On a conjecture of Chen-Guo-Wang
Ning, Bo; Zheng, Yu
2015-01-01
Towards confirming Sun's conjecture on the strict log-concavity of combinatorial sequence involving the n$th$ Bernoulli number, Chen, Guo and Wang proposed a conjecture about the log-concavity of the function $\\theta(x)=\\sqrt[x]{2\\zeta(x)\\Gamma(x+1)}$ for $x\\in (6,\\infty)$, where $\\zeta(x)$ is the Riemann zeta function and $\\Gamma(x)$ is the Gamma function. In this paper, we first prove this conjecture along the spirit of Zhu's previous work. Second, we extend Chen et al.'s conjecture in the ...
Energy Technology Data Exchange (ETDEWEB)
Schelter, Eric John [Los Alamos National Laboratory; Wu, Ruilian [Los Alamos National Laboratory; Scott, Brian L [Los Alamos National Laboratory; Thompson, Joe D [Los Alamos National Laboratory; Batista, Enrique R [Los Alamos National Laboratory; Morris, David E [Los Alamos National Laboratory; Kiplinger, Jaqueline L [Los Alamos National Laboratory
2008-01-01
Actinide complexes of the redox-active ligand dpp-BIAN{sup 2-} (dpp-BIAN = bis(2,6-diisopropylphenyl)acenaphthylene), An(dpp-BIAN){sub 2}(THF){sub n} (An = Th, n = 1; An = U, n = 0, 1) have been prepared. Solid-state magnetic and single-crystal X-ray data for U(dpp-BIAN){sub 2}(THF){sub n} show when n = 0, the complex exists in an f{sup 2}-{pi}*{sup 4} configuration; whereas an intramolecular electron transfer occurs for n = 1, resulting in an f{sup 3}-{pi}*{sup 3} ground configuration. The magnetic data also indicate that interconversion between the two forms of the complex is possible, limited only by the ability of THF vapor to penetrate the solid on cooling of the sample. Spectroscopic data indicate the complex exists solely in the f{sup 2}-{pi}*{sup 4} form in solution, evidenced by the appearance of only small changes in the electronic absorption spectra of the U(dpp-BIAN){sub 2} complex on titration with THF and by measurement of the solution magnetic moment m d{sub 8}-tetrahydrofuran using Evans method. Electrochemistry of the complexes is reported, with small differences observed in wave potentials between metals and in the presence of THF. These data represent the first example of a well-defined, reversible intramolecular electron transfer in an f-element complex and the second example of oxidation state change through dative interaction with a metal ion.
Evaluation Of Water Quality At River Bian In Merauke Papua
Djaja, Irba; Purwanto, P.; Sunoko, H. R.
2018-02-01
River Bian in Merauke Regency has been utilized by local people in Papua (the Marind) who live along the river for fulfilling their daily needs, such as shower, cloth and dish washing, and even defecation, waste disposal, including domestic waste, as well as for ceremonial activities related to the locally traditional culture. Change in land use for other necessities and domestic activities of the local people have mounted pressures on the status of the River Bian, thus decreasing the quality of the river. This study had objectives to find out and to analyze river water quality and water quality status of the River Bian, and its compliance with water quality standards for ideal use. The study determined sample point by a purposive sampling method, taking the water samples with a grab method. The analysis of the water quality was performed by standard and pollution index methods. The study revealed that the water quality of River Bian, concerning BOD, at the station 3 had exceeded quality threshold. COD parameter for all stations had exceeded the quality threshold for class III. At three stations, there was a decreasing value due to increasing PI, as found at the stations 1, 2, and 3. In other words, River Bian had been lightly contaminated.
Evaluation Of Water Quality At River Bian In Merauke Papua
Directory of Open Access Journals (Sweden)
Djaja Irba
2018-01-01
Full Text Available River Bian in Merauke Regency has been utilized by local people in Papua (the Marind who live along the river for fulfilling their daily needs, such as shower, cloth and dish washing, and even defecation, waste disposal, including domestic waste, as well as for ceremonial activities related to the locally traditional culture. Change in land use for other necessities and domestic activities of the local people have mounted pressures on the status of the River Bian, thus decreasing the quality of the river. This study had objectives to find out and to analyze river water quality and water quality status of the River Bian, and its compliance with water quality standards for ideal use. The study determined sample point by a purposive sampling method, taking the water samples with a grab method. The analysis of the water quality was performed by standard and pollution index methods. The study revealed that the water quality of River Bian, concerning BOD, at the station 3 had exceeded quality threshold. COD parameter for all stations had exceeded the quality threshold for class III. At three stations, there was a decreasing value due to increasing PI, as found at the stations 1, 2, and 3. In other words, River Bian had been lightly contaminated.
Indian Academy of Sciences (India)
Home; Journals; Journal of Chemical Sciences. Zhu Qing Wang. Articles written in Journal of Chemical Sciences. Volume 121 Issue 4 July 2009 pp 543-548. Highly sensitive optical chemosensor for the detection of Cu using a rhodamine B spirolatam · Gen Hua Wu Dong Xiang Wang Da Yu Wu Yuan Gao Zhu Qing Wang.
Ge, Shu; Chen, Gui-Zhen; Liu, Song-Hao
2009-08-01
In order to identify the relations between the Si-Bin Bian-stone of the mineral composition characteristics and Bian-stone of the good infrared emission features. A detailed study of the Sibin Bian-stone samples was conducted by using the laser Raman spectroscopy and high-resolution transmission electron microscopy (HRTEM). The study is to provide theoretical physical support for Bian-stone in the treatment of primary dysmenorrhea. And Thermal tomography technology (TTM) is intended to be carried out to assess the effects of Bian-stone. The Raman spectroscopic study confirmed the existence of fine-grained pyrite, anatase, calcitepyrite and graphite. It is believed that the combination of good thermal properties of the above 4 minerals make the Sibin Bian-stone as a useful material with very good physiotherapical functions. The ultrasonic has a resonance with the body's biological molecules so that it can improve meridians microcirculation. Hence, the Sibin Bian-stones can be used to make acupuncture tools for stimulating the circulation of the blood in vessels and relieving pains of human beings by utilizing its infrared thermal radiation property. TTM which accepts the heat produced by the metabolism process of life can reflect the energy status information, TTM will be introduced to evaluate effect at the overall level of the abdomen from the thermal image and analyze to derive a comprehensive diagnosis. In sum, this experiment is explored to provide a new idea for the modernization of traditional Chinese medicine.
Farooq, Muhammad; Abu Taha, Nael; Butorac, Rachel R.; Evans, Daniel Anthony; Elzatahry, Ahmed A.; Elsayed, Elsayed Ahmed; Wadaan, Mohammad A. M.; Al-Deyab, Salem S.; Cowley, Alan H.
2015-01-01
N-Heterocyclic carbene (NHC) metal complexes possess diverse biological activities but have yet to be extensively explored as potential chemotherapeutic agents. We have previously reported the synthesis of a new class of NHC metal complexes N-heterocyclic with acetate [IPr(BIAN)AuOAc] and chloride [IPr(BIAN)AuCl] ligands. In the experiments reported herein, the zebrafish embryos were exposed to serial dilutions of each of these complexes for 10–12 h. One hundred percent mortality was observed at concentrations ≥50 µM. At sub-lethal concentrations (10–30 µM), both compounds influenced zebrafish embryonic development. However, quite diverse categories of abnormalities were found in exposed embryos with each compound. Severe brain deformation and notochord degeneration were evident in the case of [IPr(BIAN)AuOAc]. The zebrafish embryos treated with [IPr(BIAN)AuCl] exhibited stunted growth and consequently had smaller body sizes. A depletion of 30%–40% glutathione was detected in the treated embryos, which could account for one of the possible mechanism of neurotoxicity. The fact that these compounds are capable of both affecting the growth and also compromising antioxidant systems by elevating intracellular ROS production implies that they could play an important role as a new breed of therapeutic molecules. PMID:26501273
Zhang, Genxi; Ding, Fuxiang; Wang, Jinyu; Dai, Guojun; Xie, Kaizhou; Zhang, Lijun; Wang, Wei; Zhou, Shenghua
2011-02-01
In our research, single nucleotide polymorphisms (SNPs) of exon regions of the myostatin gene were detected by PCR-SSCP in the Bian chicken and three reference chicken populations (Jinghai, Youxi, and Arbor Acre). Four novel SNPs (G2283A, C7552T, C7638T, and T7661A) were detected. The findings from the least square means showed that Bian chickens with EE and DE genotypes had significantly higher body weight, at 6-18 weeks of age, than those of the DD genotype (P chicken.
Zhang, Xuedan; Zhang, Ruqing; Chen, Dexing
2014-01-01
Chen Ye, an official of the Southern Song Dynasty, also known as Chen Rihua as his styled name, was born in Changle, Fuzhou in the reign of Shaoxing, and died during the reign of Duanping. He had been consecutively in the positions of Jiang shi lang (Court Gentleman for Ceremonial Service), Zhi zhou (Prefect) of Lingding, the Ti xing (Judicial Commissioner) of Guangdong, the Zong ling (Overseer-general) of Sichuan, Shan ding (Reviser), Shu lin and other positions in Tongzhou, Yuanzhou. His works included 1 volume of Gu ling xian sheng nian pu (Mr. Guling's Chronological Biography), 1 volume of Tan xie (On Humor), 1 volume of Shi hua (Poetry), 8 volumes of Jin yuan li shu (Jin Yuan's Smart Technique), 3 volumes of Yi jian zhi lei bian (Classified Compilation of Yijian's Annals), (Zeng guang) Suo sui lu (Augmented Records of Trivial Matters), 5 volumes of Jia cang jing yan fang (Family-preserved Empirical Recipes). He also compiled the 8-volume Yin jiang zhi (Yinjiang's Annals), published the 2-volume Jia cang ji yao fang (Collected Essential Recipes from Family Preservation), and other proses and poetry. Jia cang jing yan fang was a formulary compiled by Chen Ye, which was lost. Altogether 74 of its recipes were cited in Fu ren da quan liang fang (Complete Effective Prescriptions for Women's Diseases), Shou qin yang lao shu (A Book for Pursuing Seniors' Longevity and Healthcare), Pu ji fang (Prescriptions for Universal Relief) and Yong le da dian (Yongle Encyclopedia).
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science. H CHEN. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 51. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study · H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG · More Details ...
Calycosin regulates glucocorticoid-induced apoptosis via Nrf2/ARE ...
African Journals Online (AJOL)
Lifeng Fu1, WeiLiang Wu2, Jian Zhu2, Shu Qiang2, Jansong Chen2* ... Results: CA reduced the apoptosis and accumulation of ROS in DEX-treated cells. ..... its downstream effectors (Figure 5 A-C). However .... Cao J, Chen Z, Zhu Y, Li Y, Guo C, Gao K, Chen L, Shi ... Hong W. Experimental study on the effect of Calycosin.
Canivez, Gary L.; Kush, Joseph C.
2013-01-01
Weiss, Keith, Zhu, and Chen (2013a) and Weiss, Keith, Zhu, and Chen (2013b), this issue, report examinations of the factor structure of the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) and Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV), respectively; comparing Wechsler Hierarchical Model (W-HM) and…
[ZHU Lian's New Acupuncture Academic System and acupuncture science initialization].
Zhang, Shujian; Zhang, Lijian
2015-11-01
Acupuncture scientization was a consensus of most of acupuncture scholars who had long-term perspectives in the 20th century, among them Ms. ZHULian was the important one. Ms. ZHU Lian built a systemic new acupuncture" academic structure in practice and theory aspects. At the same time, as the main architect of Institute of Acupuncture-moxibustion of China Academy of Traditional Chinese Medicine, Ms. ZHU Lian was the first one who began to carry out the acupuncture clinical trail and laboratory experiment in modern way, which meant "acupuncture therapy" was transformed into "acupuncture science" by Ms. ZHULian's endeavor.
Zhang, Genxi; Zhang, Li; Wei, Yue; Wang, Jinyu; Ding, Fuxiang; Dai, Guojun; Xie, Kaizhou
2012-01-01
Myostatin, or growth and differentiation factor 8, is a member of the transforming growth factor-β superfamily; it functions as a negative regulator of skeletal muscle development and growth in mammals. In this study, single nucleotide polymorphisms in the 5' regulatory region and exon 1 of the myostatin gene were detected by PCR-SSCP in the Bian, Jinghai, Youxi, and Arbor Acre chickens, and the associations of the polymorphisms with reproduction traits were analyzed. Seven SNPs (A326G, C334G, C1346T, G1375A, A1473G, G1491A, and G2283A) were found in the myostatin gene. Association analysis showed that the G2283A were significantly associated with reproduction traits. Bian chickens of the GG genotype had a greater age at first egg than those of the GA and AA genotypes (Pchickens of the GA and AA genotypes had larger egg number at 300 days than those of the GG genotype (Pchickens of the AA genotype had significantly higher body weight at 300 days than those of the GG genotype (P<0.05). These results suggested that the myostatin gene may have certain effects on reproduction traits other than merely as a negative regulator of skeletal muscle development and growth in mammals previously reported.
On the Unsteady-Motion Theory of Magnetic Forces for Maglev
1993-11-01
DivisionEnergy Technology Division Forces for Maglev Energy Technology DivisionEnergy Technology Division by S. S. Chen, S. Zhu, and Y. Cai APQ 4 袲...On the Unsteady-Motion Theory of Magnetic Forces for Maglev by S. S. Chen, S. Zhu, and Y. Cai Energy Technology Division November 1993 Work supported...vi On The Unsteady-Motion Theory of Magnetic Forces for Maglev by S. S
Zhao, Pengna; Wang, Yanping; Gu, Feifei; Li, Chaozheng; Wei, Yulong; Wang, Guangjun; Zhang, Weibo
2018-02-12
To observe the impacts of the intervention with electric thermal bian stone and air suction cup on blood perfusion (BP) at meridian points and explore the approach of accurate measurement and regulation of meridian qi and blood balance in "precise acupuncture". The laser Doppler line scanner (LDLS) was used to measure BP at bilateral yua n-primary points at the pericardium meridian, the triple energizer meridian, the gallbladder meridian and the liver meridian (small cycle of jueyin to shaoyang meridians) at 31 healthy receptors. The bias ratio of blood perfusion (BPBR) deviated to the reference value was calculated. The electric thermal bian stone and air suction cup were used in the intervention at the he -sea points of the affected meridians in which BPBR was relatively higher at the yuan -primary points. The electric thermal bian stone therapy was used when BPBR was less than -30% and the air suction cupping therapy was used when BPBR was higher than 30%. BP was measured twice before intervention and it was measured separately at the moment after intervention and in 20 min after intervention. The means of BP before and after intervention and the change ratio of blood perfusion (BPCR) before intervention, at the moment after intervention and 20 min after intervention were calculated. 1. After the intervention of electric thermal bian stone, BP mean was increased from (103.51±41.21) PU to (121.97±56.22) PU ( P 0.05), but the change ratio was highly remained. 2. After intervention with air suction cup, BP mean was reduced from (194.83±81.14) PU to (173.88±88.26) PU. Before intervention, at the moment after intervention and 20 min after intervention, separately, BPCR were (7.62±30.49)%, (-12.12±18.20)% and (-14.35±21.25)%. BPCR at the moment after intervention and in 20 min after intervention were significantly different from that before intervention (both P cup is opposite.
Horseshoes in modified Chen's attractors
International Nuclear Information System (INIS)
Huang Yan; Yang Xiaosong
2005-01-01
In this paper we study dynamics of a class of modified Chen's attractors, we show that these attractors are chaotic by giving a rigorous verification for existence of horseshoes in these systems. We prove that the Poincare maps derived from these modified Chen's attractors are semi-conjugate to the 2-shift map
Pramana – Journal of Physics | Indian Academy of Sciences
Indian Academy of Sciences (India)
dimensional coupled double-distribution-function lattice Boltzmann models for compressible Navier–Stokes equations. RUO-FAN QIU YAN-CHENG YOU CHENG-XIANG ZHU RONG-QIAN CHEN JIAN-FENG ZHU. Research Article Volume 89 Issue ...
Titanisierung von Implantatoberflächen
Zimmermann, Hanngörg; Heinlein, Markus; Guldner, Norbert W.
Titan gilt seit Jahrzehnten als einer der wichtigsten Implantatwerkstoffe in der Medizin. Neben den guten mechanischen Eigenschaften (Leichtigkeit, hohe Festigkeit etc.), besitzen Titanimplantate vor allem eine hervorragende Körperverträglichkeit, so dass die Implantate optimal in den humanen Organismus integriert werden [1]. Ist jedoch aufgrund der Anforderungen an das Implantat eine hohe Flexibilität und/ oder Elastizität gefragt, so scheidet der Werkstoff Titan aufgrund seiner spröden und unflexiblen Materialeigenschaften aus. Die Folge ist der Einsatz von Implantatmaterialien, sowohl künstlichen als auch biologischen Ursprungs, welche nicht selten eine unzureichende Biokompatibilität aufweisen und somit zu Fremdköper- und immunologischen Reaktionen und Einkapselung des Implantates führen können. Die Erhöhung der Körperverträglichkeit, eine Adaption an das biologische Umfeld und eine hohe Biokompatibilität sind demzufolge die wichtigsten Eigenschaften bei der bedarfsgerechten Herstellung von Implantaten und Implantatoberflächen. Zur Gestaltung von innovativen, biokompatiblen Oberflächen stehen unterschiedliche technische Lösungsansätze zur Verfügung. Zum einen besteht die Möglichkeit, geeignete Oberflächeneigenschaften aus dem Grundmaterial selbst zu optimieren. Dies geschieht unter anderem durch Modifikation der Werkstoffoberflächen in Form von Texturierungen und Oberflächenrauhigkeiten. Zum anderen können die Oberflächeneigenschaften unabhängig von denen des Trägermaterials gestaltet werden. Durch Funktionalisierung der Oberflächen mit geeigneten Beschichtungen oder der Zugabe von Medikamenten (Drug Eluting) werden die Kunststoffimplantate dahingehend verändert, dass eine Steigerung der Körperakzeptanz erreicht wird. Die Titanbeschichtung von Implantatoberflächen kombiniert die positiven Materialeigenschaften von Titan und Polymer.
DEFF Research Database (Denmark)
Gimpel, Denise
been the first to write children’s literature. In 1914 she was among the first group of women to gain a Boxer Indemnity grant to study in America. The reiteration of these many “firsts” has led to a rather stereotypical portrait of Chen Hengzhe in Chinese sources and, as a result, in most Western...
Czech Academy of Sciences Publication Activity Database
Löw, I.; Bubrin, M.; Paretzki, A.; Fiedler, Jan; Záliš, Stanislav; Kaim, W.
2017-01-01
Roč. 455, č. 2 (2017), s. 540-548 ISSN 0020-1693 R&D Projects: GA MŠk LD14129 Grant - others:COST(XE) CM1202 Institutional support: RVO:61388955 Keywords : BIAN diimine ligand * Carbonylmetal complexes * Electron transfer Subject RIV: CG - Electrochemistry OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 2.002, year: 2016
International Nuclear Information System (INIS)
Hughes, B.D.; Frankel, N.E.; Ninham, B.W.
1990-01-01
An alternative view is presented of the Chen's generalization of a formula of classic algebraic number theory, based on the Mellin transformation and Reimann's zeta function. The advantages of the Mellin transform, as a method with a primary role in asymptotic analysis, are outlined. 10 refs
Stability analysis of distributed order fractional chen system.
Aminikhah, H; Refahi Sheikhani, A; Rezazadeh, H
2013-01-01
We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results.
Stability Analysis of Distributed Order Fractional Chen System
Aminikhah, H.; Refahi Sheikhani, A.; Rezazadeh, H.
2013-01-01
We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results. PMID:24489508
Mechanisms of all-trans retinoic acid-induced differentiation of acute ...
Indian Academy of Sciences (India)
Author Affiliations. Ji-Wang Zhang1 Jian Gu1 Zhen-Yi Wang1 Sai-Juan Chen1 Zhu Chen1. Shanghai Institute of Hematology, Ruijin Hospital Affiliated to Shanghai Second Medical University, 197 Ruijin Road II, Shanghai 200025, People's Republic of China ...
Complete synchronization of two Chen-Lee systems
International Nuclear Information System (INIS)
Sheu, L-J; Chen, J-H; Chen, H-K; Tam, L-M; Lao, S-K; Chen, W-C; Lin, K-T
2008-01-01
This study demonstrates that complete synchronization of two Chen-Lee chaotic systems can be easily achieved. The upper bound of the Chen-Lee chaotic system is estimated numerically. A controller is designed to synchronize two chaotic systems. Sufficient conditions for synchronization are obtained using Lyapunov's direct method. Two numerical examples are presented to verify the proposed synchronization approach
Morphological evolution in single-crystalline Bi2Te3 nanoparticles ...
Indian Academy of Sciences (India)
to have ZT exceeding 5 (Lin et al 2000). ... as nanoparticles (NPs) (Jiang and Zhu 2007; Cao et al. 2008a, b) ... als, semimetals, alloys and other compounds (Chen and ..... Cao Y Q, Zhao X B, Zhu T J, Zhang X B and Tu J P 2008a Appl. Phys.
Eine praktische Anwendung von CMC-Flächen in der Bionik
Apeltauer, Christian
2011-01-01
Die vorliegende Arbeit beschäftigt sich mit den theoretischen Grundlagen für die Entwicklung von Oberflächen, die unter Wasser möglichst lange eine Luftschicht an sich halten können. Ein natürliches Vorbild für solche Oberflächen ist die Pflanze Salvinia molesta; technisch interessieren solche Oberflächen zur Verringerung des Wasserwiderstandes von Schiffen und als Schutz vor Besiedlung durch Wasserorganismen. Wichtigste Gleichung bei der Entwicklung solcher Oberflächen ist...
Mechanical analysis of Chen chaotic system
International Nuclear Information System (INIS)
Liang, Xiyin; Qi, Guoyuan
2017-01-01
The Chen chaotic system is transformed into Kolmogorov type system, which is decomposed into four types of torques: inertial torque, internal torque, dissipation and external torque. By the combinations of different torques, five cases are studied to discover key factors of chaos generation and the physical meaning. The conversion among Hamiltonian energy, kinetic energy and potential energy is investigated in these five cases. The relationship between the energies and the parameters is studied. It concludes that the combination of these four types of torques is necessary conditions to produce chaos, and any combination of three types of torques cannot produce chaos in Chen system.
Failure to replicate the Mehta and Zhu (2009) color-priming effect on anagram solution times.
Steele, Kenneth M
2014-06-01
Mehta and Zhu (Science, 323, 1226-1229, 2009) hypothesized that the color red induces avoidance motivation and that the color blue induces approach motivation. In one experiment, they reported that anagrams of avoidance motivation words were solved more quickly on red backgrounds and that approach motivation anagrams were solved more quickly on blue backgrounds. Reported here is a direct replication of that experiment, using the same anagrams, instructions, and colors, with more than triple the number of participants used in the original study. The results did not show the Mehta and Zhu color-priming effects, even though statistical power was sufficient to detect the effect. The results call into question the existence of their color-priming effect on the solution of anagrams.
African Journal of Biotechnology - Vol 10, No 60 (2011)
African Journals Online (AJOL)
Microsatellite variability reveals significant genetic differentiation of giant pandas (Ailuropoda melanoleuca) in the Minshan A habitat · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Yang, R Hou, F Shen, X Yang, L Zhang, L Chen, W Chen, W Zhang, Q Zhu, Z Zhang ...
DEFF Research Database (Denmark)
Gimpel, Denise
Chen Hengzhe has been celebrated as China’s first female professor, first professor of Western history, first person to publish a history of the West that was not a translation into Chinese. She is moreover celebrated as one of the first to write fiction and poetry in the vernacular and to have......; they speak to important questions in China today. This study, then, is not a biography of a person; it is an attempt to understand the way in which foreign influences (narratives of being, organizing, thinking, writing) seep into a person’s life and work and meld with the “home” influences (narratives...
Adaptive synchronization of hyperchaotic Chen system with uncertain parameters
International Nuclear Information System (INIS)
Park, Ju H.
2005-01-01
This article addresses control for the chaos synchronization of hyperchaotic Chen system with five uncertain parameters. Based on the Lyapunov stability theory, an adaptive control law is derived to make the states of two identical hyperchaotic Chen systems asymptotically synchronized. Finally, a numerical simulations is presented to show the effectiveness of the proposed chaos synchronization scheme
A Partnership Training Program in Breast Cancer Research Using Molecular Imaging Techniques
2009-07-01
mucous or serous lining fluid and its surfactant layer. Therefore, the destiny of particle compounds that are soluble in this lining fluid is different...SYSTEMS There have been very few studies on the destiny , distribution, metabolism and bioaccumulation of nanoparticles in humans. Fol- lowing exposure...12. [86] Zhu, X.; Zhu, L.; Li, Y.; Duan, Z.; Chen, W. and Alvarez, P. J. (2007) Developmental toxicity in zebrafish (Danio rerio) embryos after
Chaos in the fractional order Chen system and its control
International Nuclear Information System (INIS)
Li Chunguang; Chen Guanrong
2004-01-01
In this letter, we study the chaotic behaviors in the fractional order Chen system. We found that chaos exists in the fractional order Chen system with order less than 3. The lowest order we found to have chaos in this system is 2.1. Linear feedback control of chaos in this system is also studied
A simple observer of the generalized Chen chaotic systems
International Nuclear Information System (INIS)
Sun, Y.-J.
2009-01-01
In this paper, the generalized Chen chaotic system is considered and the state observation problem of such a system is investigated. Based on the time-domain approach, a simple observer for the generalized Chen chaotic system is proposed to guarantee the global exponential stability of the resulting error system. Furthermore, the guaranteed exponential convergence rate can be correctly estimated. Finally, a numerical example is provided to illustrate the use of the main result.
Vega Jiménez, Junior
2015-01-01
Los orígenes de la medicina tradicional china en Cuba datan de la época colonial, cuyas técnicasfueronintroducidas a través de los inmigrantes chinos. Es muy frecuentelautilización, tanto en el argot popular como médico,delrefrán: "A ese no lo cura ni el médico chino".El origen de esta frase es real, y proviene del poco conocido JuanCham-Bom-Bian. La mayor parte de su estancia en Cuba ocurrió entre la sciudades de La Habana y Cárdenas; enesta última ocurrió su misteriosa muerte. El objetivo d...
The age grading and the Chen-Ruan cup product
DEFF Research Database (Denmark)
A. Hepworth, Richard
2010-01-01
We prove that the obstruction bundle used to define the cup-product in Chen-Ruan cohomology is determined by the so-called `age grading' or `degree-shifting numbers'. Indeed, the obstruction bundle can be directly computed using the age grading. We obtain a Kunneth Theorem for Chen-Ruan cohomology...... as a direct consequence of an elementary property of the age grading, and explain how several other results - including associativity of the cup-product - can be proved in a similar way....
Bao, Yan; Yang, Taoxi; Zhang, Jinfan; Zhang, Jiyuan; Lin, Xiaoxiong; Paolini, Marco; Pöppel, Ernst; Silveira, Sarita
2017-06-01
The eminent Chinese artist LaoZhu has created a homogeneous set of abstract pictures that are referred to as the "third abstraction." By definition, these pictures are meant to be representations of the artist's personal involvement and as such to create an internal point of view in the observer on an implicit level of processing. Aiming at investigating whether the artist's choice of a specific color is experienced in a specific way in the recipient, we assessed both explicit and implicit (i.e. neurocognitive) correlates in naive viewers of LaoZhu's pieces. The behavioral results reveal a preference of the original red paintings over color-changed counterparts in green or black. Paradoxically and inconsistent with predictions, we found higher levels of neural activation in several brain regions (predominantly in the frontal and parietal cortices) for the color-changed compared to the original red conditions. These observations add empirically to the complementarity of early visual pathways and higher-order cognition as well as of explicit and implicit information processing during aesthetic appreciation. We discuss our findings in light of processing effort and top-down control of the color-changed paintings. With regard to the third abstraction as defined by LaoZhu, in particular to the distinction between an external and internal point of view when viewing abstract art, our results contribute to an understanding of "abstraction and empathy" as a fundamental part of aesthetic appreciations. © 2017 The Institute of Psychology, Chinese Academy of Sciences and John Wiley & Sons Australia, Ltd.
Bulletin of Materials Science | Indian Academy of Sciences
Indian Academy of Sciences (India)
Author Affiliations. Xiaoming Liao1 Hongyang Zhu1 Guangfu Yin1 Zhongbing Huang1 Yadong Yao1 Xianchun Chen1. College of Materials Science and Engineering, Sichuan University, Chengdu 610064, P.R. of China ...
Immunogenicity of novel sulfadimethoxide conjugates | Chen ...
African Journals Online (AJOL)
Immunogenicity of novel sulfadimethoxide conjugates. L Chen, J Su, X Zhang, L Li, X He. Abstract. Sulfadimethoxine (SDM) is an antibiotic commonly added to animal feeds. Anti-SDM antibodies are useful for the detection of residual SDM in foods, feeds and biological fluids by ELISA. In this study, we show that SDM is ...
Alternative implementation of the chaotic Chen-Lee system
International Nuclear Information System (INIS)
Sheu, L.-J.; Tam, L.-M.; Chen, H.-K.; Lao, S.-K.
2009-01-01
The chaotic Chen-Lee system was developed with a formalism based on the Euler equations for the motion of a rigid body. It was proved that this system is the governing set of equations for gyro motion with feedback control. Recently, studies were conducted to explore the dynamic behavior of this system, including fractional order behavior, the generation of hyperchaos and perturbation analysis, control and anti-control of chaos, synchronization, etc. In this study, we further explore (1) the stability of the equilibrium points and (2) the implementation of an electronic circuit using the Chen-Lee system. It is shown that not only is this system related to gyro motion but can also be applied to electronic circuits for encryption purposes.
Journal of Chemical Sciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Author Affiliations. Fang Dong1 Jiang Chenning1 Zhu Ting1 Yang Jinming1. Department of Pharmaceutical Engineering, School of Chemistry and Chemical Engineering, Yancheng Teachers University, 50 Kai Fang Da Dao, Yancheng 224002, Jiangsu, P. R. China ...
Hopf bifurcation analysis of Chen circuit with direct time delay feedback
International Nuclear Information System (INIS)
Hai-Peng, Ren; Wen-Chao, Li; Ding, Liu
2010-01-01
Direct time delay feedback can make non-chaotic Chen circuit chaotic. The chaotic Chen circuit with direct time delay feedback possesses rich and complex dynamical behaviours. To reach a deep and clear understanding of the dynamics of such circuits described by delay differential equations, Hopf bifurcation in the circuit is analysed using the Hopf bifurcation theory and the central manifold theorem in this paper. Bifurcation points and bifurcation directions are derived in detail, which prove to be consistent with the previous bifurcation diagram. Numerical simulations and experimental results are given to verify the theoretical analysis. Hopf bifurcation analysis can explain and predict the periodical orbit (oscillation) in Chen circuit with direct time delay feedback. Bifurcation boundaries are derived using the Hopf bifurcation analysis, which will be helpful for determining the parameters in the stabilisation of the originally chaotic circuit
Reference: 438 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available ity and drought tolerance in Arabidopsis thaliana. 18 6902-12 16943431 2006 Sep Molecular and cellular bio...logy Chen Zhizhong|Gong Zhizhong|Hong Xuhui|Jablonowski Daniel|Ren Xiaozhi|Schaffrath Raffael|Zhang Hairong|Zhou Xiaofeng|Zhu Jian-Kang
Synchronization and anti-synchronization coexist in Chen-Lee chaotic systems
International Nuclear Information System (INIS)
Chen, J.-H.; Chen, H.-K.; Lin, Y.-K.
2009-01-01
This study demonstrates that synchronization and anti-synchronization can coexist in Chen-Lee chaotic systems by direct linear coupling. Based on Lyapunov's direct method, a linear controller was designed to assure that two different types of synchronization can simultaneously be achieved. Further, the hybrid projective synchronization of Chen-Lee chaotic systems was studied using a nonlinear control scheme. The nonlinear controller was designed according to the Lyapunov stability theory to guarantee the hybrid projective synchronization, including synchronization, anti-synchronization, and projective synchronization. Finally, numerical examples are presented in order to illustrate the proposed synchronization approach.
Parametric study of the fractional-order Chen-Lee system
International Nuclear Information System (INIS)
Tam, L.M.; Tou, W.M.S.
2008-01-01
The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q 1 = q 2 = q 3 = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found
Parametric study of the fractional-order Chen-Lee system
Energy Technology Data Exchange (ETDEWEB)
Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Tou, W.M.S. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)
2008-08-15
The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q{sub 1} = q{sub 2} = q{sub 3} = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found.
Dynamics of fractional-ordered Chen system with delay
Indian Academy of Sciences (India)
Though this subject has a history of more than 300 years, utility and applicability of fractional calculus to various branches of science and engineering have been real- ... variants of Chen system and see the qualitative changes in attractor and ...
Synthesis of substituted guanidines using Zn–Al hydrotalcite catalyst
Indian Academy of Sciences (India)
Zn–Al HT was prepared by co-precipitation method and charac- terized by ... tion of highly functionalized guanidines.4 Linton et al. explained a ..... Pi C, Zhu Z, Weng L, Chen Z and Zhou X 2007 Chem. Commun. ... J P 2000 J. Mater. Chem.
Comparing numerical methods for the solutions of the Chen system
International Nuclear Information System (INIS)
Noorani, M.S.M.; Hashim, I.; Ahmad, R.; Bakar, S.A.; Ismail, E.S.; Zakaria, A.M.
2007-01-01
In this paper, the Adomian decomposition method (ADM) is applied to the Chen system which is a three-dimensional system of ODEs with quadratic nonlinearities. The ADM yields an analytical solution in terms of a rapidly convergent infinite power series with easily computable terms. Comparisons between the decomposition solutions and the classical fourth-order Runge-Kutta (RK4) numerical solutions are made. In particular we look at the accuracy of the ADM as the Chen system changes from a non-chaotic system to a chaotic one. To highlight some computational difficulties due to a high Lyapunov exponent, a comparison with the Lorenz system is given
Impulsive synchronization of Chen's hyperchaotic system
International Nuclear Information System (INIS)
Haeri, Mohammad; Dehghani, Mahsa
2006-01-01
In this Letter the impulsive synchronization of the Chen's hyperchaotic systems is discussed. Some new and sufficient conditions on varying impulsive distance are established in order to guarantee the synchronizabillity of the systems using the synchronization method. In particular, some simple conditions are derived in synchronizing the systems by equal impulsive distances. Two illustrative examples are provided to show the feasibility and the effectiveness of the proposed method. The boundaries of the stable regions are also estimated
Ningrum, R. W.; Surarso, B.; Farikhin; Safarudin, Y. M.
2018-03-01
This paper proposes the combination of Firefly Algorithm (FA) and Chen Fuzzy Time Series Forecasting. Most of the existing fuzzy forecasting methods based on fuzzy time series use the static length of intervals. Therefore, we apply an artificial intelligence, i.e., Firefly Algorithm (FA) to set non-stationary length of intervals for each cluster on Chen Method. The method is evaluated by applying on the Jakarta Composite Index (IHSG) and compare with classical Chen Fuzzy Time Series Forecasting. Its performance verified through simulation using Matlab.
Genetic diversity of bitter taste receptor gene family in Sichuan
Indian Academy of Sciences (India)
Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE Volume 95 Issue 3 September 2016 pp 675-681 ...
Sociology in Times of Crisis: Chen Da, National Salvation and the Indigenization of Knowledge
Directory of Open Access Journals (Sweden)
Ana Maria Candela
2015-08-01
Full Text Available Chen Da was one of the foremost sociologists of China from the 1920s to the 1940s. His intellectual habitus took shape from the long crisis that defined Chinese intellectual life from the mid-19th to mid-20th centuries, a period of continuous imperial assault on Chinese sovereignty. As China integrated into the capitalist world-system, neo-Confucian structures of knowledge came into question. Intellectuals took up sociology to guide China’s transition from an empire to a nation-state. Through his studies on labor, migration, and population, Chen Da contributed to the institutionalization of sociology in China. Chen sought to craft a theory of Chinese development that followed universal trajectories of progress but was also attuned to the complexity of Chinese society on the ground. Through his efforts to indigenize sociology, Chen developed a non-Marxist historical materialism, a deterritorialized and pluralistic conceptualization of China as a nation, and a theory of eugenic transformation centered on the concept of “mode of living.” The questions which Chen Da confronted are emblematic of the predicament faced by Chinese social scientists today, who again struggle with the dynamics of a deterritorialzied “Greater China,” rising social fragmentation, and refigured eugenic discourses and policies that aim to craft the Chinese people into ideal national subjects fit for post-socialist development.
A numeric-analytic method for approximating the chaotic Chen system
International Nuclear Information System (INIS)
Mossa Al-sawalha, M.; Noorani, M.S.M.
2009-01-01
The epitome of this paper centers on the application of the differential transformation method (DTM) the renowned Chen system which is described as a three-dimensional system of ODEs with quadratic nonlinearities. Numerical comparisons are made between the DTM and the classical fourth-order Runge-Kutta method (RK4). Our work showcases the precision of the DTM as the Chen system transforms from a non-chaotic system to a chaotic one. Since the Lyapunov exponent for this system is much higher compared to other chaotic systems, we shall highlight the difficulties of the simulations with respect to its accuracy. We wrap up our investigations to reveal that this direct symbolic-numeric scheme is effective and accurate.
Chang, Zhi-Min; Yang, Lin; Zhang, Zheng-Guang; Chen, Xiang-Sheng
2015-12-11
Two new species of the issid genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae): Neotetricodes longispinus Chang et Chen sp. nov. (China: Yunnan) and Neotetricodes xiphoideus Chang et Chen sp. nov. (China: Yunnan) are described and illustrated. The generic characteristic is redefined. A checklist and key to the species of the genus are provided. The female genitalia of the genus are firstly described.
How Memory Is Tested Influences What Is Measured: Reply to Wyble and Chen (2017)
Swallow, Khena M.; Jiang, Yuhong V.; Tan, Deborah H.
2017-01-01
In this response to Wyble and Chen's (2017) commentary on attribute amnesia, we hope to achieve several goals. First, we clarify how our view diverges from that described by Wyble and Chen. We argue that because the surprise memory test is disruptive, it is an insensitive tool for measuring the persistence of recently attended target attributes in…
Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe
Spinner, Kaspar H.
2014-01-01
Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe. - In: Standardorientierung im Lese- und Literaturunterricht der Sekundarstufe I / Cornelia Rosebrock ; Heike Wirthwein. - Baltmannsweiler : Schneider-Verl. Hohengehren, 2014. - S. 126-132
Ronald Malt or Chen Zhongwei: Who performed the first surgical replantation?
Fan, Ka-Wai
2018-01-01
This article discusses the contributions of the two pioneers of the surgical procedure of replantation-Ronald Malt in the US and Chen Zhongwei in China. Ronald Malt performed the reattachment surgery on a boy who had an accident in 1962, but he published his case report two years later in 1964. Chen Zhongwei performed a similar surgery on a worker who cut off his forearm in 1963, but he published his case report the same year. There is some debate about which one of these reputed surgeons should be given credit for being the first one to perform this breakthrough surgery, because although Malt was the first to perform the procedure, Zhongwei was the first to report it. To shed light on this controversy, criteria for scientific priority suggested by Ronald Vale and Anthony Hyman were applied. Although the criteria mainly favored Zhongwei as the pioneer of this procedure, he did not entirely fulfill one of the criteria. Therefore, the article could not present a definitive answer to the question, and it concludes by pointing out the highly commendable achievements and contributions of both Ronald Malt and Chen Zhongwei.
Saturation mapping of QTL region determining resistance specificity ...
African Journals Online (AJOL)
STORAGESEVER
2009-09-01
Sep 1, 2009 ... S, Ni L, Zhu F, Chen W, Lan L, Lai Y, Cheng Z, Gu M, Jiang J, Li J,. Hong G, Xue Y, Han B ... Katagiri F, Markus Lange B, Moughamer T, Xia Y, Budworth P,. Zhong J, Miguel T, ... Gen. Genet. 261: 58-63. Marrs KA (1996).
Chaos control of Chen chaotic dynamical system
International Nuclear Information System (INIS)
Yassen, M.T.
2003-01-01
This paper is devoted to study the problem of controlling chaos in Chen chaotic dynamical system. Two different methods of control, feedback and nonfeedback methods are used to suppress chaos to unstable equilibria or unstable periodic orbits (UPO). The Lyapunov direct method and Routh-Hurwitz criteria are used to study the conditions of the asymptotic stability of the steady states of the controlled system. Numerical simulations are presented to show these results
TEST OF THE CHEN-ROLL-ROSS MACROECONOMIC FACTOR MODEL: EVIDENCE FROM CROATIAN STOCK MARKET
Directory of Open Access Journals (Sweden)
Denis Dolinar
2015-12-01
Full Text Available This paper empirically examines the well-known Chen-Roll-Ross model on the Croatian stock market. Modifications of definitions of the Chen-Roll-Ross model variables showed as necessary because of doubtful availability and quality of input data needed. Namely, some macroeconomic and market variables are not available in the originally defined form or do not exist. In that sense this paper gives some alternative definitions for some model variables. Also, in order to improve statistical analysis, in this paper we have modified Fama-MacBeth technique in the way that second-pass regression was substituted with panel regression analysis. Based on the two-pass regression analysis of returns of 34 Croatian stocks on 4 macroeconomic variables during the seven-and-half-year observation period the following conclusion is made. In contrast to the results of Chen, Roll and Ross (1986 for the U.S. stock market, their model is not successful when describing a risk-return relation of Croatian stocks. Nevertheless, one observed version of the Chen-RollRoss model showed certain statistical significance. Namely, two risk factors in that version of the model were statistically significant: default premium, measured as risk premium for the corporate short-term bank loan financing, and term structure premium, measured on short-run basis.
Chaos synchronization between Chen system and Genesio system
International Nuclear Information System (INIS)
Wu Xianyong; Guan Zhihong; Wu Zhengping; Li Tao
2007-01-01
This Letter presents two synchronization schemes between two different chaotic systems. Active control synchronization and adaptive synchronization between Chen system and Genesio system are studied, different controllers are designed to synchronize the drive and response systems, active control synchronization is used when system parameters are known; adaptive synchronization is employed when system parameters are unknown or uncertain. Simulation results show the effectiveness of the proposed schemes
African Journal of Biotechnology - Vol 11, No 14 (2012)
African Journals Online (AJOL)
DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. HD Ding, HJ Zhang, XH Zhu, H Liu, JS Liang, B Lu, 3259-3269 ... DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Y Hanying, X Wei, G Xingxi, 3370-3378 ... FULL TEXT DOWNLOAD FULL TEXT. J Zhang, YC Huang, Q Zhang, ZP Hong, YC Zhou, WL Chen, 3388-3393 ...
Measuring Components of Intelligence: Mission Impossible?
Gregoire, Jacques
2013-01-01
The two studies conducted by Weiss, Keith, Zhu, and Chen in 2013 on the Wechsler Adult Intelligence Scale (WAIS-IV) and the Wechsler Intelligence Scale for Children (WISC-IV), respectively, provide strong evidence for the validity of a four-factor solution corresponding to the current hierarchical model of both scales. These analyses support the…
Polyethylenimine-based micro/nanoparticles as vaccine adjuvants [Corrigendum
Directory of Open Access Journals (Sweden)
Shen C
2017-10-01
Full Text Available Shen C, Li J, Zhang Y, et al. Int J Nano. 2017;12:5443–5460.The affiliations were presented as:Chen Shen1Jun Li1Yi Zhang1Yuce Li2Guanxin Shen3Jintao Zhu2Juan Tao11Department of Dermatology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China; 2School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan, China; 3Department of Immunology, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, ChinaThe affiliations should have contained the postcodes and are corrected here:Chen Shen1Jun Li1Yi Zhang1Yuce Li2Guanxin Shen3Jintao Zhu2Juan Tao11Department of Dermatology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China; 2School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074, China; 3Department of Immunology, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, ChinaRead the original article
Tensioned Fabric Structures with Surface in the Form of Chen-Gackstatter
Directory of Open Access Journals (Sweden)
Yee Hooi Min
2016-01-01
Full Text Available Form-finding has to be carried out for tensioned fabric structure in order to determine the initial equilibrium shape under prescribed support condition and prestress pattern. Tensioned fabric structures are normally designed to be in the form of equal tensioned surface. Tensioned fabric structure is highly suited to be used for realizing surfaces of complex or new forms. However, research study on a new form as a tensioned fabric structure has not attracted much attention. Another source of inspiration minimal surface which could be adopted as form for tensioned fabric structure is very crucial. The aim of this study is to propose initial equilibrium shape of tensioned fabric structures in the form of Chen-Gackstatter. Computational form-finding using nonlinear analysis method is used to determine the Chen-Gackstatter form of uniformly stressed surfaces. A tensioned fabric structure must curve equally in opposite directions to give the resulting surface a three dimensional stability. In an anticlastic doubly curved surface, the sum of all positive and all negative curvatures is zero. This study provides an alternative choice for structural designer to consider the Chen-Gackstatter applied in tensioned fabric structures. The results on factors affecting initial equilibrium shape can serve as a reference for proper selection of surface parameter for achieving a structurally viable surface.
Effects of cutting frequency on alfalfa yield and yield components in ...
African Journals Online (AJOL)
Effects of cutting frequency on alfalfa yield and yield components in Songnen Plain, Northeast China. J Chen, F Tang, R Zhu, C Gao, G Di, Y Zhang. Abstract. The productivity and quality of alfalfa (Medicago sativa L.) is strongly influenced by cutting frequency (F). To clarify that the yield and quality of alfalfa if affected by F, ...
Indian Academy of Sciences (India)
Proc. of ICEM-1992, Budapest, pp 550-553. 23) A R Millner 1994 Multi-hundred horsepower permanent magnet brushless disk motors. Proc. of APEC Conf, pp 351-355 w. (24 C C Chen, KT Chau, J ZJiang, W Xia, M. Zhu, R. Zhang 1996 Novel permanent magnet motor drives for electric vehicles. IEEE Trans. Ind. Electron.
Lei, Ting; Belykh, Evgenii; Dru, Alexander B; Yagmurlu, Kaan; Elhadi, Ali M; Nakaji, Peter; Preul, Mark C
2016-07-01
Chen Jingrun (1933-1996), perhaps the most prodigious mathematician of his time, focused on the field of analytical number theory. His work on Waring's problem, Legendre's conjecture, and Goldbach's conjecture led to progress in analytical number theory in the form of "Chen's Theorem," which he published in 1966 and 1973. His early life was ravaged by the Second Sino-Japanese War and the Chinese Cultural Revolution. On the verge of solving Goldbach's conjecture in 1984, Chen was struck by a bicyclist while also bicycling and suffered severe brain trauma. During his hospitalization, he was also found to have Parkinson's disease. Chen suffered another serious brain concussion after a fall only a few months after recovering from the bicycle crash. With significant deficits, he remained hospitalized for several years without making progress while receiving modern Western medical therapies. In 1988 traditional Chinese medicine experts were called in to assist with his treatment. After a year of acupuncture and oxygen therapy, Chen could control his basic bowel and bladder functions, he could walk slowly, and his swallowing and speech improved. When Chen was unable to produce complex work or finish his final work on Goldbach's conjecture, his mathematical pursuits were taken up vigorously by his dedicated students. He was able to publish Youth Math, a mathematics book that became an inspiration in Chinese education. Although he died in 1996 at the age of 63 after surviving brutal political repression, being deprived of neurological function at the very peak of his genius, and having to be supported by his wife, Chen ironically became a symbol of dedication, perseverance, and motivation to his students and associates, to Chinese youth, to a nation, and to mathematicians and scientists worldwide.
An equilibrium point stabilization strategy for the Chen system
International Nuclear Information System (INIS)
Alvarez-Ramirez, Jose; Cevantes, Ilse; Femat, Ricardo
2004-01-01
The aim of this Letter is to address the equilibrium point stabilization problem of the Chen system by employing a simple linear feedback controller derived from time-scaling the dynamics of a single variable. The controller has the advantage of being easy to implement and a rigorous stability proof is provided based on singular perturbation arguments. Results are illustrated via numerical simulations
Generalized projective synchronization between Lorenz system and Chen's system
International Nuclear Information System (INIS)
Li Guohui
2007-01-01
On the basis of active backstepping design, this paper presents the generalized projective synchronization between two different chaotic systems: Lorenz system and Chen's system. The proposed method combines backstepping methods and active control without having to calculate the Lyapunov exponents and the eigenvalues of the Jacobian matrix, which makes it simple and convenient. Numerical simulations show that this method works very well
http://dx.doi.org/10.4314/ajtcam.v9i2.1
African Journals Online (AJOL)
AJTCAM
UHCC (Chen, 2009; Tong, 2010; Zhang et al., 2006; Zhu and Li, 2006). .... 2006; Yu and Kang, 2009) were identified for further study (726 patients), but without a .... inhibit its transition from G2 phase to M phase in vitro. .... Venook, A. P., Stagg, R. J., Lewis, B. J., Chase, J. L., Ring, E. J., Maroney, T. P., Hohn, D. C., (1990).
International Nuclear Information System (INIS)
Collantes Diaz, Ingrit; Goncalves, Eduardo; Yoshida, Massayoshi
2011-01-01
This work describes phytochemical analysis of an Araceae species Dracontium spruceanum (Schott) G.Zhu, which occurs in Amazon region and is popularly used against snakebite and treatment of some diseases. The solvent partitions and chromatographic fractionations of extract afforded sitosterol (I), stigmasterol (II), 3-β-hydroxycolest-5-en-7-one (III), p-hydroxybenzaldehyde (IV), p-hydroxybenzoic acid (V), acyl-glycosyl sitosterol (VI), acyl-glycosyl-7-oxo-sitosterol (VII), sitosteryl-glycoside (VIII), sucrose (IX). The polar fractions were acetylated before the purification and the isolation through chromatographic techniques yielded a mixture of peracetylated carbohydrates: 2,3,4,6-tetra-O-acetyl-1-ethyl-glucose (X), which was identified by spectroscopic analysis [GC-MS, 13 C NMR and 1 H NMR]. (author).
From Wang-Chen System with Only One Stable Equilibrium to a New Chaotic System Without Equilibrium
Pham, Viet-Thanh; Wang, Xiong; Jafari, Sajad; Volos, Christos; Kapitaniak, Tomasz
2017-06-01
Wang-Chen system with only one stable equilibrium as well as the coexistence of hidden attractors has attracted increasing interest due to its striking features. In this work, the effect of state feedback on Wang-Chen system is investigated by introducing a further state variable. It is worth noting that a new chaotic system without equilibrium is obtained. We believe that the system is an interesting example to illustrate the conversion of hidden attractors with one stable equilibrium to hidden attractors without equilibrium.
[Professor CHEN Xiuhua's experience in the treatment of atopic dermatitis].
Quan, Xiaohong; Li, Shuqian; Li, Ying
2017-03-12
Professor CHEN Xiuhua 's clinical experiences were introduced in the intervention on atopic dermatitis with external therapies of TCM acupuncture. On the basis of the theory as cultivating the earth and clearing the heart from professor CHEN Dacan and in terms of the disease stages and skin lesion characteristics, as well as in consideration of syndrome differen-tiation, the acupoints for strengthening the spleen and clearing heart fire are selected, such as Zhongwan (CV 12), Daheng (SP 15), Shuifen (CV 9), Tianshu (ST 25), Neiguan (PC 6) and Quchi (LI 11). For the repair of skin lesion, the integration of Chinese and western medicine is used, with the internal application and external use of Chinese herbal medicines involved. The topical ointments are selected rationally. The self-blood therapy is used with acupuncture, bleeding therapy and acupoint injection applied in combination on the basis of the theory of TCM zangfu organs and modern immunological mechanism, which stimulates the nonspecific immune response in the body and strengthens acupoint stimulus effects. Medical thread therapy of Guangxi Zhuang medicine is used in moxibustion for skin damage, which effectively stops itching and promotes wound healing and skin repair.
The 2nd International Conference on Water Resource and Environment (WRE 2016
Directory of Open Access Journals (Sweden)
Zhouli Liu
2016-11-01
Full Text Available Table of contents 01 The eco-toxicological effects of cadmium stress on five ornamental plants Zhouli Liu, Wei Chen, Xingyuan He, Shuai Yu, Weihang Ding 02 Study on the formation and release mechanisms of hydrogen sulfide in Longtan coal mine Jianjun Liu, Yuliang Wu, Kaixiang Fan 03 Coral bleaching in the North Reef of China’s Xisha Islands in 2014 Yuanchao Li, Xinqing Zheng, Shiquan Chen, Haiqun Xie 04 Soil chemical characteristics in a Cunninghamia lanceolata stand suffering from ice-snow damage Jie Li, Zhuomin Wang, Li Xue 05 Diversity of understory vegetation was under a Cunninghamia lanceolata stand suffering from ice-snow damage Zhiyang Lie, Weilong Huang, Tongtong Zhou, Li Xue 06 The effect of water, nitrogen and harvesting time on yield and biomass allocation of Helianthus tuberosus L. Kai Gao, Tiexia Zhu 07 The vertical variation of microbial communities in the sediment of sea cucumber pond Weiteng Mao, Pei Yu, Xinfang Lv, Yunchun Li 08 Indicating significances of alpine plant functional groups to environmental change Peixi Su, Rui Shi 09 Research on the daily CH4 fluxes of soil in summer mangrove community at Yingluogang of Guangxi, China Yong Jiang, Xingbin Chen, Shichu liang 10 Beach protection structures in middle and lower reaches of Yangtze River Junfeng Xu 11 Social responsibility management of large dam project with owner as core: an empirical case in China Jiwei Zhu, Zhao Zhai, Linan Zhou, Yun Le, Li Cao 12 The ecological function value assessment analysis of urban waterfront Jiwei Zhu, Ping Lu, Zhiqian Huang, Bei Zhou 13 Mechanism of diurnal osmotic potential changes and adjustment of three Caragana species in different habitats of the Inner Mongolia Plateau Zhirong Zheng, Shihai Lv, Chaoyang Feng 14 Biodiversity of phytoplankton and environmental influences analysis of Longfeng Wetland, China Nan Song, Yan Liu, Xinxin Lu, Yawen Fan 15 The effect of human activities on culturable soil microbes from Yaoquan Mountain in
Digallane with redox-active diimine ligand: dualism of electron-transfer reactions.
Fedushkin, Igor L; Skatova, Alexandra A; Dodonov, Vladimir A; Chudakova, Valentina A; Bazyakina, Natalia L; Piskunov, Alexander V; Demeshko, Serhiy V; Fukin, Georgy K
2014-05-19
The reactivity of digallane (dpp-Bian)Ga-Ga(dpp-Bian) (1), which consists of redox-active ligand 1,2-bis[(2,6-diisopropylphenyl)imino]acenaphthene (dpp-Bian), has been studied. The reaction of 1 with I2 proceeds via one-electron oxidation of each of two dpp-Bian ligands to a radical-anionic state and affords complex (dpp-Bian)IGa-GaI(dpp-Bian) (2). Dissolution of complex 2 in pyridine (Py) gives monomeric compound (dpp-Bian)GaI(Py) (3) as a result of a solvent-induced intramolecular electron transfer from the metal-metal bond to the dpp-Bian ligands. Treatment of compound 3 with B(C6F5)3 leads to removal of pyridine and restores compound 2. The reaction of compound 1 with 3,6-di-tert-butyl-ortho-benzoquinone (3,6-Q) proceeds with oxidation of all the redox-active centers in 1 (the Ga-Ga bond and two dpp-Bian dianions) and results in mononuclear catecholate (dpp-Bian)Ga(Cat) (4) (Cat = [3,6-Q](2-)). Treatment of 4 with AgBF4 gives a mixture of [(dpp-Bian)2Ag][BF4] (5) and (dpp-Bian)GaF(Cat) (6), which both consist of neutral dpp-Bian ligands. The reduction of benzylideneacetone (BA) with 1 generates the BA radical-anions, which dimerize, affording (dpp-Bian)Ga-(BA-BA)-Ga(dpp-Bian) (7). In this case the Ga-Ga bond remains unchanged. Within 10 min at 95 °C in solution compound 7 undergoes transformation to paramagnetic complex (dpp-Bian)Ga(BA-BA) (8) and metal-free compound C36H40N2 (9). The latter is a product of intramolecular addition of the C-H bond of one of the iPr groups to the C═N bond in dpp-Bian. Diamagnetic compounds 3, 5, 6, and 9 have been characterized by NMR spectroscopy, and paramagnetic complexes 2, 4, 7, and 8 by ESR spectroscopy. Molecular structures of 2-7 and 9 have been established by single-crystal X-ray analysis.
Protective effect of galangin in Concanavalin A-induced hepatitis in mice
Luo, Qingqiong; Zhu, Liping; Ding, Jieying; Zhuang, Xing; Xu, Lili; Chen, Fuxiang
2015-01-01
Qingqiong Luo,1,* Liping Zhu,1,* Jieying Ding,1 Xing Zhuang,1 Lili Xu,2 Fuxiang Chen1 1Department of Clinical Immunology, Shanghai Ninth People’s Hospital, Shanghai JiaoTong University School of Medicine, 2Division of Gastroenterology, Zhongshan Hospital, Fudan University, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Galangin is an active pharmacological ingredient from propolis and Alpinia officinarum Hance, an...
Ma Ying-jeou’s Presidential Discourse
Directory of Open Access Journals (Sweden)
Jonathan Sullivan
2012-01-01
Full Text Available Despite the substantial advances made in cross-Strait relations during Ma Ying-jeou’s (Ma Yingjiu first term, the ROC president’s rhetoric varied considerably as he grappled with the difficult reality of implementing campaign and inauguration pledges to establish better relations with China while striving to maintain national respect and sovereignty. In this article, we put forward a framework for measuring, analysing and explaining this variation in President Ma’s first-term discourse. Analysing a very large number of Ma’s speeches, addresses, etc., we provide empirical assessments of how the content of Ma’s public pronouncements has developed over time, how his rhetoric varies according to the strategic context and timing of a speech, and how his discourse compares to that of his predecessor, Chen Shui-bian (Chen Shuibian. In addressing these questions, the article contributes a quantitative perspective to existing work on political discourse in Taiwan and to the growing methodological and applied literature on how to systematically analyse Chinese political text.
Directory of Open Access Journals (Sweden)
Kirill Ole THOMPSON
2017-06-01
Full Text Available We are bearing witness to the rapid rise of a brave new world of education as flashy websites and interactive software replace individual study and classroom lectures. The expansion of college lecture halls has been stretched thin with video lessons and distance learning, and the siren call of massive open online courses (MOOCs by star Ivy League professors renders the traditional classroom barren in the eyes of savvy students who have the system pegged. Several questions arise in this context. Can the students of today receive a college education in the full sense? Does learning still have the same quality without close interactions with teachers and classmates in small to medium sized classrooms? Does research hold the same significance today when much of the work is done and so much information supplied by computers? What lessons do Zhu Xi’s teachings on inquiry and learning have for this educational world of e-texts and cyber-lessons? While not a Luddite tract, the present study raises questions and concerns about the goals and conduct of higher education today which, as Heisenberg avers, should not only aim at transmitting knowledge understood in set ways, but also at inculcating new ways of thinking and understanding. A college education, as Zhu Xi holds for “advanced learning”, is as much about cultivating a thoughtful, responsible person as producing a professional expert. Such education should include cultivating a student’s sensitivity, logic, and judgment, as well as knowledge about humanity, society, and the world. It is often forgotten that such sensitivity, logic, knowledge, and commitment not only make the student more thoughtful and responsible, in short more self-conscious, but also give her additional perspectives and enhance her professional expertise.
International Nuclear Information System (INIS)
Wu Shuang-Hong; Chen Zhi; Li Shi-Bin; Wang Xiao-Hui; Wei Xiong-Bang; Li Wen-Lian
2015-01-01
We choose 8-hydroxyquinoline derivative-metal complexes (Beq, Mgq, and Znq) as the acceptors (A) and 4,4',4”-tri-(2-methylphenyl phenylamino) triphenylaine (m-MTDATA) as the donor (D) respectively to study the existing energy transfer process in the organic ultraviolet (UV) photodetector (PD), which has an important influence on the sensitivity of PDs. The energy transfer process from D to A without exciplex formation is discussed, differing from the working mechanism of previous PDs with Gaq [Zisheng Su, Wenlian Li, Bei Chu, Tianle Li, Jianzhuo Zhu, Guang Zhang, Fei Yan, Xiao Li, Yiren Chen and Chun-Sing Lee 2008 Appl. Phys. Lett. 93 103309)] and REq [J. B. Wang, W. L. Li, B. Chu, L. L. Chen, G. Zhang, Z. S. Su, Y. R. Chen, D. F. Yang, J. Z. Zhu, S. H. Wu, F. Yan, H. H. Liu, C. S. Lee 2010 Org. Electron. 11 1301] used as an A material. Under 365-nm UV irradiation with an intensity of 1.2 mW/cm 2 , the m-MTDATA:Beq blend device with a weight ratio of 1:1 shows a response of 192 mA/W with a detectivity of 6.5× 10 11 Jones, which exceeds those of PDs based on Mgq (146 mA/W) and Znq (182 mA/W) due to better energy level alignment between m-MTDATA/Beq and lower radiative decay. More photophysics processes of the PDs involved are discussed in detail. (paper)
China Report: Political, Sociological and Military Affairs.
1983-03-18
Production Brigade of Guangbao Commune in raising chickens and rabbits in a big way. We must mobilize the commune member house- holds to utilize...The state and the commune, production brigades, and production teams operate fish farms, some of which raise fry . Why not go ahead with raising fish...Wei Xinyi, Huang Yu, Yang Jike, Guo Tixiang, Meng Fulin, Hu Tan, Zhu Nong, Fang Shiliang, Wang Zenong, Pan Ezhang, Liu Zhengwen, Chen Tianren, Ma
Protective effect of galangin in Concanavalin A- induced hepatitis in mice
Luo Q; Zhu L; Ding J; Zhuang X; Xu L; Chen F
2015-01-01
Qingqiong Luo,1,* Liping Zhu,1,* Jieying Ding,1 Xing Zhuang,1 Lili Xu,2 Fuxiang Chen1 1Department of Clinical Immunology, Shanghai Ninth People’s Hospital, Shanghai JiaoTong University School of Medicine, 2Division of Gastroenterology, Zhongshan Hospital, Fudan University, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Galangin is an active pharmacological ingredient from propolis and Alpinia officinarum Hance, and has been r...
Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing
Directory of Open Access Journals (Sweden)
Richard K. Payne
2016-03-01
Full Text Available Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between the expectations of the dominant religious culture and the immigrant culture in terms of the ways in which religious leaders represent themselves. Both Billy Graham and the Dalai Lama present themselves in very humble terms, consistent with the expectations of the Pietist background to American popular religion. Yogi Chen on the contrary tends toward a self-aggrandizing style, which although consistent with the competitive nature of premodern Tibetan religious culture is not congruent with the expectations of American popular religion.
Theoretical and experimental study of Chen chaotic system with notch filter feedback control
International Nuclear Information System (INIS)
Ming, Zhang Xiao; Jian-Hua, Peng; Ju-Fang, Chen
2010-01-01
Since the past two decades, the time delay feedback control method has attracted more and more attention in chaos control studies because of its simplicity and efficiency compared with other chaos control schemes. Recently, it has been proposed to suppress low-dimensional chaos with the notch filter feedback control method, which can be implemented in a laser system. In this work, we have analytically determined the controllable conditions for notch filter feedback controlling of Chen chaotic system in terms of the Hopf bifurcation theory. The conditions for notch filter feedback controlled Chen chaoitc system having a stable limit cycle solution are given. Meanwhile, we also analysed the Hopf bifurcation direction, which is very important for parameter settings in notch filter feedback control applications. Finally, we apply the notch filter feedback control methods to the electronic circuit experiments and numerical simulations based on the theoretical analysis. The controlling results of notch filter feedback control method well prove the feasibility and reliability of the theoretical analysis. (general)
Maximilien Brice
2002-01-01
L. to r.: Dr Diether Blechschmidt, Adviser for Non Member States Relations, Dr Peter Jenni, Spokesman, ATLAS Experiment, Prof. Chen, Mr Jean-Luc Baldy, Head of the LHC Civil Engineering Group and Dr John Ellis, Adviser for Non Member States Relations.
Directory of Open Access Journals (Sweden)
Pin-Yi Lin
2014-01-01
Full Text Available Background. Limited scientific evidence supports the positive effects of traditional Chinese medicine (TCM for treating dysmenorrhea. Thus, an observation period of 3 months could verify the ancient indication that TCM treatments effectively alleviate menstrual cramps in women with primary dysmenorrhea or endometriosis. Methods. A prospective, nonrandomized study (primary dysmenorrhea and endometriosis groups was conducted in women with dysmenorrhea for more than three consecutive menstrual cycles. All patients received TCM prescriptions based on bian zheng lun zhi theory 14 days before menstruation for a period of 12 weeks. Pain intensity was evaluated using a 10-cm visual analogue scale and two validated questionnaires (the Menstrual Distress Questionnaire and the World Health Organization Quality of Life questionnaire. Results. Of the initial 70 intent-to-treat participants, the women with dysmenorrhea reported significant alleviation of cramps during menstruation after the 12-week TCM treatment. Mixed model analysis revealed that TCM prescriptions were more effective in alleviating fatigue, hot flashes, dizziness, painful breasts, excitement, and irritability in the primary dysmenorrhea group (N=36 than in the endometriosis group (N=34. Conclusion. TCM prescriptions based on syndrome differentiation theory might be a potentially viable choice for treating painful menstruation and premenstrual symptoms after ruling out endometriosis.
Wu, Shuang-Hong; Li, Wen-Lian; Chen, Zhi; Li, Shi-Bin; Wang, Xiao-Hui; Wei, Xiong-Bang
2015-02-01
We choose 8-hydroxyquinoline derivative-metal complexes (Beq, Mgq, and Znq) as the acceptors (A) and 4,4',4”-tri-(2-methylphenyl phenylamino) triphenylaine (m-MTDATA) as the donor (D) respectively to study the existing energy transfer process in the organic ultraviolet (UV) photodetector (PD), which has an important influence on the sensitivity of PDs. The energy transfer process from D to A without exciplex formation is discussed, differing from the working mechanism of previous PDs with Gaq [Zisheng Su, Wenlian Li, Bei Chu, Tianle Li, Jianzhuo Zhu, Guang Zhang, Fei Yan, Xiao Li, Yiren Chen and Chun-Sing Lee 2008 Appl. Phys. Lett. 93 103309)] and REq [J. B. Wang, W. L. Li, B. Chu, L. L. Chen, G. Zhang, Z. S. Su, Y. R. Chen, D. F. Yang, J. Z. Zhu, S. H. Wu, F. Yan, H. H. Liu, C. S. Lee 2010 Org. Electron. 11 1301] used as an A material. Under 365-nm UV irradiation with an intensity of 1.2 mW/cm2, the m-MTDATA:Beq blend device with a weight ratio of 1:1 shows a response of 192 mA/W with a detectivity of 6.5× 1011 Jones, which exceeds those of PDs based on Mgq (146 mA/W) and Znq (182 mA/W) due to better energy level alignment between m-MTDATA/Beq and lower radiative decay. More photophysics processes of the PDs involved are discussed in detail. Project supported by the National Natural Science Foundation of China (Grant Nos. 61371046, 61405026, 61474016, and 61421002) and China Postdoctoral Science Foundation (Grant No. 2014M552330).
Software-Lösungen in B2B-Verkaufsgesprächen wirkungsvoll einsetzen
Thoma, Axel Michael
2017-01-01
Dieser Beitrag befasst sich mit dem Einsatz von Software-Lösungen in B2B-Verkaufsgesprächen (auf Englisch: Digital Sales Enablement). Anhand aktueller Beispiele aus der Geschäftswelt wird erklärt, wie solche Lösungen helfen (1) die Produktivität zu steigern, (2) Kunden zu aktivieren und (3) Neugeschäft zu entwickeln. Ebenfalls werden die Konzeption und Umsetzung solcher Lösungen behandelt.
Jonsson, J.E.; Afton, A.D.
2009-01-01
Body size affects foraging and forage intake rates directly via energetic processes and indirectly through interactions with social status and social behaviour. Ambient temperature has a relatively greater effect on the energetics of smaller species, which also generally are more vulnerable to predator attacks than are larger species. We examined variability in an index of intake rates and an index of alertness in Lesser Snow Geese Chen caerulescens caerulescens and Ross's Geese Chen rossii wintering in southwest Louisiana. Specifically we examined variation in these response variables that could be attributed to species, age, family size and ambient temperature. We hypothesized that the smaller Ross's Geese would spend relatively more time feeding, exhibit relatively higher peck rates, spend more time alert or raise their heads up from feeding more frequently, and would respond to declining temperatures by increasing their proportion of time spent feeding. As predicted, we found that Ross's Geese spent more time feeding than did Snow Geese and had slightly higher peck rates than Snow Geese in one of two winters. Ross's Geese spent more time alert than did Snow Geese in one winter, but alert rates differed by family size, independent of species, in contrast to our prediction. In one winter, time spent foraging and walking was inversely related to average daily temperature, but both varied independently of species. Effects of age and family size on time budgets were generally independent of species and in accordance with previous studies. We conclude that body size is a key variable influencing time spent feeding in Ross's Geese, which may require a high time spent feeding at the expense of other activities. ?? 2008 The Authors.
Huang, Weiping; Li, Naiqi
2015-03-01
Through the collection of Practice of acupuncture and moxibustion written by CHEN Jingwen, the acupuncture master in the Republic of China, the academic characteristics on acupuncture and moxibusiton were analyzed. The literature comparison method was adopted to compare the works of LUO Zhaoju, ZENG Tianzhi and LI Wenxian, etc. at the same period. It was discovered that CHEN Jingwen was the medical master who systematicly brought up the theory of acupoint properties earlier in the modern times. Classifying drugs based on acupoints was his academic feature. Additionally, the compatibility therapy of Chinese medicine was introduced to explain the essential ideas on the acupoints combination. The treatment was determined on the basis of zangxiang theory and the reinforcing and reducing therapy of acupuncture was emphasized in the determination of treatment and prescription. CHEN Jingwen's theory of acupoint property had been stressed and spread among the medical scholars in the Republic of China and he had made the beneficial exploration for the development of modern acupuncture and moxibustion therapy.
Calligraphy and meditation for stress reduction: an experimental comparison
Kao, Henry; Zhu,Lin.; Chen,Hao Yi; Liu,Ivy C.Y.; Zhang,Manlin; Chao,An An
2014-01-01
Henry SR Kao,1 Lin Zhu,2 An An Chao,3 Hao Yi Chen,4 Ivy CY Liu,5 Manlin Zhang6 1Department of Social Work and Social Administration, University of Hong Kong, Hong Kong; 2Department of Psychology, Renmin University of China, Beijing, 3International Society of Calligraphy Therapy, Hong Kong; 4Department of Business Administration, National Chengchi University, Taipei, Taiwan, 5Department of Psychology, Fu Jen Catholic University, Taipei, Taiwan; 6Department of Psychology, Sun Yat-Sen University...
Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing
Richard K. Payne
2016-01-01
Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between ...
International Nuclear Information System (INIS)
Karimipour, V.
2006-01-01
In the preceding Comment [Jian-Zhong Du, Su-Juan Qin, Qiao-Yan Wen, and Fu-Chen Zhu, Phys. Rev. A 74, 016301 (2006)], it has been shown that in a quantum secret sharing protocol proposed in [S. Bagherinezhad and V. Karimipour, Phys. Rev. A 67, 044302 (2003)], one of the receivers can cheat by splitting the entanglement of the carrier and intercepting the secret, without being detected. In this reply we show that a simple modification of the protocol prevents the receivers from this kind of cheating
Polyethylenimine-based micro/nanoparticles as vaccine adjuvants [Corrigendum
2017-01-01
Shen C, Li J, Zhang Y, et al. Int J Nano. 2017;12:5443–5460.The affiliations were presented as:Chen Shen1Jun Li1Yi Zhang1Yuce Li2Guanxin Shen3Jintao Zhu2Juan Tao11Department of Dermatology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China; 2School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan, China; 3Department of Immunology, Tongji Medical College, Huazhong University of Science and Te...
Le jeu de la création : Le mangeur (2005 de Ying Chen
Directory of Open Access Journals (Sweden)
Nicole Dunham
2013-11-01
Full Text Available Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005 de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants : le ventre du père, les tableaux peints par ce dernier et l’espace-temps de A., et la fenêtre. Ces éléments deviennent des aires de jeu, remettant en question les concepts de l’intérieur et de l’extérieur et du créateur et de l’œuvre. En nous servant du texte « Le Tunnel » écrit par Ying Chen, nous démontrerons que cette notion du jeu s’applique également à l’ensemble de son œuvre.
Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation
International Nuclear Information System (INIS)
Tam, L.M.; Chen, J.H.; Chen, H.K.; Wai Meng Si Tou
2008-01-01
A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, ε, and ω. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study
Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation
Energy Technology Data Exchange (ETDEWEB)
Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Chen, J.H. [Department of Mechanical Engineering, Chung Hua University, Hsinchu, Taiwan (China); Chen, H.K. [Department of Mechanical Engineering, Hsiuping Institute of Technology, Taichung, Taiwan (China); Wai Meng Si Tou [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)
2008-11-15
A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, {epsilon}, and {omega}. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study.
2011-11-16
... present ``Treatment of Cancer with Recombinant Immunotoxins: From Technology Transfer to the Patient.'' Dr. Pastan is an NIH Distinguished Investigator and Chief, Laboratory of Molecular Biology, National Cancer Institute Center for Cancer Research. This annual series honors Dr. Philip S. Chen, Jr. for his almost 50...
Xu, Jing-Yuan; Zhu, Yan; Yi, Ze; Wu, Gang; Xie, Guo-Yong; Qin, Min-Jian
2018-01-01
"Wu zhu yu", which is obtained from the dried unripe fruits of Tetradium ruticarpum (A. Jussieu) T. G. Hartley, has been used as a traditional Chinese medicine for treatment of headaches, abdominal colic, and hypertension for thousands of years. The present study was designed to assess the molecular genetic diversity among 25 collected accessions of T. ruticarpum (Wu zhu yu in Chinese) from different areas of China, based on inter-primer binding site (iPBS) markers and inter-simple sequence repeat (ISSR) markers. Thirteen ISSR primers generated 151 amplification bands, of which 130 were polymorphic. Out of 165 bands that were amplified using 10 iPBS primers, 152 were polymorphic. The iPBS markers displayed a higher proportion of polymorphic loci (PPL = 92.5%) than the ISSR markers (PPL = 84.9%). The results showed that T. ruticarpum possessed high loci polymorphism and genetic differentiation occurred in this plant. The combined data of iPBS and ISSR markers scored on 25 accessions produced five clusters that approximately matched the geographic distribution of the species. The results indicated that both iPBS and ISSR markers were reliable and effective tools for analyzing the genetic diversity in T. ruticarpum. Copyright © 2018 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Kondorskiy, A.; Nakamura, H.
2004-01-01
The title theory is developed by combining the Herman-Kluk semiclassical theory for adiabatic propagation on single potential-energy surface and the semiclassical Zhu-Nakamura theory for nonadiabatic transition. The formulation with use of natural mathematical principles leads to a quite simple expression for the propagator based on classical trajectories and simple formulas are derived for overall adiabatic and nonadiabatic processes. The theory is applied to electronically nonadiabatic photodissociation processes: a one-dimensional problem of H 2 + in a cw (continuous wave) laser field and a two-dimensional model problem of H 2 O in a cw laser field. The theory is found to work well for the propagation duration of several molecular vibrational periods and wide energy range. Although the formulation is made for the case of laser induced nonadiabatic processes, it is straightforwardly applicable to ordinary electronically nonadiabatic chemical dynamics
Dong, Chun-Wang; Zhu, Hong-Kai; Zhao, Jie-Wen; Jiang, Yong-Wen; Yuan, Hai-Bo; Chen, Quan-Sheng
2017-06-01
Tea is one of the three greatest beverages in the world. In China, green tea has the largest consumption, and needle-shaped green tea, such as Maofeng tea and Sparrow Tongue tea, accounts for more than 40% of green tea (Zhu et al., 2017). The appearance of green tea is one of the important indexes during the evaluation of green tea quality. Especially in market transactions, the price of tea is usually determined by its appearance (Zhou et al., 2012). Human sensory evaluation is usually conducted by experts, and is also easily affected by various factors such as light, experience, psychological and visual factors. In the meantime, people may distinguish the slight differences between similar colors or textures, but the specific levels of the tea are hard to determine (Chen et al., 2008). As human description of color and texture is qualitative, it is hard to evaluate the sensory quality accurately, in a standard manner, and objectively. Color is an important visual property of a computer image (Xie et al., 2014; Khulal et al., 2016); texture is a visual performance of image grayscale and color changing with spatial positions, which can be used to describe the roughness and directivity of the surface of an object (Sanaeifar et al., 2016). There are already researchers who have used computer visual image technologies to identify the varieties, levels, and origins of tea (Chen et al., 2008; Xie et al., 2014; Zhu et al., 2017). Most of their research targets are crush, tear, and curl (CTC) red (green) broken tea, curly green tea (Bilochun tea), and flat-typed green tea (West Lake Dragon-well green tea) as the information sources. However, the target of the above research is to establish a qualitative evaluation method on tea quality (Fu et al., 2013). There is little literature on the sensory evaluation of the appearance quality of needle-shaped green tea, especially research on a quantitative evaluation model (Zhou et al., 2012; Zhu et al., 2017).
Wang, Ting; Guo, Rixin; Zhou, Guohong; Zhou, Xidan; Kou, Zhenzhen; Sui, Feng; Li, Chun; Tang, Liying; Wang, Zhuju
2016-07-21
Panax notoginseng (Burk.) F.H. Chen is a widely used traditional Chinese medicine known as Sanqi or Tianqi in China. This plant, which is distributed primarily in the southwest of China, has wide-ranging pharmacological effects and can be used to treat cardiovascular diseases, pain, inflammation and trauma as well as internal and external bleeding due to injury. This paper provides up-to-date information on investigations of this plant, including its botany, ethnopharmacology, phytochemistry, pharmacology and toxicology. The possible uses and perspectives for future investigation of this plant are also discussed. The relevant information on Panax notoginseng (Burk.) F.H. Chen was collected from numerous resources, including classic books about Chinese herbal medicine, and scientific databases, including Pubmed, SciFinder, ACS, Ebsco, Elsevier, Taylor, Wiley and CNKI. More than 200 chemical compounds have been isolated from Panax notoginseng (Burk.) F.H. Chen, including saponins, flavonoids and cyclopeptides. The plant has pharmacological effects on the cardiovascular system, immune system as well as anti-inflammatory, anti-atherosclerotic, haemostatic and anti-tumour activities, etc. Panax notoginseng is a valuable traditional Chinese medical herb with multiple pharmacological effects. This review summarizes the botany, ethnopharmacology, phytochemistry, pharmacology and toxicology of P. notoginseng, and presents the constituents and their corresponding chemical structures found in P. notoginseng comprehensively for the first time. Future research into its phytochemistry of bio-active components should be performed by using bioactivity-guided isolation strategies. Further work on elucidation of the structure-function relationship among saponins, understanding of multi-target network pharmacology of P. notoginseng, as well as developing its new clinical usage and comprehensive utilize will enhance the therapeutic potentials of P. notoginseng. Copyright © 2016
Directory of Open Access Journals (Sweden)
GB Jiao
2010-01-01
Full Text Available In the current work, the courtship and mating of Scorpiops luridus Zhu Lourenço & Qi, 2005 (Euscorpiidae from Xizang province (Tibet, China, were studied for the first time in the laboratory. Most of the mating behaviors in Scorpiops luridus are not remarkably different from those exhibited by other scorpions. However, for the first time a male pulling a female with its chelicerae to rapidly accomplish the sperm uptake was observed. Additionally, the sexual stinging behavior displayed by the male occurred in the initial stage, not during the promenade stage as previously described in several scorpion species. Through observation and analysis, we speculate that venom injection during sexual stinging is selective, possibly relying on the status shown by the stung scorpion (passive or aggressive. In order to clearly describe the process of courtship and mating, both sequences are represented in a flow chart, while the main behavior components of these processes were identified, analyzed and discussed.
Security problems for a pseudorandom sequence generator based on the Chen chaotic system
Özkaynak, Fatih; Yavuz, Sırma
2013-09-01
Recently, a novel pseudorandom number generator scheme based on the Chen chaotic system was proposed. In this study, we analyze the security weaknesses of the proposed generator. By applying a brute force attack on a reduced key space, we show that 66% of the generated pseudorandom number sequences can be revealed. Executable C# code is given for the proposed attack. The computational complexity of this attack is O(n), where n is the sequence length. Both mathematical proofs and experimental results are presented to support the proposed attack.
Wang, Wei; Ye, Jiaren; Bidgoli, Tandis; Yang, Xianghua; Shi, Hesheng; Shu, Yu
2017-11-01
Paleogene syn-rift successions in the South China Sea are poorly understood and systematic provenance analysis, which could provide clues to their history, is lacking. Here we report 409 new concordant U-Pb ages from detrital zircons separated from the Paleogene Wenchang, Enping, and Zhuhai formations in the Zhu 1 depression, Pearl River Mouth Basin. The new data, combined with the published age data from the region, document changes in the provenance of syn-rift successions. Detrital zircons from the Eocene Wenchang Formation are unimodal, with Jurassic-Cretaceous (180-80 Ma) ages making up >80% of grains. The ages are consistent with the geochronology of intrabasinal highs, dominated by igneous rocks emplaced during the Yanshanian orogeny, and suggest local provenance. By contrast, detrital zircons from the upper Eocene to lower Oligocene Enping Formation form three well-recognized age-clusters, with peaks at 150, 254, and 438 Ma that match documented tectonomagmatism in South China Block (SCB). Combined with increasing numbers of Precambrian zircons, the data suggest increasing influence of regional provenance of the SCB. Similar age peaks are also recognized from the limited number of zircons analyzed from the upper Oligocene Zhuhai Formation and comparability with modern shelf and river sediment indicates the unit was mainly sourced from the SCB and likely transported by a paleo-Pearl River. We infer that the change in provenance, from local uplifts within the Zhu 1 to the SCB, is related to distinct phases of PRMB rift development; however, later changes are best explained by SCB drainage evolution.
Li, H; Lai, W
1999-04-01
Being the earliest monograph on plague in China, Luo Zhiyuan's Shu yi hui bian, not included in the National Catalogue of TCM Books, include the following contents: personal idea on the etiology of plague; Luo's friend Wu Xuanchang' unpublished Shu yu zhi fa on the treatment and manifestations of plague; Luo's specific recipe for plague based on medified Wang Qingren's Jie du huo xue decoction based on Wang Qingrens yi lin gai cuo; therapy for critical cases; many therapies applied on Lingnan, including experimental recipes, external therapy, preventive methods, and preventing recurrence methods; Luo's special administrating methods, including persisting day-and-night method, immediate persisting method, single-dose persisting method, and double-dose persisting method. He also gave several cured case records. His book, featuring unique idea with good effect, was repeatedly printed and extensively distributed, exerting influence, more or less, on the plague monographs of later ages, and occupying important position in the history of plague on Lingnan and the whole country as well. His idea of "that poisons and static blood" in pathogenesis and therapeutic principle of antitoxicity and activating blood is coincided with the results of present day clinical and laboratory studies. His administration of medicines is heuristic to the therapy of critical cases with Chinese medicaments and to the recognition of pathogenesis, etiology, and treatment of modern plague as well as other diseases of similar etiology and pathognesis and is worth of further study.
Dark energy from cosmological fluids obeying a Shan-Chen non-ideal equation of state
Bini, Donato; Geralico, Andrea; Gregoris, Daniele; Succi, Sauro
2014-01-01
We consider a Friedmann-Robertson-Walker universe with a fluid source obeying a nonideal equation of state with ‘‘asymptotic freedom,’’ namely ideal gas behavior (pressure changes directly proportional to density changes) both at low and high density regimes, following a fluid dynamical model due to Shan and Chen. It is shown that, starting from an ordinary energy density component, such fluids naturally evolve towards a universe with a substantial ‘‘dark energy’’ component at the present tim...
International Nuclear Information System (INIS)
Moreno M, A.; Moreno B, A.
2000-01-01
In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)
Energy Technology Data Exchange (ETDEWEB)
Moreno M, A. [Departamento de Apoyo en Ciencias Aplicadas, Benemerita Universidad Autonoma de Puebla, 4 Sur 104, Centro Historico, 72000 Puebla (Mexico); Moreno B, A
2000-07-01
In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)
Chen-Nester-Tung quasi-local energy and Wang-Yau quasi-local mass
Liu, Jian-Liang; Yu, Chengjie
2017-10-01
In this paper, we show that the Chen-Nester-Tung (CNT) quasi-local energy with 4D isometric matching references is closely related to the Wang-Yau (WY) quasi-local energy. As a particular example, we compute the second variation of the CNT quasi-local energy for axially symmetric Kerr-like spacetimes with axially symmetric embeddings at the obvious critical point (0 , 0) and find that it is a saddle critical point in most of the cases. Also, as a byproduct, we generalize a previous result about the coincidence of the CNT quasi-local energy and Brown-York mass for axially symmetric Kerr-like spacetimes by Tam and the first author Liu and Tam (2016) to general spacetimes.
Modern process study on Chen Co and Ranwu Lake of Tibetan Plateau
Ju, J.
2013-12-01
Lakes are important junctions of geospheres. There are many lakes distributed on the Tibetan Plateau (TP). Lake sediment is one of the important media for retrieving the past environmental changes. Because of the uniqueness of environment of the TP, sediment, water and ecological system in lakes has local characteristic inevitably. Modern process research on different lakes will benefit interpreting the proxies more accurately. The development of observation station makes the observation and sampling more convenient. Modern process of lakes can be fulfilled in two ways, spatial or seasonal variation study, with a same aim finding out the dominant factors controlling the variations. Chen Co is a closed lake locating at inland area of southern Tibet. Ranwu Lake is an open lake locating at outflow area of SE Tibet. In this study, I studied the spatial and (or) seasonal variation of lake water and sediment in the two distinct types of lakes to make clear the mechanism of modern process. Particular attention was given to the pattern and degree of influence of rivers supplied by glaciers on lakes. Preliminary conclusions are outlined as follow: (1) In the lakes with glacier melt supplying rivers, the patterns of supply of the rivers to the lake are different. In close lake Chen Co, the influence of glacier melt is mainly reflected in the south lake area. In the open lake Ranwu Lake, the influence is comprehensive and direct. This difference influencing patterns how the lake sediments reflected the glacier melt under the past environmental changes. (2) The supply of Kaluxiong Qu River, supplied mainly by glacier melt, to Chen co has North-South difference: more directly to south lake area, reflecting by lower value of conductivity and pH, finer grain size and west to east transporting trend, greater deposition rate, more allogenic fine sediments, not obvious biological and endogenic deposition there. This enlightens the site selection for lake cores and interpretation of
Powerful women leaders rise in Asia despite gender inequality.
Over the years, Asia has produced some of the worlds most formidable women leaders, including Indira Ghandi, Madame Mao, Benazir Bhutto, and Corazon Aquino. The list continues with South Asia's leaders, prime ministers, opposition leaders, and vice-presidents, however, such an impressive list does not reflect true equality nor enlightened gender politics. According to Sonny Lo, sociology professor at Hong Kong University, no Asian political system observes true gender equality. It is noted that these Asian leaders rose into prominence after the death or imprisonment of their fathers or husbands. Nevertheless, the elections of Anson Chan and life-long dissident Annette Lu, signal the emergence of a new model for women leaders in Asia. Still, Lo emphasizes that this new trend is merely a reflection of civil service equal opportunity rules. Lo adds that even Taiwan President Chen Sui-Bian's all-women cabinet does not reflect the nation's sentiment, but a wish to project an image.
Le jeu de la création : Le mangeur (2005) de Ying Chen
Nicole Dunham
2013-01-01
Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005) de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants...
Information systems and computing technology
Zhang, Lei
2013-01-01
Invited papersIncorporating the multi-cross-sectional temporal effect in Geographically Weighted Logit Regression K. Wu, B. Liu, B. Huang & Z. LeiOne shot learning human actions recognition using key posesW.H. Zou, S.G. Li, Z. Lei & N. DaiBand grouping pansharpening for WorldView-2 satellite images X. LiResearch on GIS based haze trajectory data analysis system Y. Wang, J. Chen, J. Shu & X. WangRegular papersA warning model of systemic financial risks W. Xu & Q. WangResearch on smart mobile phone user experience with grounded theory J.P. Wan & Y.H. ZhuThe software reliability analysis based on
Pitchfork bifurcation and circuit implementation of a novel Chen hyper-chaotic system
International Nuclear Information System (INIS)
Dong En-Zeng; Chen Zeng-Qiang; Chen Zai-Ping; Ni Jian-Yun
2012-01-01
In this paper, a novel four dimensional hyper-chaotic system is coined based on the Chen system, which contains two quadratic terms and five system parameters. The proposed system can generate a hyper-chaotic attractor in wide parameters regions. By using the center manifold theorem and the local bifurcation theory, a pitchfork bifurcation is demonstrated to arise at the zero equilibrium point. Numerical analysis demonstrates that the hyper-chaotic system can generate complex dynamical behaviors, e.g., a direct transition from quasi-periodic behavior to hyper-chaotic behavior. Finally, an electronic circuit is designed to implement the hyper-chaotic system, the experimental results are consist with the numerical simulations, which verifies the existence of the hyper-chaotic attractor. Due to the complex dynamic behaviors, this new hyper-chaotic system is useful in the secure communication. (general)
Wormholes supported by phantom energy from Shan-Chen cosmological fluids
Energy Technology Data Exchange (ETDEWEB)
Wang, Deng [Nankai University, Theoretical Physics Division, Chern Institute of Mathematics, Tianjin (China); Meng, Xin-He [Nankai University, Department of Physics, Tianjin (China); Institute of Theoretical Physics, CAS, State key Lab of Theoretical Physics, Beijing (China)
2016-03-15
In the present paper, the exact solutions of spherically symmetrical Einstein field equations describing wormholes supported by phantom energy that violates the null energy condition from Shan-Chen background fluid are obtained. We have considered the important case of the model parameter ψ ∼ 1, which corresponds to the ''saturation effect'', and this regime corresponds to an effective form of ''asymptotic freedom'' for the fluids, but occurring at cosmological rather than subnuclear scales. Then we investigate the allowed range for the values of the model parameters g and ω when the spacetime metrics describe wormholes and discuss the possible singularities of the solutions, finding that the obtained spacetimes are geodesically complete. Furthermore, we construct two traversable wormholes through matching our obtained interior solutions to the exterior Schwarzschild solutions and analyze the traversabilities of the wormholes. Finally, we consider the case of anisotropic pressure and discover that the transverse pressure also crosses the phantom divide -1 with the growth of the wormhole dimension, and it tends to be the same as the radial pressure with the growth of the wormhole radius. (orig.)
Ginzburg, Irina
2016-02-01
In this Comment on the recent work (Zhu and Ma, 2013) [11] by Zhu and Ma (ZM) we first show that all three local gray Lattice Boltzmann (GLB) schemes in the form (Zhu and Ma, 2013) [11]: GS (Chen and Zhu, 2008; Gao and Sharma, 1994) [1,4], WBS (Walsh et al., 2009) [12] and ZM, fail to get constant Darcy's velocity in series of porous blocks. This inconsistency is because of their incorrect definition of the macroscopic velocity in the presence of the heterogeneous momentum exchange, while the original WBS model (Walsh et al., 2009) [12] does this properly. We improve the GS and ZM schemes for this and other related deficiencies. Second, we show that the ;discontinuous velocity; they recover on the stratified interfaces with their WBS scheme is inherent, in different degrees, to all LBE Brinkman schemes, including ZM scheme. None of them guarantees the stress and the velocity continuity by their implicit interface conditions, even in the frame of the two-relaxation-times (TRT) collision operator where these two properties are assured in stratified Stokes flow, Ginzburg (2007) [5]. Third, the GLB schemes are presented in work (Zhu and Ma, 2013) [11] as the alternative ones to direct, Brinkman-force based (BF) schemes (Freed, 1998; Nie and Martys, 2007) [3,8]. Yet, we show that the BF-TRT scheme (Ginzburg, 2008) [6] gets the solutions of any of the improved GLB schemes for specific, viscosity-dependent choice of its one or two local relaxation rates. This provides the principal difference between the GLB and BF: while the BF may respect the linearity of the Stokes-Brinkman equation rigorously, the GLB-TRT cannot, unless it reduces to the BF via the inverse transform of the relaxation rates. Furthermore, we show that, in limited parameter space, ;gray; schemes may run one another. From the practical point of view, permeability values obtained with the GLB are viscosity-dependent, unlike with the BF. Finally, the GLB shares with the BF a so-called anisotropy (Ginzburg
2012-07-10
2007;25(1):97-98. [19] Stewart C. Blast Injuries. Colorado Springs: USAF Academy Hospital; 2006. 88 p. [20] Cernak I, Wang Z, Jiang J, Bian X, Savic J...Wang Z, Jiang J, Bian X, Savic J. Ultrastructural and Functional Characteristics of Blast Injury- Induced Neurotrauma. Journal of Trauma: Injury
Thermoelectric cooler concepts and the limit for maximum cooling
International Nuclear Information System (INIS)
Seifert, W; Hinsche, N F; Pluschke, V
2014-01-01
The conventional analysis of a Peltier cooler approximates the material properties as independent of temperature using a constant properties model (CPM). Alternative concepts have been published by Bian and Shakouri (2006 Appl. Phys. Lett. 89 212101), Bian (et al 2007 Phys. Rev. B 75 245208) and Snyder et al (2012 Phys. Rev. B 86 045202). While Snyder's Thomson cooler concept results from a consideration of compatibility, the method of Bian et al focuses on the redistribution of heat. Thus, both approaches are based on different principles. In this paper we compare the new concepts to CPM and we reconsider the limit for maximum cooling. The results provide a new perspective on maximum cooling. (paper)
Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige
Giafferri, Xiaomin
2008-01-01
Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authen...
The impact of systematic landscape conservation planning on ecosystem: Chen Youlan river watershed
Chen, Chi-ju
2017-04-01
Heraclitus said that "no man ever steps in the same river twice." Everything continues to change. Land use change will keep redefine itself and subject the Earth and humankind to collateral changes. Humankind benefits from ecosystem in many ways. The ecosystem provides people with nutrients, enriches soil with sediment, and sustains all living organisms with water; these benefits are known as ecosystem services. In Taiwan, land use change has impacted ecosystem and biodiversity on various levels. Thus, we took six land use scenarios from 1999 to 2005 in Chen Youlan river watershed as our case study, intending to observe the course of ecosystem and biodiversity changes and the cause of it. Systematic Landscape conservation planning (SLCP) framework can be adopted when designing land use policy to safeguard human interests and ecosystem. This study use SLCP to develop ecosystem services and biodiversity protection strategies. Several strategies were designed by using 1999 to 2005 data as provision to protect the intactness of future ecosystem services and biodiversity. This research explores the potential and possible impacts of different land use protection strategies in the future. It is possible to identify the conservation priority of a certain region by using the Zonation meta-algorithm. This study selects the zonation critical protection area (Joint set of Yushan National Park) as strategy A, B and C. Strategy D takes Yushan National Park as a protected area; unstable hot spots in 1999/03 (Joint set of Yushan National Park) are selected as strategy E. Next, we used Kappa statistical method to find the minimal ecosystem services change and biodiversity hotspots change of the five aforementioned strategies and compared with those from 1999/03. By the Kappa statistical method, we further prioritized the important conservation areas by strategy A, B, C, E in the future. The results can not only serve as management reference for government agencies, but also develop
Directory of Open Access Journals (Sweden)
Yucheng Lin
2016-10-01
Full Text Available Forty-three new species of Nesticidae are described from China, Indonesia, Philippines, Singapore, Thailand, Vietnam and Madagascar, and two new junior synonyms are suggested. A new genus, Speleoticus gen. n., is described with Nesticus navicellatus Liu & Li, 2013 as the type species, and four species are transferfed from Nesticus, i.e., Speleoticus globosus (Liu & Li, 2013, comb. n., S. libo (Chen & Zhu, 2005, comb. n., S. navicellatus (Liu & Li, 2015, comb. n. and S. uenoi (Yaginuma, 1972, comb. n. The new species described in this paper belong to four genera and are: Hamus cornutus sp. n. (♂♀, H. kangdingensis sp. n. (♂, H. luzon sp. n. (♀, H. mangunensis sp. n. (♂, Nescina kohi sp. n. (♂♀, Nesticella baiseensis sp. n. (♂♀, N. baobab sp. n. (♂, N. caeca sp. n. (♂♀, N. chongqing sp. n. (♀, N. dazhuangensis sp. n. (♂♀, N. fuliangensis sp. n. (♂♀, N. gazuida sp. n. (♀, N. gongshanensis sp. n. (♀, N. griswoldi sp. n. (♂♀, N. hongheensis sp. n. (♂♀, N. huomachongensis sp. n. (♂♀, N. jingpo sp. n. (♀, N. kaohsiungensis sp. n. (♂♀, N. lisu sp. n. (♂♀, N. liuzhaiensis sp. n. (♀, N. nandanensis sp. n. (♂♀, N. phami sp. n. (♂♀, N. potala sp. n. (♀, N. qiaoqiensis sp. n. (♀, N. qiongensis sp. n. (♂♀, N. robusta sp. n. (♂♀, N. rongtangensis sp. n. (♂, N. sanchaheensis sp. n. (♂♀, N. sulawesi sp. n. (♀, N. sumatrana sp. n. (♂, N. tibetana sp. n. (♂♀, N. vanlang sp. n. (♀, N. wanzaiensis sp. n. (♂♀, N. xiongmao sp. n. (♂♀, N. xixia sp. n. (♂♀, N. yanbeiensis sp. n. (♂♀, N. yao sp. n. (♀, N. zhiyuani sp. n. (♂♀, Pseudonesticus dafangensis sp. n. (♂♀, P. miao sp. n. (♂♀, P. spinosus sp. n. (♂♀, P. wumengensis sp. n. (♀, P. ziyunensis sp. n. (♂♀. Nesticella inthanoni (Lehtinen & Saaristo, 1980, syn. n. is synonymised with N. mollicula (Thorell, 1898; N. taiwan Tso & Yoshida, 2000, syn. n. is synonymised with N. odonta (Chen
The flea beetle genus Meishania Chen & Wang is revised and five new species - M. cangshanensis sp. nov., M. flavipennis sp. nov., M. fulvotigera sp. nov., and M. sichuanica sp. nov. from China and M. bhutanensis sp. nov. from Bhutan - are described. All species of Meishania are illustrated and a key...
Directory of Open Access Journals (Sweden)
Chen BQ
2017-03-01
Full Text Available Biao-Qi Chen,1 Ranjith Kumar Kankala,1,2 Ai-Zheng Chen,1,2 Ding-Zhu Yang,1 Xiao-Xia Cheng,1 Ni-Na Jiang,1,2 Kai Zhu,3,4 Shi-Bin Wang1,2 1Institute of Biomaterials and Tissue Engineering, 2Fujian Provincial Key Laboratory of Biochemical Technology, Huaqiao University, Xiamen, Fujian, 3Department of Cardiac Surgery, Zhongshan Hospital, Fudan University, 4Shanghai Institute of Cardiovascular Disease, Shanghai, People’s Republic of China Abstract: Attempts to reflect the physiology of organs is quite an intricacy during the tissue engineering process. An ideal scaffold and its surface topography can address and manipulate the cell behavior during the regeneration of targeted tissue, affecting the cell growth and differentiation significantly. Herein, silk fibroin (SF nanoparticles were incorporated into poly(L-lactic acid (PLLA to prepare composite scaffolds via phase-inversion technique using supercritical carbon dioxide (SC-CO2. The SF nanoparticle core increased the surface roughness and hydrophilicity of the PLLA scaffolds, leading to a high affinity for albumin attachment. The in vitro cytotoxicity test of SF/PLLA scaffolds in L929 mouse fibroblast cells indicated good biocompatibility. Then, the in vitro interplay between mouse preosteoblast cell (MC3T3-E1 and various topological structures and biochemical cues were evaluated. The cell adhesion, proliferation, osteogenic differentiation and their relationship with the structures as well as SF content were explored. The SF/PLLA weight ratio (2:8 significantly affected the MC3T3-E1 cells by improving the expression of key players in the regulation of bone formation, ie, alkaline phosphatase (ALP, osteocalcin (OC and collagen 1 (COL-1. These results suggest not only the importance of surface topography and biochemical cues but also the potential of applying SF/PLLA composite scaffolds as biomaterials in bone tissue engineering. Keywords: super critical fluids, surface topography, bone
CERN Photo Service
2008-01-01
21 October 2008 - LHC Inauguration - IHEP Beijing representative Prof. Chen, People's Republic of China, welcomed by CERN Director-General R. Aymar, CERN Chief Scientific Officer J. Engelen and CERN Financial Officer S. Lettow.
Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige
Directory of Open Access Journals (Sweden)
Xiaomin Giafferri
2008-12-01
Full Text Available Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authenticité s’établit à travers les mécanismes de la fictionnalisation de l’Histoire. L’observation de leur manifestation est amenée à considérer deux axes principaux : l’organisation du récit et la mise en scène des personnages.
Directory of Open Access Journals (Sweden)
Yu Y
2017-08-01
Full Text Available Yanyan Yu, Gaoxing Su, Hongyan Zhu, Qing Zhu, Yong Chen, Bohui Xu, Yuqin Li, Wei Zhang School of Pharmacy, Nantong University, Nantong, People’s Republic of China Abstract: In this study, we fabricated a novel electrochemical biosensing platform on the basis of target-triggered proximity hybridization-mediated isothermal exponential amplification reaction (EXPAR for ultrasensitive protein analysis. Through rational design, the aptamers for protein recognition were integrated within two DNA probes. Via proximity hybridization principle, the affinity protein-binding event was converted into DNA assembly process. The recognition of protein by aptamers can trigger the strand displacement through the increase of the local concentrations of the involved probes. As a consequence, the output DNA was displaced, which can hybridize with the duplex probes immobilized on the electrode surface subsequently, leading to the initiation of the EXPAR as well as the cleavage of duplex probes. Each cleavage will release the gold nanoparticles (AuNPs binding sequence. With the modification of G-quadruplex sequence, electrochemical signals were yielded by the AuNPs through oxidizing 3,3',5,5'-tetramethylbenzidine in the presence of H2O2. The study we proposed exhibited high sensitivity toward platelet-derived growth factor BB (PDGF-BB with the detection limit of 52 fM. And, this method also showed great selectivity among the PDGF isoforms and performed well in spiked human serum samples. Keywords: electrochemical biosensor, proximity hybridization, PDGF-BB, isothermal exponential amplification, G-quadruplex
Terrone, Antonio
2010-01-01
This research starts from the historical assertion that notwithstanding their claim of increased religious tolerance, the dramatic post-Mao political campaigns have continued to weaken the pervasive force of religious faith, traditional monastery-centered religious power, religious leadership, and
Directory of Open Access Journals (Sweden)
Chen SL
2013-04-01
Full Text Available Shao-Liang Chen, Jian-Cheng Zhu, Xiao-Bo Li, Fei Ye, Jun-Jie Zhang, Zhi-Zhong Liu, Nai-Liang Tian, Song Lin, Cheng-Yu Lv Nanjing First Hospital, Nanjing Medical University, Nanjing, People's Republic of China Background: Stent grafting for treatment of type B aortic dissection has been extensively used. However, the difference in the long-term clinical outcome between patients with chronic versus acute type B aortic dissection remains unknown. This study aimed to analyze the difference in long-term clinical outcome after endovascular repair for patients with chronic (93% complete false-lumen thrombosis. Untreated tear and type I endoleak were predictors of clinical events during follow-up. Conclusion: Comparable long-term clinical results were achieved in patients with chronic or acute type B aortic dissection after implantation of a stent graft. Keywords: aortic dissection, endovascular repair, procedure-related events, propensity score matching
Maximilien Brice
2007-01-01
Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.
Mak, Kwok-Kei; Lai, Ching-Man; Ko, Chih-Hung; Chou, Chien; Kim, Dong-Il; Watanabe, Hiroko; Ho, Roger C M
2014-10-01
The Revised Chen Internet Addiction Scale (CIAS-R) was developed to assess Internet addiction in Chinese populations, but its psychometric properties in adolescents have not been examined. This study aimed to evaluate the factor structure and psychometric properties of CIAS-R in Hong Kong Chinese adolescents. 860 Grade 7 to 13 students (38 % boys) completed the CIAS-R, the Young's Internet Addiction Test (IAT), and the Health of the Nation Outcome Scales for Children and Adolescents (HoNOSCA) in a survey. The prevalence of Internet addiction as assessed by CIAS-R was 18 %. High internal consistency and inter-item correlations were reported for the CIAS-R. Results from the confirmatory factor analysis suggested a four-factor structure of Compulsive Use and Withdrawal, Tolerance, Interpersonal and Health-related Problems, and Time Management Problems. Moreover, results of hierarchical multiple regression supported the incremental validity of the CIAS-R to predict mental health outcomes beyond the effects of demographic differences and self-reported time spent online. The CIAS is a reliable and valid measure of internet addiction problems in Hong Kong adolescents. Future study is warranted to validate the cutoffs of the CIAS-R for identification of adolescents with Internet use problems who may have mental health needs.
Directory of Open Access Journals (Sweden)
Chih-Hung Ko
2005-12-01
Full Text Available The aim of this study was to establish the optimal cut-off points of the Chen Internet Addiction Scale (CIAS, to screen for and diagnose Internet addiction among adolescents in the community by using the well- established diagnostic criteria of Internet addiction. This survey of 454 adolescents used screening (57/58 and diagnostic (63/64 cut-off points of the CIAS, a self-reported instrument, based on the results of systematic diagnostic interviews by psychiatrists. The area under the curve of the receiver operating characteristic curve revealed that CIAS has good diagnostic accuracy (89.6%. The screening cut-off point had high sensitivity (85.6% and the diagnostic cut-off point had the highest diagnostic accuracy, classifying 87.6% of participants correctly. Accordingly, the screening point of the CIAS could provide a screening function in two-stage diagnosis, and the diagnostic point could serve as a diagnostic criterion in one-stage massive epidemiologic research.
Ground-state magnetization of the Ising spin glass: A recursive numerical method and Chen-Ma scaling
Sepehrinia, Reza; Chalangari, Fartash
2018-03-01
The ground-state properties of quasi-one-dimensional (Q1D) Ising spin glass are investigated using an exact numerical approach and analytical arguments. A set of coupled recursive equations for the ground-state energy are introduced and solved numerically. For various types of coupling distribution, we obtain accurate results for magnetization, particularly in the presence of a weak external magnetic field. We show that in the weak magnetic field limit, similar to the 1D model, magnetization exhibits a singular power-law behavior with divergent susceptibility. Remarkably, the spectrum of magnetic exponents is markedly different from that of the 1D system even in the case of two coupled chains. The magnetic exponent makes a crossover from being dependent on a distribution function to a constant value independent of distribution. We provide an analytic theory for these observations by extending the Chen-Ma argument to the Q1D case. We derive an analytical formula for the exponent which is in perfect agreement with the numerical results.
Politics in the Western Maya Region (I: Ajawil/Ajawlel and Ch'e'n
Directory of Open Access Journals (Sweden)
Péter Bíró
2011-01-01
Full Text Available In a series of articles I reflect on the use of various expressions which are connected to what we call the political in the inscriptions of the Classic Maya Western Region. These words express concepts which help to understand the intricate details of the interactions between the political entities and their internal organisations in the Classic Maya Lowlands. Words such as 7ajawil, 7ajawlel, the kennings built on the base of ch'e7n (cave, pond, the emblem glyphs and titles will be examined in light of what they tell us about the functioning of the political organisation of the Classic Period in a constrained region.En una serie de artículos como éste investigo el uso de varias palabras en las inscripciones mayas de la época Clásica de la Región Occidental vinculadas con lo que nosotros llamamos "política". Estas palabras expresan conceptos que ayudan a entender los matices de las relaciones entre las entidades políticas de las Tierras Bajas Mayas y su organización interna. Términos como ajaw'ü I ajawlel, los difrasismos con base ch'e'n (cueva, pozo, los glifos emblemas y los títulos serán examinados tomando en cuenta la información que nos proporcionan sobre el funcionamiento de la organización política de la época Clásica en una región restringida.
Directory of Open Access Journals (Sweden)
Lin-Lin Wang
2015-11-01
Full Text Available “Zhu She Yong Xue Shuan Tong” lyophilized powder (ZSYXST, consists of a series of saponins extracted from Panax notoginseng, which has been widely used in China for the treatment of strokes. In this study, an ultra-high performance liquid chromatography with quadrupole time-of-flight mass spectrometry (UHPLC-Q-TOF/MS combined with preparative high performance liquid chromatography (PHPLC method was developed to rapidly identify both major and minor saponins in ZSYXST. Some high content components were removed through PHPLC in order to increase the sensitivity of the trace saponins. Then, specific characteristic fragment ions in both positive and negative mode were utilized to determine the types of aglycone, saccharide, as well as the saccharide chain linkages. As a result, 94 saponins, including 20 pairs of isomers and ten new compounds, which could represent higher than 98% components in ZSYXST, were identified or tentatively identified in commercial ZSYXST samples.
Dong, Yajie
2017-02-01
Quantum dots (QDs) have gone through a long journey before finding their ways into the display field. This talk will briefly touch on the history before trying to answer several key questions related to QDs applications in display: What are QDs? How are they made? What properties do they have and Why? How can these properties be used to improve color and efficiency of display, in either photoluminescence (PL) or electroluminescence (EL) mode? And what are the remaining challenges for QDs wide adoption in display industry? Lastly, some most recent progresses in our UCF lab at both PL and EL fronts will be highlighted. For PL, a cadmium-free perovskite-polymer composite films with exceptionally narrow emission green peaks (FWHM 20 nm) and good water and thermal stability will be reported. Together with red quantum dots or PFS/KSF phosphors as down-converters for blue LEDs, a white-light source with 95% Rec. 2020 color gamut was demonstrated [1]. For EL, red quantum dot light emitting devices (QLEDs) with record luminance of 165,000 Cd/m2 has been obtained at a current density of 1000 mA/cm2 with a low driving voltage of 5.8 V and CIE coordinates of (0.69, 0.31). [2] The potential of using these QLEDs for light sources for integrated sensing platform [3] or high efficiency, high color quality hybrid white OLED [4] will be discussed. [1] Y. N. Wang, J. He, H. Chen, J. S. Chen, R. D. Zhu, P. Ma, A. Towers, Y. Lin, A. J. Gesquiere, S. T. Wu, Y. J. Dong. Ultrastable, Highly Luminescent Organic-Inorganic Perovskite - Polymer Composite Films, Advanced Materials, accepted, (2016). [2] Y. J. Dong, J.M. Caruge, Z. Q. Zhou, C. Hamilton, Z. Popovic, J. Ho, M. Stevenson, G. Liu, V. Bulovic, M. Bawendi, P. T. Kazlas, S. Coe-Sullivan, and J. Steckel Ultra-bright, Highly Efficient, Low Roll-off Inverted Quantum-Dot Light Emitting Devices (QLEDs). SID Symp. Dig. Tech. Pap. 46, 270-273 (2015). [3] J. He, H. Chen, S. T. Wu, and Y. J. Dong, Integrated Sensing Platform Based on Quantum
Gu, Chun Tao; Li, Chun Yan; Yang, Li Jie; Huo, Gui Cheng
2014-08-01
A Gram-stain-negative bacterial strain, 10-17(T), was isolated from traditional sourdough in Heilongjiang Province, China. The bacterium was characterized by a polyphasic approach, including 16S rRNA gene sequence analysis, RNA polymerase β subunit (rpoB) gene sequence analysis, DNA gyrase (gyrB) gene sequence analysis, initiation translation factor 2 (infB) gene sequence analysis, ATP synthase β subunit (atpD) gene sequence analysis, fatty acid methyl ester analysis, determination of DNA G+C content, DNA-DNA hybridization and an analysis of phenotypic features. Strain 10-17(T) was phylogenetically related to Enterobacter hormaechei CIP 103441(T), Enterobacter cancerogenus LMG 2693(T), Enterobacter asburiae JCM 6051(T), Enterobacter mori LMG 25706(T), Enterobacter ludwigii EN-119(T) and Leclercia adecarboxylata LMG 2803(T), having 99.5%, 99.3%, 98.7%, 98.5%, 98.4% and 98.4% 16S rRNA gene sequence similarity, respectively. On the basis of polyphasic characterization data obtained in the present study, a novel species, Enterobacter xiangfangensis sp. nov., is proposed and the type strain is 10-17(T) ( = LMG 27195(T) = NCIMB 14836(T) = CCUG 62994(T)). Enterobacter sacchari Zhu et al. 2013 was reclassified as Kosakonia sacchari comb. nov. on the basis of 16S rRNA, rpoB, gyrB, infB and atpD gene sequence analysis and the type strain is strain SP1(T)( = CGMCC 1.12102(T) = LMG 26783(T)). © 2014 IUMS.
Franson, J. Christian; Hoffman, D.J.; Schmutz, J.A.
2009-01-01
Reduced populations of emperor geese (Chen canagica), a Bering Sea endemic, provided the need to assess plasma biochemistry values as indicators of population health. A precursory step to such an investigation was to evaluate patterns of variability in plasma biochemistry values among age, sex, and reproductive period. Plasma from 63 emperor geese was collected on their breeding grounds on the Yukon-Kuskokwim Delta in western Alaska, USA. The geese sampled included 18 incubating adult females captured, in mid June, on their nests by using bow nets, and 30 adults and 15 goslings captured in corral traps in late July and early August, when the adults were molting their wing feathers and the goslings were 5-6 weeks old. Plasma was evaluated for 15 biochemical parameters, by comparing results among age, sex, and sampling period (incubation versus wing-feather molt). Ten of the 15 biochemical parameters assayed differed among adults during incubation, the adults during molt, and the goslings at molt, whereas sex differences were noted in few parameters.
Lake, B.C.; Schmutz, J.A.; Lindberg, M.S.; Ely, Craig R.; Eldridge, W.D.; Broerman, F.J.
2008-01-01
We studied body mass of prefledging Emperor Geese Chen canagica at three locations across the Yukon-Kuskokwim Delta, Alaska, during 1990-2004 to investigate whether large-scale variation in body mass was related to interspecific competition for food. From 1990 to 2004, densities of Cackling Geese Branta hutchinsii minima more than doubled and were c. 2-5?? greater than densities of Emperor Geese, which were relatively constant over time. Body mass of prefledging Emperor Geese was strongly related (negatively) to interspecific densities of geese (combined density of Cackling and Emperor Geese) and positively related to measures of food availability (grazing lawn extent and net above-ground primary productivity (NAPP)). Grazing by geese resulted in consumption of ??? 90% of the NAPP that occurred in grazing lawns during the brood-rearing period, suggesting that density-dependent interspecific competition was from exploitation of common food resources. Efforts to increase the population size of Emperor Geese would benefit from considering competitive interactions among goose species and with forage plants. ?? 2008 The Authors.
Debris flow run off simulation and verification ‒ case study of Chen-You-Lan Watershed, Taiwan
Directory of Open Access Journals (Sweden)
M.-L. Lin
2005-01-01
Full Text Available In 1996 typhoon Herb struck the central Taiwan area, causing severe debris flow in many subwatersheds of the Chen-You-Lan river watershed. More severe cases of debris flow occurred following Chi-Chi earthquake, 1999. In order to identify the potentially affected area and its severity, the ability to simulate the flow route of debris is desirable. In this research numerical simulation of debris flow deposition process had been carried out using FLO-2D adopting Chui-Sue river watershed as the study area. Sensitivity study of parameters used in the numerical model was conducted and adjustments were made empirically. The micro-geomorphic database of Chui-Sue river watershed was generated and analyzed to understand the terrain variations caused by the debris flow. Based on the micro-geomorphic analysis, the debris deposition in the Chui-Sue river watershed in the downstream area, and the position and volume of debris deposition were determined. The simulated results appeared to agree fairly well with the results of micro-geomorphic study of the area when not affected by other inflow rivers, and the trends of debris distribution in the study area appeared to be fairly consistent.
Hirschheydt, Monika von
2015-01-01
Arvustus: Nürnberg, Reiner, Höxtermann, Ekkehard, Voigt, Martina. Elisabeth Schiemann 1881-1972. Vom AußBruch der Genetik und der Frauen in den UmBrüchen des 20. Jahrhunderts. Beiträge eines Symposiums zum 200. Gründungsjubiläum der Humboldt-Universität Berlin. Rangsdorf: Basilisken-Presse 2014
Directory of Open Access Journals (Sweden)
Dan-Ping Xu
2017-01-01
Full Text Available Background. Myocardial infarction (MI is the main cause of global mortality and morbidity despite the development of therapeutic approaches. ShenZhuGuanXin granules (SG have been shown to possess cardioprotective effects against coronary heart disease (CHD. However, little is known about its specific mechanism. The present study aimed to investigate the therapeutic effect of SG in cardiac dysfunction and to demonstrate whether SG can promote myocardium angiogenesis by establishing a rat model of myocardial infarction with left anterior descending ligating. Methods and Results. Three days after MI, rats were randomly divided into six groups: sham group (sham, MI group (MI, MI + low dose SG (SG-L group, MI + middle dose SG (SG-M group, MI + high dose SG (SG-H group, and MI + compound Danshen dropping pills (CDDP group as a positive control. Four weeks after administration, rats underwent hemodynamics and echocardiography study. Ventricle tissues were processed for histology and immunohistochemistry studies. Compared with MI group, SG treatment dose-dependently improved cardiac hemodynamic function, attenuated infarct size, increased microvessel density, and increased the expression of PECAM-1/CD31 and VEGF. Conclusions. SG dose-dependently improved cardiac hemodynamic function and attenuated infarct size by promoting angiogenesis through upregulating PECAM-1/CD31 and VEGF expression.
Catalyst activity or stability: the dilemma in Pd-catalyzed polyketone synthesis.
Amoroso, Francesco; Zangrando, Ennio; Carfagna, Carla; Müller, Christian; Vogt, Dieter; Hagar, Mohamed; Ragaini, Fabio; Milani, Barbara
2013-10-28
A series of Pd-complexes containing nonsymmetrical bis(aryl-imino)acenaphthene (Ar-BIAN) ligands, characterized by substituents on the meta positions of the aryl rings, have been synthesized, characterized and applied in CO/vinyl arene copolymerization reactions. Crystal structures of two neutral Pd-complexes have been solved allowing comparison of the bonding properties of the ligand. Kinetic and mechanistic investigations on these complexes have been performed. The kinetic investigations indicate that in general ligands with electron-withdrawing substituents give more active, but less stable, catalytic systems, although steric effects also play a role. The good performance observed with nonsymmetrical ligands is at least in part due to a compromise between catalyst activity and lifetime, leading to a higher overall productivity with respect to catalysts based on their symmetrical counterparts. Additionally, careful analysis of the reaction profiles provided information on the catalyst deactivation pathway. The latter begins with the reduction of a Pd(II) Ar-BIAN complex to the corresponding Pd(0) species, a reaction that can be reverted by the action of benzoquinone. Then the ligand is lost, a process that appears to be facilitated by the contemporary coordination of an olefin or a CO molecule. The so formed Pd(0) complex immediately reacts with another molecule of the initial Pd(II) complex to give a Pd(I) dimeric species that irreversibly evolves to metallic palladium. Mechanistic investigations performed on the complex with a nonsymmetrical Ar-BIAN probe evidence that the detected intermediates are characterized by the Pd-C bond trans to the Pd-N bond of the aryl ring bearing electron-withdrawing substituents. In addition, the intermediate resulting from the insertion of 4-methylstyrene into the Pd-acyl bond is a five-member palladacycle and not the open-chain η(3)-allylic species observed for complexes with Ar-BIANs substituted in ortho position.
Maximilien Brice
2012-01-01
6 June 2012 - Chinese Nanjing University President J.Chen in the ATLAS visitor centre with Member of the ATLAS Collaboration I. Wingerter and International Relations Office Adviser E. Tsesmelis. M. Qi, Nanjing University and ATLAS Collaboration, accompanies the delegation.
Zhang, Wen-Yan; Lin, Chao-Yuan
2017-04-01
The Soil Conservation Service Curve Number (SCS-CN) method, which was originally developed by the USDA Natural Resources Conservation Service, is widely used to estimate direct runoff volume from rainfall. The runoff Curve Number (CN) parameter is based on the hydrologic soil group and land use factors. In Taiwan, the national land use maps were interpreted from aerial photos in 1995 and 2008. Rapid updating of post-disaster land use map is limited due to the high cost of production, so the classification of satellite images is the alternative method to obtain the land use map. In this study, Normalized Difference Vegetation Index (NDVI) in Chen-You-Lan Watershed was derived from dry and wet season of Landsat imageries during 2003 - 2008. Land covers were interpreted from mean value and standard deviation of NDVI and were categorized into 4 groups i.e. forest, grassland, agriculture and bare land. Then, the runoff volume of typhoon events during 2005 - 2009 were estimated using SCS-CN method and verified with the measured runoff data. The result showed that the model efficiency coefficient is 90.77%. Therefore, estimating runoff by using the land cover map classified from satellite images is practicable.
Directory of Open Access Journals (Sweden)
Hongyang Zhang
2016-01-01
Full Text Available Yin-Chen-Hao-Tang (YCHT is a famous Chinese medicine formula which has long been used in clinical practice for treating various liver diseases, such as liver fibrosis. However, to date, the mechanism for its anti-fibrotic effects remains unclear. In this paper, an ultra-performance liquid chromatography-time-of-flight mass spectrometry (UPLC-TOF-MS-based metabolomic study was performed to characterize dimethylnitrosamine (DMN-induced liver fibrosis in rats and evaluate the therapeutic effects of YCHT. Partial least squares-discriminant analysis (PLS-DA showed that the model group was well separated from the control group, whereas the YCHT-treated group exhibited a tendency to restore to the controls. Seven significantly changed fibrosis-related metabolites, including unsaturated fatty acids and lysophosphatidylcholines (Lyso-PCs, were identified. Moreover, statistical analysis demonstrated that YCHT treatment could reverse the levels of most metabolites close to the normal levels. These results, along with histological and biochemical examinations, indicate that YCHT has anti-fibrotic effects, which may be due to the suppression of oxidative stress and resulting lipid peroxidation involved in hepatic fibrogenesis. This study offers new opportunities to improve our understanding of liver fibrosis and the anti-fibrotic mechanisms of YCHT.
Energy Technology Data Exchange (ETDEWEB)
Nemchinsky, V A [Key College, 225 Dania Beach Blvd, Dania Beach, FL 33040 (United States)
2007-07-07
The heating history of a droplet during its flight can be divided into two phases: (a) the initial phase when evaporation, although it occurs, does not change the heat balance of the droplet much (the case considered in our previous paper and (b) the final phase when the cooling due to evaporation balances the heat flux from the plasma. The later phase is considered in Chen's comment. In our reply, a very straightforward consideration demonstrates that even in the final phase of the droplet flight, the 'rocket' effect can be significant. (reply)
Khan, Sabeel M.; Sunny, D. A.; Aqeel, M.
2017-09-01
Nonlinear dynamical systems and their solutions are very sensitive to initial conditions and therefore need to be approximated carefully. In this article, we present and analyze nonlinear solution characteristics of the periodically forced Chen system with the application of a variational method based on the concept of finite time-elements. Our approach is based on the discretization of physical time space into finite elements where each time-element is mapped to a natural time space. The solution of the system is then determined in natural time space using a set of suitable basis functions. The numerical algorithm is presented and implemented to compute and analyze nonlinear behavior at different time-step sizes. The obtained results show an excellent agreement with the classical RK-4 and RK-5 methods. The accuracy and convergence of the method is shown by comparing numerically computed results with the exact solution for a test problem. The presented method has shown a great potential in dealing with the solutions of nonlinear dynamical systems and thus can be utilized in delineating different features and characteristics of their solutions.
Maximilien Brice
2007-01-01
Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007
Tuggle, B.N.; Crites, John L.
1984-01-01
Three species of trichostrongylid nematodes were removed from the gizzards of 25 lesser snow geese, Chen caerulescens caerulescens, collected at Winisk, Ont. A 100% prevalence of infection was noted in the sampled population with each bird harboring two or more of the following species: Epomidiostomum crami (prevalence, 92%; mean intensity, 18.7 ± 13.3), Amidostomum anseris (prevalence, 84%; mean intensity, 9.6 ± 9.8), and Amidostomum spatulatum (prevalence, 84%; mean intensity, 11.2 ± 9.8). When large burdens (>30) of both A. anseris and A. spatulatum were present in the mucosal lining of the gizzard, progressive degeneration of the epithilium and koilin linings was noted in 16% of the geese examined. Severe necrotic granulomata observed in the gizzard muscle of 36% of the geese were associated with sizable burdens (>25) of E. crami which were found burrowed in the gizzard muscle.
Yang, Qiaoling; Yang, Fan; Tang, Xiaowen; Ding, Lili; Xu, Ying; Xiong, Yinhua; Wang, Zhengtao; Yang, Li
2015-04-16
Yin-Chen-Hao-Tang (YCHT), a commonly used as a traditional chinese medicine for liver disease. Several studies indicated that YCHT may improving hepatic triglyceride metabolism and anti-apoptotic response as well as decreasing oxidative stress .However, little is known about the role of YCHT in chlorpromazine (CPZ) -induced chlolestatic liver injury. Therefore, we aimed to facilitate the understanding of the pathogenesis of cholestatic liver injury and evaluate the effect of Yin-Chen-Hao-Tang (YCHT) on chlorpromazine (CPZ)-induced cholestatic liver injury in rats based on the change of bile acids (BAs) and free fatty acids (FFAs) alone with the biochemical indicators and histological examination. We conducted an experiment on CPZ-induced cholestatic liver injury in Wistar rats with and without YCHT for nine consecutive days. Serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB), total bilirubin (TBIL), total cholesterol (TC), triglycerides (TG), low density lipoprotein-cholesterol (LDL-C) were measured to evaluate the protective effect of YCHT against chlorpromazine (CPZ)-induced cholestatic liver injury. Histopathology of the liver tissue showed that pathological injuries were relieved after YCHT pretreatment. In addition, ultra-performance lipid chromatography coupled with quadrupole mass spectrometry (UPLC-MS) and gas chromatography coupled with mass spectrometry (GC-MS) was applied to determine the content of bile acids, free fatty acids, respectively. Obtained data showed that YCHT attenuated the effect of CPZ-induced cholestatic liver injury, which was manifested by the serum biochemical parameters and histopathology of the liver tissue. YCHT regulated the lipid levels as indicated by the reversed serum levels of TC, TG, and LDL-C. YCHT also regulated the disorder of BA and FFA metabolism by CPZ induction. Results indicated that YCHT exerted a protective effect on CPZ-induced cholestasis liver injury. The variance of
Writing Beyond the Wall: Translation, Cross-cultural Exchange, and Chen Ran's 'A Private Life'
Directory of Open Access Journals (Sweden)
Kay Schaffer
2006-09-01
Full Text Available The past decade has witnessed an unprecedented rise in the global flow of knowledge, nowhere more apparent in the exchange of ideas between China and modern western democracies. Our interest concerns one aspect of this global flow— the translation of Chinese women’s autobiographical writing into English. Taking Chen Ran’s A Private Life (English edition, 2004 as a point of departure, the paper explores issues of translingual practice and cross-cultural exchange. It considers what escapes or is lost in translation as well as the additive potential of the host text. It is sometimes the case that the translation can deliberately make certain ambiguities visible—whether from pragmatic, market-driven motivations or from more complex political, historical and cultural considerations. These negotiations of meaning that occur in the translation process can reverberate on the critical reception of texts in both the ‘guest’ and ‘host’ languages (Liu 1995, with open-ended, incomplete and indeterminate effects. The paper examines the effects of the omission of a brief parenthetical section of three paragraphs from one chapter of the Chinese edition of A Private Life. Yet, even that small emendation changes the original text as a cultural object and alters potential modes of its reception. In this case, the translation results in a loss of ambiguity, irony, philosophic and rhetorical sophistication while also offering additive potentials that enhance the generation of new meanings in the translingual exchange, here with reference Tiananmen and contemporary feminism in China. The translation process provides new channels for readers, writers and theorists to dialogue and communicate across gaps of difference, despite inhibiting factors like the imposition of local restraints, the universalising pressures of western modernity, and asymmetrical relations of power between guest and host language contexts.
75 FR 18076 - Changes in Flood Elevation Determinations
2010-04-09
...; Chairman, Coconino (08-09-1418P). Arizona Daily Sun. County Board of Supervisors, 219 East Cherry Avenue... February 13, 2009; The Honorable Paul Biane, June 19, 2009 060270 No: B-1044). of San Bernardino February...
S1P transporter SPNS2 regulates proper postnatal retinal morphogenesis.
Fang, Chao; Bian, Ganlan; Ren, Pan; Xiang, Jie; Song, Jun; Yu, Caiyong; Zhang, Qian; Liu, Ling; Chen, Kun; Liu, Fangfang; Zhang, Kun; Wu, Chunfeng; Sun, Ruixia; Hu, Dan; Ju, Gong; Wang, Jian
2018-02-08
Spinster homolog 2 (SPNS2) is the membrane transporter of sphingosine-1-phosphate (S1P), and it participates in several physiologic processes by activating different S1P receptors (S1PRs). However, its functions in the nervous system remain largely unclear. We explored the important role of SPNS2 in the process of retinal morphogenesis using a spns2-deficient rat model. In the absence of the functional SPNS2 transporter, we observed progressively aggravating laminar disorganization of the epithelium at the postnatal stage of retinal development. Disrupted cell polarity, delayed cell-cycle exit of retinal progenitor cells, and insufficient migration of newborn neurons were proposed in this study as potential mechanisms accounting for this structural disorder. In addition, we analyzed the expression profiles of spns2 and s1prs, and proposed that SPNS2 regulated retinal morphogenesis by establishing the S1P level in the eye and activating S1PR3 signaling. These data indicate that SPNS2 is indispensable for normal retinal morphogenesis and provide new insights on the role of S1P in the developing retina using an established in vivo model.-Fang, C., Bian, G., Ren, P., Xiang, J., Song, J., Yu, C., Zhang, Q., Liu, L., Chen, K., Liu, F., Zhang, K., Wu, C., Sun, R., Hu, D., Ju, G., Wang, J. S1P transporter SPNS2 regulates proper postnatal retinal morphogenesis.
Indian Academy of Sciences (India)
R.Narasimhan(krishtel emaging)1461 1996 Oct 15 13:05:22
bian Pacific Ocean and its relationship with the wind field using .... Electron spin resonance dating of fault gouge from ... impact. Assimilation of IRS-P4 (MSMR) meteorological data in the NCMRWF global data ... mobile auroral current systems.
Directory of Open Access Journals (Sweden)
Kurmi OP
2018-03-01
Full Text Available Om P Kurmi,1 Liming Li,2 Kourtney J Davis,3 Jenny Wang,1 Derrick A Bennett,1 Ka Hung Chan,1 Ling Yang,1 Yiping Chen,1 Yu Guo,4 Zheng Bian,4 Junshi Chen,5 Liuping Wei,6 Donghui Jin,7 Rory Collins,1 Richard Peto,1 Zhengming Chen1 On behalf of the China Kadoorie Biobank collaborative group 1Clinical Trial Service and Epidemiological Studies Unit, Nuffield Department of Population Health, University of Oxford, Oxford, UK; 2Department of Epidemiology, School of Public Health, Peking University Health Science Center, Beijing, China; 3Real World Evidence and Epidemiology, GlaxoSmithKline, Collegeville, PA, USA; 4Chinese Academy of Medical Sciences, Beijing China; 5China National Center for Food Safety Risk Assessment, Beijing, China; 6NCDs Prevention and Control Department, Liuzhou CDC, Liuzhou, China; 7NCDs Prevention and Control Department, Hunan CDC, Changsha, China Background: China has high COPD rates, even among never-regular smokers. Little is known about nonrespiratory disease risks, especially vascular morbidity and mortality after developing airflow obstruction (AFO in Chinese adults. Objective: We aimed to investigate the prospective association of prevalent AFO with major vascular morbidity and mortality. Materials and methods: In 2004–2008, a nationwide prospective cohort study recruited 512,891 men and women aged 30–79 years from 10 diverse localities across China, tracking cause-specific mortality and coded episodes of hospitalization for 9 years. Cox regression yielded adjusted HRs for vascular diseases comparing individuals with spirometry-defined prevalent AFO at baseline to those without. Results: Of 489,382 participants with no vascular disease at baseline, 6.8% had AFO, with prevalence rising steeply with age. Individuals with prevalent AFO had significantly increased vascular mortality (n=1,429, adjusted HR 1.29, 95% CI 1.21–1.36. There were also increased risks of hemorrhagic stroke (n=823, HR 1.18, 95% CI 1.09–1
Directory of Open Access Journals (Sweden)
Zhou T
2016-09-01
Full Text Available Tao Zhou,1 Lei Jia,1 Yi-Feng Luo,2 Jun Xu,1 Ru-Hua Chen,2 Zhi-Jun Ge,2 Tie-Liang Ma,2 Hong Chen,2 Tao-Feng Zhu2 1Department of Physics and Chemistry, Henan Polytechnic University, Jiaozuo, Henan, 2The Affiliated Yixing Hospital of Jiangsu University, Yixing, Jiangsu, People’s Republic of China Abstract: A novel multifunctional halloysite nanotube (HNT-based Fe3O4@HNT-polyethyleneimine-Tip-Eu(dibenzoylmethane3 nanocomposite (Fe-HNT-Eu NC with both photoluminescent and magnetic properties was fabricated by a simple one-step hydrothermal process combined with the coupling grafting method, which exhibited high suspension stability and excellent photophysical behavior. The as-prepared multifunctional Fe-HNT-Eu NC was characterized using various techniques. The results of cell viability assay, cell morphological observation, and in vivo toxicity assay indicated that the NC exhibited excellent biocompatibility over the studied concentration range, suggesting that the obtained Fe-HNT-Eu NC was a suitable material for bioimaging and biological applications in human hepatic adenocarcinoma cells. Furthermore, the biocompatible Fe-HNT-Eu NC displayed superparamagnetic behavior with high saturation magnetization and also functioned as a magnetic resonance imaging (MRI contrast agent in vitro and in vivo. The results of the MRI tests indicated that the Fe-HNT-Eu NC can significantly decrease the T2 signal intensity values of the normal liver tissue and thus make the boundary between the normal liver and transplanted cancer more distinct, thus effectively improving the diagnosis effect of cancers. Keywords: halloysite nanotube, lanthanide complex, iron oxide, luminescence, contrast agent
upstream region of the myostatin gene in four chicken breeds and its
African Journals Online (AJOL)
user
2012-05-17
May 17, 2012 ... processing site and a carboxy-terminal region containing nine cysteines ... cultivated meat breed (minitype) and the Youxi chicken is a local breed raised for ..... Allele R was the additive gene on growth traits. Bian chickens ...
Motomura, Hiroyuki; Causse, Romain; Béarez, Philippe; Mishra, Subhrendu Sekhar
2015-09-29
The Indo-West Pacific species, Neomerinthe erostris (Alcock 1896), originally described as Scorpaena erostris, is redescribed as a senior synonym of Scorpaena gibbifrons Fowler 1938, N. rotunda Chen 1981, and N. bathyperimensis Zajonz & Klausewitz 2002. Although the latter three nominal species have been regarded as valid species and N. erostris has not been reported since 1898, examinations of type specimens of the four nominal species revealed that they represent a single species. A lectotype of Scorpaena erostris is herein designated. Neomerinthe erostris is characterized by having a distinct longitudinal ridge on the lateral surface of the maxilla and a strongly rounded dorsal profile of the head.
(dust, PM10 , and BC) using CHIMERE chemistry tra
Indian Academy of Sciences (India)
The objective of this study is to evaluate the ability of a European chemistry transport model,. 'CHIMERE' driven by ..... tive days in May 2008 (12–16 May) to simulate the dust storm ...... Regional Office for Europe, Copenhagen. Zender C, Bian ...
Advances in Global Adjoint Tomography -- Massive Data Assimilation
Ruan, Y.; Lei, W.; Bozdag, E.; Lefebvre, M. P.; Smith, J. A.; Krischer, L.; Tromp, J.
2015-12-01
Azimuthal anisotropy and anelasticity are key to understanding a myriad of processes in Earth's interior. Resolving these properties requires accurate simulations of seismic wave propagation in complex 3-D Earth models and an iterative inversion strategy. In the wake of successes in regional studies(e.g., Chen et al., 2007; Tape et al., 2009, 2010; Fichtner et al., 2009, 2010; Chen et al.,2010; Zhu et al., 2012, 2013; Chen et al., 2015), we are employing adjoint tomography based on a spectral-element method (Komatitsch & Tromp 1999, 2002) on a global scale using the supercomputer ''Titan'' at Oak Ridge National Laboratory. After 15 iterations, we have obtained a high-resolution transversely isotropic Earth model (M15) using traveltime data from 253 earthquakes. To obtain higher resolution images of the emerging new features and to prepare the inversion for azimuthal anisotropy and anelasticity, we expanded the original dataset with approximately 4,220 additional global earthquakes (Mw5.5-7.0) --occurring between 1995 and 2014-- and downloaded 300-minute-long time series for all available data archived at the IRIS Data Management Center, ORFEUS, and F-net. Ocean Bottom Seismograph data from the last decade are also included to maximize data coverage. In order to handle the huge dataset and solve the I/O bottleneck in global adjoint tomography, we implemented a python-based parallel data processing workflow based on the newly developed Adaptable Seismic Data Format (ASDF). With the help of the data selection tool MUSTANG developed by IRIS, we cleaned our dataset and assembled event-based ASDF files for parallel processing. We have started Centroid Moment Tensors (CMT) inversions for all 4,220 earthquakes with the latest model M15, and selected high-quality data for measurement. We will statistically investigate each channel using synthetic seismograms calculated in M15 for updated CMTs and identify problematic channels. In addition to data screening, we also modified
Design of Experiment Approach to Hydrogen Re-embrittlement Evaluation WP-2152
2015-04-01
2152 by Scott M Grendahl, Hoang Nguyen, Franklin Kellogg , Shuying Zhu, and Stephen Jones Approved for public release...and Materials Research Directorate, ARL Hoang Nguyen and Franklin Kellogg Bowhead Science and Technology, LLC Shuying Zhu and Stephen Jones The...ELEMENT NUMBER 6. AUTHOR(S) Scott M Grendahl, Hoang Nguyen, Franklin Kellogg , Shuying Zhu, and Stephen Jones 5d. PROJECT NUMBER W74RDV20769717 5e
Understanding the internal structures of X(4140), X(4274), X(4500) and X(4700)
Energy Technology Data Exchange (ETDEWEB)
Chen, Hua-Xing; Cui, Er-Liang [Beihang University, School of Physics and Beijing Key Laboratory of Advanced Nuclear Materials and Physics, Beijing (China); Chen, Wei [University of Saskatchewan, Department of Physics and Engineering Physics, Saskatoon, Saskatchewan (Canada); Liu, Xiang [Lanzhou University, School of Physical Science and Technology, Lanzhou (China); Lanzhou University and Institute of Modern Physics of CAS, Research Center for Hadron and CSR Physics, Lanzhou (China); Zhu, Shi-Lin [Peking University, School of Physics and State Key Laboratory of Nuclear Physics and Technology, Beijing (China); Collaborative Innovation Center of Quantum Matter, Beijing (China); Peking University, Center of High Energy Physics, Beijing (China)
2017-03-15
We investigate the newly observed X(4500) and X(4700) based on the diquark-antidiquark configuration within the framework of QCD sum rules. Both of them may be interpreted as the D-wave cs anti c anti s tetraquark states of J{sup P} = 0{sup +}, but with opposite color structures, which is remarkably similar to the result obtained in Chen and Zhu (Phys Rev D 83:034010, 2011) that X(4140) and X(4274) can be both interpreted as the S-wave cs anti c anti s tetraquark states of J{sup P} = 1{sup +}, also with opposite color structures. However, the extracted masses and these suggested assignments to these X states do depend on these running quark masses where m{sub s}(2 GeV) = 95 ± 5 MeV and m{sub c}(m{sub c}) = 1.23 ± 0.09 GeV. As a byproduct, the masses of the hidden-bottom partner states of X(4500) and X(4700) are extracted to be both around 10.64 GeV, which can be searched for in the Υφ invariant mass distribution. (orig.)
Monitoring cancer stem cells: insights into clinical oncology
Directory of Open Access Journals (Sweden)
Lin SC
2016-02-01
Full Text Available ShuChen Lin,1,* YingChun Xu,2,* ZhiHua Gan,1 Kun Han,1 HaiYan Hu,3 Yang Yao,3 MingZhu Huang,4 DaLiu Min1 1Department of Oncology, Shanghai Sixth People’s Hospital East Campus, Shanghai Jiao Tong University, 2Department of Oncology, Renji Hospital, Shanghai Jiao Tong University, 3Department of Oncology, The Sixth People’s Hospital, Shanghai Jiao Tong University, 4Department of Medical Oncology, Cancer Hospital of Fudan University, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Cancer stem cells (CSCs are a small, characteristically distinctive subset of tumor cells responsible for tumor initiation and progression. Several treatment modalities, such as surgery, glycolytic inhibition, driving CSC proliferation, immunotherapy, and hypofractionated radiotherapy, may have the potential to eradicate CSCs. We propose that monitoring CSCs is important in clinical oncology as CSC populations may reflect true treatment response and assist with managing treatment strategies, such as defining optimal chemotherapy cycles, permitting pretreatment cancer surveillance, conducting a comprehensive treatment plan, modifying radiation treatment, and deploying rechallenge chemotherapy. Then, we describe methods for monitoring CSCs. Keywords: cancer stem cells, glycolytic inhibition, watchful waiting, rechallenge, immunotherapy
Li, Mao; Li, Lel-in
2018-03-01
For the sake of curbing the spreading of Changsha-Zhuzhou-Xiangtan urban agglomeration and spatial disorder in the process of urbanization development on the regional bearing capacity of land resources and ecological environment and assisting to plan the integration process of ChangZhuTan,this paper uses the DMSP/OLS night light data of Chang ZhuTan in 1992 to 2013 to invert the urbanization process index of ChangZhuTan urban agglomeration. Based on the two scales of time and space, this paper analyzes the average index of lights, the speed of urban expansion and urban compactness index et al and studies the temporal and spatial characteristics of ChangZhuTan urban agglomeration in this period.
Yang, X.; Walboomers, X.F.; Bian, Z.; Jansen, J.A.; Fan, M.
2011-01-01
The following article from the Journal of Tissue Engineering and Regenerative Medicine, 'Effects of Pro-inflammatory Cytokines on Mineralization Potential of Rat Dental Pulp Stem Cells' by Yang X, Walboomers XF, Bian Z, Jansen JA, Fan M, published online on 11 July 2011 in Wiley Online Library
Effects of Repeated Traumatic Brain Injuries in a Combat Setting
2011-12-01
Metabolism, 30(2), 255-266. Cernak, I., Savic , J., Malicevic, Z., Zunic, G., Radosevic, P., Ivanovic, I., et al. (1996). Involvement of the central...Bian, X., & Savic , J. (2001). Ultrastructural and functional characteristics of blast injury-induced neurotrauma. The Journal of trauma, 50(4), 695-706
A Computing Platform for Parallel Sparse Matrix Computations
2016-01-05
REPORT NUMBER 19a. NAME OF RESPONSIBLE PERSON 19b. TELEPHONE NUMBER Ahmed Sameh Ahmed H. Sameh, Alicia Klinvex, Yao Zhu 611103 c. THIS PAGE The...PERCENT_SUPPORTEDNAME FTE Equivalent: Total Number: Discipline Yao Zhu 0.50 Alicia Klinvex 0.10 0.60 2 Names of Post Doctorates Names of Faculty Supported...PERCENT_SUPPORTEDNAME FTE Equivalent: Total Number: NAME Total Number: NAME Total Number: Yao Zhu Alicia Klinvex 2 ...... ...... Sub Contractors (DD882) Names of other
Tan, Shu-Qiu; Geng, Xue; Liu, Jorn-Hon; Pan, Wynn Hwai-Tzong; Wang, Li-Xiang; Liu, Hui-Kang; Hu, Lei; Chao, Hsiao-Ming
2017-07-14
Retinal ischemia-related eye diseases result in visual dysfunction. This study investigates the protective effects and mechanisms of Xue-Fu-Zhu-Yu decoction (XFZYD) with respect to retinal ischemia. Retinal ischemia (I) was induced in Wistar rats by a high intraocular pressure (HIOP) of 120 mmHg for 1 h, which was followed by reperfusion of the ischemic eye; the fellow untreated eye acted as a control. Electroretinogram (ERG), biochemistry and histopathology investigations were performed. Significant ischemic changes occurred after ischemia including decreased ERG b-wave ratios, less numerous retinal ganglion cells (RGCs), reduced inner retinal thickness, fewer choline acetyltransferase (ChAT) labeled amacrine cell bodies, increased glial fibrillary acidic protein (GFAP) immunoreactivity and increased vimentin Müller immunolabeling. These were accompanied by significant increases in the mRNA/protein concentrations of vascular endothelium growth factor, hypoxia-inducible factor-1α, pyruvate kinase M2 and retinoblastoma-binding protein 2. The ischemic changes were concentration-dependently and significantly altered when XFZYD was given for seven consecutive days before or after retina ischemia, compared to vehicle. These alterations included enhanced ERG b-wave amplitudes, more numerous RGCs, enhanced inner retinal thickness, a greater number of ChAT immunolabeled amacrine cell bodies and decreased GFAP/vimentin immunoreactivity. Furthermore, decreased mRNA levels of VEGF, HIF-1α, PKM2, and RBP2 were also found. Reduced protein concentrations of VEGF, HIF-1α, PKM2, and RBP2 were also demonstrated. Furthermore, there was an inhibition of the ischemia-associated increased ratios (target protein/β-actin) in the protein levels of VEGF, HIF-1α, PKM2, and RBP2, which were induced by Shikonin, JIB-04 or Avastin. XFZYD would seem to protect against well-known retinal ischemic changes via a synergistic inhibition of RBP2 and PKM2, as well as down-regulation of HIF-1
New World species of the genus Calliscelio Ashmead (Hymenoptera, Platygastridae, Scelioninae
Directory of Open Access Journals (Sweden)
Hua-yan Chen
2017-01-01
Full Text Available The genus Calliscelio Ashmead is presumed to be a diverse group of parasitoids of the eggs of crickets (Orthoptera: Gryllidae. A least one species has been found to be an important factor in depressing cricket pest populations. The New World species of Calliscelio are revised. Forty-two species are recognized, 3 are redescribed: C. bisulcatus (Kieffer, C. laticinctus Ashmead, C. rubriclavus (Ashmead, comb. n.; and 38 are described as new: C. absconditum Chen & Johnson, sp. n., C. absum Chen & Johnson, sp. n., C. alcoa Chen & Masner, sp. n., C. amadoi Chen & Johnson, sp. n., C. armila Chen & Masner, sp. n., C. bidens Chen & Masner, sp. n., C. brachys Chen & Johnson, sp. n., C. brevinotaulus Chen & Johnson, sp. n., C. brevitas Chen & Johnson, sp. n., C. carinigena Chen & Johnson, sp. n., C. crater Chen & Johnson, sp. n., C. crena Chen & Johnson, sp. n., C. eboris Chen & Johnson, sp. n., C. extenuatus Chen & Johnson, sp. n., C. flavicauda Chen & Johnson, sp. n., C. foveolatus Chen & Johnson, sp. n., C. gatineau Chen & Johnson, sp. n., C. glaber Chen & Masner, sp. n., C. granulatus Chen & Masner, sp. n., C. latifrons Chen & Johnson, sp. n., C. levis Chen & Johnson, sp. n., C. longius Chen & Johnson, sp. n., C. magnificus Chen & Masner, sp. n., C. migma Chen & Johnson, sp. n., C. minutia Chen & Johnson, sp. n., C. paraglaber Chen & Johnson, sp. n., C. pararemigio Chen & Masner, sp. n., C. prolixus Chen & Johnson, sp. n., C. punctatifrons Chen & Johnson, sp. n., C. remigio Chen & Masner, sp. n., C. ruga Chen & Johnson, sp. n., C. rugicoxa Chen & Masner, sp. n., C. sfina Chen & Johnson, sp. n., C. storea Chen & Johnson, sp. n., C. suni Chen & Johnson, sp. n., C. telum Chen & Johnson, sp. n., C. torqueo Chen & Johnson, sp. n., C. virga Chen & Johnson, sp. n. Four species are treated as junior synonyms of Calliscelio rubriclavus (Ashmead: Anteris nigriceps Ashmead, syn. n., Caloteleia marlattii Ashmead, syn. n., Caloteleia grenadensis Ashmead, syn. n
The 2nd International Conference on Agricultural and Biological Sciences (ABS 2016
Directory of Open Access Journals (Sweden)
Lei Pei
2016-10-01
Salvia of Labiatae in China Xiaojuan Li, Ning Xu, Guofu Zhou, Ming Wan, Qi Lin, Fanyun Meng, Jianxiu Li 15 Three pulling resistance models of pioneer plant in landslide area Yichang Chen, Koayung Yu, Chunpin Chang 16 The comparison of physiological and biochemical mechanisms of Reaumuria soongorica and Salsola passerine in different growth pattern Zijuan Zhou, Peixi Su, Rui Shi, Tingting Xie 17 Resources use efficiency of the cosmopolitan plant Potentilla anserina L. in different alpine habitats in China Rui Shi, Peixi Su, Zijuan Zhou 18 Cloning of PPDK gene from Red Amaranand transformation of Alfalfa Xuelan Liu, Yan Zhang, Xiangfa Wei 19 Variation and cluster analysis of morphological characters and nutrient content of Chucrasia tabularis seed Chong Wu, Yanlei Yin, Lijuan Feng, Xuemei Yang, Fei Wang 20 Effect of the planting density of the areca nut on the growth of intercropped Vanilla Hua Wang, Huifa Zhuang, Zihui Zhu, Hui Wang
African Journal of Biotechnology - Vol 8, No 6 (2009)
African Journals Online (AJOL)
Single nucleotide polymorphism genotyping and its application on mapping and marker-assisted plant breeding ... HH Musa, Y Xu, B Dai, X Kang, C Zhu, G Zhu ... YJ Wang, ZQ Han, B Shui, GD Liu, TX Gao, SA Nwafili, S Watanabe, YP Zhang ...
The relationship between cholesterol and cognitive function is homocysteine-dependent
Directory of Open Access Journals (Sweden)
Cheng YB
2014-10-01
Full Text Available Yibin Cheng,1 Yinlong Jin,1 Frederick W Unverzagt,2 Liqin Su,1 Lili Yang,3 Feng Ma,1 Ann M Hake,4,5 Carla Kettler,3 Chen Chen,1 Jingyi Liu,1 Jianchao Bian,6 Ping Li,7 Jill R Murrell,8 Hugh C Hendrie,2,9,10 Sujuan Gao3 1Institute for Environmental Health and Related Product Safety, Chinese Center for Disease Control and Prevention, Beijing, People’s Republic of China; 2Department of Psychiatry, 3Department of Biostatistics, 4Department of Neurology, Indiana University School of Medicine, Indianapolis, Indiana, USA; 5Eli Lilly and Company, Indianapolis, Indiana, USA; 6Shandong Institute for Prevention and Treatment of Endemic Disease in China, Jinan, People’s Republic of China; 7Sichuan Provincial Center for Disease Control and Prevention in China, Chengdu, People’s Republic of China; 8Department of Pathology and Laboratory Medicine, Indiana University School of Medicine, 9Indiana University Center for Aging Research, 10Regenstrief Institute, Inc., Indianapolis, Indiana, USA Introduction: Previous studies have identified hyperlipidemia as a potential risk factor for dementia and Alzheimer’s disease. However, studies on cholesterol measured in late-life and cognitive function have been inconsistent. Few studies have explored nonlinear relationships or considered interactions with other biomarker measures.Methods: A cross-sectional sample of 1,889 participants from four rural counties in the People’s Republic of China was included in this analysis. Serum total cholesterol, high-density lipoprotein, triglycerides, and homocysteine levels were measured in fasting blood samples. A composite cognitive score was derived based on nine standardized cognitive test scores. Analysis of covariance models were used to investigate the association between biomarker measures and the composite cognitive scores.Results: There was a significant interaction between the homocysteine quartile group and the cholesterol quartile group on cognitive scores (P=0
Cardioprotective effect of Shenxiong glucose injection on acute ...
African Journals Online (AJOL)
Yu JH, Wang LY, Akinyi M, Li YH, Duan ZZ, Zhu Y, Fan. GW. Danshensu protects ... Yin Y, Guan Y, Duan JL, Wei G, Zhu YR, Quan W, Guo. C, Zhou D, Wang YH, ... HM, Han J, Kang D. Lamotrigine increases intracellular. Ca(2+) levels and ...
Journal of Chemical Sciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Chemical Sciences. Hai-Liang Zhu. Articles written in Journal of Chemical Sciences. Volume 121 Issue 4 July 2009 pp 463-470. Synthesis, antimicrobial activity of lamotrigine and its ammonium derivatives · Yong Qian Peng-Cheng Lv Lei Shi Rui-Qin Fang Zhong-Cheng Song Hai-Liang Zhu.
National Libraries Section. General Research Libraries Division. Papers.
International Federation of Library Associations, The Hague (Netherlands).
Papers on national library services and activities, which were presented at the 1983 International Federation of Library Associations (IFLA) conference, include: (1) "The National Library of China in its Gradual Application of Modern Technology," a discussion by Zhu Nan and Zhu Yan (China) of microform usage and library automation; (2)…
Directory of Open Access Journals (Sweden)
Tian XM
2014-08-01
Full Text Available Xiumei Tian,1,* Fanwen Yang,1,* Chuan Yang,2 Ye Peng,1 Dihu Chen,3 Jixiang Zhu,1 Fupo He,1 Li Li,2 Xiaoming Chen11Department of Biomedical Engineering, Guangzhou Medical University, Guangzhou, Guangdong Province, People’s Republic of China; 2State Key Laboratory of Oncology in South China, Imaging Diagnosis and Interventional Center, Sun Yat-sen University Cancer Center, Guangzhou, Guangdong Province, People’s Republic of China; 3State Key Laboratory of Optoelectronic Materials and Technologies, School of Physics and Engineering, Sun Yat-Sen University, Guangzhou, Guangdong Province, People’s Republic of China*These authors contributed equally to this workAbstract: Poor toxicity characterization is one obstacle to the clinical deployment of Gd2O3@SiO2 core-shell nanoparticles (Gd-NPs for use as magnetic resonance (MR imaging contrast agents. To date, there is no systematic toxicity data available for Gd-NPs prepared by laser ablation in liquid. In this article, we systematically studied the Gd-NPs’ cytotoxicity, apoptosis in vitro, immunotoxicity, blood circulation half-life, biodistribution and excretion in vivo, as well as pharmacodynamics. The results show the toxicity, and in vivo MR data show that these NPs are a good contrast agent for preclinical applications. No significant differences were found in cell viability, apoptosis, and immunotoxicity between our Gd-NPs and Gd in a DTPA (diethylenetriaminepentaacetic acid chelator. Biodistribution data reveal a greater accumulation of the Gd-NPs in the liver, spleen, lung, and tumor than in the kidney, heart, and brain. Approximately 50% of the Gd is excreted via the hepatobiliary system within 4 weeks. Furthermore, dynamic contrast-enhanced T1-weighted MR images of xenografted murine tumors were obtained after intravenous administration of the Gd-NPs. Collectively, the single step preparation of Gd-NPs by laser ablation in liquid produces particles with satisfactory cytotoxicity
75 FR 4573 - Government-Owned Inventions; Availability for Licensing
2010-01-28
... differentiation. Inventors: Jinfang Zhu and William E. Paul (NIAID). Related Publication: J Zhu, TS Davidson, G Wei, D Jankovic, K Cui, DE Schones, L Guo, K Zhao, EM Shevach, WE Paul. Down-regulation of Gfi- 1... Standley, Ph.D.; 301-435-4074; [email protected] . Dated: January 21, 2010. Richard U. Rodriguez, Director...
2017-10-01
Reports an error in "Is Political Behavior a Viable Coping Strategy to Perceived Organizational Politics? Unveiling the Underlying Resource Dynamics" by Shuhua Sun and Huaizhong Chen ( Journal of Applied Psychology , Advanced Online Publication, May 22, 2017, np). In the article, Table 1 contained a formatting error. Correlation coefficient values in the last four cells of column 6 were misplaced with correlation coefficient values in the last four cells of column 7. All versions of this article have been corrected. (The following abstract of the original article appeared in record 2017-22542-001.) We conduct a theory-driven empirical investigation on whether political behavior, as a coping strategy to perceived organizational politics, creates resource trade-offs in moderating the relationship between perceived organizational politics and task performance. Drawing on conservation of resources theory, we hypothesize that political behavior mitigates the adverse effect of perceived organizational politics on task performance via psychological empowerment, yet exacerbates its adverse effect on task performance via emotional exhaustion. Three-wave multisource data from a sample of 222 employees and their 75 supervisors were collected for hypothesis testing. Findings supported our hypotheses. Our study enhances understandings of the complex resource dynamics of using political behavior to cope with perceived organizational politics and highlights the need to move stress-coping research from a focus on the stress-buffering effect of coping on outcomes to a focus on the underlying competing resource dynamics. (PsycINFO Database Record (c) 2017 APA, all rights reserved).
Institute of Scientific and Technical Information of China (English)
谢燕辉
2013-01-01
CALIGRAPHER IN THE NEW AGE39-ycar-old calligrapher.artist,seal-cutter and art historian Zhu Tianshu(朱天曙)believes in both heritage and rebellion,that is,to interpret the classics from a brand new perspective.Proficient in all kinds of calligraphy styles.Zhu developed his own script:a flow of both strength and
An authentication scheme for secure access to healthcare services.
Khan, Muhammad Khurram; Kumari, Saru
2013-08-01
Last few decades have witnessed boom in the development of information and communication technologies. Health-sector has also been benefitted with this advancement. To ensure secure access to healthcare services some user authentication mechanisms have been proposed. In 2012, Wei et al. proposed a user authentication scheme for telecare medical information system (TMIS). Recently, Zhu pointed out offline password guessing attack on Wei et al.'s scheme and proposed an improved scheme. In this article, we analyze both of these schemes for their effectiveness in TMIS. We show that Wei et al.'s scheme and its improvement proposed by Zhu fail to achieve some important characteristics necessary for secure user authentication. We find that security problems of Wei et al.'s scheme stick with Zhu's scheme; like undetectable online password guessing attack, inefficacy of password change phase, traceability of user's stolen/lost smart card and denial-of-service threat. We also identify that Wei et al.'s scheme lacks forward secrecy and Zhu's scheme lacks session key between user and healthcare server. We therefore propose an authentication scheme for TMIS with forward secrecy which preserves the confidentiality of air messages even if master secret key of healthcare server is compromised. Our scheme retains advantages of Wei et al.'s scheme and Zhu's scheme, and offers additional security. The security analysis and comparison results show the enhanced suitability of our scheme for TMIS.
Directory of Open Access Journals (Sweden)
Li Z
2018-05-01
Full Text Available Zhuohong Li, Chaofu Zhu, Baiping An, Yu Chen, Xiuyun He, Lin Qian, Lan Lan, Shijie Li Department of Oncology, The Affiliated Hospital of Chengdu University of Traditional Chinese Medicine, Chengdu, Sichuan, China Purpose: Hepatocellular carcinoma is one of the most predominant malignancies with high fatality rate and its incidence is rising at an alarming rate because of its resistance to radio- and chemotherapy. Indirubin is the major active anti-tumor ingredient of a traditional Chinese herbal medicine. The present study aimed to analyze the effects of indirubin on cell proliferation, migration, invasion, and angiogenesis of tumor-derived endothelial cells (Td-EC. Methods: Td-EC were derived from human umbilical vein endothelial cells (HUVEC by treating HUVEC with the conditioned medium of human liver cancer cell line HepG2. Cell proliferation, migration, invasion, and angiogenesis were assessed by MTT, wound healing, in vitro cell invasion, and in vitro tube formation assay. Results: Td-EC were successfully obtained from HUVEC cultured with 50% culture supernatant from serum-starved HepG2 cells. Indirubin significantly inhibited Td-EC proliferation in a dose- and time-dependent manner. Indirubin also inhibited Td-EC migration, invasion, and angiogenesis. However, indirubin’s effects were weaker on HUVEC than Td-EC. Conclusion: Indirubin significantly inhibited Td-EC proliferation, migration, invasion, and angiogenesis. Keywords: indirubin, Td-EC, proliferation, migration, invasion, angiogenesis
Experiment list: SRX193596 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available ox-hygro-hTERT (LH), and Cdk4-neo (CN), Zhu et al. (2007) in Aging Cell, vol. 6, ...), Zhu et al. (2007) in Aging Cell, vol. 6, pp 515-523, newly promoted to tier 2:... of a 41 year old caucasian heart transplant donor, immortalized with lox-hygro-hTERT (LH), and Cdk4-neo (CN
Experiment list: SRX201281 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available hygro-hTERT (LH), and Cdk4-neo (CN), Zhu et al. (2007) in Aging Cell, vol. 6, pp ...), Zhu et al. (2007) in Aging Cell, vol. 6, pp 515-523, newly promoted to tier 2:... of a 41 year old caucasian heart transplant donor, immortalized with lox-hygro-hTERT (LH), and Cdk4-neo (CN
Experiment list: SRX201282 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available ygro-hTERT (LH), and Cdk4-neo (CN), Zhu et al. (2007) in Aging Cell, vol. 6, pp 5...), Zhu et al. (2007) in Aging Cell, vol. 6, pp 515-523, newly promoted to tier 2:... of a 41 year old caucasian heart transplant donor, immortalized with lox-hygro-hTERT (LH), and Cdk4-neo (CN
Experiment list: SRX201297 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available RT (LH), and Cdk4-neo (CN), Zhu et al. (2007) in Aging Cell, vol. 6, pp 515-523, ...), Zhu et al. (2007) in Aging Cell, vol. 6, pp 515-523, newly promoted to tier 2:... of a 41 year old caucasian heart transplant donor, immortalized with lox-hygro-hTERT (LH), and Cdk4-neo (CN
Experiment list: SRX193611 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available d with lox-hygro-hTERT (LH), and Cdk4-neo (CN), Zhu et al. (2007) in Aging Cell, ...), Zhu et al. (2007) in Aging Cell, vol. 6, pp 515-523, newly promoted to tier 2:... of a 41 year old caucasian heart transplant donor, immortalized with lox-hygro-hTERT (LH), and Cdk4-neo (CN
Experiment list: SRX201296 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available RT (LH), and Cdk4-neo (CN), Zhu et al. (2007) in Aging Cell, vol. 6, pp 515-523, ...), Zhu et al. (2007) in Aging Cell, vol. 6, pp 515-523, newly promoted to tier 2:... of a 41 year old caucasian heart transplant donor, immortalized with lox-hygro-hTERT (LH), and Cdk4-neo (CN
Schmutz, J.A.; Laing, K.K.
2002-01-01
Broods of geese spend time feeding according to availability and quality of food plants, subject to inherent foraging and digestive constraints. We studied behavioral patterns of broods of Emperor Geese (Chen canagica) on the Yukon–Kuskokwim Delta, Alaska, and examined how feeding and alert behavior varied in relation to habitat and goose density. During 1994–1996, time spent feeding by Emperor Goose goslings and adult females was positively related to multispecies goose densities near observation blinds, and not to just Emperor Goose density. Similarly, body mass of Emperor Goose goslings was more strongly related (negatively) to multispecies goose densities than intraspecific densities. A grazing experiment in 1995 indicated that most above ground primary production by Carex subspathacea, a preferred food plant, was consumed by grazing geese. Those results demonstrate that interspecific competition for food occurred, with greatest support for goslings whose behavioral repertoire is limited primarily to feeding, digesting, and resting. Although the more abundant Cackling Canada Geese (Branta canadensis minima) differed from Emperor Geese in their preferred use of habitats during brooding rearing (Schmutz 2001), the two species occurred in equal abundance in habitats preferred by Emperor Goose broods. Thus, Cackling Canada Geese were a numerically significant competitor with Emperor Geese. Comparing these results to an earlier study, time spent feeding by goslings, adult females, and adult males were greater during 1993–1996 than during 1985–1986. During the interval between those studies, densities of Cackling Canada Geese increased two to three times whereas Emperor Goose numbers remained approximately stable, which implies that interspecific competition affected foraging behavior over a long time period. These density-dependent changes in foraging behavior and body mass indicate that interspecific competition affects nutrient acquisition and gosling
Recent Research in Behind-Armor Blunt Trauma and Traumatic Brain Injury
2014-02-01
Injury. Natl. Tech. Inf. Serv. 2006, ADA481896. 20. Cernak, I.; Wang, Z.; Jiang, J.; Bian, X.; Savic , J. Ultrastructural and Functional Characteristics...Malicevic, Z.; Savic J. Experimental Magnesium Depletion in Adult Rabbits Caused by Blast Overpressure. Magnes. Res. 1995, 8 (4), 249–259. 34. Cernak, I... Savic , J.; Malicevic, Z.; Zunic, G.; Radosevic, P.; Ivanovic, I.; Davidovic, L. Involvement of the Central Nervous System in the General Response
Lee, Tian-Fu; Liu, Chuan-Ming
2013-06-01
A smart-card based authentication scheme for telecare medicine information systems enables patients, doctors, nurses, health visitors and the medicine information systems to establish a secure communication platform through public networks. Zhu recently presented an improved authentication scheme in order to solve the weakness of the authentication scheme of Wei et al., where the off-line password guessing attacks cannot be resisted. This investigation indicates that the improved scheme of Zhu has some faults such that the authentication scheme cannot execute correctly and is vulnerable to the attack of parallel sessions. Additionally, an enhanced authentication scheme based on the scheme of Zhu is proposed. The enhanced scheme not only avoids the weakness in the original scheme, but also provides users' anonymity and authenticated key agreements for secure data communications.
Directory of Open Access Journals (Sweden)
Kurmi OP
2015-03-01
Full Text Available Om P Kurmi,1 Liming Li,2,3 Jenny Wang,1 Iona Y Millwood,1 Junshi Chen,4 Rory Collins,1 Yu Guo,2 Zheng Bian,2 Jiangtao Li,5 Biyun Chen,6 Kaixu Xie,7 Weifan Jia,8 Yali Gao,9 Richard Peto,1 Zhengming Chen1 On behalf of the China Kadoorie Biobank Collaborative Group 1Nuffield Department of Population Health, Clinical Trial Service Unit and Epidemiological Studies Unit (CTSU, University of Oxford, Oxford, UK; 2Department of Epidemiology and Biostatistics, School of Public Health, Peking University, 3Chinese Academy of Medical Sciences, Dong Cheng District, 4China National Center for Food Safety Risk Assessment, Beijing, 5NCDs Prevention and Control Department, Huixian CDC, Huixian, Henan, 6NCDs Prevention and Control Department, Hunan CDC, Changsha, 7NCDs Prevention and Control Department, Tongxiang CDC, Zhejiang, 8NCDs Prevention and Control Department, Liuyang CDC, Baiyikengdao, Liuyang, Changsha, Hunan, 9NCDs Prevention and Control Department, Sichuan CDC, Sichuan, Mainland China Purpose: In adult Chinese men, smoking prevalence is high, but little is known about its association with chronic respiratory disease, which is still poorly diagnosed and managed. Methods: A nationwide study recruited 0.5 million men and women aged 30–79 years during 2004–2008 from ten geographically diverse areas across the Mainland China. Information was collected from each participant regarding smoking and self-reported physician diagnosis of chronic bronchitis/emphysema (CB/E, along with measurement of lung function indices. Logistic regression was used to yield sex-specific odds ratios (ORs relating smoking to airflow obstruction (AFO, defined as forced expiratory volume in 1 second (FEV1/forced vital capacity (FVC <0.7 and CB/E, adjusting for age, areas, education, and income. Results: Overall 74% of men were ever regular smokers; among them, 7.2% had AFO compared with 5.4% in never-smokers, yielding an OR of 1.42 (95% confidence interval [CI]: 1.34–1
Right Sizing the People’s Liberation Army: Exploring the Contours of China’s Military
2007-09-01
Diyuan yu Zhongguo Haijun Jianshe” (“Stratgeic Geography and the Development of China’s Navy”), Shijie Jingji yu Zhengzhi (World Economics and...on conventional [missile forces] (hechang jianbei, yi chang wei zhu ); • Bring out focal points, put priority on quality (tuchu zhongdian, zhiliang...Juece” [“2nd Artillery Command & Control Decision- Making During a Joint Campaign”], Junshi Xueshu, July 2004, p. 65. 30. Shang Yi, “ Zhu Chenghu
Coping with the Dragon: Essays on PLA Transformation and the U.S. Military
2007-12-01
Industry], September 2002, 15–16. 19 “ Zhu Rongji Talks at Defense Group Ceremony,” Beijing Central Television Programme One Network, 1 July 1999, in FBIS...Scientific and Technological Industries Out of Their Predicament,” Junshi Jingji Yanjiu [Military Economic Research], January 1998, 8. 32...military official, Beijing, December 2003. 27 Zhu Qinglin and Meng Renzhong (Chief Eds), Zhongguo Caijun Yu Guofang Ziyuan Peizhi Yanjiu [China’s
2016-09-01
notwithstanding any other provision of law, no person shall be subject to any penalty for failing to comply with a collection of information if it...Jiepei Zhu, MD PhD, Bruce D. Spiess, MD. Evaluation of Noninvasive Cardiac Output Monitoring in Sheep with Hemodynamic Instability 2. 2016,Aug, Military...Zhu, J., Holloway, K.L., Parsons, J.T. Intracerebral hematoma incidence in a coagulopathic sheep model of deep brain stimulation (DBS) surgery
Bi Sparsity Pursuit: A Paradigm for Robust Subspace Recovery
2016-09-27
Bian, Student Member, IEEE, and Hamid Krim, Fellow, IEEE Abstract The success of sparse models in computer vision and machine learning is due to the...16. SECURITY CLASSIFICATION OF: The success of sparse models in computer vision and machine learning is due to the fact that, high dimensional data...vision and machine learning is due to the fact that, high dimensional data is distributed in a union of low dimensional subspaces in many real-world
International Nuclear Information System (INIS)
Wang Yuxiang; Zhu Shuchai; Qiu Rong; Liu Zhikun; Shen Wenbin
2011-01-01
Objective: To evaluate the prognostic significance of 3 clinical stage system in 3-dimensional conformal radiotherapy (3DCRT) for esophageal squamous cell carcinoma. Methods: From January 2004 to August 2007, 179 cases of esophageal squamous cell carcinoma were treated with 3DCRT. Before radiation, each patient was staged with UICC 2003 TNM stage, stage of Chinese esophageal cancer cooperation group (cooperation group' stage), and Zhu's clinical stage respectively. Concordance of each clinical stage and prognosis was analyzed with SPSS 11.5. Results In 179 cases of esophageal cancer, Concordance was better in T stage (Kappa = 0.271) than in TNM stage (Kappa = 0.167) between cooperation group' stage and Zhu's stage. Among them, 98 cases was staged with UICC stage, concordance of T stage was better between UICC-T and cooperation group' T stage (Kappa =0.261) than between UICCT and Zhu's T stage (Kappa = 0.045) ;concordance of TNM stage was better between UICC-TNM and Zhu's TNM stage (Kappa = 0.597) than between UICC-TNM and cooperation group' TNM stage (Kappa =0.299). With multivariate analysis, T (χ 2 value is 11.58, 26.00 and 51.05, all P 2 value is 15.28, 16.10 and 16.10, all P 2 value is 5.59, 27.78 and 27.78, all P 2 value is 15.77, 34, 35 and 51.10, all P 1 - T 3 was difficult to definite and the prognosis was not significantly different in T 1 - T 3 stage. Conclusions: In this study, 3 kinds of clinical stage could evaluate prognosis of esophageal cancer after radiotherapy; cooperation group' stage and Zhu's stage need further application, with further accuracy needed. (authors)
Directory of Open Access Journals (Sweden)
Li Xi-Ying
2013-02-01
postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915, O. ambiguus Weng & Chen, 2005 (not Wesmael, 1835 and O. mitis Chen & Weng, 2005 (not Fischer, 1963 are primary homonyms and are renamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. and O. wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005 comb. n., Diachasmimorpha longicaudata (Ashmead, 1905 and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957 comb. n. is new for China and Hunan; Xynobius maculipennis (Enderlein, 1912 comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005 comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005 comb. n., A. tracta (Weng & Chen, 2005 comb. n., Areotetes laevigatus (Weng & Chen, 2005 comb. n., Phaedrotoma dimidia (Chen & Weng, 2005 comb. n., P. improcera (Weng & Chen, 2005 comb. n., P. amputata (Weng & Chen, 2005 comb. n., P. larga (Weng & Chen, 2005 comb. n., P. osculas (Weng & Chen, 2005 comb. n., P. postuma (Chen & Weng, 2005 comb. n., P. rugulosa (Chen & Weng, 2005 comb. n., P. tabularis (Weng & Chen, 2005 comb. n., Rhogadopsis apii (Chen & Weng, 2005 comb. n., R. dimidia (Chen & Weng, 2005 comb. n., R. diutia (Chen & Weng, 2005 comb. n., R. longuria (Chen & Weng, 2005 comb. n., R. pratellae (Weng & Chen, 2005 comb. n., R. pratensis (Weng & Chen, 2005 comb. n., R. sculpta (Chen & Weng, 2005 comb. n., R. sulcifer (Fischer, 1975 comb. n., R. tabidula (Weng & Chen, 2005 comb. n., Xynobius complexus (Weng & Chen, 2005 comb. n
The People in the PLA: Recruitment, Training, and Education in China’s Military
2008-09-01
programs of instruction in related logistics engineering fields. 177 Military Economics Academy (Junshi jingji xueyuan, 军事经济学院)74 The Military...Director Zhu Fazhong is a career specialist in space, satellite, and testing issues and the former director of the Taiyuan launch testing center. Deputy...retirements frequently take place at that meeting and are announced in January or shortly thereafter. 57. Both Zhu Fazhong (born in 1948) and Zhang Jianqi
Right-Sizing the People’s Liberation Army: Exploring the Contours of China’s Military
2007-09-01
yu Zhongguo Haijun Jianshe" ("Stratgeic Geography and the Development of China’s Navy"), Shijie Jingji yu Zhengzhi (World Economics and Politics...They are: "* Maintain conventional and nuclear [missile forces], but put priority on conventional [missile forces] (hechang jianbei, yi chang wei zhu ...Zuozhan Zhihui Juece" [Ŗnd Artillery Command & Control Decision- Making During a Joint Campaign"], Junshi Xueshu, July 2004, p. 65. 30. Shang Yi, " Zhu
RLE (Research Laboratory of Electronics) Progress Report Number 130
1988-07-01
Ippen, James G. Fujimoto, Wei-Zhu Lin, Beat Zysset, Robert W. Schoenlein, 4 Michael J. Lagasse The investigation of transient carrier dynamics in GaAs...G. Fujimoto, Wei-Zhu Lin, Reginald Birngruber, Beat Zysset, Robert W. Schoenleln Working in collaboration with researchers at the Massachusetts Eye... Binaural Hearing National Institutes of Health (Grant 5 RO 1 NS 10916) H. Steven Colburn, Nathaniel 1. Durlach, Patrick M. Zurek 17 Brooklyn College14 141
Estimation of Uncertainties of Full Moment Tensors
2017-10-06
For our moment tensor inversions, we use the ‘cut-and-paste’ ( CAP ) code of Zhu and Helmberger (1996) and Zhu and Ben-Zion (2013), with some...modifications. For the misfit function we use an L1 norm Silwal and Tape (2016), and we incorporate the number of misfitting polarities into the waveform... norm of the eigenvalue triple provides the magnitude of the moment tensor, leaving two free parameters to define the source type. In the same year
Transnational Pipelines and Naval Expansion: Examining China’s Oil Insecurities in the Indian Ocean
2008-06-01
Wenmu, “China’s Energy Security and Strategy Studied,” Shijie Jingji Yu Zhengzhi 5 (2003): FBIS-CPP20030528000169. 7 Downs, “China,” 14. 4 oil...indicated that China plays the Sino-Pakistani friendship very well when competing for development projects within Pakistan. 84 Zhu Moqing, “China...Team up on Energy.” The Christian Science Monitor, April 13 2007, 6. Moqing, Zhu . “China Will Invest US$12 Billion in Pakistan.” Shanghaidaily.com
Li, Ming; Shang, Li; Bing, Shoulan
2014-11-01
Shanghai New Chinese Medical College set up by Zhu Nanshan and his sons, Zhu Xiaonan and Zhu Hegao, was a medical college of traditional Chinese medicine (TCM) with the most innovative spirit in modern time. Its affiliated research institute held the principle of "realizing the scientific truth of TCM, training TCM advanced talents", marking the beginning of the pioneering of "scientific TCM". The educational plan, clinical research and academic organization based on "carrying forward the quintessence of Chinese culture, absorbing and digesting the new knowledge" showed a certain influence at home and abroad. The College advocated the combination of communicating with famous physicians and the study of theory, cultivation of students' organization and academic society, launching of journals, and organizing students' research associations was aiming at the satisfaction of the social needs and teaching orientation. Its running experience provided useful reference for modern TCM medical education.
China Report, Political, Sociological and Military Affairs, No. 445.
1983-08-11
2052 0981], Chen Dingming [7115 7844 6900], Jin Xiulan [6855 4423 5695] (F, Mongolian), Zhao Nanqi [6392 0589 6386] Korean), Suo Jingxian [4792...Pen Center and the Guangzhou Pen Center will be headed by Chen Huangmei, another vice-president of the China center and a noted critic. The...1728 4426 6311], Zhang Tengxiao [1728 7506 7197], Chen Dingmou [7115 0002 5399], Chen Lunfen [7115 0243 5358] (F), Chen Xitong [7115 1585 0681
Technical Digest of the 1998 Summer Topical Meeting on Organic Optics and Optoelectronics
1998-07-01
Larry Dalton, University of Southern California, Los Angeles, CA Harold Fetterman , University of California, Los Angeles, CA Steve Forrest...OPTIC MODULATORS H. Fetterman , D. Chen, A. Udupa. D. Bhattachaya, B. Tsap University of Califonia, Los Angeles 90024 S. Lee, A. Chen, J. Chen, W...Chen, H.R. Fetterman , A. Chen, W.H. Steier, and L. R. Dalton, Appl. Phys. Lett. 70, (1997). 2. T.A. Tumolillo and P.R. Ashley, Appl. Phys. Lett. 62
China QIUSHI SEEKING TRUTH no 3, 1 August 1988
1988-09-16
Legal Principles in Law Circles in Recent Years 40 A New ’Political Economy’ Textbook Is Compiled in the Soviet Union [Dan Zhu ] 43 On ’Writings...Analysis on Results" (hereafter called "Census") which has been published by Zhongguo Caizheng Jingji Chubanshe (China Finance and Economics Publishing...HK2508082288 Beijing Q1USHI[SEEKING TRUTH] in Chinese No 3, 1 Aug 88 p 44 [Article by Dan Zhu 0030 4554 of the Chinese Academy of Social Sciences
Institute of Scientific and Technical Information of China (English)
陳智超
2010-01-01
Every historian should answer two questions related to each other, i. e. what is the relationship between history and reality and what is that between historiography and reality. Moreover, Chinese historians should answer other two questions also re-lated to each other, namely what is the relationship between China and the West and what is that between Chinese culture and Western culture. Based on their own outlook on the ancient and the present as well as on China and the West, every conscious Chinese historian of the 20 th century was bound to cherish a definite sense of responsi-bility and determined what role they played and what way they chose when taking on this responsibility. The present paper expounds Prof. Chen Yuan’ s answers to the above questions andhis practice concerned with them in the four stages of his lifetime.
[The relationship between acupuncture-moxibustion theory of DOU Hanqing and Neo- Confucianism].
Li, Baojin; Huang, Longxiang
2018-02-12
For the construction factors of acupuncture-moxibustion theory of DOU Hanqing , a doctor in Jin-Yuan Dynasty, we studied his life, acupuncture-moxibustion theory and culture background in the History of Medicine and Philosophy of Science & Technology. It was found that the major source of DOU Hanqing ' s Confucianism was the CHENG - ZHU Neo-Confucianism. The data show that Neo-Confucianism played an important role in the enrichment of his human nature, spirit, moral cultivation and political talent, making him a scholar in the Jin - Yuan dynasty, also shaping his medical ethics, medical skill and acupuncture-moxibustion theory. The inheritance, development and application of CHENG - ZHU Neo-Confucianism provided the most fundamental thinking, research methods and patterns for DOU Hanqing to interpret the acupuncture classics, summarize his teachers' experience and develop his theoretical system. DOU Hanqing ' s acupuncture-moxibustion practice and theory reached a new level, because he took acupuncture-moxibustion as one of the knowledge investigation and attainment of CHENG - ZHU Neo-Confucianism.
Li, Xi-Ying; van Achterberg, Cornelis; Tan, Ji-Cai
2013-01-01
van Achterberg & Li, gen. n. (type species: Areotetes carinuliferus sp. n.) and Coleopioides van Achterberg & Li, gen. n. (type species: Coleopioides postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915), Opius ambiguus Weng & Chen, 2005 (not Wesmael, 1835) and Opius mitis Chen & Weng, 2005 (not Fischer, 1963) are primary homonymsandarerenamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. andOpius wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005) comb. n.,Diachasmimorpha longicaudata (Ashmead, 1905) and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957) comb. n. is new for China and Hunan; Xynobius maculipennis(Enderlein, 1912) comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005) comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005) comb. n., Apodesmia tracta (Weng & Chen, 2005) comb. n., Areotetes laevigatus (Weng & Chen, 2005) comb. n., Phaedrotoma dimidia (Chen & Weng, 2005) comb. n., Phaedrotoma improcera (Weng & Chen, 2005) comb. n., Phaedrotoma amputata (Weng & Chen, 2005) comb. n., Phaedrotoma larga (Weng & Chen, 2005) comb. n., Phaedrotoma osculas (Weng & Chen, 2005) comb. n., Phaedrotoma postuma (Chen & Weng, 2005) comb. n., Phaedrotoma rugulosa (Chen & Weng, 2005) comb. n., Phaedrotoma tabularis (Weng & Chen, 2005) comb. n., Rhogadopsis apii (Chen & Weng, 2005) comb. n., Rhogadopsis dimidia (Chen & Weng, 2005) comb. n., Rhogadopsis diutia (Chen & Weng, 2005) comb. n., Rhogadopsis
Reference: 291 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available 291 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16244906i Chai Mao-Feng...d chloroplast protection. 4 553-64 16244906 2005 Nov Plant molecular biology An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Chen Ye-Miao|Wang Xue-Chen
Digital Repository Service at National Institute of Oceanography (India)
Wiggert, J.D.; Hood, R.R.; Naqvi, S.W.A.; Brink, K.H.; Smith, S.L.
stream_size 35035 stream_content_type text/plain stream_name Geophys_Monogr_Ser_185_1.pdf.txt stream_source_info Geophys_Monogr_Ser_185_1.pdf.txt Content-Encoding UTF-8 Content-Type text/plain; charset=UTF-8 � Indian... inter- pretations of zooplankton observations obtained during the JGOFS cruises of the mid-�990s through the use of a food web synthesis that elucidates how mesozooplankton and mi- crozooplankton contribute to carbon flows within the Ara- bian Sea...
The cellular receptors for infectious bursal disease virus | Zhu ...
African Journals Online (AJOL)
Virus receptors are simplistically defined as cell surface molecules that mediate binding (attachment, adsorption) and/or trigger membrane fusion or entry through other processes. Infectious bursal disease virus (IBDV) entry into host cells occurs by recognition of specific cellular receptor(s) with viral envelope glycoprotein, ...
DEFF Research Database (Denmark)
Wilmot-Dear, Christine Melanie; Friis, Ib; Govaerts, R. H. A.
2014-01-01
(H. Lév.) C.J. Chen in Chen et al. as the correct name for the variety named in the revision as B. zollingeriana Wedd. var. podocarpa (W.T. Wang) W.T. Wang & C.J. Chen in Chen et al., (3) that the combination B. spicata (Thunb.) Thunb., based on Urtica spicata Thunb., is not illegitimate, as stated...
1991-09-01
in FBIS-CHI-91-O55. 25-26; Guo about seven percent in the military budget. From 1980 to 1989. Xiangxing and Zhu Bin, "First Generation Ship-Based...China’s Military Expenditure in the Last Ten Years," Jingji 67JFJB, 9 March 1991. Yangjiu (Economics Studies], no. 6 (20 June 1990). 77-81, 6 The...frence on the PLA 1. Given that there have been more massive Li Ruihuan, Zhu Rongji pro-reform demonstrations in a major metropolitan or Qiao Shi 1% 4
U.S. Environmental Protection Agency — These data describe the chromatography characteristics of the MARGA instrument software as compared to an alternative, independent technique for chromatogram...
Directory of Open Access Journals (Sweden)
Kurmi OP
2016-03-01
Full Text Available Om P Kurmi,1 Julien Vaucher,1 Dan Xiao,2 Michael V Holmes,1 Yu Guo,3 Kourtney J Davis,4 Chen Wang,5 Haiyan Qin,6 Iain Turnbull,1 Peng Peng,7 Zheng Bian,3 Robert Clarke,1 Liming Li,8 Yiping Chen,1 Zhengming Chen1 On behalf of the China Kadoorie Biobank collaborative group 1Clinical Trial Service Unit & Epidemiological Studies Unit (CTSU, Nuffield Department of Population Health, University of Oxford, Oxford, UK; 2Tobacco Medicine and Tobacco Cessation Center, China–Japan Friendship Hospital, Beijing, People’s Republic of China; 3National Coordinating Centre for China Kadoorie Biobank Study, Chinese Academy of Medical Sciences, Beijing, People’s Republic of China; 4Worldwide Epidemiology, GlaxoSmithKline R&D, Collegeville, PA, USA; 5National Clinical Research Center for Respiratory Diseases, China-Japan Friendship Hospital, Beijing, People’s Republic of China; 6Medical Research Center, Beijing Chao-Yang Hospital, Capital Medical University, Beijing, People’s Republic of China; 7Radiology Department, Beijing Chao-Yang Hospital, Capital Medical University, Beijing, People’s Republic of China; 8Department of Epidemiology, School of Public Health, Peking University Health Science Center, Beijing, People’s Republic of China Background: COPD is the fourth leading cause of death worldwide, with particularly high rates in the People’s Republic of China, even among never smokers. Large population-based cohort studies should allow for reliable assessment of the determinants of diseases, which is dependent on the quality of disease diagnoses. We assessed the validity of COPD diagnoses collected through electronic health records in the People’s Republic of China. Methods: The CKB study recruited 0.5 million adults aged 30–79 years from ten diverse regions in the People’s Republic of China during the period 2004–2008. During 7 years of follow-up, 11,800 COPD cases were identified by linkage with mortality registries and the national
Seven new species of Begonia (Begoniaceae) in Northern Vietnam and Southern China
Chen, Wen-Hong; Radbouchoom, Sirilak; Nguyen, Hieu Quang; Nguyen, Hiep Tien; Nguyen4, Khang Sinh; Shui, Yu-Min
2018-01-01
Abstract Since 2016, KIB (Kunming Institute of Botany) and CPC (Centre for Plant Conservation of Vietnam) have conducted several surveys in the transboundary karst regions in Northern Vietnam and Southern China and seven new species in the genus Begonia Linn. (Begoniaceae) are firstly described. Amongst them, two species, Begonia albopunctata Y.M. Shui, W.H. Chen & H.Q. Nguyen and B. erectocarpa H.Q. Nguyen, Y.M. Shui & W.H. Chen, respectively belong to section Sphenanthera with berry fruits and section Leprosae with clavate berry fruits; four species, B. gulongshanensis Y.M. Shui & W. H. Chen, B. minissima H.Q. Nguyen, Y.M. Shui & W.H. Chen, B. mollissima Y.M. Shui, H.Q. Nguyen & W.H. Chen, B. rhytidophylla Y.M. Shui & W.H. Chen, belong to section Coelocentrum with parietal placentation; one species, Begonia bambusetorum H.Q. Nguyen, Y.M. Shui & W.H. Chen, belongs to section Diploclinium with 3-loculed ovary and capsules. The diagnostic characters of these species are described and illustrated in the text and photographs. PMID:29416422
Two new genera and three new species of Epipaschiinae Meyrick from China (Lepidoptera, Pyralidae
Directory of Open Access Journals (Sweden)
Mingqiang Wang
2017-12-01
Full Text Available Two new genera of Epipaschiinae are described. The genus Arcanusa Wang, Chen & Wu, gen. n. is established for Ar. apexiarcanusa Wang, Chen & Wu, sp. n. and Ar. sinuosa (Moore, 1888, comb. n., described in Scopocera Moore, 1888 (junior synonym of Stericta Lederer, 1863. The female genitalia of Ar. sinuosa (Moore, 1888, comb. n. are described for the first time. Androconia Wang, Chen & Wu, gen. n. is erected, including two new species, An. rallusa Wang, Chen & Wu, sp. n. and An. morulusa Wang, Chen & Wu, sp. n. Illustrations of all adults and their genitalia, and a key to the two new genera are provided.
Functionalized D-form self-assembling peptide hydrogels for bone regeneration
Directory of Open Access Journals (Sweden)
He B
2016-04-01
Full Text Available Bin He,1 Yunsheng Ou,1 Ao Zhou,1 Shuo Chen,1 Weikang Zhao,1 Jinqiu Zhao,2 Hong Li,3 Yong Zhu,1 Zenghui Zhao,1 Dianming Jiang1 1Department of Orthopedics, 2Department of Infectious Diseases, The First Affiliated Hospital of Chongqing Medical University, Chongqing, People’s Republic of China; 3School of Physical Science and Technology, Sichuan University, Chengdu, People’s Republic of China Abstract: Bone defects are very common in orthopedics, and there is great need to develop suitable bone grafts for transplantation in vivo. However, current bone grafts still encounter some limitations, including limited availability, immune rejection, poor osteoinduction and osteoconduction, poor biocompatibility and degradation properties, etc. Self-assembling peptide nanofiber scaffolds have emerged as an important substrate for cell culture and bone regeneration. We report on the structural features (eg, Congo red staining, circular dichroism spectroscopy, transmission electron microscopy, and rheometry assays and osteogenic ability of D-RADA16-RGD peptide hydrogels (with or without basic fibroblast growth factor due to the better stability of peptide bonds formed by these peptides compared with those formed by L-form peptides, and use them to fill the femoral condyle defect of Sprague Dawley rat model. The bone morphology change, two-dimensional reconstructions using microcomputed tomography, quantification of the microcomputed tomography analyses as well as histological analyses have demonstrated that RGD-modified D-form peptide scaffolds are able to enhance extensive bone regeneration. Keywords: bone defect, functionalized D-form self-assembling peptide, D-RADA16-RGD, peptide hydrogel, bone regeneration
Studies of N ~ 40 Ni isotopes via neutron-knockout (nKO) and deep-inelastic (DI) reactions
Chiara, C. J.; Recchia, F.; Gade, A.; Janssens, R. V. F.; Walters, W. B.
2013-10-01
V. BADER, T. BAUGHER, D. BAZIN, J.S. BERRYMAN, B.A. BROWN, C. LANGER, N. LARSON, S.N. LIDDICK, E. LUNDERBERG, S. NOJI, C. PROKOP, S.R. STROBERG, S. SUCHYTA, D. WEISSHAAR, S. WILLIAMS, NSCL/MSU, M. ALBERS, M. ALCORTA, P.F. BERTONE, M.P. CARPENTER, J. CHEN, C.R. HOFFMAN, F.G. KONDEV, T. LAURITSEN, A.M. ROGERS, D. SEWERYNIAK, S. ZHU, ANL, C.M. CAMPBELL, LBNL, H.M. DAVID, D.T. DOHERTY, U. of Edinburgh/ANL, A. KORICHI, CSNSM-IN2P3/ANL, C.J. LISTER, U. of Mass.-Lowell, K. WIMMER, Central Mich. U. -- Excited states in 68Ni were populated in 2nKO reactions at NSCL. Prompt γ rays were detected with the GRETINA array located in front of the S800 separator. A hodoscope at the S800 focal plane captured the 68Ni ions, where isomeric decays could be correlated with prompt γ rays. Decay of the first excited state, a 0+ isomer, was observed, confirming that its energy substantially differs from the literature value. Comparing the decay patterns of excited states with shell-model calculations provides insight into their underlying structure. Data from 70Zn + 208Pb DI reactions studied with Gammasphere provide results consistent with the 2nKO. Single-particle strengths are also under investigation in the odd- A Ni isotopes via 1nKO reactions. Supported in part by the DoE (DE-FG02-94ER40834, DE-AC02-06CH11357), NSF (PHY-1102511), and NNSA (DE-NA0000979).
Directory of Open Access Journals (Sweden)
Chen L
2017-05-01
Full Text Available Lei Chen,1,* Lingling Sun,1,* Lei Dong,2 Peng Cui,3 Ziwei Xia,4 Chao Li,1 Yu Zhu5 1Department of Otolaryngology, The Second Hospital of Tianjin Medical University, Tianjin, People’s Republic of China; 2Department of Pediatrics, Division of Hematology/Oncology, Aflac Cancer and Blood Disorders Center, Emory University School of Medicine, Atlanta, GA, USA; 3Department of Multidisciplinary Consultation Center of TCM and Western Medicine, The Affiliated Qingdao Hiser Hospital of Qingdao University, Qingdao, 4Department of Clinical Medicine, The Second Clinical Medical School of Tianjin Medical University, 5Department of Clinical Laboratory, Tianjin Huanhu Hospital, Tianjin Key Laboratory of Cerebral Vessels and Neural Degeneration, Tianjin, People’s Republic of China *These authors contributed equally to this work Abstract: LncRNA-LET, a recently identified long noncoding RNA, has been shown to act as a tumor suppressor; however, its biological function and mechanism have not been fully investigated. Our research found that there was less expression of LET in nasopharyngeal carcinoma (NPC tissues than normal tissues and that LET might inhibit proliferation, adhesion and invasion of NPC in vitro by enhancing its expression. By contrast, decreased LET expression could promote the proliferation, adhesion and invasion of NPC. In addition, the expression profiles of related genes and MAPK/ERK pathway were also regulated effectively via overexpression or silencing of LET. This result provides comprehensive evidence of LET’s antitumor effect on NPC in vitro, which might provide a new approach for clinical treatment. Keywords: LncRNA-LET, proliferation, invasion, nasopharyngeal carcinoma, MAPK/ERK pathway
Hydrogen sulfide, a potential novel drug, attenuates concanavalin A-induced hepatitis
Directory of Open Access Journals (Sweden)
Cheng P
2014-09-01
Full Text Available Ping Cheng,* Kan Chen,* Yujing Xia, Weiqi Dai, Fan Wang, Miao Shen, Chengfen Wang, Jing Yang, Rong Zhu, Huawei Zhang, Jingjing Li, Yuanyuan Zheng, Junshan Wang, Yan Zhang, Jie Lu, Yingqun Zhou, Chuanyong GuoDepartment of Gastroenterology, Shanghai Tenth People's Hospital, Tongji University of Medicine, Shanghai, People's Republic of China *These authors contributed equally to this work Background: Hydrogen sulfide (H2S is known to exert anti-inflammatory properties. Apoptosis and autophagy play important roles in concanavalin A (Con A-induced acute hepatitis. The purpose of this study was to explore both the effect and mechanism of H2S on Con A-induced acute hepatitis. Methods: BALB/c mice were randomized into sham group, Con A-injection group, and 14 µmol/kg of sodium hydrosulfide (NaHS, an H2S donor pretreatment group. Results: Aspartate aminotransferase, alanine aminotransferase, and pathological damage were significantly ameliorated by NaHS pretreatment. NaHS pretreatment significantly reduced the levels of interleukin-6 and tumor necrosis factor-α compared with those of the Con A group. The expression of Bcl-2, Bax, Beclin-1, and LC3-2, which play important roles in the apoptosis and autophagy pathways, were also clearly affected by NaHS. Furthermore, NaHS affected the p-mTOR and p-AKT. Conclusion: H2S attenuates Con A-induced acute hepatitis by inhibiting apoptosis and autophagy, in part, through activation of the PtdIns3K-AKT1 signaling pathway. Keywords: NaHS, apoptosis, PtdIns3K-AKT, autophagy
Directory of Open Access Journals (Sweden)
Wu J
2013-08-01
Full Text Available Jun Wu1, Wei He2, Wei-min Chen1, Lian Zhu21Key Laboratory of Optoelectronic Technology and Systems, 2State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing, People’s Republic of ChinaAbstract: The real-time monitoring of intracranial pressure (ICP is very important for craniocerebrally critically ill patients, but it is very difficult to realize long-time monitoring for the traditional invasive method, which very easily infects patients. Many noninvasive methods have emerged, but these have not been able to monitor ICP for long periods in real time, and they are not ready for clinical application. In order to realize long-time, online, real-time, noninvasive monitoring for ICP, a new method based on acoustoelasticity of ultrasound is herein proposed. Experimental models were devised to research the new method for experiment and simulation. Polymethyl methacrylate and hydrogel were adopted for the experiment, and their mechanical properties were very close to the real brain. A numerical solution for acoustoelasticity theory was acquired by simulating calculation based on a finite-element method. This was compared to the experimental value. The results showed a consistent match between theoretical solution and experimental value, with maximum error at most 5%. Thus, the effectiveness of the new method was verified. Theoretical and practical foundation is provided for this new method, and it could be used for animal experimentation or clinical testing in further research.Keywords: medical instruments, noninvasive, intracranial pressure, ultrasonic, acoustoelasticity, biomechanics
Digital Repository Service at National Institute of Oceanography (India)
Thamban, M.; Rao, V.P.
, Vidyanagar 671 123, India We reconstruct here the changes in regional hydr o- graphy related to the fluctuations in Indian mo n soons du r ing the late Quaternary based on the stable isotope composition of the foraminifers and organic matter in three... value du r ing the early Holocene for the eastern Arabian Sea 21 . The SW monsoon intensity was very weak and the dry NE mo n soon was the dominant feature during the LGM in the Ar a bian Sea 3 . The cool winds of the north - easterly winter...
Bacterioplankton abundance and production in Indian Ocean Regions
Digital Repository Service at National Institute of Oceanography (India)
Ramaiah, N.; Fernandes, V.; Rodrigues, V.V.; Paul, J.T.; Gauns, M.
) console. Although eu- photic depth varied widely in these locations, from as shallow as ~25 m in the bay to as deep as 150 m in the EIO, to be consistant with the JGOFS protocols followed widely, eight discrete depths (viz surface, 10, 20, 40, 60, 80... standing stocks calculated using 11 fg C per bacterial cell. Data from discrete sam- pling depths averaged from different stations in CAS, central Ara- bian Sea; EAS, eastern Arabian Sea; WB, western Bay of Bengal; CB, central Bay of Bengal; EIO...
Reversible Redox-Induced Modulation of Sterics in an α-Diimine Ligand Coordinated to Gallium
Energy Technology Data Exchange (ETDEWEB)
Zarkesh, Ryan A. [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Foster, Michael E. [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Ichimura, Andrew S. [San Francisco State Univ., CA (United States); Anstey, Mitchell R. [Davidson College, Davidson, NC (United States)
2017-07-01
The ability to tune the steric envelope through redox events post-synthetically or in tandem with other chemical processes is a powerful tool that could assist in enabling new catalytic methodologies and understanding potential pitfalls in ligand design. The α-diimine ligand, dmp-BIAN, exhibits the peculiar and previously unreported feature of varying steric profiles depending on oxidation state when paired with a main group element. A study of the factors that give rise to this behaviour as well as its impact on the incorporation of other ligands is performed.
Two new species of the stonefly genus Amphinemura (Insecta, Plecoptera, Nemouridae) from China.
Ji, Xiao-Yu; Du, Yu-Zhou; Wang, Zhi-Jie
2014-01-01
Two new species of the genus Amphinemura Ris from China are described and illustrated, i.e. A. annulata Du & Ji, sp. n. from Zhejiang, Shanxi, Shaanxi and Guizhou Province, and A. lingulata Du & Wang, sp. n. from Shaanxi and Sichuan Province. A. annulata is similar to A. tricintusidens Wang & Zhu in having an apical cavity of the epiproct, but the epiproct ventral sclerite and the median paraproct lobe of the two species are different. A. lingulata is related to A. didyma Zhu & Yang in having the similar epiproct, but they differ mostly in paraproct median and outer lobes.
Tropical Journal of Pharmaceutical Research - Vol 15, No 3 (2016)
African Journals Online (AJOL)
Wan Wu, Wei Chen, Qiong Jin, 447-451 ... Chung-Shih Chen, Mei-Lin Wang, Rosa Huang Liu, Shih-Pin Chen, Tsong-Ming Lu, Wei-Yu Tsai, Chien-Fu Huang, ... Yan-Qiong Li, Rui Hu, Li-Hui Zhong, Qian Sun, You-Ping Yan, 527-533.
Construction of full-length cDNA library of white flower Salvia ...
African Journals Online (AJOL)
STORAGESEVER
2009-05-18
May 18, 2009 ... of S. miltiorrhiza bge (Yuan et al., 1990; Wang et al.,. 1998; Huang et al., 2000). Hairy roots and ... or A. tumefaciens strains (Chen et al., 1997; Song et al.,. 1997). ..... Chen H, Yuan JP, Chen F, Zhang YL, Song JY (1997).
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
Author Affiliations. Chen Bin1 Zeng Zhirong1 Wu Xiaoqin1 Chen Minhu1 Li Mei1 Gao Xiang1 Chen Baili1 Hu Pinjin1. Department of Gastroenterology, the First Affiliated Hospital, Sun Yat-sen University, 58 Zhongshan II Road, Guangzhou 510080, People's Republic of China ...
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
Influence of free water content on the compressive mechanical behaviour of cement mortar under high strain rate · Jikai Zhou Xudong Chen Longqiang Wu Xiaowei Kan ... pp 111-117. Mechanical properties of concrete to cyclic uniaxial tensile loading using variable waveforms · YUZHI CHEN XUDONG CHEN JINGWU BU.
Directory of Open Access Journals (Sweden)
Fan ZG
2016-03-01
Full Text Available Zhong-Guo Fan,1,* Xiao-Fei Gao,1,2,* Li-Wen Chen,1 Xiao-Bo Li,1,2 Ming-Xue Shao,1,2 Qian Ji,1 Hao Zhu,1 Yi-Zhi Ren,1 Shao-Liang Chen,1,2 Nai-Liang Tian1,2 1Department of Cardiology, Nanjing First Hospital, Nanjing Medical University, 2Department of Cardiology, Nanjing Heart Center, Nanjing, People’s Republic of China *These authors contributed equally to this work Background: The effects of intra-aortic balloon pump (IABP usage in patients with acute myocardial infarction remain controversial. This study sought to evaluate the outcomes of IABP usage in these patients.Methods: Medline, EMBASE, and other internet sources were searched for relevant clinical trials. The primary efficacy endpoints (in-hospital, midterm, and long-term mortality and secondary endpoints (reinfarction, recurrent ischemia, and new heart failure in the hospital as well as safety endpoints (severe bleeding requiring blood transfusion and stroke in-hospital were subsequently analyzed.Results: Thirty-three clinical trials involving 18,889 patients were identified. The risk of long-term mortality in patients suffering from acute myocardial infarction was significantly decreased following IABP use (odds ratio [OR] 0.66, 95% confidence interval [CI]: 0.48–0.91, P=0.010. Both in-hospital and midterm mortality did not differ significantly between the IABP use group and no IABP use group (in-hospital: OR 0.87, 95% CI: 0.59–1.28, P=0.479; midterm: OR 1.12, 95% CI: 0.53–2.38, P=0.768. IABP insertion was not associated with the risk reduction of reinfarction, recurrent ischemia, or new heart failure. However, IABP use increased the risk of severe bleeding requiring blood transfusion (OR 2.05, 95% CI: 1.29–3.25, P=0.002 and stroke (OR 1.71, 95% CI: 1.04–2.82, P=0.035. In the thrombolytic therapy and cardiogenic shock subgroups, reduced mortality rates following IABP use were observed.Conclusion: IABP insertion is associated with feasible benefits with respect to long
African Journals Online (AJOL)
Items 51 - 100 of 1309 ... Li-Long Liu, Kai Xu, Lu-Mei Kang, Shu-Ping Jiang, Qing-Hua Wang, ... CR Sewani-Rusike, JE Iputo, EJ Ndebia, M Gondwe, DR Kamadyaapa ... K-M Man, W-C Chen, H-M Wang, H-Y Chen, J-L Shen, L-D Chen, F-J Tsai, ...
6th conference on Advances in Optoelectronics and Micro/nano-optics
International Nuclear Information System (INIS)
2017-01-01
would like to thank all participants of this conference, and particularly the authors of all accepted papers for their high quality and fruitful contributions. We do hope that this volume will be beneficial for readers to their future research endeavours and careers. We also gratefully acknowledge tremendous efforts and dedication of many individuals and all the Editorial Board members in IOP Publishing for their support in producing the proceedings of this event. Sincerely, Yiping Cui Conference Co-Chair CONFERENCE OFFICIALS Conference Co-Chairs Yiping Cui Southeast University, China Xiaocong Yuan Shenzhen University, China Shining Zhu Nanjing University, China Executive Chair Zhuyuan Wang Southeast University, China Technical Program Committee Guanghui Chen China Electronics Technology Group Corporation, China Yiping Cui Southeast University, China Qihuang Gong Peking University, China Min Gu Swinburne University of Technology, Australia Satoshi Kawata Osaka University, Japan Gong-Ru Lin National Taiwan University, Taiwan, China Xu Liu Zhejiang University, China Yanqing Lu Nanjing University, China Ting Mei Northwestern Polytechnical University, China Min Qiu Zhejiang University, China Marek Samoc Wroclaw University of Technology, Poland Colin Sheppard Italian Institute of Technology, Italy Charles Surya Hong Kong Polytechnic University, China Katarina Svanberg Lund University, Sweden Sune Svanberg Lund University, Sweden Jinghua Teng IMRE, Singapore Dinping Tsai Academia Sinica, Taiwan, China Zhuyuan Wang Southeast University, China Jingjun Xu Nankai University, China Baoli Yao Xi’an Institute of Optics and Precision Mechanics, China Xiaocong Yuan Shenzhen University, China Qiwen Zhan University of Dayton, USA Shining Zhu Nanjing University, China (paper)
Directory of Open Access Journals (Sweden)
Cheng X
2014-12-01
Full Text Available Xianglin Cheng,1,* Xu Pu,2,* Pen Jun,3 XiaoBo Zhu,3 Di Zhu,4 Ming Chen1 1Department of Laboratory Medicine, First Affiliated Hospital of Yangtze University, Jingzhou, 2Department of Laboratory Medicine, RenMin Hospital of Wuhan University, Wuhan, 3Key Laboratory of Analytical Chemistry for Biology and Medicine (Ministry of Education, College of Chemistry and Molecular Sciences, Wuhan University, Wuhan, Hubei, People’s Republic of China; 4Department of Medical Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA, USA *These authors contributed equally to this study and share first authorship Background: Rapid immunochromatographic tests can detect disease markers in 10–15 minutes, which facilitates clinical diagnosis and treatment programs. However, most immunochromatographic tests employ gold nanoparticles as reporters, and these have only moderate sensitivity and act as qualitative methods for analyzing high biomarker concentrations. Methods: In this study, we introduce quantum dots (QDs as fluorescent probes and immunochromatographic strips to develop quantitative fluorescence point-of-care tests (QF-POCT to analyze C-reactive protein (CRP levels. Goat anti-rabbit IgG and rabbit IgG were used as control antibodies, and mouse monoclonal CRP antibody pairs were used for disease marker detection. One monoclonal CRP antibody was conjugated with QDs and served as a signal antibody, and the other monoclonal CRP antibody was dispensed onto the nitrocellulose membrane and served as a capturing antibody. In the presence of CRP, the fluorescence intensity of the monoclonal antibody-CRP-monoclonal antibody sandwich complex captured on the nitrocellulose membrane was determined using the fluorescence strip reader. Results: QF-POCT assays could quantitatively analyze the concentration of CRP in 15 minutes had a detection limit of 0.25 mg/L, and had a wide detection linearity range (0.5–300 mg/L. The intra-assay and interassay
2012-11-01
All papers published in this volume of Journal of Physics: Conference Series have been peer reviewed through processes administered by the editors of the 26th IAHR Symposium on Hydraulic Machinery and Systems proceedings. Reviews were conducted by expert referees from the International Technical Committee to the professional and scientific standards expected of a proceedings journal published by IOP Publishing. The members of the Scientific Committee who selected and reviewed the papers included in the Proceedings of the 26th IAHR Symposium on Hydraulic Machinery and Systems are: Yulin WU Tsinghua University China François AVELLAN EPFL-LMH Switzerland (principal) Xingqi LUO Xi'an University of Sci & Tech China Martin BÖHLE Kaiserslautern University Germany Gerard BOIS Arts et Métiers ParisTech France Luca D'AGOSTINO University of Pisa Italy Eduard EGUSQUIZA Polytechnical University Catalonia Spain Richard FISHER Voith Hydro Inc USA Regiane FORTES-PATELLA Institute Polytechnique de Grenoble France Aleksandar GAJIC University of Belgrade Serbia Wei YANG China Agriculture University China YinLu YOUNG University of Michigan USA Adrian LUNGU Dunarea de Jos University of Galati Romania Arpad FAY University of Miskolcz Hungary José GONZÁLEZ Universidad de Oviedo Spain Baoshan ZHU Tsinghua University China Hongxun CHEN Shanghai University China Chisachi KATO University of Tokyo Japan Zhenyue MA Dalian University of Sci & Tech China Honggang FAN Tsinghua University China François GUIBAULT Ecole Polytechnique de Montreal Canada Pengcheng GUO Xian University of Technology China Leqing WANG Zhejiang University China Toshiaki IKOHAGI Tohoku University Japan Jiandong YANG Wuhan University China Jianzhong ZHOU Huazhong University of Sci & Tech China Jinwei LI NULL China Rennian LI Lanzhou University of Sci & Tech China Houlin LIU NULL China Juan LIU Tsinghua University China Shuhong LIU Tsinghua University China Xianwu LUO Tsinghua University China Michihiro NISHI Tsinghua
Directory of Open Access Journals (Sweden)
Zhilin Chen
2017-02-01
Full Text Available Three new species of the genus Gnamptogenys Roger, 1863 are described from southern China: Gnamptogenys dentihumera Chen, Lattke & Zhou, sp. n., Gnamptogenys nanlingensis Chen, Lattke & Zhou, sp. n. and Gnamptogenys quadrutinodules Chen, Lattke & Zhou, sp. n. A distribution map and an identification key to workers for the known species of China are provided.
Reference: 418 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available 418 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16856986i Chai Mao-Feng...cid responses in Arabidopsis. 5 665-74 16856986 2006 Sep The Plant journal An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Wang Xue-Chen|Wei Peng-Cheng|Yang Shuhua
中村淳
1994-01-01
The disputes between one sect of Taoism Quan-zhen-jiao (全真教) and the Zen sect (禅宗) of Buddhism arose three times in the reign of the Emperor Möngke. According to the Zhi-yuan-bian-wei-lu (至元辯偽録) compiled by a Buddhist monk which have been regarded as the only relevant literature, it is reported that these disputes ended in a victory for Buddhism. As the result of examining relevant parts of a report of mission composed by William of Rubruck and a Tibetan chronicle Hu-lan-deb-ther, we have fou...
Indian Academy of Sciences (India)
Smith and Carson ... Z. Physikal. Chenn., 1908, 6, 200. 13. Ephraim ... Z. anord. Chen., 190S, 58, 33S. 14. Wright ... J. Chen. Soc, 1915, 107, 1527. 15. Amadori ... Gazetta, 1922, 1, 52, 387. 16. Mori ... J. Chen. Soc., Japa), 1923, 44, 730. 17. Waradachari and Subra- Proc. Ind. Acad, Sci., 1936, 3 A, 428. Ilala. 18. Hervey and ...
Evaluation of burst pressure prediction models for line pipes
Energy Technology Data Exchange (ETDEWEB)
Zhu, Xian-Kui, E-mail: zhux@battelle.org [Battelle Memorial Institute, 505 King Avenue, Columbus, OH 43201 (United States); Leis, Brian N. [Battelle Memorial Institute, 505 King Avenue, Columbus, OH 43201 (United States)
2012-01-15
Accurate prediction of burst pressure plays a central role in engineering design and integrity assessment of oil and gas pipelines. Theoretical and empirical solutions for such prediction are evaluated in this paper relative to a burst pressure database comprising more than 100 tests covering a variety of pipeline steel grades and pipe sizes. Solutions considered include three based on plasticity theory for the end-capped, thin-walled, defect-free line pipe subjected to internal pressure in terms of the Tresca, von Mises, and ZL (or Zhu-Leis) criteria, one based on a cylindrical instability stress (CIS) concept, and a large group of analytical and empirical models previously evaluated by Law and Bowie (International Journal of Pressure Vessels and Piping, 84, 2007: 487-492). It is found that these models can be categorized into either a Tresca-family or a von Mises-family of solutions, except for those due to Margetson and Zhu-Leis models. The viability of predictions is measured via statistical analyses in terms of a mean error and its standard deviation. Consistent with an independent parallel evaluation using another large database, the Zhu-Leis solution is found best for predicting burst pressure, including consideration of strain hardening effects, while the Tresca strength solutions including Barlow, Maximum shear stress, Turner, and the ASME boiler code provide reasonably good predictions for the class of line-pipe steels with intermediate strain hardening response. - Highlights: Black-Right-Pointing-Pointer This paper evaluates different burst pressure prediction models for line pipes. Black-Right-Pointing-Pointer The existing models are categorized into two major groups of Tresca and von Mises solutions. Black-Right-Pointing-Pointer Prediction quality of each model is assessed statistically using a large full-scale burst test database. Black-Right-Pointing-Pointer The Zhu-Leis solution is identified as the best predictive model.
Evaluation of burst pressure prediction models for line pipes
International Nuclear Information System (INIS)
Zhu, Xian-Kui; Leis, Brian N.
2012-01-01
Accurate prediction of burst pressure plays a central role in engineering design and integrity assessment of oil and gas pipelines. Theoretical and empirical solutions for such prediction are evaluated in this paper relative to a burst pressure database comprising more than 100 tests covering a variety of pipeline steel grades and pipe sizes. Solutions considered include three based on plasticity theory for the end-capped, thin-walled, defect-free line pipe subjected to internal pressure in terms of the Tresca, von Mises, and ZL (or Zhu-Leis) criteria, one based on a cylindrical instability stress (CIS) concept, and a large group of analytical and empirical models previously evaluated by Law and Bowie (International Journal of Pressure Vessels and Piping, 84, 2007: 487–492). It is found that these models can be categorized into either a Tresca-family or a von Mises-family of solutions, except for those due to Margetson and Zhu-Leis models. The viability of predictions is measured via statistical analyses in terms of a mean error and its standard deviation. Consistent with an independent parallel evaluation using another large database, the Zhu-Leis solution is found best for predicting burst pressure, including consideration of strain hardening effects, while the Tresca strength solutions including Barlow, Maximum shear stress, Turner, and the ASME boiler code provide reasonably good predictions for the class of line-pipe steels with intermediate strain hardening response. - Highlights: ► This paper evaluates different burst pressure prediction models for line pipes. ► The existing models are categorized into two major groups of Tresca and von Mises solutions. ► Prediction quality of each model is assessed statistically using a large full-scale burst test database. ► The Zhu-Leis solution is identified as the best predictive model.
Clinical significance of CMTM4 expression in hepatocellular carcinoma
Directory of Open Access Journals (Sweden)
Bei CH
2017-11-01
Full Text Available Chunhua Bei,1,* Ying Zhang,1,* Riming Wei,1 Xiaonian Zhu,1 Zhigang Wang,1 Wen Zeng,2 Qiuyue Chen,3 Shengkui Tan1 1Department of Epidemiology and Statistics, School of Public Health, Guilin Medical University, 2Department of Hepatobiliary Surgery, The Affiliated Hospital of Guilin Medical University, 3Department of Pathology, 181st Hospital of Chinese People’s Liberation Army, Guilin, People’s Republic of China *These authors contributed equally to this work Abstract: CMTM4 is the most conserved member of chemokine-like factor (CKLF-like MARVEL transmembrane domain-containing (CMTM family on chromosome 16q22.1, a locus that harbors a number of tumor-suppressor genes. In previous studies, CMTM4 was reported to be downregulated and exhibited tumor-suppressor activities by regulating cell growth and cell cycle in clear cell renal cell carcinoma. However, its roles in tumorigenesis of hepatocellular carcinoma (HCC remain poorly studied. This study first investigated the expression of CMTM4 in HCC, and then examined the association between the expression of CMTM4 with the clinicopathological features and prognosis of HCC patients. It was found that CMTM4 was downregulated in HCC tissues, compared with matched adjacent nontumor tissues, as detected by immunohistochemistry. In addition, Kaplan–Meier survival analysis showed that the negative expression of CMTM4 was associated with decreased overall survival rates in patients with HCC. The results of this study suggest CMTM4 plays a role as a tumor suppressor in HCC and CMTM4 negative expression is a risk factor for poor prognosis of HCC. Keywords: chemokine-like factor-like MARVEL transmembrane domain-containing 4, hepatocellular carcinoma, immunohistochemistry, prognosis
Directory of Open Access Journals (Sweden)
Zhao TJ
2013-05-01
Full Text Available Tiejun Zhao,1 Hezhong Chen,1 Yuchao Dong,2 Jiajun Zhang,1 Haidong Huang,2 Ji Zhu,1 Wei Zhang21Institute of Cardiothoracic Surgery, 2Respiratory Department, Changhai Hospital, Shanghai, People's Republic of ChinaAbstract: In order to improve the therapeutic efficacy and minimize the side effects of lung cancer chemotherapy, the formulation of paclitaxel-loaded poly(glycolide-co-ε-caprolactone-b-D-α-tocopheryl polyethylene glycol 2000 succinate nanoparticles (PTX-loaded [PGA-co-PCL]-b-TPGS2k NPs was prepared. The novel amphiphilic copolymer (PGA-co-PCL-b-TPGS2k was synthesized by ring-opening polymerization and characterized by proton nuclear magnetic resonance spectroscopy and gel permeation chromatography. The PTX-loaded (PGA-co-PCL-b -TPGS2k NPs were characterized in terms of size, size distribution, zeta potential, drug encapsulation, surface morphology, and drug release. In vitro cellular uptakes of NPs were investigated with confocal laser scanning microscopy, indicating the coumarin 6-loaded (PGA-co-PCL-b -TPGS2k NPs could be internalized by human lung cancer A-549 cells. The antitumor effect of PTX-loaded NPs was evaluated, both in vitro and in vivo, on an A-549 cell tumor-bearing mouse model via intratumoral injection. The commercial PTX formulation Taxol was chosen as the reference. Experimental results showed that the PTX-loaded NPs possessed higher cytotoxicity and could effectively inhibit the growth of tumor. All the results suggested that amphiphilic copolymer (PGA-co-PCL-b -TPGS2k could act as a potential biological material for nanoformulation in the treatment of lung cancer.Keywords: (PGA-co-PCL-b TPGS2k, paclitaxel, nanoparticles, drug delivery, lung cancer
Directory of Open Access Journals (Sweden)
Yao J
2015-11-01
Full Text Available Jie Yao,1,* Jianxiong Li,2,* Peiliang Geng,2,* Yi Li,3,* Hong Chen,3 Yunfeng Zhu2 1Department of Oncology, People’s Liberation Army No 161 Hospital, Wuhan, 2Cancer Center, Division of Internal Medicine, Chinese PLA General Hospital, Beijing, 3Department of Oncology, Kunming General Hospital of Chendu Military Command, Kunming, People’s Republic of China *These authors contributed equally to this work Abstract: Currently, various long noncoding RNAs (lncRNAs have been identified as key regulators of multiple cancers. However, cancer stem cell (CSC-related lncRNAs have rarely been reported. In this study, we found an lncRNA that is a promoter upstream transcript of hypoxia-inducible factor-2α (HIF-2α, and we named it “lncRNA-HIF2PUT”. The function of HIF-2α is closely connected with “stem cell-like” properties, and the function of PROMPTs is often associated with the adjacent protein-coding transcripts. Herein, we showed that the expression of lncRNA-HIF2PUT was significantly correlated with HIF-2α in colorectal cancer (CRC tissues. Knockdown of lncRNA-HIF2PUT blocked the HIF-2α expression and inhibited the CSC properties in CRC cell lines DLD-1 and HT29. LncRNA-HIF2PUTsmall interfering RNA transfection resulted in decreased stemness genes expression, impaired colony formation, and spheroid formation ability, retarded migration, and invasion of the cells. These data suggest that lncRNA-HIF2PUT may be a regulator of HIF-2α and a mediator of CSCs in CRC. Keywords: HIF-2α, long noncoding RNA, colorectal cancer, stem cell properties
Indian Academy of Sciences (India)
Beak P and Chen C W 1985 Tetrahedron Lett. 4979. Boatman R J, Whitlock B J and Whitlock H W 1977 J. An. Chen. Soc. 99 4822. Diamond S E, Szalkiewicz A and Mares F 1979 J. Ann. Chen. Soc. 101 490. Ellefson C R 1979 J. Org. Chem. 44 1533. Gschwend H W and Rodriguez H R 1979 Organic reactions 26 Chapter I.
National Research Council Canada - National Science Library
1993-01-01
...; AGRICULTURE - Further Reform of Grain Circulation, Prices Advocated, Chen Yaobang on Market Challenges Facing Agriculture, Chen Yaobang on Restructuring of Crop Planting, MILITARY, PUBLIC SECURITY...
Hybrid Chaos Synchronization of Four-Scroll Systems via Active Control
Karthikeyan, Rajagopal; Sundarapandian, Vaidyanathan
2014-03-01
This paper investigates the hybrid chaos synchronization of identical Wang four-scroll systems (Wang, 2009), identical Liu-Chen four-scroll systems (Liu and Chen, 2004) and non-identical Wang and Liu-Chen four-scroll systems. Active control method is the method adopted to achieve the hybrid chaos synchronization of the four-scroll chaotic systems addressed in this paper and our synchronization results are established using Lyapunov stability theory. Since the Lyapunov exponents are not required for these calculations, the active control method is effective and convenient to hybrid synchronize identical and different Wang and Liu-Chen four-scroll chaotic systems. Numerical simulations are also shown to illustrate and validate the hybrid synchronization results derived in this paper.
New Jurassic tettigarctid cicadas from China with a novel example of disruptive coloration
Directory of Open Access Journals (Sweden)
Jun Chen
2016-12-01
Full Text Available Tettigarctidae is the most primitive family of Cicadoidea, with only two relict species. Although they are relatively well known from Eurasia, Australia, Africa, and South America, their Mesozoic examples are typically preserved only as isolated forewings. Herein, a new genus Sanmai Chen, Zhang, and B. Wang with three new species (Sanmai kongi Chen, Zhang, and B. Wang, S. mengi Chen, Zhang, and B. Wang, and S. xuni Chen, Zhang, and B. Wang are described based on fossil specimens from the Middle–Upper Jurassic of northeastern China, with well-preserved body structures, forewing and hindwing venations, making it the hitherto best known extinct tettigarctid taxon. The new genus, provisionally assigned to the tribe Turutanoviini, provides some new information about the evolution and palaeobiogeography of Mesozoic Tettigarctidae. The genus Paraprosbole is synonymized with Shuraboprosbole. In addition, the coloration pattern of forewing, prominent on some specimens of Sanmai kongi Chen, Zhang, and B. Wang sp. nov. and Sanmai xuni Chen, Zhang, and B. Wang sp. nov., represents a novel example of disruptive coloration in Tettigarctidae, which can effectively break up the body outline as well as surface, and so likely enabled these cicadas to reduce the detectability of potential predators.
Soil Behavior Under Blast Loading
2010-12-01
in detail (Lade 2005, Prevost and Popescu 1996, Chen and Baladi 1985). Models that are appropriate to be implemented into finite element programs...Chen and Baladi 1985). As the soil strain hardens, both the cone and the end cap expand. This concept of cap envelope was a major step forward...hardening cap model (Chen and Baladi 1985) 17 The modified Cam-clay model was developed at Cambridge University by Roscoe et al. (1963). This
Kinetic investigation on enantioselective hydrolytic resolution of ...
African Journals Online (AJOL)
Kinetic investigation on enantioselective hydrolytic resolution of epichlorohydrin by crude epoxide hydrolase from domestic duck liver. X Ling, D Lu, J Wang, J Chen, L Ding, J Chen, H Chai, P Ouyang ...
77 FR 11620 - Notice of Request for the Extension of a Currently Approved Information Collection
2012-02-27
... Reduction Act of 1995, this notice announces the intention of the Federal Transit Administration (FTA) to... INFORMATION CONTACT: Roy Chen, FTA Office of Technology, (202) 366-0462, or email: royweishun.chen@dot.gov...
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
Author Affiliations. Lihua Jiang1 Aiyi Zhu1 Jianse Zhang1 Changwen Wu1. National Engineering Research Center of Marine Facilities Aquaculture, College of Marine Science, Zhejiang Ocean University, Zhoushan 316022, China ...
An implicit non-staggered Cartesian grid method for incompressible ...
Indian Academy of Sciences (India)
Immersed boundary; non-staggered; implicit; viscous flow. 1. ... functions for elastic boundaries (Saiki & Biringen 1996; Lai & Peskin 2000; Zhu & Peskin ... the effects of pressure and thereby explicitly achieving a strong coupling between them.
1992-01-01
AND PROPERTIES OF WIDE BAND-GAP Il-VI STRAINED- LAYER SUPERLATTICE 227 Hailong Wang. Jie Cui. Aidong Shen. Liang Xu, Yunliang Chen. and Yuhua Shen IN...WANG JIE CUI AIDONG SHEN LIANG XU YUNLIANG CHEN AND YUHUA SHEN Shanghai Institute of Optics and Fine Mechanics, Academia Sinica P.O.Box 800-216 Shanghai...He Zujou, Cao Huazhe, Su Wuda, Chen Zhongcai, Zhon Feng and Wang Erguang, Thin Solid Films, 139,261(1986). 22) Xin Li and T.L.Tansley, J.AppI.Phys
EDITORIAL: Focus on Iron-Based Superconductors FOCUS ON IRON-BASED SUPERCONDUCTORS
Hosono, Hideo; Ren, Zhi-An
2009-02-01
-L Drechsler, N Kozlova, M Bartkowiak, J E Hamann-Borrero, G Behr, K Nenkov, H-H Klauss, H Maeter, A Amato, H Luetkens, A Kwadrin, R Khasanov, J Freudenberger, A Köhler, M Knupfer, E Arushanov, H Rosner, B Büchner and L Schultz Low-energy spin dynamics in the antiferromagnetic phase of CaFe2As2 N J Curro, A P Dioguardi, N ApRoberts-Warren, A C Shockley and P Klavins Muon spin rotation study of magnetism and superconductivity in BaFe2-xCoxAs2 and Pr1-xSrxFeAsO C Bernhard, A J Drew, L Schulz, V K Malik, M Rössle, Ch Niedermayer, Th Wolf, G D Varma, G Mu, H-H Wen, H Liu, G Wu and X H Chen Magnetic impurities in the pnictide superconductor Ba1-xKxFe2As2 Sutirtha Mukhopadhyay, Sangwon Oh, A M Mounce, Moohee Lee, W P Halperin, N Ni, S L Bud'ko, P C Canfield, A P Reyes and P L Kuhns Neutron scattering investigation of the magnetic order in single crystalline BaFe2As2 M Kofu, Y Qiu, Wei Bao, S-H Lee, S Chang, T Wu, G Wu and X H Chen An NMR study on the F-doping evolution of the iron oxypnictide LaFeAs(O1-xFx) Y Nakai, S Kitagawa, K Ishida, Y Kamihara, M Hirano and H Hosono The peculiar physical properties and phase diagram of BaFe2-xCoxAs2 single crystals X F Wang, T Wu, G Wu, R H Liu, H Chen, Y L Xie and X H Chen Synthesis of LnFeAsO1-y superconductors (Ln=La and Nd) using the high-pressure technique Kiichi Miyazawa, Kunihiro Kihou, Motoyuki Ishikado, Parasharam M Shirage, Chul-Ho Lee, Nao Takeshita, Hiroshi Eisaki, Hijiri Kito and Akira Iyo Correlation effects in the iron pnictides Qimiao Si, Elihu Abrahams, Jianhui Dai and Jian-Xin Zhu Competition/coexisitence of magnetism and superconductivity in iron pnictides probed by muon spin rotation Soshi Takeshita and Ryosuke Kadono Impurity-induced in-gap state and Tc in sign-reversing s-wave superconductors: analysis of iron oxypnictide superconductors Yuko Senga and Hiroshi Kontani Intrinsic magnetic properties of the superconductor NdFeAsO0.9F0.1 from local and global measurements R Prozorov, M E Tillman, E D Mun and P C Canfield
Peng et al., Afr J Tradit Complement Altern Med. (2015) 12(5):35-45 ...
African Journals Online (AJOL)
Proff.Adewunmi
as a kind of specific application of syndrome differentiation, You Gu Wu Yun, documented .... Zhi-Zhu-Wan (ZZW), a famous Chinese medical preparation used to treat functional dyspepsia, contains Aurantii fructus ..... Abdominal pain, vomiting,.
Effects of water stress and seed mass on germination and ...
African Journals Online (AJOL)
enoh
2012-03-01
Mar 1, 2012 ... polyvinylpyrrolidone; TCA, trichloroacetic acid; NBT, nitroblue tetrazolium; TBA ..... seeds had weaker resistances to moderate stress (-0.6. MPa) compared with .... Chen YN,Chen YP,Li WH,Zhang HF (2003). Response of ...
Blazar Sequence in Fermi Era Liang Chen
Indian Academy of Sciences (India)
Abstract. In this paper, we review the latest research results on the topic of blazar sequence. It seems that the blazar sequence is phenomenally ruled out, while the theoretical blazar sequence still holds. We point out that black hole mass is a dominated parameter accounting for high-power- high-synchrotron-peaked and ...
Molecular mechanisms of cisplatin resistance in cervical cancer
Directory of Open Access Journals (Sweden)
Zhu H
2016-06-01
Full Text Available Haiyan Zhu, Hui Luo, Wenwen Zhang, Zhaojun Shen, Xiaoli Hu, Xueqiong Zhu Department of Obstetrics and Gynecology, The Second Affiliated Hospital of Wenzhou Medical University, Wenzhou, People’s Republic of China Abstract: Patients with advanced or recurrent cervical cancer have poor prognosis, and their 1-year survival is only 10%–20%. Chemotherapy is considered as the standard treatment for patients with advanced or recurrent cervical cancer, and cisplatin appears to treat the disease effectively. However, resistance to cisplatin may develop, thus substantially compromising the efficacy of cisplatin to treat advanced or recurrent cervical cancer. In this article, we systematically review the recent literature and summarize the recent advances in our understanding of the molecular mechanisms underlying cisplatin resistance in cervical cancer. Keywords: cisplatin, epithelial–mesenchymal transition, microRNA, molecular mechanism, resistance
Calligraphy and meditation for stress reduction: an experimental comparison
Directory of Open Access Journals (Sweden)
Kao H SR
2014-02-01
Full Text Available Henry SR Kao,1 Lin Zhu,2 An An Chao,3 Hao Yi Chen,4 Ivy CY Liu,5 Manlin Zhang6 1Department of Social Work and Social Administration, University of Hong Kong, Hong Kong; 2Department of Psychology, Renmin University of China, Beijing, 3International Society of Calligraphy Therapy, Hong Kong; 4Department of Business Administration, National Chengchi University, Taipei, Taiwan, 5Department of Psychology, Fu Jen Catholic University, Taipei, Taiwan; 6Department of Psychology, Sun Yat-Sen University, Guangzhou, People's Republic of China Background: Chinese calligraphic handwriting (CCH has demonstrated a new role in health and therapy. Meanwhile, meditation is an traditional and effective method for coping with stress and staying healthy. This study compared the effectiveness of CCH and meditation as distinctive and parallel stress reduction interventions. Methods: Thirty graduate students and academic staff members in Taiwan who suffered from stress were selected by the General Health Questionnaire and randomly assigned to one of three treatment groups, ie, a CCH group, a meditation group, or a control group, for 8 consecutive weeks. Changes in physiological parameters were measured before, during, and after treatment. Results: CCH and meditation showed their strength in the respective indices of stress. There was a significant difference in respiratory rate, heart rate, and electromyographic scores between the groups. Comparing pre- and post-effects, a decrease in heart rate and an increase in skin temperature was seen in subjects who practiced CCH. Increased skin temperature and decreased respiratory rate were also seen in subjects who practiced meditation, along with reduced muscle tension and heart rate. Conclusion: CCH and meditation have good effects in stress reduction. CCH is a particularly promising new approach to reducing stress.Keywords: calligraphic handwriting, meditation, stress reduction, intervention
Protective effect of galangin in Concanavalin A- induced hepatitis in mice
Directory of Open Access Journals (Sweden)
Luo Q
2015-06-01
Full Text Available Qingqiong Luo,1,* Liping Zhu,1,* Jieying Ding,1 Xing Zhuang,1 Lili Xu,2 Fuxiang Chen1 1Department of Clinical Immunology, Shanghai Ninth People’s Hospital, Shanghai JiaoTong University School of Medicine, 2Division of Gastroenterology, Zhongshan Hospital, Fudan University, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Galangin is an active pharmacological ingredient from propolis and Alpinia officinarum Hance, and has been reported to have anti-inflammatory and antioxidative properties. The present study aims to reveal the effect of galangin on Concanavalin A (ConA-induced hepatitis (CIH, a well-established animal model of immune-mediated liver injury, and to clarify the related mechanism. C57BL/6 mice were pretreated with galangin followed by ConA challenge. Results indicated that galangin inhibited ConA-induced liver damage. Mice pretreated with galangin showed more reduction of liver damage when compared with control mice pretreated with vehicle solution. In galangin-pretreated mice with induced CIH, increases in serum levels of several inflammatory cytokines, including tumor necrosis factor-α, interferon-γ, and interleukin-12 were dramatically attenuated, and chemokines and adhesion molecules like interferon inducible protein-10, macrophage inflammatory protein-1α, and intercellular adhesion molecule-1 messenger RNA expressions in liver were decreased. Moreover, CIH mice pretreated with galangin showed less leukocyte infiltration and T-cell activation in the liver. Further, the mechanism of the anti-inflammatory effects of galangin may be attributed to its modulation of crucial inflammatory signaling pathways, including nuclear factor kappa B and interferon-gamma/signal transducer and activator of transcription 1. Collectively, these findings suggest the preventive and therapeutic potential of galangin in immune-mediated liver injury in vivo. Keywords: galangin, Concanavalin A
Directory of Open Access Journals (Sweden)
Zhang L
2013-03-01
Full Text Available Lei Zhang,1,* Yanjun Su,1,* Chen Wang,2 Yongsheng Sha,1 Hong Zhu,3 Shumin Xie,4 Sabrina Kwauk,5 Jing Zhang,2 Yunshou Lin,2 Changli Wang1,*1Department of Thoracic Surgery, Key Laboratory of Cancer Prevention and Therapy, Tianjin Lung Cancer Center, Tianjin Medical University Cancer Institute and Hospital, Tianjin, 2Tianjin Medical University, Tianjin, 3Department of Public Health, Tianjin Medical University, Tianjin, 4Xiangya Medical School of Central-South University, Changsha, People's Republic of China; 5School of Public Health, Harvard University, Boston, Cambridge, MA, USA*These authors contributed equally to this workPurpose: This study assessed the nutritional status of elderly Chinese lung cancer inpatients using a revised version of the Mini-Nutritional Assessment (MNA® tool.Patients and methods: The revised version of the MNA tool was used to assess the nutritional status of 180 elderly Chinese lung cancer inpatients prior to their scheduled surgery between June 2010 and July 2011. Patients' demographic data, anthropometric parameters, and biochemical markers were collected and analyzed.Results: Among the 180 inpatients who underwent the MNA, 9% were malnourished (MNA score < 19, 33% were at risk of malnutrition (MNA score 19–23, and 58% were well nourished (MNA score ≥ 24. There was significant correlation between the MNA scores of patients who were malnourished, at risk of malnutrition, and well nourished (P < 0.001, as well as between total MNA score and most MNA questions. The three patient groups with different nutritional statuses differed significantly in their responses to anthropometrics and global, diet, and subjective assessments.Conclusion: Incidence rates of malnutrition prior to surgery are high among elderly Chinese lung cancer inpatients. The revised MNA is a valid and reliable tool that can be used to assess and prevent malnutrition among these inpatients.Keywords: malnutrition, MNA-SF, nutrition, inpatients, diet
Elliptic Curve Integral Points on y2 = x3 + 3x ‑ 14
Zhao, Jianhong
2018-03-01
The positive integer points and integral points of elliptic curves are very important in the theory of number and arithmetic algebra, it has a wide range of applications in cryptography and other fields. There are some results of positive integer points of elliptic curve y 2 = x 3 + ax + b, a, b ∈ Z In 1987, D. Zagier submit the question of the integer points on y 2 = x 3 ‑ 27x + 62, it count a great deal to the study of the arithmetic properties of elliptic curves. In 2009, Zhu H L and Chen J H solved the problem of the integer points on y 2 = x 3 ‑ 27x + 62 by using algebraic number theory and P-adic analysis method. In 2010, By using the elementary method, Wu H M obtain all the integral points of elliptic curves y 2 = x 3 ‑ 27x ‑ 62. In 2015, Li Y Z and Cui B J solved the problem of the integer points on y 2 = x 3 ‑ 21x ‑ 90 By using the elementary method. In 2016, Guo J solved the problem of the integer points on y 2 = x 3 + 27x + 62 by using the elementary method. In 2017, Guo J proved that y 2 = x 3 ‑ 21x + 90 has no integer points by using the elementary method. Up to now, there is no relevant conclusions on the integral points of elliptic curves y 2 = x 3 + 3x ‑ 14, which is the subject of this paper. By using congruence and Legendre Symbol, it can be proved that elliptic curve y 2 = x 3 + 3x ‑ 14 has only one integer point: (x, y) = (2, 0).
Directory of Open Access Journals (Sweden)
Xia T
2018-02-01
Full Text Available Tianyi Xia, Sang Zhu, Yan Wen, Shouhong Gao, Mingming Li, Xia Tao, Feng Zhang, Wansheng Chen Department of Pharmacy, Changzheng Hospital, Second Military Medical University, Shanghai, People’s Republic of China Background: Nephrotoxicity of calcineurin inhibitors (CNIs is the major concern for long-term allograft survival despite its predominant role in current immunosuppressive regime after renal transplantation. CNI nephrotoxicity is multifactorial with demographic, environmental, and pharmacogenetic flexibility, whereas studies indicating risk factors for CNI nephrotoxicity obtained incomplete or conflicting results.Methods: A systematic review and meta-analysis of risk factors for CNI nephrotoxicity was performed on all retrieved studies through a comprehensive research of network database. Data were analyzed by Review Manager 5.2 with heterogeneity assessed using the Cochrane Q and I2 tests. CNI nephrotoxicity was primarily indicated with protocol biopsy or index-based clinical diagnosis, and the secondary outcome was defined as delayed graft function.Results: Twelve observational studies containing a total of 2,849 cases were identified. Donor age (odds ratio [OR], 1.01; 95% CI, 1.01–1.03; p=0.02, recipient zero-time arteriosclerosis (OR, 1.44; 95% CI, 1.04–1.99; p=0.03, and CYP3A5*3/*3 genotype (OR, 2.80; 95% CI, 2.63–2.98; p=0.00 were confirmed as risk factors for CNI nephrotoxicity. Subgroup and sensitivity analysis claimed donor age as a significant contributor in Asian and Caucasian areas.Conclusion: Older donor age, recipient zero-time arteriosclerosis, and CYP3A5*3/*3 genotype might add up the risk for CNI nephrotoxicity, which could be interpreted into a robust biomarker system. Keywords: calcineurin inhibitor, transplantation, nephrotoxicity, risk factor, systematic review, meta-analysis
Directory of Open Access Journals (Sweden)
Chen JR
2015-06-01
Full Text Available Jing Rui Chen,1–3 Jing Wei,1–3 Ling Yan Wang,1–3 Yan Zhu,1–3 Lan Li,1–3 Mary Akinyi Olunga,1–3 Xiu Mei Gao,1–3 Guan Wei Fan1–31Tianjin State Key Laboratory of Modern Chinese Medicine, Tianjin, People’s Republic of China; 2Key Laboratory of Pharmacology of Traditional Chinese Medicine Formulae, Ministry of Education, 3Institute of Traditional Chinese Medicine, Tianjin University of Traditional Chinese Medicine, Tianjin, People’s Republic of ChinaAim: To investigate the potential cardioprotective effects of QiShenYiQi Pill® (QSYQ on myocardial ischemia/reperfusion (I/R injury through antioxidative stress and mitochondrial protection.Methods and results: Sprague Dawley rats were pretreated with QSYQ or saline for 7 days and subjected to ischemia (30 minutes occlusion of the left anterior descending coronary artery and reperfusion (120 minutes. Cardiac functions were evaluated by echocardiogram and hemodynamics. Myocardial mitochondria were obtained to evaluate changes in mitochondrial structure and function, immediately after 120 minutes reperfusion. Pretreatment with QSYQ protected against I/R-induced myocardial structural injury and improved cardiac hemodynamics, as demonstrated by normalized serum creatine kinase and suppressed oxidative stress. Moreover, the impaired myocardial mitochondrial structure and function decreased level of ATP (accompanied by reduction of ATP5D and increase in the expression of cytochrome C. Myocardial fiber rupture, interstitial edema, and infiltrated leukocytes were all significantly ameliorated by pretreatment with QSYQ.Conclusion: Pretreatment of QSYQ in Sprague Dawley rats improves ventricular function and energy metabolism and reduces oxidative stress via ameliorating multiple mitochondrial dysfunctions during I/R injury.Keywords: QSYQ, ischemia/reperfusion injury, energy metabolism, mitochondria
Directory of Open Access Journals (Sweden)
Chen JH
2011-04-01
Full Text Available Nan Xu1,2, Julin Gu3, Yuanjie Zhu3, Hai Wen3, Qiushi Ren1, Jianghan Chen31Institute for Laser Medicine and Biophotonics, School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai, People's Republic of China; 2Department of Dermatology, Shanghai East Hospital, Shanghai, People's Republic of China; 3Department of Dermatology, Shanghai Changzheng Hospital, Shanghai, People's Republic of ChinaAbstract: Amphotericin B deoxycholate (AmB, a classic antifungal drug, remains the initial treatment of choice for deep fungal infections, but it is not appropriate for treatment of cryptococcal meningitis due to its inability to pass through the blood–brain barrier (BBB. We examined the efficacy of amphotericin B-polybutylcyanoacrylate nanoparticles (AmB-PBCA-NPs modified with polysorbate 80 that had a mean particle diameter less than 100 nanometers (69.0 ± 28.6 nm. AmB-PBCA-NPs were detected in the brain 30 minutes after systemic administration into BALB/c mice and had a higher concentration than systemically administered AmB liposome (AmB-L, P < 0.05; AmB was not detected in the brain. Following infection for 24 hours and then 7 days of treatment, the survival rate of mice in the AmB-PBCA-NP group (80% was significantly higher than that of the AmB (0% or AmB-L (60% treatment groups. Fungal load was also lower when assessed by colony-forming unit counts obtained after plating infected brain tissue (P < 0.05. Our study indicates that AmB-PBCA-NPs with polysorbate 80 coating have the capacity to transport AmB across the BBB and is an efficient treatment against cryptococcal meningitis in a mouse model.Keywords: cryptococcal meningitis, polybutylcyanoacrylate (PBCA, nanoparticles, brain targeting
Directory of Open Access Journals (Sweden)
Chen W
2017-09-01
Full Text Available Wenjie Chen,1 Jianyong Lei,1 Jiaying You,2 Yali Lei,3 Zhihui Li,1 Rixiang Gong,1 Huairong Tang,3 Jingqiang Zhu1 1Thyroid and Parathyroid Surgery Center, 2West China School of Clinical Medicine, 3Health and Management Center, West China Hospital of Sichuan University, Chengdu, People’s Republic of China Background: Recurrent laryngeal nerve (RLN invasion in papillary thyroid carcinoma (PTC is one of the main predictors of poor prognosis. The present study investigated the risk factors for RLN invasion in PTC patients.Methods: A total of 3,236 patients who received thyroidectomy due to PTC in Thyroid and Parathyroid Surgery Center of West China Hospital of Sichuan University were reviewed. Demographics and clinical factors, imaging examination (ultrasonography characteristics, surgical details, postoperative pathological details, recurrence, and postoperative complications were recorded. Univariate and multivariate analyses were used to study the risk factors of RLN invasion, Kaplan–Meier method was performed to compare the outcomes of tumor recurrence.Results: Patients with RLN invasion had a higher recurrence rate than those in the control group (p<0.001. Multivariate analyses showed that age greater than 45 years (p<0.001, a largest tumor size bigger than 10 mm (p<0.001, clinical lymph node metastasis (cN1 (p<0.001, posterior focus (p<0.001, extrathyroidal extension (p<0.001, esophageal extension (p<0.001, tracheal extension (p<0.001, and preoperative vocal cord paralysis (p<0.001 were independent predictors for RLN invasion.Conclusion: PTC patients with RLN invasion have a negative prognosis and a higher recurrence rate. Meticulous operation and careful follow-up of patients with the above factors is recommended. Keywords: papillary thyroid carcinoma, recurrent laryngeal nerve invasion, predictive factors, lymph node metastases, Hashimoto’s thyroiditis
Directory of Open Access Journals (Sweden)
Li Y
2016-12-01
Full Text Available Yinghua Li,1,* Min Guo,1,* Zhengfang Lin,1 Mingqi Zhao,1 Misi Xiao,1 Changbing Wang,1 Tiantian Xu,1 Tianfeng Chen,2 Bing Zhu1 1Center Laboratory, Guangzhou Women and Children’s Medical Center, Guangzhou Medical University, 2Department of Chemistry, Jinan University, Guangzhou, People’s Republic of China *These authors contributed equally to this work Abstract: Hepatocarcinoma is the third leading cause of cancer-related deaths around the world. Recently, a novel emerging nanosystem as anticancer therapeutic agents with intrinsic therapeutic properties has been widely used in various medical applications. In this study, surface decoration of functionalized silver nanoparticles (AgNPs by polyethylenimine (PEI and paclitaxel (PTX was synthesized. The purpose of this study was to evaluate the effect of Ag@PEI@PTX on cytotoxic and anticancer mechanism on HepG2 cells. The transmission electron microscope image and 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide assay showed that Ag@PEI@PTX had satisfactory size distribution and high stability and selectivity between cancer and normal cells. Ag@PEI@PTX-induced HepG2 cell apoptosis was confirmed by accumulation of the sub-G1 cells population, translocation of phosphatidylserine, depletion of mitochondrial membrane potential, DNA fragmentation, caspase-3 activation, and poly(ADP-ribose polymerase cleavage. Furthermore, Ag@PEI@PTX enhanced cytotoxic effects on HepG2 cells and triggered intracellular reactive oxygen species; the signaling pathways of AKT, p53, and MAPK were activated to advance cell apoptosis. In conclusion, the results reveal that Ag@PEI@PTX may provide useful information on Ag@PEI@PTX-induced HepG2 cell apoptosis and as appropriate candidate for chemotherapy of cancer. Keywords: silver nanoparticles, polyethylenimine, paclitaxel, reactive oxygen species, apoptosis
2012-11-01
-RESIGA Politehnica University of Timisoara Romania Kazuhiro TANAKA Kyushu Institute of Technology Japan Yoshinobu TSUJIMOTO Osaka University Japan Local Organizing Committee Chairman Yulin WU Tsinghua University Beijing Executive Chairman Zhengwei WANG Tsinghua University Beijing Members Shuliang CAO Tsinghua University Beijing Cichang CHEN South West University of Petroleum Chengdu Hongxun CHEN Shanghai University Shanghai Jiang DAI China Sanxia General Co Yichang Huashu DOU National University of Singapore Singapore Fengqin HAN Huanan University of Sci & Tech Guangzhou Kun LI Hefei Inst of General Machinery Hefei Rennian LI Lanzhou University of Sci & Tech Lanzhou Wanhong LI National Natural Science Foundation of China Beijing Chao LIU Yangzhou University Yangzhou Li LU China Inst of Water Resources and Hydropower Research Beijing Xingqi LUO Xi'an University of Tech Xi'an Zhenyue MA Dalian University of Sci & Tech Dalian Jiegang MU Zhejiang University of Tech Hangzhou Daqing QIN Harbin Electric Machinery Group Harbin Fujun WANG China Agriculture University Beijing Guoyu WANG Beijing Institute of Technology (BIT) Beijing Leqin WANG Zhejiang University Hangzhou Yuzhen WU NERCSPV Beijing Hongyuan XU Tsinghua University Beijing Jiandong YANG Wuhan University Wuhan Minguan YANG Jiangsu University Zhenjiang Shouqi YUAN Jiangsu University Zhenjiang Lefu ZHANG Harbin Electric Machinery Group Harbin Lixiang ZHANG Yunnan University of Sci & Tech Kunming Shengchang ZHANG Zhejiang University of Tech Hangzhou Kun ZHAO China Water & Electric Consulting Corp Beijing Yuan ZHENG Hehai University Nanjing Jianzhong ZHOU Huazhong University of Sci & Tech Wuhan Lingjiu ZHOU China Agriculture University Beijing Hongwu ZHU China Petroleum University Beijing Zuchao ZHU Zhejiang Sci-Tech University Hangzhou Secretaries Shuhong LIU (Academic), liushuhong@tsinghua.edu.cn Xianwu LUO (Registration), luoxw@tsinghua.edu.cn Baoshan ZHU (Finance), bszhu@mail.tsinghua.edu.cn
How Many Women Are Affected by or at Risk of Preeclampsia?
... pregnancy outcomes: Differences among 4 racial/ethnic groups. American Journal of Public Health, 95 (9), 1545–1551. Lin, H. C., Chen, S. F., Lin, H. C., & Chen, Y. H. (2010). Increased risk of adverse pregnancy outcomes ...
Proceedings – Mathematical Sciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Author Affiliations. Yanheng Chen1 2 Guiyun Chen1. School of Mathematics and Statistics, Southwest University, Chongqing 400715, People's Republic of China; School of Mathematics and Statistics, Chongqing Three Gorges University, Chongqing 404100, People's Republic of China ...
The validity and accuracy in foot-to-foot bioelectrical impedance ...
African Journals Online (AJOL)
The validity and accuracy in foot-to-foot bioelectrical impedance analysis measuring models referenced by dual-energy X-ray absorptiometry in body composition in standing position. KC Hsieh, HK Lu, CH Chen, TR Jang, YY Chen, MF Kao ...
Marginal scorch caused by Alternaria alternata on Purple-Caitai ...
African Journals Online (AJOL)
Marginal scorch caused by Alternaria alternata on Purple-Caitai (Brassia campestris L. ssp. chinensis L.var. utilis Tsen et Lee) in China. Qijun Nie, Zhongjiu Jiao, Fengjuan Zhu, Zhenbiao Jiao, Xiaohui Deng, Zhengming Qiu, Jinping Wu ...
Indian Academy of Sciences (India)
2011-12-08
Dec 8, 2011 ... 5FuShun Coal-Mine Brain Hospital, Gaowan Road, FuShun 113000, People's Republic of China. [Zhu Y. ... control subjects (161 males and 150 females, mean age ± ... show significant difference between cases and controls.
New St-chromosome-specific molecular markers for identifying ...
Indian Academy of Sciences (India)
et al. 1994) or JJsSt (Chen et al. 1998) was widely used in wheat breeding programme (Chen .... Japan). Table 1. The features of primers used in this study. Homologous ..... Redinbaugh M. G., Jones T. A. and Zhang Y. T. 2000 Ubiquity of.
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
YUZHI CHEN1 2 XUDONG CHEN2 JINGWU BU3. Architectural Engineering Institute, Jinling Institute of Technology, Nanjing 211169, China; College of Civil and Transportation Engineering, Hobai University, Nanjing 210098, China; College of Water Conservancy and Hydropower Engineering, Hohai University, Nanjing ...
Compressibilities and viscosities of reference, vegetable, and synthetic gear lubricants
DEFF Research Database (Denmark)
Regueira Muñiz, Teresa; Lugo, Luis; Fernández, Josefa
2014-01-01
Nowadays, one of the primary choices of base oils for environmentally aware lubricants is vegetable oils. This is due to their good natural biodegradability and very low toxicity in combination with very good lubricity characteristics. The development of new vegetable-based lubricants requires...... values of six gear lubricants, two of them reference mineral oils and the other four developed biodegradable oils based in high oleic sunflower oil or in synthetic esters. It was found that all of the lubricants have both similar compressibilities and similar expansivities. Dowson and Higginson, Zhu.......06%. Dowson and Higginson and Zhu and Wen equations of state do not predict well the isothermal compressibilities, with AAD % being around 45% for both equations. Moreover, the viscosities were measured in the temperature range from 278.15 to 373.15 K at atmospheric pressure for these oils, and the viscosity...
LDRD 2013 Annual Report: Laboratory Directed Research and Development Program Activities
Energy Technology Data Exchange (ETDEWEB)
Bookless, W. [Brookhaven National Lab. (BNL), Upton, NY (United States)
2013-12-31
This LDRD project establishes a research program led by Jingguang Chen, who has started a new position as a Joint Appointee between BNL and Columbia University as of FY2013. Under this project, Dr. Chen will establish a new program in catalysis science at BNL and Columbia University. The LDRD program will provide initial research funding to start research at both BNL and Columbia. At BNL, Dr. Chen will initiate laboratory research, including hiring research staff, and will collaborate with the existing BNL catalysis and electrocatalysis research groups. At Columbia, a subcontract to Dr. Chen will provide startup funding for his laboratory research, including initial graduate student costs. The research efforts will be linked under a common Catalysis Program in Sustainable Fuels. The overall impact of this project will be to strengthen the BNL catalysis science program through new linked research thrusts and the addition of an internationally distinguished catalysis scientist.
Genomewide analysis of MATE-type gene family in maize reveals ...
Indian Academy of Sciences (India)
Huasheng Zhu and Jiandong Wu contributed equally to this work. As a group of secondary active transporters, the MATE gene family consists of multiple genes that widely exist in ..... Roots of the stress-treated plants were collected at 0,.
African Journal of Biotechnology - Vol 11, No 41 (2012)
African Journals Online (AJOL)
Lenaldo Muniz de Oliveira, Nayra da Silva Negreiros Cardoso, Luzimar Gonzaga .... Ju-Hong Zhang, Jian-Ying Guo, Jing-Yuan Xia, Fang-Hao Wan, 9873-9880 ... Zhu Xiao-yan, Chang Shu-juan, Zhang Ying-jun, Luo Hai-ling, 9894-9905.
Efficacy of traditional Chinese herbal medicine in the treatment of ...
African Journals Online (AJOL)
Department, 3Department of Vascular Surgery, The Teaching Hospital of Chengdu University of Traditional Chinese Medicine,. Chengdu, Sichuan ... Background: The rate of gastrointestinal adenomatous polyps, often regarded as precancerous lesions, developing ..... Ling-Bai-Zhu on promoting apoptosis of transplanted.
Enhancement of Radiation Therapy in Prostate Cancer by DNA-PKcs Inhibitor
2015-09-01
Center, Urology Habib , Amyn; UTSouthwestern Medical Center, Neurology & Neurotherapeutics Chen, Benjamin; UTSouthwestern Medical Center, Radiation...Tsong Hsieh 3,5,7 , Amyn A. Habib 4,5,6 , Benjamin Chen 1,4 and Debabrata Saha 1,4 1 Department of Radiation Oncology, 3 Department of Urology, 4
The effects of reciprocal cross on inheritance of DNA methylation in ...
African Journals Online (AJOL)
enoh
2012-03-20
Mar 20, 2012 ... DNA methylation plays an important role for regulation of gene expression. To study ... genes, and newly acquired epigenetic states of trans- ... GACTGCGTACCAATTCAGA(E6). ATCATGAGTCCTGCTCGGTAC(H6). GACTGCGTACCAATTCAGT(E7) ..... Chen XQ, Ma Y, Chen F, Song WQ, Zhang L (2009).
Pitfalls in VAR based return decompositions: A clarification
DEFF Research Database (Denmark)
Engsted, Tom; Pedersen, Thomas Quistgaard; Tanggaard, Carsten
in their analysis is not "cashflow news" but "inter- est rate news" which should not be zero. Consequently, in contrast to what Chen and Zhao claim, their decomposition does not serve as a valid caution against VAR based decompositions. Second, we point out that in order for VAR based decompositions to be valid......Based on Chen and Zhao's (2009) criticism of VAR based return de- compositions, we explain in detail the various limitations and pitfalls involved in such decompositions. First, we show that Chen and Zhao's interpretation of their excess bond return decomposition is wrong: the residual component...
Indian Academy of Sciences (India)
user1
Multi-Wavelength Studies on H2O Maser Host Galaxies (J. S. Zhang & J. .... N(HI) and Jet Power/Emission in AGNs (Zhongzu Wu, Minfeng Gu & Ming Zhu), 319 .... Emanuela Orrù, David Rafferty, Huub Röttgering, Anna Scaife, Aleksandar ...
Luteoloside Inhibits Proliferation of Human Chronic Myeloid ...
African Journals Online (AJOL)
Purpose: To investigate the effects of luteoloside on the proliferation of human chronic ..... Zhang N, Wang D, Zhu Y, Wang J, Lin H. Inhibition ... Han X. Protection of Luteolin-7-O-Glucoside Against ... Hwang YJ, Lee EJ, Kim HR, Hwang KA.
Extraction-condition Optimization of Baicalein and Schisandrin from ...
African Journals Online (AJOL)
effects of individual factors on extraction rates of baicalein and schisandrin determined by high performance liquid ..... Huang HL, Wang YJ, Zhang QY, Liu B, Wang FY, Li JJ,. Zhu RZ. ... Liu C, Zhao X, Fan Y, Han G, Nguyen T. Astragalus.
Conducting polymer based biomolecular electronic devices
Indian Academy of Sciences (India)
Characterization of conducting polymers has been considered to be very .... and CH4) on surface plasmon resonance of Langmuir–Blodgett films of ..... [37] D G Zhu, M C Petty, H Ancelin and J Yarwood, Thin Solid Films 176, 151 (1989).
preliminary phytochemical screening and antioxidant activity
African Journals Online (AJOL)
DR. AMINU
reduction mechanism of DPPH correlated with presence of hydroxyl ... are known to occur in plant species belonging to the .... Alcohol, wine and ... oxidation. Athelosclerosis, 123: 83-91. Zhu, N., Wang, M., Wei, G.J., Lin, J.K., Yang, C.S. and.
A potential explanation for the effect of carbon source on the ...
African Journals Online (AJOL)
USER
2010-08-16
Aug 16, 2010 ... structure, mixed liquor suspended solids (MLSS), sludge volume index (SVI) .... Fine air bubbles for aeration were supplied through an air sparger at the ..... Ren TT, Liu L, Sheng GP, Liu XW, Yu HQ, Zhang MC, Zhu JR (2008).
Quantitative detection of fusion protein rIFN-β-HSA by a sandwich ...
African Journals Online (AJOL)
user
2011-02-14
Feb 14, 2011 ... (Corning-Costar, NY, USA), urine microalbumin kits were purchased from ... regarded as the standard of rIFN-β-HSA and was stored at −80°C. ... and antibody concentration, sample incubating time and detecting. Zhu et al.
Geotechnical properties of some organoclays
Indian Academy of Sciences (India)
Because of their low permeability, clays are the main material used as a liner in solid waste ... 2004; Matott et al 2006) and also potential sorbents in waste-water and contaminated soils (Zhu ..... Waste Management & Research 26: 464–473.
Bulletin of Materials Science | Indian Academy of Sciences
Indian Academy of Sciences (India)
Author Affiliations. Xiuqiang Li1 Dong Zhang1 Peiying Zhu1 Chao Yang1. Key Laboratory of Advanced Civil Engineering Materials, Ministry of Education, College of Materials Science and Engineering, Tongji University, 4800 CaoAn Road, Shanghai 200092, China ...
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 96; Online resources. Population genetic diversity of marble goby (Oxyeleotris marmoratus)inferred from mitochondrial DNA and microsatellite analysis. CHENG ZHAO XIAOPING ZHU YICHUN GU QINTAO WANG ZECHENG LI SHAOWU YIN. ONLINE RESOURCES Volume 96 ...
African Journal of Traditional, Complementary and Alternative ...
African Journals Online (AJOL)
Anti-tumour effects of polysaccharides isolated from Artemisia Annua L by inducing cell apoptosis and immunomodulatory anti-hepatoma effects of polysaccharides · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Chen, J Chen, X Wang, C Liu, 15-22.
Trend analysis and change point detection of annual and seasonal ...
Indian Academy of Sciences (India)
elevation ranges from 0 m in the coastal areas of the. Persian Gulf to over ... been explained by Kang and Yusof (2012); Dhorde ...... J L 2004 Detection of statistically significant trends in ... Sun H, Chen Y, Li W, Li F, Chen Y, Hao X and Yang Y.
The Response of Small Scale Rigid Targets to Shallow Buried Explosive Detonations
2011-09-01
properties as applied in this work was based on some of the standard defini- tions of soil constitutive properties as found in, e.g., Chen and Baladi [18...Technology Corporation; 2007. [18] Chen WF, Baladi GY. Soil plasticity: theory and implementation. New York: Elsevier Science; 1985. [19] Zimmerman
Enhanced Thermal Transport of Surfaces with Superhydrophobic Coatings
2015-07-01
resistance conferred by superhydrophobic fluorinated polyacrylate-silica composite coatings on cold-rolled steel. Journal of Applied Polymer Science... thiolates on metals as a form of nanotechnology. ChemInform. 2005:36. doi: 10.1002/chin.200532281. 9. Chen C-H, Cai Q, Tsai C, Chen C-L, Xiong G
Evaluation of effectiveness in a novel wound healing ointment ...
African Journals Online (AJOL)
Evaluation of effectiveness in a novel wound healing ointment-crocodile oil burn ointment. Hua-Liang Li, Yi-Tao Deng, Zi-Ran Zhang, Qi-Rui Fu, Ya-Hui Zheng, Xing-Mei Cao, Jing Nie, Li-Wen Fu, Li-Ping Chen, You-Xiong Xiong, Dong-Yan Shen, Qing-Xi Chen ...
2014-09-18
22:477– 505 , 2007. [21] Bushnell, Michael L. and Vishwani Agrawal. Essentials of Electronic Testing for Digital, Memory, and Mixed-Signal VLSI...Investigation”. Knowledge and information systems, 10(4):453–472, 2006. [68] Liang, Nia -Chiang, Ping-Chieh Chen, Tony Sun, Guang Yang, Ling-Jyh Chen
A comparative study assessing a new tool for occluding ...
African Journals Online (AJOL)
0.630, p=0.068 and p=0.047, respectively) (Table 2). A comparative study assessing a new tool for occluding parenchymal blood flow during liver resection for hepatocellular carcinoma. S Zhou, X-J Xue, R-R Li, D-F Chen, W-Y Chen, G-X Liu, ...
A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBand EFHC2gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN SONG YULAI ...
The roles of electronic books in the transformation of learning and instruction
Huang, Ronghuai; Chen, Nian-Shing; Kang, Myunghee; McKenney, Susan; Churchill, Daniel
2014-01-01
Huang, R., Chen, N., Kang, M. McKenney, S. & Churchill, D. (2013). The roles of electronic books in the transformation of learning and instruction. In N. Chen, R. Huang, Kinshuk, Y. Li, D. G. Sampson (Eds.) Proceedings of the IEEE 13th International Conference on Advanced Learning Technologies
2009-09-01
this project: A. Noman M. Ahsanuzzaman, Steve Acree, Nandita Basu, Sten Berglund, Carol Bratt, Gordon Brown, Xaisong Chen, Jaehyun Cho, Pat Clark...A.S.C. Chen (eds). Chapelle, F.H., J.S. Widdowson, J.S. Bruner, E. Mendez , and C.C. Casey (2003). Methodology for Estimating Times of Remediation
A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBitalic> and EFHC2italic> gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN ...
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Sadhana. B Chen. Articles written in Sadhana. Volume 38 Issue 4 August 2013 pp 557-569. Flexibility-based structural damage identification using Gauss–Newton method · B Chen S Nagarajaiah · More Details Abstract Fulltext PDF. Structural damage will change the dynamic characteristics, including ...
Theory of computational complexity
Du, Ding-Zhu
2011-01-01
DING-ZHU DU, PhD, is a professor in the Department of Computer Science at the University of Minnesota. KER-I KO, PhD, is a professor in the Department of Computer Science at the State University of New York at Stony Brook.
78 FR 71625 - Government-Owned Inventions; Availability for Licensing
2013-11-29
... available. In vivo data available (animal). Inventors: Dimiter S. Dimitrov (NCI), Zhu Zhongyu (NCI), Pradman... . Collaborative Research Opportunity: The National Cancer Institute, Laboratory of Human Carcinogenesis, is... studies are of great importance for future pre-clinical and clinical studies of MJC13. Potential...
Institute of Scientific and Technical Information of China (English)
2011-01-01
Commemorating the 100th Anniversary of the Revolution of 1911 Promoting the Deep Development of the CPC History and National History by the Research and Publication of the History of the Revolution of …………1911 Zhu Jiamu (4)
African Journal of Biotechnology - Vol 10, No 65 (2011)
African Journals Online (AJOL)
HQ Lou, Y Hu, L Zhang, YJ Zhang, PG Tu, XT Yu, YJ Jin, L Wang, 14286-14292 ... The effect of osmopriming on germination, seedling growth and phosphatase activities of lettuce under saline ... S Han, TH Zhu, SJ Li, FL Li, 14404-14409.
Hypersurfaces in nearly Kaehler manifold S3× S3
Indian Academy of Sciences (India)
BIAOGUI YANG1 QINGQING ZHU2. School of Mathematics and Computer Science, Fujian Normal University, Qishan Campus, Fuzhou 350117, People's Republic of China; Math Teaching and Research Group, Zhangzhou Branch Campus of Xiamen Shuangshi Middle School, Zhangzhou 363107, People's Republic of ...
African Journals Online (AJOL)
user
2011-03-07
Mar 7, 2011 ... African Journal of Biotechnology Vol. 10(10), pp. 1827-1832, 7 ... and even death (Zhu, 2001). ... as a nitrogen fertilizer equivalent to 150 kg N ha-1 and triple- super- ... negatively the plant fresh weight, but the effect ratio.
Electroantennogram responses of the potato tuber moth ...
Indian Academy of Sciences (India)
PRAKASH
seven test compounds were chosen from different chemical classes such ... The test chemicals were diluted in paraffin ..... Jansens S, Cornelissen R, de Clercq R, Reynaerts A and ... Park K C, Zhu J, Harris J, Ocheing S A and Baker T C 2001.
The geranylgeranyl pyrophosphate synthase gene from Ginkgo ...
African Journals Online (AJOL)
STORAGESEVER
2009-04-06
Apr 6, 2009 ... Ginkgo biloba is one of the oldest living plant species and often referred to as “a .... GbGGDPS were analyzed and the sequence comparison was conducted ... function of plant GGDPS genes (Zhu et al., 1997) and human and.
DNA damage and decrease of cellular oxidase activity in piglet ...
African Journals Online (AJOL)
DNA damage and decrease of cellular oxidase activity in piglet sertoli cells exposed to gossypol. Ming Zhang, Hui Yuan, Zuping He, Liyun Yuan, Jine Yi, Sijun Deng, Li Zhu, Chengzhi Guo, Yin Lu, Jing Wu, Lixin Wen, Qiang Wei, Liqun Xue ...
THREE NEW SPECIES OF CRAMBINAE(LEPIDOPTERA : PYRALIDAE) IN CHINA
Institute of Scientific and Technical Information of China (English)
CHENTie-mei; SONGShi-mei; YUANDe-cheng
2003-01-01
Three new species of Crambinae from China, Eschata truncata Song & Chen, sp. nov., Eschata tricornia Song & Chen, sp. nov., Pseudargyria acuta Song & Chen, sp. nov. and the female of Girdharia tau-romma Kapur are described, with figures and illustrations of genitalia provided. E. truncata resembles E.smithi Bleszynski, but valva with one short truncated process in costa; E. tricornia differed from all recorded species by valva with a triangular process on dorsum; P. acuta resembles P. marginepunctalis (Hampson), but with cucullus rapidly pointed and aedeagus with one group of cornuti. E. bleszynskiella Minet is proposed as a junior synonym of E. shanghaiensis Wang & Sung.
An oxygen isotope study of quartz veins within eclogites from the Dabie terrane
Institute of Scientific and Technical Information of China (English)
LI; Yiliang
2001-01-01
[1]Liu, T. S., Loess and the Environment, Beijing: China Ocean Press, 1985, 1-251.[2]Chen, L. X., Zhu, Q. G., Luo, H. B. et al., East Asian Monsoon, Beijing: China Meteorology Press, 1991, 28-61.[3]An, Z. S., Liu, T. S., Lu, Y. C. et al., The long-term palaeomonsoon variation recorded by the loess-palaeosol sequence in central China, Quaternary International, 1990, (7/8): 91-95.[4]Guo, Z. T., Liu, T. S., Fedoroff, N. et al., Shift of the monsoon intensity on the Loess Plateau at ca. 0.85 MaBP, Chinese Science Bulletin, 1993, 38(2): 586-591.[5]Chen, J., An, Z. S., Wang, Y. J. et al., Distributions of Rb and Sr in the Luochuan loess-paleosol sequence of China during the last 800 ka: Implications for paleomonsoon variations, Science in China, Ser. D, 1999, 42(3): 225-232.[6]Chen, J., Wang, Y. J., Ji, J. F. et al., Rb/Sr variations and its climatic stratigraphical significance of a loess-paleosol profile from Luochuan, Shaanxi Province, Quaternary Sciences (in Chinese), 1999, 19(4): 350-356.[7]Guo, Z. T.,Liu, T. S., Fedoroff, N. et al., Climate extremes in loess of China coupled with the strength of deep-water for-mation in the North Atlantic, Global and Planetary Change, 1998, 18: 113-128.[8]Guo, Z. T., Liu, T. S., An, Z. S., Paleosols of the last 0.15 Ma in the Weinan loess section and their paleoclimate signifi-cance, Quaternary Sciences (in Chinese), 1994, 14(3): 256-269.[9]Guo, Z, T,, Fedoroff, N., Liu, T. S., Micromorphology of the loess-paleosol sequence of the last 130 ka in China and pa-leoclimatic event, Science in China (in Chinese), Ser. D, 1996, 26(3): 392-398.[10]Guo, Z., Liu, T., Guiot, J., et al., High frequency pulses of East Asian monsoon climate in the last two glaciations: Link with the North Atlantic, Climate Dynamics, 1996, 12: 701-709.[11]Guo, Z. T., Peng, S. Z., Wei, L. Y. et al., Weathering signals of Millennial-Scale oscillations of the East Asian Summer monsoon over the last 220 ka, Chinese Science
2011-09-01
applied in this work was based on some of the standard definitions of soil constitutive properties as found in, e.g., Chen and Baladi [20], and...Livermore, CA. [20] Chen, W. F., and Baladi , G. Y., 1985. Soil Plasticity: Theory and Implementation. Elsevier Science, New York. [21] Zimmerman, H.D
75 FR 4509 - Uniform Criteria for State Observational Surveys of Seat Belt Use
2010-01-28
... statistical issues: Ms. Chou-Lin Chen, Chief, Mathematical Analysis Division, National Center for Statistics..., Washington, DC 20590. Telephone number: 202-366-1048; E- mail: Chou-Lin.Chen@dot.gov . For legal issues: Ms..., and reduce burden. E. Paperwork Reduction Act Under the Paperwork Reduction Act of 1995, a person is...
Journal of Chemical Sciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
... XIONG1 WEIHUA ZHU1 HEMING XIAO1. Institute for Computation in Molecular and Materials Science and Department of Chemistry, School of Chemical Engineering, Nanjing University of Science and Technology, Nanjing 210094, China; School of Materials Science and Engineering, Nanjing Institute of Technology, ...
Genetics Home Reference: alcohol use disorder
... use disorder can cause major health, social, and economic problems, and can endanger affected individuals and others ... Available from http://www.ncbi.nlm.nih.gov/books/NBK424857/ Citation on PubMed Zhu EC, Soundy TJ, ... Bulletins Genetics Home Reference Celebrates Its 15th Anniversary ...
Room temperature deposition of amorphous p-type CuFeO2 and ...
Indian Academy of Sciences (India)
fabrication of CuFeO2/n-Si heterojunction by RF sputtering method. TAO ZHU1 ... Transparent conducting amorphous p-type CuFeO2 (CFO) thin film was prepared by radio-frequency ... Delafossite oxides CuMO2 (M is trivalent cation, such as.
Cofactor interactions in the activation of tissue non-specific alkaline ...
African Journals Online (AJOL)
JTEkanem
stabilization of protein structure and regulation of enzymatic ... structure of ALP at low and high concentrations respectively4,5. ..... Zhang, Y.X., Zhu, Y., Xi, H.W., Liu, Y.L. and Zhou, H.M. ... Garen, A. and Levinthal, C. (1960) A fine structure ...
Electrochemical behaviour of superhydrophobic coating fabricated ...
Indian Academy of Sciences (India)
ties make it useful in household and industrial fields such as marine, automotive and ... are its simplicity, more cost effectiveness and less complex condition to .... Li M, Zhai J, Liu H, Song Y, Jiang L and Zhu D 2003 J. Phys. Chem. B 107 9954.
JPRS Report, Soviet Union Political Affairs Soviet Commentary on the 19th Party Conference.
1988-08-31
tific-Production Association " Venta " I. Tumas, painter at the Vilnius City Construction Repair Trust; and V. Zhu- kovskiy, milling machine...general director of the Scientific- Production Association " Venta ," began his statement by replying to a question from the audience about the harm
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
... Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 95; Issue 1. Novel NPHS1 gene mutations in a Chinese family with congenital nephrotic syndrome. Fengjie Yang Yaxian Chen Yu Zhang Liru Qiu Yu Chen Jianhua Zhou. Research Note Volume 95 Issue 1 March 2016 pp 161- ...
A reviewof the pharmacologicalmechanism of traditional Chinese ...
African Journals Online (AJOL)
A reviewof the pharmacologicalmechanism of traditional Chinese medicine in the intervention of coronary heart disease and stroke. W Zhang, K Gao, K Gao, J Liu, J Liu, H Zhao, H Zhao, J Wang, J Wang, Y Li, Y Li, G Murtaza, G Murtaza, J Chen, J Chen, W Wang, W Wang ...
Journal of Chemical Sciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Chemical Sciences. Chen Chai. Articles written in Journal of Chemical Sciences. Volume 126 Issue 3 May 2014 pp 813-820 Regular Articles. First total synthesis of Boehmenan · Yamu Xia Xiaoli Dai Haixin Liu Chen Chai · More Details Abstract Fulltext PDF. The first total synthesis of dilignan ...
Three novel antioxidants from Cinnamomum plants | Cheng | African ...
African Journals Online (AJOL)
Three novel antioxidants from Cinnamomum plants. K-C Cheng, H-A Chen, P-F Wu, W-L Yang, H-M Wang, C-Y Chen. Abstract. In this study, we identified three novel antioxidants, subamolide C (1), subamolide E (2) and isokotomolide A (3) from the constitutes of Cinnamomum subavenium and Cinnamomum kotoense.
van Achterberg, Cornelis; Long, Khuat Dang
2010-01-01
Abstract The species of seventeen genera of Agathidinae (Braconidae) from Vietnam are revised: Agathis Latreille, 1804, Bassus Fabricius, 1804; Biroia Szépligeti, 1900; Braunsia Kriechbaumer, 1894; Camptothlipsis Enderlein, 1920; Coccygidium de Saussure, 1892; Coronagathis gen. n. (type species: Coronagathis cornifera sp. n.); Cremnops Foerster, 1862; Disophrys Foerster, 1862; Earinus Wesmael, 1837; Euagathis Szépligeti, 1900; Gyragathis gen. n. (type species: Gyragathis quyi sp. n.), Gyrochus Enderlein, 1920; Lytopylus Foerster, 1862; Therophilus Wesmael, 1837; Troticus Brullé, 1846, and Zelodia gen. n. (type species: Zelomorpha varipes van Achterberg & Maetô, 1990). Keys to the Vietnamese species are given. Sixty-five species are recognised, of which twelve species are newly recorded for Vietnam: Bassus albifasciatus (Watanabe, 1934), Coccygidium angostura (Bhat & Gupta, 1977), Cremnops atricornis (Smith, 1874), stat. n., Disophrys erythrocephala Cameron, 1900, Gyrochus yunnanensis Wang, 1984, Lytopylus romani (Shestakov, 1940), comb. n., Therophilus festivus (Muesebeck, 1953), comb. n., Therophilus javanus (Bhat & Gupta, 1977), comb. n., Therophilus lienhuachihensis (Chou & Sharkey, 1989), comb. n., Therophilus marshi (Bhat & Gupta, 1977), comb. n., Zelodia absoluta (Chen & Yang, 1998), comb. n. and Zelodia longidorsata (Bhat & Gupta, 1977), comb. n. Forty-two species are new to science: Agathis citrinisoma sp. n., Bassus albobasalis sp. n., Bassus albozonatus sp. n., Biroia soror sp. n., Braunsia bicolorata sp. n., Braunsia devriesi sp. n., Braunsia maculifera sp. n., Braunsia nigrapiculata sp. n., Braunsia pumatica sp. n., Camptothlipsis hanoiensis sp. n., Coronagathis cornifera sp. n., Earinus aurantius sp. n., Earinus brevistigmus sp. n., Euagathis flavosoma sp. n., Disophrys maculifera sp. n., Disophrys quymanhi sp. n., Disophrys rhinoides sp. n., Gyragathis quyi sp. n., Therophilus annuliferus sp. n., Therophilus cattienensis sp. n., Therophilus
Lateral strukturierte Oberflächen zur THz-Strahlmanipulation
Jahn, David; Koch, Martin (Prof. Dr.)
2018-01-01
Die Terahertz-Zeitbereichsspektroskopie ist mittlerweile eine etablierte spektroskopische Methode im Frequenzbereich von 0;2 THz bis etwa 5 THz. Mit der stetigen Verbesserung von Zeitbereichs-Spektrometern, in den letzten Jahren hauptsächlich vorangetrieben durch die Verbesserung der Materialsysteme sowohl im photoleitenden Emitter als auch im Detektor sind heute Systeme mit bis zu 90 dB SNR und 4;5 THz Brandbreite verfügbar. Auch der Einfluss anderer Systemkomponenten, deren Beitrag zum...
C. Huang , G. Zhao , HW Zhang & YQ Chen
Indian Academy of Sciences (India)
the host stars' birth cloud with higher abundance of Si will make the cloud ... with the metallicity distribution of nearby field F, G, or K stars which are known to .... In the early stage of planetesimal accumulation, the rate of growth of planetesimal.
Chaos synchronization of the fractional-order Chen's system
International Nuclear Information System (INIS)
Zhu Hao; Zhou Shangbo; He Zhongshi
2009-01-01
In this paper, based on the stability theorem of linear fractional systems, a necessary condition is given to check the chaos synchronization of fractional systems with incommensurate order. Chaos synchronization is studied by utilizing the Pecora-Carroll (PC) method and the coupling method. The necessary condition can also be used as a tool to confirm results of a numerical simulation. Numerical simulation results show the effectiveness of the necessary condition.
Directory of Open Access Journals (Sweden)
Liu X
2012-10-01
Full Text Available Xun Liu,1,2,* Mu-hua Cheng,3,* Cheng-gang Shi,1 Cheng Wang,1 Cai-lian Cheng,1 Jin-xia Chen,1 Hua Tang,1 Zhu-jiang Chen,1 Zeng-chun Ye,1 Tan-qi Lou11Division of Nephrology, Department of Internal Medicine, The Third Affiliated Hospital of Sun Yet-sun University, Guangzhou, China; 2College of Biology Engineering, South China University of Technology, Guangzhou, China; 3Department of Nuclear Medicine, The Third Affiliated Hospital of Sun Yet-sun University, Guangzhou, China *These authors contributed equally to this paperBackground: Chronic kidney disease (CKD is recognized worldwide as a public health problem, and its prevalence increases as the population ages. However, the applicability of formulas for estimating the glomerular filtration rate (GFR based on serum creatinine (SC levels in elderly Chinese patients with CKD is limited.Materials and methods: Based on values obtained with the technetium-99m diethylenetriaminepentaacetic acid (99mTc-DTPA renal dynamic imaging method, 319 elderly Chinese patients with CKD were enrolled in this study. Serum creatinine was determined by the enzymatic method. The GFR was estimated using the Cockroft–Gault (CG equation, the Modification of Diet in Renal Disease (MDRD equations, the Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI equation, the Jelliffe-1973 equation, and the Hull equation.Results: The median of difference ranged from −0.3–4.3 mL/min/1.73 m2. The interquartile range (IQR of differences ranged from 13.9–17.6 mL/min/1.73 m2. Accuracy with a deviation less than 15% ranged from 27.6%–32.9%. Accuracy with a deviation less than 30% ranged from 53.6%–57.7%. Accuracy with a deviation less than 50% ranged from 74.9%–81.5%. None of the equations had accuracy up to the 70% level with a deviation less than 30% from the standard glomerular filtration rate (sGFR. Bland–Altman analysis demonstrated that the mean difference ranged from −3.0–2.4 mL/min/1.73 m2. However, the
Directory of Open Access Journals (Sweden)
Jin JF
2015-07-01
Full Text Available Jing-fen Jin,1 Ling-ling Zhu,2 Meng Chen,3 Hui-min Xu,3 Hua-fen Wang,1 Xiu-qin Feng,1 Xiu-ping Zhu,3 Quan Zhou31Division of Nursing, 2VIP Care Ward, Division of Nursing, 3Department of Pharmacy, The Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, People’s Republic of ChinaBackground: Intravenous (IV, intramuscular (IM, and subcutaneous (SC are the three most frequently used injection routes in medication administration. Comparative studies of SC versus IV, IM versus IV, or IM versus SC have been sporadically conducted, and some new findings are completely different from the dosage recommendation as described in prescribing information. However, clinicians may still be ignorant of such new evidence-based findings when choosing treatment methods.Methods: A literature search was performed using PubMed, MEDLINE, and Web of Sciences™ Core Collection to analyze the advantages and disadvantages of SC, IV, and IM administration in head-to-head comparative studies.Results: “SC better than IV” involves trastuzumab, rituximab, antitumor necrosis factor medications, bortezomib, amifostine, recombinant human granulocyte-macrophage colony-stimulating factor, granulocyte colony-stimulating factor, recombinant interleukin-2, immunoglobulin, epoetin alfa, heparin, and opioids. “IV better than SC” involves ketamine, vitamin K1, and abatacept. With respect to insulin and ketamine, whether IV has advantages over SC is determined by specific clinical circumstances. “IM better than IV” involves epinephrine, hepatitis B immunoglobulin, pegaspargase, and some antibiotics. “IV better than IM” involves ketamine, morphine, and antivenom. “IM better than SC” involves epinephrine. “SC better than IM” involves interferon-beta-1a, methotrexate, human chorionic gonadotropin, hepatitis B immunoglobulin, hydrocortisone, and morphine. Safety, efficacy, patient preference, and pharmacoeconomics are four principles
A cognitive network for oracle bone characters related to animals
Dress, Andreas; Grünewald, Stefan; Zeng, Zhenbing
2016-01-01
In this paper, we present an analysis of oracle bone characters for animals from a “cognitive” point of view. After some general remarks on oracle-bone characters presented in Sec. 1 and a short outline of the paper in Sec. 2, we collect various oracle-bone characters for animals from published resources in Sec. 3. In the next section, we begin analyzing a group of 60 ancient animal characters from www.zdic.net, a highly acclaimed internet dictionary of Chinese characters that is strictly based on historical sources, and introduce five categories of specific features regarding their (graphical) structure that will be used in Sec. 5 to associate corresponding feature vectors to these characters. In Sec. 6, these feature vectors will be used to investigate their dissimilarity in terms of a family of parameterized distance measures. And in the last section, we apply the SplitsTree method as encoded in the NeighborNet algorithms to construct a corresponding family of dissimilarity-based networks with the intention of elucidating how the ancient Chinese might have perceived the “animal world” in the late bronze age and to demonstrate that these pictographs reflect an intuitive understanding of this world and its inherent structure that predates its classification in the oldest surviving Chinese encyclopedia from approximately the third century BC, the Er Ya, as well as similar classification systems in the West by one to two millennia. We also present an English dictionary of 70 oracle bone characters for animals in Appendix A. In Appendix B, we list various variants of animal characters that were published in the Jia Gu Wen Bian (cf. 甲骨文编, A Complete Collection of Oracle Bone Characters, edited by the Institute of Archaeology of the Chinese Academy of Social Sciences, published by the Zhonghua Book Company in 1965). We recall the frequencies of the 521 most frequent oracle bone characters in Appendix C as reported in [T. Chen, Yin-Shang Jiaguwen Zixing
Genome-Wide Chromosomal Targets of Oncogenic Transcription Factors
2008-04-01
Altman, W.E., Attiya, S., Bader, J.S., Bemben, L.A., Berka , J., Braverman, M.S., Chen, Y.J., Chen, Z., et al. 2005. Genome sequencing in microfabricated...software after filtering to exclude bad spots. qPCR validation. Primer pairs used in Figure 1 were designed to cover three peaks and three troughs in
Journal of Biosciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Biosciences. Chen Fang. Articles written in Journal of Biosciences. Volume 30 Issue 3 June 2005 pp 351-357 Articles. Expression of a ribosome inactivating protein (curcin 2) in Jatropha curcas is induced by stress · Wei Qin Huang Ming-Xing Xu Ying Zhang Xin-Shen Chen Fang · More Details ...
The genus Bryoerythrophyllum (Musci, Pottiaceae in Antarctica
Directory of Open Access Journals (Sweden)
Sollman Philip
2015-07-01
Full Text Available Antarctic material of the genus Bryoerythrophyllum P. C. Chen was studied from all specimens present in KRAM. Bryoerythrophyllum recurvirostrum (Hedw. P. C. Chen var. antarcticum L. I. Savicz & Smirnova is treated as a distinct species: B. antarcticum (L. I. Savicz & Smirnova P. Sollman, stat. nov. Three species are now known in the Antarctic region: B. antarcticum, B. recurvirostrum and B. rubrum (Jur. ex Geh. P. C. Chen. Bryoerythrophyllum rubrum is reported for the first time from the Antarctic. It is a bipolar species. A key to the taxa is given. These species are described and briefly discussed, with notes on illustrations, reproduction, habitat, world range, distribution and elevation in Antarctica.
Sensing of polymeric sensor-based rhodamine B derivative for metal ...
Indian Academy of Sciences (India)
TONG-MOU GENG1 XIE WANG1 FENG ZHU1 HUI JIANG1 YU WANG2. Collaborative Innovation Center for Petrochemical New Materials, Anhui Key Laboratory of Functional Coordination Compounds, School of Chemistry and Chemical Engineering, Anqing Normal University, Anqing 246011, People's Republic of China ...
Novel technique for prediction of time points for scheduling of multipurpose batch plants
CSIR Research Space (South Africa)
Seid, R
2012-01-01
Full Text Available . Consequently this avoids costly computational times due to iterations. In the model by Majozi and Zhu (2001) the sequence constraint that pertains to tasks that consume and produce the same state, the starting time of the consuming task at time point p must...
Pramana – Journal of Physics | Indian Academy of Sciences
Indian Academy of Sciences (India)
Author Affiliations. Wenfeng Luo1 Xiaoxia Zhao2 Shuyuan Lv1 Haiyan Zhu1. School of Electronic Engineering, Xi'an University of Posts and Telecommunications, Xi'an, Shaanxi 710121, China; School of Physics and Mechanical and Electronic Engineering, Xi'an University, Xi'an, Shaanxi 710065, China ...
Velocity Distributions of Runaway Stars Produced by Supernovae in ...
Indian Academy of Sciences (India)
J. Astrophys. Astr. (2016) 37: 22. DOI: 10.1007/s12036-016-9400-2. Velocity Distributions of Runaway Stars Produced by Supernovae in the Galaxy. Abudusaimaitijiang Yisikandeer. ∗. , Chunhua Zhu, Zhaojun Wang. & Guoliang Lü. School of Physical Science and Technology, Xinjiang University, Urumqi, 830046, China. ∗.
Indepth exploration on history of Qing doctors traveling to Japan.
Guo, X; Saka, S; Okada, K
1999-04-01
During the one hundred years and more from the beginning of the 18th century to the beginning of the 19th century, about 16 Chinese doctors, at the invitation of Japanese, went to Japan successively by trade ships to practice medicine and teach Chinese medicine. They also conducted academic exchanges with Japanese doctors. Because both the Japanese authorities of that time and the emperor of Qing dynasty implemented the policy of closing the country, they could only do things in certain areas within limited time. By consulting a vast amount of data and following the footprints of some of the Chinese doctors in Japan, the author has got things into shape about the comings and goings of the doctors who went to Japan during the century and their activities, with the stressed point laid on the achievements of such influential doctors as Zhu Laizhang, Zhu Zizhang, Zhou Qilai, Zhao Songyang, Li Renshan, Hu Zhaoxin and so on.
An Efficient and Secure Arbitrary N-Party Quantum Key Agreement Protocol Using Bell States
Liu, Wen-Jie; Xu, Yong; Yang, Ching-Nung; Gao, Pei-Pei; Yu, Wen-Bin
2018-01-01
Two quantum key agreement protocols using Bell states and Bell measurement were recently proposed by Shukla et al. (Quantum Inf. Process. 13(11), 2391-2405, 2014). However, Zhu et al. pointed out that there are some security flaws and proposed an improved version (Quantum Inf. Process. 14(11), 4245-4254, 2015). In this study, we will show Zhu et al.'s improvement still exists some security problems, and its efficiency is not high enough. For solving these problems, we utilize four Pauli operations { I, Z, X, Y} to encode two bits instead of the original two operations { I, X} to encode one bit, and then propose an efficient and secure arbitrary N-party quantum key agreement protocol. In the protocol, the channel checking with decoy single photons is introduced to avoid the eavesdropper's flip attack, and a post-measurement mechanism is used to prevent against the collusion attack. The security analysis shows the present protocol can guarantee the correctness, security, privacy and fairness of quantum key agreement.
Axiomatic conformal field theory
International Nuclear Information System (INIS)
Gaberdiel, M.R.; Goddard, P.
2000-01-01
A new rigourous approach to conformal field theory is presented. The basic objects are families of complex-valued amplitudes, which define a meromorphic conformal field theory (or chiral algebra) and which lead naturally to the definition of topological vector spaces, between which vertex operators act as continuous operators. In fact, in order to develop the theory, Moebius invariance rather than full conformal invariance is required but it is shown that every Moebius theory can be extended to a conformal theory by the construction of a Virasoro field. In this approach, a representation of a conformal field theory is naturally defined in terms of a family of amplitudes with appropriate analytic properties. It is shown that these amplitudes can also be derived from a suitable collection of states in the meromorphic theory. Zhu's algebra then appears naturally as the algebra of conditions which states defining highest weight representations must satisfy. The relationship of the representations of Zhu's algebra to the classification of highest weight representations is explained. (orig.)
(DEPSCOR FY 09) Obfuscation and Deobfuscation of Intent of Computer Programs
2012-12-21
increased as the malware distribution mechanism has moved to the web through infected sites. In this use a site is hacked so as to distribute malware to...Simpósio Brasileiro em Segurança da Informaçao e de Sistemas Computacionais (2009). (Chen et al., 2012) Jundong Chen, Matthias R. Brust, Vir V. Phoha
The effects of growth time on the quality of graphene synthesized by ...
Indian Academy of Sciences (India)
by LPCVD. A JAFARI, R ALIPOUR∗ and M GHORANNEVISS ..... Li T, Hass J, Marchenkoy A N, Conrad E H, First P N and de ... Ni Z H, Chen W, Fan X F, Kuo J L, Yu T, Wee A T S ... Chen S, Cai W, Piner R D, Suk J W, Wu Y, Ren Y, Kang Y.
African Journals Online (AJOL)
Vol 9, No 1 (2006), Splenectomy in a rural surgical practice, Abstract PDF. E Alufohai, OO Odusanya. Vol 20, No 9 (2017), Spontaneous Retropharyngeal Emphysema: A Case Report, Abstract PDF. T-H Chi, C-C Hung, R-F Chen, C-H Yuan, J-C Chen. Vol 5, No 2 (2002), Spontaneous Rupture Of A Massive Hydrocephalus ...
Phase relation of LaFe11· 6Si1· 4 compounds annealed at different ...
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science; Volume 35; Issue 2. Phase relation of LaFe11.6Si1.4 compounds annealed at different high-temperature and the magnetic property of LaFe11.6−CoSi1.4 compounds. Xiang Chen Yungui Chen Yongbai Tang. Volume 35 Issue 2 April 2012 pp 175-182 ...
Hsieh, Hui-Chen
2016-01-01
Developing the ability to speak English is a daunting task that has long been omitted in a test-driven pedagogy context (Chang, 2011; Li, 2012a, 2012b; Chen & Tsai, 2012; Katchen, 1989, 1995). Since speaking is not tested for school admissions, most students are not motivated to learn it (Chang, 2011; Chen & Tsai, 2012). Now, globalization…
a review of the anticancer potential of the antimalarial herbal
African Journals Online (AJOL)
David Ofori-Adjei
2013-09-01
Sep 1, 2013 ... Volume 47, Number 3 ... topoisomerase II as their principal targets.10 ... The work by Zhu and Gooderham, ... executed at least in part through the mitochondrial ... vascular endothelial growth factor and angiopoetin, .... decrease in plasma glucose when given orally to a ... well as the cost of chemotherapy.
Headspace Solid-Phase Microextraction Coupled with Gas ...
African Journals Online (AJOL)
Tropical Journal of Pharmaceutical Research May 2015; 14(5): 891-898. ISSN: 1596-5996 ... with the potential to analyze volatile compounds in raw and processed FCP. .... hydrocarbons, furans and oxazoles were formed during the ..... vol. 1. Beijing: China Medical Science and Technology. Press; pp 29-30. 11. Zhu CY ...
NREL Research Pushes Perovskites Closer to Market | News | NREL
even get close-to the above-20% efficiencies dominated by silicon solar panels. NREL researcher Kai Zhu ; Perovskites have a couple of major benefits over silicon solar panels. The silicon technology requires a high as excellent semiconductors. This means perovskite panels are more flexible than rigid silicon panels
Empirical training for conditional random fields
Zhu, Zhemin; Hiemstra, Djoerd; Apers, Peter M.G.; Wombacher, Andreas
2013-01-01
In this paper (Zhu et al., 2013), we present a practi- cally scalable training method for CRFs called Empir- ical Training (EP). We show that the standard train- ing with unregularized log likelihood can have many maximum likelihood estimations (MLEs). Empirical training has a unique closed form MLE
Hydrological indications of aeolian salts in mid-latitude deserts of ...
Indian Academy of Sciences (India)
Hydrological indications of aeolian salts in mid-latitude deserts of northwestern China. B Q Zhu. Supplementary data. Figure S1. Photograph views of Quaternary and modern sediments of aeolian and lacustrine/fluvial facies that consisted of clay and sand/silt sand alternations in the Taklamakan and Badanjilin Deserts.
The adverse reaction of chitooligosaccharides in rats | Liu | African ...
African Journals Online (AJOL)
The adverse reaction of chitooligosaccharides in rats. A Liu, K Sun, C Si, Z Zhu, W Zhang. Abstract. In this study, hair removal effect after subcutaneous injection of chitooligosaccharides in mice was investigated. Different methods of observation of hair removal, tissue slices and detection of hematological parameters, like ...
Chu, Shih-Meng; Shih, Wei-Tai; Yang, Yao-Hsu; Chen, Pau-Chung; Chu, Yen-Hua
2015-06-20
Chinese herbal products (CHPs) are commonly used in patients with hyperlipidemia in traditional Chinese medicine (TCM). Because hyperlipidemia and related disease are common issues worldwide, this study analyzed the prescription patterns and frequencies of CHPs for treating patients with hyperlipidemia in Taiwan. Traditional Chinese medicine (TCM) has become popular as a therapy for controlling symptoms in patients with hyperlipidemia. This study aimed to analyze the prescription patterns of TCM for patients with hyperlipidemia in Taiwan. The study population was recruited from a random-sampled cohort of 1,000,000 people from the National Health Insurance Research Database between 2003 and 2009. We identified 30,784 outpatient visits related with hyperlipidemia diagnosis and collected these medical records. Association rules of data mining were conducted to explore the co-prescription patterns for Chinese herbal products (CHPs). The most commonly prescribed herbal formula for hyperlipidemia treatment was Xue-Fu-Zhu-Yu-Tang (16.1%), and Shan Zha (Crataegi fructus; 25.0%) was the most commonly prescribed single herb. The most commonly prescribed combination of an herbal formula and a single herb was Xue-Fu-Zhu-Yu-Tang and Dan Shen (Radix Salviae Miltiorrhizae), and the most commonly prescribed combination of couplet herbs was Dan Shen and Shan Zha. Xue-Fu-Zhu-Yu-Tang is the most frequently prescribed formula and is typically prescribed with Shan Zha, Dan Shen, and He Shou Wu for patients with hyperlipidemia. Clinical trials are warranted in future research to investigate the effects of the CHPs in terms of safety and efficacy and in particular to evaluate potential interactions with conventional treatments. Copyright © 2015. Published by Elsevier Ireland Ltd.
Vehicle/Guideway Interaction in Maglev Systems
1992-03-01
Technology Division Materials and Components in Maglev Systems Technology Division Materials and Components Technology Division byY. Cai, S. S. Chen, and D. M...Transportation Systems Reports (UC-330, Vehicle/Guideway Interaction in Maglev Systems by Y. Cai and S. S. Chen Materials and Components Technology Division D. M...Surface Irregularities ...................................... 32 4 Vehicle/Guideway Interaction in Transrapid Maglev System .................. 34 4.1
Indian Academy of Sciences (India)
20. Nevill GA and Cook D 1969 Can. J. Chen. 47 743. 21. Glasel GA 1969 Org. Magn. Reson. 1481. 22. Soundarajan S 1958 Trans. Faraday Soc. 54147. 23. Rein R 1971 Int. J. Quant. Chem., Symp, 4341. 24. Woet D 1972.J. Am. Chen, Soc. 94.8213. 25. Bideau.JP, Huong PV and Toure S 1976 Acta Crystallogr. B32481.
2010-02-19
... Company Ltd., 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan; and (4) Yi-Lan Chen, a.k.a., Kevin Chen, 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan, and 7th Floor, Number 17... the requirements of the Paperwork Reduction Act of 1995 (44 U.S.C. 3501 et seq.) (PRA), unless that...
Indian Academy of Sciences (India)
Home; Journals; Sadhana. WAN-MING LIU. Articles written in Sadhana. Volume 41 Issue 7 July 2016 pp 713-719. Integrated fleet assignment and aircraft routing based on delay propagation · WAN-MING LIU XING-HUI ZHU YAN-LONG QI · More Details Abstract Fulltext PDF. Airlines' expensive resources, especially aircraft ...
Effect of ultrasonic specific energy on waste activated sludge ...
African Journals Online (AJOL)
USER
2010-03-22
Mar 22, 2010 ... Yuanyuan Yan, Leiyu Feng*, Chaojie Zhang, Hongguang Zhu and Qi Zhou. State Key ... soluble chemical oxygen demand; TCOD, total chemical oxygen demand ... studied as well as their effects on the characteristics of sludge. .... universal liquid module (ULM) which could detect particle size from. 0.04 up ...
75 FR 21638 - Government-Owned Inventions; Availability for Licensing
2010-04-26
... been shown to play a role in bone morphogenesis, cardiovascular tissue generation, immune regulation... tissue generation. Means of studying the role of SMAD7 in immune regulation. Inventors: Marilyn Diaz (NIEHS). Related Publication: Dong C, Zhu S, Wang T, Yoon W, Li Z, Alvarez RJ, Dijke P, White B, Wigley...
DNA methylation of PTEN gene promoter region is not correlated ...
African Journals Online (AJOL)
Yomi
2012-02-23
Feb 23, 2012 ... of Shandong, Qingdao Agricultural University, Qingdao, 266109, China. 2Daping ... (Kang et al., 2002), glioblastoma (Baeza et al., 2003), breast cancer ... DNA isolation by using micro DNA isolation kit (Tiangen, Beijing,. China) .... Asano T, Yao Y, Zhu J, Li D, Abbruzzese JL, Reddy SA (2004). The PI.
Ministry of Finance: Discharge Reduction Funds to Provide Supports in Six Major Areas
Institute of Scientific and Technical Information of China (English)
2010-01-01
@@ Zhu Guangyao, assistant Minister of the Ministry of Finance, said at the climate summit in Copenhagen on December 16, 2009 that, the government budget would increase the investment in the areas of energy conservation, discharge reduction and renewable energy sources in 2010 and during the period of Twelfth Five-Year Plan.
Journal of Chemical Sciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Chemical Sciences. Cheng-Li Yao. Articles written in Journal of Chemical Sciences. Volume 121 Issue 1 January 2009 pp 89-93 Full Papers. Sucrose/bovine serum albumin mediated biomimetic crystallization of calcium carbonate · Cheng-Li Yao Wang-Hua Xu Ai-Min Ding Jin-Mao Zhu.
On integral equation methods for electromagnetic scattering by biperiodic structures
Bugert, Beatrice
2014-01-01
In der vorliegenden Arbeit verwenden wir Integralgleichungsmethoden, um die Streuung von zeitharmonischen elektromagnetischen ebenen Wellen an biperiodischen mehrschichtigen Strukturen zu untersuchen. Solche Strukturen modellieren wir durch die vertikale Anordnung einer endlichen Anzahl an sich nicht schneidenden, polyedrisch Lipschitz regulären Grenzflächen. Wir unterscheiden Streuobjekte bestehend aus einer Oberfläche und solche bestehend aus mindestens zwei Oberflächen. Das elektromagnetis...
Ühinemise ja iseolemise vastuseis. Ideaalid ja reaalsus / Rein Tootmaa
Tootmaa, Rein
2001-01-01
Mängufilmid "Keiser ja palgamõrtsukas" ("Jing ke ci qin wang") : režissöör Chen Kaige : Jaapan-Hiina-Prantsusmaa 1999 ja "Tiiger ja draakon" ("Wo hu chang long") : režissöör Ang Lee : Hiina-Hongkong-Ameerika Ühendriigid 2000. Lisa : Aare Ermeli koostatud Chen Kaige ja Ang Lee loomingu lühikokkuvõtted. Kokkuvõte inglise keeles lk. 128
Genetic analysis of body weight of Takifugu rubripes at different ...
African Journals Online (AJOL)
Tuoyo Aghomotsegin
2016-11-09
Nov 9, 2016 ... 3Key Laboratory of Sustainable Development of Marine Fisheries, Ministry of Agriculture, China .... During the larval-culture period, water ... The measured values at time t were conditioned on measured values at time t – 1. Thus, the conditional genetic model can be written as follows (Zhu, 1995; Atchley ...
2016-04-01
16] J. Saunier, F. Alloin, J.Y. Sanchez, L. Maniguet, “Plasticized microporous poly(vinylidene fluoride) separators for lithium-ion batteries. III... International 5, pp. 133-1341, (2013). [20] X.H. Liu, Y. Liu, A. Kushima, S. Zhang, T. Zhu, J. Li, J.Y. Huang, “In Situ TEM Experiment of Electrochemical
Biisofraxidin on Apoptosis of Human Gastric Cancer BGC-823 Cells
African Journals Online (AJOL)
Wu et al. Trop J Pharm Res, October 2015; 14(10): 1803. Tropical Journal of Pharmaceutical Research ... Jian-Tao Wu1,2*, She-Min Lv1, Chun-Hui Lu1, Jun Gong1 and Jian-Bo An3 ..... Zhu AK, Zhou H, Xia JZ, Jin HC, Wang K, Yan J, Zuo JB,.
Reference: 759 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available 759 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u18434608i Guan Yue-Feng...s. 2 852-63 18434608 2008 Jun Plant physiology Gao Ju-Fang|Guan Yue-Feng|Huang Xue-Yong|Yang Zhong-Nan|Zhang Hong-Xia|Zhu Jun
Whole Exome Analysis of Early Onset Alzheimer’s Disease
2015-04-01
SA, Shan X, Jones BA, Zhao G, Woodward ML, Li X, Zhu Y, McEachern EJ, Silverman MA, Watson NV, Gong CX, Vocadlo DJ1. Pharmacological inhibition of O...ADGC) genotyped on the exome chip, which included 195,039 variants with MAFɚ%. Enrichment analysis of the variant list was conducted using DAVID
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
Yang Zhao1 Haiqing Tong1 Ronghao Cai1 Xiaojian Peng1 Xiaoyu Li1 Defang Gan2 Suwen Zhu1. Key Laboratory of Crop Biology of Anhui Province, School of Life Sciences, Anhui Agricultural University, Hefei 230036, People's Republic of China; School of Horticulture, Anhui Agricultural University, Hefei 230036, People's ...
Cellulose sulphuric acid as a biodegradable catalyst for conversion ...
Indian Academy of Sciences (India)
important applications of these compounds are 1,3- dipolar cycloaddition to produce five-membered hetero- cycles2 and their ... Diazonium salts are multipurpose compounds in organic chemistry. However, their poor stability lim- ..... Organometallics 21 5549. 5. Liu Q and Tor Y 2003 Org. Lett. 5 2571. 6. Zhu W and Ma D ...
Implicit-shifted Symmetric QR Singular Value Decomposition of 3x3 Matrices
2016-04-01
Graph 33, 4, 138:1– 138:11. TREFETHEN, L. N., AND BAU III, D. 1997. Numerical linear algebra , vol. 50. Siam. XU, H., SIN, F., ZHU, Y., AND BARBIČ, J...matrices with minimal branching and elementary floating point operations. Tech. rep., University of Wisconsin- Madison. SAITO, S., ZHOU, Z.-Y., AND
Effects of drought and salt stress on seed germination of three ...
African Journals Online (AJOL)
use
2011-12-07
Dec 7, 2011 ... At sowing, inadequate soil moisture results in irregular seed germination and unsynchronised seedling ... Soil salinity affects germination by either an osmotic stress or ion toxic effect (Bewley and Black, ..... Zhu et al., 2006) as an inert osmoticum in germination tests (Dodd and Donovan, 1999) and is a non- ...
Tavin, Kevin; Kallio-Tavin, Mira
2014-01-01
Against the backdrop of objective and subjective violence, two contemporary artworks are interpreted through theories of the Other. Zhu Yu's "Eating People" (2000) is considered through Lacanian psychoanalytic theory and, in particular, through an Ethics of the Real. Teemu Mäki's "My Way, a Work in Progress" (1995) is…
DEFF Research Database (Denmark)
Henriksen, Knud; Sporring, Jon; Hornbæk, Kasper
2004-01-01
reviews and provides a mathematical foundation for virtual trackballs. The first, but still popular, virtual trackball was described by Chen et al. [CHECK END OF SENTENCE]. We show that the virtual trackball by Chen et al. does not rotate the object along the intended great circular arc on the virtual...... trackball and we give a correction. Another popular virtual trackball is Shoemake's quaternion implementation [CHECK END OF SENTENCE], which we show to be a special case of the virtual trackball by Chen et al.. Shoemake extends the scope of the virtual trackball to the full screen. Unfortunately, Shoemake......'s virtual trackball is inhomogeneous and discontinuous with consequences for usability. Finally, we review Bell's virtual trackball [CHECK END OF SENTENCE] and discuss studies of the usability of virtual trackballs....
2018-02-01
Retracted Review article: Nucleophagy in Human Disease: Beyond the Physiological Role. [Tohoku J. Exp. Med., 2018, 244 (1), 75-81. doi: 10.1620/tjem.244.75.] The above Review article was published online on January 27, 2018. Soon after its publication (on February 1, 2018), Dr. Nian Fu and Prof. Linxi Chen informed the Editor-in-Chief, The Tohoku Journal of Experimental Medicine (TJEM), about serious violation of publication ethics. Indeed, Dr. Nian Fu and Prof. Linxi Chen were astonished to find their names as coauthors of this Review article, because they were not involved in the submission process of this Review article and they do not know any of other coauthors. In addition, the Review article is similar to their unpublished manuscript. After a thorough investigation in accordance with the recommendations of the Committee on Publication Ethics (COPE), the Editor-in-Chief of TJEM decided to retract this Review article. The reasons for Retraction are summarized below: forged authors and an unexpected case of plagiarism. Forged authors: Dr. Nian Fu and Prof. Linxi Chen were added as co-authors of the Review article without their knowledge. In fact, the signature provided by Prof. Linxi Chen is apparently different from the signature of a coauthor, named Linxi Chen, on the AUTHORS’ RESPONSIBILITY FORM, provided by the corresponding author of the Review article. More critically, the signature provided by Dr. Nian Fu is completely different from the signature of Nian Fu, because the Chinese characters are different between the two signatures. In addition, the replies from three authors (Ming Zhou, Hongwen Ji and Yong Xia) clearly indicate that they misunderstand the identity of Dr. Nina Fu. We also attempted to contact two authors, named Nian Fu and Linxi Chen, via e-mail. As expected, the forged authors did not respond to our inquiries, despite that their e-mail addresses appear to be active. An unexpected case of plagiarism: This Review article is similar to the
Directory of Open Access Journals (Sweden)
Cui J
2017-11-01
Full Text Available Jianfeng Cui,1,* Shouzhen Chen,1,* Qiyu Bo,2 Shiyu Wang,1 Ning Zhang,1 Meng Yu,1 Wenfu Wang,1 Jie Han,3 Yaofeng Zhu,1 Benkang Shi1 1Department of Urology, 2Department of First Operating Room, Qilu Hospital of Shandong University, 3Department of Radiation Oncology, Shandong Cancer Hospital and Institute Affiliated to Shandong University, Jinan, People’s Republic of China *These authors contributed equally to this work Background and objectives: Among the cancers of the urogenital system, bladder cancer is ranked second both in incidence and mortality, and hence, a more accurate estimate of the prognosis for individual patients with non-muscle-invasive bladder cancer (NMIBC is urgently needed. Prognostic nutritional index (PNI which is based on serum albumin levels and peripheral lymphocyte count has been confirmed to have prognostic value in various cancers. The aim of this study was to clarify the prognostic value of PNI in patients with NMIBC.Methods: Data of 329 patients with NMIBC were evaluated retrospectively. Recurrence-free survival (RFS was assessed using the Kaplan–Meier method, and the equivalences of survival curves were tested by log-rank tests. The univariate and multivariate analyses were performed using the Cox proportional hazards regression model. Discrimination of the nomogram was measured by the concordance index. A p-value of <0.05 was considered statistically significant.Results: In univariate analysis, age, tumor focality, tumor size, tumor grade, pathological T stage and preoperative PNI were significantly associated with RFS. Multivariate analysis identified PNI as an independent predictor of RFS in patients with NMIBC. According to these independent predictors, a nomogram for the prediction of recurrence was developed.Conclusion: PNI can be regarded as an independent prognostic factor for predicting RFS in NMIBC. The nomogram could be useful to improve personalized therapy for patients with NMIBC. Keywords: non
Directory of Open Access Journals (Sweden)
Fu QW
2016-10-01
Full Text Available Qi-Wei Fu,1,* Yun-Peng Zi,1,* Wei Xu,1 Rong Zhou,1 Zhu-Yun Cai,1 Wei-Jie Zheng,1 Feng Chen,2 Qi-Rong Qian1 1Department of Orthopedics, Changzheng Hospital, Second Military Medical University, 2State Key Laboratory of High Performance Ceramics and Superfine Microstructure, Shanghai Institute of Ceramics, Chinese Academy of Sciences, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Calcium phosphate-based biomaterials have been well studied in biomedical fields due to their outstanding chemical and biological properties which are similar to the inorganic constituents in bone tissue. In this study, amorphous calcium phosphate (ACP nanoparticles were prepared by a precipitation method, and used for preparation of ACP-poly(D,L-lactic acid (ACP-PLA nanofibers and water-soluble drug-containing ACP-PLA nanofibers by electrospinning. Promoting the encapsulation efficiency of water-soluble drugs in electrospun hydrophobic polymer nanofibers is a common problem due to the incompatibility between the water-soluble drug molecules and hydrophobic polymers solution. Herein, we used a native biomolecule of lecithin as a biocompatible surfactant to overcome this problem, and successfully prepared water-soluble drug-containing ACP-PLA nanofibers. The lecithin and ACP nanoparticles played important roles in stabilizing water-soluble drug in the electrospinning composite solution. The electrospun drug-containing ACP-PLA nanofibers exhibited fast mineralization in simulated body fluid. The ACP nanoparticles played the key role of seeds in the process of mineralization. Furthermore, the drug-containing ACP-PLA nanofibers exhibited sustained drug release which simultaneously occurred with the in situ mineralization in simulated body fluid. The osteoblast-like (MG63 cells with spreading filopodia were well observed on the as-prepared nanofibrous mats after culturing for 24 hours, indicating a high cytocompatibility. Due
Zhu, Youwei; Jiang, Haifeng; Su, Hang; Zhong, Na; Li, Runji; Li, Xiaotong; Chen, Tianzhen; Tan, Haoye; Du, Jiang; Xu, Ding; Yan, Huan; Xu, Dawen; Zhao, Min
2018-06-20
Cognitive rehabilitation therapy has been found to improve cognitive deficits and impulse control problems in methamphetamine use disorder (MUD). However, there is limited research regarding this therapy's feasibility when using mobile-based health technologies in supporting recovery from MUD in China. The main aim of this study was to test whether 4 weeks of a newly designed computerized cognitive addiction therapy (CCAT) app can improve cognitive impairments, eliminate drug-related attention bias, and attenuate risk decision-making behaviors in participants with MUD. Forty MUD participants were assigned randomly to either the CCAT group (n=20), who received 4 weeks of CCAT plus regular detoxification treatment as usual, or the control group (n=20), who only received the regular detoxification treatment as usual, in drug rehabilitation centers in Shanghai. The CCAT was designed by combine methamphetamine use-related picture stimuli with cognitive training with the aim of improving cognitive function and eliminating drug-related attention bias. The CogState Battery, Delay Discounting Task (DDT), Iowa Gambling Task (IGT), and Balloon Analog Risk Task (BART) were administered face-to-face to all participants before and after CCAT interventions. Forty male patients were recruited. The mean age was 32.70 (SD 5.27) years in the CCAT group and mean 35.05 (SD 8.02) years in the control group. Compared to the control group, CCAT improved working memory in the CCAT group (P=.01). Group×time interactions were observed among DDT, IGT, and BART tasks, with rates of discounting delayed rewards, IGT, and BART scores (Pcognitive impairment and impulsive control in MUD. Further study is needed to understand the underlying brain mechanisms of the cognitive therapy. ClinicalTrials.gov NCT03318081; https://clinicaltrials.gov/ct2/show/NCT03318081 (Archived by WebCite at https://clinicaltrials.gov/ct2/show/NCT03318081). ©Youwei Zhu, Haifeng Jiang, Hang Su, Na Zhong, Runji Li
Directory of Open Access Journals (Sweden)
Chen FC
2016-06-01
Full Text Available Fu-chao Chen,1 Jun Zhu,1 Bin Li,1 Fang-jun Yuan,1 Lin-hai Wang2 1Department of Pharmacy, Dongfeng Hospital, 2Department of Pharmacy, Renmin Hospital, Hubei University of Medicine, Shiyan, Hubei, People’s Republic of China Background: Mixing 5-hydroxytryptamine-3 (5-HT3 receptor antagonists with patient-controlled analgesia (PCA solutions of tramadol has been shown to decrease the incidence of nausea and vomiting associated with the use of tramadol PCA for postoperative pain. However, such mixtures are not commercially available, and the stability of the drug combinations has not been duly studied. The study aimed to evaluate the stability of tramadol with three 5-HT3 receptor antagonists in 0.9% sodium chloride injection for PCA administration.Materials and methods: Test samples were prepared by adding 1,000 mg tramadol hydrochloride, 8 mg ondansetron hydrochloride, and 6 mg granisetron hydrochloride or 5 mg tropisetron hydrochloride to 100 mL of 0.9% sodium chloride injection in polyolefin bags. The samples were prepared in triplicates, stored at either 25°C or 4°C for 14 days, and assessed using the following compatibility parameters: precipitation, cloudiness, discoloration, and pH. Chemical stability was also determined using a validated high-pressure liquid chromatography method.Results: All of the mixtures were clear and colorless throughout the initial observation period. No change in the concentration of tramadol hydrochloride occurred with any of the 5-HT3 receptor antagonists during the 14 days. Similarly, little or no loss of the 5-HT3 receptor antagonists occurred over the 14-day period.Conclusion: Our results suggest that mixtures of tramadol hydrochloride, ondansetron hydrochloride, granisetron hydrochloride, or tropisetron hydrochloride in 0.9% sodium chloride injection were physically and chemically stable for 14 days when stored in polyolefin bags at both 4°C and 25°C. Keywords: tramadol, ondansetron, granisetron
2. Sino-German workshop on fuel cells. Book of abstracts
Energy Technology Data Exchange (ETDEWEB)
NONE
2003-07-01
The CD-ROM contains the content of 13 lectures and 19 proposals for joint projects, which were presented on the second Sino-German Workshop on fuel cells. The topics of the 13 lectures are: Ab-initio calculations of oxygen species on low-index platinum surfaces (Pachenko, M.T.M. Koper, T.E. Shubina, S.J. Mitchell, E. Roduner). Cross-Linked (Composite) Polyaryl Blend Membranes for Membrane Fuel Cells. (J.A. Kerres, A. Ullrich, W. Zhang, M. Hein, V. Gogel, L. Joerissen, Th. Frey, A. Friedrich). Performance and Methanol Permeation of Direct Methanol Fuel Cells: Dependence on Operating Conditions and on Electrode Structure(V. Gogel, Th. Frey, K.A. Friedrich, L. Joerissen, J. Garche, Z. Yongsheng). Experimental Investigation of Flow Bed Configuration Effect on Performance of Liquid Feed Direct Methanol Fuel Cells. (H. Guo, C.F. Ma, M.H. Wang, F. Ye, J. Yu, Y. Wang, C.Y. Wang). Improvement of MEAs for DMFC by a tuned production sequence assisted by mathematical modelling (Lindermeir, G. Rosenthal, U. Kunz, U. Hoffmann). Performance of the self-breathing air DMFC with solution grafted PVDF-g-PSSA membranes (X. Qiu, G. Guo, W. Li, W. Zhu, L. Chen). Modeling the Effects of Methanol Crossover on DMFC (J. Zhang, Y. Wang). The characteristics of 40 kW PEM fuel cell engine for vehicle(M. Hou, P. Ming, H. Zhang). A New and Simple Method for Preparing Biocathode in Biofuel Cells (D. Sun, C. Cai, X. Li, W. Xing, T. Lu). Nonlinear Model Reduction of a Dynamic Two-dimensional Molten Carbonate Fuel Cell Model (M. Mangold, M. Sheng). Recent Advances in Design and Fabrication of Low-Temperature Solid Oxide Fuel Cells (C. Xia, G. Meng). Novel CVD Techniques for Micro- and IT-SOFC Fabrication (G. Meng, H. Song, Q. Dong, D. Peng). Fundamental properties of La{sub 0.6}Sr{sub 0.4}Co{sub 0.8}Fe{sub 0.2}O{sub 3-{delta}} at high temperatures (S. Wang, T.-L. Wen).
1989-05-17
brand , which symbolizes feudal autocracy, in that the new form has been posited in the hopes that reform can forcefully be implemented so as to...ucts; name- brand and high-quality products; products of energy, communications, transportation, and raw mate- rial industries; aid agriculture...1986 election. Chen Weiye fought a skillful battle although he had been seen as an underdog . The smashing victory of Chen Weiye and Huang Wentai plus
Viets, Carmen
2001-01-01
Faseroptische SERS-Sensoren wurden durch die Beschichtung der Endflächen von optischen Fasern mit rauhen Metallfilmen erzeugt. Zu den verschiedenen Präparationstechniken, die angewendet und verglichen wurden, gehörten das langsame Aufdampfen von Metall-Inselfilmen und das Bedampfen von Nanopartikeln, aufgerauhten oder elektronenlithographisch strukturierten Oberflächen mit Metallfilmen. Der Einfluß der Laserleistung auf die Messungen mit SERS-Sensoren wurde untersucht, und es wurden maximale ...
Unconventional Density Wave and Superfluidity in Cold Atom Systems
2014-06-01
Tsai, Chairperson Professor Kirill Shtengel Professor Vivek Aji 3 Copyright by Chen-Yen Lai 2014 4 The Dissertation of Chen-Yen Lai is approved...thank my dissertation committee members, Professor Vivek Aji and Pro- fessor Kirill Shtengel, for their help, kindness, insightful comments and...near balance to a stripe-CDW ( red ) as the imbalance increases. The insert shows the strong imbalance region, where single species p-wave majority
Quasi-Static Evolution, Catastrophe, and Failed Eruption of Solar Flux Ropes
2016-12-30
Ropes James Chen Beam Physics Branch Plasma Physics Division December 30, 2016 Approved for public release; distribution is unlimited. i REPORT...pressure gradient force combine to balance the major radial hoop force. The macroscopic forces on the flux ropes and onset conditions are quantified...Solar physics theory 67-4989-07 Quasi-Static Evolution, Catastrophe, and “Failed” Eruption of Solar Flux Ropes James Chen1 Plasma Physics Division
Aerial Logistics Management for Carrier Onboard Delivery
2016-09-01
NAVAL POSTGRADUATE SCHOOL MONTEREY, CALIFORNIA THESIS AERIAL LOGISTICS MANAGEMENT FOR CARRIER ONBOARD DELIVERY by Samuel L. Chen September 2016...AND SUBTITLE AERIAL LOGISTICS MANAGEMENT FOR CARRIER ONBOARD DELIVERY 5. FUNDING NUMBERS 6. AUTHOR(S) Samuel L. Chen 7. PERFORMING ORGANIZATION NAME(S...delivery (COD) is the use of aircraft to transport people and cargo from a forward logistics site (FLS) to a carrier strike group (CSG). The goal of
The Role of Protein Elongation Factor eEF1A2 in Breast Cancer
2006-09-01
apoptosis . A summary of common EMT markers is listed in Table I. Importantly, these developmental regulators can induce EMT in a nondevelopmental...1978; Chen et al., 1997), apoptosis (Chen et al., 1997), and metabolic regulation (Bissell et al., 1977) has been known for decades, the molecular...marks the Spemann organizer in vertebrate gastrulation and is one of the fi rst identifi ed regulators of embryological patterning (De Robertis et al
Hess, Lisa M; Louder, Anthony; Winfree, Katherine; Zhu, Yajun E; Oton, Ana B; Nair, Radhika
2017-06-01
In lung cancer, there is an increasing number of oral agents available for patients; however, little is known about the factors associated with adherence to and treatment duration on oral medications in non-small cell lung cancer (NSCLC). To evaluate the clinical and demographic factors associated with adherence and treatment discontinuation, respectively, to oral oncolytics among patients with NSCLC. A retrospective, claims-based analysis of the Humana Research Database supplemented with medical chart review was conducted among patients with NSCLC who started an oral oncolytic between January 1, 2008, and June 30, 2013. Patients were required to be enrolled at least 1 year before the start of oral oncolytics and have no evidence of any oral oncolytic use during this period. Logistic regression models and Cox proportional hazard models were used to identify predictors associated with medication adherence and treatment duration, respectively. Among all oral oncolytics, only the cohort starting on erlotinib had sufficient sample size (n = 1,452). A wide variety of factors were found to be associated with adherence. Low-income subsidy status, previous use of intravenous chemotherapy, and lower total baseline health care costs were significantly related to decreasing adherence (each P cost was associated with decreasing adherence to erlotinib (P costs (P Company to Comprehensive Health Insights, a Humana company, as a collaborative research project involving employees of both companies. Hess, Winfree, Zhu, and Oton are employees of Eli Lilly and Company. Louder and Nair are employees of Comprehensive Health Insights, which received funding to complete this research. Study concept and design were contributed by Hess, Zhu, Winfree, and Oton. Nair and Louder collected the data, and data interpretation was performed by all the authors. The manuscript was written primarily by Hess, along with Nair, and revised by Hess, Nair, Louder, and Winfree, with assistance from Zhu and
2008-03-01
Navigation System,” Science and Global Security, December 2004, pp. 219-250. 68. Kang Guohua, Liu Jianye, Zhu Yanhua, and Xiong Zhi, “GPS/SST/SINS zuhe...73. Xie Tao, “‘Shen liu’ shenkong fangda ‘hangtian jingji ’” (“‘Shenzhou’ VI Amplifies the ‘Space Economy’”), Zhongguo Hangtian (Aerospace China
1992-05-22
as semiconductor material. Impor- tant applications are thin film solar cells, thin film transistors for liquid crystal displays, photoreceptors for...171, 1989. 307-311 3 T.MINAMI, H.NANTO and S.TAKATA, Thin Solid Films, Vol.124, 1985. 43-47 4 D.Z.DA, F.R.ZHU and H.S.TANG, Acta Energiae Solaris
Retracted: Effect of Paris polyphylla extract on seconddegree burns ...
African Journals Online (AJOL)
2018-01-26
Jan 26, 2018 ... This article previously published in Volume 15 Issue 10 of this journal in October 2016 has been retracted in line with the guidelines from the Committee on Publication Ethics (COPE, http://publicationethics.org/resources/guidelines). Retracted: Ma Z, Yin W, Hu G, Zhu Z, Huang Z. Effect of Paris polyphylla ...
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics. Jain Fang Gui. Articles written in Journal of Genetics. Volume 89 Issue 2 August 2010 pp 163-171 Research Article. Chromosomal localization of rDNA genes and genomic organization of 5S rDNA in Oreochromis mossambicus, O. urolepis hornorum and their hybrid · Hua Ping Zhu Mai ...
Salt tolerance in red clover (Trifolium pratense L.) seedlings
African Journals Online (AJOL)
Jane
2011-08-15
Aug 15, 2011 ... This study was conducted to investigate the effect of salt stress on germination of 28 red clover. (Trifolium pratense ... tolerance with the aim of improving crop plants (Zhu,. 2001) or soil .... The interaction of salinity and population in terms of PI ... in shoot growth is probably due to hormonal signals generated ...
The KdV—Burgers equation in a modified speed gradient continuum model
International Nuclear Information System (INIS)
Lai Ling-Ling; Ge Hong-Xia; Cheng Rong-Jun; Li Zhi-Peng
2013-01-01
Based on the full velocity difference model, Jiang et al. put forward the speed gradient model through the micro-macro linkage (Jiang R, Wu Q S and Zhu Z J 2001 Chin. Sci. Bull. 46 345 and Jiang R, Wu Q S and Zhu Z J 2002 Trans. Res. B 36 405). In this paper, the Taylor expansion is adopted to modify the model. The backward travel problem is overcome by our model, which exists in many higher-order continuum models. The neutral stability condition of the model is obtained through the linear stability analysis. Nonlinear analysis shows clearly that the density fluctuation in traffic flow leads to a variety of density waves. Moreover, the Korteweg-de Vries—Burgers (KdV—Burgers) equation is derived to describe the traffic flow near the neutral stability line and the corresponding solution for traffic density wave is derived. The numerical simulation is carried out to investigate the local cluster effects. The results are consistent with the realistic traffic flow and also further verify the results of nonlinear analysis
Andersen-Ranberg, Johan; Kongstad, Kenneth Thermann; Nafisi, Majse; Staerk, Dan; Okkels, Finn Thyge; Mortensen, Uffe Hasbro; Lindberg Møller, Birger; Frandsen, Rasmus John Normand; Kannangara, Rubini
2017-10-05
Carminic acid is a C-glucosylated octaketide anthraquinone and the main constituent of the natural dye carmine (E120), possessing unique coloring, stability, and solubility properties. Despite being used since ancient times, longstanding efforts to elucidate its route of biosynthesis have been unsuccessful. Herein, a novel combination of enzymes derived from a plant (Aloe arborescens, Aa), a bacterium (Streptomyces sp. R1128, St), and an insect (Dactylopius coccus, Dc) that allows for the biosynthesis of the C-glucosylated anthraquinone, dcII, a precursor for carminic acid, is reported. The pathway, which consists of AaOKS, StZhuI, StZhuJ, and DcUGT2, presents an alternative biosynthetic approach for the production of polyketides by using a type III polyketide synthase (PKS) and tailoring enzymes originating from a type II PKS system. The current study showcases the power of using transient expression in Nicotiana benthamiana for efficient and rapid identification of functional biosynthetic pathways, including both soluble and membrane-bound enzymes. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Massive Star Formation: Accreting from Companion X. Chen1 ...
Indian Academy of Sciences (India)
Abstract. We report the possible accretion from companion in the mas- sive star forming region (G350.69–0.49). This region seems to be a binary system composed of a diffuse object (possible nebulae or UC HII region) and a Massive Young Stellar Object (MYSO) seen in Spitzer IRAC image. The diffuse object and MYSO ...
Mitochondrial genome of Taiwan pig ( Sus Scrofa ) | Chen | African ...
African Journals Online (AJOL)
The purpose of this study is to investigate the complete nucleotide sequence of the mitochondrial genome of the Taiwan Lanyu pig (Sus scrofa) and its phylogenetic relationships with other pig breeds. Thirty-four forward and reverse primers were designed. Sequencing was performed in both directions. The results showed ...
Food Fortification to Prevent and Control Iron Deficiency | Chen ...
African Journals Online (AJOL)
It is essential to prevent the fortification iron from reacting with the absorption inhibitors. To ensure adequate absorption therefore, various factors must be considered before initiating a fortification programme. These include cost effectiveness of fortification in increasing absorbable iron, palatability of the fortified food and the ...
Chemische Reaktionen auf Oberflächen - eine SFG Studie
Kirsch, Harald
2014-01-01
This thesis focused on the investigation of chemical reactions on surfaces by usage of Sum Frequency Generation (SFG) spectroscopy and Thermal Desorption Spectroscopy (TDS). Understanding of chemical reactions on surfaces is of critical importance for modification and optimization of a variety of environmental and industrial processes, but the complexity of the ongoing reactions under "realistic" conditions often hinders an understanding on a molecular level. The aim of this work was to get i...
Existence of positive periodic solution of mutualism system with several delays
International Nuclear Information System (INIS)
Wu Haihui; Xia Yonghui; Lin Muren
2008-01-01
In this paper, by using Mawhin coincidence degree, some sufficient conditions are obtained for the global existence of positive periodic solutions of a mutualism systems with bounded and unbounded delays. Our results generalize significantly improve those of Gopalsamy and He [Gopalsamy K, He XZ. Persistence, attractivity, and delay in facultative mutualism. J Math Anal Appl 1997;215:154-73], Yang et al. [Yang F, Jiang D, Ying A. Existence of positive solution of multidelays facultative mutualism system. J Eng Math 2002;3:64-8], Chen et al. [Chen FD, Shi JL, Chen XX. Periodicity in Lotka-Volterra facultative mutualism system with several delays. J Eng Math 2004;21(3)] and Xia and Lin [Xia YH, Lin M, Existence of positive periodic solution of mutualism system with infinite delays. Ann Diff Eqs 2005;21(3):448-53
Robust anonymous authentication scheme for telecare medical information systems.
Xie, Qi; Zhang, Jun; Dong, Na
2013-04-01
Patient can obtain sorts of health-care delivery services via Telecare Medical Information Systems (TMIS). Authentication, security, patient's privacy protection and data confidentiality are important for patient or doctor accessing to Electronic Medical Records (EMR). In 2012, Chen et al. showed that Khan et al.'s dynamic ID-based authentication scheme has some weaknesses and proposed an improved scheme, and they claimed that their scheme is more suitable for TMIS. However, we show that Chen et al.'s scheme also has some weaknesses. In particular, Chen et al.'s scheme does not provide user's privacy protection and perfect forward secrecy, is vulnerable to off-line password guessing attack and impersonation attack once user's smart card is compromised. Further, we propose a secure anonymity authentication scheme to overcome their weaknesses even an adversary can know all information stored in smart card.
Effect of indole-3-butyric acid (IBA) on in vitro root induction in ...
African Journals Online (AJOL)
ishtiaq
2012-03-08
Mar 8, 2012 ... physiological analyses of photo autotrophic callus cultures of the fern Platycerium coronarium (Koenig) under CO2 enrichment. J. Exp. Bot. 46 (10): 1535-1542. Liu C, Zhu J, Liu Z, Li L, Pan R, Jin L (2002). Exogenous auxin effects on growth and phenotype of normal and hairy roots of Pueraria lobata. (Wild.) ...
Theoretical and Experimental Study of Light Shift in a CPT-Based RB Vapor Cell Frequency Standard
2001-01-01
Questions and Answers ROBERT LUTWAK (Datum): When you servo the microwave power to eliminate the light shift, what do you servo to? To what are you...leveling that signal? MIA0 ZHU: Do you mean what I servo to o r where did I do the servo? LUTWAK : What is the error signal that determines the TR
Using Transverse Optical Patterns for Ultra-Low-Light All-Optical Switching
2008-01-01
opportunities. Michael Stenner was busy writing his thesis when I arrived in the group, but was still willing to help me find my way around and answer my...Lett. 96, 143901 (2006). 162 M. D. Stenner and M. A. Neifeld, Z. Zhu, A. M. C. Dawes, and D. J. Gauthier, Distortion management in slow-light pulse
2010-06-01
... on the Commission's Web site at http://www.ferc.gov . A free Webcast of this event is available... navigating to http://www.ferc.gov 's Calendar of Events and locating this event in the calendar. The event.... Jinxiang Zhu, ABB. Devin Van Zandt, GE. 12:30 p.m Lunch. 1:30 p.m Norm Richardson, Ventyx. John Condren...
Formal matched asymptotics for degenerate Ricci flow neckpinches
International Nuclear Information System (INIS)
Angenent, Sigurd B; Isenberg, James; Knopf, Dan
2011-01-01
Gu and Zhu (2008 Commun. Anal. Geom. 16 467–94) have shown that type-II Ricci flow singularities develop from nongeneric rotationally symmetric Riemannian metrics on S n+1 (n≥2). In this paper, we describe and provide plausibility arguments for a detailed asymptotic profile and rate of curvature blow-up that we predict such solutions exhibit
McGrew, Kevin S.
2010-01-01
The consensus of most intelligence scholars is that the Flynn effect (FE) is real, IQ test batteries are now routinely restandardized on a regular basis. A cornerstone in Flynn's explanation of the FE is his analysis of select Wechsler subtest scores across time. The featured articles by Kaufman and Zhou, Zhu, and Weiss question whether Flynn's…
Transparent and Stretchable High-Performance Supercapacitors Based on Wrinkled Graphene Electrodes
2013-12-18
2, 870–875. 38. Chen, T.; Dai, L. Carbon Nanomaterials for High- Performance Supercapacitors . Mater. Today 2013, 16, 272–280. 39. Stoller, M. D...High-Performance Supercapacitors Based onWrinkledGraphene Electrodes Tao Chen,† Yuhua Xue,† Ajit K. Roy,‡ and Liming Dai†,* †Center of Advanced Science...electrodes and the associated supercapacitor cells cannot be both trans- parent and stretchable.1318 It is highly desirable to integrate the
Wang, Xiaolin; Wang,Qingbing; Li,Jianfeng; An,Sai; Chen,Yi; Jiang,Chen
2015-01-01
Qingbing Wang,1,2 Jianfeng Li,3 Sai An,3 Yi Chen,1 Chen Jiang,3 Xiaolin Wang1,2 1Department of Interventional Radiology, Zhongshan Hospital, Fudan University, 2Shanghai Institute of Medical Imaging, 3Key Laboratory of Smart Drug Delivery, Ministry of Education, Department of Pharmaceutics, School of Pharmacy, Fudan University, Shanghai, People’s Republic of China Background: Gene therapy is a very promising technology for treatment of pancreatic ductal adenocarci...
2013-01-01
Mian BM. Hedgehog Signaling Pathway Activation in Bladder Transitional Cell Carcinoma (TCC). J Urol., 2010, 184(1):344-351. PMID: 20488474 3...Tanner MJ, Welliver RC Jr, Chen M, Shtutman M, Godoy A, Smith G, Mian BM, Buttyan R. Effects of Androgen Receptor and Androgen on Gene Expression in...activities. Proc. Natl. Acad. Sci. USA, 2012, 109(34):13799-804. PMID: 22869755 Manuscripts in Preparation 1. Chen M* (co-first author), Li N*, Carkner
CLEAR: Cross-Layer Exploration for Architecting Resilience
2017-03-01
unavailable, or in an economy mode (low resilience, low power mode) when ABFT is available. However, the overheads outweigh benefits (details in [Cheng 16b...layer r Design, Automation , & Test in Europe, 2010. [Chen 05] Chen, Z. and J. Dong table real number codes based on random m Lecture Notes in...tolerate soft errors in processor c ACM/EDAC/IEEE Design Automation Conf., 2016. [Cheng 16b] Cheng, E., et al. -layer exploration for architecting
Agent Reasoning Transparency: The Influence of Information Level on Automation-Induced Complacency
2017-06-30
automation performance using working memory capacity. Ergonomics . 2014;57(3):295–318. Barber D, Davis L, Nicholson D, Finkelstein N, Chen JYC. The...ELEMENT NUMBER 6. AUTHOR(S) Julia L Wright, Jessie YC Chen, Michael J Barnes, and Peter A Hancock 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK ...Appendix C. Cube Comparisons Test 131 Appendix D. Spatial Orientation Test 135 Appendix E. National Aeronautics and Space Administration-Task Load Index
Directory of Open Access Journals (Sweden)
Yoer Javier Castaño Pareja
2013-01-01
Full Text Available During the fourth presidency of General Tomás Cipriano de Mosquera, the Colom- bian government interfered in a diplomatic incident which apparently violated the neutrality that this country had promised to maintain during the war between Peru and Spain in the 1865-1866 period as a consequence of the Hispanic inva- sion of guano producing islands. In this paper some causes that made a few mem- bers of the Colombian government to decide to support Peru¿s war effort without the consent of Congress are explored. Subsequently, this research identifies the features and characteristics of diplomatic positions that in that time were in con- flict within the Colombian government and that marked the course of diploma- tic relations with the neighbouring countries, in an international political context that was characterized by European invasions on some Latin American territories.
Chen YC; Ho HO; Chiu CC; Sheu MT
2013-01-01
Ying-Chen Chen,1,* Hsiu-O Ho,1,* Chiao-Chi Chiu,1 Ming-Thau Sheu1,2 1School of Pharmacy, College of Pharmacy, Taipei Medical University, 2Clinical Research Center and Traditional Herbal Medicine Research Center, Taipei Medical University Hospital, Taipei, Taiwan*These authors contributed equally to this workAbstract: In this study, alendronate, the most commonly used biphosphonate for treating osteoporosis, was formulated as gastroretentive dosage form (GRDF) tablets to enhance its oral bioav...
Chen,Wei; Ju,Jing; Yang,Yehong; Wang,Hao; Chen,Wenjie; Zhao,Xuelan; Ye,Hongying; Zhang,Yu
2018-01-01
Wei Chen,1 Jing Ju,1 Yehong Yang,2 Hao Wang,3 Wenjie Chen,1 Xuelan Zhao,1 Hongying Ye,2 Yu Zhang1 1Department of Geriatrics, Huashan Hospital, Fudan University, Shanghai, China; 2Department of Endocrinology, Huashan Hospital, Fudan University, Shanghai, China; 3Core Center of Animal Facility, School of Medicine, Fudan University, Shanghai, China Introduction: Diabetic cardiomyopathy is characterized by an imbalance between myocyte death and regeneration mediated by the progressive loss of c...
Reforming China’s Criminal Procedure Law
Winckler, Hugo
2014-01-01
Sources:- Wang Jianxun, “The provisions of the reform of criminal procedural law legalising secret investigations are a step backwards,” Caijing wang, 5 September 2011.- Chen Youxi, “The legalisation of secret investigations is an important violation of political integrity,” Zhongguo wangluo dianshitai – CNTV web site, Opinion section, 27 November 2011.- Wu Zhehua, “Chen Weidong discusses reform of the criminal procedure law: Behind each article there is a story,” Zhongguoguangbo wang, 8 Marc...
Chen, Ming; Anderson, Erik; Hill, Geoffrey; Chen, John J; Patrianakos, Thomas
2015-01-01
Ming Chen,1 Erik Anderson,2 Geoffrey Hill,3 John J Chen,4 Thomas Patrianakos2 1Department of Surgery, University of Hawaii, Honolulu, HI, 2Department of Ophthalmology, John H Stroger, Jr Hospital of Cook County, Chicago, IL, 3Department of Ophthalmology, UT Southwestern Medical Center, Dallas, TX, 4Biostatistics Core, John A Burns School of Medicine, University of Hawaii, Honolulu, HI, USA Purpose: To compare cumulative dissipated energy between two phacoemulsification mac...
Chen, Ming; Sweeney, Henry W; Luke, Becky; Chen, Mindy; Brown, Mathew
2009-01-01
Ming Chen1, Henry W Sweeney2, Becky Luke3, Mindy Chen4, Mathew Brown51University of Hawaii, Honolulu, Hawaii, USA; 2Research Support Services, the Queens Medical Center, Honolulu, Hawaii, USA; 3Surgical Suite, Honolulu, Hawaii, USA; 4University of California, Irvine, CA, USA; 5University of California, San Diego, CA, USAAbstract: Cumulative dissipated energy (CDE) was used with Infiniti® Vision System (Alcon Labs) as an energy delivery guide to compare four different phaco techniques ...
Chen, Ming
2009-01-01
Ming Chen1, Henry W Sweeney2, Becky Luke3, Mindy Chen4, Mathew Brown51University of Hawaii, Honolulu, Hawaii, USA; 2Research Support Services, the Queens Medical Center, Honolulu, Hawaii, USA; 3Surgical Suite, Honolulu, Hawaii, USA; 4University of California, Irvine, CA, USA; 5University of California, San Diego, CA, USAAbstract: Cumulative dissipated energy (CDE) was used with Infiniti® Vision System (Alcon Labs) as an energy delivery guide to compare four different phaco techniques ...
Tung, Li-Chen; Lin, Chin-Kai; Hsieh, Ching-Lin; Chen, Ching-Chi; Huang, Chin-Tsan; Wang, Chun-Hou
2013-01-01
Li-Chen Tung,1,# Chin-Kai Lin,2,# Ching-Lin Hsieh,3,4 Ching-Chi Chen,1 Chin-Tsan Huang,1 Chun-Hou Wang5,6 1Department of Physical Medicine and Rehabilitation, Chi Mei Medical Center, Tainan, 2Program of Early Intervention, Department of Early Childhood Education, National Taichung University of Education, Taichung, 3School of Occupational Therapy, College of Medicine, National Taiwan University, Taipei, 4Department of Physical Medicine and Rehabilitation, National Taiwan University Hospital, ...
Lanthanide metal-organic frameworks
International Nuclear Information System (INIS)
Cheng, Peng
2015-01-01
This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).
Lanthanide metal-organic frameworks
Energy Technology Data Exchange (ETDEWEB)
Cheng, Peng (ed.) [Nankai Univ., Tianjin (China). Dept. of Chemistry
2015-03-01
This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).
Bile acids cycle disruption in patients with nasopharyngeal ...
African Journals Online (AJOL)
2014-12-31
Dec 31, 2014 ... Cite as: Wang C-S, Liu S-H, Peng J, Tang C, Zhu W-G. Bile acids cycle disruption in patients .... stein-Barr virus in the development of nasopharyngeal carcinoma. Chin. J. Cancer 2014; 33(11): 556 PubMed. -568. 2. Mrizak D, Martin N, Barjon C, Jimenez-Pailhes AS,. Mustapha R, Niki T, Guigay J, Pancre V, ...
2001-04-01
généralement nécessite le déploiement d’une ou de plusieurs bouées fonctionnant sur piles pour fournir une passerelle au nœud terrestre . Les conditions...diskreter Prozesse. In Proc. of VDI/ VDE GMA KongreJ Me& und Automa- tisierungstechnik, 1998. [2] A. Biere, A. Cimatti, E. Clarke, and Y. Zhu. Sym- bolic
An Assessment of China’s Anti-Satellite and Space Warfare Programs, Policies and Doctrines
2008-01-19
Zhu Rinzhong, “The Theory of GPS and Methods of Countering It,” Junshi xueshu, May 1999, pp. 5859, in Dean Cheng, “The Chinese Space Program: A 21st...Haijun Xueshu Yanjiu 海军学术研究 Military Economics Research Junshi Jingji Yanjiu 军事经济研究 Modern Military Branches Xiandai Bingzhong 现代兵种 Air Force Logistics
Blood Transcriptomics and Metabolomics for Personalized Medicine
2015-10-31
involved in rheumatoid arthritis . PLoS Comput Biol 2011;7. [100] Zhu J. Stitching together multiple data dimensions reveals interacting metabolomic...capability, detecting N10,000 metabo- lites, together with environmental exposure, dietary intake, microbial activity, and pharmaceutical drugs. Thus...research to clinical care has constantly seen huge disap- pointments. With the accumulation of detailed, information-rich data, human subjects start to
2017-07-01
Clinical Metastases PRINCIPAL INVESTIGATOR: Rosandra Kaplan CONTRACTING ORGANIZATION: The Geneva Foundation Tacoma, WA 98402 REPORT DATE: July 2017...2017 4. TITLE AND SUBTITLE Role of Mesenchymal-Derived Stem Cells in Stimulating Dormant Tumor Cells to Proliferate and Form Clinical Metastases 5a...PRODUCTS: publications, conference papers, and presentations ; Jennifer Zhu submitted an abstract and will present this work at the Annual
Park, Min Sook; He, Zhe; Chen, Zhiwei; Oh, Sanghee; Bian, Jiang
2016-11-24
media datasets shared frequent semantic types such as "Amino Acid, Peptide, or Protein," "Body Part, Organ, or Organ Component," and "Disease or Syndrome." Although the 3 social media datasets vary greatly in size, they exhibited similar conceptual coverage among UMLS source vocabularies and the identified concepts showed similar semantic type distributions. As such, concepts that are both frequently used by consumers and also found in professional vocabularies such as SNOMED CT can be suggested to OAC CHV to improve its coverage. ©Min Sook Park, Zhe He, Zhiwei Chen, Sanghee Oh, Jiang Bian. Originally published in JMIR Medical Informatics (http://medinform.jmir.org), 24.11.2016.
Scattering of plane waves by rough surfaces in the sense of Born approximation
Arnold, Thomas
2014-01-01
Das Thema dieser Arbeit ist die Streuung elektromagnetischer ebener Wellen an rauen Oberflächen, also an ebenen Oberflächen mit glatten und beschränkten Störungen. Darüber hinaus wird ein kleiner Kontrast der Materialkonstanten zwischen dem Deckmaterial und dem Material unter der rauen Oberfläche angenommen. Unter diesen Voraussetzungen wird ein Fernfeld-Formel für das gestreute Feld mit Hilfe von Born-Approximation und Fourier-Techniken hergeleitet. Dieser Ansatz basiert auf einer Modifikati...
Distributed mechatronics controller for modular wall climbing robot
CSIR Research Space (South Africa)
Tlale, NS
2006-07-01
Full Text Available - climbing robot for inspection in nuclear power plants.”, Proc. IEEE Int. Conf. on Robotics and Automation, pp. 409-1414. (Chen 2001) Chen, D-. J., 2001, “Architecture for Systematic Development of Mechatronics Software Systems”, Licentiate Thesis... provide a more cost effective solution to the problem (Luk et al 1991). Such robots are termed service robots by the International Service Robot Association (ISRA) (Pransky 1996). They are defined as machines that sense, think, and act to benefit (or...
Bai,Fang; Yin,You; Chen,Ting; Chen,Jihui; Ge,Meixin; Lu,Yunshu; Xie,Fangyuan; Zhang,Jian; Wu,Kejin; Liu,Yan
2018-01-01
Fang Bai,1–3,* You Yin,4,* Ting Chen,1,* Jihui Chen,1 Meixin Ge,2 Yunshu Lu,2 Fangyuan Xie,5 Jian Zhang,1 Kejin Wu,3 Yan Liu1,6 1Department of Pharmacy, Xinhua Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, 2Department of General Surgery, Xinhua Hospital, Affiliated to Shanghai Jiao Tong University, School of Medicine, Shanghai, 3Department of Breast Surgery, Obstetrics and Gynaecology Hospital, Fudan University, Shanghai, 4Department of Neurology, Changzheng...
Chen,Hong; Xu,Hong; Meng,Yugang; Zhang,Yun; Chen,Junying; Wei,Xiaoning
2016-01-01
Hong Chen,1 Hong Xu,1 Yu-gang Meng,1 Yun Zhang,2 Jun-ying Chen,1 Xiao-ning Wei1 1Department of Gynaecology, The First Affiliated Hospital of Guangxi Medical University, Nanning, Guangxi, 2Department of Gynaecology, The People’s Hospital of Suzhou High Tech District, Suzhou, Jiangsu, People’s Republic of China Background: Uterine leiomyoma is one of the most common benign tumors in women. It dramatically decreases the quality of life in the affected women. However, there ...
Directory of Open Access Journals (Sweden)
Haoyu Liu
2017-03-01
Full Text Available A second species of Qingryllus Chen & Zheng is described and illustrated, Q. jiguanshanensis sp. n., from Sichuan, China. This new species is similar to Q. striofemorus Chen & Zheng, 1995, but differs from the latter by the posterior margin of pronotum being distinctly widened, the veins of tegmina yellowish-white only on lateral side of dorsal area, and the epiphallus distinctly widened posteriorly. A distribution map of the species of this genus and habitus photographs of the new species are presented.
2012-08-06
K2-2 COMPUTATIONAL STUDY OF EXTERNAL FIXATION DEVICES SURFACE HEATING IN 1.5T AND 3T MRI SYSTEMS Yan Liu*1, Jianxiang Shen1, Ji Chen1, Wolfgang...communications have been ex- panding rapidly with the proliferation of consumer wireless devices such as smart phones, tablet PCs, handheld gaming devices, and...Computational Study of External Fixation Devices Surface Heating in 1.5T and 3T MRI Systems Yan Liu* (1) , Jianxiang Shen (1) , Ji Chen (1) , and
Is the Chinese Army the Real Winner in PLA Reforms
2016-10-01
44 Commentary / The Chinese Army and PLA Reforms JFQ 83, 4th Quarter 2016 Is the Chinese Army the Real Winner in PLA Reforms? By Phillip C. Saunders...and John Chen G round force officers run China’s military, the People’s Liberation Army ( PLA ). About 70 percent of PLA soldiers serve in the PLA ...Saunders and Chen 45 services and arms of the PLA ” has meant reductions in “technologically backward” PLAA units and personnel increases for the other
International Nuclear Information System (INIS)
Taherkhani, Farid; Akbarzadeh, Hamed; Feyzi, Mostafa; Rafiee, Hamid Reza
2015-01-01
Molecular dynamics simulation has been implemented for doping effect on melting temperature, heat capacity, self-diffusion coefficient of gold–copper bimetallic nanostructure with 55 total gold and copper atom numbers and its bulk alloy. Trend of melting temperature for gold–copper bimetallic nanocluster is not same as melting temperature copper–gold bulk alloy. Molecular dynamics simulation of our result regarding bulk melting temperature is consistence with available experimental data. Molecular dynamics simulation shows that melting temperature of gold–copper bimetallic nanocluster increases with copper atom fraction. Semi-empirical potential model and quantum Sutton–Chen potential models do not change melting temperature trend with copper doping of gold–copper bimetallic nanocluster. Self-diffusion coefficient of copper atom is greater than gold atom in gold–copper bimetallic nanocluster. Semi-empirical potential within the tight-binding second moment approximation as new application potential model for melting temperature of gold–copper bulk structure shows better result in comparison with EAM, Sutton–Chen potential, and quantum Sutton–Chen potential models
Energy Technology Data Exchange (ETDEWEB)
Taherkhani, Farid, E-mail: faridtaherkhani@gmail.com, E-mail: f.taherkhani@razi.ac.ir [Razi University, Department of Physical Chemistry (Iran, Islamic Republic of); Akbarzadeh, Hamed [Hakim Sabzevari University, Department of Chemistry (Iran, Islamic Republic of); Feyzi, Mostafa; Rafiee, Hamid Reza [Razi University, Department of Physical Chemistry (Iran, Islamic Republic of)
2015-01-15
Molecular dynamics simulation has been implemented for doping effect on melting temperature, heat capacity, self-diffusion coefficient of gold–copper bimetallic nanostructure with 55 total gold and copper atom numbers and its bulk alloy. Trend of melting temperature for gold–copper bimetallic nanocluster is not same as melting temperature copper–gold bulk alloy. Molecular dynamics simulation of our result regarding bulk melting temperature is consistence with available experimental data. Molecular dynamics simulation shows that melting temperature of gold–copper bimetallic nanocluster increases with copper atom fraction. Semi-empirical potential model and quantum Sutton–Chen potential models do not change melting temperature trend with copper doping of gold–copper bimetallic nanocluster. Self-diffusion coefficient of copper atom is greater than gold atom in gold–copper bimetallic nanocluster. Semi-empirical potential within the tight-binding second moment approximation as new application potential model for melting temperature of gold–copper bulk structure shows better result in comparison with EAM, Sutton–Chen potential, and quantum Sutton–Chen potential models.
Geotourism Aspects of the Lufeng Dinosaur National Geopark in Yunnan Province, China
Directory of Open Access Journals (Sweden)
Daněk Tomáš
2016-03-01
Full Text Available The Lufeng Dinosaur National Geopark in Yunnan province, China, is important part of geoheritage with a great scientific and aesthetic value. The area has been under scientific research since 1938 when the first dinosaur fossils were discovered here by geologist Bian Meinian and technician Wang Cunyi. Professor Yang announced the discovery of new early Jurassic herbivore prosauropod by Lufeng in 1941, which he gave the name Lufengosaurus huenei. In 2004, the area was listed as the China`s National Geopark. It was opened for visitors in 2008. Besides the high scientific value, the geopark is also an important resource for science based and educational tourism. This paper briefly introduces the history of scientific research, the basic geology of the site and the most important fossils discovered here. The main characteristics, geodiversity, and geotourism of fossil geoheritage in the area are discussed here.
Li, Feng; Chen, Yan; Liu, Shubo; Qi, Jian; Wang, Weiying; Wang, Chenhua; Zhong, Ruiyue; Chen, Zhijun; Li, Xiaoming; Guan, Yuanzhou; Kong, Wei; Zhang, Yong
2017-01-01
Feng Li,1 Yan Chen,1,2 Shubo Liu,1 Jian Qi,1 Weiying Wang,1 Chenhua Wang,1 Ruiyue Zhong,1 Zhijun Chen,1 Xiaoming Li,1 Yuanzhou Guan,1 Wei Kong,1,2 Yong Zhang1,2 1National Engineering Laboratory for AIDS Vaccine, School of Life Sciences, Jilin University, Changchun, 2Key Laboratory for Molecular Enzymology and Engineering, the Ministry of Education, School of Life Sciences, Jilin University, Changchun, China Abstract: Zein-based nano/microparticles have been demonstrated to be promising carr...
International Nuclear Information System (INIS)
Hu Manfeng; Xu Zhenyuan; Zhang Rong; Hu Aihua
2007-01-01
Based on the active control idea and the invariance principle of differential equations, a general scheme of adaptive full state hybrid projective synchronization (FSHPS) and parameters identification of a class of chaotic (hyper-chaotic) systems with linearly dependent uncertain parameters is proposed in this Letter. With this effective scheme parameters identification and FSHPS of chaotic and hyper-chaotic systems can be realized simultaneously. Numerical simulations on the chaotic Chen system and the hyper-chaotic Chen system are presented to verify the effectiveness of the proposed scheme
2013-10-01
Wu K, Wang L, Jiao X, Ju X, Li Z, Ertel A, Addya S, McCue P, Lisanti MP, Wang C, Davis RJ, Mardon G, Pestell RG. Androgen therapy resistant...Li Z, Hu J, Chen K, Wu J, Pestell RG. DACH1 inhibited prostate cancer cellular proliferation and Interleukon-6 signaling. AACR 103rd Annual Meeting...March 31 – April 4, 2012, Chicago, IL. Wang J, Cai S, Chen K, Sun Y, Li S, Pestell RG, Wu K. Regulation of AR transcriptional activity and
Directory of Open Access Journals (Sweden)
Martha C. Martínez Quintanilla
2017-04-01
Full Text Available Existen organismos silvestres que son altamente vulnerables ante estresores antropogénicos y naturales, estos organismos pueden ser de utilidad para evaluar la salud ambiental mediante diferentes indicadores confiables, sencillos, rápidos, económicos para determinar y si es posible reducir estos efectos negativos. En este estudio proponemos al ganso nevado (Chen caerulescens como posible biomonitor de estrés y genotóxicos ambientales mediante la relación heterófilo/linfocito (H/L, la prueba de micronúcleos (EMN, prolongaciones nucleares en eritrocitos (EPN y eritrocitos policromáticos (EPC. Durante la temporada de caza (2012-2013 en el humedal de Málaga, Durango, México, colectamos 18 organismos. Los eritrocitos fueron las células más abundantes, de núcleo y morfología elípticos, de tamaño 12.68 ± 0.89 µm. Observamos heterófilos (11.07±1.32 µm, eosinófilos (9.67±1.26 µm, basófilos (5.75 ± 0.78 µm, monocitos (10.49±1.36 µm y linfocitos (6.53±1.0 µm. No identificamos alteración en las proporciones ni en la morfología de leucocitos, sin embargo, es necesario un mayor número de organismos para establecer los parámetros sanguíneos de base normal para esta especie. La relación h/l fue de 0.41 ± 0.11 este valor es similar a lo reportado para esta y otras especies de aves consideradas como sanas. Establecimos la frecuencia basal de EMN (2.6±1.45, epn (249.2 ± 89.74 y EPC (156.5 ± 50. El ganso nevado es un organismo que se perfila como buen candidato a biomonitor ambiental debido a la frecuencia basal de su relación H/L, EMN, EPN y EPC, pero debe probarse en condiciones estandarizadas y a través de estudios en zonas con y sin contaminación.
Advanced Optical Technologies for Defense Trauma and Critical Care
2017-03-12
and characterizing full upper airway of obstructive sleep apnea patients supported by NIH grants. Student Theses: None Project 5: Fiberoptic...technique permits unprecedented non-disruptive evaluation of wound biofilm behavior including tissue invasion. Student Theses: Towards in vivo...signaling on factor assemblies at DNA damage sites. Nucleic Acids Research, 2015 1 doi: 10.1093/nar/gkv976 5. Ferraro-Gideon, J., Sheykhani, R., Zhu
JPRS Report, Science & Technology. China: Energy
1992-01-28
Rural Power Industry Has Record Year [CHINA DAILY (National), 8 Jan 92] 4 Achievements in Energy Conservation and Future Tasks [ Zhu ...Development Targets Detailed [Yuan Changlong; GUIZHOU RIBAO, 23 Sep 91] 21 Another Power Crunch in Zhejiang Province [Xie Ranhao; JINGJI RIBAO, 7 Dec 91...OVERSEAS EDITION, 20 Dec 91] 25 THERMAL POWER Shenhai Plant Completed, Generating Power [ JINGJI RIBAO, 27 Dec 92] 26 Jiangyou Power Plant
Beyond the Strait: PLA Missions Other Than Taiwan
2009-04-01
PLA Logistics and Command College, “China’s Peaceful Development and the PLA’s Historical Mission,” Junshi Jingji Yanjiu (Military Economics...Chubanshe, 2005, pp. 117-126, 163-172; Zhu Tingzhang, Zhongguo Zhoubian Anquan Huanjing yu Zhanlue (China’s Peripheral Security Environment and...on the Construction of Gas Pipelines in Central Asia”), Guoji Shiyou Jingji (International Petroleum Economics), Vol. 16, No. 2, 2008, www.cnki.net
Retracted: Effect of Paris polyphylla extract on second- degree burns ...
African Journals Online (AJOL)
2018-01-26
Jan 26, 2018 ... Retracted: Ma Z, Yin W, Hu G, Zhu Z, Huang Z. Effect of Paris polyphylla extract on second-degree burns in rats. Trop J Pharm Res 2016; 15(10):2131-2135 doi: http://dx.doi.org/10.4314/tjpr.v15i10.11. From the Editor. Our attention was drawn to the falsification of the data published in this article which was ...
Signaling Pathways that Mediate Neurotoxin-Induced Death of Dopamine Neurons
2008-11-01
2001), and prion encephalopathies (Boel- laard et al., 1991; Liberski et al., 2002). Nutrient deprivation, including withdrawal of serum (Mitchener...2001), prion encephalopathies (Boellaard et al., 1991; Jeffrey et al., 1992), and diffuse Lewy body disease (Zhu et al., 2003). Extensive cytoplasmic...tor receptor levels using antisense oligonucleotides prevents the loss of axotomized sensory neurons in the dorsal root ganglia of newborn rats. J
Mobile point-of-care monitors and diagnostic device design
Karlen, Walter
2014-01-01
PrefaceEditorsContributorsSensors and SystemsInterfacing Diagnostics with Consumer ElectronicsPakorn Preechaburana, Anke Suska, and Daniel FilippiniLab on a CellphoneAhmet F. Coskun, Hongying Zhu, Onur Mudanyali, and Aydogan OzcanThe Phone OximeterChristian Leth PetersenCurrent Technology and Advances in Transepidermal Water Loss SensorsPietro Salvo, Bernardo Melai, Nicola Calisi, and Fabio Di FrancescoPortable High-Frequency Ultrasound Imaging System Design and Hardware Considerations
2017-07-01
Clinical Metastases PRINCIPAL INVESTIGATOR: Jeffrey Green CONTRACTING ORGANIZATION: The Geneva Foundation Tacoma, WA 98402 REPORT DATE: July 2017 TYPE...2016 - 14 June 2017 4. TITLE AND SUBTITLE Role of Mesenchymal-Derived Stem Cells in Stimulating Dormant Tumor Cells to Proliferate and Form Clinical ...and/or select agents. Nothing to report. 6. PRODUCTS: • publications, conference papers, and presentations ; Jennifer Zhu submitted an abstract and will
Cui, Y.; Shao, L.; Qiao, P.
2017-12-01
Geochemistry analysis and detrital zircon U-Pb geochronology aim to fully investigate the "source to sink" patterns of northern South China Sea (SCS) from Eocene to Miocene. Evolutional history of the surrounding drainage system has been highly focused on, in comparison to sedimentary characteristics of the SCS basins. Rapid local provenances were prevailed while large-scale fluvial transport remained to evolve during Eocene. Since early Oligocene, sediments from the South China were more abundantly delivered to the northeastern Pearl River Mouth Basin in addition to Dongsha volcanism supplement. Aside from intrabasinal provenances, long-distance transport started to play significant role in Zhu1 Depression, possibly reaching western and southern Baiyun Sag, partially. Western Qiongdongnan Basin might accept sediments from central Vietnam with its eastern area more affected from Hainan Island and Southern Uplift. In the late Oligocene, due to drastic sea-level changes and rapid exhumation, mafic to altramafic sediments were transported in abundance to Central Depression from Kontum Massif, while multiple provenances casted integrated influence on eastern sedimentary sequences. Southern Baiyun Sag was also affected by an increased supplement from the west Shenhu Uplift or even central Vietnam. Overall pattern did not change greatly since early Miocene, but long-distance transport has become dominant in the northern SCS. Under controlled by regional tectonic cycles, Pearl River gradually evolved into the present scale and exerted its influence on basinal provenances by several stages. Zhu1 Depression was partially delivered sediments from its tributaries in early Oligocene while northern Zhu2 Depression has not been provided abundant materials until late Oligocene. Meanwhile, although detailed transportation routine remains uncertain and controversial, an impressive paleo-channel spanning the whole Qiongdongnan Basin was presumed to supply huge amount of mafic to
A Brief Introduction of Air Traffic Management
Institute of Scientific and Technical Information of China (English)
1997-01-01
Air Traffic Management (ATM) started publication in 1995 by Air Traffic Management Bureau of CAAC. It is the first magazine about ATM field in CAAC. The chairman of Editorial Board of ATM is Mr. Bao Peide, Vice Minister of CAAC. Mr. Chen Ziye, Vice President of the 1st Research Institute of CAAC and Chen Xuhua, General Director of Air Traffic Management Bureau are vice chairmen of the editorial board, and six general directors of local air traffic management bureau and some professors and experts are members of the editorial board.
A glimpse into the littoral nutrient dynamics of a lake system connected to the sea
CSIR Research Space (South Africa)
Taljaard, Susan
2018-01-01
Full Text Available -situ sources are those situated in the floodplains of water bodies such as septic tank systems from low-lying developments (e.g. Chen, 1988; Fraterrigo and Downing, 2008). The smaller, dynamic and more linear nature of over 80% of South Africa’s estuaries... of agricultural watersheds in central Navarre (Spain). Agric. Water Manage. 95 1111–1128. https://doi.org/10.1016/j.agwat.2008.06.013 CHEN M (1988) Pollution of ground water by nutrients and fecal coliforms from lakeshore septic tank systems. Water Air Soil...
清末民初における『レ・ミゼラブル』の移入と日本 : 陳景韓訳「哀史之一節逸犯」を例として
梁, 艶; Liang, Yan
2011-01-01
Victor Hugo was introduced into China through his Japanese translations. However, the route of the reception of his masterpiece Les Misérables in China has not yet been explained clearly. In this paper, I will take Ai Shi Zhi Yi Jie Yi Fan, a Chinese translation by Chen Jinghan of a part of Les Misérables, as an example to see how Les Misérables was introduced into China. By examining Japanese translations of Les Misérables, I come to the conclusion that Chen was influenced by Kuroiwa Ruikô's...
The Secret of Guided Missile Re-Entry,
1986-06-25
I RD-PAI169 598 THE SECRET OF GUIDED MISSILE RE-ENTRY(U) FOREIGN / I TECHNOLOGY DIV NRIGHT-PATTERSON RFB OH J CHEN ET AL. I 25 JUN 96 FTD-ID(RS)T...TECHNOLOGY DIVISION THE SECRET OF GUIDED MISSILE RE-ENTRY by Chen Jingzhong, An Sehua J L 0 7 ’:;85’ ’ 0 *Approved for public release; Distribution...unlimite t d. :. 86 7 034.. FTD- ID(RS)T-0459-86 HUMAN TRANSLATION FTD-ID(RS)T-0459-86 25 June 1986 MICROFICHE NR: F - - 0Q 9? THE SECRET OF GUIDED
Initiation and Propagation of Coronal Mass Ejections P. F. Chen
Indian Academy of Sciences (India)
Introduction. Coronal mass ejections (CMEs) have been observed for over 30 years. They keep being an intriguing research topic, not only because they are now realized to be the major driver for space weather disturbances, which are intimately connected to human activities, but also because they themselves are full of ...
Die Beifuß-Ambrosie auf Ackerflächen - ein Problem?
Directory of Open Access Journals (Sweden)
Verschwele, Arnd
2014-07-01
Full Text Available Common ragweed (Ambrosia artemisiifolia is spreading on agricultural fields in Germany, mainly in Brandenburg and Bayern. Competitive crops like winter cereals and oilseed-rape can reduce growth of this plant better than spring crops. In maize or cereals a chemical control is possible, but problems may arise because of the late emergence of ragweed and its high ability to regrowth. In crops like sunflower or lupines herbicide choice is limited and thus preventive control measures are crucial. An integrated approach is needed in order to avoid yield losses and to stop the spreading of ragweed in Germany.
Diskrepanz: Die EU-Frauenpolitik zwischen Deregulierung und Gleichheitsansprüchen
Directory of Open Access Journals (Sweden)
Ingrid Biermann
2003-03-01
Full Text Available In von neun Autorinnen verfassten Beiträgen gibt der Band Einblicke in zentrale Felder der EU-Politik: die europäische Wirtschafts- und Währungsunion (EWWU, die Strukturpolitik, die Gleichstellungspolitik und das Gender Mainstreaming, die Osterweiterung sowie die Ausarbeitung einer europäischen Verfassung. Damit werden wesentliche Teile des Maastricht-Vertrags (1992, des Amsterdamer Vertrags (1997 und des Nizza-Vertrags (2000 behandelt. Hierdurch bildet dieser Band eine wichtige Grundlage für die Diskussion über die Frauenpolitik der EU.
Analysis of a SCADA System Anomaly Detection Model Based on Information Entropy
2014-03-27
Gerard, 2005:3) The NTSB report lists alarm management as one of the top five areas for improvement in pipeline SCADA systems (Gerard, 2005:1...Zhang, Qin, Wang, and Liang for leak detection in a SCADA -run pipeline system. A concept derived from information theory improved leak detection...System for West Products Pipeline . Journal of Loss Prevention in the Process Industries, 22(6), 981-989. Zhu, B., & Sastry, S. (2010). SCADA
Glucocorticoid Receptor-Mediated Repression of Pro-Inflammatory Genes in Rheumatoid Arthritis
2015-10-01
Braun TP, Zhu X, Szumowski M, Scott GD, Grossberg AJ, et al. 2011. Central nervous system inflam - mation induces muscle atrophy via activation of the...glucocorticoid receptor and nutritional sensor mTOR in skeletal muscle . Cell Metab. 13:170–82 133. Lutzner N, Kalbacher H, Krones-Herzig A, Rosl F. 2012...suggestions for reducing this burden to Department of Defense, Washington Headquarters Services, Directorate for Information Operations and Reports (0704
1987-07-17
Yuhua Guan, Gillian C. Lynch and Donald L. Thompson Department of Chemistry, Oklahoma State University, Stillwater, OK 74078 Classical trajectories...P20 PHOTOFRAGMrTATION OF ALKYL IODIDES -- Photofragmentation Channels and Energy Partitioning of the Fragments Qihe Zhu, Shouling Huang, J.R. Cao , Ye...Chemistry (314) 553-5344 Upton, NY 11973 (516) 282-4348 Dr. William L. Hase Wayne State University Dr. Yuhua Guan 435 Chemistry Department of Chemistry
Resilient Control and Intrusion Detection for SCADA Systems
2014-05-01
Lowe. The myths and facts behind cyber security risks for industrial control systems . VDE Congress, 2004. [45] I. S. C37.1-1994. Ieee standard...Resilient Control and Intrusion Detection for SCADA Systems Bonnie Xia Zhu Electrical Engineering and Computer Sciences University of California at...3. DATES COVERED 00-00-2014 to 00-00-2014 4. TITLE AND SUBTITLE Resilient Control and Intrusion Detection for SCADA Systems 5a. CONTRACT
Journey Through Statistical Mechanics
Yang, C. N.
2013-05-01
My first involvement with statistical mechanics and the many body problem was when I was a student at The National Southwest Associated University in Kunming during the war. At that time Professor Wang Zhu-Xi had just come back from Cambridge, England, where he was a student of Fowler, and his thesis was on phase transitions, a hot topic at that time, and still a very hot topic today...
China Report, Economic Affairs, No. 369
1983-08-03
Transportation Capacity Urged (SHIJIE JINGJI DAOBAO, 9 May 83) .. h2 Briefs Shandong Containerized Traffic ^ GENERAL Function of -Year Patent" During...forum on economic work attended by responsible comrades of all prefectures and cities, Vice Governor Zhu Kui put forward five views on the question...TRANSPORTATION GREAT INCREASE IN TRANSPORTATION CAPACITY URGED Shanghai SHIJIE JINGJI DAOBAO in Chinese 9 May 83 P 1 [Article: "Disseminate Widely Used New
DEREGULATION, FINANCIAL CRISIS, AND BANK EFFICIENCY IN TAIWAN: AN ESTIMATION OF UNDESIRABLE OUTPUTS
Liao, Chang-Sheng
2018-01-01
Purpose- This study investigates the undesirable impacts of outputson bank efficiency and contributes to the literature by assessing howregulation policies and other events impact bank efficiency in Taiwan inregards to deregulation, financial crisis, and financial reform from 1993 to2011. Methodology- In order to effectively deal with both undesirableand desirable outputs, this study follows Seiford and Zhu (2002), who recommendusing the standard data envelopment analysis model to measure per...
Optimum profit model considering production, quality and sale problem
Chen, Chung-Ho; Lu, Chih-Lun
2011-12-01
Chen and Liu ['Procurement Strategies in the Presence of the Spot Market-an Analytical Framework', Production Planning and Control, 18, 297-309] presented the optimum profit model between the producers and the purchasers for the supply chain system with a pure procurement policy. However, their model with a simple manufacturing cost did not consider the used cost of the customer. In this study, the modified Chen and Liu's model will be addressed for determining the optimum product and process parameters. The authors propose a modified Chen and Liu's model under the two-stage screening procedure. The surrogate variable having a high correlation with the measurable quality characteristic will be directly measured in the first stage. The measurable quality characteristic will be directly measured in the second stage when the product decision cannot be determined in the first stage. The used cost of the customer will be measured by adopting Taguchi's quadratic quality loss function. The optimum purchaser's order quantity, the producer's product price and the process quality level will be jointly determined by maximising the expected profit between them.
Choi, Younsung; Nam, Junghyun; Lee, Donghoon; Kim, Jiye; Jung, Jaewook; Won, Dongho
2014-01-01
An anonymous user authentication scheme allows a user, who wants to access a remote application server, to achieve mutual authentication and session key establishment with the server in an anonymous manner. To enhance the security of such authentication schemes, recent researches combined user's biometrics with a password. However, these authentication schemes are designed for single server environment. So when a user wants to access different application servers, the user has to register many times. To solve this problem, Chuang and Chen proposed an anonymous multiserver authenticated key agreement scheme using smart cards together with passwords and biometrics. Chuang and Chen claimed that their scheme not only supports multiple servers but also achieves various security requirements. However, we show that this scheme is vulnerable to a masquerade attack, a smart card attack, a user impersonation attack, and a DoS attack and does not achieve perfect forward secrecy. We also propose a security enhanced anonymous multiserver authenticated key agreement scheme which addresses all the weaknesses identified in Chuang and Chen's scheme.
Directory of Open Access Journals (Sweden)
Ma X
2015-09-01
Full Text Available Xiao Ma,1,2 Yan-ling Zhao,2 Yun Zhu,3 Zhe Chen,1,2 Jia-bo Wang,4 Rui-yu Li,1,4 Chang Chen,1,2 Shi-zhang Wei,1,2 Jian-yu Li,3 Bing Liu,5 Rui-lin Wang,3 Yong-gang Li,3 Li-fu Wang,3 Xiao-he Xiao4 1Pharmacy College, Chengdu University of Traditional Chinese Medicine, Chengdu, People’s Republic of China; 2Department of Pharmacy, 302 Military Hospital of People’s Liberation Army, Beijing, People’s Republic of China; 3Department of Integrative Medical Center, 302 Military Hospital of People’s Liberation Army, Beijing, People’s Republic of China; 4China Military Institute of Chinese Medicine, 302 Military Hospital of People’s Liberation Army, Beijing, People’s Republic of China; 5School of Chinese Medicine, The University of Hong Kong, Hong Kong Background: Paeonia lactiflora Pall. (PLP, a traditional Chinese herbal medicine, has been used for hepatic disease treatment over thousands of years. In our previous study, PLP was shown to demonstrate therapeutic effect on hepatitis with severe cholestasis. The aim of this study was to evaluate the antioxidative effect of PLP on alpha-naphthylisothiocyanate (ANIT-induced cholestasis by activating NF-E2-related factor 2 (Nrf2 via phosphatidylinositol 3-kinase (PI3K/Akt signaling pathway. Materials and methods: Liquid chromatography-mass spectrometry (LC-MS was performed to identify the main compounds present in PLP. The mechanism of action of PLP and its therapeutic effect on cholestasis, induced by ANIT, were further investigated. Serum indices such as total bilirubin (TBIL, direct bilirubin (DBIL, aspartate aminotransferase (AST, alanine aminotransferase (ALT, alkaline phosphatase (ALP, γ-glutamyl transpeptidase (γ-GT, and total bile acid (TBA were measured, and histopathology of liver was also performed to determine the efficacy of treatment with PLP. Moreover, in order to illustrate the underlying signaling pathway, liver glutathione (GSH content and mRNA or protein levels of glutamate
International Symposium on Scientific Computing, Computer Arithmetic and Validated Numerics
DEVELOPMENTS IN RELIABLE COMPUTING
1999-01-01
The SCAN conference, the International Symposium on Scientific Com puting, Computer Arithmetic and Validated Numerics, takes place bian nually under the joint auspices of GAMM (Gesellschaft fiir Angewandte Mathematik und Mechanik) and IMACS (International Association for Mathematics and Computers in Simulation). SCAN-98 attracted more than 100 participants from 21 countries all over the world. During the four days from September 22 to 25, nine highlighted, plenary lectures and over 70 contributed talks were given. These figures indicate a large participation, which was partly caused by the attraction of the organizing country, Hungary, but also the effec tive support system have contributed to the success. The conference was substantially supported by the Hungarian Research Fund OTKA, GAMM, the National Technology Development Board OMFB and by the J6zsef Attila University. Due to this funding, it was possible to subsidize the participation of over 20 scientists, mainly from Eastern European countries. I...
THE DEMOBILIZATION OF TWO ILLEGAL ARMED GROUPS: ANALYSIS OF THE COVERAGE BY NATIONAL PRESS
Directory of Open Access Journals (Sweden)
Yeny Serrano
2012-12-01
Full Text Available Given the start of new peace talks between the FARC guerrillas and the Colom-bian government, it is crucial to understand the role of Colombian journalists in reporting peace and war.This article presents an analysis on the National Press coverage of the demobilizations of a paramilitary group (Bloque Cacique Nutibara and a section of the FARC guerrillas (BloqueCacicaGaitana within a frame that reflects over the ethical practice of journalism in the context of war. The results are consistent with literature arguing that ethical codes are not documents dictating how journalists should do their job, but rather they repre-sent political acts of communication which allow journalists to reclaim their prof-fessional independence from sources and defend themselves from threats. The paper also discusses the apparent tension between journalism ethics, and the barriers imposed by the media´s informational needs and the strategic military aims of armed groups.
[A review for a traditional Chinese medical journal Shou Shi Yi Bao].
Xiao, Mei-Hua; Sun, Wen-Zhong
2009-06-01
Shou Shi Yi Bao was a journal of traditional Chinese medicine (TCM) during the period from 1935 to 1937, and was originated by Chen Huan-yun, a TCM physician in Suzhou. It is mainly to transmit the knowledge of TCM and to promote the epidemic prevention capacity of local public. The editorial characteristics and historical value of the journal were explored in initial background, staff writers, editorial policies, contents and the Editor Chen's medical ideas. Shou Shi Yi Bao was supported by many famous TCM physicians, although the journal was originated from the civil society. It was an academic TCM journal with perfect practicability for orientating to the public and highlighting the academic spirit. Chen Huan-yun was a resolute defender of TCM, and had many opinions on clinical practice and lots of scientific suggestions on TCM development. Shou Shi Yi Bao reflected the main characteristics of TCM journals in 1930s. The journal was one of the important documents to study the TCM history during the period of the Republic of China in Jiangsu Province, and it also set a stage for the struggle between TCM and Western medicine at that time. The documentary information of the journal has literature and history values in reflecting the historical process of TCM self-improvement. The success of the journal was due to not only the broken-up sectarian bias and cooperation of the TCM practitioners but also the preponderant geographic and cultural circumstances of Suzhou as well as Chen Huan-yun's profound knowledge in traditional Chinese culture and medicine.
Directory of Open Access Journals (Sweden)
Yu H
2017-06-01
Full Text Available Hongliang Yu,1 Dong Pei,2 Longyun Chen,2 Xiaoxiang Zhou,2 Haiwen Zhu2 1Department of Radiation Oncology, Jiangsu Cancer Hospital and Jiangsu Institute of Cancer Research, The Affiliated Cancer Hospital of Nanjing Medical University, Nanjing, 2Department of Radiation Oncology, Yancheng Third People’s Hospital, Yancheng, Jiangsu, People’s Republic of China Background: Dedifferentiated liposarcoma (DDLPS is one of the most deadly types of soft tissue sarcoma. To date, there have been few studies dedicated to elucidating the molecular mechanisms behind the disease; therefore, the molecular mechanisms behind this malignancy remain largely unknown.Materials and methods: Microarray profiles of 46 DDLPS samples and nine normal fat controls were extracted from Gene Expression Omnibus (GEO. Quality control for these microarray profiles was performed before analysis. Hierarchical clustering and principal component analysis were used to distinguish the general differences in gene expression between DDLPS samples and the normal fat controls. Differentially expressed genes (DEGs were identified using the Limma package in R. Next, the enriched Gene Ontology (GO terms and Kyoto Encyclopedia of Genes and Genomes (KEGG pathways were obtained using the online tool DAVID (http://david.abcc.ncifcrf.gov/. A protein–protein interaction (PPI network was constructed using the STRING database and Cytoscape software. Furthermore, the hub genes within the PPI network were identified.Results: All 55 microarray profiles were confirmed to be of high quality. The gene expression pattern of DDLPS samples was significantly different from that of normal fat controls. In total, 700 DEGs were identified, and 83 enriched GO terms and three KEGG pathways were obtained. Specifically, within the DEGs of DDLPS samples, several pathways were identified as being significantly enriched, including the PPAR signaling pathway, cell cycle pathway, and pyruvate metabolism pathway
Study of acupuncture for low back pain in recent 20 years: a bibliometric analysis via CiteSpace
Directory of Open Access Journals (Sweden)
Liang YD
2017-04-01
Full Text Available Yu-Dan Liang,1,* Ying Li,1,* Jian Zhao,2 Xiao-Yin Wang,3 Hui-Zheng Zhu,1 Xiu-Hua Chen1 1The Second Clinical Medical College of Guangzhou University of Chinese Medicine, Guangzhou, 2Longgang District People’s Hospital of Shenzhen, Shenzhen, 3Guangdong Second Traditional Chinese Medicine Hospital, Guangzhou, People’s Republic of China *These authors contributed equally to this work Background: Acupuncture has been applied to relieve low back pain (LBP in many countries. However, a bibliometric analysis of the global use of acupuncture for LBP is rare.Objective: The aim of this study was to demonstrate the state of the art and trends concerning the global use of acupuncture for LBP in recent 20 years.Methods: Literature relating to acupuncture for LBP from 1997 to 2016 was retrieved from Web of Science. CiteSpace was used to analyze country/institution, cited journals, authors/cited authors, cited references, and keywords. An analysis of counts and centrality was used to reveal publication outputs, countries/institutions, core journals, active authors, foundation references, hot topics, and frontiers.Results: A total of 958 references were obtained, and the total number of publications continually increased over the investigated period. Journal articles (662 were the most frequently occurring document type. The most productive country and institution in this field was the USA (342 and Harvard University (47, respectively. The J Altern Complem Med (69 was the most productive journal, and Pain (636 was the most cocited journal, which reflected the nature of the research. The Haake’s (2007 article (cocitation counts: 130 and the Cherkin’s (2001 article (centrality: 0.59 were the most representative and symbolic references, with the highest cocitation number and centrality, respectively. Cherkin was the most influential author, with the highest number of publications of 25 and a cocitation number of 226. The four hot topics in acupuncture for
Directory of Open Access Journals (Sweden)
Xu YW
2016-05-01
Full Text Available Yawen Xu,* Shaobo Zheng,* Binshen Chen, Yong Wen, Shanwen Zhu Department of Urology, Zhujiang Hospital, Southern Medical University, Guangzhou, People’s Republic of China *These authors contributed equally to this work Background: Prostate cancer (PCa is a leading cause of cancer-related death in men. Sodium phenylbutyrate (SPB has shown its potential as an anticancer therapy in numerous cancer types. In the present study, we attempted to assess the effect of SPB against PCa and whether this treatment was associated with the regulation of survivin. Methods: Two human PCa cancer cell lines, DU145 and PC3, were used in the present study. Cell Counting Kit-8 (CCK-8 assay was conducted to measure the proliferation of PCa cells incubated with SPB. The effect of SPB on the cell apoptosis, cell colony formation ability, and cell morphological change was also assessed. Transwell experiment and Western blotting assay were performed to determine the effect of SPB on the migration and invasion ability of both cell types. Moreover, the expression pattern of survivin and MAPK members in both cell types after the treatment of SPB was also detected. Additionally, an in vivo tumor formation assay was performed to evaluate the treatment potential of SPB against PCa. Results: We found that the viability of PCa cells was significantly inhibited by SPB treatment. As illustrated by flow cytometry, for DU145 cell line the average apoptotic rate of SPB-treated cells was significantly lower than that of the control group (P<0.05; similar results were also seen for PC3 (P<0.05. SPB administration also attenuated the colony formation and migration abilities in both cell lines. The expression level of survivin in SPB-treated cells was significantly downregulated, while the phosphorylation of p-38 and ERK was enhanced. Furthermore, in vivo tumor formation of both cell lines was suppressed by SPB as well. Conclusion: The above results confirmed the potential of SPB as an
Directory of Open Access Journals (Sweden)
Gao YH
2018-01-01
Full Text Available Yong-hua Gao,1,* Wei-jie Guan,2,* Ya-nan Zhu,3 Rong-chang Chen,2 Guo-jun Zhang1 1Department of Respiratory and Critical Care Medicine, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan, 2State Key Laboratory of Respiratory Disease, National Clinical Research Center for Respiratory Disease, Guangzhou Institute of Respiratory Diseases, The First Affiliated Hospital of Guangzhou Medical University, Guangzhou, Guangdong, 3Department of Emergency Medicine, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan, People’s Republic of China *These authors contributed equally to this work Background and aims: Pseudomonas aeruginosa (PA is the most common pathogen in bronchiectasis and frequently develops resistance to multiple classes of antibiotics, but little is known about the clinical impacts of PA-resistant (PA-R isolates on bronchiectasis. We, therefore, investigated the prevalence, risk factors and prognostic implications of PA-R isolates in hospitalized bronchiectasis patients.Patients and methods: Between June 2011 and July 2016, data from adult bronchiectasis patients isolated with PA at the First Affiliated Hospital of Zhengzhou University were retrospectively analyzed. PA was classified as PA-R in case antibiogram demonstrated resistance on at least one occasion.Results: Seven hundred forty-seven bronchiectasis patients were assessed. Of these, 147 (19.7% had PA isolate in the sputum or bronchoscopic culture. PA-R and PA-sensitive accounted for 88 (59.9% and 59 (31.1% patients, respectively. In multivariate model, factors associated with PA-R isolate in bronchiectasis included prior exposure to antibiotics (odds ratio [OR] =6.18, three or more exacerbations in the previous year (OR =2.81, higher modified Medical Research Council dyspnea scores (OR =1.93 and greater radiologic severity (OR =1.15. During follow-up (median: 26 months; interquartile range: 6–59 months, 36 patients died, of whom 24 (66
Directory of Open Access Journals (Sweden)
Yu W
2017-03-01
Full Text Available Weilin Yu,1,* Tuan-Wei Sun,2,3,* Chao Qi,2,3 Zhenyu Ding,1 Huakun Zhao,1 Shichang Zhao,1 Zhongmin Shi,1 Ying-Jie Zhu,2,3 Daoyun Chen,1 Yaohua He1,4 1Department of Orthopedics, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, 2State Key Laboratory of High Performance Ceramics and Superfine Microstructure, Shanghai Institute of Ceramics, Chinese Academy of Sciences, Shanghai, 3University of Chinese Academy of Sciences, Beijing, 4School of Biomedical Engineering, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, Shanghai, China *These authors contributed equally to this work Abstract: Biomaterials with high osteogenic activity are desirable for sufficient healing of bone defects resulting from trauma, tumor, infection, and congenital abnormalities. Synthetic materials mimicking the structure and composition of human trabecular bone are of considerable potential in bone augmentation. In the present study, a zinc (Zn-doped mesoporous hydroxyapatite microspheres (Zn-MHMs/collagen scaffold (Zn-MHMs/Coll was developed through a lyophilization fabrication process and designed to mimic the trabecular bone. The Zn-MHMs were synthesized through a microwave-hydrothermal method by using creatine phosphate as an organic phosphorus source. Zn-MHMs that consist of hydroxyapatite nanosheets showed relatively uniform spherical morphology, mesoporous hollow structure, high specific surface area, and homogeneous Zn distribution. They were additionally investigated as a drug nanocarrier, which was efficient in drug delivery and presented a pH-responsive drug release behavior. Furthermore, they were incorporated into the collagen matrix to construct a biomimetic scaffold optimized for bone tissue regeneration. The Zn-MHMs/Coll scaffolds showed an interconnected pore structure in the range of 100–300 µm and a sustained release of Zn ions. More importantly, the Zn-MHMs/Coll scaffolds could enhance the osteogenic differentiation
Directory of Open Access Journals (Sweden)
Liu S
2017-04-01
Full Text Available Si Liu,1 Chao-zhu He,1 Yan-ting Cai,1 Qiu-ping Xing,1 Ying-zhen Guo,1 Zhi-long Chen,1 Ji-liang Su,1 Li-ping Yang2 1School of Nursing, Nanchang University, 2Department of Endocrinology, The Second Affiliated Hospital of Nanchang University, Nanchang, Jiangxi, China Objectives: The aim of this study was to perform an updated systematic review and meta-analysis to assess the clinical efficacy, safety, and cost-effectiveness of negative-pressure wound therapy (NPWT in the treatment of diabetic foot ulcers (DFUs.Methods: We searched the Cochrane Library, MEDLINE, EMBASE, Ovid, and Chinese Biological Medicine databases up to June 30, 2016. We also manually searched the articles from reference lists of the retrieved articles, which used the NPWT system in studies of vacuum-assisted closure therapy. Studies were identified and selected, and two independent reviewers extracted data from the studies.Results: A total of eleven randomized controlled trials, which included a total of 1,044 patients, were selected from 691 identified studies. Compared with standard dressing changes, NPWT had a higher rate of complete healing of ulcers (relative risk, 1.48; 95% confidence interval [CI]: 1.24–1.76; P<0.001, shorter healing time (mean difference, −8.07; 95% CI: −13.70–−2.45; P=0.005, greater reduction in ulcer area (mean difference, 12.18; 95% CI: 8.50–15.86; P<0.00001, greater reduction in ulcer depth (mean difference, 40.82; 95% CI: 35.97–45.67; P<0.00001, fewer amputations (relative risk, 0.31; 95% CI: 0.15–0.62; P=0.001, and no effect on the incidence of treatment-related adverse effects (relative risk, 1.12; 95% CI: 0.66–1.89; P=0.68. Meanwhile, many analyses showed that the NPWT was more cost-effective than standard dressing changes.Conclusion: These results indicate that NPWT is efficacious, safe, and cost-effective in treating DFUs. Keywords: diabetic foot ulcers, negative-pressure wound therapy, complete wound closure, amputation, meta
Directory of Open Access Journals (Sweden)
Huang HM
2017-05-01
Full Text Available Hai-ming Huang,1,2 Jun Cao,3 Lin-mei Zhu,4 Yu-qing Chen,2 Fu-ding Lu,2 Hong-wei Cai1 1Department of Anesthesiology, Xiangya Hospital, Central South University, Changsha, 2Department of Anesthesiology, 3Department of Hepatic and Biliary Pancreatic Surgery, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, 4Department of Obstetrics and Gynecology, Clifford Hospital, Guangzhou University of Chinese Medicine, Guangzhou, People’s Republic of China Abstract: A number of animal models have been developed to examine the pathophysiological consequences of surgical procedures, but anesthetic methods, monitoring, and management measures in these models are very different from those used in humans. This study was designed to create a rat model of abdominal surgery using anesthetic methods and perioperative treatment similar to those used in the clinic and to investigate the effects of different injury severities and depths of anesthesia and analgesia on surgical stress and postoperative recovery. Abdominal skin/muscle incision was compared with exploratory laparotomy in rats under propofol intravenous anesthesia, accompanied by perioperative measures such as oxygen inhalation, fluid infusion, warmth, blood gas analysis, and infection prevention. Stress indices (mean arterial pressure, heart rate, blood glucose, and plasma corticosterone were monitored during anesthesia and surgery, and recovery indicators (body weight, food consumption, and pain were measured after surgery. In addition, animals undergoing laparotomy were subjected to low and high dosages of propofol and sufentanil, in order to examine the relationship between anesthetic and analgesic depth and stress on recovery. Exploratory laparotomy induced a greater stress response and caused slower postoperative recovery as measured than somatic injury. High-dose sufentanil downregulated plasma corticosterone and improved postoperative recovery more effectively than high-dose propofol (P<0
Directory of Open Access Journals (Sweden)
Wu R
2015-08-01
Full Text Available Ruyan Wu,1,* Dandan Zhu,1,* Youchun Xia,2,* Haosen Wang,2 Weiwei Tao,1 Wenda Xue,1 Baomei Xia,1 Li Ren,1 Xin Zhou,1 Guochun Li,3 Gang Chen1 1Center for Translational Systems Biology and Neuroscience, Key Laboratory of Integrative Biomedicine of Brain Diseases, Nanjing University of Chinese Medicine, Nanjing, People’s Republic of China; 2The Fourth People’s Hospital of Taizhou, Taizhou, People’s Republic of China; 3School of Basic Chinese Medicine, Nanjing University of Chinese Medicine, Nanjing, People’s Republic of China *These authors contributed equally to this work Introduction: Conventional antidepressants, including fluoxetine, have a major disadvantage in delayed onset of efficacy. Yueju, an herbal medicine used to treat mood disorders was recently found to exhibit rapid antidepressant effects. The present study was conducted to evaluate the role of Yueju in rapidly acting on major depressive disorder (MDD.Methods: Participants were MDD patients with scores of 24-item Hamilton Depression Rating Scale (HDRS-24 ≥20 and without history of antidepressant use. They randomly received daily oral doses of Yueju (23 g/day plus fluoxetine (20 mg/day (experimental group or placebo plus fluoxetine (control group for 7 days. HDRS-24 was used as the primary outcome measurement at baseline, and on days 1, 3, 5, and 7. Concentrations of serum brain-derived neurotrophic factor (BDNF were assessed at baseline and on days 1 and 7.Results: In all, 18 participants met the criteria for data analysis. Compared to baseline level, only experimental group showed significant decrease of HDRS-24 score from day 3 to day 7 (P<0.05. Experimental group also showed significant improvement compared with control group from day 3 to day 7 (P<0.05. No correlation between treatment outcomes with serum BDNF levels was observed. However, experimental group showed significant correlation for serum BDNF level on day 1 with day 7 (r=0.721, P=0.028, whereas the control
Disease burden of COPD in China: a systematic review
Directory of Open Access Journals (Sweden)
Zhu B
2018-04-01
Full Text Available Bifan Zhu,1 Yanfang Wang,2 Jian Ming,3 Wen Chen,4 Luying Zhang4 1Shanghai Health Development Research Center, Shanghai Medical Information Center, Shanghai, China; 2The First Affiliated Hospital of Wannan Medical College, Wuhu, China; 3IQVIA, Shanghai, China; 4School of Public Health, Fudan University, Shanghai, China Abstract: Chronic obstructive pulmonary disease (COPD is one of the main contributors to the global burden of disease. The aim of this systematic review was to quantify the disease burden of COPD in China and to determine the risk factors of the disease. The number of studies included in the review was 47 with an average quality assessment score of 7.70 out of 10. Reported COPD prevalence varied between 1.20% and 8.87% in different provinces/cities across China. The prevalence rate of COPD was higher among men (7.76% than women (4.07%. The disease was more prevalent in rural areas (7.62% than in urban areas (6.09%. The diagnostic rate of COPD patients in China varied from 23.61% to 30.00%. The percentage of COPD patients receiving outpatient treatment was around 50%, while the admission rate ranged between 8.78% and 35.60%. Tobacco exposure and biomass fuel/solid fuel usage were documented as two important risk factors of COPD. COPD ranked among the top three leading causes of death in China. The direct medical cost of COPD ranged from 72 to 3,565 USD per capita per year, accounting for 33.33% to 118.09% of local average annual income. The most commonly used scales for the assessment of quality of life (QoL included Saint George Respiratory Questionnaire, Airways Questionnaire 20, SF-36, and their revised versions. The status of QoL was worse among COPD patients than in non-COPD patients, and COPD patients were at higher risks of depression. The COPD burden in China was high in terms of economic burden and QoL. In view of the high smoking rate and considerable concerns related to air pollution and smog in China, countermeasures
2012-02-10
Cremer , J-Y Chen, C.K. Westbrook, L.Q. Maurice, J. Propul. Power 18 (1) (2002) 192–198. K. Harstad, J. Bellan / Combustion and Flame 157 (2010) 1594... Cremer , J.-Y. Chen, C.K. Westbrook, L.Q. Maurice, J. Propuls. Power 18 (1) (2002) 192–198. a 10-9 10-7 10-5 10-3 10-1 101 N oh (m ol /m 3 ) T0 = 800...Caltech by the Army Research Office under the direction of Drs. David Mann, Kevin McNesby and Ralph Anthenien. References 1U. C. Müeller, N. Peters, A
Spiegelberg, Jakob; Rusz, Ján
2015-12-01
In the framework of the slice transition operator technique, a general multislice theory for electron scattering in crystals is developed. To achieve this generalization, we combine the approaches for inelastic scattering derived by Yoshioka [J. Phys. Soc. Jpn. 12, 6 (1957)] and backscattering based on the formalism of Chen and Van Dyck [Ultramicroscopy 70, 29-44 (1997)]. A computational realization of the obtained equations is suggested. The proposed computational scheme is tested on elastic backscattering of electrons, where we consider single backscattering in analogy to the computational scheme proposed by Chen and Van Dyck. Copyright © 2015 Elsevier B.V. All rights reserved.
Rural Health, Center of Excellence for Remote and Medically Under-Served Areas (CERMUSA). Addendum
2010-07-01
Plaque *c. Pulpitis or an abscess d. Gingivitis 4. Pulp necrosis can be defined as: a. A viral infection in the gums *b. Death of the pulp...families. Available data indicate higher incidences of breast and prostate cancer affecting U.S. military versus the general population (Zhu et al...Meyerowitz, B. E., et al. (2006). Fatigue in long-term breast carcinoma survivors: A longitudinal investigation. Cancer, 106(4), 751-758. Courneya, K
Contribution of sodium dodecyl sulphate and sodium lauric acid in ...
Indian Academy of Sciences (India)
Tao Q, He H P, Frost R L, Yuan P and Zhu J X 2009 Appl. Surf. Sci. 255 4334. 15. Pavan P C, Gomes G D A and Valim J B 1998 Microporous. Mesoporous Mater. 21 659. 16. Li P G, Lv F Z, Xu Z X, Qi G G and Zhang Y H 2013 J. Mater. Sci. 48 5437. 17. Saber O and Tagaya H 2003 J. Incl. Phenom. Macrocyclic. Chem.
1993-06-01
C. Carls) "Attachment of Ti02 powders to hollow glass microbeads:activity of the TiO2 -coated beads in the photoassisted oxidation of ethanol to...22) R. B. Gregory, and Y. Zhu, in Proc. 3rd Intl. Workshop on Positron and Positroniim Chemistry, edited by Y. C. Jean (World Scientific, Singapore...overlap in multicomponent systems. Factor analysis-rank annihilation (FARA) is an eigenanalysis technique 2-5 for analyzing two-dimensional data. FARA
JPRS Report, China: Qiushi (Seeking Truth) No 12, 16 December 1988
1989-04-07
Enlai, Zhu De, Liu Shaoqi, and Ren Bishi also issued important instructions to us. On 5 August, we returned to the headquarters of the North China...during which the national quintessence will not be endangered. (Excerpted by Li [2621] from the 31 October 1988 SHIJIE JINGJI DAOBAO) JPRS-CAR...Tiajun [5105 6993 6511] in the 29 October 1988 JINGJI RIBAO) Speculate Less on the Distinction of Features but More on the Practical Value—Reading An
Uudiseid maailmast / Nele-Eva Steinfeld
Steinfeld, Nele-Eva
2012-01-01
Lühisõnumid: Plaadifirma Naxosa sai 25-aastaseks. Jüri Reinvere ooper "Puhastus" Soome Rahvusooperis. Louis Langree saab Cincinnati sümfooniaorkestri uueks peadirigendiks. Sir Antonio Pappano ja Jiří Belohlavek pälvisid kõrge tunnustuse. Tokyo keelpillikvartett lõpetab tegevuse 2012. aastal. Öökontserdid Wigmore Hallis. Jeruusalemma keelpillikvarteti esinemine häiritud. Yehudi Menuhini konkursi võitsid Kevin Zhu ja Kenneth Arthur Renshaw. Kõrgeima auhinnaga Joseph Joachimi konkurss
VEST: An Aspect-Based Composition Tool for Real-Time Systems
2003-01-01
VEST: An Aspect-Based Composition Tool for Real - Time Systems * John A. Stankovic Ruiqing Zhu Ram Poornalingam Chenyang Lu Zhendong Yu Marty Humphrey...Composition Tool for Real - Time Systems 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER 5e. TASK...it is obvious that designers of embedded real - time systems face many difficult problems. By working through various product scenarios with avionics
Cancer Prevention and Control Research Manpower Development
1999-10-01
for preeclampsia in twin pregnancies: a population-based cohort study. Obstet Gynecol 1995;85:645-50. 17. Gu Y , He S, Shi L, Li 0, Zhu Kr, Yin Z, Wang...Gestational Diabetes, Sickle Cell Anemia in the laboratories of Jayduff Vadgama, P.D. and of Steven Taylor, M.D. at Charles Drew University of Medicine...California RESEARCH EXPERIENCE: Sickle Cell Anemia Infant Neurodevelopment and language acquisistion Deviant sexual behavior and group therapy
Defining Hepatocellular Carcinoma Subtypes and Treatment Responses in Patient-Derived Tumorgrafts
2017-10-01
Specific AIM 2: Determine the efficacy of small RNA therapeutics against the LIN28B/LET-7 pathway in PDXs activating this oncogenic pathway Major...Task 1: Identify and deliver small RNAs to target PDX populations (ongoing). Major Task 2: Define response to small RNAs in target PDX populations...Allow time to receive the regulatory approval for animal use (IACUC and DoD ACURO). This task was performed by Drs. Yopp, Singal, and Zhu. We
Cyanide- and phenoxo-bridged heterobimetallic Fe(III)-Mn(III ...
Indian Academy of Sciences (India)
134 5083. 6. Jeon I R, Calancea S, Panja A, Piñero Cruz D M,. Koumousi E S, Dechambenoit P, Coulon C, Wattiaux A,. Rosa P, Mathonière C and Clérac R 2013 Chem. Sci. 4. 2463. 7. (a) Liu C M, Xiong R G, Zhang D Q and Zhu D B 2010J. Am. Chem. Soc. 132 4044; (b) Zhang Y Z and Sato O. 2010 Inorg. Chem. 49 1271.