earliest stages of deformation, which could be reproduced using an elasto-plastic self consistent (EPSC) model. Evidence is found from multiple sources to suggest that twinning was occurring before macroscopic yielding. This included small deviations in the lattice strains, {111} intensity changes and peak width broadening all occurring below the macroscopic yield point. The accumulation of permanent deformation on sub-yield mechanical cycling of the material was found, which further supports the diffraction data. TEM revealed that fine deformation twins similar to those observed in heavily deformed samples formed during sub-yield cycling. It is concluded that twinning had occurred before macroscopic plastic deformation began, unlike the behaviour traditionally expected from hexagonal metals such as Mg.

  12. A methodology for replacement of conventional steel by microalloyed steel in bus tubular structures

    International Nuclear Information System (INIS)

    Cruz, Magnus G.H.; Viecelli, Alexandre

    2008-01-01

    The aim of this article is to show the use of a methodology that allows, in a trustful way and without the need to build up a complete physical model, the replacement of conventional steel by structural microalloyed steel (HSLA) in tubular structure, concerning passengers transport in vehicles with capacity of more than 20 people. The validation of the methodology is based on the ECE R66-00 regulation and on the Brazilian CONTRAN 811/96 resolution, which regulate minimal conditions of safety for this kind of vehicle. The methodology has four sequential and dependent stages, where the main focus is related to the experimental tests through the models that are simplified initially for later calibration using finite element method. Modular structures made of two different materials were tested and analyzed to confirm the present methodology, first the structure made of steel that is used by the bus industry in Brazil was tested and then it was compared with the new microalloyed steel. Experimental values are compared with calculated ones, foreseeing parametric optimisation and keeping the security levels according to legislation

  13. A methodology for replacement of conventional steel by microalloyed steel in bus tubular structures

    Energy Technology Data Exchange (ETDEWEB)

    Cruz, Magnus G.H. [Marcopolo S.A., Unidade Ana Rech, Av. Rio Branco, 4889, Ana Rach, 95060-650 Caxias do Sul (Brazil)], E-mail: magnus@verbonet.com.br; Viecelli, Alexandre [Mechanical Engineering Department, Universidade de Caxias do Sul, Rua Francisco Getulio Vargas, 1130, 95070-560 Caxias do Sul, RS (Brazil)], E-mail: avieceli@ucs.br

    2008-07-01

    The aim of this article is to show the use of a methodology that allows, in a trustful way and without the need to build up a complete physical model, the replacement of conventional steel by structural microalloyed steel (HSLA) in tubular structure, concerning passengers transport in vehicles with capacity of more than 20 people. The validation of the methodology is based on the ECE R66-00 regulation and on the Brazilian CONTRAN 811/96 resolution, which regulate minimal conditions of safety for this kind of vehicle. The methodology has four sequential and dependent stages, where the main focus is related to the experimental tests through the models that are simplified initially for later calibration using finite element method. Modular structures made of two different materials were tested and analyzed to confirm the present methodology, first the structure made of steel that is used by the bus industry in Brazil was tested and then it was compared with the new microalloyed steel. Experimental values are compared with calculated ones, foreseeing parametric optimisation and keeping the security levels according to legislation.

  14. Statistical evaluation of unobserved nonuniform corrosion in A216 steel

    International Nuclear Information System (INIS)

    Pulsipher, B.A.

    1988-07-01

    Tests designed to promote nonuniform corrosion have been conducted at PNL on A216 steel. In all of the tests performed to date, there have been no manifestations of significant nonuniform corrosion. Although this may suggest that nonuniform corrosion in A216 steel may not be a significant problem in the nuclear waste repository, a question arises as to whether enough tests have been conducted for a sufficient length of time to rule out nonuniform corrosion of A216 steel. In this report, a method for determining the required number of tests is examined for two of the mechanisms of nonuniform corrosion: pitting and crevice corrosion

  15. Steel making

    CERN Document Server

    Chakrabarti, A K

    2014-01-01

    "Steel Making" is designed to give students a strong grounding in the theory and state-of-the-art practice of production of steels. This book is primarily focused to meet the needs of undergraduate metallurgical students and candidates for associate membership examinations of professional bodies (AMIIM, AMIE). Besides, for all engineering professionals working in steel plants who need to understand the basic principles of steel making, the text provides a sound introduction to the subject.Beginning with a brief introduction to the historical perspective and current status of steel making together with the reasons for obsolescence of Bessemer converter and open hearth processes, the book moves on to: elaborate the physiochemical principles involved in steel making; explain the operational principles and practices of the modern processes of primary steel making (LD converter, Q-BOP process, and electric furnace process); provide a summary of the developments in secondary refining of steels; discuss principles a...

  16. 30 CFR 285.224 - What happens if MMS accepts my bid?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What happens if MMS accepts my bid? 285.224... Renewable Energy Leases Competitive Lease Award Process § 285.224 What happens if MMS accepts my bid? If we... withdraw an OCS area in which we have held a lease sale before you and MMS execute the lease in that area...

  17. Plane strain forging of a niobium micro-alloyed steel

    International Nuclear Information System (INIS)

    Balancin, O.; Ferran L, G.; Rio de Janeiro Univ.

    1984-01-01

    Various termomechanical treatments were carried out on a niobium micro-alloyed steel and a low carbon steel as reference material, using an apparatus for hot phane strain forging. Control of processing variables and the presence of niobium strongly modify the austenite microstructure, which upon decomposition produces various phases such as polygonal and acicular ferrite and martensite, alone or together in variable proportions. Corresponding to this diversity of structures there is a wide variation in mechanical properties at room temperature: the initial yield point varies from 310 to 650 MPa and the reduction of area in uniaxial tension from 82 to 57% for the niobium steel. These results show that hot forging a niobium micro-alloyed steel may be a suitable manufacturing process for satisfying a wide range of specifications in a final product with low equivalent carbon. (Author) [pt

  18. Vibration Properties of a Steel-PMMA Composite Beam

    OpenAIRE

    He, Yuyang; Jin, Xiaoxiong

    2015-01-01

    A steel-polymethyl methacrylate (steel-PMMA) beam was fabricated to investigate the vibration properties of a one-dimensional phononic crystal structure. The experimental system included an excitation system, a signal acquisition system, and a data analysis and processing system. When an excitation signal was exerted on one end of the beam, the signals of six response points were collected with acceleration sensors. Subsequent signal analysis showed that the beam was attenuated in certain fre...

  19. Reliability Analysis of a Steel Frame

    Directory of Open Access Journals (Sweden)

    M. Sýkora

    2002-01-01

    Full Text Available A steel frame with haunches is designed according to Eurocodes. The frame is exposed to self-weight, snow, and wind actions. Lateral-torsional buckling appears to represent the most critical criterion, which is considered as a basis for the limit state function. In the reliability analysis, the probabilistic models proposed by the Joint Committee for Structural Safety (JCSS are used for basic variables. The uncertainty model coefficients take into account the inaccuracy of the resistance model for the haunched girder and the inaccuracy of the action effect model. The time invariant reliability analysis is based on Turkstra's rule for combinations of snow and wind actions. The time variant analysis describes snow and wind actions by jump processes with intermittencies. Assuming a 50-year lifetime, the obtained values of the reliability index b vary within the range from 3.95 up to 5.56. The cross-profile IPE 330 designed according to Eurocodes seems to be adequate. It appears that the time invariant reliability analysis based on Turkstra's rule provides considerably lower values of b than those obtained by the time variant analysis.

  20. The heat treatment of steel. A mathematical control problem

    Energy Technology Data Exchange (ETDEWEB)

    Hoemberg, Dietmar; Kern, Daniela

    2009-07-21

    The goal of this paper is to show how the heat treatment of steel can be modelled in terms of a mathematical optimal control problem. The approach is applied to laser surface hardening and the cooling of a steel slab including mechanical effects. Finally, it is shown how the results can be utilized in industrial practice by a coupling with machine-based control. (orig.)

  1. A sustainability assessment system for Chinese iron and steel firms

    OpenAIRE

    Long, Yunguang; Pan, Jieyi; Farooq, Sami; Boer, Harry

    2016-01-01

    The environmental impact of the Chinese iron and steel industry is huge due to its high consumption of ore, coal and energy, and water and air pollution. It is important not only for China but also for the rest of the world that the Chinese iron and steel industry becomes more sustainable. A sustainable assessment indicator system is an important tool to support that development. Currently, however, a sustainable assessment system, specifically designed to match the characteristics of Chinese...

  2. Machinability of a Stainless Steel by Electrochemical Discharge Microdrilling

    International Nuclear Information System (INIS)

    Coteata, Margareta; Pop, Nicolae; Slatineanu, Laurentiu; Schulze, Hans-Peter; Besliu, Irina

    2011-01-01

    Due to the chemical elements included in their structure for ensuring an increased resistance to the environment action, the stainless steels are characterized by a low machinability when classical machining methods are applied. For this reason, sometimes non-traditional machining methods are applied, one of these being the electrochemical discharge machining. To obtain microholes and to evaluate the machinability by electrochemical discharge microdrilling, test pieces of stainless steel were used for experimental research. The electrolyte was an aqueous solution of sodium silicate with different densities. A complete factorial plan was designed to highlight the influence of some input variables on the sizes of the considered machinability indexes (electrode tool wear, material removal rate, depth of the machined hole). By mathematically processing of experimental data, empirical functions were established both for stainless steel and carbon steel. Graphical representations were used to obtain more suggestive vision concerning the influence exerted by the considered input variables on the size of the machinability indexes.

  3. A friction model for cold forging of aluminum, steel and stainless steel provided with conversion coating and solid film lubricant

    DEFF Research Database (Denmark)

    Bay, Niels; Eriksen, Morten; Tan, Xincai

    2011-01-01

    Adopting a simulative tribology test system for cold forging the friction stress for aluminum, steel and stainless steel provided with typical lubricants for cold forging has been determined for varying normal pressure, surface expansion, sliding length and tool/work piece interface temperature...

  4. Microstructure of a high boron 9-12% chromium steel

    Energy Technology Data Exchange (ETDEWEB)

    Andren, H.O. [Chalmers Univ. of Technology, Goeteborg (Sweden). Dept. of Applied Physics

    2008-07-01

    Additions of small amounts of boron (10-100 ppm) to 9-12% chromium steels are often made since they have been found to be beneficial for the creep strength up to and above 600 C. The effect of boron is to restrict the coarsening of M{sub 23}C{sub 6} precipitates during service. It was found that increasing the boron content from 9 to 40 ppm gave a decrease in coarsening constant at 600 C by a factor of 2. The present understanding of boron solution, non-equilibrium grain boundary segregation, incorporation into M{sub 23}C{sub 6}, and diffusion is reviewed in the paper. A very high boron addition (300 ppm) was made in the trial TAF steel already in the 1950'ies. The microstructure of a similar trial steel, FT3B, has been studied detail. In this steel large Mo, Cr, Fe and V containing metal borides are formed rather than the expected BN, with the crystal structure M{sub 2}B{sub 2}. Nitrogen is therefore still available for the formation of VN. Due to tempering at a low temperature (690 C) to a high strength (830 MPa), this steel contained a dense distribution of very small VN precipitates, 5-15 nm in size. A similar VN distribution is probably the cause of the still unsurpassed creep strength of the TAF steel. (orig.)

  5. A liquid aluminum corrosion resistance surface on steel substrate

    International Nuclear Information System (INIS)

    Wang Deqing; Shi Ziyuan; Zou Longjiang

    2003-01-01

    The process of hot dipping pure aluminum on a steel substrate followed by oxidation was studied to form a surface layer of aluminum oxide resistant to the corrosion of aluminum melt. The thickness of the pure aluminum layer on the steel substrate is reduced with the increase in temperature and time in initial aluminizing, and the thickness of the aluminum layer does not increase with time at given temperature when identical temperature and complete wetting occur between liquid aluminum and the substrate surface. The thickness of the Fe-Al intermetallic layer on the steel base is increased with increasing bath temperature and time. Based on the experimental data and the mathematics model developed by the study, a maximum exists in the thickness of the Fe-Al intermetallic at certain dipping temperature. X-ray diffraction (XRD) and energy dispersive X-ray (EDX) analysis reveals that the top portion of the steel substrate is composed of a thin layer of α-Al 2 O 3 , followed by a thinner layer of FeAl 3 , and then a much thicker one of Fe 2 Al 5 on the steel base side. In addition, there is a carbon enrichment zone in diffusion front. The aluminum oxide surface formed on the steel substrate is in perfect condition after corrosion test in liquid aluminum at 750 deg. C for 240 h, showing extremely good resistance to aluminum melt corrosion

  6. Marble waste characterization as a desulfurizing slag component for steel

    International Nuclear Information System (INIS)

    Coleti, J.L.; Grillo, F.F.; Tenorio, J.A.S.; De Oliveira, J.R.

    2014-01-01

    The current steel market requires from steel plants better quality of its products. As a result, steel plants need to search for improvements and costs reduction in its process. Hence, the residue of marble containing significant quantities of calcium and magnesium carbonates, raw materials of steel refining slag, was characterized in order to replace the conventional lime used. Therefore, it will be possible to reduce the cost and volume of waste produced by the ornamental rock industry. The following methods were applied to test the waste potential: SEM with EDS, x-ray diffraction, x-ray fluorescence (EDX), Thermogravimetry (TG) and analysis of surface area and particle size by the BET method using dispersion leisure. The results indicated the feasibility of waste as raw material in the composition of desulfurizing slags. (author)

  7. Nanostructures in a ferritic and an oxide dispersion strengthened steel induced by dynamic plastic deformation

    DEFF Research Database (Denmark)

    Zhang, Zhenbo

    fission and fusion reactors. In this study, two candidate steels for nuclear reactors, namely a ferritic/martensitic steel (modified 9Cr-1Mo steel) and an oxide dispersion strengthened (ODS) ferritic steel (PM2000), were nanostructured by dynamic plastic deformation (DPD). The resulting microstructure...

  8. Fabrication and characterization of a Spanish RAFM steel

    International Nuclear Information System (INIS)

    Rodriguez, D.; Serrano, M.; Moran, A.; Artimez, J. M.

    2009-01-01

    One of the main challenges for the realization of the future fusion reactor is the development and qualification of structural materials for first wall and breeding blanket. The fusion reactor application requires materials resistant to radiation damage, with excellent mechanical properties at high temperatures, good corrosion behaviour and reduced activation potential. Reduced Activation (RAFM) 9Cr Ferritic/Martenistic steels are the main candidates for first wall and blanket of fusion reactors, due to their resistance to swelling and excellent structural and thermal properties. These steels are based on the classical Cr-Mo steel grades but with a chemical composition modified in order to fulfil the low activation requirements, substituting the alloying elements with long decay times due to high activation by neutron irradiation. For this purpose the Mo is replaced by W, the Nb by Ta and Ni is removed. A summary of the activities related to the evaluation of the microstructural and mechanical properties of a reduced activation ferritic/martensitic steel fabricated at a semi-industrial scale in Spain will be presented in this paper. The steel chemical composition fulfils or is very close to the compositional specifications and metallurgical properties of the EUROFER steel. This activity corresponds to the ITMA and CIEMAT participation on Task 4 of the CONSOLIDER TECNO F US INGENIO 2010, financed by the Spanish Ministry of Science and Innovation. (author)

  9. 30 CFR 285.659 - What requirements must I include in my SAP, COP, or GAP regarding air quality?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What requirements must I include in my SAP, COP, or GAP regarding air quality? 285.659 Section 285.659 Mineral Resources MINERALS MANAGEMENT SERVICE... must I include in my SAP, COP, or GAP regarding air quality? (a) You must comply with the Clean Air Act...

  10. The miRNA Pull Out Assay as a Method to Validate the miR-28-5p Targets Identified in Other Tumor Contexts in Prostate Cancer

    DEFF Research Database (Denmark)

    Rizzo, Milena; Berti, Gabriele; Russo, Francesco

    2017-01-01

    targets in the pull out sample. We showed that E2F6, TEX-261, MAPK1, MPL, N4BP1, and RAP1B but not BAG1, OTUB1, MAD2L1, and p21 were significantly enriched, suggesting that not all the miR-28-5p targets are regulated by this miRNA in PCa. We then verified whether the miR-28-5p-interacting targets were...

  11. 30 CFR 285.435 - How can I relinquish a lease or a grant or parts of a lease or grant?

    Science.gov (United States)

    2010-07-01

    ..., DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY ALTERNATE USES OF EXISTING FACILITIES ON THE OUTER... relinquishment application with MMS. A relinquishment takes effect on the date we approve your application... obligations under the lease or grant. (b) Your relinquishment application must include: (1) Name; (2) Contact...

  12. Dicty_cDB: VHI285 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHI285 (Link to dictyBase) - - - Contig-U16073-1 - (Link to Or...iginal site) VHI285F 136 - - - - - - Show VHI285 Library VH (Link to library) Clone ID VHI285 (Link to dicty...Base) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U16073-1 Original site URL http://dictycdb.b... DNA Score E Sequences producing significant alignments: (bits) Value N ( BJ423035 ) Dict...yostelium discoideum cDNA clone:ddv47i22, 5' ... 72 2e-27 3 ( BJ419916 ) Dictyostelium discoideum cD

  13. China’s steel industry as a driving force for economic growth and international competitiveness

    OpenAIRE

    Popescu, Gh. H.; Nica, E.; Nicolăescu, E.; Lăzăroiu, G.

    2016-01-01

    The theory that we shall seek to elaborate here puts considerable emphasis on technological features of China’s steel production, its emergence as the world’s most significant steel producer and main manufacturing base, and the transitory decline in steel demand related to the international financial crisis. The purpose of this article is to gain a deeper understanding of the global incorporation of China’s steel enterprises, its portion of worldwide steel consumption, and its industrial poli...

  14. Effect of residual stress on fatigue crack propagation at 200 C in a welded joint austenitic stainless steel - ferritic steel

    International Nuclear Information System (INIS)

    Zahouane, A.I.; Gauthier, J.P.; Petrequin, P.

    1988-01-01

    Fatigue resistance of heterogeneous welded joints between austenitic stainless steels and ferritic steels is evaluated for reactor components and more particularly effect of residual stress on fatigue crack propagation in a heterogeneous welded joint. Residual stress is measured by the hole method in which a hole is drilled through the center of a strain gage glued the surface of the materials. In the non uniform stress field a transmissibility function is used for residual stress calculation. High compression residual stress in the ferritic metal near the interface ferritic steel/weld slow down fatigue crack propagation. 5 tabs., 15 figs., 19 refs [fr

  15. A review of hot cracking in austenitic stainless steel weldments

    International Nuclear Information System (INIS)

    Shankar, V.; Gill, T.P.S.; Mannan, S.L.; Rodriguez, P.

    1991-01-01

    The occurrence of hot cracking in austenitic stainless steel weldments is discussed with respect to its origin and metallurgical contributory factors. Of the three types of hot cracking, namely solidification cracking, liquation and ductility dip cracking, solidification cracking occurs in the interdendritic regions in weld metal while liquation and ductility dip cracking occur intergranularly in the heat-affected zone (HAZ). Segregation of impurity and minor elements such as sulphur, phosphorous, silicon, niobium, boron etc to form low melting eutectic phases has been found to be the major cause of hot cracking. Control of HAZ cracking requires minimisation of impurity elements in the base metal. In stabilized stainless steels containing niobium, higher amounts of delta-ferrite have been found necessary to prevent cracking than in unstabilized compositions. Titanium compounds have been found to cause liquation cracking in maraging steels and titanium containing stainless steels and superalloys. In nitrogen added stainless steels, cracking resistance decreases when the solidification mode changes to primary austenitic due to nitrogen addition. A review of the test methods to evaluate hot cracking behaviour showed that several external restraint and semi-self-restraint tests are available. The finger Test, WRC Fissure Bend Test, the PVR test and the Varestraint Test are described along with typical test results. Hot ductility testing to reveal HAZ cracking tendency during welding is described, which is of particular importance to stabilized stainless steels. Based on the literature, recommendations are made for welding stabilized and nitrogen added steels, indicating areas of further work. (author). 81 refs., 30 figs., 1 tab

  16. Optimization of the A-TIG welding for stainless steels

    Science.gov (United States)

    Jurica, M.; Kožuh, Z.; Garašić, I.; Bušić, M.

    2018-03-01

    The paper presents the influence of the activation flux and shielding gas on tungsten inert gas (A-TIG) welding of the stainless steel. In introduction part, duplex stainless steel was analysed. The A-TIG process was explained and the possibility of welding stainless steels using the A-TIG process to maximize productivity and the cost-effectiveness of welded structures was presented. In the experimental part duplex, 7 mm thick stainless steel has been welded in butt joint. The influence of activation flux chemical composition upon the weld penetration has been investigated prior the welding. The welding process was performed by a robot with TIG equipment. With selected A-TIG welding technology preparation of plates and consumption of filler material (containing Cr, Ni and Mn) have been avoided. Specimens sectioned from the produced welds have been subjected to tensile strength test, macrostructure analysis and corrosion resistance analysis. The results have confirmed that this type of stainless steel can be welded without edge preparation and addition of filler material containing critical raw materials as Cr, Ni and Mn when the following welding parameters are set: current 200 A, welding speed 9,1 cm/min, heat input 1,2 kJ/mm and specific activation flux is used.

  17. Hot ductility and fracture mechanisms of a structural steel

    International Nuclear Information System (INIS)

    Calvo, J.; Cabrera, J. M.; Prado, J. M.

    2006-01-01

    The hot ductility of a structural steel produced from scrap recycling has been studied to determine the origin of the transverse cracks in the corners that appeared in some billets. Samples extracted both from a billet with transverse cracks and from a billet with no external damage were tested. To evaluate the influence of residual elements and inclusions, the steel was compared to another one impurity free. Reduction in area of the samples tensile tested to the fracture was taken as a measure of the hot ductility. The tests were carried out at temperatures ranging from 1000 degree centigree to 650 degree centigree and at a strain rate of 1.10-3 s-1. The fracture surfaces of the tested samples were observed by scanning electron microscopy in order to determine the embrittling mechanisms that could be acting. The steel with residuals and impurities exhibited lower ductility values for a wider temperature range than the clean steel. The embrittling mechanisms also changed as compared to the impurity free steel. (Author)

  18. 21 CFR 137.285 - Degerminated yellow corn meal.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Degerminated yellow corn meal. 137.285 Section 137... Cereal Flours and Related Products § 137.285 Degerminated yellow corn meal. Degerminated yellow corn meal, degermed yellow corn meal, conforms to the definition and standard of identity prescribed by § 137.265 for...

  19. Deformation mechanism maps for pure iron, corrosion resistant austenitic steels and a low-alloy carbon steel

    International Nuclear Information System (INIS)

    Frost, H.Y.; Ashby, M.F.

    1980-01-01

    Principles of construction of deformation mechanisms charts for iron base alloys are presented. Deformation mechanisms charts for pure iron, 316 and 314 stainless steels, a ferritic steel with 1% Cr, Mo, V are given, examples of the charts application being provided. The charts construction is based, when it is possible, on the state equations, deduced from theoretical models and satisfying experimental data. The charts presented should be considered as an attempt to unite the main regularities of the theory of dislocations and diffusion with the observed experimental picture of plastic deformation and creep of commercial steels [ru

  20. Dynamic recrystallization behavior of a medium carbon vanadium microalloyed steel

    International Nuclear Information System (INIS)

    Wei, Hai-lian; Liu, Guo-quan; Xiao, Xiang; Zhang, Ming-he

    2013-01-01

    The dynamic recrystallization behavior of a medium carbon vanadium microalloyed steel was systematically investigated at the temperatures from 900 °C to 1100 °C and strain rates from 0.01 s −1 to 10 s −1 on a Gleeble-1500 thermo-simulation machine. The flow stress constitutive equation of hot deformation for this steel was developed with the activation energy Q being about 273 kJ/mol, which is in reasonable agreement with those reported before. Activation energy analysis showed that vanadium addition in microalloyed steels seemed not to affect the activation energy much. The effect of Zener–Hollomon parameter on the characteristic points of flow curves was studied using the power law relation, and the dependence of critical strain (stress) on peak strain (stress) obeyed a linear equation. Dynamic recrystallization is the most important softening mechanism for the experimental steel during hot compression. The dynamic recrystallization kinetics model of this steel was established based on flow stress and a frequently-used dynamic recrystallization kinetics equation. Dynamic recrystallization microstructure under different deformation conditions was also observed and the dependence of steady-state grain size on the Zener–Hollomon parameter was plotted

  1. A new generation of ultra high strength steel pipelines

    International Nuclear Information System (INIS)

    Brozda, J.; Zeman, M.; Weglowski, M.

    2008-01-01

    For many years an increased demand for natural gas can be observed. Ultra high-strength pipelines with higher operating pressures and/or reduced wall thickness are a means to reduce transmission costs. Motivated by reduced investment costs (overcharge a few billion of dollars), tend towards the development of a new grade of pipeline steel with microalloying element for example Nb, that potentially lowers the total cost of long-distance gas pipelines by 5 - 15%. New long distance pipelines have budgets in excess of several billion dollars. This paper describes mechanical properties of new generation of pipelines steel with higher content of niobium and the influence the welding thermal cycles on the microstructure and brittle fracture resistance. The resistance to cold cracking has also been determined. It was found that the new steel has close properties to API X70 grade steels, but is cheaper in manufacturing and installation. The steel has been covered by the amended EN 10028-5 standard and proper modifications will also be made in other European standards. (author)

  2. Characterization of the heart rate curve during a maximum incremental test on a treadmill. DOI: 10.5007/1980-0037.2011v13n4p285

    Directory of Open Access Journals (Sweden)

    Eduardo Marcel Fernandes Nascimento

    2011-08-01

    Full Text Available The objective of this study was to analyze the heart rate (HR profile plotted against incremental workloads (IWL during a treadmill test using three mathematical models [linear, linear with 2 segments (Lin2, and sigmoidal], and to determine the best model for the identification of the HR threshold that could be used as a predictor of ventilatory thresholds (VT1 and VT2. Twenty-two men underwent a treadmill incremental test (retest group: n=12 at an initial speed of 5.5 km.h-1, with increments of 0.5 km.h-1 at 1-min intervals until exhaustion. HR and gas exchange were continuously measured and subsequently converted to 5-s and 20-s averages, respectively. The best model was chosen based on residual sum of squares and mean square error. The HR/IWL ratio was better fitted with the Lin2 model in the test and retest groups (p0.05. During a treadmill incremental test, the HR/IWL ratio seems to be better fitted with a Lin2 model, which permits to determine the HR threshold that coincides with VT1.

  3. A preliminary bending fatigue spectrum for steel monostrand cables

    DEFF Research Database (Denmark)

    Winkler, Jan; Fischer, Gregor; Georgakis, Christos T.

    2011-01-01

    This paper presents the results of the experimental study on the bending fatigue resistance of high-strength steel monostrand cables. From the conducted fatigue tests in the high-stress, low-cycle region, a preliminary bending fatigue spectrum is derived for the estimation of monostrand cable...... service life expectancy. The presented preliminary bending fatigue spectrum of high-strength monostrands is currently unavailable in the published literature. The presented results provide relevant information on the bending mechanism and fatigue characteristics of monostrand steel cables in tension...... and flexure and show that localized cable bending has a pronounced influence on the fatigue resistance of cables under dynamic excitations....

  4. A low temperature aluminizing treatment of hot work tool steel

    Energy Technology Data Exchange (ETDEWEB)

    Matijevic, B., E-mail: bozidar.matijevic@fsb.hr [University of Zagreb, Faculty of Mechanical Engineering and Naval Architecture, Zagreb (Croatia)

    2010-07-01

    Conventional aluminizing processes by pack cementation are typically carried out at elevated temperatures. A low temperature powder aluminizing technology was applied to hot tool steel H13. The aluminizing treating temperature was from 550 to 620°C. Effects of temperature and time on the microstructure and phase evolution were investigated. Also, the intermetallic layer thickness was measured in the aluminized layer of a steel substrate. The cross-sectional microstructures, the aluminized layer thickness and the oxide layer were studied. Scanning electron microscopy (SEM), energy dispersive X-ray spectroscopy (EDX), glow discharge optical spectroscopy (GDOS) were applied to observe the cross-sections and the distribution of elements. (author)

  5. A LOW TEMPERATURE ALUMINIZING TREATMENT OF HOT WORK TOOL STEEL

    OpenAIRE

    Matijević, Božidar

    2013-01-01

    Conventional aluminizing processes by pack cementation are typically carried out at elevated temperatures. A low temperature powder aluminizing technology was applied to the X40CrMoV5-1 hot tool steel. The aluminizing temperature was from 550 °C to 620 °C. Effects of temperature and time on the microstructure and phase evolution were investigated. Also, the intermetallic layer thickness was measured in the aluminized layer of a steel substrate. The cross-sectional microstructures, the alumini...

  6. A low temperature aluminizing treatment of hot work tool steel

    International Nuclear Information System (INIS)

    Matijevic, B.

    2010-01-01

    Conventional aluminizing processes by pack cementation are typically carried out at elevated temperatures. A low temperature powder aluminizing technology was applied to hot tool steel H13. The aluminizing treating temperature was from 550 to 620°C. Effects of temperature and time on the microstructure and phase evolution were investigated. Also, the intermetallic layer thickness was measured in the aluminized layer of a steel substrate. The cross-sectional microstructures, the aluminized layer thickness and the oxide layer were studied. Scanning electron microscopy (SEM), energy dispersive X-ray spectroscopy (EDX), glow discharge optical spectroscopy (GDOS) were applied to observe the cross-sections and the distribution of elements. (author)

  7. Tribology of steel/steel interaction in oil-in-water emulsion; a rationale for lubricity.

    Science.gov (United States)

    Kumar, Deepak; Daniel, Jency; Biswas, S K

    2010-05-15

    Oil droplets are dispersed in water by an anionic surfactant to form an emulsion. The lubricity of this emulsion in steel/steel interaction is explored in a ball on flat nanotribometer. The droplet size and charge are measured using dynamic light scattering, while the substrate charge density is estimated using the pH titration method. These data are combined to calculate the DLVO forces for the droplets generated for a range of surfactant concentration and two oil to water volume ratios. The droplets have a clear bi-modal size distribution. The study shows that the smaller droplets which experience weak repulsion are situated (at the highest DLVO barrier) much closer to the substrate than the bigger droplets, which experience the same DLVO force, are. We suggest that the smaller droplets thus play a more important role in lubricity than what the bigger droplets do. The largest volume of such small droplets occurs in the 0.5 mM-1 mM range of surfactant concentration and 1% oil to water volume ratio, where the coefficient of friction is also observed to be the least. Copyright © 2010 Elsevier Inc. All rights reserved.

  8. Comparison of Corrosion Behavior of Low-Alloy Steel Containing Copper and Antimony with 409L Stainless Steel for a Flue Gas Desulfurization System

    Energy Technology Data Exchange (ETDEWEB)

    Park, Sun-Ah; Shin, Su-Bin; Kim, Jung-Gu [Sungkyunkwan University, Suwon (Korea, Republic of)

    2016-07-15

    The corrosion behavior of low alloy steel containing Cu, Sb and 409L stainless steel was investigated for application in the low-temperature section of a flue gas desulfurization (FGD) system. The electrochemical properties were evaluated by potentiodynamic polarization testing and electrochemical impedance spectroscopy (EIS) in 16.9 vol% H{sub 2}SO{sub 4} + 0.35 vol% HCl at 60 ℃. The inclusions in these steels ere identified by electron probe microanalyzer (EPMA). The corrosion products of the steels were analyzed using scanning electron microscope (SEM) with energy dispersive spectroscopy (EDS) and transmission electron microscopy (TEM). The corrosion rate of the low alloy steel containing Cu, Sb was about 100 times lower than that of 409L stainless steel. For stainless steel without passivation, active corrosion behavior was shown. In contrast, in the low alloy steel, the Cu, Sb compounds accumulated on the surface improved the corrosion resistance by suppressing the anodic dissolution reaction.

  9. A STUDY OF IRON AND STEEL SECTOR IN INDIA

    OpenAIRE

    Chand, Sumit

    2008-01-01

    ABSTRACT The iron and steel manufacturing sector is one of the largest sectors in the world in terms of financial volume of trade, employment potential, development of ancillary and allied industries and geographical spread. Added to this is the fact that iron and steel is used as an input in almost all the industrial and manufacturing sectors and goods produced by them. As a result this sector attracts the maximum attention of almost all the countries of the world, whether being one of t...

  10. Creep of A508/533 Pressure Vessel Steel

    Energy Technology Data Exchange (ETDEWEB)

    Richard Wright

    2014-08-01

    ABSTRACT Evaluation of potential Reactor Pressure Vessel (RPV) steels has been carried out as part of the pre-conceptual Very High Temperature Reactor (VHTR) design studies. These design studies have generally focused on American Society of Mechanical Engineers (ASME) Code status of the steels, temperature limits, and allowable stresses. Initially, three candidate materials were identified by this process: conventional light water reactor (LWR) RPV steels A508 and A533, 2¼Cr-1Mo in the annealed condition, and Grade 91 steel. The low strength of 2¼Cr-1Mo at elevated temperature has eliminated this steel from serious consideration as the VHTR RPV candidate material. Discussions with the very few vendors that can potentially produce large forgings for nuclear pressure vessels indicate a strong preference for conventional LWR steels. This preference is based in part on extensive experience with forging these steels for nuclear components. It is also based on the inability to cast large ingots of the Grade 91 steel due to segregation during ingot solidification, thus restricting the possible mass of forging components and increasing the amount of welding required for completion of the RPV. Grade 91 steel is also prone to weld cracking and must be post-weld heat treated to ensure adequate high-temperature strength. There are also questions about the ability to produce, and very importantly, verify the through thickness properties of thick sections of Grade 91 material. The availability of large components, ease of fabrication, and nuclear service experience with the A508 and A533 steels strongly favor their use in the RPV for the VHTR. Lowering the gas outlet temperature for the VHTR to 750°C from 950 to 1000°C, proposed in early concept studies, further strengthens the justification for this material selection. This steel is allowed in the ASME Boiler and Pressure Vessel Code for nuclear service up to 371°C (700°F); certain excursions above that temperature are

  11. A calculation model for the noise from steel railway bridges

    NARCIS (Netherlands)

    Janssens, M.H.A.; Thompson, D.J.

    1996-01-01

    The sound level of a train crossing a steel railway bridge is usually about 10 dB higher than on plain track. In the Netherlands there are many such bridges which, for practical reasons, cannot be replaced by more intrinsically quiet concrete bridges. A computational model is described for the

  12. Fracture toughness of welded joints of ASTM A543 steel plate

    International Nuclear Information System (INIS)

    Susukida, H.; Uebayashi, T.; Yoshida, K.; Ando, Y.

    1977-01-01

    Fracture toughness and weldability tests have been performed on a high strength steel which is a modification of ASTM A543 Grade B Class 1 steel, with a view to using it for nuclear reactor containment vessels. The results showed that fracture toughness of welded joints of ASTM A543 modified high strength steel is superior and the steel is suitable for manufacturing the containment vessels

  13. A GBT-framework towards modal modelling of steel structures

    DEFF Research Database (Denmark)

    Hansen, Anders Bau; Jönsson, Jeppe

    2017-01-01

    In modern structural steel frame design, the modelling of joints between beams and columns are based on very simple assumptions. The joints are most often assumed to behave as a perfect hinge or as a rigid joint. This means that in the overall static analysis relative rotations and changes...

  14. Thermoelectric System Absorbing Waste Heat from a Steel Ladle

    Science.gov (United States)

    Lu, Baiyi; Meng, Xiangning; Zhu, Miaoyong; Suzuki, Ryosuke O.

    2018-06-01

    China's iron and steel industry has made great progress in energy savings and emission reductions with the application of many waste heat recovery technologies. However, most of the medium and low temperature waste heat and radiant waste heat has not been effectively utilized. This paper proposes a thermoelectric system that generates electricity by absorbing the radiant heat from the surface of steel ladles in a steel plant. The thermoelectric behavior of modules in this system is analyzed by a numerical simulation method. The effects of external resistance and module structure on thermoelectric performance are also discussed in the temperature range of the wall surface of a steel ladle. The results show that the wall temperature has a significant influence on the thermoelectric behavior of the module, so its uniformity and stability should be considered in practical application. The ratio of the optimum external resistance to the internal resistance of the thermoelectric module is in the range of 1.6-2.0, which indicates the importance of external load optimization for a given thermoelectric system. In addition, the output power and the conversion efficiency of the module can be significantly improved by increasing the length of the thermoelectric legs and adopting a double-layer structure. Finally, through the optimization of external resistance and structure, the power output can reach 83-304 W/m2. This system is shown to be a promising approach for energy recovery.

  15. Vanadium Effect on a Medium Carbon Forging Steel

    Directory of Open Access Journals (Sweden)

    Carlos Garcia-Mateo

    2016-05-01

    Full Text Available In the present work the influence of vanadium on the hardenability and the bainitic transformation of a medium carbon steel is analyzed. While V in solid solution enhances the former, it hardly affects bainitic transformation. The results also reveal an unexpected result, an increase of the prior austenite grain size as the V content increases.

  16. Thermophysical properties of a Type 308 stainless steel weld

    International Nuclear Information System (INIS)

    Lore, J.D.; Richards, H.L.; King, R.T.; Greene, L.M.; Darby, D.M.

    1975-01-01

    Thermal expansion, thermal diffusivity, specific heat, and thermal conductivity measurements were obtained in vacuo for a Type 304-308 stainless steel weldment for use in the Liquid Metal Fast Breeder Reactor. Property measurements were somewhat variant, depending upon the direction of measurement, but the observed differences were small. (U.S.)

  17. Irradiation proposition of ferritic steels in a russian reactor

    International Nuclear Information System (INIS)

    Seran, J.L.; Decours, J.; Levy, L.

    1987-04-01

    Using the low temperatures of russian reactors, a sample irradiation is proposed to study mechanical properties and swelling of martensitic steels (EM10, T91, 1.4914, HT9), ferrito-martensitic (EM12) and ferritic (F17), at temperatures lower than 400 0 C [fr

  18. Detection of Fatigue Damage in a Steel Member

    DEFF Research Database (Denmark)

    Rytter, Anders; Brincker, Rune; Hansen, Lars Pilegaard

    1991-01-01

    In this paper the possibilities of detection of crack extension in a steel beam by observation of changes in the dynamical response are investigated. System changes are observed by frequency domain and the time domain techniques. The position and the size of the crack are found by finite element...

  19. Detection of Fatigue Damage in a Steel Member

    DEFF Research Database (Denmark)

    Rytter, A.; Brincker, Rune; Hansen, Lars Pilegaard

    In this paper the posibilities of detection of crack extension in a steel beam by observation of changes in the dynamical response are investigated. System changes are observed by frequency domain and time domain techniques. The position and the size of the crack by finite element calculations...

  20. Electrolytic decontamination of stainless steel using a basic electrolyte

    International Nuclear Information System (INIS)

    Childs, E.L.; Long, J.L.

    1981-01-01

    An electrolytic plutonium decontamination process or stainless steel was developed for use as the final step in a proposed radioactive waste handling and decontamination facility to be construced at the Rockwell International Rocky Flats plutonium handling facility. This paper discusses test plan, which was executed to compare the basic electrolyte with phosphoric acid and nitric acid electrolytes. 1 ref

  1. 30 CFR 285.526 - What instruments other than a surety bond may I use to meet the financial assurance requirement?

    Science.gov (United States)

    2010-07-01

    ... with: (i) Minimum net assets of $500,000,000; and (ii) Minimum Bankrate.com Safe & Sound rating of 3 Stars, and Capitalization, Assets, Equity and Liquidity (CAEL) rating of 3 or less; (4) Negotiable U.S... insured trust account by a licensed securities brokerage firm for the benefit of the MMS; (5) Investment...

  2. Filler metal selection for welding a high nitrogen stainless steel

    Science.gov (United States)

    Du Toit, Madeleine

    2002-06-01

    Cromanite is a high-strength austenitic stainless steel that contains approximately 19% chromium, 10% manganese, and 0.5% nitrogen. It can be welded successfully, but due to the high nitrogen content of the base metal, precautions have to be taken to ensure sound welds with the desired combination of properties. Although no matching filler metals are currently available, Cromanite can be welded using a range of commercially available stainless steel welding consumables. E307 stainless steel, the filler metal currently recommended for joining Cromanite, produces welds with mechanical properties that are generally inferior to those of the base metal. In wear applications, these lower strength welds would probably be acceptable, but in applications where full use is made of the high strength of Cromanite, welds with matching strength levels would be required. In this investigation, two welding consumables, ER2209 (a duplex austenitic-ferritic stainless steel) and 15CrMn (an austenitic-manganese hardfacing wire), were evaluated as substitutes for E307. When used to join Cromanite, 15CrMn produced welds displaying severe nitrogen-induced porosity, and this consumable is therefore not recommended. ER2209, however, outperformed E307, producing sound porosity-free welds with excellent mechanical properties, including high ductility and strength levels exceeding the minimum limits specified for Cromanite.

  3. Ballistic Characterization Of A Typical Military Steel Helmet

    Directory of Open Access Journals (Sweden)

    Mohamed Ali Maher

    2017-08-01

    Full Text Available In this study the ballistic limit of a steel helmet against a FMJ 919 mm caliber bullet is estimated. The helmet model is the typical polish helmet wz.31.The helmet material showed high strength low alloy steel material of 0.28 carbon content and 9.125 kgm2 areal density. The tensile test according to ASTM E8 showed a tensile strength of 1236.4 MPa .The average hardness value was about HV550. First shooting experiment has been executed using a 9 mm pistol based on 350 ms muzzle velocity at 5m against the simply supported helmet complete penetrations rose in this test were in the form of cracks on the helmet surface and partial penetrations were in the form of craters on the surface whose largest diameter and depth were 43 mm and 20.2 mm consequently .The second experiment was on a rifled gun arrangement 13 bullets of 919 mm caliber were shot on the examined simply supported steel helmet at a zero obliquity angle at different velocities to determine the ballistic limit velocity V50 according to MIL-STD-662F. Three major outcomes were revealed 1 the value V50 which found to be about 390 ms is higher than the one found in literature 360 ms German steel helmet model 1A1. 2 The smallest the standard deviation of the mixed results zone data the most accurate the ballistic limit is. 3Similar to the performance of blunt-ended projectiles impacting overmatching targets tD near 11 or larger It was found that the dominating failure mode of the steel helmet stuck by a hemispherical-nose projectile was plugging mode despite of having tD ratio of about 19 undermatching.

  4. Superplasticity in a lean Fe-Mn-Al steel.

    Science.gov (United States)

    Han, Jeongho; Kang, Seok-Hyeon; Lee, Seung-Joon; Kawasaki, Megumi; Lee, Han-Joo; Ponge, Dirk; Raabe, Dierk; Lee, Young-Kook

    2017-09-29

    Superplastic alloys exhibit extremely high ductility (>300%) without cracks when tensile-strained at temperatures above half of their melting point. Superplasticity, which resembles the flow behavior of honey, is caused by grain boundary sliding in metals. Although several non-ferrous and ferrous superplastic alloys are reported, their practical applications are limited due to high material cost, low strength after forming, high deformation temperature, and complicated fabrication process. Here we introduce a new compositionally lean (Fe-6.6Mn-2.3Al, wt.%) superplastic medium Mn steel that resolves these limitations. The medium Mn steel is characterized by ultrafine grains, low material costs, simple fabrication, i.e., conventional hot and cold rolling, low deformation temperature (ca. 650 °C) and superior ductility above 1300% at 850 °C. We suggest that this ultrafine-grained medium Mn steel may accelerate the commercialization of superplastic ferrous alloys.Research in new alloy compositions and treatments may allow the increased strength of mass-produced, intricately shaped parts. Here authors introduce a superplastic medium manganese steel which has an inexpensive lean chemical composition and which is suited for conventional manufacturing processes.

  5. Recent developments in turning hardened steels - A review

    Science.gov (United States)

    Sivaraman, V.; Prakash, S.

    2017-05-01

    Hard materials ranging from HRC 45 - 68 such as hardened AISI H13, AISI 4340, AISI 52100, D2 STL, D3 STEEL Steel etc., need super hard tool materials to machine. Turning of these hard materials is termed as hard turning. Hard turning makes possible direct machining of the hard materials and also eliminates the lubricant requirement and thus favoring dry machining. Hard turning is a finish turning process and hence conventional grinding is not required. Development of the new advanced super hard tool materials such as ceramic inserts, Cubic Boron Nitride, Polycrystalline Cubic Boron Nitride etc. enabled the turning of these materials. PVD and CVD methods of coating have made easier the production of single and multi layered coated tool inserts. Coatings of TiN, TiAlN, TiC, Al2O3, AlCrN over cemented carbide inserts has lead to the machining of difficult to machine materials. Advancement in the process of hard machining paved way for better surface finish, long tool life, reduced tool wear, cutting force and cutting temperatures. Micro and Nano coated carbide inserts, nanocomposite coated PCBN inserts, micro and nano CBN coated carbide inserts and similar developments have made machining of hardened steels much easier and economical. In this paper, broad literature review on turning of hardened steels including optimizing process parameters, cooling requirements, different tool materials etc., are done.

  6. Development of a new dual phase steel with laminated microstructural morphology

    Energy Technology Data Exchange (ETDEWEB)

    Saeidi, N., E-mail: navidsae@gmail.com [Department of Materials Engineering, Isfahan University of Technology, Isfahan, 4156–83111 (Iran, Islamic Republic of); Karimi, M. [Department of Materials Science and Engineering, Shahrood University of Technology, Shahrood, 3619995161 (Iran, Islamic Republic of); Toroghinejad, M.R. [Department of Materials Engineering, Isfahan University of Technology, Isfahan, 4156–83111 (Iran, Islamic Republic of)

    2017-05-01

    The development of dual phase steels to meet the current world demands, for the purpose of decreasing the fuel consumption with increasing the strength to weight ratio, requires certain microstructural modifications. In the present research, a new morphology of DP steel, known as Laminated–DP steel, as well as its unique production method has been introduced. The new process developed involved properly selecting low carbon steels, stacking them in a laminated manner and performing a roll bonding process followed by short austenitization treatment. The martensite volume fraction was designed and obtained to be 24%. Scanning electron microscopy (SEM) was employed for microstructural examination. Moreover, deformation and tensile behavior of the newly developed steel were studied and compared with those of some ordinary DP steel (ODP). Room temperature uniaxial tensile tests also revealed mechanical properties comparable with those of the commercial DP600 steel, a kind of structural automotive steel. - Highlights: • A new method for producing dual phase steels was introduced. • Employing a new thermo-mechanical process a laminated microstructure was obtained. • Mechanical properties of the new laminated DP steel were studied. • Tensile properties of the new DP steel were comparable with those of the commercial DP600 steel.

  7. Possible consequences of changing to a more environmental-friendly steel production in China

    International Nuclear Information System (INIS)

    Kolstad, Julie Riise

    2005-01-01

    China is the world's biggest steel producer, the world's biggest steel consumer and the world's biggest polluter. The superpower is forced to change its steel production in a more environmental-friendly way, but necessary measures will be expensive; moreover, they will have consequences far past China's borders. The possible effects are elaborated in the article (ml)

  8. A Study of the Effect of Interrupted Quenches on a Thermomechanically Processed High Carbon Steel.

    Science.gov (United States)

    1982-10-01

    steel . Successful martempering requires a cooling rate sufficient to avoid the nose of the C- curve and thus prevent significant bainite formation. When...STUDY OF THE EFFECT OF INTERRUPTED QUENCHES ON A THERMONECHANICALLY PROCESSED HIGH CARBON STEEL by Steven A. Barton October 1982 Thesis Advisor: T.R...unlimited. A Study of the Effect of Interrupted Quenches on a Thermomechanically Processed High Carbon Steel by Steven A. Barton Lieutenant, United

  9. Forming of High-strength Steels Using a Hot-melt Dry Lubricant

    DEFF Research Database (Denmark)

    Hörnström, Sven-Erik; Karlsson, Erik; Olsson, Mikael

    2008-01-01

    during forming resulting in seizure of the tool/steel sheet contact and extensive scratching of the steel sheet surface. As a result, a number of concepts have been developed in order to reduce the tendency to galling in metal forming, including the development of new dry lubricants, new forming tool...... steel grades and improved surface engineering treatments such as the deposition of low friction CVD and PVD coatings. In the present study the performance of a hot-melt dry lubricant in the forming of hot and cold rolled and hot-dip galvanized high strength steel has been evaluated and compared...... with a conventional rust protection oil using four different tests methods, i.e. a strip reduction test, a bending under tension test, a stretch-forming test and a pin-on disc test. In the tests, two different cold work tool steels, a conventional steel grade and a nitrogen alloyed PM steel grade were evaluated...

  10. Residual stresses and fatigue in a duplex stainless steel

    International Nuclear Information System (INIS)

    Johansson, Johan

    1999-01-01

    Duplex stainless steels, consisting of approximately equal amounts of austenite and ferrite, often combine the best features of austenitic and ferritic stainless steels. They generally have good mechanical properties, including high strength and ductility, and the corrosion resistance is often better than conventional austenitic grades. This has lead to a growing use of duplex stainless steels as a material in mechanically loaded constructions. However, detailed knowledge regarding its mechanical properties and deformation mechanisms are still lacking. In this thesis special emphasis has been placed on the residual stresses and their influence on mechanical behaviour of duplex stainless steels. Due to the difference in coefficient of thermal expansion between the two phases, tensile microstresses are found in the austenitic phase and balancing compressive microstresses in the ferritic phase. The first part of this thesis is a literature survey, which will give an introduction to duplex stainless steels and review the fatigue properties of duplex stainless steels and the influence of residual stresses in two-phase material. The second part concerns the evolution of the residual stress state during uniaxial loading. Initial residual stresses were found to be almost two times higher in the transverse direction compared to the rolling direction. During loading the absolute value of the microstresses increased in the macroscopic elastic regime but started to decrease with increasing load in the macroscopic plastic regime. A significant increase of the microstresses was also found to occur during unloading. Finite element simulations also show stress variation within one phase and a strong influence of both the elastic and plastic anisotropy of the individual phases on the simulated stress state. In the third part, the load sharing between the phases during cyclic loading is studied. X-ray diffraction stress analysis and transmission electron microscopy show that even if

  11. Residual stresses and fatigue in a duplex stainless steel

    Energy Technology Data Exchange (ETDEWEB)

    Johansson, Johan

    1999-05-01

    Duplex stainless steels, consisting of approximately equal amounts of austenite and ferrite, often combine the best features of austenitic and ferritic stainless steels. They generally have good mechanical properties, including high strength and ductility, and the corrosion resistance is often better than conventional austenitic grades. This has lead to a growing use of duplex stainless steels as a material in mechanically loaded constructions. However, detailed knowledge regarding its mechanical properties and deformation mechanisms are still lacking. In this thesis special emphasis has been placed on the residual stresses and their influence on mechanical behaviour of duplex stainless steels. Due to the difference in coefficient of thermal expansion between the two phases, tensile microstresses are found in the austenitic phase and balancing compressive microstresses in the ferritic phase. The first part of this thesis is a literature survey, which will give an introduction to duplex stainless steels and review the fatigue properties of duplex stainless steels and the influence of residual stresses in two-phase material. The second part concerns the evolution of the residual stress state during uniaxial loading. Initial residual stresses were found to be almost two times higher in the transverse direction compared to the rolling direction. During loading the absolute value of the microstresses increased in the macroscopic elastic regime but started to decrease with increasing load in the macroscopic plastic regime. A significant increase of the microstresses was also found to occur during unloading. Finite element simulations also show stress variation within one phase and a strong influence of both the elastic and plastic anisotropy of the individual phases on the simulated stress state. In the third part, the load sharing between the phases during cyclic loading is studied. X-ray diffraction stress analysis and transmission electron microscopy show that even if

  12. Behavior of the elements in the mechanically alloyed and cast ferritic steels and a type 316 stainless steel in a flowing sodium environment

    International Nuclear Information System (INIS)

    Suzuki, T.; Mutoh, I.

    1988-01-01

    Sodium corrosion behavior of a mechanically alloyed ferritic steel, dispersion-strengthened with addition of Y 2 0 3 and Ti, two kinds of melted/cast ferritic steels and a Type 316 stainless steel was examined by using a non-isothermal sodium loop system, constructed of another Type 316 stainless steel, with a direct resistance electrical heater. The sodium conditions were 675 0 C, 4.0 m/s in velocity and 1-2 ppm oxygen concentration and a cumulative exposure time of the specimens was about 3000 h. The absorption of Ni and selective dissolution of Cr played an important role in the corrosion of the mechanically alloyed ferritic steel as in the case of the cast ferritic steels. However, the region of Ni absorption and Cr diminution was deeper than that of the cast ferritic steels. Peculiar finding for the mechanically alloyed ferritic steel was the corroded surface with irregularly shaped protuberance, that might be related with formation of sodium titanate, and the absorption of carbon and nitrogen to form carbide and nitride of titanium. It seems that these facts resulted in the irregular weight loss of the specimens, which depended on the downstream position and the cumulative exposure time. However, the tensile properties of the mechanically alloyed ferritic steel did not noticeably change by the sodium exposure

  13. 27 CFR 25.285 - Refund of beer tax excessively paid.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Refund of beer tax... TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS BEER Refund or Adjustment of Tax or Relief From Liability § 25.285 Refund of beer tax excessively paid. (a) Eligibility. A brewer who, under the provisions...

  14. 49 CFR 192.285 - Plastic pipe: Qualifying persons to make joints.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 3 2010-10-01 2010-10-01 false Plastic pipe: Qualifying persons to make joints... Materials Other Than by Welding § 192.285 Plastic pipe: Qualifying persons to make joints. (a) No person may make a plastic pipe joint unless that person has been qualified under the applicable joining procedure...

  15. 30 CFR 285.102 - What are MMS's responsibilities under this part?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What are MMS's responsibilities under this part... Provisions § 285.102 What are MMS's responsibilities under this part? (a) The MMS will ensure that any..., monitoring, and enforcement of activities authorized by a lease or grant under this part. (b) The MMS will...

  16. PSpice Model of Lightning Strike to a Steel Reinforced Structure

    International Nuclear Information System (INIS)

    Koone, Neil; Condren, Brian

    2003-01-01

    Surges and arcs from lightning can pose hazards to personnel and sensitive equipment, and processes. Steel reinforcement in structures can act as a Faraday cage mitigating lightning effects. Knowing a structure's response to a lightning strike allows hazards associated with lightning to be analyzed. A model of lightning's response in a steel reinforced structure has been developed using PSpice (a commercial circuit simulation). Segments of rebar are modeled as inductors and resistors in series. A program has been written to take architectural information of a steel reinforced structure and 'build' a circuit network that is analogous to the network of reinforcement in a facility. A severe current waveform (simulating a 99th percentile lightning strike), modeled as a current source, is introduced in the circuit network, and potential differences within the structure are determined using PSpice. A visual three-dimensional model of the facility displays the voltage distribution across the structure using color to indicate the potential difference relative to the floor. Clear air arcing distances can be calculated from the voltage distribution using a conservative value for the dielectric breakdown strength of air. Potential validation tests for the model will be presented

  17. Vibration Properties of a Steel-PMMA Composite Beam

    Directory of Open Access Journals (Sweden)

    Yuyang He

    2015-01-01

    Full Text Available A steel-polymethyl methacrylate (steel-PMMA beam was fabricated to investigate the vibration properties of a one-dimensional phononic crystal structure. The experimental system included an excitation system, a signal acquisition system, and a data analysis and processing system. When an excitation signal was exerted on one end of the beam, the signals of six response points were collected with acceleration sensors. Subsequent signal analysis showed that the beam was attenuated in certain frequency ranges. The lumped mass method was then used to calculate the bandgap of the phononic crystal beam to analyze the vibration properties of a beam made of two different materials. The finite element method was also employed to simulate the vibration of the phononic crystal beam, and the simulation results were consistent with theoretical calculations. The existence of the bandgap was confirmed experimentally and theoretically, which allows for the potential applications of phononic crystals, including wave guiding and filtering, in integrated structures.

  18. SCC-induced failure of a 304 stainless steel pipe

    International Nuclear Information System (INIS)

    Tapping, R.L.; Disney, D.J.; Szostak, F.J.

    1993-01-01

    On 1991 January 12, a 304 Stainless Steel (SS) suction line in the AECL-Research NRU reactor failed, shutting down the reactor for approximately 12 months. The pipe, a 32 mm schedule 40 304 stainless steel line exposed to D 2 O at temperatures ≤35 degrees C had been in service for approximately 20 years, although no manufacturing data or composition specifications were available. The failure and resultant leak resulted in a small loss of D 2 O moderator from the reactor vessel. The pipe cracked approximately 180 degrees C around the circumference of a weld. This failure was unexpected and hense a thorough metallographic examination was carried out on the failed section, on the rest of the line (Line 1212), and on representative samples from the rest of the reactor in order to assess the integrity of the remaining piping

  19. Study of copper precipitation behavior in a Cu-bearing austenitic antibacterial stainless steel

    International Nuclear Information System (INIS)

    Ren, Ling; Nan, Li; Yang, Ke

    2011-01-01

    Copper (Cu) precipitation behavior in a type 304 Cu-bearing austenitic antibacterial stainless steel was studied by analyses of variations in micro-hardness, electrical resistivity, electrochemical impedance and lattice constant of the steel, complemented with transmission electron microscopy (TEM) observation, showing more or less changes on these properties of the steel with different aging time. It was found that both micro-hardness and electrical resistivity measurements were relatively sensitive and accurate to reflect the Cu precipitation behavior in the experimental steel, indicating the beginning and finishing points of the precipitation, which are more simple and effective to be used for development of the new type of antibacterial stainless steels.

  20. Fatigue crack Behaviour in a High Strength Tool Steel

    DEFF Research Database (Denmark)

    Højerslev, Christian; Carstensen, Jesper V.; Brøndsted, Povl

    2002-01-01

    The influence of microstructure on fatigue crack initiation and crack growth of a hardened and tempered high speed steel was investigated. The evolution of fatigue cracks was followed in four point bending at room temperature. It was found that a carbide damage zone exists above a threshold load...... value of maximally 80% of the yield strength of the steel. The size of this carbide damage zone increases with increasing load amplitude, and the zone is apparently associated with crack nucleation. On fatigue crack propagation plastic deformation of the matrix occurs in a radius of approximately 4...... microns in front of the fatigue crack tip, which is comparable with the relevant mean free carbide spacing....

  1. Aluminum electroplating on steel from a fused bromide electrolyte

    Energy Technology Data Exchange (ETDEWEB)

    Prabhat K. Tripathy; Laura A. Wurth; Eric J. Dufek; Toni Y. Gutknecht; Natalie J. Gese; Paula Hahn; Steven M. Frank; Guy L. Frederickson; J. Stephen Herring

    2014-08-01

    A quaternary bromide bath (LiBr–KBr–CsBr–AlBr3) was used to electro-coat aluminum on steel substrates. The electrolytewas prepared by the addition of AlBr3 into the eutectic LiBr–KBr–CsBr melt. A smooth, thick, adherent and shiny aluminum coating could be obtained with 80 wt.% AlBr3 in the ternary melt. The SEM photographs of the coated surfaces suggest the formation of thick and dense coatings with good aluminum coverage. Both salt immersion and open circuit potential measurement suggested that the coatings did display a good corrosionresistance behavior. Annealing of the coated surfaces, prior to corrosion tests, suggested the robustness of the metallic aluminum coating in preventing the corrosion of the steel surfaces. Studies also indicated that the quaternary bromide plating bath can potentially provide a better aluminumcoating on both ferrous and non-ferrous metals, including complex surfaces/geometries.

  2. Development and evaluation of a cleanable high efficiency steel filter

    International Nuclear Information System (INIS)

    Bergman, W.; Larsen, G.; Weber, F.; Wilson, P.; Lopez, R.; Valha, G.; Conner, J.; Garr, J.; Williams, K.; Biermann, A.; Wilson, K.; Moore, P.; Gellner, C.; Rapchun, D.; Simon, K.; Turley, J.; Frye, L.; Monroe, D.

    1993-01-01

    We have developed a high efficiency steel filter that can be cleaned in-situ by reverse air pulses. The filter consists of 64 pleated cylindrical filter elements packaged into a 6l0 x 6l0 x 292 mm aluminum frame and has 13.5 m 2 of filter area. The filter media consists of a sintered steel fiber mat using 2 μm diameter fibers. We conducted an optimization study for filter efficiency and pressure drop to determine the filter design parameters of pleat width, pleat depth, outside diameter of the cylinder, and the total number of cylinders. Several prototype cylinders were then built and evaluated in terms of filter cleaning by reverse air pulses. The results of these studies were used to build the high efficiency steel filter. We evaluated the prototype filter for efficiency and cleanability. The DOP filter certification test showed the filter has a passing efficiency of 99.99% but a failing pressure drop of 0.80 kPa at 1,700 m 3 /hr. Since we were not able to achieve a pressure drop less than 0.25 kPa, the steel filter does not meet all the criteria for a HEPA filter. Filter loading and cleaning tests using AC Fine dust showed the filter could be repeatedly cleaned by reverse air pulses. The next phase of the prototype evaluation consisted of installing the unit and support housing in the exhaust duct work of a uranium grit blaster for a field evaluation at the Y-12 Plant in Oak Ridge, TN. The grit blaster is used to clean the surface of uranium parts and generates a cloud of UO 2 aerosols. We used a 1,700 m 3 /hr slip stream from the 10,200 m 3 /hr exhaust system

  3. 30 CFR 285.210 - How does MMS initiate the competitive leasing process?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How does MMS initiate the competitive leasing... OCS Renewable Energy Leases Competitive Lease Process § 285.210 How does MMS initiate the competitive leasing process? The MMS may publish in the Federal Register a public notice of Request for Interest to...

  4. 30 CFR 285.103 - When may MMS prescribe or approve departures from these regulations?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false When may MMS prescribe or approve departures... CONTINENTAL SHELF General Provisions § 285.103 When may MMS prescribe or approve departures from these regulations? (a) The MMS may prescribe or approve departures from these regulations when departures are...

  5. 30 CFR 285.510 - May MMS reduce or waive my lease or grant payments?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false May MMS reduce or waive my lease or grant... Financial Assurance Requirements Payments § 285.510 May MMS reduce or waive my lease or grant payments? (a) The MMS Director may reduce or waive the rent or operating fee or components of the operating fee...

  6. 30 CFR 285.540 - How will MMS equitably distribute revenues to States?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will MMS equitably distribute revenues to... Financial Assurance Requirements Revenue Sharing with States § 285.540 How will MMS equitably distribute revenues to States? (a) The MMS will distribute among the eligible coastal States 27 percent of the...

  7. Chemistry conditions in crevices of carbon steel and stainless steel: a comparative study

    International Nuclear Information System (INIS)

    Pushpalata, R.; Veena, S.; Chandran, Sinu; Mohan, T.V.K.; Rangarajan, S.; Narasimhan, S.V.

    2008-01-01

    Occurrence of crevice corrosion in the steam generator tubes of nuclear power plants may lead to transport of radioactivity to the secondary side. It is expected that effect of crevice corrosion will be more pronounced in a passive material like stainless steel (SS) as compared to carbon steel (CS). Theoretical modeling of the dynamics of crevice chemistry calls for experimental data with respect to various water chemistry parameters like pH, conductivity and concentrations of the ionic species in typical crevices of different geometry (aspect ratio of length and width). This paper presents the experimental results obtained with crevices in CS -106 B, SS-304 (nano grain) and SS 316 blocks (varying dimensions) exposed to a medium containing 1 ppm of lithium and chloride ion each for 10 days in static autoclave at 245 deg C. The bulk solution pH showed a reduction in alkalinity and slight increase in conductivity. In case of CS about 58 times increase in Cl - was observed in the smaller crevice of dimension 1 mm (width) x 25 mm (depth) whereas it was only ∼ 12 times in the bigger crevice (2 mm x 39 mm). Other anionic impurities like SO 4 2- and Br - present as impurities in NaCI were also found to be concentrated in the crevices whereas not much increase in cationic impurities was observed. In a similar experiment with SS blocks with crevice dimension comparable to diffusion layer thickness, appreciable increase in chloride concentration was observed. Electrochemical experiments were also carried out in deaerated NaCI (3.5%) solution at 25 deg C with CS, SS-304 (nano grain) and SS-316 (normal-grain) coupons. The OCP was -297 mV for SS-316 whereas for SS-304 coupon the OCP was -339 mV. Potentiodynamic anodic polarization curve showed a passive behavior up to 0.0V and then a sudden increase in anodic current. On nano-grained SS, a yellowish film on the surface was observed with a large number of pits whereas severe general corrosion was observed in the normal

  8. Aluminium Electroplating on Steel from a Fused Bromide Electrolyte

    Energy Technology Data Exchange (ETDEWEB)

    Prabhat Tripathy; Laura Wurth; Eric Dufek; Toni Y. Gutknecht; Natalie Gese; Paula Hahn; Steven Frank; Guy Fredrickson; J Stephen Herring

    2014-08-01

    A quaternary bromide bath (LiBr-KBr-CsBr-AlBr3) was used to electro-coat aluminium on steel substrates. The electrolyte was prepared by the addition of AlBr3 into the eutectic LiBr-KBr-CsBr melt. A smooth, thick, adherent and shiny aluminium coating could be obtained with 80 wt.% AlBr3 in the ternary melt. The SEM photographs of the coated surfaces suggest the formation of thick and dense coatings with good aluminium coverage. Both salt immersion and open circuit potential measurement suggest that the coatings did display good corrosion-resistance behavior. Annealing of the coated surfaces, prior to corrosion tests, suggested the robustness of the metallic aluminium coating in preventing the corrosion of the steel surfaces. Studies also indicated that the quaternary bromide plating bath can potentially provide a better aluminium coating on both ferrous and non-ferrous metals, including complex surfaces/geometries.

  9. Multilayer modelling of stainless steel with a nanocrystallised superficial layer

    Energy Technology Data Exchange (ETDEWEB)

    Petit, J. [Laboratoire Energetique Mecanique Electromagnetisme (LEME), EA4416, Universite Paris Ouest, 92410 Ville d' Avray (France); Waltz, L., E-mail: laurent.waltz@univ-montp2.fr [Laboratoire de Mecanique et Genie Civil de Montpellier (LMGC), University of Montpellier II, Place Eugene Bataillon, 34000 Montpellier (France); Montay, G.; Retraint, D.; Roos, A.; Francois, M. [Institut Charles Delaunay - LASMIS, UMR CNRS 6279, University of Technology of Troyes, 10010 Troyes (France)

    2012-02-28

    Highlights: Black-Right-Pointing-Pointer SMAT has been used for nanocrystallisation of an austenitic stainless steel. Black-Right-Pointing-Pointer The mechanical response of the nano-phase has been obtained by an indirect method. Black-Right-Pointing-Pointer Minimisation of a stress formulated objective function. Black-Right-Pointing-Pointer The model predicts the strain at which diffuse necking occurs. - Abstract: In order to obtain the macroscopic mechanical response of a 316L stainless steel, nanocrystallised by Surface Mechanical Attrition Treatment (SMAT), a multilayer model is proposed. The constitutive behaviour of each layer is determined from tensile tests or by an inverse method and its thickness is evaluated from Scanning and Transmission Electron Microscopy (SEM and TEM) analyses and local hardness measurements. The consistency of the model is verified by its ability to predict the strain at which diffuse necking occurs.

  10. Biomaterials. The Behavior of Stainless Steel as a Biomaterial

    Directory of Open Access Journals (Sweden)

    Sanda VISAN

    2011-06-01

    Full Text Available The biomaterials belong to the broad range of biocompatible chemical substances (sometimes even an element, which can be used for a period of time to treat or replace a tissue, organ or function of the human body. These materials bring many advantages in the diagnosis, prevention and medical therapy, reducing downtime for patients, restoring their biological functions, improving hospital management. The market in Romania sells a wide range of biomaterials for dental, cardiovascular medicine, renal, etc. Scientific research contributes to the discovery of new biomaterials or testing known biomaterials, for finding new applications. The paper exemplifies this contribution by presenting the testing of passive stainless steel behaviour in albumin solution using technique of cyclic voltammetry. It was shown that passivation contribute to increased stability of stainless steel implants to corrosive body fluids.

  11. Corrosion resistant steel

    International Nuclear Information System (INIS)

    Zubchenko, A.S.; Borisov, V.P.; Latyshev, V.B.

    1980-01-01

    Corrosion resistant steel for production of sheets and tubes containing C, Mn, Cr, Si, Fe is suggested. It is alloyed with vanadium and cerium for improving tensile properties and ductility. The steel can be melted by a conventional method in electric-arc or induction furnaces. The mentioned steel is intended to be used as a substitute for nickel-bearing austenitic steels

  12. Effects of nitrogen on corrosion of stainless steels in a liquid sodium environment

    International Nuclear Information System (INIS)

    Suzuki, Tadashi; Mutoh, Isao

    1990-01-01

    The corrosion of ferritic stainless steels using sodium at 650degC in a maximum isothermal region contained in a non-isothermal sodium loop constructed of a Type 316 stainless steel has been examined. Also, previous results on corrosion of austenitic stainless steels in sodium at 700degC in the same loop have been reproduced. The selective dissolution and absorption of nickel, the selective dissolution of chromium, and the resultant increase in iron in the surface of stainless steels in the loop mainly determine the corrosion loss of the stainless steel specimens. The austenitic steels hardly decarburize, but denitride. The ferritic steels decarburize and denitride and the denitriding is more remarkable than the decarburizing. The vanadium and niobium, carbide and nitride formers, in the ferritic steels inhibit the decarburizing to some extent, but barely inhibit the denitriding. The nitrogen in the steels rapidly diffuses to the grain boundaries, and rapidly dissolves into sodium, which will lower surface energy of the steels to enhance the dissolution of other elements. The dissolved N in sodium would then be transported to the free surface of the sodium adjacent to the argon cover gas of sodium and easily be released into the cover gas. This mechanism would cause the rapid dissolution of nitrogen into sodium and the enhancement of the corrosion rate of the steels containing nitrogen. (orig.)

  13. High temperature damage of a re-sulfurized stainless steel

    International Nuclear Information System (INIS)

    Tinet, Hougo

    2002-01-01

    After having evoked the industrial problem raised by high-temperature damage in the 303 stainless steel, and outlined that the experimental study of high-temperature damage implies the study of the sane (or non damaged) material, the study of micro-voids germination, growth and coalescence, and the study of the material failure process, the author of this research thesis reports a bibliographical study on the behaviour of sane re-sulfurized stainless steel and different damage models. He presents experimental techniques (thermal-mechanical compression and tensile tests, image analysis in optical microscopy) which have been used in this work, and describes and comments results obtained on axisymmetric samples for micro-void germination, growth and coalescence in case of a damage under low and medium stress triaxiality. The last part addresses the study of the damage of strongly notched samples (stress triaxialities close to those existing at the crack bottom) [fr

  14. Material characterization of a novel new armour steel

    Science.gov (United States)

    Bester, J. N.; Stumpf, W. E.

    2012-08-01

    The material characterization of a novel new armour steel with comparison to a leading commercial benchmark alloy is presented. Direct ballistic and experimental comparison is drawn. The 5.56 × 45 mm [M193] and 7.62 × 51 mm [NATO Ball] projectiles were used in a cartridge type high pressure barrel configuration to evaluate the superior plugging resistance of the new steel over a range of plate thicknesses. To characterize the dynamic plasticity of the materials, quasi-static, notched and high temperature tensile tests as well as Split Hopkinson Pressure Bar tests in tension and compression were performed. The open source explicit solver, IMPACT (sourceforge.net) is used in an ongoing numerical and sensitivity analysis of ballistic impact. A simultaneous multi variable fitting algorithm is planned to evaluate several selected numerical material models and show their relative correlation to experimental data. This study as well as micro-metallurgical investigation of adiabatic shear bands and localized deformation zones should result in new insights in to the underlying metallurgical and physical behavior of armour plate steels during ballistic perforation.

  15. Material characterization of a novel new armour steel

    Directory of Open Access Journals (Sweden)

    Stumpf W.E.

    2012-08-01

    Full Text Available The material characterization of a novel new armour steel with comparison to a leading commercial benchmark alloy is presented. Direct ballistic and experimental comparison is drawn. The 5.56 × 45 mm [M193] and 7.62 × 51 mm [NATO Ball] projectiles were used in a cartridge type high pressure barrel configuration to evaluate the superior plugging resistance of the new steel over a range of plate thicknesses. To characterize the dynamic plasticity of the materials, quasi-static, notched and high temperature tensile tests as well as Split Hopkinson Pressure Bar tests in tension and compression were performed. The open source explicit solver, IMPACT (sourceforge.net is used in an ongoing numerical and sensitivity analysis of ballistic impact. A simultaneous multi variable fitting algorithm is planned to evaluate several selected numerical material models and show their relative correlation to experimental data. This study as well as micro-metallurgical investigation of adiabatic shear bands and localized deformation zones should result in new insights in to the underlying metallurgical and physical behavior of armour plate steels during ballistic perforation.

  16. Marine Atmospheric Corrosion of Carbon Steel: A Review

    OpenAIRE

    Alc?ntara, Jenifer; de la Fuente, Daniel; Chico, Bel?n; Simancas, Joaqu?n; D?az, Iv?n; Morcillo, Manuel

    2017-01-01

    The atmospheric corrosion of carbon steel is an extensive topic that has been studied over the years by many researchers. However, until relatively recently, surprisingly little attention has been paid to the action of marine chlorides. Corrosion in coastal regions is a particularly relevant issue due the latter’s great importance to human society. About half of the world’s population lives in coastal regions and the industrialisation of developing countries tends to concentrate production pl...

  17. Liquidity management efficiency of Indian Steel Companies (a Case Study)

    OpenAIRE

    Dr. Amalendu Bhunia; Islam Uddin Khan

    2011-01-01

    Liquidity management is of crucial importance in financial management decision. The optimalof liquidity management is could be achieve by company that manage the trade-off between profitability and liquidity management. The paper analyses the association between the liquidity management and profitability of 230 Indian private sector steel companies obtained from CMIE database. Liquidity management indicators and profitability indicator over the period from 2002 to 2010 are modeled as a linear...

  18. Hot Ductility Behavior of a Peritectic Steel during Continuous Casting

    OpenAIRE

    Arıkan, Mustafa

    2015-01-01

    Hot ductility properties of a peritectic steel for welded gas cylinders during continuous casting were studied by performing hot tensile tests at certain temperatures ranging from 1200 to 700 °C for some cooling rates by using Gleeble-3500 thermo-mechanical test and simulation machine in this study. The effects of cooling rate and strain rate on hot ductility were investigated and continuous casting process map (time-temperature-ductility) were plotted for this material. Reduction of area ...

  19. Study of a low alloy steel rust using Moessbauer spectroscopy

    International Nuclear Information System (INIS)

    Maier, I.A.; Saragovi-Badler, C.; Labenski, F.

    1978-01-01

    Moessbauer spectroscopy has been used to analyze the internal and external rust layers of a weathering steel exposed for ten months to an urban-industrial atmosphere. Superparamagnetic α-FeOOH and γ-FeOOH were found in both layers. The external one also contained small sized delta-FeOOH and/or amorphous iron oxyhydroxide. These compounds were not present in the internal layer at this stage of the patina formation. (author)

  20. Mechanical And Microstructural Evaluation Of A Wear Resistant Steel

    International Nuclear Information System (INIS)

    Santos, F.L.F. dos; Vieira, A.G.; Correa, E.C.S.; Pinheiro, I.P.

    2010-01-01

    In the present work, the analysis of the mechanical properties and the microstructural features of a high strength low alloy steel, containing chromium, molybdenum and boron, subjected to different heat treatments, was conducted. After austenitizing at 910 deg C for 10 minutes, three operations were carried out: oil quenching, oil quenching followed by tempering at 200 deg C for 120 minutes and austempering at 400 deg C for 5 minutes followed by water cooling. The analysis was performed through tensile and hardness tests, optical microscopy and X-ray diffraction. The bainitic structure led to high strength and toughness, both essential mechanical properties for wear resistant steels. The occurrence of allotriomorphic ferrite and retained austenite in the samples also increased the wear resistance. This phenomenon is related to the fact that both structures are able to be deformed and, in the case of the retained austenite, the transformation induced plasticity TRIP effect may take place as the material is used. (author)

  1. Diffusion creep and its inhibition in a stainless steel

    International Nuclear Information System (INIS)

    Crossland, I.G.; Clay, B.D.

    1977-01-01

    The creep of 20% Cr, 25% Ni, Nb stainless steel was examined at low stresses and temperatures around 0.55 T/sub m/. The initial creep behaviour was consistent with the Coble theory of grain boundary diffusion creep; however, steady state creep was not observed and the creep rates quickly fell below the Coble theoretical values although they still remained greater than the Herring--Nabarro predictions. This reduction in creep rate was attributable to an increase in the effective viscosity of the steel rather than to any change in threshold stress. A model is proposed which explains the initial creep rates as being due to Coble creep with elastic accommodation at grain boundary particles. At higher strains grain boundary collapse caused by vacancy sinking is accommodated at precipitate particles by plastic deformation of the adjacent matrix material. 11 figures

  2. Metadynamic and static recrystallization softening behavior of a bainite steel

    Science.gov (United States)

    Li, Lixin; Zheng, Liangyu; Ye, Ben; Tong, Zeqiong

    2018-01-01

    The metadynamic recrystallization (MDRX) and static recrystallization (SRX) softening behavior of a bainite steel was investigated by two-pass isothermal compression experiments at temperatures of 1173, 1273, 1373, and 1473 K and strain rates of 0.01, 0.1, 1, and 10 s-1 with inter-pass times of 1, 5, 10, and 30 s on a Gleeble-1500 thermo-mechanical simulator. Kinetic equations were developed to evaluate the softening fractions caused by MDRX and SRX. A comparison between the experimental and predicted softening fractions showed that the proposed kinetic equations can provide a precise estimation of the MDRX and SRX behavior of the studied steel. The results based on the kinetic equations indicated that the MDRX and SRX softening fraction increases with the increase in strain rate, deformation temperature, inter-pass time, and pre-strain; the activation energy of MDRX is much smaller than that of SRX; and the no-recrystallization temperature of the investigated steel is 1179.4 K.

  3. Dynamic response analysis of a 24-story damped steel structure

    Science.gov (United States)

    Feng, Demin; Miyama, Takafumi

    2017-10-01

    In Japanese and Chinese building codes, a two-stage design philosophy, damage limitation (small earthquake, Level 1) and life safety (extreme large earthquake, Level 2), is adopted. It is very interesting to compare the design method of a damped structure based on the two building codes. In the Chinese code, in order to be consistent with the conventional seismic design method, the damped structure is also designed at the small earthquake level. The effect of damper systems is considered by the additional damping ratio concept. The design force will be obtained from the damped design spectrum considering the reduction due to the additional damping ratio. The additional damping ratio by the damper system is usually calculated by a time history analysis method at the small earthquake level. The velocity dependent type dampers such as viscous dampers can function well even in the small earthquake level. But, if steel damper is used, which usually remains elastic in the small earthquake, there will be no additional damping ratio achieved. On the other hand, a time history analysis is used in Japan both for small earthquake and extreme large earthquake level. The characteristics of damper system and ductility of the structure can be modelled well. An existing 24-story steel frame is modified to demonstrate the design process of the damped structure based on the two building codes. Viscous wall type damper and low yield steel panel dampers are studied as the damper system.

  4. Anodic Protection performance of Steels ASTM A 516-60 And JIS G 3131 SPHC In Concentrated Sulfuric Acid

    International Nuclear Information System (INIS)

    Harsisto; Ginting, Immanuel; Eddy, D.C

    2001-01-01

    One of the methods to protect a carbon steel material from corrosion attack of sulfuric acid environment is with anodic protection. This research was intended to investigate the effect of anodic protection quickened with potential polarization, The material under investigation were ASTM A 516 and JIS G 3131-SPHC in highly concentrated H 2 SO 4 solution. The results showed that potential that was effective for anodic protection in ASTM A 516-60 were at 236-436 mV for 75%, 276-476 mV for 80%, 264-514 mV for 85%,285-485 mV for 90%, and 231-431 mV for 97% H 2 SO 4 so that in JlS G 3131-SPHC were at 303 -503 mV for 75%, 290-490 mV for 80%, 269- 516 mV for 85%, 264-514 mV for 90%, and 287 -487 mV for 97% H 2 SO 4

  5. The Climate for Steel. Actions for, and conditions to, a Copenhagen climate agreement from the perspective of the EU steel sector

    International Nuclear Information System (INIS)

    Slingerland, S.; Werring, L.; De Bruijn, S.; Korteland, M.

    2009-02-01

    A position paper discussing the relationship between climate change policies and competitiveness in the global steel sector. Question is how the need for effective action to confront global climate change can be combined with a level playing field for competition in the global steel sector, taking into account the position of Corus Netherlands as a European steel producer. More specifically; what conditions in an international agreement could provide such a level playing field? Chapter 2 of this paper briefly outlines some essential characteristics of the global and European steel sector. Chapter 3 outlines the present status quo of the multilateral climate change negotiation process towards the December 2009 Copenhagen conference. Chapter 4 gives a view on climate and competitiveness for the EU steel sector. Chapter 5 finally provides conclusions and recommendations for provisions in an international agreement that could provide for a competitive level playing field in the steel sector

  6. Image analysis of corrosion pit initiation on ASTM type A240 stainless steel and ASTM type A 1008 carbon steel

    Science.gov (United States)

    Nine, H. M. Zulker

    The adversity of metallic corrosion is of growing concern to industrial engineers and scientists. Corrosion attacks metal surface and causes structural as well as direct and indirect economic losses. Multiple corrosion monitoring tools are available although those are time-consuming and costly. Due to the availability of image capturing devices in today's world, image based corrosion control technique is a unique innovation. By setting up stainless steel SS 304 and low carbon steel QD 1008 panels in distilled water, half-saturated sodium chloride and saturated sodium chloride solutions and subsequent RGB image analysis in Matlab, in this research, a simple and cost-effective corrosion measurement tool has identified and investigated. Additionally, the open circuit potential and electrochemical impedance spectroscopy results have been compared with RGB analysis to gratify the corrosion. Additionally, to understand the importance of ambiguity in crisis communication, the communication process between Union Carbide and Indian Government regarding the Bhopal incident in 1984 was analyzed.

  7. Heterogeneities in local plastic flow behavior in a dissimilar weld between low-alloy steel and stainless steel

    Energy Technology Data Exchange (ETDEWEB)

    Mas, Fanny [Université Grenoble Alpes, SIMAP, 38000 Grenoble (France); CNRS, SIMAP, 38000 Grenoble (France); Martin, Guilhem, E-mail: guilhem.martin@simap.grenoble-inp.fr [Université Grenoble Alpes, SIMAP, 38000 Grenoble (France); CNRS, SIMAP, 38000 Grenoble (France); Lhuissier, Pierre; Bréchet, Yves; Tassin, Catherine [Université Grenoble Alpes, SIMAP, 38000 Grenoble (France); CNRS, SIMAP, 38000 Grenoble (France); Roch, François [Areva NP, Tour Areva, 92084 Paris La Défense (France); Todeschini, Patrick [EDF R& D, Avenue des Renardières, 77250 Moret-sur-Loing (France); Simar, Aude [Institute of Mechanics, Materials and Civil Engineering (iMMC), Université catholique de Louvain, 1348 Louvain-la-Neuve (Belgium)

    2016-06-14

    In dissimilar welds between low-alloy steel and stainless steel, the post-weld heat-treatment results in a high variety of microstructures coexisting around the fusion line, due to carbon diffusion and carbides dissolution/precipitation. The local constitutive laws in the vicinity of the fusion zone were identified by micro tensile specimens for the sub-millimeter sized zones, equivalent bulk materials representing the decarburized layer using both wet H{sub 2} atmosphere and diffusion couple, and nano-indentation for the carburized regions (i.e. the martensitic band and the austenitic region). The decarburized zone presents only 50% of the yield strength of the low-alloy steel heat affected zone and a ductility doubled. The carburized zones have a yield strength 3–5 times higher than that of the low-alloy steel heat affected zone and have almost no strain hardening capacity. These properties result in heterogeneous plastic deformation happening over only millimeters when the weld is loaded perpendicularly to the weld line, affecting its overall behavior. The constitutive laws experimentally identified were introduced as inputs into a finite elements model of the transverse tensile test performed on the whole dissimilar weld. A good agreement between experiments and simulations was achieved on the global stress-strain curve. The model also well predicts the local strain field measured by microscale DIC. A large out-of-plane deformation due to the hard carburized regions has also been identified.

  8. 77 FR 70478 - RG Steel Wheeling, LLC, Wheeling Office, A Division Of RG Steel, LLC, Including On-Site Leased...

    Science.gov (United States)

    2012-11-26

    ... Unlimited and Green Energy Initiatives LLC, Including Workers Whose Wages Were Reported Through Severstal..., Wheeling Office, a division of RG Steel, LLC, including on-site leased workers from Pro Unlimited and Green Energy Initiatives, LLC, Wheeling, West Virginia (TA-W-81,880) and Mountain State Carbon, LLC, including...

  9. Corrosion of a carbon steel in simulated liquid nuclear wastes

    International Nuclear Information System (INIS)

    Saenz Gonzalez, Eduardo

    2005-01-01

    This work is part of a collaboration agreement between CNEA (National Atomic Energy Commission of Argentina) and USDOE (Department of Energy of the United States of America), entitled 'Tank Corrosion Chemistry Cooperation', to study the corrosion behavior of carbon steel A537 class 1 in different simulated non-radioactive wastes in order to establish the safety concentration limits of the tank waste chemistry at Hanford site (Richland-US). Liquid high level nuclear wastes are stored in tanks made of carbon steel A537 (ASTM nomenclature) that were designed for a service life of 20 to 50 years. A thickness reduction of some tank walls, due to corrosion processes, was detected at Hanford site, beyond the existing predicted values. Two year long-term immersion tests were started using non radioactive simulated liquid nuclear waste solutions at 40 C degrees. This work extends throughout the first year of immersion. The simulated solutions consist basically in combinations of the 10 most corrosion significant chemical components: 5 main components (NaNO 3 , NaCl, NaF, NaNO 2 and NaOH) at three concentration levels and 5 secondary components at two concentration levels. Measurements of the general corrosion rate with time were performed for carbon steel coupons, both immersed in the solutions and in the vapor phases, using weight loss and electrochemistry impedance spectroscopy techniques. Optic and scanning electron microscopy examination, analysis of U-bend samples and corrosion potential measurements, were also done. Localized corrosion susceptibility (pitting and crevice corrosion) was assessed in isolated short-term tests by means of cyclic potentiodynamic polarization curves. The effect of the simulated waste composition on the corrosion behavior of A537 steel was studied based on statistical analyses. The Surface Response Model could be successfully applied to the statistical analysis of the A537 steel corrosion in the studied solutions. General corrosion was not

  10. Hydrogen embrittlement property of a 1700-MPa-class ultrahigh-strength tempered martensitic steel

    Energy Technology Data Exchange (ETDEWEB)

    Li Songjie; Zhang Boping [School of Materials Science and Engineering, University of Science and Technology Beijing, No. 30 Xueyuan Road, Hidian Zone, Beijing 100083 (China); Akiyama, Eiji; Yuuji, Kimura; Tsuzaki, Kaneaki [Structural Metals Center, National Institute for Materials Science, 1-2-1 Sengen, Tsukuba, Ibaraki 305-0047 (Japan); Uno, Nobuyoshi, E-mail: AKIYAMA.Eiji@nims.go.j [Nippon Steel and Sumikin Metal Products Co, Ltd, SA Bldg., 17-12 Kiba 2-chome, Koto-ku, Tokyo (Japan)

    2010-04-15

    The hydrogen embrittlement property of a prototype 1700-MPa-class ultrahigh-strength steel (NIMS17) containing hydrogen traps was evaluated using a slow strain rate test (SSRT) after cathodic hydrogen precharging, cyclic corrosion test (CCT) and atmospheric exposure. The hydrogen content in a fractured specimen was measured after SSRT by thermal desorption spectroscopy (TDS). The relationship between fracture stress and hydrogen content for the hydrogen-precharged specimens showed that the fracture stress of NIMS17 steel was higher, at a given hydrogen content, than that of conventional AISI 4135 steels with tensile strengths of 1300 and 1500 MPa. This suggests better resistance of NIMS17 steel to hydrogen embrittlement. However, hydrogen uptake to NIMS17 steel under CCT and atmospheric exposure decreased the fracture stress. This is because of the stronger hydrogen uptake to the steel containing hydrogen traps than to the AISI 4135 steels. Although NIMS17 steel has a higher strength level than AISI 4135 steel with a tensile strength of 1500 MPa, the decrease in fracture stress is similar between these steels.

  11. Hydrogen embrittlement property of a 1700-MPa-class ultrahigh-strength tempered martensitic steel

    Directory of Open Access Journals (Sweden)

    Songjie Li, Eiji Akiyama, Kimura Yuuji, Kaneaki Tsuzaki, Nobuyoshi Uno and Boping Zhang

    2010-01-01

    Full Text Available The hydrogen embrittlement property of a prototype 1700-MPa-class ultrahigh-strength steel (NIMS17 containing hydrogen traps was evaluated using a slow strain rate test (SSRT after cathodic hydrogen precharging, cyclic corrosion test (CCT and atmospheric exposure. The hydrogen content in a fractured specimen was measured after SSRT by thermal desorption spectroscopy (TDS. The relationship between fracture stress and hydrogen content for the hydrogen-precharged specimens showed that the fracture stress of NIMS17 steel was higher, at a given hydrogen content, than that of conventional AISI 4135 steels with tensile strengths of 1300 and 1500 MPa. This suggests better resistance of NIMS17 steel to hydrogen embrittlement. However, hydrogen uptake to NIMS17 steel under CCT and atmospheric exposure decreased the fracture stress. This is because of the stronger hydrogen uptake to the steel containing hydrogen traps than to the AISI 4135 steels. Although NIMS17 steel has a higher strength level than AISI 4135 steel with a tensile strength of 1500 MPa, the decrease in fracture stress is similar between these steels.

  12. Hydrogen embrittlement property of a 1700-MPa-class ultrahigh-strength tempered martensitic steel

    International Nuclear Information System (INIS)

    Li Songjie; Zhang Boping; Akiyama, Eiji; Yuuji, Kimura; Tsuzaki, Kaneaki; Uno, Nobuyoshi

    2010-01-01

    The hydrogen embrittlement property of a prototype 1700-MPa-class ultrahigh-strength steel (NIMS17) containing hydrogen traps was evaluated using a slow strain rate test (SSRT) after cathodic hydrogen precharging, cyclic corrosion test (CCT) and atmospheric exposure. The hydrogen content in a fractured specimen was measured after SSRT by thermal desorption spectroscopy (TDS). The relationship between fracture stress and hydrogen content for the hydrogen-precharged specimens showed that the fracture stress of NIMS17 steel was higher, at a given hydrogen content, than that of conventional AISI 4135 steels with tensile strengths of 1300 and 1500 MPa. This suggests better resistance of NIMS17 steel to hydrogen embrittlement. However, hydrogen uptake to NIMS17 steel under CCT and atmospheric exposure decreased the fracture stress. This is because of the stronger hydrogen uptake to the steel containing hydrogen traps than to the AISI 4135 steels. Although NIMS17 steel has a higher strength level than AISI 4135 steel with a tensile strength of 1500 MPa, the decrease in fracture stress is similar between these steels.

  13. A crack arrest test using a toughness gradient steel plate

    International Nuclear Information System (INIS)

    Okamura, H.; Yagawa, G.; Urabe, Y.; Satoh, M.; Sano, J.

    1995-01-01

    Pressurized thermal shock (PTS) is a phenomenon that can occur in the reactor pressure vessels (RPVs) with internal pressure and is one of the most severe stress conditions that can be applied to the vessel. Preliminary research has shown that no PTS concern is likely to exist on Japanese RPVs during their design service lives. However, public acceptance of vessel integrity requires analyses and experiment in order to establish an analytical method and a database for life extension of Japanese RPVs. The Japanese PTS integrity study was carried out from FY 1983 to FY 1991 as a national project by Japan Power Engineering and Inspection Corporation (JAPEIC) under contract with Ministry of International Trade and Industry (MITI) in cooperation with LWR utilities and vendors. Here, a crack arrest test was carried out using a toughness gradient steel plate with three layers to study the concept of crack arrest toughness. Four-point bending load with thermal shock was applied to the large flat plate specimen with a surface crack. Five crack initiations and arrests were observed during the test and the propagated crack bifurcated. Finally, cracks were arrested at the boundary of the first and the second layer, except for a small segment of the crack. The first crack initiation took place slightly higher than the lower bound of K Ic data obtained by ITCT specimens. That is, the K IC concept for brittle crack initiation was verified for heavy section steel plates. The first crack arrest took place within the scatter band of K Ia and K Id data for the first layer. That is, the K Ia concept appears applicable for crack arrest of a short crack jump

  14. Effect of free Cr content on corrosion behavior of 3Cr steels in a CO2 environment

    Science.gov (United States)

    Li, Wei; Xu, Lining; Qiao, Lijie; Li, Jinxu

    2017-12-01

    The corrosion behavior of 3Cr steels with three microstructures (martensite, bainite, combined ferrite and pearlite) in simulated oil field formation water with a CO2 partial pressure of 0.8 MPa was investigated. The relationships between Cr concentrations in corrosion scales and corrosion rates were studied. The precipitated phases that contained Cr were observed in steels of different microstructures, and free Cr content levels were compared. The results showed that steel with the martensite microstructure had the highest free Cr content, and thus had the highest corrosion resistance. The free Cr content of bainite steel was lower than that of martensite steel, and the corrosion rate of bainite steel was higher than that of martensite steel. Because large masses of Cr were combined in ferrite and pearlite steel, the corrosion rates of ferrite and pearlite steel were the highest. Free Cr content in steel affects its corrosion behavior greatly.

  15. Tool steels

    DEFF Research Database (Denmark)

    Højerslev, C.

    2001-01-01

    On designing a tool steel, its composition and heat treatment parameters are chosen to provide a hardened and tempered martensitic matrix in which carbides are evenly distributed. In this condition the matrix has an optimum combination of hardness andtoughness, the primary carbides provide...... resistance against abrasive wear and secondary carbides (if any) increase the resistance against plastic deformation. Tool steels are alloyed with carbide forming elements (Typically: vanadium, tungsten, molybdenumand chromium) furthermore some steel types contains cobalt. Addition of alloying elements...... serves primarily two purpose (i) to improve the hardenabillity and (ii) to provide harder and thermally more stable carbides than cementite. Assuming proper heattreatment, the properties of a tool steel depends on the which alloying elements are added and their respective concentrations....

  16. Requirements for a cleanable steel HEPA filter derived from a systems analysis

    International Nuclear Information System (INIS)

    Bergman, W.

    1996-06-01

    A systems analysis was conducted to determine customer requirements for a cleanable high efficiency particulate air (HEPA) filter in DOE Environmental Management (EM) facilities. The three principal drivers for cleanable steel HEPA are large cost savings, improved filter reliability, and new regulations; they produce a strong incentive to DOE customers to use cleanable steel HEPA filters. Input for customer requirements were obtained from field trips to EM sites and from discussions. Most existing applications require that cleanable steel HEPA filters meet size/performance requirements of standard glass HEPA filters; applications in new facilities can relax size/weight/pressure drop requirements on a case-by-case basis. We then obtained input from commercial firms on availability of cleanable steel HEPA filters. Systems analysis then showed that currently available technology was only able to meet customer needs in a limited number of cases. Further development is needed to meet requirements of EM customers. For cleanable steel HEPA to be retrofitted into existing systems, pressure drop and weight must be reduced. Pressure drop can be reduced by developing steel fiber media from 0.5 μm dia steel fibers. Weight can be reduced by packaging the steel fiber media in one of the standard HEPA configurations. Although most applications will be able to use standard 304 or 316L alloys, an acid resistant alloy such as Hastelloy or Inconel will be needed for incinerator and other thermal processes

  17. A discussion on improving hydration activity of steel slag by altering its mineral compositions.

    Science.gov (United States)

    Wang, Qiang; Yan, Peiyu; Feng, Jianwen

    2011-02-28

    This study aims to investigate the ways to improve the cementitious properties of steel slag. The results show that the cementitious phase of steel slag is composed of silicate and aluminate, but the large particles of these phases make a very small contribution to the cementitious properties of steel slag. RO phase (CaO-FeO-MnO-MgO solid solution), Fe(3)O(4), C(2)F and f-CaO make no contribution to the cementitious properties of steel slag. A new kind of steel slag with more cementitious phase and less RO phase can be obtained by removing some large particles. This new steel slag possesses better cementitious properties than the original steel slag. The large particles can be used as fine aggregates for concrete. Adding regulating agent high in CaO and SiO(2) during manufacturing process of steel slag to increase the cementitious phase to inert phase ratio is another way to improve its cementitious properties. The regulating agent should be selected to adapt to the specific steel slag and the alkalinity should be increased as high as possible on the premise that the f-CaO content does not increase. The cooling rate should be enhanced to improve the hydration activity of the cementitious phase at the early ages and the grindability of steel slag. Copyright © 2010 Elsevier B.V. All rights reserved.

  18. A Steel Ball Surface Quality Inspection Method Based on a Circumferential Eddy Current Array Sensor.

    Science.gov (United States)

    Zhang, Huayu; Xie, Fengqin; Cao, Maoyong; Zhong, Mingming

    2017-07-01

    To efficiently inspect surface defects on steel ball bearings, a new method based on a circumferential eddy current array (CECA) sensor was proposed here. The best probe configuration, in terms of the coil quality factor (Q-factor), magnetic field intensity, and induced eddy current density on the surface of a sample steel ball, was determined using 3-, 4-, 5-, and 6-coil probes, for analysis and comparison. The optimal lift-off from the measured steel ball, the number of probe coils, and the frequency of excitation current suitable for steel ball inspection were obtained. Using the resulting CECA sensor to inspect 46,126 steel balls showed a miss rate of ~0.02%. The sensor was inspected for surface defects as small as 0.05 mm in width and 0.1 mm in depth.

  19. A Steel Ball Surface Quality Inspection Method Based on a Circumferential Eddy Current Array Sensor

    Directory of Open Access Journals (Sweden)

    Huayu Zhang

    2017-07-01

    Full Text Available To efficiently inspect surface defects on steel ball bearings, a new method based on a circumferential eddy current array (CECA sensor was proposed here. The best probe configuration, in terms of the coil quality factor (Q-factor, magnetic field intensity, and induced eddy current density on the surface of a sample steel ball, was determined using 3-, 4-, 5-, and 6-coil probes, for analysis and comparison. The optimal lift-off from the measured steel ball, the number of probe coils, and the frequency of excitation current suitable for steel ball inspection were obtained. Using the resulting CECA sensor to inspect 46,126 steel balls showed a miss rate of ~0.02%. The sensor was inspected for surface defects as small as 0.05 mm in width and 0.1 mm in depth.

  20. Surface characterization of adsorbed asphaltene on a stainless steel surface

    International Nuclear Information System (INIS)

    Abdallah, W.A.; Taylor, S.D.

    2007-01-01

    X-ray photoelectron spectroscopy was used to characterize a single layer of adsorbed asphaltene on a metallic surface. The deposits were created by immersing a stainless steel disc into a dilute asphaltene solution with either toluene or dichloromethane as the solvent, although the toluene solution allowed for better control of the adsorbed asphaltene layer and less atmospheric oxygen contamination. The analyses for C 1s, S 2p 3/2 , N 1s and O 1s photoemission peaks indicated that different functional groups are present in the asphaltene layer including carboxylic, pyrrolic, pyridininc, thiophenic and sulfite, with slight differences in their binding energies

  1. A Study on the Waste Water Treatment Technology for Steel Industry: Recycle And Reuse.

    OpenAIRE

    Sanjeev Kumar Sinha; Vikas Kumar Sinha; Samir Kr. Pandey; Anup Tiwari

    2016-01-01

    The steel industry is one of the most important and vital Industry of the present and the future. It is the asset of a nation. Steel plants use a tremendous amount of water for waste transfer, cooling and dust control. The steel plants have sintering mills, coke plants, blast furnaces, chemical byproducts and chemical processes, water cooled rolls, pumps, extrusion experiment, transfer lines for sludges and slurries. All these plants use a tremendous amount of water to cool the pr...

  2. A novel hybrid joining methodology for composite to steel joints

    Science.gov (United States)

    Sarh, Bastian

    This research has established a novel approach for designing, analyzing, and fabricating load bearing structural connections between resin infused composite materials and components made of steel or other metals or alloys. A design philosophy is proposed wherein overlapping joint sections comprised of fiber reinforced plastics (FRP's) and steel members are connected via a combination of adhesive bonding and integrally placed composite pins. A film adhesive is utilized, placed into the dry stack prior to resin infusion and is cured after infusion through either local heat elements or by placing the structure into an oven. The novel manner in which the composite pins are introduced consists of perforating the steel member with holes and placing pre-formed composite pins through them, also prior to resin infusion of the composite section. In this manner joints are co-molded structures such that secondary processing is eliminated. It is shown that such joints blend the structural benefits of adhesive and mechanically connected joints, and that the fabrication process is feasible for low-cost, large-scale production as applicable to the shipbuilding industry. Analysis procedures used for designing such joints are presented consisting of an adhesive joint design theory and a pin placement theory. These analysis tools are used in the design of specimens, specific designs are fabricated, and these evaluated through structural tests. Structural tests include quasi-static loading and low cycle fatigue evaluation. This research has thereby invented a novel philosophy on joints, created the manufacturing technique for fabricating such joints, established simple to apply analysis procedures used in the design of such joints (consisting of both an adhesive and a pin placement analysis), and has validated the methodology through specimen fabrication and testing.

  3. Slainless steel tube drawing on a mandrel

    International Nuclear Information System (INIS)

    Sokolovskij, V.I.; Parshin, V.S.; Veshkurtsev, V.I.

    1976-01-01

    A new technique for drawing stainless pipes on a mandrel has been developed at the Ural Polytechnical Institute. The method involves metal surfacing with a salt melt and results in stretching equal to 2.0. The use of such metal coats as lubrication sublayers makes possible repeated drawing with and without a mandrel. In both cases, the process does not involve intermediate heat treatment and/or any additional preparation of the surface

  4. Solidification process of a tool steel with niobium

    International Nuclear Information System (INIS)

    Makray, E.T.; Bresciani Filho, E.; Martinez Nazar, A.M.

    1984-01-01

    The solidification process of M2 high speed steel where tungsten was totally substituted by niobium was analysed. It occurs through a eutectic type reaction, in four steps. It was verified that one can apply the Coupled Zone Concept to explain the solification mechanism of this alloy: there is a primary phase (NbC), which is envolved by the other phase (ferrite) as a halo in order to send the composition back to the coupled growth region, where the binary eutectic forms. The last step is the formation of other compounds at the grain boundary. (Author) [pt

  5. Testing of a steel containment vessel model

    International Nuclear Information System (INIS)

    Luk, V.K.; Hessheimer, M.F.; Matsumoto, T.; Komine, K.; Costello, J.F.

    1997-01-01

    A mixed-scale containment vessel model, with 1:10 in containment geometry and 1:4 in shell thickness, was fabricated to represent an improved, boiling water reactor (BWR) Mark II containment vessel. A contact structure, installed over the model and separated at a nominally uniform distance from it, provided a simplified representation of a reactor shield building in the actual plant. This paper describes the pretest preparations and the conduct of the high pressure test of the model performed on December 11-12, 1996. 4 refs., 2 figs

  6. Marine Atmospheric Corrosion of Carbon Steel: A Review.

    Science.gov (United States)

    Alcántara, Jenifer; Fuente, Daniel de la; Chico, Belén; Simancas, Joaquín; Díaz, Iván; Morcillo, Manuel

    2017-04-13

    The atmospheric corrosion of carbon steel is an extensive topic that has been studied over the years by many researchers. However, until relatively recently, surprisingly little attention has been paid to the action of marine chlorides. Corrosion in coastal regions is a particularly relevant issue due the latter's great importance to human society. About half of the world's population lives in coastal regions and the industrialisation of developing countries tends to concentrate production plants close to the sea. Until the start of the 21st century, research on the basic mechanisms of rust formation in Cl - -rich atmospheres was limited to just a small number of studies. However, in recent years, scientific understanding of marine atmospheric corrosion has advanced greatly, and in the authors' opinion a sufficient body of knowledge has been built up in published scientific papers to warrant an up-to-date review of the current state-of-the-art and to assess what issues still need to be addressed. That is the purpose of the present review. After a preliminary section devoted to basic concepts on atmospheric corrosion, the marine atmosphere, and experimentation on marine atmospheric corrosion, the paper addresses key aspects such as the most significant corrosion products, the characteristics of the rust layers formed, and the mechanisms of steel corrosion in marine atmospheres. Special attention is then paid to important matters such as coastal-industrial atmospheres and long-term behaviour of carbon steel exposed to marine atmospheres. The work ends with a section dedicated to issues pending, noting a series of questions in relation with which greater research efforts would seem to be necessary.

  7. Marine Atmospheric Corrosion of Carbon Steel: A Review

    Science.gov (United States)

    Alcántara, Jenifer; de la Fuente, Daniel; Chico, Belén; Simancas, Joaquín; Díaz, Iván; Morcillo, Manuel

    2017-01-01

    The atmospheric corrosion of carbon steel is an extensive topic that has been studied over the years by many researchers. However, until relatively recently, surprisingly little attention has been paid to the action of marine chlorides. Corrosion in coastal regions is a particularly relevant issue due the latter’s great importance to human society. About half of the world’s population lives in coastal regions and the industrialisation of developing countries tends to concentrate production plants close to the sea. Until the start of the 21st century, research on the basic mechanisms of rust formation in Cl−-rich atmospheres was limited to just a small number of studies. However, in recent years, scientific understanding of marine atmospheric corrosion has advanced greatly, and in the authors’ opinion a sufficient body of knowledge has been built up in published scientific papers to warrant an up-to-date review of the current state-of-the-art and to assess what issues still need to be addressed. That is the purpose of the present review. After a preliminary section devoted to basic concepts on atmospheric corrosion, the marine atmosphere, and experimentation on marine atmospheric corrosion, the paper addresses key aspects such as the most significant corrosion products, the characteristics of the rust layers formed, and the mechanisms of steel corrosion in marine atmospheres. Special attention is then paid to important matters such as coastal-industrial atmospheres and long-term behaviour of carbon steel exposed to marine atmospheres. The work ends with a section dedicated to issues pending, noting a series of questions in relation with which greater research efforts would seem to be necessary. PMID:28772766

  8. AM363 martensitic stainless steel: A multiphase equation of state

    Science.gov (United States)

    De Lorenzi-Venneri, Giulia; Crockett, Scott D.

    2017-01-01

    A multiphase equation of state for stainless steel AM363 has been developed within the Opensesame approach and has been entered as material 4295 in the LANL-SESAME Library. Three phases were constructed separately: the low pressure martensitic phase, the austenitic phase and the liquid. Room temperature data and the explicit introduction of a magnetic contribution to the free energy determined the martensitic phase, while shock Hugoniot data was used to determine the austenitic phase and the phase boundaries. More experimental data or First Principles calculations would be useful to better characterize the liquid.

  9. Embrittlement of a 17Cr ferritic steel irradiated in Phenix

    International Nuclear Information System (INIS)

    Allegraud, G.; Boutard, J.L.; Boyer, J.M.

    1987-01-01

    Charpy V and tensile tests have been performed with samples made of 17Cr ferritic steel irradiated in Phenix at temperatures between 390 and 540C up to a maximum dose of 83.3 dpaF. All over the temperature and dose ranges, irradiation leads to an increase of the ductile brittle transition temperature (DBTT). The DBTT and hardening are decreasing functions of the irradiation temperature. Fast neutron flux at 390C hardens the material more than a sole thermal ageing does

  10. Prevention of Crevice Corrosion of STS 304 Stainless Steel by a Mg-alloy Galvanic Anode

    International Nuclear Information System (INIS)

    Lim, U. J.; Yun, B. D.; Kim, J. J.

    2006-01-01

    Prevention of crevice corrosion was studied for STS 304 stainless steel using a Mg-alloy galvanic anode in solutions with various specific resistivity. The crevice corrosion and corrosion protection characteristics of the steel was investigated by the electrochemical polarization and galvanic corrosion tests. Experimental results show that the crevice corrosion of STS 304 stainless steel does not occur in solutions of high specific resistivity, but it occurs in solutions of low specific resistivity like in solutions with resistivities of 30, 60 and 115 Ω · m. With decreasing specific resistivity of the solution, the electrode potential of STS 304 stainless steel in the crevice is lowered. The potential of STS 304 stainless steel in the crevice after coupling is cathodically polarized more by decreasing specific resistivity indicating that the crevice corrosion of STS 304 stainless steel is prevented by the Mg-alloy galvanic anode

  11. Estimation of CO2 emission for each process in the Japanese steel industry: a process analysis

    International Nuclear Information System (INIS)

    Sakamoto, Y.; Tonooka, Y.

    2000-01-01

    The CO 2 emission for each process in the Japanese steel industry is estimated by a process analysis using statistical data in order to evaluate the possibility of reducing CO 2 emissions. The emission factor of CO 2 for each product and also for crude steel produced from an integrated steel plant route and an electric arc furnaces route is estimated and compared. The CO 2 emissions can be estimated from production amounts of products for each process and for crude steel. The CO 2 emission of blast furnaces is the largest and that of rolling and piping follows. The emission factor of CO 2 of crude steel produced from an integrated steel plant route is approximately 3.8 times as high as that produced via an electric arc furnace route. (Author)

  12. Steel. A handbook for materials research and engineering. Vol. 1. Fundamentals

    Energy Technology Data Exchange (ETDEWEB)

    1992-01-01

    This STEEL Textbook is the outcome of reflections within the Materials Committee of the German Iron and Steel Institute on whether to republish the Manual of Special Steels, the highly commendable work by E. Houdremont. Discussions came to the conclusion, however, that for various reasons it was neither possible nor expedient simply to publish a follow-up edition of the famed Houdremont. To begin with and from today's vantage point, there no longer seemed to be any justification for restricting the work to special steels in the sense of the term as understood by E. Houdremont. The term ''special steel'' has never gained acceptance in official circles or standards. If we replace it by the term ''high-grade steel'', which is nowadays defined in standards, and this would appear permissible with certain qualifications, and if we bear in mind that the boundaries between high-grade steels and non-high-grade steels, the commercial and quality steels, although defined in standards (see part A), nonetheless in terms of engineering parameters are quite blurred, so it would seem only fitting for such as work to cover all the various grades of steel, also in view of the great significance of the non-high-grade steels. Because of the very many different grades of steel, this approach necessarily involves the collaboration of very many experts, in other words it entails a joint effort. Moreover, the vast, barely manageable quantity of literature in this field all of which can hardly be analysed by just one person, inevitably leads to the conclusion that there is a need to produce the new work as a joint effort. (orig.).

  13. Behavior of Equipment Support Beam Joint Directly Connected to A Steel-plate Concrete(SC) Wall

    International Nuclear Information System (INIS)

    Kim, K. S.; Kwon, K. J.

    2008-01-01

    To decrease the time for building nuclear power plants, a modular construction method, 'Steel-plate Concrete(SC)', has been investigated for over a decade. To construct a SC wall, a pair of steel plates are placed in parallel similar to a form-work in conventional reinforced concrete (RC) structures, and concrete is filled between the steel plates. Instead of removing the steel plates after the concrete has cured, the steel plates serve as components of the structural member. The exposed steel plate of SC structures serves as the base plate for the equipment support, and the headed studs welded to the steel plates are used as anchor bolts. Then, a support beam can be directly welded to the surface of the steel plate in any preferred position. In this study, we discuss the behavior and evaluation method of the equipment support joint directly connected to exposed steel plate of SC wall

  14. Plasticity of low carbon steel in a hot state

    Energy Technology Data Exchange (ETDEWEB)

    Konovalov, V P; Rizol' , A I; Shram, N N [Ural' skij Nauchno-Issledovatel' skij Inst. Chernykh Metallov, Sverdlovsk (USSR)

    1977-07-01

    The hot ductility (in tapered-specimen piersing test and the in wedge-shaped specimen rolling test) is studied of the Armeo-type low carbon steel produced by vacuum induction and open hearth techniques. The variations of the chemical composition within specified ranges, particularly as regards sulphur, oxygen and the Mn/S ratio, have a marked effect on the processing ductility. The temperature range of brittle fracture and acceptable hot working reductions as functions of the chemical composition have been revealed.

  15. Precipitation reactions in a beryllium-bearing stainless steel

    International Nuclear Information System (INIS)

    Carr, M.J.; Heiple, C.R.

    1980-01-01

    Precipitation reactions in a beryllium-bearing stainless steel alloy have been studied by TEM and electron diffraction for ageing temperatures between 400 0 and 900 0 C. The nominal composition of the alloy was 38% Ni - 21% Cr - 1% Mn - 0.5% Be - Bal Fe. Specimens were solutionized for one hour at 1150 0 C and water quenched. The ageing reaction was studied by hardness measurements for times between 0.5 and 16 hours. The TEM specimens dicussed herein were made from samples aged one hour

  16. Evaluation of welds on a ferritic-austenitic stainless steel

    International Nuclear Information System (INIS)

    Pleva, J.; Johansson, B.

    1984-01-01

    Five different welding methods for the ferritic-austenitic steel 22Cr6Ni3MoN have been evaluated on mill welded heavy wall pipes. The corrosion resistance of the weld joints has been tested both in standard tests and in special environments, related to certain oil and gas wells. The tests were conclusive in that a welding procedure with the addition of sufficient amounts of filler metal should be employed. TIG welds without or with marginal filler addition showed poor resistance to pitting, and to boiling nitric acid. Contents of main alloying elements in ferrite and austenite phases have been measured and causes of corrosion attack in welds are discussed

  17. Characterization of a Laser Surface-Treated Martensitic Stainless Steel

    OpenAIRE

    S.R. Al-Sayed; A.A. Hussein; A.A. Nofal; S.I. Hassab Elnaby; H. Elgazzar

    2017-01-01

    Laser surface treatment was carried out on AISI 416 machinable martensitic stainless steel containing 0.225 wt.% sulfur. Nd:YAG laser with a 2.2-KW continuous wave was used. The aim was to compare the physical and chemical properties achieved by this type of selective surface treatment with those achieved by the conventional treatment. Laser power of different values (700 and 1000 W) with four corresponding different laser scanning speeds (0.5, 1, 2, and 3 m?min?1) was adopted to reach the op...

  18. Plasticity of low carbon steel in a hot state

    International Nuclear Information System (INIS)

    Konovalov, V.P.; Rizol', A.I.; Shram, N.N.

    1977-01-01

    The hot ductility (in tapered-specimen piersing test and the in wedge-shaped specimen rolling test) is studied of the Armeo-type low carbon steel produced by vacuum induction and open hearth techniques. The variations of the chemical composition within specified ranges, particularly as regards sulphur, oxygen and the Mn/S ratio, have a marked effect on the processing ductility. The temperature range of brittle fracture and acceptable hot working reductions as functions of the chemical composition have been revealed

  19. Advanced metallic structural materials and a new role for microalloyed steels

    International Nuclear Information System (INIS)

    Korchynsky, M.

    2004-01-01

    The recent worldwide surge of steel consumption, mainly of low-strength carbon grades, has created raw-materials shortages and price increases. These supply-demand strains could be relaxed by satisfying engineering needs with less steel. However, materials used for such a substitution must combine high weight reducing potential with low cost. Microalloyed (MA) steels are cost-effective substitutes, since their high strength is the result of grain refinement and precipitation hardening. These two strengthening mechanisms are developed by the interaction of micro-additives: niobium or vanadium with the deformation occurring during hot rolling followed by cooling. The physical metallurgy of these phenomena is discussed in the paper. The optimum alloy design of MA steels combines superior properties with lowest processing cost. In many applications, the versatility and adaptability of vanadium steels provides an economic advantage. The monetary value of weight production is sufficient to increase the profitability of steel makers and to lower the material cost to steel users. This 'win-win' situation is financed by the elimination of efforts spent in producing inefficient steel, yielding an increase in wealth formation. The gain acceptance of substitution by the consumer, a long-term strategic plan is needed to be implemented by the beneficiaries - both steel producers and steel users. The successful substitution is of importance to the national economy, resources and energy conservation, and the environment. Since microalloyed steels, used as a replacement for carbon steels, offer low cost weight savings, they deserve to be classified as advanced structural materials. (author)

  20. A comprehensive review on cold work of AISI D2 tool steel

    Science.gov (United States)

    Abdul Rahim, Mohd Aidil Shah bin; Minhat, Mohamad bin; Hussein, Nur Izan Syahriah Binti; Salleh, Mohd Shukor bin

    2017-11-01

    As a common material in mould and die application, AISI D2 cold work tool steel has proven to be a promising chosen material in the industries. However, challenges remain in using AISI D2 through a modified version with a considerable progress having been made in recent years. This paper provides a critical review of the original as-cast AISI D2 cold work tool steel up to the modified version. The main purpose is to develop an understanding of current modified tool steel trend; the machinability of AISI D2 (drilling, milling, turning, grinding and EDM/WEDM; and the microstructure evolution and mechanical properties of these cold work tool steels due to the presence of alloy materials in the steel matrix. The doping of rare earth alloy element, new steel fabrication processes, significant process parameter in machinability and surface treatment shows that there have been few empirical investigations into these cold work tool steel alloys. This study has discovered that cold work tool steel will remain to be explored in order to survive in the steel industries.

  1. A study on laser welding deformation of 304 stainless steel

    International Nuclear Information System (INIS)

    Kitagawa, Akikazu; Maehara, Kenji; Takeda, Shinnosuke; Matsunawa, Akira

    2002-01-01

    In heavy industries, 304 austenitic stainless steel is the most popular material which is used for nuclear equipment, chemical vessels, vacuum vessels and so on. On the fabrication, not only a joint quality but also severe dimensional accuracy is required. To keep dimensional accuracy, considerable cost and efforts are requested, because the welding deformation of austenitic stainless steel is deeply depended on the physical properties of material itself. To decrease welding deformation, big jigs or water cooling method are commonly used which lead to the high cost. In general, the fusion welding by high energy density heat source results in less distortion. Today, laser welding technology has grown up to the stage that enables to weld thick plate with small deformation. The researches of welding deformation have been conducted intensively, but they are mainly concerned for arc welding, and studies for laser welding are very few. In this report, the authors will show the test results of deformation behavior in laser welding of 304 stainless steel. Also, they will discuss the deformation behavior comparing to that in arc welding. The main results of this study are as follows. 1. The angular distortion of laser welding can be unified by heat input parameter (Hp) which is used for arc welding deformation. 2. The angular distortion are same under the condition of Hp 3 in spite of different welding method, however under the condition of Hp>6-9 J/mm 3 the angular distortion is quite different depending on the power density of welding method. 3. Pure angular distortion seemed to complete just after welding, but following longitudinal distortion took place for long period. 4. The critical value of longitudinal distortion can be estimated from heat input parameter. The transverse deformation can be also estimated by heat input parameter. (author)

  2. The Effects of Shallow Cryogenic Process On The Mechanical Properties of AISI 4140 Steel

    Directory of Open Access Journals (Sweden)

    Eşref KIZILKAYA

    2018-03-01

    Full Text Available In this study, shallow cryogenic treatments were carried out for various holding time to AISI 4140 steel and the effects of heat treatment parameters on wear behavior, impact strength and tensile strength were investigated. Three different holding times were used for cryogenic heat treatments. After the cryogenic process, single tempering was applied. In addition, the abrasion tests were carried out at three different forces (5N, 10N and 15N at a constant slip speed (3.16 m / s and at three different slip distances (95 m, 190 m, 285 m. It has been determined that the shallow cryogenic process parameters significantly influence the mechanical properties of the AISI 4140 steel as a result of experimental studies., Low heat treatment times in cryogenic heat treatment have been found to have a positive effect on many mechanical properties, especially wear. The mechanical properties of the AISI 4140 steel can be optimized by controlling the shallow cryogenic heat treatment parameters.

  3. 31 CFR 285.7 - Salary offset.

    Science.gov (United States)

    2010-07-01

    ... requirements of the Computer Matching and Privacy Protection Act of 1988, 5 U.S.C. 552a, as amended, for... writing of the date deductions from salary will commence and of the amount of such deductions. (2)(i) When...

  4. Decontamination of steel by melt refining: A literature review

    International Nuclear Information System (INIS)

    Ozturk, B.; Fruehan, R.J.

    1994-01-01

    It has been reported that a large amount of metal waste is produced annually by nuclear fuel processing and nuclear power plants. These metal wastes are contaminated with radioactive elements, such as uranium and plutonium. Current Department of Energy guidelines require retrievable storage of all metallic wastes containing transuranic elements above a certain level. Because of high cost, it is important to develop an effective decontamination and volume reduction method for low level contaminated metals. It has been shown by some investigators that a melt refining technique can be used for the processing of the contaminated metal wastes. In this process, contaminated metal is melted wit a suitable flux. The radioactive elements are oxidized and transferred to a slag phase. In order to develop a commercial process it is important to have information on the thermodynamics and kinetics of the removal. Therefore, a literature search was carried out to evaluate the available information on the decontamination uranium and transuranic-contaminated plain steel, copper and stainless steel by melt a refining technique. Emphasis was given to the thermodynamics and kinetics of the removal. Data published in the literature indicate that it is possible to reduce the concentration of radioactive elements to a very low level by the melt refining method. 20 refs

  5. Dynamic fracture characterization of a pressure vessel steel

    International Nuclear Information System (INIS)

    Schmitt, W.; Boehme, W.; Klemm, W.; Memhard, D.; Winkler, S.

    1991-01-01

    Dynamic events are characterized by time and space-dependent stress and strain fields caused by wave or inertia effect. The dynamic effect at cracks may be originated from the rapid loading rate or impact loading of a structure containing a stationary crack or the time-dependent stress and strain fields of a propagating or arresting crack itself. Dynamic effects complicate the analysis of crack tip stress and strain fields, and usually considerable experimental effort and numerical technique are required. High loading rate influences the deformation and yield behavior and also the fracture toughness of materials. In order to know the propagation and arrest behavior of cracks, a heat of a German reactor pressure vessel steel was investigated, and the dynamic J-resistance curves were evaluated with large three-point bending specimens by impact loading, moreover, the crack propagation energy at large crack extension was determined with wide tension plates. The material tested was a ferritic pressure vessel steel, ASTM A 508 Cl 2. The dynamic J-resistance curves and numerical simulation and fractographic examination, and crack propagation energy are reported. (K.I.)

  6. Modelling hydrogen permeation in a hydrogen effusion probe for monitoring corrosion of carbon steels

    International Nuclear Information System (INIS)

    Santiwiparat, P.; Rirksomboon, T.; Steward, F.R.; Lister, D.H.; Cook, W.G.

    2015-01-01

    Hydrogen accumulation inside carbon steel and stainless steel devices shaped like cylindrical cups attached to a pipe containing hydrogen gas was modelled with MATLAB software. Hydrogen transfer around the bottom of the cups (edge effect) and diffusion through the cup walls (material effect) were accounted for. The variation of hydrogen pressure with time was similar for both materials, but the hydrogen plateau pressures in stainless steel cups were significantly higher than those in carbon steel cups. The geometry of the cup also affected the plateau pressure inside the cup. (author)

  7. A review on nickel-free nitrogen containing austenitic stainless steels for biomedical applications.

    Science.gov (United States)

    Talha, Mohd; Behera, C K; Sinha, O P

    2013-10-01

    The field of biomaterials has become a vital area, as these materials can enhance the quality and longevity of human life. Metallic materials are often used as biomaterials to replace structural components of the human body. Stainless steels, cobalt-chromium alloys, commercially pure titanium and its alloys are typical metallic biomaterials that are being used for implant devices. Stainless steels have been widely used as biomaterials because of their very low cost as compared to other metallic materials, good mechanical and corrosion resistant properties and adequate biocompatibility. However, the adverse effects of nickel ions being released into the human body have promoted the development of "nickel-free nitrogen containing austenitic stainless steels" for medical applications. Nitrogen not only replaces nickel for austenitic structure stability but also much improves steel properties. Here we review the harmful effects associated with nickel and emphatically the advantages of nitrogen in stainless steel, as well as the development of nickel-free nitrogen containing stainless steels for medical applications. By combining the benefits of stable austenitic structure, high strength, better corrosion and wear resistance and superior biocompatibility in comparison to the currently used austenitic stainless steel (e.g. 316L), the newly developed nickel-free high nitrogen austenitic stainless steel is a reliable substitute for the conventionally used medical stainless steels. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. A Goal Programming Optimization Model for The Allocation of Liquid Steel Production

    Science.gov (United States)

    Hapsari, S. N.; Rosyidi, C. N.

    2018-03-01

    This research was conducted in one of the largest steel companies in Indonesia which has several production units and produces a wide range of steel products. One of the important products in the company is billet steel. The company has four Electric Arc Furnace (EAF) which produces liquid steel which must be procesed further to be billet steel. The billet steel plant needs to make their production process more efficient to increase the productvity. The management has four goals to be achieved and hence the optimal allocation of the liquid steel production is needed to achieve those goals. In this paper, a goal programming optimization model is developed to determine optimal allocation of liquid steel production in each EAF, to satisfy demand in 3 periods and the company goals, namely maximizing the volume of production, minimizing the cost of raw materials, minimizing maintenance costs, maximizing sales revenues, and maximizing production capacity. From the results of optimization, only maximizing production capacity goal can not achieve the target. However, the model developed in this papare can optimally allocate liquid steel so the allocation of production does not exceed the maximum capacity of the machine work hours and maximum production capacity.

  9. Corrosion resistance of steel fibre reinforced concrete - A literature review

    DEFF Research Database (Denmark)

    Marcos Meson, Victor; Michel, Alexander; Solgaard, Anders

    2017-01-01

    Steel fibre reinforced concrete (SFRC) is increasingly being used in the construction of civil infrastructure. However, there are inconsistencies among international standards and guidelines regarding the consideration of carbon-steel fibres for the structural verification of SFRC exposed...... of the mechanisms governing the corrosion of carbon-steel fibres in cracks and its effects on the fracture behaviour of SFRC are not fully understood....

  10. The control network of air quality in the Lorraine steel industry country: an example of a specific steel industry network

    International Nuclear Information System (INIS)

    Poncin, G.

    1991-01-01

    This specific (for steel industry region) network for the air quality control mainly measures the concentrations in sulfur dioxide, airborne dust and fall out particles. The recent automation of this network implied a preliminary optimization study which consisted of a statistical analysis of the numerous data collected by many hand operated sensors. The implementation and working conditions of the new equipment have required the use of air-conditioned monoblock metallic cabins

  11. Understanding the Interaction between a Steel Microstructure and Hydrogen

    Science.gov (United States)

    Depover, Tom; Laureys, Aurélie; Wallaert, Elien

    2018-01-01

    The present work provides an overview of the work on the interaction between hydrogen (H) and the steel’s microstructure. Different techniques are used to evaluate the H-induced damage phenomena. The impact of H charging on multiphase high-strength steels, i.e., high-strength low-alloy (HSLA), transformation-induced plasticity (TRIP) and dual phase (DP) is first studied. The highest hydrogen embrittlement resistance is obtained for HSLA steel due to the presence of Ti- and Nb-based precipitates. Generic Fe-C lab-cast alloys consisting of a single phase, i.e., ferrite, bainite, pearlite or martensite, and with carbon contents of approximately 0, 0.2 and 0.4 wt %, are further considered to simplify the microstructure. Finally, the addition of carbides is investigated in lab-cast Fe-C-X alloys by adding a ternary carbide forming element to the Fe-C alloys. To understand the H/material interaction, a comparison of the available H trapping sites, the H pick-up level and the H diffusivity with the H-induced mechanical degradation or H-induced cracking is correlated with a thorough microstructural analysis. PMID:29710803

  12. Steel: Price and Policy Issues

    National Research Council Canada - National Science Library

    Cooney, Stephen

    2006-01-01

    Steel prices remain at historically elevated levels. The rapid growth of steel production and demand in China is widely considered as a major cause of the increases in both steel prices and the prices of steelmaking inputs...

  13. Creep Rupture of the Simulated HAZ of T92 Steel Compared to that of a T91 Steel.

    Science.gov (United States)

    Peng, Yu-Quan; Chen, Tai-Cheng; Chung, Tien-Jung; Jeng, Sheng-Long; Huang, Rong-Tan; Tsay, Leu-Wen

    2017-02-08

    The increased thermal efficiency of fossil power plants calls for the development of advanced creep-resistant alloy steels like T92. In this study, microstructures found in the heat-affected zone (HAZ) of a T92 steel weld were simulated to evaluate their creep-rupture-life at elevated temperatures. An infrared heating system was used to heat the samples to 860 °C (around A C1 ), 900 °C (slightly below A C3 ), and 940 °C (moderately above A C3 ) for one minute, before cooling to room temperature. The simulated specimens were then subjected to a conventional post-weld heat treatment (PWHT) at 750 °C for two hours, where both the 900 °C and 940 °C simulated specimens had fine grain sizes. In the as-treated condition, the 900 °C simulated specimen consisted of fine lath martensite, ferrite subgrains, and undissolved carbides, while residual carbides and fresh martensite were found in the 940 °C simulated specimen. The results of short-term creep tests indicated that the creep resistance of the 900 °C and 940 °C simulated specimens was poorer than that of the 860 °C simulated specimens and the base metal. Moreover, simulated T92 steel samples had higher creep strength than the T91 counterpart specimens.

  14. Hot Ductility Behavior of a Peritectic Steel during Continuous Casting

    Directory of Open Access Journals (Sweden)

    Mustafa Merih Arıkan

    2015-06-01

    Full Text Available Hot ductility properties of a peritectic steel for welded gas cylinders during continuous casting were studied by performing hot tensile tests at certain temperatures ranging from 1200 to 700 °C for some cooling rates by using Gleeble-3500 thermo-mechanical test and simulation machine in this study. The effects of cooling rate and strain rate on hot ductility were investigated and continuous casting process map (time-temperature-ductility were plotted for this material. Reduction of area (RA decreases and cracking susceptibility increases during cooling from solidification between certain temperatures depending on the cooling rate. Although the temperatures which fracture behavior change upon cooling during continuous casting may vary for different materials, it was found that the type of fracture was ductile at 1100 and 1050 °C; semi-ductile at 1000 °C, and brittle at 800 °C for the steel P245NB. There is a ductility trough between 1000 and 725 °C. The ductility trough gets slightly narrower as the cooling rate decreases.

  15. The hot working characteristics of a boron bearing and a conventional low carbon steel

    International Nuclear Information System (INIS)

    Stumpf, Waldo; Banks, Kevin

    2006-01-01

    Constitutive hot working constants were determined for an 11 ppm boron low carbon strip steel and compared from 875 to 1140 deg. C and strain rates of 0.001-2.5 s -1 to a high nitrogen low carbon strip steel. The boron steel showed a different hot working behaviour than the conventional steel with the steady state flow stress about 50-60% higher, the peak strain more than 50% higher and the eventual ferrite grain size about 40% smaller, if compared at the same temperature compensated strain rates or Z values. This difference persisted where the soaking temperature before compression was varied between 1140 and 1250 deg. C, proving that undissolved AlN in the boron-bearing steel was not responsible. With systematically varied linear cooling rates after hot working, the final ferrite grain size in the boron steel is finer and is independent of the two Z values applied during hot working. Retarded softening by dynamic recrystallisation during hot working in the boron containing steel is probably caused by boron solute drag of moving grain boundaries

  16. Push-Pull Ventilation in a Painting Shop for Large Steel Constructions

    DEFF Research Database (Denmark)

    Svidt, Kjeld; Heiselberg, Per

    This paper describes the analysis of a push-pull ventilation system for a painting shop that is used for painting steel chimneys and windmill towers.......This paper describes the analysis of a push-pull ventilation system for a painting shop that is used for painting steel chimneys and windmill towers....

  17. Fire resistance of a steel plate reinforced concrete bearing wall

    International Nuclear Information System (INIS)

    Kodaira, Akio; Kanchi, Masaki; Fujinaka, Hideo; Akita, Shodo; Ozaki, Masahiko

    2003-01-01

    Samples from a steel plate reinforced concrete bearing wall composed of concrete slab sandwiched between studded steel plates, were subjected to loaded fire resistance tests. There were two types of specimens: some were 1800 mm high while the rest were 3000 mm high ; thickness and width were the same for all specimens, at 200 mm and 800 mm, respectively. Under constant load conditions, one side of each specimen was heated along the standard fire-temperature curve. The results enabled us to approximate the relationship between the ratio of working load to concrete strength N/(Ac x c σ b) and the fire resistance time (t: minutes), as equation (1) for the 1800 mm - high specimen, and equation (2) for the 3000 mm - high specimen. N/(Ac x c σ b) = 2.21 x (1/t) 0.323 (1), .N/(Ac x c σ b) 2.30 x (1/t) 0.378 (2) In addition, the temperature of the unheated side of the specimens was 100degC at 240 minutes of continuous heating, clearly indicating that there was sufficient heat insulation. (author)

  18. A system dynamics analysis of energy consumption and corrective policies in Iranian iron and steel industry

    International Nuclear Information System (INIS)

    Ansari, Nastaran; Seifi, Abbas

    2012-01-01

    Iron and steel industry is the most energy intensive industrial sector in Iran. Long time subsidized energy has led to low energy efficiency in this industry. The sudden subsidy reform of energy prices in Iran is expected to have a great impact on steel production and energy consumption. A system dynamics model is presented in this paper to analyze steel demand, production and energy consumption in an integrated framework. A co-flow structure is used to show how subsidy reform affects energy consumption in the long run. The main focus of this paper is on direct and indirect natural gas consumption in the steel industry. Scrap based Electric Arc Furnace technology has been evaluated as an energy efficient way for steel making. The energy consumption in steel industry is estimated under various steel production and export scenarios while taking into account new energy prices to see the outlook of possible energy demand in steel industry over next 20 years. For example it is shown that under reference production scenario, potential reduction in gas consumption forced by complete removal of energy subsidy and utilizing scrap could lead to 85 billion cubic meters of gas saving over the next 20 years. -- Highlights: ► We develop a system dynamics model to analyze steel demand, production and energy consumption in Iran. ► Various scenarios have been simulated to see the energy demand of Iranian steel industry over the next 20 years. ► A co-flow structure is used to show how subsidy reform would affect energy consumption in the long run. ► A co-flow structure has been built into the SD model to formulate consumers' behavior in response to energy prices. ► Scrap based Electric Arc Furnace technology has been evaluated as an energy efficient alternative for steel making.

  19. Creep Rupture of the Simulated HAZ of T92 Steel Compared to that of a T91 Steel

    Directory of Open Access Journals (Sweden)

    Yu-Quan Peng

    2017-02-01

    Full Text Available The increased thermal efficiency of fossil power plants calls for the development of advanced creep-resistant alloy steels like T92. In this study, microstructures found in the heat-affected zone (HAZ of a T92 steel weld were simulated to evaluate their creep-rupture-life at elevated temperatures. An infrared heating system was used to heat the samples to 860 °C (around AC1, 900 °C (slightly below AC3, and 940 °C (moderately above AC3 for one minute, before cooling to room temperature. The simulated specimens were then subjected to a conventional post-weld heat treatment (PWHT at 750 °C for two hours, where both the 900 °C and 940 °C simulated specimens had fine grain sizes. In the as-treated condition, the 900 °C simulated specimen consisted of fine lath martensite, ferrite subgrains, and undissolved carbides, while residual carbides and fresh martensite were found in the 940 °C simulated specimen. The results of short-term creep tests indicated that the creep resistance of the 900 °C and 940 °C simulated specimens was poorer than that of the 860 °C simulated specimens and the base metal. Moreover, simulated T92 steel samples had higher creep strength than the T91 counterpart specimens.

  20. Compatibility of graphite with a martensitic-ferritic steel, an austenitic stainless steel and a Ni-base alloy up to 1250 C

    International Nuclear Information System (INIS)

    Hofmann, P.

    1994-08-01

    To study the chemical interactions between graphite and a martensitic-ferritic steel (1.4914), an austenitic stainless steel (1.4919; AISI 316), and a Ni-base alloy (Hastelloy X) isothermal reaction experiments were performed in the temperature range between 900 and 1250 C. At higher temperatures a rapid and complete liquefaction of the components occurred as a result of eutectic interactions. The chemical interactions are diffusion-controlled processes and can be described by parabolic rate laws. The reaction behavior of the two steels is very similar. The chemical interactions of the steels with graphite are much faster above 1100 C than those for the Ni-base alloy. Below 1000 C the effect is opposite. (orig.) [de

  1. Steel alloys

    International Nuclear Information System (INIS)

    Bloom, E.E.; Stiegler, J.O.; Rowcliffe, A.F.; Leitnaker, J.M.

    1977-01-01

    The invention deals with a fuel element for fast breeder reactors. It consits essentially of a uranium oxide, nitride, or carbide or a mixture of these fuels with a plutonium or thorium oxide, nitride, or carbide. The fuel elements are coated with an austenitic stainless steel alloy. Inside the fuel elements, vacancies or small cavities are produced by neutron effects which causes the steel coating to swell. According to the invention, swelling is prevented by a modification of type 304, 316, 321, or 12 K 72HV commercial steels. They consist mainly of Fe, Cr, and Ni in a ratio determined by a temary diagram. They may also contain 1.8 to 2.3% by weight of Mo and a fraction of Si (0.7 to 2% by weight) and Ti(0.10 to 0.5% by weight) to prevent cavity formation. They are structurally modified by cold working. (IHOE) [de

  2. A new 12% chromium steel strengthened by Z-phase precipitates

    DEFF Research Database (Denmark)

    Liu, Fang; Rashidi, Masoud; Johansson, Lennart

    2016-01-01

    In order to increase the corrosion resistance and simultaneously maintain the creep resistance of 9-12% Cr steels at 650 degrees C, a new alloy design concept was proposed, using thermodynamically stable Z-phase (CrTaN) precipitates to strengthen the steel. A new trial Z-phase strengthened 12% Cr...

  3. 49 CFR 179.500 - Specification DOT-107A * * * * seamless steel tank car tanks.

    Science.gov (United States)

    2010-10-01

    ... car tanks. 179.500 Section 179.500 Transportation Other Regulations Relating to Transportation... REGULATIONS SPECIFICATIONS FOR TANK CARS Specification for Cryogenic Liquid Tank Car Tanks and Seamless Steel Tanks (Classes DOT-113 and 107A) § 179.500 Specification DOT-107A * * * * seamless steel tank car tanks. ...

  4. A quality approach to maintain the properties of S235 JR structural carbon steel in Lebanon

    International Nuclear Information System (INIS)

    Sidawi, J.A.; Al Khatib, H.

    2004-01-01

    Full text.S235JR carbon steel is one of the most popular steels used in Lebanon. It is imported by steel dealers and is widely used by all fabricators and manufacturers of steels for many structural purposes and applications. This kind of steel has good ductile properties as well as excellent weldability. It is still known by its previous designation St 37-2 or E 24-2. S235JR is produced in many shapes and thicknesses such as steel plates, sheets, angles and different other geometric shapes. Standard chemical and mechanical tests were conducted and reported on S235JR hot-rolled structural low-carbon mild steel specimens collected from Lebanese steel market. The main objective of this work is to assure the compliance of these properties with those set by the steel manufacturer. The above mentioned tests were performed at the laboratories of the Industrial Research Institute (IR) in Lebanon to assure the quality and credibility of the results. related European and American standards were presented as references and compared with the achieved results. Discussion was presented to show the similarities and differences between S235JR steel samples and standard requirements. Some of the reasons for such differences were discussed. Sufficient data was furnished through this work for the public and mainly for the Lebanese Standard Organization LIBNOR to easily adopt and implement the EN 10025:1993 European standard that can be applied in Lebanon concerning the most commonly used hot rolled low carbon structural steel. A follow up concerning adopting and implementing EN 10025:1993 will be briefed

  5. Correlative microscopy of a carbide-free bainitic steel.

    Science.gov (United States)

    Hofer, Christina; Bliznuk, Vitaliy; Verdiere, An; Petrov, Roumen; Winkelhofer, Florian; Clemens, Helmut; Primig, Sophie

    2016-02-01

    In this work a carbide-free bainitic steel was examined by a novel correlative microscopy approach using transmission Kikuchi diffraction (TKD) and transmission electron microscopy (TEM). The individual microstructural constituents could be identified by TKD based on their different crystal structure for bainitic ferrite and retained austenite and by image quality for the martensite-austenite (M-A) constituent. Subsequently, the same area was investigated in the TEM and a good match of these two techniques regarding the identification of the area position and crystal orientation could be proven. Additionally, the M-A constituent was examined in the TEM for the first time after preceded unambiguous identification using a correlative microscopy approach. The selected area diffraction pattern showed satellites around the main reflexes which might indicate a structural modulation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. A GBT-framework towards modal modelling of steel structures

    DEFF Research Database (Denmark)

    Hansen, Anders Bau; Jönsson, Jeppe

    2017-01-01

    In modern structural steel frame design, the modelling of joints between beams and columns are based on very simple assumptions. The joints are most often assumed to behave as a perfect hinge or as a rigid joint. This means that in the overall static analysis relative rotations and changes...... the rotational stiffness of a connection. Based on a modelling of any beam-to-column joint using finite shell elements and springs for single components such as bolts, it is the primary hypothesis that it is possible to formulate a generalized connection model with few degrees of freedom related to a relevant...... set of deformation modes. This hypothesis is based on the idea of modal decomposition performed in generalized beam theories (GBT). The question is – is it possible to formulate an eigenvalue problem with a solution corresponding to mode shapes for the deformation of the joint by using the finite...

  7. 77 FR 14445 - Application for a License To Export Steel Forging

    Science.gov (United States)

    2012-03-09

    ... NUCLEAR REGULATORY COMMISSION Application for a License To Export Steel Forging Pursuant to 10 CFR 110.70(b) ``Public Notice of Receipt of an Application,'' please take notice that the Nuclear... head steel February 7, 2012 forging. forging will be XR175 machined into the 11005983 finished vessel...

  8. harmonic load modeling: a case study of 33 kv abuja steel mill feeder

    African Journals Online (AJOL)

    HOD

    techniques are adopted. This paper studied the harmonic orders of the 33 kV Abuja Steel Feeder modeled as a ... (ETAP) software package was deployed to perform Discrete Fast Transform (DFT) while the input ... and documented in research and development articles ... network with 33kV Abuja Steel feeder as case study.

  9. High strength reinforcing steel bars : concrete shear friction interface : final report : Part A.

    Science.gov (United States)

    2017-03-01

    High-strength steel (HSS) reinforcement, specifically ASTM A706 Grade 80 (550), is now permitted by the AASHTO LRFD Bridge Design Specifications for use in reinforced concrete bridge components in non-seismic regions. Using Grade 80 (550) steel reinf...

  10. Crack arrest toughness measurements with A533B steel

    International Nuclear Information System (INIS)

    Salonen, Seppo.

    1979-11-01

    This work covers crack arrest toughness measurements on A533B steel done at the Technical Research Centre of Finland. These measurements are one part of a multinational effort, involving 30 laboratories. The aim of the cooperative test program is to examine two test procedures for measuring the crack arrest toughness, to give information about their reproducibility, and to identify the factors affecting the interpretation. The principles given for the testing were easy to apply in general and the results were satisfactory. Some factors in the test runs and in the specimen's behaviour are indicated which can cause error in the results or make implementation of the test more difficult. By comparing the results from our laboratory with average values from the test program a good agreement can be seen. Crack arrest toughness values derived from the compared procedures with a static analysis agree closely, but values calculated using a dynamic analysis differ considerably. (author)

  11. Dynamic Magnification Factor in a Box-Shape Steel Girder

    Science.gov (United States)

    Rahbar-Ranji, A.

    2014-01-01

    The dynamic effect of moving loads on structures is treated as a dynamic magnification factor when resonant is not imminent. Studies have shown that the calculated magnification factors from field measurements could be higher than the values specified in design codes. It is the main aim of present paper to investigate the applicability and accuracy of a rule-based expression for calculation of dynamic magnification factor for lifting appliances used in marine industry. A steel box shape girder of a crane is considered and transient dynamic analysis using computer code ANSYS is implemented. Dynamic magnification factor is calculated for different loading conditions and compared with rule-based equation. The effects of lifting speeds, acceleration, damping ratio and position of cargo are examined. It is found that rule-based expression underestimate dynamic magnification factor.

  12. Thermal fatigue behaviour for a 316 L type steel

    Science.gov (United States)

    Fissolo, A.; Marini, B.; Nais, G.; Wident, P.

    1996-10-01

    This paper deals with initiation and growth of cracks produced by thermal fatigue loadings on 316 L steel, which is a reference material for the first wall of the next fusion reactor ITER. Two types of facilities have been built. As for true components, thermal cycles have been repeatedly applied on the surface of the specimen. The first is mainly concerned with initiation, which is detected with a light microscope. The second allows one to determine the propagation of a single crack. Crack initiation is analyzed using the French RCC-MR code procedure, and the strain-controlled isothermal fatigue curves. To predict crack growth, a model previously proposed by Haigh and Skelton is applied. This is based on determination of effective stress intensity factors, which takes into account both plastic strain and crack closure phenomena. It is shown that estimations obtained with such methodologies are in good agreement with experimental data.

  13. Thermal fatigue behaviour for a 316 L type steel

    International Nuclear Information System (INIS)

    Fissolo, A.; Marini, B.; Nais, G.; Wident, P.

    1996-01-01

    This paper deals with initiation and growth of cracks produced by thermal fatigue loadings on 316 L steel, which is a reference material for the first wall of the next fusion reactor ITER. Two types of facilities have been built. As for true components, thermal cycles have been repeatedly applied on the surface of the specimen. The first is mainly concerned with initiation, which is detected with a light microscope. The second allows one to determine the propagation of a single crack. Crack initiation is analyzed using the French RCC-MR code procedure, and the strain-controlled isothermal fatigue curves. To predict crack growth, a model previously proposed by Haigh and Skelton is applied. This is based on determination of effective stress intensity factors, which takes into account both plastic strain and crack closure phenomena. It is shown that estimations obtained with such methodologies are in good agreement with experimental data. (orig.)

  14. A study of point defects in quenched stainless steels

    International Nuclear Information System (INIS)

    Kheloufi, Khelifa.

    1977-07-01

    Thin foils of stainless steels (18%Cr, 14%Ni) containing boron (50x10 -6 ) and stabilised with titanium have been quenched at different rates in order to observe secondary defects by transmission electron microscopy. A rapid quenching in gallium has not given any secondary defects either before or after annealing. But samples quenched from temperatures greater than 800 0 C-900 0 C exhibit a dislocation density approximately 10 9 cm/cm 3 . A vacancy concentration less than 10 -6 has been observed by positron annihilation technique. After a moderate quenching, any secondary defects has been observed. It is thus clear that boron does not favour the secondary defects formation as does phosphorus [fr

  15. Polyaspartic acid as a green corrosion inhibitor for carbon steel

    Energy Technology Data Exchange (ETDEWEB)

    Cui, R. [Department of Chemistry, Hebei Normal University, Shijiazhuang 050016 (China); Department of Chemistry and Materials Engineering, Changshu Institute of Technology, Changshu 215500 (China); Gu, N.; Li, C. [Department of Chemistry, Hebei Normal University, Shijiazhuang 050016 (China)

    2011-04-15

    The inhibitor effect of the environmentally friendly corrosion inhibitor polyaspartic acid (PASP) on the corrosion of carbon steel in 0.5 M H{sub 2}SO{sub 4} was investigated by weight loss, potentiodynamic polarization, electrochemical impedance spectroscopy (EIS), and scanning electron microscopy (SEM). Polarization curve results clearly reveal the fact that PASP is a good anode-type inhibitor. EIS results confirm its corrosion inhibition ability. The inhibition efficiency increases with increasing PASP concentration, and the maximum inhibition efficiency was 80.33% at 10 C. SEM reveals that a protective film forms on the surface of the inhibited sample. The adsorption of this inhibitor is found to follow the Freundlich adsorption isotherm. A mechanism is proposed to explain the inhibitory action of the corrosion inhibitor. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  16. Critical cleavage fracture stress characterization of A508 nuclear pressure vessel steels

    International Nuclear Information System (INIS)

    Wu, Sujun; Jin, Huijin; Sun, Yanbin; Cao, Luowei

    2014-01-01

    The critical cleavage fracture stress of SA508 Gr.4N and SA508 Gr.3 low alloy reactor pressure vessel (RPV) steels was studied through the combination of experiments and finite element method (FEM) analysis. The results showed that the value of the local cleavage fracture stress, σ F , of SA508 Gr.4N steel was significantly higher than that of SA508 Gr.3 steel. Detailed microstructural analysis was carried out using FEGSEM which revealed much smaller grains, finer and more homogenous carbide particles formed in SA508 Gr.4N steel. Compared with the SA508 Gr.3 steel currently used in the nuclear industry, the SA508 Gr.4N steel possesses higher strength and notch toughness as well as improved cleavage fracture behavior, and is considered a better candidate RPV steel for the next generation nuclear reactors. - Highlights: • Critical cleavage fracture stress was calculated through experiments and FEM. • Effects of both grain and carbide particle sizes on σ F were discussed. • The SA508 Gr.4N steel is a better candidate for the next generation nuclear reactors

  17. Phase transition in a shock loaded 304 stainless steel

    International Nuclear Information System (INIS)

    Naulin, G.

    1989-11-01

    Systematic shock recovery experiments have been performed on a Z2 CN 18-10 stainless steel (304 AISI), shocked in a pressure range of 5-13 GPa. The pulse durations lay between 0.1 μs and 2 μs. The phases transformation γ (fcc) to α' (bcc) is studied. The evolution of microstructures, the nucleation and the coalescence of α' phase embryos have been observed by TEM examinations. Quantitative measurements of the α' phase allow to plot diagrams of transformed phase versus shock pressure and pulse duration. Manganin gages allow to know the pressure evolution during the impact. The Olson and Cohen model describes the development of the α' phase versus the plastic deformation. An adaptation of this model has been developed, which describes the development of the α' phase versus shock pressure and pulse duration. Theoretical laws give a good correlation with experimental results [fr

  18. Stress corrosion cracking of A515 grade 60 carbon steel

    International Nuclear Information System (INIS)

    Moore, E.L.

    1971-01-01

    An investigation was conducted to evaluate the effect of welding method plate thickness, and subsequent stress relief treatment on the stress corrosion cracking propensity of ASTM A515 Grade 60 carbon steel plate exposed to a 5 M NaNO 3 solution at 190 0 F for eight weeks. It was found that all weld coupons receiving no thermal stress relief treatment cracked within eight weeks; all weld coupons given a vibratory stress relief cracked within eight weeks; two of the eight weld coupons stress relieved at 600 0 F for one hour cracked within eight weeks; none of the weld coupons stress relieved at 1100 0 F for one hour cracked within eight weeks; and that cracking was generally more severe in coupons fabricated from 7/8 inch plate by shielded metal arc welding than it was in coupons fabricated by other welding methods. (U.S.)

  19. Effect of laser absorption on picosecond laser ablation of Cr12MoV mold steel, 9Cr18 stainless steel and H13A cemented carbide

    Science.gov (United States)

    Wu, Baoye; Liu, Peng; Wang, Xizhao; Zhang, Fei; Deng, Leimin; Duan, Jun; Zeng, Xiaoyan

    2018-05-01

    Due to excellent properties, Cr12MoV mold steel, 9Cr18 stainless steel and H13A cemented carbide are widely used in industry. In this paper, the effect of absorption of laser light on ablation efficiency and roughness have been studied using a picosecond pulse Nd:YVO4 laser. The experimental results reveal that laser wavelength, original surface roughness and chemical composition play an important role in controlling ablation efficiency and roughness. Firstly, higher ablation efficiency with lower surface roughness is achieved on the ablation of 9Cr18 at 532, comparing with 1064 nm. Secondly, the ablation efficiency increases while the Ra of the ablated region decreases with the decrease of original surface roughness on ablation of Cr12MoV mold steel at 532 nm. Thirdly, the ablation efficiency of H13A cemented carbide is much higher than 9Cr18 stainless steel and Cr12MoV mold steel at 1064 nm. Scanning electron microscopy images reveals the formation of pores on the surface of 9Cr18 stainless steel and Cr12MoV mold steel at 532 nm while no pores are formed at 1064 nm. As to H13A cemented carbide, worm-like structure is formed at 1064 nm. The synergetic effects of the heat accumulation, plasma shielding and ablation threshold on laser ablation efficiency and machining quality were analyzed and discussed systematically in this paper.

  20. Characterization of oxide films formed on steels in a BWR environment

    International Nuclear Information System (INIS)

    Honda, Takashi; Ohashi, Kenya; Kashimura, Eiji; Furutani, Yasumasa

    1988-01-01

    Environmental effects on corrosion bahaviors and properties of oxide films were evaluated for austenitic stainless and carbon steels in high-temperature water simulating a Boiling Water Reactor condition. The existence ratios of Cr and OH - in oxide films formed on stainless steel decreased and those of Fe, Ni and O 2- increased with increases of temperature and dissolved oxygen concentration. Changes of pH in the test region did not affect the composition of these species. These results indicated that Cr tended to combine with OH - , i.e., Cr existed as hydroxides or oxyhydroxides. Further, Fe and Ni tended to form spinel type oxides, which were indentified by XRD. In addition, the corrosion resistance of stainless steel was higher than that of carbon steel in all environments. The protectivity of magnetite films on carbon steel increased with temperature, dissolved oxygen concentration and pH. However, Ni ferrite, formed on stainless steel, further improved the corrosion resistance under such conditions. On the other hand, as the solubility of magnetite increased with decreases in the above mentioned factors, the corrosion resistance of carbon steel decreased. But, even under such conditions Cr, contained in stainless steel, tended to form stable films and suppressed corrosion. (author)

  1. Method of applying a coating to a steel plate

    Energy Technology Data Exchange (ETDEWEB)

    Masuda, T; Murakami, S; Chihara, Y; Iijima, K

    1968-07-19

    An application of a coating material containing a radically or ionically polymerizable monomer that can be changed into a high molecular compound by irradiation with ionizing radiations is provided to protect steel from corrosion and the adhesion of organic material. In this irradiation, the radiation doses are not more than 30 Mrad. The coating material is at least one kind of vehicle selected from the group consisting of a radically or ionically polymerizable monomer, polymer, copolymer, or compound of this monomer. They are, for example, styrene, acrylate, methacrylate, vinyl pyridine and their derivatives, acrylonitrile, acrylamide, and other vinyl compounds, etc. The absorption doses may be 30 or less Mrad, but preferably in the range of from 10 to 1 Mrad. Advantages are that the auxiliary heating can be performed below 100/sup 0/C, and that hardening can be carried out below 50/sup 0/C. Furthermore, the irradiation time is shorter than 30 seconds; may kinds of vehicles can be used; and solvent is unnecessary. In one example, 15 parts of acrylamide, 40 parts of styrene and 45 parts of ethyl acrylate are copolymerized. This copolymer is dissolved into 100 parts of styrene and is mixed with 50 parts of rutile and 50 parts of yellow lead. The obtained vehicle is hardened with 10 Mrad. The coated film 30..mu.. thick shows no defects due to weathering after 3 months. In another example, a mixture of 80 parts of unsaturated polyester and 20 parts of ethylene dimethacrylate gives 3H by irradiation with 6 Mrad in inert gas.

  2. Phase transformations evaluation on a UNS S31803 duplex stainless steel based on nondestructive testing

    International Nuclear Information System (INIS)

    Macedo Silva, Edgard de; Costa de Albuquerque, Victor Hugo; Pereira Leite, Josinaldo; Gomes Varela, Antonio Carlos; Pinho de Moura, Elineudo; Tavares, Joao Manuel R.S.

    2009-01-01

    Duplex stainless steel presents special mechanical properties such as, for example, mechanical and corrosion strength, becoming competitive in relation to the other types of stainless steel. One of the great problems of duplex stainless steel microstructural changes study is related to embrittlement above 300 deg. C, with the precipitation of the α' phase occurring over the ferritic microstructure. Aiming to characterise embrittlement of duplex stainless steel, hardening kinetics, from 425 to 475 deg. C, was analysed through the speed of sound, Charpy impact energy, X-ray diffraction, hardness and microscopy parameters. The presence of two hardening stages, detected through the speed of sound, was observed, one being of brittle characteristic and the other ductile. Moreover, the speed of sound showed a direct correlation with the material's hardness. Thus, it is concluded that the speed of sound is a promising nondestructive parameter to follow-up embrittlement in duplex stainless steel.

  3. Phase transformations evaluation on a UNS S31803 duplex stainless steel based on nondestructive testing

    Energy Technology Data Exchange (ETDEWEB)

    Macedo Silva, Edgard de, E-mail: edgard@cefetpb.edu.br [Centro federal de Educacao Tecnologica da Paraiba (CEFET PB), Area da Industria, Avenida 1o de Maio, 720 - 58015-430 - Joao Pessoa/PB (Brazil); Costa de Albuquerque, Victor Hugo, E-mail: victor.albuquerque@fe.up.pt [Universidade Federal da Paraiba (UFPB), Departamento de Engenharia Mecanica (DEM), Cidade Universitaria, S/N - 58059-900 - Joao Pessoa/PB (Brazil); Pereira Leite, Josinaldo, E-mail: josinaldo@ct.ufpb.br [Universidade Federal da Paraiba (UFPB), Departamento de Engenharia Mecanica (DEM), Cidade Universitaria, S/N - 58059-900 - Joao Pessoa/PB (Brazil); Gomes Varela, Antonio Carlos, E-mail: varela@cefetpb.edu.br [Universidade Federal da Paraiba (UFPB), Departamento de Engenharia Mecanica (DEM), Cidade Universitaria, S/N - 58059-900 - Joao Pessoa/PB (Brazil); Pinho de Moura, Elineudo, E-mail: elineudo@pq.cnpq.br [Universidade Federal do Ceara (UFC), Departamento de Engenharia Metalurgica e de Materiais, Campus do Pici, Bloco 715, 60455-760 - Fortaleza/CE (Brazil); Tavares, Joao Manuel R.S., E-mail: tavares@fe.up.pt [Faculdade de Engenharia da Universidade do Porto (FEUP), Departamento de Engenharia Mecanica e Gestao Industrial (DEMEGI)/Instituto de Engenharia Mecanica e Gestao Industrial - INEGI, Rua Dr. Roberto Frias, s/n, 4200-465 Porto (Portugal)

    2009-08-15

    Duplex stainless steel presents special mechanical properties such as, for example, mechanical and corrosion strength, becoming competitive in relation to the other types of stainless steel. One of the great problems of duplex stainless steel microstructural changes study is related to embrittlement above 300 deg. C, with the precipitation of the {alpha}' phase occurring over the ferritic microstructure. Aiming to characterise embrittlement of duplex stainless steel, hardening kinetics, from 425 to 475 deg. C, was analysed through the speed of sound, Charpy impact energy, X-ray diffraction, hardness and microscopy parameters. The presence of two hardening stages, detected through the speed of sound, was observed, one being of brittle characteristic and the other ductile. Moreover, the speed of sound showed a direct correlation with the material's hardness. Thus, it is concluded that the speed of sound is a promising nondestructive parameter to follow-up embrittlement in duplex stainless steel.

  4. 30 CFR 285.905 - When must I submit my decommissioning application?

    Science.gov (United States)

    2010-07-01

    ... application? 285.905 Section 285.905 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY ALTERNATE USES OF EXISTING FACILITIES ON THE OUTER CONTINENTAL SHELF Decommissioning Decommissioning Applications § 285.905 When must I submit my decommissioning application? You must...

  5. 30 CFR 285.543 - Example of how the inverse distance formula works.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Example of how the inverse distance formula works. 285.543 Section 285.543 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR... Financial Assurance Requirements Revenue Sharing with States § 285.543 Example of how the inverse distance...

  6. 30 CFR 285.534 - When may MMS cancel my bond?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false When may MMS cancel my bond? 285.534 Section 285.534 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE... Assurance Requirements Changes in Financial Assurance § 285.534 When may MMS cancel my bond? When your lease...

  7. 30 CFR 285.1016 - When will an Alternate Use RUE be cancelled?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false When will an Alternate Use RUE be cancelled? 285.1016 Section 285.1016 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR... Rue Administration § 285.1016 When will an Alternate Use RUE be cancelled? The Secretary may cancel an...

  8. 30 CFR 285.810 - What must I include in my Safety Management System?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What must I include in my Safety Management System? 285.810 Section 285.810 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR..., COPs and GAPs Safety Management Systems § 285.810 What must I include in my Safety Management System...

  9. 30 CFR 285.202 - What types of leases will MMS issue?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What types of leases will MMS issue? 285.202 Section 285.202 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE... Renewable Energy Leases General Lease Information § 285.202 What types of leases will MMS issue? The MMS may...

  10. 18 CFR 284.285 - Pregrant of abandonment of unbundled sales services.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Pregrant of abandonment of unbundled sales services. 284.285 Section 284.285 Conservation of Power and Water Resources... Sales by Interstate Pipelines § 284.285 Pregrant of abandonment of unbundled sales services. Abandonment...

  11. An Experimental Study on the Shear Hysteresis and Energy Dissipation of the Steel Frame with a Trapezoidal-Corrugated Steel Plate.

    Science.gov (United States)

    Shon, Sudeok; Yoo, Mina; Lee, Seungjae

    2017-03-06

    The steel frame reinforced with steel shear wall is a lateral load resisting system and has higher strength and shear performance than the concrete shear wall system. Especially, using corrugated steel plates in these shear wall systems improves out-of-plane stiffness and flexibility in the deformation along the corrugation. In this paper, a cyclic loading test of this steel frame reinforced with trapezoidal-corrugated steel plate was performed to evaluate the structural performance. The hysteresis behavior and the energy dissipation capacity of the steel frame were also compared according to the corrugated direction of the plate. For the test, one simple frame model without the wall and two frame models reinforced with the plate are considered and designed. The test results showed that the model reinforced with the corrugated steel plate had a greater accumulated energy dissipation capacity than the experimental result of the non-reinforced model. Furthermore, the energy dissipation curves of two reinforced frame models, which have different corrugated directions, produced similar results.

  12. Fracture modelling of a high performance armour steel

    Science.gov (United States)

    Skoglund, P.; Nilsson, M.; Tjernberg, A.

    2006-08-01

    The fracture characteristics of the high performance armour steel Armox 500T is investigated. Tensile mechanical experiments using samples with different notch geometries are used to investigate the effect of multi-axial stress states on the strain to fracture. The experiments are numerically simulated and from the simulation the stress at the point of fracture initiation is determined as a function of strain and these data are then used to extract parameters for fracture models. A fracture model based on quasi-static experiments is suggested and the model is tested against independent experiments done at both static and dynamic loading. The result show that the fracture model give reasonable good agreement between simulations and experiments at both static and dynamic loading condition. This indicates that multi-axial loading is more important to the strain to fracture than the deformation rate in the investigated loading range. However on-going work will further characterise the fracture behaviour of Armox 500T.

  13. [Health & safety in a steel plant: technical and managerial action].

    Science.gov (United States)

    Fusato, M

    2012-01-01

    The report presents the experience in a steel company to improve the management of issues relating to health and safety of workers. The first part of the work focuses on the description of the interventions made by the company in recent years, which can be divided into technical interventions on production facilities, training and information, organizational activities and specific projects in collaboration with the health service. The second part presents the certification project according to OHSAS 18001, with particular focus on the efforts for a lean management of the documentation required by the management systems and for the automation of internal processes. The last part finally describes in detail the manner in which it was decided to address some issues that significantly affect the factory doctor: the recording and analysis of accidents and medications, management of hazardous substances and personal protective equipment.

  14. Use of steel slag as a new material for roads

    Science.gov (United States)

    Ochoa Díaz, R.; Romero Farfán, M.; Cardenas, J.; Forero, J.

    2017-12-01

    This research paper aims to analyse the behaviour of MDC-19 hot dense asphalt mixtures with steel slag as coarse aggregate, by using asphalt 80-100, in order to verify if this residue has suitable characteristics that allow its use. The physical and mechanical characterization was accomplished using phosphorous slag from the company Acerías Paz del Río S.A. The working formula was then determined for each mixture using the RAMCODES methodology, the briquettes were produced in the laboratory and then, the design verification was performed. Taking into account the results obtained, it is concluded that the use of phosphorous slag as coarse aggregate in asphalt mixtures is workable, since acceptable design parameters and verification are obtained that meet the specifications for use as a rolling layer.

  15. Evolution of dislocations and twins in a strong and ductile nanotwinned steel

    International Nuclear Information System (INIS)

    Zhou, P.; Liang, Z.Y.; Liu, R.D.; Huang, M.X.

    2016-01-01

    A twinning-induced plasticity (TWIP) steel was subjected to a simple processing route (i.e. cold rolling followed by a recovery heat treatment) suitable for large-scale industrial production, resulting in the production of a strong and ductile nanotwinned steel. This nanotwinned steel combines high yield strength (1450 MPa), high ultimate tensile strength (1600 MPa) and good ductility (25% total elongation). Detailed transmission electron microscopy observation reveals that the twin volume fraction of the nanotwinned steel remains constant during tensile deformation. This is different to the deformation behaviour of recrystallized TWIP steels whose twin volume fraction increase continuously with strain during tensile deformation. The constant twin volume fraction indicates that a maximum twin volume fraction has been reached during the cold rolling process. In contrast, the dislocation density of the nanotwinned steel increases with strain as measured by the synchrotron X-ray diffraction experiments. In other words, the plastic deformation of the nanotwinned steel is mainly accommodated by glide and multiplication of dislocations. Based on the experimental results, an analytical model was developed to capture the respective effects of dislocations and twins on the strength and ductility of the present nanotwinned steel. The modelling results indicate that the strength is contributed by both twins and dislocations while the ductility is mainly attributed to dislocation multiplication. -- Graphical abstract: (a) TEM bright field image showing intensive nanotwins in the nanotwinned steel. Selected area diffraction pattern obtained within the red circle. (b) The engineering stress–stain curve of the nanotwinned steel. Display Omitted

  16. A study of DLC coatings for ironing of stainless steel

    Science.gov (United States)

    Sulaiman, M. H.; Christiansen, P.; Bay, N.

    2017-09-01

    Stamping of sheet metal components without lubrication or using minimum amount of hazard free lubricant is a possible solution to diminish health hazards to personnel and environmental impact and to reduce production costs. This paper studies the application of diamond-like coating (DLC) under severe lubrication conditions by adopting strip reduction testing to replicate industrial ironing production of deep drawn, stainless steel cans. Three DLC coatings are investigated; multi-layer, double layer and single layer. Experiments revealed that the double layer coating worked successful, i.e. with no sign of galling using no lubrication even at elevated tool temperature, while the other two coatings peeled off and resulted in severe galling unless lubrication was applied.

  17. Effect of aging on the tribological and mechanical properties of a high-nitrogen stainless austenitic steel

    International Nuclear Information System (INIS)

    Korshunov, L.G.; Chernenko, N.L.; Tereshchenko, N.A.; Uvarov, A.I.

    2005-01-01

    The effect of aging, associated with predominant precipitation of vanadium nitrides (VN), on tribological and mechanical properties of austenitic steel 10Kh18AG18N5MF hardened from 1100 Deg C is studied. Metallographic, X-ray diffraction and electron microscopical methods are used to study structural transformations proceeding in the steel on aging as well as on friction loading under conditions of dry slipping friction in steel-abrasive and steel-steel pairs. It is shown that the aging at temperatures of 600-700 Deg C resulting in a considerable increase of strength properties of the steel demonstrates a relatively weak positive effect on steel resistance to abrasive and adhesive wear. It is stated that the use of aging by continuous mechanism permits attaining favourable mechanical and tribological properties in vanadium-alloying nitrogen-bearing austenitic steels [ru

  18. Application of Response Surface Methodology for Modeling of Postweld Heat Treatment Process in a Pressure Vessel Steel ASTM A516 Grade 70.

    Science.gov (United States)

    Peasura, Prachya

    2015-01-01

    This research studied the application of the response surface methodology (RSM) and central composite design (CCD) experiment in mathematical model and optimizes postweld heat treatment (PWHT). The material of study is a pressure vessel steel ASTM A516 grade 70 that is used for gas metal arc welding. PWHT parameters examined in this study included PWHT temperatures and time. The resulting materials were examined using CCD experiment and the RSM to determine the resulting material tensile strength test, observed with optical microscopy and scanning electron microscopy. The experimental results show that using a full quadratic model with the proposed mathematical model is YTS = -285.521 + 15.706X1 + 2.514X2 - 0.004X1(2) - 0.001X2(2) - 0.029X1X2. Tensile strength parameters of PWHT were optimized PWHT time of 5.00 hr and PWHT temperature of 645.75°C. The results show that the PWHT time is the dominant mechanism used to modify the tensile strength compared to the PWHT temperatures. This phenomenon could be explained by the fact that pearlite can contribute to higher tensile strength. Pearlite has an intensity, which results in increased material tensile strength. The research described here can be used as material data on PWHT parameters for an ASTM A516 grade 70 weld.

  19. Ductile fracture toughness of heavy section pressure vessel steel plate. A specimen-size study of ASTM A 533 steels

    International Nuclear Information System (INIS)

    Williams, J.A.

    1979-09-01

    The ductile fracture toughness, J/sub Ic/, of ASTM A 533, Grade B, Class 1 and ASTM A 533, heat treated to simulate irradiation, was determined for 10- to 100-mm thick compact specimens. The toughness at maximum specimen load was also measured to determine the conservatism of J/sub Ic/. The toughness of ASTM A 533, Grade B, Class 1 steel was 349 kJ/m 2 and at the equivalent upper shelf temperature, the heat treated material exhibited 87 kJ/m 2 . The maximum load fracture toughness was found to be linearly proportional to specimen size, and only specimens which failed to meet ASTM size criteria exhibited maximum load toughness less than J/sub Ic/

  20. Welding of austenitic stainless steel with a high molybdenum content

    International Nuclear Information System (INIS)

    Liljas, A.; Holmberg, B.

    1984-01-01

    Welding of austenitic steel is discussed. Welding tests of AVESTA 250 SMO (six percent Mo) are reported. Welding without special additives can make the joints susceptible for corrosion in aggressive environments, e.g. sea water. (L.E.)

  1. Evaluation of selected martensitic stainless steels for use in downhole tubular expansion - Results of a laboratory study

    Energy Technology Data Exchange (ETDEWEB)

    Mack, Robert [Shell International E and P, b.v. Kessler Park 1, Postbus 60, 2280 AB Rijswijk (Netherlands)

    2004-07-01

    A laboratory program was performed to evaluate the potential of selected martensitic stainless steels for downhole cladding applications. The evaluation of the effects of tubular expansion on mechanical properties, defects, and resistance to environmentally assisted cracking demonstrated that some steels were acceptable for the intended application. The results were used to qualify and select the stainless steel for the intended sweet cladding applications. (authors)

  2. Microstructure and Properties of a New Cr - Mn Steel without Boron Additions for Use in Hot Stamping

    Science.gov (United States)

    Zhou, H.; Zhu, G.; Li, Q.; Chen, Q.

    2015-09-01

    Anew hot-stamping steel that is alloyed with chromium and manganese and does not contain boron additions has been developed. The effect of reheating temperature and cooling rates on the mechanical properties and structure of the steel is determined. Atreatment regime that increases the ductility of the steel without a noticeable decrease in its strength is proposed.

  3. Hegelian Steel

    DEFF Research Database (Denmark)

    Kjær, Poul F.

    2015-01-01

    Even in our globalized world the notion of national economies remain incredibly strong, just as a considerable part of the literature on transnational governance and globalization continue to rely on a zero-sum perspective concerning the relationship between the national and the transnational. De...... of the European steel industry....

  4. A Stress Measurement Method for Steel Strands Based on LC Oscillation

    Directory of Open Access Journals (Sweden)

    Dongjun Chen

    2018-01-01

    Full Text Available The prestress loss is one of the main factors affecting the safety of prestressed concrete structure. While the detecting signals like sound and light are difficult to spread in steel strands, there is no effective method for prestress detection of the bonded prestressed steel strands in existing structures yet. In this paper, taking into consideration that the electromagnetic oscillation characteristic can make the signal propagate effectively on the bonded prestressed steel strands, a nondestructive prestress detection method based on the electromagnetic effect to detect oscillation frequency is proposed. In a detection circuit, the steel strands are simulated as an inductance component, in which an induced electromagnetic signal passes through the steel strands to form resonance. And then, a frequency meter is used to detect the oscillation frequency of the resonant circuit. The oscillation frequency is supposed to have relationship with the prestress loading on the steel strands. A section of steel strands with a length of 1.2 m is adopted to test the correlation of stress and oscillation frequency. Both the theoretical and experimental results show that the resonant frequency of the circuit decreases with the increase of the stress of the strand and is linear in a certain range.

  5. A new effect of retained austenite on ductility enhancement in high strength bainitic steel

    Energy Technology Data Exchange (ETDEWEB)

    Wang Ying; Zhang Ke; Guo Zhenghong; Chen Nailu [School of Materials Science and Engineering, Shanghai Jiao Tong University, Shanghai 200240 (China); Rong Yonghua, E-mail: yhrong@sjtu.edu.cn [School of Materials Science and Engineering, Shanghai Jiao Tong University, Shanghai 200240 (China)

    2012-08-30

    Highlights: Black-Right-Pointing-Pointer A new DARA effect in the bainitic steel is proposed. Black-Right-Pointing-Pointer The conditions of DARA effect are proposed. Black-Right-Pointing-Pointer The mechanism of retained austenite on ductility enhancement is clarified. - Abstract: A designed high strength bainitic steel with considerable amount of retained austenite is presented in order to study the effect of retained austenite on the ductility enhancement in bainitic steels. Transformation induced plasticity (TRIP) effect is verified by both X-ray diffraction (XRD) measurement of retained austenite fraction in various deformation stages and transmission electron microscopy observation of the deformed twin-type martensite. Results from XRD line profile analysis reveal that the average dislocation density in bainite during the deformation is lower than that before deformation, and such a phenomenon can be explained by a new effect, dislocations absorption by retained austenite (DARA) effect, based on our previous investigation of martensitic steels. DARA effect availably enhances the compatibility of deformation ability of bainite with retained austenite. In view of microstructure similarity of bainitic steels with martensitic steels, the conditions of DARA effect are proposed. The effects of retained austenite on the ductility enhancement in bainitic steels are clarified.

  6. Acute changes in lung function associated with proximity to a steel plant: a randomized study.

    Science.gov (United States)

    Dales, Robert; Kauri, Lisa Marie; Cakmak, Sabit; Mahmud, Mamun; Weichenthal, Scott A; Van Ryswyk, Keith; Kumarathasan, Premkumari; Thomson, Errol; Vincent, Renaud; Broad, Gayle; Liu, Ling

    2013-05-01

    Steel production is a major industry worldwide yet there is relatively little information on the pulmonary effects of air quality near steel manufacturing plants. The aim of this study was to examine how lung function changes acutely when healthy subjects are situated near a steel plant which is adjacent to a residential area. Sixty-one subjects were randomly assigned to spend 5 consecutive, 8-hour days in a residential neighborhood approximately 0.9km from a steel plant, or approximately 4.5km away at a college campus. Subjects crossed-over between sites after a nine-day washout period. Lung function was measured daily at both sites along with air pollutants including SO2, NO2, O3, PM2.5, and ultrafine particles. Diffusion capacity and pulse oximetry were also examined. Compared with the college site, the forced expiratory volume in 1-second/forced vital capacity, forced expiratory flow between 25% and 75% of the FVC, total lung capacity, functional residual capacity, and residual volume were lower near the steel plant by 0.67% (95% CI: 0.28, 1.06),1.62% (95% CI: 0.50, 2.75), 1.54% (95% CI: 0.68, 2.39), 3.54% (95% CI: 1.95, 5.13) and 11.3% (95% CI: 4.92, 17.75), respectively. Diffusion capacity, forced expiratory volume in 1s, and pulse oximetry were also lower near the plant but these effects were not statistically significant. Sulfur dioxide, ultrafine particulates, and oxides of nitrogen were greater near the steel plant site compared to the college site. Spending short periods of time near a steel plant is associated with a decrease in lung function. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  7. Steel slag carbonation in a flow-through reactor system: the role of fluid-flux.

    Science.gov (United States)

    Berryman, Eleanor J; Williams-Jones, Anthony E; Migdisov, Artashes A

    2015-01-01

    Steel production is currently the largest industrial source of atmospheric CO2. As annual steel production continues to grow, the need for effective methods of reducing its carbon footprint increases correspondingly. The carbonation of the calcium-bearing phases in steel slag generated during basic oxygen furnace (BOF) steel production, in particular its major constituent, larnite {Ca2SiO4}, which is a structural analogue of olivine {(MgFe)2SiO4}, the main mineral subjected to natural carbonation in peridotites, offers the potential to offset some of these emissions. However, the controls on the nature and efficiency of steel slag carbonation are yet to be completely understood. Experiments were conducted exposing steel slag grains to a CO2-H2O mixture in both batch and flow-through reactors to investigate the impact of temperature, fluid flux, and reaction gradient on the dissolution and carbonation of steel slag. The results of these experiments show that dissolution and carbonation of BOF steel slag are more efficient in a flow-through reactor than in the batch reactors used in most previous studies. Moreover, they show that fluid flux needs to be optimized in addition to grain size, pressure, and temperature, in order to maximize the efficiency of carbonation. Based on these results, a two-stage reactor consisting of a high and a low fluid-flux chamber is proposed for CO2 sequestration by steel slag carbonation, allowing dissolution of the slag and precipitation of calcium carbonate to occur within a single flow-through system. Copyright © 2014. Published by Elsevier B.V.

  8. Determination of the annealing for AISI430 steel in a continous furnace

    International Nuclear Information System (INIS)

    Pinto, A.H.; Diab Junior, A.

    1984-01-01

    It's discussed a mathematical model, which represents the heating of a steel piece inside a continuous annealing furnace. It's described the experimental technique used to obtain good annealing conditions for a required quality. (Author) [pt

  9. Microstructure and Mechanical Properties of ASTM A743 CA6NM Steel Welded by FCAW Process

    OpenAIRE

    Silva, Rafael de Paula; Faria, Maria Ismenia Sodero Toledo; Almeida, Luiz Fernando Cursino Briet de; Nunes, Carlos Angelo; Vieira, Décio; Borges Júnior, Wanderlei

    2017-01-01

    CA6NM steel is widely used in the manufacture of hydraulic turbines metallic parts, due to its resistance to corrosion and cavitation damage, combined with good weldability and fatigue properties. However, welding of this type of steel is complex and to ensure a minimum residual stress after welding it is necessary perform a post welding heat treatment (PWHT) of the part. This study aims to analyze the effect of a PWHT on the microstructure and mechanical properties of CA6NM steel weld joint ...

  10. Steel heat treating: mathematical modelling and numerical simulation of a problem arising in the automotive industry

    Directory of Open Access Journals (Sweden)

    Jose Manuel Diaz Moreno

    2017-12-01

    Full Text Available We describe a mathematical model for the industrial heating and cooling processes of a steel workpiece representing the steering rack of an automobile. The goal of steel heat treating is to provide a hardened surface on critical parts of the workpiece while keeping the rest soft and ductile in order to reduce fatigue. The high hardness is due to the phase transformation of steel accompanying the rapid cooling. This work takes into account both heating-cooling stage and viscoplastic model. Once the general mathematical formulation is derived, we can perform some numerical simulations.

  11. A Numerical Investigation of CFRP-Steel Interfacial Failure with Material Point Method

    International Nuclear Information System (INIS)

    Shen Luming; Faleh, Haydar; Al-Mahaidi, Riadh

    2010-01-01

    The success of retrofitting steel structures by using the Carbon Fibre Reinforced Polymers (CFRP) significantly depends on the performance and integrity of CFRP-steel joint and the effectiveness of the adhesive used. Many of the previous numerical studies focused on the design and structural performance of the CFRP-steel system and neglected the mechanical responses of adhesive layer, which results in the lack of understanding in how the adhesive layer between the CFRP and steel performs during the loading and failure stages. Based on the recent observation on the failure of CFRP-steel bond in the double lap shear tests, a numerical approach is proposed in this study to simulate the delamination process of CFRP sheet from steel plate using the Material Point Method (MPM). In the proposed approach, an elastoplasticity model with a linear hardening and softening law is used to model the epoxy layer. The MPM, which does not employ fixed mesh-connectivity, is employed as a robust spatial discretization method to accommodate the multi-scale discontinuities involved in the CFRP-steel bond failure process. To demonstrate the potential of the proposed approach, a parametric study is conducted to investigate the effects of bond length and loading rates on the capacity and failure modes of CFRP-steel system. The evolution of the CFRP-steel bond failure and the distribution of stress and strain along bond length direction will be presented. The simulation results not only well match the available experimental data but also provide a better understanding on the physics behind the CFRP sheet delamination process.

  12. A novel Mo-W interlayer approach for CVD diamond deposition on steel

    Energy Technology Data Exchange (ETDEWEB)

    Kundrát, Vojtěch; Sullivan, John; Ye, Haitao, E-mail: h.ye@aston.ac.uk [School of Engineering and Applied Science, Aston University, Birmingham, B4 7ET (United Kingdom); Zhang, Xiaoling; Cooke, Kevin; Sun, Hailin [Miba Coating Group: Teer Coatings Ltd, West-Stone-House, West-Stone, Berry-Hill-Industrial-Estate, WR9 9AS, Droitwich (United Kingdom)

    2015-04-15

    Steel is the most widely used material in engineering for its cost/performance ratio and coatings are routinely applied on its surface to further improve its properties. Diamond coated steel parts are an option for many demanding industrial applications through prolonging the lifetime of steel parts, enhancement of tool performance as well as the reduction of wear rates. Direct deposition of diamond on steel using conventional chemical vapour deposition (CVD) processes is known to give poor results due to the preferential formation of amorphous carbon on iron, nickel and other elements as well as stresses induced from the significant difference in the thermal expansion coefficients of those materials. This article reports a novel approach of deposition of nanocrystalline diamond coatings on high-speed steel (M42) substrates using a multi-structured molybdenum (Mo) – tungsten (W) interlayer to form steel/Mo/Mo-W/W/diamond sandwich structures which overcome the adhesion problem related to direct magnetron sputtering deposition of pure tungsten. Surface, interface and tribology properties were evaluated to understand the role of such an interlayer structure. The multi-structured Mo-W interlayer has been proven to improve the adhesion between diamond films and steel substrates by acting as an effective diffusion barrier during the CVD diamond deposition.

  13. A novel Mo-W interlayer approach for CVD diamond deposition on steel

    Science.gov (United States)

    Kundrát, Vojtěch; Zhang, Xiaoling; Cooke, Kevin; Sun, Hailin; Sullivan, John; Ye, Haitao

    2015-04-01

    Steel is the most widely used material in engineering for its cost/performance ratio and coatings are routinely applied on its surface to further improve its properties. Diamond coated steel parts are an option for many demanding industrial applications through prolonging the lifetime of steel parts, enhancement of tool performance as well as the reduction of wear rates. Direct deposition of diamond on steel using conventional chemical vapour deposition (CVD) processes is known to give poor results due to the preferential formation of amorphous carbon on iron, nickel and other elements as well as stresses induced from the significant difference in the thermal expansion coefficients of those materials. This article reports a novel approach of deposition of nanocrystalline diamond coatings on high-speed steel (M42) substrates using a multi-structured molybdenum (Mo) - tungsten (W) interlayer to form steel/Mo/Mo-W/W/diamond sandwich structures which overcome the adhesion problem related to direct magnetron sputtering deposition of pure tungsten. Surface, interface and tribology properties were evaluated to understand the role of such an interlayer structure. The multi-structured Mo-W interlayer has been proven to improve the adhesion between diamond films and steel substrates by acting as an effective diffusion barrier during the CVD diamond deposition.

  14. A novel Mo-W interlayer approach for CVD diamond deposition on steel

    Directory of Open Access Journals (Sweden)

    Vojtěch Kundrát

    2015-04-01

    Full Text Available Steel is the most widely used material in engineering for its cost/performance ratio and coatings are routinely applied on its surface to further improve its properties. Diamond coated steel parts are an option for many demanding industrial applications through prolonging the lifetime of steel parts, enhancement of tool performance as well as the reduction of wear rates. Direct deposition of diamond on steel using conventional chemical vapour deposition (CVD processes is known to give poor results due to the preferential formation of amorphous carbon on iron, nickel and other elements as well as stresses induced from the significant difference in the thermal expansion coefficients of those materials. This article reports a novel approach of deposition of nanocrystalline diamond coatings on high-speed steel (M42 substrates using a multi-structured molybdenum (Mo – tungsten (W interlayer to form steel/Mo/Mo-W/W/diamond sandwich structures which overcome the adhesion problem related to direct magnetron sputtering deposition of pure tungsten. Surface, interface and tribology properties were evaluated to understand the role of such an interlayer structure. The multi-structured Mo-W interlayer has been proven to improve the adhesion between diamond films and steel substrates by acting as an effective diffusion barrier during the CVD diamond deposition.

  15. 31 CFR 285.5 - Centralized offset of Federal payments to collect nontax debts owed to the United States.

    Science.gov (United States)

    2010-07-01

    ... offset of certain types of Federal payments, including tax refunds (31 CFR 285.2), Federal benefit... certified payment vouchers or other similar forms, to a disbursing official for disbursement. Payment record means information contained on a payment request, in the form of a certified payment voucher or other...

  16. Microbial-Influenced Corrosion of Corten Steel Compared with Carbon Steel and Stainless Steel in Oily Wastewater by Pseudomonas aeruginosa

    Science.gov (United States)

    Mansouri, Hamidreza; Alavi, Seyed Abolhasan; Fotovat, Meysam

    2015-07-01

    The microbial corrosion behavior of three important steels (carbon steel, stainless steel, and Corten steel) was investigated in semi petroleum medium. This work was done in modified nutrient broth (2 g nutrient broth in 1 L oily wastewater) in the presence of Pseudomonas aeruginosa and mixed culture (as a biotic media) and an abiotic medium for 2 weeks. The behavior of corrosion was analyzed by spectrophotometric and electrochemical methods and at the end was confirmed by scanning electron microscopy. The results show that the degree of corrosion of Corten steel in mixed culture, unlike carbon steel and stainless steel, is less than P. aeruginosa inoculated medium because some bacteria affect Corten steel less than other steels. According to the experiments, carbon steel had less resistance than Corten steel and stainless steel. Furthermore, biofilm inhibits separated particles of those steels to spread to the medium; in other words, particles get trapped between biofilm and steel.

  17. Small punch creep test in a 316 austenitic stainless steel

    Directory of Open Access Journals (Sweden)

    Saucedo-Muñoz, Maribel L.

    2015-03-01

    Full Text Available The small punch creep test was applied to evaluate the creep behavior of a 316 type austenitic stainless steel at temperatures of 650, 675 and 700 °C. The small punch test was carried out using a creep tester with a specimen size of 10×10×0.3 mm at 650, 675 and 700 °C using loads from 199 to 512 N. The small punch creep curves show the three stages found in the creep curves of the conventional uniaxial test. The conventional creep relationships which involve parameters such as creep rate, stress, time to rupture and temperature were followed with the corresponding parameters of small punch creep test and they permitted to explain the creep behavior in this steel. The mechanism and activation energy of the deformation process were the grain boundary sliding and diffusion, respectively, during creep which caused the intergranular fracture in the tested specimens.El ensayo de termofluencia por indentación se utilizó para evaluar el comportamiento a la termofluencia en un acero inoxidable austenítico 316. Este ensayo se realizó en una máquina de indentación con muestras de 10×10×0,3 mm a temperaturas de 650, 675 y 700 °C con cargas de 199 a 512 N. Las curvas de termofluencia del ensayo mostraron las tres etapas características observadas en el ensayo convencional de tensión. Asimismo, las principales relaciones de termofluencia entre parámetros como velocidad de termofluencia, esfuerzo, tiempo de ruptura y temperatura se observaron en los parámetros correspondientes al ensayo de indentación, lo que permitió caracterizar el comportamiento de termofluencia en este acero. El mecanismo y la energía de activación del proceso de deformación en la termofluencia corresponden al deslizamiento de los límites de grano y la difusión a través de los mismos, respectivamente, lo cual causó la fractura intergranular en las muestras ensayadas.

  18. Development of a facility for fabricating nuclear waste canisters from radioactively contaminated steel

    International Nuclear Information System (INIS)

    Logan, J.A.; Larsen, M.M.

    1986-01-01

    This paper describes design of a facility and processes capable of using radioactively contaminated waste steel as the principal raw material for fabricating stainless steel canisters to be used for disposal of nuclear high-level waste. By such action, expenditure (i.e., permanent loss to society) of thousands of tons of uncontaminated chromium and nickel to fabricate such canisters can be avoided. Moreover, the cost and risks involved in disposing of large accumulations of radioactively contaminated steel as low-level radioactive waste (LLRW), that would otherwise be necessary, can also be avoided. The canister fabrication processes (involving centrifugal casting) described herein have been tested and proven for this application. The performance characteristics of stainless steel canisters so fabricated have been tested and agreed to by the organizations that have been involved in this development work (Battelle Memorial Institute, DuPont, EGandG and the Savannah River Laboratory) as equivalent to the performance characteristics of canisters fabricated of uncontaminated wrought stainless steel. It is estimated that the production cost for fabricating canisters by the methods described will not differ greatly from the production cost using uncontaminated wrought steel, and the other costs avoided by not having to dispose of the contaminated steel as LLRW could cause this method to produce the lowest ultimate overall costs

  19. Deformation Induced Martensitic Transformation and Its Initial Microstructure Dependence in a High Alloyed Duplex Stainless Steel

    DEFF Research Database (Denmark)

    Xie, Lin; Huang, Tian Lin; Wang, Yu Hui

    2017-01-01

    Deformation induced martensitic transformation (DIMT) usually occurs in metastable austenitic stainless steels. Recent studies have shown that DIMT may occur in the austenite phase of low alloyed duplex stainless steels. The present study demonstrates that DIMT can also take place in a high alloyed...... Fe–23Cr–8.5Ni duplex stainless steel, which exhibits an unexpectedly rapid transformation from γ-austenite into α′-martensite. However, an inhibited martensitic transformation has been observed by varying the initial microstructure from a coarse alternating austenite and ferrite band structure...

  20. A comparison of the tribological behaviour of steel/steel, steel/DLC and DLC/DLC contact when lubricated with mineral and biodegradable oils

    OpenAIRE

    Kalin, Mitjan; Vižintin, Jože

    2015-01-01

    Diamond-like carbon (DLC) coatings, which can nowadays be applied to many highly loaded mechanical components, sometimes need to operate under lubricated conditions. It is reasonable to expect that in steel/DLC contacts, at least the steel counter body will behave according to conventional lubrication mechanisms and will interact with lubricants and additives in the contact. However, in DLC/DLC contacts, such mechanisms are still unclear. For example, the "inertness" of DLC coatings raises se...

  1. Observation and study of centrally produced pion clusters in 28.5-GeV/c p-p interactions

    International Nuclear Information System (INIS)

    Erwin, A.R.; Harvey, E.H.; Larson, G.P.; Collins, G.B.; Ficenec, J.R.; Stringfellow, B.C.; Trower, W.P.; Gutay, L.J.; Laasanen, A.; Willmann, R.B.; Anderson, E.W.; Fisher, G.P.; Lazuras, E.; von Lindern, L.; Ramanauskas, A.; Schubelin, P.; Thorndike, A.M.; Turkot, F.

    1976-01-01

    A double-arm spectrometer is used to identify a pion cluster produced in central p-p collisions at 28.5 GeV/c. Cluster properties studied are angular momentum, quantum statistics, multiplicity, and effective mass. There is some speculation on the production mechanism

  2. The steel scrap age.

    Science.gov (United States)

    Pauliuk, Stefan; Milford, Rachel L; Müller, Daniel B; Allwood, Julian M

    2013-04-02

    Steel production accounts for 25% of industrial carbon emissions. Long-term forecasts of steel demand and scrap supply are needed to develop strategies for how the steel industry could respond to industrialization and urbanization in the developing world while simultaneously reducing its environmental impact, and in particular, its carbon footprint. We developed a dynamic stock model to estimate future final demand for steel and the available scrap for 10 world regions. Based on evidence from developed countries, we assumed that per capita in-use stocks will saturate eventually. We determined the response of the entire steel cycle to stock saturation, in particular the future split between primary and secondary steel production. During the 21st century, steel demand may peak in the developed world, China, the Middle East, Latin America, and India. As China completes its industrialization, global primary steel production may peak between 2020 and 2030 and decline thereafter. We developed a capacity model to show how extensive trade of finished steel could prolong the lifetime of the Chinese steelmaking assets. Secondary steel production will more than double by 2050, and it may surpass primary production between 2050 and 2060: the late 21st century can become the steel scrap age.

  3. MDM2 SNP309 and SNP285 Act as Negative Prognostic Markers for Non-small Cell Lung Cancer Adenocarcinoma Patients

    Science.gov (United States)

    Deben, Christophe; Op de Beeck, Ken; Van den Bossche, Jolien; Jacobs, Julie; Lardon, Filip; Wouters, An; Peeters, Marc; Van Camp, Guy; Rolfo, Christian; Deschoolmeester, Vanessa; Pauwels, Patrick

    2017-01-01

    Objectives: Two functional polymorphisms in the MDM2 promoter region, SNP309T>G and SNP285G>C, have been shown to impact MDM2 expression and cancer risk. Currently available data on the prognostic value of MDM2 SNP309 in non-small cell lung cancer (NSCLC) is contradictory and unavailable for SNP285. The goal of this study was to clarify the role of these MDM2 SNPs in the outcome of NSCLC patients. Materials and Methods: In this study we genotyped SNP309 and SNP285 in 98 NSCLC adenocarcinoma patients and determined MDM2 mRNA and protein levels. In addition, we assessed the prognostic value of these common SNPs on overall and progression free survival, taking into account the TP53 status of the tumor. Results and Conclusion: We found that the SNP285C allele, but not the SNP309G allele, was significantly associated with increased MDM2 mRNA expression levels (p = 0.025). However, we did not observe an association with MDM2 protein levels for SNP285. The SNP309G allele was significantly associated with the presence of wild type TP53 (p = 0.047) and showed a strong trend towards increased MDM2 protein levels (p = 0.068). In addition, patients harboring the SNP309G allele showed a worse overall survival, but only in the presence of wild type TP53. The SNP285C allele was significantly associated with an early age of diagnosis and metastasis. Additionally, the SNP285C allele acted as an independent predictor for worse progression free survival (HR = 3.97; 95% CI = 1.51 - 10.42; p = 0.005). Our data showed that both SNP309 (in the presence of wild type TP53) and SNP285 act as negative prognostic markers for NSCLC patients, implicating a prominent role for these variants in the outcome of these patients. PMID:28819417

  4. Microscopic examination of crack growth in a pressure vessel steel

    Energy Technology Data Exchange (ETDEWEB)

    Isacsson, M.; Narstroem, T. [Royal Inst. of Tech., Stockholm (Sweden)

    1997-01-01

    A fairly systematic microscopic study concerning ductile and ductile-brittle crack growth in the A508B pressure vessel steel has been performed. The main method of investigation was to subject fracture mechanics specimens (sub-sized three point bend specimens) to predetermined load levels corresponding to different amounts of ductile crack extension. The specimens were then cut perpendicularly to the plane of the crack and the area in front of the crack was examined in a SEM. The object of these examinations was to determine if newly encountered computational results could be correlated to crack extension characteristics and to study whether the mechanism of ductile growth was of the void growth type or of the fast shear mechanism. This is important for further numerical modelling of the process. Both the original material and a specially heat treated piece were investigated. The heat treatment was performed in order to raise the transition temperature to about 60 deg C with the object to provide a more convenient testing situation. Charpy V tests were performed for the specially heat treated material to obtain the temperature dependence of the toughness. This was also studied by performing fracture toughness determination on the same type of specimens as were used for the microscopic study. The heat treatment used fulfilled the above purpose and the microscopic studies provide a good understanding of the micro mechanisms operating in the ductile fracture process for this material. 19 refs, 8 figs, 3 tabs.

  5. Microscopic examination of crack growth in a pressure vessel steel

    International Nuclear Information System (INIS)

    Isacsson, M.; Narstroem, T.

    1997-01-01

    A fairly systematic microscopic study concerning ductile and ductile-brittle crack growth in the A508B pressure vessel steel has been performed. The main method of investigation was to subject fracture mechanics specimens (sub-sized three point bend specimens) to predetermined load levels corresponding to different amounts of ductile crack extension. The specimens were then cut perpendicularly to the plane of the crack and the area in front of the crack was examined in a SEM. The object of these examinations was to determine if newly encountered computational results could be correlated to crack extension characteristics and to study whether the mechanism of ductile growth was of the void growth type or of the fast shear mechanism. This is important for further numerical modelling of the process. Both the original material and a specially heat treated piece were investigated. The heat treatment was performed in order to raise the transition temperature to about 60 deg C with the object to provide a more convenient testing situation. Charpy V tests were performed for the specially heat treated material to obtain the temperature dependence of the toughness. This was also studied by performing fracture toughness determination on the same type of specimens as were used for the microscopic study. The heat treatment used fulfilled the above purpose and the microscopic studies provide a good understanding of the micro mechanisms operating in the ductile fracture process for this material

  6. Electrochemical characterisation of a martensitic stainless steel in a neutral chloride solution

    International Nuclear Information System (INIS)

    Marcelin, Sabrina; Pébère, Nadine; Régnier, Sophie

    2013-01-01

    Highlights: ► A better knowledge of the electrochemical behaviour of a martensitic stainless steel in bulk electrolyte was obtained. ► Quantitative parameters were obtained from impedance measurements. ► The study will be used as reference to investigate crevice corrosion using a thin layer cell. - Abstract: This paper focuses on the characterisation of the electrochemical behaviour of a martensitic stainless steel in 0.1 M NaCl + 0.04 M Na 2 SO 4 solution and is a part of a study devoted to crevice corrosion resistance of stainless steels. Polarisation curves and electrochemical impedance measurements were obtained for different experimental conditions in bulk electrolyte. X-ray photoelectron spectroscopy (XPS) was used to analyse the passive films. At the corrosion potential, the stainless steel was in the passive state and the corrosion process was controlled by the properties of the passive film formed during air exposure. During immersion in the deaerated solution, the passive film was only slightly modified, whereas it was altered both in composition and thickness during immersion in the aerated solution. After cathodic polarisation of the stainless steel electrode surface, the oxide film was almost totally removed and the surface appeared to be uniformly active for oxygen reduction. The new passive film, formed at the corrosion potential, was enriched with iron species and less protective. Impedance diagrams allowed the characterisation of both the oxide film (high-frequency range) and the charge transfer process (low-frequency range).

  7. 42 CFR 137.285 - Are Self-Governance Tribes required to accept Federal environmental responsibilities to enter...

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Are Self-Governance Tribes required to accept..., DEPARTMENT OF HEALTH AND HUMAN SERVICES TRIBAL SELF-GOVERNANCE Construction Nepa Process § 137.285 Are Self-Governance Tribes required to accept Federal environmental responsibilities to enter into a construction...

  8. Design and evaluation of a heat recuperator for steel slags

    International Nuclear Information System (INIS)

    Gutiérrez Trashorras, Antonio J.; Álvarez, Eduardo Álvarez; Río González, José Luis; Suarez Cuesta, José Manuel; Bernat, Jorge Xiberta

    2013-01-01

    New techniques for emissions reduction and energy efficiency are important challenges of the steel industry. Although great advantages have been reached in these fields, there are still new opportunities. One of them is the possible development of systems to recover energy from slags. The recent policies that encourage the use of renewable and alternative energies determine a favorable scenario for the development of new techniques of heat recovering. In this context, this article presents a new heat recuperation system for the slags produced in the factories of Arcelor–Mittal in Asturias (Spain) and study in detail the design of an innovative slags heat exchanger. To adjust its performance and to determine the influence of the geometric and flow design parameters, the heat exchanger has been simulated using numerical analysis software (CFD). -- Highlights: • A new design of a heat recuperator for slags energy recovery is presented. • The effects of the design parameters have been studied with a numerical model. • Refractory materials with high thermal conductivity improve heat recuperation

  9. Electrochemical corrosion response of a low carbon heat treated steel in a NaCl solution

    Energy Technology Data Exchange (ETDEWEB)

    Osorio, W.R.; Peixoto, L.C.; Garcia, L.R.; Garcia, A. [Department of Materials Engineering, State University of Campinas, SP (Brazil)

    2009-10-15

    Dual-phase (DP) steels are produced from a specific heat treatment procedure and have recently emerged as a potential class of engineering materials for a number of structural and automobile applications. Such steels have high strength-to-weight ratio and reasonable formability. The present study aims to investigate the effects of four different and conventional heat treatments (i.e., hot rolling, normalizing, annealing, and intercritical annealing) on the resulting microstructural patterns and on the electrochemical corrosion behavior. Electrochemical impedance spectroscopy (EIS) and Tafel plots were carried out on heat treated steel samples in a 0.5 M NaCl solution at 25 C with neutral pH. An equivalent circuit analysis was also used to provide quantitative support for the discussions. The normalizing and the annealing heat treatments have provided the highest and the lowest corrosion resistances, respectively. The intercritical annealing and as-received (hot rolled) low carbon steel samples have shown similar corrosion behavior. Although a deleterious effect on the corrosion resistance has been verified for DP steel due to the residual stress from the martensite formation, it combines good mechanical properties with intermediate electrochemical corrosion resistance. (Abstract Copyright [2009], Wiley Periodicals, Inc.)

  10. Atmospheric Corrosion Behavior and Mechanism of a Ni-Advanced Weathering Steel in Simulated Tropical Marine Environment

    Science.gov (United States)

    Wu, Wei; Zeng, Zhongping; Cheng, Xuequn; Li, Xiaogang; Liu, Bo

    2017-12-01

    Corrosion behavior of Ni-advanced weathering steel, as well as carbon steel and conventional weathering steel, in a simulated tropical marine atmosphere was studied by field exposure and indoor simulation tests. Meanwhile, morphology and composition of corrosion products formed on the exposed steels were surveyed through scanning electron microscopy, energy-dispersive x-ray spectroscopy and x-ray diffraction. Results indicated that the additive Ni in weathering steel played an important role during the corrosion process, which took part in the formation of corrosion products, enriched in the inner rust layer and promoted the transformation from loose γ-FeOOH to dense α-FeOOH. As a result, the main aggressive ion, i.e., Cl-, was effectively separated in the outer rust layer which leads to the lowest corrosion rate among these tested steels. Thus, the resistance of Ni-advanced weathering steel to atmospheric corrosion was significantly improved in a simulated tropical marine environment.

  11. Irradiation damage of ferritic/martensitic steels: Fusion program data applied to a spallation neutron source

    International Nuclear Information System (INIS)

    Klueh, R.L.

    1997-01-01

    Ferritic/martensitic steels were chosen as candidates for future fusion power plants because of their superior swelling resistance and better thermal properties than austenitic stainless steels. For the same reasons, these steels are being considered for the target structure of a spallation neutron source, where the structural materials will experience even more extreme irradiation conditions than expected in a fusion power plant first wall (i.e., high-energy neutrons that produce large amounts of displacement damage and transmutation helium). Extensive studies on the effects of neutron irradiation on the mechanical properties of ferritic/martensitic steels indicate that the major problem involves the effect of irradiation on fracture, as determined by a Charpy impact test. There are indications that helium can affect the impact behavior. Even more helium will be produced in a spallation neutron target material than in the first wall of a fusion power plant, making helium effects a prime concern for both applications. 39 refs., 10 figs

  12. Characterization of a Laser Surface-Treated Martensitic Stainless Steel

    Directory of Open Access Journals (Sweden)

    S.R. Al-Sayed

    2017-05-01

    Full Text Available Laser surface treatment was carried out on AISI 416 machinable martensitic stainless steel containing 0.225 wt.% sulfur. Nd:YAG laser with a 2.2-KW continuous wave was used. The aim was to compare the physical and chemical properties achieved by this type of selective surface treatment with those achieved by the conventional treatment. Laser power of different values (700 and 1000 W with four corresponding different laser scanning speeds (0.5, 1, 2, and 3 m•min−1 was adopted to reach the optimum conditions for impact toughness, wear, and corrosion resistance for laser heat treated (LHT samples. The 0 °C impact energy of LHT samples indicated higher values compared to the conventionally heat treated (CHT samples. This was accompanied by the formation of a hard surface layer and a soft interior base metal. Microhardness was studied to determine the variation of hardness values with respect to the depth under the treated surface. The wear resistance at the surface was enhanced considerably. Microstructure examination was characterized using optical and scanning electron microscopes. The corrosion behavior of the LHT samples was also studied and its correlation with the microstructures was determined. The corrosion data was obtained in 3.5% NaCl solution at room temperature by means of a potentiodynamic polarization technique.

  13. Characterization of a Laser Surface-Treated Martensitic Stainless Steel.

    Science.gov (United States)

    Al-Sayed, S R; Hussein, A A; Nofal, A A; Hassab Elnaby, S I; Elgazzar, H

    2017-05-29

    Laser surface treatment was carried out on AISI 416 machinable martensitic stainless steel containing 0.225 wt.% sulfur. Nd:YAG laser with a 2.2-KW continuous wave was used. The aim was to compare the physical and chemical properties achieved by this type of selective surface treatment with those achieved by the conventional treatment. Laser power of different values (700 and 1000 W) with four corresponding different laser scanning speeds (0.5, 1, 2, and 3 m•min-1) was adopted to reach the optimum conditions for impact toughness, wear, and corrosion resistance for laser heat treated (LHT) samples. The 0 °C impact energy of LHT samples indicated higher values compared to the conventionally heat treated (CHT) samples. This was accompanied by the formation of a hard surface layer and a soft interior base metal. Microhardness was studied to determine the variation of hardness values with respect to the depth under the treated surface. The wear resistance at the surface was enhanced considerably. Microstructure examination was characterized using optical and scanning electron microscopes. The corrosion behavior of the LHT samples was also studied and its correlation with the microstructures was determined. The corrosion data was obtained in 3.5% NaCl solution at room temperature by means of a potentiodynamic polarization technique.

  14. The creep properties of a low alloy ferritic steel containing an intermetallic precipitate dispersion

    International Nuclear Information System (INIS)

    Batte, A.D.; Murphy, M.C.; Edmonds, D.V.

    1976-01-01

    A good combination of creep rupture ductility and strength together with excellent long term thermal stability, has been obtained from a dispersion of intermetallic Laves phase precipitate in a non-transforming ferritic low alloy steel. The steel is without many of the problems currently associated with the heat affected zone microstructures of low alloy transformable ferritic steels, and can be used as a weld metal. Following suitable development to optimize the composition and heat treatment, such alloys may provide a useful range of weldable creep resistant steels for steam turbine and other high temperature applications. They would offer the unique possibility of easily achievable microstructural uniformity, giving good long term strength and ductility across the entire welded joint

  15. Retained austenite thermal stability in a nanostructured bainitic steel

    International Nuclear Information System (INIS)

    Avishan, Behzad; Garcia-Mateo, Carlos; Yazdani, Sasan; Caballero, Francisca G.

    2013-01-01

    The unique microstructure of nanostructured bainite consists of very slender bainitic ferrite plates and high carbon retained austenite films. As a consequence, the reported properties are opening a wide range of different commercial uses. However, bainitic transformation follows the T 0 criteria, i.e. the incomplete reaction phenomena, which means that the microstructure is not thermodynamically stable because the bainitic transformation stops well before austenite reaches an equilibrium carbon level. This article aims to study the different microstructural changes taking place when nanostructured bainite is destabilized by austempering for times well in excess of that strictly necessary to end the transformation. Results indicate that while bainitic ferrite seems unaware of the extended heat treatment, retained austenite exhibits a more receptive behavior to it. - Highlights: • Nanostructured bainitic steel is not thermodynamically stable. • Extensive austempering in these microstructures has not been reported before. • Precipitation of cementite particles is unavoidable at longer austempering times. • TEM, FEG-SEM and XRD analysis were used for microstructural characterization

  16. Retained austenite thermal stability in a nanostructured bainitic steel

    Energy Technology Data Exchange (ETDEWEB)

    Avishan, Behzad, E-mail: b_avishan@sut.ac.ir [Faculty of Materials Engineering, Sahand University of Technology, Tabriz (Iran, Islamic Republic of); Garcia-Mateo, Carlos, E-mail: cgm@cenim.csic.es [Department of Physical Metallurgy, National Centre for Metallurgical Research (CENIM-CSIC), MATERALIA Research Group, Avda. Gregorio del Amo, 8, 28040, Madrid (Spain); Yazdani, Sasan, E-mail: yazdani@sut.ac.ir [Faculty of Materials Engineering, Sahand University of Technology, Tabriz (Iran, Islamic Republic of); Caballero, Francisca G., E-mail: fgc@cenim.csic.es [Department of Physical Metallurgy, National Centre for Metallurgical Research (CENIM-CSIC), MATERALIA Research Group, Avda. Gregorio del Amo, 8, 28040, Madrid (Spain)

    2013-07-15

    The unique microstructure of nanostructured bainite consists of very slender bainitic ferrite plates and high carbon retained austenite films. As a consequence, the reported properties are opening a wide range of different commercial uses. However, bainitic transformation follows the T{sub 0} criteria, i.e. the incomplete reaction phenomena, which means that the microstructure is not thermodynamically stable because the bainitic transformation stops well before austenite reaches an equilibrium carbon level. This article aims to study the different microstructural changes taking place when nanostructured bainite is destabilized by austempering for times well in excess of that strictly necessary to end the transformation. Results indicate that while bainitic ferrite seems unaware of the extended heat treatment, retained austenite exhibits a more receptive behavior to it. - Highlights: • Nanostructured bainitic steel is not thermodynamically stable. • Extensive austempering in these microstructures has not been reported before. • Precipitation of cementite particles is unavoidable at longer austempering times. • TEM, FEG-SEM and XRD analysis were used for microstructural characterization.

  17. Precipitation Kinetics in a Nb-stabilized Ferritic Stainless Steel

    Science.gov (United States)

    Labonne, M.; Graux, A.; Cazottes, S.; Danoix, F.; Cuvilly, F.; Chassagne, F.; Perez, M.; Massardier, V.

    2017-08-01

    The precipitation occurring in a Nb-stabilized ferritic stainless steel, containing initially Nb(C, N) carbonitrides and Fe3Nb3X precipitates, was investigated during aging treatments performed between 923 K and 1163 K (650 °C and 890 °C) by combining different techniques, (thermoelectric power (TEP), scanning/transmission electron microscopy (SEM/TEM), and atom probe tomography (APT)), in order to determine the precipitation kinetics, the nature and morphology of the newly formed precipitates as well as the chemistry of the initial Fe3Nb3X precipitates, where X stands for C or N. The following composition was proposed for these precipitates: (Fe0.81 Cr0.19)3 (Nb0.85 Si0.08 Mo0.07)3 (N0.8 C0.2), highlighting the simultaneous presence of N and C in the precipitates. With regard to the precipitation in the investigated temperature range, two main phenomena, associated with a hardness decrease, were clearly identified: (i) the precipitation of Fe2Nb precipitates from the niobium initially present in solution or coming from the progressive dissolution of the Fe3Nb3X precipitates and (ii) the precipitation of the χ-phase at grain boundaries for longer aging times. From the TEP kinetics, a time-temperature-precipitation diagram has been proposed.

  18. Experimental determination of the constitutive behaviour of a metastable austenitic stainless steel

    NARCIS (Netherlands)

    Post, J.; Nolles, H.; Datta, K.; Datta, K.; Geijselaers, Hubertus J.M.

    2008-01-01

    This article presents measurements to describe the constitutive behaviour of a semi-austenitic precipitation hardenable stainless steel called Sandvik Nanoflex™, during metal forming and hardening. The material is metastable, which causes strain-induced transformation during forming. Depending on

  19. Tribological behaviour of line hardening of steel U13A with Nd: TAG laser

    International Nuclear Information System (INIS)

    Sagaro, R.; Ceballos, J. S.; Mascarell, J.; Blanco, A.

    1999-01-01

    To diminish wear in tribological systems is frequently to harden locally the load carrying areas, which are subjected to wear. A Nd: YAG laser was for the improvement of hardness and wear resistance of steel U13A. The friction and wear characteristics of steel U13A in sliding contact against steel 65MN4 under unlubricated conditions were evaluated for conventional treatments and after laser irradiation. In addition the transformations occurring during laser treatments and the influence of laser parameters for quenching on tribological characteristics are presented. The experimental work indicates that wear resistance of steel U13A (AISI W 112) is several times higher then that for conventional heat treatments

  20. Quench and partitioning steel: a new AHSS concept for automotive anti-intrusion applications

    Energy Technology Data Exchange (ETDEWEB)

    De Cooman, B.C. [Graduate Inst. for Ferrous Technology, Pohang Univ. of Science and Technology, Pohang (Korea); Speer, J.G. [Advanced Steel Processing and Products Research Centre, Colorado School of Mines, Golden, CO (United States)

    2006-09-15

    A new type of high strength, high toughness, martensitic steel, based on a newly proposed quench and partitioning (Q and P) process, is presented. This high strength martensitic grade is produced by the controlled low temperature partitioning of carbon from as-quenched martensite laths to retained inter-lath austenite under conditions where both low temperature transition carbide formation and cementite precipitation are suppressed. The contribution focuses on both the current understanding of the fundamental processes involved and includes a discussion of the technical feasibility of large-scale industrial production of these steels as sheet products. The Q and P process, which is carried out on steels with a lean composition, should be implemented easily on some current industrial continuous annealing and galvanizing lines. In addition, martensitic Q and P sheet steel is characterized by very favourable combinations of strength, ductility and toughness, which are particularly relevant for high strength anti-intrusion automotive parts. (orig.)

  1. The low-temperature aging embrittlement in a 2205 duplex stainless steel

    International Nuclear Information System (INIS)

    Weng, K.L.; Chen, H.R.; Yang, J.R.

    2004-01-01

    The effect of isothermal treatment (at temperatures ranging between 400 and 500 deg. C) on the embrittlement of a 2205 duplex stainless steel (with 45 ferrite-55 austenite, vol.%) has been investigated. The impact toughness and hardness of the aged specimens were measured, while the corresponding fractography was studied. The results show that the steel is susceptible to severe embrittlement when exposed at 475 deg. C; this aging embrittlement is analogous with that of the ferritic stainless steels, which is ascribed to the degenerated ferrite phase. High-resolution transmission electron microscopy reveals that an isotropic spinodal decomposition occurred during aging at 475 deg. C in the steel studied; the original δ-ferrite decomposed into a nanometer-scaled modulated structure with a complex interconnected network, which contained an iron-rich BCC phase (α) and a chromium-enriched BCC phase (α'). It is suggested that the locking of dislocations in the modulated structure leads to the severe embrittlement

  2. A real-time surface inspection system for precision steel balls based on machine vision

    Science.gov (United States)

    Chen, Yi-Ji; Tsai, Jhy-Cherng; Hsu, Ya-Chen

    2016-07-01

    Precision steel balls are one of the most fundament components for motion and power transmission parts and they are widely used in industrial machinery and the automotive industry. As precision balls are crucial for the quality of these products, there is an urgent need to develop a fast and robust system for inspecting defects of precision steel balls. In this paper, a real-time system for inspecting surface defects of precision steel balls is developed based on machine vision. The developed system integrates a dual-lighting system, an unfolding mechanism and inspection algorithms for real-time signal processing and defect detection. The developed system is tested under feeding speeds of 4 pcs s-1 with a detection rate of 99.94% and an error rate of 0.10%. The minimum detectable surface flaw area is 0.01 mm2, which meets the requirement for inspecting ISO grade 100 precision steel balls.

  3. Design of a 3-D Magnetic Mapping System to Locate Reinforcing Steel in Concrete Pavements

    Science.gov (United States)

    2017-12-01

    This report outlines the design, fabrication, and testing of a 3-D magnetic mapping system used to locate reinforcing steel in concrete pavements developed at Kansas State University (KSU) in 2006. The magnetic sensing functionality is based on the p...

  4. Composite Bonding to Stainless Steel Crowns Using a New Universal Bonding and Single-Bottle Systems

    OpenAIRE

    Mohammad Ali Hattan; Sharat Chandra Pani; Mohammad AlOmari

    2013-01-01

    Aim. The aim of this study is to evaluate the shear bond strength of nanocomposite to stainless steel crowns using a new universal bonding system. Material and Methods. Eighty (80) stainless steel crowns (SSCs) were divided into four groups (20 each). Packable nanocomposite was bonded to the lingual surface of the crowns in the following methods: Group A without adhesive (control group), Group B using a new universal adhesive system (Scotchbond Universal Adhesive, 3M ESPE, Seefeld, Germany), ...

  5. CorTen steel: a solution to atmospheric degradation in acid and marine environments

    OpenAIRE

    Ruiz Galende, Patricia

    2018-01-01

    35 p.: il. [EN] Weathering steel has a special resistance against the atmospheric corrosion through the formation of a protective layer. This layer is formed, among others, due to the reaction of some alloy elements present in the steel with reactive species, such as sulphur and nitrogen oxides and/or chlorides, which are present in the environment. For that reason, it is a widely used material in outdoor structures (facades, bridges) and it is in vogue among modern sculptors because this ...

  6. Investigation of the relationships between mechanical properties and microstructure in a Fe-9%Cr ODS steel

    OpenAIRE

    Hary Benjamin; Guilbert Thomas; Wident Pierre; Baudin Thierry; Logé Roland; de Carlan Yann

    2016-01-01

    Ferritic-martensitic Oxide Dispersion Strengthened (ODS) steels are potential materials for fuel pin cladding in Sodium Fast Reactor (SFR) and their optimisation is essential for future industrial applications. In this paper, a feasibility study concerning the generation of tensile specimens using a quenching dilatometer is presented. The ODS steel investigated contains 9%Cr and exhibits a phase transformation between ferrite and austenite around 870 °C. The purpose was to generate different ...

  7. Kinetics of sigma phase formation in a Duplex Stainless Steel

    Directory of Open Access Journals (Sweden)

    Rodrigo Magnabosco

    2009-09-01

    Full Text Available This work determines the kinetics of sigma phase formation in UNS S31803 Duplex Stainless Steel (DSS, describing the phase transformations that occur in isothermal aging between 700 and 900 ºC for time periods up to 1032 hours, allowing the determination of the Time-Temperature-Precipitation (TTP diagram for sigma phase and proposing a model to predict the kinetics of sigma phase formation using a Johnson-Mehl-Avrami (JMA type expression. The higher kinetics of sigma phase formation occurs at 850 ºC. However, isothermal aging between 700 and 900 ºC for time periods up to 1032 hours are not sufficient to the establishment of thermodynamic equilibrium. Activation energy for both nucleation and growth of sigma phase is determined (185 kJ.mol-1 and its value is equivalent to the activation energy for Cr diffusion in ferrite, indicating that diffusion of Cr is probably the major thermally activated process involved in sigma phase formation. The determined JMA type expression presents good fit with experimental data between 700 and 850 ºC.

  8. Methods to Evaluate Corrosion in Buried Steel Structures: A Review

    Directory of Open Access Journals (Sweden)

    Lorena-de Arriba-Rodriguez

    2018-05-01

    Full Text Available Around the world, there are thousands of metal structures completely or partially buried in the soil. The main concern in their design is corrosion. Corrosion is a mechanism that degrades materials and causes structural failures in infrastructures, which can lead to severe effects on the environment and have direct impact on the population health. In addition, corrosion is extremely complex in the underground environment due to the variability of the local conditions. The problem is that there are many methods to its evaluation but none have been clearly established. In order to ensure the useful life of such structures, engineers usually consider an excess thickness that increases the economic cost of manufacturing and does not satisfy the principles of efficiency in the use of resources. In this paper, an extended revision of the existing methods to evaluate corrosion is carried out to optimize the design of buried steel structures according to their service life. Thus, they are classified into two categories depending on the information they provide: qualitative and quantitative methods. As a result, it is concluded that the most exhaustive methodologies for estimating soil corrosion are quantitative methods fed by non-electrochemical data based on experimental studies that measure the mass loss of structures.

  9. Effect of microstructure on the sulphide stress cracking susceptibility of a high strength pipeline steel

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez, E. [Centro de Investigacion en Ingenieria y Ciencias Aplicadas-UAEM, Av. Universidad 1001, 62209-Cuernavaca, Mor. (Mexico); Gonzalez-Rodriguez, J.G. [Centro de Investigacion en Ingenieria y Ciencias Aplicadas-UAEM, Av. Universidad 1001, 62209-Cuernavaca, Mor. (Mexico)], E-mail: ggonzalez@uaem.mx; Torres-Islas, A.; Serna, S. [Centro de Investigacion en Ingenieria y Ciencias Aplicadas-UAEM, Av. Universidad 1001, 62209-Cuernavaca, Mor. (Mexico); Campillo, B. [Intituto de Ciencias Fisicas-Facultad de Quimicas-Universidad Nacional Autonoma de Mexico Cuernavaca, Mor. (Mexico); Dominguez-Patino, G. [Centro de Investigacion en Ingenieria y Ciencias Aplicadas-UAEM, Av. Universidad 1001, 62209-Cuernavaca, Mor. (Mexico); Juarez-Islas, J.A. [Instituto de Investigaciones en Materiales-Universidad Nacional Autonoma de Mexico, Circuito Exterior S/N, Cd. Universitaria, C.P. 04510, Mexico, D.F. (Mexico)

    2008-12-15

    The sulphide stress cracking (SSC) susceptibility of a newly developed high strength microalloyed steel with three different microstructures has been evaluated using the slow strain rate testing (SSRT) technique. Studies were complemented with potentiodynamic polarization curves and hydrogen permeation measurements. Material included a C-Mn steel having Ni, Cu, and Mo as main microalloying elements with three microstructures: martensitic, ferritic and ferritic + bainitic. Testing temperatures included 25, 50, 70 and 90 deg. C. Detailed SEM observations of the microstructure and fracture surfaces were done to identify possible degradation mechanisms. The results showed that in all cases, the corrosion rate, number of hydrogen atoms at the surface and the percentage reduction in area increased with temperature. The steel with a martensitic microstructure had the highest SSC susceptibility at all temperatures, whereas the ferritic steels were susceptible only at 25 deg. C, and the most likely mechanism is hydrogen embrittlement assisted by anodic dissolution.

  10. Fracture toughness of a welded super duplex stainless steel

    Energy Technology Data Exchange (ETDEWEB)

    Pilhagen, Johan, E-mail: pilhagen@kth.se [Department of Materials Science and Engineering, KTH Royal Institute of Technology, Stockholm (Sweden); Sieurin, Henrik [Scania CV AB, Södertälje (Sweden); Sandström, Rolf [Department of Materials Science and Engineering, KTH Royal Institute of Technology, Stockholm (Sweden)

    2014-06-01

    Fracture toughness testing was conducted on standard single-edge notched bend bar specimens of base and weld metal. The material was the SAF 2906 super duplex stainless steel. The aim was to evaluate the susceptibility for brittle failure at sub-zero temperatures for the base and weld metal. The base metal was tested between −103 and −60 °C and was evaluated according to the crack-tip opening displacement method. The fracture event at and below −80 °C can be described as ductile until critical cleavage initiation occurs, which caused unstable failure of the specimen. The welding method used was submerged arc welding with a 7 wt% nickel filler metal. The welded specimens were post-weld heat treated (PWHT) at 1100 °C for 20 min and then quenched. Energy-dispersive X-ray spectroscopy analysis showed that during PWHT substitutional element partitioning occurred which resulted in decreased nickel content in the ferrite. The PWHT weld metal specimens were tested at −72 °C. The fracture sequence was critical cleavage fracture initiation after minor crack-tip blunting and ductile fracture.

  11. Emerging surface characterization techniques for carbon steel corrosion: a critical brief review

    OpenAIRE

    Dwivedi, D.; Lepkova, K.; Becker, T.

    2017-01-01

    Carbon steel is a preferred construction material in many industrial and domestic applications, including oil and gas pipelines, where corrosion mitigation using film-forming corrosion inhibitor formulations is a widely accepted method. This review identifies surface analytical techniques that are considered suitable for analysis of thin films at metallic substrates, but are yet to be applied to analysis of carbon steel surfaces in corrosive media or treated with corrosion inhibitors. The rev...

  12. Design and experimental analysis of a new shear connector for steel and concrete composite structures

    OpenAIRE

    Veríssimo, G. S.; Paes, J. L. R.; Valente, Isabel; Cruz, Paulo J. S.; Fakury, R. H.

    2006-01-01

    This work presents the design of a new shear connector and the corresponding results obtained on push-out tests. This new shear connector consists on a steel rib with indented cut shape that provides resistance to longitudinal shear and prevents transversal separation between the concrete slab and the steel profile (uplift). Adding to this, the connector openings cut makes easier the arrangement of transversal reinforcement bars. The installation of the connectors is simple and requires only ...

  13. Cooperative conflict and contested space: a case study of risk and safety in the steel industry.

    OpenAIRE

    2008-01-01

    This dissertation is a journey into the world of risk and safety in the steel industry. The problem statement that is explored in this study relates to the nature of the relationship between safety performance and stakeholders in the steel industry, the nature of the relationships between different stakeholders and the way in which these relationships impact on risk management strategies. The author contends that safety is not a normative or procedural system within the workplace, but rather ...

  14. Wootz Crucible Steel: A Newly Discovered Production Site in South India

    OpenAIRE

    Sharad Srinivasan

    1994-01-01

    During the course of field investigations of copper mining and smelting in South India, the author of this paper came across a previously unrecorded archaeometallurgical site in Mel-siruvalur, South Arcot district, Tamil Nadu, which investigations have confinned was a production centre for wootz crucible steel in the Deccan. The find of this production centre supports the idea that wootz steel production was relatiYely widespread in South India, and extends the known horizons of this technolo...

  15. Corrosion resistance of steel fibre reinforced concrete – a literature review

    DEFF Research Database (Denmark)

    Marcos Meson, Victor; Michel, Alexander; Solgaard, Anders

    2016-01-01

    Steel fibre reinforced concrete (SFRC) is increasingly being used in the construction of prefabricated segmental linings for bored tunnels, since it entails simplified production processes and higher quality standards. However, international standards and guidelines are not consistent regarding...... the consideration of steel fibres for the structural verification of SFRC elements exposed to corrosive environments, hampering the development of civil infrastructure built of SFRC. In particular, the long-term effect of exposure to chlorides is in focus and under discussion. This paper reviews the existing...... the existence of a critical crack width, below 0.20 mm, where corrosion of carbon-steel fibres is not critical and the structural integrity of the exposed SFRC can be ensured over the long-term. A doctoral project investigating chloride-induced corrosion of steel fibres on cracked SFRC has been initiated...

  16. A wireless embedded passive sensor for monitoring the corrosion potential of reinforcing steel

    International Nuclear Information System (INIS)

    Bhadra, Sharmistha; Thomson, Douglas J; Bridges, Greg E

    2013-01-01

    Corrosion of reinforcing steel, which results in premature deterioration of reinforced concrete structures, is a worldwide problem. Most corrosion sensing techniques require some type of wired connection between the sensor and monitoring electronics. This causes significant problems in their installation and long-term use. In this paper we describe a new type of passive embeddable wireless sensor that is based on an LC coil resonator where the resonant frequency is changed by the corrosion potential of the reinforcing steel. The resonant frequency can be monitored remotely by an interrogator coil inductively coupled to the sensor coil. The sensor unit comprises an inductive coil connected in parallel with a voltage dependent capacitor (varactor) and a pair of corrosion electrodes consisting of a reinforcing steel sensing electrode and a stainless steel reference electrode. Change of potential difference between the electrodes due to variation of the corrosion potential of the reinforcing steel changes the capacitance of the varactor and shifts the resonant frequency of the sensor. A time-domain gating method was used for the interrogation of the inductively coupled corrosion sensor. Results of an accelerated corrosion test using the sensor indicate that the corrosion potential can be monitored with a resolution of less than 10 mV. The sensor is simple in design and requires no power source, making it an inexpensive option for long-term remote monitoring of the corrosion state of reinforcing steel. (paper)

  17. Processing of a new high strength high toughness steel with duplex microstructure (Ferrite + Austenite)

    International Nuclear Information System (INIS)

    Martis, Codrick J.; Putatunda, Susil K.; Boileau, James

    2013-01-01

    Highlights: ► This new steel has exceptional combination of high strength and fracture toughness. ► Austempering treatment resulted in a very fine scale bainitic ferrite microstructure. ► As the austempering temperature increases yield strength and toughness decreases. ► Maximum fracture toughness of 105 MPa √m is obtained after austempering at 371 °C. ► A relationship between fracture toughness and the parameter σ y (X γ C γ ) 1/2 was observed. - Abstract: In this investigation a new third generation advanced high strength steel (AHSS) has been developed. This steel was synthesized by austempering of a low carbon and low alloy steel with high silicon content. The influence of austempering temperature on the microstructure and the mechanical properties including the fracture toughness of this steel was also examined. Compact tension and cylindrical tensile specimens were prepared from a low carbon low alloy steel and were initially austenitized at 927 °C for 2 h and then austempered in the temperature range between 371 °C and 399 °C to produce different microstructures. The microstructures were characterized by X-ray diffraction, scanning electron microscopy and optical metallography. Test results show that the austempering heat treatment has resulted in a microstructure consisting of very fine scale bainitic ferrite and austenite. A combination of very high tensile strength of 1388 MPa and fracture toughness of 105 MPa √m was obtained after austempering at 371 °C

  18. Study of Irradiation Effects on the Fracture Properties of A533-Series Ferritic Steels

    International Nuclear Information System (INIS)

    Lee, Yong Bok; Lee, Gyeong Geun; Kwon, Jun Hyun

    2011-01-01

    Since the Kori nuclear power plant unit 3 (Kori-3) was founded in 1986, the surveillance tests have been conducted five times. One of the primary objectives of the surveillance test is to determine the effects of irradiation on reactor pressure vessel (RPV) steel embrittlement. The RPV is made out of ferritic steels such as SA533 type B class 1, which were used for early nuclear power plants industry including Kori-2, 3, 4 and Yonggwang-1, 2 units in Korea. The Westinghouse supplied Kori-3 with the RPV steels ASTM A533 grade B class 1, which is equivalent to SA533 type B class 1. The irradiation effects on tensile properties in ASTM A533 grade B class 1 steel had been studied by Steichen and Williams. They experimentally determined the effect of strain rate and temperature on the tensile properties of unirradiated and irradiated A533 grade B steel 1. The effects of neutron irradiation on ferritic steels could be determined from tensile properties, as well as the fracture strength and toughness measurements. Hunter and Williams have reported that the strength and ductility for unirradiated material at a low strain rate increase with decreasing test temperature. Also, neutron irradiation increases strength and decreases ductility. Crosley and Ripling revealed that the yield strength of unirradiated material rapidly increases with the strain rate. Therefore, yield strength for unirradiated and irradiated materials should be determined by test parameters along with strain rate and temperature. In this study we compare ASTM A533 grad B class 1 steel obtained from several papers with SA533 type B class 1 steel taken from the surveillance data of Kori-3 unit, whose mechanical property of unirradiated and irradiated materials was correlated with the rate-temperature parameter

  19. A procedure for the production of steel exhibiting a low specific activity of gamma emitters

    International Nuclear Information System (INIS)

    Dolenek, J.; Raska, P.; Kodrle, L. et al.

    1989-01-01

    Steel exhibiting low specific gamma activity can be obtained from a metallic charge containing liquid and solid pig iron produced from ores, sinters, coke, limestone and other components. This charge is worked up in a metallurgical fining unit using predetermined amounts of slag-forming substances such as lime, limestone and dolomite; fining ore can also be present. The smelt must be kept in constant motion. The pig iron smelt for the production of this steel contains 0.1-1.1% Si and 0.1-1.0% Mn. All equipment with which the charge and steel will come in contact must be free from remains of previous productions and, preferrably, fitted with new lining. This concerns runners, pig iron transportation mixers, ladles and the production unit. (P.A.)

  20. A Review on the Potential Use of Austenitic Stainless Steels in Nuclear Fusion Reactors

    Science.gov (United States)

    Şahin, Sümer; Übeyli, Mustafa

    2008-12-01

    Various engineering materials; austenitic stainless steels, ferritic/martensitic steels, vanadium alloys, refractory metals and composites have been suggested as candidate structural materials for nuclear fusion reactors. Among these structural materials, austenitic steels have an advantage of extensive technological database and lower cost compared to other non-ferrous candidates. Furthermore, they have also advantages of very good mechanical properties and fission operation experience. Moreover, modified austenitic stainless (Ni and Mo free) have relatively low residual radioactivity. Nevertheless, they can't withstand high neutron wall load which is required to get high power density in fusion reactors. On the other hand, a protective flowing liquid wall between plasma and solid first wall in these reactors can eliminate this restriction. This study presents an overview of austenitic stainless steels considered to be used in fusion reactors.

  1. Microstructural characterisation of a P91 steel normalised and tempered at different temperatures

    International Nuclear Information System (INIS)

    Hurtado-Norena, C.; Danon, C.A.; Luppo, M.I.; Bruzzoni, P.

    2015-01-01

    9%Cr-1%Mo martensitic-ferritic steels are used in power plant components with operating temperatures of around 600 deg. C because of their good mechanical properties at high temperature as well as good oxidation resistance. These steels are generally used in the normalised and tempered condition. This treatment results in a structure of tempered lath martensite where the precipitates are distributed along the lath interfaces and within the martensite laths. The characterisation of these precipitates is of fundamental importance because of their relationship with the creep behaviour of these steels in service. In the present work, the different types of precipitates found in these steels have been studied on specimens in different metallurgical conditions. The techniques used in this investigation were X-ray diffraction with synchrotron light, scanning electron microscopy, energy dispersive microanalysis and transmission electron microscopy. (authors)

  2. Simulation of a Local Collision of SC Wall Using High Energy Absorbing Steel

    Energy Technology Data Exchange (ETDEWEB)

    Yoo, H. K.; Chung, C. H.; Park, J.; Lee, J. W. [Dankook University, Yongin (Korea, Republic of); Kim, S. Y. [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)

    2011-05-15

    Local damage evaluations for nuclear power plant(NPP) design are performed against turbine impact, tornado impact, airplane engine impact, etc., where turbine is a internal source of impact, whereas tornado and airplane engine are external sources of impact. The thickness of NPP wall structure is determined at initial design stage not to be penetrated by local impacts. This study investigated the local damage of NPP substructure against internal turbine impact. Simulation of local collisions of SC wall in NPP structure, which consists of two models: one using general steel and the other using high energy absorbing steel, were performed. The performance of SC wall using ductile high energy absorbing steel can be greatly improved on local collisions when compared with that of general steel

  3. Simulation of a Local Collision of SC Wall Using High Energy Absorbing Steel

    International Nuclear Information System (INIS)

    Yoo, H. K.; Chung, C. H.; Park, J.; Lee, J. W.; Kim, S. Y.

    2011-01-01

    Local damage evaluations for nuclear power plant(NPP) design are performed against turbine impact, tornado impact, airplane engine impact, etc., where turbine is a internal source of impact, whereas tornado and airplane engine are external sources of impact. The thickness of NPP wall structure is determined at initial design stage not to be penetrated by local impacts. This study investigated the local damage of NPP substructure against internal turbine impact. Simulation of local collisions of SC wall in NPP structure, which consists of two models: one using general steel and the other using high energy absorbing steel, were performed. The performance of SC wall using ductile high energy absorbing steel can be greatly improved on local collisions when compared with that of general steel

  4. Corrosion Inhibition of AISI/SAE Steel in a Marine Environment

    Directory of Open Access Journals (Sweden)

    Fatai Olufemi ARAMIDE

    2009-12-01

    Full Text Available Effect of Sodium nitrite as a corrosion inhibitor of mild steel in sea water wasinvestigated, using the conventional weight loss method. Differentpercentages of sodium nitrite were used from 0% to 10% in sea water.Samples of mild steel were exposed to these corrosive media and the weightloss was calculated at intervals of 120 hours, 168 hours, 208 hours, 256 hours,304 hours and 352 hours. It was observed that corrosion rate increases withtime of exposure to the corrosive medium (inhibited or non-inhibited and thatsodium nitrite can be used to retards the corrosion rate of mild steel if theappropriate concentration is used in sea water. It was concluded that theoptimum percentage of sodium nitrate in sea water that gives the optimumcorrosion inhibition of mild steel is 4%.

  5. A Short review on wrought austenitic stainless steels at high temperatures: processing, microstructure, properties and performance

    Directory of Open Access Journals (Sweden)

    Ronald Lesley Plaut

    2007-12-01

    Full Text Available Wrought austenitic stainless steels are widely used in high temperature applications. This short review discusses initially the processing of this class of steels, with emphasis on solidification and hot working behavior. Following, a brief summary is made on the precipitation behavior and the numerous phases that may appear in their microstructures. Creep and oxidation resistance are, then, briefly discussed, and finalizing their performance is compared with other high temperature metallic materials.

  6. Benzohydroxamic acid as a reductometric titrant:determination of manganese, chromium and vanadium in steels

    International Nuclear Information System (INIS)

    Ahmed, M.K.; Subbarao, C.

    1981-01-01

    A method has been developed for the rapid determination of manganese and chromium by direct stepwise reductometric titration with benzohydroxamic acid, and of vanadium by titration with ascorbic acid (with benzohydroxamic acid as indicator) in the same aliquot. The method is free from the interference of common alloying elements present in steels. Some BCS steel samples have been analysed with good precision and accuracy. (author)

  7. A phase analysis of mild steel corrosion using 57Fe Moessbauer technique

    International Nuclear Information System (INIS)

    Lal, Roshan; Sharma, N.D.; Suman

    2005-01-01

    A phase analysis of corrosion of mild steel was studied by 57 Fe Moessbauer spectroscopy, when the fumes of aqueous hydrochloric acid in the environment of thermal power plant react with various equipment's and machinery parts made from mild steel. The formation of ΥFeOOH was observed. But the presence of some amount of αFeOOH in the super paramagnetic form cannot be ruled out. (author)

  8. A model for fracture toughness evaluation of the carburized layer for SAE 5115 steel

    OpenAIRE

    Sandor, Leonardo Taborda; Ferreira, Itamar

    2006-01-01

    The purpose of this work is to propose a model for evaluating the fracture toughness along the SAE 5115 steel carburized layer. Due to the small thickness of those layers, it is impossible to machine specimens from those layer in accordance with standards. For simulating the microstructures of the carburized layer in order to get samples for tensile and the fracture toughness testing, specimens of SAE 5115, 5140, 5160, and 52100 steels have been machined, assuming the local influence just the...

  9. Diode Laser Welding/Brazing of Aluminum Alloy to Steel Using a Nickel Coating

    Directory of Open Access Journals (Sweden)

    Jin Yang

    2018-06-01

    Full Text Available Joining Al alloy to steel is of great interest for application in the automotive industry. Although a vast number of studies have been conducted to join Al to steel, the joining of Al to steel is still challenging due to the formation of brittle Fe–Al intermetallic compounds. In this work, the microstructure and mechanical properties of the dissimilar Al/steel joints with and without a nickel coating are comparatively investigated. A homogenous reaction layer composed of FeZn10 and Fe2Al5 is formed at the interface in the joints without Ni coating, and the joint facture load is only 743 N. To prevent the formation of brittle Fe2Al5, Ni electroplated coating is applied onto a steel surface. It has been shown that a nonhomogeneous reaction layer is observed at the interfacial region: Ni5Zn21 is formed at the direct irradiation zone, while Al3Ni is formed at the fusion zone root. The microhardness of the interfacial layer is reduced, which leads to the improvement of the joint mechanical properties. The average fracture load of the Al/Ni-coated steel joints reaches 930 N. In all of the cases, failure occurs at the Ni coating/fusion zone interface.

  10. A numerical study on the mechanical properties and the processing behaviour of composite high strength steels

    Energy Technology Data Exchange (ETDEWEB)

    Muenstermann, Sebastian [RWTH Aachen (Germany). Dept. of Ferrous Metallurgy; Vajragupta, Napat [RWTH Aachen (Germany). Materials Mechanics Group; Weisgerber, Bernadette [ThyssenKrupp Steel Europe AG (Germany). Patent Dept.; Kern, Andreas [ThyssenKrupp Steel Europe AG (Germany). Dept. of Quality Affairs

    2013-06-01

    The demand for lightweight construction in mechanical and civil engineering has strongly promoted the development of high strength steels with excellent damage tolerance. Nowadays, the requirements from mechanical and civil engineering are even more challenging, as gradients in mechanical properties are demanded increasingly often for components that are utilized close to the limit state of load bearing capacity. A metallurgical solution to this demand is given by composite rolling processes. In this process components with different chemical compositions were jointed, which develop after heat treatment special properties. These are actually evaluated in order to verify that structural steels with the desired gradients in mechanical properties can be processed. A numerical study was performed aiming to numerically predict strenght and toughness properties, as well as the procesing behaviour using Finite Element (FE) simulations with damage mechanics approaches. For determination of mechanical properties, simulations of tensile specimen, SENB sample, and a mobile crane have been carried out for different configurations of composite rolled materias out of high strebght structural steels. As a parameter study, both the geometrical and the metallurgical configurations of the composite rolled steels were modified. Thickness of each steel layer and materials configuration have been varied. Like this, a numerical procedure to define optimum tailored configurations of high strenght steels could be established.

  11. Carbon-14 speciation during anoxic corrosion of activated steel in a repository environment

    Energy Technology Data Exchange (ETDEWEB)

    Wieland, E.; Cvetkovic, B.Z.; Kunz, D. [Paul Scherrer Institute, Villigen (Switzerland). Lab. for Waste Management; Salazar, G.; Szidat, S. [Bern Univ. (Switzerland). Dept. of Chemistry and Biochemistry and Oeschger Centre for Climate Change Research

    2018-01-15

    Radioactive waste contains significant amounts of {sup 14}C which has been identified a key radionuclide in safety assessments. In Switzerland, the {sup 14}C inventory of a cement-based repository for low- and intermediate-level radioactive waste (L/ILW) is mainly associated with activated steel (∝85 %). {sup 14}C is produced by {sup 14}N activation in steel parts exposed to thermal neutron flux in light water reactors. Release of {sup 14}C occurs in the near field of a deep geological repository due to anoxic corrosion of activated steel. Although the {sup 14}C inventory of the L/ILW repository and the sources of {sup 14}C are well known, the formation of {sup 14}C species during steel corrosion is only poorly understood. The aim of the present study was to identify and quantify the {sup 14}C-bearing carbon species formed during the anoxic corrosion of iron and steel and further to determine the {sup 14}C speciation in a corrosion experiment with activated steel. All experiments were conducted in conditions similar to those anticipated in the near field of a cement-based repository.

  12. Influence of refining time on nonmetallic inclusions in a low-carbon, silicon-killed steel

    International Nuclear Information System (INIS)

    Fernandes, Marcolino; Pires, Jose Carlos; Cheung, Noe; Garcia, Amauri

    2003-01-01

    Nonmetallic inclusions are harmful to the mechanical properties of every kind of steel produced worldwide. The greater the size of the inclusion present in the structure of a determined kind of steel, the greater its negative effect on the quality of the steel. Therefore, the objective of this work was to investigate the size, the quantity, the shape and the chemical composition of nonmetallic inclusions formed throughout the refining process of silicon-killed, low-carbon steel, as a function of the treatment time in a ladle furnace, trying to ensure the flotation of inclusions bigger than 25 μm. This investigation was carried out using a scanning electron microscope (SEM), with an analysis system using energy dispersive spectometry (EDS). Based on this work, it was possible to know more precisely the nature of the inclusions, the necessary time to ensure flotation of large inclusions, the efficiency of the slag to capture the inclusions, and the inclusion level of the steel throughout its refining process to try to obtain a higher quality steel product

  13. Productivity Improvement in a Steel Industry using Supply Chain Management Technique

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Soltani

    2013-06-01

    Full Text Available Cost reduction is one of the methods applied for improving the productivity of organizations. In productivity literature, particularly in nonparametric methods, cost reduction related methods are regarded as input oriented models. This paper presents a Supply Chain Management (SCM model in which purchasing iron ore and coke from different resources, along with production and distribution of steel products were investigated to improve the productivity of a steel making plant in Iran. The model was designed based on a single objective concept with a focus on total cost minimization. The constraints of the model consisted principal restriction concerning mines, coke plant and products. The model was implemented in steel factories (blast furnace affiliated with Iranian Mines and Mining Industries Development and Renovation Organization (IMIDRO.The results showed that the priority for providing iron ore should be given to Iran Central Iron Ore Company (ICIOC which has enough production capacity to satisfy the required ores. The results further suggested that at the best productivity condition, Isfahan steel plant should focus on the beam and bar production. The other plants, i.e. Zagros plant, should focus on L-beam and slab and finally Meibod steel plant should concentrate on slab production. It was also showed that the coke production plants cannot supply the required tonnage of the steel plants. Therefore, some new plants should be established to achieve self-sufficiency in this industry. This model can be used as a support tool for decision-makers at strategic and tactical decision levels.

  14. Enhanced hot ductility of a Cr–Mo low alloy steel by rare earth cerium

    International Nuclear Information System (INIS)

    Jiang, X.; Song, S.-H.

    2014-01-01

    The hot ductility of a 1Cr–0.5Mo low alloy steel is investigated over a temperature range of 700–1050 °C using a Gleeble thermomechanical simulator in conjunction with various characterization techniques. The steel samples undoped and doped with cerium are heated at 1300 °C for 3 min and then cooled with a rate of 5 K s −1 down to different test temperatures, followed by tensile deformation until fracture. The results show that the hot ductility of the steel, evaluated by the reduction in area, can be substantially enhanced by a minor addition of cerium, especially in the range 800–1000 °C. In the austenite–ferrite dual-phase region, cerium may delay the formation of proeutectoid ferrite layers along austenite grain boundaries, thereby increasing the hot ductility of the steel. In the single austenite region, grain boundary segregation of cerium may increase the grain boundary cohesion, toughening the steel and thus raising the resistance to grain boundary sliding as well as promoting dynamic recrystallization. Consequently, the hot ductility of the steel is enhanced

  15. Ergonomic assessment of brake and accelerator mechanisms of MF285 and MF399 tractors using electromyography method

    Directory of Open Access Journals (Sweden)

    A Nikkhah

    2016-04-01

    Full Text Available Introduction: Too many people are working in the agricultural sector and therefore, pay more attention to the safety and health at work in the agricultural sector is important. This issue is more important in developing industrial countries where the level of the ergonomic working condition is less than that of developed countries. Attention to ergonomic condition of agricultural machinery drivers is one of the goals of agricultural mechanization. Therefore, in this study the ergonomic conditions of brake and accelerator mechanisms for MF285 and MF399 tractor's drivers were investigated using a new method. Materials and Methods: 25 people were selected for experiment. The electrical activity of Medialis gastrocnemius, Lateralis gastrocnemius, Vastus medialis, Vastus lateralis, Quadratus Lumborum and Trapezius muscles of drivers before and during pressing the pedal and after rest time were recorded using Biovision device. Measurements were performed for each person on each muscle 30 seconds before pressing the pedal, 60 seconds after pressing the pedal and after 60 seconds of rest. For all drivers, the muscles on the right side (brake and accelerator side have been selected and tested. The measurements were performed in compliance with appropriate time intervals between the measurements. Results and Discussion: Ergonomic assessment of brake pedal: The results showed that the RMS electrical activity of muscles of Vastus medialis and Medial gastrocnemius, during 60 seconds braking were 2.47 and 1.97. So, Vastus medialis and Medial gastrocnemius had the highest stress during pressing the MF399 tractor's brake pedal. Moreover, the Medial gastrocnemius and Lateral gastrocnemius with RMS electrical activity ratio of 2.47 and 1.74 had the highest RMS electrical activity ratio respectively, during 60 seconds braking compared to before braking of MF285 tractor. The comparison of results showed that the Vastus medialis and Trapezius had the higher stress

  16. Biomonitoring of some heavy metal contaminations from a steel ...

    African Journals Online (AJOL)

    Soil and plants growing in the vicinity of industrial areas display increased concentrations of heavy metals and give an indication of the environmental quality. The contamination source for aluminum, iron, nickel and lead in the Botanical garden of Mobarakeh Steel Company was recognized by analyzing the leaves and ...

  17. A study of DLC coatings for ironing of stainless steel

    DEFF Research Database (Denmark)

    Sulaiman, Mohd Hafis Bin; Christiansen, Peter; Bay, Niels Oluf

    2017-01-01

    severe lubrication conditions by adopting strip reduction testing to replicate industrial ironing production of deep drawn, stainless steel cans. Three DLC coatings are investigated; multi-layer, double layer and single layer. Experiments revealed that the double layer coating worked successful, i...

  18. Localized corrosion of carbon steel in a CO{sub 2}-saturated oilfield formation water

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, G.A. [Department of Mechanical and Manufacturing Engineering, University of Calgary, Calgary, AB, T2N 1N4 (Canada); Cheng, Y.F., E-mail: fcheng@ucalgary.c [Department of Mechanical and Manufacturing Engineering, University of Calgary, Calgary, AB, T2N 1N4 (Canada)

    2011-01-01

    In this work, corrosion and localized corrosion behavior of X65 pipeline steel were studied in a simulated, CO{sub 2}-saturated oilfield formation water by various electrochemical measurement techniques, including electrochemical impedance spectroscopy (EIS), potentiodynamic polarization curves, galvanic current and localized EIS (LEIS). The morphology and composition of the formed corrosion scale were characterized by scanning electron microscopy and energy-dispersive X-ray analysis. A conceptual model was developed to illustrate the occurrence of localized corrosion of the steel under scale. Both galvanic current and LEIS measurements showed that a galvanic effect existed between the bare steel and the scale-covered region. The scale-covered region served as cathode and the bare steel site as the anode. The big cathode vs. small anode geometry accelerated the local corrosion reaction. At an elevated temperature, a compact, crystalline scale was formed on the steel surface, enhancing the galvanic effect. Moreover, the stability of the scale was increased with time, and localized corrosion of the steel under scale experienced mechanistic changes with time.

  19. Study of the distribution of alloying elements between the phases of a heat treated steel

    International Nuclear Information System (INIS)

    Lambert, N.; Greday, T.

    1977-01-01

    The behavior of some low-alloy steels during industrial heat treatments is systematically studied. Firstly, the influence of the chemical analysis of the steel, the shape and size of carbides on the kinetics of the dissolution of these carbides at high temperature is pointed out in the case of steels with a relatively simple chemical analysis. Secondly, the effect of tempering treatments on the mechanical properties and characteristic parameters of the microstructure is studied in the case of three low-alloy steels. Bainitic microstructure appears to be the less disturbed one after a tempering treatment. Against, martensitic microstructures undergo an important softening and the mechanical properties of the pearlite lie as a very low level whatever their heat treatment. Peculiar conditions of tempering promotes a fine precipitation and its combined secondary hardening. These conditions are related to both chemical analysis and initial microstructure of the steel. Besides, some chemical identifications were performed in the scanning electron microscope on alloyed carbides precipitated in the steel during very long time tempering treatments

  20. Biomechanical cadaveric comparison of patellar ligament suture protected by a steel cable versus a synthetic cable.

    Science.gov (United States)

    Bouget, P; Breque, C; Beranger, J S; Faure, J P; Khiami, F; Vendeuvre, T

    2017-12-01

    Purpose and hypothesis: Patellar ligament rupture is a rare disabling pathology requiring a surgical ligament suture protected by a frame. The gold standard is the steel cable, but its rigidity and the necessity of a surgical re-intervention for its removal render it unsatisfactory. The objective of this paper is to quantify the mechanical protection provided by the terylene® in comparison with steel. Twenty-four knees of 12 fresh frozen cadaveric subjects were divided into 2 homogeneous groups (terylene and steel) of 12 knees (mean age = 69.3 years). Proximal ligament repair was performed according to a three-tunnel transosseous reinsertion technique. Mechanical tests were performed in flexion to simulate movement of the knee. The interligament gap and the amplitude angulation of the knee were measured by a system of extensometer and optical goniometer. Mechanical analysis permitted calculation of flexion amplitude for a ligament gap of 1 and 2 mm taking as initial angle the adjusting angle of pretension of the protection frame. Study of deformations of frames was performed. Statistical analysis was performed with a Wilcoxon Mann Whitney test. There is no significant difference in protection of the ligament suture between the "terylene" and "steel" groups. Mean flexion amplitudes (mΔF) show no significant differences between the 2 groups for a distension of the suture of 1 mm (m ΔF terylene1 = 4.74 °; mΔF steel1 = 5.91°; p = 0.198) and 2 mm (mΔF terylene2 = 8.71°; mΔF steel2 = 10.41°; p = 0.114). Elastic deformation of terylene was significantly greater than that of steel (p = 0.0004). Suture protection of the patellar ligament by a terylene wire is not significantly different from that provided by steel frame. The elastic properties of terylene and absence of a need for re intervention to secure its removal lead us towards its use in acute ruptures of the patellar ligament. The main limits involve the properties of

  1. Residual stresses in a weldment of pressure vessel steel

    International Nuclear Information System (INIS)

    Gott, K.E.

    1978-01-01

    A study was made of the distribution of residual stresses around a typical weld from a light water reactor pressure vessel by an X-ray double-exposure camera technique. So that the magnitude, sign, and distribution of the residual stresses were as similar as possible to those found in practice, a wide, full-thickness specimen of A533B Cl 1 steel containing a submerged-arc weld was stress-relief annealed. To obtain a three-dimensional distribution of the stresses the specimen was examined at different levels through the thickness. Following the removal of material by milling, the specimen surface was electropolished to free it from cold work. Corrections have been made to take into account specimen relaxation. To completely define the original stress system it is desirable also to measure the change in curvature on removing a layer of material. Unless this is done assumptions must be made which complicate the calculations unnecessarily. This became apparent after the experimental work was completed. In the centre of the plate the methods of correction which can be used are sensitive to errors in the measurements. The corrected results show that the dominant residual stress is perpendicular to the weld. It is positive at the surfaces and negative in the centre of the plate. The maximum value can reach the yield stress. The residual stresses in the weld metal can locally vary considerably: from 100 to 350N/mm 2 over a distance of 5mm. Such large variations have been found to coincide with the heat-affected zones of the individual weld runs. (author)

  2. Corrosion of carbon steel in neutral water

    International Nuclear Information System (INIS)

    Kawai, Noboru; Iwahori, Toru; Kurosawa, Tatsuo

    1983-01-01

    The initial corrosion behavior of materials used in the construction of heat exchanger and piping system of BWR nuclear power plants and thermal power plants have been examined in neutral water at 30, 50, 100, 160, 200, and 285 deg C with two concentrations of dissolved oxygen in the water. In air-saturated water, the corrosion rate of carbon steel was so higher than those in deaerated conditions and the maximum corrosion rate was observed at 200 deg C. The corrosion rate in deaerated water gradually increased with increasing the water temperature. Low alloy steel (2.25 Cr, 1Mo) exhibited good corrosion resistance compared with the corrosion of carbon steel under similar testing conditions. Oxide films grown on carbon steel in deaerated water at 50, 100, 160, 200, and 285 deg C for 48 and 240 hrs were attacked by dissolved oxygen in room temperature water respectively. However the oxide films formed higher than about 160 deg C showed more protective. The electrochemical behavior of carbon steel with oxide films was also similar to the effect of temperature on the stability of oxide films. (author)

  3. A study on the irradiation embrittlement and recovery characteristics of light water reactor pressure vessel steels

    International Nuclear Information System (INIS)

    Chi, Se Hwan; Hong, Jun Hwa; Lee, Bong Sang; Oh, Jong Myung; Song, Sook Hyang; Milan, Brumovsky

    1999-03-01

    The neutron irradiation embrittlement phenomenon of light water RPV steels greatly affects the life span for safe operation of a reactor. Reliable evaluation and prediction of the embrittlement of RPV steels, especially of aged reactors, are of importance to the safe operation of a reactor. In addition, the thermal recovery of embrittled RPV has been recognized as an option for life extension. This study aimed to tracer/refine available technologies for embrittlement characterization and prediction, to prepare relevant materials for several domestic RPV steels of the embrittlement and recovery, and to find out possible remedy for steel property betterment. Small specimen test techniques, magnetic measurement techniques, and the Meechan and Brinkmann's recovery curve analysis method were examined/applied as the evaluation techniques. Results revealed a high irradiation sensitivity in YG 3 RPV steel. Further extended study may be urgently needed. Both the small specimen test technique for the direct determination of fracture toughness, and the magnetic measurement technique for embrittlement evaluation appeared to be continued for the technical improvement and data base preparation. Manufacturing process relevant to the heat treatment appeared to be improved in lowering the irradiation sensitivity of the steel. Further study is needed especially in applying the present techniques to the new structural materials under new irradiation environment of advanced reactors. (author)

  4. Preliminary studies on steel slag as a substitute for coarse aggregate on concrete

    Directory of Open Access Journals (Sweden)

    Karolina Rahmi

    2017-01-01

    Full Text Available The development of science and technology in the field of construction that is rapidly increasing, is always followed by the growing community needs for infrastructure facilities, such as buildings, bridges and other construction. One of the key element in that development is concrete. Due to the rapid development of science and technology in the field of construction, it’s required a building material which has better advantage than the materials of the existing building. To obtain a better building materials, one alternative is the use of waste as aggregate in concrete mixture. In this study the authors using waste steel waste (steel slag as a substitute for coarse aggregate. Steel slag used is steel waste from PT. Growth Sumatra Industry. The gravel substitution variations is 0%, 15%, and 25% and the testing was done by the slump test, compressive strength and flexural strength of concrete. From the test results obtained optimum compressive strength variation occurs in 25% substitution of steel slag gravel amounted to 40.481 MPa, whereas for the optimum bending capacity contained in variations of 25% substitution of steel slag gravel amounted to 19.592 N / mm2. And for optimum slump value obtained on the variation of normal concrete. This shows the workability of the concrete normally higher than the other variation.

  5. Enhancement of mechanical properties of a TRIP-aided austenitic stainless steel by controlled reversion annealing

    Energy Technology Data Exchange (ETDEWEB)

    Hamada, A.S., E-mail: atef.hamada@suezuniv.edu.eg [Centre for Advanced Steels Research, Box 4200, University of Oulu, 90014 Oulu (Finland); Metallurgical and Materials Engineering Department, Faculty of Petroleum & Mining Engineering, Suez University, Box 43721, Suez (Egypt); Kisko, A.P. [Centre for Advanced Steels Research, Box 4200, University of Oulu, 90014 Oulu (Finland); Sahu, P. [Department of Physics, Jadavpur University, Kolkata 700032 (India); Karjalainen, L.P. [Centre for Advanced Steels Research, Box 4200, University of Oulu, 90014 Oulu (Finland)

    2015-03-25

    Controlled martensitic reversion annealing was applied to a heavily cold-worked metastable austenitic low-Ni Cr–Mn austenitic stainless steel (Type 201) to obtain different ultrafine austenite grain sizes to enhance the mechanical properties, which were then compared with the conventional coarse-grained steel. Characterization of the deformed and reversion annealed microstructures was performed by electron back scattered diffraction (EBSD), X-ray diffraction (XRD) and light and transmission electron microscopy (TEM). The steel with a reverted grain size ~1.5 μm due to annealing at 800 °C for 10 s showed significant improvements in the mechanical properties with yield stress ~800 MPa and tensile strength ~1100 MPa, while the corresponding properties of its coarse grained counterpart were ~450 MPa and ~900 MPa, respectively. However, the fracture elongation of the reversion annealed steel was ~50% as compared to ~70% in the coarse grained steel. A further advantage is that the anisotropy of mechanical properties present in work-hardened steels also disappears during reversion annealing.

  6. A study on the irradiation embrittlement and recovery characteristics of light water reactor pressure vessel steels

    Energy Technology Data Exchange (ETDEWEB)

    Chi, Se Hwan; Hong, Jun Hwa; Lee, Bong Sang; Oh, Jong Myung; Song, Sook Hyang; Milan, Brumovsky [NRI Czech (Czech Republic)

    1999-03-01

    The neutron irradiation embrittlement phenomenon of light water RPV steels greatly affects the life span for safe operation of a reactor. Reliable evaluation and prediction of the embrittlement of RPV steels, especially of aged reactors, are of importance to the safe operation of a reactor. In addition, the thermal recovery of embrittled RPV has been recognized as an option for life extension. This study aimed to tracer/refine available technologies for embrittlement characterization and prediction, to prepare relevant materials for several domestic RPV steels of the embrittlement and recovery, and to find out possible remedy for steel property betterment. Small specimen test techniques, magnetic measurement techniques, and the Meechan and Brinkmann's recovery curve analysis method were examined/applied as the evaluation techniques. Results revealed a high irradiation sensitivity in YG 3 RPV steel. Further extended study may be urgently needed. Both the small specimen test technique for the direct determination of fracture toughness, and the magnetic measurement technique for embrittlement evaluation appeared to be continued for the technical improvement and data base preparation. Manufacturing process relevant to the heat treatment appeared to be improved in lowering the irradiation sensitivity of the steel. Further study is needed especially in applying the present techniques to the new structural materials under new irradiation environment of advanced reactors. (author)

  7. A Metallurgical Evaluation of the Powder-Bed Laser Additive Manufactured 4140 Steel Material

    Science.gov (United States)

    Wang, Wesley; Kelly, Shawn

    2016-03-01

    Using laser powder bed fusion (PBF-L) additive manufacturing (AM) process for steel or iron powder has been attempted for decades. This work used a medium carbon steel (AISI 4140) powder to explore the feasibility of AM. The high carbon equivalent of 4140 steel (CEIIW ≈ 0.83) has a strong tendency toward cold cracking. As such, the process parameters must be carefully controlled to ensure the AM build quality. Through an orthogonally designed experimental matrix, a laser-welding procedure was successfully developed to produce 4140 steel AM builds with no welding defects. In addition, the microstructure and micro-cleanliness of the as-welded PBF-L AM builds were also examined. The results showed an ultra-fine martensite lath structure and an ultra-clean internal quality with minimal oxide inclusion distribution. After optimizing the PBF-L AM process parameters, including the laser power and scan speed, the as-welded AM builds yielded an average tensile strength higher than 1482 MPa and an average 33 J Charpy V-notch impact toughness at -18°C. The surface quality, tensile strength, and Charpy V-notch impact toughness of AM builds were comparable to the wrought 4140 steel. The excellent mechanical properties of 4140 steel builds created by the PBF-L AM AM process make industrial production more feasible, which shows great potential for application in the aerospace, automobile, and machinery industries.

  8. A Study of the Batch Annealing of Cold-Rolled HSLA Steels Containing Niobium or Titanium

    Science.gov (United States)

    Fang, Chao; Garcia, C. Isaac; Choi, Shi-Hoon; DeArdo, Anthony J.

    2015-08-01

    The batch annealing behavior of two cold-rolled, microalloyed HSLA steels has been studied in this program. One steel was microalloyed with niobium while the other with titanium. A successfully batch annealed steel will exhibit minimum variation in properties along the length of the coil, even though the inner and outer wraps experience faster heating and cooling rates and lower soaking temperatures, i.e., the so-called "cold spot" areas, than the mid-length portion of the coil, i.e., the so-called "hot spot" areas. The variation in strength and ductility is caused by differences in the extent of annealing in the different areas. It has been known for 30 years that titanium-bearing HSLA steels show more variability after batch annealing than do the niobium-bearing steels. One of the goals of this study was to try to explain this observation. In this study, the annealing kinetics of the surface and center layers of the cold-rolled sheet were compared. The surface and center layers of the niobium steel and the surface layer of the titanium steel all showed similar annealing kinetics, while the center layer of the titanium steel exhibited much slower kinetics. Metallographic results indicate that the stored energy of the cold-rolled condition, as revealed by grain center sub-grain boundary density, appeared to strongly influence the annealing kinetics. The kinetics were followed by the Kernel Average Misorientation reconstruction of the microstructure at different stages on annealing. Possible pinning effects caused by microalloy precipitates were also considered. Methods of improving uniformity and increasing kinetics, involving optimizing both hot-rolled and cold-rolled microstructure, are suggested.

  9. Corrosion effect of Bacillus cereus on X80 pipeline steel in a Beijing soil environment.

    Science.gov (United States)

    Wan, Hongxia; Song, Dongdong; Zhang, Dawei; Du, Cuiwei; Xu, Dake; Liu, Zhiyong; Ding, De; Li, Xiaogang

    2018-06-01

    The corrosion of X80 pipeline steel in the presence of Bacillus cereus (B. cereus) was studied through electrochemical and surface analyses and live/dead staining. Scanning electron microscopy and live/dead straining results showed that a number of B. cereus adhered to the X80 steel. Electrochemical impedance spectroscopy showed that B. cereus could accelerate the corrosion of X80 steel. In addition, surface morphology observations indicated that B. cereus could accelerate pitting corrosion in X80 steel. The depth of the largest pits due to B. cereus was approximately 11.23μm. Many pits were found on the U-shaped bents and cracks formed under stress after 60days of immersion in the presence of B. cereus. These indicate that pitting corrosion can be accelerated by B. cereus. X-ray photoelectron spectroscopy results revealed that NH 4 + existed on the surface of X80 steel. B. cereus is a type of nitrate-reducing bacteria and hence the corrosion mechanism of B. cereus may involve nitrate reduction on the X80 steel. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Structure and creep of Russian reactor steels with a BCC structure

    Science.gov (United States)

    Sagaradze, V. V.; Kochetkova, T. N.; Kataeva, N. V.; Kozlov, K. A.; Zavalishin, V. A.; Vil'danova, N. F.; Ageev, V. S.; Leont'eva-Smirnova, M. V.; Nikitina, A. A.

    2017-05-01

    The structural phase transformations have been revealed and the characteristics of the creep and long-term strength at 650, 670, and 700°C and 60-140 MPa have been determined in six Russian reactor steels with a bcc structure after quenching and high-temperature tempering. Creep tests were carried out using specially designed longitudinal and transverse microsamples, which were fabricated from the shells of the fuel elements used in the BN-600 fast neutron reactor. It has been found that the creep rate of the reactor bcc steels is determined by the stability of the lath martensitic and ferritic structures in relation to the diffusion processes of recovery and recrystallization. The highest-temperature oxide-free steel contains the maximum amount of the refractory elements and carbides. The steel strengthened by the thermally stable Y-Ti nanooxides has a record high-temperature strength. The creep rate at 700°C and 100 MPa in the samples of this steel is lower by an order of magnitude and the time to fracture is 100 times greater than that in the oxide-free reactor steels.

  11. STRENGTHENING OF A REINFORCED CONCRETE BRIDGE WITH PRESTRESSED STEEL WIRE ROPES

    Directory of Open Access Journals (Sweden)

    Kexin Zhang

    2017-10-01

    Full Text Available This paper describes prestressed steel wire ropes as a way to strengthen a 20-year-old RC T-beam bridge. High strength, low relaxation steel wire ropes with minor radius, high tensile strain and good corrosion resistance were used in this reinforcement. The construction process for strengthening with prestressed steel wire ropes—including wire rope measuring, extruding anchor heads making, anchorage installing, tensioning steel wire ropes and pouring mortar was described. Ultimate bearing capacity of the bridge after strengthening was discussed based on the concrete structure theory. The flexural strength of RC T-beam bridges strengthened with prestressed steel wire ropes was governed by the failure of concrete crushing. To investigate effectiveness of the strengthening method, fielding-load tests were carried out before and after strengthening. The results of concrete strain and deflection show that the flexural strength and stiffness of the strengthened beam are improved. The crack width measurement also indicates that this technique could increase the durability of the bridge. Thus, this strengthened way with prestressed steel wire rope is feasible and effective.

  12. Fracture toughness of a nanoscale WC-Co tool steel

    International Nuclear Information System (INIS)

    Densley, J.M.; Hirth, J.P.

    1997-01-01

    Tungsten carbide tool steels, comprising WC particles with 6.7--25wt% Co distributed in the interparticle regions as a quasi-continuous binder phase, can be considered as WC-Co composites. The fracture toughness of such WC-Co composites is dependent on the volume fraction, contiguity and thickness of the cobalt binder, and the size of the tungsten carbide grains. Research has shown that the ductile binder undergoes nearly all the plastic deformation during fracture, which provides the primary energy consuming process that enhances fracture resistance. Recent manufacturing developments have given rise to the production of a WC-6.7wt% Co cermet having an average WC grain size of 70 nm, with a corresponding binder mean thickness, h, of 9 nm calculated from d = h(1-V f )/V f where d = 70 nm and V f = 0.114. This composite has shown a higher wear resistance than that of conventional cermets in proportion to their hardness. Such improvement has been attributed to the difficulty in forming dislocations in the very small grains. There are also indications that the Co binder in the nanoscale cermet contains higher contents of dissolved W and C than for conventional scale cermets. Because plastic deformation is initially confined to the binder phase, it was of interest to perform mode 1 and mixed mode toughness tests on the nanoscale cermet to determine whether flow localization influenced mixed mode toughness as in bulk materials. Two generations of this cermet were provided by Rogers Tool Works. The first generation, A, had lower binder contiguity, with occasional agglomerations of WC grains. The second generation, B, was cleaner, with the cobalt binder more uniformly separating the WC grains

  13. A new steel with good low-temperature sulfuric acid dew point corrosion resistance

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, X.Q.; Li, X.G. [Corrosion and Protection Center, University of Science and Technology Beijing (China); Key Laboratory of Corrosion and Protection (Ministry of Education), Beijing (China); Sun, F.L. [Corrosion and Protection Center, University of Science and Technology Beijing (China); Lv, S.J. [Corrosion and Protection Center, University of Science and Technology Beijing (China); Equipment and Power Department, Shijiazhuang Refine and Chemical Company Limited, SINOPEC, Shijiazhuang (China)

    2012-07-15

    In this work, new steels (1, 2, and 3) were developed for low-temperature sulfuric acid dew point corrosion. The mass loss rate, macro- and micro-morphologies and compositions of corrosion products of new steels in 10, 30, and 50% H{sub 2}SO{sub 4} solutions at its corresponding dew points were investigated by immersion test, scanning electron microscopy (SEM) and energy-dispersive spectrometry (EDS). The results indicated that mass loss rate of all the tested steels first strongly increased and then decreased as H{sub 2}SO{sub 4} concentration increased, which reached maximum at 30%. Corrosion resistance of 2 steel is the best among all specimens due to its fine and homogeneous morphologies of corrosion products. The electrochemical corrosion properties of new steels in 10 and 30% H{sub 2}SO{sub 4} solutions at its corresponding dew points were studied by potentiodynamic polarization and electrochemical impedance spectroscopy (EIS) techniques. The results demonstrated that corrosion resistance of 2 steel is the best among all the experimental samples due to its lowest corrosion current density and highest charge transfer resistance, which is consistent with the results obtained from immersion tests. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  14. Mechanical Properties of a Bainitic Steel Producible by Hot Rolling

    Directory of Open Access Journals (Sweden)

    Rana R.

    2017-12-01

    Full Text Available A carbide-free bainitic microstructure is suitable for achieving a combination of ultra high strength and high ductility. In this work, a steel containing nominally 0.34C-2Mn-1.5Si-1Cr (wt.% was produced via industrial hot rolling and laboratory heat treatments. The austenitization (900°C, 30 min. and austempering (300-400°C, 3 h treatments were done in salt bath furnaces. The austempering treatments were designed to approximately simulate the coiling step, following hot rolling and run-out-table cooling, when the bainitic transformation would take place and certain amount of austenite would be stabilized due to suppression of carbide precipitation. The microstructures and various mechanical properties (tensile properties, bendability, flangeability, and room and subzero temperature impact toughness relevant for applications were characterized. It was found that the mechanical properties were highly dependent on the stability of the retained austenite, presence of martensite in the microstructure and the size of the microstructural constituents. The highest amount of retained austenite (~ 27 wt.% was obtained in the sample austempered at 375°C but due to lower austenite stability and coarser overall microstructure, the sample exhibited lower tensile ductility, bendability, flangeability and impact toughness. The sample austempered at 400°C also showed poor properties due to the presence of initial martensite and coarse microstructure. The best combination of mechanical properties was achieved for the samples austempered at 325-350°C with a lower amount of retained austenite but with the highest mechanical stability.

  15. Hydrogen embrittlement of ASTM A 203 D nuclear structural steel

    International Nuclear Information System (INIS)

    Chakravartty, J.K.; Prasad, G.E.; Sinha, T.K.; Asundi, M.K.

    1986-01-01

    The influence of hydrogen on the mechanical properties of ASTM A 203 D nuclear structural steel has been studied by tension, bend and delayed-failure tests at room temperature. While the tension tests of hydrogen charged unnotched specimens reveal no change in ultimate strength and ductility, the effect of hydrogen is manifested in notched specimens (tensile and bend) as a decrease in ultimate strength (maximum load in bend test) and ductility; the effect increases with increasing hydrogen content. It is observed that for a given hydrogen concentration, the decrease in bend ductility is remarkably large compared to that in tensile ductility. Hydrogen charging does not cause any delayed-failure upto 200 h under an applied tensile stress, 0.85 times the notch tensile strength. However delayed failure occurs in hydrogen charged bend samples in less than 10 h under an applied bending load of about 0.80 times of the uncharged maximum load. Fractographs of hydrogen charged unnotched specimens show ductile dimple fracture, while those of notched tension and bend specimens under hydrogen-charged conditions show a mixture of ductile dimple and quasi-cleavage cracking. The proportion of quasi-cleavage cracking increases with increasing hydrogen content and this fracture mode is more predominant in bend specimens. The changes in tensile properties and fracture modes can reasonably be explained by existing theories of hydrogen embrittlement. An attempt is made to explain the significant difference in the embrittlement susceptibility of bend and tensile specimens in the light of difference in triaxiality and plastic zone size near the notch tip. (orig.)

  16. A Method for Monitoring Iron and Steel Factory Economic Activity Based on Satellites

    Directory of Open Access Journals (Sweden)

    Yi Zhou

    2018-06-01

    Full Text Available The Chinese government has promulgated a de-capacity policy for economic growth and environmental sustainability, especially for the iron and steel industry. With these policies, this study aimed to monitor the economic activities and evaluate the production conditions of an iron and steel factory based on satellites via Landsat-8 Thermal Infrared Sensor (TIRS data and high-resolution images from January 2013 to October 2017, and propel next economic adjustment and environmental protection. Our methods included the construction of a heat island intensity index for an iron and steel factory (ISHII, a heat island radio index for an iron and steel factory (ISHRI and a dense classifying approach to monitor the spatiotemporal changes of the internal heat field of an iron and steel factory. Additionally, we used GF-2 and Google Earth images to identify the main production area, detect facility changes to a factory that alters its heat field and verify the accuracy of thermal analysis in a specific time span. Finally, these methods were used together to evaluate economic activity. Based on five iron and steel factories in the Beijing-Tianjin-Hebei region, when the ISHII curve is higher than the seasonal changes in a time series, production is normal; otherwise, there is a shut-down or cut-back. In the spatial pattern analyses, the ISHRI is large in normal production and decreases when cut-back or shut-down occurs. The density classifying images and high-resolution images give powerful evidence to the above-mentioned results. Finally, three types of economic activities of normal production, shut-down or cut-back were monitored for these samples. The study provides a new perspective and method for monitoring the economic activity of an iron and steel factory and provides supports for sustainable development in China.

  17. Precipitation evolution in a Ti-free and Ti-containing stainless maraging steel

    International Nuclear Information System (INIS)

    Schober, M.; Schnitzer, R.; Leitner, H.

    2009-01-01

    Stainless maraging steels have a Cr content higher than 12 wt% and show a excellent combination of high strength and ductility, which make them attractive for use in machinery fields and aircraft applications. The massive increase of strength during ageing treatment of maraging steels is related to a precipitation sequence of various nm-scaled intermetallic phases. The peak hardness especially in Ti-containing maraging steels can be reached after short-time ageing at temperatures around 500 o C. However, precipitation reactions in different stainless maraging steels are not fully understood, especially the evolution from clustering over growing to coarsening. In the present work a commercial maraging steel and a Ti-containing model alloy are investigated and compared to each other. The steels were isothermally heat treated at 525 o C for a range of times. Special emphasis was laid on the correlation of hardness to the formation and presence of different kinds of precipitates. The isothermal aged samples were investigated by using two advanced three-dimensional energy compensated atom probes (LEAP TM and 3DAP TM ) both in voltage mode and in laser mode. The atom probe data were correlated to standard hardness measurements. The results show that the partial substitution of Al by Ti results in a different precipitation behaviour. While the Ti-free maraging steel exhibit only one type of precipitate, the Ti-containing grade shows a change in the type of precipitates during ageing. However, this change leads to an accelerated coarsening and thus to a faster drop in hardness.

  18. Precipitation evolution in a Ti-free and Ti-containing stainless maraging steel.

    Science.gov (United States)

    Schober, M; Schnitzer, R; Leitner, H

    2009-04-01

    Stainless maraging steels have a Cr content higher than 12wt% and show a excellent combination of high strength and ductility, which make them attractive for use in machinery fields and aircraft applications. The massive increase of strength during ageing treatment of maraging steels is related to a precipitation sequence of various nm-scaled intermetallic phases. The peak hardness especially in Ti-containing maraging steels can be reached after short-time ageing at temperatures around 500 degrees C. However, precipitation reactions in different stainless maraging steels are not fully understood, especially the evolution from clustering over growing to coarsening. In the present work a commercial maraging steel and a Ti-containing model alloy are investigated and compared to each other. The steels were isothermally heat treated at 525 degrees C for a range of times. Special emphasis was laid on the correlation of hardness to the formation and presence of different kinds of precipitates. The isothermal aged samples were investigated by using two advanced three-dimensional energy compensated atom probes (LEAP and 3DAP) both in voltage mode and in laser mode. The atom probe data were correlated to standard hardness measurements. The results show that the partial substitution of Al by Ti results in a different precipitation behaviour. While the Ti-free maraging steel exhibit only one type of precipitate, the Ti-containing grade shows a change in the type of precipitates during ageing. However, this change leads to an accelerated coarsening and thus to a faster drop in hardness.

  19. Finite element modeling of reinforced concrete beams with a hybrid combination of steel and aramid reinforcement

    International Nuclear Information System (INIS)

    Hawileh, R.A.

    2015-01-01

    Highlights: • Modeling of concrete beams reinforced steel and FRP bars. • Developed finite element models achieved good results. • The models are validated via comparison with experimental results. • Parametric studies are performed. - Abstract: Corrosion of steel bars has an adverse effect on the life-span of reinforced concrete (RC) members and is usually associated with crack development in RC beams. Fiber reinforced polymer (FRP) bars have been recently used to reinforce concrete members in flexure due to their high tensile strength and superior corrosion resistance properties. However, FRP materials are brittle in nature, thus RC beams reinforced with such materials would exhibit a less ductile behavior when compared to similar members reinforced with conventional steel reinforcement. Recently, researchers investigated the performance of concrete beams reinforced with a hybrid combination of steel and Aramid Fiber Reinforced Polymer (AFRP) reinforcement to maintain a reasonable level of ductility in such members. The function of the AFRP bars is to increase the load-carrying capacity, while the function of the steel bars is to ensure ductility of the flexural member upon yielding in tension. This paper presents a three-dimensional (3D) finite element (FE) model that predicted the load versus mid-span deflection response of tested RC beams conducted by other researchers with a hybrid combination of steel and AFRP bars. The developed FE models account for the constituent material nonlinearities and bond–slip behavior between the reinforcing bars and adjacent concrete surfaces. It was concluded that the developed models can accurately capture the behavior and predicts the load-carrying capacity of such RC members. In addition, a parametric study is conducted using the validated models to investigate the effect of AFRP bar size, FRP material type, bond–slip action, and concrete compressive strength on the performance of concrete beams when reinforced

  20. High purity in steels as a criterion for materials development

    International Nuclear Information System (INIS)

    Jacobi, H.

    1995-01-01

    This summarizing report discusses the materials and application prospects for higher purity in steels, which will make possible further advances in materials behaviour and workability. Improvements in purity and homogeneity permit in particular more rational production of thin foils and wire, one-piece shaping of complicated bodywork components and the drawing, wall-ironing and flanging of two-piece beverage cans. Welded designs in plant and mechanical engineering can be fabricated with less effort and less weight. Difficult component geometries and shaping processes can be more easily mastered. Steels with optimized fracture toughness can be exposed to more extreme loads at even lower temperatures: applications worthy of mention include offshore engineering and large-diameter linepipes for use in arctic regions and at great underwater depths. Liquefied-gas transport vessels can be made more resistant to brittle rupture. The bending fatigue strength and service-life of valve-spring and rolling-bearing steels can be significantly increased. High-purity surfaces on piston rods and cylinders guarantee reliability in hydraulic systems, and high-purity calendering rolls permit defect-free embossing of paper surfaces. (orig.)

  1. Study of corrosion resistance of AISI 444 ferritic stainless steel for application as a biomaterial

    International Nuclear Information System (INIS)

    Marques, Rogerio Albuquerque

    2014-01-01

    Ferritic stainless steels are ferromagnetic materials. This property does not allow their use in orthopedic prosthesis. Nevertheless, in some specific applications, this characteristic is very useful, such as, for fixing dental and facial prostheses by using magnetic attachments. In this study, the corrosion resistance and cytotoxicity of the AISI 444 ferritic stainless steel, with low nickel content, extra-low interstitial levels (C and N) and Ti and Nb stabilizers, were investigated for magnetic dental attachments application. The ISO 5832-1 (ASTM F-139) austenitic stainless steel and a commercial universal keeper for dental attachment (Neo-magnet System) were evaluated for comparison reasons. The first stainless steel is the most used metallic material for prostheses, and the second one, is a ferromagnetic keeper for dental prostheses (NeoM). In vitro cytotoxicity analysis was performed by the red neutral incorporation method. The results showed that the AISI 444 stainless steel is non cytotoxic. The corrosion resistance was studied by anodic polarization methods and electrochemical impedance spectroscopy (EIS), in a saline phosphate buffered solution (PBS) at 37 °C. The electronic properties of the passive film formed on AISI 444 SS were evaluated by the Mott-Schottky approach. All tested materials showed passivity in the PBS medium and the passive oxide film presented a duplex nature. The highest susceptibility to pitting corrosion was associated to the NeoM SS. This steel was also associated to the highest dopant concentration. The comparatively low levels of chromium (nearly 12.5%) and molybdenum (0.3%) of NeoM relatively to the other studied stainless steels are the probable cause of its lower corrosion resistance. The NeoM chemical composition does not match that of the SUS444 standards. The AISI 444 SS pitting resistance was equivalent to the ISO 5832-1 pointing out that it is a potential candidate for replacement of commercial ferromagnetic alloys used

  2. A morphological evaluation of a duplex stainless steel processed by high energy Ball Mill

    International Nuclear Information System (INIS)

    Yonekubo, Ariane Emi; Cintho, Osvaldo Mitsuyuki; Aguiar, Denilson Jose Marcolino de; Capocchi, Jose Deodoro Trani

    2009-01-01

    The duplex stainless steels are formed by a ferrite and austenite mixture, giving them a combination of properties. Commercially, these steels are hot rolled, developing an anisotropic, alternated ferrite and austenite elongated lamellae microstructure. In this work, a duplex stainless steel was produced by the mixture of elementary powders with the composition Fe-19.5Cr-5Ni processed in an ATTRITOR ball mill during periods up to 15 hours. The powders obtained were compressed in specimens and were heat treated in the temperatures of 900, 1050 and 1200 °C during 1 hour and analysed by x ray diffraction, optic microscopy, scanning electron microscopy and energy dispersion spectroscopy. An optimized microstructure with ultrafine, equiaxial and regular duplex microstructure was obtained in the 15 hour milling and 1200 °C heat treatment. Afterwards, a commercially super duplex stainless steel UNS S32520 was aged at 800 °C aiming the precipitation of σ phase in order to reduce its toughness and then, milled in SPEX mill. The resulting microstructure was a very fine duplex type with irregular grain boundary morphology duo to the grain growth barrier promoted by the renascent σ phase particles during sintering process. (author)

  3. Corrosion studies of a chromium steel in imitated seawater

    International Nuclear Information System (INIS)

    Lakatos-Varsanyi, M.; Meisel, W.

    2002-01-01

    A series of in-door experiments was performed to get some insight into the corrosion behavior of a commercial alloy Fe-12% Cr (3CR12) exposed to imitated seawater. Applying different analytical methods, the main corrosion process was found to be the formation of flakes on the surface which, peel off after they have reached a certain size. Some Cr is dissolved in the solution, its relative concentration with respect to Fe is higher than in the bulk material. The flakes consist mainly of mixed oxihydroxides of the type FeOOH containing some Cr and Mg. The oxidic layer on the interface is very thin, behaves essentially stationary with a slight growth of about 0.05 nm/day. It consists of Cr oxide with some inclusions of Fe and Mg and is not of a chromite type. Immediately below this oxidic layer, the metallic substrate exhibits a thin layer depleted in Cr and behaving like α-Fe (bcc). As compared with stainless steel, potentiostatic current vs. time records at anodic potentials below the pitting potential indicate a very different stability of the surface films for 3CR12. The kinetics of the passive layer formation on 3CR12 was found to follow a parabolic law initially and to change later (after 10...100 seconds in deaerated solution and even earlier in aerated solution) to a linear law. After some time, pitting corrosion and/or cracks due to internal stresses play the dominant role. Cr does not form a protective oxidic layer. The surface morphology of samples exposed at -200 mV for 20 and 80 minutes has been studied by scanning electron microscopy and scanning Auger microprobe. The results reflect the competing formation of oxidic layers and pitting, the participation of Cr in the dissolution process. It is also suggested that Mg, which is a component of the solution was incorporated into the rust and some Mg was also found on the metallic surface. (author)

  4. Mechanosynthesis of A Ferritic ODS (Oxide Dispersion Strengthened) Steel Containing 14% Chromium and Its Characterization

    Science.gov (United States)

    Rivai, A. K.; Dimyati, A.; Adi, W. A.

    2017-05-01

    One of the advanced materials for application at high temperatures which is aggressively developed in the world is ODS (Oxide Dispersion strengthened) steel. ODS ferritic steels are one of the candidate materials for future nuclear reactors in the world (Generation IV reactors) because it is able to be used in the reactor above 600 °C. ODS ferritic steels have also been developed for the interconnect material of SOFC (Solid Oxide Fuel Cell) which will be exposed to about 800 °C of temperature. The steel is strengthened by dispersing homogeneously of oxide particles (ceramic) in nano-meter sized in the matrix of the steel. Synthesis of a ferritic ODS steel by dispersion of nano-particles of yttrium oxide (yttria: Y2O3) as the dispersion particles, and containing high-chromium i.e. 14% has been conducted. Synthesis of the ODS steels was done mechanically (mechanosynthesis) using HEM (High Energy ball Milling) technique for 40 and 100 hours. The resulted samples were characterized using SEM-EDS (Scanning Electron Microscope-Energy Dispersive Spectroscope), and XRD (X-ray diffraction) to analyze the microstructure characteristics. The results showed that the crystal grains of the sample with 100 hours milling time was much smaller than the sample with 40 hours milling time, and some amount of alloy was formed during the milling process even for 40 hours milling time. Furthermore, the structure analysis revealed that some amount of iron atom substituted by a slight amount of chromium atom as a solid solution. The quantitative analysis showed that the phase mostly consisted of FeCr solid-solution with the structure was BCC (body-centered cubic).

  5. Heat treatment temperature influence on ASTM A890 GR 6A super duplex stainless steel microstructure

    International Nuclear Information System (INIS)

    Martins, Marcelo; Casteletti, Luiz Carlos

    2005-01-01

    Duplex and super duplex stainless steels are ferrous alloys with up to 26% chromium, 8% nickel, 5% molybdenum and 0.3% nitrogen, which are largely used in applications in media containing ions from the halogen family, mainly the chloride ion (Cl - ). The emergence of this material aimed at substituting Copper-Nickel alloys (Cupro-Nickel) that despite presenting good corrosion resistance, has mechanical properties quite inferior to steel properties. The metallurgy of duplex and super duplex stainless steel is complex due to high sensitiveness to sigma phase precipitation that becomes apparent, due to the temperatures they are exposed on cooling from solidification as well as from heat treatment processes. The objective of this study was to verify the influence of heat treating temperatures on the microstructure and hardness of ASTM A890/A890M Gr 6A super duplex stainless steel type. Microstructure control is of extreme importance for castings, as the chemical composition and cooling during solidification inevitably provide conditions for precipitation of sigma phase. Higher hardness in these materials is directly associated to high sigma phase concentration in the microstructure, precipitated in the ferrite/austenite interface. While heat treatment temperature during solution treatment increases, the sigma phase content in the microstructure decreases and consequently, the material hardness diminishes. When the sigma phase was completely dissolved by the heat treatment, the material hardness was influenced only due to ferrite and austenite contents in the microstructure

  6. Influence of Steel Fibers on the Structural Performance of a Prestressed Concrete Containment Building

    International Nuclear Information System (INIS)

    Choun, Youngsun; Hahm, Daegi; Park, Junhee

    2013-01-01

    A large number of previous experimental investigations indicate that the use of steel fibers in conventional reinforced concrete (RC) can enhance the structural and functional performance of prestressed concrete containment buildings (PCCBs) in nuclear power plants. A prevention of through-wall cracks and an increase of the post-cracking ductility will improve the ultimate internal pressure capacity, and a high shear resistance under cyclic loadings will increase the seismic resisting capacity. In this study, the effects of steel fiber reinforced concrete (SFRC) on the ultimate pressure and seismic capacities of a PCCB are investigated. The effects of steel fibers on the ultimate pressure and shear resisting capacities of a PCCB are investigated. It is revealed that both of the ultimate pressure capacity and the shear resisting capacity of a PCCB can be greatly enhanced by introducing steel fibers in a conventional RC. Estimation results indicate that the ultimate pressure capacity and maximum lateral displacement of a PCCB can be improved by 16% and 64%, respectively, if a conventional RC contains hooked steel fibers in a volume fraction of 1.0%

  7. Influence of Steel Fibers on the Structural Performance of a Prestressed Concrete Containment Building

    Energy Technology Data Exchange (ETDEWEB)

    Choun, Youngsun; Hahm, Daegi; Park, Junhee [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2013-05-15

    A large number of previous experimental investigations indicate that the use of steel fibers in conventional reinforced concrete (RC) can enhance the structural and functional performance of prestressed concrete containment buildings (PCCBs) in nuclear power plants. A prevention of through-wall cracks and an increase of the post-cracking ductility will improve the ultimate internal pressure capacity, and a high shear resistance under cyclic loadings will increase the seismic resisting capacity. In this study, the effects of steel fiber reinforced concrete (SFRC) on the ultimate pressure and seismic capacities of a PCCB are investigated. The effects of steel fibers on the ultimate pressure and shear resisting capacities of a PCCB are investigated. It is revealed that both of the ultimate pressure capacity and the shear resisting capacity of a PCCB can be greatly enhanced by introducing steel fibers in a conventional RC. Estimation results indicate that the ultimate pressure capacity and maximum lateral displacement of a PCCB can be improved by 16% and 64%, respectively, if a conventional RC contains hooked steel fibers in a volume fraction of 1.0%.

  8. Reproducing crucible steel: a practical guide and a comparative analysis to persian manuscripts

    Directory of Open Access Journals (Sweden)

    Moshtagh Khorasani, Manouchehr

    2013-12-01

    Full Text Available Different terms are used in old Persian manuscripts, such as Ta’id Besârat, to define and refer to crucible or watered steel and different types of swords. However, there are few manuscripts that describe the way crucible steel cakes and blades were made such as the manuscript Gŏharnâme. The present article deals with the making of crucible steel as described in Persian manuscripts and also with a new reproduction process of making crucible steel as conducted by the Finnish smith Niko Hynninen.Los antiguos manuscritos persas, tales como Ta’id Besârat, emplean diversos términos para definir y referirse al acero de crisol o acero de Damasco y a diversos tipos de espada. Sin embargo, existen pocos manuscritos que describan el modo en que se elaboraban los lingotes y hojas de acero de crisol, entre ellos el manuscrito Gŏharnâme. El presente artículo describe el proceso de elaboración del acero de crisol tal y como lo refieren los manuscritos persas, así como una moderna reproducción del mismo realizada por el forjador finlandés Niko Hynninen.

  9. Effects of silane on the interfacial fracture of a parylene film over a stainless steel substrate

    International Nuclear Information System (INIS)

    Tan, T.; Meng, J.; Rahbar, N.; Li, H.; Papandreou, G.; Maryanoff, C.A.; Soboyejo, W.O.

    2012-01-01

    Parylene can be coated on stainless steel substrates with and without γ-methacryloxypropyltrimethoxysilane (γ-MPS) as an adhesion promoter. In order to study the effects of silane (γ-MPS) on the adhesion and mixed-mode interfacial fracture performance between parylene C and 316L stainless steel, this paper presents the results of a combined experimental and theoretical approach. Atomic force microscopy (AFM) was used to obtain pull-off forces between parylene coated AFM tips with or without γ-MPS and 316L substrates. A combination of adhesion theories and fracture mechanics models was then used to obtain estimates of the fracture energy release rates over a wide range of mode mixities between pure mode I and pure mode II. The trends in the estimates were shown to be in good agreement with experimental measurements of interfacial fracture toughness obtained from Brazil nut tests coated with parylene C in the presence or absence of γ-MPS over the same range of mode mixities. The study determined that the contribution of silane to the adhesion of parylene C to 316L steel was modest. - Highlights: ► An integrated experimental and modeling approach was applied to characterize effects of silane on interfacial fracture behavior of a parylene film over a stainless steel substrate. ► AFM measurements were obtained for the adhesion of parylene over stainless steel in the presence and absence wiht γ-methacryloxypropyltrimethoxysilane(γ-MPS). ► Brazil nut test was also used to measure interfacial fracture energy release rates over a wide range of mode mixities. ► Good agreement was achieved between these measurements and predictions from both zone and row fracture mechanics models.

  10. Numerical simulation of continuous cooling of a low alloy steel to predict microstructure and hardness

    International Nuclear Information System (INIS)

    Kakhki, M Eshraghi; Kermanpur, A; Golozar, M A

    2009-01-01

    In this work, a numerical model was developed to simulate the continuous cooling of a low alloy steel. In order to simulate the kinetics of diffusional phase transformations, the Johnson–Mehl–Avrami–Kolmogorov (JMAK) equation and additivity rule were employed, while a new model was applied for martensitic transformation. In addition, a novel approach was applied for computing the actual phase fractions in the multiphase steel. Effects of latent heat release during phase transformations, temperature and phase fractions on the variation of thermo-physical properties were considered. The developed numerical model was applied to simulate the cooling process during the Jominy end quench test as well as the quenching of a steel gear in water and oil. In this respect, precise models were used to simulate the complex boundary conditions in the Jominy test and a stainless steel probe was used for determining the heat transfer coefficients of quenching media by an inverse method. The present model was validated against cooling curve measurements, metallographic analysis and hardness tests. Good agreement was found between the experimental and simulation results. This model is able to simulate the continuous cooling and kinetics of phase transformation and to predict the final distribution of microstructures and hardness in low alloy steels

  11. A Steel Wire Stress Measuring Sensor Based on the Static Magnetization by Permanent Magnets

    Directory of Open Access Journals (Sweden)

    Dongge Deng

    2016-10-01

    Full Text Available A new stress measuring sensor is proposed to evaluate the axial stress in steel wires. Without using excitation and induction coils, the sensor mainly consists of a static magnetization unit made of permanent magnets and a magnetic field measurement unit containing Hall element arrays. Firstly, the principle is illustrated in detail. Under the excitation of the magnetization unit, a spatially varying magnetized region in the steel wire is utilized as the measurement region. Radial and axial magnetic flux densities at different lift-offs in this region are measured by the measurement unit to calculate the differential permeability curve and magnetization curve. Feature parameters extracted from the curves are used to evaluate the axial stress. Secondly, the special stress sensor for Φ5 and Φ7 steel wires is developed accordingly. At last, the performance of the sensor is tested experimentally. Experimental results show that the sensor can measure the magnetization curve accurately with the error in the range of ±6%. Furthermore, the obtained differential permeability at working points 1200 A/m and 10000 A/m change almost linearly with the stress in steel wires, the goodness of linear fits are all higher than 0.987. Thus, the proposed steel wire stress measuring sensor is feasible.

  12. 31 CFR 285.1 - Collection of past-due support by administrative offset.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Collection of past-due support by administrative offset. 285.1 Section 285.1 Money and Finance: Treasury Regulations Relating to Money and Finance... include current basic pay, special pay, incentive pay, retainer pay, overtime, or in the case of an...

  13. 30 CFR 285.436 - Can MMS require lease or grant contraction?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Can MMS require lease or grant contraction? 285... Administration Lease Or Grant Contraction § 285.436 Can MMS require lease or grant contraction? At an interval no more frequent than every 5 years, the MMS may review your lease or grant area to determine whether the...

  14. Characterization of Residual Stress as a Function of Friction Stir Welding Parameters in ODS Steel MA956

    Science.gov (United States)

    2013-06-01

    dispersion strengthened - Eurofer steel ,” J. Nucl. Mater., vol. 416 , pp. 2229, Sep 1, 2011. [10] H. J. K. Lemmen and K. J. Sudmeijer, I, “Laser beam...Reynolds and W. Tang, “Structure, properties, and residual stress of 304L stainless steel friction stir welds,” Scr. Mater., vol. 48, pp. 12891294...OF RESIDUAL STRESS AS A FUNCTION OF FRICTION STIR WELDING PARAMETERS IN ODS STEEL MA956 by Martin S. Bennett June 2013 Thesis Advisor

  15. Impurity content of reduced-activation ferritic steels and a vanadium alloy

    International Nuclear Information System (INIS)

    Klueh, R.L.; Grossbeck, M.L.; Bloom, E.E.

    1997-01-01

    Inductively coupled plasma mass spectrometry was used to analyze a reduced-activation ferritic/martensitic steel and a vanadium alloy for low-level impurities that would compromise the reduced-activation characteristics of these materials. The ferritic steel was from the 5-ton IEA heat of modified F82H, and the vanadium alloy was from a 500-kg heat of V-4Cr-4Ti. To compare techniques for analysis of low concentrations of impurities, the vanadium alloy was also examined by glow discharge mass spectrometry. Two other reduced-activation steels and two commercial ferritic steels were also analyzed to determine the difference in the level of the detrimental impurities in the IEA heat and steels for which no extra effort was made to restrict some of the tramp impurities. Silver, cobalt, molybdenum, and niobium proved to be the tramp impurities of most importance. The levels observed in these two materials produced with present technology exceeded the limits for low activation for either shallow land burial or recycling. The chemical analyses provide a benchmark for the improvement in production technology required to achieve reduced activation; they also provide a set of concentrations for calculating decay characteristics for reduced-activation materials. The results indicate the progress that has been made and give an indication of what must still be done before the reduced-activation criteria can be achieved

  16. Comparative Study of Hardening Mechanisms During Aging of a 304 Stainless Steel Containing α'-Martensite

    Science.gov (United States)

    Jeong, S. W.; Kang, U. G.; Choi, J. Y.; Nam, W. J.

    2012-09-01

    Strain aging and hardening behaviors of a 304 stainless steel containing deformation-induced martensite were investigated by examining mechanical properties and microstructural evolution for different aging temperature and time. Introduced age hardening mechanisms of a cold rolled 304 stainless steel were the additional formation of α'-martensite, hardening of α'-martensite, and hardening of deformed austenite. The increased amount of α'-martensite at an aging temperature of 450 °C confirmed the additional formation of α'-martensite as a hardening mechanism in a cold rolled 304 stainless steel. Additionally, the increased hardness in both α'-martensite and austenite phases with aging temperature proved that hardening of both α'-martensite and austenite phases would be effective as hardening mechanisms in cold rolled and aged 304 stainless steels. The results suggested that among hardening mechanisms, hardening of an α'-martensite phase, including the diffusion of interstitial solute carbon atoms to dislocations and the precipitation of fine carbide particles would become a major hardening mechanism during aging of cold rolled 304 stainless steels.

  17. Combating Wear of ASTM A36 Steel by Surface Modification Using Thermally Sprayed Cermet Coatings

    Directory of Open Access Journals (Sweden)

    Vineet Shibe

    2016-01-01

    Full Text Available Thermal spray coatings can be applied economically on machine parts to enhance their requisite surface properties like wear, corrosion, erosion resistance, and so forth. Detonation gun (D-Gun thermal spray coatings can be applied on the surface of carbon steels to improve their wear resistance. In the present study, alloy powder cermet coatings WC-12% Co and Cr3C2-25% NiCr have been deposited on ASTM A36 steel with D-Gun thermal spray technique. Sliding wear behavior of uncoated ASTM A36 steel and D-Gun sprayed WC-12% Co and Cr3C2-25% NiCr coatings on base material is observed on a Pin-On-Disc Wear Tester. Sliding wear performance of WC-12% Co coating is found to be better than the Cr3C2-25% NiCr coating. Wear performance of both these cermet coatings is found to be better than uncoated ASTM A36 steel. Thermally sprayed WC-12% Co and Cr3C2-25% NiCr cermet coatings using D-Gun thermal spray technique is found to be very useful in improving the sliding wear resistance of ASTM A36 steel.

  18. The efficiency of a corrosion inhibitor on steel in a simulated concrete environment

    Energy Technology Data Exchange (ETDEWEB)

    Gartner, Nina; Kosec, Tadeja, E-mail: tadeja.kosec@zag.si; Legat, Andraž

    2016-12-01

    The aim of the present work was to characterize the efficiency of a corrosion inhibitor on steel in a simulated concrete pore solution. Laboratory measurements were performed at various chloride and inhibitor concentrations in order to simulate different applications of the inhibitor when used for the protection or rehabilitation of steel reinforcement in concrete. Two electrochemical techniques, i.e. potentiodynamic polarization scans and electrochemical impedance spectroscopy, were used for this study. The exposed surfaces of the steel specimens were subsequently investigated by Raman spectroscopy and scanning electron microscopy. It was found that the inhibitor can efficiently retard the corrosion of steel in a simulated concrete pore solution at concentrations of the inhibitor >2.0% and of chlorides <0.3% at a pH 10.5. On the other hand, when these conditions are not fulfilled, localized corrosion was observed. The results of the Raman and SEM/EDS analysis showed various morphologies of corrosion products and different types of corrosion attack depending on the pH of the pore solution, and the applied concentrations of the chlorides and the inhibitor. - Highlights: • Electrochemical studies performed at various Cl{sup −} and inhibitor concentrations. • Exposed steel surfaces investigated by Raman spectroscopy and SEM. • Cl{sup −}/inhibitor ratio is important parameter for the inhibitor's efficiency. • The corrosion can re-occur if the concentration of the inhibitor is reduced. • Different corrosion behaviour and oxides in the presence of inhibitor and/or Cl{sup −}.

  19. The "shadow sign": a radiographic differentiation of stainless steel versus titanium spinal instrumentation in spine surgery.

    Science.gov (United States)

    Jones-Quaidoo, Sean M; Novicoff, Wendy; Park, Andrew; Arlet, Vincent

    2011-12-01

    Stainless steel spinal instrumentation has been supplanted in recent years by titanium instrumentation. Knowing whether stainless steel or titanium was used in a previous surgery can guide clinical decision making processes, but frequently the clinician has no way to know what type of metal was used. We describe the radiographic "shadow sign," in which superimposed titanium rods and screws remain radiolucent enough that the contour of the underlying components can be seen on a lateral radiograph, whereas superimposed stainless steel rods and screws are completely radiopaque. This technique was evaluated using a retrospective, randomized, and blinded radiographic comparison of titanium and stainless steel spinal instrumentation. The objective was to determine whether the "shadow sign" can reliably differentiate titanium from stainless steel spinal instrumentation. Lateral radiographs from 16 cases of posterior spinal instrumentation (6 titanium, 6 stainless steel, and 2 replicates of each to assess intraobserver reliability) were randomly selected from a database of cases performed for pediatric scoliosis in a university setting from 2005 to 2009. The cases were randomized then shown to 19 orthopaedic surgery residents, 1 spine fellow, and 2 spine attendings. After the "shadow sign" was described, the surgeons were asked to determine what type of metal each implant was made of. The κ value for both stainless steel and titanium versus the gold standard was 0.83 [standard error (SE) = 0.053], indicating excellent agreement. The κ value for agreement between raters was 0.71 (SE = 0.016) and the κ value for agreement within raters was 0.70 (SE = 0.016), both of which indicated substantial agreement. The "shadow sign" can help a clinician differentiate titanium from stainless steel spinal instrumentation based on radiographic appearance alone. Furthermore, our study reveals that the level of experience in diagnosing spinal lateral radiographs also enhances the use of

  20. The corrosion behavior of steel exposed to a DC electric field in the simulated wet-dry cyclic environment

    Energy Technology Data Exchange (ETDEWEB)

    Dai, Nianwei [Shanghai Key Laboratory of Materials Protection and Advanced Materials in Electric Power, Shanghai University of Electric Power, Shanghai 200090 (China); Department of Materials Science, Fudan University, Shanghai 200433 (China); Chen, Qimeng [Shanghai Key Laboratory of Materials Protection and Advanced Materials in Electric Power, Shanghai University of Electric Power, Shanghai 200090 (China); Zhang, Junxi, E-mail: zhangjunxi@shiep.edu.cn [Shanghai Key Laboratory of Materials Protection and Advanced Materials in Electric Power, Shanghai University of Electric Power, Shanghai 200090 (China); Zhang, Xin; Ni, Qingzhao [Shanghai Key Laboratory of Materials Protection and Advanced Materials in Electric Power, Shanghai University of Electric Power, Shanghai 200090 (China); Jiang, Yiming; Li, Jin [Department of Materials Science, Fudan University, Shanghai 200433 (China)

    2017-05-01

    The corrosion of steel exposed under a direct current (DC) electric field during simulated wet-dry cycles was investigated using weight gain, electrochemical tests, X-ray diffraction (XRD) and scanning electron microscopy (SEM) techniques. The results show that the steel exposed to a DC electric field exhibits a higher corrosion rate than those exposed under no DC electric field. The higher the DC electric field intensity, the higher the corrosion rate of steel. The XRD and SEM analyses indicate that more γ-FeOOH and cracks appear in the rust formed on steel exposed to the DC electric field. The porous γ-FeOOH, formation and expansion of cracks enhance the transfer of oxygen and corrosion products, thereby accelerating corrosion of steel exposed to DC electric field. - Highlights: • Effect of DC electric field on the corrosion of steel in wet/dry cycles was studied. • DC electric field accelerates the steel corrosion in wet/dry cyclic processes. • More γ-FeOOH is generated on the surface of steel exposed under a DC electric field. • More cracks appear in the rust formed on the steel exposed under a DC electric filed.

  1. The corrosion behavior of steel exposed to a DC electric field in the simulated wet-dry cyclic environment

    International Nuclear Information System (INIS)

    Dai, Nianwei; Chen, Qimeng; Zhang, Junxi; Zhang, Xin; Ni, Qingzhao; Jiang, Yiming; Li, Jin

    2017-01-01

    The corrosion of steel exposed under a direct current (DC) electric field during simulated wet-dry cycles was investigated using weight gain, electrochemical tests, X-ray diffraction (XRD) and scanning electron microscopy (SEM) techniques. The results show that the steel exposed to a DC electric field exhibits a higher corrosion rate than those exposed under no DC electric field. The higher the DC electric field intensity, the higher the corrosion rate of steel. The XRD and SEM analyses indicate that more γ-FeOOH and cracks appear in the rust formed on steel exposed to the DC electric field. The porous γ-FeOOH, formation and expansion of cracks enhance the transfer of oxygen and corrosion products, thereby accelerating corrosion of steel exposed to DC electric field. - Highlights: • Effect of DC electric field on the corrosion of steel in wet/dry cycles was studied. • DC electric field accelerates the steel corrosion in wet/dry cyclic processes. • More γ-FeOOH is generated on the surface of steel exposed under a DC electric field. • More cracks appear in the rust formed on the steel exposed under a DC electric filed.

  2. Nondestructive characterization of embrittlement in reactor pressure vessel steels -- A feasibility study

    International Nuclear Information System (INIS)

    McHenry, H.I.; Alers, G.A.

    1998-01-01

    The Nuclear Regulatory Commission recently initiated a study by NIST to assess the feasibility of using physical-property measurements for evaluating radiation embrittlement in reactor pressure vessel (RPV) steels. Ultrasonic and magnetic measurements provide the most promising approaches for nondestructive characterization of RPV steels because elastic waves and magnetic fields can sense the microstructural changes that embrittle materials. The microstructural changes of particular interest are copper precipitation hardening, which is the likely cause of radiation embrittlement in RPV steels, and the loss of dislocation mobility that is an attribute of the ductile-to-brittle transition. Measurements were made on a 1% copper steel, ASTM grade A710, in the annealed, peak-aged and overaged conditions, and on an RPV steel, ASTM grade A533B. Nonlinear ultrasonic and micromagnetic techniques were the most promising measures of precipitation hardening. Ultrasonic velocity measurements and the magnetic properties associated with hysteresis-loop measurements were not particularly sensitive to either precipitation hardening or the ductile-to-brittle transition. Measurements of internal friction using trapped ultrasonic resonance modes detected energy losses due to the motion of pinned dislocations; however, the ultrasonic attenuation associated with these measurements was small compared to the attenuation caused by beam spreading that would occur in conventional ultrasonic testing of RPVs

  3. Effects of solution treatment on mechanical properties and corrosion resistance of 4A duplex stainless steel

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Panpan; Wang, Aiqin; Wang, Wenyan [Henan Univ. of Science and Technology, Luoyang (China). School of Material Science and Engineering; Xie, Jingpei [Henan Univ. of Science and Technology, Luoyang (China). Collaborative Innovation Center of Nonferrous Metals

    2018-02-15

    In this study, 4A duplex stainless steels were prepared via remelting in an intermediate frequency furnace and subsequently solution treated at different temperatures. The effects of solution treatment on the mechanical properties and corrosion resistance of 4A duplex stainless steel were investigated. Microstructures were characterized via optical microscopy and scanning electron microscopy. The mechanical properties were evaluated via hardness test, tensile test, and impact test experiments. The point corrosion resistance was studied via chemical immersion and potentiodynamic anodic polarization. The results showed that with increasing solution temperature in the range of 1223 - 1423 K, the tensile strength and hardness first decreased and then increased, and minimum values were obtained at 1323 K. The σ phase precipitated at the boundaries of the α/γ phases in samples solution treated at 1223 K, decreasing both impact energy and pitting potential of the experimental steels. When experimental steels were solution treated at 1373 K for 2 h, a suitable volume fraction of α/γ was uniformly distributed throughout the microstructure, and the steels exhibited optimal mechanical properties and pitting corrosion resistance.

  4. Quenching and partitioning treatment of a low-carbon martensitic stainless steel

    Energy Technology Data Exchange (ETDEWEB)

    Tsuchiyama, Toshihiro, E-mail: toshi@zaiko.kyushu-u.ac.jp [Department of Materials Science and Engineering, Graduate School of Engineering, Kyushu University, 744 Motooka, Nishi-ku, Fukuoka 819-0395 (Japan); Tobata, Junya; Tao, Teruyuki [Graduate School of Engineering, Kyushu University, 744 Motooka, Nishi-ku, Fukuoka 819-0395 (Japan); Nakada, Nobuo; Takaki, Setsuo [Department of Materials Science and Engineering, Graduate School of Engineering, Kyushu University, 744 Motooka, Nishi-ku, Fukuoka 819-0395 (Japan)

    2012-01-15

    Highlights: Black-Right-Pointing-Pointer The amount of retained austenite was increased by Q and P treatment in 12Cr-0.1C steel. Black-Right-Pointing-Pointer Ideal carbon concentrations in austenite and ferrite were calculated assuming CCE condition. Black-Right-Pointing-Pointer The optimum partitioning treatment condition for 12Cr-0.1C steel was found. Black-Right-Pointing-Pointer The strength-ductility balance of 12Cr-0.1C steel was improved by TRIP effect. - Abstract: Quenching and partitioning (Q and P) treatment was applied to a commercial low-carbon martensitic stainless steel, AISI Type 410 (Fe-12Cr-0.1C). The quench interruption temperature was optimized with consideration of the ideal carbon concentration in untransformed austenite after partitioning to lower the Ms temperature to room temperature. After partitioning at an appropriate temperature, a significant fraction of austenite was retained through the enrichment of carbon into the untransformed austenite. It was also suggested that the addition of silicon is not necessarily required for the Q and P treatment of 12Cr steel because of the retardation of carbide precipitation at the partitioning temperature owing to the large amount of chromium. Tensile testing revealed that the Q and P-treated material exhibited a significantly improved strength-ductility balance compared with conventional quench-and-tempered materials due to the transformation-induced plasticity (TRIP) effect by the retained austenite.

  5. Quenching and partitioning treatment of a low-carbon martensitic stainless steel

    International Nuclear Information System (INIS)

    Tsuchiyama, Toshihiro; Tobata, Junya; Tao, Teruyuki; Nakada, Nobuo; Takaki, Setsuo

    2012-01-01

    Highlights: ► The amount of retained austenite was increased by Q and P treatment in 12Cr–0.1C steel. ► Ideal carbon concentrations in austenite and ferrite were calculated assuming CCE condition. ► The optimum partitioning treatment condition for 12Cr–0.1C steel was found. ► The strength–ductility balance of 12Cr–0.1C steel was improved by TRIP effect. - Abstract: Quenching and partitioning (Q and P) treatment was applied to a commercial low-carbon martensitic stainless steel, AISI Type 410 (Fe–12Cr–0.1C). The quench interruption temperature was optimized with consideration of the ideal carbon concentration in untransformed austenite after partitioning to lower the Ms temperature to room temperature. After partitioning at an appropriate temperature, a significant fraction of austenite was retained through the enrichment of carbon into the untransformed austenite. It was also suggested that the addition of silicon is not necessarily required for the Q and P treatment of 12Cr steel because of the retardation of carbide precipitation at the partitioning temperature owing to the large amount of chromium. Tensile testing revealed that the Q and P-treated material exhibited a significantly improved strength–ductility balance compared with conventional quench-and-tempered materials due to the transformation-induced plasticity (TRIP) effect by the retained austenite.

  6. Studies on A-TIG welding of Low Activation Ferritic/Martensitic (LAFM) steel

    International Nuclear Information System (INIS)

    Vasantharaja, P.; Vasudevan, M.

    2012-01-01

    Low Activation Ferritic–Martensitic steels (LAFM) are chosen as the candidate material for structural components in fusion reactors. The structural components are generally fabricated by welding processes. Activated Tungsten Inert Gas (A-TIG) welding is an emerging process for welding of thicker components. In the present work, attempt was made to develop A-TIG welding technology for LAFM steel plates of 10 mm thick. Activated flux was developed for LAFM steel by carrying out various bead-on-plate TIG welds without flux and with flux. The optimum flux was identified as one which gave maximum depth of penetration at minimum heat input values. With the optimized flux composition, LAFM steel plate of 10 mm thickness was welded in square butt weld joint configuration using double side welding technique. Optical and Scanning Electron Microscopy was used for characterizing the microstructures. Microhardness measurements were made across the weld cross section for as welded and post weld heat treated samples. Tensile and impact toughness properties were determined. The mechanical properties values obtained in A-TIG weld joint were comparable to that obtained in weld joints of LAFM steel made by Electron beam welding process.

  7. Studies on A-TIG welding of Low Activation Ferritic/Martensitic (LAFM) steel

    Science.gov (United States)

    Vasantharaja, P.; Vasudevan, M.

    2012-02-01

    Low Activation Ferritic-Martensitic steels (LAFM) are chosen as the candidate material for structural components in fusion reactors. The structural components are generally fabricated by welding processes. Activated Tungsten Inert Gas (A-TIG) welding is an emerging process for welding of thicker components. In the present work, attempt was made to develop A-TIG welding technology for LAFM steel plates of 10 mm thick. Activated flux was developed for LAFM steel by carrying out various bead-on-plate TIG welds without flux and with flux. The optimum flux was identified as one which gave maximum depth of penetration at minimum heat input values. With the optimized flux composition, LAFM steel plate of 10 mm thickness was welded in square butt weld joint configuration using double side welding technique. Optical and Scanning Electron Microscopy was used for characterizing the microstructures. Microhardness measurements were made across the weld cross section for as welded and post weld heat treated samples. Tensile and impact toughness properties were determined. The mechanical properties values obtained in A-TIG weld joint were comparable to that obtained in weld joints of LAFM steel made by Electron beam welding process.

  8. Thermo-mechanical behaviour during encapsulation of glass in a steel vessel

    International Nuclear Information System (INIS)

    Nakhodchi, S.; Smith, D.J.; Thomas, B.G.

    2016-01-01

    Quantitative numerical simulations and qualitative evaluations are conducted to elucidate thermo-mechanical behaviour during pouring and solidification of molten glass into a stainless-steel cylindrical container. Residual stress and structural integrity in this casting/vitrification process is important because it can be used for long-term storage of high-level nuclear wastes. The predicted temperature and stress distributions in the glass and container agree well with previous measurements of the temperature histories and residual stresses. Three different thermal-stress models are developed using the finite-element method and compared. Two simple slice models were developed based on the generalized plane strain assumption as well as a detailed two-dimensional axi-symmetric model that adds elements according to the stages of pouring glass into the stainless steel container. The results reveal that mechanical interaction between the glass and the wall of the stainless steel container generates residual tensile stresses that approach the yield strength of the steel. Together, these results reveal important insights into the mechanism of stress generation in the process, the structural integrity of the product, and accuracy of the modelling-tool predictions. - Highlights: • Source of residual stresses in glass and stainless steel containers (canisters) is discussed. • Final residual stresses in both glass and container is quantified. • Simple models presented for simulation of complicated casting process. • Comparison between detailed and simple FE modeling.

  9. Influence of sigma-phase formation on the localized corrosion behavior of a duplex stainless steel

    International Nuclear Information System (INIS)

    Adhe, K.N.; Kain, V.; Madangopal, K.; Gadiyar, H.S.

    1996-01-01

    Because of their austenitic-ferritic microstructures, duplex stainless steels offer a good combination of mechanical and corrosion resistance properties. However, heat treatments can lower the mechanical strength of these stainless steels as well as render them susceptible to intergranular corrosion (IGC) and pitting corrosion. In this study, a low-carbon (0.02%) duplex stainless steel is subjected to various heat treatments at 450 to 950 C for 30 min to 10 h. The heat-treated samples than undergo ASTM IGC and pitting corrosion tests, and the results are correlated with the microstructures obtained after each heat treatment. In the absence of Cr 23 C 6 precipitation, σ-phase precipitates render this duplex stainless steel susceptible to IGC and pitting corrosion. Even submicroscopic σ-phase precipitates are deleterious for IGC resistance. Longer-duration heat treatments (at 750 to 850 C) induce chromium diffusion to replenish the chromium-depleted regions around the σ-phase precipitates and improve IGC resistance; pitting resistance, however, is not fully restored. Various mechanisms of σ-phase formation are discussed to show that regions adjacent to σ-phase are depleted of chromium and molybdenum. The effect of chemical composition (pitting resistance equivalent) on the pitting resistance of various stainless steels is also noted

  10. Investigation of Steel Surfaces Treated by a Hybrid Ion Implantation Technique

    International Nuclear Information System (INIS)

    Reuther, H.; Richter, E.; Prokert, F.; Ueda, M.; Beloto, A. F.; Gomes, G. F.

    2004-01-01

    Implantation of nitrogen ions into stainless steel in combination with oxidation often results in a decrease or even complete removal of the chromium in the nitrogen containing outermost surface layer. While iron nitrides can be formed easily by this method, due to the absence of chromium, the formation of chromium nitrides is impossible and the beneficial influence of chromium in the steel for corrosion resistance cannot be used. To overcome this problem we use the following hybrid technique. A thin chromium layer is deposited on steel and subsequently implanted with nitrogen ions. Chromium can be implanted by recoil into the steel surface and thus the formation of iron/chromium nitrides should be possible. Both beam line ion implantation and plasma immersion ion implantation are used. Due to the variation of the process parameters, different implantation profiles and different compounds are produced. The produced layers are characterized by Auger electron spectroscopy, conversion electron Moessbauer spectroscopy and X-ray diffraction. The obtained results show that due to the variation of the implantation parameters, the formation of iron/chromium nitrides can be achieved and that plasma immersion ion implantation is the most suitable technique for the enrichment of chromium in the outermost surface layer of the steel when compared to the beam line implantation.

  11. A Novel Methods for Fracture Toughness Evaluation of Tool Steels with Post-Tempering Cryogenic Treatment

    Directory of Open Access Journals (Sweden)

    Ramona Sola

    2017-02-01

    Full Text Available Cryogenic treatments are usually carried out immediately after quenching, but their use can be extended to post tempering in order to improve their fracture toughness. This research paper focuses on the influence of post-tempering cryogenic treatment on the microstructure and mechanical properties of tempered AISI M2, AISI D2, and X105CrCoMo18 steels. The aforementioned steels have been analysed after tempering and tempering + cryogenic treatment with scanning electron microscopy, X-ray diffraction for residual stress measurements, and micro- and nano-indentation to determine Young’s modulus and plasticity factor measurement. Besides the improvement of toughness, a further aim of the present work is the investigation of the pertinence of a novel technique for characterizing the fracture toughness via scratch experiments on cryogenically-treated steels. Results show that the application of post-tempering cryogenic treatment on AISI M2, AISI D2, and X105CrCoMo18 steels induce precipitation of fine and homogeneously dispersed sub-micrometric carbides which do not alter hardness and Young’s modulus values, but reduce residual stresses and increase fracture toughness. Finally, scratch test proved to be an alternative simple technique to determine the fracture toughness of cryogenically treated steels.

  12. Microstructure and mechanical properties of an oxide dispersion strengthened ferritic steel by a new fabrication route

    International Nuclear Information System (INIS)

    Guo Lina; Jia Chengchang; Hu Benfu; Li Huiying

    2010-01-01

    A reduced activation oxide dispersion strengthened (ODS) ferritic steel with nominal composition of Fe-12Cr-2.5W-0.25Ti-0.2V-0.4Y 2 O 3 (designated 12Cr-ODS) was produced by using EDTA-citrate complex method to synthesize and add Y 2 O 3 particles to an argon atomized steel powder, followed by hot isostatic pressing at 1160 deg. C for 3 h under the pressure of 130 MPa, forging at 1150 deg. C, and heat treatment at 1050 deg. C for 2 h. The microstructure, tensile, and Charpy impact properties of the 12Cr-ODS steel were investigated. Transmission electron microscopy studies indicate that the 12Cr-ODS steel exhibits the characteristic ferritic structure containing few dislocations. Tensile characterization has shown that the 12Cr-ODS steel has superior tensile strength accompanied by good elongation at room temperature and 550 deg. C. The material exhibits very attractive Charpy impact properties with upper shelf energy of 22 J and a ductile-to-brittle transition temperature (DBTT) of about -15 deg. C. The formation of small, equiaxed grains and fine dispersion of oxide particles are the main reasons for the good compromise between tensile strength and impact properties.

  13. Environmental and Geotechnical Assessment of the Steel Slags as a Material for Road Structure

    Directory of Open Access Journals (Sweden)

    Wojciech Sas

    2015-07-01

    Full Text Available Slags are the final solid wastes from the steel industry. Their production from waste and associated materials is a proper implementation of the basic objectives and principles of the waste management. This study aims to investigate the chemical and selected significant geotechnical parameters of steel slag as the alternative materials used in road construction. These investigations are strongly desired for successful application in engineering. Young’s modules E, and resilient modules Mr showed that their values corresponding with requirements for subbase (principal or auxiliary and riding surface as well. Tested mechanical properties were conducted in soaked and un-soaked (optimal moisture content conditions. The designated high content of chromium and zinc are strongly associated with the internal crystal structure of steel slag. The results do not lead to threats when they are applied in roads’ structures. Mechanical characterization was obtained by performing California bearing ratio (CBR tests for steel slag in fixed compaction and moisture content conditions. Moreover, cyclic loading of steel slag was conducted with the application of cyclic California bearing ratio (cCBR apparatus to characterization of this material as a controlled low-strength material. Finally, field studies that consist of static load plate VSS tests were presented.

  14. Environmental and Geotechnical Assessment of the Steel Slags as a Material for Road Structure.

    Science.gov (United States)

    Sas, Wojciech; Głuchowski, Andrzej; Radziemska, Maja; Dzięcioł, Justyna; Szymański, Alojzy

    2015-07-30

    Slags are the final solid wastes from the steel industry. Their production from waste and associated materials is a proper implementation of the basic objectives and principles of the waste management. This study aims to investigate the chemical and selected significant geotechnical parameters of steel slag as the alternative materials used in road construction. These investigations are strongly desired for successful application in engineering. Young's modules E , and resilient modules M r showed that their values corresponding with requirements for subbase (principal or auxiliary) and riding surface as well. Tested mechanical properties were conducted in soaked and un-soaked (optimal moisture content) conditions. The designated high content of chromium and zinc are strongly associated with the internal crystal structure of steel slag. The results do not lead to threats when they are applied in roads' structures. Mechanical characterization was obtained by performing California bearing ratio (CBR) tests for steel slag in fixed compaction and moisture content conditions. Moreover, cyclic loading of steel slag was conducted with the application of cyclic California bearing ratio (cCBR) apparatus to characterization of this material as a controlled low-strength material. Finally, field studies that consist of static load plate VSS tests were presented.

  15. Microstructure and mechanical properties of an oxide dispersion strengthened ferritic steel by a new fabrication route

    Energy Technology Data Exchange (ETDEWEB)

    Guo Lina, E-mail: guoln702@yahoo.com.cn [School of Material Science and Engineering, University of Science and Technology Beijing, Beijing 100083 (China); Jia Chengchang; Hu Benfu; Li Huiying [School of Material Science and Engineering, University of Science and Technology Beijing, Beijing 100083 (China)

    2010-07-25

    A reduced activation oxide dispersion strengthened (ODS) ferritic steel with nominal composition of Fe-12Cr-2.5W-0.25Ti-0.2V-0.4Y{sub 2}O{sub 3} (designated 12Cr-ODS) was produced by using EDTA-citrate complex method to synthesize and add Y{sub 2}O{sub 3} particles to an argon atomized steel powder, followed by hot isostatic pressing at 1160 deg. C for 3 h under the pressure of 130 MPa, forging at 1150 deg. C, and heat treatment at 1050 deg. C for 2 h. The microstructure, tensile, and Charpy impact properties of the 12Cr-ODS steel were investigated. Transmission electron microscopy studies indicate that the 12Cr-ODS steel exhibits the characteristic ferritic structure containing few dislocations. Tensile characterization has shown that the 12Cr-ODS steel has superior tensile strength accompanied by good elongation at room temperature and 550 deg. C. The material exhibits very attractive Charpy impact properties with upper shelf energy of 22 J and a ductile-to-brittle transition temperature (DBTT) of about -15 deg. C. The formation of small, equiaxed grains and fine dispersion of oxide particles are the main reasons for the good compromise between tensile strength and impact properties.

  16. Finite element simulation of photoacoustic fiber optic sensors for surface corrosion detection on a steel rod

    Science.gov (United States)

    Tang, Qixiang; Owusu Twumasi, Jones; Hu, Jie; Wang, Xingwei; Yu, Tzuyang

    2018-03-01

    Structural steel members have become integral components in the construction of civil engineering infrastructures such as bridges, stadiums, and shopping centers due to versatility of steel. Owing to the uniqueness in the design and construction of steel structures, rigorous non-destructive evaluation techniques are needed during construction and operation processes to prevent the loss of human lives and properties. This research aims at investigating the application of photoacoustic fiber optic transducers (FOT) for detecting surface rust of a steel rod. Surface ultrasonic waves propagation in intact and corroded steel rods was simulated using finite element method (FEM). Radial displacements were collected and short-time Fourier transform (STFT) was applied to obtain the spectrogram. It was found that the presence of surface rust between the FOT and the receiver can be detected in both time and frequency domain. In addition, spectrogram can be used to locate and quantify surface rust. Furthermore, a surface rust detection algorithm utilizing the FOT has been proposed for detection, location and quantification of the surface rust.

  17. Use of Neural Networks for Damage Assessment in a Steel Mast

    DEFF Research Database (Denmark)

    Kirkegaard, Poul Henning; Rytter, A.

    1994-01-01

    In this paper the possibility of using a Multilayer Perceptron (MLP) network trained with the Backpropagation Algorithm for detecting location and size of a damage in a civil engineering structure is investigated. The structure considered is a 20 m high steel lattice mast subjected to wind excita...... as well as full-scale tests where the mast is identified by an ARMA-model. The results show that a neural network trained with simulated data is capable for detecting location of a damage in a steel lattice mast when the network is subjected to experimental data.·...

  18. Analyses of a steel containment vessel with an outer contact structure under severe internal overpressurization conditions

    International Nuclear Information System (INIS)

    Porter, V.L.

    1993-01-01

    Many Mark-I and Mark-II BWR plants are designed with a steel vessel as the primary containment. Typically, the steel containment vessel (SCV) is enclosed within a reinforced concrete shield building with only a small gap (50--90mm) separating the two structures. This paper describes finite element analyses performed to evaluate the effects of contact and friction between a steel containment vessel and an outer contact structure when the containment vessel is subjected to large internal pressures. These computations were motivated by a joint program on containment integrity involving the Nuclear Power Engineering Corporation (NUPEC) of Japan, the US Nuclear Regulatory Commission (NRC), and Sandia National Laboratories for testing model containments

  19. Surface enhancement of cold work tool steels by friction stir processing with a pinless tool

    Science.gov (United States)

    Costa, M. I.; Verdera, D.; Vieira, M. T.; Rodrigues, D. M.

    2014-03-01

    The microstructure and mechanical properties of enhanced tool steel (AISI D2) surfaces produced using a friction stir welding (FSW) related procedure, called friction stir processing (FSP), are analysed in this work. The surface of the tool steel samples was processed using a WC-Co pinless tool and varying processing conditions. Microstructural analysis revealed that meanwhile the original substrate structure consisted of a heterogeneous distribution of coarse carbides in a ferritic matrix, the transformed surfaces consisted of very small carbides, homogenously distributed in a ferrite- bainite- martensite matrix. The morphology of the surfaces, as well as its mechanical properties, evaluated by hardness and tensile testing, were found to vary with increasing tool rotation speed. Surface hardness was drastically increased, relative to the initial hardness of bulk steel. This was attributed to ferrite and carbide refinement, as well as to martensite formation during solid state processing. At the highest rotation rates, tool sliding during processing deeply compromised the characteristics of the processed surfaces.

  20. Microstructural evolution of a cold work tool steel after pulsed laser remelting

    Directory of Open Access Journals (Sweden)

    L. Kosec

    2012-01-01

    Full Text Available The aim of this study is the investigation of micro-structural behaviour of a Mat. No. 1.2379 (EN-X160CrMoV121; AISI D2 cold work tool steel after remelting with a precise pulsed Nd:YAG laser. The investigated steel is one of the most hard to weld tool steels, due to large amount of alloying elements. The analysis was done on single spots remelted with specific laser pulse shape and parameters, assuring crack-less solidification. Re-solidifi ed areas were investigated with microscopy, hardness measurements, X-ray spectroscopy and diffraction method. Laser treatment causes rapid solidifi cation leading into a formation of a fine dendritic microstructures containing high amount of retained austenite causing a significant decrease of hardness.

  1. Microstructural development of diffusion-brazed austenitic stainless steel to magnesium alloy using a nickel interlayer

    International Nuclear Information System (INIS)

    Elthalabawy, Waled M.; Khan, Tahir I.

    2010-01-01

    The differences in physical and metallurgical properties of stainless steels and magnesium alloys make them difficult to join using conventional fusion welding processes. Therefore, the diffusion brazing of 316L steel to magnesium alloy (AZ31) was performed using a double stage bonding process. To join these dissimilar alloys, the solid-state diffusion bonding of 316L steel to a Ni interlayer was carried out at 900 deg. C followed by diffusion brazing to AZ31 at 510 deg. C. Metallographic and compositional analyses show that a metallurgical bond was achieved with a shear strength of 54 MPa. However, during the diffusion brazing stage B 2 intermetallic compounds form within the joint and these intermetallics are pushed ahead of the solid/liquid interface during isothermal solidification of the joint. These intermetallics had a detrimental effect on joint strengths when the joint was held at the diffusion brazing temperature for longer than 20 min.

  2. Discrete size optimization of steel trusses using a refined big bang-big crunch algorithm

    Science.gov (United States)

    Hasançebi, O.; Kazemzadeh Azad, S.

    2014-01-01

    This article presents a methodology that provides a method for design optimization of steel truss structures based on a refined big bang-big crunch (BB-BC) algorithm. It is shown that a standard formulation of the BB-BC algorithm occasionally falls short of producing acceptable solutions to problems from discrete size optimum design of steel trusses. A reformulation of the algorithm is proposed and implemented for design optimization of various discrete truss structures according to American Institute of Steel Construction Allowable Stress Design (AISC-ASD) specifications. Furthermore, the performance of the proposed BB-BC algorithm is compared to its standard version as well as other well-known metaheuristic techniques. The numerical results confirm the efficiency of the proposed algorithm in practical design optimization of truss structures.

  3. A coupled carbonation-rust formation mechanical damage model for steel corrosion in reinforced concrete

    International Nuclear Information System (INIS)

    Nguyen, Huyen; Bary, B.; L'Hostis, Valerie; DeLarrard, T.

    2014-01-01

    This paper aims at presenting a strategy to simulate the corrosion of steel reinforcement due to carbonation of concrete in atmospheric environment. We propose a model coupling drying, carbonation, diffusion of oxygen, formation of rust and mechanics to describe these phenomena. The rust layer is assumed to be composed of two sub-layers with different elastic modulus. An unstable layer with a low modulus (from 0.1 to 5 GPa) is located next to the transformed medium, and another more stable one with a higher modulus (from 100 to 150 GPa) at the interface with steel reinforcement. This model is applied to a numerical meso-structure composed of 4 phases: mortar matrix, randomly distributed aggregates, steel rebar and rust layers to underline the effect of aggregates on damage initiation and corresponding crack pattern of concrete cover. (authors)

  4. Influence of HIP pressure on tensile properties of a 14Cr ODS ferritic steel

    Energy Technology Data Exchange (ETDEWEB)

    Oksiuta, Z., E-mail: z.oksiuta@pb.edu.pl [Bialystok Technical University, Mechanical Department, Wiejska 45c, 15-351 Bialystok (Poland); Ozieblo, A.; Perkowski, K.; Osuchowski, M. [Institute of Ceramics and Building Materials, Postępu 9, 02-676 Warsaw (Poland); Lewandowska, M. [Warsaw University of Technology, Woloska 141, 02-504 Warsaw (Poland)

    2014-02-15

    Highlights: • The HIPping parameters of the 14Cr–2W–0.3Ti–0.3Y{sub 2}O{sub 3} ODS steel powder were investigated. • The density and microstructure of the tested specimens after HIPping were studied. • The mechanical properties, high temperature tensile tests, were performed. • Residual porosity was observed in all tested specimens. • HIPping pressure has negligible influence on the strength of the ODS steel however improves material ductility. - Abstract: An oxide dispersion strengthened ferritic steel with a nominal composition of Fe–14Cr–2W–0.3Ti–0.3Y{sub 2}O{sub 3} (in wt.%) was consolidated by hot isostatic pressing at 1150 °C under various pressures in the range of 185–300 MPa for 3 h. The microstructure, microhardness and high temperature tensile properties of the steel were investigated. With increasing compaction pressure the density of specimens also increased, however OM and SEM observations revealed residual porosity in all tested specimens and similar ferritic microstructure with bimodal-like grains and numerous of large oxide particles, located at the grain boundaries. Mechanical testing revealed that compaction pressure has negligible influence on the hardness and tensile strength of the ODS steel, however improves the material ductility.

  5. Influence of HIP pressure on tensile properties of a 14Cr ODS ferritic steel

    International Nuclear Information System (INIS)

    Oksiuta, Z.; Ozieblo, A.; Perkowski, K.; Osuchowski, M.; Lewandowska, M.

    2014-01-01

    Highlights: • The HIPping parameters of the 14Cr–2W–0.3Ti–0.3Y 2 O 3 ODS steel powder were investigated. • The density and microstructure of the tested specimens after HIPping were studied. • The mechanical properties, high temperature tensile tests, were performed. • Residual porosity was observed in all tested specimens. • HIPping pressure has negligible influence on the strength of the ODS steel however improves material ductility. - Abstract: An oxide dispersion strengthened ferritic steel with a nominal composition of Fe–14Cr–2W–0.3Ti–0.3Y 2 O 3 (in wt.%) was consolidated by hot isostatic pressing at 1150 °C under various pressures in the range of 185–300 MPa for 3 h. The microstructure, microhardness and high temperature tensile properties of the steel were investigated. With increasing compaction pressure the density of specimens also increased, however OM and SEM observations revealed residual porosity in all tested specimens and similar ferritic microstructure with bimodal-like grains and numerous of large oxide particles, located at the grain boundaries. Mechanical testing revealed that compaction pressure has negligible influence on the hardness and tensile strength of the ODS steel, however improves the material ductility

  6. Yield stress of duplex stainless steel specimens estimated using a compound Hall–Petch equation

    Directory of Open Access Journals (Sweden)

    Noriaki Hirota, Fuxing Yin, Tsukasa Azuma and Tadanobu Inoue

    2010-01-01

    Full Text Available In this study, the 0.2% yield stress of duplex stainless steel was evaluated using a compound Hall–Petch equation. The compound Hall–Petch equation was derived from four types of duplex stainless steel, which contained 0.2–64.4 wt% δ-ferrite phase, had different chemical compositions and were annealed at different temperatures. Intragranular yield stress was measured with an ultra-microhardness tester and evaluated with the yield stress model proposed by Dao et al. Grain size, volume fraction and texture were monitored by electron backscattering diffraction measurement. The kγ constant in the compound equation for duplex stainless steel agrees well with that for γ-phase SUS316L steel in the temperature range of 1323–1473 K. The derived compound Hall–Petch equation predicts that the yield stress will be in good agreement with the experimental results for the Cr, Mn, Si, Ni and N solid-solution states. We find that the intragranular yield stress of the δ-phase of duplex stainless steel is rather sensitive to the chemical composition and annealing conditions, which is attributed to the size misfit parameter.

  7. The Effect of the Width of an Aluminum Plate on a Bouncing Steel Ball

    Directory of Open Access Journals (Sweden)

    Christine Hathaway

    2013-01-01

    Full Text Available The effect of the distance between clamping supports of an aluminum alloy plate on the coefficient of restitution of a bouncing steel ball was investigated. The plate was supported on two wooden blocks with a meter stick secured on either side. A steel ball was dropped from a constant height and a motion detector was used to find the coefficient of restitution. Measurements were made with the wooden blocks at a range of distances. It was found that as the distance between the wooden blocks increased, the coefficient of restitution decreased linearly

  8. Intergranular brittle fracture of a low alloy steel. Global and local approaches

    International Nuclear Information System (INIS)

    Kantidis, E.

    1993-08-01

    The intergranular brittle fracture of a low alloy steel (A533B.Cl1) is studied: an embrittlement heat treatment is used to develop two brittle 'states' that fail through an intergranular way at low temperatures. This mode of fracture leads to an important shift of the transition temperature (∼ 165 deg C) and a decrease in the fracture toughness. The local approach to fracture, developed for cleavage, is applied to the case of intergranular fracture. Modifications are proposed. The physical supports of these models are verified by biaxial (tension-torsion) tests. From the local approaches developed for intergranular fracture, the static and dynamic fracture toughness of the embrittled steel is predicted. The local approach applied to a structural steel, which presents mixed modes of fracture (cleavage and intergranular), showed that this mode of fracture seems to be controlled by intergranular loss of cohesion

  9. Analyses of a steel containment vessel with an outer contact structure under severe internal overpressurization conditions

    International Nuclear Information System (INIS)

    Porter, V.L.

    1994-01-01

    Many Mark-I and Mark-II BWR plants are designed with a steel vessel as the primary containment. Typically, the steel containment vessel (SCV) is enclosed within a reinforced concrete shield building with only a small gap (74-90 mm) separating the two structures. This paper describes finite element analyses performed to evaluate the effects of contact and friction between a steel containment vessel and an outer contact structure when the containment vessel is subjected to large internal pressures. These computations were motivated by a joint program on containment integrity involving the Nuclear Power Engineering Corporation (NUPEC) of Japan, the US Nuclear Regulatory Commission (NRC), and Sandia National Laboratories for testing model containments. Under severe accident loading conditions, the steel containment vessel in a typical Mark-I or Mark-II plant may deform under internal pressurization such that it contacts the inner surface of a shield building wall. (Thermal expansion from increasing accident temperatures would also close the gap between the SCV and the shield building, but temperature effects are not considered in these analyses.) The amount and location of contact and the pressure at which it occurs all affect how the combined structure behaves. A preliminary finite element model has been developed to analyze a model of a typical steel containment vessel con-ling into contact with an outer structure. Both the steel containment vessel and the outer contact structure were modelled with axisymmetric shell finite elements. Of particular interest are the influence that the contact structure has on deformation and potential failure modes of the containment vessel. Furthermore, the coefficient of friction between the two structures was varied to study its effects on the behavior of the containment vessel and on the uplift loads transmitted to the contact structure. These analyses show that the material properties of an outer contact structure and the amount

  10. An Archaeometallurgical Investigation of a Steel Sword from the Safavid Dynasty

    Science.gov (United States)

    Dini, Ghasem

    2018-02-01

    In this study, a steel sword belonging to the Safavid dynasty was investigated to identify its chemistry, microstructure, mechanical properties, and processing. To this aim, chemical and phase analyses, optical microscopy investigations and a hardness test were conducted. The results indicated that the sword blade material was plain carbon steel containing 1.42 wt.% C. The microstructure consisted of spheroidal cementite particles in a ferrite matrix, facilitating the formation of a curved sword. It seemed that a combination of heat treatment and metal-forming techniques (thermo-mechanical process) was utilized to obtain this microstructure.

  11. Rayleigh Number Criterion for Formation of A-Segregates in Steel Castings and Ingots

    DEFF Research Database (Denmark)

    Rad, M. Torabi; Kotas, Petr; Beckermann, C.

    2013-01-01

    A Rayleigh number-based criterion is developed for predicting the formation of A-segregates in steel castings and ingots. The criterion is calibrated using available experimental data for ingots involving 27 different steel compositions. The critical Rayleigh number above which A-segregates can b......, the primary reason for this over-prediction is persumed to be the presence of a central zone of equiaxed grains in the casting sections. A-segregates do not form when the grain structure is equiaxed. © The Minerals, Metals & Materials Society and ASM International 2013...

  12. A three-dimensional rupture analysis of steel liners anchored to concrete pressure and containment vessels

    International Nuclear Information System (INIS)

    Bangash, Y.

    1987-01-01

    Steel liners or plates are anchored to concrete pressure and containment vessels for nuclear and offshore facilities. Due to extreme loading conditions a liner may buckle due to the pull-out or shearing of anchors from the base metal and concrete. Under certain conditions attributed to loadings, liner metal deterioration and cracking of concrete behind the liner, the liner may fail by rupture. This paper presents a three-dimensional analysis of steel-concrete elements, using finite elements analysis in which a provision is made for liner instability, anchor strength and stiffness, concrete cracking and finally liner rupture. The analysis is tested first on an octagonal slab with and without an anchored steel liner. It is then extended to concrete pressure and containment vessels. The analytical results obtained are compared well with those available from the experimental tests and other sources. (author)

  13. Investigation of the hot ductility of a high-strength boron steel

    International Nuclear Information System (INIS)

    Güler, Hande; Ertan, Rukiye; Özcan, Reşat

    2014-01-01

    In this study, the high-temperature ductility behaviour of an Al–Si-coated 22MnB5 sheet was investigated. The mechanical properties of Al–Si-coated 22MnB5 boron steel were examined via hot tensile tests performed at temperatures ranging from 400 to 900 °C at a strain rate of 0.083 s −1 . The deformation and fracture mechanisms under hot tensile testing were considered in relation to the testing data and to the fracture-surface observations performed via SEM. The hot ductility of the tested boron steel was observed as a function of increasing temperature and the Al–Si-coated 22MnB5 boron steel exhibited a ductility loss at 700 °C

  14. A possible recycling method for high grade steels EAFD in polymer composites.

    Science.gov (United States)

    Niubó, M; Fernández, A I; Chimenos, J M; Haurie, L

    2009-11-15

    This work evaluates the feasibility of incorporating electric arc furnace dust (EAFD), as filler in a polymer matrix, to obtain a moldable heavyweight sheet, useful for acoustic insulation in automotive industry. For this purpose EAFD from a steel factory that manufactures high quality steels, was characterized and different formulations of composites were prepared. Physical and mechanical properties, as well as fire behaviour were tested and compared with a polymer composite compounded with common mineral fillers. Optimum formulation with 25% EAFD fulfils the RoHs Directive used by automotive industry to regulate heavy metals content. Leaching test was also performed on prepared composites to classify the material after use.

  15. 76 FR 67673 - Welded ASTM A-312 Stainless Steel Pipe From South Korea and Taiwan: Final Results of Expedited...

    Science.gov (United States)

    2011-11-02

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-580-810, A-583-815] Welded ASTM A-312... the antidumping duty orders on welded ASTM A-312 stainless steel pipe from South Korea and Taiwan... duty orders on welded ASTM A-312 stainless steel pipe from South Korea and Taiwan pursuant to section...

  16. A Review on Strengthening Steel Beams Using FRP under Fatigue

    Directory of Open Access Journals (Sweden)

    Mohamed Kamruzzaman

    2014-01-01

    Full Text Available In recent decades, the application of fibre-reinforced polymer (FRP composites for strengthening structural elements has become an efficient option to meet the increased cyclic loads or repair due to corrosion or fatigue cracking. Hence, the objective of this study is to explore the existing FRP reinforcing techniques to care for fatigue damaged structural steel elements. This study covers the surface treatment techniques, adhesive curing, and support conditions under cyclic loading including fatigue performance, crack propagation, and failure modes with finite element (FE simulation of the steel bridge girders and structural elements. FRP strengthening composites delay initial cracking, reduce the crack growth rate, extend the fatigue life, and decrease the stiffness decay with residual deflection. Prestressed carbon fibre-reinforced polymer (CFRP is the best strengthening option. End anchorage prevents debonding of the CRRP strips at the beam ends by reducing the local interfacial shear and peel stresses. Hybrid-joint, nanoadhesive, and carbon-flex can also be attractive for strengthening systems.

  17. A review on strengthening steel beams using FRP under fatigue.

    Science.gov (United States)

    Kamruzzaman, Mohamed; Jumaat, Mohd Zamin; Sulong, N H Ramli; Islam, A B M Saiful

    2014-01-01

    In recent decades, the application of fibre-reinforced polymer (FRP) composites for strengthening structural elements has become an efficient option to meet the increased cyclic loads or repair due to corrosion or fatigue cracking. Hence, the objective of this study is to explore the existing FRP reinforcing techniques to care for fatigue damaged structural steel elements. This study covers the surface treatment techniques, adhesive curing, and support conditions under cyclic loading including fatigue performance, crack propagation, and failure modes with finite element (FE) simulation of the steel bridge girders and structural elements. FRP strengthening composites delay initial cracking, reduce the crack growth rate, extend the fatigue life, and decrease the stiffness decay with residual deflection. Prestressed carbon fibre-reinforced polymer (CFRP) is the best strengthening option. End anchorage prevents debonding of the CRRP strips at the beam ends by reducing the local interfacial shear and peel stresses. Hybrid-joint, nanoadhesive, and carbon-flex can also be attractive for strengthening systems.

  18. A Review on Strengthening Steel Beams Using FRP under Fatigue

    Science.gov (United States)

    Jumaat, Mohd Zamin; Ramli Sulong, N. H.

    2014-01-01

    In recent decades, the application of fibre-reinforced polymer (FRP) composites for strengthening structural elements has become an efficient option to meet the increased cyclic loads or repair due to corrosion or fatigue cracking. Hence, the objective of this study is to explore the existing FRP reinforcing techniques to care for fatigue damaged structural steel elements. This study covers the surface treatment techniques, adhesive curing, and support conditions under cyclic loading including fatigue performance, crack propagation, and failure modes with finite element (FE) simulation of the steel bridge girders and structural elements. FRP strengthening composites delay initial cracking, reduce the crack growth rate, extend the fatigue life, and decrease the stiffness decay with residual deflection. Prestressed carbon fibre-reinforced polymer (CFRP) is the best strengthening option. End anchorage prevents debonding of the CRRP strips at the beam ends by reducing the local interfacial shear and peel stresses. Hybrid-joint, nanoadhesive, and carbon-flex can also be attractive for strengthening systems. PMID:25243221

  19. A Peristaltic Micro Pump Driven by a Rotating Motor with Magnetically Attracted Steel Balls

    Directory of Open Access Journals (Sweden)

    Zhaoying Zhou

    2009-04-01

    Full Text Available In this paper, we present a membrane peristaltic micro pump driven by a rotating motor with magnetically attracted steel balls for lab-on-a-chip applications. The fabrication process is based on standard soft lithography technology and bonding of a PDMS layer with a PMMA substrate. A linear flow rate range ~490 μL/min was obtained by simply varying the rotation speed of a DC motor, and a maximum back pressure of 592 Pa was achieved at a rotation speed of 43 rpm. The flow rate of the pump can also be adjusted by using steel balls with different diameters or changing the number of balls. Nevertheless, the micro pump can also work in high speed mode. A high back pressure up to 10 kPa was achieved at 500 rpm using a high speed DC motor, and an utmost flow rate up to 5 mL/min was reached.

  20. Effect of a steel toe cap on forefoot injury pattern in a cadaveric model.

    Science.gov (United States)

    Kwon, John Y; Campbell, John T; Myerson, Mark S; Jeng, Cliff L

    2011-04-01

    Crush injuries to the foot are a common workplace injury and a significant source of morbidity, disability and lost wages. Many regulatory bodies including the Occupational Safety and Health Administration (OSHA) recommend the use of safety shoes in certain occupations to help protect against these occupational hazards. However there remains controversy and paucity of published data regarding the protection afforded by a steel toe cap in regards to clinical injury pattern. This study looks to investigates the protective influence of a steel toe cap on crush injuries of the forefoot. Five non-osteoporotic paired cadaver lower extremities were appropriately fitted to a standard work boot. One foot of each pair was fitted into a steel toe capped boot (designated ``ST'' group) while the other foot was fitted into an identical version of the work boot but without the protective steel toe cap (designated ``NST'' group). Each foot was crushed using a custom designed rig with a load of 150 lb dropped from a calibrated height of 3 feet to the forefoot. X-rays were obtained to assess fracture location & comminution and stress fluoroscopy was used to assess for any ligamentous Lisfranc injury. The NST group averaged 8.2 fractured bones per foot while the ST group averaged 3.6 fractured bones per foot (p = 0.001). The NST group demonstrated significantly more metatarsal fractures (3.2 fractures/foot) versus the ST group (one fracture/foot) (p = 0.020). The NST group demonstrated significantly more proximal phalanx fractures (4.2 fractures/foot) compared to the ST group (2.6 fractures/foot) (p = 0.035). Middle and distal phalanx fractures were not significantly different between the two groups. A higher percentage of the bones fractured were deemed comminuted in the NST group (53.6%) versus the ST group (38.8%) although this did not reach statistical significance. This study demonstrated that the steel toe affords protective advantages in crush injuries to the foot in limiting

  1. Detection of Interfacial Debonding in a Rubber-Steel-Layered Structure Using Active Sensing Enabled by Embedded Piezoceramic Transducers.

    Science.gov (United States)

    Feng, Qian; Kong, Qingzhao; Jiang, Jian; Liang, Yabin; Song, Gangbing

    2017-09-01

    Rubber-steel-layered structures are used in many engineering applications. Laminated rubber-steel bearing, as a type of seismic isolation device, is one of the most important applications of the rubber-steel-layered structures. Interfacial debonding in rubber-steel-layered structures is a typical failure mode, which can severely reduce their load-bearing capacity. In this paper, the authors developed a simple but effective active sensing approach using embedded piezoceramic transducers to provide an in-situ detection of the interfacial debonding between the rubber layers and steel plates. A sandwiched rubber-steel-layered specimen, consisting of one rubber layer and two steel plates, was fabricated as the test specimen. A novel installation technique, which allows the piezoceramic transducers to be fully embedded into the steel plates without changing the geometry and the surface conditions of the plates, was also developed in this research. The active sensing approach, in which designed stress waves can propagate between a pair of the embedded piezoceramic transducers (one as an actuator and the other one as a sensor), was employed to detect the steel-rubber debonding. When the rubber-steel debonding occurs, the debonded interfaces will attenuate the propagating stress wave, so that the amplitude of the received signal will decrease. The rubber-steel debonding was generated by pulling the two steel plates in opposite directions in a material-testing machine. The changes of the received signal before and after the debonding were characterized in a time domain and further quantified by using a wavelet packet-based energy index. Experiments on the healthy rubber-steel-layered specimen reveal that the piezoceramic-induced stress wave can propagate through the rubber layer. The destructive test on the specimen demonstrates that the piezoceramic-based active sensing approach can effectively detect the rubber-steel debonding failure in real time. The active sensing

  2. Synthesis and Characterization of Oxide Dispersion Strengthened Ferritic Steel via a Sol-Gel Route

    International Nuclear Information System (INIS)

    Sun Qinxing; Zhang Tao; Wang Xianping; Fang Qianfeng; Hu Jing; Liu Changsong

    2012-01-01

    Nanocrystalline oxide dispersion strengthened (ODS) ferritic steel powders with nominal composition of Fe-14Cr-3W-0.3Ti-0.4Y 2 O 3 are synthesized using sol-gel method and hydrogen reduction. At low reduction temperature the impurity phase of CrO is detected. At higher reduction temperature the impurity phase is Cr 2 O 3 which eventually disappears with increasing reduction time. A pure ODS ferritic steel phase is obtained after reducing the sol-gel resultant products at 1200°C for 3 h. The HRTEM and EDS mapping indicate that the Y 2 O 3 particles with a size of about 15 nm are homogenously dispersed in the alloy matrix. The bulk ODS ferritic steel samples prepared from such powders exhibit good mechanical performance with an ultimate tensile stress of 960 MPa.

  3. Distinct Fracture Patterns in Construction Steels for Reinforced Concrete under Quasistatic Loading— A Review

    Directory of Open Access Journals (Sweden)

    Fernando Suárez

    2018-03-01

    Full Text Available Steel is one of the most widely used materials in construction. Nucleation growth and coalescence theory is usually employed to explain the fracture process in ductile materials, such as many metals. The typical cup–cone fracture pattern has been extensively studied in the past, giving rise to numerical models able to reproduce this pattern. Nevertheless, some steels, such as the eutectoid steel used for manufacturing prestressing wires, does not show this specific shape but a flat surface with a dark region in the centre of the fracture area. Recent studies have deepened the knowledge on these distinct fracture patterns, shedding light on some aspects that help to understand how damage begins and propagates in each case. The numerical modelling of both fracture patterns have also been discussed and reproduced with different approaches. This work reviews the main recent advances in the knowledge on this subject, particularly focusing on the experimental work carried out by the authors.

  4. Thermochemical surface engineering of steels

    DEFF Research Database (Denmark)

    Thermochemical Surface Engineering of Steels provides a comprehensive scientific overview of the principles and different techniques involved in thermochemical surface engineering, including thermodynamics, kinetics principles, process technologies and techniques for enhanced performance of steels...

  5. Brillouin Corrosion Expansion Sensors for Steel Reinforced Concrete Structures Using a Fiber Optic Coil Winding Method

    Directory of Open Access Journals (Sweden)

    Xingjun Lv

    2011-11-01

    Full Text Available In this paper, a novel kind of method to monitor corrosion expansion of steel rebars in steel reinforced concrete structures named fiber optic coil winding method is proposed, discussed and tested. It is based on the fiber optical Brillouin sensing technique. Firstly, a strain calibration experiment is designed and conducted to obtain the strain coefficient of single mode fiber optics. Results have shown that there is a good linear relationship between Brillouin frequency and applied strain. Then, three kinds of novel fiber optical Brillouin corrosion expansion sensors with different fiber optic coil winding packaging schemes are designed. Sensors were embedded into concrete specimens to monitor expansion strain caused by steel rebar corrosion, and their performance was studied in a designed electrochemical corrosion acceleration experiment. Experimental results have shown that expansion strain along the fiber optic coil winding area can be detected and measured by the three kinds of sensors with different measurement range during development the corrosion. With the assumption of uniform corrosion, diameters of corrosion steel rebars were obtained using calculated average strains. A maximum expansion strain of 6,738 με was monitored. Furthermore, the uniform corrosion analysis model was established and the evaluation formula to evaluate mass loss rate of steel rebar under a given corrosion rust expansion rate was derived. The research has shown that three kinds of Brillouin sensors can be used to monitor the steel rebar corrosion expansion of reinforced concrete structures with good sensitivity, accuracy and monitoring range, and can be applied to monitor different levels of corrosion. By means of this kind of monitoring technique, quantitative corrosion expansion monitoring can be carried out, with the virtues of long durability, real-time monitoring and quasi-distribution monitoring.

  6. Brillouin corrosion expansion sensors for steel reinforced concrete structures using a fiber optic coil winding method.

    Science.gov (United States)

    Zhao, Xuefeng; Gong, Peng; Qiao, Guofu; Lu, Jie; Lv, Xingjun; Ou, Jinping

    2011-01-01

    In this paper, a novel kind of method to monitor corrosion expansion of steel rebars in steel reinforced concrete structures named fiber optic coil winding method is proposed, discussed and tested. It is based on the fiber optical Brillouin sensing technique. Firstly, a strain calibration experiment is designed and conducted to obtain the strain coefficient of single mode fiber optics. Results have shown that there is a good linear relationship between Brillouin frequency and applied strain. Then, three kinds of novel fiber optical Brillouin corrosion expansion sensors with different fiber optic coil winding packaging schemes are designed. Sensors were embedded into concrete specimens to monitor expansion strain caused by steel rebar corrosion, and their performance was studied in a designed electrochemical corrosion acceleration experiment. Experimental results have shown that expansion strain along the fiber optic coil winding area can be detected and measured by the three kinds of sensors with different measurement range during development the corrosion. With the assumption of uniform corrosion, diameters of corrosion steel rebars were obtained using calculated average strains. A maximum expansion strain of 6,738 με was monitored. Furthermore, the uniform corrosion analysis model was established and the evaluation formula to evaluate mass loss rate of steel rebar under a given corrosion rust expansion rate was derived. The research has shown that three kinds of Brillouin sensors can be used to monitor the steel rebar corrosion expansion of reinforced concrete structures with good sensitivity, accuracy and monitoring range, and can be applied to monitor different levels of corrosion. By means of this kind of monitoring technique, quantitative corrosion expansion monitoring can be carried out, with the virtues of long durability, real-time monitoring and quasi-distribution monitoring.

  7. Survey of postirradiation heat treatment as a means to mitigate radiation embrittlement of reactor vessel steels

    International Nuclear Information System (INIS)

    Hawthorne, J.R.

    1979-01-01

    Nuclear-radiation service typically produces a progressive reduction in the notch ductility of low-alloy steels. The reduction is manifested by a decrease in Charpy-V (Csub(v)) upper-shelf energy level and by an elevation in temperature of the ductile-to-brittle transition. Post irradiation heat treatment (annealing) is being investigated as a method for the reversal of these detrimental radiation effects for reactor-vessel steels. This study was undertaken to analyze factors which could affect annealing response, report data available to qualify suspected influences on annealing, and summarize experimental results generated for many commercially produced reactor materials and companion materials produced in the laboratory

  8. A computational model for the carbon transfer in stainless steel sodium systems

    International Nuclear Information System (INIS)

    Casadio, S.; Scibona, G.

    1980-01-01

    A method is proposed of computing the carbon transfer in the type 316, 304 and 321 stainless steels in sodium environment as a function of temperature, exposure time and carbon concentration in the sodium. The method is based on the criteria developed at ANL by introducing some simplifications and takes also into account the correlations obtained at WARD. Calculated carbon profiles are compared both with experimental data and with the results available by the other computer methods. The limits for quantitative predictions of the stainless steel carburization or decarburization exposed in a specific environment are discussed. (author)

  9. A Study on the Characteristics of Corrosion in Cold Worked Flexible STS 304 Stainless Steel Pipes

    International Nuclear Information System (INIS)

    Kim, In Soo; Kim, Sung Jin

    1993-01-01

    Effects of cold working on the corrosion resistance of austenitic STS 304 stainless steel pipes were investigated using anodic polarization method, EDX analysis and SEM technique. Corrosion products had a lots of S and Cl - ion. Generally, corrosion patterns as a result of STS 304 stainless steel to concrete environment were proceeded in the order of the pitting to intergranular corrosion. In the case of the flexible pipes were covered tightly with other polymer materials, crevice corrosion occurred to a much greater extent on austenitic than on martensitic region

  10. Hot ductility behavior of a low carbon advanced high strength steel (AHSS) microalloyed with boron

    OpenAIRE

    Mejía, Ignacio; Bedolla Jacuinde, Arnoldo; Maldonado, Cuauhtémoc; Cabrera Marrero, José M.

    2011-01-01

    The current study analyses the influence of boron addition on the hot ductility of a low carbon advanced high strength NiCrVCu steel. For this purpose hot tensile tests were carried out at different temperatures (650, 750, 800, 900 and 1000 ◦C) at a constant true strain rate of 0.001 s−1. Experimental results showed a substantial improvement in hot ductility for the low carbon advanced high strength steel when microalloyed with boron compared with that without boron addition. Nevertheless,...

  11. Modeling of the structural response to fire of a high-rise steel building

    DEFF Research Database (Denmark)

    Gentili, Filippo; Giuliani, Luisa; Bontempi, Franco

    2011-01-01

    Observations from the tests and the real fire investigations have consistently shown that the performance of a whole steel-framed building in fire is very different from the performance of its individual members (Usmani et al, 2000). In this context, it is of interest to investigate the failures...... problems due to the triggering of local mechanism should be overcome to this purpose. In this paper, a steel structure has been considered as case study and the response of the structural system to fire and fire effects has been investigated with the avail of a finite element commercial code. These kinds...

  12. Modeling of roughness effect on hydrogen permeation in a low carbon steel

    OpenAIRE

    Carreño, J. A.; Uribe, I.; Carrillo, J. C.

    2003-01-01

    A model is presented to evaluate the effect of the roughness and the profile of concentration of hydrogen in a low carbon steel. The model takes advantage of the Fick's Second Law, to predict the transport of hydrogen in the steel. The problem is treated as a variational one and its space solution is made numerically by means of the Finite Elements Method, while the temporal equation is solved via the Finite Differences Method, in order to determine the concentration profiles of Hydrogen in t...

  13. Metallurgical and acoustical characterization of a hydroformed, 304 stainless steel, Caribbean-style musical pan

    International Nuclear Information System (INIS)

    Murr, L.E.; Gaytan, S.M.; Lopez, M.I.; Bujanda, D.E.; Martinez, E.Y.; Whitmyre, G.; Price, H.

    2008-01-01

    We report herein the metallurgical and acoustical characterization of hydroformed 304 stainless steel, Caribbean pans. These pans were fully tuned to chromatic tones and compared to a manufactured, low-carbon, Caribbean steel pan standard. Hydroformed platforms had a Vickers microindentation hardness of HV 345, which was reduced by annealing during pan fabrication to HV 270. Skirts welded to the hydroformed head had a microindentation hardness of HV 440. Microstructural characterization by light optical metallography and transmission electron microscopy illustrated microstructures (including grain structures) characteristic of these pan microindentation hardnesses

  14. Steel Industry Wastes.

    Science.gov (United States)

    Schmidtke, N. W.; Averill, D. W.

    1978-01-01

    Presents a literature review of wastes from steel industry, covering publications of 1976-77. This review covers: (1) coke production; (2) iron and steel production; (3) rolling operations; and (4) surface treatment. A list of 133 references is also presented. (NM)

  15. Magnetic property variation in carbon steel and chrome-molybdenum steel as a function of uniaxial stress noncoaxial with the magnetic field (abstract)

    International Nuclear Information System (INIS)

    Sablik, M.J.; Kaminski, D.A.; Jiles, D.C.; Biner, S.B.

    1993-01-01

    Magnescope 1 magnetic measurements were made on carbon steel specimens ranging from 0.1--0.8 wt %C and on chrome-molybdenum steel specimens cut from electric power plant pipes previously in service. The carbon steel specimens were heat-treated using three procedures: (1) spheroidization, (2) quenching, and (3) quench and tempering. The specimens were subjected to uniaxial tension up to 40 ksi. The inspection head was aligned so that the magnetic field was oriented at different angles with respect to the stress axis. Magnetic properties (such as coercivity and maximum differential permeability) were extracted from digitized magnetic hysteresis loop measurements. Magnetic properties were studied as a function of stress at each angle of stress-field orientation. To our knowledge, such a comprehensive study of noncoaxial stress and field effects has never been accomplished before for such a wide variety of steel specimens. Results for the various materials are presented for different orientation angles and compared to numerical results from the noncoaxial magnetomechanical hysteresis model of Sablik et al. 2

  16. Passivation behavior of a ferritic stainless steel in concentrated alkaline solutions

    Directory of Open Access Journals (Sweden)

    Arash Fattah-alhosseini

    2015-10-01

    Full Text Available The passivation behavior of AISI 430 ferritic stainless steel was investigated in concentrated alkaline solutions in relation to several test parameters, using electrochemical techniques. Increasing solution pH (varying from 11.5 to 14.0 leads to an increase in the corrosion rate of the alloy. Mott–Schottky analysis revealed that passive films formed on AISI 430 ferritic stainless steel behave as n-type semiconductor and the donor densities increased with pH. Electrochemical impedance spectroscopy (EIS results showed that the reciprocal capacitance of the passive film is directly proportional to its thickness, which decreases with pH increase. The results revealed that for this ferritic stainless steel in concentrated alkaline solutions, decreasing the solution pH offers better conditions for forming passive films with higher protection behavior, due to the growth of a much thicker and less defective film.

  17. Precipitation-hardening stainless steels with a shape-memory effect

    Science.gov (United States)

    Sagaradze, V. V.; Afanasiev, S. V.; Volkova, E. G.; Zavalishin, V. A.

    2016-02-01

    The possibility of obtaining the shape-memory effect as a result of the γ → ɛ → γ transformations in aging stainless steels strengthened by VC carbides has been investigated. Regimes are given for strengthening aging (at 650 and 720°C) for stainless steels that predominantly contain (in wt %) 0.06-0.45C, 1-2V, 2-5Si, 9 and 13-14Cr. The values of reversible deformation e (amount of shape-memory effect) determined after heating to 400°C in samples preliminarily deformed to 3.5-4% vary from 0.15 to 2.7%, depending on the composition of the steels and regimes of stabilizing and destabilizing aging.

  18. Unit rupture work as a criterion for quantitative estimation of hardenability in steel

    International Nuclear Information System (INIS)

    Kramarov, M.A.; Orlov, E.D.; Rybakov, A.B.

    1980-01-01

    Shown is possible utilization of high sensitivity of resistance to fracture of structural steel to the hardenability degree in the course of hardening to find the quantitative estimation of the latter one. Proposed is a criterion kappa, the ratio of the unit rupture work in the case of incomplete hardenability (asub(Tsub(ih))) under investigation, and the analoguc value obtained in the case of complete hardenability Asub(Tsub(Ch)) at the testing temperature corresponding to the critical temperature Tsub(100(M). Confirmed is high criterion sensitivity of the hardened steel structure on the basis of experimental investigation of the 40Kh, 38KhNM and 38KhNMFA steels after isothermal hold-up at different temperatures, corresponding to production of various products of austenite decomposition

  19. A New Green Ionic Liquid-Based Corrosion Inhibitor for Steel in Acidic Environments

    Directory of Open Access Journals (Sweden)

    Ayman M. Atta

    2015-06-01

    Full Text Available This work examines the use of new hydrophobic ionic liquid derivatives, namely octadecylammonium tosylate (ODA-TS and oleylammonium tosylate (OA-TS for corrosion protection of steel in 1 M hydrochloric acid solution. Their chemical structures were determined from NMR analyses. The surface activity characteristics of the prepared ODA-TS and OA-TS were evaluated from conductance, surface tension and contact angle measurements. The data indicate the presence of a double bond in the chemical structure of OA-TS modified its surface activity parameters. Potentiodynamic polarization, electrochemical impedance spectroscopy (EIS measurements, scanning electron microscope (SEM, Energy dispersive X-rays (EDX analysis and contact angle measurements were utilized to investigate the corrosion protection performance of ODA-TS and OA-TS on steel in acidic solution. The OA-TS and ODA-TS compounds showed good protection performance in acidic chloride solution due to formation of an inhibitive film on the steel surface.

  20. A computer system to aid in the planning of steel rolls cuts

    Directory of Open Access Journals (Sweden)

    Nelson Maculan

    2007-03-01

    Full Text Available The planning of cuts in steel rolls is a combinatory optimization problem. Some companies of the metallurgical industry use the steel cold lamination process so that it acquires the necessary physical properties. In this case, the cutting patterns should consist of compartments of items compatible with the lamination process, hindering the task of cuts planning. A compartment represents an intermediate roll to be laminated, so that it is possible to combine intermediate rolls with different lamination needs in the same roll of the stock. In this work the prototype of the RollCut System will be presented to aid with the cuts planning.

  1. A discussion for stabilization time of carbon steel in atmospheric corrosion

    Science.gov (United States)

    Zhang, Zong-kai; Ma, Xiao-bing; Cai, Yi-kun

    2017-09-01

    Stabilization time is an important parameter in long-term prediction of carbon steel corrosion in atmosphere. The range of the stabilization time of carbon steel in atmospheric corrosion has been published in many scientific literatures. However, the results may not precise because engineering experiences is dominant. This paper deals with the recalculation of stabilization time based on ISO CORRAG program, and analyzes the results and makes a comparison to the data mentioned above. In addition, a new thinking to obtain stabilization time will be proposed.

  2. Combating Wear of ASTM A36 Steel by Surface Modification Using Thermally Sprayed Cermet Coatings

    OpenAIRE

    Shibe, Vineet; Chawla, Vikas

    2016-01-01

    Thermal spray coatings can be applied economically on machine parts to enhance their requisite surface properties like wear, corrosion, erosion resistance, and so forth. Detonation gun (D-Gun) thermal spray coatings can be applied on the surface of carbon steels to improve their wear resistance. In the present study, alloy powder cermet coatings WC-12% Co and Cr3C2-25% NiCr have been deposited on ASTM A36 steel with D-Gun thermal spray technique. Sliding wear behavior of uncoated ASTM A36 ste...

  3. The effect of grain size on the mechanical response of a metastable austenitic stainless steel

    Directory of Open Access Journals (Sweden)

    Sinclair C.W.

    2013-11-01

    Full Text Available The combination of high environmental resistance and excellent strength, elongation and energy absorption make austenitic stainless steels potentially attractive for transportation applications. In the case of metastable grades that undergo a strain induced martensitic transformation it is possible to significantly change the mechanical properties simply by changing the austenite grain size. Predicting such behaviour using physically based models is, however, extremely challenging. Here, some recent work on the coupling between grain size and mechanical response will be presented for a metastable AISI 301 LN stainless steel. Successes and continuing challenges will be highlighted.

  4. Is galvanic corrosion between titanium alloy and stainless steel spinal implants a clinical concern?

    Science.gov (United States)

    Serhan, Hassan; Slivka, Michael; Albert, Todd; Kwak, S Daniel

    2004-01-01

    Surgeons are hesitant to mix components made of differing metal classes for fear of galvanic corrosion complications. However, in vitro studies have failed to show a significant potential for galvanic corrosion between titanium and stainless steel, the two primary metallic alloys used for spinal implants. Galvanic corrosion resulting from metal mixing has not been described in the literature for spinal implant systems. To determine whether galvanic potential significantly affects in vitro corrosion of titanium and stainless steel spinal implant components during cyclical compression bending. Bilateral spinal implant constructs consisting of pedicle screws, slotted connectors, 6.35-mm diameter rods and a transverse rod connector assembled in polyethylene test blocks were tested in vitro. Two constructs had stainless steel rods with mixed stainless steel (SS-SS) and titanium (SS-Ti) components, and two constructs had titanium rods with mixed stainless steel (Ti-SS) and titanium (Ti-Ti) components. Each construct was immersed in phosphate-buffered saline (pH 7.4) at 37 C and tested in cyclic compression bending using a sinusoidal load-controlling function with a peak load of 300 N and a frequency of 5 Hz until a level of 5 million cycles was reached. The samples were then removed and analyzed visually for evidence of corrosion. In addition, scanning electron microscopy (SEM) and energy dispersive spectrometry (EDS) were used to evaluate the extent of corrosion at the interconnections. None of the constructs failed during testing. Gross observation of the implant components after disassembly revealed that no corrosion had occurred on the surface of the implants that had not been in contact with another component. The Ti-Ti interfaces showed some minor signs of corrosion only detectable using SEM and EDS. The greatest amount of corrosion occurred at the SS-SS interfaces and was qualitatively less at the SS-Ti and Ti-SS interfaces. The results from this study indicate

  5. A study of the mechanisms for the irradiation embrittlement of reactor pressure vessel steels

    International Nuclear Information System (INIS)

    Solt, G.; Zimmermann, U.; Waeber, W.B.; Mercier, O.; Frisius, F.; Ghazi-Wakili, K.

    1987-03-01

    Irradiation damage particles were detected by small angle neutron scattering and positron annihilation techniques in two RPV steels. The particle radii were 8A and 14A prior to heat treatments for the plate and weldment, respectively; annealing leads to coarsening in the weldment, the volume fraction remains essentially constant at about 0.14%. The model of copper-rich precipitates 'diluted' by Mn atoms or, alternatively, by vacancy agglomerates is consistent with the neutron scattering data, the presence of simple voids in the weldment would contradict the positron results. Preliminary results on these steels and also on related alloys by methods 'new' in this field are reported. (author)

  6. Effect of tempering time on the ballistic performance of a high strength armour steel

    OpenAIRE

    Jena, Pradipta Kumar; Senthil P., Ponguru; K., Siva Kumar

    2016-01-01

    The investigation describes and analyses the effect of tempering time on the mechanical and ballistic performance of a high strength armour steel. The steel is subjected to tempering at 300 °C for 2, 24 and 48 h. A marginal variation in strength and hardness is observed with increase in tempering time, whereas ductility and Charpy impact values are found to be decreasing. Ballistic performance of the samples are evaluated by impacting 7.62 mm and 12.7 mm armour piercing projectiles at 0° angl...

  7. Impact of steel slag on the ammonium adsorption by zeolite and a new configuration of zeolite-steel slag substrate for constructed wetlands.

    Science.gov (United States)

    Shi, Pengbo; Jiang, Yingbo; Zhu, Hongtao; Sun, Dezhi

    2017-07-01

    The CaO dissolution from slag, as well as the effects of influencing parameters (i.e. pH and Ca 2+ concentration) on the ammonium adsorption onto zeolite, was systematically studied in this paper. Modeling results of Ca 2+ and OH - release from slag indicated that pseudo-second-order reaction had a better fitness than pseudo-first-order reaction. Changing pH value from 7 to 12 resulted in a drastic reduction of the ammonium adsorption capacity on zeolite, from the peak adsorption capacity at pH 7. High Ca 2+ concentration in solution also inhibited the adsorption of ammonium onto zeolite. There are two proposed mechanisms for steel slag inhibiting the ammonium adsorption capacity of zeolite. On the one hand, OH - released from steel slag can react with ammonium ions to produce the molecular form of ammonia (NH 3 ·H 2 O), which would cause the dissociation of NH 4 + from zeolite. On the other hand, Ca 2+ could replace the NH 4 + ions to adhere onto the surface of zeolite. An innovative substrate filling configuration with zeolite placed upstream of the steel slag was then proposed to eliminate the disadvantageous effects of steel slag. Experimental results showed that this novel filling configuration was superior to two other filling configurations in terms of ammonium removal.

  8. Reactor pressure vessel steels ASTM A533B and A508 Cl.2

    International Nuclear Information System (INIS)

    Pelli, R.; Kemppainen, M.; Toerroenen, K.

    1979-11-01

    This report presents the tensile test results of steels ASTM A533B and A508 Cl.2 obtained in connection with a programme initiated to gather and create information needed for the assessment of the structural integrity of the reactor pressure vessels. The tensile properties were studied between -196 and 300 degC varying austenitizing and tempering temperatures and having two different carbon contents for the heats of A533B. (author)

  9. Microstructural Developments Leading to New Advanced High Strength Sheet Steels: A Historical Assessment of Critical Metallographic Observations

    Energy Technology Data Exchange (ETDEWEB)

    Matlock, David K [CSM/ASPPRC; Thomas, Larrin S [CSM/ASPPRC; Taylor, Mark D [CSM/ASPPRC; De Moor, Emmanuel [CSM/ASPPRC; Speer, John G [CSM/ASPPRC

    2015-08-03

    In the past 30+ years significant advancements have been made in the development of higher strength sheet steels with improved combinations of strength and ductility that have enabled important product improvements leading to safer, lighter weight, and more fuel efficient automobiles and in other applications. Properties of the primarily low carbon, low alloy steels are derived through careful control of time-temperature processing histories designed to produce multiphase ferritic based microstructures that include martensite and other constituents including retained austenite. The basis for these developments stems from the early work on dual-phase steels which was the subject of much interest. In response to industry needs, dual-phase steels have evolved as a unique class of advanced high strength sheet steels (AHSS) in which the thermal and mechanical processing histories have been specifically designed to produce constituent combinations for the purpose of simultaneously controlling strength and deformation behavior, i.e. stress-strain curve shapes. Improvements continue as enhanced dual-phase steels have recently been produced with finer microstructures, higher strengths, and better overall formability. Today, dual phase steels are the primary AHSS products used in vehicle manufacture, and several companies have indicated that the steels will remain as important design materials well into the future. In this presentation, fundamental results from the early work on dual-phase steels will be reviewed and assessed in light of recent steel developments. Specific contributions from industry/university cooperative research leading to product improvements will be highlighted. The historical perspective provided in the evolution of dual-phase steels represents a case-study that provides important framework and lessons to be incorporated in next generation AHSS products.

  10. The creep-fatigue crack growth behaviour of a 1CrMoV rotor steel

    International Nuclear Information System (INIS)

    Priest, R.H.; Miller, D.A.; Gladwin, D.N.; Maguire, J.

    1989-01-01

    Crack growth rates under simultaneous creep-fatigue conditions have been quantified for a 1CrMoV rotor steel. Measured growth rates were partitioned into cyclic and hold period contributions and these characterized by the relevant fracture mechanics parameters K and C. Cyclic growth rates measured in the creep-fatigue tests were enhanced compared with pure fatigue rates. This observation is compared with the behaviour of other steels and explained by quantitative metallography. The resulting crack growth equation can be used during integrity assessments for plant components containing cracks which are subject to thermal fatigue

  11. Sulphide stress corrosion behaviour of a nickel coated high-strength low-alloyed steel

    Energy Technology Data Exchange (ETDEWEB)

    Salvago, G; Fumagalli, G; Cigada, A; Scolari, P

    1987-01-01

    The sulphide stress corrosion cracking (SSCC) of the quenched and tempered AISI 4137 H steel either bare or coated with nickel alloys was examined. Both traditional electrochemical and linear elastic fracture mechanics methods were used to examine cracking in the NACE environment and in environments simulating the geothermal fluids found in the area of Larderello in Italy. Some tests were carried out on a geothermal well in Ferrara. High nickel content coatings seem to increase the SSCC resistance of the AISI 4137-H steel. Galvanic couplings effects are possible factors responsible for the behaviour in SSCC.

  12. The influence of temperature on the tensile properties of a super duplex stainless steel

    International Nuclear Information System (INIS)

    Girones, A.; Mateo, A.; Llanes, L.; Anglada, M

    2001-01-01

    Tensile tests, at temperatures ranging between 275 and 475 degree centigree were performed in a superduplex stainless steel EN 1.4410. The dependence of yield stress and ultimate tensile strength on temperature indicates the existence of dynamic strain aging (DSA). In order to evaluate the influence of strain rate on this phenomenon, tests were conducted at two different strain rates, both at 325 degree centigree, temperature at which DSA is maximum for this materials. The results shows that the flow stress has an inverse strain rate sensitivity which confirms the existence of DSA in the steel under study. (Author) 10 refs

  13. Nitrogen-alloyed martensitic steels

    International Nuclear Information System (INIS)

    Berns, H.

    1988-01-01

    A report is presented on initial results with pressure-nitrided martensitic steels. In heat-resistant steels, thermal stability and toughness are raised by nitrogen. In cold work steel, there is a more favourable corrosion behaviour. (orig./MM) [de

  14. 76 FR 13665 - Arcelor Mittal, Formerly Known as Mittal Steel Walker Wire, a Subsidiary of Arcelor Mittal...

    Science.gov (United States)

    2011-03-14

    ... Known as Mittal Steel Walker Wire, a Subsidiary of Arcelor Mittal--Montreal, Including On-Site Leased... Steel Walker Wire, a subsidiary of Arcelor Mittal-- Montreal, including on-site leased workers from... Walker Wire, Inc., Ferndale, Michigan, separated from employment on or after July 23, 2006 through August...

  15. Transfer of bacteria between stainless steel and chicken meat: A CLSM and DGGE study of biofilms

    Directory of Open Access Journals (Sweden)

    Christine C. Gaylarde

    2016-08-01

    Full Text Available This study aimed to assess the interaction between bacteria and food processing surfaces using novel methods. Microbial cross contamination between stainless steel, a common food processing material, and raw chicken was studied using microbiological culture, specialized microscope and molecular techniques. Confocal laser scanning microscopy (CLSM allowed the visualization of biofilms containing single or dual species of Escherichia coli O157:H7, Salmonella typhimurium, Bacillus cereus, Staphylococcus aureus and Pseudomonas aeruginosa, formed after 6 days’ incubation on stainless steel or 4h on raw chicken. The results provided information on intra-biofilm location and stratification of species within dual species biofilms. Top-to-bottom Z-stack images revealed that, on both materials, S. typhimurium and E. coli attached concurrently, the former in greater numbers. E. coli and B. cereus segregated on steel, E. coli more frequent near the metal surface, B. cereus almost the only species in outer layers. Few cells of S. aureus, found at all depths, were seen in the 2.9 µm thick biofilm on steel with E. coli. Greatest attachment was shown by P. aeruginosa, followed by S. typhimurium, E. coli and finally Gram positive species. Large amounts of EPS in P. aeruginosa biofilms made visualization difficult on both materials, but especially on chicken meat, a limitation of this technique. Nevertheless, CLSM was useful for determining time sequence of adhesion and species makeup of thin biofilms. The technique showed that five min contact between bacterially-contaminated chicken and sterile steel resulted in greatest transfer of P. aeruginosa, followed by S. typhimurium. This was confirmed using DGGE. Gram positive bacteria transferred poorly. A biofilm containing 2.3 × 105  cfu·cm−2 B. cereus on steel transferred an undetectable number of cells to chicken after 5 min contact. This species was unable to form biofilm on chicken when incubated for 4 h

  16. Flat ended steel wires, backscattering targets for calibrating over a large dynamic range

    NARCIS (Netherlands)

    Lubbers, Jaap; Graaff, Reindert

    2006-01-01

    A series of flat ended stainless steel wires was constructed and experimentally evaluated as point targets giving a calibrated backscattering over a large range (up to 72 dB) for ultrasound frequencies in the range 2 to 10 MHz. Over a range of 36 dB, theory was strictly followed (within 1 dB),

  17. A Simple Experiment To Measure the Content of Oxygen in the Air Using Heated Steel Wool

    Science.gov (United States)

    Vera, Francisco; Rivera, Rodrigo; Nunez, Cesar

    2011-01-01

    The typical experiment to measure the oxygen content in the atmosphere uses the rusting of steel wool inside a closed volume of air. Two key aspects of this experiment that make possible a successful measurement of the content of oxygen in the air are the use of a closed atmosphere and the use of a chemical reaction that involves the oxidation of…

  18. Magnetic anisotropy of textured Nnsub(2,85)Nisub(0,15)Bsub(4)

    International Nuclear Information System (INIS)

    Vlasov, K.B.; Timoshchuk, V.I.; Sesekin, P.N.

    1975-01-01

    Magnetic measurements on Mnsub(2.85)Nisub(0.15)Bsub(4) alloy powder oriented in magnetic field were carried out. The alloy was made by sintering briquetted magnesium, boron, and nickel powders in an evacuated quartz ampule at a temperature of 1150 deg C for 40 h. The average particle size obtained was of an order of 30 μm. The sintered alloy was desintegrated to a particle size below 10 μm and resultant powder placed in a spirit-of-wine filled ampule. The orientation effect was caused by suspension cooling in a magnetic field, of 25 kOe to temperatures below the ferromagnetic transition point and was fixed by further cooling below alcohol freezing temperature. The research indicated that the pattern of magnetizing curves of the alloy in fields of an order of tens of kilooersteds was largely due to the crystallographic magnetic anisotropy energy

  19. A Gas Scheduling Optimization Model for Steel Enterprises

    Directory of Open Access Journals (Sweden)

    Niu Honghai

    2017-01-01

    Full Text Available Regarding the scheduling problems of steel enterprises, this research designs the gas scheduling optimization model according to the rules and priorities. Considering different features and the process changes of the gas unit in the process of actual production, the calculation model of process state and gas consumption soft measurement together with the rules of scheduling optimization is proposed to provide the dispatchers with real-time gas using status of each process, then help them to timely schedule and reduce the gas volume fluctuations. In the meantime, operation forewarning and alarm functions are provided to avoid the abnormal situation in the scheduling, which has brought about very good application effect in the actual scheduling and ensures the safety of the gas pipe network system and the production stability.

  20. Comparative study in the induced corrosion by sulfate reducing microorganisms, in a stainless steel 304L sensitized and a carbon steel API X65

    International Nuclear Information System (INIS)

    Diaz S, A.; Gonzalez F, E.; Arganis J, C.; Luna C, P.; Carapia M, L.

    2004-01-01

    In spite of the operational experience related with the presence of the phenomenon of microbiological corrosion (MIC) in industrial components, it was not but until the decade of the 80 s when the nuclear industry recognized its influence in some systems of Nuclear Generating Power plants. At the moment, diverse studies that have tried to explain the generation mechanism of this phenomenon exist; however, they are even important queries that to solve, especially those related with the particularities of the affected metallic substrates. Presently work, the electrochemical behavior of samples of stainless steel AISI 304L sensitized is evaluated and the carbon steel APIX65, before the action of sulfate reducing microorganisms low the same experimental conditions; found that for the APIX65 the presence of this type of bacteria promoted the formation of a stable biofilm that allowed the maintenance of the microorganisms that damaged the material in isolated places where stings were generated; while in the AISI 304L, it was not detected damage associated to the inoculated media. The techniques of Resistance to the Polarization and Tafel Extrapolation, allowed the calculation of the speed of uniform corrosion, parameter that doesn't seem to be influenced by the presence of the microorganisms; while that noise electrochemical it distinguished in real time, the effect of the sulfate reducing in the steel APIX65. (Author)

  1. A new model for fatigue damage accumulation of austenitic stainless steel under variable amplitude loading

    International Nuclear Information System (INIS)

    Taheri, S.; Vincent, L.; Le-Roux, J.C.

    2013-01-01

    The application of Miner's rule using a loading issued from a mock-up of a RHR system (removal heat system) of PWR plant, made of 304 steel gives a very important non-conservative fatigue life in strain control when strain fatigue curve is used. This result is due to the absence of sequence effect in Miner's rule. Many non linear damage accumulation models have been proposed to get a sequence effect. Shortcomings of some non linear damage accumulation models are discussed. So Smith-Watson-Topper and Fatemi-Socie criterions with a linear damage accumulation rule are then applied to experimental data. A major issue is the need for an elastic-plastic constitutive law which is difficult to propose in the presence of high cycle secondary hardening observed in austenitic stainless steels. A conservative model for fatigue damage accumulation under variable amplitude loading is then proposed for austenitic stainless steels in strain control, which does not need a constitutive law, but takes into account plasticity through cyclic strain stress curve. The model uses a linear damage accumulation rule. This model is based on the fact that for stainless steels, pre-hardening is detrimental for fatigue life in strain control, while it is beneficial in stress control. In the presence of low mean stress, the model is approved based on a large number of tests. Moreover the model allows to explain the larger detrimental effect of a tension mean stress in strain control tests than in stress control tests. (authors)

  2. Crowd-induced vibrations of a steel footbridge in Reykjavík

    DEFF Research Database (Denmark)

    Ingólfsson, Einar Thór; Gudmundsson, G. V.; Živanović, S.

    2012-01-01

    in relation to the results obtained from a controlled crowd test on a steel footbridge in Reykjavik, Iceland. A systematic quantification of the measured vibration response is carried out and the results are presented statistically through their probability distributions. Finally, testimonies from...

  3. Effects of the new fast forward rotating five-shift roster at a Dutch steel company

    NARCIS (Netherlands)

    Klein Hesselink, J.; Leede, J. de; Goudswaard, A.

    2010-01-01

    This article reports a field study of a shift roster change in a large steel producer. The changes in the roster are threefold: (1) from backward rotating to forward rotating; (2) from rather slow (three) to fast rotating (two consecutive shifts); (3) the number of days off after the night shifts

  4. Developing Customized Programs for Steel and Other Heavy Industries: A Case Study.

    Science.gov (United States)

    Day, Philip R., Jr.

    1984-01-01

    This article discusses the successful implementation of a unique customized training program for steel and other industries. A contextual framework for understanding both the process and the product is presented. Traditional labor management problems are examined as well as the DACUM (Developing a Curriculum) procedure of identifying job-related…

  5. Explosive Forming of Low Carbon Steel Sheet into a Stepped Disc Shape

    OpenAIRE

    S. Balasubramanian; S. Sarvat Ali; E.S. Bhagiradha Rao

    1984-01-01

    This paper deals with the explosive forming of deep drawing quality steel into a two stepped disc type shape. An attempt has been made to predict the forming parameters from theoretical considerations by equating the disc shape with an equivalent dome. Results of forming this shape in a single stage vis-a-vis forming in two stages are compared.

  6. Pathways to a low-carbon iron and steel industry in the medium-term : the case of Germany

    NARCIS (Netherlands)

    Arens, Marlene; Worrell, Ernst; Eichhammer, Wolfgang; Hasanbeigi, Ali; Zhang, Qi

    2017-01-01

    The iron and steel industry is a major industrial emitter of carbon dioxide globally and in Germany. If European and German climate targets were set as equal proportional reduction targets (referred to here as “flat” targets) among sectors, the German steel industry would have to reduce its carbon

  7. A transmission Kikuchi diffraction study of cementite in a quenched and tempered steel

    Energy Technology Data Exchange (ETDEWEB)

    Saleh, Ahmed A., E-mail: asaleh@uow.edu.au [School of Mechanical, Materials and Mechatronic Engineering, University of Wollongong, NSW 2522 (Australia); Casillas, Gilberto [Electron Microscopy Centre, University of Wollongong, NSW 2500 (Australia); Pereloma, Elena V. [School of Mechanical, Materials and Mechatronic Engineering, University of Wollongong, NSW 2522 (Australia); Electron Microscopy Centre, University of Wollongong, NSW 2500 (Australia); Carpenter, Kristin R. [School of Mechanical, Materials and Mechatronic Engineering, University of Wollongong, NSW 2522 (Australia); Plate Mill: Manufacturing, BlueScope Steel Ltd., Port Kembla, NSW 2505 (Australia); Killmore, Christopher R. [Research & Development: Sales & Marketing, BlueScope Steel Ltd., Port Kembla, NSW 2505 (Australia); Gazder, Azdiar A. [Electron Microscopy Centre, University of Wollongong, NSW 2500 (Australia)

    2016-04-15

    This is the first transmission Kikuchi diffraction (TKD) study to report the indexing of nano-sized cementite as distinct structures and its orientation relationship with the body-centered cubic matrix in a quenched and tempered steel. Crystallographic analysis via TKD and selected area diffraction returned the well-known Bagaryatskii and Isaichev orientation relationships. However, the indexing of nano-sized cementite via TKD was sensitive to the thickness of the electron transparent region such that TEM remains the most precise method to characterise such precipitates. - Highlights: • Nano-sized cementite in a QT steel has been investigated by TKD and TEM. • Cementite has been indexed as distinct structures via TKD. • Crystallographic analysis returned the Bagaryatskii and Isaichev ORs. • Success of TKD is sensitive to the thickness of the electron transparent region. • TEM remains the most precise technique to characterise nano-sized precipitates.

  8. A transmission Kikuchi diffraction study of cementite in a quenched and tempered steel

    International Nuclear Information System (INIS)

    Saleh, Ahmed A.; Casillas, Gilberto; Pereloma, Elena V.; Carpenter, Kristin R.; Killmore, Christopher R.; Gazder, Azdiar A.

    2016-01-01

    This is the first transmission Kikuchi diffraction (TKD) study to report the indexing of nano-sized cementite as distinct structures and its orientation relationship with the body-centered cubic matrix in a quenched and tempered steel. Crystallographic analysis via TKD and selected area diffraction returned the well-known Bagaryatskii and Isaichev orientation relationships. However, the indexing of nano-sized cementite via TKD was sensitive to the thickness of the electron transparent region such that TEM remains the most precise method to characterise such precipitates. - Highlights: • Nano-sized cementite in a QT steel has been investigated by TKD and TEM. • Cementite has been indexed as distinct structures via TKD. • Crystallographic analysis returned the Bagaryatskii and Isaichev ORs. • Success of TKD is sensitive to the thickness of the electron transparent region. • TEM remains the most precise technique to characterise nano-sized precipitates.

  9. Compositional homogeneity in a medical-grade stainless steel sintered with a Mn–Si additive

    International Nuclear Information System (INIS)

    Salahinejad, E.; Hadianfard, M.J.; Ghaffari, M.; Mashhadi, Sh. Bagheri; Okyay, A.K.

    2012-01-01

    In this paper, chemical composition uniformity in amorphous/nanocrystallization medical-grade stainless steel (ASTM ID: F2581) sintered with a Mn–Si additive was studied via scanning electron microscopy, energy dispersive X-ray spectroscopy, and transmission electron microscopy. The results show that as a result of sintering at 1000 °C, no dissociation of Mn–Si additive particles embedded in the stainless steel matrix occurs. In contrast, sintering at 1050 °C develops a relatively homogeneous microstructure from the chemical composition viewpoint. The aforementioned phenomena are explained by liquation of the Mn–Si eutectic additive, thereby wetting of the main powder particles, penetrating into the particle contacts and pore zones via capillary forces, and providing a path of high diffusivity. - Highlights: ► Local chemical composition in a sintered stainless steel was studied. ► Due to sintering at 1000 °C, no dissociation of additive particles occurs. ► Sintering at 1050 °C provides a uniform chemical composition.

  10. Hydrogen production by electrolysis of a phosphate solution on a stainless steel cathode

    International Nuclear Information System (INIS)

    De Silva Munoz, L.; Bergel, A.; Basseguy, R.; Feron, D.

    2010-01-01

    The catalytic properties of phosphate species, already shown on the reduction reaction in anaerobic corrosion of steels, are exploited here for hydrogen production. Phosphate species work as a homogeneous catalyst that enhances the cathodic current at mild pH values. A voltammetric study of the hydrogen evolution reaction is performed using phosphate solutions at different concentrations on 316L stainless steel and platinum rotating disk electrodes. Then, hydrogen is produced in an electrolytic cell using a phosphate solution as the catholyte. Results show that 316L stainless steel electrodes have a stable behaviour as cathodes in the electrolysis of phosphate solutions. Phosphate (1 M, pH 4. 0/5. 0) as the catholyte can equal the performance of a KOH 25%w solution with the advantage of working at mild pH values. The use of phosphate and other weak acids as catalysts of the hydrogen evolution reaction could be a promising technology in the development of electrolysis units that work at mild pH values with low-cost electrodes and construction materials. (authors)

  11. A comparison of low-chromium and high-chromium reduced-activation steels for fusion applications

    International Nuclear Information System (INIS)

    Klueh, R.L.; Maziasz, P.J.; Alexander, D.J.

    1996-01-01

    Ferritic steels have been considered candidate structural materials for first wall and blanket structures for fusion power plants since the late 1970s. The first steels considered in the United States were the conventional Cr-Mo steels Sandvik HT9 (nominally 12Cr-1Mo-0.25V-0.5W-0.5Ni-0.2C, here designated l2Cr-1MoVW), modified 9Cr-1Mo steel (9Cr-1Mo-0.2V-0.06Nb-0. IC, designated 9Cr-1MoVNb) and, to a lesser extent, 2 1/4Cr-1Mo steel (2.25Cr-Mo-0.1C). All compositions are in wt. %. The normalized-and-tempered 9 and 12Cr steels had a tempered martensite microstructure, and the normalized-and-tempered 2 1/4 Cr steel had a tempered bainite microstructure. This report describes chromium steels tested in normalized and tempered conditions. Miniature tensile and Charpy specimens were tested

  12. AFM study of the early corrosion of a high strength steel in a diluted sodium chloride solution

    International Nuclear Information System (INIS)

    Sanchez, Javier; Fullea, Jose; Andrade, Carmen; Gaitero, Juan J.; Porro, Antonio

    2008-01-01

    The high strength steels employed as reinforcement in pre-stressed concrete structures are drawn wire steels of eutectoid composition with a pearlitic microstructure. This work is focused on the study, by atomic force microscopy, of the early stages of the corrosion of such steels as a consequence of their exposition to a sodium chloride solution. The obtained images show the pearlitic microstructure of the steel, with a preferential attack of the ferrite phase and the cementite acting as a cathode. The corrosion rate was determined by calculating the amount of material lost from a roughness analysis. The obtained results are in good agreement with the predictions of Galvelel's theory, according to which the corrosion rate slows down as the pit depth increases

  13. Mechanical properties of dynamic diffusion bonded joints in a mild alloy steel

    International Nuclear Information System (INIS)

    Gomez de Salazar, J. M.; Urena, A.; Menendez, M.

    2001-01-01

    Mechanical properties in Dynamic Diffusion Bonded (DDB) in a A.S.T.M. 1045 steel (=.45%C) joints were studied. The thermomechanical cycle added to the process, favours both the initial deformation stage and probably the diffusion mechanisms which participate in bond formation. (Author) 11 refs

  14. Resistance spot welding of a complicated joint in new advanced high strength steel

    NARCIS (Netherlands)

    Joop Pauwelussen; Nick den Uijl

    2015-01-01

    The goal of this article is to investigate resistance spot welding of a complicated welding configuration of three sheets of dissimilar steel sheet materials with shunt welds, using simulations. The configuration used resembles a case study of actual welds in automotive applications. One of the

  15. Study of cladding toughness in a pressure vessel steel water reactor

    International Nuclear Information System (INIS)

    Soulat, P.; Al Mundheri, M.

    1984-12-01

    Toughness of cladding and pressure vessel steel were determined at different temperatures in order to appreciate the participation of cladding resistance against crack propagation. The toughness of cladding is comparable with typical results on austenitic welds. The test on covered CT specimens shows the possibility of having a relatively good prevision of the behaviour of a coated structure

  16. Airborne heavy metal pollution in the environment of a danish steel plant

    DEFF Research Database (Denmark)

    Vestergaard, N. K.; Stephansen, U.; Rasmussen, L.

    1986-01-01

    A survey of heavy metal deposition was carried out in the vicinity of a Danish steel plant. Bulk precipitation and transplanted lichen (Hypogymnia physodes (L.) Nyl.) were sampled at 12 stations in the environment before and after the production had been converted from open-hearth furnaces...

  17. Low Temperature Gaseous Nitriding of a Stainless Steel Containing Strong Nitride Formers

    DEFF Research Database (Denmark)

    Fernandes, Frederico Augusto Pires; Christiansen, Thomas Lundin; Somers, Marcel A. J.

    Low temperature thermochemical surface hardening of the precipitation hardening austenitic stainless steel A286 in solution treated state was investigated. A286 contains, besides high amounts of Cr, also substantial amounts of strong nitride formers as Ti, Al and V. It is shown that simultaneous...

  18. Microstructure Charaterization of a Hardened and Tempered Tool Steel: from Macro to Nano Scale

    DEFF Research Database (Denmark)

    Højerslev, Christian; Somers, Marcel A. J.; Carstensen, Jesper V.

    2002-01-01

    The microstructure of a conventionally heat treated PM AISI M3:2 tool steel, was characterised by a combination of light optical and electron microscopy, covering the range from micro to nano scale. Dilatometry and X-ray diffractometry were used for an overall macro characterisation of the phases...

  19. A combined SEM and CV Study of Solid Oxide Fuel Cell Interconnect Steels

    DEFF Research Database (Denmark)

    Kammer Hansen, Kent; Ofoegbu, Stanley; Mikkelsen, Lars

    2012-01-01

    Scanning electron microscopy and cyclic voltammetry were used to investigate the high temperature oxidation behavior of two solid oxide fuel cell interconnect steels. One alloy had a low content of manganese; the other alloy had a high content of manganese. Four reduction and four oxidation peaks...

  20. International competitiveness and leakage: A case study of the European steel industry

    NARCIS (Netherlands)

    Kuik, O.J.

    2014-01-01

    This study develops and applies an analytical framework for examining the determinants of carbon leakage and competitiveness. The study has a long-term perspective and focuses on the European steel industry. For the case study, a CGE model is used to develop feasible scenarios of the evolution of

  1. Conditional release of steel from decommissioning in a form of reinforced concrete - 59058

    International Nuclear Information System (INIS)

    Pritrsky, Jozef; Brodnan, Miroslav; Necas, Vladimir

    2012-01-01

    The paper deals with the conditional release of low-level radioactive steel from decommissioning in a form of reinforced concrete. The main goal was to determine limits for radionuclides concentration and calculate the annual dose for a member of a critical group of public, which should not exceed 10 μSv/year (according to IAEA Safety Guide RS-G-1.7). Corrosion is the principle mechanism of radionuclides release in this case; therefore effort was devoted to assess the time-dependent rate of steel reinforcement corrosion. It was assumed, that concrete is initially highly alkaline (with pH of 12 to 13) because of hydration products such as calcium hydroxide, which keeps the steel surface passive and protected from corrosion. However, carbonic acid resulting from carbon dioxide and water in the atmosphere can react with these products to produce calcium carbonate. This process is referred to as a 'carbonation', and leads after a period of time to significant reduction of the alkalinity (to pH as low as 8.5) followed by destruction of passive layer and starting corrosion of the embedded steel. The analytical principles and a set of input data have been implemented into a mathematical model developed by means of GoldSim software. The paper presents the results of mathematical simulation of corrosion process, which are compared with real measured values. (authors)

  2. 30 CFR 285.913 - What happens if I fail to comply with my approved decommissioning application?

    Science.gov (United States)

    2010-07-01

    ... approved decommissioning application? 285.913 Section 285.913 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY ALTERNATE USES OF EXISTING FACILITIES ON THE OUTER CONTINENTAL SHELF Decommissioning Compliance with An Approved Decommissioning Application § 285.913 What...

  3. 30 CFR 285.612 - How will my SAP be processed for Federal consistency under the Coastal Zone Management Act?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will my SAP be processed for Federal consistency under the Coastal Zone Management Act? 285.612 Section 285.612 Mineral Resources MINERALS... Plan § 285.612 How will my SAP be processed for Federal consistency under the Coastal Zone Management...

  4. 30 CFR 285.647 - How will my GAP be processed for Federal consistency under the Coastal Zone Management Act?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will my GAP be processed for Federal consistency under the Coastal Zone Management Act? 285.647 Section 285.647 Mineral Resources MINERALS... Activities Plan § 285.647 How will my GAP be processed for Federal consistency under the Coastal Zone...

  5. Spreading of lithium on a stainless steel surface at room temperature

    Energy Technology Data Exchange (ETDEWEB)

    Skinner, C.H., E-mail: cskinner@pppl.gov [Princeton Plasma Physics Laboratory, Princeton, NJ 08543 (United States); Capece, A.M. [Princeton Plasma Physics Laboratory, Princeton, NJ 08543 (United States); Roszell, J.P.; Koel, B.E. [Department of Chemical and Biological Engineering, Princeton University, NJ 08540 (United States)

    2016-01-15

    Lithium conditioned plasma facing surfaces have lowered recycling and enhanced plasma performance on many fusion devices and liquid lithium plasma facing components are under consideration for future machines. A key factor in the performance of liquid lithium components is the wetting by lithium of its container. We have observed the surface spreading of lithium from a mm-scale particle to adjacent stainless steel surfaces using a scanning Auger microprobe that has elemental discrimination. The spreading of lithium occurred at room temperature (when lithium is a solid) from one location at a speed of 0.62 μm/day under ultrahigh vacuum conditions. Separate experiments using temperature programmed desorption (TPD) investigated bonding energetics between monolayer-scale films of lithium and stainless steel. While multilayer lithium desorption from stainless steel begins to occur just above 500 K (E{sub des} = 1.54 eV), sub-monolayer Li desorption occurred in a TPD peak at 942 K (E{sub des} = 2.52 eV) indicating more energetically favorable lithium-stainless steel bonding (in the absence of an oxidation layer) than lithium–lithium bonding.

  6. Influence of thermo-mechanical treatment on the tensile properties of a modified 14Cr–15Ni stainless steel

    Energy Technology Data Exchange (ETDEWEB)

    Vijayanand, V.D., E-mail: vdvijayanand@igcar.gov.in; Laha, K.; Parameswaran, P.; Nandagopal, M.; Panneer Selvi, S.; Mathew, M.D.

    2014-10-15

    The titanium modified 14Cr–15Ni austenitic stainless steel is used as clad and wrapper material for fast breeder nuclear reactor. Thermo-mechanical treatments consisting of solution annealing at two different temperatures of 1273 and 1373 K followed by cold-work and thermal ageing have been imparted to the steel to tailor its microstructure for enhancing strength. Tensile tests have been carried out on the thermo-mechanically treated steel at nominal strain rate of 1.6 × 10{sup −4} s{sup −1} over a temperature range of 298–1073 K. The yield stress and the ultimate tensile strength of the steel increased with increase in solution treatment temperature and this has been attributed to the fine and higher density of Ti(C,N) precipitate. Tensile flow behaviour of the steel has been analysed using Ludwigson and Voce constitutive equations. The steel heat treated at higher solution temperature exhibited earlier onset of cross slip during tensile deformation. The rate of recovery at higher test temperatures was also influenced by variations in solution heat treatment temperature. In addition, dynamic recrystallization during tensile deformation at higher temperatures was profound for steel solution heat-treated at lower temperature. The differences in flow behaviour and softening mechanisms during tensile testing of the steel after different heat treated conditions have been attributed to the nature of Ti(C,N) precipitation.

  7. Influence of thermo-mechanical treatment on the tensile properties of a modified 14Cr–15Ni stainless steel

    International Nuclear Information System (INIS)

    Vijayanand, V.D.; Laha, K.; Parameswaran, P.; Nandagopal, M.; Panneer Selvi, S.; Mathew, M.D.

    2014-01-01

    The titanium modified 14Cr–15Ni austenitic stainless steel is used as clad and wrapper material for fast breeder nuclear reactor. Thermo-mechanical treatments consisting of solution annealing at two different temperatures of 1273 and 1373 K followed by cold-work and thermal ageing have been imparted to the steel to tailor its microstructure for enhancing strength. Tensile tests have been carried out on the thermo-mechanically treated steel at nominal strain rate of 1.6 × 10 −4 s −1 over a temperature range of 298–1073 K. The yield stress and the ultimate tensile strength of the steel increased with increase in solution treatment temperature and this has been attributed to the fine and higher density of Ti(C,N) precipitate. Tensile flow behaviour of the steel has been analysed using Ludwigson and Voce constitutive equations. The steel heat treated at higher solution temperature exhibited earlier onset of cross slip during tensile deformation. The rate of recovery at higher test temperatures was also influenced by variations in solution heat treatment temperature. In addition, dynamic recrystallization during tensile deformation at higher temperatures was profound for steel solution heat-treated at lower temperature. The differences in flow behaviour and softening mechanisms during tensile testing of the steel after different heat treated conditions have been attributed to the nature of Ti(C,N) precipitation

  8. Impact of a nickel-reduced stainless steel implant on striated muscle microcirculation: a comparative in vivo study.

    Science.gov (United States)

    Kraft, C N; Burian, B; Perlick, L; Wimmer, M A; Wallny, T; Schmitt, O; Diedrich, O

    2001-12-05

    The impairment of skeletal muscle microcirculation by a biomaterial may have profound consequences. With moderately good physical and corrosion characteristics, implant-quality stainless steel is particularly popular in orthopedic surgery. However, due to the presence of a considerable amount of nickel in the alloy, concern has been voiced in respect to local tissue responses. More recently a stainless steel alloy with a significant reduction of nickel has become commercially available. We, therefore, studied in vivo nutritive perfusion and leukocytic response of striated muscle to this nickel-reduced alloy, and compared these results with those of the materials conventional stainless steel and titanium. Using the hamster dorsal skinfold chamber preparation and intravital microscopy, we could demonstrate that reduction of the nickel quantity in a stainless steel implant has a positive effect on local microvascular parameters. Although the implantation of a conventional stainless steel sample led to a distinct and persistent activation of leukocytes combined with disruption of the microvascular endothelial integrity, marked leukocyte extravasation, and considerable venular dilation, animals with a nickel-reduced stainless steel implant showed only a moderate increase of these parameters, with a clear tendency of recuperation. Titanium implants merely caused a transient increase of leukocyte-endothelial cell interaction within the first 120 min, and no significant change in macromolecular leakage, leukocyte extravasation, or venular diameter. Pending biomechanical and corrosion testing, nickel-reduced stainless steel may be a viable alternative to conventional implant-quality stainless steel for biomedical applications. Concerning tolerance by the local vascular system, titanium currently remains unsurpassed. Copyright 2001 John Wiley & Sons, Inc. J Biomed Mater Res 57: 404-412, 2001

  9. A Novel Approach for Evaluating the Contraction of Hypo-Peritectic Steels during Initial Solidification by Surface Roughness

    Directory of Open Access Journals (Sweden)

    Junli Guo

    2018-04-01

    Full Text Available The contraction of peritectic steels in the initial solidification has an important influence on the formation of surface defects of continuously cast slabs. In order to understand the contraction behavior of the initial solidification of steels in the mold, the solidification process and surface roughness in a commercial hypo-peritectic and several non-peritectic steels were investigated using Confocal Scanning Laser Microscope (CSLM. The massive transformation of delta-Fe (δ to austenite (γ was documented in the hypo-peritectic steel, which caused surface wrinkles and greatly increases the surface roughness of samples in the experiments. Surface roughness (Ra(δ→γ was calculated to evaluate the contraction level of the hypo-peritectic steel due to δ–γ transformation. The result shows that the surface roughness method can facilitate the estimation of the contraction level of peritectic transformation over a wide range of cooling rates.

  10. Anaerobic corrosion of carbon steel under unsaturated conditions in a nuclear waste deep geological repository

    International Nuclear Information System (INIS)

    Kwong, G.; Wang, St.; Newman, R.C.

    2009-01-01

    Full text of publication follows: Anaerobic corrosion behaviour of carbon steel in humid conditions, but not submerged in aqueous solution, was studied based on hydrogen generation. Initial tests monitored the hydrogen evolution from carbon steel in a high humidity environment (≥ 75% RH) at near-ambient temperature (30 C) using a high sensitivity pressure gauge system (sensitivity of 0.01 μm.a -1 ). The presence of hydrogen in test runs that showed no, or minimal, pressure increase was confirmed by a solid-state potentiometric hydrogen sensor which has the capability of detecting hydrogen partial pressure as low as 10 -6 bar or a corrosion rate of 1.5 * 10 -4 μm.a -1 . Preliminary results indicate that a corrosion rate as high as 0.2 μm.a -1 can be sustained for steel coated with salt at 100% RH. Higher corrosion rates (as high as 0.8 μm.a -1 ) were obtained in less humid environment (71% RH). Without a salt deposit, pickled steel in humid environment (as high as 100% RH) also showed detectable corrosion for a period up to 800 hours, during which 0.8 kPa of hydrogen was accumulated prior to the apparent arrest of corrosion, representing a metal loss of 3 nm. Corrosion scales are also identified with x-ray photoelectron spectroscopy (XPS) as well as by mass change monitoring using a quartz crystal microbalance. Corrosion mechanisms and prediction for longer-term exposure will be discussed. Results will be useful in predicting long-term carbon steel corrosion behaviour and improving the current knowledge of hydrogen gas evolution in a deep geological repository for nuclear waste. (authors)

  11. Stress corrosion cracking for 316 stainless steel clips in a condensate stabilizer

    Energy Technology Data Exchange (ETDEWEB)

    Al-Awar, A.; Aldajah, S.; Harhara, A. [Department of Mechanical Engineering, United Arab Emirates University, P. O. Box 17555 Al-AIn 17555 (United Arab Emirates)

    2011-09-15

    In one of the gas processing facilities in Abu Dhabi, UAE; a case of 316L stainless steel material failure occurred in the fractionating column due to stress cracking corrosion twice in a cycle of less than 2 years. This paper studies the stress corrosion cracking behavior of the 316L stainless steel in an accelerated corrosion environment and compares it with a higher corrosion resistant nickel alloy (Inconel 625). The experimental work was designed according to ASTM G36 standard, the samples were immersed in a boiling magnesium chloride medium which provided the accelerated corrosion environment and the tested samples were shaped into U-bend specimens as they underwent both plastic and elastic stresses. The specimens were then tested to determine the time required for cracks to initiate. The results of the experimental work showed that the main mode of failure was stress corrosion cracking initiated by the proven presence of chlorides, hydrogen sulfide, and water at elevated temperatures. Inconel 625 samples placed in the controlled environment showed better corrosion resistance as it took them an average of 56 days to initiate cracks, whereas it took an average of 24 days to initiate cracks in the stainless steel 316L samples. The scanning electron microscopy (SEM) micrographs showed that the cracks in the stainless steel 316L samples were longer, wider, and deeper compared to the cracks of Inconel 625. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  12. Application Feasibility of PRE 50 grade Super Austenitic Stainless Steel as a Steam Generator Tubing

    Energy Technology Data Exchange (ETDEWEB)

    Park, Yong Soo [Yonsei University, Seoul (Korea, Republic of); Kim, Young sik [Andong National University, Andong (Korea, Republic of); Kim, Taek Jun; Kim, Sun Tae; Park, Hui Sang [Yonsei University, Seoul (Korea, Republic of)

    1997-07-01

    The aim of this study is to evaluate the properties of the super austenitic stainless steel, SR-50A for application as steam generator tubing material. The microstructure, mechanical properties, corrosion properties, were analyzed and the results were compared between super austenitic stainless steel and Alloy 600 and Alloy 690. Super austenitic stainless steel, SR-50A is superior to Alloy 600, Alloy 690 and Alloy 800 in the mechanical properties(tensile strength, yield strength, and elongation). It was investigated that thermal conductivity of SR-50A was higher than Alloy 600. As a result of thermal treatment on super stainless steel, SR-50A, caustic SCC resistance was increased and its resistance was as much as Alloy 600TT and Alloy 690TT. In this study, optimum thermal treatment condition to improve the caustic corrosion properties was considered as 650 deg C or 550 deg C 15 hours. However, it is necessary to verify the corrosion mechanism and to prove the above results in the various corrosive environments. 27 refs., 6 tabs., 59 figs. (author)

  13. Experimental observations and modelling of thermal history within a steel plate during water jet impingement

    International Nuclear Information System (INIS)

    Liu, Z.D.; Fraser, D.; Samarasekera, I.V.; Lockhart, G.T.

    2002-01-01

    In order to investigate heat transfer of steel plates under a water jet impingement and to further simulate runout table operation in a hot strip mill, a full-scale pilot runout table facility was designed and constructed at the University of British Columbia (UBC). This paper describes the experimental details, data acquisition and data handling techniques for steel plates during water jet impingement by one circular water jet from an industrial header. Recorded visual observations at the impinging surface were obtained. The effects of cooling water temperature and impingement velocity on the heat transfer from a steel plate were studied. A two-dimensional finite element method-based transient inverse heat conduction model was developed. With the help of the model, heat fluxes and heat transfer coefficients along the impinging surface under various cooling conditions were calculated. The microstructural evolution of the steel plate was also investigated for the varying cooling conditions. Samples were obtained from each plate, polished, etched and then photographed. (author)

  14. Development and validation of a nuclear data and calculation system for Superphenix with steel reflectors

    International Nuclear Information System (INIS)

    Bosq, J.Ch.

    1998-01-01

    This thesis concerns the definition and the validation of the ERANOS neutronic calculation system for steel reflected fast reactors. The calculation system uses JEF2.2 evaluated nuclear data, the ECCO cell code and the BISTRO and VARIANT transport codes. After a description of the physical phenomena induced by the existence of the these sub-critical media, an inventory of the past studies related to steel reflectors is reported. A calculational scheme taking into account the important physical phenomena (strong neutronic slowing-down, presence of broad resonances of the structural materials and spatial variation of the spectrum in the reflector) is defined. This method is validated with the TRIPOLI4 reference Monte-Carlo code. The use of this upgraded calculation method for the analysis of the part of the CIRANO experimental program devoted to the study of steel reflected configurations leads to discrepancies between the calculated and measured values. These remaining discrepancies obtained for the reactivity and the fission rate traverses are due to inaccurate nuclear data for the structural materials. The adjustment of these nuclear data in order to reduce these discrepancies id demonstrated. The additional uncertainty associated to the integral parameters of interest for a nuclear reactor (reactivity and power distribution) induced by the replacement of a fertile blanket by a steel reflector is determined for the Superphenix reactor and is proved to be small. (author)

  15. Low-temperature nitriding of austenitic steel in a vibrofluidized bed

    Science.gov (United States)

    Baraz, V. R.; Grachev, S. V.

    1999-11-01

    The prospects for use of a vibrofluidized bed (VFB) for low-temperature nitrogen saturation of high-strength austenitic steel based on Cr-Ni-Mn (12Kh17N8G2S2MF) are considered. The positive effect of preliminary plastic deformation on the intensity of nitriding is described. The temperature and time parameters of nitriding in a VFB for strain-aging austenitic steel 12Kh17N8G2S2MF are shown to be adequate for the regimes of the final heat-treatment operation of aging. This creates the possibility of combining the operations of surface alloying and strain aging into a single cycle. This combined treatment increases substantially the resistance of the steel to cyclic loads while preserving the strength parameters. It is shown that the presented method of low-temperature nitriding in a VFB is expedient for improving the service characteristics of austenitic steel 12Kh17N8G2S2MF used for production of force springs of automobile brake systems.

  16. Conversion of MX nitrides to Z-phase in a martensitic 12% Cr steel

    DEFF Research Database (Denmark)

    Cipolla, L.; Danielsen, Hilmar Kjartansson; Venditti, D.

    2010-01-01

    A 12% Cr model steel was designed with the purpose of studying the nucleation and growth of modified Z-phase, Cr(V,Nb)N. The model alloy develops Z-phase after relatively short ageing times and contains only nitrides of Cr, V and Nb. Interferences from the presence of carbides and the development...

  17. Martensitic transformation and stress partitioning in a high-carbon steel

    DEFF Research Database (Denmark)

    Villa, Matteo; Grumsen, Flemming Bjerg; Pantleon, Karen

    2012-01-01

    Martensitic transformation in a high-carbon steel was investigated with (synchrotron) X-ray diffraction at sub-zero Celsius temperature. In situ angular X-ray diffraction was applied to: (i) quantitatively determine the fractions of retained austenite and martensite; and (ii) measure the evolutio...

  18. Austenite Formation from Martensite in a 13Cr6Ni2Mo Supermartensitic Stainless Steel

    NARCIS (Netherlands)

    Bojack, A.; Zhao, L.; Morris, P.F.; Sietsma, J.

    2016-01-01

    The influence of austenitization treatment of a 13Cr6Ni2Mo supermartensitic stainless steel (X2CrNiMoV13-5-2) on austenite formation during reheating and on the fraction of austenite retained after tempering treatment is measured and analyzed. The results show the formation of austenite in two

  19. A Study on DLC Tool Coating for Deep Drawing and Ironing of Stainless Steel

    DEFF Research Database (Denmark)

    Üstünyagiz, Esmeray; Hafis Sulaiman, Mohd; Christiansen, Peter

    2018-01-01

    ) to replicate industrial ironing of deep drawn, stainless steel parts. Non-hazardous tribo-systems in form of a double layer Diamond-like coated tool applied under dry condition or with an environmentally friendly lubricant were investigated via emulating industrial process conditions in laboratory tests...

  20. Viscoelastic behavior and durability of steel wire - reinforced polyethylene pipes under a high internal pressure

    NARCIS (Netherlands)

    Ivanov, S.; Anoshkin, A.N.; Zuyko, V.Yu

    2011-01-01

    The strength tests of steel-wire-reinforced polyethylene pipe specimens showed that, under a constant internal pressure exceeding 80% of their short-term ultimate pressure, the fracture of the specimens occurred in less than 24 hours. At pressures slightly lower than this level, some specimens did