WorldWideScience

Sample records for zhu bian chen

  1. Zhu Qing Wang

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences. Zhu Qing Wang. Articles written in Journal of Chemical Sciences. Volume 121 Issue 4 July 2009 pp 543-548. Highly sensitive optical chemosensor for the detection of Cu using a rhodamine B spirolatam · Gen Hua Wu Dong Xiang Wang Da Yu Wu Yuan Gao Zhu Qing Wang.

  2. H CHEN

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. H CHEN. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 51. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study · H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG · More Details ...

  3. Chen Hengzhe

    DEFF Research Database (Denmark)

    Gimpel, Denise

    been the first to write children’s literature. In 1914 she was among the first group of women to gain a Boxer Indemnity grant to study in America. The reiteration of these many “firsts” has led to a rather stereotypical portrait of Chen Hengzhe in Chinese sources and, as a result, in most Western...

  4. Chen Hengzhe

    DEFF Research Database (Denmark)

    Gimpel, Denise

    Chen Hengzhe has been celebrated as China’s first female professor, first professor of Western history, first person to publish a history of the West that was not a translation into Chinese. She is moreover celebrated as one of the first to write fiction and poetry in the vernacular and to have......; they speak to important questions in China today. This study, then, is not a biography of a person; it is an attempt to understand the way in which foreign influences (narratives of being, organizing, thinking, writing) seep into a person’s life and work and meld with the “home” influences (narratives...

  5. Evaluation Of Water Quality At River Bian In Merauke Papua

    Science.gov (United States)

    Djaja, Irba; Purwanto, P.; Sunoko, H. R.

    2018-02-01

    River Bian in Merauke Regency has been utilized by local people in Papua (the Marind) who live along the river for fulfilling their daily needs, such as shower, cloth and dish washing, and even defecation, waste disposal, including domestic waste, as well as for ceremonial activities related to the locally traditional culture. Change in land use for other necessities and domestic activities of the local people have mounted pressures on the status of the River Bian, thus decreasing the quality of the river. This study had objectives to find out and to analyze river water quality and water quality status of the River Bian, and its compliance with water quality standards for ideal use. The study determined sample point by a purposive sampling method, taking the water samples with a grab method. The analysis of the water quality was performed by standard and pollution index methods. The study revealed that the water quality of River Bian, concerning BOD, at the station 3 had exceeded quality threshold. COD parameter for all stations had exceeded the quality threshold for class III. At three stations, there was a decreasing value due to increasing PI, as found at the stations 1, 2, and 3. In other words, River Bian had been lightly contaminated.

  6. Evaluation Of Water Quality At River Bian In Merauke Papua

    Directory of Open Access Journals (Sweden)

    Djaja Irba

    2018-01-01

    Full Text Available River Bian in Merauke Regency has been utilized by local people in Papua (the Marind who live along the river for fulfilling their daily needs, such as shower, cloth and dish washing, and even defecation, waste disposal, including domestic waste, as well as for ceremonial activities related to the locally traditional culture. Change in land use for other necessities and domestic activities of the local people have mounted pressures on the status of the River Bian, thus decreasing the quality of the river. This study had objectives to find out and to analyze river water quality and water quality status of the River Bian, and its compliance with water quality standards for ideal use. The study determined sample point by a purposive sampling method, taking the water samples with a grab method. The analysis of the water quality was performed by standard and pollution index methods. The study revealed that the water quality of River Bian, concerning BOD, at the station 3 had exceeded quality threshold. COD parameter for all stations had exceeded the quality threshold for class III. At three stations, there was a decreasing value due to increasing PI, as found at the stations 1, 2, and 3. In other words, River Bian had been lightly contaminated.

  7. On a conjecture of Chen-Guo-Wang

    OpenAIRE

    Ning, Bo; Zheng, Yu

    2015-01-01

    Towards confirming Sun's conjecture on the strict log-concavity of combinatorial sequence involving the n$th$ Bernoulli number, Chen, Guo and Wang proposed a conjecture about the log-concavity of the function $\\theta(x)=\\sqrt[x]{2\\zeta(x)\\Gamma(x+1)}$ for $x\\in (6,\\infty)$, where $\\zeta(x)$ is the Riemann zeta function and $\\Gamma(x)$ is the Gamma function. In this paper, we first prove this conjecture along the spirit of Zhu's previous work. Second, we extend Chen et al.'s conjecture in the ...

  8. Chen's inversion formula

    International Nuclear Information System (INIS)

    Hughes, B.D.; Frankel, N.E.; Ninham, B.W.

    1990-01-01

    An alternative view is presented of the Chen's generalization of a formula of classic algebraic number theory, based on the Mellin transformation and Reimann's zeta function. The advantages of the Mellin transform, as a method with a primary role in asymptotic analysis, are outlined. 10 refs

  9. Horseshoes in modified Chen's attractors

    International Nuclear Information System (INIS)

    Huang Yan; Yang Xiaosong

    2005-01-01

    In this paper we study dynamics of a class of modified Chen's attractors, we show that these attractors are chaotic by giving a rigorous verification for existence of horseshoes in these systems. We prove that the Poincare maps derived from these modified Chen's attractors are semi-conjugate to the 2-shift map

  10. Thorium and uranium redox-active ligand complexes; reversible intramolecular electron transfer in U(dpp-BIAN)2/ U(dpp-BIAN)2(THE)

    Energy Technology Data Exchange (ETDEWEB)

    Schelter, Eric John [Los Alamos National Laboratory; Wu, Ruilian [Los Alamos National Laboratory; Scott, Brian L [Los Alamos National Laboratory; Thompson, Joe D [Los Alamos National Laboratory; Batista, Enrique R [Los Alamos National Laboratory; Morris, David E [Los Alamos National Laboratory; Kiplinger, Jaqueline L [Los Alamos National Laboratory

    2008-01-01

    Actinide complexes of the redox-active ligand dpp-BIAN{sup 2-} (dpp-BIAN = bis(2,6-diisopropylphenyl)acenaphthylene), An(dpp-BIAN){sub 2}(THF){sub n} (An = Th, n = 1; An = U, n = 0, 1) have been prepared. Solid-state magnetic and single-crystal X-ray data for U(dpp-BIAN){sub 2}(THF){sub n} show when n = 0, the complex exists in an f{sup 2}-{pi}*{sup 4} configuration; whereas an intramolecular electron transfer occurs for n = 1, resulting in an f{sup 3}-{pi}*{sup 3} ground configuration. The magnetic data also indicate that interconversion between the two forms of the complex is possible, limited only by the ability of THF vapor to penetrate the solid on cooling of the sample. Spectroscopic data indicate the complex exists solely in the f{sup 2}-{pi}*{sup 4} form in solution, evidenced by the appearance of only small changes in the electronic absorption spectra of the U(dpp-BIAN){sub 2} complex on titration with THF and by measurement of the solution magnetic moment m d{sub 8}-tetrahydrofuran using Evans method. Electrochemistry of the complexes is reported, with small differences observed in wave potentials between metals and in the presence of THF. These data represent the first example of a well-defined, reversible intramolecular electron transfer in an f-element complex and the second example of oxidation state change through dative interaction with a metal ion.

  11. [ZHU Lian's New Acupuncture Academic System and acupuncture science initialization].

    Science.gov (United States)

    Zhang, Shujian; Zhang, Lijian

    2015-11-01

    Acupuncture scientization was a consensus of most of acupuncture scholars who had long-term perspectives in the 20th century, among them Ms. ZHULian was the important one. Ms. ZHU Lian built a systemic new acupuncture" academic structure in practice and theory aspects. At the same time, as the main architect of Institute of Acupuncture-moxibustion of China Academy of Traditional Chinese Medicine, Ms. ZHU Lian was the first one who began to carry out the acupuncture clinical trail and laboratory experiment in modern way, which meant "acupuncture therapy" was transformed into "acupuncture science" by Ms. ZHULian's endeavor.

  12. Biological Screening of Newly Synthesized BIAN N-Heterocyclic Gold Carbene Complexes in Zebrafish Embryos

    Science.gov (United States)

    Farooq, Muhammad; Abu Taha, Nael; Butorac, Rachel R.; Evans, Daniel Anthony; Elzatahry, Ahmed A.; Elsayed, Elsayed Ahmed; Wadaan, Mohammad A. M.; Al-Deyab, Salem S.; Cowley, Alan H.

    2015-01-01

    N-Heterocyclic carbene (NHC) metal complexes possess diverse biological activities but have yet to be extensively explored as potential chemotherapeutic agents. We have previously reported the synthesis of a new class of NHC metal complexes N-heterocyclic with acetate [IPr(BIAN)AuOAc] and chloride [IPr(BIAN)AuCl] ligands. In the experiments reported herein, the zebrafish embryos were exposed to serial dilutions of each of these complexes for 10–12 h. One hundred percent mortality was observed at concentrations ≥50 µM. At sub-lethal concentrations (10–30 µM), both compounds influenced zebrafish embryonic development. However, quite diverse categories of abnormalities were found in exposed embryos with each compound. Severe brain deformation and notochord degeneration were evident in the case of [IPr(BIAN)AuOAc]. The zebrafish embryos treated with [IPr(BIAN)AuCl] exhibited stunted growth and consequently had smaller body sizes. A depletion of 30%–40% glutathione was detected in the treated embryos, which could account for one of the possible mechanism of neurotoxicity. The fact that these compounds are capable of both affecting the growth and also compromising antioxidant systems by elevating intracellular ROS production implies that they could play an important role as a new breed of therapeutic molecules. PMID:26501273

  13. Application thinking on Bian-stone of the acousto-optic effect in the treatment of primary dysmenorrhea

    Science.gov (United States)

    Ge, Shu; Chen, Gui-Zhen; Liu, Song-Hao

    2009-08-01

    In order to identify the relations between the Si-Bin Bian-stone of the mineral composition characteristics and Bian-stone of the good infrared emission features. A detailed study of the Sibin Bian-stone samples was conducted by using the laser Raman spectroscopy and high-resolution transmission electron microscopy (HRTEM). The study is to provide theoretical physical support for Bian-stone in the treatment of primary dysmenorrhea. And Thermal tomography technology (TTM) is intended to be carried out to assess the effects of Bian-stone. The Raman spectroscopic study confirmed the existence of fine-grained pyrite, anatase, calcitepyrite and graphite. It is believed that the combination of good thermal properties of the above 4 minerals make the Sibin Bian-stone as a useful material with very good physiotherapical functions. The ultrasonic has a resonance with the body's biological molecules so that it can improve meridians microcirculation. Hence, the Sibin Bian-stones can be used to make acupuncture tools for stimulating the circulation of the blood in vessels and relieving pains of human beings by utilizing its infrared thermal radiation property. TTM which accepts the heat produced by the metabolism process of life can reflect the energy status information, TTM will be introduced to evaluate effect at the overall level of the abdomen from the thermal image and analyze to derive a comprehensive diagnosis. In sum, this experiment is explored to provide a new idea for the modernization of traditional Chinese medicine.

  14. Polymorphism in exons of the myostatin gene and its relationship with body weight traits in the Bian chicken.

    Science.gov (United States)

    Zhang, Genxi; Ding, Fuxiang; Wang, Jinyu; Dai, Guojun; Xie, Kaizhou; Zhang, Lijun; Wang, Wei; Zhou, Shenghua

    2011-02-01

    In our research, single nucleotide polymorphisms (SNPs) of exon regions of the myostatin gene were detected by PCR-SSCP in the Bian chicken and three reference chicken populations (Jinghai, Youxi, and Arbor Acre). Four novel SNPs (G2283A, C7552T, C7638T, and T7661A) were detected. The findings from the least square means showed that Bian chickens with EE and DE genotypes had significantly higher body weight, at 6-18 weeks of age, than those of the DD genotype (P chicken.

  15. Polymorphisms of the myostatin gene and its relationship with reproduction traits in the Bian chicken.

    Science.gov (United States)

    Zhang, Genxi; Zhang, Li; Wei, Yue; Wang, Jinyu; Ding, Fuxiang; Dai, Guojun; Xie, Kaizhou

    2012-01-01

    Myostatin, or growth and differentiation factor 8, is a member of the transforming growth factor-β superfamily; it functions as a negative regulator of skeletal muscle development and growth in mammals. In this study, single nucleotide polymorphisms in the 5' regulatory region and exon 1 of the myostatin gene were detected by PCR-SSCP in the Bian, Jinghai, Youxi, and Arbor Acre chickens, and the associations of the polymorphisms with reproduction traits were analyzed. Seven SNPs (A326G, C334G, C1346T, G1375A, A1473G, G1491A, and G2283A) were found in the myostatin gene. Association analysis showed that the G2283A were significantly associated with reproduction traits. Bian chickens of the GG genotype had a greater age at first egg than those of the GA and AA genotypes (Pchickens of the GA and AA genotypes had larger egg number at 300 days than those of the GG genotype (Pchickens of the AA genotype had significantly higher body weight at 300 days than those of the GG genotype (P<0.05). These results suggested that the myostatin gene may have certain effects on reproduction traits other than merely as a negative regulator of skeletal muscle development and growth in mammals previously reported.

  16. Mechanical analysis of Chen chaotic system

    International Nuclear Information System (INIS)

    Liang, Xiyin; Qi, Guoyuan

    2017-01-01

    The Chen chaotic system is transformed into Kolmogorov type system, which is decomposed into four types of torques: inertial torque, internal torque, dissipation and external torque. By the combinations of different torques, five cases are studied to discover key factors of chaos generation and the physical meaning. The conversion among Hamiltonian energy, kinetic energy and potential energy is investigated in these five cases. The relationship between the energies and the parameters is studied. It concludes that the combination of these four types of torques is necessary conditions to produce chaos, and any combination of three types of torques cannot produce chaos in Chen system.

  17. [Textual research on Chen Ye and his Jia cang jing yan fang (Family-preserved Empirical Recipes) of the Song Dynasty].

    Science.gov (United States)

    Zhang, Xuedan; Zhang, Ruqing; Chen, Dexing

    2014-01-01

    Chen Ye, an official of the Southern Song Dynasty, also known as Chen Rihua as his styled name, was born in Changle, Fuzhou in the reign of Shaoxing, and died during the reign of Duanping. He had been consecutively in the positions of Jiang shi lang (Court Gentleman for Ceremonial Service), Zhi zhou (Prefect) of Lingding, the Ti xing (Judicial Commissioner) of Guangdong, the Zong ling (Overseer-general) of Sichuan, Shan ding (Reviser), Shu lin and other positions in Tongzhou, Yuanzhou. His works included 1 volume of Gu ling xian sheng nian pu (Mr. Guling's Chronological Biography), 1 volume of Tan xie (On Humor), 1 volume of Shi hua (Poetry), 8 volumes of Jin yuan li shu (Jin Yuan's Smart Technique), 3 volumes of Yi jian zhi lei bian (Classified Compilation of Yijian's Annals), (Zeng guang) Suo sui lu (Augmented Records of Trivial Matters), 5 volumes of Jia cang jing yan fang (Family-preserved Empirical Recipes). He also compiled the 8-volume Yin jiang zhi (Yinjiang's Annals), published the 2-volume Jia cang ji yao fang (Collected Essential Recipes from Family Preservation), and other proses and poetry. Jia cang jing yan fang was a formulary compiled by Chen Ye, which was lost. Altogether 74 of its recipes were cited in Fu ren da quan liang fang (Complete Effective Prescriptions for Women's Diseases), Shou qin yang lao shu (A Book for Pursuing Seniors' Longevity and Healthcare), Pu ji fang (Prescriptions for Universal Relief) and Yong le da dian (Yongle Encyclopedia).

  18. Immunogenicity of novel sulfadimethoxide conjugates | Chen ...

    African Journals Online (AJOL)

    Immunogenicity of novel sulfadimethoxide conjugates. L Chen, J Su, X Zhang, L Li, X He. Abstract. Sulfadimethoxine (SDM) is an antibiotic commonly added to animal feeds. Anti-SDM antibodies are useful for the detection of residual SDM in foods, feeds and biological fluids by ELISA. In this study, we show that SDM is ...

  19. Titanisierung von Implantatoberflächen

    Science.gov (United States)

    Zimmermann, Hanngörg; Heinlein, Markus; Guldner, Norbert W.

    Titan gilt seit Jahrzehnten als einer der wichtigsten Implantatwerkstoffe in der Medizin. Neben den guten mechanischen Eigenschaften (Leichtigkeit, hohe Festigkeit etc.), besitzen Titanimplantate vor allem eine hervorragende Körperverträglichkeit, so dass die Implantate optimal in den humanen Organismus integriert werden [1]. Ist jedoch aufgrund der Anforderungen an das Implantat eine hohe Flexibilität und/ oder Elastizität gefragt, so scheidet der Werkstoff Titan aufgrund seiner spröden und unflexiblen Materialeigenschaften aus. Die Folge ist der Einsatz von Implantatmaterialien, sowohl künstlichen als auch biologischen Ursprungs, welche nicht selten eine unzureichende Biokompatibilität aufweisen und somit zu Fremdköper- und immunologischen Reaktionen und Einkapselung des Implantates führen können. Die Erhöhung der Körperverträglichkeit, eine Adaption an das biologische Umfeld und eine hohe Biokompatibilität sind demzufolge die wichtigsten Eigenschaften bei der bedarfsgerechten Herstellung von Implantaten und Implantatoberflächen. Zur Gestaltung von innovativen, biokompatiblen Oberflächen stehen unterschiedliche technische Lösungsansätze zur Verfügung. Zum einen besteht die Möglichkeit, geeignete Oberflächeneigenschaften aus dem Grundmaterial selbst zu optimieren. Dies geschieht unter anderem durch Modifikation der Werkstoffoberflächen in Form von Texturierungen und Oberflächenrauhigkeiten. Zum anderen können die Oberflächeneigenschaften unabhängig von denen des Trägermaterials gestaltet werden. Durch Funktionalisierung der Oberflächen mit geeigneten Beschichtungen oder der Zugabe von Medikamenten (Drug Eluting) werden die Kunststoffimplantate dahingehend verändert, dass eine Steigerung der Körperakzeptanz erreicht wird. Die Titanbeschichtung von Implantatoberflächen kombiniert die positiven Materialeigenschaften von Titan und Polymer.

  20. Chaos control of Chen chaotic dynamical system

    International Nuclear Information System (INIS)

    Yassen, M.T.

    2003-01-01

    This paper is devoted to study the problem of controlling chaos in Chen chaotic dynamical system. Two different methods of control, feedback and nonfeedback methods are used to suppress chaos to unstable equilibria or unstable periodic orbits (UPO). The Lyapunov direct method and Routh-Hurwitz criteria are used to study the conditions of the asymptotic stability of the steady states of the controlled system. Numerical simulations are presented to show these results

  1. Impulsive synchronization of Chen's hyperchaotic system

    International Nuclear Information System (INIS)

    Haeri, Mohammad; Dehghani, Mahsa

    2006-01-01

    In this Letter the impulsive synchronization of the Chen's hyperchaotic systems is discussed. Some new and sufficient conditions on varying impulsive distance are established in order to guarantee the synchronizabillity of the systems using the synchronization method. In particular, some simple conditions are derived in synchronizing the systems by equal impulsive distances. Two illustrative examples are provided to show the feasibility and the effectiveness of the proposed method. The boundaries of the stable regions are also estimated

  2. Bya rog prog zhu, The raven crest : the life and teachings of bDe chen 'od gsal rdo rje treasure revealer of contemporary Tibet

    NARCIS (Netherlands)

    Terrone, Antonio

    2010-01-01

    This research starts from the historical assertion that notwithstanding their claim of increased religious tolerance, the dramatic post-Mao political campaigns have continued to weaken the pervasive force of religious faith, traditional monastery-centered religious power, religious leadership, and

  3. Stability analysis of distributed order fractional chen system.

    Science.gov (United States)

    Aminikhah, H; Refahi Sheikhani, A; Rezazadeh, H

    2013-01-01

    We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results.

  4. Stability Analysis of Distributed Order Fractional Chen System

    Science.gov (United States)

    Aminikhah, H.; Refahi Sheikhani, A.; Rezazadeh, H.

    2013-01-01

    We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results. PMID:24489508

  5. Failure to replicate the Mehta and Zhu (2009) color-priming effect on anagram solution times.

    Science.gov (United States)

    Steele, Kenneth M

    2014-06-01

    Mehta and Zhu (Science, 323, 1226-1229, 2009) hypothesized that the color red induces avoidance motivation and that the color blue induces approach motivation. In one experiment, they reported that anagrams of avoidance motivation words were solved more quickly on red backgrounds and that approach motivation anagrams were solved more quickly on blue backgrounds. Reported here is a direct replication of that experiment, using the same anagrams, instructions, and colors, with more than triple the number of participants used in the original study. The results did not show the Mehta and Zhu color-priming effects, even though statistical power was sufficient to detect the effect. The results call into question the existence of their color-priming effect on the solution of anagrams.

  6. Adaptive synchronization of hyperchaotic Chen system with uncertain parameters

    International Nuclear Information System (INIS)

    Park, Ju H.

    2005-01-01

    This article addresses control for the chaos synchronization of hyperchaotic Chen system with five uncertain parameters. Based on the Lyapunov stability theory, an adaptive control law is derived to make the states of two identical hyperchaotic Chen systems asymptotically synchronized. Finally, a numerical simulations is presented to show the effectiveness of the proposed chaos synchronization scheme

  7. Chaos in the fractional order Chen system and its control

    International Nuclear Information System (INIS)

    Li Chunguang; Chen Guanrong

    2004-01-01

    In this letter, we study the chaotic behaviors in the fractional order Chen system. We found that chaos exists in the fractional order Chen system with order less than 3. The lowest order we found to have chaos in this system is 2.1. Linear feedback control of chaos in this system is also studied

  8. Complete synchronization of two Chen-Lee systems

    International Nuclear Information System (INIS)

    Sheu, L-J; Chen, J-H; Chen, H-K; Tam, L-M; Lao, S-K; Chen, W-C; Lin, K-T

    2008-01-01

    This study demonstrates that complete synchronization of two Chen-Lee chaotic systems can be easily achieved. The upper bound of the Chen-Lee chaotic system is estimated numerically. A controller is designed to synchronize two chaotic systems. Sufficient conditions for synchronization are obtained using Lyapunov's direct method. Two numerical examples are presented to verify the proposed synchronization approach

  9. The BIAN ligand 1,2-bis[(2,6-diisopropylphenyl)imino]acenaphthene: An electron sponge or a „normal“ alpha-diimine ligand?

    Czech Academy of Sciences Publication Activity Database

    Löw, I.; Bubrin, M.; Paretzki, A.; Fiedler, Jan; Záliš, Stanislav; Kaim, W.

    2017-01-01

    Roč. 455, č. 2 (2017), s. 540-548 ISSN 0020-1693 R&D Projects: GA MŠk LD14129 Grant - others:COST(XE) CM1202 Institutional support: RVO:61388955 Keywords : BIAN diimine ligand * Carbonylmetal complexes * Electron transfer Subject RIV: CG - Electrochemistry OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 2.002, year: 2016

  10. A simple observer of the generalized Chen chaotic systems

    International Nuclear Information System (INIS)

    Sun, Y.-J.

    2009-01-01

    In this paper, the generalized Chen chaotic system is considered and the state observation problem of such a system is investigated. Based on the time-domain approach, a simple observer for the generalized Chen chaotic system is proposed to guarantee the global exponential stability of the resulting error system. Furthermore, the guaranteed exponential convergence rate can be correctly estimated. Finally, a numerical example is provided to illustrate the use of the main result.

  11. Chemical constituents from tubers of Dracontium spruceanum (Schott) G. Zhu ex Dracontium loretense Krause (Araceae)

    International Nuclear Information System (INIS)

    Collantes Diaz, Ingrit; Goncalves, Eduardo; Yoshida, Massayoshi

    2011-01-01

    This work describes phytochemical analysis of an Araceae species Dracontium spruceanum (Schott) G.Zhu, which occurs in Amazon region and is popularly used against snakebite and treatment of some diseases. The solvent partitions and chromatographic fractionations of extract afforded sitosterol (I), stigmasterol (II), 3-β-hydroxycolest-5-en-7-one (III), p-hydroxybenzaldehyde (IV), p-hydroxybenzoic acid (V), acyl-glycosyl sitosterol (VI), acyl-glycosyl-7-oxo-sitosterol (VII), sitosteryl-glycoside (VIII), sucrose (IX). The polar fractions were acetylated before the purification and the isolation through chromatographic techniques yielded a mixture of peracetylated carbohydrates: 2,3,4,6-tetra-O-acetyl-1-ethyl-glucose (X), which was identified by spectroscopic analysis [GC-MS, 13 C NMR and 1 H NMR]. (author).

  12. Comparing numerical methods for the solutions of the Chen system

    International Nuclear Information System (INIS)

    Noorani, M.S.M.; Hashim, I.; Ahmad, R.; Bakar, S.A.; Ismail, E.S.; Zakaria, A.M.

    2007-01-01

    In this paper, the Adomian decomposition method (ADM) is applied to the Chen system which is a three-dimensional system of ODEs with quadratic nonlinearities. The ADM yields an analytical solution in terms of a rapidly convergent infinite power series with easily computable terms. Comparisons between the decomposition solutions and the classical fourth-order Runge-Kutta (RK4) numerical solutions are made. In particular we look at the accuracy of the ADM as the Chen system changes from a non-chaotic system to a chaotic one. To highlight some computational difficulties due to a high Lyapunov exponent, a comparison with the Lorenz system is given

  13. The age grading and the Chen-Ruan cup product

    DEFF Research Database (Denmark)

    A. Hepworth, Richard

    2010-01-01

    We prove that the obstruction bundle used to define the cup-product in Chen-Ruan cohomology is determined by the so-called `age grading' or `degree-shifting numbers'. Indeed, the obstruction bundle can be directly computed using the age grading. We obtain a Kunneth Theorem for Chen-Ruan cohomology...... as a direct consequence of an elementary property of the age grading, and explain how several other results - including associativity of the cup-product - can be proved in a similar way....

  14. An equilibrium point stabilization strategy for the Chen system

    International Nuclear Information System (INIS)

    Alvarez-Ramirez, Jose; Cevantes, Ilse; Femat, Ricardo

    2004-01-01

    The aim of this Letter is to address the equilibrium point stabilization problem of the Chen system by employing a simple linear feedback controller derived from time-scaling the dynamics of a single variable. The controller has the advantage of being easy to implement and a rigorous stability proof is provided based on singular perturbation arguments. Results are illustrated via numerical simulations

  15. Dynamics of fractional-ordered Chen system with delay

    Indian Academy of Sciences (India)

    Though this subject has a history of more than 300 years, utility and applicability of fractional calculus to various branches of science and engineering have been real- ... variants of Chen system and see the qualitative changes in attractor and ...

  16. Generalized projective synchronization between Lorenz system and Chen's system

    International Nuclear Information System (INIS)

    Li Guohui

    2007-01-01

    On the basis of active backstepping design, this paper presents the generalized projective synchronization between two different chaotic systems: Lorenz system and Chen's system. The proposed method combines backstepping methods and active control without having to calculate the Lyapunov exponents and the eigenvalues of the Jacobian matrix, which makes it simple and convenient. Numerical simulations show that this method works very well

  17. [Comparison of the effects of the intervention with electric thermal bian stone and air suction cup on blood perfusion at meridian points].

    Science.gov (United States)

    Zhao, Pengna; Wang, Yanping; Gu, Feifei; Li, Chaozheng; Wei, Yulong; Wang, Guangjun; Zhang, Weibo

    2018-02-12

    To observe the impacts of the intervention with electric thermal bian stone and air suction cup on blood perfusion (BP) at meridian points and explore the approach of accurate measurement and regulation of meridian qi and blood balance in "precise acupuncture". The laser Doppler line scanner (LDLS) was used to measure BP at bilateral yua n-primary points at the pericardium meridian, the triple energizer meridian, the gallbladder meridian and the liver meridian (small cycle of jueyin to shaoyang meridians) at 31 healthy receptors. The bias ratio of blood perfusion (BPBR) deviated to the reference value was calculated. The electric thermal bian stone and air suction cup were used in the intervention at the he -sea points of the affected meridians in which BPBR was relatively higher at the yuan -primary points. The electric thermal bian stone therapy was used when BPBR was less than -30% and the air suction cupping therapy was used when BPBR was higher than 30%. BP was measured twice before intervention and it was measured separately at the moment after intervention and in 20 min after intervention. The means of BP before and after intervention and the change ratio of blood perfusion (BPCR) before intervention, at the moment after intervention and 20 min after intervention were calculated. 1. After the intervention of electric thermal bian stone, BP mean was increased from (103.51±41.21) PU to (121.97±56.22) PU ( P 0.05), but the change ratio was highly remained. 2. After intervention with air suction cup, BP mean was reduced from (194.83±81.14) PU to (173.88±88.26) PU. Before intervention, at the moment after intervention and 20 min after intervention, separately, BPCR were (7.62±30.49)%, (-12.12±18.20)% and (-14.35±21.25)%. BPCR at the moment after intervention and in 20 min after intervention were significantly different from that before intervention (both P cup is opposite.

  18. Alternative implementation of the chaotic Chen-Lee system

    International Nuclear Information System (INIS)

    Sheu, L.-J.; Tam, L.-M.; Chen, H.-K.; Lao, S.-K.

    2009-01-01

    The chaotic Chen-Lee system was developed with a formalism based on the Euler equations for the motion of a rigid body. It was proved that this system is the governing set of equations for gyro motion with feedback control. Recently, studies were conducted to explore the dynamic behavior of this system, including fractional order behavior, the generation of hyperchaos and perturbation analysis, control and anti-control of chaos, synchronization, etc. In this study, we further explore (1) the stability of the equilibrium points and (2) the implementation of an electronic circuit using the Chen-Lee system. It is shown that not only is this system related to gyro motion but can also be applied to electronic circuits for encryption purposes.

  19. Chaos synchronization between Chen system and Genesio system

    International Nuclear Information System (INIS)

    Wu Xianyong; Guan Zhihong; Wu Zhengping; Li Tao

    2007-01-01

    This Letter presents two synchronization schemes between two different chaotic systems. Active control synchronization and adaptive synchronization between Chen system and Genesio system are studied, different controllers are designed to synchronize the drive and response systems, active control synchronization is used when system parameters are known; adaptive synchronization is employed when system parameters are unknown or uncertain. Simulation results show the effectiveness of the proposed schemes

  20. Juan Cham-Bom-Bian: recorrido del "médico chino"desde la Habana hacia Cárdenas. Breves apuntes históricos

    OpenAIRE

    Vega Jiménez, Junior

    2015-01-01

    Los orígenes de la medicina tradicional china en Cuba datan de la época colonial, cuyas técnicasfueronintroducidas a través de los inmigrantes chinos. Es muy frecuentelautilización, tanto en el argot popular como médico,delrefrán: "A ese no lo cura ni el médico chino".El origen de esta frase es real, y proviene del poco conocido JuanCham-Bom-Bian. La mayor parte de su estancia en Cuba ocurrió entre la sciudades de La Habana y Cárdenas; enesta última ocurrió su misteriosa muerte. El objetivo d...

  1. [Professor CHEN Xiuhua's experience in the treatment of atopic dermatitis].

    Science.gov (United States)

    Quan, Xiaohong; Li, Shuqian; Li, Ying

    2017-03-12

    Professor CHEN Xiuhua 's clinical experiences were introduced in the intervention on atopic dermatitis with external therapies of TCM acupuncture. On the basis of the theory as cultivating the earth and clearing the heart from professor CHEN Dacan and in terms of the disease stages and skin lesion characteristics, as well as in consideration of syndrome differen-tiation, the acupoints for strengthening the spleen and clearing heart fire are selected, such as Zhongwan (CV 12), Daheng (SP 15), Shuifen (CV 9), Tianshu (ST 25), Neiguan (PC 6) and Quchi (LI 11). For the repair of skin lesion, the integration of Chinese and western medicine is used, with the internal application and external use of Chinese herbal medicines involved. The topical ointments are selected rationally. The self-blood therapy is used with acupuncture, bleeding therapy and acupoint injection applied in combination on the basis of the theory of TCM zangfu organs and modern immunological mechanism, which stimulates the nonspecific immune response in the body and strengthens acupoint stimulus effects. Medical thread therapy of Guangxi Zhuang medicine is used in moxibustion for skin damage, which effectively stops itching and promotes wound healing and skin repair.

  2. The "third abstraction" of the Chinese artist LaoZhu: Neural and behavioral indicators of aesthetic appreciation.

    Science.gov (United States)

    Bao, Yan; Yang, Taoxi; Zhang, Jinfan; Zhang, Jiyuan; Lin, Xiaoxiong; Paolini, Marco; Pöppel, Ernst; Silveira, Sarita

    2017-06-01

    The eminent Chinese artist LaoZhu has created a homogeneous set of abstract pictures that are referred to as the "third abstraction." By definition, these pictures are meant to be representations of the artist's personal involvement and as such to create an internal point of view in the observer on an implicit level of processing. Aiming at investigating whether the artist's choice of a specific color is experienced in a specific way in the recipient, we assessed both explicit and implicit (i.e. neurocognitive) correlates in naive viewers of LaoZhu's pieces. The behavioral results reveal a preference of the original red paintings over color-changed counterparts in green or black. Paradoxically and inconsistent with predictions, we found higher levels of neural activation in several brain regions (predominantly in the frontal and parietal cortices) for the color-changed compared to the original red conditions. These observations add empirically to the complementarity of early visual pathways and higher-order cognition as well as of explicit and implicit information processing during aesthetic appreciation. We discuss our findings in light of processing effort and top-down control of the color-changed paintings. With regard to the third abstraction as defined by LaoZhu, in particular to the distinction between an external and internal point of view when viewing abstract art, our results contribute to an understanding of "abstraction and empathy" as a fundamental part of aesthetic appreciations. © 2017 The Institute of Psychology, Chinese Academy of Sciences and John Wiley & Sons Australia, Ltd.

  3. Eine praktische Anwendung von CMC-Flächen in der Bionik

    OpenAIRE

    Apeltauer, Christian

    2011-01-01

    Die vorliegende Arbeit beschäftigt sich mit den theoretischen Grundlagen für die Entwicklung von Oberflächen, die unter Wasser möglichst lange eine Luftschicht an sich halten können. Ein natürliches Vorbild für solche Oberflächen ist die Pflanze Salvinia molesta; technisch interessieren solche Oberflächen zur Verringerung des Wasserwiderstandes von Schiffen und als Schutz vor Besiedlung durch Wasserorganismen. Wichtigste Gleichung bei der Entwicklung solcher Oberflächen ist...

  4. How Memory Is Tested Influences What Is Measured: Reply to Wyble and Chen (2017)

    Science.gov (United States)

    Swallow, Khena M.; Jiang, Yuhong V.; Tan, Deborah H.

    2017-01-01

    In this response to Wyble and Chen's (2017) commentary on attribute amnesia, we hope to achieve several goals. First, we clarify how our view diverges from that described by Wyble and Chen. We argue that because the surprise memory test is disruptive, it is an insensitive tool for measuring the persistence of recently attended target attributes in…

  5. Courtship and mating of Scorpiops luridus Zhu Lourenço & Qi, 2005 (Scorpiones: Euscorpiidae from Xizang province, China

    Directory of Open Access Journals (Sweden)

    GB Jiao

    2010-01-01

    Full Text Available In the current work, the courtship and mating of Scorpiops luridus Zhu Lourenço & Qi, 2005 (Euscorpiidae from Xizang province (Tibet, China, were studied for the first time in the laboratory. Most of the mating behaviors in Scorpiops luridus are not remarkably different from those exhibited by other scorpions. However, for the first time a male pulling a female with its chelicerae to rapidly accomplish the sperm uptake was observed. Additionally, the sexual stinging behavior displayed by the male occurred in the initial stage, not during the promenade stage as previously described in several scorpion species. Through observation and analysis, we speculate that venom injection during sexual stinging is selective, possibly relying on the status shown by the stung scorpion (passive or aggressive. In order to clearly describe the process of courtship and mating, both sequences are represented in a flow chart, while the main behavior components of these processes were identified, analyzed and discussed.

  6. Semiclassical theory of electronically nonadiabatic chemical dynamics: Incorporation of the Zhu-Nakamura theory into the frozen Gaussian propagation method

    International Nuclear Information System (INIS)

    Kondorskiy, A.; Nakamura, H.

    2004-01-01

    The title theory is developed by combining the Herman-Kluk semiclassical theory for adiabatic propagation on single potential-energy surface and the semiclassical Zhu-Nakamura theory for nonadiabatic transition. The formulation with use of natural mathematical principles leads to a quite simple expression for the propagator based on classical trajectories and simple formulas are derived for overall adiabatic and nonadiabatic processes. The theory is applied to electronically nonadiabatic photodissociation processes: a one-dimensional problem of H 2 + in a cw (continuous wave) laser field and a two-dimensional model problem of H 2 O in a cw laser field. The theory is found to work well for the propagation duration of several molecular vibrational periods and wide energy range. Although the formulation is made for the case of laser induced nonadiabatic processes, it is straightforwardly applicable to ordinary electronically nonadiabatic chemical dynamics

  7. The role and significance of Luo Zhiyuan's Shu yi hui bian in the history of plague in Lingnan (south of the five ridges).

    Science.gov (United States)

    Li, H; Lai, W

    1999-04-01

    Being the earliest monograph on plague in China, Luo Zhiyuan's Shu yi hui bian, not included in the National Catalogue of TCM Books, include the following contents: personal idea on the etiology of plague; Luo's friend Wu Xuanchang' unpublished Shu yu zhi fa on the treatment and manifestations of plague; Luo's specific recipe for plague based on medified Wang Qingren's Jie du huo xue decoction based on Wang Qingrens yi lin gai cuo; therapy for critical cases; many therapies applied on Lingnan, including experimental recipes, external therapy, preventive methods, and preventing recurrence methods; Luo's special administrating methods, including persisting day-and-night method, immediate persisting method, single-dose persisting method, and double-dose persisting method. He also gave several cured case records. His book, featuring unique idea with good effect, was repeatedly printed and extensively distributed, exerting influence, more or less, on the plague monographs of later ages, and occupying important position in the history of plague on Lingnan and the whole country as well. His idea of "that poisons and static blood" in pathogenesis and therapeutic principle of antitoxicity and activating blood is coincided with the results of present day clinical and laboratory studies. His administration of medicines is heuristic to the therapy of critical cases with Chinese medicaments and to the recognition of pathogenesis, etiology, and treatment of modern plague as well as other diseases of similar etiology and pathognesis and is worth of further study.

  8. Bian Zheng Lun Zhi as a Complementary and Alternative Treatment for Menstrual Cramps in Women with Dysmenorrhea: A Prospective Clinical Observation

    Directory of Open Access Journals (Sweden)

    Pin-Yi Lin

    2014-01-01

    Full Text Available Background. Limited scientific evidence supports the positive effects of traditional Chinese medicine (TCM for treating dysmenorrhea. Thus, an observation period of 3 months could verify the ancient indication that TCM treatments effectively alleviate menstrual cramps in women with primary dysmenorrhea or endometriosis. Methods. A prospective, nonrandomized study (primary dysmenorrhea and endometriosis groups was conducted in women with dysmenorrhea for more than three consecutive menstrual cycles. All patients received TCM prescriptions based on bian zheng lun zhi theory 14 days before menstruation for a period of 12 weeks. Pain intensity was evaluated using a 10-cm visual analogue scale and two validated questionnaires (the Menstrual Distress Questionnaire and the World Health Organization Quality of Life questionnaire. Results. Of the initial 70 intent-to-treat participants, the women with dysmenorrhea reported significant alleviation of cramps during menstruation after the 12-week TCM treatment. Mixed model analysis revealed that TCM prescriptions were more effective in alleviating fatigue, hot flashes, dizziness, painful breasts, excitement, and irritability in the primary dysmenorrhea group (N=36 than in the endometriosis group (N=34. Conclusion. TCM prescriptions based on syndrome differentiation theory might be a potentially viable choice for treating painful menstruation and premenstrual symptoms after ruling out endometriosis.

  9. Lessons from Zhu Xi’s Views on Inquiry and Learning for Contemporary Advanced Humanities Education and Research

    Directory of Open Access Journals (Sweden)

    Kirill Ole THOMPSON

    2017-06-01

    Full Text Available We are bearing witness to the rapid rise of a brave new world of education as flashy websites and interactive software replace individual study and classroom lectures. The expansion of college lecture halls has been stretched thin with video lessons and distance learning, and the siren call of massive open online courses (MOOCs by star Ivy League professors renders the traditional classroom barren in the eyes of savvy students who have the system pegged. Several questions arise in this context. Can the students of today receive a college education in the full sense? Does learning still have the same quality without close interactions with teachers and classmates in small to medium sized classrooms? Does research hold the same significance today when much of the work is done and so much information supplied by computers? What lessons do Zhu Xi’s teachings on inquiry and learning have for this educational world of e-texts and cyber-lessons? While not a Luddite tract, the present study raises questions and concerns about the goals and conduct of higher education today which, as Heisenberg avers, should not only aim at transmitting knowledge understood in set ways, but also at inculcating new ways of thinking and understanding. A college education, as Zhu Xi holds for “advanced learning”, is as much about cultivating a thoughtful, responsible person as producing a professional expert. Such education should include cultivating a student’s sensitivity, logic, and judgment, as well as knowledge about humanity, society, and the world. It is often forgotten that such sensitivity, logic, knowledge, and commitment not only make the student more thoughtful and responsible, in short more self-conscious, but also give her additional perspectives and enhance her professional expertise.

  10. Forecasting Jakarta composite index (IHSG) based on chen fuzzy time series and firefly clustering algorithm

    Science.gov (United States)

    Ningrum, R. W.; Surarso, B.; Farikhin; Safarudin, Y. M.

    2018-03-01

    This paper proposes the combination of Firefly Algorithm (FA) and Chen Fuzzy Time Series Forecasting. Most of the existing fuzzy forecasting methods based on fuzzy time series use the static length of intervals. Therefore, we apply an artificial intelligence, i.e., Firefly Algorithm (FA) to set non-stationary length of intervals for each cluster on Chen Method. The method is evaluated by applying on the Jakarta Composite Index (IHSG) and compare with classical Chen Fuzzy Time Series Forecasting. Its performance verified through simulation using Matlab.

  11. Review of the genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae) with description of two new species.

    Science.gov (United States)

    Chang, Zhi-Min; Yang, Lin; Zhang, Zheng-Guang; Chen, Xiang-Sheng

    2015-12-11

    Two new species of the issid genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae): Neotetricodes longispinus Chang et Chen sp. nov. (China: Yunnan) and Neotetricodes xiphoideus Chang et Chen sp. nov. (China: Yunnan) are described and illustrated. The generic characteristic is redefined. A checklist and key to the species of the genus are provided. The female genitalia of the genus are firstly described.

  12. Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe

    OpenAIRE

    Spinner, Kaspar H.

    2014-01-01

    Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe. - In: Standardorientierung im Lese- und Literaturunterricht der Sekundarstufe I / Cornelia Rosebrock ; Heike Wirthwein. - Baltmannsweiler : Schneider-Verl. Hohengehren, 2014. - S. 126-132

  13. Sociology in Times of Crisis: Chen Da, National Salvation and the Indigenization of Knowledge

    Directory of Open Access Journals (Sweden)

    Ana Maria Candela

    2015-08-01

    Full Text Available Chen Da was one of the foremost sociologists of China from the 1920s to the 1940s. His intellectual habitus took shape from the long crisis that defined Chinese intellectual life from the mid-19th to mid-20th centuries, a period of continuous imperial assault on Chinese sovereignty. As China integrated into the capitalist world-system, neo-Confucian structures of knowledge came into question. Intellectuals took up sociology to guide China’s transition from an empire to a nation-state. Through his studies on labor, migration, and population, Chen Da contributed to the institutionalization of sociology in China. Chen sought to craft a theory of Chinese development that followed universal trajectories of progress but was also attuned to the complexity of Chinese society on the ground. Through his efforts to indigenize sociology, Chen developed a non-Marxist historical materialism, a deterritorialized and pluralistic conceptualization of China as a nation, and a theory of eugenic transformation centered on the concept of “mode of living.” The questions which Chen Da confronted are emblematic of the predicament faced by Chinese social scientists today, who again struggle with the dynamics of a deterritorialzied “Greater China,” rising social fragmentation, and refigured eugenic discourses and policies that aim to craft the Chinese people into ideal national subjects fit for post-socialist development.

  14. Hopf bifurcation analysis of Chen circuit with direct time delay feedback

    International Nuclear Information System (INIS)

    Hai-Peng, Ren; Wen-Chao, Li; Ding, Liu

    2010-01-01

    Direct time delay feedback can make non-chaotic Chen circuit chaotic. The chaotic Chen circuit with direct time delay feedback possesses rich and complex dynamical behaviours. To reach a deep and clear understanding of the dynamics of such circuits described by delay differential equations, Hopf bifurcation in the circuit is analysed using the Hopf bifurcation theory and the central manifold theorem in this paper. Bifurcation points and bifurcation directions are derived in detail, which prove to be consistent with the previous bifurcation diagram. Numerical simulations and experimental results are given to verify the theoretical analysis. Hopf bifurcation analysis can explain and predict the periodical orbit (oscillation) in Chen circuit with direct time delay feedback. Bifurcation boundaries are derived using the Hopf bifurcation analysis, which will be helpful for determining the parameters in the stabilisation of the originally chaotic circuit

  15. Synchronization and anti-synchronization coexist in Chen-Lee chaotic systems

    International Nuclear Information System (INIS)

    Chen, J.-H.; Chen, H.-K.; Lin, Y.-K.

    2009-01-01

    This study demonstrates that synchronization and anti-synchronization can coexist in Chen-Lee chaotic systems by direct linear coupling. Based on Lyapunov's direct method, a linear controller was designed to assure that two different types of synchronization can simultaneously be achieved. Further, the hybrid projective synchronization of Chen-Lee chaotic systems was studied using a nonlinear control scheme. The nonlinear controller was designed according to the Lyapunov stability theory to guarantee the hybrid projective synchronization, including synchronization, anti-synchronization, and projective synchronization. Finally, numerical examples are presented in order to illustrate the proposed synchronization approach.

  16. His Excellency Professor Jiaer Chen President, National Natural Science Foundation, People's Republic of China

    CERN Multimedia

    Maximilien Brice

    2002-01-01

    L. to r.: Dr Diether Blechschmidt, Adviser for Non Member States Relations, Dr Peter Jenni, Spokesman, ATLAS Experiment, Prof. Chen, Mr Jean-Luc Baldy, Head of the LHC Civil Engineering Group and Dr John Ellis, Adviser for Non Member States Relations.

  17. TEST OF THE CHEN-ROLL-ROSS MACROECONOMIC FACTOR MODEL: EVIDENCE FROM CROATIAN STOCK MARKET

    Directory of Open Access Journals (Sweden)

    Denis Dolinar

    2015-12-01

    Full Text Available This paper empirically examines the well-known Chen-Roll-Ross model on the Croatian stock market. Modifications of definitions of the Chen-Roll-Ross model variables showed as necessary because of doubtful availability and quality of input data needed. Namely, some macroeconomic and market variables are not available in the originally defined form or do not exist. In that sense this paper gives some alternative definitions for some model variables. Also, in order to improve statistical analysis, in this paper we have modified Fama-MacBeth technique in the way that second-pass regression was substituted with panel regression analysis. Based on the two-pass regression analysis of returns of 34 Croatian stocks on 4 macroeconomic variables during the seven-and-half-year observation period the following conclusion is made. In contrast to the results of Chen, Roll and Ross (1986 for the U.S. stock market, their model is not successful when describing a risk-return relation of Croatian stocks. Nevertheless, one observed version of the Chen-RollRoss model showed certain statistical significance. Namely, two risk factors in that version of the model were statistically significant: default premium, measured as risk premium for the corporate short-term bank loan financing, and term structure premium, measured on short-run basis.

  18. 76 FR 71048 - Sixth Annual Philip S. Chen, Jr. Distinguished Lecture on Innovation and Technology Transfer

    Science.gov (United States)

    2011-11-16

    ... present ``Treatment of Cancer with Recombinant Immunotoxins: From Technology Transfer to the Patient.'' Dr. Pastan is an NIH Distinguished Investigator and Chief, Laboratory of Molecular Biology, National Cancer Institute Center for Cancer Research. This annual series honors Dr. Philip S. Chen, Jr. for his almost 50...

  19. Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing

    Directory of Open Access Journals (Sweden)

    Richard K. Payne

    2016-03-01

    Full Text Available Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between the expectations of the dominant religious culture and the immigrant culture in terms of the ways in which religious leaders represent themselves. Both Billy Graham and the Dalai Lama present themselves in very humble terms, consistent with the expectations of the Pietist background to American popular religion. Yogi Chen on the contrary tends toward a self-aggrandizing style, which although consistent with the competitive nature of premodern Tibetan religious culture is not congruent with the expectations of American popular religion.

  20. Parametric study of the fractional-order Chen-Lee system

    Energy Technology Data Exchange (ETDEWEB)

    Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Tou, W.M.S. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)

    2008-08-15

    The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q{sub 1} = q{sub 2} = q{sub 3} = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found.

  1. Parametric study of the fractional-order Chen-Lee system

    International Nuclear Information System (INIS)

    Tam, L.M.; Tou, W.M.S.

    2008-01-01

    The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q 1 = q 2 = q 3 = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found

  2. A numeric-analytic method for approximating the chaotic Chen system

    International Nuclear Information System (INIS)

    Mossa Al-sawalha, M.; Noorani, M.S.M.

    2009-01-01

    The epitome of this paper centers on the application of the differential transformation method (DTM) the renowned Chen system which is described as a three-dimensional system of ODEs with quadratic nonlinearities. Numerical comparisons are made between the DTM and the classical fourth-order Runge-Kutta method (RK4). Our work showcases the precision of the DTM as the Chen system transforms from a non-chaotic system to a chaotic one. Since the Lyapunov exponent for this system is much higher compared to other chaotic systems, we shall highlight the difficulties of the simulations with respect to its accuracy. We wrap up our investigations to reveal that this direct symbolic-numeric scheme is effective and accurate.

  3. Software-Lösungen in B2B-Verkaufsgesprächen wirkungsvoll einsetzen

    OpenAIRE

    Thoma, Axel Michael

    2017-01-01

    Dieser Beitrag befasst sich mit dem Einsatz von Software-Lösungen in B2B-Verkaufsgesprächen (auf Englisch: Digital Sales Enablement). Anhand aktueller Beispiele aus der Geschäftswelt wird erklärt, wie solche Lösungen helfen (1) die Produktivität zu steigern, (2) Kunden zu aktivieren und (3) Neugeschäft zu entwickeln. Ebenfalls werden die Konzeption und Umsetzung solcher Lösungen behandelt.

  4. Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing

    OpenAIRE

    Richard K. Payne

    2016-01-01

    Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between ...

  5. Tensioned Fabric Structures with Surface in the Form of Chen-Gackstatter

    Directory of Open Access Journals (Sweden)

    Yee Hooi Min

    2016-01-01

    Full Text Available Form-finding has to be carried out for tensioned fabric structure in order to determine the initial equilibrium shape under prescribed support condition and prestress pattern. Tensioned fabric structures are normally designed to be in the form of equal tensioned surface. Tensioned fabric structure is highly suited to be used for realizing surfaces of complex or new forms. However, research study on a new form as a tensioned fabric structure has not attracted much attention. Another source of inspiration minimal surface which could be adopted as form for tensioned fabric structure is very crucial. The aim of this study is to propose initial equilibrium shape of tensioned fabric structures in the form of Chen-Gackstatter. Computational form-finding using nonlinear analysis method is used to determine the Chen-Gackstatter form of uniformly stressed surfaces. A tensioned fabric structure must curve equally in opposite directions to give the resulting surface a three dimensional stability. In an anticlastic doubly curved surface, the sum of all positive and all negative curvatures is zero. This study provides an alternative choice for structural designer to consider the Chen-Gackstatter applied in tensioned fabric structures. The results on factors affecting initial equilibrium shape can serve as a reference for proper selection of surface parameter for achieving a structurally viable surface.

  6. Ronald Malt or Chen Zhongwei: Who performed the first surgical replantation?

    Science.gov (United States)

    Fan, Ka-Wai

    2018-01-01

    This article discusses the contributions of the two pioneers of the surgical procedure of replantation-Ronald Malt in the US and Chen Zhongwei in China. Ronald Malt performed the reattachment surgery on a boy who had an accident in 1962, but he published his case report two years later in 1964. Chen Zhongwei performed a similar surgery on a worker who cut off his forearm in 1963, but he published his case report the same year. There is some debate about which one of these reputed surgeons should be given credit for being the first one to perform this breakthrough surgery, because although Malt was the first to perform the procedure, Zhongwei was the first to report it. To shed light on this controversy, criteria for scientific priority suggested by Ronald Vale and Anthony Hyman were applied. Although the criteria mainly favored Zhongwei as the pioneer of this procedure, he did not entirely fulfill one of the criteria. Therefore, the article could not present a definitive answer to the question, and it concludes by pointing out the highly commendable achievements and contributions of both Ronald Malt and Chen Zhongwei.

  7. Time budgets of Snow Geese Chen caerulescens and Ross's Geese Chen rossii in mixed flocks: Implications of body size, ambient temperature and family associations

    Science.gov (United States)

    Jonsson, J.E.; Afton, A.D.

    2009-01-01

    Body size affects foraging and forage intake rates directly via energetic processes and indirectly through interactions with social status and social behaviour. Ambient temperature has a relatively greater effect on the energetics of smaller species, which also generally are more vulnerable to predator attacks than are larger species. We examined variability in an index of intake rates and an index of alertness in Lesser Snow Geese Chen caerulescens caerulescens and Ross's Geese Chen rossii wintering in southwest Louisiana. Specifically we examined variation in these response variables that could be attributed to species, age, family size and ambient temperature. We hypothesized that the smaller Ross's Geese would spend relatively more time feeding, exhibit relatively higher peck rates, spend more time alert or raise their heads up from feeding more frequently, and would respond to declining temperatures by increasing their proportion of time spent feeding. As predicted, we found that Ross's Geese spent more time feeding than did Snow Geese and had slightly higher peck rates than Snow Geese in one of two winters. Ross's Geese spent more time alert than did Snow Geese in one winter, but alert rates differed by family size, independent of species, in contrast to our prediction. In one winter, time spent foraging and walking was inversely related to average daily temperature, but both varied independently of species. Effects of age and family size on time budgets were generally independent of species and in accordance with previous studies. We conclude that body size is a key variable influencing time spent feeding in Ross's Geese, which may require a high time spent feeding at the expense of other activities. ?? 2008 The Authors.

  8. Using Detrital Zircon Geochronology to Constrain Paleogene Provenance and Its Relationship to Rifting in the Zhu 1 Depression, Pearl River Mouth Basin, South China Sea

    Science.gov (United States)

    Wang, Wei; Ye, Jiaren; Bidgoli, Tandis; Yang, Xianghua; Shi, Hesheng; Shu, Yu

    2017-11-01

    Paleogene syn-rift successions in the South China Sea are poorly understood and systematic provenance analysis, which could provide clues to their history, is lacking. Here we report 409 new concordant U-Pb ages from detrital zircons separated from the Paleogene Wenchang, Enping, and Zhuhai formations in the Zhu 1 depression, Pearl River Mouth Basin. The new data, combined with the published age data from the region, document changes in the provenance of syn-rift successions. Detrital zircons from the Eocene Wenchang Formation are unimodal, with Jurassic-Cretaceous (180-80 Ma) ages making up >80% of grains. The ages are consistent with the geochronology of intrabasinal highs, dominated by igneous rocks emplaced during the Yanshanian orogeny, and suggest local provenance. By contrast, detrital zircons from the upper Eocene to lower Oligocene Enping Formation form three well-recognized age-clusters, with peaks at 150, 254, and 438 Ma that match documented tectonomagmatism in South China Block (SCB). Combined with increasing numbers of Precambrian zircons, the data suggest increasing influence of regional provenance of the SCB. Similar age peaks are also recognized from the limited number of zircons analyzed from the upper Oligocene Zhuhai Formation and comparability with modern shelf and river sediment indicates the unit was mainly sourced from the SCB and likely transported by a paleo-Pearl River. We infer that the change in provenance, from local uplifts within the Zhu 1 to the SCB, is related to distinct phases of PRMB rift development; however, later changes are best explained by SCB drainage evolution.

  9. Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation

    Energy Technology Data Exchange (ETDEWEB)

    Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Chen, J.H. [Department of Mechanical Engineering, Chung Hua University, Hsinchu, Taiwan (China); Chen, H.K. [Department of Mechanical Engineering, Hsiuping Institute of Technology, Taichung, Taiwan (China); Wai Meng Si Tou [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)

    2008-11-15

    A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, {epsilon}, and {omega}. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study.

  10. Security problems for a pseudorandom sequence generator based on the Chen chaotic system

    Science.gov (United States)

    Özkaynak, Fatih; Yavuz, Sırma

    2013-09-01

    Recently, a novel pseudorandom number generator scheme based on the Chen chaotic system was proposed. In this study, we analyze the security weaknesses of the proposed generator. By applying a brute force attack on a reduced key space, we show that 66% of the generated pseudorandom number sequences can be revealed. Executable C# code is given for the proposed attack. The computational complexity of this attack is O(n), where n is the sequence length. Both mathematical proofs and experimental results are presented to support the proposed attack.

  11. Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation

    International Nuclear Information System (INIS)

    Tam, L.M.; Chen, J.H.; Chen, H.K.; Wai Meng Si Tou

    2008-01-01

    A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, ε, and ω. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study

  12. Dark energy from cosmological fluids obeying a Shan-Chen non-ideal equation of state

    OpenAIRE

    Bini, Donato; Geralico, Andrea; Gregoris, Daniele; Succi, Sauro

    2014-01-01

    We consider a Friedmann-Robertson-Walker universe with a fluid source obeying a nonideal equation of state with ‘‘asymptotic freedom,’’ namely ideal gas behavior (pressure changes directly proportional to density changes) both at low and high density regimes, following a fluid dynamical model due to Shan and Chen. It is shown that, starting from an ordinary energy density component, such fluids naturally evolve towards a universe with a substantial ‘‘dark energy’’ component at the present tim...

  13. Le jeu de la création : Le mangeur (2005 de Ying Chen

    Directory of Open Access Journals (Sweden)

    Nicole Dunham

    2013-11-01

    Full Text Available Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005 de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants : le ventre du père, les tableaux peints par ce dernier et l’espace-temps de A., et la fenêtre. Ces éléments deviennent des aires de jeu, remettant en question les concepts de l’intérieur et de l’extérieur et du créateur et de l’œuvre. En nous servant du texte « Le Tunnel » écrit par Ying Chen, nous démontrerons que cette notion du jeu s’applique également à l’ensemble de son œuvre.

  14. Theoretical and experimental study of Chen chaotic system with notch filter feedback control

    International Nuclear Information System (INIS)

    Ming, Zhang Xiao; Jian-Hua, Peng; Ju-Fang, Chen

    2010-01-01

    Since the past two decades, the time delay feedback control method has attracted more and more attention in chaos control studies because of its simplicity and efficiency compared with other chaos control schemes. Recently, it has been proposed to suppress low-dimensional chaos with the notch filter feedback control method, which can be implemented in a laser system. In this work, we have analytically determined the controllable conditions for notch filter feedback controlling of Chen chaotic system in terms of the Hopf bifurcation theory. The conditions for notch filter feedback controlled Chen chaoitc system having a stable limit cycle solution are given. Meanwhile, we also analysed the Hopf bifurcation direction, which is very important for parameter settings in notch filter feedback control applications. Finally, we apply the notch filter feedback control methods to the electronic circuit experiments and numerical simulations based on the theoretical analysis. The controlling results of notch filter feedback control method well prove the feasibility and reliability of the theoretical analysis. (general)

  15. Chen Jingrun, China's famous mathematician: devastated by brain injuries on the doorstep to solving a fundamental mathematical puzzle.

    Science.gov (United States)

    Lei, Ting; Belykh, Evgenii; Dru, Alexander B; Yagmurlu, Kaan; Elhadi, Ali M; Nakaji, Peter; Preul, Mark C

    2016-07-01

    Chen Jingrun (1933-1996), perhaps the most prodigious mathematician of his time, focused on the field of analytical number theory. His work on Waring's problem, Legendre's conjecture, and Goldbach's conjecture led to progress in analytical number theory in the form of "Chen's Theorem," which he published in 1966 and 1973. His early life was ravaged by the Second Sino-Japanese War and the Chinese Cultural Revolution. On the verge of solving Goldbach's conjecture in 1984, Chen was struck by a bicyclist while also bicycling and suffered severe brain trauma. During his hospitalization, he was also found to have Parkinson's disease. Chen suffered another serious brain concussion after a fall only a few months after recovering from the bicycle crash. With significant deficits, he remained hospitalized for several years without making progress while receiving modern Western medical therapies. In 1988 traditional Chinese medicine experts were called in to assist with his treatment. After a year of acupuncture and oxygen therapy, Chen could control his basic bowel and bladder functions, he could walk slowly, and his swallowing and speech improved. When Chen was unable to produce complex work or finish his final work on Goldbach's conjecture, his mathematical pursuits were taken up vigorously by his dedicated students. He was able to publish Youth Math, a mathematics book that became an inspiration in Chinese education. Although he died in 1996 at the age of 63 after surviving brutal political repression, being deprived of neurological function at the very peak of his genius, and having to be supported by his wife, Chen ironically became a symbol of dedication, perseverance, and motivation to his students and associates, to Chinese youth, to a nation, and to mathematicians and scientists worldwide.

  16. Pitchfork bifurcation and circuit implementation of a novel Chen hyper-chaotic system

    International Nuclear Information System (INIS)

    Dong En-Zeng; Chen Zeng-Qiang; Chen Zai-Ping; Ni Jian-Yun

    2012-01-01

    In this paper, a novel four dimensional hyper-chaotic system is coined based on the Chen system, which contains two quadratic terms and five system parameters. The proposed system can generate a hyper-chaotic attractor in wide parameters regions. By using the center manifold theorem and the local bifurcation theory, a pitchfork bifurcation is demonstrated to arise at the zero equilibrium point. Numerical analysis demonstrates that the hyper-chaotic system can generate complex dynamical behaviors, e.g., a direct transition from quasi-periodic behavior to hyper-chaotic behavior. Finally, an electronic circuit is designed to implement the hyper-chaotic system, the experimental results are consist with the numerical simulations, which verifies the existence of the hyper-chaotic attractor. Due to the complex dynamic behaviors, this new hyper-chaotic system is useful in the secure communication. (general)

  17. Le jeu de la création : Le mangeur (2005) de Ying Chen

    OpenAIRE

    Nicole Dunham

    2013-01-01

    Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005) de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants...

  18. Chen-Nester-Tung quasi-local energy and Wang-Yau quasi-local mass

    Science.gov (United States)

    Liu, Jian-Liang; Yu, Chengjie

    2017-10-01

    In this paper, we show that the Chen-Nester-Tung (CNT) quasi-local energy with 4D isometric matching references is closely related to the Wang-Yau (WY) quasi-local energy. As a particular example, we compute the second variation of the CNT quasi-local energy for axially symmetric Kerr-like spacetimes with axially symmetric embeddings at the obvious critical point (0 , 0) and find that it is a saddle critical point in most of the cases. Also, as a byproduct, we generalize a previous result about the coincidence of the CNT quasi-local energy and Brown-York mass for axially symmetric Kerr-like spacetimes by Tam and the first author Liu and Tam (2016) to general spacetimes.

  19. From Wang-Chen System with Only One Stable Equilibrium to a New Chaotic System Without Equilibrium

    Science.gov (United States)

    Pham, Viet-Thanh; Wang, Xiong; Jafari, Sajad; Volos, Christos; Kapitaniak, Tomasz

    2017-06-01

    Wang-Chen system with only one stable equilibrium as well as the coexistence of hidden attractors has attracted increasing interest due to its striking features. In this work, the effect of state feedback on Wang-Chen system is investigated by introducing a further state variable. It is worth noting that a new chaotic system without equilibrium is obtained. We believe that the system is an interesting example to illustrate the conversion of hidden attractors with one stable equilibrium to hidden attractors without equilibrium.

  20. Enterobacter xiangfangensis sp. nov., isolated from Chinese traditional sourdough, and reclassification of Enterobacter sacchari Zhu et al. 2013 as Kosakonia sacchari comb. nov.

    Science.gov (United States)

    Gu, Chun Tao; Li, Chun Yan; Yang, Li Jie; Huo, Gui Cheng

    2014-08-01

    A Gram-stain-negative bacterial strain, 10-17(T), was isolated from traditional sourdough in Heilongjiang Province, China. The bacterium was characterized by a polyphasic approach, including 16S rRNA gene sequence analysis, RNA polymerase β subunit (rpoB) gene sequence analysis, DNA gyrase (gyrB) gene sequence analysis, initiation translation factor 2 (infB) gene sequence analysis, ATP synthase β subunit (atpD) gene sequence analysis, fatty acid methyl ester analysis, determination of DNA G+C content, DNA-DNA hybridization and an analysis of phenotypic features. Strain 10-17(T) was phylogenetically related to Enterobacter hormaechei CIP 103441(T), Enterobacter cancerogenus LMG 2693(T), Enterobacter asburiae JCM 6051(T), Enterobacter mori LMG 25706(T), Enterobacter ludwigii EN-119(T) and Leclercia adecarboxylata LMG 2803(T), having 99.5%, 99.3%, 98.7%, 98.5%, 98.4% and 98.4% 16S rRNA gene sequence similarity, respectively. On the basis of polyphasic characterization data obtained in the present study, a novel species, Enterobacter xiangfangensis sp. nov., is proposed and the type strain is 10-17(T) ( = LMG 27195(T) = NCIMB 14836(T) = CCUG 62994(T)). Enterobacter sacchari Zhu et al. 2013 was reclassified as Kosakonia sacchari comb. nov. on the basis of 16S rRNA, rpoB, gyrB, infB and atpD gene sequence analysis and the type strain is strain SP1(T)( = CGMCC 1.12102(T) = LMG 26783(T)). © 2014 IUMS.

  1. Xue-fu-Zhu-Yu decoction protects rats against retinal ischemia by downregulation of HIF-1α and VEGF via inhibition of RBP2 and PKM2.

    Science.gov (United States)

    Tan, Shu-Qiu; Geng, Xue; Liu, Jorn-Hon; Pan, Wynn Hwai-Tzong; Wang, Li-Xiang; Liu, Hui-Kang; Hu, Lei; Chao, Hsiao-Ming

    2017-07-14

    Retinal ischemia-related eye diseases result in visual dysfunction. This study investigates the protective effects and mechanisms of Xue-Fu-Zhu-Yu decoction (XFZYD) with respect to retinal ischemia. Retinal ischemia (I) was induced in Wistar rats by a high intraocular pressure (HIOP) of 120 mmHg for 1 h, which was followed by reperfusion of the ischemic eye; the fellow untreated eye acted as a control. Electroretinogram (ERG), biochemistry and histopathology investigations were performed. Significant ischemic changes occurred after ischemia including decreased ERG b-wave ratios, less numerous retinal ganglion cells (RGCs), reduced inner retinal thickness, fewer choline acetyltransferase (ChAT) labeled amacrine cell bodies, increased glial fibrillary acidic protein (GFAP) immunoreactivity and increased vimentin Müller immunolabeling. These were accompanied by significant increases in the mRNA/protein concentrations of vascular endothelium growth factor, hypoxia-inducible factor-1α, pyruvate kinase M2 and retinoblastoma-binding protein 2. The ischemic changes were concentration-dependently and significantly altered when XFZYD was given for seven consecutive days before or after retina ischemia, compared to vehicle. These alterations included enhanced ERG b-wave amplitudes, more numerous RGCs, enhanced inner retinal thickness, a greater number of ChAT immunolabeled amacrine cell bodies and decreased GFAP/vimentin immunoreactivity. Furthermore, decreased mRNA levels of VEGF, HIF-1α, PKM2, and RBP2 were also found. Reduced protein concentrations of VEGF, HIF-1α, PKM2, and RBP2 were also demonstrated. Furthermore, there was an inhibition of the ischemia-associated increased ratios (target protein/β-actin) in the protein levels of VEGF, HIF-1α, PKM2, and RBP2, which were induced by Shikonin, JIB-04 or Avastin. XFZYD would seem to protect against well-known retinal ischemic changes via a synergistic inhibition of RBP2 and PKM2, as well as down-regulation of HIF-1

  2. Modern process study on Chen Co and Ranwu Lake of Tibetan Plateau

    Science.gov (United States)

    Ju, J.

    2013-12-01

    Lakes are important junctions of geospheres. There are many lakes distributed on the Tibetan Plateau (TP). Lake sediment is one of the important media for retrieving the past environmental changes. Because of the uniqueness of environment of the TP, sediment, water and ecological system in lakes has local characteristic inevitably. Modern process research on different lakes will benefit interpreting the proxies more accurately. The development of observation station makes the observation and sampling more convenient. Modern process of lakes can be fulfilled in two ways, spatial or seasonal variation study, with a same aim finding out the dominant factors controlling the variations. Chen Co is a closed lake locating at inland area of southern Tibet. Ranwu Lake is an open lake locating at outflow area of SE Tibet. In this study, I studied the spatial and (or) seasonal variation of lake water and sediment in the two distinct types of lakes to make clear the mechanism of modern process. Particular attention was given to the pattern and degree of influence of rivers supplied by glaciers on lakes. Preliminary conclusions are outlined as follow: (1) In the lakes with glacier melt supplying rivers, the patterns of supply of the rivers to the lake are different. In close lake Chen Co, the influence of glacier melt is mainly reflected in the south lake area. In the open lake Ranwu Lake, the influence is comprehensive and direct. This difference influencing patterns how the lake sediments reflected the glacier melt under the past environmental changes. (2) The supply of Kaluxiong Qu River, supplied mainly by glacier melt, to Chen co has North-South difference: more directly to south lake area, reflecting by lower value of conductivity and pH, finer grain size and west to east transporting trend, greater deposition rate, more allogenic fine sediments, not obvious biological and endogenic deposition there. This enlightens the site selection for lake cores and interpretation of

  3. The impact of systematic landscape conservation planning on ecosystem: Chen Youlan river watershed

    Science.gov (United States)

    Chen, Chi-ju

    2017-04-01

    Heraclitus said that "no man ever steps in the same river twice." Everything continues to change. Land use change will keep redefine itself and subject the Earth and humankind to collateral changes. Humankind benefits from ecosystem in many ways. The ecosystem provides people with nutrients, enriches soil with sediment, and sustains all living organisms with water; these benefits are known as ecosystem services. In Taiwan, land use change has impacted ecosystem and biodiversity on various levels. Thus, we took six land use scenarios from 1999 to 2005 in Chen Youlan river watershed as our case study, intending to observe the course of ecosystem and biodiversity changes and the cause of it. Systematic Landscape conservation planning (SLCP) framework can be adopted when designing land use policy to safeguard human interests and ecosystem. This study use SLCP to develop ecosystem services and biodiversity protection strategies. Several strategies were designed by using 1999 to 2005 data as provision to protect the intactness of future ecosystem services and biodiversity. This research explores the potential and possible impacts of different land use protection strategies in the future. It is possible to identify the conservation priority of a certain region by using the Zonation meta-algorithm. This study selects the zonation critical protection area (Joint set of Yushan National Park) as strategy A, B and C. Strategy D takes Yushan National Park as a protected area; unstable hot spots in 1999/03 (Joint set of Yushan National Park) are selected as strategy E. Next, we used Kappa statistical method to find the minimal ecosystem services change and biodiversity hotspots change of the five aforementioned strategies and compared with those from 1999/03. By the Kappa statistical method, we further prioritized the important conservation areas by strategy A, B, C, E in the future. The results can not only serve as management reference for government agencies, but also develop

  4. Wormholes supported by phantom energy from Shan-Chen cosmological fluids

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Deng [Nankai University, Theoretical Physics Division, Chern Institute of Mathematics, Tianjin (China); Meng, Xin-He [Nankai University, Department of Physics, Tianjin (China); Institute of Theoretical Physics, CAS, State key Lab of Theoretical Physics, Beijing (China)

    2016-03-15

    In the present paper, the exact solutions of spherically symmetrical Einstein field equations describing wormholes supported by phantom energy that violates the null energy condition from Shan-Chen background fluid are obtained. We have considered the important case of the model parameter ψ ∼ 1, which corresponds to the ''saturation effect'', and this regime corresponds to an effective form of ''asymptotic freedom'' for the fluids, but occurring at cosmological rather than subnuclear scales. Then we investigate the allowed range for the values of the model parameters g and ω when the spacetime metrics describe wormholes and discuss the possible singularities of the solutions, finding that the obtained spacetimes are geodesically complete. Furthermore, we construct two traversable wormholes through matching our obtained interior solutions to the exterior Schwarzschild solutions and analyze the traversabilities of the wormholes. Finally, we consider the case of anisotropic pressure and discover that the transverse pressure also crosses the phantom divide -1 with the growth of the wormhole dimension, and it tends to be the same as the radial pressure with the growth of the wormhole radius. (orig.)

  5. Psychometric properties of the Revised Chen Internet Addiction Scale (CIAS-R) in Chinese adolescents.

    Science.gov (United States)

    Mak, Kwok-Kei; Lai, Ching-Man; Ko, Chih-Hung; Chou, Chien; Kim, Dong-Il; Watanabe, Hiroko; Ho, Roger C M

    2014-10-01

    The Revised Chen Internet Addiction Scale (CIAS-R) was developed to assess Internet addiction in Chinese populations, but its psychometric properties in adolescents have not been examined. This study aimed to evaluate the factor structure and psychometric properties of CIAS-R in Hong Kong Chinese adolescents. 860 Grade 7 to 13 students (38 % boys) completed the CIAS-R, the Young's Internet Addiction Test (IAT), and the Health of the Nation Outcome Scales for Children and Adolescents (HoNOSCA) in a survey. The prevalence of Internet addiction as assessed by CIAS-R was 18 %. High internal consistency and inter-item correlations were reported for the CIAS-R. Results from the confirmatory factor analysis suggested a four-factor structure of Compulsive Use and Withdrawal, Tolerance, Interpersonal and Health-related Problems, and Time Management Problems. Moreover, results of hierarchical multiple regression supported the incremental validity of the CIAS-R to predict mental health outcomes beyond the effects of demographic differences and self-reported time spent online. The CIAS is a reliable and valid measure of internet addiction problems in Hong Kong adolescents. Future study is warranted to validate the cutoffs of the CIAS-R for identification of adolescents with Internet use problems who may have mental health needs.

  6. Writing Beyond the Wall: Translation, Cross-cultural Exchange, and Chen Ran's 'A Private Life'

    Directory of Open Access Journals (Sweden)

    Kay Schaffer

    2006-09-01

    Full Text Available The past decade has witnessed an unprecedented rise in the global flow of knowledge, nowhere more apparent in the exchange of ideas between China and modern western democracies. Our interest concerns one aspect of this global flow— the translation of Chinese women’s autobiographical writing into English. Taking Chen Ran’s A Private Life (English edition, 2004 as a point of departure, the paper explores issues of translingual practice and cross-cultural exchange. It considers what escapes or is lost in translation as well as the additive potential of the host text. It is sometimes the case that the translation can deliberately make certain ambiguities visible—whether from pragmatic, market-driven motivations or from more complex political, historical and cultural considerations. These negotiations of meaning that occur in the translation process can reverberate on the critical reception of texts in both the ‘guest’ and ‘host’ languages (Liu 1995, with open-ended, incomplete and indeterminate effects. The paper examines the effects of the omission of a brief parenthetical section of three paragraphs from one chapter of the Chinese edition of A Private Life. Yet, even that small emendation changes the original text as a cultural object and alters potential modes of its reception. In this case, the translation results in a loss of ambiguity, irony, philosophic and rhetorical sophistication while also offering additive potentials that enhance the generation of new meanings in the translingual exchange, here with reference Tiananmen and contemporary feminism in China. The translation process provides new channels for readers, writers and theorists to dialogue and communicate across gaps of difference, despite inhibiting factors like the imposition of local restraints, the universalising pressures of western modernity, and asymmetrical relations of power between guest and host language contexts.

  7. Politics in the Western Maya Region (I: Ajawil/Ajawlel and Ch'e'n

    Directory of Open Access Journals (Sweden)

    Péter Bíró

    2011-01-01

    Full Text Available In a series of articles I reflect on the use of various expressions which are connected to what we call the political in the inscriptions of the Classic Maya Western Region. These words express concepts which help to understand the intricate details of the interactions between the political entities and their internal organisations in the Classic Maya Lowlands. Words such as 7ajawil, 7ajawlel, the kennings built on the base of ch'e7n (cave, pond, the emblem glyphs and titles will be examined in light of what they tell us about the functioning of the political organisation of the Classic Period in a constrained region.En una serie de artículos como éste investigo el uso de varias palabras en las inscripciones mayas de la época Clásica de la Región Occidental vinculadas con lo que nosotros llamamos "política". Estas palabras expresan conceptos que ayudan a entender los matices de las relaciones entre las entidades políticas de las Tierras Bajas Mayas y su organización interna. Términos como ajaw'ü I ajawlel, los difrasismos con base ch'e'n (cueva, pozo, los glifos emblemas y los títulos serán examinados tomando en cuenta la información que nos proporcionan sobre el funcionamiento de la organización política de la época Clásica en una región restringida.

  8. [Academic thoughts on Practice of acupuncture and moxibustion written by CHEN Jingwen, the acupuncture master in the Republic of China].

    Science.gov (United States)

    Huang, Weiping; Li, Naiqi

    2015-03-01

    Through the collection of Practice of acupuncture and moxibustion written by CHEN Jingwen, the acupuncture master in the Republic of China, the academic characteristics on acupuncture and moxibusiton were analyzed. The literature comparison method was adopted to compare the works of LUO Zhaoju, ZENG Tianzhi and LI Wenxian, etc. at the same period. It was discovered that CHEN Jingwen was the medical master who systematicly brought up the theory of acupoint properties earlier in the modern times. Classifying drugs based on acupoints was his academic feature. Additionally, the compatibility therapy of Chinese medicine was introduced to explain the essential ideas on the acupoints combination. The treatment was determined on the basis of zangxiang theory and the reinforcing and reducing therapy of acupuncture was emphasized in the determination of treatment and prescription. CHEN Jingwen's theory of acupoint property had been stressed and spread among the medical scholars in the Republic of China and he had made the beneficial exploration for the development of modern acupuncture and moxibustion therapy.

  9. Molecular diversity analysis of Tetradium ruticarpum (WuZhuYu) in China based on inter-primer binding site (iPBS) markers and inter-simple sequence repeat (ISSR) markers.

    Science.gov (United States)

    Xu, Jing-Yuan; Zhu, Yan; Yi, Ze; Wu, Gang; Xie, Guo-Yong; Qin, Min-Jian

    2018-01-01

    "Wu zhu yu", which is obtained from the dried unripe fruits of Tetradium ruticarpum (A. Jussieu) T. G. Hartley, has been used as a traditional Chinese medicine for treatment of headaches, abdominal colic, and hypertension for thousands of years. The present study was designed to assess the molecular genetic diversity among 25 collected accessions of T. ruticarpum (Wu zhu yu in Chinese) from different areas of China, based on inter-primer binding site (iPBS) markers and inter-simple sequence repeat (ISSR) markers. Thirteen ISSR primers generated 151 amplification bands, of which 130 were polymorphic. Out of 165 bands that were amplified using 10 iPBS primers, 152 were polymorphic. The iPBS markers displayed a higher proportion of polymorphic loci (PPL = 92.5%) than the ISSR markers (PPL = 84.9%). The results showed that T. ruticarpum possessed high loci polymorphism and genetic differentiation occurred in this plant. The combined data of iPBS and ISSR markers scored on 25 accessions produced five clusters that approximately matched the geographic distribution of the species. The results indicated that both iPBS and ISSR markers were reliable and effective tools for analyzing the genetic diversity in T. ruticarpum. Copyright © 2018 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  10. Traditional uses, botany, phytochemistry, pharmacology and toxicology of Panax notoginseng (Burk.) F.H. Chen: A review.

    Science.gov (United States)

    Wang, Ting; Guo, Rixin; Zhou, Guohong; Zhou, Xidan; Kou, Zhenzhen; Sui, Feng; Li, Chun; Tang, Liying; Wang, Zhuju

    2016-07-21

    Panax notoginseng (Burk.) F.H. Chen is a widely used traditional Chinese medicine known as Sanqi or Tianqi in China. This plant, which is distributed primarily in the southwest of China, has wide-ranging pharmacological effects and can be used to treat cardiovascular diseases, pain, inflammation and trauma as well as internal and external bleeding due to injury. This paper provides up-to-date information on investigations of this plant, including its botany, ethnopharmacology, phytochemistry, pharmacology and toxicology. The possible uses and perspectives for future investigation of this plant are also discussed. The relevant information on Panax notoginseng (Burk.) F.H. Chen was collected from numerous resources, including classic books about Chinese herbal medicine, and scientific databases, including Pubmed, SciFinder, ACS, Ebsco, Elsevier, Taylor, Wiley and CNKI. More than 200 chemical compounds have been isolated from Panax notoginseng (Burk.) F.H. Chen, including saponins, flavonoids and cyclopeptides. The plant has pharmacological effects on the cardiovascular system, immune system as well as anti-inflammatory, anti-atherosclerotic, haemostatic and anti-tumour activities, etc. Panax notoginseng is a valuable traditional Chinese medical herb with multiple pharmacological effects. This review summarizes the botany, ethnopharmacology, phytochemistry, pharmacology and toxicology of P. notoginseng, and presents the constituents and their corresponding chemical structures found in P. notoginseng comprehensively for the first time. Future research into its phytochemistry of bio-active components should be performed by using bioactivity-guided isolation strategies. Further work on elucidation of the structure-function relationship among saponins, understanding of multi-target network pharmacology of P. notoginseng, as well as developing its new clinical usage and comprehensive utilize will enhance the therapeutic potentials of P. notoginseng. Copyright © 2016

  11. Analysis of the Constituents in “Zhu She Yong Xue Shuan Tong” by Ultra High Performance Liquid Chromatography with Quadrupole Time-of-Flight Mass Spectrometry Combined with Preparative High Performance Liquid Chromatography

    Directory of Open Access Journals (Sweden)

    Lin-Lin Wang

    2015-11-01

    Full Text Available “Zhu She Yong Xue Shuan Tong” lyophilized powder (ZSYXST, consists of a series of saponins extracted from Panax notoginseng, which has been widely used in China for the treatment of strokes. In this study, an ultra-high performance liquid chromatography with quadrupole time-of-flight mass spectrometry (UHPLC-Q-TOF/MS combined with preparative high performance liquid chromatography (PHPLC method was developed to rapidly identify both major and minor saponins in ZSYXST. Some high content components were removed through PHPLC in order to increase the sensitivity of the trace saponins. Then, specific characteristic fragment ions in both positive and negative mode were utilized to determine the types of aglycone, saccharide, as well as the saccharide chain linkages. As a result, 94 saponins, including 20 pairs of isomers and ten new compounds, which could represent higher than 98% components in ZSYXST, were identified or tentatively identified in commercial ZSYXST samples.

  12. Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige

    OpenAIRE

    Giafferri, Xiaomin

    2008-01-01

    Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authen...

  13. Activation energy and R. Chen frequency factor in the Randall and Wilkins original equation for second order kinetics. Emission curve simulated in Microsoft Excel algebra

    International Nuclear Information System (INIS)

    Moreno M, A.; Moreno B, A.

    2000-01-01

    In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)

  14. New contributions to the knowledge of Chinese flea beetle fauna (III): Revision of Meishania Chen & Wang with description of five new species (Coleoptera: Chrysomelidae: Galerucinae)

    Science.gov (United States)

    The flea beetle genus Meishania Chen & Wang is revised and five new species - M. cangshanensis sp. nov., M. flavipennis sp. nov., M. fulvotigera sp. nov., and M. sichuanica sp. nov. from China and M. bhutanensis sp. nov. from Bhutan - are described. All species of Meishania are illustrated and a key...

  15. Debris flow run off simulation and verification ‒ case study of Chen-You-Lan Watershed, Taiwan

    Directory of Open Access Journals (Sweden)

    M.-L. Lin

    2005-01-01

    Full Text Available In 1996 typhoon Herb struck the central Taiwan area, causing severe debris flow in many subwatersheds of the Chen-You-Lan river watershed. More severe cases of debris flow occurred following Chi-Chi earthquake, 1999. In order to identify the potentially affected area and its severity, the ability to simulate the flow route of debris is desirable. In this research numerical simulation of debris flow deposition process had been carried out using FLO-2D adopting Chui-Sue river watershed as the study area. Sensitivity study of parameters used in the numerical model was conducted and adjustments were made empirically. The micro-geomorphic database of Chui-Sue river watershed was generated and analyzed to understand the terrain variations caused by the debris flow. Based on the micro-geomorphic analysis, the debris deposition in the Chui-Sue river watershed in the downstream area, and the position and volume of debris deposition were determined. The simulated results appeared to agree fairly well with the results of micro-geomorphic study of the area when not affected by other inflow rivers, and the trends of debris distribution in the study area appeared to be fairly consistent.

  16. Satellite-derived land covers for runoff estimation using SCS-CN method in Chen-You-Lan Watershed, Taiwan

    Science.gov (United States)

    Zhang, Wen-Yan; Lin, Chao-Yuan

    2017-04-01

    The Soil Conservation Service Curve Number (SCS-CN) method, which was originally developed by the USDA Natural Resources Conservation Service, is widely used to estimate direct runoff volume from rainfall. The runoff Curve Number (CN) parameter is based on the hydrologic soil group and land use factors. In Taiwan, the national land use maps were interpreted from aerial photos in 1995 and 2008. Rapid updating of post-disaster land use map is limited due to the high cost of production, so the classification of satellite images is the alternative method to obtain the land use map. In this study, Normalized Difference Vegetation Index (NDVI) in Chen-You-Lan Watershed was derived from dry and wet season of Landsat imageries during 2003 - 2008. Land covers were interpreted from mean value and standard deviation of NDVI and were categorized into 4 groups i.e. forest, grassland, agriculture and bare land. Then, the runoff volume of typhoon events during 2005 - 2009 were estimated using SCS-CN method and verified with the measured runoff data. The result showed that the model efficiency coefficient is 90.77%. Therefore, estimating runoff by using the land cover map classified from satellite images is practicable.

  17. Plasma biochemistry values in emperor geese (Chen canagica) in Alaska: comparisons among age, sex, incubation, and molt.

    Science.gov (United States)

    Franson, J. Christian; Hoffman, D.J.; Schmutz, J.A.

    2009-01-01

    Reduced populations of emperor geese (Chen canagica), a Bering Sea endemic, provided the need to assess plasma biochemistry values as indicators of population health. A precursory step to such an investigation was to evaluate patterns of variability in plasma biochemistry values among age, sex, and reproductive period. Plasma from 63 emperor geese was collected on their breeding grounds on the Yukon-Kuskokwim Delta in western Alaska, USA. The geese sampled included 18 incubating adult females captured, in mid June, on their nests by using bow nets, and 30 adults and 15 goslings captured in corral traps in late July and early August, when the adults were molting their wing feathers and the goslings were 5-6 weeks old. Plasma was evaluated for 15 biochemical parameters, by comparing results among age, sex, and sampling period (incubation versus wing-feather molt). Ten of the 15 biochemical parameters assayed differed among adults during incubation, the adults during molt, and the goslings at molt, whereas sex differences were noted in few parameters.

  18. A variational numerical method based on finite elements for the nonlinear solution characteristics of the periodically forced Chen system

    Science.gov (United States)

    Khan, Sabeel M.; Sunny, D. A.; Aqeel, M.

    2017-09-01

    Nonlinear dynamical systems and their solutions are very sensitive to initial conditions and therefore need to be approximated carefully. In this article, we present and analyze nonlinear solution characteristics of the periodically forced Chen system with the application of a variational method based on the concept of finite time-elements. Our approach is based on the discretization of physical time space into finite elements where each time-element is mapped to a natural time space. The solution of the system is then determined in natural time space using a set of suitable basis functions. The numerical algorithm is presented and implemented to compute and analyze nonlinear behavior at different time-step sizes. The obtained results show an excellent agreement with the classical RK-4 and RK-5 methods. The accuracy and convergence of the method is shown by comparing numerically computed results with the exact solution for a test problem. The presented method has shown a great potential in dealing with the solutions of nonlinear dynamical systems and thus can be utilized in delineating different features and characteristics of their solutions.

  19. Screening for Internet Addiction: An Empirical Study on Cut-off Points for the Chen Internet Addiction Scale

    Directory of Open Access Journals (Sweden)

    Chih-Hung Ko

    2005-12-01

    Full Text Available The aim of this study was to establish the optimal cut-off points of the Chen Internet Addiction Scale (CIAS, to screen for and diagnose Internet addiction among adolescents in the community by using the well- established diagnostic criteria of Internet addiction. This survey of 454 adolescents used screening (57/58 and diagnostic (63/64 cut-off points of the CIAS, a self-reported instrument, based on the results of systematic diagnostic interviews by psychiatrists. The area under the curve of the receiver operating characteristic curve revealed that CIAS has good diagnostic accuracy (89.6%. The screening cut-off point had high sensitivity (85.6% and the diagnostic cut-off point had the highest diagnostic accuracy, classifying 87.6% of participants correctly. Accordingly, the screening point of the CIAS could provide a screening function in two-stage diagnosis, and the diagnostic point could serve as a diagnostic criterion in one-stage massive epidemiologic research.

  20. Ground-state magnetization of the Ising spin glass: A recursive numerical method and Chen-Ma scaling

    Science.gov (United States)

    Sepehrinia, Reza; Chalangari, Fartash

    2018-03-01

    The ground-state properties of quasi-one-dimensional (Q1D) Ising spin glass are investigated using an exact numerical approach and analytical arguments. A set of coupled recursive equations for the ground-state energy are introduced and solved numerically. For various types of coupling distribution, we obtain accurate results for magnetization, particularly in the presence of a weak external magnetic field. We show that in the weak magnetic field limit, similar to the 1D model, magnetization exhibits a singular power-law behavior with divergent susceptibility. Remarkably, the spectrum of magnetic exponents is markedly different from that of the 1D system even in the case of two coupled chains. The magnetic exponent makes a crossover from being dependent on a distribution function to a constant value independent of distribution. We provide an analytic theory for these observations by extending the Chen-Ma argument to the Q1D case. We derive an analytical formula for the exponent which is in perfect agreement with the numerical results.

  1. Serum Metabolomic Characterization of Liver Fibrosis in Rats and Anti-Fibrotic Effects of Yin-Chen-Hao-Tang

    Directory of Open Access Journals (Sweden)

    Hongyang Zhang

    2016-01-01

    Full Text Available Yin-Chen-Hao-Tang (YCHT is a famous Chinese medicine formula which has long been used in clinical practice for treating various liver diseases, such as liver fibrosis. However, to date, the mechanism for its anti-fibrotic effects remains unclear. In this paper, an ultra-performance liquid chromatography-time-of-flight mass spectrometry (UPLC-TOF-MS-based metabolomic study was performed to characterize dimethylnitrosamine (DMN-induced liver fibrosis in rats and evaluate the therapeutic effects of YCHT. Partial least squares-discriminant analysis (PLS-DA showed that the model group was well separated from the control group, whereas the YCHT-treated group exhibited a tendency to restore to the controls. Seven significantly changed fibrosis-related metabolites, including unsaturated fatty acids and lysophosphatidylcholines (Lyso-PCs, were identified. Moreover, statistical analysis demonstrated that YCHT treatment could reverse the levels of most metabolites close to the normal levels. These results, along with histological and biochemical examinations, indicate that YCHT has anti-fibrotic effects, which may be due to the suppression of oxidative stress and resulting lipid peroxidation involved in hepatic fibrogenesis. This study offers new opportunities to improve our understanding of liver fibrosis and the anti-fibrotic mechanisms of YCHT.

  2. Body mass of prefledging Emperor Geese Chen canagica: Large-scale effects of interspecific densities and food availability

    Science.gov (United States)

    Lake, B.C.; Schmutz, J.A.; Lindberg, M.S.; Ely, Craig R.; Eldridge, W.D.; Broerman, F.J.

    2008-01-01

    We studied body mass of prefledging Emperor Geese Chen canagica at three locations across the Yukon-Kuskokwim Delta, Alaska, during 1990-2004 to investigate whether large-scale variation in body mass was related to interspecific competition for food. From 1990 to 2004, densities of Cackling Geese Branta hutchinsii minima more than doubled and were c. 2-5?? greater than densities of Emperor Geese, which were relatively constant over time. Body mass of prefledging Emperor Geese was strongly related (negatively) to interspecific densities of geese (combined density of Cackling and Emperor Geese) and positively related to measures of food availability (grazing lawn extent and net above-ground primary productivity (NAPP)). Grazing by geese resulted in consumption of ??? 90% of the NAPP that occurred in grazing lawns during the brood-rearing period, suggesting that density-dependent interspecific competition was from exploitation of common food resources. Efforts to increase the population size of Emperor Geese would benefit from considering competitive interactions among goose species and with forage plants. ?? 2008 The Authors.

  3. Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige

    Directory of Open Access Journals (Sweden)

    Xiaomin Giafferri

    2008-12-01

    Full Text Available Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authenticité s’établit à travers les mécanismes de la fictionnalisation de l’Histoire. L’observation de leur manifestation est amenée à considérer deux axes principaux : l’organisation du récit et la mise en scène des personnages.

  4. Traditional Chinese Medicine ShenZhuGuanXin Granules Mitigate Cardiac Dysfunction and Promote Myocardium Angiogenesis in Myocardial Infarction Rats by Upregulating PECAM-1/CD31 and VEGF Expression

    Directory of Open Access Journals (Sweden)

    Dan-Ping Xu

    2017-01-01

    Full Text Available Background. Myocardial infarction (MI is the main cause of global mortality and morbidity despite the development of therapeutic approaches. ShenZhuGuanXin granules (SG have been shown to possess cardioprotective effects against coronary heart disease (CHD. However, little is known about its specific mechanism. The present study aimed to investigate the therapeutic effect of SG in cardiac dysfunction and to demonstrate whether SG can promote myocardium angiogenesis by establishing a rat model of myocardial infarction with left anterior descending ligating. Methods and Results. Three days after MI, rats were randomly divided into six groups: sham group (sham, MI group (MI, MI + low dose SG (SG-L group, MI + middle dose SG (SG-M group, MI + high dose SG (SG-H group, and MI + compound Danshen dropping pills (CDDP group as a positive control. Four weeks after administration, rats underwent hemodynamics and echocardiography study. Ventricle tissues were processed for histology and immunohistochemistry studies. Compared with MI group, SG treatment dose-dependently improved cardiac hemodynamic function, attenuated infarct size, increased microvessel density, and increased the expression of PECAM-1/CD31 and VEGF. Conclusions. SG dose-dependently improved cardiac hemodynamic function and attenuated infarct size by promoting angiogenesis through upregulating PECAM-1/CD31 and VEGF expression.

  5. Activation energy and R. Chen frequency factor in the Randall and Wilkins original equation for second order kinetics. Emission curve simulated in Microsoft Excel algebra; Energia de activacion y factor de frecuencia de R. Chen en la ecuacion original de Randall y Wilkins para cinetica de segundo orden. Curva de emision simulada en algebra de Microsoft Excel

    Energy Technology Data Exchange (ETDEWEB)

    Moreno M, A. [Departamento de Apoyo en Ciencias Aplicadas, Benemerita Universidad Autonoma de Puebla, 4 Sur 104, Centro Historico, 72000 Puebla (Mexico); Moreno B, A

    2000-07-01

    In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)

  6. Variation in foraging behavior and body mass in broods of Emperor Geese (Chen canagica): Evidence for interspecific density dependence

    Science.gov (United States)

    Schmutz, J.A.; Laing, K.K.

    2002-01-01

    Broods of geese spend time feeding according to availability and quality of food plants, subject to inherent foraging and digestive constraints. We studied behavioral patterns of broods of Emperor Geese (Chen canagica) on the Yukon–Kuskokwim Delta, Alaska, and examined how feeding and alert behavior varied in relation to habitat and goose density. During 1994–1996, time spent feeding by Emperor Goose goslings and adult females was positively related to multispecies goose densities near observation blinds, and not to just Emperor Goose density. Similarly, body mass of Emperor Goose goslings was more strongly related (negatively) to multispecies goose densities than intraspecific densities. A grazing experiment in 1995 indicated that most above ground primary production by Carex subspathacea, a preferred food plant, was consumed by grazing geese. Those results demonstrate that interspecific competition for food occurred, with greatest support for goslings whose behavioral repertoire is limited primarily to feeding, digesting, and resting. Although the more abundant Cackling Canada Geese (Branta canadensis minima) differed from Emperor Geese in their preferred use of habitats during brooding rearing (Schmutz 2001), the two species occurred in equal abundance in habitats preferred by Emperor Goose broods. Thus, Cackling Canada Geese were a numerically significant competitor with Emperor Geese. Comparing these results to an earlier study, time spent feeding by goslings, adult females, and adult males were greater during 1993–1996 than during 1985–1986. During the interval between those studies, densities of Cackling Canada Geese increased two to three times whereas Emperor Goose numbers remained approximately stable, which implies that interspecific competition affected foraging behavior over a long time period. These density-dependent changes in foraging behavior and body mass indicate that interspecific competition affects nutrient acquisition and gosling

  7. Calycosin regulates glucocorticoid-induced apoptosis via Nrf2/ARE ...

    African Journals Online (AJOL)

    Lifeng Fu1, WeiLiang Wu2, Jian Zhu2, Shu Qiang2, Jansong Chen2* ... Results: CA reduced the apoptosis and accumulation of ROS in DEX-treated cells. ..... its downstream effectors (Figure 5 A-C). However .... Cao J, Chen Z, Zhu Y, Li Y, Guo C, Gao K, Chen L, Shi ... Hong W. Experimental study on the effect of Calycosin.

  8. Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.

    CERN Multimedia

    Maximilien Brice

    2007-01-01

    Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.

  9. 21 October 2008 - LHC Inauguration - IHEP Beijing representative Prof. Chen, People's Republic of China, welcomed by CERN Director-General R. Aymar, CERN Chief Scientific Officer J. Engelen and CERN Financial Officer S. Lettow.

    CERN Multimedia

    CERN Photo Service

    2008-01-01

    21 October 2008 - LHC Inauguration - IHEP Beijing representative Prof. Chen, People's Republic of China, welcomed by CERN Director-General R. Aymar, CERN Chief Scientific Officer J. Engelen and CERN Financial Officer S. Lettow.

  10. 6 June 2012 - Chinese Nanjing University President J.Chen in the ATLAS visitor centre with Member of the ATLAS Collaboration I. Wingerter and International Relations Office Adviser E. Tsesmelis. M. Qi, Nanjing University and ATLAS Collaboration, accompanies the delegation.

    CERN Multimedia

    Maximilien Brice

    2012-01-01

    6 June 2012 - Chinese Nanjing University President J.Chen in the ATLAS visitor centre with Member of the ATLAS Collaboration I. Wingerter and International Relations Office Adviser E. Tsesmelis. M. Qi, Nanjing University and ATLAS Collaboration, accompanies the delegation.

  11. The prevalence and pathogenicity of gizzard nematodes of the genera Amidostomum and Epomidiostomum (Trichostrongylidae) in the lesser snow goose (Chen caerulescens caerulescens)

    Science.gov (United States)

    Tuggle, B.N.; Crites, John L.

    1984-01-01

    Three species of trichostrongylid nematodes were removed from the gizzards of 25 lesser snow geese, Chen caerulescens caerulescens, collected at Winisk, Ont. A 100% prevalence of infection was noted in the sampled population with each bird harboring two or more of the following species: Epomidiostomum crami (prevalence, 92%; mean intensity, 18.7 ± 13.3), Amidostomum anseris (prevalence, 84%; mean intensity, 9.6 ± 9.8), and Amidostomum spatulatum (prevalence, 84%; mean intensity, 11.2 ± 9.8). When large burdens (>30) of both A. anseris and A. spatulatum were present in the mucosal lining of the gizzard, progressive degeneration of the epithilium and koilin linings was noted in 16% of the geese examined. Severe necrotic granulomata observed in the gizzard muscle of 36% of the geese were associated with sizable burdens (>25) of E. crami which were found burrowed in the gizzard muscle.

  12. Chlorpromazine-induced perturbations of bile acids and free fatty acids in cholestatic liver injury prevented by the Chinese herbal compound Yin-Chen-Hao-Tang.

    Science.gov (United States)

    Yang, Qiaoling; Yang, Fan; Tang, Xiaowen; Ding, Lili; Xu, Ying; Xiong, Yinhua; Wang, Zhengtao; Yang, Li

    2015-04-16

    Yin-Chen-Hao-Tang (YCHT), a commonly used as a traditional chinese medicine for liver disease. Several studies indicated that YCHT may improving hepatic triglyceride metabolism and anti-apoptotic response as well as decreasing oxidative stress .However, little is known about the role of YCHT in chlorpromazine (CPZ) -induced chlolestatic liver injury. Therefore, we aimed to facilitate the understanding of the pathogenesis of cholestatic liver injury and evaluate the effect of Yin-Chen-Hao-Tang (YCHT) on chlorpromazine (CPZ)-induced cholestatic liver injury in rats based on the change of bile acids (BAs) and free fatty acids (FFAs) alone with the biochemical indicators and histological examination. We conducted an experiment on CPZ-induced cholestatic liver injury in Wistar rats with and without YCHT for nine consecutive days. Serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB), total bilirubin (TBIL), total cholesterol (TC), triglycerides (TG), low density lipoprotein-cholesterol (LDL-C) were measured to evaluate the protective effect of YCHT against chlorpromazine (CPZ)-induced cholestatic liver injury. Histopathology of the liver tissue showed that pathological injuries were relieved after YCHT pretreatment. In addition, ultra-performance lipid chromatography coupled with quadrupole mass spectrometry (UPLC-MS) and gas chromatography coupled with mass spectrometry (GC-MS) was applied to determine the content of bile acids, free fatty acids, respectively. Obtained data showed that YCHT attenuated the effect of CPZ-induced cholestatic liver injury, which was manifested by the serum biochemical parameters and histopathology of the liver tissue. YCHT regulated the lipid levels as indicated by the reversed serum levels of TC, TG, and LDL-C. YCHT also regulated the disorder of BA and FFA metabolism by CPZ induction. Results indicated that YCHT exerted a protective effect on CPZ-induced cholestasis liver injury. The variance of

  13. WAIS-IV and WISC-IV Structural Validity: Alternate Methods, Alternate Results. Commentary on Weiss et al. (2013a) and Weiss et al. (2013b)

    Science.gov (United States)

    Canivez, Gary L.; Kush, Joseph C.

    2013-01-01

    Weiss, Keith, Zhu, and Chen (2013a) and Weiss, Keith, Zhu, and Chen (2013b), this issue, report examinations of the factor structure of the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) and Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV), respectively; comparing Wechsler Hierarchical Model (W-HM) and…

  14. [Reiner Nürnberg, Ekkehard Höxtermann, Martina Voigt. Elisabeth Schiemann 1881-1972. Vom AußBruch der Genetik und der Frauen in den UmBrüchen des 20. Jahrhunderts] / Monika von Hirschheydt

    Index Scriptorium Estoniae

    Hirschheydt, Monika von

    2015-01-01

    Arvustus: Nürnberg, Reiner, Höxtermann, Ekkehard, Voigt, Martina. Elisabeth Schiemann 1881-1972. Vom AußBruch der Genetik und der Frauen in den UmBrüchen des 20. Jahrhunderts. Beiträge eines Symposiums zum 200. Gründungsjubiläum der Humboldt-Universität Berlin. Rangsdorf: Basilisken-Presse 2014

  15. "Is political behavior a viable coping strategy to perceived organizational politics? Unveiling the underlying resource dynamics": Correction to Sun and Chen (2017).

    Science.gov (United States)

    2017-10-01

    Reports an error in "Is Political Behavior a Viable Coping Strategy to Perceived Organizational Politics? Unveiling the Underlying Resource Dynamics" by Shuhua Sun and Huaizhong Chen ( Journal of Applied Psychology , Advanced Online Publication, May 22, 2017, np). In the article, Table 1 contained a formatting error. Correlation coefficient values in the last four cells of column 6 were misplaced with correlation coefficient values in the last four cells of column 7. All versions of this article have been corrected. (The following abstract of the original article appeared in record 2017-22542-001.) We conduct a theory-driven empirical investigation on whether political behavior, as a coping strategy to perceived organizational politics, creates resource trade-offs in moderating the relationship between perceived organizational politics and task performance. Drawing on conservation of resources theory, we hypothesize that political behavior mitigates the adverse effect of perceived organizational politics on task performance via psychological empowerment, yet exacerbates its adverse effect on task performance via emotional exhaustion. Three-wave multisource data from a sample of 222 employees and their 75 supervisors were collected for hypothesis testing. Findings supported our hypotheses. Our study enhances understandings of the complex resource dynamics of using political behavior to cope with perceived organizational politics and highlights the need to move stress-coping research from a focus on the stress-buffering effect of coping on outcomes to a focus on the underlying competing resource dynamics. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  16. Two phases of droplet evaporation during plasma arc spraying: reply to Chen's comment about the 'rocket' effect under conditions of thermal plasma spraying

    Energy Technology Data Exchange (ETDEWEB)

    Nemchinsky, V A [Key College, 225 Dania Beach Blvd, Dania Beach, FL 33040 (United States)

    2007-07-07

    The heating history of a droplet during its flight can be divided into two phases: (a) the initial phase when evaporation, although it occurs, does not change the heat balance of the droplet much (the case considered in our previous paper and (b) the final phase when the cooling due to evaporation balances the heat flux from the plasma. The later phase is considered in Chen's comment. In our reply, a very straightforward consideration demonstrates that even in the final phase of the droplet flight, the 'rocket' effect can be significant. (reply)

  17. Redescription of the Indo-West Pacific scorpionfish (Scorpaenidae), Neomerinthe erostris (Alcock 1896), a senior synonym of Scorpaena gibbifrons Fowler 1938, N. rotunda Chen 1981, and N. bathyperimensis Zajonz & Klausewitz 2002.

    Science.gov (United States)

    Motomura, Hiroyuki; Causse, Romain; Béarez, Philippe; Mishra, Subhrendu Sekhar

    2015-09-29

    The Indo-West Pacific species, Neomerinthe erostris (Alcock 1896), originally described as Scorpaena erostris, is redescribed as a senior synonym of Scorpaena gibbifrons Fowler 1938, N. rotunda Chen 1981, and N. bathyperimensis Zajonz & Klausewitz 2002. Although the latter three nominal species have been regarded as valid species and N. erostris has not been reported since 1898, examinations of type specimens of the four nominal species revealed that they represent a single species. A lectotype of Scorpaena erostris is herein designated. Neomerinthe erostris is characterized by having a distinct longitudinal ridge on the lateral surface of the maxilla and a strongly rounded dorsal profile of the head.

  18. The cellular receptors for infectious bursal disease virus | Zhu ...

    African Journals Online (AJOL)

    Virus receptors are simplistically defined as cell surface molecules that mediate binding (attachment, adsorption) and/or trigger membrane fusion or entry through other processes. Infectious bursal disease virus (IBDV) entry into host cells occurs by recognition of specific cellular receptor(s) with viral envelope glycoprotein, ...

  19. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Fang Dong1 Jiang Chenning1 Zhu Ting1 Yang Jinming1. Department of Pharmaceutical Engineering, School of Chemistry and Chemical Engineering, Yancheng Teachers University, 50 Kai Fang Da Dao, Yancheng 224002, Jiangsu, P. R. China ...

  20. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Xiaoming Liao1 Hongyang Zhu1 Guangfu Yin1 Zhongbing Huang1 Yadong Yao1 Xianchun Chen1. College of Materials Science and Engineering, Sichuan University, Chengdu 610064, P.R. of China ...

  1. Pramana – Journal of Physics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    dimensional coupled double-distribution-function lattice Boltzmann models for compressible Navier–Stokes equations. RUO-FAN QIU YAN-CHENG YOU CHENG-XIANG ZHU RONG-QIAN CHEN JIAN-FENG ZHU. Research Article Volume 89 Issue ...

  2. Morphological evolution in single-crystalline Bi2Te3 nanoparticles ...

    Indian Academy of Sciences (India)

    to have ZT exceeding 5 (Lin et al 2000). ... as nanoparticles (NPs) (Jiang and Zhu 2007; Cao et al. 2008a, b) ... als, semimetals, alloys and other compounds (Chen and ..... Cao Y Q, Zhao X B, Zhu T J, Zhang X B and Tu J P 2008a Appl. Phys.

  3. On the Unsteady-Motion Theory of Magnetic Forces for Maglev

    Science.gov (United States)

    1993-11-01

    DivisionEnergy Technology Division Forces for Maglev Energy Technology DivisionEnergy Technology Division by S. S. Chen, S. Zhu, and Y. Cai APQ 4 袲...On the Unsteady-Motion Theory of Magnetic Forces for Maglev by S. S. Chen, S. Zhu, and Y. Cai Energy Technology Division November 1993 Work supported...vi On The Unsteady-Motion Theory of Magnetic Forces for Maglev by S. S

  4. Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007

    CERN Multimedia

    Maximilien Brice

    2007-01-01

    Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007

  5. African Journal of Biotechnology - Vol 10, No 60 (2011)

    African Journals Online (AJOL)

    Microsatellite variability reveals significant genetic differentiation of giant pandas (Ailuropoda melanoleuca) in the Minshan A habitat · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Yang, R Hou, F Shen, X Yang, L Zhang, L Chen, W Chen, W Zhang, Q Zhu, Z Zhang ...

  6. Mechanisms of all-trans retinoic acid-induced differentiation of acute ...

    Indian Academy of Sciences (India)

    Author Affiliations. Ji-Wang Zhang1 Jian Gu1 Zhen-Yi Wang1 Sai-Juan Chen1 Zhu Chen1. Shanghai Institute of Hematology, Ruijin Hospital Affiliated to Shanghai Second Medical University, 197 Ruijin Road II, Shanghai 200025, People's Republic of China ...

  7. Blazar Sequence in Fermi Era Liang Chen

    Indian Academy of Sciences (India)

    Abstract. In this paper, we review the latest research results on the topic of blazar sequence. It seems that the blazar sequence is phenomenally ruled out, while the theoretical blazar sequence still holds. We point out that black hole mass is a dominated parameter accounting for high-power- high-synchrotron-peaked and ...

  8. MARGA_Chen et al_2016

    Data.gov (United States)

    U.S. Environmental Protection Agency — These data describe the chromatography characteristics of the MARGA instrument software as compared to an alternative, independent technique for chromatogram...

  9. A Partnership Training Program in Breast Cancer Research Using Molecular Imaging Techniques

    Science.gov (United States)

    2009-07-01

    mucous or serous lining fluid and its surfactant layer. Therefore, the destiny of particle compounds that are soluble in this lining fluid is different...SYSTEMS There have been very few studies on the destiny , distribution, metabolism and bioaccumulation of nanoparticles in humans. Fol- lowing exposure...12. [86] Zhu, X.; Zhu, L.; Li, Y.; Duan, Z.; Chen, W. and Alvarez, P. J. (2007) Developmental toxicity in zebrafish (Danio rerio) embryos after

  10. 古今中西之間--陳垣與20世紀中國史學%Between the Ancient and the Present and between China and the West:Prof. Chen Yuan and Chinese Historiography in the 20 th Century

    Institute of Scientific and Technical Information of China (English)

    陳智超

    2010-01-01

    Every historian should answer two questions related to each other, i. e. what is the relationship between history and reality and what is that between historiography and reality. Moreover, Chinese historians should answer other two questions also re-lated to each other, namely what is the relationship between China and the West and what is that between Chinese culture and Western culture. Based on their own outlook on the ancient and the present as well as on China and the West, every conscious Chinese historian of the 20 th century was bound to cherish a definite sense of responsi-bility and determined what role they played and what way they chose when taking on this responsibility. The present paper expounds Prof. Chen Yuan’ s answers to the above questions andhis practice concerned with them in the four stages of his lifetime.

  11. http://dx.doi.org/10.4314/ajtcam.v9i2.1

    African Journals Online (AJOL)

    AJTCAM

    UHCC (Chen, 2009; Tong, 2010; Zhang et al., 2006; Zhu and Li, 2006). .... 2006; Yu and Kang, 2009) were identified for further study (726 patients), but without a .... inhibit its transition from G2 phase to M phase in vitro. .... Venook, A. P., Stagg, R. J., Lewis, B. J., Chase, J. L., Ring, E. J., Maroney, T. P., Hohn, D. C., (1990).

  12. Genetic diversity of bitter taste receptor gene family in Sichuan

    Indian Academy of Sciences (India)

    Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE Volume 95 Issue 3 September 2016 pp 675-681 ...

  13. Reference: 438 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available ity and drought tolerance in Arabidopsis thaliana. 18 6902-12 16943431 2006 Sep Molecular and cellular bio...logy Chen Zhizhong|Gong Zhizhong|Hong Xuhui|Jablonowski Daniel|Ren Xiaozhi|Schaffrath Raffael|Zhang Hairong|Zhou Xiaofeng|Zhu Jian-Kang

  14. African Journal of Biotechnology - Vol 11, No 14 (2012)

    African Journals Online (AJOL)

    DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. HD Ding, HJ Zhang, XH Zhu, H Liu, JS Liang, B Lu, 3259-3269 ... DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Y Hanying, X Wei, G Xingxi, 3370-3378 ... FULL TEXT DOWNLOAD FULL TEXT. J Zhang, YC Huang, Q Zhang, ZP Hong, YC Zhou, WL Chen, 3388-3393 ...

  15. Untitled

    Indian Academy of Sciences (India)

    Proc. of ICEM-1992, Budapest, pp 550-553. 23) A R Millner 1994 Multi-hundred horsepower permanent magnet brushless disk motors. Proc. of APEC Conf, pp 351-355 w. (24 C C Chen, KT Chau, J ZJiang, W Xia, M. Zhu, R. Zhang 1996 Novel permanent magnet motor drives for electric vehicles. IEEE Trans. Ind. Electron.

  16. Measuring Components of Intelligence: Mission Impossible?

    Science.gov (United States)

    Gregoire, Jacques

    2013-01-01

    The two studies conducted by Weiss, Keith, Zhu, and Chen in 2013 on the Wechsler Adult Intelligence Scale (WAIS-IV) and the Wechsler Intelligence Scale for Children (WISC-IV), respectively, provide strong evidence for the validity of a four-factor solution corresponding to the current hierarchical model of both scales. These analyses support the…

  17. Effects of cutting frequency on alfalfa yield and yield components in ...

    African Journals Online (AJOL)

    Effects of cutting frequency on alfalfa yield and yield components in Songnen Plain, Northeast China. J Chen, F Tang, R Zhu, C Gao, G Di, Y Zhang. Abstract. The productivity and quality of alfalfa (Medicago sativa L.) is strongly influenced by cutting frequency (F). To clarify that the yield and quality of alfalfa if affected by F, ...

  18. Saturation mapping of QTL region determining resistance specificity ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-09-01

    Sep 1, 2009 ... S, Ni L, Zhu F, Chen W, Lan L, Lai Y, Cheng Z, Gu M, Jiang J, Li J,. Hong G, Xue Y, Han B ... Katagiri F, Markus Lange B, Moughamer T, Xia Y, Budworth P,. Zhong J, Miguel T, ... Gen. Genet. 261: 58-63. Marrs KA (1996).

  19. Synthesis of substituted guanidines using Zn–Al hydrotalcite catalyst

    Indian Academy of Sciences (India)

    Zn–Al HT was prepared by co-precipitation method and charac- terized by ... tion of highly functionalized guanidines.4 Linton et al. explained a ..... Pi C, Zhu Z, Weng L, Chen Z and Zhou X 2007 Chem. Commun. ... J P 2000 J. Mater. Chem.

  20. Food Fortification to Prevent and Control Iron Deficiency | Chen ...

    African Journals Online (AJOL)

    It is essential to prevent the fortification iron from reacting with the absorption inhibitors. To ensure adequate absorption therefore, various factors must be considered before initiating a fortification programme. These include cost effectiveness of fortification in increasing absorbable iron, palatability of the fortified food and the ...

  1. Lateral strukturierte Oberflächen zur THz-Strahlmanipulation

    OpenAIRE

    Jahn, David; Koch, Martin (Prof. Dr.)

    2018-01-01

    Die Terahertz-Zeitbereichsspektroskopie ist mittlerweile eine etablierte spektroskopische Methode im Frequenzbereich von 0;2 THz bis etwa 5 THz. Mit der stetigen Verbesserung von Zeitbereichs-Spektrometern, in den letzten Jahren hauptsächlich vorangetrieben durch die Verbesserung der Materialsysteme sowohl im photoleitenden Emitter als auch im Detektor sind heute Systeme mit bis zu 90 dB SNR und 4;5 THz Brandbreite verfügbar. Auch der Einfluss anderer Systemkomponenten, deren Beitrag zum...

  2. Massive Star Formation: Accreting from Companion X. Chen1 ...

    Indian Academy of Sciences (India)

    Abstract. We report the possible accretion from companion in the mas- sive star forming region (G350.69–0.49). This region seems to be a binary system composed of a diffuse object (possible nebulae or UC HII region) and a Massive Young Stellar Object (MYSO) seen in Spitzer IRAC image. The diffuse object and MYSO ...

  3. Initiation and Propagation of Coronal Mass Ejections P. F. Chen

    Indian Academy of Sciences (India)

    Introduction. Coronal mass ejections (CMEs) have been observed for over 30 years. They keep being an intriguing research topic, not only because they are now realized to be the major driver for space weather disturbances, which are intimately connected to human activities, but also because they themselves are full of ...

  4. Mitochondrial genome of Taiwan pig ( Sus Scrofa ) | Chen | African ...

    African Journals Online (AJOL)

    The purpose of this study is to investigate the complete nucleotide sequence of the mitochondrial genome of the Taiwan Lanyu pig (Sus scrofa) and its phylogenetic relationships with other pig breeds. Thirty-four forward and reverse primers were designed. Sequencing was performed in both directions. The results showed ...

  5. Chemische Reaktionen auf Oberflächen - eine SFG Studie

    OpenAIRE

    Kirsch, Harald

    2014-01-01

    This thesis focused on the investigation of chemical reactions on surfaces by usage of Sum Frequency Generation (SFG) spectroscopy and Thermal Desorption Spectroscopy (TDS). Understanding of chemical reactions on surfaces is of critical importance for modification and optimization of a variety of environmental and industrial processes, but the complexity of the ongoing reactions under "realistic" conditions often hinders an understanding on a molecular level. The aim of this work was to get i...

  6. C. Huang , G. Zhao , HW Zhang & YQ Chen

    Indian Academy of Sciences (India)

    the host stars' birth cloud with higher abundance of Si will make the cloud ... with the metallicity distribution of nearby field F, G, or K stars which are known to .... In the early stage of planetesimal accumulation, the rate of growth of planetesimal.

  7. Chaos synchronization of the fractional-order Chen's system

    International Nuclear Information System (INIS)

    Zhu Hao; Zhou Shangbo; He Zhongshi

    2009-01-01

    In this paper, based on the stability theorem of linear fractional systems, a necessary condition is given to check the chaos synchronization of fractional systems with incommensurate order. Chaos synchronization is studied by utilizing the Pecora-Carroll (PC) method and the coupling method. The necessary condition can also be used as a tool to confirm results of a numerical simulation. Numerical simulation results show the effectiveness of the necessary condition.

  8. Relación heterófilo/linfocito, frecuencia espontánea de eritrocitos micronucleados y prolongaciones nucleares en el ganso nevado (Chen caerulescens: Una propuesta como posible biomonitor de estrés y genotóxicos ambientales

    Directory of Open Access Journals (Sweden)

    Martha C. Martínez Quintanilla

    2017-04-01

    Full Text Available Existen organismos silvestres que son altamente vulnerables ante estresores antropogénicos y naturales, estos organismos pueden ser de utilidad para evaluar la salud ambiental mediante diferentes indicadores confiables, sencillos, rápidos, económicos para determinar y si es posible reducir estos efectos negativos. En este estudio proponemos al ganso nevado (Chen caerulescens como posible biomonitor de estrés y genotóxicos ambientales mediante la relación heterófilo/linfocito (H/L, la prueba de micronúcleos (EMN, prolongaciones nucleares en eritrocitos (EPN y eritrocitos policromáticos (EPC. Durante la temporada de caza (2012-2013 en el humedal de Málaga, Durango, México, colectamos 18 organismos. Los eritrocitos fueron las células más abundantes, de núcleo y morfología elípticos, de tamaño 12.68 ± 0.89 µm. Observamos heterófilos (11.07±1.32 µm, eosinófilos (9.67±1.26 µm, basófilos (5.75 ± 0.78 µm, monocitos (10.49±1.36 µm y linfocitos (6.53±1.0 µm. No identificamos alteración en las proporciones ni en la morfología de leucocitos, sin embargo, es necesario un mayor número de organismos para establecer los parámetros sanguíneos de base normal para esta especie. La relación h/l fue de 0.41 ± 0.11 este valor es similar a lo reportado para esta y otras especies de aves consideradas como sanas. Establecimos la frecuencia basal de EMN (2.6±1.45, epn (249.2 ± 89.74 y EPC (156.5 ± 50. El ganso nevado es un organismo que se perfila como buen candidato a biomonitor ambiental debido a la frecuencia basal de su relación H/L, EMN, EPN y EPC, pero debe probarse en condiciones estandarizadas y a través de estudios en zonas con y sin contaminación.

  9. Designing and Implementing the Intranet for ZhuHai State-Kai Polymer and New Materials Co.,Ltd

    OpenAIRE

    Chen, Si; Jiang, Min

    2010-01-01

    This Thesis was commissioned by Zhuhai State-Kai Polymer and New Materials company, which is a chemical and pharmacy SME in China. The Thesis aimed to design and implement the Intranet with the characteristics of the case company on the basis of the identified requirements. The designed Intranet innovates in a computerized system to replace the current manual system used in its business life. The questionnaire approach was used to gather the information and requirements both from the view...

  10. China Report: Political, Sociological and Military Affairs.

    Science.gov (United States)

    1983-03-18

    Production Brigade of Guangbao Commune in raising chickens and rabbits in a big way. We must mobilize the commune member house- holds to utilize...The state and the commune, production brigades, and production teams operate fish farms, some of which raise fry . Why not go ahead with raising fish...Wei Xinyi, Huang Yu, Yang Jike, Guo Tixiang, Meng Fulin, Hu Tan, Zhu Nong, Fang Shiliang, Wang Zenong, Pan Ezhang, Liu Zhengwen, Chen Tianren, Ma

  11. Calligraphy and meditation for stress reduction: an experimental comparison

    OpenAIRE

    Kao, Henry; Zhu,Lin.; Chen,Hao Yi; Liu,Ivy C.Y.; Zhang,Manlin; Chao,An An

    2014-01-01

    Henry SR Kao,1 Lin Zhu,2 An An Chao,3 Hao Yi Chen,4 Ivy CY Liu,5 Manlin Zhang6 1Department of Social Work and Social Administration, University of Hong Kong, Hong Kong; 2Department of Psychology, Renmin University of China, Beijing, 3International Society of Calligraphy Therapy, Hong Kong; 4Department of Business Administration, National Chengchi University, Taipei, Taiwan, 5Department of Psychology, Fu Jen Catholic University, Taipei, Taiwan; 6Department of Psychology, Sun Yat-Sen University...

  12. Protective effect of galangin in Concanavalin A- induced hepatitis in mice

    OpenAIRE

    Luo Q; Zhu L; Ding J; Zhuang X; Xu L; Chen F

    2015-01-01

    Qingqiong Luo,1,* Liping Zhu,1,* Jieying Ding,1 Xing Zhuang,1 Lili Xu,2 Fuxiang Chen1 1Department of Clinical Immunology, Shanghai Ninth People’s Hospital, Shanghai JiaoTong University School of Medicine, 2Division of Gastroenterology, Zhongshan Hospital, Fudan University, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Galangin is an active pharmacological ingredient from propolis and Alpinia officinarum Hance, and has been r...

  13. Protective effect of galangin in Concanavalin A-induced hepatitis in mice

    OpenAIRE

    Luo, Qingqiong; Zhu, Liping; Ding, Jieying; Zhuang, Xing; Xu, Lili; Chen, Fuxiang

    2015-01-01

    Qingqiong Luo,1,* Liping Zhu,1,* Jieying Ding,1 Xing Zhuang,1 Lili Xu,2 Fuxiang Chen1 1Department of Clinical Immunology, Shanghai Ninth People’s Hospital, Shanghai JiaoTong University School of Medicine, 2Division of Gastroenterology, Zhongshan Hospital, Fudan University, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Galangin is an active pharmacological ingredient from propolis and Alpinia officinarum Hance, an...

  14. Powerful women leaders rise in Asia despite gender inequality.

    Science.gov (United States)

    Over the years, Asia has produced some of the worlds most formidable women leaders, including Indira Ghandi, Madame Mao, Benazir Bhutto, and Corazon Aquino. The list continues with South Asia's leaders, prime ministers, opposition leaders, and vice-presidents, however, such an impressive list does not reflect true equality nor enlightened gender politics. According to Sonny Lo, sociology professor at Hong Kong University, no Asian political system observes true gender equality. It is noted that these Asian leaders rose into prominence after the death or imprisonment of their fathers or husbands. Nevertheless, the elections of Anson Chan and life-long dissident Annette Lu, signal the emergence of a new model for women leaders in Asia. Still, Lo emphasizes that this new trend is merely a reflection of civil service equal opportunity rules. Lo adds that even Taiwan President Chen Sui-Bian's all-women cabinet does not reflect the nation's sentiment, but a wish to project an image.

  15. Chen et al., Afr J Tradit Complement Altern Med. (2012) 9(2):234 ...

    African Journals Online (AJOL)

    AJTCAM

    E-mail: qidongfanjian@sina.com .... under an inverted microscope. ... Stars image analyzing equipment (Shanghai, P.R. China) was used to analyze the image ... Inverted microscope: The cultured neurons in the control group grew well and ...

  16. Critical node lifetimes in random networks via the Chen-Stein method

    NARCIS (Netherlands)

    Franceschetti, M.; Meester, R.W.J.

    2006-01-01

    This correspondence considers networks where nodes are connected randomly and can fail at random times. It provides scaling laws that allow to find the critical time at which isolated nodes begin to appear in the system as its size tends to infinity. Applications are in the areas of sensor and

  17. Chen et al., Afr J Tradit Complement Altern Med. (2016) 13(1):25-32 ...

    African Journals Online (AJOL)

    PROF ADEWUNMI

    The phosphorylation of PKA substrate was not activated after 48 hours of treatment with ephedrine and anisodamine. Conclusion: Ephedrine and anisodamine inhibit the proliferation of SKBR3 cells via a significantly change of intracellular cAMP concentration. Key words: anisodamine, breast cancer, cyclic adenosine ...

  18. Q. Shen1, X. Chen1, Jiyune Yi2, DR Jiang1 & YJ Yun3

    Indian Academy of Sciences (India)

    imately six months to cover the 2-yr pulsation cycle of VX Sgr. We used a special phase referencing ... but the υ = 2 line has relatively few maser features, most of which reside in the. Southern and Northern parts. ... stronger masers of both the lines appear, among which the main features reside in the inner shell and show ...

  19. Chen and Xiaodong Afr J Tradit Complement Altern Med. (2013) 10 ...

    African Journals Online (AJOL)

    AJTCAM

    As an ancient medicine, Solanum nigrum Linne has been playing an important role in the treatment of cancer in China since ancient times. It is reported in the literatures that Solanum nigrum Linne can inhibit tumour cell growth and promote apoptosis of tumour cells, and has immunomodulatory and cytotoxic effects (Son et ...

  20. In search of low cost titanium: the Fray Farthing Chen (FFC) Cambridge process

    CSIR Research Space (South Africa)

    Oosthuizen, SJ

    2010-10-01

    Full Text Available delivering a sponge product, aimed at replacing Kroll sponge alone, does not have potential for large reduction in overall titanium cost. Significant cost savings can only be achieved by also reducing the large number of process steps required to process... the sponge to mill product, including sponge purification, comminution, electrode forming, Vacuum Arc Re-melting, Hot and cold rolling. Presently, economy of scale in the production of titanium dictates that it is most cost effective to cast the largest...

  1. In search of low cost titanium: the fray farthing chen (FFC) cambridge process

    CSIR Research Space (South Africa)

    Oosthuizen, SJ

    2011-03-01

    Full Text Available delivering a sponge product, aimed at replacing Kroll sponge alone, does not have potential for large reduction in overall titanium cost. Significant cost savings can be achieved only by also reducing the large number of process steps required... to process the sponge to mill product, including sponge purification, comminution, electrode forming, vacuum arc re-melting, and hot and cold rolling. Presently, economy of scale in the production of titanium dictates that it is most cost...

  2. Chen et al., Afr J Tradit Complement Altern Med. (2014) 11(1):15-22

    African Journals Online (AJOL)

    cadewumi

    x300mm,Japan ) column. The columns were eluted with 0.1M nitric acid and calibrated with ..... Mushiake, H, Tsunoda, T, Nukatsuka,M, Shimao K, Fukushima M, Tahara H. (2005). Dendritic cells might be one of key factors for eliciting antitumor ...

  3. Calibrating the Shan-Chen lattice Boltzmann model for immiscible displacement in porous media

    DEFF Research Database (Denmark)

    Christensen, Britt Stenhøj Baun; Schaap, M.G.; Wildenschild, D.

    2006-01-01

    The lattice Boltzmann (LB) modeling technique is increasingly being applied in a variety of fields where computational fluid dynamics are investigated. In our field of interest, environmentally related flow processes in porous media, the use of the LB method is still not common. For the LB...

  4. Beiträge zur Beugungstheorie elektromagnetischer Wellen an Kanten vollkommen leitender Flächen

    OpenAIRE

    Zinal, Sherko

    2011-01-01

    Den Kern der vorliegenden Arbeit bilden die Untersuchung sowie die Formulierung von Lösungsansätzen für ein elementares, elektromagnetisches Beugungsproblem; einer undendlich langen Schlitzleitung mit einseitig begrenzter etallisierungsplatte (Abschnitt 1.2). Motiviert wird dieses Beugungsproblem im Hinblick auf die Beugungsproblematik planarer Strahler (Antennen) mit endlich ausgedehnter Grundmetallisierung (Abschnitt 1.1). In Kapitel 2 wird ein Stromlinien-Modell zur Formulierung des Beugun...

  5. VizieR Online Data Catalog: IRS spectra with features of crystalline silicates (Chen+, 2016)

    Science.gov (United States)

    Chen, R.; Luo, A.; Liu, J.; Jiang, B.

    2018-04-01

    Spectra taken by the IRS (Houck et al. 2004ApJS..154...18H) on the Spitzer space telescope (Werner et al. 2004ApJS..154....1W) are now publicly available. These spectra are produced using the bksub.tbl products from SL and LL modules of final SSC pipeline, version 18.18. From the IRS data archive, we found a collection of 16986 low-resolution spectra. The spectra are merged by four slits: SL2 (5.21-7.56 μm), SL1 (7.57-14.28 μm), LL2 (14.29-20.66 μm), and LL1 (20.67-38.00 μm). As crystalline silicates have no features in the SL2 band, we choose the spectra that include all the other three bands: SL1, LL2, and LL1 so that the object has a continuous spectrum from about 7.5-38 μm. In this way, five of the seven infrared complexes of crystalline silicates are covered, i.e., the 10, 18, 23, 28, and 33 μm complexes. (5 data files).

  6. Die Beifuß-Ambrosie auf Ackerflächen - ein Problem?

    Directory of Open Access Journals (Sweden)

    Verschwele, Arnd

    2014-07-01

    Full Text Available Common ragweed (Ambrosia artemisiifolia is spreading on agricultural fields in Germany, mainly in Brandenburg and Bayern. Competitive crops like winter cereals and oilseed-rape can reduce growth of this plant better than spring crops. In maize or cereals a chemical control is possible, but problems may arise because of the late emergence of ragweed and its high ability to regrowth. In crops like sunflower or lupines herbicide choice is limited and thus preventive control measures are crucial. An integrated approach is needed in order to avoid yield losses and to stop the spreading of ragweed in Germany.

  7. Effects of different cleaning treatments on heavy metal removal of Panax notoginseng (Burk) F. H. Chen.

    Science.gov (United States)

    Dahui, Liu; Na, Xu; Li, Wang; Xiuming, Cui; Lanping, Guo; Zhihui, Zhang; Jiajin, Wang; Ye, Yang

    2014-01-01

    The quality and safety of Panax notoginseng products has become a focus of concern in recent years. Contamination with heavy metals is one of the important factors as to P. notoginseng safety. Cleaning treatments can remove dust, soil, impurities or even heavy metals and pesticide residues on agricultural products. But effects of cleaning treatments on the heavy metal content of P. notoginseng roots have still not been studied. In order to elucidate this issue, the effects of five different cleaning treatments (CK, no treatment; T1, warm water (50°C) washing; T2, tap water (10°C) washing; T3, drying followed by polishing; and T4, drying followed by tap water (10°C) washing) on P. notoginseng roots' heavy metal (Cu, Pb, Cd, As and Hg) contents were studied. The results showed that heavy metal (all five) content in the three parts all followed the order of hair root > rhizome > root tuber under the same treatment. Heavy metal removals were in the order of Hg > As > Pb > Cu > Cd. Removal efficiencies of the four treatments were in the order of T2 > T1 > T3 > T4. Treatments (T1-T4) could decrease the contents of heavy metal in P. notoginseng root significantly. Compared with the requirements of WM/T2-2004, P. notoginseng roots' heavy metal contents of Cu, Pb, As and Hg were safe under treatments T1 and T2. In conclusion, the cleaning process after production was necessary and could reduce the content of heavy metals significantly. Fresh P. notoginseng root washed with warm water (T2) was the most efficient treatment to remove heavy metal and should be applied in production.

  8. Chen et al., Afr J Tradit Complement Altern Med. (2011) 8(4):467-476

    African Journals Online (AJOL)

    AJTCAM

    Keywords: Shen-qi-di-huang decoction, proteinuria, nephrin, adriamycin nephropathy. Introduction. Proteinuria is a clinical signature of podocyte injury resulting in many renal diseases. The slit diaphragm (SD) which connects neighboring foot processes of podocytes represents a critical structure of protein filtration (Tarabra ...

  9. AtCCX1 transports Na + and K + in Pitch pastoris | Chen | African ...

    African Journals Online (AJOL)

    Compartmentation of Na+ into vacuoles is an important way for cells to avoid the toxic effects of salt. Here, Arabidopsis AtCCX1 was studied in Pitch pastoris GS115. Yeast expressing AtCCX1 grew better in high H+ concentration medium and high salt medium than original strain and increased Na+ accumulation and ...

  10. First record of molluscs naturally infected with Angiostrongylus cantonensis (Chen, 1935 (Nematoda: Metastrongylidae in Brazil

    Directory of Open Access Journals (Sweden)

    Roberta Lima Caldeira

    2007-11-01

    Full Text Available Seeking the identification of Angiostrongylus cantonensis as a potential etiological agent of three clinical cases of eosinophilic meningitis, mollusc specimens were collected in the state of Espírito Santo, Brazil. The snails were identified as Sarasinula marginata (45 specimens, Subulina octona (157, Achatina fulica (45 and Bradybaena similaris (23. Larvae obtained were submitted to polymerase chain reaction and restriction fragment length polymorphism diagnosis. Their genetic profile were corresponded to A. cantonensis. Rattus norvegicus experimentally infected with third-stage larvae, developed menigoencephalitis, and parasites became sexually mature in the lungs. Additionally, larvae obtained from A. fulica snails, from São Vicente, state of São Paulo, also showed genetic profiles of this nematode. This is the first record of Brazilian molluscs infected with this nematode species.

  11. VizieR Online Data Catalog: YSO candidates in the Magellanic Bridge (Chen+, 2014)

    Science.gov (United States)

    Chen, C.-H. R.; Indebetouw, R.; Muller, E.; Kawamura, A.; Gordon, K. D.; Sewilo, M.; Whitney, B. A.; Fukui, Y.; Madden, S. C.; Meade, M. R.; Meixner, M.; Oliveira, J. M.; Robitaille, T. P.; Seale, J. P.; Shiao, B.; van Loon, J. Th.

    2017-06-01

    The Spitzer observations of the Bridge were obtained as part of the Legacy Program "Surveying the Agents of Galaxy Evolution in the Tidally-Stripped, Low-Metallicity Small Magellanic Cloud" (SAGE-SMC; Gordon et al. 2011AJ....142..102G). These observations included images taken at 3.6, 4.5, 5.8, and 8.0 um bands with the InfraRed Array Camera (IRAC) and at 24, 70, and 160 um bands with the Multiband Imaging Photometer for Spitzer (MIPS). The details of data processing are given in Gordon et al. (2011AJ....142..102G). To construct multi-wavelength SEDs for sources in the Spitzer catalog, we have expanded it by adding photometry from optical and NIR surveys covering the Bridge, i.e., BRI photometry from the Super COSMOS Sky Surveys (SSS; Hambly et al. 2001MNRAS.326.1279H) and JHKs photometry from the Two Micron All Sky Survey (2MASS; Skrutskie et al. 2006AJ....131.1163S, Cat. VII/233). (5 data files).

  12. Was kommt nach dem Handel? Umnutzung von Einzelhandelsflächen und deren Beitrag zur Stadtentwicklung

    OpenAIRE

    Sperle, Tilman

    2012-01-01

    In der Stadt europäischen Typs sind Stadt und Handel eng miteinander verwoben. Die Bedeutung des Handels geht weit über dessen originäre Versorgungsfunktion hinaus. Für die städtischen Zentren und Nebenzentren übernimmt er sowohl gestaltende als auch soziale Funktionen und trägt mit seiner belebenden Wirkung maßgeblich zum urbanen Leben bei. Mit dem tief greifenden Strukturwandel im Einzelhandel verändert sich diese Beziehung zwischen Stadt und Handel dramatisch, Trading-down-Prozesse geh...

  13. VizieR Online Data Catalog: Sample of Fermi Blazars (Chen+, 2016)

    Science.gov (United States)

    Chen, Y.-Y.; Zhang, X.; Xiong, D.-R.; Wang, S.-J.; Yu, X.-L.

    2016-04-01

    We tried to select a large number of blazars with reliable redshift, radio core and extended radio luminosity at 1.4GHz. Firstly, we considered the following samples of blazars to get the radio core luminosity and extended luminosity at 1.4GHz: Kharb et al. (2010, J/ApJ/710/764), Antonucci & Ulvestad (1985ApJ...294..158A), Cassaro et al. (1999A&AS..139..601C), Murphy et al. (1993MNRAS.264..298M), Landt & Bignall (2008MNRAS.391..967L), Caccianiga & Marcha (2004, Cat. J/MNRAS/348/973), Giroletti et al. (2004). We cross-correlated these samples with the Fermi LAT Third Source Catalog (3FGL), and we acquired the 3FGL spectral index and energy flux at 0.1-100GeV from clean sources in 3FGL (Fermi-LAT Collaboration 2015, J/ApJS/218/23) Using these catalogs, we compiled 201 Fermi blazars. (1 data file).

  14. Diskrepanz: Die EU-Frauenpolitik zwischen Deregulierung und Gleichheitsansprüchen

    Directory of Open Access Journals (Sweden)

    Ingrid Biermann

    2003-03-01

    Full Text Available In von neun Autorinnen verfassten Beiträgen gibt der Band Einblicke in zentrale Felder der EU-Politik: die europäische Wirtschafts- und Währungsunion (EWWU, die Strukturpolitik, die Gleichstellungspolitik und das Gender Mainstreaming, die Osterweiterung sowie die Ausarbeitung einer europäischen Verfassung. Damit werden wesentliche Teile des Maastricht-Vertrags (1992, des Amsterdamer Vertrags (1997 und des Nizza-Vertrags (2000 behandelt. Hierdurch bildet dieser Band eine wichtige Grundlage für die Diskussion über die Frauenpolitik der EU.

  15. VizieR Online Data Catalog: Quasars narrow absorption lines from SDSS (Chen+, 2015)

    Science.gov (United States)

    Chen, Z.-F.; Gu, Q.-S.; Chen, Y.-M.; Cao, Y.

    2017-11-01

    The Baryon Oscillation Spectroscopic Survey (BOSS: Eisenstein et al. 2011AJ....142...72E; Paris et al. 2012, Cat. VII/269) is the main dark-time legacy survey of the third stage of the SDSS, which used the same 2.5-m telescope (Gunn et al. 2006AJ....131.2332G; Ross et al. 2012, J/ApJS/199/3) as the first and second stages of the SDSS (hereafter SDSS-I/II). SDSS-I/II spectra have a wavelength coverage from 3800-9200Å with a spectral resolution of 1800-2200 (e.g. York et al. 2000AJ....120.1579Y). BOSS spectra span a range from 3600-10500Å at a resolution of 1300-2500 (Paris et al. 2012, Cat. VII/269). During the first two years, BOSS detected 87822 quasars over an area of 3275 deg2, including 7932 quasars that were observed by SDSS-I/II as well. Quasars observed by both SDSS-I/II and BOSS provide a remarkable chance to study the variabilities of absorption lines in a large population. Throughout this work, we take the quasar emission redshifts provided by Hewett & Wild (2010, J/MNRAS/405/2302, http://das.sdss.org/va/HewettWilddr7qso_newz/) directly. (2 data files).

  16. REVIEW: LOVE IN LHASA Lhasa hong chen 拉萨红尘

    Directory of Open Access Journals (Sweden)

    Reviewed by Wu Jing 吴晶

    2018-05-01

    Full Text Available Published in 2002, Love in Lhasa is Baima's first novel. The background is the 1980s at a time when China was engaging in fast-paced development of industrialization and commercialization as part of the Reform and Opening Up that began in the late 1970s. Most of the novel's episodes are set on the Tibetan Plateau where local Tibetans are affected by the trend of modernization. Young people in particular have increased opportunities to go out and see the world and also experience more challenges in dealing with issues of self-identity, and exploring the meaning of their existence. Against such a fast-changing social background, Tibetan women are faced with poignant life choices, especially as compared to traditional women. The novel's plot unfolds with the parallel life trajectories of the two female characters, Langsa and Yama, who are classmates and close friends at Tibet Military College. After graduation, the two young women leave the army and work in non-military areas as nurses. Langsa, the narrator, falls in love with a pilgrim, Varma, who comes from an isolated part of Tibet where Tibetan, Hui, and Han nationalities live together. They enjoy their otherworldly, extremely romantic relationship, and in the end, choose to live a reclusive life in the unknown hinterlands of Tibet. In contrast, Yama, the heroine, undergoes more complicated love experiences. Yama is the focus of this novel, embodying qualities of a "lost girl," such as beauty, rebelliousness, freedom-loving, desire, dreamer, degradation, and despair. After a pre-marriage affair with Di, a young Han man, she marries Zedan, a Tibetan, and her first real love. Disappointed by domestic life, she succumbs to temptation and has an extra-marital affair with Xu Nan in Shanghai. ...

  17. The Analysis of Differences and Similarities of Eastern and Western Women’s Images in Liang Sanbo Yu Zhu Yingtai and Romeo and Juliet Novel

    Directory of Open Access Journals (Sweden)

    Yenny Yenny

    2010-11-01

    Full Text Available Sanpek Engtay and Romeo Juliet are the two famous classic love novels from Eastern and Western countries. They are liked by many generation of eastern and western readers. Both novels describe the image of women at each decade. Engtay represents the image of women at feudalism era while Juliet represents it Renainsance era. In this article, the writer did research at education, marriage, love, women's personality, and women's position at each decade. Library research was done in this study with the purpose of letting people know the differences and similarities of women's images between those two decades It can be concluded that in both writings, they have some similarities when describing love, mindset, and women's personality. The differences are about education, marriage, and women's position at feudalism and Renainsance decades.

  18. The 2nd International Conference on Water Resource and Environment (WRE 2016

    Directory of Open Access Journals (Sweden)

    Zhouli Liu

    2016-11-01

    Full Text Available Table of contents 01 The eco-toxicological effects of cadmium stress on five ornamental plants Zhouli Liu, Wei Chen, Xingyuan He, Shuai Yu, Weihang Ding 02 Study on the formation and release mechanisms of hydrogen sulfide in Longtan coal mine Jianjun Liu, Yuliang Wu, Kaixiang Fan 03 Coral bleaching in the North Reef of China’s Xisha Islands in 2014 Yuanchao Li, Xinqing Zheng, Shiquan Chen, Haiqun Xie 04 Soil chemical characteristics in a Cunninghamia lanceolata stand suffering from ice-snow damage Jie Li, Zhuomin Wang, Li Xue 05 Diversity of understory vegetation was under a Cunninghamia lanceolata stand suffering from ice-snow damage Zhiyang Lie, Weilong Huang, Tongtong Zhou, Li Xue 06 The effect of water, nitrogen and harvesting time on yield and biomass allocation of Helianthus tuberosus L. Kai Gao, Tiexia Zhu 07 The vertical variation of microbial communities in the sediment of sea cucumber pond Weiteng Mao, Pei Yu, Xinfang Lv, Yunchun Li 08 Indicating significances of alpine plant functional groups to environmental change Peixi Su, Rui Shi 09 Research on the daily CH4 fluxes of soil in summer mangrove community at Yingluogang of Guangxi, China Yong Jiang, Xingbin Chen, Shichu liang 10 Beach protection structures in middle and lower reaches of Yangtze River Junfeng Xu 11 Social responsibility management of large dam project with owner as core: an empirical case in China Jiwei Zhu, Zhao Zhai, Linan Zhou, Yun Le, Li Cao 12 The ecological function value assessment analysis of urban waterfront Jiwei Zhu, Ping Lu, Zhiqian Huang, Bei Zhou 13 Mechanism of diurnal osmotic potential changes and adjustment of three Caragana species in different habitats of the Inner Mongolia Plateau Zhirong Zheng, Shihai Lv, Chaoyang Feng 14 Biodiversity of phytoplankton and environmental influences analysis of Longfeng Wetland, China Nan Song, Yan Liu, Xinxin Lu, Yawen Fan 15 The effect of human activities on culturable soil microbes from Yaoquan Mountain in

  19. Reply to 'Comment II on 'Quantum secret sharing based on reusable Greenberger-Horne-Zeilinger states as secure carriers''

    International Nuclear Information System (INIS)

    Karimipour, V.

    2006-01-01

    In the preceding Comment [Jian-Zhong Du, Su-Juan Qin, Qiao-Yan Wen, and Fu-Chen Zhu, Phys. Rev. A 74, 016301 (2006)], it has been shown that in a quantum secret sharing protocol proposed in [S. Bagherinezhad and V. Karimipour, Phys. Rev. A 67, 044302 (2003)], one of the receivers can cheat by splitting the entanglement of the carrier and intercepting the secret, without being detected. In this reply we show that a simple modification of the protocol prevents the receivers from this kind of cheating

  20. Polyethylenimine-based micro/nanoparticles as vaccine adjuvants [Corrigendum

    OpenAIRE

    2017-01-01

    Shen C, Li J, Zhang Y, et al. Int J Nano. 2017;12:5443–5460.The affiliations were presented as:Chen Shen1Jun Li1Yi Zhang1Yuce Li2Guanxin Shen3Jintao Zhu2Juan Tao11Department of Dermatology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China; 2School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan, China; 3Department of Immunology, Tongji Medical College, Huazhong University of Science and Te...

  1. Ma Ying-jeou’s Presidential Discourse

    Directory of Open Access Journals (Sweden)

    Jonathan Sullivan

    2012-01-01

    Full Text Available Despite the substantial advances made in cross-Strait relations during Ma Ying-jeou’s (Ma Yingjiu first term, the ROC president’s rhetoric varied considerably as he grappled with the difficult reality of implementing campaign and inauguration pledges to establish better relations with China while striving to maintain national respect and sovereignty. In this article, we put forward a framework for measuring, analysing and explaining this variation in President Ma’s first-term discourse. Analysing a very large number of Ma’s speeches, addresses, etc., we provide empirical assessments of how the content of Ma’s public pronouncements has developed over time, how his rhetoric varies according to the strategic context and timing of a speech, and how his discourse compares to that of his predecessor, Chen Shui-bian (Chen Shuibian. In addressing these questions, the article contributes a quantitative perspective to existing work on political discourse in Taiwan and to the growing methodological and applied literature on how to systematically analyse Chinese political text.

  2. Polyethylenimine-based micro/nanoparticles as vaccine adjuvants [Corrigendum

    Directory of Open Access Journals (Sweden)

    Shen C

    2017-10-01

    Full Text Available Shen C, Li J, Zhang Y, et al. Int J Nano. 2017;12:5443–5460.The affiliations were presented as:Chen Shen1Jun Li1Yi Zhang1Yuce Li2Guanxin Shen3Jintao Zhu2Juan Tao11Department of Dermatology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China; 2School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan, China; 3Department of Immunology, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, ChinaThe affiliations should have contained the postcodes and are corrected here:Chen Shen1Jun Li1Yi Zhang1Yuce Li2Guanxin Shen3Jintao Zhu2Juan Tao11Department of Dermatology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China; 2School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074, China; 3Department of Immunology, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, ChinaRead the original article

  3. Sensory quality evaluation for appearance of needle-shaped green tea based on computer vision and nonlinear tools.

    Science.gov (United States)

    Dong, Chun-Wang; Zhu, Hong-Kai; Zhao, Jie-Wen; Jiang, Yong-Wen; Yuan, Hai-Bo; Chen, Quan-Sheng

    2017-06-01

    Tea is one of the three greatest beverages in the world. In China, green tea has the largest consumption, and needle-shaped green tea, such as Maofeng tea and Sparrow Tongue tea, accounts for more than 40% of green tea (Zhu et al., 2017). The appearance of green tea is one of the important indexes during the evaluation of green tea quality. Especially in market transactions, the price of tea is usually determined by its appearance (Zhou et al., 2012). Human sensory evaluation is usually conducted by experts, and is also easily affected by various factors such as light, experience, psychological and visual factors. In the meantime, people may distinguish the slight differences between similar colors or textures, but the specific levels of the tea are hard to determine (Chen et al., 2008). As human description of color and texture is qualitative, it is hard to evaluate the sensory quality accurately, in a standard manner, and objectively. Color is an important visual property of a computer image (Xie et al., 2014; Khulal et al., 2016); texture is a visual performance of image grayscale and color changing with spatial positions, which can be used to describe the roughness and directivity of the surface of an object (Sanaeifar et al., 2016). There are already researchers who have used computer visual image technologies to identify the varieties, levels, and origins of tea (Chen et al., 2008; Xie et al., 2014; Zhu et al., 2017). Most of their research targets are crush, tear, and curl (CTC) red (green) broken tea, curly green tea (Bilochun tea), and flat-typed green tea (West Lake Dragon-well green tea) as the information sources. However, the target of the above research is to establish a qualitative evaluation method on tea quality (Fu et al., 2013). There is little literature on the sensory evaluation of the appearance quality of needle-shaped green tea, especially research on a quantitative evaluation model (Zhou et al., 2012; Zhu et al., 2017).

  4. Die Erfassung von städtischen Oberflächen mittels EDV-gestützter Luftbildauswertung : ein Beitrag zur klimatologischen und luftklimatischen Bewertung von städtischen Teilflächen

    Directory of Open Access Journals (Sweden)

    M. Sandtner

    Full Text Available The article shows that the computer-aided, analogous-visual, stereometric interpretation of large-scale colour-infrared (CIR aerial photographs and subsequent data processing in a Geographical Information System (GIS can provide fundamental data necessary to describe aspects of urban ecology in a scale relevant for city-planning. This is exemplified by an evaluation of urban areas concerning their climates and airpollution using maps of urban surfaces (scale1:2500. An argumentation relying on such detailed and current basic data can stress the importance of environmental aspects in contrast to competing public and private interests in the process of city planning.

  5. Erste Erfahrungen mit RDA an wissenschaftlichen Universalbibliotheken in Deutschland - Ergebnisse aus Fokusgruppengesprächen mit Katalogisierenden

    Directory of Open Access Journals (Sweden)

    Heidrun Wiesenmüller

    2017-04-01

    Full Text Available Einige Monate nach dem Umstieg auf das neue Regelwerk "Resource Description and Access" (RDA wurden an 18 großen deutschen wissenschaftlichen Universalbibliotheken Fokusgruppengespräche mit Katalogisierererinnen und Katalogisierern durchgeführt. Die Katalogisierenden wurden u.a. befragt, wie sicher sie sich bei der Anwendung von RDA fühlen, was sie am neuen Regelwerk gut oder schlecht finden, wie sie den Aufwand im Vergleich zum früheren Regelwerk RAK einschätzen, welche Informations- und Hilfsmittel sie verwenden und wie sie zu den regelmäßigen Änderungen im Standard stehen. Der vorliegende Aufsatz dokumentiert die Ergebnisse der Gespräche.   Several months after the introduction of the new cataloging standard "Resource Description and Access" (RDA, focus-group interviews with catalogers were conducted at 18 large academic and state libraries in Germany. Among other things, the catalogers were asked how confident they feel in applying RDA, which aspects of the new cataloging code they like or do not like, how they estimate the expenditure of time in comparison to the former cataloging code RAK, which sources they use to get help or information, and what they think about the frequent changes to the new standard. The paper presents the results of these interviews.

  6. Organisation der Lektoratsarbeit in Öffentlichen Bibliotheken, ihre Stärken und Schwächen

    OpenAIRE

    Umlauf, Konrad

    2011-01-01

    Die Praxis der Lektoratsarbeit an Öffentlichen Bibliotheken wurde 2010 mit einer Online-Befragung unter Biblothekspersonal erhoben. Die Fragen richten sich auf die Aufbauorganisation (Anteil der Lektoren unter dem Personal, den am Bestandsaufbau beteiligten Personalgruppen, die Lektoratsaufgaben im Einzelnen, typische Aufgaben der Lektoren neben den Lektoratsaufgaben, insbes. Verbindung von Lektoratsaufgaben mit Auskunftsdienst), die Ablauforganisation (Entscheidungsablauf und Kaufsitzungen, ...

  7. Chem TV: Choices I, v. 1.5.1 (by B. A. Luceigh, P. Ngo, and J. Chen)

    Science.gov (United States)

    Kraig Steffen, L.

    1999-08-01

    CHEM TV: Sunland, CA, 1998. 24.95, students; 59.95, faculty. This CD-ROM presents a series of interactive overviews and drills for students of organic chemistry. The material covered is generally taught in the first semester. This suite is much more than a simple presentation of material and, for students sufficiently motivated to take the time and work with the problems, will provide valuable review. Five interactive spaces are provided: concentration drills that emphasize recall of related structures/names, reagents/reactions, and stereochemistry; a structural review based on epinephrine; interactive synthesis projects; arcade game reagent review; and a set of timed self-tests. The CD-ROM installed and ran without problem on a Power PC Mac and on a Pentium running Windows 95. The program did fail to run when a student reviewing it switched to a very new version of Windows Quick Time. Most of the drills ran without a problem, although at times it was unclear how to respond to queries. I turned off the music, which would be much less annoying if the loops were simply longer. Publishers are flooding the market with add-on computer-based materials for the various levels of chemistry. Many constitute little more than a stack of overheads. This is one that may be of sufficient value to warrant the extra cost. A large number of examples are provided for many of the areas covered. Most of the graphical interfaces are clear and easy to manipulate, with the exception of a couple of mechanistic screens that had hard-to-figure-out arrows. Two sections, or modules, are of special note. The first of these is the synthesis challenges, where students must choose reactants, reagents, and reaction conditions for a particular reaction. These synthesis problems are well thought out and can be challenging. It is unfortunate that there are only five of them. The Self-Tests module is also of great practical value, forcing students to work through a variety of topics (200 problems) with limited time allotted per test. The structures are clear and easy to view and include a large number of three-dimensional molecular models that help make the connection between simple line drawings and actual molecules. More feedback information on incorrect answers would be nice, although it is obvious that this can balloon into an unworkable situation if every possible "wrong" answer is considered. The structure summary, which uses a single complicated molecule to review a large range of structural topics, is a good integrated look at bonding, stereochemistry, and conformational analysis. The concentration game is informative, albeit a bit obtuse on a few of the answers! The selection drills, a shooting gallery game with various chemical targets, seems a bit silly, but then if one can learn to recognize all the major reducing agents by snagging butterflies with faux nets than this could be helpful! With its varying levels of difficulty, this set of modules should be accessible even to weaker students and yet will provide a challenge for the more advanced. A great future addition would be an interactive module builder that allows faculty to modify existing questions and add their own. How can one effectively use this program? The relatively low cost does make it accessible for individual students to purchase, perhaps as a "recommended" item for the class. Another very practical option is to purchase 5-10 copies (assuming a class size of around 30-40) and make them available through a common computer laboratory (or an appropriate network site-license arrangement) or for check-out to small groups of students. One drawback is that only about 1/3 of the major topics that fill the year in organic are covered. I have used some of the drills as in-class interactive examples with a projector and laptop. This type of interactive tutorial-quiz-based program is a welcome change from the simple textbook on a CD-ROM approach. Given easy access to computers and an environment that encourages individual and small-group interactions, I believe this program can be a worthwhile aid for students of organic chemistry.

  8. Helical Magnetic Fields in AGN Jets Y. J. Chen1,2,∗ , G.-Y. Zhao1,2 ...

    Indian Academy of Sciences (India)

    Abstract. We establish a simple model to describe the helical mag- netic fields in AGN jets projected on the sky plane and the line-of-sight. This kind of profile has been detected in the polarimetric VLBI observa- tion of many blazar objects, suggesting the existence of helical magnetic fields in these sources. Key words.

  9. VizieR Online Data Catalog: New IR photometric study of Ap and Am stars (Chen+, 2017)

    Science.gov (United States)

    Chen, P. S.; Liu, J. Y.; Shan, H. G.

    2018-05-01

    In the General Catalog of Ap and Am stars (Renson & Manfroid 2009, Cat. III/260) 8265 stars are included in which, as Renson & Manfroid (2009, Cat. III/260) described, only 426 stars are of the "well known confirmed sample". We take these 426 stars as our working sample. The cross-identifications of 2MASS/WISE counterparts for all Ap, Am, and HgMn stars listed in this paper are made from Cutri et al. (2012, Cat. II/311) by using the radius of 2 arcsec. All 426 Ap, Am, and HgMn stars have 2MASS and/or WISE counterparts, which are listed in Table 3. The cross-identifications of IRAS counterparts are made according to the positional error ellipse of the source, because it has a 95% confidence level (IRAS Explanatory Supplement, Beichman et al. 1988, Cat. II/274). Finally, 202 stars are found to have the IRAS counterparts from IRAS PSC/FSC, which is listed in Table 4. (5 data files).

  10. J. Chen1, Z.-Q. Shen1, H. Sudou3, S. Iguchi4, Y. Murata5

    Indian Academy of Sciences (India)

    4National Astronomical Observatory of Japan, Tokyo 181-8588, Japan. 5The Institute of Space and Astronautical Science, JAXA, Kanagawa 229-8510, Japan. 6Research Center for Space and Cosmic Evolution, Ehime University,. Matsuyama 790-8577, Japan. ∗ e-mail: gyzhao@shao.ac.cn. Abstract. It was argued that 3C ...

  11. X-ray Time Lags in TeV Blazars X. Chen1,∗ , G. Fossati1, E. Liang1 ...

    Indian Academy of Sciences (India)

    Abstract. We use Monte Carlo/Fokker–Planck simulations to study the. X-ray time lags. Our results show that soft lags will be observed as long as the decay of the flare is dominated by radiative cooling, even when acceleration and cooling time scales are similar. Hard lags can be pro- duced in the presence of a competitive ...

  12. Trichodina nobilis Chen, 1963 and Trichodina reticulata Hirschmann et Partsch, 1955 from ornamental freshwater fishes in Brazil

    Directory of Open Access Journals (Sweden)

    ML Martins

    Full Text Available In the present work Trichodina reticulata and T. nobilis (Ciliophora: Trichodinidae are morphologically characterised from ornamental freshwater fish culture in the State of Santa Catarina, Brazil. The prevalence of infection and a list of comparative measurements are discussed. We examined "southern platyfish" Xiphophorus maculatus (n = 35, "goldfish" Carassius auratus (n = 31, "guppy" Poecilia reticulata (n = 20, "sailfin molly" Poecilia latipinna (n = 6, "beta" Betta splendens (n = 2 and "spotted headstander" Chilodus punctatus (n = 1. After being anesthetised in a benzocaine solution, fishes were examined for parasitological evaluation. A total of 51.57% fishes were parasitised by Trichodina spp. Carassius auratus was the most parasitised species, followed by X. maculatus and P. reticulata. Beta splendens, C. punctatus and P. latipinna were not parasitised by any trichodinid species. Two species of Trichodina were collected from the skin of fish: T. nobilis was found in C. auratus, P. reticulata and X. maculatus and T. reticulata was only observed in C. auratus. The importance of adequate handling in ornamental fish culture are also discussed.

  13. Energy transfer ultraviolet photodetector with 8-hydroxyquinoline derivative-metal complexes as acceptors

    International Nuclear Information System (INIS)

    Wu Shuang-Hong; Chen Zhi; Li Shi-Bin; Wang Xiao-Hui; Wei Xiong-Bang; Li Wen-Lian

    2015-01-01

    We choose 8-hydroxyquinoline derivative-metal complexes (Beq, Mgq, and Znq) as the acceptors (A) and 4,4',4”-tri-(2-methylphenyl phenylamino) triphenylaine (m-MTDATA) as the donor (D) respectively to study the existing energy transfer process in the organic ultraviolet (UV) photodetector (PD), which has an important influence on the sensitivity of PDs. The energy transfer process from D to A without exciplex formation is discussed, differing from the working mechanism of previous PDs with Gaq [Zisheng Su, Wenlian Li, Bei Chu, Tianle Li, Jianzhuo Zhu, Guang Zhang, Fei Yan, Xiao Li, Yiren Chen and Chun-Sing Lee 2008 Appl. Phys. Lett. 93 103309)] and REq [J. B. Wang, W. L. Li, B. Chu, L. L. Chen, G. Zhang, Z. S. Su, Y. R. Chen, D. F. Yang, J. Z. Zhu, S. H. Wu, F. Yan, H. H. Liu, C. S. Lee 2010 Org. Electron. 11 1301] used as an A material. Under 365-nm UV irradiation with an intensity of 1.2 mW/cm 2 , the m-MTDATA:Beq blend device with a weight ratio of 1:1 shows a response of 192 mA/W with a detectivity of 6.5× 10 11 Jones, which exceeds those of PDs based on Mgq (146 mA/W) and Znq (182 mA/W) due to better energy level alignment between m-MTDATA/Beq and lower radiative decay. More photophysics processes of the PDs involved are discussed in detail. (paper)

  14. Energy transfer ultraviolet photodetector with 8-hydroxyquinoline derivative-metal complexes as acceptors

    Science.gov (United States)

    Wu, Shuang-Hong; Li, Wen-Lian; Chen, Zhi; Li, Shi-Bin; Wang, Xiao-Hui; Wei, Xiong-Bang

    2015-02-01

    We choose 8-hydroxyquinoline derivative-metal complexes (Beq, Mgq, and Znq) as the acceptors (A) and 4,4',4”-tri-(2-methylphenyl phenylamino) triphenylaine (m-MTDATA) as the donor (D) respectively to study the existing energy transfer process in the organic ultraviolet (UV) photodetector (PD), which has an important influence on the sensitivity of PDs. The energy transfer process from D to A without exciplex formation is discussed, differing from the working mechanism of previous PDs with Gaq [Zisheng Su, Wenlian Li, Bei Chu, Tianle Li, Jianzhuo Zhu, Guang Zhang, Fei Yan, Xiao Li, Yiren Chen and Chun-Sing Lee 2008 Appl. Phys. Lett. 93 103309)] and REq [J. B. Wang, W. L. Li, B. Chu, L. L. Chen, G. Zhang, Z. S. Su, Y. R. Chen, D. F. Yang, J. Z. Zhu, S. H. Wu, F. Yan, H. H. Liu, C. S. Lee 2010 Org. Electron. 11 1301] used as an A material. Under 365-nm UV irradiation with an intensity of 1.2 mW/cm2, the m-MTDATA:Beq blend device with a weight ratio of 1:1 shows a response of 192 mA/W with a detectivity of 6.5× 1011 Jones, which exceeds those of PDs based on Mgq (146 mA/W) and Znq (182 mA/W) due to better energy level alignment between m-MTDATA/Beq and lower radiative decay. More photophysics processes of the PDs involved are discussed in detail. Project supported by the National Natural Science Foundation of China (Grant Nos. 61371046, 61405026, 61474016, and 61421002) and China Postdoctoral Science Foundation (Grant No. 2014M552330).

  15. Digallane with redox-active diimine ligand: dualism of electron-transfer reactions.

    Science.gov (United States)

    Fedushkin, Igor L; Skatova, Alexandra A; Dodonov, Vladimir A; Chudakova, Valentina A; Bazyakina, Natalia L; Piskunov, Alexander V; Demeshko, Serhiy V; Fukin, Georgy K

    2014-05-19

    The reactivity of digallane (dpp-Bian)Ga-Ga(dpp-Bian) (1), which consists of redox-active ligand 1,2-bis[(2,6-diisopropylphenyl)imino]acenaphthene (dpp-Bian), has been studied. The reaction of 1 with I2 proceeds via one-electron oxidation of each of two dpp-Bian ligands to a radical-anionic state and affords complex (dpp-Bian)IGa-GaI(dpp-Bian) (2). Dissolution of complex 2 in pyridine (Py) gives monomeric compound (dpp-Bian)GaI(Py) (3) as a result of a solvent-induced intramolecular electron transfer from the metal-metal bond to the dpp-Bian ligands. Treatment of compound 3 with B(C6F5)3 leads to removal of pyridine and restores compound 2. The reaction of compound 1 with 3,6-di-tert-butyl-ortho-benzoquinone (3,6-Q) proceeds with oxidation of all the redox-active centers in 1 (the Ga-Ga bond and two dpp-Bian dianions) and results in mononuclear catecholate (dpp-Bian)Ga(Cat) (4) (Cat = [3,6-Q](2-)). Treatment of 4 with AgBF4 gives a mixture of [(dpp-Bian)2Ag][BF4] (5) and (dpp-Bian)GaF(Cat) (6), which both consist of neutral dpp-Bian ligands. The reduction of benzylideneacetone (BA) with 1 generates the BA radical-anions, which dimerize, affording (dpp-Bian)Ga-(BA-BA)-Ga(dpp-Bian) (7). In this case the Ga-Ga bond remains unchanged. Within 10 min at 95 °C in solution compound 7 undergoes transformation to paramagnetic complex (dpp-Bian)Ga(BA-BA) (8) and metal-free compound C36H40N2 (9). The latter is a product of intramolecular addition of the C-H bond of one of the iPr groups to the C═N bond in dpp-Bian. Diamagnetic compounds 3, 5, 6, and 9 have been characterized by NMR spectroscopy, and paramagnetic complexes 2, 4, 7, and 8 by ESR spectroscopy. Molecular structures of 2-7 and 9 have been established by single-crystal X-ray analysis.

  16. S1P transporter SPNS2 regulates proper postnatal retinal morphogenesis.

    Science.gov (United States)

    Fang, Chao; Bian, Ganlan; Ren, Pan; Xiang, Jie; Song, Jun; Yu, Caiyong; Zhang, Qian; Liu, Ling; Chen, Kun; Liu, Fangfang; Zhang, Kun; Wu, Chunfeng; Sun, Ruixia; Hu, Dan; Ju, Gong; Wang, Jian

    2018-02-08

    Spinster homolog 2 (SPNS2) is the membrane transporter of sphingosine-1-phosphate (S1P), and it participates in several physiologic processes by activating different S1P receptors (S1PRs). However, its functions in the nervous system remain largely unclear. We explored the important role of SPNS2 in the process of retinal morphogenesis using a spns2-deficient rat model. In the absence of the functional SPNS2 transporter, we observed progressively aggravating laminar disorganization of the epithelium at the postnatal stage of retinal development. Disrupted cell polarity, delayed cell-cycle exit of retinal progenitor cells, and insufficient migration of newborn neurons were proposed in this study as potential mechanisms accounting for this structural disorder. In addition, we analyzed the expression profiles of spns2 and s1prs, and proposed that SPNS2 regulated retinal morphogenesis by establishing the S1P level in the eye and activating S1PR3 signaling. These data indicate that SPNS2 is indispensable for normal retinal morphogenesis and provide new insights on the role of S1P in the developing retina using an established in vivo model.-Fang, C., Bian, G., Ren, P., Xiang, J., Song, J., Yu, C., Zhang, Q., Liu, L., Chen, K., Liu, F., Zhang, K., Wu, C., Sun, R., Hu, D., Ju, G., Wang, J. S1P transporter SPNS2 regulates proper postnatal retinal morphogenesis.

  17. Comment on "An improved gray Lattice Boltzmann model for simulating fluid flow in multi-scale porous media": Intrinsic links between LBE Brinkman schemes

    Science.gov (United States)

    Ginzburg, Irina

    2016-02-01

    In this Comment on the recent work (Zhu and Ma, 2013) [11] by Zhu and Ma (ZM) we first show that all three local gray Lattice Boltzmann (GLB) schemes in the form (Zhu and Ma, 2013) [11]: GS (Chen and Zhu, 2008; Gao and Sharma, 1994) [1,4], WBS (Walsh et al., 2009) [12] and ZM, fail to get constant Darcy's velocity in series of porous blocks. This inconsistency is because of their incorrect definition of the macroscopic velocity in the presence of the heterogeneous momentum exchange, while the original WBS model (Walsh et al., 2009) [12] does this properly. We improve the GS and ZM schemes for this and other related deficiencies. Second, we show that the ;discontinuous velocity; they recover on the stratified interfaces with their WBS scheme is inherent, in different degrees, to all LBE Brinkman schemes, including ZM scheme. None of them guarantees the stress and the velocity continuity by their implicit interface conditions, even in the frame of the two-relaxation-times (TRT) collision operator where these two properties are assured in stratified Stokes flow, Ginzburg (2007) [5]. Third, the GLB schemes are presented in work (Zhu and Ma, 2013) [11] as the alternative ones to direct, Brinkman-force based (BF) schemes (Freed, 1998; Nie and Martys, 2007) [3,8]. Yet, we show that the BF-TRT scheme (Ginzburg, 2008) [6] gets the solutions of any of the improved GLB schemes for specific, viscosity-dependent choice of its one or two local relaxation rates. This provides the principal difference between the GLB and BF: while the BF may respect the linearity of the Stokes-Brinkman equation rigorously, the GLB-TRT cannot, unless it reduces to the BF via the inverse transform of the relaxation rates. Furthermore, we show that, in limited parameter space, ;gray; schemes may run one another. From the practical point of view, permeability values obtained with the GLB are viscosity-dependent, unlike with the BF. Finally, the GLB shares with the BF a so-called anisotropy (Ginzburg

  18. Comparison of long-term clinical outcome between patients with chronic versus acute type B aortic dissection treated by implantation of a stent graft: a single-center report

    Directory of Open Access Journals (Sweden)

    Chen SL

    2013-04-01

    Full Text Available Shao-Liang Chen, Jian-Cheng Zhu, Xiao-Bo Li, Fei Ye, Jun-Jie Zhang, Zhi-Zhong Liu, Nai-Liang Tian, Song Lin, Cheng-Yu Lv Nanjing First Hospital, Nanjing Medical University, Nanjing, People's Republic of China Background: Stent grafting for treatment of type B aortic dissection has been extensively used. However, the difference in the long-term clinical outcome between patients with chronic versus acute type B aortic dissection remains unknown. This study aimed to analyze the difference in long-term clinical outcome after endovascular repair for patients with chronic (93% complete false-lumen thrombosis. Untreated tear and type I endoleak were predictors of clinical events during follow-up. Conclusion: Comparable long-term clinical results were achieved in patients with chronic or acute type B aortic dissection after implantation of a stent graft. Keywords: aortic dissection, endovascular repair, procedure-related events, propensity score matching

  19. Information systems and computing technology

    CERN Document Server

    Zhang, Lei

    2013-01-01

    Invited papersIncorporating the multi-cross-sectional temporal effect in Geographically Weighted Logit Regression K. Wu, B. Liu, B. Huang & Z. LeiOne shot learning human actions recognition using key posesW.H. Zou, S.G. Li, Z. Lei & N. DaiBand grouping pansharpening for WorldView-2 satellite images X. LiResearch on GIS based haze trajectory data analysis system Y. Wang, J. Chen, J. Shu & X. WangRegular papersA warning model of systemic financial risks W. Xu & Q. WangResearch on smart mobile phone user experience with grounded theory J.P. Wan & Y.H. ZhuThe software reliability analysis based on

  20. Proximity hybridization-mediated isothermal exponential amplification for ultrasensitive electrochemical protein detection

    Directory of Open Access Journals (Sweden)

    Yu Y

    2017-08-01

    Full Text Available Yanyan Yu, Gaoxing Su, Hongyan Zhu, Qing Zhu, Yong Chen, Bohui Xu, Yuqin Li, Wei Zhang School of Pharmacy, Nantong University, Nantong, People’s Republic of China Abstract: In this study, we fabricated a novel electrochemical biosensing platform on the basis of target-triggered proximity hybridization-mediated isothermal exponential amplification reaction (EXPAR for ultrasensitive protein analysis. Through rational design, the aptamers for protein recognition were integrated within two DNA probes. Via proximity hybridization principle, the affinity protein-binding event was converted into DNA assembly process. The recognition of protein by aptamers can trigger the strand displacement through the increase of the local concentrations of the involved probes. As a consequence, the output DNA was displaced, which can hybridize with the duplex probes immobilized on the electrode surface subsequently, leading to the initiation of the EXPAR as well as the cleavage of duplex probes. Each cleavage will release the gold nanoparticles (AuNPs binding sequence. With the modification of G-quadruplex sequence, electrochemical signals were yielded by the AuNPs through oxidizing 3,3',5,5'-tetramethylbenzidine in the presence of H2O2. The study we proposed exhibited high sensitivity toward platelet-derived growth factor BB (PDGF-BB with the detection limit of 52 fM. And, this method also showed great selectivity among the PDGF isoforms and performed well in spiked human serum samples. Keywords: electrochemical biosensor, proximity hybridization, PDGF-BB, isothermal exponential amplification, G-quadruplex 

  1. Investigations of Tissue-Level Mechanisms of Primary Blast Injury Through Modeling, Simulation, Neuroimaging and Neuropathological Studies

    Science.gov (United States)

    2012-07-10

    2007;25(1):97-98. [19] Stewart C. Blast Injuries. Colorado Springs: USAF Academy Hospital; 2006. 88 p. [20] Cernak I, Wang Z, Jiang J, Bian X, Savic J...Wang Z, Jiang J, Bian X, Savic J. Ultrastructural and Functional Characteristics of Blast Injury- Induced Neurotrauma. Journal of Trauma: Injury

  2. Excess risk of major vascular diseases associated with airflow obstruction: a 9-year prospective study of 0.5 million Chinese adults

    Directory of Open Access Journals (Sweden)

    Kurmi OP

    2018-03-01

    Full Text Available Om P Kurmi,1 Liming Li,2 Kourtney J Davis,3 Jenny Wang,1 Derrick A Bennett,1 Ka Hung Chan,1 Ling Yang,1 Yiping Chen,1 Yu Guo,4 Zheng Bian,4 Junshi Chen,5 Liuping Wei,6 Donghui Jin,7 Rory Collins,1 Richard Peto,1 Zhengming Chen1 On behalf of the China Kadoorie Biobank collaborative group 1Clinical Trial Service and Epidemiological Studies Unit, Nuffield Department of Population Health, University of Oxford, Oxford, UK; 2Department of Epidemiology, School of Public Health, Peking University Health Science Center, Beijing, China; 3Real World Evidence and Epidemiology, GlaxoSmithKline, Collegeville, PA, USA; 4Chinese Academy of Medical Sciences, Beijing China; 5China National Center for Food Safety Risk Assessment, Beijing, China; 6NCDs Prevention and Control Department, Liuzhou CDC, Liuzhou, China; 7NCDs Prevention and Control Department, Hunan CDC, Changsha, China Background: China has high COPD rates, even among never-regular smokers. Little is known about nonrespiratory disease risks, especially vascular morbidity and mortality after developing airflow obstruction (AFO in Chinese adults. Objective: We aimed to investigate the prospective association of prevalent AFO with major vascular morbidity and mortality. Materials and methods: In 2004–2008, a nationwide prospective cohort study recruited 512,891 men and women aged 30–79 years from 10 diverse localities across China, tracking cause-specific mortality and coded episodes of hospitalization for 9 years. Cox regression yielded adjusted HRs for vascular diseases comparing individuals with spirometry-defined prevalent AFO at baseline to those without. Results: Of 489,382 participants with no vascular disease at baseline, 6.8% had AFO, with prevalence rising steeply with age. Individuals with prevalent AFO had significantly increased vascular mortality (n=1,429, adjusted HR 1.29, 95% CI 1.21–1.36. There were also increased risks of hemorrhagic stroke (n=823, HR 1.18, 95% CI 1.09–1

  3. Advanced Materials and Processing 2010

    Science.gov (United States)

    Zhang, Yunfeng; Su, Chun Wei; Xia, Hui; Xiao, Pengfei

    2011-06-01

    -pipe steel and its finite element simulation / Kyong-Ho Chang and Gab-Chul Jang -- Residual stress distribution of 600MPa grade high tensile strength steel pipe using welding FE simulation / Kyong-Ho Chang and Gab-Chul Jang -- In-situ preparation and magnetic properties of Fe[symbol]O[symbol]/wood composite / Honglin Gao ... [et al.] -- The application of the cohesive zone model on the analysis of mechanical properties of carbon nano-tube composites with debonding interface / Wen-Liang Zhu and Dong-Mei Luo -- Microstructures and mechanical properties of As-Cast Mg-Zr-Ca alloys for biomedical applications / Ying-Long Zhou ... [et al.] -- Effect of polyurethane/nano-SiO[symbol] composites coating on thermo-mechanical properties of polyethylene film / Ching Yern Chee and Iskandar Idris Yaacob -- Effects evaluation for different rare earth elements in magnesium-lithium alloy / Bin Jiang ... [et al.] -- Effect of sintering temperature on the structure and bioactivity of HAp-5.0wt.%SO[symbol] bioceramic composites / Xiao-Wu Li ... [et al.] -- Study on the high cycle fatigue property of Ti-600 alloy at ambient temperature / Liying Zeng ... [et al.] -- Study on deformation-induced ferrite transformation of steel 2.25Cr1MoNb / Li Qing-Fen, Zhou Hui-Min and Chen Hong-Bin -- Effect of Fe addition on the cycle performance of FeS2 cathode for Li/FeS[symbol] battery / Young-Jin Choi ... [et al.] -- Effect of annealing process on recrystallization microstructure and texture of low carbon steel strip / Haiyan Wang ... [et al.].Grain-boundary segregation and co-segregation behavior of three elements in steel 2.25Gr1Mo / Wang Jun ... [et al.] -- Effect of partial crystallization on the mechanical properties of [symbol] bulk metallic glass / P. H. Tsai ... [et al.] -- Influence of plastic deformation on the evolution of defect structures, microhardness and electrical conductivity of copper / Jingmei Tao ... [et al.] -- Microstructure and room temperature mechanical properties of the Ni

  4. On Meng Chen-shun's Romance Theory and His Opera and Drama Greation%孟称舜"传情"理论及其戏曲创作

    Institute of Scientific and Technical Information of China (English)

    刘伟

    2002-01-01

    孟称舜戏曲深受汤显祖的影响,前期剧作和"传情"理论表现出对"至情"的赞颂和对封建礼教的批判.作为生活在明清易代时期的落魄文人,他又与那个时代和环境紧密相连,由于受到当时社会、思想等多种因素的影响,其传情理论和戏曲创作都发生了很大的变化.他以"诚"为主体,他"情正"与"言道"结合的"言情"倾向,是他的特色,也是他的局限.

  5. 论陈亮事功主义伦理思想的基本特征%On Chen Liang's Essential Features of Utilitarian Ethics

    Institute of Scientific and Technical Information of China (English)

    朱晓鹏

    2005-01-01

    陈亮是永康学派的创始人.他的事功主义伦理思想的基本特征是"理欲统一"的道德观、"义利合一"的价值观和"学为成人"的人生观.这种事功主义伦理思想具有创新精神,对中国传统的伦理观是一种挑战,对后世产生了深远的影响.

  6. Diskrepanz: Die EU-Frauenpolitik zwischen Deregulierung und Gleichheitsansprüchen Internal Discrepancies: EU Women’s Policies between Deregulation and Claims to Equality

    Directory of Open Access Journals (Sweden)

    Ingrid Biermann

    2003-03-01

    Full Text Available In von neun Autorinnen verfassten Beiträgen gibt der Band Einblicke in zentrale Felder der EU-Politik: die europäische Wirtschafts- und Währungsunion (EWWU, die Strukturpolitik, die Gleichstellungspolitik und das Gender Mainstreaming, die Osterweiterung sowie die Ausarbeitung einer europäischen Verfassung. Damit werden wesentliche Teile des Maastricht-Vertrags (1992, des Amsterdamer Vertrags (1997 und des Nizza-Vertrags (2000 behandelt. Hierdurch bildet dieser Band eine wichtige Grundlage für die Diskussion über die Frauenpolitik der EU.This anthology, consisting of nine essays written by women authors, offers insights into central areas of EU politics: the European Economic and Currency Union, structural policies, policies dealing with gender equality, the expansion of the EU, as well as the creation of a new European constitution. These policies include relevant parts of the 1992 Maastricht Treaty, the 1997 Treaty of Amsterdam, and the 2000 Treaty of Nizza. The information and insights presented here make this book an important basis for any discussions about EU women’s policies.

  7. Discussion of “Nanoscale Fluid Mechanics and Energy Conversion” (Chen, X., Xu, B., and Liu, L., 2014, ASME Appl. Mech. Rev., 66(5), p. 050803)

    NARCIS (Netherlands)

    Eijkel, Jan C.T.

    2014-01-01

    The authors of the paper “Nanoscale Fluid Mechanics and Energy Conversion” have presented an overview of recent applications of nanofluidic phenomena for energy conversion and storage. The discussion given here aims to place this paper in a broader context of literature and theory.

  8. Redescription of Paragaleus tengi (Chen, 1963) (Carcharhiniformes: Hemigaleidae) and first record of Paragaleus randalli Compagno, Krupp & Carpenter, 1996 from the western North Pacific.

    Science.gov (United States)

    White, William T; Harris, Mark

    2013-01-01

    Paragaleus tengi was previously considered to be the only member of this genus occurring in the Western Pacific, with Paragaleus randalli occurring in the Indian Ocean and allopatric in distribution. Recent molecular and morphological studies showed that P. randalli also occurs in the Western Pacific with records from Thailand, Malaysia and Indonesia previously mostly incorrectly attributed to P. tengi. This paper provides a redescription of P. tengi and confirms the presence of P. randalli from off Taiwan in the western North Pacific. These two species are morphologically very similar in appearance but differ in meristics, dentition, some coloration attributes and minor morphological characters. The conservation status of these two species needs to be reassessed based on this new information.

  9. How Structural Deficiencies Hamper Estonia’s Catching-up Process. Strukturschwächen als Hemmnis für Estlands Aufholprozess

    Directory of Open Access Journals (Sweden)

    Klaus Schrader

    2016-10-01

    Full Text Available Estonia is widely regarded as a paramount example for a successful transformation of a socialist economic system to a functioning market economy. Against the backdrop of this positive image which contrasts strongly with the crisis scenarios in Southern Europe the remaining problems of Estonia are often ignored. Estonia has hardly succeeded in catching-up economically with the richer countries of the EU. In this paper the authors raise the question why the catching-up process of Estonia is not as successful as it could have been expected from the policy performance during the last decades. It turns out that Estonia faces a serious productivity problem, particularly in the manufacturing sector producing tradable goods which is normally the driving engine behind economic and technological catching-up. The Estonian economy has failed to undergo the necessary structural change towards technologically more advanced employment structures and export patterns. Accordingly, Estonian economic policy needs to create a suitable business environment to support this kind of structural change.

  10. Photoluminescent (PL) or electroluminescent (EL) quantum dots for display, lighting, and photomedicine (Conference Presentation)

    Science.gov (United States)

    Dong, Yajie

    2017-02-01

    Quantum dots (QDs) have gone through a long journey before finding their ways into the display field. This talk will briefly touch on the history before trying to answer several key questions related to QDs applications in display: What are QDs? How are they made? What properties do they have and Why? How can these properties be used to improve color and efficiency of display, in either photoluminescence (PL) or electroluminescence (EL) mode? And what are the remaining challenges for QDs wide adoption in display industry? Lastly, some most recent progresses in our UCF lab at both PL and EL fronts will be highlighted. For PL, a cadmium-free perovskite-polymer composite films with exceptionally narrow emission green peaks (FWHM 20 nm) and good water and thermal stability will be reported. Together with red quantum dots or PFS/KSF phosphors as down-converters for blue LEDs, a white-light source with 95% Rec. 2020 color gamut was demonstrated [1]. For EL, red quantum dot light emitting devices (QLEDs) with record luminance of 165,000 Cd/m2 has been obtained at a current density of 1000 mA/cm2 with a low driving voltage of 5.8 V and CIE coordinates of (0.69, 0.31). [2] The potential of using these QLEDs for light sources for integrated sensing platform [3] or high efficiency, high color quality hybrid white OLED [4] will be discussed. [1] Y. N. Wang, J. He, H. Chen, J. S. Chen, R. D. Zhu, P. Ma, A. Towers, Y. Lin, A. J. Gesquiere, S. T. Wu, Y. J. Dong. Ultrastable, Highly Luminescent Organic-Inorganic Perovskite - Polymer Composite Films, Advanced Materials, accepted, (2016). [2] Y. J. Dong, J.M. Caruge, Z. Q. Zhou, C. Hamilton, Z. Popovic, J. Ho, M. Stevenson, G. Liu, V. Bulovic, M. Bawendi, P. T. Kazlas, S. Coe-Sullivan, and J. Steckel Ultra-bright, Highly Efficient, Low Roll-off Inverted Quantum-Dot Light Emitting Devices (QLEDs). SID Symp. Dig. Tech. Pap. 46, 270-273 (2015). [3] J. He, H. Chen, S. T. Wu, and Y. J. Dong, Integrated Sensing Platform Based on Quantum

  11. New World species of the genus Calliscelio Ashmead (Hymenoptera, Platygastridae, Scelioninae

    Directory of Open Access Journals (Sweden)

    Hua-yan Chen

    2017-01-01

    Full Text Available The genus Calliscelio Ashmead is presumed to be a diverse group of parasitoids of the eggs of crickets (Orthoptera: Gryllidae. A least one species has been found to be an important factor in depressing cricket pest populations. The New World species of Calliscelio are revised. Forty-two species are recognized, 3 are redescribed: C. bisulcatus (Kieffer, C. laticinctus Ashmead, C. rubriclavus (Ashmead, comb. n.; and 38 are described as new: C. absconditum Chen & Johnson, sp. n., C. absum Chen & Johnson, sp. n., C. alcoa Chen & Masner, sp. n., C. amadoi Chen & Johnson, sp. n., C. armila Chen & Masner, sp. n., C. bidens Chen & Masner, sp. n., C. brachys Chen & Johnson, sp. n., C. brevinotaulus Chen & Johnson, sp. n., C. brevitas Chen & Johnson, sp. n., C. carinigena Chen & Johnson, sp. n., C. crater Chen & Johnson, sp. n., C. crena Chen & Johnson, sp. n., C. eboris Chen & Johnson, sp. n., C. extenuatus Chen & Johnson, sp. n., C. flavicauda Chen & Johnson, sp. n., C. foveolatus Chen & Johnson, sp. n., C. gatineau Chen & Johnson, sp. n., C. glaber Chen & Masner, sp. n., C. granulatus Chen & Masner, sp. n., C. latifrons Chen & Johnson, sp. n., C. levis Chen & Johnson, sp. n., C. longius Chen & Johnson, sp. n., C. magnificus Chen & Masner, sp. n., C. migma Chen & Johnson, sp. n., C. minutia Chen & Johnson, sp. n., C. paraglaber Chen & Johnson, sp. n., C. pararemigio Chen & Masner, sp. n., C. prolixus Chen & Johnson, sp. n., C. punctatifrons Chen & Johnson, sp. n., C. remigio Chen & Masner, sp. n., C. ruga Chen & Johnson, sp. n., C. rugicoxa Chen & Masner, sp. n., C. sfina Chen & Johnson, sp. n., C. storea Chen & Johnson, sp. n., C. suni Chen & Johnson, sp. n., C. telum Chen & Johnson, sp. n., C. torqueo Chen & Johnson, sp. n., C. virga Chen & Johnson, sp. n. Four species are treated as junior synonyms of Calliscelio rubriclavus (Ashmead: Anteris nigriceps Ashmead, syn. n., Caloteleia marlattii Ashmead, syn. n., Caloteleia grenadensis Ashmead, syn. n

  12. Commentary on: "An integrated metabolic atlas of clear cell renal cell carcinoma." Hakimi AA, Reznik E, Lee CH, Creighton CJ, Brannon AR, Luna A, Aksoy BA, Liu EM, Shen R, Lee W, Chen Y, Stirdivant SM, Russo P, Chen YB, Tickoo SK, Reuter VE, Cheng EH, Sander C, Hsieh JJ.: Cancer Cell. 2016 Jan 11;29(1):104-16.

    Science.gov (United States)

    Lee, Byron H

    2017-09-01

    Dysregulated metabolism is a hallmark of cancer, manifested through alterations in metabolites. We performed metabolomic profiling on 138 matched clear cell renal cell carcinoma (ccRCC)/normal tissue pairs and found that ccRCC is characterized by broad shifts in central carbon metabolism, one-carbon metabolism, and antioxidant response. Tumor progression and metastasis were associated with metabolite increases in glutathione and cysteine/methionine metabolism pathways. We develop an analytic pipeline and visualization tool (metabolograms) to bridge the gap between TCGA transcriptomic profiling and our metabolomic data, which enables us to assemble an integrated pathway-level metabolic atlas and to demonstrate discordance between transcriptome and metabolome. Lastly, expression profiling was performed on a high-glutathione cluster, which corresponds to a poor-survival subgroup in the ccRCC TCGA cohort. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Uso de plâncton silvestre, fermento fresco e levedura desidratada na alimentação de larvas do cascudo chinelo, Loricariichthys platymetopon (Isbrüchen & Nijssen, 1979 (Osteichthyes, Loricariidae Natural plankton, fresh ferment and dehydrated yeast utilization at Loricariichthys platymetopon (Isbrüchen & Nijssen, 1979 (Osteichthyes, Loricariidae, cascudo chinelo, fry feeding

    Directory of Open Access Journals (Sweden)

    Claudemir Martins Soares

    2002-05-01

    Full Text Available Objetivando avaliar a utilização de diferentes alimentos para larvas do cascudo chinelo Loricariichthys platymetopon (Osteichthyes, Loricariidae, 240 larvas com cinco dias pós-eclosão foram distribuídas em 20 aquários (12 L. Foram utilizados cinco tratamentos com quatro repetições cada, os quais consistiram do emprego de diferentes tipos de alimentos como: plâncton (P, fermento (F, levedura desidratada (LD e as combinações P+F e P+LD por 15 dias consecutivos. O F e a LD foram fornecidos à vontade três vezes ao dia, enquanto o P foi fornecido pela manhã, após os aquários serem sifonados. Os valores da temperatura, pH, condutividade elétrica e oxigênio dissolvido se mantiveram dentro de níveis aceitáveis para a aquicultura. Os valores de biomassa/aquário das larvas alimentadas com P+LD foram superiores aos dos alimentados com P, F e P+F, entretanto não diferiram daqueles com o uso de LD. As larvas alimentadas com P+LD apresentaram valores de peso final médio superiores às dos demais tratamentos, sendo que F levou a valores de peso final médio inferiores em comparação ao uso de P, LD e P+F. Observou-se menor sobrevivência com o uso de P em comparação a LD e P+LD. Conclui-se que se pode utilizar P+LD na criação do cascudo chinelo em suas fases iniciais de desenvolvimento.Aiming to evaluate different foods effects in the rearing of Loricariichthys platymetopon (Osteichthyes, Loricariidae fry, 240 5-day-after-hatch specimens were distributed in 20 aquarium glasses (12 L. Five treatments, with four repetitions each, were tested, consisting in: plankton (P, fresh ferment (F, dehydrated yeast (DY and the combinations P+F and P+DY, for 15 days. F and DY were given ad libitum three times a day, and P only in the morning, after the aquariums siphoning. Temperature, pH, electric conductivity and dissolved oxygen were in levels acceptable for fish. The fry biomass per aquarium values were higher for the P + DY treatment, when compared to P, F and P+F, but equal to DY. Also, P +DY-fed fry showed higher mean final weight than all the other treatments. F-treated fry showed mean final weight lower than the ones treated with P, DY and P+F. The P treatment showed lower survival rate than DY and P+DY. The results indicate that P + DY can be used for Loricariichthys platymetopon fry rearing during their initial development phases.

  14. 研究/電子資源使用統計標準與規範之探討/陳雪華;許嘉珍;朱雅琦 | Study of the Electronic Resources Usage Statistics Standards and Guidelines/ Hsueh-Hua Chen;Chia-Chen Hsu;Ya-Chi Chu

    Directory of Open Access Journals (Sweden)

    陳雪華、許嘉珍、朱雅琦

    2007-04-01

    Full Text Available

    近年來,由於資訊科技的進步,圖書館中的電子資源數量快速增加,所佔預算金額比例也大幅增長。圖書館希望能夠透過評鑑電子資源的使用,以便能夠在電 子資源館藏發展等方面做出正確的決策。由於體認到電子資源使用統計之重要性,圖書館界與相關組織紛紛發展或修訂圖書館統計標準,增列電子資源使用統計的項 目以充分反映圖書館電子資源使用之狀況。本文主要採用文獻分析法以及內容分析法,收集探討並比較近軍來國內外電子資源使用統計之相關規範及標準,包含 ISO 2789、 ICOLC Guidelines、州ANSI/NISO Z39.7、CNS13151、ARL E-Metrlcs、E-Measures Project、以及Project COUNTER等。

    Recently, due to the advances of information technology, electronic resources are gradually replacing print resources as the largest consumer of library acquisition budgets. Logically, libraries want to evaluate the usage of electronic resources and incorporate the results into their decision making regarding electronic resource acquisition. Over these years, there is a general awareness among libraries to develop statistics standards and guidelines for library electronic resources usage. In this paper, literature review and content analysis methods are used to compare several library statistics standards, including: ISO 2789 、ICOLC Guidelines、ANSI/NISO Z39.7、CNS13151、ARL E-Metrics、E-Measures Project、and Project COUNTER etc.

    頁次:89-102

  15. The relationship between cholesterol and cognitive function is homocysteine-dependent

    Directory of Open Access Journals (Sweden)

    Cheng YB

    2014-10-01

    Full Text Available Yibin Cheng,1 Yinlong Jin,1 Frederick W Unverzagt,2 Liqin Su,1 Lili Yang,3 Feng Ma,1 Ann M Hake,4,5 Carla Kettler,3 Chen Chen,1 Jingyi Liu,1 Jianchao Bian,6 Ping Li,7 Jill R Murrell,8 Hugh C Hendrie,2,9,10 Sujuan Gao3 1Institute for Environmental Health and Related Product Safety, Chinese Center for Disease Control and Prevention, Beijing, People’s Republic of China; 2Department of Psychiatry, 3Department of Biostatistics, 4Department of Neurology, Indiana University School of Medicine, Indianapolis, Indiana, USA; 5Eli Lilly and Company, Indianapolis, Indiana, USA; 6Shandong Institute for Prevention and Treatment of Endemic Disease in China, Jinan, People’s Republic of China; 7Sichuan Provincial Center for Disease Control and Prevention in China, Chengdu, People’s Republic of China; 8Department of Pathology and Laboratory Medicine, Indiana University School of Medicine, 9Indiana University Center for Aging Research, 10Regenstrief Institute, Inc., Indianapolis, Indiana, USA Introduction: Previous studies have identified hyperlipidemia as a potential risk factor for dementia and Alzheimer’s disease. However, studies on cholesterol measured in late-life and cognitive function have been inconsistent. Few studies have explored nonlinear relationships or considered interactions with other biomarker measures.Methods: A cross-sectional sample of 1,889 participants from four rural counties in the People’s Republic of China was included in this analysis. Serum total cholesterol, high-density lipoprotein, triglycerides, and homocysteine levels were measured in fasting blood samples. A composite cognitive score was derived based on nine standardized cognitive test scores. Analysis of covariance models were used to investigate the association between biomarker measures and the composite cognitive scores.Results: There was a significant interaction between the homocysteine quartile group and the cholesterol quartile group on cognitive scores (P=0

  16. SUBJECT INDEX

    Indian Academy of Sciences (India)

    R.Narasimhan(krishtel emaging)1461 1996 Oct 15 13:05:22

    bian Pacific Ocean and its relationship with the wind field using .... Electron spin resonance dating of fault gouge from ... impact. Assimilation of IRS-P4 (MSMR) meteorological data in the NCMRWF global data ... mobile auroral current systems.

  17. 75 FR 18076 - Changes in Flood Elevation Determinations

    Science.gov (United States)

    2010-04-09

    ...; Chairman, Coconino (08-09-1418P). Arizona Daily Sun. County Board of Supervisors, 219 East Cherry Avenue... February 13, 2009; The Honorable Paul Biane, June 19, 2009 060270 No: B-1044). of San Bernardino February...

  18. Investigation of silk fibroin nanoparticle-decorated poly(L-lactic acid composite scaffolds for osteoblast growth and differentiation

    Directory of Open Access Journals (Sweden)

    Chen BQ

    2017-03-01

    Full Text Available Biao-Qi Chen,1 Ranjith Kumar Kankala,1,2 Ai-Zheng Chen,1,2 Ding-Zhu Yang,1 Xiao-Xia Cheng,1 Ni-Na Jiang,1,2 Kai Zhu,3,4 Shi-Bin Wang1,2 1Institute of Biomaterials and Tissue Engineering, 2Fujian Provincial Key Laboratory of Biochemical Technology, Huaqiao University, Xiamen, Fujian, 3Department of Cardiac Surgery, Zhongshan Hospital, Fudan University, 4Shanghai Institute of Cardiovascular Disease, Shanghai, People’s Republic of China Abstract: Attempts to reflect the physiology of organs is quite an intricacy during the tissue engineering process. An ideal scaffold and its surface topography can address and manipulate the cell behavior during the regeneration of targeted tissue, affecting the cell growth and differentiation significantly. Herein, silk fibroin (SF nanoparticles were incorporated into poly(L-lactic acid (PLLA to prepare composite scaffolds via phase-inversion technique using supercritical carbon dioxide (SC-CO2. The SF nanoparticle core increased the surface roughness and hydrophilicity of the PLLA scaffolds, leading to a high affinity for albumin attachment. The in vitro cytotoxicity test of SF/PLLA scaffolds in L929 mouse fibroblast cells indicated good biocompatibility. Then, the in vitro interplay between mouse preosteoblast cell (MC3T3-E1 and various topological structures and biochemical cues were evaluated. The cell adhesion, proliferation, osteogenic differentiation and their relationship with the structures as well as SF content were explored. The SF/PLLA weight ratio (2:8 significantly affected the MC3T3-E1 cells by improving the expression of key players in the regulation of bone formation, ie, alkaline phosphatase (ALP, osteocalcin (OC and collagen 1 (COL-1. These results suggest not only the importance of surface topography and biochemical cues but also the potential of applying SF/PLLA composite scaffolds as biomaterials in bone tissue engineering. Keywords: super critical fluids, surface topography, bone

  19. A survey of the spider family Nesticidae (Arachnida, Araneae in Asia and Madagascar, with the description of forty-three new species

    Directory of Open Access Journals (Sweden)

    Yucheng Lin

    2016-10-01

    Full Text Available Forty-three new species of Nesticidae are described from China, Indonesia, Philippines, Singapore, Thailand, Vietnam and Madagascar, and two new junior synonyms are suggested. A new genus, Speleoticus gen. n., is described with Nesticus navicellatus Liu & Li, 2013 as the type species, and four species are transferfed from Nesticus, i.e., Speleoticus globosus (Liu & Li, 2013, comb. n., S. libo (Chen & Zhu, 2005, comb. n., S. navicellatus (Liu & Li, 2015, comb. n. and S. uenoi (Yaginuma, 1972, comb. n. The new species described in this paper belong to four genera and are: Hamus cornutus sp. n. (♂♀, H. kangdingensis sp. n. (♂, H. luzon sp. n. (♀, H. mangunensis sp. n. (♂, Nescina kohi sp. n. (♂♀, Nesticella baiseensis sp. n. (♂♀, N. baobab sp. n. (♂, N. caeca sp. n. (♂♀, N. chongqing sp. n. (♀, N. dazhuangensis sp. n. (♂♀, N. fuliangensis sp. n. (♂♀, N. gazuida sp. n. (♀, N. gongshanensis sp. n. (♀, N. griswoldi sp. n. (♂♀, N. hongheensis sp. n. (♂♀, N. huomachongensis sp. n. (♂♀, N. jingpo sp. n. (♀, N. kaohsiungensis sp. n. (♂♀, N. lisu sp. n. (♂♀, N. liuzhaiensis sp. n. (♀, N. nandanensis sp. n. (♂♀, N. phami sp. n. (♂♀, N. potala sp. n. (♀, N. qiaoqiensis sp. n. (♀, N. qiongensis sp. n. (♂♀, N. robusta sp. n. (♂♀, N. rongtangensis sp. n. (♂, N. sanchaheensis sp. n. (♂♀, N. sulawesi sp. n. (♀, N. sumatrana sp. n. (♂, N. tibetana sp. n. (♂♀, N. vanlang sp. n. (♀, N. wanzaiensis sp. n. (♂♀, N. xiongmao sp. n. (♂♀, N. xixia sp. n. (♂♀, N. yanbeiensis sp. n. (♂♀, N. yao sp. n. (♀, N. zhiyuani sp. n. (♂♀, Pseudonesticus dafangensis sp. n. (♂♀, P. miao sp. n. (♂♀, P. spinosus sp. n. (♂♀, P. wumengensis sp. n. (♀, P. ziyunensis sp. n. (♂♀. Nesticella inthanoni (Lehtinen & Saaristo, 1980, syn. n. is synonymised with N. mollicula (Thorell, 1898; N. taiwan Tso & Yoshida, 2000, syn. n. is synonymised with N. odonta (Chen

  20. Multifunctional nanocomposite based on halloysite nanotubes for efficient luminescent bioimaging and magnetic resonance imaging

    Directory of Open Access Journals (Sweden)

    Zhou T

    2016-09-01

    Full Text Available Tao Zhou,1 Lei Jia,1 Yi-Feng Luo,2 Jun Xu,1 Ru-Hua Chen,2 Zhi-Jun Ge,2 Tie-Liang Ma,2 Hong Chen,2 Tao-Feng Zhu2 1Department of Physics and Chemistry, Henan Polytechnic University, Jiaozuo, Henan, 2The Affiliated Yixing Hospital of Jiangsu University, Yixing, Jiangsu, People’s Republic of China Abstract: A novel multifunctional halloysite nanotube (HNT-based Fe3O4@HNT-polyethyleneimine-Tip-Eu(dibenzoylmethane3 nanocomposite (Fe-HNT-Eu NC with both photoluminescent and magnetic properties was fabricated by a simple one-step hydrothermal process combined with the coupling grafting method, which exhibited high suspension stability and excellent photophysical behavior. The as-prepared multifunctional Fe-HNT-Eu NC was characterized using various techniques. The results of cell viability assay, cell morphological observation, and in vivo toxicity assay indicated that the NC exhibited excellent biocompatibility over the studied concentration range, suggesting that the obtained Fe-HNT-Eu NC was a suitable material for bioimaging and biological applications in human hepatic adenocarcinoma cells. Furthermore, the biocompatible Fe-HNT-Eu NC displayed superparamagnetic behavior with high saturation magnetization and also functioned as a magnetic resonance imaging (MRI contrast agent in vitro and in vivo. The results of the MRI tests indicated that the Fe-HNT-Eu NC can significantly decrease the T2 signal intensity values of the normal liver tissue and thus make the boundary between the normal liver and transplanted cancer more distinct, thus effectively improving the diagnosis effect of cancers. Keywords: halloysite nanotube, lanthanide complex, iron oxide, luminescence, contrast agent

  1. COPD and its association with smoking in the Mainland China: a cross-sectional analysis of 0.5 million men and women from ten diverse areas

    Directory of Open Access Journals (Sweden)

    Kurmi OP

    2015-03-01

    Full Text Available Om P Kurmi,1 Liming Li,2,3 Jenny Wang,1 Iona Y Millwood,1 Junshi Chen,4 Rory Collins,1 Yu Guo,2 Zheng Bian,2 Jiangtao Li,5 Biyun Chen,6 Kaixu Xie,7 Weifan Jia,8 Yali Gao,9 Richard Peto,1 Zhengming Chen1 On behalf of the China Kadoorie Biobank Collaborative Group 1Nuffield Department of Population Health, Clinical Trial Service Unit and Epidemiological Studies Unit (CTSU, University of Oxford, Oxford, UK; 2Department of Epidemiology and Biostatistics, School of Public Health, Peking University, 3Chinese Academy of Medical Sciences, Dong Cheng District, 4China National Center for Food Safety Risk Assessment, Beijing, 5NCDs Prevention and Control Department, Huixian CDC, Huixian, Henan, 6NCDs Prevention and Control Department, Hunan CDC, Changsha, 7NCDs Prevention and Control Department, Tongxiang CDC, Zhejiang, 8NCDs Prevention and Control Department, Liuyang CDC, Baiyikengdao, Liuyang, Changsha, Hunan, 9NCDs Prevention and Control Department, Sichuan CDC, Sichuan, Mainland China Purpose: In adult Chinese men, smoking prevalence is high, but little is known about its association with chronic respiratory disease, which is still poorly diagnosed and managed. Methods: A nationwide study recruited 0.5 million men and women aged 30–79 years during 2004–2008 from ten geographically diverse areas across the Mainland China. Information was collected from each participant regarding smoking and self-reported physician diagnosis of chronic bronchitis/emphysema (CB/E, along with measurement of lung function indices. Logistic regression was used to yield sex-specific odds ratios (ORs relating smoking to airflow obstruction (AFO, defined as forced expiratory volume in 1 second (FEV1/forced vital capacity (FVC <0.7 and CB/E, adjusting for age, areas, education, and income. Results: Overall 74% of men were ever regular smokers; among them, 7.2% had AFO compared with 5.4% in never-smokers, yielding an OR of 1.42 (95% confidence interval [CI]: 1.34–1

  2. Validity of COPD diagnoses reported through nationwide health insurance systems in the People’s Republic of China

    Directory of Open Access Journals (Sweden)

    Kurmi OP

    2016-03-01

    Full Text Available Om P Kurmi,1 Julien Vaucher,1 Dan Xiao,2 Michael V Holmes,1 Yu Guo,3 Kourtney J Davis,4 Chen Wang,5 Haiyan Qin,6 Iain Turnbull,1 Peng Peng,7 Zheng Bian,3 Robert Clarke,1 Liming Li,8 Yiping Chen,1 Zhengming Chen1 On behalf of the China Kadoorie Biobank collaborative group 1Clinical Trial Service Unit & Epidemiological Studies Unit (CTSU, Nuffield Department of Population Health, University of Oxford, Oxford, UK; 2Tobacco Medicine and Tobacco Cessation Center, China–Japan Friendship Hospital, Beijing, People’s Republic of China; 3National Coordinating Centre for China Kadoorie Biobank Study, Chinese Academy of Medical Sciences, Beijing, People’s Republic of China; 4Worldwide Epidemiology, GlaxoSmithKline R&D, Collegeville, PA, USA; 5National Clinical Research Center for Respiratory Diseases, China-Japan Friendship Hospital, Beijing, People’s Republic of China; 6Medical Research Center, Beijing Chao-Yang Hospital, Capital Medical University, Beijing, People’s Republic of China; 7Radiology Department, Beijing Chao-Yang Hospital, Capital Medical University, Beijing, People’s Republic of China; 8Department of Epidemiology, School of Public Health, Peking University Health Science Center, Beijing, People’s Republic of China Background: COPD is the fourth leading cause of death worldwide, with particularly high rates in the People’s Republic of China, even among never smokers. Large population-based cohort studies should allow for reliable assessment of the determinants of diseases, which is dependent on the quality of disease diagnoses. We assessed the validity of COPD diagnoses collected through electronic health records in the People’s Republic of China. Methods: The CKB study recruited 0.5 million adults aged 30–79 years from ten diverse regions in the People’s Republic of China during the period 2004–2008. During 7 years of follow-up, 11,800 COPD cases were identified by linkage with mortality registries and the national

  3. Understanding the internal structures of X(4140), X(4274), X(4500) and X(4700)

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Hua-Xing; Cui, Er-Liang [Beihang University, School of Physics and Beijing Key Laboratory of Advanced Nuclear Materials and Physics, Beijing (China); Chen, Wei [University of Saskatchewan, Department of Physics and Engineering Physics, Saskatoon, Saskatchewan (Canada); Liu, Xiang [Lanzhou University, School of Physical Science and Technology, Lanzhou (China); Lanzhou University and Institute of Modern Physics of CAS, Research Center for Hadron and CSR Physics, Lanzhou (China); Zhu, Shi-Lin [Peking University, School of Physics and State Key Laboratory of Nuclear Physics and Technology, Beijing (China); Collaborative Innovation Center of Quantum Matter, Beijing (China); Peking University, Center of High Energy Physics, Beijing (China)

    2017-03-15

    We investigate the newly observed X(4500) and X(4700) based on the diquark-antidiquark configuration within the framework of QCD sum rules. Both of them may be interpreted as the D-wave cs anti c anti s tetraquark states of J{sup P} = 0{sup +}, but with opposite color structures, which is remarkably similar to the result obtained in Chen and Zhu (Phys Rev D 83:034010, 2011) that X(4140) and X(4274) can be both interpreted as the S-wave cs anti c anti s tetraquark states of J{sup P} = 1{sup +}, also with opposite color structures. However, the extracted masses and these suggested assignments to these X states do depend on these running quark masses where m{sub s}(2 GeV) = 95 ± 5 MeV and m{sub c}(m{sub c}) = 1.23 ± 0.09 GeV. As a byproduct, the masses of the hidden-bottom partner states of X(4500) and X(4700) are extracted to be both around 10.64 GeV, which can be searched for in the Υφ invariant mass distribution. (orig.)

  4. Indirubin inhibits cell proliferation, migration, invasion and angiogenesis in tumor-derived endothelial cells

    Directory of Open Access Journals (Sweden)

    Li Z

    2018-05-01

    Full Text Available Zhuohong Li, Chaofu Zhu, Baiping An, Yu Chen, Xiuyun He, Lin Qian, Lan Lan, Shijie Li Department of Oncology, The Affiliated Hospital of Chengdu University of Traditional Chinese Medicine, Chengdu, Sichuan, China Purpose: Hepatocellular carcinoma is one of the most predominant malignancies with high fatality rate and its incidence is rising at an alarming rate because of its resistance to radio- and chemotherapy. Indirubin is the major active anti-tumor ingredient of a traditional Chinese herbal medicine. The present study aimed to analyze the effects of indirubin on cell proliferation, migration, invasion, and angiogenesis of tumor-derived endothelial cells (Td-EC. Methods: Td-EC were derived from human umbilical vein endothelial cells (HUVEC by treating HUVEC with the conditioned medium of human liver cancer cell line HepG2. Cell proliferation, migration, invasion, and angiogenesis were assessed by MTT, wound healing, in vitro cell invasion, and in vitro tube formation assay. Results: Td-EC were successfully obtained from HUVEC cultured with 50% culture supernatant from serum-starved HepG2 cells. Indirubin significantly inhibited Td-EC proliferation in a dose- and time-dependent manner. Indirubin also inhibited Td-EC migration, invasion, and angiogenesis. However, indirubin’s effects were weaker on HUVEC than Td-EC. Conclusion: Indirubin significantly inhibited Td-EC proliferation, migration, invasion, and angiogenesis. Keywords: indirubin, Td-EC, proliferation, migration, invasion, angiogenesis

  5. Monitoring cancer stem cells: insights into clinical oncology

    Directory of Open Access Journals (Sweden)

    Lin SC

    2016-02-01

    Full Text Available ShuChen Lin,1,* YingChun Xu,2,* ZhiHua Gan,1 Kun Han,1 HaiYan Hu,3 Yang Yao,3 MingZhu Huang,4 DaLiu Min1 1Department of Oncology, Shanghai Sixth People’s Hospital East Campus, Shanghai Jiao Tong University, 2Department of Oncology, Renji Hospital, Shanghai Jiao Tong University, 3Department of Oncology, The Sixth People’s Hospital, Shanghai Jiao Tong University, 4Department of Medical Oncology, Cancer Hospital of Fudan University, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Cancer stem cells (CSCs are a small, characteristically distinctive subset of tumor cells responsible for tumor initiation and progression. Several treatment modalities, such as surgery, glycolytic inhibition, driving CSC proliferation, immunotherapy, and hypofractionated radiotherapy, may have the potential to eradicate CSCs. We propose that monitoring CSCs is important in clinical oncology as CSC populations may reflect true treatment response and assist with managing treatment strategies, such as defining optimal chemotherapy cycles, permitting pretreatment cancer surveillance, conducting a comprehensive treatment plan, modifying radiation treatment, and deploying rechallenge chemotherapy. Then, we describe methods for monitoring CSCs. Keywords: cancer stem cells, glycolytic inhibition, watchful waiting, rechallenge, immunotherapy

  6. Advances in Global Adjoint Tomography -- Massive Data Assimilation

    Science.gov (United States)

    Ruan, Y.; Lei, W.; Bozdag, E.; Lefebvre, M. P.; Smith, J. A.; Krischer, L.; Tromp, J.

    2015-12-01

    Azimuthal anisotropy and anelasticity are key to understanding a myriad of processes in Earth's interior. Resolving these properties requires accurate simulations of seismic wave propagation in complex 3-D Earth models and an iterative inversion strategy. In the wake of successes in regional studies(e.g., Chen et al., 2007; Tape et al., 2009, 2010; Fichtner et al., 2009, 2010; Chen et al.,2010; Zhu et al., 2012, 2013; Chen et al., 2015), we are employing adjoint tomography based on a spectral-element method (Komatitsch & Tromp 1999, 2002) on a global scale using the supercomputer ''Titan'' at Oak Ridge National Laboratory. After 15 iterations, we have obtained a high-resolution transversely isotropic Earth model (M15) using traveltime data from 253 earthquakes. To obtain higher resolution images of the emerging new features and to prepare the inversion for azimuthal anisotropy and anelasticity, we expanded the original dataset with approximately 4,220 additional global earthquakes (Mw5.5-7.0) --occurring between 1995 and 2014-- and downloaded 300-minute-long time series for all available data archived at the IRIS Data Management Center, ORFEUS, and F-net. Ocean Bottom Seismograph data from the last decade are also included to maximize data coverage. In order to handle the huge dataset and solve the I/O bottleneck in global adjoint tomography, we implemented a python-based parallel data processing workflow based on the newly developed Adaptable Seismic Data Format (ASDF). With the help of the data selection tool MUSTANG developed by IRIS, we cleaned our dataset and assembled event-based ASDF files for parallel processing. We have started Centroid Moment Tensors (CMT) inversions for all 4,220 earthquakes with the latest model M15, and selected high-quality data for measurement. We will statistically investigate each channel using synthetic seismograms calculated in M15 for updated CMTs and identify problematic channels. In addition to data screening, we also modified

  7. Bestimmung des Bodenreibungsbeiwertes und der Oberflächenreibung eisbedeckter Wasserflächen im Meiningenstrom der Darß-Zingster Boddenkette und Anwendung auf vertikal integrierte hydronumerische Modelle

    OpenAIRE

    Schönfeldt, Hans-Jürgen; Raabe, Armin; Baudler, Henning

    2016-01-01

    In einem hydronumerischen Modell zur Prognose des Strömungs- und Wasserstandsfeldes flacher Gewässer wird eine auf der Turbulenztheorie basierende Tiefenkorrektur für den Bodenreibungsbeiwertwert eingeführt und auf der Basis von Berechnungen für die DarßZingster Boddenkette überprüft. Für einen ausgewählten Meßpunkt der Darß-Zingster Boddenkette wurde der Reibungsbeiwert sowohl am Boden als auch unter einer Eisschicht experimentell bestimmt. Die Auswirkungen einer Tiefenkorrektur des Reibungs...

  8. Das Usutu-Virus als Ursache von Massensterben bei Amseln Turdus merula und anderen Vogelarten in Europa: Erfahrungen aus fünf Ausbrüchen zwischen 2001 und 2011

    OpenAIRE

    Bosch, Stefan; Schmidt-Chanasit, Jonas; Fiedler, Wolfgang

    2012-01-01

    Das Usutu-Virus (USUV) ist ein durch Stechmücken der Gattung Culex übertragenes Flavivirus. Es wurde wahrscheinlich durch Zugvögel oder Stechmücken nach Europa eingeschleppt und hat sich inzwischen dauerhaft in der einheimischen Stechmücken-und Vogelfauna etabliert. Seit seinem Erstnachweis 2001 in Österreich hat das USUV fünf größere Ausbrüche mit USUV-assoziierten Vogelsterben, vor allem unter Amseln und in Volieren gehaltenen Eulen, sowie vermutlich kleinere Ausbrüche ohne augenfälliges Vo...

  9. Monitoring Protein Conformation Changes as an Activating Step for Protein Interactions with Cross-linking/MS Analysis. / Chen, Zhuo; Rasmussen, Morten; Tahir, Salman; Clark, C.A.C; Barlow, Paul; Rappsilber, Juri

    DEFF Research Database (Denmark)

    Rasmussen, Morten

    of C3 to its active form C3b. C3 (187kDa) is a twelve domain protein (ANA, CUB, TED and MG1 to MG9). During the conversion of C3 to C3b, one domain, ANA (99 residues), is proteolytically removed and a number of domains change their position. This exposes protein-binding sites for downstream...... interactions in the complement response.   Methods 250 pmol of C3 and C3b were both cross-linked with a 1000X excess of cross-linkers. BS2G, BS3, and sulfo-EGS were applied respectively. The cross-linking products were separated with 1D-PAGE gel. Monomer bands were sliced and digested with trypsin. Cross......-terminus. The TED domain relocates as is revealed by three cross-links to the ANA domain in C3 and four cross-links to the MG1 domain in C3b, a domain that is remote in C3. In C3b case, a cross-link within the CUB domain suggests a folded structure of this domain, a matter of dispute in the competing crystal...

  10. A cognitive network for oracle bone characters related to animals

    Science.gov (United States)

    Dress, Andreas; Grünewald, Stefan; Zeng, Zhenbing

    2016-01-01

    In this paper, we present an analysis of oracle bone characters for animals from a “cognitive” point of view. After some general remarks on oracle-bone characters presented in Sec. 1 and a short outline of the paper in Sec. 2, we collect various oracle-bone characters for animals from published resources in Sec. 3. In the next section, we begin analyzing a group of 60 ancient animal characters from www.zdic.net, a highly acclaimed internet dictionary of Chinese characters that is strictly based on historical sources, and introduce five categories of specific features regarding their (graphical) structure that will be used in Sec. 5 to associate corresponding feature vectors to these characters. In Sec. 6, these feature vectors will be used to investigate their dissimilarity in terms of a family of parameterized distance measures. And in the last section, we apply the SplitsTree method as encoded in the NeighborNet algorithms to construct a corresponding family of dissimilarity-based networks with the intention of elucidating how the ancient Chinese might have perceived the “animal world” in the late bronze age and to demonstrate that these pictographs reflect an intuitive understanding of this world and its inherent structure that predates its classification in the oldest surviving Chinese encyclopedia from approximately the third century BC, the Er Ya, as well as similar classification systems in the West by one to two millennia. We also present an English dictionary of 70 oracle bone characters for animals in Appendix A. In Appendix B, we list various variants of animal characters that were published in the Jia Gu Wen Bian (cf. 甲骨文编, A Complete Collection of Oracle Bone Characters, edited by the Institute of Archaeology of the Chinese Academy of Social Sciences, published by the Zhonghua Book Company in 1965). We recall the frequencies of the 521 most frequent oracle bone characters in Appendix C as reported in [T. Chen, Yin-Shang Jiaguwen Zixing

  11. Consumers' Use of UMLS Concepts on Social Media: Diabetes-Related Textual Data Analysis in Blog and Social Q&A Sites.

    Science.gov (United States)

    Park, Min Sook; He, Zhe; Chen, Zhiwei; Oh, Sanghee; Bian, Jiang

    2016-11-24

    media datasets shared frequent semantic types such as "Amino Acid, Peptide, or Protein," "Body Part, Organ, or Organ Component," and "Disease or Syndrome." Although the 3 social media datasets vary greatly in size, they exhibited similar conceptual coverage among UMLS source vocabularies and the identified concepts showed similar semantic type distributions. As such, concepts that are both frequently used by consumers and also found in professional vocabularies such as SNOMED CT can be suggested to OAC CHV to improve its coverage. ©Min Sook Park, Zhe He, Zhiwei Chen, Sanghee Oh, Jiang Bian. Originally published in JMIR Medical Informatics (http://medinform.jmir.org), 24.11.2016.

  12. Thermoelectric cooler concepts and the limit for maximum cooling

    International Nuclear Information System (INIS)

    Seifert, W; Hinsche, N F; Pluschke, V

    2014-01-01

    The conventional analysis of a Peltier cooler approximates the material properties as independent of temperature using a constant properties model (CPM). Alternative concepts have been published by Bian and Shakouri (2006 Appl. Phys. Lett. 89 212101), Bian (et al 2007 Phys. Rev. B 75 245208) and Snyder et al (2012 Phys. Rev. B 86 045202). While Snyder's Thomson cooler concept results from a consideration of compatibility, the method of Bian et al focuses on the redistribution of heat. Thus, both approaches are based on different principles. In this paper we compare the new concepts to CPM and we reconsider the limit for maximum cooling. The results provide a new perspective on maximum cooling. (paper)

  13. Rapid and quantitative detection of C-reactive protein using quantum dots and immunochromatographic test strips

    Directory of Open Access Journals (Sweden)

    Cheng X

    2014-12-01

    Full Text Available Xianglin Cheng,1,* Xu Pu,2,* Pen Jun,3 XiaoBo Zhu,3 Di Zhu,4 Ming Chen1 1Department of Laboratory Medicine, First Affiliated Hospital of Yangtze University, Jingzhou, 2Department of Laboratory Medicine, RenMin Hospital of Wuhan University, Wuhan, 3Key Laboratory of Analytical Chemistry for Biology and Medicine (Ministry of Education, College of Chemistry and Molecular Sciences, Wuhan University, Wuhan, Hubei, People’s Republic of China; 4Department of Medical Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA, USA *These authors contributed equally to this study and share first authorship Background: Rapid immunochromatographic tests can detect disease markers in 10–15 minutes, which facilitates clinical diagnosis and treatment programs. However, most immunochromatographic tests employ gold nanoparticles as reporters, and these have only moderate sensitivity and act as qualitative methods for analyzing high biomarker concentrations. Methods: In this study, we introduce quantum dots (QDs as fluorescent probes and immunochromatographic strips to develop quantitative fluorescence point-of-care tests (QF-POCT to analyze C-reactive protein (CRP levels. Goat anti-rabbit IgG and rabbit IgG were used as control antibodies, and mouse monoclonal CRP antibody pairs were used for disease marker detection. One monoclonal CRP antibody was conjugated with QDs and served as a signal antibody, and the other monoclonal CRP antibody was dispensed onto the nitrocellulose membrane and served as a capturing antibody. In the presence of CRP, the fluorescence intensity of the monoclonal antibody-CRP-monoclonal antibody sandwich complex captured on the nitrocellulose membrane was determined using the fluorescence strip reader. Results: QF-POCT assays could quantitatively analyze the concentration of CRP in 15 minutes had a detection limit of 0.25 mg/L, and had a wide detection linearity range (0.5–300 mg/L. The intra-assay and interassay

  14. Peer review statement

    Science.gov (United States)

    2012-11-01

    All papers published in this volume of Journal of Physics: Conference Series have been peer reviewed through processes administered by the editors of the 26th IAHR Symposium on Hydraulic Machinery and Systems proceedings. Reviews were conducted by expert referees from the International Technical Committee to the professional and scientific standards expected of a proceedings journal published by IOP Publishing. The members of the Scientific Committee who selected and reviewed the papers included in the Proceedings of the 26th IAHR Symposium on Hydraulic Machinery and Systems are: Yulin WU Tsinghua University China François AVELLAN EPFL-LMH Switzerland (principal) Xingqi LUO Xi'an University of Sci & Tech China Martin BÖHLE Kaiserslautern University Germany Gerard BOIS Arts et Métiers ParisTech France Luca D'AGOSTINO University of Pisa Italy Eduard EGUSQUIZA Polytechnical University Catalonia Spain Richard FISHER Voith Hydro Inc USA Regiane FORTES-PATELLA Institute Polytechnique de Grenoble France Aleksandar GAJIC University of Belgrade Serbia Wei YANG China Agriculture University China YinLu YOUNG University of Michigan USA Adrian LUNGU Dunarea de Jos University of Galati Romania Arpad FAY University of Miskolcz Hungary José GONZÁLEZ Universidad de Oviedo Spain Baoshan ZHU Tsinghua University China Hongxun CHEN Shanghai University China Chisachi KATO University of Tokyo Japan Zhenyue MA Dalian University of Sci & Tech China Honggang FAN Tsinghua University China François GUIBAULT Ecole Polytechnique de Montreal Canada Pengcheng GUO Xian University of Technology China Leqing WANG Zhejiang University China Toshiaki IKOHAGI Tohoku University Japan Jiandong YANG Wuhan University China Jianzhong ZHOU Huazhong University of Sci & Tech China Jinwei LI NULL China Rennian LI Lanzhou University of Sci & Tech China Houlin LIU NULL China Juan LIU Tsinghua University China Shuhong LIU Tsinghua University China Xianwu LUO Tsinghua University China Michihiro NISHI Tsinghua

  15. Commentary on "Optimal schedule of bacillus Calmette-Guérin for non-muscle-invasive bladder cancer: A meta-analysis of comparative studies." Zhu S, Tang Y, Li K, Shang Z, Jiang N, Nian X, Sun L, Niu Y, Department of Urology Tianjin Institute of Urology, 2nd Hospital of Tianjin Medical University, People's Republic of China.: BMC Cancer 2013; 13:332. doi:10.1186/1471-2407-13-332.

    Science.gov (United States)

    See, William A

    2014-11-01

    To explore the necessity of maintenance, efficacy of low-dose and superiority of various combination therapies of Bacillus Calmette-Guérin (BCG) in treatment of superficial bladder cancer (BCa). Comprehensive searches of electronic databases (PubMed, Embase, and the Cochrane Library), were performed, then a systematic review and cumulative meta-analysis of 21 randomized, controlled trials (RCTs) and 9 retrospective comparative studies were carried out according to, predefined inclusion criteria. Significantly better recurrence-free survivals (RFS) were observed respectively in patients who received BCG maintenance, standard-dose and BCG plus epirubicin therapy comparing to those received induction, low-dose and BCG alone. BCG maintenance therapy was also associated with significantly better progression-free survival (PFS), but there were more incidences of adverse events. Pooled results showed no remarkable advantage of BCG combined with Mitomycin C or with interferon α-2b in improving oncologic outcomes. Sensitivity-analyses stratified by study-design and tumor stage led to very similar overall results and often to a decrease of the between-study heterogeneity. Our data confirmed that non-RCT only affected strength rather than direction of the overall results. All patients with superficial BCa should be encouraged to accept BCG maintenance therapy with standard-dose if well tolerated. Patients can benefit from BCG combined with epirubicin but not from BCG combined with Mitomycin C or interferon α-2b. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. JPRS Report, China

    National Research Council Canada - National Science Library

    1993-01-01

    ...; AGRICULTURE - Further Reform of Grain Circulation, Prices Advocated, Chen Yaobang on Market Challenges Facing Agriculture, Chen Yaobang on Restructuring of Crop Planting, MILITARY, PUBLIC SECURITY...

  17. The 2nd International Conference on Agricultural and Biological Sciences (ABS 2016

    Directory of Open Access Journals (Sweden)

    Lei Pei

    2016-10-01

    Salvia of Labiatae in China Xiaojuan Li, Ning Xu, Guofu Zhou, Ming Wan, Qi Lin, Fanyun Meng, Jianxiu Li 15 Three pulling resistance models of pioneer plant in landslide area Yichang Chen, Koayung Yu, Chunpin Chang 16 The comparison of physiological and biochemical mechanisms of Reaumuria soongorica and Salsola passerine in different growth pattern Zijuan Zhou, Peixi Su, Rui Shi, Tingting Xie 17 Resources use efficiency of the cosmopolitan plant Potentilla anserina L. in different alpine habitats in China Rui Shi, Peixi Su, Zijuan Zhou 18 Cloning of PPDK gene from Red Amaranand transformation of Alfalfa Xuelan Liu, Yan Zhang, Xiangfa Wei 19 Variation and cluster analysis of morphological characters and nutrient content of Chucrasia tabularis seed Chong Wu, Yanlei Yin, Lijuan Feng, Xuemei Yang, Fei Wang 20 Effect of the planting density of the areca nut on the growth of intercropped Vanilla Hua Wang, Huifa Zhuang, Zihui Zhu, Hui Wang

  18. 6th conference on Advances in Optoelectronics and Micro/nano-optics

    International Nuclear Information System (INIS)

    2017-01-01

    would like to thank all participants of this conference, and particularly the authors of all accepted papers for their high quality and fruitful contributions. We do hope that this volume will be beneficial for readers to their future research endeavours and careers. We also gratefully acknowledge tremendous efforts and dedication of many individuals and all the Editorial Board members in IOP Publishing for their support in producing the proceedings of this event. Sincerely, Yiping Cui Conference Co-Chair CONFERENCE OFFICIALS Conference Co-Chairs Yiping Cui Southeast University, China Xiaocong Yuan Shenzhen University, China Shining Zhu Nanjing University, China Executive Chair Zhuyuan Wang Southeast University, China Technical Program Committee Guanghui Chen China Electronics Technology Group Corporation, China Yiping Cui Southeast University, China Qihuang Gong Peking University, China Min Gu Swinburne University of Technology, Australia Satoshi Kawata Osaka University, Japan Gong-Ru Lin National Taiwan University, Taiwan, China Xu Liu Zhejiang University, China Yanqing Lu Nanjing University, China Ting Mei Northwestern Polytechnical University, China Min Qiu Zhejiang University, China Marek Samoc Wroclaw University of Technology, Poland Colin Sheppard Italian Institute of Technology, Italy Charles Surya Hong Kong Polytechnic University, China Katarina Svanberg Lund University, Sweden Sune Svanberg Lund University, Sweden Jinghua Teng IMRE, Singapore Dinping Tsai Academia Sinica, Taiwan, China Zhuyuan Wang Southeast University, China Jingjun Xu Nankai University, China Baoli Yao Xi’an Institute of Optics and Precision Mechanics, China Xiaocong Yuan Shenzhen University, China Qiwen Zhan University of Dayton, USA Shining Zhu Nanjing University, China (paper)

  19. The outcomes of intra-aortic balloon pump usage in patients with acute myocardial infarction: a comprehensive meta-analysis of 33 clinical trials and 18,889 patients

    Directory of Open Access Journals (Sweden)

    Fan ZG

    2016-03-01

    Full Text Available Zhong-Guo Fan,1,* Xiao-Fei Gao,1,2,* Li-Wen Chen,1 Xiao-Bo Li,1,2 Ming-Xue Shao,1,2 Qian Ji,1 Hao Zhu,1 Yi-Zhi Ren,1 Shao-Liang Chen,1,2 Nai-Liang Tian1,2 1Department of Cardiology, Nanjing First Hospital, Nanjing Medical University, 2Department of Cardiology, Nanjing Heart Center, Nanjing, People’s Republic of China *These authors contributed equally to this work Background: The effects of intra-aortic balloon pump (IABP usage in patients with acute myocardial infarction remain controversial. This study sought to evaluate the outcomes of IABP usage in these patients.Methods: Medline, EMBASE, and other internet sources were searched for relevant clinical trials. The primary efficacy endpoints (in-hospital, midterm, and long-term mortality and secondary endpoints (reinfarction, recurrent ischemia, and new heart failure in the hospital as well as safety endpoints (severe bleeding requiring blood transfusion and stroke in-hospital were subsequently analyzed.Results: Thirty-three clinical trials involving 18,889 patients were identified. The risk of long-term mortality in patients suffering from acute myocardial infarction was significantly decreased following IABP use (odds ratio [OR] 0.66, 95% confidence interval [CI]: 0.48–0.91, P=0.010. Both in-hospital and midterm mortality did not differ significantly between the IABP use group and no IABP use group (in-hospital: OR 0.87, 95% CI: 0.59–1.28, P=0.479; midterm: OR 1.12, 95% CI: 0.53–2.38, P=0.768. IABP insertion was not associated with the risk reduction of reinfarction, recurrent ischemia, or new heart failure. However, IABP use increased the risk of severe bleeding requiring blood transfusion (OR 2.05, 95% CI: 1.29–3.25, P=0.002 and stroke (OR 1.71, 95% CI: 1.04–2.82, P=0.035. In the thrombolytic therapy and cardiogenic shock subgroups, reduced mortality rates following IABP use were observed.Conclusion: IABP insertion is associated with feasible benefits with respect to long

  20. Toxicity evaluation of Gd2O3@SiO2 nanoparticles prepared by laser ablation in liquid as MRI contrast agents in vivo

    Directory of Open Access Journals (Sweden)

    Tian XM

    2014-08-01

    Full Text Available Xiumei Tian,1,* Fanwen Yang,1,* Chuan Yang,2 Ye Peng,1 Dihu Chen,3 Jixiang Zhu,1 Fupo He,1 Li Li,2 Xiaoming Chen11Department of Biomedical Engineering, Guangzhou Medical University, Guangzhou, Guangdong Province, People’s Republic of China; 2State Key Laboratory of Oncology in South China, Imaging Diagnosis and Interventional Center, Sun Yat-sen University Cancer Center, Guangzhou, Guangdong Province, People’s Republic of China; 3State Key Laboratory of Optoelectronic Materials and Technologies, School of Physics and Engineering, Sun Yat-Sen University, Guangzhou, Guangdong Province, People’s Republic of China*These authors contributed equally to this workAbstract: Poor toxicity characterization is one obstacle to the clinical deployment of Gd2O3@SiO2 core-shell nanoparticles (Gd-NPs for use as magnetic resonance (MR imaging contrast agents. To date, there is no systematic toxicity data available for Gd-NPs prepared by laser ablation in liquid. In this article, we systematically studied the Gd-NPs’ cytotoxicity, apoptosis in vitro, immunotoxicity, blood circulation half-life, biodistribution and excretion in vivo, as well as pharmacodynamics. The results show the toxicity, and in vivo MR data show that these NPs are a good contrast agent for preclinical applications. No significant differences were found in cell viability, apoptosis, and immunotoxicity between our Gd-NPs and Gd in a DTPA (diethylenetriaminepentaacetic acid chelator. Biodistribution data reveal a greater accumulation of the Gd-NPs in the liver, spleen, lung, and tumor than in the kidney, heart, and brain. Approximately 50% of the Gd is excreted via the hepatobiliary system within 4 weeks. Furthermore, dynamic contrast-enhanced T1-weighted MR images of xenografted murine tumors were obtained after intravenous administration of the Gd-NPs. Collectively, the single step preparation of Gd-NPs by laser ablation in liquid produces particles with satisfactory cytotoxicity

  1. The role of long noncoding RNA-LET in cell proliferation and invasion of nasopharyngeal carcinoma and its mechanism

    Directory of Open Access Journals (Sweden)

    Chen L

    2017-05-01

    Full Text Available Lei Chen,1,* Lingling Sun,1,* Lei Dong,2 Peng Cui,3 Ziwei Xia,4 Chao Li,1 Yu Zhu5 1Department of Otolaryngology, The Second Hospital of Tianjin Medical University, Tianjin, People’s Republic of China; 2Department of Pediatrics, Division of Hematology/Oncology, Aflac Cancer and Blood Disorders Center, Emory University School of Medicine, Atlanta, GA, USA; 3Department of Multidisciplinary Consultation Center of TCM and Western Medicine, The Affiliated Qingdao Hiser Hospital of Qingdao University, Qingdao, 4Department of Clinical Medicine, The Second Clinical Medical School of Tianjin Medical University, 5Department of Clinical Laboratory, Tianjin Huanhu Hospital, Tianjin Key Laboratory of Cerebral Vessels and Neural Degeneration, Tianjin, People’s Republic of China *These authors contributed equally to this work Abstract: LncRNA-LET, a recently identified long noncoding RNA, has been shown to act as a tumor suppressor; however, its biological function and mechanism have not been fully investigated. Our research found that there was less expression of LET in nasopharyngeal carcinoma (NPC tissues than normal tissues and that LET might inhibit proliferation, adhesion and invasion of NPC in vitro by enhancing its expression. By contrast, decreased LET expression could promote the proliferation, adhesion and invasion of NPC. In addition, the expression profiles of related genes and MAPK/ERK pathway were also regulated effectively via overexpression or silencing of LET. This result provides comprehensive evidence of LET’s antitumor effect on NPC in vitro, which might provide a new approach for clinical treatment. Keywords: LncRNA-LET, proliferation, invasion, nasopharyngeal carcinoma, MAPK/ERK pathway

  2. Efficacy of intravenous amphotericin B-polybutylcyanoacrylate nanoparticles against cryptococcal meningitis in mice

    Directory of Open Access Journals (Sweden)

    Chen JH

    2011-04-01

    Full Text Available Nan Xu1,2, Julin Gu3, Yuanjie Zhu3, Hai Wen3, Qiushi Ren1, Jianghan Chen31Institute for Laser Medicine and Biophotonics, School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai, People's Republic of China; 2Department of Dermatology, Shanghai East Hospital, Shanghai, People's Republic of China; 3Department of Dermatology, Shanghai Changzheng Hospital, Shanghai, People's Republic of ChinaAbstract: Amphotericin B deoxycholate (AmB, a classic antifungal drug, remains the initial treatment of choice for deep fungal infections, but it is not appropriate for treatment of cryptococcal meningitis due to its inability to pass through the blood–brain barrier (BBB. We examined the efficacy of amphotericin B-polybutylcyanoacrylate nanoparticles (AmB-PBCA-NPs modified with polysorbate 80 that had a mean particle diameter less than 100 nanometers (69.0 ± 28.6 nm. AmB-PBCA-NPs were detected in the brain 30 minutes after systemic administration into BALB/c mice and had a higher concentration than systemically administered AmB liposome (AmB-L, P < 0.05; AmB was not detected in the brain. Following infection for 24 hours and then 7 days of treatment, the survival rate of mice in the AmB-PBCA-NP group (80% was significantly higher than that of the AmB (0% or AmB-L (60% treatment groups. Fungal load was also lower when assessed by colony-forming unit counts obtained after plating infected brain tissue (P < 0.05. Our study indicates that AmB-PBCA-NPs with polysorbate 80 coating have the capacity to transport AmB across the BBB and is an efficient treatment against cryptococcal meningitis in a mouse model.Keywords: cryptococcal meningitis, polybutylcyanoacrylate (PBCA, nanoparticles, brain targeting

  3. Calligraphy and meditation for stress reduction: an experimental comparison

    Directory of Open Access Journals (Sweden)

    Kao H SR

    2014-02-01

    Full Text Available Henry SR Kao,1 Lin Zhu,2 An An Chao,3 Hao Yi Chen,4 Ivy CY Liu,5 Manlin Zhang6 1Department of Social Work and Social Administration, University of Hong Kong, Hong Kong; 2Department of Psychology, Renmin University of China, Beijing, 3International Society of Calligraphy Therapy, Hong Kong; 4Department of Business Administration, National Chengchi University, Taipei, Taiwan, 5Department of Psychology, Fu Jen Catholic University, Taipei, Taiwan; 6Department of Psychology, Sun Yat-Sen University, Guangzhou, People's Republic of China Background: Chinese calligraphic handwriting (CCH has demonstrated a new role in health and therapy. Meanwhile, meditation is an traditional and effective method for coping with stress and staying healthy. This study compared the effectiveness of CCH and meditation as distinctive and parallel stress reduction interventions. Methods: Thirty graduate students and academic staff members in Taiwan who suffered from stress were selected by the General Health Questionnaire and randomly assigned to one of three treatment groups, ie, a CCH group, a meditation group, or a control group, for 8 consecutive weeks. Changes in physiological parameters were measured before, during, and after treatment. Results: CCH and meditation showed their strength in the respective indices of stress. There was a significant difference in respiratory rate, heart rate, and electromyographic scores between the groups. Comparing pre- and post-effects, a decrease in heart rate and an increase in skin temperature was seen in subjects who practiced CCH. Increased skin temperature and decreased respiratory rate were also seen in subjects who practiced meditation, along with reduced muscle tension and heart rate. Conclusion: CCH and meditation have good effects in stress reduction. CCH is a particularly promising new approach to reducing stress.Keywords: calligraphic handwriting, meditation, stress reduction, intervention

  4. Preoperative prognostic nutritional index and nomogram predicting recurrence-free survival in patients with primary non-muscle-invasive bladder cancer without carcinoma in situ

    Directory of Open Access Journals (Sweden)

    Cui J

    2017-11-01

    Full Text Available Jianfeng Cui,1,* Shouzhen Chen,1,* Qiyu Bo,2 Shiyu Wang,1 Ning Zhang,1 Meng Yu,1 Wenfu Wang,1 Jie Han,3 Yaofeng Zhu,1 Benkang Shi1 1Department of Urology, 2Department of First Operating Room, Qilu Hospital of Shandong University, 3Department of Radiation Oncology, Shandong Cancer Hospital and Institute Affiliated to Shandong University, Jinan, People’s Republic of China *These authors contributed equally to this work Background and objectives: Among the cancers of the urogenital system, bladder cancer is ranked second both in incidence and mortality, and hence, a more accurate estimate of the prognosis for individual patients with non-muscle-invasive bladder cancer (NMIBC is urgently needed. Prognostic nutritional index (PNI which is based on serum albumin levels and peripheral lymphocyte count has been confirmed to have prognostic value in various cancers. The aim of this study was to clarify the prognostic value of PNI in patients with NMIBC.Methods: Data of 329 patients with NMIBC were evaluated retrospectively. Recurrence-free survival (RFS was assessed using the Kaplan–Meier method, and the equivalences of survival curves were tested by log-rank tests. The univariate and multivariate analyses were performed using the Cox proportional hazards regression model. Discrimination of the nomogram was measured by the concordance index. A p-value of <0.05 was considered statistically significant.Results: In univariate analysis, age, tumor focality, tumor size, tumor grade, pathological T stage and preoperative PNI were significantly associated with RFS. Multivariate analysis identified PNI as an independent predictor of RFS in patients with NMIBC. According to these independent predictors, a nomogram for the prediction of recurrence was developed.Conclusion: PNI can be regarded as an independent prognostic factor for predicting RFS in NMIBC. The nomogram could be useful to improve personalized therapy for patients with NMIBC. Keywords: non

  5. Assessing the nutritional status of elderly Chinese lung cancer patients using the Mini-Nutritional Assessment (MNA® tool

    Directory of Open Access Journals (Sweden)

    Zhang L

    2013-03-01

    Full Text Available Lei Zhang,1,* Yanjun Su,1,* Chen Wang,2 Yongsheng Sha,1 Hong Zhu,3 Shumin Xie,4 Sabrina Kwauk,5 Jing Zhang,2 Yunshou Lin,2 Changli Wang1,*1Department of Thoracic Surgery, Key Laboratory of Cancer Prevention and Therapy, Tianjin Lung Cancer Center, Tianjin Medical University Cancer Institute and Hospital, Tianjin, 2Tianjin Medical University, Tianjin, 3Department of Public Health, Tianjin Medical University, Tianjin, 4Xiangya Medical School of Central-South University, Changsha, People's Republic of China; 5School of Public Health, Harvard University, Boston, Cambridge, MA, USA*These authors contributed equally to this workPurpose: This study assessed the nutritional status of elderly Chinese lung cancer inpatients using a revised version of the Mini-Nutritional Assessment (MNA® tool.Patients and methods: The revised version of the MNA tool was used to assess the nutritional status of 180 elderly Chinese lung cancer inpatients prior to their scheduled surgery between June 2010 and July 2011. Patients' demographic data, anthropometric parameters, and biochemical markers were collected and analyzed.Results: Among the 180 inpatients who underwent the MNA, 9% were malnourished (MNA score < 19, 33% were at risk of malnutrition (MNA score 19–23, and 58% were well nourished (MNA score ≥ 24. There was significant correlation between the MNA scores of patients who were malnourished, at risk of malnutrition, and well nourished (P < 0.001, as well as between total MNA score and most MNA questions. The three patient groups with different nutritional statuses differed significantly in their responses to anthropometrics and global, diet, and subjective assessments.Conclusion: Incidence rates of malnutrition prior to surgery are high among elderly Chinese lung cancer inpatients. The revised MNA is a valid and reliable tool that can be used to assess and prevent malnutrition among these inpatients.Keywords: malnutrition, MNA-SF, nutrition, inpatients, diet

  6. Research on simulation and experiment of noninvasive intracranial pressure monitoring based on acoustoelasticity effects

    Directory of Open Access Journals (Sweden)

    Wu J

    2013-08-01

    Full Text Available Jun Wu1, Wei He2, Wei-min Chen1, Lian Zhu21Key Laboratory of Optoelectronic Technology and Systems, 2State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing, People’s Republic of ChinaAbstract: The real-time monitoring of intracranial pressure (ICP is very important for craniocerebrally critically ill patients, but it is very difficult to realize long-time monitoring for the traditional invasive method, which very easily infects patients. Many noninvasive methods have emerged, but these have not been able to monitor ICP for long periods in real time, and they are not ready for clinical application. In order to realize long-time, online, real-time, noninvasive monitoring for ICP, a new method based on acoustoelasticity of ultrasound is herein proposed. Experimental models were devised to research the new method for experiment and simulation. Polymethyl methacrylate and hydrogel were adopted for the experiment, and their mechanical properties were very close to the real brain. A numerical solution for acoustoelasticity theory was acquired by simulating calculation based on a finite-element method. This was compared to the experimental value. The results showed a consistent match between theoretical solution and experimental value, with maximum error at most 5%. Thus, the effectiveness of the new method was verified. Theoretical and practical foundation is provided for this new method, and it could be used for animal experimentation or clinical testing in further research.Keywords: medical instruments, noninvasive, intracranial pressure, ultrasonic, acoustoelasticity, biomechanics

  7. Functionalized D-form self-assembling peptide hydrogels for bone regeneration

    Directory of Open Access Journals (Sweden)

    He B

    2016-04-01

    Full Text Available Bin He,1 Yunsheng Ou,1 Ao Zhou,1 Shuo Chen,1 Weikang Zhao,1 Jinqiu Zhao,2 Hong Li,3 Yong Zhu,1 Zenghui Zhao,1 Dianming Jiang1 1Department of Orthopedics, 2Department of Infectious Diseases, The First Affiliated Hospital of Chongqing Medical University, Chongqing, People’s Republic of China; 3School of Physical Science and Technology, Sichuan University, Chengdu, People’s Republic of China Abstract: Bone defects are very common in orthopedics, and there is great need to develop suitable bone grafts for transplantation in vivo. However, current bone grafts still encounter some limitations, including limited availability, immune rejection, poor osteoinduction and osteoconduction, poor biocompatibility and degradation properties, etc. Self-assembling peptide nanofiber scaffolds have emerged as an important substrate for cell culture and bone regeneration. We report on the structural features (eg, Congo red staining, circular dichroism spectroscopy, transmission electron microscopy, and rheometry assays and osteogenic ability of D-RADA16-RGD peptide hydrogels (with or without basic fibroblast growth factor due to the better stability of peptide bonds formed by these peptides compared with those formed by L-form peptides, and use them to fill the femoral condyle defect of Sprague Dawley rat model. The bone morphology change, two-dimensional reconstructions using microcomputed tomography, quantification of the microcomputed tomography analyses as well as histological analyses have demonstrated that RGD-modified D-form peptide scaffolds are able to enhance extensive bone regeneration. Keywords: bone defect, functionalized D-form self-assembling peptide, D-RADA16-RGD, peptide hydrogel, bone regeneration

  8. Studies of N ~ 40 Ni isotopes via neutron-knockout (nKO) and deep-inelastic (DI) reactions

    Science.gov (United States)

    Chiara, C. J.; Recchia, F.; Gade, A.; Janssens, R. V. F.; Walters, W. B.

    2013-10-01

    V. BADER, T. BAUGHER, D. BAZIN, J.S. BERRYMAN, B.A. BROWN, C. LANGER, N. LARSON, S.N. LIDDICK, E. LUNDERBERG, S. NOJI, C. PROKOP, S.R. STROBERG, S. SUCHYTA, D. WEISSHAAR, S. WILLIAMS, NSCL/MSU, M. ALBERS, M. ALCORTA, P.F. BERTONE, M.P. CARPENTER, J. CHEN, C.R. HOFFMAN, F.G. KONDEV, T. LAURITSEN, A.M. ROGERS, D. SEWERYNIAK, S. ZHU, ANL, C.M. CAMPBELL, LBNL, H.M. DAVID, D.T. DOHERTY, U. of Edinburgh/ANL, A. KORICHI, CSNSM-IN2P3/ANL, C.J. LISTER, U. of Mass.-Lowell, K. WIMMER, Central Mich. U. -- Excited states in 68Ni were populated in 2nKO reactions at NSCL. Prompt γ rays were detected with the GRETINA array located in front of the S800 separator. A hodoscope at the S800 focal plane captured the 68Ni ions, where isomeric decays could be correlated with prompt γ rays. Decay of the first excited state, a 0+ isomer, was observed, confirming that its energy substantially differs from the literature value. Comparing the decay patterns of excited states with shell-model calculations provides insight into their underlying structure. Data from 70Zn + 208Pb DI reactions studied with Gammasphere provide results consistent with the 2nKO. Single-particle strengths are also under investigation in the odd- A Ni isotopes via 1nKO reactions. Supported in part by the DoE (DE-FG02-94ER40834, DE-AC02-06CH11357), NSF (PHY-1102511), and NNSA (DE-NA0000979).

  9. Risk factors for calcineurin inhibitor nephrotoxicity after renal transplantation: a systematic review and meta-analysis

    Directory of Open Access Journals (Sweden)

    Xia T

    2018-02-01

    Full Text Available Tianyi Xia, Sang Zhu, Yan Wen, Shouhong Gao, Mingming Li, Xia Tao, Feng Zhang, Wansheng Chen Department of Pharmacy, Changzheng Hospital, Second Military Medical University, Shanghai, People’s Republic of China Background: Nephrotoxicity of calcineurin inhibitors (CNIs is the major concern for long-term allograft survival despite its predominant role in current immunosuppressive regime after renal transplantation. CNI nephrotoxicity is multifactorial with demographic, environmental, and pharmacogenetic flexibility, whereas studies indicating risk factors for CNI nephrotoxicity obtained incomplete or conflicting results.Methods: A systematic review and meta-analysis of risk factors for CNI nephrotoxicity was performed on all retrieved studies through a comprehensive research of network database. Data were analyzed by Review Manager 5.2 with heterogeneity assessed using the Cochrane Q and I2 tests. CNI nephrotoxicity was primarily indicated with protocol biopsy or index-based clinical diagnosis, and the secondary outcome was defined as delayed graft function.Results: Twelve observational studies containing a total of 2,849 cases were identified. Donor age (odds ratio [OR], 1.01; 95% CI, 1.01–1.03; p=0.02, recipient zero-time arteriosclerosis (OR, 1.44; 95% CI, 1.04–1.99; p=0.03, and CYP3A5*3/*3 genotype (OR, 2.80; 95% CI, 2.63–2.98; p=0.00 were confirmed as risk factors for CNI nephrotoxicity. Subgroup and sensitivity analysis claimed donor age as a significant contributor in Asian and Caucasian areas.Conclusion: Older donor age, recipient zero-time arteriosclerosis, and CYP3A5*3/*3 genotype might add up the risk for CNI nephrotoxicity, which could be interpreted into a robust biomarker system. Keywords: calcineurin inhibitor, transplantation, nephrotoxicity, risk factor, systematic review, meta-analysis

  10. Hydrogen sulfide, a potential novel drug, attenuates concanavalin A-induced hepatitis

    Directory of Open Access Journals (Sweden)

    Cheng P

    2014-09-01

    Full Text Available Ping Cheng,* Kan Chen,* Yujing Xia, Weiqi Dai, Fan Wang, Miao Shen, Chengfen Wang, Jing Yang, Rong Zhu, Huawei Zhang, Jingjing Li, Yuanyuan Zheng, Junshan Wang, Yan Zhang, Jie Lu, Yingqun Zhou, Chuanyong GuoDepartment of Gastroenterology, Shanghai Tenth People's Hospital, Tongji University of Medicine, Shanghai, People's Republic of China *These authors contributed equally to this work Background: Hydrogen sulfide (H2S is known to exert anti-inflammatory properties. Apoptosis and autophagy play important roles in concanavalin A (Con A-induced acute hepatitis. The purpose of this study was to explore both the effect and mechanism of H2S on Con A-induced acute hepatitis. Methods: BALB/c mice were randomized into sham group, Con A-injection group, and 14 µmol/kg of sodium hydrosulfide (NaHS, an H2S donor pretreatment group. Results: Aspartate aminotransferase, alanine aminotransferase, and pathological damage were significantly ameliorated by NaHS pretreatment. NaHS pretreatment significantly reduced the levels of interleukin-6 and tumor necrosis factor-α compared with those of the Con A group. The expression of Bcl-2, Bax, Beclin-1, and LC3-2, which play important roles in the apoptosis and autophagy pathways, were also clearly affected by NaHS. Furthermore, NaHS affected the p-mTOR and p-AKT. Conclusion: H2S attenuates Con A-induced acute hepatitis by inhibiting apoptosis and autophagy, in part, through activation of the PtdIns3K-AKT1 signaling pathway. Keywords: NaHS, apoptosis, PtdIns3K-AKT, autophagy

  11. Protective effect of galangin in Concanavalin A- induced hepatitis in mice

    Directory of Open Access Journals (Sweden)

    Luo Q

    2015-06-01

    Full Text Available Qingqiong Luo,1,* Liping Zhu,1,* Jieying Ding,1 Xing Zhuang,1 Lili Xu,2 Fuxiang Chen1 1Department of Clinical Immunology, Shanghai Ninth People’s Hospital, Shanghai JiaoTong University School of Medicine, 2Division of Gastroenterology, Zhongshan Hospital, Fudan University, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Galangin is an active pharmacological ingredient from propolis and Alpinia officinarum Hance, and has been reported to have anti-inflammatory and antioxidative properties. The present study aims to reveal the effect of galangin on Concanavalin A (ConA-induced hepatitis (CIH, a well-established animal model of immune-mediated liver injury, and to clarify the related mechanism. C57BL/6 mice were pretreated with galangin followed by ConA challenge. Results indicated that galangin inhibited ConA-induced liver damage. Mice pretreated with galangin showed more reduction of liver damage when compared with control mice pretreated with vehicle solution. In galangin-pretreated mice with induced CIH, increases in serum levels of several inflammatory cytokines, including tumor necrosis factor-α, interferon-γ, and interleukin-12 were dramatically attenuated, and chemokines and adhesion molecules like interferon inducible protein-10, macrophage inflammatory protein-1α, and intercellular adhesion molecule-1 messenger RNA expressions in liver were decreased. Moreover, CIH mice pretreated with galangin showed less leukocyte infiltration and T-cell activation in the liver. Further, the mechanism of the anti-inflammatory effects of galangin may be attributed to its modulation of crucial inflammatory signaling pathways, including nuclear factor kappa B and interferon-gamma/signal transducer and activator of transcription 1. Collectively, these findings suggest the preventive and therapeutic potential of galangin in immune-mediated liver injury in vivo. Keywords: galangin, Concanavalin A

  12. Elliptic Curve Integral Points on y2 = x3 + 3x ‑ 14

    Science.gov (United States)

    Zhao, Jianhong

    2018-03-01

    The positive integer points and integral points of elliptic curves are very important in the theory of number and arithmetic algebra, it has a wide range of applications in cryptography and other fields. There are some results of positive integer points of elliptic curve y 2 = x 3 + ax + b, a, b ∈ Z In 1987, D. Zagier submit the question of the integer points on y 2 = x 3 ‑ 27x + 62, it count a great deal to the study of the arithmetic properties of elliptic curves. In 2009, Zhu H L and Chen J H solved the problem of the integer points on y 2 = x 3 ‑ 27x + 62 by using algebraic number theory and P-adic analysis method. In 2010, By using the elementary method, Wu H M obtain all the integral points of elliptic curves y 2 = x 3 ‑ 27x ‑ 62. In 2015, Li Y Z and Cui B J solved the problem of the integer points on y 2 = x 3 ‑ 21x ‑ 90 By using the elementary method. In 2016, Guo J solved the problem of the integer points on y 2 = x 3 + 27x + 62 by using the elementary method. In 2017, Guo J proved that y 2 = x 3 ‑ 21x + 90 has no integer points by using the elementary method. Up to now, there is no relevant conclusions on the integral points of elliptic curves y 2 = x 3 + 3x ‑ 14, which is the subject of this paper. By using congruence and Legendre Symbol, it can be proved that elliptic curve y 2 = x 3 + 3x ‑ 14 has only one integer point: (x, y) = (2, 0).

  13. Cardioprotection against ischemia/reperfusion injury by QiShenYiQi Pill® via ameliorate of multiple mitochondrial dysfunctions

    Directory of Open Access Journals (Sweden)

    Chen JR

    2015-06-01

    Full Text Available Jing Rui Chen,1–3 Jing Wei,1–3 Ling Yan Wang,1–3 Yan Zhu,1–3 Lan Li,1–3 Mary Akinyi Olunga,1–3 Xiu Mei Gao,1–3 Guan Wei Fan1–31Tianjin State Key Laboratory of Modern Chinese Medicine, Tianjin, People’s Republic of China; 2Key Laboratory of Pharmacology of Traditional Chinese Medicine Formulae, Ministry of Education, 3Institute of Traditional Chinese Medicine, Tianjin University of Traditional Chinese Medicine, Tianjin, People’s Republic of ChinaAim: To investigate the potential cardioprotective effects of QiShenYiQi Pill® (QSYQ on myocardial ischemia/reperfusion (I/R injury through antioxidative stress and mitochondrial protection.Methods and results: Sprague Dawley rats were pretreated with QSYQ or saline for 7 days and subjected to ischemia (30 minutes occlusion of the left anterior descending coronary artery and reperfusion (120 minutes. Cardiac functions were evaluated by echocardiogram and hemodynamics. Myocardial mitochondria were obtained to evaluate changes in mitochondrial structure and function, immediately after 120 minutes reperfusion. Pretreatment with QSYQ protected against I/R-induced myocardial structural injury and improved cardiac hemodynamics, as demonstrated by normalized serum creatine kinase and suppressed oxidative stress. Moreover, the impaired myocardial mitochondrial structure and function decreased level of ATP (accompanied by reduction of ATP5D and increase in the expression of cytochrome C. Myocardial fiber rupture, interstitial edema, and infiltrated leukocytes were all significantly ameliorated by pretreatment with QSYQ.Conclusion: Pretreatment of QSYQ in Sprague Dawley rats improves ventricular function and energy metabolism and reduces oxidative stress via ameliorating multiple mitochondrial dysfunctions during I/R injury.Keywords: QSYQ, ischemia/reperfusion injury, energy metabolism, mitochondria

  14. Paclitaxel-loaded poly(glycolide-co-ε-caprolactone-b-D-α-tocopheryl polyethylene glycol 2000 succinate nanoparticles for lung cancer therapy

    Directory of Open Access Journals (Sweden)

    Zhao TJ

    2013-05-01

    Full Text Available Tiejun Zhao,1 Hezhong Chen,1 Yuchao Dong,2 Jiajun Zhang,1 Haidong Huang,2 Ji Zhu,1 Wei Zhang21Institute of Cardiothoracic Surgery, 2Respiratory Department, Changhai Hospital, Shanghai, People's Republic of ChinaAbstract: In order to improve the therapeutic efficacy and minimize the side effects of lung cancer chemotherapy, the formulation of paclitaxel-loaded poly(glycolide-co-ε-caprolactone-b-D-α-tocopheryl polyethylene glycol 2000 succinate nanoparticles (PTX-loaded [PGA-co-PCL]-b-TPGS2k NPs was prepared. The novel amphiphilic copolymer (PGA-co-PCL-b-TPGS2k was synthesized by ring-opening polymerization and characterized by proton nuclear magnetic resonance spectroscopy and gel permeation chromatography. The PTX-loaded (PGA-co-PCL-b -TPGS2k NPs were characterized in terms of size, size distribution, zeta potential, drug encapsulation, surface morphology, and drug release. In vitro cellular uptakes of NPs were investigated with confocal laser scanning microscopy, indicating the coumarin 6-loaded (PGA-co-PCL-b -TPGS2k NPs could be internalized by human lung cancer A-549 cells. The antitumor effect of PTX-loaded NPs was evaluated, both in vitro and in vivo, on an A-549 cell tumor-bearing mouse model via intratumoral injection. The commercial PTX formulation Taxol was chosen as the reference. Experimental results showed that the PTX-loaded NPs possessed higher cytotoxicity and could effectively inhibit the growth of tumor. All the results suggested that amphiphilic copolymer (PGA-co-PCL-b -TPGS2k could act as a potential biological material for nanoformulation in the treatment of lung cancer.Keywords: (PGA-co-PCL-b TPGS2k, paclitaxel, nanoparticles, drug delivery, lung cancer

  15. Clinical significance of CMTM4 expression in hepatocellular carcinoma

    Directory of Open Access Journals (Sweden)

    Bei CH

    2017-11-01

    Full Text Available Chunhua Bei,1,* Ying Zhang,1,* Riming Wei,1 Xiaonian Zhu,1 Zhigang Wang,1 Wen Zeng,2 Qiuyue Chen,3 Shengkui Tan1 1Department of Epidemiology and Statistics, School of Public Health, Guilin Medical University, 2Department of Hepatobiliary Surgery, The Affiliated Hospital of Guilin Medical University, 3Department of Pathology, 181st Hospital of Chinese People’s Liberation Army, Guilin, People’s Republic of China *These authors contributed equally to this work Abstract: CMTM4 is the most conserved member of chemokine-like factor (CKLF-like MARVEL transmembrane domain-containing (CMTM family on chromosome 16q22.1, a locus that harbors a number of tumor-suppressor genes. In previous studies, CMTM4 was reported to be downregulated and exhibited tumor-suppressor activities by regulating cell growth and cell cycle in clear cell renal cell carcinoma. However, its roles in tumorigenesis of hepatocellular carcinoma (HCC remain poorly studied. This study first investigated the expression of CMTM4 in HCC, and then examined the association between the expression of CMTM4 with the clinicopathological features and prognosis of HCC patients. It was found that CMTM4 was downregulated in HCC tissues, compared with matched adjacent nontumor tissues, as detected by immunohistochemistry. In addition, Kaplan–Meier survival analysis showed that the negative expression of CMTM4 was associated with decreased overall survival rates in patients with HCC. The results of this study suggest CMTM4 plays a role as a tumor suppressor in HCC and CMTM4 negative expression is a risk factor for poor prognosis of HCC. Keywords: chemokine-like factor-like MARVEL transmembrane domain-containing 4, hepatocellular carcinoma, immunohistochemistry, prognosis

  16. Knockdown of a HIF-2α promoter upstream long noncoding RNA impairs colorectal cancer stem cell properties in vitro through HIF-2α downregulation

    Directory of Open Access Journals (Sweden)

    Yao J

    2015-11-01

    Full Text Available Jie Yao,1,* Jianxiong Li,2,* Peiliang Geng,2,* Yi Li,3,* Hong Chen,3 Yunfeng Zhu2 1Department of Oncology, People’s Liberation Army No 161 Hospital, Wuhan, 2Cancer Center, Division of Internal Medicine, Chinese PLA General Hospital, Beijing, 3Department of Oncology, Kunming General Hospital of Chendu Military Command, Kunming, People’s Republic of China *These authors contributed equally to this work Abstract: Currently, various long noncoding RNAs (lncRNAs have been identified as key regulators of multiple cancers. However, cancer stem cell (CSC-related lncRNAs have rarely been reported. In this study, we found an lncRNA that is a promoter upstream transcript of hypoxia-inducible factor-2α (HIF-2α, and we named it “lncRNA-HIF2PUT”. The function of HIF-2α is closely connected with “stem cell-like” properties, and the function of PROMPTs is often associated with the adjacent protein-coding transcripts. Herein, we showed that the expression of lncRNA-HIF2PUT was significantly correlated with HIF-2α in colorectal cancer (CRC tissues. Knockdown of lncRNA-HIF2PUT blocked the HIF-2α expression and inhibited the CSC properties in CRC cell lines DLD-1 and HT29. LncRNA-HIF2PUTsmall interfering RNA transfection resulted in decreased stemness genes expression, impaired colony formation, and spheroid formation ability, retarded migration, and invasion of the cells. These data suggest that lncRNA-HIF2PUT may be a regulator of HIF-2α and a mediator of CSCs in CRC. Keywords: HIF-2α, long noncoding RNA, colorectal cancer, stem cell properties

  17. Predictive factors and prognosis for recurrent laryngeal nerve invasion in papillary thyroid carcinoma

    Directory of Open Access Journals (Sweden)

    Chen W

    2017-09-01

    Full Text Available Wenjie Chen,1 Jianyong Lei,1 Jiaying You,2 Yali Lei,3 Zhihui Li,1 Rixiang Gong,1 Huairong Tang,3 Jingqiang Zhu1 1Thyroid and Parathyroid Surgery Center, 2West China School of Clinical Medicine, 3Health and Management Center, West China Hospital of Sichuan University, Chengdu, People’s Republic of China Background: Recurrent laryngeal nerve (RLN invasion in papillary thyroid carcinoma (PTC is one of the main predictors of poor prognosis. The present study investigated the risk factors for RLN invasion in PTC patients.Methods: A total of 3,236 patients who received thyroidectomy due to PTC in Thyroid and Parathyroid Surgery Center of West China Hospital of Sichuan University were reviewed. Demographics and clinical factors, imaging examination (ultrasonography characteristics, surgical details, postoperative pathological details, recurrence, and postoperative complications were recorded. Univariate and multivariate analyses were used to study the risk factors of RLN invasion, Kaplan–Meier method was performed to compare the outcomes of tumor recurrence.Results: Patients with RLN invasion had a higher recurrence rate than those in the control group (p<0.001. Multivariate analyses showed that age greater than 45 years (p<0.001, a largest tumor size bigger than 10 mm (p<0.001, clinical lymph node metastasis (cN1 (p<0.001, posterior focus (p<0.001, extrathyroidal extension (p<0.001, esophageal extension (p<0.001, tracheal extension (p<0.001, and preoperative vocal cord paralysis (p<0.001 were independent predictors for RLN invasion.Conclusion: PTC patients with RLN invasion have a negative prognosis and a higher recurrence rate. Meticulous operation and careful follow-up of patients with the above factors is recommended. Keywords: papillary thyroid carcinoma, recurrent laryngeal nerve invasion, predictive factors, lymph node metastases, Hashimoto’s thyroiditis

  18. Polyethylenimine-functionalized silver nanoparticle-based co-delivery of paclitaxel to induce HepG2 cell apoptosis

    Directory of Open Access Journals (Sweden)

    Li Y

    2016-12-01

    Full Text Available Yinghua Li,1,* Min Guo,1,* Zhengfang Lin,1 Mingqi Zhao,1 Misi Xiao,1 Changbing Wang,1 Tiantian Xu,1 Tianfeng Chen,2 Bing Zhu1 1Center Laboratory, Guangzhou Women and Children’s Medical Center, Guangzhou Medical University, 2Department of Chemistry, Jinan University, Guangzhou, People’s Republic of China *These authors contributed equally to this work Abstract: Hepatocarcinoma is the third leading cause of cancer-related deaths around the world. Recently, a novel emerging nanosystem as anticancer therapeutic agents with intrinsic therapeutic properties has been widely used in various medical applications. In this study, surface decoration of functionalized silver nanoparticles (AgNPs by polyethylenimine (PEI and paclitaxel (PTX was synthesized. The purpose of this study was to evaluate the effect of Ag@PEI@PTX on cytotoxic and anticancer mechanism on HepG2 cells. The transmission electron microscope image and 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide assay showed that Ag@PEI@PTX had satisfactory size distribution and high stability and selectivity between cancer and normal cells. Ag@PEI@PTX-induced HepG2 cell apoptosis was confirmed by accumulation of the sub-G1 cells population, translocation of phosphatidylserine, depletion of mitochondrial membrane potential, DNA fragmentation, caspase-3 activation, and poly(ADP-ribose polymerase cleavage. Furthermore, Ag@PEI@PTX enhanced cytotoxic effects on HepG2 cells and triggered intracellular reactive oxygen species; the signaling pathways of AKT, p53, and MAPK were activated to advance cell apoptosis. In conclusion, the results reveal that Ag@PEI@PTX may provide useful information on Ag@PEI@PTX-induced HepG2 cell apoptosis and as appropriate candidate for chemotherapy of cancer. Keywords: silver nanoparticles, polyethylenimine, paclitaxel, reactive oxygen species, apoptosis

  19. Design of Experiment Approach to Hydrogen Re-embrittlement Evaluation WP-2152

    Science.gov (United States)

    2015-04-01

    2152 by Scott M Grendahl, Hoang Nguyen, Franklin Kellogg , Shuying Zhu, and Stephen Jones Approved for public release...and Materials Research Directorate, ARL Hoang Nguyen and Franklin Kellogg Bowhead Science and Technology, LLC Shuying Zhu and Stephen Jones The...ELEMENT NUMBER 6. AUTHOR(S) Scott M Grendahl, Hoang Nguyen, Franklin Kellogg , Shuying Zhu, and Stephen Jones 5d. PROJECT NUMBER W74RDV20769717 5e

  20. A Computing Platform for Parallel Sparse Matrix Computations

    Science.gov (United States)

    2016-01-05

    REPORT NUMBER 19a. NAME OF RESPONSIBLE PERSON 19b. TELEPHONE NUMBER Ahmed Sameh Ahmed H. Sameh, Alicia Klinvex, Yao Zhu 611103 c. THIS PAGE The...PERCENT_SUPPORTEDNAME FTE Equivalent: Total Number: Discipline Yao Zhu 0.50 Alicia Klinvex 0.10 0.60 2 Names of Post Doctorates Names of Faculty Supported...PERCENT_SUPPORTEDNAME FTE Equivalent: Total Number: NAME Total Number: NAME Total Number: Yao Zhu Alicia Klinvex 2 ...... ...... Sub Contractors (DD882) Names of other

  1. upstream region of the myostatin gene in four chicken breeds and its

    African Journals Online (AJOL)

    user

    2012-05-17

    May 17, 2012 ... processing site and a carboxy-terminal region containing nine cysteines ... cultivated meat breed (minitype) and the Youxi chicken is a local breed raised for ..... Allele R was the additive gene on growth traits. Bian chickens ...

  2. Retracted: Effects of pro-inflammatory cytokines on mineralization potential of rat dental pulp stem cells

    NARCIS (Netherlands)

    Yang, X.; Walboomers, X.F.; Bian, Z.; Jansen, J.A.; Fan, M.

    2011-01-01

    The following article from the Journal of Tissue Engineering and Regenerative Medicine, 'Effects of Pro-inflammatory Cytokines on Mineralization Potential of Rat Dental Pulp Stem Cells' by Yang X, Walboomers XF, Bian Z, Jansen JA, Fan M, published online on 11 July 2011 in Wiley Online Library

  3. (dust, PM10 , and BC) using CHIMERE chemistry tra

    Indian Academy of Sciences (India)

    The objective of this study is to evaluate the ability of a European chemistry transport model,. 'CHIMERE' driven by ..... tive days in May 2008 (12–16 May) to simulate the dust storm ...... Regional Office for Europe, Copenhagen. Zender C, Bian ...

  4. Effects of Repeated Traumatic Brain Injuries in a Combat Setting

    Science.gov (United States)

    2011-12-01

    Metabolism, 30(2), 255-266. Cernak, I., Savic , J., Malicevic, Z., Zunic, G., Radosevic, P., Ivanovic, I., et al. (1996). Involvement of the central...Bian, X., & Savic , J. (2001). Ultrastructural and functional characteristics of blast injury-induced neurotrauma. The Journal of trauma, 50(4), 695-706

  5. Nomenclatural corrections to the taxonomic revision of The Old World species of Boehmeria (Urticaceae, tribus Boehmeriae) by Wilmot-Dear and Friis (2013)

    DEFF Research Database (Denmark)

    Wilmot-Dear, Christine Melanie; Friis, Ib; Govaerts, R. H. A.

    2014-01-01

    (H. Lév.) C.J. Chen in Chen et al. as the correct name for the variety named in the revision as B. zollingeriana Wedd. var. podocarpa (W.T. Wang) W.T. Wang & C.J. Chen in Chen et al., (3) that the combination B. spicata (Thunb.) Thunb., based on Urtica spicata Thunb., is not illegitimate, as stated...

  6. 專論/台灣圖書館史數位圖書館建構之研究/王梅玲;蔡明月;陳志銘;柯雲娥;蔡佳縈;陳勇汀;林怡甄 | A Digital Library Pilot Study on Taiwan Libraries' History / Mei-Ling Wang; Ming-Yueh Tsay; Chih-Ming Chen; Yun-Er Ke; Chia-Ying Tsai; Yong-Ting Chen; Yi-Jen Lin

    Directory of Open Access Journals (Sweden)

    王梅玲、蔡明月、陳志銘、柯雲娥、蔡佳縈、陳勇汀、林怡甄

    2008-04-01

    Full Text Available

    圖書館是保存與詮釋人類文化重要的機構,1990 年代開始,網際網路的進步,促成數位圖書館蓬勃發展,有人預測它就是未來的圖書館,因此,圖書館界與教育界積極參與相關研究。台灣地區歷經日據時期、重建 時期、成長時期及茁壯時期四階段,建設許多圖書館,有其豐富的主題與素材值得發展成為數位圖書館。政治大學圖書資訊與檔案學研究所有鑑於此,提出「『台灣 百無圖書館史』數位圖書館」的構想,並獲得政大「發展國際一流大學及頂尖研究中心計畫」經費支持。本研究計畫目的包括:(1探索以台彎圖書館事業史為主 題的數位圖書館建構模式;(2建構數位圖書館以支援圖書資訊學教育與研究;(3研訂圖書館事業史料文獻的Metadata與數位資料格式;(4將圖 書文獻與文物數位化以建構數位館藏;(5發展數位圖書館系統與技術;(6研發數位圖書館網站的瀏覽與檢索功能;(7探討數位圖書館支援數位學習的模 式。計畫成果共研訂六種 Metadata標準:建置746筆數位化資料;以Dspace系統平台,依據需求設計台灣百年圖書館史系統架構與網站,最後提出結論與建議。

    Libraries are important social institutions that preserve and communicate human culture and knowledge. From the beginning of 1990s, the digital library has grown up rapidly based on the progress of the Internet. Libraries and educational institutions should be actively involved in digital library research and development. The Taiwan libraries’ history can be divided into four stages: Japanese occupation period, reconstruction period, growth period and strong period. In these processes, many events and libraries with rich materials that can be developed into a digital library. Graduate Institute of Library, Information and Archival Studies, National Chengchi University, planned the Digital Library Pilot Study on Taiwan Libraries’ History and got the university support. The pilot study objectives include: (1 exploring the digital library model on Taiwan libraries' history; (2 constructing digital library to support education and research in information and library science; (3 developing Metadata standards of library documents and heritage; (4 digitalizing documents and heritage to build digital collections (5 developing digital library systems and technology; (6 researching browsing and search functions of the digital library; (7 exploring the model of the digital library supports e-learning. In this pilot study, we developed six Metadata standards, built 746 digital resources, constructed a digital library system and web site, and proposed the conclusions and suggestions finally.

    頁次:15-38

  7. China Report, Political, Sociological and Military Affairs, No. 445.

    Science.gov (United States)

    1983-08-11

    2052 0981], Chen Dingming [7115 7844 6900], Jin Xiulan [6855 4423 5695] (F, Mongolian), Zhao Nanqi [6392 0589 6386] Korean), Suo Jingxian [4792...Pen Center and the Guangzhou Pen Center will be headed by Chen Huangmei, another vice-president of the China center and a noted critic. The...1728 4426 6311], Zhang Tengxiao [1728 7506 7197], Chen Dingmou [7115 0002 5399], Chen Lunfen [7115 0243 5358] (F), Chen Xitong [7115 1585 0681

  8. Technical Digest of the 1998 Summer Topical Meeting on Organic Optics and Optoelectronics

    Science.gov (United States)

    1998-07-01

    Larry Dalton, University of Southern California, Los Angeles, CA Harold Fetterman , University of California, Los Angeles, CA Steve Forrest...OPTIC MODULATORS H. Fetterman , D. Chen, A. Udupa. D. Bhattachaya, B. Tsap University of Califonia, Los Angeles 90024 S. Lee, A. Chen, J. Chen, W...Chen, H.R. Fetterman , A. Chen, W.H. Steier, and L. R. Dalton, Appl. Phys. Lett. 70, (1997). 2. T.A. Tumolillo and P.R. Ashley, Appl. Phys. Lett. 62

  9. COUPLET CALIGRAPHY

    Institute of Scientific and Technical Information of China (English)

    谢燕辉

    2013-01-01

    CALIGRAPHER IN THE NEW AGE39-ycar-old calligrapher.artist,seal-cutter and art historian Zhu Tianshu(朱天曙)believes in both heritage and rebellion,that is,to interpret the classics from a brand new perspective.Proficient in all kinds of calligraphy styles.Zhu developed his own script:a flow of both strength and

  10. 75 FR 4573 - Government-Owned Inventions; Availability for Licensing

    Science.gov (United States)

    2010-01-28

    ... differentiation. Inventors: Jinfang Zhu and William E. Paul (NIAID). Related Publication: J Zhu, TS Davidson, G Wei, D Jankovic, K Cui, DE Schones, L Guo, K Zhao, EM Shevach, WE Paul. Down-regulation of Gfi- 1... Standley, Ph.D.; 301-435-4074; [email protected] . Dated: January 21, 2010. Richard U. Rodriguez, Director...

  11. Cardioprotective effect of Shenxiong glucose injection on acute ...

    African Journals Online (AJOL)

    Yu JH, Wang LY, Akinyi M, Li YH, Duan ZZ, Zhu Y, Fan. GW. Danshensu protects ... Yin Y, Guan Y, Duan JL, Wei G, Zhu YR, Quan W, Guo. C, Zhou D, Wang YH, ... HM, Han J, Kang D. Lamotrigine increases intracellular. Ca(2+) levels and ...

  12. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences. Hai-Liang Zhu. Articles written in Journal of Chemical Sciences. Volume 121 Issue 4 July 2009 pp 463-470. Synthesis, antimicrobial activity of lamotrigine and its ammonium derivatives · Yong Qian Peng-Cheng Lv Lei Shi Rui-Qin Fang Zhong-Cheng Song Hai-Liang Zhu.

  13. African Journal of Biotechnology - Vol 8, No 6 (2009)

    African Journals Online (AJOL)

    Single nucleotide polymorphism genotyping and its application on mapping and marker-assisted plant breeding ... HH Musa, Y Xu, B Dai, X Kang, C Zhu, G Zhu ... YJ Wang, ZQ Han, B Shui, GD Liu, TX Gao, SA Nwafili, S Watanabe, YP Zhang ...

  14. National Libraries Section. General Research Libraries Division. Papers.

    Science.gov (United States)

    International Federation of Library Associations, The Hague (Netherlands).

    Papers on national library services and activities, which were presented at the 1983 International Federation of Library Associations (IFLA) conference, include: (1) "The National Library of China in its Gradual Application of Modern Technology," a discussion by Zhu Nan and Zhu Yan (China) of microform usage and library automation; (2)…

  15. Experiment list: SRX193596 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ox-hygro-hTERT (LH), and Cdk4-neo (CN), Zhu et al. (2007) in Aging Cell, vol. 6, ...), Zhu et al. (2007) in Aging Cell, vol. 6, pp 515-523, newly promoted to tier 2:... of a 41 year old caucasian heart transplant donor, immortalized with lox-hygro-hTERT (LH), and Cdk4-neo (CN

  16. Experiment list: SRX201281 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available hygro-hTERT (LH), and Cdk4-neo (CN), Zhu et al. (2007) in Aging Cell, vol. 6, pp ...), Zhu et al. (2007) in Aging Cell, vol. 6, pp 515-523, newly promoted to tier 2:... of a 41 year old caucasian heart transplant donor, immortalized with lox-hygro-hTERT (LH), and Cdk4-neo (CN

  17. Experiment list: SRX201282 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ygro-hTERT (LH), and Cdk4-neo (CN), Zhu et al. (2007) in Aging Cell, vol. 6, pp 5...), Zhu et al. (2007) in Aging Cell, vol. 6, pp 515-523, newly promoted to tier 2:... of a 41 year old caucasian heart transplant donor, immortalized with lox-hygro-hTERT (LH), and Cdk4-neo (CN

  18. Experiment list: SRX201297 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available RT (LH), and Cdk4-neo (CN), Zhu et al. (2007) in Aging Cell, vol. 6, pp 515-523, ...), Zhu et al. (2007) in Aging Cell, vol. 6, pp 515-523, newly promoted to tier 2:... of a 41 year old caucasian heart transplant donor, immortalized with lox-hygro-hTERT (LH), and Cdk4-neo (CN

  19. Experiment list: SRX193611 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available d with lox-hygro-hTERT (LH), and Cdk4-neo (CN), Zhu et al. (2007) in Aging Cell, ...), Zhu et al. (2007) in Aging Cell, vol. 6, pp 515-523, newly promoted to tier 2:... of a 41 year old caucasian heart transplant donor, immortalized with lox-hygro-hTERT (LH), and Cdk4-neo (CN

  20. Experiment list: SRX201296 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available RT (LH), and Cdk4-neo (CN), Zhu et al. (2007) in Aging Cell, vol. 6, pp 515-523, ...), Zhu et al. (2007) in Aging Cell, vol. 6, pp 515-523, newly promoted to tier 2:... of a 41 year old caucasian heart transplant donor, immortalized with lox-hygro-hTERT (LH), and Cdk4-neo (CN

  1. Bio-functionalized dense-silica nanoparticles for MR/NIRF imaging of CD146 in gastric cancer

    Directory of Open Access Journals (Sweden)

    Wang P

    2015-01-01

    Full Text Available Pu Wang,1,* Yazhuo Qu,2,* Chuan Li,3 Li Yin,2 Caifei Shen,1 Wei Chen,3 Shiming Yang,4 Xiuwu Bian,2 Dianchun Fang11Institute of Gastroenterology, 2Institute of Pathology, 3Department of Radiology, Southwest Hospital, The Third Military Medical University, Chongqing, People’s Republic of China; 4Department of Gastroenterology, Xinqiao Hospital, The Third Military Medical University, Chongqing, People’s Republic of China*These authors contributed equally to this workPurpose: Nano dense-silica (dSiO2 has many advantages such as adjustable core–shell structure, multiple drug delivery, and controllable release behavior. Improving the gastric tumor-specific targeting efficiency based on the development of various strategies is crucial for anti-cancer drug delivery systems.Methods: Superparamagnetic iron oxide nanoparticles (SPION were coated with dSiO2 as core–shell nanoparticles, and labeled with near infra-red fluorescence (NIRF dye 800ZW (excitation wavelength: 778 nm/­emission wavelength: 806 nm and anti-CD146 monoclonal antibody YY146 for magnetic resonance (MR/NIRF imaging study in xenograft gastric cancer model. The morphology and the size of pre- and postlabeling SPION@dSiO2 core–shell nanoparticles were characterized using transmission electron microscopy. Iron content in SPION@dSiO2 nanoparticles was measured by inductively coupled plasma optical emission spectrometry. Fluorescence microscopy and fluorescence-activated cell sorter studies were carried out to confirm the binding specificity of YY146 and 800ZW–SPION@dSiO2–YY146 on MKN45 cells. In vivo and in vitro NIRF imaging, control (nanoparticles only and blocking studies, and histology were executed on MKN45 tumor-bearing nude mice to estimate the affinity of 800ZW–SPION@dSiO2–YY146 to target tumor CD146.Results: 800ZW–SPION@dSiO2–YY146 nanoparticles were uniformly spherical in shape and dispersed evenly in a cell culture medium. The diameter of the nanoparticle

  2. Committees

    Science.gov (United States)

    2012-11-01

    -RESIGA Politehnica University of Timisoara Romania Kazuhiro TANAKA Kyushu Institute of Technology Japan Yoshinobu TSUJIMOTO Osaka University Japan Local Organizing Committee Chairman Yulin WU Tsinghua University Beijing Executive Chairman Zhengwei WANG Tsinghua University Beijing Members Shuliang CAO Tsinghua University Beijing Cichang CHEN South West University of Petroleum Chengdu Hongxun CHEN Shanghai University Shanghai Jiang DAI China Sanxia General Co Yichang Huashu DOU National University of Singapore Singapore Fengqin HAN Huanan University of Sci & Tech Guangzhou Kun LI Hefei Inst of General Machinery Hefei Rennian LI Lanzhou University of Sci & Tech Lanzhou Wanhong LI National Natural Science Foundation of China Beijing Chao LIU Yangzhou University Yangzhou Li LU China Inst of Water Resources and Hydropower Research Beijing Xingqi LUO Xi'an University of Tech Xi'an Zhenyue MA Dalian University of Sci & Tech Dalian Jiegang MU Zhejiang University of Tech Hangzhou Daqing QIN Harbin Electric Machinery Group Harbin Fujun WANG China Agriculture University Beijing Guoyu WANG Beijing Institute of Technology (BIT) Beijing Leqin WANG Zhejiang University Hangzhou Yuzhen WU NERCSPV Beijing Hongyuan XU Tsinghua University Beijing Jiandong YANG Wuhan University Wuhan Minguan YANG Jiangsu University Zhenjiang Shouqi YUAN Jiangsu University Zhenjiang Lefu ZHANG Harbin Electric Machinery Group Harbin Lixiang ZHANG Yunnan University of Sci & Tech Kunming Shengchang ZHANG Zhejiang University of Tech Hangzhou Kun ZHAO China Water & Electric Consulting Corp Beijing Yuan ZHENG Hehai University Nanjing Jianzhong ZHOU Huazhong University of Sci & Tech Wuhan Lingjiu ZHOU China Agriculture University Beijing Hongwu ZHU China Petroleum University Beijing Zuchao ZHU Zhejiang Sci-Tech University Hangzhou Secretaries Shuhong LIU (Academic), liushuhong@tsinghua.edu.cn Xianwu LUO (Registration), luoxw@tsinghua.edu.cn Baoshan ZHU (Finance), bszhu@mail.tsinghua.edu.cn

  3. Use of epoxidized natural rubber as a compatibilizer in silica-filled natural rubber tire tread compounds ; Verwendung von epoxydiertem Naturkautschuk als Verträglichkeitsvermittler in Zusammensetzungen aus kieselsäuregefülltem Naturkautschuk für Reifenlaufflächen

    NARCIS (Netherlands)

    Sengloyluan, K.; Sahakaro, Kannika; Noordermeer, Jacobus W.M.

    2012-01-01

    Silica-reinforced natural rubber (NR) tire tread compounds with epoxidized natural rubber (ENR) as a compatibilizer are investigated. ENR contents of 2.5-15.0 phr, with epoxide levels of 10, 38 and 51 mol%, are used. The addition of ENRs, especially ENR-38 and ENR-51, as compatibilizers decreases

  4. 热河生物群凌源东方叶肢介的软体构造及其分类意义%SOFT BODY PRESERVATION IN THE CONCHOSTRACAN EOSESTHERIA LINGYUANENSIS CHEN FROM THE JEHOL BIOTA AND ITS TAXONOMIC SIGNIFICANCE

    Institute of Scientific and Technical Information of China (English)

    沈炎彬

    2011-01-01

    东方叶肢介(Eosestheria)是著名热河生物群中最为常见的一类甲壳动物,关于它的形态、壳瓣结构及微细纹饰特征的研究已相当详尽,但一直没有关于其软体构造的报道。本文描述的凌源东方叶肢介(Eosestheria lingyuanensis)采自辽宁北票市尖山沟村,产于下白垩统义县组的尖山沟夹层。这些软体构造包括:头部形态、眼、闭壳肌痕、雄性执握肢、体节、消化道及尾节等。通过与现生叶肢介软体形态构造比较,显示其与刺尾亚目的蚌壳虫科的代表最为亲近。从而为探讨化石与现生叶肢介之间的演化关系及建立高一级的统一分类,提供了有价值的依据。%The clam shrimp Eosestheria is an extraordinarily abundant and important member of the con-chostracan fauna from the famous Jehol Biota. Here the occurrence of partial soft body preservation in E. Lingyuanensis is reported for the first time, occurring as impressions, inside the valve, of the head, eye, adductor muscle scar, male claspers, digestive tube, and telson.The exceptionally preserved specimens were found in the Lower Cretaceous Yixian Formation at Jianshangou village, near Beipiao, in Liaoning Province of NE China. The preservation of soft parts in conchostracans is significant partly because its occurrence is very rare-known previously only from about 16 species . Worldwide and several of which are actually much less complete than the present material. Soft body characteristics are also important for accurate taxonomic determination and assessment of relationships. For example, all conchostracan males have the first pair of trunk limbs modified to form so called 'claspers', which hold to the female during mating. Some modification of the second pair of trunk limbs is seen in lae-vicaudatan conchostracans, two species of which are also known as fossils with soft body parts, butthe second pair appears not to be clasper-like in form. Eosestheria lingyuanensis on the other hand has two pairs of clearly defined claspers as in spini-caudatan conchostracans. Furthermore in its more distinct growth lines and acute rostrum as well as its two pairs of claspers it clearly belongs to the suborder Spinicaudata. Within that group, although it is similar to the Cyzicidae in its rostrum lacking an apical spine and in its short stout telson, it differs in its less developed occipital notch and larger palp with a row of pores.Although the name Conchostraca is commonly used in fossil and extant literature, recent molecular and morphological analyses show that the 'Conchostraca' appears not to be a monophyletic group. As such it has no taxonomic meaning. It has therefore been abandoned as a taxonomic unit by many authors. However, Shen et al. (2006) retain use of the 'Conchostraca', which include five suborders. Laevicaudata, Spinicaudata, Cycles-therida, Leaiina and Estheriellina. The two latter are distinct extinct groups and their soft bodies were found recently in several specimens. Leaiina with 1-5 radial carina on the carapace valve ranges from the Devonian to Permian and Estheriellina with 3-16 radial costae on the carapace valve appears in the Triassic to Cretaceous interval.

  5. Comments on X. Yin, A. Wen, Y. Chen, and T. Wang, `Studies in an optical millimeter-wave generation scheme via two parallel dual-parallel Mach-Zehnder modulators', Journal of Modern Optics, 58(8), 2011, pp. 665-673

    Science.gov (United States)

    Hasan, Mehedi; Maldonado-Basilio, Ramón; Hall, Trevor J.

    2015-04-01

    Yin et al. have described an innovative filter-less optical millimeter-wave generation scheme for octotupling of a 10 GHz RF oscillator, or sedecimtupling of a 5 GHz RF oscillator using two parallel dual-parallel Mach-Zehnder modulators (DP-MZMs). The great merit of their design is the suppression of all harmonics except those of order ? (octotupling) or all harmonics except those of order ? (sedecimtupling), where ? is an integer. A demerit of their scheme is the requirement to set a precise RF signal modulation index in order to suppress the zeroth order optical carrier. The purpose of this comment is to show that, in the case of the octotupling function, all harmonics may be suppressed except those of order ?, where ? is an odd integer, by the simple addition of an optical ? phase shift between the two DP-MZMs and an adjustment of the RF drive phases. Since the carrier is suppressed in the modified architecture, the octotupling circuit is thereby released of the strict requirement to set the drive level to a precise value without any significant increase in circuit complexity.

  6. 專論/以關鍵詞網絡探討動態性知識管理議題/陳良駒;張正宏 | Exploring Dynamic Knowledge Management Research Issues: A Keyword Network Analysis / Liang-Chu Chen; Jeng-Horng Chang

    Directory of Open Access Journals (Sweden)

    陳良駒、張正宏

    2007-10-01

    Full Text Available

    知識管理是企業邁向知識經濟時代的實務顯學,也是學術界近年來持續探討的重要研究議題。然而知識管理的面向是一種多維度的呈現,如何快速而正確的瞭 解知識管理議題的發展,是許多組織知識工作者及學術研究學者努力的目標。許多學者提出知識管理內容的架構及分類,但卻都是屬於一種由上而下的靜態設計。社 會網絡分析是呈現及量測網絡實體成員互動的技術,適合建構關係網絡的動態性。本文嘗試以關鍵詞網絡來分析國內資訊相關系所從事知識管理研究的主題及脈絡, 並透過關鍵詞的連結來建構一套動態性的知識管理研究範疇。研究成果除驗證知識管理學域中的研究重點,更透過網絡關係來連結多樣性的研究構想,進而提供產官 學界更宏觀且動態的知識管理研究建議。

    Knowledge management (KM is an important practice in a corporation and an essential issue that academic scholars intend to explore continuously in the era of knowledge economy. However, KM presents a variety of perspectives that are still undefined for many knowledge workers and academic researchers. Many scholars propose a few categories and frameworks about KM, but a static outcome. Social network analysis (SNA is a method to present and measure the interaction among network entities and it is suitable to construct the dynamic relationship networks. The purpose of this study is to acquire the research issues and contexts of KM within information-related graduate schools based on a keyword network analysis. Moreover, we build a dynamic KM research network through these linkages with keywords. The results of this study confirm the essential research perspectives in a KM domain and suggest a variety of KM research ideas which provide the industries, governments, and academic communities with a macro and dynamic KM research viewpoint.

    頁次:81-94

  7. Response to the comment by C. Kisielowski, H.A. Calderon, F.R. Chen, S. Helveg, J.R. Jinschek, P. Specht, D. Van Dyck on the article "On the influence of the electron dose-rate on the HRTEM image contrast" by J. Barthel, M. Lentzen, A. Thust, Ultramicroscopy 176 (2017) 37-45.

    Science.gov (United States)

    Barthel, Juri; Lentzen, Markus; Thust, Andreas

    2017-08-01

    In a recent article [1] we examined the influence of the applied electron dose rate on the magnitude of the image contrast in high-resolution transmission electron microscopy (HRTEM). We concluded that the magnitude of the image contrast is not substantially affected by the applied electron dose rate. This result is in obvious contradiction to numerous earlier publications by Kisielowski and coworkers [2-7], who commented our recent article due to this contradiction. The present short communication is a response to the comment of Kisielowski and coworkers on our recent article, where we provide additional arguments supporting our initial findings and conclusions on the magnitude of the image contrast in HRTEM. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. 實徵研究/國小教師以CREATER模式推動資訊素養創新課程之歷程/謝佩紋;林菁|The Process of Elementary School Teachers Implementing an Innovation Curriculum of Information Literacy with CREATER Model/Pei-Wen Hsieh; Lin Ching Chen

    Directory of Open Access Journals (Sweden)

    謝佩紋、林菁 Pei-Wen Hsieh; Lin Ching Chen

    2009-04-01

    Full Text Available 本研究旨在探究國小教師推動資訊素養創新課程的歷程,並以CREATER革新模式的七個階段為架構,深入瞭解教師作為創新推動者在每個階段的經歷及結果,以提供有意推動資訊素養理念或其它創新的教育工作者參考。本研究採個案研究,以南部一所國小為研究個案,研究時間歷時一年半,透過觀察、訪談、文件分析等方法進行資料的蒐集。研究結果發現,國小教師推動資訊素養課程的歷程大致與CREATER模式的七個階段相符,但「關心」、「連結」與「檢視」階段並無明顯次序,教師以組織內成員的角色推動創新,能有效地將創新理念化為行動,但行動能否持續及發揮效果,還有賴團隊組成的完整性、教師的持續更新力及組織內掌握實權者的支持與參與。The purpose of this study was to explore the change process of implementing an information literacy curriculum by elementary school teachers. Based on the CREATER model, this study investigated the teachers’ experiences as change agents in each stage of the process. The research results could provide guidelines for educators who are devoted to promote the information literacy or other innovations. The method of case study was used to design this study. The subjects of this study were the teachers who voluntarily implemented the information literacy curriculum in an elementary school in the southern part of Taiwan. The methods for collecting research data were observations, interviews, and document analyses. The research results showed that the change process of implementing the information literacy curriculum corresponded to the seven stages of the CREATER model. However, the stages of “care,” “relate,” and “examine,” did not obviously happen in sequence. As members of the organization, the teachers could transform effectively the innovative concept into an action, but whether the innovation could be persistent depended on team relationships, teachers’ self-renewal capacity, and approvals and participation of the leaders who really managed the organization.頁次:70-89

  9. Fortschritt als Fraktur im frühen Science Fiction Film. Metaphorologische Überlegungen zu Auf- und Einbrüchen in LE VOYAGE DANS LA LUNE und LE VOYAGE À TRAVERS L`IMPOSSIBLE von G. Méliès

    Directory of Open Access Journals (Sweden)

    Hartmann, Jörg

    2009-09-01

    Full Text Available Fantasies of man travelling into space form a main part of the popular movie genre ‘Science Fiction’. These celluloid visions are not only fantasies of improving transport, they also convey a meaning in a figurative sense. They can be seen as a modern adoption of one of humanities oldest metaphors, ‘life as a sea fare voyage’: the meaning, which was once expressed by this ‘nautical metaphor’, has been transferred and can nowadays be found in films, which show astro-nauts crossing the frontier from known space into the unknown space. In order to conclude on their attitude towards technological progress in the early 20th century, the two oldest space travel movies, Le Voyage dans la Lune (F 1902 and Le Voyage a Travers L’Impossible (F 1904 will be analyzed.

  10. Web Usability Policies/Standards/Guidelines Do Not Influence Practices at ARL Academic Libraries. A Review of: Chen, Yu‐Hui, Carol Anne Germain and Huahai Yang. “An Exploration into the Practices of Library Web Usability in ARL Academic Libraries.” Journal of the American Society for Information Science and Technology 60.5 (2009: 953‐68.

    Directory of Open Access Journals (Sweden)

    Shandra Protzko

    2009-12-01

    Full Text Available Objective – To survey the current status of Web usability Policies/Standards/Guidelines (PSGs found in academic libraries of the Association of Research Libraries (ARL. Researchers sought to investigate whether PSGs are in place, the levels of difficulty surrounding implementation, the impact of PSGs on design, testing, and resource allocation, and the relationship between ARL ranking and usability practice or PSGs.Design – Survey.Setting – North America.Subjects – Academic libraries of the ARL.Methods – An 18‐question survey consisting of multiple choice, Likert scale, and open‐ended questions was sent to all 113 ARL libraries in November 2007. Survey recipients were selected as the person in charge of Web site usability by visiting library Web sites and phone inquiry. The survey was concluded in January 2008 with a response rate of 74% (84 institutions. The researchers used t‐test to detect any difference in ARL library ranking between libraries with and without PSGs. Pair‐wise t‐tests were conducted to identify gaps in difficulty implementing PSGs. In addition, they used Pearson’s Correlation to investigate any significant correlations between variables such as ARL rank and resource allocation.Main Results – Of the 84 respondents, 34 (40% have general library Web PSGs and 25 (30% have specific usability PSGs; 41 (49% have at least one type of in‐library PSG. Of the 43 (51% libraries that do not have PSGs, 30 (36% are at universities with institutional Web usability PSGs; 26 (87% follow those guidelines. There was no statistically significant relationship between ARL ranking and PSG status (see Table 1. The authors asked about difficulty in implementing PSGs. Of the 32 libraries responding to a question about general library Web PSGs, most had slight or moderate difficulty. Twenty‐three libraries with specific usability PSGs identified difficulty levels; some had no difficulty, but a majority had moderate difficulty. For the 26 libraries using institutional Web usability PSGs, most had no or slight difficulty. Pair‐wise t‐tests showed that library Web usability PSGs were significantly more difficult to implement than university Web usability PSGs. Enforcement/agreement issues were reported as the primary difficulty in implementing in‐library PSGs. Technical issues and ambiguity were obstacles at the institutional level. More than half of the 84 libraries have Web advisory committees and about one third have usability committees or Web usability subcommittees. Several libraries answered that they have none of these committees, but indicated that they have some sort of ad hoc committee or user study group to address usability issues. Of the 84 respondents, 71 (85% have conducted usability testing. Sixty‐two libraries (73.8% rated usability testing as important, very important, or extremely important: the rate given for the importance of usability testing did not correlate with ARL ranking. Cited most often in open ended questioningwere the importance of iterative testing, library wide buy‐in, and staff and resource availability. Main web pages were tested most frequently. Fifty‐three libraries (74.6% tested their lower level pages at least once. OPACs were tested the least often. The amount of testing was impacted neither by the existence of library Web PSGs nor usability PSGs. The top two testing methods were in‐person observation and think aloud protocol.Of the 84 libraries, 24 (28% reported having staff dedicated to Web usability issues; twenty full‐time staff and four part‐time staff. There was a weak association between ARL ranking and hours worked by dedicated staff; no association existed for regular staff who take on Web responsibilities. Fifty‐one (60% of libraries had regular staff whose duties included Web usability; forty‐six full‐time and five part‐time. Training did not correlate to amount of testing methods used. There was a weak link between ALR ranking and availability of resources and, the authors showed, more testing was done as resources increased. In response to a query about future Web usability plans, the focus was on usability testing and site redesign, with only three libraries planning to refine or establish usability PSGs.Conclusion – The authors hypothesized that “web usability PSGs would influence usability practice within libraries and other institutions” (953. The data show that PSGs do not influence practices. The authors conclude that there is no significant relationship between PSGs and testing practices or PSGs and the availability of resources. Likewise, ARL ranking had no effect on the establishment of usability PSGs. Most libraries are conducting usability testing, and there was a weak link between ARL ranking and availability of testing resources. Highlighted in the open‐ended questions is the lack of usability expertise among stakeholders. Workload, inadequate human resources, and lack of organizational cohesion are also cited as barriers to the adoption of Web usability PSGs. The authors speculate that Web professionals likely use their own working knowledge and internalized guidelines without having formal documentation. The authors further speculate that the difficulty related to creating mental models that adequately represent library tasks may hinder the use of formal usability PSGs. Additionally, libraries may not regard the lack of usability PSGs as a liability, especially in light of the lack of government mandates or standards. The authors recommend educational efforts for key players on the value of Web usability, support for hiring dedicated staff, and formal documentation to guide design practice. The authors plan to compare the collected PSGs in an upcoming project. Future research could focus on non‐ARL libraries, the relationship between PSGs and user experience, and Content Management System (CMS usability characteristics.

  11. The optimal choice of medication administration route regarding intravenous, intramuscular, and subcutaneous injection

    Directory of Open Access Journals (Sweden)

    Jin JF

    2015-07-01

    Full Text Available Jing-fen Jin,1 Ling-ling Zhu,2 Meng Chen,3 Hui-min Xu,3 Hua-fen Wang,1 Xiu-qin Feng,1 Xiu-ping Zhu,3 Quan Zhou31Division of Nursing, 2VIP Care Ward, Division of Nursing, 3Department of Pharmacy, The Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, People’s Republic of ChinaBackground: Intravenous (IV, intramuscular (IM, and subcutaneous (SC are the three most frequently used injection routes in medication administration. Comparative studies of SC versus IV, IM versus IV, or IM versus SC have been sporadically conducted, and some new findings are completely different from the dosage recommendation as described in prescribing information. However, clinicians may still be ignorant of such new evidence-based findings when choosing treatment methods.Methods: A literature search was performed using PubMed, MEDLINE, and Web of Sciences™ Core Collection to analyze the advantages and disadvantages of SC, IV, and IM administration in head-to-head comparative studies.Results: “SC better than IV” involves trastuzumab, rituximab, antitumor necrosis factor medications, bortezomib, amifostine, recombinant human granulocyte-macrophage colony-stimulating factor, granulocyte colony-stimulating factor, recombinant interleukin-2, immunoglobulin, epoetin alfa, heparin, and opioids. “IV better than SC” involves ketamine, vitamin K1, and abatacept. With respect to insulin and ketamine, whether IV has advantages over SC is determined by specific clinical circumstances. “IM better than IV” involves epinephrine, hepatitis B immunoglobulin, pegaspargase, and some antibiotics. “IV better than IM” involves ketamine, morphine, and antivenom. “IM better than SC” involves epinephrine. “SC better than IM” involves interferon-beta-1a, methotrexate, human chorionic gonadotropin, hepatitis B immunoglobulin, hydrocortisone, and morphine. Safety, efficacy, patient preference, and pharmacoeconomics are four principles

  12. An oxygen isotope study of quartz veins within eclogites from the Dabie terrane

    Institute of Scientific and Technical Information of China (English)

    LI; Yiliang

    2001-01-01

    [1]Liu, T. S., Loess and the Environment, Beijing: China Ocean Press, 1985, 1-251.[2]Chen, L. X., Zhu, Q. G., Luo, H. B. et al., East Asian Monsoon, Beijing: China Meteorology Press, 1991, 28-61.[3]An, Z. S., Liu, T. S., Lu, Y. C. et al., The long-term palaeomonsoon variation recorded by the loess-palaeosol sequence in central China, Quaternary International, 1990, (7/8): 91-95.[4]Guo, Z. T., Liu, T. S., Fedoroff, N. et al., Shift of the monsoon intensity on the Loess Plateau at ca. 0.85 MaBP, Chinese Science Bulletin, 1993, 38(2): 586-591.[5]Chen, J., An, Z. S., Wang, Y. J. et al., Distributions of Rb and Sr in the Luochuan loess-paleosol sequence of China during the last 800 ka: Implications for paleomonsoon variations, Science in China, Ser. D, 1999, 42(3): 225-232.[6]Chen, J., Wang, Y. J., Ji, J. F. et al., Rb/Sr variations and its climatic stratigraphical significance of a loess-paleosol profile from Luochuan, Shaanxi Province, Quaternary Sciences (in Chinese), 1999, 19(4): 350-356.[7]Guo, Z. T.,Liu, T. S., Fedoroff, N. et al., Climate extremes in loess of China coupled with the strength of deep-water for-mation in the North Atlantic, Global and Planetary Change, 1998, 18: 113-128.[8]Guo, Z. T., Liu, T. S., An, Z. S., Paleosols of the last 0.15 Ma in the Weinan loess section and their paleoclimate signifi-cance, Quaternary Sciences (in Chinese), 1994, 14(3): 256-269.[9]Guo, Z, T,, Fedoroff, N., Liu, T. S., Micromorphology of the loess-paleosol sequence of the last 130 ka in China and pa-leoclimatic event, Science in China (in Chinese), Ser. D, 1996, 26(3): 392-398.[10]Guo, Z., Liu, T., Guiot, J., et al., High frequency pulses of East Asian monsoon climate in the last two glaciations: Link with the North Atlantic, Climate Dynamics, 1996, 12: 701-709.[11]Guo, Z. T., Peng, S. Z., Wei, L. Y. et al., Weathering signals of Millennial-Scale oscillations of the East Asian Summer monsoon over the last 220 ka, Chinese Science

  13. Catalyst activity or stability: the dilemma in Pd-catalyzed polyketone synthesis.

    Science.gov (United States)

    Amoroso, Francesco; Zangrando, Ennio; Carfagna, Carla; Müller, Christian; Vogt, Dieter; Hagar, Mohamed; Ragaini, Fabio; Milani, Barbara

    2013-10-28

    A series of Pd-complexes containing nonsymmetrical bis(aryl-imino)acenaphthene (Ar-BIAN) ligands, characterized by substituents on the meta positions of the aryl rings, have been synthesized, characterized and applied in CO/vinyl arene copolymerization reactions. Crystal structures of two neutral Pd-complexes have been solved allowing comparison of the bonding properties of the ligand. Kinetic and mechanistic investigations on these complexes have been performed. The kinetic investigations indicate that in general ligands with electron-withdrawing substituents give more active, but less stable, catalytic systems, although steric effects also play a role. The good performance observed with nonsymmetrical ligands is at least in part due to a compromise between catalyst activity and lifetime, leading to a higher overall productivity with respect to catalysts based on their symmetrical counterparts. Additionally, careful analysis of the reaction profiles provided information on the catalyst deactivation pathway. The latter begins with the reduction of a Pd(II) Ar-BIAN complex to the corresponding Pd(0) species, a reaction that can be reverted by the action of benzoquinone. Then the ligand is lost, a process that appears to be facilitated by the contemporary coordination of an olefin or a CO molecule. The so formed Pd(0) complex immediately reacts with another molecule of the initial Pd(II) complex to give a Pd(I) dimeric species that irreversibly evolves to metallic palladium. Mechanistic investigations performed on the complex with a nonsymmetrical Ar-BIAN probe evidence that the detected intermediates are characterized by the Pd-C bond trans to the Pd-N bond of the aryl ring bearing electron-withdrawing substituents. In addition, the intermediate resulting from the insertion of 4-methylstyrene into the Pd-acyl bond is a five-member palladacycle and not the open-chain η(3)-allylic species observed for complexes with Ar-BIANs substituted in ortho position.

  14. Bi Sparsity Pursuit: A Paradigm for Robust Subspace Recovery

    Science.gov (United States)

    2016-09-27

    Bian, Student Member, IEEE, and Hamid Krim, Fellow, IEEE Abstract The success of sparse models in computer vision and machine learning is due to the...16. SECURITY CLASSIFICATION OF: The success of sparse models in computer vision and machine learning is due to the fact that, high dimensional data...vision and machine learning is due to the fact that, high dimensional data is distributed in a union of low dimensional subspaces in many real-world

  15. Recent Research in Behind-Armor Blunt Trauma and Traumatic Brain Injury

    Science.gov (United States)

    2014-02-01

    Injury. Natl. Tech. Inf. Serv. 2006, ADA481896. 20. Cernak, I.; Wang, Z.; Jiang, J.; Bian, X.; Savic , J. Ultrastructural and Functional Characteristics...Malicevic, Z.; Savic J. Experimental Magnesium Depletion in Adult Rabbits Caused by Blast Overpressure. Magnes. Res. 1995, 8 (4), 249–259. 34. Cernak, I... Savic , J.; Malicevic, Z.; Zunic, G.; Radosevic, P.; Ivanovic, I.; Davidovic, L. Involvement of the Central Nervous System in the General Response

  16. Study of acupuncture for low back pain in recent 20 years: a bibliometric analysis via CiteSpace

    Directory of Open Access Journals (Sweden)

    Liang YD

    2017-04-01

    Full Text Available Yu-Dan Liang,1,* Ying Li,1,* Jian Zhao,2 Xiao-Yin Wang,3 Hui-Zheng Zhu,1 Xiu-Hua Chen1 1The Second Clinical Medical College of Guangzhou University of Chinese Medicine, Guangzhou, 2Longgang District People’s Hospital of Shenzhen, Shenzhen, 3Guangdong Second Traditional Chinese Medicine Hospital, Guangzhou, People’s Republic of China *These authors contributed equally to this work Background: Acupuncture has been applied to relieve low back pain (LBP in many countries. However, a bibliometric analysis of the global use of acupuncture for LBP is rare.Objective: The aim of this study was to demonstrate the state of the art and trends concerning the global use of acupuncture for LBP in recent 20 years.Methods: Literature relating to acupuncture for LBP from 1997 to 2016 was retrieved from Web of Science. CiteSpace was used to analyze country/institution, cited journals, authors/cited authors, cited references, and keywords. An analysis of counts and centrality was used to reveal publication outputs, countries/institutions, core journals, active authors, foundation references, hot topics, and frontiers.Results: A total of 958 references were obtained, and the total number of publications continually increased over the investigated period. Journal articles (662 were the most frequently occurring document type. The most productive country and institution in this field was the USA (342 and Harvard University (47, respectively. The J Altern Complem Med (69 was the most productive journal, and Pain (636 was the most cocited journal, which reflected the nature of the research. The Haake’s (2007 article (cocitation counts: 130 and the Cherkin’s (2001 article (centrality: 0.59 were the most representative and symbolic references, with the highest cocitation number and centrality, respectively. Cherkin was the most influential author, with the highest number of publications of 25 and a cocitation number of 226. The four hot topics in acupuncture for

  17. Systemic immune–inflammation index as a useful prognostic indicator predicts survival in patients with advanced gastric cancer treated with neoadjuvant chemotherapy

    Directory of Open Access Journals (Sweden)

    Chen L

    2017-12-01

    Full Text Available Li Chen,1,* Ying Yan,2,* Lihua Zhu,3 Xiliang Cong,1 Sen Li,1 Shubin Song,1 Hongjiang Song,1 Yingwei Xue1 1Department of Gastrointestinal Surgery, Harbin Medical University Cancer Hospital, Harbin Medical University, Harbin, Heilongjiang, 2Department of Internal Oncology, Harbin The First Hospital, Harbin, Heilongjiang, 3Department of Pathogen Biology, School of Basic Medical Sciences, North China University of Science and Technology, Tangshan, Hebei, China *These authors contributed equally to this work Background and objective: A novel systemic immune–inflammation index named SII (SII=N×P/L, which is based on neutrophil (N, platelet (P and lymphocyte (L counts, has emerged and reflects comprehensively the balance of host inflammatory and immune status. We aimed to evaluate the potential prognostic significance of SII in patients with advanced gastric cancer who received neoadjuvant chemotherapy.Subjects and methods: The retrospective analysis included data from 107 patients with advanced gastric cancer undergoing neoadjuvant chemotherapy and 185 patients with pathology-proven gastric cancer. The optimal cutoff value of SII by receiver operating characteristic curve stratified patients into low SII (<600×109/L and high SII (SII ≥600×109/L groups. The clinical outcomes of disease-free survival (DFS and overall survival (OS were calculated by Kaplan–Meier survival curves and compared using log-rank test. Univariate and multivariate Cox proportional hazards regression models were used to analyze the prognostic value of SII.Results: The results indicated that SII had prognostic significance using the cutoff value of 600×109/L on DFS and OS in univariate and multivariate Cox regression survival analyses. Low SII was associated with prolonged DFS and OS, and the mean DFS and OS for patients with low SII were longer than for those with high SII (57.22 vs 41.56 months and 62.25 vs 45.60 months, respectively. Furthermore, we found that patients

  18. Identification of key genes and molecular mechanisms associated with dedifferentiated liposarcoma based on bioinformatic methods

    Directory of Open Access Journals (Sweden)

    Yu H

    2017-06-01

    Full Text Available Hongliang Yu,1 Dong Pei,2 Longyun Chen,2 Xiaoxiang Zhou,2 Haiwen Zhu2 1Department of Radiation Oncology, Jiangsu Cancer Hospital and Jiangsu Institute of Cancer Research, The Affiliated Cancer Hospital of Nanjing Medical University, Nanjing, 2Department of Radiation Oncology, Yancheng Third People’s Hospital, Yancheng, Jiangsu, People’s Republic of China Background: Dedifferentiated liposarcoma (DDLPS is one of the most deadly types of soft tissue sarcoma. To date, there have been few studies dedicated to elucidating the molecular mechanisms behind the disease; therefore, the molecular mechanisms behind this malignancy remain largely unknown.Materials and methods: Microarray profiles of 46 DDLPS samples and nine normal fat controls were extracted from Gene Expression Omnibus (GEO. Quality control for these microarray profiles was performed before analysis. Hierarchical clustering and principal component analysis were used to distinguish the general differences in gene expression between DDLPS samples and the normal fat controls. Differentially expressed genes (DEGs were identified using the Limma package in R. Next, the enriched Gene Ontology (GO terms and Kyoto Encyclopedia of Genes and Genomes (KEGG pathways were obtained using the online tool DAVID (http://david.abcc.ncifcrf.gov/. A protein–protein interaction (PPI network was constructed using the STRING database and Cytoscape software. Furthermore, the hub genes within the PPI network were identified.Results: All 55 microarray profiles were confirmed to be of high quality. The gene expression pattern of DDLPS samples was significantly different from that of normal fat controls. In total, 700 DEGs were identified, and 83 enriched GO terms and three KEGG pathways were obtained. Specifically, within the DEGs of DDLPS samples, several pathways were identified as being significantly enriched, including the PPAR signaling pathway, cell cycle pathway, and pyruvate metabolism pathway

  19. Sodium phenylbutyrate antagonizes prostate cancer through the induction of apoptosis and attenuation of cell viability and migration

    Directory of Open Access Journals (Sweden)

    Xu YW

    2016-05-01

    Full Text Available Yawen Xu,* Shaobo Zheng,* Binshen Chen, Yong Wen, Shanwen Zhu Department of Urology, Zhujiang Hospital, Southern Medical University, Guangzhou, People’s Republic of China *These authors contributed equally to this work Background: Prostate cancer (PCa is a leading cause of cancer-related death in men. Sodium phenylbutyrate (SPB has shown its potential as an anticancer therapy in numerous cancer types. In the present study, we attempted to assess the effect of SPB against PCa and whether this treatment was associated with the regulation of survivin. Methods: Two human PCa cancer cell lines, DU145 and PC3, were used in the present study. Cell Counting Kit-8 (CCK-8 assay was conducted to measure the proliferation of PCa cells incubated with SPB. The effect of SPB on the cell apoptosis, cell colony formation ability, and cell morphological change was also assessed. Transwell experiment and Western blotting assay were performed to determine the effect of SPB on the migration and invasion ability of both cell types. Moreover, the expression pattern of survivin and MAPK members in both cell types after the treatment of SPB was also detected. Additionally, an in vivo tumor formation assay was performed to evaluate the treatment potential of SPB against PCa. Results: We found that the viability of PCa cells was significantly inhibited by SPB treatment. As illustrated by flow cytometry, for DU145 cell line the average apoptotic rate of SPB-treated cells was significantly lower than that of the control group (P<0.05; similar results were also seen for PC3 (P<0.05. SPB administration also attenuated the colony formation and migration abilities in both cell lines. The expression level of survivin in SPB-treated cells was significantly downregulated, while the phosphorylation of p-38 and ERK was enhanced. Furthermore, in vivo tumor formation of both cell lines was suppressed by SPB as well. Conclusion: The above results confirmed the potential of SPB as an

  20. Evaluation of zinc-doped mesoporous hydroxyapatite microspheres for the construction of a novel biomimetic scaffold optimized for bone augmentation

    Directory of Open Access Journals (Sweden)

    Yu W

    2017-03-01

    Full Text Available Weilin Yu,1,* Tuan-Wei Sun,2,3,* Chao Qi,2,3 Zhenyu Ding,1 Huakun Zhao,1 Shichang Zhao,1 Zhongmin Shi,1 Ying-Jie Zhu,2,3 Daoyun Chen,1 Yaohua He1,4 1Department of Orthopedics, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, 2State Key Laboratory of High Performance Ceramics and Superfine Microstructure, Shanghai Institute of Ceramics, Chinese Academy of Sciences, Shanghai, 3University of Chinese Academy of Sciences, Beijing, 4School of Biomedical Engineering, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, Shanghai, China *These authors contributed equally to this work Abstract: Biomaterials with high osteogenic activity are desirable for sufficient healing of bone defects resulting from trauma, tumor, infection, and congenital abnormalities. Synthetic materials mimicking the structure and composition of human trabecular bone are of considerable potential in bone augmentation. In the present study, a zinc (Zn-doped mesoporous hydroxyapatite microspheres (Zn-MHMs/collagen scaffold (Zn-MHMs/Coll was developed through a lyophilization fabrication process and designed to mimic the trabecular bone. The Zn-MHMs were synthesized through a microwave-hydrothermal method by using creatine phosphate as an organic phosphorus source. Zn-MHMs that consist of hydroxyapatite nanosheets showed relatively uniform spherical morphology, mesoporous hollow structure, high specific surface area, and homogeneous Zn distribution. They were additionally investigated as a drug nanocarrier, which was efficient in drug delivery and presented a pH-responsive drug release behavior. Furthermore, they were incorporated into the collagen matrix to construct a biomimetic scaffold optimized for bone tissue regeneration. The Zn-MHMs/Coll scaffolds showed an interconnected pore structure in the range of 100–300 µm and a sustained release of Zn ions. More importantly, the Zn-MHMs/Coll scaffolds could enhance the osteogenic differentiation

  1. Evaluation of negative-pressure wound therapy for patients with diabetic foot ulcers: systematic review and meta-analysis

    Directory of Open Access Journals (Sweden)

    Liu S

    2017-04-01

    Full Text Available Si Liu,1 Chao-zhu He,1 Yan-ting Cai,1 Qiu-ping Xing,1 Ying-zhen Guo,1 Zhi-long Chen,1 Ji-liang Su,1 Li-ping Yang2 1School of Nursing, Nanchang University, 2Department of Endocrinology, The Second Affiliated Hospital of Nanchang University, Nanchang, Jiangxi, China Objectives: The aim of this study was to perform an updated systematic review and meta-analysis to assess the clinical efficacy, safety, and cost-effectiveness of negative-pressure wound therapy (NPWT in the treatment of diabetic foot ulcers (DFUs.Methods: We searched the Cochrane Library, MEDLINE, EMBASE, Ovid, and Chinese Biological Medicine databases up to June 30, 2016. We also manually searched the articles from reference lists of the retrieved articles, which used the NPWT system in studies of vacuum-assisted closure therapy. Studies were identified and selected, and two independent reviewers extracted data from the studies.Results: A total of eleven randomized controlled trials, which included a total of 1,044 patients, were selected from 691 identified studies. Compared with standard dressing changes, NPWT had a higher rate of complete healing of ulcers (relative risk, 1.48; 95% confidence interval [CI]: 1.24–1.76; P<0.001, shorter healing time (mean difference, −8.07; 95% CI: −13.70–−2.45; P=0.005, greater reduction in ulcer area (mean difference, 12.18; 95% CI: 8.50–15.86; P<0.00001, greater reduction in ulcer depth (mean difference, 40.82; 95% CI: 35.97–45.67; P<0.00001, fewer amputations (relative risk, 0.31; 95% CI: 0.15–0.62; P=0.001, and no effect on the incidence of treatment-related adverse effects (relative risk, 1.12; 95% CI: 0.66–1.89; P=0.68. Meanwhile, many analyses showed that the NPWT was more cost-effective than standard dressing changes.Conclusion: These results indicate that NPWT is efficacious, safe, and cost-effective in treating DFUs. Keywords: diabetic foot ulcers, negative-pressure wound therapy, complete wound closure, amputation, meta

  2. PREFACE: XXVIII International Conference on Photonic, Electronic and Atomic Collisions (ICPEAC 2013)

    Science.gov (United States)

    Xiao, Guoqing; Cai, Xiaohong; Ding, Dajun; Ma, Xinwen; Zhao, Yongtao

    2014-04-01

    express its great appreciation to National Natural Science Foundation of China (NSFC), Chinese Academy of Sciences (CAS), International Union of Pure and Applied Physics (IUPAP), IMP, and IMP-YIPA for financial support, to Fangfang Ruan, Qiang Liang, Dacheng Zhang, Shukai Tian, Yuyu Wang, Wenping Zhu, Wei Liang, Mingwu Zhang, Haibo Yuan, Shan Sha, Jieru Ren, Jie Yang and Zhenhai Chen for their contributions to the organization, and to the volunteer group from Lanzhou University, the High School Attached Northwest Normal University and IMP for their excellent volunteer work. The Local Organizing Committee would like to thank all of the participants and the authors of the proceedings for their supports and contributions to the conference. Guoqing Xiao Director of Institute of Modern Physics, Chinese Academy of Sciences

  3. Successful in vivo hyperthermal therapy toward breast cancer by Chinese medicine shikonin-loaded thermosensitive micelle

    Directory of Open Access Journals (Sweden)

    Su Y

    2017-05-01

    Full Text Available Yonghua Su,1,* Nian Huang,1,* Di Chen,2,* Li Zhang,2,* Xia Dong,2 Yun Sun,2 Xiandi Zhu,2 Fulei Zhang,2 Jie Gao,2 Ying Wang,2 Kexing Fan,2 Puichi Lo,3 Wei Li,2 Changquan Ling1 1Department of Integrative Oncology, Changhai Hospital of Traditional Chinese Medicine, 2International Joint Cancer Institute, The Second Military Medical University, Shanghai, 3Department of Biomedical Sciences, City University of Hong Kong, Kowloon Tong, Hong Kong, China *These authors contributed equally to this work Abstract: The Chinese traditional medicine Shikonin is an ideal drug due to its multiple targets to tumor cells. But in clinics, improving its aqueous solubility and tumor accumulation is still a challenge. Herein, a copolymer with tunable poly(N-isopropylacrymaide and polylactic acid block lengths is designed, synthesized, and characterized in nuclear magnetic resonance. The corresponding thermosensitive nanomicelle (TN with well-defined core-shell structure is then assembled in an aqueous solution. For promoting the therapeutic index, the physical-chemistry properties of TNs including narrow size, low critical micellar concentration, high serum stability, tunable volume phase transition temperature (VPTT, high drug-loading capacity, and temperature-controlled drug release are systematically investigated and regulated through the fine self-assembly. The shikonin is then entrapped in a degradable inner core resulting in a shikonin-loaded thermosensitive nanomicelle (STN with a VPTT of ~40°C. Compared with small-molecular shikonin, the in vitro cellular internalization and cytotoxicity of STN against breast cancer cells (Michigan Cancer Foundation-7 are obviously enhanced. In addition, the therapeutic effect is further enhanced by the programmed cell death (PCD specifically evoked by shikonin. Interestingly, both the proliferation inhibition and PCD are synergistically promoted as T > VPTT, namely the temperature-regulated passive targeting. Consequently, as

  4. Impact of different analgesic depths and abdominal trauma of different severities on stress and recovery of rats undergoing total intravenous anesthesia

    Directory of Open Access Journals (Sweden)

    Huang HM

    2017-05-01

    Full Text Available Hai-ming Huang,1,2 Jun Cao,3 Lin-mei Zhu,4 Yu-qing Chen,2 Fu-ding Lu,2 Hong-wei Cai1 1Department of Anesthesiology, Xiangya Hospital, Central South University, Changsha, 2Department of Anesthesiology, 3Department of Hepatic and Biliary Pancreatic Surgery, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, 4Department of Obstetrics and Gynecology, Clifford Hospital, Guangzhou University of Chinese Medicine, Guangzhou, People’s Republic of China Abstract: A number of animal models have been developed to examine the pathophysiological consequences of surgical procedures, but anesthetic methods, monitoring, and management measures in these models are very different from those used in humans. This study was designed to create a rat model of abdominal surgery using anesthetic methods and perioperative treatment similar to those used in the clinic and to investigate the effects of different injury severities and depths of anesthesia and analgesia on surgical stress and postoperative recovery. Abdominal skin/muscle incision was compared with exploratory laparotomy in rats under propofol intravenous anesthesia, accompanied by perioperative measures such as oxygen inhalation, fluid infusion, warmth, blood gas analysis, and infection prevention. Stress indices (mean arterial pressure, heart rate, blood glucose, and plasma corticosterone were monitored during anesthesia and surgery, and recovery indicators (body weight, food consumption, and pain were measured after surgery. In addition, animals undergoing laparotomy were subjected to low and high dosages of propofol and sufentanil, in order to examine the relationship between anesthetic and analgesic depth and stress on recovery. Exploratory laparotomy induced a greater stress response and caused slower postoperative recovery as measured than somatic injury. High-dose sufentanil downregulated plasma corticosterone and improved postoperative recovery more effectively than high-dose propofol (P<0

  5. Mesenchymal stem cell-based NK4 gene therapy in nude mice bearing gastric cancer xenografts

    Directory of Open Access Journals (Sweden)

    Zhu Y

    2014-12-01

    Full Text Available Yin Zhu,1,* Ming Cheng,2,* Zhen Yang,3 Chun-Yan Zeng,3 Jiang Chen,3 Yong Xie,3 Shi-Wen Luo,3 Kun-He Zhang,3 Shu-Feng Zhou,4 Nong-Hua Lu1,31Department of Gastroenterology, 2Department of Orthopedics, 3Institute of Digestive Disease, The First Affiliated Hospital of Nanchang University, Jiangxi, People’s Republic of China; 4Department of Pharmaceutical Sciences, College of Pharmacy, University of South Florida, Tampa, FL, USA*These authors contributed equally to this workAbstract: Mesenchymal stem cells (MSCs have been recognized as promising delivery vehicles for gene therapy of tumors. Gastric cancer is the third leading cause of worldwide cancer mortality, and novel treatment modalities are urgently needed. NK4 is an antagonist of hepatocyte growth factor receptors (Met which are often aberrantly activated in gastric cancer and thus represent a useful candidate for targeted therapies. This study investigated MSC-delivered NK4 gene therapy in nude mice bearing gastric cancer xenografts. MSCs were transduced with lentiviral vectors carrying NK4 complementary DNA or enhanced green fluorescent protein (GFP. Such transduction did not change the phenotype of MSCs. Gastric cancer xenografts were established in BALB/C nude mice, and the mice were treated with phosphate-buffered saline (PBS, MSCs-GFP, Lenti-NK4, or MSCs-NK4. The tropism of MSCs toward gastric cancer cells was determined by an in vitro migration assay using MKN45 cells, GES-1 cells and human fibroblasts and their presence in tumor xenografts. Tumor growth, tumor cell apoptosis and intratumoral microvessel density of tumor tissue were measured in nude mice bearing gastric cancer xenografts treated with PBS, MSCs-GFP, Lenti-NK4, or MSCs-NK4 via tail vein injection. The results showed that MSCs migrated preferably to gastric cancer cells in vitro. Systemic MSCs-NK4 injection significantly suppressed the growth of gastric cancer xenografts. MSCs-NK4 migrated and accumulated in tumor

  6. Antibiotic-resistant Pseudomonas aeruginosa infection in patients with bronchiectasis: prevalence, risk factors and prognostic implications

    Directory of Open Access Journals (Sweden)

    Gao YH

    2018-01-01

    Full Text Available Yong-hua Gao,1,* Wei-jie Guan,2,* Ya-nan Zhu,3 Rong-chang Chen,2 Guo-jun Zhang1 1Department of Respiratory and Critical Care Medicine, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan, 2State Key Laboratory of Respiratory Disease, National Clinical Research Center for Respiratory Disease, Guangzhou Institute of Respiratory Diseases, The First Affiliated Hospital of Guangzhou Medical University, Guangzhou, Guangdong, 3Department of Emergency Medicine, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan, People’s Republic of China *These authors contributed equally to this work Background and aims: Pseudomonas aeruginosa (PA is the most common pathogen in bronchiectasis and frequently develops resistance to multiple classes of antibiotics, but little is known about the clinical impacts of PA-resistant (PA-R isolates on bronchiectasis. We, therefore, investigated the prevalence, risk factors and prognostic implications of PA-R isolates in hospitalized bronchiectasis patients.Patients and methods: Between June 2011 and July 2016, data from adult bronchiectasis patients isolated with PA at the First Affiliated Hospital of Zhengzhou University were retrospectively analyzed. PA was classified as PA-R in case antibiogram demonstrated resistance on at least one occasion.Results: Seven hundred forty-seven bronchiectasis patients were assessed. Of these, 147 (19.7% had PA isolate in the sputum or bronchoscopic culture. PA-R and PA-sensitive accounted for 88 (59.9% and 59 (31.1% patients, respectively. In multivariate model, factors associated with PA-R isolate in bronchiectasis included prior exposure to antibiotics (odds ratio [OR] =6.18, three or more exacerbations in the previous year (OR =2.81, higher modified Medical Research Council dyspnea scores (OR =1.93 and greater radiologic severity (OR =1.15. During follow-up (median: 26 months; interquartile range: 6–59 months, 36 patients died, of whom 24 (66

  7. 2. Sino-German workshop on fuel cells. Book of abstracts

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2003-07-01

    The CD-ROM contains the content of 13 lectures and 19 proposals for joint projects, which were presented on the second Sino-German Workshop on fuel cells. The topics of the 13 lectures are: Ab-initio calculations of oxygen species on low-index platinum surfaces (Pachenko, M.T.M. Koper, T.E. Shubina, S.J. Mitchell, E. Roduner). Cross-Linked (Composite) Polyaryl Blend Membranes for Membrane Fuel Cells. (J.A. Kerres, A. Ullrich, W. Zhang, M. Hein, V. Gogel, L. Joerissen, Th. Frey, A. Friedrich). Performance and Methanol Permeation of Direct Methanol Fuel Cells: Dependence on Operating Conditions and on Electrode Structure(V. Gogel, Th. Frey, K.A. Friedrich, L. Joerissen, J. Garche, Z. Yongsheng). Experimental Investigation of Flow Bed Configuration Effect on Performance of Liquid Feed Direct Methanol Fuel Cells. (H. Guo, C.F. Ma, M.H. Wang, F. Ye, J. Yu, Y. Wang, C.Y. Wang). Improvement of MEAs for DMFC by a tuned production sequence assisted by mathematical modelling (Lindermeir, G. Rosenthal, U. Kunz, U. Hoffmann). Performance of the self-breathing air DMFC with solution grafted PVDF-g-PSSA membranes (X. Qiu, G. Guo, W. Li, W. Zhu, L. Chen). Modeling the Effects of Methanol Crossover on DMFC (J. Zhang, Y. Wang). The characteristics of 40 kW PEM fuel cell engine for vehicle(M. Hou, P. Ming, H. Zhang). A New and Simple Method for Preparing Biocathode in Biofuel Cells (D. Sun, C. Cai, X. Li, W. Xing, T. Lu). Nonlinear Model Reduction of a Dynamic Two-dimensional Molten Carbonate Fuel Cell Model (M. Mangold, M. Sheng). Recent Advances in Design and Fabrication of Low-Temperature Solid Oxide Fuel Cells (C. Xia, G. Meng). Novel CVD Techniques for Micro- and IT-SOFC Fabrication (G. Meng, H. Song, Q. Dong, D. Peng). Fundamental properties of La{sub 0.6}Sr{sub 0.4}Co{sub 0.8}Fe{sub 0.2}O{sub 3-{delta}} at high temperatures (S. Wang, T.-L. Wen).

  8. Electrospinning of calcium phosphate-poly(D,L-lactic acid nanofibers for sustained release of water-soluble drug and fast mineralization

    Directory of Open Access Journals (Sweden)

    Fu QW

    2016-10-01

    Full Text Available Qi-Wei Fu,1,* Yun-Peng Zi,1,* Wei Xu,1 Rong Zhou,1 Zhu-Yun Cai,1 Wei-Jie Zheng,1 Feng Chen,2 Qi-Rong Qian1 1Department of Orthopedics, Changzheng Hospital, Second Military Medical University, 2State Key Laboratory of High Performance Ceramics and Superfine Microstructure, Shanghai Institute of Ceramics, Chinese Academy of Sciences, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Calcium phosphate-based biomaterials have been well studied in biomedical fields due to their outstanding chemical and biological properties which are similar to the inorganic constituents in bone tissue. In this study, amorphous calcium phosphate (ACP nanoparticles were prepared by a precipitation method, and used for preparation of ACP-poly(D,L-lactic acid (ACP-PLA nanofibers and water-soluble drug-containing ACP-PLA nanofibers by electrospinning. Promoting the encapsulation efficiency of water-soluble drugs in electrospun hydrophobic polymer nanofibers is a common problem due to the incompatibility between the water-soluble drug molecules and hydrophobic polymers solution. Herein, we used a native biomolecule of lecithin as a biocompatible surfactant to overcome this problem, and successfully prepared water-soluble drug-containing ACP-PLA nanofibers. The lecithin and ACP nanoparticles played important roles in stabilizing water-soluble drug in the electrospinning composite solution. The electrospun drug-containing ACP-PLA nanofibers exhibited fast mineralization in simulated body fluid. The ACP nanoparticles played the key role of seeds in the process of mineralization. Furthermore, the drug-containing ACP-PLA nanofibers exhibited sustained drug release which simultaneously occurred with the in situ mineralization in simulated body fluid. The osteoblast-like (MG63 cells with spreading filopodia were well observed on the as-prepared nanofibrous mats after culturing for 24 hours, indicating a high cytocompatibility. Due

  9. Efficacy and safety of immunosuppressive therapy in the treatment of seronegative hepatitis associated aplastic anemia

    Directory of Open Access Journals (Sweden)

    Chen HF

    2014-09-01

    Full Text Available Hai-Fei Chen,* Bin-Xian Xu, Hong-Shi Shen,* Zheng-Yang Li, Ling-Juan Jin, Jie-Qing Tang, Jing Wang, Jing-Jing Zhu, Long-Mei Qin, Qing-Ya Cui, Yong-Ya Ren, Tian-Qin Wu Department of hematology, 100th hospital of People’s Liberation Army, Suzhou, Jiangsu province, The People’s Republic of China *These authors have contributed equally to this paper Objective: To investigate the clinical characteristics of seronegative hepatitis-associated aplastic anemia (AA (SNHAA and hepatitis B virus (HBV infection complicating AA (HBVAA, and thereby compare the efficacy of immunosuppressive therapy (IST.Methods: An analysis was conducted on the clinical data of ten patients with SNHAA out of 332 cases of AA from our center at AA diagnosis, and on the efficacy of IST. This was compared to 22 cases of HBVAA at AA onset as well as the associated IST outcomes.Results: Nine patients with SNHAA developed severe aplastic anemia, with a median age of 18 years. After IST, six (60% of the SNHAA patients achieved complete remission and two achieved partial remission. The patients with HBVAA had a total response rate of 82.3%. The disease recurred in two HBVAA patients. No statistically significant differences were observed in response rate, mortality, and recurrence rate between both groups. As compared with HBVAA, patients with SNHAA had a shorter interval from the acute episode of hepatitis to AA onset (4 months versus 92 months, P=0.00, a quicker response to IST (2.5 months versus 4.5 months, P=0.018, a lower proportion of bone marrow hematopoietic tissues (20.6% versus 23.6%, P=0.03, and lower white blood cell and absolute neutrophil count (0.8×109/L versus 1.23×109/L and 0.26×109/L versus 0.58×109/L, P=0.026 and P=0.0009, respectively. No significant liver damage or hepatitis B fulminant infection was observed in either group during the follow-up. Conclusion: The prevalence of SNHAA is 3.01%. SNHAA often presents as severe AA and responds to IST quickly

  10. Comparison of pulsed versus continuous oxygen delivery using realistic adult nasal airway replicas

    Directory of Open Access Journals (Sweden)

    Chen JZ

    2017-08-01

    Full Text Available John Z Chen,1 Ira M Katz,2 Marine Pichelin,2 Kaixian Zhu,3 Georges Caillibotte,2 Michelle L Noga,4 Warren H Finlay,1 Andrew R Martin1 1Department of Mechanical Engineering, University of Alberta, Edmonton, AB, Canada; 2Medical R&D, Air Liquide Santé International, Centre de Recherche Paris-Saclay, Les Loges-en-Josas, 3Centre Explor!, Air Liquide Healthcare, Gentilly, France; 4Radiology and Diagnostic Imaging, University of Alberta, Edmonton, AB, Canada Background: Portable oxygen concentrators (POCs typically include pulse flow (PF modes to conserve oxygen. The primary aims of this study were to develop a predictive in vitro model for inhaled oxygen delivery using a set of realistic airway replicas, and to compare PF for a commercial POC with steady flow (SF from a compressed oxygen cylinder. Methods: Experiments were carried out using a stationary compressed oxygen cylinder, a POC, and 15 adult nasal airway replicas based on airway geometries derived from medical images. Oxygen delivery via nasal cannula was tested at PF settings of 2.0 and 6.0, and SF rates of 2.0 and 6.0 L/min. A test lung simulated three breathing patterns representative of a chronic obstructive pulmonary disease patient at rest, during exercise, and while asleep. Volume-averaged fraction of inhaled oxygen (FiO2 was calculated by analyzing oxygen concentrations sampled at the exit of each replica and inhalation flow rates over time. POC pulse volumes were also measured using a commercial O2 conserver test system to attempt to predict FiO2 for PF. Results: Relative volume-averaged FiO2 using PF ranged from 68% to 94% of SF values, increasing with breathing frequency and tidal volume. Three of 15 replicas failed to trigger the POC when used with the sleep breathing pattern at the 2.0 setting, and four of 15 replicas failed to trigger at the 6.0 setting. FiO2 values estimated from POC pulse characteristics followed similar trends but were lower than those derived from

  11. Stability of tramadol with three 5-HT3 receptor antagonists in polyolefin bags for patient-controlled delivery systems

    Directory of Open Access Journals (Sweden)

    Chen FC

    2016-06-01

    Full Text Available Fu-chao Chen,1 Jun Zhu,1 Bin Li,1 Fang-jun Yuan,1 Lin-hai Wang2 1Department of Pharmacy, Dongfeng Hospital, 2Department of Pharmacy, Renmin Hospital, Hubei University of Medicine, Shiyan, Hubei, People’s Republic of China Background: Mixing 5-hydroxytryptamine-3 (5-HT3 receptor antagonists with patient-controlled analgesia (PCA solutions of tramadol has been shown to decrease the incidence of nausea and vomiting associated with the use of tramadol PCA for postoperative pain. However, such mixtures are not commercially available, and the stability of the drug combinations has not been duly studied. The study aimed to evaluate the stability of tramadol with three 5-HT3 receptor antagonists in 0.9% sodium chloride injection for PCA administration.Materials and methods: Test samples were prepared by adding 1,000 mg tramadol hydrochloride, 8 mg ondansetron hydrochloride, and 6 mg granisetron hydrochloride or 5 mg tropisetron hydrochloride to 100 mL of 0.9% sodium chloride injection in polyolefin bags. The samples were prepared in triplicates, stored at either 25°C or 4°C for 14 days, and assessed using the following compatibility parameters: precipitation, cloudiness, discoloration, and pH. Chemical stability was also determined using a validated high-pressure liquid chromatography method.Results: All of the mixtures were clear and colorless throughout the initial observation period. No change in the concentration of tramadol hydrochloride occurred with any of the 5-HT3 receptor antagonists during the 14 days. Similarly, little or no loss of the 5-HT3 receptor antagonists occurred over the 14-day period.Conclusion: Our results suggest that mixtures of tramadol hydrochloride, ondansetron hydrochloride, granisetron hydrochloride, or tropisetron hydrochloride in 0.9% sodium chloride injection were physically and chemically stable for 14 days when stored in polyolefin bags at both 4°C and 25°C. Keywords: tramadol, ondansetron, granisetron

  12. Integer Flows and Circuit Covers of Graphs and Signed Graphs

    Science.gov (United States)

    Cheng, Jian

    The work in Chapter 2 is motivated by Tutte and Jaeger's pioneering work on converting modulo flows into integer-valued flows for ordinary graphs. For a signed graphs (G, sigma), we first prove that for each k ∈ {2, 3}, if (G, sigma) is (k - 1)-edge-connected and contains an even number of negative edges when k = 2, then every modulo k-flow of (G, sigma) can be converted into an integer-valued ( k + 1)-ow with a larger or the same support. We also prove that if (G, sigma) is odd-(2p+1)-edge-connected, then (G, sigma) admits a modulo circular (2 + 1/ p)-flows if and only if it admits an integer-valued circular (2 + 1/p)-flows, which improves all previous result by Xu and Zhang (DM2005), Schubert and Steffen (EJC2015), and Zhu (JCTB2015). Shortest circuit cover conjecture is one of the major open problems in graph theory. It states that every bridgeless graph G contains a set of circuits F such that each edge is contained in at least one member of F and the length of F is at most 7/5∥E(G)∥. This concept was recently generalized to signed graphs by Macajova et al. (JGT2015). In Chapter 3, we improve their upper bound from 11∥E( G)∥ to 14/3 ∥E(G)∥, and if G is 2-edgeconnected and has even negativeness, then it can be further reduced to 11/3 ∥E(G)∥. Tutte's 3-flow conjecture has been studied by many graph theorists in the last several decades. As a new approach to this conjecture, DeVos and Thomassen considered the vectors as ow values and found that there is a close relation between vector S1-flows and integer 3-NZFs. Motivated by their observation, in Chapter 4, we prove that if a graph G admits a vector S1-flow with rank at most two, then G admits an integer 3-NZF. The concept of even factors is highly related to the famous Four Color Theorem. We conclude this dissertation in Chapter 5 with an improvement of a recent result by Chen and Fan (JCTB2016) on the upperbound of even factors. We show that if a graph G contains an even factor, then it

  13. A Newly Designed Mobile-Based Computerized Cognitive Addiction Therapy App for the Improvement of Cognition Impairments and Risk Decision Making in Methamphetamine Use Disorder: Randomized Controlled Trial.

    Science.gov (United States)

    Zhu, Youwei; Jiang, Haifeng; Su, Hang; Zhong, Na; Li, Runji; Li, Xiaotong; Chen, Tianzhen; Tan, Haoye; Du, Jiang; Xu, Ding; Yan, Huan; Xu, Dawen; Zhao, Min

    2018-06-20

    Cognitive rehabilitation therapy has been found to improve cognitive deficits and impulse control problems in methamphetamine use disorder (MUD). However, there is limited research regarding this therapy's feasibility when using mobile-based health technologies in supporting recovery from MUD in China. The main aim of this study was to test whether 4 weeks of a newly designed computerized cognitive addiction therapy (CCAT) app can improve cognitive impairments, eliminate drug-related attention bias, and attenuate risk decision-making behaviors in participants with MUD. Forty MUD participants were assigned randomly to either the CCAT group (n=20), who received 4 weeks of CCAT plus regular detoxification treatment as usual, or the control group (n=20), who only received the regular detoxification treatment as usual, in drug rehabilitation centers in Shanghai. The CCAT was designed by combine methamphetamine use-related picture stimuli with cognitive training with the aim of improving cognitive function and eliminating drug-related attention bias. The CogState Battery, Delay Discounting Task (DDT), Iowa Gambling Task (IGT), and Balloon Analog Risk Task (BART) were administered face-to-face to all participants before and after CCAT interventions. Forty male patients were recruited. The mean age was 32.70 (SD 5.27) years in the CCAT group and mean 35.05 (SD 8.02) years in the control group. Compared to the control group, CCAT improved working memory in the CCAT group (P=.01). Group×time interactions were observed among DDT, IGT, and BART tasks, with rates of discounting delayed rewards, IGT, and BART scores (Pcognitive impairment and impulsive control in MUD. Further study is needed to understand the underlying brain mechanisms of the cognitive therapy. ClinicalTrials.gov NCT03318081; https://clinicaltrials.gov/ct2/show/NCT03318081 (Archived by WebCite at https://clinicaltrials.gov/ct2/show/NCT03318081). ©Youwei Zhu, Haifeng Jiang, Hang Su, Na Zhong, Runji Li

  14. A role of Yueju in fast-onset antidepressant action on major depressive disorder and serum BDNF expression: a randomly double-blind, fluoxetine-adjunct, placebo-controlled, pilot clinical study

    Directory of Open Access Journals (Sweden)

    Wu R

    2015-08-01

    Full Text Available Ruyan Wu,1,* Dandan Zhu,1,* Youchun Xia,2,* Haosen Wang,2 Weiwei Tao,1 Wenda Xue,1 Baomei Xia,1 Li Ren,1 Xin Zhou,1 Guochun Li,3 Gang Chen1 1Center for Translational Systems Biology and Neuroscience, Key Laboratory of Integrative Biomedicine of Brain Diseases, Nanjing University of Chinese Medicine, Nanjing, People’s Republic of China; 2The Fourth People’s Hospital of Taizhou, Taizhou, People’s Republic of China; 3School of Basic Chinese Medicine, Nanjing University of Chinese Medicine, Nanjing, People’s Republic of China *These authors contributed equally to this work Introduction: Conventional antidepressants, including fluoxetine, have a major disadvantage in delayed onset of efficacy. Yueju, an herbal medicine used to treat mood disorders was recently found to exhibit rapid antidepressant effects. The present study was conducted to evaluate the role of Yueju in rapidly acting on major depressive disorder (MDD.Methods: Participants were MDD patients with scores of 24-item Hamilton Depression Rating Scale (HDRS-24 ≥20 and without history of antidepressant use. They randomly received daily oral doses of Yueju (23 g/day plus fluoxetine (20 mg/day (experimental group or placebo plus fluoxetine (control group for 7 days. HDRS-24 was used as the primary outcome measurement at baseline, and on days 1, 3, 5, and 7. Concentrations of serum brain-derived neurotrophic factor (BDNF were assessed at baseline and on days 1 and 7.Results: In all, 18 participants met the criteria for data analysis. Compared to baseline level, only experimental group showed significant decrease of HDRS-24 score from day 3 to day 7 (P<0.05. Experimental group also showed significant improvement compared with control group from day 3 to day 7 (P<0.05. No correlation between treatment outcomes with serum BDNF levels was observed. However, experimental group showed significant correlation for serum BDNF level on day 1 with day 7 (r=0.721, P=0.028, whereas the control

  15. Intravenous moxifloxacin in routine hospital treatment of respiratory tract infections in China: results of a multicenter, noninterventional study

    Directory of Open Access Journals (Sweden)

    Chen R

    2011-04-01

    Full Text Available Rongchang Chen1, Wenjiang Ma2, Xuezhong Yu3, Xinmin Liu4, Jihong Zhu5, Hong Liang6, Xiaomei Wu7, Tao Guo81State Key Laboratory of Respiratory Disease, First Affiliated Hospital of Guangzhou Medical University, China; 2Respiratory Department, The First Affiliated Hospital of Medical School of Zhejiang University, China; 3Emergency Department, Peking Union Medical College Hospital, China; 4Geriatric Department, Peking University First Hospital, China; 5Emergency Department, Peking University People's Hospital, China; 6Respiratory Department, Huadong Hospital Affiliated to Fudan University, China; 7Respiratory Department, The Second Affiliated Hospital of Harbin Medical University, China; 8Hematology Department, Wuhan Union Hospital, ChinaObjective: To investigate the effectiveness, safety, and tolerability of moxifloxacin (MXF (intravenous [IV] or sequential therapy [IV followed by oral] under daily treatment conditions in a large number of patients with respiratory tract infections.Design: Patients with a diagnosis of respiratory tract infection should be treated with MXF IV and/or tablets 400 mg once daily for a duration at the physician's discretion. For each patient, the physician documented data at an initial visit and at the end of therapy (EOT visit and/or, in the case of sequential therapy, an interim visit when the patient switched to oral treatment.Results: A total of 1953 patients treated with MXF were documented and were valid for an effectiveness and safety evaluation. An improvement was observed in 98.1% (n = 1911/1949 of patients treated with MXF. Recovery was documented in 89.9% (n = 1754/1951 of the patients. At the EOT visit, severity of infection was assessed to be "relieved" or at least "improved" in 96.5% (n = 1873/1940 of the patients. Physicians assessed overall effectiveness as "good" or "very good" in 93.3% (n = 1822/1953 of all patients. The physicians' overall tolerability rating was "very good" or "good" in 93.5% (n

  16. Letter from the Editor

    Directory of Open Access Journals (Sweden)

    Germán A. Prieto

    2018-01-01

    Full Text Available Letter from the editor Our first issue of 2018 is available now. We have 9 articles in this issue, in topics ranging from soil characterization, petrophysical properties of rocks, signal processing of images and GNSS station to asteroid impact effects. Mechanical soil properties in sandy-pebble soil are studied as a function of grain size content in Lu et al. Satellite-derived soil moisture estimation is discussed in Thanabalan and Vidhya, based on a semi-empirical approach and backscattering images. Macroscopic mechanical characteristics of rocks depend on a number of factors, including microstructure damage. Under changing temperature conditions (freeze-thaw rock samples studied by Jiang show significant strength decrease, which has important consequences in engineering. Advanced signal processing methods are used in Zeng et al. for image retrieval applied to remote sensing data, using a Bayesian network approach. Similarly, Oktar and Erdogan use linear trend and wavelet analysis to continuous GNSS data showing both displacements due to tectonic as well as atmospheric and hydrologic effects. Debris flows can in some cases become serious hazards because they can block river flow as a debris flow dam. Chen et al. propose a method to identify the formation of such dams, with an example from the Er river in Taiwan. Mamaseni et al. study the petrophysical properties of three formations in the Duhok Basin, northern Iran, based on well-log data. Results suggest a significant thickness with good moveable hydrocarbons in the study area. Methane adsorption and gas content are strongly influenced by shale composition. Zhu et al. show that Total Organic Content has a stronger influence on methane adsorption and gas content than the mineral composition, studying samples from the southern Sichuan Basin. Our last contribution in this issue discussed a large asteroid impact in eastern Colombia. The impact would have affected the environment and landscape, but

  17. Disease burden of COPD in China: a systematic review

    Directory of Open Access Journals (Sweden)

    Zhu B

    2018-04-01

    Full Text Available Bifan Zhu,1 Yanfang Wang,2 Jian Ming,3 Wen Chen,4 Luying Zhang4 1Shanghai Health Development Research Center, Shanghai Medical Information Center, Shanghai, China; 2The First Affiliated Hospital of Wannan Medical College, Wuhu, China; 3IQVIA, Shanghai, China; 4School of Public Health, Fudan University, Shanghai, China Abstract: Chronic obstructive pulmonary disease (COPD is one of the main contributors to the global burden of disease. The aim of this systematic review was to quantify the disease burden of COPD in China and to determine the risk factors of the disease. The number of studies included in the review was 47 with an average quality assessment score of 7.70 out of 10. Reported COPD prevalence varied between 1.20% and 8.87% in different provinces/cities across China. The prevalence rate of COPD was higher among men (7.76% than women (4.07%. The disease was more prevalent in rural areas (7.62% than in urban areas (6.09%. The diagnostic rate of COPD patients in China varied from 23.61% to 30.00%. The percentage of COPD patients receiving outpatient treatment was around 50%, while the admission rate ranged between 8.78% and 35.60%. Tobacco exposure and biomass fuel/solid fuel usage were documented as two important risk factors of COPD. COPD ranked among the top three leading causes of death in China. The direct medical cost of COPD ranged from 72 to 3,565 USD per capita per year, accounting for 33.33% to 118.09% of local average annual income. The most commonly used scales for the assessment of quality of life (QoL included Saint George Respiratory Questionnaire, Airways Questionnaire 20, SF-36, and their revised versions. The status of QoL was worse among COPD patients than in non-COPD patients, and COPD patients were at higher risks of depression. The COPD burden in China was high in terms of economic burden and QoL. In view of the high smoking rate and considerable concerns related to air pollution and smog in China, countermeasures

  18. Effects of water stress and seed mass on germination and ...

    African Journals Online (AJOL)

    enoh

    2012-03-01

    Mar 1, 2012 ... polyvinylpyrrolidone; TCA, trichloroacetic acid; NBT, nitroblue tetrazolium; TBA ..... seeds had weaker resistances to moderate stress (-0.6. MPa) compared with .... Chen YN,Chen YP,Li WH,Zhang HF (2003). Response of ...

  19. How Many Women Are Affected by or at Risk of Preeclampsia?

    Science.gov (United States)

    ... pregnancy outcomes: Differences among 4 racial/ethnic groups. American Journal of Public Health, 95 (9), 1545–1551. Lin, H. C., Chen, S. F., Lin, H. C., & Chen, Y. H. (2010). Increased risk of adverse pregnancy outcomes ...

  20. Proceedings – Mathematical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Yanheng Chen1 2 Guiyun Chen1. School of Mathematics and Statistics, Southwest University, Chongqing 400715, People's Republic of China; School of Mathematics and Statistics, Chongqing Three Gorges University, Chongqing 404100, People's Republic of China ...

  1. Kinetic investigation on enantioselective hydrolytic resolution of ...

    African Journals Online (AJOL)

    Kinetic investigation on enantioselective hydrolytic resolution of epichlorohydrin by crude epoxide hydrolase from domestic duck liver. X Ling, D Lu, J Wang, J Chen, L Ding, J Chen, H Chai, P Ouyang ...

  2. 77 FR 11620 - Notice of Request for the Extension of a Currently Approved Information Collection

    Science.gov (United States)

    2012-02-27

    ... Reduction Act of 1995, this notice announces the intention of the Federal Transit Administration (FTA) to... INFORMATION CONTACT: Roy Chen, FTA Office of Technology, (202) 366-0462, or email: royweishun.chen@dot.gov...

  3. Reference: 291 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 291 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16244906i Chai Mao-Feng...d chloroplast protection. 4 553-64 16244906 2005 Nov Plant molecular biology An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Chen Ye-Miao|Wang Xue-Chen

  4. Paeonia lactiflora Pall. protects against ANIT-induced cholestasis by activating Nrf2 via PI3K/Akt signaling pathway

    Directory of Open Access Journals (Sweden)

    Ma X

    2015-09-01

    Full Text Available Xiao Ma,1,2 Yan-ling Zhao,2 Yun Zhu,3 Zhe Chen,1,2 Jia-bo Wang,4 Rui-yu Li,1,4 Chang Chen,1,2 Shi-zhang Wei,1,2 Jian-yu Li,3 Bing Liu,5 Rui-lin Wang,3 Yong-gang Li,3 Li-fu Wang,3 Xiao-he Xiao4 1Pharmacy College, Chengdu University of Traditional Chinese Medicine, Chengdu, People’s Republic of China; 2Department of Pharmacy, 302 Military Hospital of People’s Liberation Army, Beijing, People’s Republic of China; 3Department of Integrative Medical Center, 302 Military Hospital of People’s Liberation Army, Beijing, People’s Republic of China; 4China Military Institute of Chinese Medicine, 302 Military Hospital of People’s Liberation Army, Beijing, People’s Republic of China; 5School of Chinese Medicine, The University of Hong Kong, Hong Kong Background: Paeonia lactiflora Pall. (PLP, a traditional Chinese herbal medicine, has been used for hepatic disease treatment over thousands of years. In our previous study, PLP was shown to demonstrate therapeutic effect on hepatitis with severe cholestasis. The aim of this study was to evaluate the antioxidative effect of PLP on alpha-naphthylisothiocyanate (ANIT-induced cholestasis by activating NF-E2-related factor 2 (Nrf2 via phosphatidylinositol 3-kinase (PI3K/Akt signaling pathway. Materials and methods: Liquid chromatography-mass spectrometry (LC-MS was performed to identify the main compounds present in PLP. The mechanism of action of PLP and its therapeutic effect on cholestasis, induced by ANIT, were further investigated. Serum indices such as total bilirubin (TBIL, direct bilirubin (DBIL, aspartate aminotransferase (AST, alanine aminotransferase (ALT, alkaline phosphatase (ALP, γ-glutamyl transpeptidase (γ-GT, and total bile acid (TBA were measured, and histopathology of liver was also performed to determine the efficacy of treatment with PLP. Moreover, in order to illustrate the underlying signaling pathway, liver glutathione (GSH content and mRNA or protein levels of glutamate

  5. EDITORIAL: Focus on Iron-Based Superconductors FOCUS ON IRON-BASED SUPERCONDUCTORS

    Science.gov (United States)

    Hosono, Hideo; Ren, Zhi-An

    2009-02-01

    -L Drechsler, N Kozlova, M Bartkowiak, J E Hamann-Borrero, G Behr, K Nenkov, H-H Klauss, H Maeter, A Amato, H Luetkens, A Kwadrin, R Khasanov, J Freudenberger, A Köhler, M Knupfer, E Arushanov, H Rosner, B Büchner and L Schultz Low-energy spin dynamics in the antiferromagnetic phase of CaFe2As2 N J Curro, A P Dioguardi, N ApRoberts-Warren, A C Shockley and P Klavins Muon spin rotation study of magnetism and superconductivity in BaFe2-xCoxAs2 and Pr1-xSrxFeAsO C Bernhard, A J Drew, L Schulz, V K Malik, M Rössle, Ch Niedermayer, Th Wolf, G D Varma, G Mu, H-H Wen, H Liu, G Wu and X H Chen Magnetic impurities in the pnictide superconductor Ba1-xKxFe2As2 Sutirtha Mukhopadhyay, Sangwon Oh, A M Mounce, Moohee Lee, W P Halperin, N Ni, S L Bud'ko, P C Canfield, A P Reyes and P L Kuhns Neutron scattering investigation of the magnetic order in single crystalline BaFe2As2 M Kofu, Y Qiu, Wei Bao, S-H Lee, S Chang, T Wu, G Wu and X H Chen An NMR study on the F-doping evolution of the iron oxypnictide LaFeAs(O1-xFx) Y Nakai, S Kitagawa, K Ishida, Y Kamihara, M Hirano and H Hosono The peculiar physical properties and phase diagram of BaFe2-xCoxAs2 single crystals X F Wang, T Wu, G Wu, R H Liu, H Chen, Y L Xie and X H Chen Synthesis of LnFeAsO1-y superconductors (Ln=La and Nd) using the high-pressure technique Kiichi Miyazawa, Kunihiro Kihou, Motoyuki Ishikado, Parasharam M Shirage, Chul-Ho Lee, Nao Takeshita, Hiroshi Eisaki, Hijiri Kito and Akira Iyo Correlation effects in the iron pnictides Qimiao Si, Elihu Abrahams, Jianhui Dai and Jian-Xin Zhu Competition/coexisitence of magnetism and superconductivity in iron pnictides probed by muon spin rotation Soshi Takeshita and Ryosuke Kadono Impurity-induced in-gap state and Tc in sign-reversing s-wave superconductors: analysis of iron oxypnictide superconductors Yuko Senga and Hiroshi Kontani Intrinsic magnetic properties of the superconductor NdFeAsO0.9F0.1 from local and global measurements R Prozorov, M E Tillman, E D Mun and P C Canfield

  6. Variability of glomerular filtration rate estimation equations in elderly Chinese patients with chronic kidney disease

    Directory of Open Access Journals (Sweden)

    Liu X

    2012-10-01

    Full Text Available Xun Liu,1,2,* Mu-hua Cheng,3,* Cheng-gang Shi,1 Cheng Wang,1 Cai-lian Cheng,1 Jin-xia Chen,1 Hua Tang,1 Zhu-jiang Chen,1 Zeng-chun Ye,1 Tan-qi Lou11Division of Nephrology, Department of Internal Medicine, The Third Affiliated Hospital of Sun Yet-sun University, Guangzhou, China; 2College of Biology Engineering, South China University of Technology, Guangzhou, China; 3Department of Nuclear Medicine, The Third Affiliated Hospital of Sun Yet-sun University, Guangzhou, China *These authors contributed equally to this paperBackground: Chronic kidney disease (CKD is recognized worldwide as a public health problem, and its prevalence increases as the population ages. However, the applicability of formulas for estimating the glomerular filtration rate (GFR based on serum creatinine (SC levels in elderly Chinese patients with CKD is limited.Materials and methods: Based on values obtained with the technetium-99m diethylenetriaminepentaacetic acid (99mTc-DTPA renal dynamic imaging method, 319 elderly Chinese patients with CKD were enrolled in this study. Serum creatinine was determined by the enzymatic method. The GFR was estimated using the Cockroft–Gault (CG equation, the Modification of Diet in Renal Disease (MDRD equations, the Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI equation, the Jelliffe-1973 equation, and the Hull equation.Results: The median of difference ranged from −0.3–4.3 mL/min/1.73 m2. The interquartile range (IQR of differences ranged from 13.9–17.6 mL/min/1.73 m2. Accuracy with a deviation less than 15% ranged from 27.6%–32.9%. Accuracy with a deviation less than 30% ranged from 53.6%–57.7%. Accuracy with a deviation less than 50% ranged from 74.9%–81.5%. None of the equations had accuracy up to the 70% level with a deviation less than 30% from the standard glomerular filtration rate (sGFR. Bland–Altman analysis demonstrated that the mean difference ranged from −3.0–2.4 mL/min/1.73 m2. However, the

  7. Abstracts from the 15th International Myopia Conference

    Directory of Open Access Journals (Sweden)

    Alexandra Benavente-Perez

    2016-11-01

    Full Text Available Table of contents O1 Changes in peripheral refraction associated with decreased ocular axial growth rate in marmosets Alexandra Benavente-Perez, Ann Nour, Tobin Ansel, Kathleen Abarr, Luying Yan, Keisha Roden, David Troilo O2 PPARα activation suppresses myopia development by increasing scleral collagen synthesis--a new drug target to suppress myopia development Chanyi Lu, Miaozhen Pan, Min Zheng, Jia Qu, Xiangtian Zhou O3 Evidence and possibilities for local ocular growth regulating signal pathways Christine F Wildsoet O4 Myopia researches at Eye Hospital of Wenzhou Medical University Fan Lu, Xiangtian Zhou, Jie Chen, Jinhua Bao, Liang Hu, Qinmei Wang, Zibing Jin, Jia Qu O5 Color, temporal contrast and myopia Frances Rucker, Stephanie Britton, Stephan Hanowsky, Molly Spatcher O6 The impact of atropine usage on visual function and reading performance in myopic school children in Taiwan Hui-Ying Kuo, Ching-Hsiu Ke, I-Hsin Kuo, Chien-Chun Peng, Han-Yin Sun O7 Increased time outdoors prevents the onset of myopia: evidence from randomised clinical trials Ian G Morgan O8 Environmental risk factors and gene-environment interactions for myopia in the ALSPAC cohort Jeremy A. Guggenheim, Rupal L. Shah, Cathy Williams O9 Retinal metabolic profiling identifies declines in FP receptor-linked signaling as contributors to form-deprived myopic development in guinea pigs Jinglei Yang, Peter S. Reinach, Sen Zhang, Miaozhen Pan, Wenfeng Sun, Bo Liu, Xiangtian Zhou O10 The study of peripheral refraction in moderate and high myopes after one month of wearing orthokeratology lens Jun Jiang, Haoran Wu, Fan Lu O11 Axial length of school children around the earth’s equatorial area and factors affecting the axial length Kazuo Tsubota, Hiroko Ozawa, Hidemasa Torii, Shigemasa Takamizawa, Toshihide Kurihara, Kazuno Negishi O12 Processing of defocus in the chicken retina by retinal ganglion cells Klaus Graef, Daniel Rathbun, Frank Schaeffel O13 Blue SAD light protects

  8. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Chen Bin1 Zeng Zhirong1 Wu Xiaoqin1 Chen Minhu1 Li Mei1 Gao Xiang1 Chen Baili1 Hu Pinjin1. Department of Gastroenterology, the First Affiliated Hospital, Sun Yat-sen University, 58 Zhongshan II Road, Guangzhou 510080, People's Republic of China ...

  9. Tropical Journal of Pharmaceutical Research - Vol 15, No 3 (2016)

    African Journals Online (AJOL)

    Wan Wu, Wei Chen, Qiong Jin, 447-451 ... Chung-Shih Chen, Mei-Lin Wang, Rosa Huang Liu, Shih-Pin Chen, Tsong-Ming Lu, Wei-Yu Tsai, Chien-Fu Huang, ... Yan-Qiong Li, Rui Hu, Li-Hui Zhong, Qian Sun, You-Ping Yan, 527-533.

  10. Untitled

    Indian Academy of Sciences (India)

    Beak P and Chen C W 1985 Tetrahedron Lett. 4979. Boatman R J, Whitlock B J and Whitlock H W 1977 J. An. Chen. Soc. 99 4822. Diamond S E, Szalkiewicz A and Mares F 1979 J. Ann. Chen. Soc. 101 490. Ellefson C R 1979 J. Org. Chem. 44 1533. Gschwend H W and Rodriguez H R 1979 Organic reactions 26 Chapter I.

  11. Untitled

    Indian Academy of Sciences (India)

    Smith and Carson ... Z. Physikal. Chenn., 1908, 6, 200. 13. Ephraim ... Z. anord. Chen., 190S, 58, 33S. 14. Wright ... J. Chen. Soc, 1915, 107, 1527. 15. Amadori ... Gazetta, 1922, 1, 52, 387. 16. Mori ... J. Chen. Soc., Japa), 1923, 44, 730. 17. Waradachari and Subra- Proc. Ind. Acad, Sci., 1936, 3 A, 428. Ilala. 18. Hervey and ...

  12. Three new species of the genus Gnamptogenys (Hymenoptera, Formicidae from southern China with a key to the known Chinese species

    Directory of Open Access Journals (Sweden)

    Zhilin Chen

    2017-02-01

    Full Text Available Three new species of the genus Gnamptogenys Roger, 1863 are described from southern China: Gnamptogenys dentihumera Chen, Lattke & Zhou, sp. n., Gnamptogenys nanlingensis Chen, Lattke & Zhou, sp. n. and Gnamptogenys quadrutinodules Chen, Lattke & Zhou, sp. n. A distribution map and an identification key to workers for the known species of China are provided.

  13. Sadhana | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Influence of free water content on the compressive mechanical behaviour of cement mortar under high strain rate · Jikai Zhou Xudong Chen Longqiang Wu Xiaowei Kan ... pp 111-117. Mechanical properties of concrete to cyclic uniaxial tensile loading using variable waveforms · YUZHI CHEN XUDONG CHEN JINGWU BU.

  14. Construction of full-length cDNA library of white flower Salvia ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-05-18

    May 18, 2009 ... of S. miltiorrhiza bge (Yuan et al., 1990; Wang et al.,. 1998; Huang et al., 2000). Hairy roots and ... or A. tumefaciens strains (Chen et al., 1997; Song et al.,. 1997). ..... Chen H, Yuan JP, Chen F, Zhang YL, Song JY (1997).

  15. Study on spatial-temporal change of Changsha-Zhuzhou-Xiangtan urban agglomeration based on DMSP / OLS night light data

    Science.gov (United States)

    Li, Mao; Li, Lel-in

    2018-03-01

    For the sake of curbing the spreading of Changsha-Zhuzhou-Xiangtan urban agglomeration and spatial disorder in the process of urbanization development on the regional bearing capacity of land resources and ecological environment and assisting to plan the integration process of ChangZhuTan,this paper uses the DMSP/OLS night light data of Chang ZhuTan in 1992 to 2013 to invert the urbanization process index of ChangZhuTan urban agglomeration. Based on the two scales of time and space, this paper analyzes the average index of lights, the speed of urban expansion and urban compactness index et al and studies the temporal and spatial characteristics of ChangZhuTan urban agglomeration in this period.

  16. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Lihua Jiang1 Aiyi Zhu1 Jianse Zhang1 Changwen Wu1. National Engineering Research Center of Marine Facilities Aquaculture, College of Marine Science, Zhejiang Ocean University, Zhoushan 316022, China ...

  17. Marginal scorch caused by Alternaria alternata on Purple-Caitai ...

    African Journals Online (AJOL)

    Marginal scorch caused by Alternaria alternata on Purple-Caitai (Brassia campestris L. ssp. chinensis L.var. utilis Tsen et Lee) in China. Qijun Nie, Zhongjiu Jiao, Fengjuan Zhu, Zhenbiao Jiao, Xiaohui Deng, Zhengming Qiu, Jinping Wu ...

  18. Peng et al., Afr J Tradit Complement Altern Med. (2015) 12(5):35-45 ...

    African Journals Online (AJOL)

    Proff.Adewunmi

    as a kind of specific application of syndrome differentiation, You Gu Wu Yun, documented .... Zhi-Zhu-Wan (ZZW), a famous Chinese medical preparation used to treat functional dyspepsia, contains Aurantii fructus ..... Abdominal pain, vomiting,.

  19. An implicit non-staggered Cartesian grid method for incompressible ...

    Indian Academy of Sciences (India)

    Immersed boundary; non-staggered; implicit; viscous flow. 1. ... functions for elastic boundaries (Saiki & Biringen 1996; Lai & Peskin 2000; Zhu & Peskin ... the effects of pressure and thereby explicitly achieving a strong coupling between them.

  20. Efficacy of traditional Chinese herbal medicine in the treatment of ...

    African Journals Online (AJOL)

    Department, 3Department of Vascular Surgery, The Teaching Hospital of Chengdu University of Traditional Chinese Medicine,. Chengdu, Sichuan ... Background: The rate of gastrointestinal adenomatous polyps, often regarded as precancerous lesions, developing ..... Ling-Bai-Zhu on promoting apoptosis of transplanted.

  1. Genomewide analysis of MATE-type gene family in maize reveals ...

    Indian Academy of Sciences (India)

    Huasheng Zhu and Jiandong Wu contributed equally to this work. As a group of secondary active transporters, the MATE gene family consists of multiple genes that widely exist in ..... Roots of the stress-treated plants were collected at 0,.

  2. Right Sizing the People’s Liberation Army: Exploring the Contours of China’s Military

    Science.gov (United States)

    2007-09-01

    Diyuan yu Zhongguo Haijun Jianshe” (“Stratgeic Geography and the Development of China’s Navy”), Shijie Jingji yu Zhengzhi (World Economics and...on conventional [missile forces] (hechang jianbei, yi chang wei zhu ); • Bring out focal points, put priority on quality (tuchu zhongdian, zhiliang...Juece” [“2nd Artillery Command & Control Decision- Making During a Joint Campaign”], Junshi Xueshu, July 2004, p. 65. 30. Shang Yi, “ Zhu Chenghu

  3. The People in the PLA: Recruitment, Training, and Education in China’s Military

    Science.gov (United States)

    2008-09-01

    programs of instruction in related logistics engineering fields. 177 Military Economics Academy (Junshi jingji xueyuan, 军事经济学院)74 The Military...Director Zhu Fazhong is a career specialist in space, satellite, and testing issues and the former director of the Taiyuan launch testing center. Deputy...retirements frequently take place at that meeting and are announced in January or shortly thereafter. 57. Both Zhu Fazhong (born in 1948) and Zhang Jianqi

  4. Right-Sizing the People’s Liberation Army: Exploring the Contours of China’s Military

    Science.gov (United States)

    2007-09-01

    yu Zhongguo Haijun Jianshe" ("Stratgeic Geography and the Development of China’s Navy"), Shijie Jingji yu Zhengzhi (World Economics and Politics...They are: "* Maintain conventional and nuclear [missile forces], but put priority on conventional [missile forces] (hechang jianbei, yi chang wei zhu ...Zuozhan Zhihui Juece" [Ŗnd Artillery Command & Control Decision- Making During a Joint Campaign"], Junshi Xueshu, July 2004, p. 65. 30. Shang Yi, " Zhu

  5. Coping with the Dragon: Essays on PLA Transformation and the U.S. Military

    Science.gov (United States)

    2007-12-01

    Industry], September 2002, 15–16. 19 “ Zhu Rongji Talks at Defense Group Ceremony,” Beijing Central Television Programme One Network, 1 July 1999, in FBIS...Scientific and Technological Industries Out of Their Predicament,” Junshi Jingji Yanjiu [Military Economic Research], January 1998, 8. 32...military official, Beijing, December 2003. 27 Zhu Qinglin and Meng Renzhong (Chief Eds), Zhongguo Caijun Yu Guofang Ziyuan Peizhi Yanjiu [China’s

  6. Estimation of Uncertainties of Full Moment Tensors

    Science.gov (United States)

    2017-10-06

    For our moment tensor inversions, we use the ‘cut-and-paste’ ( CAP ) code of Zhu and Helmberger (1996) and Zhu and Ben-Zion (2013), with some...modifications. For the misfit function we use an L1 norm Silwal and Tape (2016), and we incorporate the number of misfitting polarities into the waveform... norm of the eigenvalue triple provides the magnitude of the moment tensor, leaving two free parameters to define the source type. In the same year

  7. Studies of the Effects of Perfluorocarbon Emulsions on Platelet Number and Function in Models of Critical Battlefield Injury

    Science.gov (United States)

    2016-09-01

    notwithstanding any other provision of law, no person shall be subject to any penalty for failing to comply with a collection of information if it...Jiepei Zhu, MD PhD, Bruce D. Spiess, MD. Evaluation of Noninvasive Cardiac Output Monitoring in Sheep with Hemodynamic Instability 2. 2016,Aug, Military...Zhu, J., Holloway, K.L., Parsons, J.T. Intracerebral hematoma incidence in a coagulopathic sheep model of deep brain stimulation (DBS) surgery

  8. RLE (Research Laboratory of Electronics) Progress Report Number 130

    Science.gov (United States)

    1988-07-01

    Ippen, James G. Fujimoto, Wei-Zhu Lin, Beat Zysset, Robert W. Schoenlein, 4 Michael J. Lagasse The investigation of transient carrier dynamics in GaAs...G. Fujimoto, Wei-Zhu Lin, Reginald Birngruber, Beat Zysset, Robert W. Schoenleln Working in collaboration with researchers at the Massachusetts Eye... Binaural Hearing National Institutes of Health (Grant 5 RO 1 NS 10916) H. Steven Colburn, Nathaniel 1. Durlach, Patrick M. Zurek 17 Brooklyn College14 141

  9. EDITORIAL: Nanotechnology under the skin Nanotechnology under the skin

    Science.gov (United States)

    Demming, Anna

    2011-07-01

    spectrum. Like microorganisms that can be critical to life processes and fatal too, there is no doubt a little yin-yang in the role of nanoparticles in our future. Perhaps one of the exciting elements in nanomedical research is the possibility of putting materials with potentially harmful characteristics to use for healing. The results of scientific endeavour at the nanoscale continue to progress our understanding, allowing us to maximise the potential of nanotechnology within informed restrictions. Where knowledge lays the boundaries, a little imagination adds wings, and the current state of research in nanomedicine seems well set to take flight. References [1] Grecco A C P 2011 Nanotechnology 22 265103 [2] Zhu X, Wang J, Zhang X, Chang Y and Chen Y 2009 Nanotechnology 20 195103 [3] Liu Y et al 2009 Nanotechnology 20 415102 [4] Weinstein S and Peer D 2010 Nanotechnology 22 232001 [5] Iijima S 1991 Nature 354 56-8 [6] Ou Z, Wu B, Xing D, Zhou F, Wang H and Tang Y 2009 Nanotechnology 20 105102 [7] Wallace E J and Sansom M S P 2009 Nanotechnology 20 045101 [8] Zhu Y, Ran T, Li Y, Guo J and Li W 2006 Nanotechnology 17 4668 [9] Lam C-W, James J T, McCluskey R and Hunter R L 2004 Toxicol. Sci. 77 126-34

  10. Two new genera and three new species of Epipaschiinae Meyrick from China (Lepidoptera, Pyralidae

    Directory of Open Access Journals (Sweden)

    Mingqiang Wang

    2017-12-01

    Full Text Available Two new genera of Epipaschiinae are described. The genus Arcanusa Wang, Chen & Wu, gen. n. is established for Ar. apexiarcanusa Wang, Chen & Wu, sp. n. and Ar. sinuosa (Moore, 1888, comb. n., described in Scopocera Moore, 1888 (junior synonym of Stericta Lederer, 1863. The female genitalia of Ar. sinuosa (Moore, 1888, comb. n. are described for the first time. Androconia Wang, Chen & Wu, gen. n. is erected, including two new species, An. rallusa Wang, Chen & Wu, sp. n. and An. morulusa Wang, Chen & Wu, sp. n. Illustrations of all adults and their genitalia, and a key to the two new genera are provided.

  11. Revision of the subfamily Opiinae (Hymenoptera, Braconidae from Hunan (China, including thirty-six new species and two new genera

    Directory of Open Access Journals (Sweden)

    Li Xi-Ying

    2013-02-01

    postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915, O. ambiguus Weng & Chen, 2005 (not Wesmael, 1835 and O. mitis Chen & Weng, 2005 (not Fischer, 1963 are primary homonyms and are renamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. and O. wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005 comb. n., Diachasmimorpha longicaudata (Ashmead, 1905 and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957 comb. n. is new for China and Hunan; Xynobius maculipennis (Enderlein, 1912 comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005 comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005 comb. n., A. tracta (Weng & Chen, 2005 comb. n., Areotetes laevigatus (Weng & Chen, 2005 comb. n., Phaedrotoma dimidia (Chen & Weng, 2005 comb. n., P. improcera (Weng & Chen, 2005 comb. n., P. amputata (Weng & Chen, 2005 comb. n., P. larga (Weng & Chen, 2005 comb. n., P. osculas (Weng & Chen, 2005 comb. n., P. postuma (Chen & Weng, 2005 comb. n., P. rugulosa (Chen & Weng, 2005 comb. n., P. tabularis (Weng & Chen, 2005 comb. n., Rhogadopsis apii (Chen & Weng, 2005 comb. n., R. dimidia (Chen & Weng, 2005 comb. n., R. diutia (Chen & Weng, 2005 comb. n., R. longuria (Chen & Weng, 2005 comb. n., R. pratellae (Weng & Chen, 2005 comb. n., R. pratensis (Weng & Chen, 2005 comb. n., R. sculpta (Chen & Weng, 2005 comb. n., R. sulcifer (Fischer, 1975 comb. n., R. tabidula (Weng & Chen, 2005 comb. n., Xynobius complexus (Weng & Chen, 2005 comb. n

  12. Bacterioplankton abundance and production in Indian Ocean Regions

    Digital Repository Service at National Institute of Oceanography (India)

    Ramaiah, N.; Fernandes, V.; Rodrigues, V.V.; Paul, J.T.; Gauns, M.

    ) console. Although eu- photic depth varied widely in these locations, from as shallow as ~25 m in the bay to as deep as 150 m in the EIO, to be consistant with the JGOFS protocols followed widely, eight discrete depths (viz surface, 10, 20, 40, 60, 80... standing stocks calculated using 11 fg C per bacterial cell. Data from discrete sam- pling depths averaged from different stations in CAS, central Ara- bian Sea; EAS, eastern Arabian Sea; WB, western Bay of Bengal; CB, central Bay of Bengal; EIO...

  13. New stable isotope records of sediment cores from the SE Arabian Sea - Inferences on the variations in monsoon regime during the late Quaternery

    Digital Repository Service at National Institute of Oceanography (India)

    Thamban, M.; Rao, V.P.

    , Vidyanagar 671 123, India We reconstruct here the changes in regional hydr o- graphy related to the fluctuations in Indian mo n soons du r ing the late Quaternary based on the stable isotope composition of the foraminifers and organic matter in three... value du r ing the early Holocene for the eastern Arabian Sea 21 . The SW monsoon intensity was very weak and the dry NE mo n soon was the dominant feature during the LGM in the Ar a bian Sea 3 . The cool winds of the north - easterly winter...

  14. Reversible Redox-Induced Modulation of Sterics in an α-Diimine Ligand Coordinated to Gallium

    Energy Technology Data Exchange (ETDEWEB)

    Zarkesh, Ryan A. [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Foster, Michael E. [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Ichimura, Andrew S. [San Francisco State Univ., CA (United States); Anstey, Mitchell R. [Davidson College, Davidson, NC (United States)

    2017-07-01

    The ability to tune the steric envelope through redox events post-synthetically or in tandem with other chemical processes is a powerful tool that could assist in enabling new catalytic methodologies and understanding potential pitfalls in ligand design. The α-diimine ligand, dmp-BIAN, exhibits the peculiar and previously unreported feature of varying steric profiles depending on oxidation state when paired with a main group element. A study of the factors that give rise to this behaviour as well as its impact on the incorporation of other ligands is performed.

  15. Introduction to Indian Ocean biogeochemical processes and ecological variability: Current understanding and emerging perspectives

    Digital Repository Service at National Institute of Oceanography (India)

    Wiggert, J.D.; Hood, R.R.; Naqvi, S.W.A.; Brink, K.H.; Smith, S.L.

    stream_size 35035 stream_content_type text/plain stream_name Geophys_Monogr_Ser_185_1.pdf.txt stream_source_info Geophys_Monogr_Ser_185_1.pdf.txt Content-Encoding UTF-8 Content-Type text/plain; charset=UTF-8 � Indian... inter- pretations of zooplankton observations obtained during the JGOFS cruises of the mid-�990s through the use of a food web synthesis that elucidates how mesozooplankton and mi- crozooplankton contribute to carbon flows within the Ara- bian Sea...

  16. モンゴル時代の「道仏論争」の実像:クビライの中国支配への道

    OpenAIRE

    中村淳

    1994-01-01

    The disputes between one sect of Taoism Quan-zhen-jiao (全真教) and the Zen sect (禅宗) of Buddhism arose three times in the reign of the Emperor Möngke. According to the Zhi-yuan-bian-wei-lu (至元辯偽録) compiled by a Buddhist monk which have been regarded as the only relevant literature, it is reported that these disputes ended in a victory for Buddhism. As the result of examining relevant parts of a report of mission composed by William of Rubruck and a Tibetan chronicle Hu-lan-deb-ther, we have fou...

  17. An authentication scheme for secure access to healthcare services.

    Science.gov (United States)

    Khan, Muhammad Khurram; Kumari, Saru

    2013-08-01

    Last few decades have witnessed boom in the development of information and communication technologies. Health-sector has also been benefitted with this advancement. To ensure secure access to healthcare services some user authentication mechanisms have been proposed. In 2012, Wei et al. proposed a user authentication scheme for telecare medical information system (TMIS). Recently, Zhu pointed out offline password guessing attack on Wei et al.'s scheme and proposed an improved scheme. In this article, we analyze both of these schemes for their effectiveness in TMIS. We show that Wei et al.'s scheme and its improvement proposed by Zhu fail to achieve some important characteristics necessary for secure user authentication. We find that security problems of Wei et al.'s scheme stick with Zhu's scheme; like undetectable online password guessing attack, inefficacy of password change phase, traceability of user's stolen/lost smart card and denial-of-service threat. We also identify that Wei et al.'s scheme lacks forward secrecy and Zhu's scheme lacks session key between user and healthcare server. We therefore propose an authentication scheme for TMIS with forward secrecy which preserves the confidentiality of air messages even if master secret key of healthcare server is compromised. Our scheme retains advantages of Wei et al.'s scheme and Zhu's scheme, and offers additional security. The security analysis and comparison results show the enhanced suitability of our scheme for TMIS.

  18. Browse Title Index

    African Journals Online (AJOL)

    Items 51 - 100 of 1309 ... Li-Long Liu, Kai Xu, Lu-Mei Kang, Shu-Ping Jiang, Qing-Hua Wang, ... CR Sewani-Rusike, JE Iputo, EJ Ndebia, M Gondwe, DR Kamadyaapa ... K-M Man, W-C Chen, H-M Wang, H-Y Chen, J-L Shen, L-D Chen, F-J Tsai, ...

  19. Soil Behavior Under Blast Loading

    Science.gov (United States)

    2010-12-01

    in detail (Lade 2005, Prevost and Popescu 1996, Chen and Baladi 1985). Models that are appropriate to be implemented into finite element programs...Chen and Baladi 1985). As the soil strain hardens, both the cone and the end cap expand. This concept of cap envelope was a major step forward...hardening cap model (Chen and Baladi 1985) 17 The modified Cam-clay model was developed at Cambridge University by Roscoe et al. (1963). This

  20. Reference: 418 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 418 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16856986i Chai Mao-Feng...cid responses in Arabidopsis. 5 665-74 16856986 2006 Sep The Plant journal An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Wang Xue-Chen|Wei Peng-Cheng|Yang Shuhua

  1. Taiwan in 2004: Elections, Referenda, and Other Democratic Challenges

    National Research Council Canada - National Science Library

    Dumbaugh, Kerry

    2005-01-01

    .... In both the presidential and legislative election campaigns, Chen emphasized gaining a separate international identity for Taiwan -- an emphasis to which Beijing strenuously objected as dangerously...

  2. 77 FR 28880 - Ocean Transportation Intermediary License Applicants

    Science.gov (United States)

    2012-05-16

    ... (NVO & OFF), 332 Hindry Avenue, Inglewood, CA 90301, Officers: Edison Chen, Manager (Qualifying..., Schiller Park, IL 60176, Officers: Scott A. Case, Vice President (Qualifying Individual), Thomas C. Case...

  3. 2000年《照明工程学报》总目次

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Equipment of Sealing by Clamp for Compact Fluorescent Lamps Li Jiankang(1-1) A Study on Relationshop between Flicker of Fluorescent Lamp and Visual Fatigue Gu Yimin Zhou Jian et al.(1-7) Development of Photon Multiplication Material Zheng Muzhou(1-11) New Light Sources for Automobiles Wang Erghen(1-15) Artificial Neural Network Applicable for Light Guide Lighting Wang Aiying(1-21) A Comprehensive Method for Evaluating Light Environment in Housing Zhang Yaogen Zhang Jianping et al.(1-25) The Technical Measures of Raising the Illumination Quality for Residences Dai Yuxing(1-29) Simulated Photoelectric System of Colour Vision Liu Enyu(2-1) Measurement of the Temperature Distribution on the Filaments of the Automotive Lamps Using the Spectroscopic Method Zhou Wei Zhou Taiming Lu Zhunhao et al.(2-8) Ecoconstruction Electrical Light Source Yang Shiguang(2-11) The Algorithms of Ray Tracing used in Computer Aided Headlamp Design Yuan Jiao Zhu Minghua(2-17) A Study of Starting Process of Metal Halide Lamp (with auxiliary electrode) When Operating by Ballast-Ignitor System Lou Xiaomei Zhu Dingchang(2-20) The Design and Calculation of Perforated Metal Sheet Zhang Haicong David Chang(2-25) Improving the Relationship between the Fluorescent Lamp's Life-span and It's Burning Point Electrocircuit Wang Haiou et al.(3-1) The Design and Study on Intelligent Multiple Lamp Switch System Wang Lucai et al.(3-6) The Technique of a Si-Al Chemical Compound in Water Solvent Coating Phosphor with It's Controling System Leng Huji et al.(3-9) Self-dosing Technology and Control System-Research for Compact Fluorescet lamp Chen Gang(3-11) The Key Technology of Fluorescent Lamps by Analyzing the Quality of Swizerland FALMA′S Compact Fluorescent lamp Leng Huji et al.(3-13) An Approch to Setting the Time of Technical Performance in Lamp Production Line Zhao Jianyu(3-17) A Study of the Spectral Visual Matching Method He Guoxing(3-20) Examing the Uniformity of the Colour Spaces of CIE CAM97s by Counstructing

  4. High performance all polymer solar cells fabricated via non-halogenated solvents (Presentation Recording)

    Science.gov (United States)

    Zhou, Yan; Bao, Zhenan

    2015-10-01

    crystallinity, surface roughness, charge carrier mobility, and absorptions of the polymers blends are found irrelevant to the performance of these all polymer solar cells. This work demonstrates that a better understanding of tuning polymer phase separation domain size provides an important path towards high performance, all-polymer solar cells. The use of polymer side-chain engineering provides an effective molecular engineering approach that may be combined with additional processing parameter control to further elevate the performance of all-polymer solar cells. We obtained a record PCE of 4.8% (avarage from 20 devices), with an average JSC of 9.8 mA cm-2. The highest PCE shoots to 5.1%, with JSC as high as 10.2 mA cm-2, and VOC of 1.02 V. It is the highest performance ever published for an all-polymer solar cell.4 1. Li, G.; Zhu, R.; Yang, Y., Nat. Photon. 2012, 6 , 153-161. 2. (a) Nelson, J., Mater. Today 2011, 14 , 462-470; (b) Lin, Y.; Li, Y.; Zhan, X., Chem. Soc. Rev. 2012, 41, 4245-4272; (c) Chen, J.; Cao, Y., Acc. Chem. Res. 2009, 42, 1709-1718. 3. Sonar, P.; Fong Lim, J. P.; Chan, K. L., Energy Environ. Sci. 2011, 4, 1558. 4. Facchetti, A., Mater. Today 2013, 16 , 123-132.

  5. Retrospective analysis of non-laboratory-based adverse drug reactions induced by intravenous radiocontrast agents in a Joint Commission International-accredited academic medical center hospital in China

    Directory of Open Access Journals (Sweden)

    Chen QL

    2017-04-01

    Full Text Available Qin-lan Chen,1 Xiao-ying Zhao,2 Xiao-mi Wang,1 Na Lv,2 Ling-ling Zhu,3 Hui-min Xu,4 Quan Zhou4 1Radiology Nursing Unit, Division of Nursing, 2Department of Quality Management, 3Geriatric VIP Care Ward, Division of Nursing, 4Department of Pharmacy, The Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China Abstract: The authors retrospectively analyzed the pattern and characteristics of non-laboratory-based adverse drug reactions (ADRs induced by intravenous radiocontrast agents in a large-scale hospital in China during 2014–2015. There were 314 ADR cases among 118,208 patients receiving enhanced CT or MRI examinations. The frequency of moderate/severe ADRs defined by Chinese Society of Radiology (ie, severe vomiting, systematic urticaria, facial swelling, dyspnea, vasovagal reaction, laryngeal edema, seizure, trembling, convulsions, unconsciousness, shock, death, and other unexpected adverse reactions was rare (0.0431%, whereas the mild ADRs were uncommon (0.2225% and accounted for 83.76% of ADRs. Frequency of ADRs induced by iodinated contrast agents was related with examination site, sex, and type of patient settings (P<0.01 and was higher compared with gadolinium contrast agents (0.3676% vs 0.0504%, P<0.01. From 2014 to 2015, frequencies of total and moderate/severe ADRs induced by iodinated contrast agents decreased significantly (0.4410% vs 0.2947%, P<0.01; 0.0960% vs 0.0282%, P<0.01, respectively. Frequency of ADRs differed among different iodinated contrast and gadolinium contrast (P<0.05 agents. Iopromide’s ADR frequency in 2014 was significantly higher compared with iopamidol, ioversol, or iohexol (P<0.01. Frequency of moderate/severe ADRs induced by iodixanol was 4.1–5.4 times that of iohexol, iopromide, or iopamidol. Rash was the predominant ADR subtype (84.39% and occurred more frequently with iodixanol compared with iohexol, iopamidol, or ioversol (P<0

  6. Determination of single-nucleotide polymorphism in the proximal promoter region of apolipoprotein M gene in coronary artery diseases

    Directory of Open Access Journals (Sweden)

    Lu Zheng

    2009-09-01

    Full Text Available Lu Zheng1, Guanghua Luo1, Xiaoying Zhang1, Jun Zhang1, Jiang Zhu1, Jiang Wei1, Qinfeng Mu1, Lujun Chen1, Peter Nilsson-Ehle2, Ning Xu21Comprehensive Laboratory, The Third Affiliated Hospital, Suzhou University, Changzhou China; 2Division of Clinical Chemistry and Pharmacology, Department of Laboratory Medicine, Lund University, Lund, SwedenObjective: It has been reported that single-nucleotide polymorphism (SNP in the proximal promoter region of apolipoprotein M (apoM gene may confer the risk in the development of type 2 diabetes (T2D and coronary artery disease (CAD in the Han Chinese. However, in a recent study demonstrated that plasma apoM level did not correlated to the coronary heart disease. In the present studies, we investigated the SNP T-778C of apoM gene in CAD patients and controls in the Han Chinese population. Moreover we examined whether serum apoM levels could be influenced by this promoter mutation.Material and methods: One hundred twenty-six CAD patients and 118 non-CAD patients were subjected in the present study. All patients were confirmed by the angiography. The genotyping of polymorphisms T-778C in apoM promoter was determined by real-time polymerase chain reaction. Serum apoM levels were semi-quantitatively determined by the dot-blotting analysis. Results: Distribution of apoM T-778C genotype in non-CAD patients was as following: 84.7% were T/T, 15.3% were T/C and 0.0% was C/C. T allele frequencies were 92.4% and C allele, 7.6%. In the CAD patients, 99 patients (78.6% had the T/T genotype, 25 patients (19.8% with T/C genotype and 2 patients (1.6% with C/C genotype. The allele frequency was 88.5% for the T allele and 11.5% for the C allele. There was no statistical significant difference of serum apoM levels found in these three genotypes.Conclusions: There was no significant difference in allele or genotype frequencies between CAD patients and non-CAD patients. Binary logistic regression analysis with adjustments for age

  7. Analysis of pramipexole dose–response relationships in Parkinson's disease

    Directory of Open Access Journals (Sweden)

    Wang Y

    2016-12-01

    Full Text Available Ying Wang,1 Sheng-Gang Sun,2 Sui-Qiang Zhu,3 Chun-Feng Liu,4 Yi-Ming Liu,5 Qing Di,6 Hui-Fang Shang,7 Yan Ren,8 Wei Xiang,9 Sheng-Di Chen1 1Department of Neurology, Ruijin Hospital Affiliated to Shanghai Jiao Tong University School of Medicine, Shanghai, 2Department of Neurology, Union Hospital Affiliated to Tongji Medical College of Huazhong University of Science and Technology, Wuhan, 3Department of Neurology, Tongji Hospital Affiliated to Tongji Medical College of Huazhong University of Science and Technology, Wuhan, 4Department of Neurology, The Second Affiliated Hospital of Soochow University, Suzhou, 5Department of Neurology, Qilu Hospital Affiliated to Shandong University, Jinan, 6Department of Neurology, Nanjing Brain Hospital, Nanjing, 7Department of Neurology, West China Hospital Affiliated to Sichuan University, Chengdu, 8Department of Neurology, First Affiliated Hospital of China Medical University, Shenyang, 9Medical Department, Boehringer Ingelheim (China Investment Co., Ltd., Shanghai, People’s Republic of China Background: Pramipexole (PPX, a non-ergot dopamine receptor agonist, is a first-line treatment for Parkinson’s disease (PD. A critical dose level above which a better benefit-to-harm ratio exists has not been examined.Methods: Chinese PD patients (n=464 were retrospectively analyzed by PPX maintenance dose, PD stage, combined levodopa dose, and baseline tremor contribution. The sum score of Baseline Activities of Daily Living (part II and Motor Examination (III of the Unified Parkinson’s Disease Rating Scale (UPDRS II+III was used as a covariate for final score adjustment.Results: Sustained-release (SR and immediate-release (IR PPX showed similar efficacy based on score changes at 18 weeks, with comparable tolerability. Approximately two-third of patients received PPX at ≥1.5 mg/d, and one fourth of patients had ≥20% tremor contribution to UPDRS II+III. After treatment, patients receiving PPX ≥1.5 mg/d showed

  8. Preclinical evaluation of a urokinase plasminogen activator receptor-targeted nanoprobe in rhesus monkeys

    Directory of Open Access Journals (Sweden)

    Chen Y

    2015-10-01

    Full Text Available Yushu Chen,1 Li Gong,2 Ning Gao,3 Jichun Liao,1 Jiayu Sun,1 Yuqing Wang,1 Lei Wang,1 Pengjin Zhu,1 Qing Fan,1 Yongqiang Andrew Wang,4 Wen Zeng,2 Hui Mao,3 Lily Yang,5 Fabao Gao11Molecular Imaging Center, Department of Radiology, West China Hospital, Sichuan University, Chengdu, 2Sichuan Primed Bio-Tech Group Co, Ltd, Chengdu, People’s Republic of China; 3Department of Radiology and Imaging Sciences, Emory University School of Medicine, Atlanta, GA, 4Ocean NanoTech, LLC, San Diego, CA, 5Department of Surgery, Emory University School of Medicine, Atlanta, GA, USAPurpose: To translate a recombinant peptide containing the amino-terminal fragment (ATF of urokinase plasminogen activator receptor-targeted magnetic iron oxide (IO nanoparticles (uPAR-targeted human ATF-IONPs into clinical applications, we conducted a pilot study to evaluate the toxicity and pharmacokinetics of this nanoparticle in normal rhesus monkeys.Methods: We assessed the changes in the following: magnetic resonance imaging (MRI signals from pretreatment stage to 14 days posttreatment, serum iron concentrations from 5 minutes posttreatment to 12 weeks posttreatment, routine blood examination and serum chemistry analysis results from pretreatment stage to 12 weeks after administration, and results of staining of the liver with Perls’ Prussian Blue and hematoxylin–eosin at 24 hours and 3 months posttreatment in two rhesus monkeys following an intravenous administration of the targeted nanoparticles either with a polyethylene glycol (ATF-PEG-IONP or without a PEG (ATF-IONP coating.Results: The levels of alkaline phosphatase, alanine transaminase, and direct bilirubin in the two monkeys increased immediately after the administration of the IONPs but returned to normal within 20 days and stayed within the normal reference range 3 months after the injection. The creatinine levels of the two monkeys stayed within the normal range during the study. In addition, red blood cells

  9. Whole-body MRI versus 18F-FDG PET/CT for pretherapeutic assessment and staging of lymphoma: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Wang D

    2018-06-01

    Full Text Available Danyang Wang,1 Yanlei Huo,1 Suyun Chen,1 Hui Wang,1 Yingli Ding,2 Xiaochun Zhu,3 Chao Ma1,4 1Department of Nuclear Medicine, Affiliated XinHua Hospital of Shanghai Jiaotong University School of Medicine, Shanghai, China; 2Department of Nuclear Medicine, Affiliated Third People’s Hospital of Shanghai Jiaotong University School of Medicine, Shanghai, China; 3Department of Nuclear Medicine, Affiliated Ninth People’s Hospital of Shanghai Jiaotong University School of Medicine, Shanghai, China; 4Department of Nuclear Medicine, Tenth People’s Hospital of Tongji University, Shanghai, China Purpose: 18F-fluorodeoxyglucose (18F-FDG positron emission tomography/computed tomography (PET/CT is the reference standard in staging of 18F-FDG-avid lymphomas; however, there is no recommended functional imaging modality for indolent lymphomas. Therefore, we aimed to compare the performance of whole-body magnetic resonance imaging (WB-MRI with that of 18F-FDG PET/CT for lesion detection and initial staging in patients with aggressive or indolent lymphoma. Materials and methods: We searched the MEDLINE, EMBASE, and CENTRAL databases for studies that compared WB-MRI with 18F-FDG PET/CT for lymphoma staging or lesion detection. The methodological quality of the studies was assessed using version 2 of the “Quality Assessment of Diagnostic Accuracy Studies” tool. The pooled staging accuracy (µ of WB-MRI and 18F-FDG PET/CT for initial staging and for assessing possible heterogeneity (χ2 across studies were calculated using commercially available software. Results: Eight studies comprising 338 patients were included. In terms of staging, the meta-analytic staging accuracies of WB-MRI and 18F-FDG PET/CT for Hodgkin lymphoma and aggressive non-Hodgkin lymphoma (NHL were 98% (95% CI, 94%–100% and 98% (95% CI, 94%–100%, respectively. The pooled staging accuracy of 18F-FDG PET/CT dropped to 87% (95% CI, 72%–97% for staging in patients with indolent lymphoma

  10. Peripheral venous blood neutrophil-to-lymphocyte ratio predicts survival in patients with advanced gastric cancer treated with neoadjuvant chemotherapy

    Directory of Open Access Journals (Sweden)

    Chen L

    2017-05-01

    Full Text Available Li Chen,1 Yanjiao Zuo,1 Lihua Zhu,2 Yuxin Zhang,3 Sen Li,1 Fei Ma,4 Yu Han,5 Hongjiang Song,1 Yingwei Xue11Department of Gastrointestinal Surgery, Harbin Medical University Cancer Hospital, Harbin Medical University, Harbin, Heilongjiang, 2Department of Pathogen Biology, School of Basic Medical Sciences, North China University of Science and Technology, Tangshan, Hebei, 3Department of General Surgery, Mudanjiang First People’s Hospital, Mudanjiang, 4Department of Breast Surgery, 5Department of Gastrointestinal Oncology, Harbin Medical University Cancer Hospital, Harbin Medical University, Harbin, Heilongjiang, People’s Republic of ChinaBackground: Accurate and useful predictors of gastric carcinoma treated with neoadjuvant chemotherapy are lacking at present. We aim to explore the potential prognostic significance of the neutrophil-to-lymphocyte ratio (NLR in advanced gastric cancer receiving S-1 plus oxaliplatin (SOX or oxaliplatin and capecitabine (XELOX regimen.Methods: We enrolled 91 patients with advanced gastric cancer treated with neoadjuvant chemotherapy from August 2008 to September 2015. The peripheral venous blood samples were collected before neoadjuvant chemotherapy. The NLR was divided into two groups: low NLR <2.17 group and high NLR ≥2.17 group. Univariate analysis on disease-free survival (DFS and overall survival (OS were generated using the Kaplan–Meier method and compared using the log-rank test. Prognostic factors were assessed by univariate analyses, and the independent prognostic factors were evaluated using multivariate analysis (Cox’s proportional-hazards regression model.Results: The univariate analysis showed that median DFS and median OS were worse for high NLR values than low NLR values before neoadjuvant chemotherapy (median DFS: 19.97 and 26.87 months, respectively, P=0.299; median OS: 25.83 and 29.73 months, respectively, P=0.405. Multivariate analysis showed that the NLR before neoadjuvant

  11. Electrospun nanofibrous SF/P(LLA-CL membrane: a potential substratum for endothelial keratoplasty

    Directory of Open Access Journals (Sweden)

    Chen JZ

    2015-05-01

    Full Text Available Junzhao Chen,1,* Chenxi Yan,1,* Mengyu Zhu,1,* Qinke Yao,1 Chunyi Shao,1 Wenjuan Lu,1 Jing Wang,2 Xiumei Mo,2 Ping Gu,1 Yao Fu,1 Xianqun Fan1 1Department of Ophthalmology, Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine, 2Biomaterials and Tissue Engineering Laboratory, College of Chemistry and Chemical Engineering and Biotechnology, Donghua University, Shanghai, People’s Republic of China *These authors contributed equally to this work Background: Cornea transplant technology has progressed markedly in recent decades, allowing surgeons to replace diseased corneal endothelium by a thin lamellar structure. A thin, transparent, biocompatible, tissue-engineered substratum with corneal endothelial cells for endothelial keratoplasty is currently of interest. Electrospinning a nanofibrous structure can simulate the extracellular matrix and have beneficial effects for cell culture. Silk fibroin (SF has good biocompatibility but poor mechanical properties, while poly(L-lactic acid-co-Ɛ-caprolactone (P(LLA-CL has good mechanical properties but poor biocompatibility. Blending SF with P(LLA-CL can maintain the advantages of both these materials and overcome their disadvantages. Blended electrospun nanofibrous membranes may be suitable for regeneration of the corneal endothelium. The aim of this study was to produce a tissue-engineered construct suitable for endothelial keratoplasty.Methods: Five scaffolds containing different SF:P(LLA-CL blended ratios (100:0, 75:25, 50:50, 25:75, 0:100 were manufactured. A human corneal endothelial (B4G12 cell line was cultured on the membranes. Light transmission, speed of cell adherence, cell viability (live-dead test, cell proliferation (Ki-67, BrdU staining, and cell monolayer formation were detected on membranes with the different blended ratios, and expression of some functional genes was also detected by real-time polymerase chain reaction.Results: Different blended ratios of scaffolds

  12. Pharmacokinetics, tissue distribution, and metabolites of a polyvinylpyrrolidone-coated norcantharidin chitosan nanoparticle formulation in rats and mice, using LC-MS/MS

    Directory of Open Access Journals (Sweden)

    Ding XY

    2012-04-01

    Full Text Available Xin-Yuan Ding1, Cheng-Jiao Hong2, Yang Liu1, Zong-Lin Gu1, Kong-Lang Xing1, Ai-Jun Zhu1, Wei-Liang Chen1, Lin-Seng Shi1, Xue-Nong Zhang1, Qiang Zhang31Department of Pharmaceutics, College of Pharmaceutical science, Soochow University, Suzhou, 2Jiang Su Provincial Key Laboratory of Radiation Medicine and Protection, Suzhou, 3Department of Pharmaceutics, School of Pharmaceutical Science, Peking University, Beijing, People’s Republic of ChinaAbstract: A novel formulation containing polyvinylpyrrolidone (PVP K30-coated norcantharidin (NCTD chitosan nanoparticles (PVP–NCTD–NPs was prepared by ionic gelation between chitosan and sodium tripolyphosphate. The average particle size of the PVP–NCTD–NPs produced was 140.03 ± 6.23 nm; entrapment efficiency was 56.33% ± 1.41%; and drug-loading efficiency was 8.38% ± 0.56%. The surface morphology of NCTD nanoparticles (NPs coated with PVP K30 was characterized using various analytical techniques, including X-ray diffraction and atomic force microscopy. NCTD and its metabolites were analyzed using a sensitive and specific liquid chromatography-tandem mass spectrometry method with samples from mice and rats. The results indicated the importance of the PVP coating in controlling the shape and improving the entrapment efficiency of the NPs. Pharmacokinetic profiles of the NCTD group and PVP–NCTD–NP group, after oral and intravenous administration in rats, revealed that relative bioavailabilities were 173.3% and 325.5%, respectively. The elimination half-life increased, and there was an obvious decrease in clearance. The tissue distribution of NCTD in mice after the intravenous administration of both formulations was investigated. The drug was not quantifiable at 6 hours in all tissues except for the liver and kidneys. The distribution of the drug in the liver and bile was notably improved in the PVP–NCTD–NP group. The metabolites and excretion properties of NCTD were investigated by analyzing

  13. Pharmacokinetic drug interactions with clopidogrel: updated review and risk management in combination therapy

    Directory of Open Access Journals (Sweden)

    Wang ZY

    2015-03-01

    Full Text Available Zhi-Yu Wang,1 Meng Chen,1 Ling-Ling Zhu,2 Lu-Shan Yu,3 Su Zeng,3 Mei-Xiang Xiang,4 Quan Zhou1 1Department of Pharmacy, 2VIP Care Ward, Division of Nursing, the Second Affiliated Hospital, School of Medicine, 3Department of Pharmaceutical Analysis and Drug Metabolism, College of Pharmaceutical Sciences, 4Department of Cardiology, the Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang Province, People’s Republic of China Background: Coprescribing of clopidogrel and other drugs is common. Available reviews have addressed the drug–drug interactions (DDIs when clopidogrel is as an object drug, or focused on combination use of clopidogrel and a special class of drugs. Clinicians may still be ignorant of those DDIs when clopidogrel is a precipitant drug, the factors determining the degree of DDIs, and corresponding risk management.Methods: A literature search was performed using PubMed, MEDLINE, Web of Science, and the Cochrane Library to analyze the pharmacokinetic DDIs of clopidogrel and new P2Y12 receptor inhibitors.Results: Clopidogrel affects the pharmacokinetics of cerivastatin, repaglinide, ferulic acid, sibutramine, efavirenz, and omeprazole. Low efficacy of clopidogrel is anticipated in the presence of omeprazole, esomeprazole, morphine, grapefruit juice, scutellarin, fluoxetine, azole antifungals, calcium channel blockers, sulfonylureas, and ritonavir. Augmented antiplatelet effects are anticipated when clopidogrel is coprescribed with aspirin, curcumin, cyclosporin, St John’s wort, rifampicin, and angiotensin-converting enzyme inhibitors. The factors determining the degree of DDIs with clopidogrel include genetic status (eg, cytochrome P540 [CYP]2B6*6, CYP2C19 polymorphism, CYP3A5*3, CYP3A4*1G, and CYP1A2-163C>A, species differences, and dose strength. The DDI risk does not exhibit a class effect, eg, the effects of clopidogrel on cerivastatin versus other statins, the effects of proton pump

  14. Effects of drug pharmacokinetic/pharmacodynamic properties, characteristics of medication use, and relevant pharmacological interventions on fall risk in elderly patients

    Directory of Open Access Journals (Sweden)

    Chen Y

    2014-06-01

    Full Text Available Ying Chen,1 Ling-Ling Zhu,2 Quan Zhou3 1Liaison Office of Geriatric VIP Patients, 2First Geriatric VIP Ward, Division of Nursing, 3Department of Pharmacy, Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, People’s Republic of China Background: Falls among the elderly are an issue internationally and a public health problem that brings substantial economic and quality-of-life burdens to individuals and society. Falls prevention is an important measure of nursing quality and patient safety. Numerous studies have evaluated the association of medication use with fall risk in elderly patients. However, an up-to-date review has not been available to summarize the multifaceted pharmaceutical concerns in the prevention of medication-related falls. Materials and methods: Relevant literature was identified by performing searches in PubMed, Web of Science, and the Cochrane Library, covering the period until February 2014. We included studies that described an association between medications and falls, and effects of drug pharmacokinetic/pharmacodynamic properties, characteristics of medication use, and pharmacological interventions on fall risk in elderly patients. The full text of each included article was critically reviewed, and data interpretation was performed. Results: Fall-risk-increasing drugs (FRIDs include central nervous system-acting agents, cough preparations, nonsteroidal anti-inflammatory drugs, anti-Alzheimer’s agents, antiplatelet agents, calcium antagonists, diuretics, α-blockers, digoxin, hypoglycemic drugs, neurotoxic chemotherapeutic agents, nasal preparations, and antiglaucoma ophthalmic preparations. The degree of medication-related fall risk was dependent on one or some of the following factors: drug pharmacokinetic/pharmacodynamic properties (eg, elimination half-life, metabolic pathway, genetic polymorphism, risk rating of medications despite belonging to the same therapeutic class and

  15. A secure smart-card based authentication and key agreement scheme for telecare medicine information systems.

    Science.gov (United States)

    Lee, Tian-Fu; Liu, Chuan-Ming

    2013-06-01

    A smart-card based authentication scheme for telecare medicine information systems enables patients, doctors, nurses, health visitors and the medicine information systems to establish a secure communication platform through public networks. Zhu recently presented an improved authentication scheme in order to solve the weakness of the authentication scheme of Wei et al., where the off-line password guessing attacks cannot be resisted. This investigation indicates that the improved scheme of Zhu has some faults such that the authentication scheme cannot execute correctly and is vulnerable to the attack of parallel sessions. Additionally, an enhanced authentication scheme based on the scheme of Zhu is proposed. The enhanced scheme not only avoids the weakness in the original scheme, but also provides users' anonymity and authenticated key agreements for secure data communications.

  16. [Exploration and analysis of the thought of medical education in the Shanghai New Chinese Medical College].

    Science.gov (United States)

    Li, Ming; Shang, Li; Bing, Shoulan

    2014-11-01

    Shanghai New Chinese Medical College set up by Zhu Nanshan and his sons, Zhu Xiaonan and Zhu Hegao, was a medical college of traditional Chinese medicine (TCM) with the most innovative spirit in modern time. Its affiliated research institute held the principle of "realizing the scientific truth of TCM, training TCM advanced talents", marking the beginning of the pioneering of "scientific TCM". The educational plan, clinical research and academic organization based on "carrying forward the quintessence of Chinese culture, absorbing and digesting the new knowledge" showed a certain influence at home and abroad. The College advocated the combination of communicating with famous physicians and the study of theory, cultivation of students' organization and academic society, launching of journals, and organizing students' research associations was aiming at the satisfaction of the social needs and teaching orientation. Its running experience provided useful reference for modern TCM medical education.

  17. China's efforts to shed its title of "Leader in liver disease".

    Science.gov (United States)

    Li, X; Xu, W F

    2007-10-01

    According to Xinhua News, Chen Zhu, China's Minister of Health, mentioned at the 2007 Annual Conference of the China Association for Science and Technology (CAST) that an action plan for the diagnosis and treatment of hepatitis B could control hepatitis B virus (HBV) infection to below 1% by 2050. This plan is one of the Health Ministry's goals for middle-long-term development planning in medical science and technology that China is endeavoring to reach (http://hbv.39.net/079/18/127612.html, available as of September 18, 2007). The Ministry's strategy involves a series of action plans for other areas like HIV, tuberculosis, malignant tumor control, and mental health, but chronic HBV therapy is more important and more urgent. HBV infection is a leading cause of illness and death in China. Approximately 60% of the population has a history of HBV infection, and 9.8% of persons in China are chronically infected with HBV and at risk for premature death from liver disease. Each year, an estimated 263,000 persons in China die from HBV-related liver cancer or cirrhosis, accounting for 37%~50% of HBV-related deaths worldwide (Available as a report from the Centers for Disease Control and Prevention (CDC), 2007;56:441-445. http://www.cdc.gov/mmwr/previe / mmwrhtml/mm5618a2.htm, May 11, 2007). Besides China, HBV is highly prevalent in approximately 45% of the global population and is found in the Far East, parts of the Middle East, sub-Saharan Africa, parts of South America, and the Amazon basin, where at least 8% of the population are HBV chronic carriers (hepatitis B surface antigen [HBsAg] positivity rates > 8%) (Figure 1) (Int J Med Sci 2005;2:50-57). China seems to have become a "Leader in liver disease." Annually, more than 1,000 billion RMB is spent on HBV therapy and prevention, while the resulting indirect economic losses are inestimable. The reasons for the high rates of chronic HBV infection in China are complex. First, HBV infection has broad clinical

  18. China QIUSHI SEEKING TRUTH no 3, 1 August 1988

    Science.gov (United States)

    1988-09-16

    Legal Principles in Law Circles in Recent Years 40 A New ’Political Economy’ Textbook Is Compiled in the Soviet Union [Dan Zhu ] 43 On ’Writings...Analysis on Results" (hereafter called "Census") which has been published by Zhongguo Caizheng Jingji Chubanshe (China Finance and Economics Publishing...HK2508082288 Beijing Q1USHI[SEEKING TRUTH] in Chinese No 3, 1 Aug 88 p 44 [Article by Dan Zhu 0030 4554 of the Chinese Academy of Social Sciences

  19. Annual Staunton Hill Conference on China’s People Liberation Army (PLA) (2nd) Held in Staunton Hill, Virginia on September 6 - 8, 1991

    Science.gov (United States)

    1991-09-01

    in FBIS-CHI-91-O55. 25-26; Guo about seven percent in the military budget. From 1980 to 1989. Xiangxing and Zhu Bin, "First Generation Ship-Based...China’s Military Expenditure in the Last Ten Years," Jingji 67JFJB, 9 March 1991. Yangjiu (Economics Studies], no. 6 (20 June 1990). 77-81, 6 The...frence on the PLA 1. Given that there have been more massive Li Ruihuan, Zhu Rongji pro-reform demonstrations in a major metropolitan or Qiao Shi 1% 4

  20. Transnational Pipelines and Naval Expansion: Examining China’s Oil Insecurities in the Indian Ocean

    Science.gov (United States)

    2008-06-01

    Wenmu, “China’s Energy Security and Strategy Studied,” Shijie Jingji Yu Zhengzhi 5 (2003): FBIS-CPP20030528000169. 7 Downs, “China,” 14. 4 oil...indicated that China plays the Sino-Pakistani friendship very well when competing for development projects within Pakistan. 84 Zhu Moqing, “China...Team up on Energy.” The Christian Science Monitor, April 13 2007, 6. Moqing, Zhu . “China Will Invest US$12 Billion in Pakistan.” Shanghaidaily.com

  1. Two new species of the stonefly genus Amphinemura (Insecta, Plecoptera, Nemouridae) from China.

    Science.gov (United States)

    Ji, Xiao-Yu; Du, Yu-Zhou; Wang, Zhi-Jie

    2014-01-01

    Two new species of the genus Amphinemura Ris from China are described and illustrated, i.e. A. annulata Du & Ji, sp. n. from Zhejiang, Shanxi, Shaanxi and Guizhou Province, and A. lingulata Du & Wang, sp. n. from Shaanxi and Sichuan Province. A. annulata is similar to A. tricintusidens Wang & Zhu in having an apical cavity of the epiproct, but the epiproct ventral sclerite and the median paraproct lobe of the two species are different. A. lingulata is related to A. didyma Zhu & Yang in having the similar epiproct, but they differ mostly in paraproct median and outer lobes.

  2. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences. Chen Fang. Articles written in Journal of Biosciences. Volume 30 Issue 3 June 2005 pp 351-357 Articles. Expression of a ribosome inactivating protein (curcin 2) in Jatropha curcas is induced by stress · Wei Qin Huang Ming-Xing Xu Ying Zhang Xin-Shen Chen Fang · More Details ...

  3. Evaluation of effectiveness in a novel wound healing ointment ...

    African Journals Online (AJOL)

    Evaluation of effectiveness in a novel wound healing ointment-crocodile oil burn ointment. Hua-Liang Li, Yi-Tao Deng, Zi-Ran Zhang, Qi-Rui Fu, Ya-Hui Zheng, Xing-Mei Cao, Jing Nie, Li-Wen Fu, Li-Ping Chen, You-Xiong Xiong, Dong-Yan Shen, Qing-Xi Chen ...

  4. Enhanced Thermal Transport of Surfaces with Superhydrophobic Coatings

    Science.gov (United States)

    2015-07-01

    resistance conferred by superhydrophobic fluorinated polyacrylate-silica composite coatings on cold-rolled steel. Journal of Applied Polymer Science... thiolates on metals as a form of nanotechnology. ChemInform. 2005:36. doi: 10.1002/chin.200532281. 9. Chen C-H, Cai Q, Tsai C, Chen C-L, Xiong G

  5. Advances in SCA and RF-DNA Fingerprinting Through Enhanced Linear Regression Attacks and Application of Random Forest Classifiers

    Science.gov (United States)

    2014-09-18

    22:477– 505 , 2007. [21] Bushnell, Michael L. and Vishwani Agrawal. Essentials of Electronic Testing for Digital, Memory, and Mixed-Signal VLSI...Investigation”. Knowledge and information systems, 10(4):453–472, 2006. [68] Liang, Nia -Chiang, Ping-Chieh Chen, Tony Sun, Guang Yang, Ling-Jyh Chen

  6. A comparative study assessing a new tool for occluding ...

    African Journals Online (AJOL)

    0.630, p=0.068 and p=0.047, respectively) (Table 2). A comparative study assessing a new tool for occluding parenchymal blood flow during liver resection for hepatocellular carcinoma. S Zhou, X-J Xue, R-R Li, D-F Chen, W-Y Chen, G-X Liu, ...

  7. (DEPSCOR FY 09) Obfuscation and Deobfuscation of Intent of Computer Programs

    Science.gov (United States)

    2012-12-21

    increased as the malware distribution mechanism has moved to the web through infected sites. In this use a site is hacked so as to distribute malware to...Simpósio Brasileiro em Segurança da Informaçao e de Sistemas Computacionais (2009). (Chen et al., 2012) Jundong Chen, Matthias R. Brust, Vir V. Phoha

  8. The roles of electronic books in the transformation of learning and instruction

    NARCIS (Netherlands)

    Huang, Ronghuai; Chen, Nian-Shing; Kang, Myunghee; McKenney, Susan; Churchill, Daniel

    2014-01-01

    Huang, R., Chen, N., Kang, M. McKenney, S. & Churchill, D. (2013). The roles of electronic books in the transformation of learning and instruction. In N. Chen, R. Huang, Kinshuk, Y. Li, D. G. Sampson (Eds.) Proceedings of the IEEE 13th International Conference on Advanced Learning Technologies

  9. Trend analysis and change point detection of annual and seasonal ...

    Indian Academy of Sciences (India)

    elevation ranges from 0 m in the coastal areas of the. Persian Gulf to over ... been explained by Kang and Yusof (2012); Dhorde ...... J L 2004 Detection of statistically significant trends in ... Sun H, Chen Y, Li W, Li F, Chen Y, Hao X and Yang Y.

  10. The effects of growth time on the quality of graphene synthesized by ...

    Indian Academy of Sciences (India)

    by LPCVD. A JAFARI, R ALIPOUR∗ and M GHORANNEVISS ..... Li T, Hass J, Marchenkoy A N, Conrad E H, First P N and de ... Ni Z H, Chen W, Fan X F, Kuo J L, Yu T, Wee A T S ... Chen S, Cai W, Piner R D, Suk J W, Wu Y, Ren Y, Kang Y.

  11. Genome-Wide Chromosomal Targets of Oncogenic Transcription Factors

    Science.gov (United States)

    2008-04-01

    Altman, W.E., Attiya, S., Bader, J.S., Bemben, L.A., Berka , J., Braverman, M.S., Chen, Y.J., Chen, Z., et al. 2005. Genome sequencing in microfabricated...software after filtering to exclude bad spots. qPCR validation. Primer pairs used in Figure 1 were designed to cover three peaks and three troughs in

  12. The Response of Small Scale Rigid Targets to Shallow Buried Explosive Detonations

    Science.gov (United States)

    2011-09-01

    properties as applied in this work was based on some of the standard defini- tions of soil constitutive properties as found in, e.g., Chen and Baladi [18...Technology Corporation; 2007. [18] Chen WF, Baladi GY. Soil plasticity: theory and implementation. New York: Elsevier Science; 1985. [19] Zimmerman

  13. Application of an Arbitrary Lagrangian Eulerian Method to Describe High Velocity Gas-Particle Flow Behavior

    Science.gov (United States)

    2011-09-01

    applied in this work was based on some of the standard definitions of soil constitutive properties as found in, e.g., Chen and Baladi [20], and...Livermore, CA. [20] Chen, W. F., and Baladi , G. Y., 1985. Soil Plasticity: Theory and Implementation. Elsevier Science, New York. [21] Zimmerman, H.D

  14. Untitled

    Indian Academy of Sciences (India)

    20. Nevill GA and Cook D 1969 Can. J. Chen. 47 743. 21. Glasel GA 1969 Org. Magn. Reson. 1481. 22. Soundarajan S 1958 Trans. Faraday Soc. 54147. 23. Rein R 1971 Int. J. Quant. Chem., Symp, 4341. 24. Woet D 1972.J. Am. Chen, Soc. 94.8213. 25. Bideau.JP, Huong PV and Toure S 1976 Acta Crystallogr. B32481.

  15. A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBand EFHC2gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN SONG YULAI ...

  16. A reviewof the pharmacologicalmechanism of traditional Chinese ...

    African Journals Online (AJOL)

    A reviewof the pharmacologicalmechanism of traditional Chinese medicine in the intervention of coronary heart disease and stroke. W Zhang, K Gao, K Gao, J Liu, J Liu, H Zhao, H Zhao, J Wang, J Wang, Y Li, Y Li, G Murtaza, G Murtaza, J Chen, J Chen, W Wang, W Wang ...

  17. African Journal of Traditional, Complementary and Alternative ...

    African Journals Online (AJOL)

    Anti-tumour effects of polysaccharides isolated from Artemisia Annua L by inducing cell apoptosis and immunomodulatory anti-hepatoma effects of polysaccharides · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Chen, J Chen, X Wang, C Liu, 15-22.

  18. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    ... Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 95; Issue 1. Novel NPHS1 gene mutations in a Chinese family with congenital nephrotic syndrome. Fengjie Yang Yaxian Chen Yu Zhang Liru Qiu Yu Chen Jianhua Zhou. Research Note Volume 95 Issue 1 March 2016 pp 161- ...

  19. Impacts of DNAPL Source Treatment: Experimental and Modeling Assessment of the Benefits of Partial DNAPL Source Removal

    Science.gov (United States)

    2009-09-01

    this project: A. Noman M. Ahsanuzzaman, Steve Acree, Nandita Basu, Sten Berglund, Carol Bratt, Gordon Brown, Xaisong Chen, Jaehyun Cho, Pat Clark...A.S.C. Chen (eds). Chapelle, F.H., J.S. Widdowson, J.S. Bruner, E. Mendez , and C.C. Casey (2003). Methodology for Estimating Times of Remediation

  20. Enhancement of Radiation Therapy in Prostate Cancer by DNA-PKcs Inhibitor

    Science.gov (United States)

    2015-09-01

    Center, Urology Habib , Amyn; UTSouthwestern Medical Center, Neurology & Neurotherapeutics Chen, Benjamin; UTSouthwestern Medical Center, Radiation...Tsong Hsieh 3,5,7 , Amyn A. Habib 4,5,6 , Benjamin Chen 1,4 and Debabrata Saha 1,4 1 Department of Radiation Oncology, 3 Department of Urology, 4

  1. A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBitalic> and EFHC2italic> gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN ...

  2. Browse Title Index

    African Journals Online (AJOL)

    Vol 9, No 1 (2006), Splenectomy in a rural surgical practice, Abstract PDF. E Alufohai, OO Odusanya. Vol 20, No 9 (2017), Spontaneous Retropharyngeal Emphysema: A Case Report, Abstract PDF. T-H Chi, C-C Hung, R-F Chen, C-H Yuan, J-C Chen. Vol 5, No 2 (2002), Spontaneous Rupture Of A Massive Hydrocephalus ...

  3. 75 FR 7358 - Addition of Certain Persons to the Entity List: Addition of Persons Acting Contrary to the...

    Science.gov (United States)

    2010-02-19

    ... Company Ltd., 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan; and (4) Yi-Lan Chen, a.k.a., Kevin Chen, 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan, and 7th Floor, Number 17... the requirements of the Paperwork Reduction Act of 1995 (44 U.S.C. 3501 et seq.) (PRA), unless that...

  4. 75 FR 4509 - Uniform Criteria for State Observational Surveys of Seat Belt Use

    Science.gov (United States)

    2010-01-28

    ... statistical issues: Ms. Chou-Lin Chen, Chief, Mathematical Analysis Division, National Center for Statistics..., Washington, DC 20590. Telephone number: 202-366-1048; E- mail: Chou-Lin.Chen@dot.gov . For legal issues: Ms..., and reduce burden. E. Paperwork Reduction Act Under the Paperwork Reduction Act of 1995, a person is...

  5. The effects of reciprocal cross on inheritance of DNA methylation in ...

    African Journals Online (AJOL)

    enoh

    2012-03-20

    Mar 20, 2012 ... DNA methylation plays an important role for regulation of gene expression. To study ... genes, and newly acquired epigenetic states of trans- ... GACTGCGTACCAATTCAGA(E6). ATCATGAGTCCTGCTCGGTAC(H6). GACTGCGTACCAATTCAGT(E7) ..... Chen XQ, Ma Y, Chen F, Song WQ, Zhang L (2009).

  6. Sadhana | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    YUZHI CHEN1 2 XUDONG CHEN2 JINGWU BU3. Architectural Engineering Institute, Jinling Institute of Technology, Nanjing 211169, China; College of Civil and Transportation Engineering, Hobai University, Nanjing 210098, China; College of Water Conservancy and Hydropower Engineering, Hohai University, Nanjing ...

  7. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences. Chen Chai. Articles written in Journal of Chemical Sciences. Volume 126 Issue 3 May 2014 pp 813-820 Regular Articles. First total synthesis of Boehmenan · Yamu Xia Xiaoli Dai Haixin Liu Chen Chai · More Details Abstract Fulltext PDF. The first total synthesis of dilignan ...

  8. Three novel antioxidants from Cinnamomum plants | Cheng | African ...

    African Journals Online (AJOL)

    Three novel antioxidants from Cinnamomum plants. K-C Cheng, H-A Chen, P-F Wu, W-L Yang, H-M Wang, C-Y Chen. Abstract. In this study, we identified three novel antioxidants, subamolide C (1), subamolide E (2) and isokotomolide A (3) from the constitutes of Cinnamomum subavenium and Cinnamomum kotoense.

  9. The validity and accuracy in foot-to-foot bioelectrical impedance ...

    African Journals Online (AJOL)

    The validity and accuracy in foot-to-foot bioelectrical impedance analysis measuring models referenced by dual-energy X-ray absorptiometry in body composition in standing position. KC Hsieh, HK Lu, CH Chen, TR Jang, YY Chen, MF Kao ...

  10. High School Students' Topic Preferences and Oral Development in an English-Only Short-Term Intensive Language Program

    Science.gov (United States)

    Hsieh, Hui-Chen

    2016-01-01

    Developing the ability to speak English is a daunting task that has long been omitted in a test-driven pedagogy context (Chang, 2011; Li, 2012a, 2012b; Chen & Tsai, 2012; Katchen, 1989, 1995). Since speaking is not tested for school admissions, most students are not motivated to learn it (Chang, 2011; Chen & Tsai, 2012). Now, globalization…

  11. Sadhana | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Sadhana. B Chen. Articles written in Sadhana. Volume 38 Issue 4 August 2013 pp 557-569. Flexibility-based structural damage identification using Gauss–Newton method · B Chen S Nagarajaiah · More Details Abstract Fulltext PDF. Structural damage will change the dynamic characteristics, including ...

  12. New St-chromosome-specific molecular markers for identifying ...

    Indian Academy of Sciences (India)

    et al. 1994) or JJsSt (Chen et al. 1998) was widely used in wheat breeding programme (Chen .... Japan). Table 1. The features of primers used in this study. Homologous ..... Redinbaugh M. G., Jones T. A. and Zhang Y. T. 2000 Ubiquity of.

  13. EDITORIAL: Big challenges and nanosolutions Big challenges and nanosolutions

    Science.gov (United States)

    Demming, Anna

    2011-07-01

    population dynamics will evolve throughout future generations attracts considerable debate and a range of strong opinions. But in the meantime, as this issue's review highlights, there is a great deal of scope in exploiting nanotechnology to find potential technological solutions to the challenges increasing populations pose at present. And that's not to mention the intriguing insights into nanoscale physics that may be discovered along the way. References [1] Penza M, Rossi R, Alvisi M and Serra E 2010 Nanotechnology 21 105501 [2] Gu B, Zhu Y, Chang J, Peng C, Liu D, Min Y, Luo W, Howarth R W and Ge Y 2011 Environ. Res. Lett. 6 014011 [3] Galloway J N, Townsend A R, Erisman J W, Bekunda M, Cai Z, Freney J R, Martinelli L A, Seitzinger S P and Sutton M A 2008 Science 320 889-92 [4] Humplik T et al 2011 Nanotechnology 22 292001 [5] Guo Z, Meng F, Luo T, Li M and Liu J 2009 Nanotechnology 20 125501 [6] Chen Y, Chen Z, He Y, Lin H, Sheng P, Liu C, Luo S and Cai Q 2010 Nanotechnology 20 105102 [7] Ren L, Ma L, Jin L, Wang J-B, Qiu M and Yu Y 2009 Nanotechnology 20 405602 [8] Wang Y, Wang G, Wang H, Cai W, Liang C and Zhang L 2009 Nanotechnology 20 156604 [9] Hardin G 1968 Science 162 1243-8

  14. PREFACE: Strongly correlated electron systems Strongly correlated electron systems

    Science.gov (United States)

    Saxena, Siddharth S.; Littlewood, P. B.

    2012-07-01

    make use of 'small' electrons packed to the highest possible density. These are by definition 'strongly correlated'. For example: good photovoltaics must be efficient optical absorbers, which means that photons will generate tightly bound electron-hole pairs (excitons) that must then be ionised at a heterointerface and transported to contacts; efficient solid state refrigeration depends on substantial entropy changes in a unit cell, with large local electrical or magnetic moments; efficient lighting is in a real sense the inverse of photovoltaics; the limit of an efficient battery is a supercapacitor employing mixed valent ions; fuel cells and solar to fuel conversion require us to understand electrochemistry on the scale of a single atom; and we already know that the only prospect for effective high temperature superconductivity involves strongly correlated materials. Even novel IT technologies are now seen to have value not just for novel function but also for efficiency. While strongly correlated electron systems continue to excite researchers and the public alike due to the fundamental science issues involved, it seems increasingly likely that support for the science will be leveraged by its impact on energy and sustainability. Strongly correlated electron systems contents Strongly correlated electron systemsSiddharth S Saxena and P B Littlewood Magnetism, f-electron localization and superconductivity in 122-type heavy-fermion metalsF Steglich, J Arndt, O Stockert, S Friedemann, M Brando, C Klingner, C Krellner, C Geibel, S Wirth, S Kirchner and Q Si High energy pseudogap and its evolution with doping in Fe-based superconductors as revealed by optical spectroscopyN L Wang, W Z Hu, Z G Chen, R H Yuan, G Li, G F Chen and T Xiang Structural investigations on YbRh2Si2: from the atomic to the macroscopic length scaleS Wirth, S Ernst, R Cardoso-Gil, H Borrmann, S Seiro, C Krellner, C Geibel, S Kirchner, U Burkhardt, Y Grin and F Steglich Confinement of chiral magnetic

  15. ABSTRACT

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    Commemorating the 100th Anniversary of the Revolution of 1911 Promoting the Deep Development of the CPC History and National History by the Research and Publication of the History of the Revolution of …………1911 Zhu Jiamu (4)

  16. Biisofraxidin on Apoptosis of Human Gastric Cancer BGC-823 Cells

    African Journals Online (AJOL)

    Wu et al. Trop J Pharm Res, October 2015; 14(10): 1803. Tropical Journal of Pharmaceutical Research ... Jian-Tao Wu1,2*, She-Min Lv1, Chun-Hui Lu1, Jun Gong1 and Jian-Bo An3 ..... Zhu AK, Zhou H, Xia JZ, Jin HC, Wang K, Yan J, Zuo JB,.

  17. Novel technique for prediction of time points for scheduling of multipurpose batch plants

    CSIR Research Space (South Africa)

    Seid, R

    2012-01-01

    Full Text Available . Consequently this avoids costly computational times due to iterations. In the model by Majozi and Zhu (2001) the sequence constraint that pertains to tasks that consume and produce the same state, the starting time of the consuming task at time point p must...

  18. Room temperature deposition of amorphous p-type CuFeO2 and ...

    Indian Academy of Sciences (India)

    fabrication of CuFeO2/n-Si heterojunction by RF sputtering method. TAO ZHU1 ... Transparent conducting amorphous p-type CuFeO2 (CFO) thin film was prepared by radio-frequency ... Delafossite oxides CuMO2 (M is trivalent cation, such as.

  19. Genetics Home Reference: alcohol use disorder

    Science.gov (United States)

    ... use disorder can cause major health, social, and economic problems, and can endanger affected individuals and others ... Available from http://www.ncbi.nlm.nih.gov/books/NBK424857/ Citation on PubMed Zhu EC, Soundy TJ, ... Bulletins Genetics Home Reference Celebrates Its 15th Anniversary ...

  20. Influence of Mechanical Loading on the Integrity and Performance of Energy Harvesting and Storage Materials at the Micron and Submicron Scales

    Science.gov (United States)

    2016-04-01

    16] J. Saunier, F. Alloin, J.Y. Sanchez, L. Maniguet, “Plasticized microporous poly(vinylidene fluoride) separators for lithium-ion batteries. III... International 5, pp. 133-1341, (2013). [20] X.H. Liu, Y. Liu, A. Kushima, S. Zhang, T. Zhu, J. Li, J.Y. Huang, “In Situ TEM Experiment of Electrochemical

  1. Conducting polymer based biomolecular electronic devices

    Indian Academy of Sciences (India)

    Characterization of conducting polymers has been considered to be very .... and CH4) on surface plasmon resonance of Langmuir–Blodgett films of ..... [37] D G Zhu, M C Petty, H Ancelin and J Yarwood, Thin Solid Films 176, 151 (1989).

  2. (Brassica napus L.) cultivars

    African Journals Online (AJOL)

    user

    2011-03-07

    Mar 7, 2011 ... African Journal of Biotechnology Vol. 10(10), pp. 1827-1832, 7 ... and even death (Zhu, 2001). ... as a nitrogen fertilizer equivalent to 150 kg N ha-1 and triple- super- ... negatively the plant fresh weight, but the effect ratio.

  3. Building for the Future: China’s Progress in Space Technology During the Tenth 5-Year Plan and the U.S. Response

    Science.gov (United States)

    2008-03-01

    Navigation System,” Science and Global Security, December 2004, pp. 219-250. 68. Kang Guohua, Liu Jianye, Zhu Yanhua, and Xiong Zhi, “GPS/SST/SINS zuhe...73. Xie Tao, “‘Shen liu’ shenkong fangda ‘hangtian jingji ’” (“‘Shenzhou’ VI Amplifies the ‘Space Economy’”), Zhongguo Hangtian (Aerospace China

  4. Theoretical and Experimental Study of Light Shift in a CPT-Based RB Vapor Cell Frequency Standard

    Science.gov (United States)

    2001-01-01

    Questions and Answers ROBERT LUTWAK (Datum): When you servo the microwave power to eliminate the light shift, what do you servo to? To what are you...leveling that signal? MIA0 ZHU: Do you mean what I servo to o r where did I do the servo? LUTWAK : What is the error signal that determines the TR

  5. Using Transverse Optical Patterns for Ultra-Low-Light All-Optical Switching

    Science.gov (United States)

    2008-01-01

    opportunities. Michael Stenner was busy writing his thesis when I arrived in the group, but was still willing to help me find my way around and answer my...Lett. 96, 143901 (2006). 162 M. D. Stenner and M. A. Neifeld, Z. Zhu, A. M. C. Dawes, and D. J. Gauthier, Distortion management in slow-light pulse

  6. Quantitative detection of fusion protein rIFN-β-HSA by a sandwich ...

    African Journals Online (AJOL)

    user

    2011-02-14

    Feb 14, 2011 ... (Corning-Costar, NY, USA), urine microalbumin kits were purchased from ... regarded as the standard of rIFN-β-HSA and was stored at −80°C. ... and antibody concentration, sample incubating time and detecting. Zhu et al.

  7. Cofactor interactions in the activation of tissue non-specific alkaline ...

    African Journals Online (AJOL)

    JTEkanem

    stabilization of protein structure and regulation of enzymatic ... structure of ALP at low and high concentrations respectively4,5. ..... Zhang, Y.X., Zhu, Y., Xi, H.W., Liu, Y.L. and Zhou, H.M. ... Garen, A. and Levinthal, C. (1960) A fine structure ...

  8. A potential explanation for the effect of carbon source on the ...

    African Journals Online (AJOL)

    USER

    2010-08-16

    Aug 16, 2010 ... structure, mixed liquor suspended solids (MLSS), sludge volume index (SVI) .... Fine air bubbles for aeration were supplied through an air sparger at the ..... Ren TT, Liu L, Sheng GP, Liu XW, Yu HQ, Zhang MC, Zhu JR (2008).

  9. Empirical training for conditional random fields

    NARCIS (Netherlands)

    Zhu, Zhemin; Hiemstra, Djoerd; Apers, Peter M.G.; Wombacher, Andreas

    2013-01-01

    In this paper (Zhu et al., 2013), we present a practi- cally scalable training method for CRFs called Empir- ical Training (EP). We show that the standard train- ing with unregularized log likelihood can have many maximum likelihood estimations (MLEs). Empirical training has a unique closed form MLE

  10. Ministry of Finance: Discharge Reduction Funds to Provide Supports in Six Major Areas

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    @@ Zhu Guangyao, assistant Minister of the Ministry of Finance, said at the climate summit in Copenhagen on December 16, 2009 that, the government budget would increase the investment in the areas of energy conservation, discharge reduction and renewable energy sources in 2010 and during the period of Twelfth Five-Year Plan.

  11. DNA methylation of PTEN gene promoter region is not correlated ...

    African Journals Online (AJOL)

    Yomi

    2012-02-23

    Feb 23, 2012 ... of Shandong, Qingdao Agricultural University, Qingdao, 266109, China. 2Daping ... (Kang et al., 2002), glioblastoma (Baeza et al., 2003), breast cancer ... DNA isolation by using micro DNA isolation kit (Tiangen, Beijing,. China) .... Asano T, Yao Y, Zhu J, Li D, Abbruzzese JL, Reddy SA (2004). The PI.

  12. Subject Index

    Indian Academy of Sciences (India)

    user1

    Multi-Wavelength Studies on H2O Maser Host Galaxies (J. S. Zhang & J. .... N(HI) and Jet Power/Emission in AGNs (Zhongzu Wu, Minfeng Gu & Ming Zhu), 319 .... Emanuela Orrù, David Rafferty, Huub Röttgering, Anna Scaife, Aleksandar ...

  13. Genetic analysis of body weight of Takifugu rubripes at different ...

    African Journals Online (AJOL)

    Tuoyo Aghomotsegin

    2016-11-09

    Nov 9, 2016 ... 3Key Laboratory of Sustainable Development of Marine Fisheries, Ministry of Agriculture, China .... During the larval-culture period, water ... The measured values at time t were conditioned on measured values at time t – 1. Thus, the conditional genetic model can be written as follows (Zhu, 1995; Atchley ...

  14. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    ... XIONG1 WEIHUA ZHU1 HEMING XIAO1. Institute for Computation in Molecular and Materials Science and Department of Chemistry, School of Chemical Engineering, Nanjing University of Science and Technology, Nanjing 210094, China; School of Materials Science and Engineering, Nanjing Institute of Technology, ...

  15. Effect of indole-3-butyric acid (IBA) on in vitro root induction in ...

    African Journals Online (AJOL)

    ishtiaq

    2012-03-08

    Mar 8, 2012 ... physiological analyses of photo autotrophic callus cultures of the fern Platycerium coronarium (Koenig) under CO2 enrichment. J. Exp. Bot. 46 (10): 1535-1542. Liu C, Zhu J, Liu Z, Li L, Pan R, Jin L (2002). Exogenous auxin effects on growth and phenotype of normal and hairy roots of Pueraria lobata. (Wild.) ...

  16. 78 FR 71625 - Government-Owned Inventions; Availability for Licensing

    Science.gov (United States)

    2013-11-29

    ... available. In vivo data available (animal). Inventors: Dimiter S. Dimitrov (NCI), Zhu Zhongyu (NCI), Pradman... . Collaborative Research Opportunity: The National Cancer Institute, Laboratory of Human Carcinogenesis, is... studies are of great importance for future pre-clinical and clinical studies of MJC13. Potential...

  17. Sensing of polymeric sensor-based rhodamine B derivative for metal ...

    Indian Academy of Sciences (India)

    TONG-MOU GENG1 XIE WANG1 FENG ZHU1 HUI JIANG1 YU WANG2. Collaborative Innovation Center for Petrochemical New Materials, Anhui Key Laboratory of Functional Coordination Compounds, School of Chemistry and Chemical Engineering, Anqing Normal University, Anqing 246011, People's Republic of China ...

  18. a review of the anticancer potential of the antimalarial herbal

    African Journals Online (AJOL)

    David Ofori-Adjei

    2013-09-01

    Sep 1, 2013 ... Volume 47, Number 3 ... topoisomerase II as their principal targets.10 ... The work by Zhu and Gooderham, ... executed at least in part through the mitochondrial ... vascular endothelial growth factor and angiopoetin, .... decrease in plasma glucose when given orally to a ... well as the cost of chemotherapy.

  19. preliminary phytochemical screening and antioxidant activity

    African Journals Online (AJOL)

    DR. AMINU

    reduction mechanism of DPPH correlated with presence of hydroxyl ... are known to occur in plant species belonging to the .... Alcohol, wine and ... oxidation. Athelosclerosis, 123: 83-91. Zhu, N., Wang, M., Wei, G.J., Lin, J.K., Yang, C.S. and.

  20. African Journal of Biotechnology - Vol 11, No 41 (2012)

    African Journals Online (AJOL)

    Lenaldo Muniz de Oliveira, Nayra da Silva Negreiros Cardoso, Luzimar Gonzaga .... Ju-Hong Zhang, Jian-Ying Guo, Jing-Yuan Xia, Fang-Hao Wan, 9873-9880 ... Zhu Xiao-yan, Chang Shu-juan, Zhang Ying-jun, Luo Hai-ling, 9894-9905.

  1. Luteoloside Inhibits Proliferation of Human Chronic Myeloid ...

    African Journals Online (AJOL)

    Purpose: To investigate the effects of luteoloside on the proliferation of human chronic ..... Zhang N, Wang D, Zhu Y, Wang J, Lin H. Inhibition ... Han X. Protection of Luteolin-7-O-Glucoside Against ... Hwang YJ, Lee EJ, Kim HR, Hwang KA.

  2. Extraction-condition Optimization of Baicalein and Schisandrin from ...

    African Journals Online (AJOL)

    effects of individual factors on extraction rates of baicalein and schisandrin determined by high performance liquid ..... Huang HL, Wang YJ, Zhang QY, Liu B, Wang FY, Li JJ,. Zhu RZ. ... Liu C, Zhao X, Fan Y, Han G, Nguyen T. Astragalus.

  3. African Journal of Biotechnology - Vol 10, No 65 (2011)

    African Journals Online (AJOL)

    HQ Lou, Y Hu, L Zhang, YJ Zhang, PG Tu, XT Yu, YJ Jin, L Wang, 14286-14292 ... The effect of osmopriming on germination, seedling growth and phosphatase activities of lettuce under saline ... S Han, TH Zhu, SJ Li, FL Li, 14404-14409.

  4. Reference: 759 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 759 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u18434608i Guan Yue-Feng...s. 2 852-63 18434608 2008 Jun Plant physiology Gao Ju-Fang|Guan Yue-Feng|Huang Xue-Yong|Yang Zhong-Nan|Zhang Hong-Xia|Zhu Jun

  5. Hypersurfaces in nearly Kaehler manifold S3× S3

    Indian Academy of Sciences (India)

    BIAOGUI YANG1 QINGQING ZHU2. School of Mathematics and Computer Science, Fujian Normal University, Qishan Campus, Fuzhou 350117, People's Republic of China; Math Teaching and Research Group, Zhangzhou Branch Campus of Xiamen Shuangshi Middle School, Zhangzhou 363107, People's Republic of ...

  6. Theory of computational complexity

    CERN Document Server

    Du, Ding-Zhu

    2011-01-01

    DING-ZHU DU, PhD, is a professor in the Department of Computer Science at the University of Minnesota. KER-I KO, PhD, is a professor in the Department of Computer Science at the State University of New York at Stony Brook.

  7. Geotechnical properties of some organoclays

    Indian Academy of Sciences (India)

    Because of their low permeability, clays are the main material used as a liner in solid waste ... 2004; Matott et al 2006) and also potential sorbents in waste-water and contaminated soils (Zhu ..... Waste Management & Research 26: 464–473.

  8. The Flynn Effect and Its Critics: Rusty Linchpins and "Lookin' for g and Gf in Some of the Wrong Places"

    Science.gov (United States)

    McGrew, Kevin S.

    2010-01-01

    The consensus of most intelligence scholars is that the Flynn effect (FE) is real, IQ test batteries are now routinely restandardized on a regular basis. A cornerstone in Flynn's explanation of the FE is his analysis of select Wechsler subtest scores across time. The featured articles by Kaufman and Zhou, Zhu, and Weiss question whether Flynn's…

  9. Retracted: Effect of Paris polyphylla extract on seconddegree burns ...

    African Journals Online (AJOL)

    2018-01-26

    Jan 26, 2018 ... This article previously published in Volume 15 Issue 10 of this journal in October 2016 has been retracted in line with the guidelines from the Committee on Publication Ethics (COPE, http://publicationethics.org/resources/guidelines). Retracted: Ma Z, Yin W, Hu G, Zhu Z, Huang Z. Effect of Paris polyphylla ...

  10. Electrochemical behaviour of superhydrophobic coating fabricated ...

    Indian Academy of Sciences (India)

    ties make it useful in household and industrial fields such as marine, automotive and ... are its simplicity, more cost effectiveness and less complex condition to .... Li M, Zhai J, Liu H, Song Y, Jiang L and Zhu D 2003 J. Phys. Chem. B 107 9954.

  11. 75 FR 30387 - Improving Market and Planning Efficiency Through Improved Software; Notice of Agenda and...

    Science.gov (United States)

    2010-06-01

    ... on the Commission's Web site at http://www.ferc.gov . A free Webcast of this event is available... navigating to http://www.ferc.gov 's Calendar of Events and locating this event in the calendar. The event.... Jinxiang Zhu, ABB. Devin Van Zandt, GE. 12:30 p.m Lunch. 1:30 p.m Norm Richardson, Ventyx. John Condren...

  12. Pramana – Journal of Physics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Wenfeng Luo1 Xiaoxia Zhao2 Shuyuan Lv1 Haiyan Zhu1. School of Electronic Engineering, Xi'an University of Posts and Telecommunications, Xi'an, Shaanxi 710121, China; School of Physics and Mechanical and Electronic Engineering, Xi'an University, Xi'an, Shaanxi 710065, China ...

  13. WAN-MING LIU

    Indian Academy of Sciences (India)

    Home; Journals; Sadhana. WAN-MING LIU. Articles written in Sadhana. Volume 41 Issue 7 July 2016 pp 713-719. Integrated fleet assignment and aircraft routing based on delay propagation · WAN-MING LIU XING-HUI ZHU YAN-LONG QI · More Details Abstract Fulltext PDF. Airlines' expensive resources, especially aircraft ...

  14. 75 FR 21638 - Government-Owned Inventions; Availability for Licensing

    Science.gov (United States)

    2010-04-26

    ... been shown to play a role in bone morphogenesis, cardiovascular tissue generation, immune regulation... tissue generation. Means of studying the role of SMAD7 in immune regulation. Inventors: Marilyn Diaz (NIEHS). Related Publication: Dong C, Zhu S, Wang T, Yoon W, Li Z, Alvarez RJ, Dijke P, White B, Wigley...

  15. Headspace Solid-Phase Microextraction Coupled with Gas ...

    African Journals Online (AJOL)

    Tropical Journal of Pharmaceutical Research May 2015; 14(5): 891-898. ISSN: 1596-5996 ... with the potential to analyze volatile compounds in raw and processed FCP. .... hydrocarbons, furans and oxazoles were formed during the ..... vol. 1. Beijing: China Medical Science and Technology. Press; pp 29-30. 11. Zhu CY ...

  16. The geranylgeranyl pyrophosphate synthase gene from Ginkgo ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-04-06

    Apr 6, 2009 ... Ginkgo biloba is one of the oldest living plant species and often referred to as “a .... GbGGDPS were analyzed and the sequence comparison was conducted ... function of plant GGDPS genes (Zhu et al., 1997) and human and.

  17. Cellulose sulphuric acid as a biodegradable catalyst for conversion ...

    Indian Academy of Sciences (India)

    important applications of these compounds are 1,3- dipolar cycloaddition to produce five-membered hetero- cycles2 and their ... Diazonium salts are multipurpose compounds in organic chemistry. However, their poor stability lim- ..... Organometallics 21 5549. 5. Liu Q and Tor Y 2003 Org. Lett. 5 2571. 6. Zhu W and Ma D ...

  18. Electroantennogram responses of the potato tuber moth ...

    Indian Academy of Sciences (India)

    PRAKASH

    seven test compounds were chosen from different chemical classes such ... The test chemicals were diluted in paraffin ..... Jansens S, Cornelissen R, de Clercq R, Reynaerts A and ... Park K C, Zhu J, Harris J, Ocheing S A and Baker T C 2001.

  19. Formal matched asymptotics for degenerate Ricci flow neckpinches

    International Nuclear Information System (INIS)

    Angenent, Sigurd B; Isenberg, James; Knopf, Dan

    2011-01-01

    Gu and Zhu (2008 Commun. Anal. Geom. 16 467–94) have shown that type-II Ricci flow singularities develop from nongeneric rotationally symmetric Riemannian metrics on S n+1 (n≥2). In this paper, we describe and provide plausibility arguments for a detailed asymptotic profile and rate of curvature blow-up that we predict such solutions exhibit

  20. Organization of the Optical Society of America Photonic Science Topical Meeting Series. Volume 3. The Microphysics of Surfaces: Beam-Induced Processes Held in Santa Fe, New Mexico on 11-13 February 1991

    Science.gov (United States)

    1992-05-22

    as semiconductor material. Impor- tant applications are thin film solar cells, thin film transistors for liquid crystal displays, photoreceptors for...171, 1989. 307-311 3 T.MINAMI, H.NANTO and S.TAKATA, Thin Solid Films, Vol.124, 1985. 43-47 4 D.Z.DA, F.R.ZHU and H.S.TANG, Acta Energiae Solaris

  1. NREL Research Pushes Perovskites Closer to Market | News | NREL

    Science.gov (United States)

    even get close-to the above-20% efficiencies dominated by silicon solar panels. NREL researcher Kai Zhu ; Perovskites have a couple of major benefits over silicon solar panels. The silicon technology requires a high as excellent semiconductors. This means perovskite panels are more flexible than rigid silicon panels

  2. Velocity Distributions of Runaway Stars Produced by Supernovae in ...

    Indian Academy of Sciences (India)

    J. Astrophys. Astr. (2016) 37: 22. DOI: 10.1007/s12036-016-9400-2. Velocity Distributions of Runaway Stars Produced by Supernovae in the Galaxy. Abudusaimaitijiang Yisikandeer. ∗. , Chunhua Zhu, Zhaojun Wang. & Guoliang Lü. School of Physical Science and Technology, Xinjiang University, Urumqi, 830046, China. ∗.

  3. Effect of ultrasonic specific energy on waste activated sludge ...

    African Journals Online (AJOL)

    USER

    2010-03-22

    Mar 22, 2010 ... Yuanyuan Yan, Leiyu Feng*, Chaojie Zhang, Hongguang Zhu and Qi Zhou. State Key ... soluble chemical oxygen demand; TCOD, total chemical oxygen demand ... studied as well as their effects on the characteristics of sludge. .... universal liquid module (ULM) which could detect particle size from. 0.04 up ...

  4. Whole Exome Analysis of Early Onset Alzheimer’s Disease

    Science.gov (United States)

    2015-04-01

    SA, Shan X, Jones BA, Zhao G, Woodward ML, Li X, Zhu Y, McEachern EJ, Silverman MA, Watson NV, Gong CX, Vocadlo DJ1. Pharmacological inhibition of O...ADGC) genotyped on the exome chip, which included 195,039 variants with MAFɚ%. Enrichment analysis of the variant list was conducted using DAVID

  5. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Yang Zhao1 Haiqing Tong1 Ronghao Cai1 Xiaojian Peng1 Xiaoyu Li1 Defang Gan2 Suwen Zhu1. Key Laboratory of Crop Biology of Anhui Province, School of Life Sciences, Anhui Agricultural University, Hefei 230036, People's Republic of China; School of Horticulture, Anhui Agricultural University, Hefei 230036, People's ...

  6. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Xiuqiang Li1 Dong Zhang1 Peiying Zhu1 Chao Yang1. Key Laboratory of Advanced Civil Engineering Materials, Ministry of Education, College of Materials Science and Engineering, Tongji University, 4800 CaoAn Road, Shanghai 200092, China ...

  7. Effects of drought and salt stress on seed germination of three ...

    African Journals Online (AJOL)

    use

    2011-12-07

    Dec 7, 2011 ... At sowing, inadequate soil moisture results in irregular seed germination and unsynchronised seedling ... Soil salinity affects germination by either an osmotic stress or ion toxic effect (Bewley and Black, ..... Zhu et al., 2006) as an inert osmoticum in germination tests (Dodd and Donovan, 1999) and is a non- ...

  8. JPRS Report, Soviet Union Political Affairs Soviet Commentary on the 19th Party Conference.

    Science.gov (United States)

    1988-08-31

    tific-Production Association " Venta " I. Tumas, painter at the Vilnius City Construction Repair Trust; and V. Zhu- kovskiy, milling machine...general director of the Scientific- Production Association " Venta ," began his statement by replying to a question from the audience about the harm

  9. DNA damage and decrease of cellular oxidase activity in piglet ...

    African Journals Online (AJOL)

    DNA damage and decrease of cellular oxidase activity in piglet sertoli cells exposed to gossypol. Ming Zhang, Hui Yuan, Zuping He, Liyun Yuan, Jine Yi, Sijun Deng, Li Zhu, Chengzhi Guo, Yin Lu, Jing Wu, Lixin Wen, Qiang Wei, Liqun Xue ...

  10. Implicit-shifted Symmetric QR Singular Value Decomposition of 3x3 Matrices

    Science.gov (United States)

    2016-04-01

    Graph 33, 4, 138:1– 138:11. TREFETHEN, L. N., AND BAU III, D. 1997. Numerical linear algebra , vol. 50. Siam. XU, H., SIN, F., ZHU, Y., AND BARBIČ, J...matrices with minimal branching and elementary floating point operations. Tech. rep., University of Wisconsin- Madison. SAITO, S., ZHOU, Z.-Y., AND

  11. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics. Jain Fang Gui. Articles written in Journal of Genetics. Volume 89 Issue 2 August 2010 pp 163-171 Research Article. Chromosomal localization of rDNA genes and genomic organization of 5S rDNA in Oreochromis mossambicus, O. urolepis hornorum and their hybrid · Hua Ping Zhu Mai ...

  12. Salt tolerance in red clover (Trifolium pratense L.) seedlings

    African Journals Online (AJOL)

    Jane

    2011-08-15

    Aug 15, 2011 ... This study was conducted to investigate the effect of salt stress on germination of 28 red clover. (Trifolium pratense ... tolerance with the aim of improving crop plants (Zhu,. 2001) or soil .... The interaction of salinity and population in terms of PI ... in shoot growth is probably due to hormonal signals generated ...

  13. Hydrological indications of aeolian salts in mid-latitude deserts of ...

    Indian Academy of Sciences (India)

    Hydrological indications of aeolian salts in mid-latitude deserts of northwestern China. B Q Zhu. Supplementary data. Figure S1. Photograph views of Quaternary and modern sediments of aeolian and lacustrine/fluvial facies that consisted of clay and sand/silt sand alternations in the Taklamakan and Badanjilin Deserts.

  14. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 96; Online resources. Population genetic diversity of marble goby (Oxyeleotris marmoratus)inferred from mitochondrial DNA and microsatellite analysis. CHENG ZHAO XIAOPING ZHU YICHUN GU QINTAO WANG ZECHENG LI SHAOWU YIN. ONLINE RESOURCES Volume 96 ...

  15. Fulltext PDF

    Indian Academy of Sciences (India)

    2011-12-08

    Dec 8, 2011 ... 5FuShun Coal-Mine Brain Hospital, Gaowan Road, FuShun 113000, People's Republic of China. [Zhu Y. ... control subjects (161 males and 150 females, mean age ± ... show significant difference between cases and controls.

  16. The Cat, the Cradle, and the Silver Spoon: Violence in Contemporary Art and the Question of Ethics for Art Education

    Science.gov (United States)

    Tavin, Kevin; Kallio-Tavin, Mira

    2014-01-01

    Against the backdrop of objective and subjective violence, two contemporary artworks are interpreted through theories of the Other. Zhu Yu's "Eating People" (2000) is considered through Lacanian psychoanalytic theory and, in particular, through an Ethics of the Real. Teemu Mäki's "My Way, a Work in Progress" (1995) is…

  17. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences. Cheng-Li Yao. Articles written in Journal of Chemical Sciences. Volume 121 Issue 1 January 2009 pp 89-93 Full Papers. Sucrose/bovine serum albumin mediated biomimetic crystallization of calcium carbonate · Cheng-Li Yao Wang-Hua Xu Ai-Min Ding Jin-Mao Zhu.

  18. The adverse reaction of chitooligosaccharides in rats | Liu | African ...

    African Journals Online (AJOL)

    The adverse reaction of chitooligosaccharides in rats. A Liu, K Sun, C Si, Z Zhu, W Zhang. Abstract. In this study, hair removal effect after subcutaneous injection of chitooligosaccharides in mice was investigated. Different methods of observation of hair removal, tissue slices and detection of hematological parameters, like ...

  19. Evaluation on prognosis of esophageal squamous cell carcinoma patients after three-dimensional conformal radiotherapy with different clinical stage system

    International Nuclear Information System (INIS)

    Wang Yuxiang; Zhu Shuchai; Qiu Rong; Liu Zhikun; Shen Wenbin

    2011-01-01

    Objective: To evaluate the prognostic significance of 3 clinical stage system in 3-dimensional conformal radiotherapy (3DCRT) for esophageal squamous cell carcinoma. Methods: From January 2004 to August 2007, 179 cases of esophageal squamous cell carcinoma were treated with 3DCRT. Before radiation, each patient was staged with UICC 2003 TNM stage, stage of Chinese esophageal cancer cooperation group (cooperation group' stage), and Zhu's clinical stage respectively. Concordance of each clinical stage and prognosis was analyzed with SPSS 11.5. Results In 179 cases of esophageal cancer, Concordance was better in T stage (Kappa = 0.271) than in TNM stage (Kappa = 0.167) between cooperation group' stage and Zhu's stage. Among them, 98 cases was staged with UICC stage, concordance of T stage was better between UICC-T and cooperation group' T stage (Kappa =0.261) than between UICCT and Zhu's T stage (Kappa = 0.045) ;concordance of TNM stage was better between UICC-TNM and Zhu's TNM stage (Kappa = 0.597) than between UICC-TNM and cooperation group' TNM stage (Kappa =0.299). With multivariate analysis, T (χ 2 value is 11.58, 26.00 and 51.05, all P 2 value is 15.28, 16.10 and 16.10, all P 2 value is 5.59, 27.78 and 27.78, all P 2 value is 15.77, 34, 35 and 51.10, all P 1 - T 3 was difficult to definite and the prognosis was not significantly different in T 1 - T 3 stage. Conclusions: In this study, 3 kinds of clinical stage could evaluate prognosis of esophageal cancer after radiotherapy; cooperation group' stage and Zhu's stage need further application, with further accuracy needed. (authors)

  20. Revision of the subfamily Opiinae (Hymenoptera, Braconidae) from Hunan (China), including thirty-six new species and two new genera

    Science.gov (United States)

    Li, Xi-Ying; van Achterberg, Cornelis; Tan, Ji-Cai

    2013-01-01

    van Achterberg & Li, gen. n. (type species: Areotetes carinuliferus sp. n.) and Coleopioides van Achterberg & Li, gen. n. (type species: Coleopioides postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915), Opius ambiguus Weng & Chen, 2005 (not Wesmael, 1835) and Opius mitis Chen & Weng, 2005 (not Fischer, 1963) are primary homonymsandarerenamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. andOpius wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005) comb. n.,Diachasmimorpha longicaudata (Ashmead, 1905) and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957) comb. n. is new for China and Hunan; Xynobius maculipennis(Enderlein, 1912) comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005) comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005) comb. n., Apodesmia tracta (Weng & Chen, 2005) comb. n., Areotetes laevigatus (Weng & Chen, 2005) comb. n., Phaedrotoma dimidia (Chen & Weng, 2005) comb. n., Phaedrotoma improcera (Weng & Chen, 2005) comb. n., Phaedrotoma amputata (Weng & Chen, 2005) comb. n., Phaedrotoma larga (Weng & Chen, 2005) comb. n., Phaedrotoma osculas (Weng & Chen, 2005) comb. n., Phaedrotoma postuma (Chen & Weng, 2005) comb. n., Phaedrotoma rugulosa (Chen & Weng, 2005) comb. n., Phaedrotoma tabularis (Weng & Chen, 2005) comb. n., Rhogadopsis apii (Chen & Weng, 2005) comb. n., Rhogadopsis dimidia (Chen & Weng, 2005) comb. n., Rhogadopsis diutia (Chen & Weng, 2005) comb. n., Rhogadopsis

  1. Seven new species of Begonia (Begoniaceae) in Northern Vietnam and Southern China

    Science.gov (United States)

    Chen, Wen-Hong; Radbouchoom, Sirilak; Nguyen, Hieu Quang; Nguyen, Hiep Tien; Nguyen4, Khang Sinh; Shui, Yu-Min

    2018-01-01

    Abstract Since 2016, KIB (Kunming Institute of Botany) and CPC (Centre for Plant Conservation of Vietnam) have conducted several surveys in the transboundary karst regions in Northern Vietnam and Southern China and seven new species in the genus Begonia Linn. (Begoniaceae) are firstly described. Amongst them, two species, Begonia albopunctata Y.M. Shui, W.H. Chen & H.Q. Nguyen and B. erectocarpa H.Q. Nguyen, Y.M. Shui & W.H. Chen, respectively belong to section Sphenanthera with berry fruits and section Leprosae with clavate berry fruits; four species, B. gulongshanensis Y.M. Shui & W. H. Chen, B. minissima H.Q. Nguyen, Y.M. Shui & W.H. Chen, B. mollissima Y.M. Shui, H.Q. Nguyen & W.H. Chen, B. rhytidophylla Y.M. Shui & W.H. Chen, belong to section Coelocentrum with parietal placentation; one species, Begonia bambusetorum H.Q. Nguyen, Y.M. Shui & W.H. Chen, belongs to section Diploclinium with 3-loculed ovary and capsules. The diagnostic characters of these species are described and illustrated in the text and photographs. PMID:29416422

  2. Wide Band Gap Semiconductors Symposium Held in Boston, Massachusetts on 2-6 December 1991. Materials Research Society Symposium Proceedings. Volume 242

    Science.gov (United States)

    1992-01-01

    AND PROPERTIES OF WIDE BAND-GAP Il-VI STRAINED- LAYER SUPERLATTICE 227 Hailong Wang. Jie Cui. Aidong Shen. Liang Xu, Yunliang Chen. and Yuhua Shen IN...WANG JIE CUI AIDONG SHEN LIANG XU YUNLIANG CHEN AND YUHUA SHEN Shanghai Institute of Optics and Fine Mechanics, Academia Sinica P.O.Box 800-216 Shanghai...He Zujou, Cao Huazhe, Su Wuda, Chen Zhongcai, Zhon Feng and Wang Erguang, Thin Solid Films, 139,261(1986). 22) Xin Li and T.L.Tansley, J.AppI.Phys

  3. Pitfalls in VAR based return decompositions: A clarification

    DEFF Research Database (Denmark)

    Engsted, Tom; Pedersen, Thomas Quistgaard; Tanggaard, Carsten

    in their analysis is not "cashflow news" but "inter- est rate news" which should not be zero. Consequently, in contrast to what Chen and Zhao claim, their decomposition does not serve as a valid caution against VAR based decompositions. Second, we point out that in order for VAR based decompositions to be valid......Based on Chen and Zhao's (2009) criticism of VAR based return de- compositions, we explain in detail the various limitations and pitfalls involved in such decompositions. First, we show that Chen and Zhao's interpretation of their excess bond return decomposition is wrong: the residual component...

  4. THREE NEW SPECIES OF CRAMBINAE(LEPIDOPTERA : PYRALIDAE) IN CHINA

    Institute of Scientific and Technical Information of China (English)

    CHENTie-mei; SONGShi-mei; YUANDe-cheng

    2003-01-01

    Three new species of Crambinae from China, Eschata truncata Song & Chen, sp. nov., Eschata tricornia Song & Chen, sp. nov., Pseudargyria acuta Song & Chen, sp. nov. and the female of Girdharia tau-romma Kapur are described, with figures and illustrations of genitalia provided. E. truncata resembles E.smithi Bleszynski, but valva with one short truncated process in costa; E. tricornia differed from all recorded species by valva with a triangular process on dorsum; P. acuta resembles P. marginepunctalis (Hampson), but with cucullus rapidly pointed and aedeagus with one group of cornuti. E. bleszynskiella Minet is proposed as a junior synonym of E. shanghaiensis Wang & Sung.

  5. The genus Bryoerythrophyllum (Musci, Pottiaceae in Antarctica

    Directory of Open Access Journals (Sweden)

    Sollman Philip

    2015-07-01

    Full Text Available Antarctic material of the genus Bryoerythrophyllum P. C. Chen was studied from all specimens present in KRAM. Bryoerythrophyllum recurvirostrum (Hedw. P. C. Chen var. antarcticum L. I. Savicz & Smirnova is treated as a distinct species: B. antarcticum (L. I. Savicz & Smirnova P. Sollman, stat. nov. Three species are now known in the Antarctic region: B. antarcticum, B. recurvirostrum and B. rubrum (Jur. ex Geh. P. C. Chen. Bryoerythrophyllum rubrum is reported for the first time from the Antarctic. It is a bipolar species. A key to the taxa is given. These species are described and briefly discussed, with notes on illustrations, reproduction, habitat, world range, distribution and elevation in Antarctica.

  6. International Symposium on Scientific Computing, Computer Arithmetic and Validated Numerics

    CERN Document Server

    DEVELOPMENTS IN RELIABLE COMPUTING

    1999-01-01

    The SCAN conference, the International Symposium on Scientific Com­ puting, Computer Arithmetic and Validated Numerics, takes place bian­ nually under the joint auspices of GAMM (Gesellschaft fiir Angewandte Mathematik und Mechanik) and IMACS (International Association for Mathematics and Computers in Simulation). SCAN-98 attracted more than 100 participants from 21 countries all over the world. During the four days from September 22 to 25, nine highlighted, plenary lectures and over 70 contributed talks were given. These figures indicate a large participation, which was partly caused by the attraction of the organizing country, Hungary, but also the effec­ tive support system have contributed to the success. The conference was substantially supported by the Hungarian Research Fund OTKA, GAMM, the National Technology Development Board OMFB and by the J6zsef Attila University. Due to this funding, it was possible to subsidize the participation of over 20 scientists, mainly from Eastern European countries. I...

  7. “La Diplomacia Secreta”: la participación de Colombia en el conflicto entre Perú y España por las islas guaneras

    Directory of Open Access Journals (Sweden)

    Yoer Javier Castaño Pareja

    2013-01-01

    Full Text Available During the fourth presidency of General Tomás Cipriano de Mosquera, the Colom- bian government interfered in a diplomatic incident which apparently violated the neutrality that this country had promised to maintain during the war between Peru and Spain in the 1865-1866 period as a consequence of the Hispanic inva- sion of guano producing islands. In this paper some causes that made a few mem- bers of the Colombian government to decide to support Peru¿s war effort without the consent of Congress are explored. Subsequently, this research identifies the features and characteristics of diplomatic positions that in that time were in con- flict within the Colombian government and that marked the course of diploma- tic relations with the neighbouring countries, in an international political context that was characterized by European invasions on some Latin American territories.

  8. Geotourism Aspects of the Lufeng Dinosaur National Geopark in Yunnan Province, China

    Directory of Open Access Journals (Sweden)

    Daněk Tomáš

    2016-03-01

    Full Text Available The Lufeng Dinosaur National Geopark in Yunnan province, China, is important part of geoheritage with a great scientific and aesthetic value. The area has been under scientific research since 1938 when the first dinosaur fossils were discovered here by geologist Bian Meinian and technician Wang Cunyi. Professor Yang announced the discovery of new early Jurassic herbivore prosauropod by Lufeng in 1941, which he gave the name Lufengosaurus huenei. In 2004, the area was listed as the China`s National Geopark. It was opened for visitors in 2008. Besides the high scientific value, the geopark is also an important resource for science based and educational tourism. This paper briefly introduces the history of scientific research, the basic geology of the site and the most important fossils discovered here. The main characteristics, geodiversity, and geotourism of fossil geoheritage in the area are discussed here.

  9. THE DEMOBILIZATION OF TWO ILLEGAL ARMED GROUPS: ANALYSIS OF THE COVERAGE BY NATIONAL PRESS

    Directory of Open Access Journals (Sweden)

    Yeny Serrano

    2012-12-01

    Full Text Available Given the start of new peace talks between the FARC guerrillas and the Colom-bian government, it is crucial to understand the role of Colombian journalists in reporting peace and war.This article presents an analysis on the National Press coverage of the demobilizations of a paramilitary group (Bloque Cacique Nutibara and a section of the FARC guerrillas (BloqueCacicaGaitana within a frame that reflects over the ethical practice of journalism in the context of war. The results are consistent with literature arguing that ethical codes are not documents dictating how journalists should do their job, but rather they repre-sent political acts of communication which allow journalists to reclaim their prof-fessional independence from sources and defend themselves from threats. The paper also discusses the apparent tension between journalism ethics, and the barriers imposed by the media´s informational needs and the strategic military aims of armed groups.

  10. Utilization and management of organic wastes in Chinese agriculture: Past, present and perspectives

    Institute of Scientific and Technical Information of China (English)

    JU; Xiaotang

    2005-01-01

    [1]King,F.H.,Farmers of forty centuries or permanent agriculture in China,Korea and Japan,German translation of first edition (Madison,Wis.,1911),1984.Georg,E.,Siebeneicher,Neu-Ulm und München,208.[2]FAO,FAO Soils Bulletin 40,China:Recycling of organic wastes in agriculture,Food and Agriculture Organization of the United Nations,Rome,2nd ed.,1978.[3]Roelcke,M.,Organic materials in rice production in the Yangtze River Delta-Investigation on the composition and effects of Waterlogged Compost (in German with English abstract),University Diploma Dissertation,Faculty of Agriculture and Horticulture,Freising-Weihenstephan:Munich Technical University,1988,114.[4]Zhu,Z.L.,Chen,D.L.,Nitrogen fertilizer use in China-Contributions to food production,impacts on the environment and best management strategies,Nutrient Cycling in Agroecosystems,2002,63:117-127.[5]Ju,X.T.,Liu,X.J.,Zhang,F.S.et al,Nitrogen fertilization,soil nitrate accumulation,and policy recommendations in several agricultural regions of China,Ambio,2004,33(6):300-305.[6]Extension Center of Agricultural Techniques in China,ed.,Organic Manure Resources in China,Beijing:China Agricultural Publishing House,1999,1-8.[7]Cao,L.G.,The Fertilization History,Beijing:China Agricultural Publishing House,1981.[8]Liu,G.L.,Food production and balanced fertilization in China,in Proceeding of Third International Conference for Balanced Fertilization (ed.Institute of Soil Science and Fertilization,Chinese Academic of Agricultural Science),Beijing:China Agricultural Publishing House,1989,16-21.[9]China Agricultural Yearbook,Editorial Committee of China Agricultural Yearbook,Beijing:China Agricultural Publishing House,1950 - 2003[10]Ellis,E.C.,Wang,S.M.,Sustainable traditional agriculture in the Tai Lake Region of China,Agriculture,Ecosystems and Environment,1997,61,177-193.[11]Ge,J.X.,The History of Chinese Population,Shanghai:Fudan University Publishing House,2001,5:831 - 832.[12]Zhang,S.X.,The Resources of Cultivable Land and

  11. LDL Particle Testing

    Science.gov (United States)

    ... P. Caulfield, Jay Wohlgemuth, Zhizong Chen, Robert Superko, Charles M. Rowland, Robert J. Glynn, Paul M. Ridker, ... See Less Ask a Laboratory Scientist Your questions will be answered by a laboratory scientist as part ...

  12. 77 FR 52311 - Wooden Bedroom Furniture From the People's Republic of China: Partial Rescission of Antidumping...

    Science.gov (United States)

    2012-08-29

    ... Furniture Co., Ltd. Zhangjiagang Zheng Yan Decoration Co., Ltd. Zhangjiang Sunwin Arts & Crafts Co., Ltd.... Trendex Industries Limited Wan Bao Chen Group Hong Kong Co., Ltd. World Design International Co., Ltd...

  13. On synchronization of three chaotic systems

    International Nuclear Information System (INIS)

    Yan Jianping; Li Changpin

    2005-01-01

    In this paper, a simple but efficient method is applied to the synchronization of three chaotic systems, i.e., the chaotic Lorenz, Chua, and Chen systems. Numerical simulations show this method works very well

  14. ONE WAY ANOVA RANDOMIZED COMPLETE BLOCKS

    African Journals Online (AJOL)

    ******

    2012-04-24

    Apr 24, 2012 ... Key words: Grey mullet, growth, foreign DNA, genetically modified. INTRODUCTION ... ration, food quality and preservation (Shears et al., 1991;. Chen et al. ... fish eggs (Khoo et al., 1992) and 4) direct injection of foreign DNA ...

  15. Hybrid Chaos Synchronization of Four-Scroll Systems via Active Control

    Science.gov (United States)

    Karthikeyan, Rajagopal; Sundarapandian, Vaidyanathan

    2014-03-01

    This paper investigates the hybrid chaos synchronization of identical Wang four-scroll systems (Wang, 2009), identical Liu-Chen four-scroll systems (Liu and Chen, 2004) and non-identical Wang and Liu-Chen four-scroll systems. Active control method is the method adopted to achieve the hybrid chaos synchronization of the four-scroll chaotic systems addressed in this paper and our synchronization results are established using Lyapunov stability theory. Since the Lyapunov exponents are not required for these calculations, the active control method is effective and convenient to hybrid synchronize identical and different Wang and Liu-Chen four-scroll chaotic systems. Numerical simulations are also shown to illustrate and validate the hybrid synchronization results derived in this paper.

  16. Fulltext PDF

    Indian Academy of Sciences (India)

    Journal of Earth System Science wishes to place on record the valuable ... Chen Xun-Hong, University of Nebraska-Lincoln, Nebraska, United States ... Dasgupta Somnath, Indian Institute of Science Education and Research, Kolkata.

  17. The Application of First‑Trimester Volumetry in Predicting Pregnancy ...

    African Journals Online (AJOL)

    Rawal MY, Malhotra N. Ultrasonography in Early Intrauterine pregnancy. ... Leung KY, Ma Teresa, Lau BY, Chen M. First trimester ultrasound volumetry: .... Ghosh A, Tang MH, Lam YH, Fung E, Chan V. Ultrasound measurement of placental ...

  18. Appiah-Adjei et al

    African Journals Online (AJOL)

    PUBLICATIONS1

    ing, sale of automobile spare parts, and metal fabrication. Some of these activities generate huge ... Keywords: Groundwater quality, pollution, waste disposal, Suame, Ghana ... of fertilizers (Chen et al., 2007; Parris, 2011;. Shen et al., 2011), ...

  19. Genetics Home Reference: isobutyryl-CoA dehydrogenase deficiency

    Science.gov (United States)

    ... An Y, Weavil SD, Chaing SH, Bali D, McDonald MT, Kishnani PS, Chen YT, Millington DS. Rare ... 10 All Bulletins Features What is direct-to-consumer genetic testing? What are genome editing and CRISPR- ...

  20. Genetics Home Reference: short-chain acyl-CoA dehydrogenase deficiency

    Science.gov (United States)

    ... An Y, Weavil SD, Chaing SH, Bali D, McDonald MT, Kishnani PS, Chen YT, Millington DS. Rare ... 10 All Bulletins Features What is direct-to-consumer genetic testing? What are genome editing and CRISPR- ...