WorldWideScience

Sample records for zhang zhanhai huiding

  1. w zhang

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. W ZHANG. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 51. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study · H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG · More Details ...

  2. p zhang

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. P ZHANG. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 51. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study · H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG · More Details ...

  3. zhang xiurong

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. ZHANG XIURONG. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 48. Structures and electronic properties of W m Cu n ( n + m ≤ 7 ) clusters · YU ZHICHENG ZHANG XIURONG HUO PEIYING GAO KUN · More Details Abstract Fulltext PDF.

  4. "Pipa Fairy Maiden" Zhang Hongyan

    Institute of Scientific and Technical Information of China (English)

    1995-01-01

    WHEN Zhang Hongyan plays the completely traditional Chinese musical instrument, the pipa, she is called a "pipa fairy maiden" by her audiences, "the pipa queen with outstanding talent and appearance" by the Hong Kong press and "a national flower of the Women Philharmonic Orchestra" in Singapore. Having completed her master’s degree program at the folk music department of the Central Conservatory of Music. Zhang is continuing there as a teacher. On the unforgettable night of June 9, 1992, Zhang Hongyan presented her first solo concerto concert at the Beijing Concert Hall, in cooperation with the celebrated Central Philharmonic Orchestra based in Beijing and its famous conductor Hu Yongyan. This concert made her the first folk musical instrument player to present a special concerto concert in cooperation with a Western style orchestra. It is the result of many years of effort. Zhang was born in Shengxian County, Zhejiang Province, famous as the home of Yue Opera. Her father is a musician with a Yue Opera

  5. dujuan zhang

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. DUJUAN ZHANG. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 59. In vitro bioactivity evaluation of α -calcium sulphate hemihydrate and bioactive glass composites for their potential use in bone regeneration · YANYAN ZHENG CHENGDONG ...

  6. Ping Zhang

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. PING ZHANG. Articles written in Bulletin of Materials Science. Volume 36 Issue 6 November 2013 pp 1073-1077. Intrinsic structure and friction properties of graphene and graphene oxide nanosheets studied by scanning probe microscopy · Yan-Huai Ding Hu-Ming Ren Fei-Hu ...

  7. Zhang functions and various models

    CERN Document Server

    Zhang, Yunong

    2015-01-01

    This book focuses on solving different types of time-varying problems. It presents various Zhang dynamics (ZD) models by defining various Zhang functions (ZFs) in real and complex domains. It then provides theoretical analyses of such ZD models and illustrates their results. It also uses simulations to substantiate their efficacy and show the feasibility of the presented ZD approach (i.e., different ZFs leading to different ZD models), which is further applied to the repetitive motion planning (RMP) of redundant robots, showing its application potential.

  8. Zhang Qing and His Meticulous Chinese Paintings

    Institute of Scientific and Technical Information of China (English)

    JULIE; M.SEGRAVES

    2002-01-01

    ZHANG Qing was initially drawn to the bird and flower paint-ings of the Tang and Song dynasties (7th-12th centuries). Later,Qing Dynasty (1644-1911) artist Ren Bonian, famous for hispaintings of figures, also became an important influence.Although Zhang Qing considers his style to be firmly rooted in tradi-

  9. Mortal Ancestors, Immortal Images: Zhang Dai’s Biographical Portraits

    Directory of Open Access Journals (Sweden)

    Duncan M. Campbell

    2012-11-01

    Full Text Available Towards the end of his long life, the prolific late-Ming historian and essayist Zhang Dai 張岱 (1597-?1684 completed a book that he had been working on for many years. Entitled Portraits of the Eminent and Worthy Immortals of Zhejiang During the Ming Dynasty (You Ming yuyue san bu xiu tuzan 有明於越三不朽名賢圖贊 the book included the short biographies (with poetic panegyrics and portraits of 109 men and women of Zhang Dai’s hometown of Shaoxing, one of the epicentres of China’s élite cultural life. The book was organised according to the “Three Immortalities of Life”: moral force, meritorious service, and wise words. Zhang also included a number of his own friends and family members in this collection. This paper discusses aspects the relationship between text and image in this late-imperial Chinese work, both in the context of Zhang Dai’s practice as a biographer who had a strong visual sense and in regard to his particular historical plight as someone who had survived the collapse of one dynasty and who had lived on under its successor regime.

  10. Hiina tänapäeva arhitektuur - karmiilmeline, aga põnev / Zhang Ke, Zhang Hong, Xiaodu Liu ; interv. Hanna Läkk ja Ene Läkk

    Index Scriptorium Estoniae

    Zhang Ke

    2006-01-01

    Intervjuu Hiina arhitektuuribüroo Standardarchitecture arhitektide Zhang Ke ja Zhang Hongiga ning arhitektuuribüroo Urbanus arhitekti Xiaodu Liuga Hollandis Hiina tänapäeva tutvustaval näitusel. Hiina arhitektide haridusest, oma arhitektuuribüroode töödest, tänapäeva hiina arhitektuurist, põhiprobleemidest

  11. Twist of Magnetic Fields in Solar Active Regions Hongqi Zhang ...

    Indian Academy of Sciences (India)

    tribpo

    in active regions also shows the butterfly pattern through the solar cycle. And, less than 30% of the active regions do not follow the general trend (Zhang & Bao 1998). The longitudinal distribution of current helicity parameter h|| of active regions in both the hemispheres in the last decade was presented by Zhang & Bao ...

  12. Aesthetic Function Realized in the Selected Modern Chinese Essays by Zhang Peiji

    Institute of Scientific and Technical Information of China (English)

    罗丹

    2014-01-01

    The selected modern Chinese essays translated by Zhang Peiji is a masterpiece for Chinese scholars to do translation research. Prof. Zhang not only excels at translating the Chinese works accurately but also conveys the aesthetic value in the translated version. This paper wil analyse the aesthetic function used in Zhang Peiji’s selected modern Chinese essays from five aspects, music value, rhythm value, ful-grownness value, conciseness value and artistic conception value.

  13. Mortal Ancestors, Immortal Images: Zhang Dai’s Biographical Portraits

    OpenAIRE

    Duncan M. Campbell

    2012-01-01

    Towards the end of his long life, the prolific late-Ming historian and essayist Zhang Dai 張岱 (1597-?1684) completed a book that he had been working on for many years. Entitled Portraits of the Eminent and Worthy Immortals of Zhejiang During the Ming Dynasty (You Ming yuyue san bu xiu tuzan 有明於越三不朽名賢圖贊) the book included the short biographies (with poetic panegyrics) and portraits of 109 men and women of Zhang Dai’s hometown of Shaoxing, one of the epicentres of China’s élite cultural life. Th...

  14. Immunological evaluation of Lactobacillus casei Zhang: a newly isolated strain from koumiss in Inner Mongolia, China

    Directory of Open Access Journals (Sweden)

    Du Ruiting

    2008-11-01

    Full Text Available Abstract Background There is increasing evidence to suggest an immunomodulation function both within the intestines and systemically upon consuming probiotic species. We recently isolated a novel LAB, Lactobacillus caseiZhang (LcZhang from koumiss. LcZhang exhibited favorable probiotic properties, such as acid resistance, bile resistance, gastrointestinal (GI colonization ability, etc. In order to examine the immunomodulatory qualities of LcZhang, we administered LcZhang to healthy mice with varying doses of either live or heat-killed LcZhang and measured various parameters of the host immune response. Results The study was performed in four separate experiments via oral administration of live and heat-killed LcZhang to BALB/c mice for several consecutive days. We investigated the immunomodulating capacity of LcZhang in vivo by analyzing the profile of cytokines, T cell subpopulations, and immunoglobulin concentrations induced in blood serum and intestinal fluid in BALB/c mice. Only live bacteria elicited a wide range of immune responses, which include the increased production of interferon-γ (IFN-γ, and depression of tumor necrosis factor-α (TNF-α levels. In addition, interleukin-2 (IL-2 and IL-2 receptor gene transcription increased significantly, but the proportion of T cell subsets appeared to be unaffected. We also observed that LcZhang was capable of inducing gut mucosal responses by enhancing the production of secretory Immunoglobulin A (sIgA as well influencing the systemic immunity via the cytokines released to the circulating blood. Conclusion The present work shows that the dose-dependent administration of LcZhang is capable of influencing immune responses, implying that it may be a valuable strain for probiotic use in humans.

  15. Dr.Zhang Ren's Experience in Acupuncture Treatment of Obstinate Eye Diseases

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    @@ Dr.Zhang Ren (張仁), the board chairman of Shanghai Acupuncture Association, has been engaging in acupuncture treatment for more than 30years, during which he has kept on exploring the acupuncture therapies for obstinate diseases,especially for the obstinate eye diseases, ant summed up rich experience in this aspect. The following is a summary of what the author has learned from Dr. Zhang Ren.

  16. Fermentation characteristics and transit tolerance of probiotic Lactobacillus casei Zhang in soymilk and bovine milk during storage.

    Science.gov (United States)

    Wang, J; Guo, Z; Zhang, Q; Yan, L; Chen, W; Liu, X-M; Zhang, H-P

    2009-06-01

    Lactobacillus casei Zhang is a novel strain that was screened out of koumiss collected in Inner Mongolia, and our previous research showed that L. casei Zhang has health benefits such as cholesterol-reducing and immunomodulating effects. The fermentation characteristics of L. casei Zhang in soymilk and bovine milk and the transit tolerance of L. casei Zhang in fermented milk products during refrigerated storage for 28 d were assessed. A faster decrease in pH and faster growth of L. casei Zhang during fermentation were observed in soymilk compared with bovine milk at various inoculation rates, probably because of the low pH buffering capacity of soymilk. The fermented bovine milk samples had much higher final titratable acidity (TA) values (between 0.80 and 0.93%) than the soymilk samples (between 0.40 and 0.46%). Dramatic increases in TA values in the fermented soymilk samples during storage were observed, and the TA values of the fermented soymilk samples changed from survival rates of freshly prepared cultures of L. casei Zhang in simulated gastric juice at pH 2.0 and 2.5 were 31 and 69%, respectively, and the delivery of L. casei Zhang through fermented soymilk and bovine milk significantly improved the viability of L. casei Zhang in simulated gastric transit. Lactobacillus casei Zhang showed good tolerance to simulated gastric juice and intestinal juice in the fermented soymilk and bovine milk samples, and maintained high viability (>10(8) cfu/g) during storage at 4 degrees C for 28 d. Our results indicated that both soymilk and bovine milk could serve as vehicles for delivery of probiotic L. casei Zhang, and further research is needed to elucidate the mechanism of the change in pH and TA of L. casei Zhang in fermented milk samples during fermentation and storage and to understand the difference between soy- and milk-based systems.

  17. On soliton solutions of the Wu-Zhang system

    Directory of Open Access Journals (Sweden)

    Inc Mustafa

    2016-01-01

    Full Text Available In this paper, the extended tanh and hirota methods are used to construct soliton solutions for the WuZhang (WZ system. Singular solitary wave, periodic and multi soliton solutions of the WZ system are obtained.

  18. ‘A Special Zone for Confucianism’? Theses of the Academician Zhang Xianglong on Traditional Chinese Culture”

    Directory of Open Access Journals (Sweden)

    Monika GÄNßBAUER

    2014-05-01

    Full Text Available This article introduces the work of the academician Zhang Xianglong (b. 1949, focussing on his idea of establishing a “special zone for Confucianism” in China. Zhang argues that special protection is needed for Confucian traditions which he perceives as the leading culture of China. Confucian culture should find its way out of the museum, says Zhang. He also refers to the political concept of “one country, two systems” that was implemented when Hongkong was restored to Chinese rule. Zhang applies this to his idea of a “special zone for Confucianism”, suggesting that this political concept could be extended to “one country, three systems”. In my view Zhang is developing new, creative ideas for possible experimental fields dealing with Confucianism in the context of the People’s Republic of China. In the end it is my argument that it would be helpful to conduct in-depth research on the possible role of Confucianism in today’s China.

  19. Further investigations on a question of Zhang and Lü

    Directory of Open Access Journals (Sweden)

    Abhijit Banerjee

    2015-09-01

    Full Text Available In the paper taking the question of Zhang and Lü [15] into background, wepresent one theorem which will improve and extend results of Banerjee-Majumdar [2] and arecent result of Li-Huang [9].

  20. Relational demography in coach-athlete dyads | Zhang | African ...

    African Journals Online (AJOL)

    This study used an adapted version of Zhang's (2004) trust questionnaire to examine perceived characteristic and trust differences between coach and athlete dyads that differ in gender or ethnicity as well as in dyads that were similar. The four different gender dyad groups were male athlete with male coach (MAMC), ...

  1. [Learning experience of acupuncture technique from professor ZHANG Jin].

    Science.gov (United States)

    Xue, Hongsheng; Zhang, Jin

    2017-08-12

    As a famous acupuncturist in the world, professor ZHANG Jin believes the key of acupuncture technique is the use of force, and the understanding of the "concentrating the force into needle body" is essential to understand the essence of acupuncture technique. With deep study of Huangdi Neijing ( The Inner Canon of Huangdi ) and Zhenjiu Dacheng ( Compendium of Acupuncture and Moxibustion ), the author further learned professor ZHANG Jin 's theory and operation specification of "concentrating force into needle body, so the force arriving before and together with needle". The whole-body force should be subtly focused on the tip of needle, and gentle force at tip of needle could get significant reinforcing and reducing effect. In addition, proper timing at tip of needle could start reinforcing and reducing effect, lead qi to disease location, and achieve superior clinical efficacy.

  2. Integrative Genomic and Proteomic Analysis of the Response of Lactobacillus casei Zhang to Glucose Restriction.

    Science.gov (United States)

    Yu, Jie; Hui, Wenyan; Cao, Chenxia; Pan, Lin; Zhang, Heping; Zhang, Wenyi

    2018-03-02

    Nutrient starvation is an important survival challenge for bacteria during industrial production of functional foods. As next-generation sequencing technology has greatly advanced, we performed proteomic and genomic analysis to investigate the response of Lactobacillus casei Zhang to a glucose-restricted environment. L. casei Zhang strains were permitted to evolve in glucose-restricted or normal medium from a common ancestor over a 3 year period, and they were sampled at 1000, 2000, 3000, 4000, 5000, 6000, 7000, and 8000 generations and subjected to proteomic and genomic analyses. Genomic resequencing data revealed different point mutations and other mutational events in each selected generation of L. casei Zhang under glucose restriction stress. The differentially expressed proteins induced by glucose restriction were mostly related to fructose and mannose metabolism, carbohydrate metabolic processes, lyase activity, and amino-acid-transporting ATPase activity. Integrative proteomic and genomic analysis revealed that the mutations protected L. casei Zhang against glucose starvation by regulating other cellular carbohydrate, fatty acid, and amino acid catabolism; phosphoenolpyruvate system pathway activation; glycogen synthesis; ATP consumption; pyruvate metabolism; and general stress-response protein expression. The results help reveal the mechanisms of adapting to glucose starvation and provide new strategies for enhancing the industrial utility of L. casei Zhang.

  3. Effect of LongZhang Gargle on Biofilm Formation and Acidogenicity of Streptococcus mutans In Vitro

    Directory of Open Access Journals (Sweden)

    Yutao Yang

    2016-01-01

    Full Text Available Streptococcus mutans, with the ability of high-rate acid production and strong biofilm formation, is considered the predominant bacterial species in the pathogenesis of human dental caries. Natural products which may be bioactive against S. mutans have become a hot spot to researches to control dental caries. LongZhang Gargle, completely made from Chinese herbs, was investigated for its effects on acid production and biofilm formation by S. mutans in this study. The results showed an antimicrobial activity of LongZhang Gargle against S. mutans planktonic growth at the minimum inhibitory concentration (MIC of 16% and minimum bactericidal concentration (MBC of 32%. Acid production was significantly inhibited at sub-MIC concentrations. Biofilm formation was also significantly disrupted, and 8% was the minimum concentration that resulted in at least 50% inhibition of biofilm formation (MBIC50. A scanning electron microscopy (SEM showed an effective disruption of LongZhang Gargle on S. mutans biofilm integrity. In addition, a confocal laser scanning microscopy (CLSM suggested that the extracellular polysaccharides (EPS synthesis could be inhibited by LongZhang Gargle at a relatively low concentration. These findings suggest that LongZhang Gargle may be a promising natural anticariogenic agent in that it suppresses planktonic growth, acid production, and biofilm formation against S. mutans.

  4. A bandwidth correction to the Allegri-Zhang solution for accelerated random vibration testing

    Directory of Open Access Journals (Sweden)

    Benasciutti Denis

    2018-01-01

    Full Text Available In 2008, Allegri and Zhang published a study [Int. J. Fatigue. 2008, 30(6:967-977] in which they provided an exact analytical solution to the inverse scaling law for accelerated vibration tests of linear systems submitted to stationary Gaussian excitations By combining finite element analysis with multiaxial spectral methods defined in the frequency-domain, their solution generalised the simple inverse power law model suggested in some standards. The solution adopted the “equivalent von Mises stress” multiaxial criterion combined with the narrow-band damage expression. This work aims to propose a bandwidth correction to the original Allegri-Zhang solution to account for the actual spectral banwidth of the local multiaxial stress. The corrected Allegri-Zhang solution is also extended to another multiaxial spectral method, namely the “Projection-by-Projection” criterion. A numerical example is finally discussed, in which the corrected solution is applied to an L-shaped beam submitted to random accelerations.

  5. A New Probiotic Cheddar Cheese with High ACE-Inhibitory Activity and γ-Aminobutyric Acid Content Produced with Koumiss-Derived Lactobacillus casei Zhang

    Directory of Open Access Journals (Sweden)

    Hai Kuan Wang

    2010-01-01

    Full Text Available Cheddar cheese has been manufactured with Lactobacillus casei Zhang as the dairy starter adjunct. L. casei Zhang had previously been isolated from koumiss collected from Xilin Guole in Inner Mongolia and characterized in detail with regard to their probiotic potential. The addition of L. casei Zhang to Cheddar cheese had no adverse effects on sensory criteria. The cheese made with 0.1, 1 and 2 % of the probiotic strain L. casei Zhang adjuncts contained high levels of the Lactobacillus after 6 months of ripening with final counts of 9.6·10^7, 7.7·10^7 and 1.02·10^8 CFU/g, respectively. In the ripe control cheese, without the addition of probiotic strain L. casei Zhang, the number of Lactobacillus reached 5.7·107 CFU/g. Enterobacterial repetitive intergenic consensus PCR (ERIC-PCR analysis was used to distinguish the added L. casei Zhang from the natural flora of the cheese and to determine whether L. casei Zhang grew in the cheese. ACE-inhibitory activity and γ-aminobutyric acid (GABA concentrations in the cheese were measured. Compared with control cheese, experimental cheese with 0.1, 1 and 2 % of probiotic strain L. casei Zhang revealed some increase in ACE-inhibitory activity and GABA mass fraction. In the present study, the production of both ACE-inhibitory activity and GABA in the probiotic cheese with the L. casei Zhang adjunct isolated from koumiss has been found for the first time. The results suggest that cheese with the probiotic strain L. casei Zhang showed good potential for application in the management of hypertension.

  6. False become true: Christie's catalogue of Zhang Hongtu

    Directory of Open Access Journals (Sweden)

    Sandra Valenzuela Arellano

    2013-06-01

    Full Text Available By analyzing the series Christie’s Catalogue Project by the artist Zhang Hongtu, this essay traces relationships between: Cultural heritance, national identity, fakeness, popular culture and legitimacy of power structures, within contemporary China. Contemporary art creates assemblies of meanings related to its time, sometimes relating the present with history, high with vernacular culture, soft power with the construction of collective memory. This essay aims to reconstruct with words, through textual and visual analysis, those visual assemblies.

  7. Adaptation of Lactobacillus casei Zhang to Gentamycin Involves an Alkaline Shock Protein

    Directory of Open Access Journals (Sweden)

    Wenyi Zhang

    2017-11-01

    Full Text Available Lactobacillus (L. casei Zhang is a koumiss-originated probiotic strain, which was used as a model in a long-term antibiotics-driven evolution experiment to reveal bacterial evolutionary dynamics; and we isolated gentamycin-resistant L. casei Zhang descendents. To decipher the gentamycin resistance mechanism, here we cultivated the parental L. casei Zhang and its descendent cells in an antibiotics-containing environment to compare their global protein expression profiles using the iTRAQ-based proteomic approach. A total of 72 proteins were significantly up-regulated (>2.0-fold, P < 0.05, whilst 32 proteins were significantly down-regulated <−2.0-fold, P < 0.05 in the descendent line. The gentamycin-resistant descendent line showed elevated expression in some carbohydrates, amino acids, and purine metabolic pathways. Several stress-related proteins were also differentially expressed. Among them, one alkaline shock protein, asp23, was up-regulated most in the gentamycin-resistant strain (21.9-fold increase compared with the parental strain. The asp23 gene disruption mutant was significantly more sensitive to gentamycin compared with the wild type, suggesting an important role of this gene in developing the gentamycin-resistant phenotype in L. casei. Our report has described the adaptation of a probiotic strain that has acquired antibiotics resistance through long-term antibiotics exposure at the proteome level, and we revealed a novel mechanism of gentamycin resistance.

  8. Robustness analysis of the Zhang neural network for online time-varying quadratic optimization

    International Nuclear Information System (INIS)

    Zhang Yunong; Ruan Gongqin; Li Kene; Yang Yiwen

    2010-01-01

    A general type of recurrent neural network (termed as Zhang neural network, ZNN) has recently been proposed by Zhang et al for the online solution of time-varying quadratic-minimization (QM) and quadratic-programming (QP) problems. Global exponential convergence of the ZNN could be achieved theoretically in an ideal error-free situation. In this paper, with the normal differentiation and dynamics-implementation errors considered, the robustness properties of the ZNN model are investigated for solving these time-varying problems. In addition, linear activation functions and power-sigmoid activation functions could be applied to such a perturbed ZNN model. Both theoretical-analysis and computer-simulation results demonstrate the good ZNN robustness and superior performance for online time-varying QM and QP problem solving, especially when using power-sigmoid activation functions.

  9. Short communication: Protection of lyophilized milk starter Lactobacillus casei Zhang by glutathione.

    Science.gov (United States)

    Zhang, Juan; Liu, Qian; Chen, Wei; Du, Guocheng; Chen, Jian

    2016-03-01

    Lyophilization is considered an effective way to preserve the activity of milk starters, such as lactic acid bacteria, in which proper protective agents play key roles. In this study, Lactobacillus casei Zhang, a probiotic bacterium applied as a milk starter in China, was used to investigate the effects of various cryoprotectants according to cell survival rate and physiological characteristics. The result showed a significant survival improvement to 86.6% when glutathione (GSH) was added as an ideal cryoprotectant. Further study revealed that GSH plays a key role on maintaining higher unsaturation ratio of cell membrane and shorter chain length of saturated fatty acids. In this case, the intact cell structure can be obtained. These findings will contribute not only to deepen the understanding of cells during lyophilization but also to improve the industrial performance of certain milk starters such as L. casei Zhang by application of GSH as cryoprotectant. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  10. Space and Intermediality in Jia Zhang-ke’s Still Life

    Directory of Open Access Journals (Sweden)

    Cecília Mello

    2014-07-01

    Full Text Available This article is dedicated to an analysis of Chinese director Jia Zhang-ke’s film Still Life (San Xia Hao Ren 三峡好人, 2006 from the point of view of its intermedial relationship with Chinese landscape painting. As I will suggest, Jia’s discovery of a real landscape and a vanishing cityscape in this film, shot on location in the region of the Three Gorges of the Yangtze River, springs from a realist impulse and from an original aesthetic response to a new historical and social conjuncture. But while it seems firmly located in the landscape of contemporary China, the film also shares aesthetic qualities with the tradition of Chinese landscape painting, mounted on hanging or hand scrolls. A focus on this particular instance of intermediality leads to a reflection on cinema’s spatial organization in light of current revisions in film and audiovisual theory, which suggest that filmic space and its spectatorial experience should be considered above all from the point of view of touch and movement. It also allows for a broader understanding of the political implications of intermediality in Jia Zhang-ke’s oeuvre, fruit of an organic link between form and content that brings a historical resonance to a contemporary perspective.

  11. Lactobacillus casei Zhang and vitamin K2 prevent intestinal tumorigenesis in mice via adiponectin-elevated different signaling pathways.

    Science.gov (United States)

    Zhang, Yong; Ma, Chen; Zhao, Jie; Xu, Haiyan; Hou, Qiangchuan; Zhang, Heping

    2017-04-11

    The incidence of colon cancer has increased considerably and the intestinal microbiota participate in the development of colon cancer. We showed that the L. casei Zhang or vitamin K2 (Menaquinone-7) intervention significantly alleviated intestinal tumor burden in mice. This was associated with increased serum adiponectin levels in both treatments. But osteocalcin level was only increased by L. casei Zhang. Furthermore, the anti-carcinogenic actions of L. casei Zhang were mediated by hepatic Chloride channel-3(CLCN3)/Nuclear Factor Kappa B(NF-κB) and intestinal Claudin15/Chloride intracellular channel 4(CLIC4)/Transforming Growth Factor Beta(TGF-β) signaling, while the vitamin K2 effect involved a hepatic Vitamin D Receptor(VDR)-phosphorylated AMPK signaling pathway. Fecal DNA sequencing by the Pacbio RSII method revealed there was significantly lower Helicobacter apodemus, Helicobacter mesocricetorum, Allobaculum stercoricanis and Adlercreutzia equolifaciens following both interventions compared to the model group. Moreover, different caecum acetic acid and butyric acid levels and enrichment of other specific microbes also determined the activity of the different regulatory pathways. Together these data show that L. casei Zhang and Vitamin K2 can suppress gut risk microbes and promote beneficial microbial metabolites to reduce colonic tumor development in mice.

  12. Nonequilibrium steady state of a weakly-driven Kardar–Parisi–Zhang equation

    Science.gov (United States)

    Meerson, Baruch; Sasorov, Pavel V.; Vilenkin, Arkady

    2018-05-01

    We consider an infinite interface of d  >  2 dimensions, governed by the Kardar–Parisi–Zhang (KPZ) equation with a weak Gaussian noise which is delta-correlated in time and has short-range spatial correlations. We study the probability distribution of the interface height H at a point of the substrate, when the interface is initially flat. We show that, in stark contrast with the KPZ equation in d  statistics of directed polymers in random potential.

  13. Le langage des couleurs dans les films de Zhang Yimou

    OpenAIRE

    Xiaomin Giafferri

    2009-01-01

    Tout film, ou du moins tout film de fiction, est récit. Représentation visuelle et sonore, le film transpose à l’écran la réalité par un enchaînement d’images, où des traits physiques, gestes, mouvements, paysages se combinent pour former un espace de fiction. Le cinéma en tant qu’art possède un langage spécifique ; dans un film coloré, les couleurs comme moyen d’expression font partie du langage pictural. A partir de quatre films de Zhang Yimou connus en Europe, Le so...

  14. Air pollution in China, with Junfeng (Jim) Zhang by Ashley Ahearn.

    Science.gov (United States)

    Zhang, Junfeng Jim

    2011-06-01

    Air pollution in China, one of the world’s oldest civilizations, reflects a combination of traditional and modern-day factors. Severe air pollution in Chinese cities is the result of rapid industrialization, urbanization, and growth in vehicle use. At the same time, traditional indoor burning of solid fuels such as coal and dung presents acute, severe exposures to pollutants including particulate matter, carbon monoxide, arsenic, and mercury. In this podcast, Junfeng (Jim) Zhang tells host Ashley Ahearn about some of the factors that make air pollution a significant problem in China.

  15. Period of Light Variability in BL Lac ON 231 Xu Yun Bing1, Zhang ...

    Indian Academy of Sciences (India)

    period light variability may be greater than the current observation history and needs further monitoring certification (Zhang et al. 1998). To establish the real periods of ON 231, we employ wavelet analysis and DCF method to search a periodicity in the light curves. 2. Periodicity analysis of ON231. 2.1 Light curve of ON 231.

  16. Security analysis of boolean algebra based on Zhang-Wang digital signature scheme

    International Nuclear Information System (INIS)

    Zheng, Jinbin

    2014-01-01

    In 2005, Zhang and Wang proposed an improvement signature scheme without using one-way hash function and message redundancy. In this paper, we show that this scheme exits potential safety concerns through the analysis of boolean algebra, such as bitwise exclusive-or, and point out that mapping is not one to one between assembly instructions and machine code actually by means of the analysis of the result of the assembly program segment, and which possibly causes safety problems unknown to the software

  17. Security analysis of boolean algebra based on Zhang-Wang digital signature scheme

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, Jinbin, E-mail: jbzheng518@163.com [School of Mathematics and Computer Science, Long Yan University, Longyan 364012 (China)

    2014-10-06

    In 2005, Zhang and Wang proposed an improvement signature scheme without using one-way hash function and message redundancy. In this paper, we show that this scheme exits potential safety concerns through the analysis of boolean algebra, such as bitwise exclusive-or, and point out that mapping is not one to one between assembly instructions and machine code actually by means of the analysis of the result of the assembly program segment, and which possibly causes safety problems unknown to the software.

  18. Zhang neural network for online solution of time-varying convex quadratic program subject to time-varying linear-equality constraints

    International Nuclear Information System (INIS)

    Zhang Yunong; Li Zhan

    2009-01-01

    In this Letter, by following Zhang et al.'s method, a recurrent neural network (termed as Zhang neural network, ZNN) is developed and analyzed for solving online the time-varying convex quadratic-programming problem subject to time-varying linear-equality constraints. Different from conventional gradient-based neural networks (GNN), such a ZNN model makes full use of the time-derivative information of time-varying coefficient. The resultant ZNN model is theoretically proved to have global exponential convergence to the time-varying theoretical optimal solution of the investigated time-varying convex quadratic program. Computer-simulation results further substantiate the effectiveness, efficiency and novelty of such ZNN model and method.

  19. Comparative analysis of the gene expression profile of probiotic Lactobacillus casei Zhang with and without fermented milk as a vehicle during transit in a simulated gastrointestinal tract.

    Science.gov (United States)

    Wang, Jicheng; Zhong, Zhi; Zhang, Wenyi; Bao, Qiuhua; Wei, Aibin; Meng, He; Zhang, Heping

    2012-06-01

    Studies have found that the survival of probiotics could be strongly enhanced with dairy products as delivery vehicles, but the molecular mechanism by which this might occur has seldom been mentioned. In this study, microarray technology was used to detect the gene expression profile of Lactobacillus casei Zhang with and without fermented milk used as a delivery vehicle during transit in simulated gastrointestinal juice. Numerous genes of L. casei Zhang in strain suspension were upregulated compared to those from L. casei Zhang in fermented milk. These data might indicate that L. casei Zhang is stimulated directly without the protection of fermented milk, and the high-level gene expression observed here may be a stress response at the transcriptional level. A large proportion of genes involved in translation and cell division were downregulated in the bacteria that were in strain suspension during transit in simulated intestinal juice. This may impede protein biosynthesis and cell division and partially explain the lower viability of L. casei Zhang during transit in the gastrointestinal tract without the delivery vehicle. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  20. [The academic characteristics of acupuncture and moxibustion of professor ZHANG Yongshu:a famous acupuncturist in Southern Fujian].

    Science.gov (United States)

    Xu, Weiwei; Meng, Xianjun; Zhu, Anning; Wang, Yu; Luo, Wuyougumo; Kuang, Zifang

    2017-01-12

    Professor ZHANG Yongshu , who studied from professor LIU Zhangjie , is a famous acupuncturist in Quanzhou of Southern Fujian. The publications authored by professor ZHANG Yongshu were collected in this study to summarize his academic characteristics of acupuncture and moxibustion. The result indicated he highly valued the regulation of yang qi , and established the theory of "developing yang to nourish yin ", which proposes to develop yang qi to achieve the effect of culturing yin ; he summarized eight methods to regulate the governor vessel and conception vessel, which can condition the body's yin and yang ; he paid attention to moxibustion therapy and its dosage, and made the best of direct moxibustion. In addition, he focused on meridian theory with effective application of meridian syndrome differentiation; in clinical treatment, he regulated the hand- yangming meridian to treat diseases by nourishing yang , generating yin and regulating fu .

  1. ZHANG Ting-dong (张亭栋)—— A Pioneer in Treating Leukemia with Arsenous Acid

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    @@ Prof. ZHANG Ting-dong, male, was born in Wuqiao County, He-bei Province on Nov. 8,1932, and in 1950 graduated from Harbin Medical University. And from 1960 to 1963 he studied in and then graduated from Western Doctors'class for Learning Traditional Chinese Medicine(TCM).

  2. A Theta lift representation for the Kawazumi-Zhang and Faltings invariants of genus-two Riemann surfaces

    CERN Document Server

    Pioline, Boris

    2016-01-01

    The Kawazumi-Zhang invariant $\\varphi$ for compact genus-two Riemann surfaces was recently shown to be a eigenmode of the Laplacian on the Siegel upper half-plane, away from the separating degeneration divisor. Using this fact and the known behavior of $\\varphi$ in the non-separating degeneration limit, it is shown that $\\varphi$ is equal to the Theta lift of the unique (up to normalization) weak Jacobi form of weight $-2$. This identification provides the complete Fourier-Jacobi expansion of $\\varphi$ near the non-separating node, gives full control on the asymptotics of $\\varphi$ in the various degeneration limits, and provides a efficient numerical procedure to evaluate $\\varphi$ to arbitrary accuracy. It also reveals a mock-type holomorphic Siegel modular form of weight $-2$ underlying $\\varphi$. From the general relation between the Faltings invariant, the Kawazumi-Zhang invariant and the discriminant for hyperelliptic Riemann surfaces, a Theta lift representation for the Faltings invariant in genus two ...

  3. Capturing Parent-Child Interactions With Social Media: Comment on Zhang et al. (2015).

    Science.gov (United States)

    Leung, Ricky; Dong, Guanghui; Qin, Xiaoxia; Lin, Shao

    2016-06-01

    Zhang et al. conducted a qualitative study of children presented with 19 parental structuring behaviors of parental control and were asked to attribute the parent's intent behind the behaviors. The authors developed several conceptual categories, "parent-centered," "child-centered," or "social" interests. Here, we describe how their 12 propositions could be empirically tested in further studies using social media. © The Author(s) 2016.

  4. Proof and Pedagogy in Ancient China: Examples from Liu Hui's Commentary on "JIU ZHANG SUAN SHU".

    Science.gov (United States)

    Siu, Man-Keung

    1993-01-01

    Illustrates the pedagogical implications embodied in Liu Hui's discussion on the ancient Chinese mathematical classic "JIU ZHANG SUAN SHU" (Nine Chapters on the Mathematical Art) with respect to aspects of proof and, more generally, the role of proof in mathematics. Provides examples involving area and volume. (Contains 25 references.)…

  5. Many particle approximation of the Aw-Rascle-Zhang second order model for vehicular traffic.

    Science.gov (United States)

    Francesco, Marco Di; Fagioli, Simone; Rosini, Massimiliano D

    2017-02-01

    We consider the follow-the-leader approximation of the Aw-Rascle-Zhang (ARZ) model for traffic flow in a multi population formulation. We prove rigorous convergence to weak solutions of the ARZ system in the many particle limit in presence of vacuum. The result is based on uniform BV estimates on the discrete particle velocity. We complement our result with numerical simulations of the particle method compared with some exact solutions to the Riemann problem of the ARZ system.

  6. Characteristic Sign Renewals of Kardar-Parisi-Zhang Fluctuations

    Science.gov (United States)

    Takeuchi, Kazumasa A.; Akimoto, Takuma

    2016-09-01

    Tracking the sign of fluctuations governed by the (1+1)-dimensional Kardar-Parisi-Zhang (KPZ) universality class, we show, both experimentally and numerically, that its evolution has an unexpected link to a simple stochastic model called the renewal process, studied in the context of aging and ergodicity breaking. Although KPZ and the renewal process are fundamentally different in many aspects, we find remarkable agreement in some of the time correlation properties, such as the recurrence time distributions and the persistence probability, while the two systems can be different in other properties. Moreover, we find inequivalence between long-time and ensemble averages in the fraction of time occupied by a specific sign of the KPZ-class fluctuations. The distribution of its long-time average converges to nontrivial broad functions, which are found to differ significantly from that of the renewal process, but instead be characteristic of KPZ. Thus, we obtain a new type of ergodicity breaking for such systems with many-body interactions. Our analysis also detects qualitative differences in time-correlation properties of circular and flat KPZ-class interfaces, which were suggested from previous experiments and simulations but still remain theoretically unexplained.

  7. A note on Wang et al's attack on Zhang et al's multiparty quantum secret sharing

    International Nuclear Information System (INIS)

    Gao Gan

    2012-01-01

    Recently, Wang et al (2008 Phys. Lett. A 373 65) proposed an attack on Zhang et al's (2007 Opt. Commun. 269 418) multiparty quantum secret sharing scheme, in which the first and the last agent are reported to be able to cooperatively eavesdrop on all the secret messages without being detected. In this paper, we show that in Wang et al's attack, on average no more than half the secret messages can be eavesdropped. (paper)

  8. Review of the genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae) with description of two new species.

    Science.gov (United States)

    Chang, Zhi-Min; Yang, Lin; Zhang, Zheng-Guang; Chen, Xiang-Sheng

    2015-12-11

    Two new species of the issid genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae): Neotetricodes longispinus Chang et Chen sp. nov. (China: Yunnan) and Neotetricodes xiphoideus Chang et Chen sp. nov. (China: Yunnan) are described and illustrated. The generic characteristic is redefined. A checklist and key to the species of the genus are provided. The female genitalia of the genus are firstly described.

  9. A Chinese View on the Cultural Conditionality of Logic and Epistemology: Zhang Dongsun’s Intercultural Methodology

    Directory of Open Access Journals (Sweden)

    Jana Rošker

    2010-12-01

    Full Text Available Recognizing the fact that comprehension, analysis and transmission of reality are based on diversely structured socio-political contexts as well as on different categorical and essential postulates, offers a prospect of enrichment. Thus, this article presents an analysis and interpretation of one of the first Chinese theoreticians, working in the field of intercultural methodology. Although Zhang Dongsun (1886–1973 can be considered as one of the leading Chinese philosophers of the 20th Century, his criticism of Sinicized Marxist ideologies marked him as a political dissident and he was consequently consigned to oblivion for several decades; only recently has his work been rediscovered by a number of younger Chinese theorists, who have shown a growing interest in his ideas. Although he is still relatively unknown in the West, Zhang definitely deserves to be recognized for his contributions to Chinese and comparative philosophy. The present article focuses on his extraordinary ability to introduce Western thought in a way which was compatible with the specific methodology of traditional Chinese thought. According to such presumptions, culture is viewed as an entity composed of a number of specific discourses and relations. The article shows how the interweaving and interdependence of these discourses form different cultural backgrounds, which manifest themselves in the specific, culturally determined structures of language and logic. It also explains the role of traditional elements in his cultural epistemology.

  10. The role of C-type lectin receptors in human skin immunity: immunological interactions between dendritic cells, Langerhans cells and keratinocytes

    NARCIS (Netherlands)

    van den Berg, L.M.

    2013-01-01

    Langerhanscellen kunnen actief contact met elkaar maken in de huid waardoor ze informatie over binnendringende ziekteverwekkers uitwisselen. Dit leidt tot een efficiënte afweerreactie. Linda van den Berg geeft hier een beschrijving van. Daarnaast ontdekte ze dat een koolhydraat afkomstig van een

  11. Coloring the spots : Diagnosis, measurement instruments and treatment in vitiligo

    NARCIS (Netherlands)

    Lommerts, J.E.

    2018-01-01

    Vitiligo is een verworven huidziekte die voorkomt bij ongeveer 1% van de algehele wereldbevolking. Het is een ontsierende aandoening en wordt veroorzaakt door selectieve destructie van pigment aanmakende cellen (melanocyten) in de huid, waardoor witte plekken ontstaan. Dit proefschrift richt zich op

  12. Reply to comment by Ma and Zhang on "Rescaling the complementary relationship for land surface evaporation"

    Science.gov (United States)

    Crago, Richard; Qualls, Russell; Szilagyi, Jozsef; Huntington, Justin

    2017-07-01

    Ma and Zhang (2017) note a concern they have with our rescaled Complementary Relationship (CR) for land surface evaporation when daily average wind speeds are very low (perhaps less than 1 m/s). We discuss conditions and specific formulations that lead to this concern, but ultimately argue that under these conditions, a key assumption behind the CR itself may not be satisfied at the daily time scale. Thus, careful consideration of the reliability of the CR is needed when wind speeds are very low.

  13. Koeien met een glimlach op SMILE-bedrijven

    NARCIS (Netherlands)

    Smolders, E.A.A.

    2006-01-01

    Informatie over het SMILE-project (Sustainable Milk Initiative Launch in Europe), waarbij melkveehouders kijken op elkaars bedrijf en daarmee gestimuleerd worden om stalaanpassingen op het eigen bedrijf door te voeren, waarmee het aantal beschadigingen aan huid, hakken, knieën en nek bij hun koeien

  14. Tens bij bevallingen

    NARCIS (Netherlands)

    Tuin-Nuis, F.D.F.

    2000-01-01

    TENS (Transcutane Electrische Neuro Stimulatie) is een pijnverlichtingsmethode die berust op de Gate Control Theory van Melzack en Wall. Door middel van electrische pulsen via de huid zou de geleiding van nociceptieve signalen (pijnprikkels) worden beïnvloed en zou het lichaam endorfinen aanmaken:

  15. Warmtetransport in Kleding bij Aanstraling met Warmte (Heat Transport in Clothing during Irradiation with Heat)

    Science.gov (United States)

    1990-01-22

    afgifte van do huid en van do kieding. Door sornoring van do drogo on do natto (ovaporatievo) warutostroom is do total. varmtostroom verkregon...stralingsmodol is. In do experimenten is do natte warintestroom buiten beschouwing gelaten. Indion do natto warintestrooin wel in hot experimont wordt

  16. Le langage des couleurs dans les films de Zhang Yimou

    Directory of Open Access Journals (Sweden)

    Xiaomin Giafferri

    2009-05-01

    Full Text Available Tout film, ou du moins tout film de fiction, est récit. Représentation visuelle et sonore, le film transpose à l’écran la réalité par un enchaînement d’images, où des traits physiques, gestes, mouvements, paysages se combinent pour former un espace de fiction. Le cinéma en tant qu’art possède un langage spécifique ; dans un film coloré, les couleurs comme moyen d’expression font partie du langage pictural. A partir de quatre films de Zhang Yimou connus en Europe, Le sorgho rouge, Epouses et concubines, Judou et Hero, ce texte tente de réfléchir sur ces questions: si l’on admet que les limites du récit filmique diffèrent de celles du récit verbal, romanesque par exemple, les couleurs qui ne constituent pas un trait pertinent d’identification, participent-elle à la prise en charge de l’histoire ? Composante de l’espace filmique dont les fonctions narratives sont incontestées, sont-elle définitivement non diégétiques ?

  17. A quantitative approach to assess the risk of skin sensitization from hair dye ingredients : A case study using p-phenylenediamine (PPD)

    NARCIS (Netherlands)

    Ezendam J; Park M; Salverda-Nijhof JGW; VTS; V&Z

    2013-01-01

    Methode om een veilige limiet voor allergie door haarverf vast te stellen
    Het gebruik van haarverf is in principe veilig. Wel bevat dit product stoffen die bij sommige mensen allergische reacties kunnen veroorzaken, zoals jeuk, roodheid en zwellingen van de huid. Zo reageert een klein percentage

  18. Recent developments on the Kardar-Parisi-Zhang surface-growth equation.

    Science.gov (United States)

    Wio, Horacio S; Escudero, Carlos; Revelli, Jorge A; Deza, Roberto R; de la Lama, Marta S

    2011-01-28

    The stochastic nonlinear partial differential equation known as the Kardar-Parisi-Zhang (KPZ) equation is a highly successful phenomenological mesoscopic model of surface and interface growth processes. Its suitability for analytical work, its explicit symmetries and its prediction of an exact dynamic scaling relation for a one-dimensional substratum led people to adopt it as a 'standard' model in the field during the last quarter of a century. At the same time, several conjectures deserving closer scrutiny were established as dogmas throughout the community. Among these, we find the beliefs that 'genuine' non-equilibrium processes are non-variational in essence, and that the exactness of the dynamic scaling relation owes its existence to a Galilean symmetry. Additionally, the equivalence among planar and radial interface profiles has been generally assumed in the literature throughout the years. Here--among other topics--we introduce a variational formulation of the KPZ equation, remark on the importance of consistency in discretization and challenge the mainstream view on the necessity for scaling of both Galilean symmetry and the one-dimensional fluctuation-dissipation theorem. We also derive the KPZ equation on a growing domain as a first approximation to radial growth, and outline the differences with respect to the classical case that arises in this new situation.

  19. Bitcoins: virtueel geld, beslag op gebakken lucht?

    NARCIS (Netherlands)

    Jongbloed, A.W.

    In het Delta Lloyd magazine april 2015, p. 32, wordt aandacht besteed aan Martijn Wismeijer (43 jaar). Hij liet onlangs twee chips onder zijn huid implanteren, een voor bitcoins en een voor de honderden wachtwoorden die hij voor digitale toepassingen gebruikt. 1 Het is een feit dat we in het huidige

  20. Clinical and patient reported outcomes in vitiligo

    NARCIS (Netherlands)

    Linthorst Homan, M.W.

    2012-01-01

    Vitiligo is een stoornis die tot gevolg heeft dat door pigmentverlies de aangedane huid wit wordt. Hoewel in westerse landen de ziekte als onschuldig wordt gezien, is de kwaliteit van leven van een patiënt met vitiligo minder in vergelijking met de algemene bevolking. Bovendien heeft een vijfde van

  1. Generalized One-Band Model Based on Zhang-Rice Singlets for Tetragonal CuO

    Science.gov (United States)

    Hamad, I. J.; Manuel, L. O.; Aligia, A. A.

    2018-04-01

    Tetragonal CuO (T-CuO) has attracted attention because of its structure similar to that of the cuprates. It has been recently proposed as a compound whose study can give an end to the long debate about the proper microscopic modeling for cuprates. In this work, we rigorously derive an effective one-band generalized t -J model for T-CuO, based on orthogonalized Zhang-Rice singlets, and make an estimative calculation of its parameters, based on previous ab initio calculations. By means of the self-consistent Born approximation, we then evaluate the spectral function and the quasiparticle dispersion for a single hole doped in antiferromagnetically ordered half filled T-CuO. Our predictions show very good agreement with angle-resolved photoemission spectra and with theoretical multiband results. We conclude that a generalized t -J model remains the minimal Hamiltonian for a correct description of single-hole dynamics in cuprates.

  2. Analysis of Liu Zhiji Theory of Historians' and Zhang Xuecheng' s Cultivation Comparison%刘知几与章学诚的史家修养理论比较研究

    Institute of Scientific and Technical Information of China (English)

    董传岭

    2012-01-01

    Liu Zhiji and Zhang Xuecheng are famous for their historical theory in ancient China. They all put forward the theory of historian historians' cultivation which has important sense to improve historian self-cultivation and historical development. Liu Zhiji argued that historians should have "ability, learning, knowledge", Zhang Xuecheng further put forward historian moral on the basis of the Liu Zhiji~s theory,enriched and developed the theory of the historians~ cultiva- tion. They all emphasize "ability,learning, knowledge", Liu Zhiji emphasize "knowledge" mostly, but Zhang Xuecheng relied heavily on "moral". Comparison and analysis on Liu Zhiji and Zhang Xuecheng's theory of self-cultivation,not only enable us to find their theories difference, under- standing the theory deeply, but also has certain enlightenment function on the contemporary historiography development.%我国古代史学理论大家刘知几、章学诚均提出了有关史家修养的理论,刘知几认为史家应具备"才、学、识",章学诚在继承刘知几史家修养理论的基础上,进一步提出"史德",丰富和发展了史家修养理论。刘知几、章学诚均重视"才、学、识",但刘知几最重"史识",章学诚尤重"史德"。比较和分析二者的史家修养理论,不仅能使我们发现他们理论的异同,深刻理解史家修养理论,而且对当今史学发展也具有一定的启示功用。

  3. Market Feasibility of Burberry and Gucci in Zhang Jiagang City, P.R China : Case: Introduce a New Luxury Brand into Kelly Mall

    OpenAIRE

    Wang, Ning; Wu, Youran

    2012-01-01

    With the rapid development of Chinese economy, wealth has spread from largest coastal cities to smaller cities and luxury stores have started to follow. Kelly Mall is the largest high-end department store situated in Zhang Jiagang City, Jiangsu Province, P.R China. This research aims to figure out if Kelly Mall should introduce a new luxury brand, help-ing Kelly Mall’s board members make decision on taking either Burberry or Gucci or both of them into its luxury department. Theoretical framew...

  4. Thinning Zhang-Suen dan Stentiford untuk Menentukan Ekstraksi Ciri (Minutiae Sebagai Identifikasi Pola Sidik Jari

    Directory of Open Access Journals (Sweden)

    Faiza Alif Fakhrina

    2016-11-01

    Full Text Available Fingerprint is the skin on the palms of the hands and feet that are covered with small ridge lines. Fingerprint pattern belonging to every human is being unique. There are fingerprint on the ridge pattern will not change during human life. Ridge pattern is characteristic of the fingrprint that can be used for biometric identification. Based on fingerprint ridge pattern into four, namely whorl, ulnar loop, radial loop, and arch. Minutiae Extraction (Crossing Number, Core and Delta, Center Point Location can be used for fingerprint pattern recognition. Some of the methods used in the fingerprint pattern recognition is Minutiae Extraction, and Thinning Zhang-Suen and Stentiford. Croosing Number is used for process Minutiae Extraction, example termination and bifurcation. The classification method used Linear Discriminant Analysis. The result fingerprint pattern recognition is system can recognize fingerprint patter as much as 20 images and system can not recognize fingerprint pattern as much as 10 images. Accuracy of fingerprint pattern recognition is 66%.

  5. China marks World Population Day. Address by Zhang Weiqing: (Excerpts).

    Science.gov (United States)

    Zhang, W

    1998-08-01

    This is a summary of remarks by Minister Zhang Weiqing of China's State Family Planning Commission (SFPC) given on World Population Day in China. The world's population size has increased by 1 billion since 1987, and will reach 6 billion by 1999. As the most populous developing country in the world, China has a greater population pressure and bears a large responsibility regarding stabilization of the world's population and realization of sustainable development. China has a less developed economy and a high percentage of rural and illiterate persons, many of whom are below the poverty line. The interests of both present and future generations must be taken into account with regard to development. In addition, the modernization drive must include strategies for sustainable development and basic national policies of FP and environmental protection in order to achieve a balance among population growth, the economy, resources, and the environment. After 30 years of effort, China has succeeded in solving its population problem by integrating governmental guidance with voluntary public participation in FP. In 1997, the birthrate decreased to 16.57/1000, and the total fertility rate was below replacement level. Changes in attitude toward marriage and childbearing have occurred, as has awareness of voluntary participation in FP. However, some problems have emerged in the implementation of population and FP programs. China will carry out its programs strictly and effectively while developing the national economy. Goals include: 1) stressing the IEC program regarding contraception and regular FP management and services; 2) integrating the FP program with economic development; 3) helping the public to become well off; 4) protecting maternal and child health; 5) improving the status of women; 6) delivering reproductive services; and 7) improving social security measures. Efforts will be made to enable the public to have a more active part in implementing the FP program.

  6. Retraction RETRACTION of "Tumor necrosis factor alpha gene -308G>A polymorphism association with the risk of esophageal cancer in a Han Chinese population" by H. Zhao, H.W. Zhang, T. Zhang and X.M. Gu - Genet. Mol. Res. 15 (2): gmr.15025866 DOI: http://dx.doi.org/10.4238/gmr.15025866.

    Science.gov (United States)

    Zhao, H; Zhang, H W; Zhang, T; Gu, X M

    2016-10-07

    The retracted article is: Zhao H, Zhang HW, Zhang T and Gu XM (2016). Tumor necrosis factor alpha gene -308G>A polymorphism association with the risk of esophageal cancer in a Han Chinese population. Genet. Mol. Res. 15: gmr.15025866. Two major concerns were found in this article. Firstly, it was found to be substantially equal to the article "Tumor necrosis factor-alpha gene -308G > A polymorphism alters the risk of hepatocellular carcinoma in a Han Chinese population" published in the Diagnostic Pathology Diagnostic Pathology (2014) 9: 199, by Feng et al.; licensee BioMed Central. 2014 - DOI: 10.1186/s13000-014-0199-3. Secondly, the authors do not discuss limitations of their approaches in the discussion. The discussion is largely an elaboration of the literature in the introduction part. However, even in that context, the discussion does not appropriately review the literature and there are frequent references to conclusions that are not supported by the cited literature. The GMR editorial staff was alerted and after a thorough investigation, there is strong reason to believe that the peer review process was failure. Also, after review and contacting the authors, the editors of Genetics and Molecular Research decided to retract this article in accordance with the recommendations of the Committee on Publication Ethics (COPE). The authors and their institutions were advised of this serious breach of ethics.

  7. Height distribution tails in the Kardar-Parisi-Zhang equation with Brownian initial conditions

    Science.gov (United States)

    Meerson, Baruch; Schmidt, Johannes

    2017-10-01

    For stationary interface growth, governed by the Kardar-Parisi-Zhang (KPZ) equation in 1 + 1 dimensions, typical fluctuations of the interface height at long times are described by the Baik-Rains distribution. Recently Chhita et al (2016 arXiv:1611.06690) used the totally asymmetric simple exclusion process (TASEP) to study the height fluctuations in systems of the KPZ universality class for Brownian interfaces with arbitrary diffusion constant. They showed that there is a one-parameter family of long-time distributions, parameterized by the diffusion constant of the initial random height profile. They also computed these distributions numerically by using Monte Carlo (MC) simulations. Here we address this problem analytically and focus on the distribution tails at short times. We determine the (stretched exponential) tails of the height distribution by applying the optimal fluctuation method (OFM) to the KPZ equation. We argue that, by analogy with other initial conditions, the ‘slow’ tail holds at arbitrary times and therefore provides a proper asymptotic to the family of long-time distributions studied in Chhita et al (2016 arXiv:1611.06690). We verify this hypothesis by performing large-scale MC simulations of a TASEP with a parallel-update rule. The ‘fast’ tail, predicted by the OFM, is also expected to hold at arbitrary times, at sufficiently large heights.

  8. When fast and slow interfaces grow together: Connection to the half-space problem of the Kardar-Parisi-Zhang class

    Science.gov (United States)

    Ito, Yasufumi; Takeuchi, Kazumasa A.

    2018-04-01

    We study height fluctuations of interfaces in the (1 +1 ) -dimensional Kardar-Parisi-Zhang (KPZ) class, growing at different speeds in the left half and the right half of space. Carrying out simulations of the discrete polynuclear growth model with two different growth rates, combined with the standard setting for the droplet, flat, and stationary geometries, we find that the fluctuation properties at and near the boundary are described by the KPZ half-space problem developed in the theoretical literature. In particular, in the droplet case, the distribution at the boundary is given by the largest-eigenvalue distribution of random matrices in the Gaussian symplectic ensemble, often called the GSE Tracy-Widom distribution. We also characterize crossover from the full-space statistics to the half-space one, which arises when the difference between the two growth speeds is small.

  9. Book Review ~ Advancing Online Learning in Asia. Editors: David Murphy, Namin Shin, and Weiyuan Zhang

    Directory of Open Access Journals (Sweden)

    Insung Jung

    2004-08-01

    Full Text Available The Internet, high-speed electronic communications, and computers have transformed the way we teach and learn. With the development of these new information and communication technologies, the idea of online education has been adopted in many developed, and more recently in developing countries, to bring wider opportunities to people in the form of increased access to flexible and interactive, open and distance learning systems. As stated in the Introduction of “Advancing Online Learning in Asia” edited by Murphy, Shin, and Zhang, online education is now everywhere and it “is changing the ways in which educational institutions interact with their students, for both traditional and distance education universities.” By examining recent developments of online education in Asia from multiple perspectives, this book has a potential to be an invaluable resource to educators. Taking cases from the Asian region in which online learning was introduced, implemented, and experienced, this book presents the cases from a number of perspectives, especially from student perspectives, and addresses pedagogical and technical issues faced by online educators. The breadth of the articles in this book provides a wide range of online learning cases and varied perspectives, which should clearly appeal to educators, researchers, administrators, and policy makers in online education.

  10. 论张洁小说女性三种形态的身体%On the Three Forms of Female Body in Zhang Jie’s Novels

    Institute of Scientific and Technical Information of China (English)

    黄晓娟; 邱慧婷

    2016-01-01

    Zhang Jie,the only female writer having been twice awarded the Mao Dun Literature Awards, has been focusing on the destiny of female character and broadening the way of portraying females. Different forms of female body presented in her novel represented her reflection on female destiny and patriarchal culture in different dimensions.Her exploring,constructing and pursuing of the ideal female personality can be found in her analysis of different forms of female body such as the feminized body,the suffering body and the masculinized body,which can also be contributed to the understanding of Zhang Jie’s literary world and her reflections on the harmony between the sexes.%张洁是中国文坛唯一两次获得“茅盾文学奖”的女作家,一直致力于女性命运的关照和女性写作视野的开拓。她小说中的女性呈现出不同的身体形态,代表着作者对女性命运和男权文化不同维度的思考。通过雌化的身体、承受的身体和雄化的身体等不同形态身体的探析,可以发现张洁对理想女性人格积极探寻和建构追求的过程,有助于深入认知张洁的文学世界及其对两性和谐的思考。

  11. Maximum of an Airy process plus Brownian motion and memory in Kardar-Parisi-Zhang growth

    Science.gov (United States)

    Le Doussal, Pierre

    2017-12-01

    We obtain several exact results for universal distributions involving the maximum of the Airy2 process minus a parabola and plus a Brownian motion, with applications to the one-dimensional Kardar-Parisi-Zhang (KPZ) stochastic growth universality class. This allows one to obtain (i) the universal limit, for large time separation, of the two-time height correlation for droplet initial conditions, e.g., C∞=limt2/t1→+∞h(t1) h (t2)¯c/h(t1)2¯c, with C∞≈0.623 , as well as conditional moments, which quantify ergodicity breaking in the time evolution; (ii) in the same limit, the distribution of the midpoint position x (t1) of a directed polymer of length t2; and (iii) the height distribution in stationary KPZ with a step. These results are derived from the replica Bethe ansatz for the KPZ continuum equation, with a "decoupling assumption" in the large time limit. They agree and confirm, whenever they can be compared, with (i) our recent tail results for two-time KPZ with the work by de Nardis and Le Doussal [J. Stat. Mech. (2017) 053212, 10.1088/1742-5468/aa6bce], checked in experiments with the work by Takeuchi and co-workers [De Nardis et al., Phys. Rev. Lett. 118, 125701 (2017), 10.1103/PhysRevLett.118.125701] and (ii) a recent result of Maes and Thiery [J. Stat. Phys. 168, 937 (2017), 10.1007/s10955-017-1839-2] on midpoint position.

  12. Dissipation dynamics of clothianidin and its control efficacy against Bradysia odoriphaga Yang and Zhang in Chinese chive ecosystems.

    Science.gov (United States)

    Zhang, Peng; He, Min; Zhao, Yunhe; Ren, Yupeng; Wei, Yan; Mu, Wei; Liu, Feng

    2016-07-01

    Clothianidin is a second-generation neonicotinoid insecticide that is quite effective against Bradysia odoriphaga Yang and Zhang, the major insect pest affecting Chinese chive in northern China. In this study, the dissipation of clothianidin in soil and its residue in leaves and pseudostems/bulbs as well as its control efficacy against B. odoriphaga and two other secondary pests were investigated in Chinese chive fields after soil application of clothianidin by the directional spray-washing method. The half-life of clothianidin was 35.73-36.10 days, and it could be detected in Chinese chive plants in both treatment plots up to 240 days after a single soil application. Clothianidin applied at 3.0 and 6.0 kg AI ha(-1) could suppress B. odoriphaga population growth, achieve satisfactory levels of pest control for almost 10 months and reduce the losses of the yield in winter. Moreover, the treatments also significantly reduced Thrips alliorum and Acrolepia alliella populations up to nearly 180 days after one application. Clothianidin can be considered to show long-lasting efficacy against B. odoriphaga and to be safe for use in Chinese chive at 3.0 and 6.0 kg AI ha(-1) once in the early root-rearing period to control B. odoriphaga in these cultivation ecosystems. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  13. Finite-size effects in the short-time height distribution of the Kardar-Parisi-Zhang equation

    Science.gov (United States)

    Smith, Naftali R.; Meerson, Baruch; Sasorov, Pavel

    2018-02-01

    We use the optimal fluctuation method to evaluate the short-time probability distribution P(H, L, t) of height at a single point, H=h(x=0, t) , of the evolving Kardar-Parisi-Zhang (KPZ) interface h(x, t) on a ring of length 2L. The process starts from a flat interface. At short times typical (small) height fluctuations are unaffected by the KPZ nonlinearity and belong to the Edwards-Wilkinson universality class. The nonlinearity, however, strongly affects the (asymmetric) tails of P(H) . At large L/\\sqrt{t} the faster-decaying tail has a double structure: it is L-independent, -\\lnP˜≤ft\\vert H\\right\\vert 5/2/t1/2 , at intermediately large \\vert H\\vert , and L-dependent, -\\lnP˜ ≤ft\\vert H\\right\\vert 2L/t , at very large \\vert H\\vert . The transition between these two regimes is sharp and, in the large L/\\sqrt{t} limit, behaves as a fractional-order phase transition. The transition point H=Hc+ depends on L/\\sqrt{t} . At small L/\\sqrt{t} , the double structure of the faster tail disappears, and only the very large-H tail, -\\lnP˜ ≤ft\\vert H\\right\\vert 2L/t , is observed. The slower-decaying tail does not show any L-dependence at large L/\\sqrt{t} , where it coincides with the slower tail of the GOE Tracy-Widom distribution. At small L/\\sqrt{t} this tail also has a double structure. The transition between the two regimes occurs at a value of height H=Hc- which depends on L/\\sqrt{t} . At L/\\sqrt{t} \\to 0 the transition behaves as a mean-field-like second-order phase transition. At \\vert H\\vert c-\\vert the slower tail behaves as -\\lnP˜ ≤ft\\vert H\\right\\vert 2L/t , whereas at \\vert H\\vert >\\vert H_c-\\vert it coincides with the slower tail of the GOE Tracy-Widom distribution.

  14. Mg2+ improves the thermotolerance of probiotic Lactobacillus rhamnosus GG, Lactobacillus casei Zhang and Lactobacillus plantarum P-8.

    Science.gov (United States)

    Yang, Y; Huang, S; Wang, J; Jan, G; Jeantet, R; Chen, X D

    2017-04-01

    Food-related carbohydrates and proteins are often used as thermoprotectants for probiotic lactobacilli during industrial production and processing. However, the effect of inorganic salts is rarely reported. Magnesium is the second-most abundant cation in bacteria, and commonly found in various foods. Mg 2+ homeostasis is important in Salmonella and has been reported to play a critical role in their thermotolerance. However, the role of Mg 2+ in thermotolerance of other bacteria, in particular probiotic bacteria, still remains a hypothesis. In this study, the effect of Mg 2+ on thermotolerance of probiotic lactobacilli was investigated in three well-documented probiotic strains, Lactobacillus rhamnosus GG, Lactobacillus casei Zhang and Lactobacillus plantarum P-8, in comparison with Zn 2+ and Na + . Concentrations of Mg 2+ between 10 and 50 mmol l -1 were found to increase the bacterial survival upon heat challenge. Remarkably, Mg 2+ addition at 20 mmol l -1 led to a 100-fold higher survival of L. rhamnosus GG upon heat challenge. This preliminary study also showed that Mg 2+ shortened the heat-induced extended lag time of bacteria, which indicated the improvement in bacterial recovery from thermal injury. In order to improve the productivity and stability of live probiotics, extensive investigations have been carried out to improve thermotolerance of probiotics. However, most of these studies focused on the effects of carbohydrates, proteins or amino acids. The roles of inorganic salts in various food materials, which have rarely been reported, should be considered when incorporating probiotics into these foods. In this study, Mg 2+ was found to play a significant role in the thermotolerance of probiotic lactobacilli. A novel strategy may be available in the near future by employing magnesium salts as protective agents of probiotics during manufacturing process. © 2017 The Society for Applied Microbiology.

  15. Reply to the comment by Q.Q. Qiao et al. on ;Cenozoic tectonic deformation and uplift of the South Tian Shan: Implications from magnetostratigraphy and balanced cross-section restoration of the Kuqa depression; by Tao Zhang, Xiaomin Fang, Chunhui Song, Erwin Appel, and Yadong Wang [Tectonophysics, 2014, doi:10.1016/j.tecto.2014.04.044

    Science.gov (United States)

    Zhang, Tao; Fang, Xiaomin; Song, Chunhui; Appel, Erwin; Wang, Yadong

    2017-07-01

    Qiao et al. (2016) commented on our work (Zhang et al., 2014) and rejected our reinterpretation of the magnetostratigraphic results of Huang et al. (2006) and Li et al. (2006), with the results gained using the Dynamic Time Warping Algorithm technique (DTWAT) as their main basis. However, Qiao et al. (2016) did not provide details of their modeling inputs, and, in particular, the parameters they chose for their calculations, where such parameters can have a serious impact upon any results. We therefore performed calculations using the same software (i.e., Qupydon) as Qiao et al. (2016), using reliable parameter settings. The results showed that the ;interesting correlation; of a 6000 minimum cost output completely correlate with the magnetostratigraphic Chrons C18r to C3An.1n ( 40-6 Ma), which is consistent with our reinterpreted magnetostratigraphic results. Furthermore, we summarized previous biostratigraphic studies of nearby areas; the data resulting from this process also supported our reinterpreted magnetostratigraphic correlation. We were therefore able to confirm the revised magnetostratigraphic correlation of Zhang et al. (2014).

  16. Assessing the Resolution Adaptability of the Zhang-McFarlane Cumulus Parameterization With Spatial and Temporal Averaging: RESOLUTION ADAPTABILITY OF ZM SCHEME

    Energy Technology Data Exchange (ETDEWEB)

    Yun, Yuxing [Atmospheric Sciences and Global Change Division, Pacific Northwest National Laboratory, Richland WA USA; State Key Laboratory of Severe Weather, Chinese Academy of Meteorological Sciences, Beijing China; Fan, Jiwen [Atmospheric Sciences and Global Change Division, Pacific Northwest National Laboratory, Richland WA USA; Xiao, Heng [Atmospheric Sciences and Global Change Division, Pacific Northwest National Laboratory, Richland WA USA; Zhang, Guang J. [Scripps Institution of Oceanography, University of California, San Diego CA USA; Ghan, Steven J. [Atmospheric Sciences and Global Change Division, Pacific Northwest National Laboratory, Richland WA USA; Xu, Kuan-Man [NASA Langley Research Center, Hampton VA USA; Ma, Po-Lun [Atmospheric Sciences and Global Change Division, Pacific Northwest National Laboratory, Richland WA USA; Gustafson, William I. [Atmospheric Sciences and Global Change Division, Pacific Northwest National Laboratory, Richland WA USA

    2017-11-01

    Realistic modeling of cumulus convection at fine model resolutions (a few to a few tens of km) is problematic since it requires the cumulus scheme to adapt to higher resolution than they were originally designed for (~100 km). To solve this problem, we implement the spatial averaging method proposed in Xiao et al. (2015) and also propose a temporal averaging method for the large-scale convective available potential energy (CAPE) tendency in the Zhang-McFarlane (ZM) cumulus parameterization. The resolution adaptability of the original ZM scheme, the scheme with spatial averaging, and the scheme with both spatial and temporal averaging at 4-32 km resolution is assessed using the Weather Research and Forecasting (WRF) model, by comparing with Cloud Resolving Model (CRM) results. We find that the original ZM scheme has very poor resolution adaptability, with sub-grid convective transport and precipitation increasing significantly as the resolution increases. The spatial averaging method improves the resolution adaptability of the ZM scheme and better conserves the total transport of moist static energy and total precipitation. With the temporal averaging method, the resolution adaptability of the scheme is further improved, with sub-grid convective precipitation becoming smaller than resolved precipitation for resolution higher than 8 km, which is consistent with the results from the CRM simulation. Both the spatial distribution and time series of precipitation are improved with the spatial and temporal averaging methods. The results may be helpful for developing resolution adaptability for other cumulus parameterizations that are based on quasi-equilibrium assumption.

  17. Taxonomic review on the subgenus Tripodura Townes (Diptera: Chironomidae: Polypedilum) from China with eleven new species and a supplementary world checklist.

    Science.gov (United States)

    Zhang, Ruilei; Song, Chao; Qi, Xin; Wang, Xinhua

    2016-07-05

    The subgenus Tripodura Townes of Polypedilum Kieffer from China including 26 species is reviewed. Eleven new species, named P. (T.) absensilobum Zhang & Wang sp. n., P. (T.) apiculusetosum Zhang & Wang sp. n., P. (T.) arcuatum Zhang & Wang sp. n., P. (T.) bilamella Zhang & Wang sp. n., P. (T.) conghuaense Zhang & Wang sp. n., P. (T.) dengae Zhang & Wang sp. n., P. (T.) mengmanense Zhang & Wang sp. n., P. (T.) napahaiense Zhang & Wang sp. n., P. (T.) parallelum Zhang & Wang sp. n., P. (T.) pollicium Zhang & Wang sp. n. and P. (T.) trapezium Zhang & Wang sp. n. are described and illustrated based on male imagines. Three species, P. (T.) quadriguttatum Kieffer, P. (T.) unifascia (Tokunaga) and P. (T.) udominutum Niitsuma are firstly recorded in China. A key to known male imagines of Chinese species and an updated world checklist of subgenus Tripodura are presented.

  18. Effects of heavy metals and light levels on the biosynthesis of carotenoids and fatty acids in the macroalgae Gracilaria tenuistipitata (var. liui Zhang & Xia

    Directory of Open Access Journals (Sweden)

    Ernani Pinto

    2011-04-01

    Full Text Available We present here the effect of heavy metals and of different light intensities on the biosynthesis of fatty acids and pigments in the macroalga Gracilaria tenuistipitata (var. liui Zhang & Xia. In order to verify the fatty acid content, gas chromatography with flame ionization detection (GC-FID was employed. Pigments (major carotenoids and chlorophyl-a were monitored by liquid chromatography with diode array detection (HPLC-DAD. Cultures of G. tenuistipitata were exposed to cadmium (Cd2+, 200 ppb and copper (Cu2+, 200 ppb, as well as to different light conditions (low light: 100 µmol.photons.m-2.s-1, or high light: 1000 µmol.photons.m-2.s-1. Cd2+ and Cu2+ increased the saturated and monounsaturated fatty acid content [14:0, 16:0, 18:0, 18:1 (n-7 and 18:1 (n-9] and all major pigments (violaxanthin, antheraxanthin, lutein, zeaxanthin, chlorophyll-a and β-carotene. Both heavy metals decreased the levels of polyunsaturated fatty acids (PUFA [18:2 (n-6, 18:3 (n-6, 18:5 (n-4, 20:4 (n-6, 20:5 (n-3, 22:6 (n-3]. G. tenuistipitata cultures were exposed to high light intensity for five days and no statistically significant differences were observed in the content of fatty acids. On the other hand, the levels of pigments rose markedly for chlorophyll-a and all of the carotenoids studied.

  19. 张綖《诗余图谱》词调论刍议%A Elementary Analysis on the Theory of Ci-poetry Tune of Zhang Yan's Shiyu Tupu

    Institute of Scientific and Technical Information of China (English)

    张海涛

    2012-01-01

    Zhang Yan's Shiyu Tupu is the stereotyped works which shows that Ci-poetry started to depend on metrical(closely related to poetry) instead of temperament(closely related to music).One important symbol is his exploration on the tune of ci-poetry.He was not only the first one that divided the tune of Ci-poetry into three types,but also a research pioneer doing on issues such as"one tune but different names"and"one tune but different styles".What Zhangyan did laid a solid foundation for further study of future generationgs.%张綖的《诗余图谱》是词由音律向格律转变的定型之作,其中一个重要标志便是其对于词调的探讨。该书不仅首创了词调三分法,而且对同调异名和一调多体等问题皆有开拓之功,为后人的进一步研究打下了坚实的基础。

  20. AcEST: DK944638 [AcEST

    Lifescience Database Archive (English)

    Full Text Available Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST...] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb

  1. AcEST: DK944742 [AcEST

    Lifescience Database Archive (English)

    Full Text Available inghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST ... Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb

  2. AcEST: DK951674 [AcEST

    Lifescience Database Archive (English)

    Full Text Available nghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST a...Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb M

  3. AcEST: DK943549 [AcEST

    Lifescience Database Archive (English)

    Full Text Available A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),... [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web

  4. AcEST: BP917220 [AcEST

    Lifescience Database Archive (English)

    Full Text Available den, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAS...erence: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web

  5. AcEST: BP913622 [AcEST

    Lifescience Database Archive (English)

    Full Text Available den, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAS...erence: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web

  6. AcEST: DK946405 [AcEST

    Lifescience Database Archive (English)

    Full Text Available : Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, an.... Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped

  7. AcEST: BP920286 [AcEST

    Lifescience Database Archive (English)

    Full Text Available Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST an...ce: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web

  8. AcEST: BP921108 [AcEST

    Lifescience Database Archive (English)

    Full Text Available adden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BL...eference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web

  9. AcEST: DK946157 [AcEST

    Lifescience Database Archive (English)

    Full Text Available A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997)...9 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web

  10. AcEST: BP916803 [AcEST

    Lifescience Database Archive (English)

    Full Text Available en, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST...rence: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web

  11. AcEST: DK945167 [AcEST

    Lifescience Database Archive (English)

    Full Text Available Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and... Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped

  12. AcEST: DK962276 [AcEST

    Lifescience Database Archive (English)

    Full Text Available Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and ...Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped B

  13. AcEST: DK956790 [AcEST

    Lifescience Database Archive (English)

    Full Text Available ro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (199....19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web

  14. AcEST: BP912908 [AcEST

    Lifescience Database Archive (English)

    Full Text Available -2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web..., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (199

  15. AcEST: DK943569 [AcEST

    Lifescience Database Archive (English)

    Full Text Available Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and ...Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped B

  16. AcEST: BP918928 [AcEST

    Lifescience Database Archive (English)

    Full Text Available nce: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller,...adden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BL

  17. AcEST: BP921502 [AcEST

    Lifescience Database Archive (English)

    Full Text Available nce: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller,...adden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BL

  18. A combined physiological and proteomic approach to reveal lactic-acid-induced alterations in Lactobacillus casei Zhang and its mutant with enhanced lactic acid tolerance.

    Science.gov (United States)

    Wu, Chongde; Zhang, Juan; Chen, Wei; Wang, Miao; Du, Guocheng; Chen, Jian

    2012-01-01

    Lactobacillus casei has traditionally been recognized as a probiotic and frequently used as an adjunct culture in fermented dairy products, where acid stress is an environmental condition commonly encountered. In the present study, we carried out a comparative physiological and proteomic study to investigate lactic-acid-induced alterations in Lactobacillus casei Zhang (WT) and its acid-resistant mutant. Analysis of the physiological data showed that the mutant exhibited 33.8% higher glucose phosphoenolpyruvate:sugar phosphotransferase system activity and lower glycolytic pH compared with the WT under acidic conditions. In addition, significant differences were detected in both cells during acid stress between intracellular physiological state, including intracellular pH, H(+)-ATPase activity, and intracellular ATP pool. Comparison of the proteomic data based on 2D-DIGE and i-TRAQ indicated that acid stress invoked a global change in both strains. The mutant protected the cells against acid damage by regulating the expression of key proteins involved in cellular metabolism, DNA replication, RNA synthesis, translation, and some chaperones. Proteome results were validated by Lactobacillus casei displaying higher intracellular aspartate and arginine levels, and the survival at pH 3.3 was improved 1.36- and 2.10-fold by the addition of 50-mM aspartate and arginine, respectively. To our knowledge, this is the first demonstration that aspartate may be involved in acid tolerance in Lactobacillus casei. Results presented here may help us understand acid resistance mechanisms and help formulate new strategies to enhance the industrial applications of this species.

  19. AcEST: DK945338 [AcEST

    Lifescience Database Archive (English)

    Full Text Available hul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David...n, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST

  20. AcEST: DK947581 [AcEST

    Lifescience Database Archive (English)

    Full Text Available e: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, a...L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gappe

  1. AcEST: DK944153 [AcEST

    Lifescience Database Archive (English)

    Full Text Available ul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David ..., Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST a

  2. AcEST: DK946346 [AcEST

    Lifescience Database Archive (English)

    Full Text Available chul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and Davi...en, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST

  3. AcEST: DK943983 [AcEST

    Lifescience Database Archive (English)

    Full Text Available e: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, a...L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gappe

  4. AcEST: DK945792 [AcEST

    Lifescience Database Archive (English)

    Full Text Available e: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, a...L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gappe

  5. AcEST: DK945525 [AcEST

    Lifescience Database Archive (English)

    Full Text Available Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-BLAST: a new gener...] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb

  6. AcEST: BP913019 [AcEST

    Lifescience Database Archive (English)

    Full Text Available chaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-BLAST: a ...008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web

  7. AcEST: DK944197 [AcEST

    Lifescience Database Archive (English)

    Full Text Available rence: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Mille...mas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), G

  8. AcEST: DK947358 [AcEST

    Lifescience Database Archive (English)

    Full Text Available -2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web...hen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipma

  9. AcEST: DK944575 [AcEST

    Lifescience Database Archive (English)

    Full Text Available jandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman ... 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web

  10. AcEST: BP921401 [AcEST

    Lifescience Database Archive (English)

    Full Text Available 2-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web...., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (19

  11. AcEST: DK944304 [AcEST

    Lifescience Database Archive (English)

    Full Text Available ul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David ..., Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST a

  12. AcEST: DK946539 [AcEST

    Lifescience Database Archive (English)

    Full Text Available ltschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and D...adden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BL

  13. AcEST: DK947183 [AcEST

    Lifescience Database Archive (English)

    Full Text Available 8] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web...F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1

  14. AcEST: DK946261 [AcEST

    Lifescience Database Archive (English)

    Full Text Available rence: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Mille...mas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), G

  15. AcEST: DK943583 [AcEST

    Lifescience Database Archive (English)

    Full Text Available , Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J....Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and

  16. AcEST: DK947295 [AcEST

    Lifescience Database Archive (English)

    Full Text Available lejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipma...TX 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web

  17. AcEST: BP919457 [AcEST

    Lifescience Database Archive (English)

    Full Text Available chul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and Davi...ejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and P

  18. AcEST: DK947778 [AcEST

    Lifescience Database Archive (English)

    Full Text Available Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997)...chaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-BLAST: a

  19. AcEST: DK943811 [AcEST

    Lifescience Database Archive (English)

    Full Text Available fer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-BLAST: a new ...-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web

  20. AcEST: DK945086 [AcEST

    Lifescience Database Archive (English)

    Full Text Available 02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web...ephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lip

  1. AcEST: DK946553 [AcEST

    Lifescience Database Archive (English)

    Full Text Available ejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman...X 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web

  2. AcEST: DK947501 [AcEST

    Lifescience Database Archive (English)

    Full Text Available Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997...Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-BLAST: a

  3. Tisaniba, a new genus of marpissoid jumping spiders from Borneo (Araneae: Salticidae).

    Science.gov (United States)

    Zhang, Jun-Xia; Maddison, Wayne P

    2014-08-14

    Six new species of marpissoid jumping spiders from Sarawak, Borneo, are described in the new genus Tisaniba Zhang & Maddison. They are the type species, T. mulu Zhang & Maddison sp. nov., as well as the species T. bijibijan Zhang & Maddison sp. nov., T. dik Zhang & Maddison sp. nov., T. kubah Zhang & Maddison sp. nov., T. selan Zhang & Maddison sp. nov., and T. selasi Zhang & Maddison sp. nov. The spiders are small and brown to black, living in leaf litter in the tropical forest. Phylogenetic analyses based on 28s and 16sND1 genes indicate that they are a distinctive group within the marpissoids. Diagnostic illustrations and photographs of living spiders are provided for all species.

  4. AcEST: BP917354 [AcEST

    Lifescience Database Archive (English)

    Full Text Available ephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lip...A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-BLAST

  5. AcEST: BP911646 [AcEST

    Lifescience Database Archive (English)

    Full Text Available .19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web... Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.

  6. AcEST: DK944786 [AcEST

    Lifescience Database Archive (English)

    Full Text Available ffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-BLAST: a new...2-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web

  7. AcEST: DK962944 [AcEST

    Lifescience Database Archive (English)

    Full Text Available haffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-BLAST: a n...-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web

  8. AcEST: DK947545 [AcEST

    Lifescience Database Archive (English)

    Full Text Available adden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BL...nghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-BLAST: a new generat

  9. AcEST: DK945776 [AcEST

    Lifescience Database Archive (English)

    Full Text Available [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web...l, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J

  10. AcEST: DK944599 [AcEST

    Lifescience Database Archive (English)

    Full Text Available er, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-BLAST: a new g...2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web

  11. AcEST: BP920620 [AcEST

    Lifescience Database Archive (English)

    Full Text Available [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web...ephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lip

  12. AcEST: BP915145 [AcEST

    Lifescience Database Archive (English)

    Full Text Available homas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),..., Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-BLAST: a new gen

  13. AcEST: DK945145 [AcEST

    Lifescience Database Archive (English)

    Full Text Available ephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lip...andro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI

  14. AcEST: DK944429 [AcEST

    Lifescience Database Archive (English)

    Full Text Available homas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),...haffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-BLAST: a n

  15. AcEST: BP915851 [AcEST

    Lifescience Database Archive (English)

    Full Text Available as L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Ga...inghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-BLAST: a new genera

  16. AcEST: DK947606 [AcEST

    Lifescience Database Archive (English)

    Full Text Available 2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web...tschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and Da

  17. AcEST: DK945626 [AcEST

    Lifescience Database Archive (English)

    Full Text Available as L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Ga...fer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-BLAST: a new

  18. AcEST: DK944993 [AcEST

    Lifescience Database Archive (English)

    Full Text Available BLASTX 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web...rence: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Mille

  19. AcEST: DK944090 [AcEST

    Lifescience Database Archive (English)

    Full Text Available .2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web...ltschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and D

  20. AcEST: DK946179 [AcEST

    Lifescience Database Archive (English)

    Full Text Available ndro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-....2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web

  1. AcEST: BP920688 [AcEST

    Lifescience Database Archive (English)

    Full Text Available mas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), G...Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-BLAST: a new gener

  2. AcEST: DK946199 [AcEST

    Lifescience Database Archive (English)

    Full Text Available ndro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-....2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web

  3. AcEST: DK943815 [AcEST

    Lifescience Database Archive (English)

    Full Text Available ASTX 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web...nce: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller,

  4. AcEST: DK947352 [AcEST

    Lifescience Database Archive (English)

    Full Text Available s L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gap...er, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-BLAST: a new g

  5. AcEST: DK946153 [AcEST

    Lifescience Database Archive (English)

    Full Text Available BLASTX 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web...rence: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Mille

  6. AcEST: BP912236 [AcEST

    Lifescience Database Archive (English)

    Full Text Available mas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), G...Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-BLAST: a new gener

  7. AcEST: DK944951 [AcEST

    Lifescience Database Archive (English)

    Full Text Available STX 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web...ce: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller,

  8. AcEST: DK943941 [AcEST

    Lifescience Database Archive (English)

    Full Text Available n F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman ...o A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-BLA

  9. AcEST: DK944579 [AcEST

    Lifescience Database Archive (English)

    Full Text Available ASTX 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web...nce: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller,

  10. a new record of zoraptera (insecta) from kenya, with remarks on their

    African Journals Online (AJOL)

    ... Kenyan species has rather fine, short, and comparatively simple metafemoral spines ... The structure found in the current species might be related to this type of .... D.K. Yeates, K. Yoshizawa, Q. Zhang, R. Zhang, W. Zhang, Y. Zhang, J. Zhao,.

  11. Exploration of the relationship between geographical environment and human diseases in ancient China.

    Science.gov (United States)

    Zhu, Jian-Ping

    2011-12-01

    The Yellow Emperor's Classic of Internal Medicine, created in the Warring States period (475 to 221 BC) described a phenomenon whereby the eastern, western, northern, southern, and central regions were liable to different diseases. It brought forward the principle of treatment in accordance with local conditions. Lv's Spring and Autumn Annals, Huai Nan Tzu (Huainanzi), and the Regiment of Health (Yangshenglun) in the Qin, Han, Wei, Jin, and Southern and Northern Dynasties all describe regional diseases such as goiter (endemic goiter) and yellowish teeth (dental fluorosis) as being caused by geologic and climatic factors. Zhang (miasma), first mentioned in the Han Dynasty, was considered related to the summer heat and dampness particular to the geographical environment of the south. Zhang was further associated with malaria in the Jin Dynasty. General Treatise on the Etiology and Symptomology of Diseases (Zhubingyuanhou Lun), in the Sui Dynasty, held that as a type of poisonous gas, Zhang was the predisposing cause of malaria, seasonal disease, and barbiers, among other conditions. General Guide (Zhinan Zonglun), in the Southern Song Dynasty, regarded Zhang malaria as a separate disease. Healthy Prescription in the Southern Wuling District (Lingnan Weisheng Fang), in the late Song and early Yuan Dynasties, explicitly put forward the concepts of cold Zhang, hot Zhang, and lockjaw Zhang. Guidelines for Treatment of Zhang Malaria (Zhangnue Zhinan), in the Ming Dynasty, maintained that cold Zhang was equivalent to malaria, while hot Zhang and lockjaw Zhang were equivalent to cold damage, the latter of which can be treated by prescriptions for cold damage. Records on Zhang gas and Zhang disease decreased during the Ming and Qing Dynasties.

  12. Investigating the origin of the Chinese name for alfalfa

    Science.gov (United States)

    Sun, Q. Z.; Xu, L. J.; Tang, X. J.; Ma, J. T.; Wang, D.; Li, D.; Liu, Q.; Tao, Y.; Li, F.

    2017-02-01

    It is assured that alfalfa (Medicago sativa L.) was introduced in Han dynasty. There are cognitive differences on whether Zhang Qian introduced alfalfa. Based on the previous studies, research inductive method was used. The relationship between Zhang Qian and alfalfa introduction was analyzed from the motivation, experience and influence of Zhang Qian to the Western Regions and the image generation of Zhang Qian brought back alfalfa’s seeds. Till to now, there are four opinions about Zhang Qian introducing Alfalfa seeds, including : (1) Zhang Qian introduced alfalfa seeds;(2) Zhang Qian did not introduce alfalfa seeds;(3) the information of Zhang Qian transferring alfalfa;(4)for commemoration Zhang Qian to the Western Regions. Although there are not direct historical materials to support Zhang Qian brought alfalfa seed to Han dynasty, it believes and confirms that the introducing of alfalfa is inextricably interwoven with Zhang Qian’s western travel. Zhangqian brought relative information from western regions during the introduction, which was the basis of non-native theory, and after that, Chinese began to plant alfalfa in Han dynasty., According to historical literatures, it is clear that the Chinese diplomat brought alfalfa seeds back to China. Alfalfa, as the favorite forage to Ferghana horse, have been already planted in Dawan in Han dynasty. Despite the debate, Zhangqian played an important pioneering role in introducing alfalfa.

  13. AcEST: BP914199 [AcEST

    Lifescience Database Archive (English)

    Full Text Available X 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web...chul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and Davi

  14. AcEST: DK947734 [AcEST

    Lifescience Database Archive (English)

    Full Text Available , Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST a...LASTX 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web

  15. AcEST: DK944111 [AcEST

    Lifescience Database Archive (English)

    Full Text Available TX 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web...e: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, a

  16. AcEST: DK943839 [AcEST

    Lifescience Database Archive (English)

    Full Text Available TX 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web...e: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, a

  17. AcEST: DK953429 [AcEST

    Lifescience Database Archive (English)

    Full Text Available andro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI...2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web

  18. AcEST: DK947103 [AcEST

    Lifescience Database Archive (English)

    Full Text Available dro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-B...2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web

  19. AcEST: DK944702 [AcEST

    Lifescience Database Archive (English)

    Full Text Available TX 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Web...e: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, a

  20. Effect of nitrates on embryo induction efficiency in cotton (Gossypium ...

    African Journals Online (AJOL)

    Fred

    cotton species (Zhang, 1994b). Somatic embryogenesis and plant regeneration systems have been established from cotton tissue, protoplasts and ovules (Zhang and Li,. 1992; Feng and Zhang, 1994; Zhang, 1995). Regeneration procedures have been used to obtain genetically modified plants after Agrobacterium- ...

  1. 从张小夫《诺日朗》的音响变化过程看电子音乐作品中的声音演变方式%The Evolution of Sound in Electronic Music Works by Taking Zhang Xiaofu's Norlong as an Example

    Institute of Scientific and Technical Information of China (English)

    骈韵頔

    2013-01-01

    张小夫以中国深厚的历史文化、传统的声乐、器乐为依托,利用自己丰富的电子音乐技术手段,创作了大量具有强烈中国民族气息的现代电子音乐作品,其中《诺日朗》是其最优秀的作品之一。本文通过仔细分析作品《诺日朗》的音乐发展过程以及作品中主要的三种素材类型,来探讨电子音乐作品中核心素材的演变方式,并以此论证张小夫注重“技术性”与“可听性”、“民族性”三者相结合的创作理念。%With Chinese history and culture , traditional vocal music and instruments as the foundation , Zhang Xiaofu has pro-duced a lot of electronic music works with Chinese style by taking advantage of much electronic music technology .Norlong is one of his best works .The thesis analyses the music developing process and three different material types in this music in detail to discuss the evolution of core material in the works of electronic music and prove Zhang Xiaofu's creative idea of the combination of "technology","audibility"and "nationality"in music.

  2. AcEST: DK962421 [AcEST

    Lifescience Database Archive (English)

    Full Text Available den, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J....t BLASTX 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jing...hui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and

  3. AcEST: DK952372 [AcEST

    Lifescience Database Archive (English)

    Full Text Available den, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J....t BLASTX 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jing...hui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and

  4. AcEST: BP920873 [AcEST

    Lifescience Database Archive (English)

    Full Text Available e: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, a...t BLASTX 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jing...hui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and

  5. Zhang Enzhao: A Fallen Banker

    Institute of Scientific and Technical Information of China (English)

    Xiao Long

    2006-01-01

    @@ In China, bank governors belong to one of the celebrity business,men clubs that enjoy great power.Entrepreneurs are always happy to know them, as a good relationship with the bankers can normally bring advantages when applying for loans. The close ties between entrepreneurs and bankers also generate risks, however, and the banking industry has proven to be one of the most risk-laden places in terms of corruptions and fund embezzlements.

  6. Aasia: missioon "Hiina" / Xiaotian Zhang

    Index Scriptorium Estoniae

    Zhang, Xiaotian

    2011-01-01

    Hiina ja Põhjamaade ärisuhete pikk ajalugu. Eesti, Soome, Rootsi ja Hiina koostööprogramm BENCH (Beneficial Business Relations between the Central Baltic Region and China, 2007-2013). Diagramm "Soome, Rootsi ja Eesti Kaubavahetus Hiinaga"

  7. New name, fiaxtion of correct spelling of three leafhopper taxa (Hemiptera: Cicadellidae)

    Science.gov (United States)

    The leafhopper genus Aspidia Yang & Zhang is a junior homonym and replaced here by Sochinsogonoidea, nomen novum. Nilgiriscopus Viraktamath and Roxasellana stellata Zhang & Zhang are fixed as the correct original spellings....

  8. An Analysis of Navy Nurse Corps Accession Sources

    Science.gov (United States)

    2014-03-01

    1 I. INTRODUCTION A. BACKGROUND Since 1998, the United States has experienced a nationwide nursing shortage (Juraschek, Zhang, Ranganathan ...supply of RNs in the civilian workforce (Juraschek, Zhang, Ranganathan , & Lin, 2012). A study by Juraschek, Zhang, Ranganathan , & Lin (2012...Postgraduate School, Monterey, CA. Retrieved from www.dtic.mil/cgi- bin/GetTRDoc?AD=ADA344570 Juraschek, S. P., Zhang, X., Ranganathan , V. K., & Lin, V

  9. Isolation and identification of two galangin metabolites from rat urine ...

    African Journals Online (AJOL)

    Isolation and identification of two galangin metabolites from rat urine and determination of their in vitro hypolipidemic activity. Xuguang Zhang, Shouqian Cheng, Hailong Li, Xiaopo Zhang, Feng Chen, Youbin Li, Junqing Zhang, Yinfeng Tan ...

  10. Browse Title Index

    African Journals Online (AJOL)

    Items 101 - 150 of 1250 ... Vol 10, No 6 (2013), A study on the anticancer activity of ethanol extract of ... S Han, X Lv, Y Wang, H Gong, C Zhang, A Tong, N Yan ... YJ Wanga, Y Zhenga, GF Zhang, JP Zhanga, CX Wua, SQ Zhang, HL Ouyang, ...

  11. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. Dong Zhang. Articles written in Bulletin of Materials Science. Volume 34 Issue 1 February 2011 pp 25-28. Aqueous colloids of graphene oxide nanosheets by exfoliation of graphite oxide without ultrasonication · Tian-You Zhang Dong Zhang · More Details Abstract Fulltext PDF.

  12. African Journal of Biotechnology - Vol 10, No 60 (2011)

    African Journals Online (AJOL)

    Microsatellite variability reveals significant genetic differentiation of giant pandas (Ailuropoda melanoleuca) in the Minshan A habitat · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Yang, R Hou, F Shen, X Yang, L Zhang, L Chen, W Chen, W Zhang, Q Zhu, Z Zhang ...

  13. FAST Maser Surveys J. S. Zhang

    Indian Academy of Sciences (India)

    nese institutions and industries and the first light is expected to be in 2016. FAST ... tem, extragalactic pulsar, high redshift megamasers and radio signals from exoplan- ets (Nan et al. ... Since OH maser emission was detected in galactic molecular clouds in 1960s. (Weaver ... OH maser (other three lines are weak or absent).

  14. DONG JIE Zhang, LIANG Wang, ZHON

    Indian Academy of Sciences (India)

    User

    development, hairless nude skin, and short life (Abitbol et al., 2015; Bryson et al., 2013). On the ... Foxn1 maintains TECs to support T-cell development via mcm2 ... were ligated upstream of the firefly luciferase gene in the plasmid pGL3-Basic.

  15. FAST Maser Surveys J. S. Zhang

    Indian Academy of Sciences (India)

    are found to be closely associated with ultra-compact HII regions, embedded IR sources, hot molecular cores, Herbig-Haro objects, and outflows etc., which can be used to probe star formation. And OH masers in circumstellar envelopes (cir- cumstellar masers) were found to be related to outflowing and cool winds from the.

  16. African Journal of Biotechnology - Vol 11, No 14 (2012)

    African Journals Online (AJOL)

    DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. HD Ding, HJ Zhang, XH Zhu, H Liu, JS Liang, B Lu, 3259-3269 ... DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Y Hanying, X Wei, G Xingxi, 3370-3378 ... FULL TEXT DOWNLOAD FULL TEXT. J Zhang, YC Huang, Q Zhang, ZP Hong, YC Zhou, WL Chen, 3388-3393 ...

  17. Phytochemical and Biological Properties of Ajuga decumbens ...

    African Journals Online (AJOL)

    Zhang B, Zeng FJ, Zhang XY. Study on anti-infection effect of Ajuga decumbens. Chin J Nosocomiol 2014;. 24: 2937-3939. 52. Li M, Peng WH. Chemical constituents and pharmacological research progress of Ajuga decumbens. J pr tradit Chinese mede 2012; 28: 322-. 323. 53. Ma SC, Du J, But PPH, Deng XL, Zhang YW, ...

  18. Studies on idiocerine leafhoppers with descriptions of Chinaocerus gen. nov. and three new species from China (Hemiptera: Cicadomorpha: Cicadellidae).

    Science.gov (United States)

    Dang, Li-Hong; Zhang, Bin; Li, Zi-Zhong

    2016-03-08

    A new leafhopper genus of the tribe Idiocerini (Hemiptera: Cicadomorpha: Cicadellidae), Chinaocerus, is described from the southwest China together with three new species, C. kangdingensis Zhang & Li sp. nov. (Sichuan Province), C. bispinatus Zhang & Li sp. nov. (Yunnan Province) and C. shii Zhang & Li sp. nov. (Sichuan Province). Descriptions and illustrations of these three new species are provided, and a key for their separation is also given.

  19. Interaction of Synuclein and Inflammation in Dopaminergic Neurodegeneration

    Science.gov (United States)

    2014-06-01

    induces degeneration of dopaminergic neurons: implications for progression of Parkinson’s disease. Neurotox Res. 19: 63-72, (2011). Kalia, L. V., S...1998). Zhang J, Niu N, Wang M, McNutt MA, Zhang D, Zhang B, Lu S, Liu Y, Liu Z. Neuron-derived IgG protects dopaminergic neurons from insult by 6...AD_________________ Award Number: W81XWH-08-1-0465 TITLE: Interaction of Synuclein and Inflammation in Dopaminergic

  20. New Jurassic tettigarctid cicadas from China with a novel example of disruptive coloration

    Directory of Open Access Journals (Sweden)

    Jun Chen

    2016-12-01

    Full Text Available Tettigarctidae is the most primitive family of Cicadoidea, with only two relict species. Although they are relatively well known from Eurasia, Australia, Africa, and South America, their Mesozoic examples are typically preserved only as isolated forewings. Herein, a new genus Sanmai Chen, Zhang, and B. Wang with three new species (Sanmai kongi Chen, Zhang, and B. Wang, S. mengi Chen, Zhang, and B. Wang, and S. xuni Chen, Zhang, and B. Wang are described based on fossil specimens from the Middle–Upper Jurassic of northeastern China, with well-preserved body structures, forewing and hindwing venations, making it the hitherto best known extinct tettigarctid taxon. The new genus, provisionally assigned to the tribe Turutanoviini, provides some new information about the evolution and palaeobiogeography of Mesozoic Tettigarctidae. The genus Paraprosbole is synonymized with Shuraboprosbole. In addition, the coloration pattern of forewing, prominent on some specimens of Sanmai kongi Chen, Zhang, and B. Wang sp. nov. and Sanmai xuni Chen, Zhang, and B. Wang sp. nov., represents a novel example of disruptive coloration in Tettigarctidae, which can effectively break up the body outline as well as surface, and so likely enabled these cicadas to reduce the detectability of potential predators.

  1. The Role of SIRT1 In Breast Cancer Stem Cells

    Science.gov (United States)

    2016-09-01

    2009;9:123-8. 56. Ma W, Xiao GG, Mao J, Lu Y, Song B, Wang L, Fan S, Fan P, Hou Z, Li J, Yu X, 20 Wang B, Wang H, Wang H, Xu F, Li Y, Liu Q, Li L...Int J Biol Sci. 2010;6:599-612. 63. Zhang Y, Zhang M, Dong H, Yong S, Li X, Olashaw N, Kruk PA, Cheng JQ, Bai W, Chen J, Nicosia SV, Zhang X

  2. Effects of insulin analogs and glucagon-like peptide-1 receptor agonists on proliferation and cellular energy metabolism in papillary thyroid cancer

    OpenAIRE

    He, Liang; Zhang, Siliang; Zhang, Xiaowen; Liu, Rui; Guan, Haixia; Zhang, Hao

    2017-01-01

    Liang He,1,* Siliang Zhang,2,* Xiaowen Zhang,3 Rui Liu,2 Haixia Guan,2 Hao Zhang1 1Department of Thyroid Surgery, The First Hospital of China Medical University, Shenyang, Liaoning, 2Department of Endocrinology and Metabolism, The Endocrine Institute and The Liaoning Provincial Key Laboratory of Endocrine Diseases, The First Hospital of China Medical University, Shenyang, Liaoning, 3Department of Endocrinology and Metabolism, Drum Tower Hospital Affiliated to Nanjing University Medical Schoo...

  3. A modified variable-coefficient projective Riccati equation method and its application to (2 + 1)-dimensional simplified generalized Broer-Kaup system

    International Nuclear Information System (INIS)

    Liu Qing; Zhu Jiamin; Hong Bihai

    2008-01-01

    A modified variable-coefficient projective Riccati equation method is proposed and applied to a (2 + 1)-dimensional simplified and generalized Broer-Kaup system. It is shown that the method presented by Huang and Zhang [Huang DJ, Zhang HQ. Chaos, Solitons and Fractals 2005; 23:601] is a special case of our method. The results obtained in the paper include many new formal solutions besides the all solutions found by Huang and Zhang

  4. Impact of Obesity on Tamoxifen Chemoprevention in a Model of Ductal Carcinoma in Situ

    Science.gov (United States)

    2012-10-01

    Sarah M. Smith. McDonald JM*, Dunlap SM*, Cogdell D, Dunmire V, Wei Q, Starzinski-Powitz A, Sawaya R, Bruner J, Fuller GN, Aldape K, and Zhang W...Sciences 104(28):11736-41, July 2007. Moore LM, Holmes KM, Smith SM, Wu Y, Tchougounova E, Uhrbom L, Sawaya R, Bruner JM, Fuller GN, and Zhang W... Bruner JM Kuang J, Yu H, Fuller GN and Zhang W. Inhibition of gliomagenesis and attenuation of mitotic transition by MIIP. Oncogene 29(24):3501-8, June

  5. Journal of Astrophysics and Astronomy | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    2016-01-27

    Jan 27, 2016 ... Author Affiliations. Bangrong Huang1 2 Xiong Zhang2 Dingrong Xiong2 Haojin Zhang2. National Astronomical Observatories/Yunnan Observatory, 650011 Kunming, China. Department of Physics, Yunnan Normal University, 650500 Kunming, China.

  6. Pramana – Journal of Physics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Sheng Zhang1 2 Hong-Qing Zhang2. Department of Mathematics, Bohai University, Jinzhou 121013, People's Republic of China; School of Mathematical Sciences, Dalian University of Technology, Dalian 116024, People's Republic of China ...

  7. synthesis and characterization of thermally stable poly(amide-imide)

    African Journals Online (AJOL)

    Preferred Customer

    properties of the nanocomposites are usually observed when the ultra fine silicate ... Unfortunately, strong interaction between polyimide chains and their rigid structure make them ..... Zhang, Q.; Li, S.; Li, W.; Zhang, S. Polymer 2007, 48, 6246.

  8. The effect of drought stress and exogenous abscisic acid on growth ...

    African Journals Online (AJOL)

    Jane

    2011-08-17

    Aug 17, 2011 ... and Zhang, 2001). .... and APX (Jiang and Zhang 2002). According to Keleo .... improve drought tolerance of fine grain aromatic rice (Oryza sativa. L.). ... Structure and differential response to abscisic acid of two promoters.

  9. Reference: 356 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 006 Mar Plant molecular biology Deng Xingwang|Dong Li|Wang Lei|Xue Yongbiao|Zhang Yansheng|Zhang Yu'e ...ein CEGENDUO negatively regulates auxin-mediated lateral root formation in Arabidopsis. 4 599-615 16525894 2

  10. mandarin (Citrus reticulata Blanco)

    African Journals Online (AJOL)

    ARL4

    between 'Shatangju' and 'Wuzishatangju' based on establishing an optimization of ..... plant species (Han et al., 2008; Zhang et al., 2010). In this study, 153 pairs of SRAP .... Wang XP, Wang YJ, Zhang JX, Xu Y, Yang KQ (2003). Randomly.

  11. African Journal of Biotechnology - Vol 11, No 41 (2012)

    African Journals Online (AJOL)

    Lenaldo Muniz de Oliveira, Nayra da Silva Negreiros Cardoso, Luzimar Gonzaga .... Ju-Hong Zhang, Jian-Ying Guo, Jing-Yuan Xia, Fang-Hao Wan, 9873-9880 ... Zhu Xiao-yan, Chang Shu-juan, Zhang Ying-jun, Luo Hai-ling, 9894-9905.

  12. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Xing Hui Zhang1 Fu Long Zhang1 Zhi Yuan Geng2. College of Chemical Engineering, Gansu Lianhe University, Lanzhou 730010, P.R. China; College of Chemistry and Chemical Engineering, Northwest Normal University, Lanzhou 730070, P.R. China ...

  13. Description of two new species of the Neoperla montivaga group (Plecoptera: Perlidae) from Guangxi Zhuang Autonomous Region, China.

    Science.gov (United States)

    Yang, Juan; Zhang, Sujiong; Li, Weihai

    2017-03-05

    The following two new species from Shiwandashan of Guangxi Zhuang Autonomous Region, China are described, Neoperla bicolor Yang, Zhang & Li, sp. nov. and N. muranyii Yang, Zhang & Li, sp. nov. The new species are compared with related congeners of their respective species subgroups.

  14. African Journal of Biotechnology - Vol 10, No 73 (2011)

    African Journals Online (AJOL)

    Morphological diversity of wild medicinal Paris L. from China and Vietnam · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. JY Zhang, J Zhang, WZ Yang, YZ Wang, H Yu, H Jin, 16421-16428 ...

  15. Using datamining approaches to selectacupoints in acupuncture ...

    African Journals Online (AJOL)

    Using datamining approaches to selectacupoints in acupuncture and Moxibustion for knee osteoarthritis. Changyan Liu, Youxin Su, Jian He, Yanan Li, Shaoqing Chen, Yingjie Zhang, Ziyi Zhang, Meili Lu, Zhen He, Wenting Wang, Yiru Wang, Lu Sheng, Zhengxuan Zhan, Xu Wang, Naixi Zheng ...

  16. African Journal of Biotechnology - Vol 10, No 65 (2011)

    African Journals Online (AJOL)

    HQ Lou, Y Hu, L Zhang, YJ Zhang, PG Tu, XT Yu, YJ Jin, L Wang, 14286-14292 ... The effect of osmopriming on germination, seedling growth and phosphatase activities of lettuce under saline ... S Han, TH Zhu, SJ Li, FL Li, 14404-14409.

  17. Identification of QTL for maize grain yield and kernel-related traits

    Indian Academy of Sciences (India)

    [Yang C., Zhang L., Jia A. and Rong T. 2016 Identification of QTL for maize grain yield and kernel-related traits. ... 2010; Zhang et al. ...... in the structure and evolution of genetic systems. ... 2013 Fine mapping a major QTL for kernel number per.

  18. Casein kinase 1-Like 3 is required for abscisic acid regulation of ...

    African Journals Online (AJOL)

    Casein kinase 1-Like 3 is required for abscisic acid regulation of seed germination, root growth, and gene expression in Arabidopsis. M Wang, D Yu, X Guo, X Li, J Zhang, L Zhao, H Chang, S Hu, C Zhang, J Shi, X Liu ...

  19. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 128; Issue 6. Triflic Anhydride-Mediated Beckmann Rearrangement Reaction of Β-Oximyl Amides: Access to 5-Iminooxazolines. MANGFEI YU QIAN ZHANG JIA WANG PENG HUANG PENGFEI YAN RUI ZHANG DEWEN DONG. Regular Article Volume 128 Issue 6 ...

  20. Thirty-seven transcription factor genes differentially respond to a ...

    Indian Academy of Sciences (India)

    Plant transcription factors and insect defence si. Thirty-seven transcription factor genes differentially respond to a harpin protein and affect resistance to the green peach aphid in Arabidopsis. HUNLIN. PIN. RUOXUE LIŲ, BEIBEI LÜ, XIAOMENG WANG, CHUNLING ZHANG, SHUPING ZHANG, JUN QIAN, LEI CHEN,.

  1. Influences of protective atmosphere on the characterization and ...

    Indian Academy of Sciences (India)

    tective atmosphere on the characterization and properties of the ceramics were investigated. All the ceramics showed ... Tian-Hang Zhang et al temperature and ..... Soc. 24 3731. 20. Wang Y, Zhang Y C, Hu Z J, Gao X, Guo X F and Jiang Y J.

  2. Preparation and characterization of water-absorbing composite ...

    African Journals Online (AJOL)

    ABCO

    2012-08-16

    Aug 16, 2012 ... 2007; Doorkosh et al., 2000), and natural polymers (Yu et al., 2009; Doorkosh et al., ... Zhang et al., 2007; Lee and Chen, 2005; Neaman et al.,. 2004; Lin et al., 2001). ..... Li A, Zhang JP, Wang AQ (2007). Utilization of starch ...

  3. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics. XUEPING ZHANG. Articles written in Journal of Genetics. Volume 96 Issue 6 December 2017 pp 985-992 RESEARCH ARTICLE. Genetic variants influencing lipid levels and risk of dyslipidemia in Chinese population · HUAICHAO LUO XUEPING ZHANG PING SHUAI YUANYING MIAO ...

  4. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    pp 107-116 Research Article. Highly conserved D-loop-like nuclear mitochondrial sequences (Numts) in tiger (Panthera tigris) · Wenping Zhang Zhihe Zhang Fujun Shen Rong Hou Xiaoping Lv Bisong Yue · More Details Abstract Fulltext PDF. Using oligonucleotide primers designed to match hypervariable segments I ...

  5. calcium sulphate hemihydrate and bioactive glass composites for ...

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 41; Issue 2. In vitro bioactivity evaluation of α -calcium sulphate hemihydrate and bioactive glass composites for their potential use in bone regeneration. YANYAN ZHENG CHENGDONG XIONG DUJUAN ZHANG LIFANG ZHANG. Volume 41 Issue 2 April 2018 Article ID ...

  6. Broad-Band Spectral Indices Variability of BL Lacertae by Wavelet ...

    Indian Academy of Sciences (India)

    by Wavelet Method. Hao-Jing Zhang1,2,∗, Jing-Ming Bai1, Yu-Ying Bao3 & Xiong Zhang2. 1Yunnan Astronomical Observatory, National Astronomical Observatory, ... 3Department of Physics, Yuxi Teachers' College, Yuxi, Yunnan 653100, China. ∗ ... broad-band spectral indices—periodic variation—methods: numerical:.

  7. Sadhana | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Sadhana. WEI XIONG. Articles written in Sadhana. Volume 41 Issue 6 June 2016 pp 621-632. Nonstationary weak signal detection based on normalization stochastic resonance with varying parameters · HAIBIN ZHANG WEI XIONG SHANGBIN ZHANG QINGBO HE FANRANG KONG · More Details Abstract ...

  8. Photoacoustic Detection of Terahertz Radiation for Chemical Sensing and Imaging Applications

    Science.gov (United States)

    2013-03-01

    ISSN 2229-5518 [39] Jingle Liu, Benjamin Clough, and X. C. Zhang, “Enhancement of photoacoustic emission through terahertz-field driven electron...materials,” Journal of Electroceramics, vol. 2: p. 257-272, 2009. [47] Jingle Liu, Benjamin Clough, and X. C. Zhang, “Enhancement of photoacoustic

  9. [The modern TCM education of Tianjin].

    Science.gov (United States)

    Xie, J

    2016-11-28

    School education had gradually become the mainstream of medical education at the turn of the Qing Dynasty and Republican period. In Tianjin, there were western medical education, including the Peiyang Medical College, Army Medical College, and Lu's Medical School, whereas, there was no traditional medical school at all. To check this defect, two private TCM medical schools, the Learning School of TCM, and the Tianjin TCM Institution were set up by Chen Zedong and Gu Jinren respectively through persistent endeavor. Meanwhile, correspondence school of TCM were established by Zhang Xichun, Wei Jiaqian, and Ma Leshan. Though more TCM schools were planned, including Tianjin Private School of TCM by Lu Zongren and Qian Boquan, North China Professional TCM School by Zhang Yinqi and other colleagues, TCM Professional School by Zhang Dianju and the Tianjin Private Acu-Moxibustion School by Zhang Lihui, etc. All these did make their contributions to the training of TCM talents in modern times.

  10. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    DEFANG GAN1 MENGDAN ZHAN1 FENG YANG1 QIQI ZHANG1 KELING HU1 WENJUAN XU1 QINGHUI LU2 LING ZHANG1 DANDI LIANG1. School of Horticulture, Anhui Agricultural University, Hefei 230036, People's Republic of China; Modern Agricultural Science and Technology Cooperative Extension Service Center ...

  11. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. Shunxiao Zhang. Articles written in Bulletin of Materials Science. Volume 31 Issue 2 April 2008 pp 193-195 Nanomaterials. Mesoscale organization of CuO nanoslices: Formation of sphere · Jun Wang Shunxiao Zhang Zhanshuang Li Jia You Piaoping Yang Xiaoyan Jing Milin ...

  12. Recombination-activating gene 1 and 2 (RAG1 and RAG2) in flounder

    Indian Academy of Sciences (India)

    2016-08-26

    Aug 26, 2016 ... Xianlei Wang1 2 Xungang Tan1 Pei-Jun Zhang1 Yuqing Zhang1 Peng Xu1. Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, China; National Oceanographic Center, 88 Xuzhou Road, Qingdao, Shandong 266071, ...

  13. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. XIAOWEN ZHANG. Articles written in Bulletin of Materials Science. Volume 37 Issue 4 June 2014 pp 895-902. Structural evolution, electrical and optical properties of AZO films deposited by sputtering ultra-high density target · Jiwen Xu Zupei Yang Hua Wang Xiaowen Zhang.

  14. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. LIFANG ZHANG. Articles written in Bulletin of Materials Science. Volume 38 Issue 3 June 2015 pp 811-816. Fabrication and characterization of PDLLA/pyrite composite bone scaffold for osteoblast culture · Lifang Zhang Yanyan Zheng Chengdong Xiong · More Details Abstract ...

  15. DMPD: Macrophage activation by endogenous danger signals. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 18161744 Macrophage activation by endogenous danger signals. Zhang X, Mosser DM. J ...Pathol. 2008 Jan;214(2):161-78. (.png) (.svg) (.html) (.csml) Show Macrophage activation by endogenous dange...r signals. PubmedID 18161744 Title Macrophage activation by endogenous danger signals. Authors Zhang X, Moss

  16. The Relationship of Goldberg's Big Five Personality Trait Measures of Mid-Level Leaders at Midwest State-Supported Colleges and Universities to the Cameron and Quinn Competing Values Model

    Science.gov (United States)

    Kempke Eppler, Michelle R.

    2012-01-01

    This dissertation expands previous work of Giberson, Resick, Dickson, Mitchelson, Randall, and Clark (2009), Zhang, Tsui, Song, & Jia (2008), and Tsui, Zhang, Wang, Xin, and Wu (2006) by examining higher education organizational culture and leadership. There is a paucity of research in examining the relationships between university mid-level…

  17. JIU-REN YIN

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. JIU-REN YIN. Articles written in Bulletin of Materials Science. Volume 40 Issue 6 October 2017 pp 1255-1261. Molecular dynamics study on the relaxation properties of bilayered graphene with defects · WEI ZHANG JIU-REN YIN PING ZHANG YAN-HUAI DING YONG J IANG.

  18. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. YONG J IANG. Articles written in Bulletin of Materials Science. Volume 40 Issue 6 October 2017 pp 1255-1261. Molecular dynamics study on the relaxation properties of bilayered graphene with defects · WEI ZHANG JIU-REN YIN PING ZHANG YAN-HUAI DING YONG J IANG.

  19. Proteomic identification of CIB1 as a potential diagnostic factor in ...

    Indian Academy of Sciences (India)

    Proteomic identification of CIB1 as a potential diagnostic factor in hepatocellular carcinoma. Tong Junrong Zhou Huancheng H E Feng Gao Yi Yang Xiaoqin Luo Zhengmao Zhang Hong Zeng Jianying Wang Yin Huang Yuanhang Zhang Jianlin Sun Longhua He Guolin. Articles Volume 36 Issue 4 September 2011 pp 659- ...

  20. Volume inequalities for asymmetric Wulff shapes

    OpenAIRE

    Schuster, Franz E.; Weberndorfer, Manuel

    2012-01-01

    Sharp reverse affine isoperimetric inequalities for asymmetric Wulff shapes and their polars are established, along with the characterization of all extremals. These new inequalities have as special cases previously obtained simplex inequalities by Ball, Barthe and Lutwak, Yang, and Zhang. In particular, they provide the solution to a problem by Zhang.

  1. Identification of sugarcane interspecies hybrids with RAPDs | Zhang ...

    African Journals Online (AJOL)

    African Journal of Biotechnology. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 7, No 8 (2008) >. Log in or Register to get access to full text downloads.

  2. Scheduling irrigation for jujube ( Ziziphus jujuba Mill. ) | Zhang ...

    African Journals Online (AJOL)

    This study was performed to select suitable indicator for scheduling the irrigation of jujube (Ziziphus jujuba Mill.) grown in the Loess Plateau. The relationships between plant-based indicators and soil matrix potential as well as meteorological factors of jujube under deficit irrigation compared with well irrigation were ...

  3. Biological advances in Bergenia genus plant | Zhang | African ...

    African Journals Online (AJOL)

    Bergenia, a genus belonging to Saxifragaceae family, is one of the most important medicinal plants, has high application values for human. Currently, wild Bergenia is becoming lacking, due to destruction of ecological environment and excessive excavation; furthermore, the study on it is not deep enough, many related ...

  4. C. Huang , G. Zhao , HW Zhang & YQ Chen

    Indian Academy of Sciences (India)

    the host stars' birth cloud with higher abundance of Si will make the cloud ... with the metallicity distribution of nearby field F, G, or K stars which are known to .... In the early stage of planetesimal accumulation, the rate of growth of planetesimal.

  5. Mapping of genes for flower-related traits and QTLs for flowering ...

    Indian Academy of Sciences (India)

    Mapping of genes for flower-related traits and QTLs for flowering time in an interspecific population of Gossypium hirsutum × G. darwinii. Shuwen Zhang, Qianqian Lan, Xiang Gao, Biao Yang, Caiping Cai, Tianzhen Zhang and Baoliang Zhou. J. Genet. 95, 197–201. Table 1. Loci composition and recombination distances of ...

  6. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. Jiuxing Zhang. Articles written in Bulletin of Materials Science. Volume 34 Issue 4 July 2011 pp 825-828. Magnetocaloric effect of Gd5Si2Ge2 alloys in low magnetic field · Hong Zeng Chunjiang Kuang Jiuxing Zhang Ming Yue · More Details Abstract Fulltext PDF.

  7. Collaborative Learning. Research to Practice Brief

    Science.gov (United States)

    Lawrence, K. S.

    2016-01-01

    A Fully Integrated Educational System practices collaborative learning among all peers. The study summarized in this report (Zhang, X., Anderson, R. C., Morris, J., Miller, B., Nguyen-Janiel, K. T., Lin, T., Zhang, J., Jadallah, M., Scott, T., Sun, J., Latawjec, B., Ma, S., Grabow, K., & Hsu, J. Y. (2016). "Improving children's competence…

  8. Frequency upconversion in catechin assisted : - square nanoplates

    Indian Academy of Sciences (India)

    VAIRAPPERUMAL TAMILMANI

    2017-11-25

    Nov 25, 2017 ... out to be a prominent ligand for its coordination on the surface of the ..... C 113. 14702. 12. Jin J, Gu Y J, Man C W Y, Cheng J, Xu Z, Zhang Y, Wang .... Ding B, Han C, Zheng L, Zhang J, Wang R and Tang. Z 2015 Tuning ...

  9. Tropical Journal of Pharmaceutical Research - Vol 14, No 7 (2015)

    African Journals Online (AJOL)

    Evaluation of Therapeutic Effects of Radiotherapy during Treatment of Lung Adenocarcinoma in Mice with Positron Emission Tomography Imaging ofF-FLT andF-FDG · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. B Qu, H Wang, W Yu, J Zhang, H Zhang, J Tian ...

  10. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Ruoxue Liu1 Beibei Lü1 Xiaomeng Wang1 Chunling Zhang1 Shuping Zhang1 Jun Qian1 Lei Chen1 Haojie Shi1 Hansong Dong1. State Ministry of Agriculture Key Laboratory of Monitoring and Management of Crop Pathogens and Insect Pests, Nanjing Agricultural University, Nanjing 210095, China ...

  11. Targeting the I-Kappa-B Kinase Epsilon (IKKe) for Breast Cancer Therapy

    Science.gov (United States)

    2009-09-01

    Mol Pharm 2009, 6(3):772-779. 15. Cheng K, Fraga D, Zhang C, Kotb M, Gaber AO, Guntaka RV, Mahato RI: Adenovirus-based vascular endothelial growth...Pharmaceutics 2009, 6, 772– 779. (27) Cheng, K.; Fraga, D.; Zhang, C.; Kotb, M.; Gaber , A. O.; Guntaka, R. V.; Mahato, R. I. Adenovirus-based vascular

  12. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. Zhang Lei. Articles written in Bulletin of Materials Science. Volume 34 Issue 1 February 2011 pp 161-167. Characterization on strength and toughness of welded joint for Q550 steel · Jiang Qinglei Li Yajiang Wang Juan Zhang Lei · More Details Abstract Fulltext PDF. Q550 high ...

  13. Journal of Astrophysics and Astronomy | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    2016-01-27

    Jan 27, 2016 ... Blazar Observations in Infrared and Optical. Methods for the Quasi-Periodic Variability Analysis in Blazars ... Astronomy Education for Physics Students · J. H. Fan J. S. Zhang J. Y. Zhang Y. Liu H. G. Wang .... Training in Astronomy for Physics Students · J. H. Fan · More Details Abstract Fulltext PDF.

  14. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 41; Issue 2. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study. H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG. Volume 41 Issue 2 April 2018 Article ID 51 ...

  15. Pinoresinol diglucoside exhibits protective effect on dexamethasone ...

    African Journals Online (AJOL)

    Pharmacotherapy Group, Faculty of Pharmacy, University of Benin, Benin City, 300001 ... Zhan-Feng Zhang, Ji-Kang Min, Dan Wang, Jian-Ming Zhong* .... mineral density meter (Beijing Zhongxi Yuanda ..... Svedbom A, Ivergård M, Hernlund E, Rizzoli R, Kanis JA. ... Pan Y, Niu Y, Li C, Zhai Y, Zhang R, Guo X, Mei Q. Du-.

  16. In situ Raman Spectroscopy Study of the Formation of Graphene from Urea and Graphite Oxide

    Science.gov (United States)

    2012-09-01

    pp. 075404, Aug., 2006. [5] K. S. Novoselov, Z. Jiang, Y. Zhang, S. Morozov, H. Stormer , U. Zeitler, J. Maan, G. Boebinger, P. Kim, and A. Geim...Room-temperature quantum hall effect in graphene.” Science, vol. 315, no. 5817, pp. 1379, Mar., 2007. [6] Y. Zhang, Y. W. Tan, H. L. Stormer , and

  17. Verification of the utility of molecular markers linked to the multiple ...

    African Journals Online (AJOL)

    GREGORY

    2010-08-30

    Aug 30, 2010 ... Feng Hui*, Wang Lili, Wei Peng, Liu Zhiyong, Li Chengyu, Wang Yugang, Ji Ruiqin and Zhang. Huaqing ..... Chin. Agric. Sci. Bull. 22: 377-379. Li CY, Feng H, Wei P, Wang LL, Zhang J, Yang HN, Jiang N (2009). Directional transfer of the genic multiple allele inherited male sterile line in Chinese cabbage.

  18. antimycobacterial and cytotoxicity evaluation of the constituents of ...

    African Journals Online (AJOL)

    nb

    AKT/mTOR pathway and S phase cell cycle arrest in HepG2 cells. Food. Chem. 138: 1034-1041. Chen T, He J, Zhang J, Li X, Zhang H, Hao. J, Li L 2012 The isolation and identification of two compounds with predominant radical scavenging activity in hempseed (seed of Cannabis sativa. L.). Food Chem. 134: 1030-1037.

  19. characterisation, phylogenetic analysis,functional annotation

    Indian Academy of Sciences (India)

    Navya

    2017-01-06

    Jan 6, 2017 ... 3Collaborative Innovation Center for Efficient and Health Production of ... qPCR: a) in five tissues from a healthy blunt snout bream, indicating ..... FAO (Food and Agriculture Organization of the United Nations) ... Sci.28, 210-214. .... Zhang F., Zhang L., Sun L.-L., Meng X.-L., Zhao Y. and Jin X. 2013 Effects of ...

  20. Retraction RETRACTION of "Association between polymorphisms in the XRCC1 gene and the risk of non-small cell lung cancer", by Han JC, Zhang YJ and Li XD - Genet. Mol. Res. 14 (4): 12888-12893 (2015).

    Science.gov (United States)

    Han, J C; Zhang, Y J; Li, X D

    2016-10-07

    The retracted article is: Han JC, Zhang YJ and Li XD (2015). Association between polymorphisms in the XRCC1 gene and the risk of non-small cell lung cancer. Genet. Mol. Res. 14: 12888-12893. The GMR editorial staff was alerted about this article (received on May 3, 2015; accepted on August 18, 2015) published on October 21, 2015 (DOI: 10.4238/2015.October.21.9) that was found to be substantially similar to the publication of "Association of XRCC1 gene polymorphisms with risk of non-small cell lung cancer" (received on January 25, 2015; accepted on March 23, 2015; e-published on April 1, 2015) by Kang et al., published in the International Journal of Clinical Experimental Pathology 8 (4): 4171-4176. The authors were aware of the Kang et al.'s paper, since they cite it several times in the manuscript published in GMR. Some of the language is similar between the two manuscripts, but what is the most concerning is that several of the tables in the papers are nearly identical. Tables 2 and 3 are exactly identical between the two articles, suggesting that the publication in GMR was plagiarized from the publication in the International Journal of Clinical Experimental Pathology. The Publisher and Editor decided to retract these articles in accordance with the recommendations of the Committee on Publication Ethics (COPE). After a thorough investigation, we have strong reason to believe that the peer review process was failure and, after review and contacting the authors, the editors of Genetics and Molecular Research decided to retract the article. The authors and their institutions were advised of this serious breach of ethics.

  1. Constitutive Modeling of the High-Temperature Flow Behavior of α-Ti Alloy Tube

    Science.gov (United States)

    Lin, Yanli; Zhang, Kun; He, Zhubin; Fan, Xiaobo; Yan, Yongda; Yuan, Shijian

    2018-05-01

    In the hot metal gas forming process, the deformation conditions, such as temperature, strain rate and deformation degree, are often prominently changed. The understanding of the flow behavior of α-Ti seamless tubes over a relatively wide range of temperatures and strain rates is important. In this study, the stress-strain curves in the temperature range of 973-1123 K and the initial strain rate range of 0.0004-0.4 s-1 were measured by isothermal tensile tests to conduct a constitutive analysis and a deformation behavior analysis. The results show that the flow stress decreases with the decrease in the strain rate and the increase of the deformation temperature. The Fields-Backofen model and Fields-Backofen-Zhang model were used to describe the stress-strain curves. The Fields-Backofen-Zhang model shows better predictability on the flow stress than the Fields-Backofen model, but there exists a large deviation in the deformation condition of 0.4 s-1. A modified Fields-Backofen-Zhang model is proposed, in which a strain rate term is introduced. This modified Fields-Backofen-Zhang model gives a more accurate description of the flow stress variation under hot forming conditions with a higher strain rate up to 0.4 s-1. Accordingly, it is reasonable to adopt the modified Fields-Backofen-Zhang model for the hot forming process which is likely to reach a higher strain rate, such as 0.4 s-1.

  2. Effect of the Chinese herb Mesima Reishi UE-1 on invasion of ...

    African Journals Online (AJOL)

    Effect of the Chinese herb Mesima Reishi UE-1 on invasion of human ovarian cancer cells in vitro. J He, X He, HY Zhang, XF Yang, J He, LH Zhang, YL Li. Abstract. To study the effects of Mesima Reishi UE-1 on the metastatic phenotype of the human ovarian cancer cell line HO8910. HO8910 cells were pretreated with ...

  3. H CHEN

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. H CHEN. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 51. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study · H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG · More Details ...

  4. Fulltext PDF

    Indian Academy of Sciences (India)

    to analyse X-ray data of astrophysical sources (Misra et al. 2004, 2006). In the optical regime, S5 0716+714 is one of the most violently variable objects with the amplitude of variations up to 2 mag (range 13.4 to 15.7 mag, Zhang &. Zhang 2007). Recently, very rapid brightness increase by 0.611 magnitudes over 3.6 min has ...

  5. Electronic Struture and Quantum Effects of Thin Metal Film Systems Based on Silicon Carbide

    Science.gov (United States)

    2013-05-01

    324, 924 (2009). [33] K. S. Novoselov et al., Nature (London) 438, 197 (2005). [34] Y. Zhang, Y.-W. Tan, H. L. Stormer , and P. Kim, Nature (London...Zhang, Y.-W. Tan, H. L. Stormer , and P. Kim, Nature (London) 438, 201 (2005). [6] K. S. Novoselov et al., Nature Phys. 2, 177 (2006). [7] E. McCann and V

  6. Y H DING

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. Y H DING. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 51. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study · H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG · More Details ...

  7. X Q TANG

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. X Q TANG. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 51. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study · H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG · More Details ...

  8. Entanglement criterion for tripartite systems based on local sum uncertainty relations

    Science.gov (United States)

    Akbari-Kourbolagh, Y.; Azhdargalam, M.

    2018-04-01

    We propose a sufficient criterion for the entanglement of tripartite systems based on local sum uncertainty relations for arbitrarily chosen observables of subsystems. This criterion generalizes the tighter criterion for bipartite systems introduced by Zhang et al. [C.-J. Zhang, H. Nha, Y.-S. Zhang, and G.-C. Guo, Phys. Rev. A 81, 012324 (2010), 10.1103/PhysRevA.81.012324] and can be used for both discrete- and continuous-variable systems. It enables us to detect the entanglement of quantum states without having a complete knowledge of them. Its utility is illustrated by some examples of three-qubit, qutrit-qutrit-qubit, and three-mode Gaussian states. It is found that, in comparison with other criteria, this criterion is able to detect some three-qubit bound entangled states more efficiently.

  9. Hyaluronic acid and oxidized regenerated cellulose prevent adhesion reformation after adhesiolysis in rat models

    OpenAIRE

    Zhang, Yan; Liu, Qin; Yang, Ning; Zhang, Xuegang

    2016-01-01

    Yan Zhang, Qin Liu, Ning Yang, Xuegang Zhang Department of Gynecology, Kunshan Hospital Affiliated to Jiangsu University, Kunshan, Jiangsu, People’s Republic of China Abstract: Postsurgical adhesion formation is the most common complication in abdominal and pelvic surgery. Adhesiolysis is the most commonly applied treatment for adhesion formation but is often followed by adhesion reformation. Therefore, an efficient strategy should be adopted to solve these problems. This study ai...

  10. A Study on Expression and Tyrosine 705 phosphorylation of STAT3 ...

    African Journals Online (AJOL)

    Fas- and Bcl-2-positive cells counts on the one hand, and apoptosis-positive nerve cells count in IP and. IC, on the ..... Chen Z, Li L, Mo X, Zhang L, Xie Y, Guo Q, Wang Y. Non-invasive ... Du W, Hong J, Wang YC, Zhang YJ, Wang P, Su YW,. Lin YW, Lu R, ... Jo M, Park MH, Kollipara PS, An BJ, Song HS, Han SB,. Kim JH ...

  11. Distribution of genes associated with yield potential and water ...

    Indian Academy of Sciences (India)

    on the FMs related to yield and water saving in wheat. Till date, six loci ..... Hu Y., Moiwo J. P., Yang Y., Han S. and Yang Y. 2010 Agricul- tural water-saving ... Lyu L., Hu Y., Li Y. and Wang P. 2007 Effect of irrigation treatment on water use ... Zhang Y. J., Fan P. S., Zhang X., Chen C. J. and Zhou M. G. 2009. Quantification of ...

  12. Synthesis and photoluminescence study of narrow-band UVB ...

    Indian Academy of Sciences (India)

    [7] Guo C, Ding X, Seo H J, Ren Z and Bai J 2011 J. Alloys. Compd. 509 4871. [8] Zhang X, Lang H and Seo H 2011 J. Fluoresc. 21 1111. [9] Zhang Z W 2013 Ceram. Int. 39 1723. [10] Yu H 2012 J. Lumin. 132 2553. [11] Wang Q 2012 J. Lumin. 132 434. [12] Palan C, Bajaj N and Omanwar S 2016 Mater. Res. Bull. 76 216.

  13. Electrospun Fibers for Composites Applications

    Science.gov (United States)

    2014-02-01

    in traditional woven mat composites. Nanofibrous interlayers were used to increase the impact and shear performance of a prepregged carbon fiber...Nylon 66 Nanofibrilmat Interleaved Carbon/Epoxy Laminates . Polymer Composites 2011, 32, 1781–1789. 21 13. Chen, Q.; Zhang, L.; Rahman, A.; Zhou...Resistance in Laminated Composites With Electrospun Nano-Interlayers. Comp. Sci. Tech. 2008, 68, 673– 683. 15. Zhang, J.; Lin, T.; Wang, X. Electrospun

  14. Why Tu Youyou Makes Less Money Than Zhang Ziyi?

    Science.gov (United States)

    Suo, Qinghui; Liu, Yang; Zhang, Daming

    2017-08-01

    Scientists normally earn less money than many other professions which require a similar amount of training and qualification. The economic theory of marginal utility and cost-benefit analysis can be applied to explain this phenomenon. Although scientists make less money than entertainment stars, the scientists do research work out of their interest and they also enjoy a much higher reputation and social status in some countries.

  15. Canonical Ensemble Model for Black Hole Radiation Jingyi Zhang

    Indian Academy of Sciences (India)

    Canonical Ensemble Model for Black Hole Radiation. 575. For entropy, there is no corresponding thermodynamical quantity, without loss of generalization. Let us define an entropy operator. ˆS = −KB ln ˆρ. (11). Then, the mean value of entropy is. S ≡〈ˆS〉 = tr( ˆρ ˆS) = −KBtr( ˆρ ln ˆρ). (12). For ideal gases, let y = V , then the ...

  16. Factors affecting soil erosion in Beijing mountain forestlands | Zhang ...

    African Journals Online (AJOL)

    The role of regions, vegetation types and forest stand density in controlling soil erosion were investigated in Beijing mountain forest, China. The main objective was to develop some models to estimate soil erosion under different forest conditions including regions, vegetation type, and stand density as influenced by artificial ...

  17. By: Kenny Zhang Report Type: Final Technical Report *Date

    International Development Research Centre (IDRC) Digital Library (Canada)

    Kenny Zhang

    2014-05-30

    May 30, 2014 ... Dr. David Zweig, Chair Professor, Division of Social Science, Hong Kong ... Keith Godin, Director, BC Ministry of Jobs, Tourism and Innovation, Keith. ..... 23) Media reports often quoted researchers of the project on stories ...

  18. [A Chinese Philosophical Foundation for the Sacred Mission of Nurses: The Ways of Heaven and Life are Correlated].

    Science.gov (United States)

    Lee, Mei-Hsiu

    2016-08-01

    Clinical nursing practice uses professional nursing techniques, empathy, and moral judgment to help relieve the pain of patients who are suffering physically or mentally from trauma or illness. Thus, nursing involves sacred tasks. According to Confucian reasoning, morality is expressed through everyday actions. Providing care to patients arouses concern and sympathy in the caregiver, which induces him or her to fully apply professional knowledge to this task. This conduct demonstrates the moral conscience of nurses. The Chinese adage "Tian-tao hsing-ming hsiang kuan tung" (the way of heaven and life are correlated), attributed to Northern Song dynasty scholar Zhang Tsai, aptly explains the sacred mission of the nursing profession. Zhang held that all humans are born with a conscience that is given by heaven. However, human senses and desires may suppress this conscience. As Zhang Tsai suggested, the conscience must be cultivated in order to be manifested. The increase in recent years of international academic discussion / research related to the value and meaning of nursing and of exploration into how to promote the moral competence of nurses, not only provide support to Zhang's argument that "tian-tao" and "hsing-ming" are correlated but also provide positive momentum toward enhancing the self-worth of nurses and enabling patients to receive better care.

  19. Hydrothermal growth of ZnO nanoflowers and their photocatalyst ...

    Indian Academy of Sciences (India)

    JINCHENG FAN1,∗, TENGFEI LI1 and HANG HENG2,3. 1School of Materials ... In this paper, the fabrication of ZnO nanoflowers on Si substrate by the ..... [21] Bae J, Han J B, Zhang X-M, Wei M, Duan X, Zhang Y and. Wang Z L 2009 J. ... 142 570. [31] Sun Y J, Wang L, Yu X G and Chen K Z 2012 CrystEngComm. 14 3199.

  20. ING4 Loss in Prostate Cancer Progression

    Science.gov (United States)

    2016-10-01

    it in the desired 245 PCR tube with the water, and then dotting ~1 uL on a labeled fresh LB agar (+ amp ) plate to keep track 246 of the colony. A...using kinetic labeling techniques vs decay following administration of transcriptional inhibitors. Analytical biochemistry 198, 19-29. Heer, R...prostate tissue. Journal of cellular biochemistry 91, 196-205. Valdez, J. M., Zhang, L., Su, Q., Dakhova, O., Zhang, Y., Shahi, P., Spencer, D. M

  1. Pharmacokinetics and tolerance study of intravitreal injection of dexamethasone-loaded nanoparticles in rabbits

    OpenAIRE

    Sun, Hongfan

    2009-01-01

    Linhua Zhang1, Yue Li2, Chao Zhang1, Yusheng Wang2, Cunxian Song11Institute of Biomedical Engineering, Peking Union Medical College and Chinese Academy of Medical Sciences, Tianjin, China; 2Department of Ophthalmology, Institute of Ophthalmology of Chinese PLA, Xijing Hospital, Fourth Military Medical University, Xi’an, ChinaAbstract: The aim of the study was to investigate the tolerance and pharmacokinetics of dexamethasone (DEX)-loaded poly(lactic acid–co-glycolic acid) ...

  2. Cyanide- and phenoxo-bridged heterobimetallic Fe(III)-Mn(III ...

    Indian Academy of Sciences (India)

    134 5083. 6. Jeon I R, Calancea S, Panja A, Piñero Cruz D M,. Koumousi E S, Dechambenoit P, Coulon C, Wattiaux A,. Rosa P, Mathonière C and Clérac R 2013 Chem. Sci. 4. 2463. 7. (a) Liu C M, Xiong R G, Zhang D Q and Zhu D B 2010J. Am. Chem. Soc. 132 4044; (b) Zhang Y Z and Sato O. 2010 Inorg. Chem. 49 1271.

  3. Improving the multiparty quantum secret sharing over two collective-noise channels against insider attack

    Science.gov (United States)

    Sun, Ying; Wen, Qiao-yan; Zhu, Fu-chen

    2010-01-01

    The security of the multiparty quantum secret sharing protocol presented by Zhang [Z.J. Zhang, Physica A, 361 (2006) 233] is analyzed. It is shown that this protocol is vulnerable to the insider attack since eavesdropping detection is performed only when all states arrive at the last agent. We propose an attack strategy and give an improved version of the original protocol. The improved protocol is robust and has the same traits with the original one.

  4. Comparison of generation 3 polyamidoamine dendrimer and generation 4 polypropylenimine dendrimer on drug loading, complex structure, release behavior, and cytotoxicity

    OpenAIRE

    Cheng, Yiyung; Shao,; Zhang ,; Hu,; Zhang,; Zhang,

    2011-01-01

    Naimin Shao1, Yunzhang Su1, Jingjing Hu2, Jiahai Zhang3, Hongfeng Zhang1, Yiyun Cheng1,41School of Life Sciences, East China Normal University, Shanghai, 2CAS Key Laboratory of Soft Matter Chemistry, Department of Chemistry, University of Science and Technology of China, Hefei,  3School of Life Sciences, University of Science and Technology of China, Hefei, 4Shanghai Key Laboratory of Magnetic Resonance, Department of Physics, East China Normal University, Shanghai, ChinaBackground: ...

  5. Plasmonic Encoding

    Science.gov (United States)

    2014-10-06

    Mangelson, B. F.; Schatz, G. C.; and Mirkin, C. A. “ Silver -based Nanodisk Codes,” ACS Nano, 2010, 9, 5446-5452. 6. Zhang, J.; Langille, M. R...Wei, W. D.; Zhang, H.; Schatz, G.; Boey, F.; Mirkin, C. A. “Free Standing Bimetallic Nanorings and Nanoring Arrays Made by On-Wire Lithography (OWL...Mirkin, C. A.; Marks, L. D.; Van Duyne, R. P. “Correlating the Structure and Localized Surface Plasmon Resonance of Single Silver Right Bipyramids

  6. Progress in Understanding the Impacts of 3-D Cloud Structure on MODIS Cloud Property Retrievals for Marine Boundary Layer Clouds

    Science.gov (United States)

    Zhang, Zhibo; Werner, Frank; Miller, Daniel; Platnick, Steven; Ackerman, Andrew; DiGirolamo, Larry; Meyer, Kerry; Marshak, Alexander; Wind, Galina; Zhao, Guangyu

    2016-01-01

    Theory: A novel framework based on 2-D Tayler expansion for quantifying the uncertainty in MODIS retrievals caused by sub-pixel reflectance inhomogeneity. (Zhang et al. 2016). How cloud vertical structure influences MODIS LWP retrievals. (Miller et al. 2016). Observation: Analysis of failed MODIS cloud property retrievals. (Cho et al. 2015). Cloud property retrievals from 15m resolution ASTER observations. (Werner et al. 2016). Modeling: LES-Satellite observation simulator (Zhang et al. 2012, Miller et al. 2016).

  7. Optical High Harmonic Generation in C60

    Science.gov (United States)

    Zhang, Guoping

    2005-03-01

    C60 et al. Physical Review Letters Physical Review B High harmonic generation (HHG) requires a strong laser field, but in a relatively weak laser field is sufficient. Numerical results presented here show while its low order harmonics result from the laser field, its high order ones are mainly from the multiple excitations. Since high order harmonics directly correlate electronic transitions, the HHG spectrum accurately measures transition energies. Therefore, is not only a promising material for HHG, but may also present an opportunity to develop HHG into an electronic structure probing tool. References: G. P. Zhang, 91, 176801 (2003); G. P. Zhang and T. F. George, 68, 165410 (2003); P. B. Corkum, 71, 1994 (1993); G. P. Zhang and Thomas F. George, 93, 147401 (2004); H. Niikura ,ature 417, 917 (2002); ibid. 421, 826 (2003); Y. Mairesse ,cience 302, 1540 (2003); A. Baltuska ,ature 421, 611 (2003).

  8. Synergistic enhancement of cancer therapy using a combination of docetaxel and photothermal ablation induced by single-walled carbon nanotubes

    Directory of Open Access Journals (Sweden)

    Zhang ZZ

    2011-10-01

    Full Text Available Lei Wang1, Mingyue Zhang1, Nan Zhang1, Jinjin Shi1, Hongling Zhang1, Min Li1, Chao Lu2, Zhenzhong Zhang1 1School of Pharmaceutical Sciences, Zhengzhou University, Zhengzhou, People’s Republic of China; 2University of Maryland, College Park, MD, USA Background: Single-walled carbon nanotubes (SWNT are poorly soluble in water, so their applications are limited. Therefore, aqueous solutions of SWNT, designed by noncovalent functionalization and without toxicity, are required for biomedical applications. Methods: In this study, we conjugated docetaxel with SWNT via p-p accumulation and used a surfactant to functionalize SWNT noncovalently. The SWNT were then conjugated with docetaxel (DTX-SWNT and linked with NGR (Asn-Gly-Arg peptide, which targets tumor angiogenesis, to obtain a water-soluble and tumor-targeting SWNT-NGR-DTX drug delivery system. Results: SWNT-NGR-DTX showed higher efficacy than docetaxel in suppressing tumor growth in a cultured PC3 cell line in vitro and in a murine S180 cancer model. Tumor volumes in the S180 mouse model decreased considerably under near-infrared radiation compared with the control group. Conclusion: The SWNT-NGR-DTX drug delivery system may be promising for high treatment efficacy with minimal side effects in future cancer therapy. Keywords: single-walled carbon nanotubes, docetaxel, NGR peptide, tumor-targeting, near-infrared radiation

  9. Understanding Drug Resistance to Targeted Therapeutics in Malignant B-Cell Lymphoproliferative Disorders (B-LPDs)

    Science.gov (United States)

    2014-10-01

    1063-70. PMC2783430. 2. Zhang J, Jima DD, Jacobs C, Fischer R, Gottwein E, Huang G, Lugar PL, Lagoo AS, Rizzieri DA, Friedman DR, Weinberg JB...Khoury, Thomas R Klumpp, Hillard M Lazarus, Victor A Lewis, Philip L McCarthy, David A Rizzieri, Mitchell Sabloff, Jeff Szer, Martin S Tallman, and...malignant human B cells identifies hundreds of novel microRNAs. Blood. 2010;116(23):e118-27 5. Zhang J, Jima DD, Jacobs C, Fischer R, Gottwein E, Huang G

  10. Tropical-Cyclone Flow Asymmetries Induced by a Uniform Flow Revisited

    Science.gov (United States)

    2011-11-01

    of about 500 m in Hurricanes Allen (1980) and Hugo (1989) by Zhang et al. (2011a). In Hugo , maximum K-values were about 110 m2 s−1 beneath the eyewall...region of intense Hurricanes Allen (1980) and Hugo (1989). Mon. Wea. Rev., 139, 1447-1462. Zhang JA Rogers RF Nolan DS and Marks FD. 2011b On the...Dept. of Meteorology, Naval Postgraduate School, Monterey, CA & NOAA’s Hurricane Research Division ∗Correspondence to: Roger K. Smith, Meteorological

  11. Computational Dimensionalities of Global Supercomputing

    Directory of Open Access Journals (Sweden)

    Richard S. Segall

    2013-12-01

    Full Text Available This Invited Paper pertains to subject of my Plenary Keynote Speech at the 17th World Multi-Conference on Systemics, Cybernetics and Informatics (WMSCI 2013 held in Orlando, Florida on July 9-12, 2013. The title of my Plenary Keynote Speech was: "Dimensionalities of Computation: from Global Supercomputing to Data, Text and Web Mining" but this Invited Paper will focus only on the "Computational Dimensionalities of Global Supercomputing" and is based upon a summary of the contents of several individual articles that have been previously written with myself as lead author and published in [75], [76], [77], [78], [79], [80] and [11]. The topics of these of the Plenary Speech included Overview of Current Research in Global Supercomputing [75], Open-Source Software Tools for Data Mining Analysis of Genomic and Spatial Images using High Performance Computing [76], Data Mining Supercomputing with SAS™ JMP® Genomics ([77], [79], [80], and Visualization by Supercomputing Data Mining [81]. ______________________ [11.] Committee on the Future of Supercomputing, National Research Council (2003, The Future of Supercomputing: An Interim Report, ISBN-13: 978-0-309-09016- 2, http://www.nap.edu/catalog/10784.html [75.] Segall, Richard S.; Zhang, Qingyu and Cook, Jeffrey S.(2013, "Overview of Current Research in Global Supercomputing", Proceedings of Forty- Fourth Meeting of Southwest Decision Sciences Institute (SWDSI, Albuquerque, NM, March 12-16, 2013. [76.] Segall, Richard S. and Zhang, Qingyu (2010, "Open-Source Software Tools for Data Mining Analysis of Genomic and Spatial Images using High Performance Computing", Proceedings of 5th INFORMS Workshop on Data Mining and Health Informatics, Austin, TX, November 6, 2010. [77.] Segall, Richard S., Zhang, Qingyu and Pierce, Ryan M.(2010, "Data Mining Supercomputing with SAS™ JMP®; Genomics: Research-in-Progress, Proceedings of 2010 Conference on Applied Research in Information Technology, sponsored by

  12. Monolithic Hierarchical Fractal Assemblies of Silica Nanoparticles Cross-Linked with Polynorbornene via ROMP: A Structure-Property Correlation from Molecular to Bulk through Nano

    Science.gov (United States)

    2012-08-23

    285. (4) (a) Leventis, N.; Vassilaras, P.; Fabrizio, E. F.; Dass , A. J. Mater. Chem. 2007, 17, 1502−1508. (b) Leventis, N.; Sotiriou-Leventis, C.; Mulik...S.; Dass , A.; Schnobrich, J.; Hobbs, A.; Fabrizio, E. F.; Luo, H.; Churu, G.; Zhang, Y.; Lu, H. J. Mater. Chem. 2008, 18, 2475−2482. (c) Leventis, N...V.; Coder, D.; Loy, D. A. Chem. Mater. 2008, 20, 2845−2847. (12) Zhang, G.; Dass , A.; Rawashdeh, A-M. M.; Thomas, J.; Counsil, J. A.; Sotiriou

  13. Enhanced immunization via dissolving microneedle array-based delivery system incorporating subunit vaccine and saponin adjuvant

    OpenAIRE

    Zhao,JiHui; Zhang,Qi-Bo; Liu,Bao; Piao,Xiang-Hua; Yan,Yu-Lu; Hu,Xiao-Ge; Zhou,Kuan; Zhang,Yong-Tai; Feng,Nian-Ping

    2017-01-01

    Ji-Hui Zhao,1,* Qi-Bo Zhang,1,* Bao Liu,2 Xiang-Hua Piao,1 Yu-Lu Yan,1 Xiao-Ge Hu,1 Kuan Zhou,1 Yong-Tai Zhang,1 Nian-Ping Feng1 1School of Pharmacy, Shanghai University of Traditional Chinese Medicine, Shanghai, People’s Republic of China; 2Anethesiology Department, Augusta University, Augusta, GA, USA *These authors contributed equally to this work Purpose: To enhance the immunogenicity of the model subunit vaccine, ovalbumin (OVA) was combined with platycodin (PD), a ...

  14. New Editors Appointed for Sections of Journal of Geophysical Research

    Science.gov (United States)

    2009-04-01

    New editors have been appointed for the Atmospheres, Biogeosciences, and Oceans sections of the Journal of Geophysical Research (JGR). Joost de Gouw (NOAA, Boulder, Colo.) and Renyi Zhang (Texas A&M, College Station) are filling the vacancies of retiring Atmospheres section editors John Austin and Jose Fuentes. De Gouw and Zhang join the continuing editors Steven Ghan and Yinon Rudich. Sara Pryor (Indiana University, Bloomington) is joining the Atmospheres section editorial board as an associate editor now; she will transition to editor in January 2010.

  15. Rapid Translation of a Novel and Potent Vaccine in HER2+ Metastatic Breast Cancer Patients

    Science.gov (United States)

    2013-10-01

    Xia3, Neil Spector2,3, Larry S Barak4, Timothy M Clay5, Takuya Osada2, Erika Hamilton6, Kimberly Blackwell6, Amy C Hobeika2, Michael A Morse2,3, H Kim...Zhang L, Boehm MF, Fritz LC, Burrows FJ: A high-affinity conformation of Hsp90 confers tumour selectivity on Hsp90 inhibitors. Nature 2003, 425:407...410. 13. Zhang H, Burrows F: Targeting multiple signal transduction pathways through inhibition of Hsp90. J Mol Med (Berl) 2004, 82:488-499. 14. Basso

  16. Polyethylenimine-based micro/nanoparticles as vaccine adjuvants [Corrigendum

    OpenAIRE

    2017-01-01

    Shen C, Li J, Zhang Y, et al. Int J Nano. 2017;12:5443–5460.The affiliations were presented as:Chen Shen1Jun Li1Yi Zhang1Yuce Li2Guanxin Shen3Jintao Zhu2Juan Tao11Department of Dermatology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China; 2School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan, China; 3Department of Immunology, Tongji Medical College, Huazhong University of Science and Te...

  17. Eight-dimensional quantum reaction rate calculations for the H+CH4 and H2+CH3 reactions on recent potential energy surfaces.

    Science.gov (United States)

    Zhou, Yong; Zhang, Dong H

    2014-11-21

    Eight-dimensional (8D) transition-state wave packet simulations have been performed on two latest potential energy surfaces (PES), the Zhou-Fu-Wang-Collins-Zhang (ZFWCZ) PES [Y. Zhou, B. Fu, C. Wang, M. A. Collins, and D. H. Zhang, J. Chem. Phys. 134, 064323 (2011)] and the Xu-Chen-Zhang (XCZ)-neural networks (NN) PES [X. Xu, J. Chen, and D. H. Zhang, Chin. J. Chem. Phys. 27, 373 (2014)]. Reaction rate constants for both the H+CH4 reaction and the H2+CH3 reaction are calculated. Simulations of the H+CH4 reaction based on the XCZ-NN PES show that the ZFWCZ PES predicts rate constants with reasonable high accuracy for low temperatures while leads to slightly lower results for high temperatures, in line with the distribution of interpolation error associated with the ZFWCZ PES. The 8D H+CH4 rate constants derived on the ZFWCZ PES compare well with full-dimensional 12D results based on the equivalent m-ZFWCZ PES, with a maximum relative difference of no more than 20%. Additionally, very good agreement is shown by comparing the 8D XCZ-NN rate constants with the 12D results obtained on the ZFWCZ-WM PES, after considering the difference in static barrier height between these two PESs. The reaction rate constants calculated for the H2+CH3 reaction are found to be in good consistency with experimental observations.

  18. Kardar–Parisi–Zhang equation in one dimension and line ensembles

    Indian Academy of Sciences (India)

    that the dynamics is defined through a suitable stochastic exchange rule. Thus one arrives at the totally asymmetric simple exclusion process (TASEP), which .... variables and can be viewed as a two-dimensional field theory in infinite volume.

  19. Zhuyi Quexian Duodong Zhang'ai Ertong de Shijian Zhijue Tezheng

    DEFF Research Database (Denmark)

    Yin, Huazhan; Sun, Zudi; Li, Dan

    2015-01-01

    To explore the characteristics of time perception of children with attention-deficit /hyperactivity disorder ( ADHD) and its relevant reasons by using a duration discrimination task. Methods: Totally 55 children with ADHD who met the Diagnostic and Statistical Manual of Mental Disorder,Fourth Edi...

  20. Preclinical and Clinical Development of Low Dose Methamphetamine for the Treatment of Traumatic Brain Injury

    Science.gov (United States)

    2014-04-01

    complex and allows Bcl-xl to promote cell survival (Jeong et al., 2008; Koh et al., 2008; Uchiyama et al., 2004). pAKT also activates inhibitors of...forebrain ischemia in the Mongolian gerbil. Neurosci. Lett. 342, 25e28. Koh , P.O., Cho, J.H., Won, C.K., Lee, H.J., Sung, J.H., Kim, M.O., 2008. Estradiol...model of focal embolic cerebral ischemia. Brain Res. 766, 83e92. Zhang, Z., Zhang, R.L., Jiang, Q., Raman , S.B., Cantwell, L., Chopp, M., 1997b. A new

  1. A Critical Review of High Entropy Alloys and Related Concepts (Postprint)

    Science.gov (United States)

    2016-10-21

    1301e1305. [306] C. Huang, Y.Z. Zhang, R. Vilar, J.Y. Shen, Dry sliding wear behavior of laser clad TiVCrAlSi high entropy alloy coatings on Ti-6Al...Res. 652e654 (2013) 1115e1118. [313] C. Huang, Y. Zhang, J. Shen, R. Vilar, Thermal stability and oxidation resis- tance of laser clad TiVCrAlSi high...Section 7.1.3). Finally, it is not always true that SS alloys are ductile. Well-known examples include b- titanium alloys, a- titanium alloys with small

  2. Improved adsorption energetics within density-functional theory using revised Perdew-Burke-Ernzerhof functionals

    DEFF Research Database (Denmark)

    Hammer, Bjørk; Hansen, Lars Bruno; Nørskov, Jens Kehlet

    1999-01-01

    A simple formulation of a generalized gradient approximation for the exchange and correlation energy of electrons has been proposed by Perdew, Burke, and Ernzerhof (PBE) [Phys. Rev. Lett. 77, 3865 (1996)]. Subsequently Zhang and Yang [Phys. Rev. Lett. 80, 890 (1998)] have shown that a slight...... revision of the PBE functional systematically improves the atomization energies for a large database of small molecules. In the present work, we show that the Zhang and Yang functional (revPBE) also improves the chemisorption energetics of atoms and molecules on transition-metal surfaces. Our test systems...

  3. Effect of Flake Thickness on Coercivity of Nanocrystalline SmCo5 Bulk Prepared from Anisotropic Nanoflake Powder (Postprint)

    Science.gov (United States)

    2016-08-23

    s). All article content, except where otherwise noted, is licensed under a Creative Commons Attribution 3.0 Unported License. [http://dx.doi.org...281, 23 (1998). 5 J. Zhou, R. Skomski, and D. J. Sellmyer, J. Appl . Phys. 93, 6495 (2003). 6 M. Yue, J. H. Zuo, W. Q. Liu, W. C. Lu, D. T. Zhang, J...X. Zhang, Z. H. Guo, and W. Li, J. Appl . Phys. 109, 07A700 (2011). 7 A. M. Gabay, M. Marinescu, J. F. Liu, and G. C. Hadjipanayis, J. Magn. Magn

  4. Role of Mitochondrial Inheritance on Prostate Cancer Outcome in African American Men. Addendum

    Science.gov (United States)

    2016-11-01

    RK, Tan DJ. Comprehensive scanning of the entire mitochondrial genome for mutations. Clin Chem. 2002; 48:1901-12. 3. Zhang W, Cui H, Wong L-J...Yang J, Price R, Nicolas A, Nalls M, Tranah G, Franceschini N, Xu Z, Schulte C, Alonso A, Cummings S, Fornage M, Zaykin D, Li L, Huang X, Kritchevsky S...L, Liu X, Liu L, Xu P, Han B, Bai C, Zhao Y, Zhang H, Yan Y, Amos CI, Chen F, Tan W, Jin L, Wu T, Lin D, Shen H. Association analyses identify

  5. Exploring the Structure of Nitrogen-Rich Ionic Liquids and Their Binding to the Surface of Oxide-Free Boron Nanoparticles

    Science.gov (United States)

    2013-01-29

    results have to be interpreted with caution. Lovelock et al.61 have shown that clean surfaces can be obtained by sputtering for the [CnC1Im][Tf2N] IL...Licence, P. Langmuir 2006, 22, 9386−9392. (58) Hurisso, B. B.; Lovelock , K. R.; Licence, P. Phys. Chem. Chem. Phys. 2011, 13, 17737−48. (59) Zhang, H.; Cui...H. Langmuir 2009, 25, 2604−2612. (60) Zhang, Q.; Ma, X.; Liu, S.; Yang, B.; Lu, L.; He, Y.; Deng, Y. J. Mater. Chem. 2011, 21, 6864. (61) Lovelock , K

  6. The Earth's revolution, Moon phase, Syzygy astronomy events, their effect in disturbances of the Earth's geomagnetic field, and the ``Magnetic Storm Double Time Method'' for predicting the occurrence time, magnitude and epicenter location of earthquakes

    Science.gov (United States)

    Chen, I. W.

    2003-04-01

    An increasing number of geomagnetic observation stations were established and operated in China since 1966 to the 1980s (and until present), effectively covering a large area of the nation. Close relativity between magnetic storms and earthquakes, as well as close relativity between the regional differences of magnetic disturbance recorded by these stations and the epicenter location of earthquakes, was discovered and observed by Tie-zheng Zhang during1966 - 1969. On such basis during 1969/1970, Zhang developed the “Magnetic Storm Double Time Method” for predicting the occurrence time, magnitude and epicenter location of EQs. By this method,.Zhang successfully predicted the Yunnan Tonghai Ms7.7 EQ Jan. 5, 1970 (occurrence date only), the Bohai ML5.2 EQ, Feb. 12, 1970 and other EQs, including the Haicheng Ms7.3 EQ Feb. 4, 1975, and the Tangshan Ms7.8 EQ July 28, 1976. On the basis of this method, Z.P. Shen developed the “Geomagnetic Deflection Angle Double Time Method” in 1970, and later developed the “Magnetic Storm - Moon Phase Double Time Method” in 1990s. With this method, Shen is able to predict the occurrence dates of most of the strongest EQs Ms37.5 on the Earth since 1991. Zhang also discovered that strong EQs often correspond with a number of sets of magnetic storms. Z.Q. Ren discovered close relativity exists between Syzygy astronomy events and such sets of magnetic storm as well as the occurrence dates of strong EQs. Computerized calculation of historical magnetic storm and EQ data proves the effectiveness of this method. Over 3,000 days of geomagnetic isoline images are computer processed by the Author from over 400,000 geomagnetic field data obtained by Zhang from over 100 geomagnetic observation stations during 1966 - 1984. Clear relativity is shown between the Earth’s revolution, Moon phases, Syzygy astronomy events related to the Earth, and their disturbance effect on the Earth’s geomagnetic field and the occurrence of EQs.

  7. Several Common Grounds of Liu Zhi-ji and Zhang Xue-cheng in Their Historical Criticism%刘知幾与章学诚史学批评理论中的几个共通面向

    Institute of Scientific and Technical Information of China (English)

    张泓林; 毕兵

    2014-01-01

    Liu Zhiji’ s General History and Zhang Xuecheng ’ s General Principles of Literature and History born several common grounds in historical philosophy such as the relationship between history and literature , the principles and the methods of historical criticism and the self-cultivation of historians .They were particularly complementary and rever-berant in terms of recording the truth without fear or favor , viewing history dialectically and having an insight into the society and human being , thus pioneering a wide range of topics on the research of history and historical philosophy . Meanwhile , by putting forward concepts from the “three accomplishments of historians” to“historians ’ morality” and the “duty” of historians themselves , they not only provided the standard for the historians themselves , but also provid-ed a reference standard for later historians to continue to reflect and improve their self -cultivation .%章学诚的《文史通义》与刘知幾的《史通》在史文关系、史学批评原则与方法、史家自身修养上的总结达到了史学理论的共通面向,尤其是双方在秉笔直书、辨证史义、论世知人等方面的史学批评理论的互补与融合,为后世史学、史学理论的发展开辟了广阔的研究领域。同时,二人关于“史学三长”到“史德”概念的发展衍变及对史家自身“天职”问题的探讨,不仅为史家自身批评素养理论提供了准绳,更是为后世史家不断反思和提高自身修养提供了参考标准。

  8. Promoting Secondary Analysis of Electronic Medical Records in China: Summary of the PLAGH-MIT Critical Data Conference and Health Datathon.

    Science.gov (United States)

    Li, Peiyao; Xie, Chen; Pollard, Tom; Johnson, Alistair Edward William; Cao, Desen; Kang, Hongjun; Liang, Hong; Zhang, Yuezhou; Liu, Xiaoli; Fan, Yong; Zhang, Yuan; Xue, Wanguo; Xie, Lixin; Celi, Leo Anthony; Zhang, Zhengbo

    2017-11-14

    Electronic health records (EHRs) have been widely adopted among modern hospitals to collect and track clinical data. Secondary analysis of EHRs could complement the traditional randomized control trial (RCT) research model. However, most researchers in China lack either the technical expertise or the resources needed to utilize EHRs as a resource. In addition, a climate of cross-disciplinary collaboration to gain insights from EHRs, a crucial component of a learning healthcare system, is not prevalent. To address these issues, members from the Massachusetts Institute of Technology (MIT) and the People's Liberation Army General Hospital (PLAGH) organized the first clinical data conference and health datathon in China, which provided a platform for clinicians, statisticians, and data scientists to team up and address information gaps in the intensive care unit (ICU). ©Peiyao Li, Chen Xie, Tom Pollard, Alistair Edward William Johnson, Desen Cao, Hongjun Kang, Hong Liang, Yuezhou Zhang, Xiaoli Liu, Yong Fan, Yuan Zhang, Wanguo Xue, Lixin Xie, Leo Anthony Celi, Zhengbo Zhang. Originally published in JMIR Medical Informatics (http://medinform.jmir.org), 14.11.2017.

  9. Computationally Efficient DOA Tracking Algorithm in Monostatic MIMO Radar with Automatic Association

    Directory of Open Access Journals (Sweden)

    Huaxin Yu

    2014-01-01

    Full Text Available We consider the problem of tracking the direction of arrivals (DOA of multiple moving targets in monostatic multiple-input multiple-output (MIMO radar. A low-complexity DOA tracking algorithm in monostatic MIMO radar is proposed. The proposed algorithm obtains DOA estimation via the difference between previous and current covariance matrix of the reduced-dimension transformation signal, and it reduces the computational complexity and realizes automatic association in DOA tracking. Error analysis and Cramér-Rao lower bound (CRLB of DOA tracking are derived in the paper. The proposed algorithm not only can be regarded as an extension of array-signal-processing DOA tracking algorithm in (Zhang et al. (2008, but also is an improved version of the DOA tracking algorithm in (Zhang et al. (2008. Furthermore, the proposed algorithm has better DOA tracking performance than the DOA tracking algorithm in (Zhang et al. (2008. The simulation results demonstrate effectiveness of the proposed algorithm. Our work provides the technical support for the practical application of MIMO radar.

  10. An improved authenticated key agreement protocol for telecare medicine information system.

    Science.gov (United States)

    Liu, Wenhao; Xie, Qi; Wang, Shengbao; Hu, Bin

    2016-01-01

    In telecare medicine information systems (TMIS), identity authentication of patients plays an important role and has been widely studied in the research field. Generally, it is realized by an authenticated key agreement protocol, and many such protocols were proposed in the literature. Recently, Zhang et al. pointed out that Islam et al.'s protocol suffers from the following security weaknesses: (1) Any legal but malicious patient can reveal other user's identity; (2) An attacker can launch off-line password guessing attack and the impersonation attack if the patient's identity is compromised. Zhang et al. also proposed an improved authenticated key agreement scheme with privacy protection for TMIS. However, in this paper, we point out that Zhang et al.'s scheme cannot resist off-line password guessing attack, and it fails to provide the revocation of lost/stolen smartcard. In order to overcome these weaknesses, we propose an improved protocol, the security and authentication of which can be proven using applied pi calculus based formal verification tool ProVerif.

  11. Polyethylenimine-based micro/nanoparticles as vaccine adjuvants [Corrigendum

    Directory of Open Access Journals (Sweden)

    Shen C

    2017-10-01

    Full Text Available Shen C, Li J, Zhang Y, et al. Int J Nano. 2017;12:5443–5460.The affiliations were presented as:Chen Shen1Jun Li1Yi Zhang1Yuce Li2Guanxin Shen3Jintao Zhu2Juan Tao11Department of Dermatology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China; 2School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan, China; 3Department of Immunology, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, ChinaThe affiliations should have contained the postcodes and are corrected here:Chen Shen1Jun Li1Yi Zhang1Yuce Li2Guanxin Shen3Jintao Zhu2Juan Tao11Department of Dermatology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China; 2School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074, China; 3Department of Immunology, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, ChinaRead the original article

  12. Bioinformatic analysis of the nucleotide binding site-encoding disease-resistance genes in foxtail millet (Setaria italica (L.) Beauv.).

    Science.gov (United States)

    Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G

    2014-08-28

    The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.

  13. Imprecise intron losses are less frequent than precise intron losses but are not rare in plants.

    Science.gov (United States)

    Ma, Ming-Yue; Zhu, Tao; Li, Xue-Nan; Lan, Xin-Ran; Liu, Heng-Yuan; Yang, Yu-Fei; Niu, Deng-Ke

    2015-05-27

    In this study, we identified 19 intron losses, including 11 precise intron losses (PILs), six imprecise intron losses (IILs), one de-exonization, and one exon deletion in tomato and potato, and 17 IILs in Arabidopsis thaliana. Comparative analysis of related genomes confirmed that all of the IILs have been fixed during evolution. Consistent with previous studies, our results indicate that PILs are a major type of intron loss. However, at least in plants, IILs are unlikely to be as rare as previously reported. This article was reviewed by Jun Yu and Zhang Zhang. For complete reviews, see the Reviewers' Reports section.

  14. Male occult triple-negative breast cancer with dermatomyositis: a case report and review of the literature

    Directory of Open Access Journals (Sweden)

    Zhang L

    2017-11-01

    Full Text Available Le Zhang,1 Chenghua Zhang,2 Zhaoying Yang,1 Miao He,3 Lijuan Zhang,1 Shereen Ezzat,4 Xi Liang5 1Department of Breast Surgery, China-Japan Union Hospital, Jilin University, Changchun, Jilin, China; 2Endoscopy Department, Jilin Cancer Hospital, Changchun, Jilin,China; 3Department of Anesthesia, The Second Hospital of Jilin University, Changchun, Jilin, China; 4Ontario Cancer Institute and The Endocrine Oncology Site Group, Princess Margaret Hospital, University Health Network, Toronto, Ontario, Canada; 5Department of Breast Surgery, The Second Affiliated Hospital of Dalian Medical University, Dalian, Liaoning, China Abstract: Occult breast cancer is defined by the presence of axillary metastases without an identifiable primary breast tumor. Here, we report a rare case of a male occult breast cancer with dermatomyositis. We performed a modified radical mastectomy consisting of whole breast mastectomy and axillary lymph node dissection. Immunohistochemistry and fluorescent in situ hybridization analyses demonstrated an adenocarcinoma likely of breast origin, which was an occult triple-negative breast cancer. Interestingly, the patient’s previously noted periorbital dermatomyositis resolved promptly following surgical excision. Keywords: male breast cancer, occult breast cancer, triple-negative breast cancer, dermato­myositis 

  15. AcEST: DK959999 [AcEST

    Lifescience Database Archive (English)

    Full Text Available TST39A01NGRL0006_D09 669 Adiantum capillus-veneris mRNA. clone: TST39A01NGRL0006_D0...9. 5' end sequence. DK959999 - Show DK959999 Clone id TST39A01NGRL0006_D09 Library TST39 Length 669 Definiti...on Adiantum capillus-veneris mRNA. clone: TST39A01NGRL0006_D09. 5' end sequence. Accession DK959999 Tissue t...nce: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller,...s, Nucleic Acids Res. 25:3389-3402. Query= DK959999|Adiantum capillus-veneris mRN

  16. AcEST: DK949999 [AcEST

    Lifescience Database Archive (English)

    Full Text Available TST38A01NGRL0007_H20 715 Adiantum capillus-veneris mRNA. clone: TST38A01NGRL0007_H2...0. 5' end sequence. DK949999 CL70Contig1 Show DK949999 Clone id TST38A01NGRL0007_H20 Library TST38 Length 71...5 Definition Adiantum capillus-veneris mRNA. clone: TST38A01NGRL0007_H20. 5' end sequence. Accession DK949999...haffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-BLAST: a n...ew generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= DK949999

  17. Molecular mapping of MS-cd 1 gene in Chinese kale | Zhang ...

    African Journals Online (AJOL)

    A dominant male sterility (DGMS) line 79-399-3 was developed from spontaneous mutation in Brassica oleracea var. capitata and has been widely used in the production of hybrid cultivar in China. In this line, male sterility is controlled by a dominant gene Ms-cd1. In the present study, primary mapping of Ms-cd1 was ...

  18. Estonian-Chinese cohesion / Liina Lelmi

    Index Scriptorium Estoniae

    Lelmi, Liina

    2009-01-01

    Eesti-Hiina majandussuhetest. Hiina asepeaministri Zhang Dejiangi Eesti visiidist ja kohtumisest peaminister Andrus Ansipi, välisminister Urmas Paeti ning majandus- ja kommunikatsiooniminister Juhan Partsiga

  19. Evaluation of NWP-based Satellite Precipitation Error Correction with Near-Real-Time Model Products and Flood-inducing Storms

    Science.gov (United States)

    Zhang, X.; Anagnostou, E. N.; Schwartz, C. S.

    2017-12-01

    Satellite precipitation products tend to have significant biases over complex terrain. Our research investigates a statistical approach for satellite precipitation adjustment based solely on numerical weather simulations. This approach has been evaluated in two mid-latitude (Zhang et al. 2013*1, Zhang et al. 2016*2) and three topical mountainous regions by using the WRF model to adjust two high-resolution satellite products i) National Oceanic and Atmospheric Administration (NOAA) Climate Prediction Center morphing technique (CMORPH) and ii) Global Satellite Mapping of Precipitation (GSMaP). Results show the adjustment effectively reduces the satellite underestimation of high rain rates, which provides a solid proof-of-concept for continuing research of NWP-based satellite correction. In this study we investigate the feasibility of using NCAR Real-time Ensemble Forecasts*3 for adjusting near-real-time satellite precipitation datasets over complex terrain areas in the Continental United States (CONUS) such as Olympic Peninsula, California coastal mountain ranges, Rocky Mountains and South Appalachians. The research will focus on flood-inducing storms occurred from May 2015 to December 2016 and four satellite precipitation products (CMORPH, GSMaP, PERSIANN-CCS and IMERG). The error correction performance evaluation will be based on comparisons against the gauge-adjusted Stage IV precipitation data. *1 Zhang, Xinxuan, et al. "Using NWP simulations in satellite rainfall estimation of heavy precipitation events over mountainous areas." Journal of Hydrometeorology 14.6 (2013): 1844-1858. *2 Zhang, Xinxuan, et al. "Hydrologic Evaluation of NWP-Adjusted CMORPH Estimates of Hurricane-Induced Precipitation in the Southern Appalachians." Journal of Hydrometeorology 17.4 (2016): 1087-1099. *3 Schwartz, Craig S., et al. "NCAR's experimental real-time convection-allowing ensemble prediction system." Weather and Forecasting 30.6 (2015): 1645-1654.

  20. DISCOVERY AND RESEARCH ON JIAHU BONE FLUTES IN WUYANG, CHINA.

    Energy Technology Data Exchange (ETDEWEB)

    JUZHONG, Z.; HARBOTTLE, G.; XINGHUA, X.; CHANGSUI, W.

    2000-11-01

    The site of Jiahu is located in Jiahu village, Wuyang County, Henan province, on the Western edge of the broad plain of Huanhuaihai. On its north the site borders the Sha River, in the upper reaches of the Huai River; its latitude is 33{degree} 36 minutes North, longitude 113{degree} 40 minutes East, and it is 67.5 meters above sea level. Between 1983 and 1987, the Henan Cultural Relics and Archaeology Institute carried out six campaigns of excavation here, revealing an area of 2400 square meters. Except for the trial excavation in the spring of 1983, Zhang Juzhong has been in charge of all the excavations. In early May 1986, while excavating tomb 78, Zhang Juzhong and Yang Zhenwei first discovered two funerary bone flutes. They soon found other, similar bone flutes in tombs 73, 94 and 121 respectively. Mr. Zhang's attention was instantly focused on these remarkable finds. In the campaign of autumn 1986, one or two more bone flutes were discovered in each of tombs 233,273, 263 and 270. Finally, in the spring of 1987, again one or two bone flutes were found in each of the tombs 282, 363,341,411,344 and 387. Up to the end of excavation in June 1987, altogether 25 bone flutes had been found, of which 17 were complete or almost complete, 6 broken or fragmentary and 2 were half-finished examples. Among the 17 complete bone flutes, there were 14 having seven holes, one five-hole, one six-hole and one eight-hole bone flute. In particular, the bone flute M282:20 was exquisitely made, and complete. Zhang Juzhong, the discoverer of the bone flutes, researcher Pei Mingxiang, the. ex-director of the division, who came to the digging site to see the progress of the work, and their coworkers were all understandably very excited.

  1. Triclosan treatment decreased the antitumor effect of sorafenib on hepatocellular carcinoma cells

    Directory of Open Access Journals (Sweden)

    Wu M

    2018-05-01

    Full Text Available Man Wu,1,2 Guanren Zhao,2 Xiaomei Zhuang,1 Tianhong Zhang,1 Ce Zhang,2 Wenpeng Zhang,1 Zhenqing Zhang1 1State Key Laboratory of Toxicology and Medical Countermeasures, Beijing Institute of Pharmacology and Toxicology, Beijing, China; 2Department of Pharmacy, The 309th Hospital of PLA, Beijing, China Background: Triclosan is a widely applied antimicrobial agent which affects the endocrine system and homeostasis; it may also promote the cirrhosis and hepatocellular carcinoma (HCC growth in a mice model. The exact roles of triclosan in regulating human hepatocellular carcinoma development and treatment remain unknown. Methods: MHCC97-H, a highly aggressive HCC cell line, was treated with indicated concentration of triclosan or sorafenib. The expression of drug-resistance genes was examined by qPCR. The clearance or metabolism of sorafenib was determined by liquid chromatograph-mass spectrometer/mass spectrometer (LC-MS/MS. MTT assay was used to examine the MHCC97-H cell proliferation. Nude mice were used to exam the anti-tumor effect of sorafenib on subcutaneous and intrahepatic growth of MHCC97-H cells. Results: In the present study, triclosan could induce the expression of drug-resistance genes in MHCC97-H cells (a highly aggressive HCC cell line, accelerate the clearance of sorafenib, and attenuate the anti-proliferation effect of this molecular targeted agent in MHCC97-H cells. Triclosan decreased the antitumor effect of sorafenib on subcutaneous and intrahepatic growth of MHCC97-H in nude mice. Conclusion: By discovering the fact that triclosan treatment enhances sorafenib resistance in HCC cells, this work suggests exposure of triclosan is detrimental to HCC patients during chemotherapy. Keywords: HCC, triclosan, sorafenib resistance, drug clearance 

  2. Precision comparison of the erosion rates derived from 137Cs measurements models with predictions based on empirical relationship

    International Nuclear Information System (INIS)

    Yang Mingyi; Liu Puling; Li Liqing

    2004-01-01

    The soil samples were collected in 6 cultivated runoff plots with grid sampling method, and the soil erosion rates derived from 137 Cs measurements were calculated. The models precision of Zhang Xinbao, Zhou Weizhi, Yang Hao and Walling were compared with predictions based on empirical relationship, data showed that the precision of 4 models is high within 50m slope length except for the slope with low slope angle and short length. Relatively, the precision of Walling's model is better than that of Zhang Xinbao, Zhou Weizhi and Yang Hao. In addition, the relationship between parameter Γ in Walling's improved model and slope angle was analyzed, the ralation is: Y=0.0109 X 1.0072 . (authors)

  3. Cryptanalysis on a modified Baptista-type cryptosystem with chaotic masking algorithm

    International Nuclear Information System (INIS)

    Chen Yong; Liao Xiaofeng

    2005-01-01

    Based on chaotic masking algorithm, an enhanced Baptista-type cryptosystem is proposed by Li et al. to resist all known attacks [S. Li, X. Mou, Z. Ji, J. Zhang, Y. Cai, Phys. Lett. A 307 (2003) 22; S. Li, G. Chen, K.-W. Wong, X. Mou, Y. Cai, Phys. Lett. A 332 (2004) 368]. In this Letter, we show that the second class bit extracting function in [S. Li, X. Mou, Z. Ji, J. Zhang, Y. Cai, Phys. Lett. A 307 (2003) 22] still leak partial information on the current chaotic state and reduce the security of cryptosystem. So, this type bit extracting function is not a good candidate for the masking algorithm

  4. Mitochondrial Replacement Techniques, Scientific Tourism, and the Global Politics of Science.

    Science.gov (United States)

    Chan, Sarah; Palacios-González, César; De Jesús Medina Arellano, María

    2017-09-01

    The United Kingdom is the first and so far only country to pass explicit legislation allowing for the licensed use of the new reproductive technology known as mitochondrial replacement therapy. The techniques used in this technology may prevent the transmission of mitochondrial DNA diseases, but they are controversial because they involve the manipulation of oocytes or embryos and the transfer of genetic material. Some commentators have even suggested that MRT constitutes germline genome modification. All eyes were on the United Kingdom as the most likely location for the first MRT birth, so it was a shock when, on September 27, 2016, an announcement went out that the first baby to result from use of the intervention had already been born. In New York City, United States-based scientist John Zhang used maternal spindle transfer (one of the recognized MRT methods) to generate five embryos for a woman carrying oocytes with deleterious mutations of the mitochondrial DNA. Zhang then shipped the only euploid embryo to Mexico, where it was transferred to the mother's uterus. Zhang's team's travel across international borders to carry out experimental procedures represents a form of scientific tourism that has not been properly ethically explored; it can, however, have seriously detrimental effects for developing countries. © 2017 The Hastings Center.

  5. Body protective compound-157 enhances alkali-burn wound healing in vivo and promotes proliferation, migration, and angiogenesis in vitro

    Directory of Open Access Journals (Sweden)

    Huang T

    2015-04-01

    Full Text Available Tonglie Huang,1,* Kuo Zhang,2,* Lijuan Sun,3 Xiaochang Xue,1 Cun Zhang,1 Zhen Shu,1 Nan Mu,1 Jintao Gu,1 Wangqian Zhang,1 Yukun Wang,1 Yingqi Zhang,1 Wei Zhang1 1State Key Laboratory of Cancer Biology, Department of Biopharmaceutics, School of Pharmacy, The Fourth Military Medical University, 2National Engineering Research Center for Miniaturized Detection Systems, School of Life Sciences, Northwest University, 3Department of Ophthalmology, Xijing Hospital, The Fourth Military Medical University, Xi’an, People’s Republic of China *These authors contributed equally to this work Abstract: Chemical burns take up a high proportion of burns admissions and can penetrate deep into tissues. Various reagents have been applied in the treatment of skin chemical burns; however, no optimal reagent for skin chemical burns currently exists. The present study investigated the effect of topical body protective compound (BPC-157 treatment on skin wound healing, using an alkali burn rat model. Topical treatment with BPC-157 was shown to accelerate wound closure following an alkali burn. Histological examination of skin sections with hematoxylin–eosin and Masson staining showed better granulation tissue formation, reepithelialization, dermal remodeling, and a higher extent of collagen deposition when compared to the model control group on the 18th day postwounding. BPC-157 could promote vascular endothelial growth factor expression in wounded skin tissues. Furthermore, 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide and cell cycle analysis demonstrated that BPC-157 enhanced the proliferation of human umbilical vein endothelial cells (HUVECs. Transwell assay and wound healing assay showed that BPC-157 significantly promoted migration of HUVECs. We also observed that BPC-157 upregulated the expression of VEGF-a and accelerated vascular tube formation in vitro. Moreover, further studies suggested that BPC-157 regulated the phosphorylation level of

  6. Treatment responses in adult depressive patients treated with ...

    African Journals Online (AJOL)

    with dexamethasone/corticotrophin-releasing hormone. Lina Zhang1*, Yanbo Chen2, ... Keywords: stress, depressive patients, hormonal response, hormonal dysregulation, sertraline, ..... interactions in depression: will cause inform cure. Mol.

  7. Viewing engineering offshoring in a network perspective

    DEFF Research Database (Denmark)

    Hansen, Zaza Nadja Lee; Zhang, Yufeng; Ahmed-Kristensen, Saeema

    2013-01-01

    of how to effectively manage engineering offshoring activities in a context of global engineering networks. The main research question, therefore, is: “Can offshoring of engineering tasks be explained and managed using the concept of Global Engineering Networks (GEN)?” Effective approaches to handling...... of large multinational corporations in Denmark were carried out. Data gathering was mainly documentary studies and interviews. The main data analysis approaches were coding (Strauss and Corbin) and pattern-matching (Yin). The dataset was analysed using the GEN framework suggested by Zhang et al. and Zhang...... by extending the GEN framework to address complications within engineering offshoring. This strengthens both academic fields, and will be able to help engineering managers to develop appropriate engineering network configurations for offshore engineering operations....

  8. Cryptanalysis of a chaos-based cryptosystem with an embedded adaptive arithmetic coder

    International Nuclear Information System (INIS)

    Wang Xing-Yuan; Xie Yi-Xin

    2011-01-01

    In this paper, we analyse a new chaos-based cryptosystem with an embedded adaptive arithmetic coder, which was proposed by Li Heng-Jian and Zhang J S (Li H J and Zhang J S 2010 Chin. Phys. B 19 050508). Although this new method has a better compression performance than its original version, it is found that there are some problems with its security and decryption processes. In this paper, it is shown how to obtain a great deal of plain text from the cipher text without prior knowledge of the secret key. After discussing the security and decryption problems of the Li Heng-Jian et al. algorithm, we propose an improved chaos-based cryptosystem with an embedded adaptive arithmetic coder that is more secure. (general)

  9. How Managers Sense and Seize “Hyped” Technologies

    DEFF Research Database (Denmark)

    Schiele, Kristen; Rydén, Pernille

    A rapid proliferation of online consumer review systems has become common in diverse industries, such as tourism (Xiang and Gretzel 2010), box office movies (Duan, Gu, andWhinston 2008; Dellarocas, Zhang and Awad 2007), online books (Chevalier and Mayzlin 2006;Chen, Wu, and Yoon 2004), and video ...... (Dellarocas 2003), and the popularity of online reviews has increased acknowledgement of the potential of social media to provide the organization with information, resources, and networks (Constantinides and Fountain 2008).......A rapid proliferation of online consumer review systems has become common in diverse industries, such as tourism (Xiang and Gretzel 2010), box office movies (Duan, Gu, andWhinston 2008; Dellarocas, Zhang and Awad 2007), online books (Chevalier and Mayzlin 2006;Chen, Wu, and Yoon 2004), and video...

  10. On the Strong Convergence of a Sufficient Descent Polak-Ribière-Polyak Conjugate Gradient Method

    Directory of Open Access Journals (Sweden)

    Min Sun

    2014-01-01

    Full Text Available Recently, Zhang et al. proposed a sufficient descent Polak-Ribière-Polyak (SDPRP conjugate gradient method for large-scale unconstrained optimization problems and proved its global convergence in the sense that lim infk→∞∥∇f(xk∥=0 when an Armijo-type line search is used. In this paper, motivated by the line searches proposed by Shi et al. and Zhang et al., we propose two new Armijo-type line searches and show that the SDPRP method has strong convergence in the sense that limk→∞∥∇f(xk∥=0 under the two new line searches. Numerical results are reported to show the efficiency of the SDPRP with the new Armijo-type line searches in practical computation.

  11. Taijiquan and Daoism. From Religion to Martial Art and Martial Art to Religion

    Directory of Open Access Journals (Sweden)

    Douglas Wile

    2012-07-01

    Full Text Available This study explores the ways in which the construction and deconstruction of a martial arts-Daoism connection has figured in political ideology, national iden-tity, and commercial interest during the past 400 years of Chinese history. Focusing on the taijiquan-Daoism-Zhang Sanfeng nexus, it traces the wrapping of a martial art in indigenous religious garb during the periods of Manchu rule, Japanese occupation, and post-Mao 21st century. It concludes by reporting on a contemporary movement in China to revive the cult of Zhang Sanfeng and to cast taijiquan as a form of religious practice. In this light, taijiquan emerges as an important site of constructing “Chinese-ness” in the face of state appropriation and Western cultural imperialism.

  12. Proceedings – Mathematical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Jiangtao Shi1 Cui Zhang1 2. School of Mathematics and Information Science, Yantai University, Yantai 264005, China; University of Primorska, IAM, Muzejski trg 2, 6000 Koper, Slovenia ...

  13. JH Fan Y. Liu Y. Li QF Zhang J. Tao O. Kurtanidze

    Indian Academy of Sciences (India)

    Astronomy Science and Technology Research Laboratory of Department of Education of Guangdong ... Department of Computer Science, Jinan University, Guangzhou 510632, China. ... Articles are also visible in Web of Science immediately.

  14. effect of metakaolin on concrete products with a pozzolan

    African Journals Online (AJOL)

    epc

    The physical and mechanical properties of Portland Cement containing metakaolin or combination of ... Metakaolin is quite useful in improving concrete ... improving the durability of concrete (Zhang ... metakaolin was obtained from a ceramic.

  15. PROPERTIES OF CHITIN REINFORCES COMPOSITES: A REVIEW

    African Journals Online (AJOL)

    user

    mechanical and thermal properties of chitin reinforced composites. ..... with crabyon fiber and normal viscose filaments. Also. Zhang et al.,[65] successfully blended chitin/cellulose using two different coagulating systems (immersed in 5.

  16. STOTEN2016 Tong data

    Data.gov (United States)

    U.S. Environmental Protection Agency — CTAG model inputs and outputs. This dataset is associated with the following publication: Tong, Z., R. Baldauf , V. Isakov , P.J. Deshmukh, and M. Zhang. Roadside...

  17. Establishment of an eco-compensation fund based on eco-services consumption.

    Science.gov (United States)

    Liu, Moucheng; Yang, Lun; Min, Qingwen

    2018-04-01

    Eco-compensation is a type of institutional arrangement that uses economic measures to adjust the relationships among stakeholders in order to conserve and/or sustainably use ecosystem services. The externality of the value of ecosystem services is one of the theoretical bases for eco-compensation. Different types of ecosystem services are consumed by people from different regions. Some are consumed by people living where the services originate, while some are carried by rivers, wind, vehicles or other natural or manmade means to other areas. Thus, the flow and consumption of ecosystem services should be seen as the basis for establishing eco-compensation funds. This paper uses satellite images of the Zhang-Cheng area near Beijing in 2013 to discuss how to establish an eco-compensation fund for stakeholders in this area. Firstly, six important types of ecosystem services in the Zhang-Cheng area were identified based on ecological function zoning, and the value of these ecosystem services was calculated based on ecological pricing methods. Secondly, the field intensity model from physics was used to analyze where Zhang-Cheng area ecosystem services flowed and calculate how much of these services were used by other areas. Thirdly, based on this analysis and calculation, the paper proposes the rates that different stakeholders should invest in the eco-compensation fund, based on their consumption of eco-services. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Controlling Self-Assembly in Al(110) Homoepitaxy

    Science.gov (United States)

    Tiwary, Yogesh; Fichthorn, Kristen

    2010-03-01

    Homoepitaxial growth on Al(110) exhibits nanoscale self-assembly into huts with well-defined (100) and (111) facets [1]. Although some of the diffusion mechanisms underlying this kinetic self-assembly were identified and incorporated into a two-dimensional model [2], we used density-functional theory (DFT) to identify many other mechanisms that are needed to describe the three-dimensional assembly seen experimentally [3]. We developed a three-dimensional kinetic Monte Carlo (KMC) model of Al(110) homoepitaxy. The inputs to the model were obtained from DFT [3,4]. Our model is in agreement with experimentally observed trends for this system. We used KMC to predict self-assembly under various growth conditions. To achieve precise placement of Al nanohuts, we simulated thermal-field-directed assembly [5]. Our results indicate that this technique can be used to create uniform arrays of nanostructures. [1] F. Buatier de Mongeot, W. Zhu, A. Molle, R. Buzio, C. Boragno, U. Valbusa, E. Wang, and Z. Zhang, Phys. Rev. Lett. 91, 016102 (2003). [2] W. Zhu, F. Buatier de Mongeot, U. Valbusa, E. G. Wang, and Z. Y. Zhang, Phys. Rev. Lett. 92, 106102 (2004). [3] Y. Tiwary and K. A. Fichthorn, submitted to Phys. Rev. B. [4] Y. Tiwary and K. A. Fichthorn, Phys. Rev. B 78, 205418 (2008). [5] C. Zhang and R. Kalyanaraman, Appl. Phys. Lett. 83, 4827 (2003).

  19. A Framework and Specific Operation of Chinese Indigenous Leadership Research Based on the Research about ZHANG Ruimin%中国本土领导研究的一种框架及操作:基于张瑞敏个案的研究过程示例

    Institute of Scientific and Technical Information of China (English)

    徐立国; 席酉民; 葛京; 宋合义

    2012-01-01

    基于对中国本土领导的界定与分析,提出中国本土领导研究的一种框架及操作,即从“领导如何成长、如何发挥作用及领导的本质”3个开放性问题出发,基于质性研究策略,采用以问题导向的探索性建构主义扎根理论方法,对中国本土领导数据进行搜集与整理.借鉴POPPER的4段式科学研究逻辑,对数据进行分析,不断地对问题进行诠释,并发现新的问题,从不断的循环中建构构念,发掘潜在的扎根理论,与现有领导理论进行对比,最终形成中国本土领导理论.%Chinese unique history and culture determine that practice and research of Chinese indigenous leadership are unique. Based on the definition and analysis of Chinese indigenous leadership research, we propose a framework and specific operation of Chinese indigenous leadership research. From three open-ended questions, based on qualitative research, using problem-oriented exploratory constructive grounded theory, we collect and sort out the data of Chinese indigenous leadership research. Following Popper's Four-scientific logic, we analyze the data, and interpret problems continuously, find new problems, construct constructs from the continuous interpreting circle, explore the potential of grounded theory, and compare with the existing leadership theories to form Chinese indigenous leadership theories. Based on the case of ZHANG Ruimin, we use the framework and specific operation and present the specific research venation of Chinese indigenous leadership research.

  20. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Lihua Jiang1 Aiyi Zhu1 Jianse Zhang1 Changwen Wu1. National Engineering Research Center of Marine Facilities Aquaculture, College of Marine Science, Zhejiang Ocean University, Zhoushan 316022, China ...

  1. Spatio-temporal variations of b-value in and around north Pakistan

    Indian Academy of Sciences (India)

    around Pakistan improved in the early 1960s, after the establishment of World .... Hazard Assessment Programme (GSHAP; Zhang et al. ..... zoning and development of design spectra for Peshawar ... Pakistan; Graphic Publishers. Kearey P ...

  2. Preliminary site characterization at Beishan northwest China-A potential site for China's high-level radioactive waste repository

    International Nuclear Information System (INIS)

    Wang Ju; Su Rui; Xue Weiming; Zheng Hualing

    2004-01-01

    Chinese nuclear power plants,radioactive waste and radioactive waste disposal are introduced. Beishan region (Gansu province,Northwest China)for high-level radioactive waste repository and preliminary site characterization are also introduced. (Zhang chao)

  3. Pullulan-coated phospholipid and Pluronic F68 complex nanoparticles for carrying IR780 and paclitaxel to treat hepatocellular carcinoma by combining photothermal therapy/photodynamic therapy and chemotherapy

    Directory of Open Access Journals (Sweden)

    Wang D

    2017-12-01

    Full Text Available Dan Wang,1,* Sipei Zhang,1,* Tao Zhang,1 Guoyun Wan,1 Bowei Chen,1 Qingqing Xiong,2 Jie Zhang,3 Wenxue Zhang,4 Yinsong Wang1 1Tianjin Key Laboratory on Technologies Enabling Development of Clinical Therapeutics and Diagnostics (Theranostics, School of Pharmacy, Tianjin Medical University, 2Key Laboratory of Cancer Prevention and Therapy, National Clinical Research Center for Cancer, Tianjin Medical University Cancer Institute and Hospital, 3Surgery Department, 4Radiotherapy Department, Tianjin Medical University General Hospital, Tianjin, China *These authors contributed equally to this work Abstract: IR780, a near-infrared dye, can also be used as a photosensitizer both for photothermal therapy (PTT and photodynamic therapy (PDT. In this study, we designed a simple but effective nanoparticle system for carrying IR780 and paclitaxel, thus hoping to combine PTT/PDT and chemotherapy to treat hepatocellular carcinoma (HCC. This nanosystem, named PDF nanoparticles, consisted of phospholipid/Pluronic F68 complex nanocores and pullulan shells. IR780 and paclitaxel were loaded separately into PDF nanoparticles to form PDFI and PDFP nanoparticles, which had regular sphere shapes and relatively small sizes. Upon near-infrared laser irradiation at 808 nm, PDFI nanoparticles showed strong PTT/PDT efficacy both in vitro and in vivo. In MHCC-97H cells, the combined treatment of PDFI nanoparticles/laser irradiation and PDFP nanoparticles exhibited significant synergistic effects on inhibiting cell proliferation and inducing cell apoptosis and cell cycle arrest at G2/M phase. In MHCC-97H tumor-bearing mice, PDFI nanoparticles exhibited excellent HCC-targeting and accumulating capability after intravenous injection. Furthermore, the combined treatment of PDFI nanoparticles/laser irradiation and PDFP nanoparticles also effectively inhibited the tumor growth and the tumor angiogenesis in MHCC-97H tumor-bearing mice. In summary, we put forward a therapeutic

  4. ater hy ater uota Systems In hina are ot orkin

    International Development Research Centre (IDRC) Digital Library (Canada)

    commerce and urban communities compete for ... China's Heihe River Basin by Junlian Zhang, College of Resource and Environment,. China Agricultural ... Adherence to water quotas in five irrigation areas in Zhangye City. Hongshuihe. 4.1.

  5. M-supplemented subgroups of finite groups

    Indian Academy of Sciences (India)

    Author Affiliations. Jia Zhang1 Long Miao1 Juping Tang2. School of Mathematical Sciences, Yangzhou University, Yangzhou 225002, People's Republic of China; Wuxi Institute of Technology, Wuxi 214121, People's Republic of China ...

  6. Evaluation of the cytotoxicity interactions between epirubicin and ...

    African Journals Online (AJOL)

    SERVER

    2008-03-18

    , Turkey. Accepted ... tant role in the field of cancer chemotherapy (Zhang et ... action mechanism, toxicity and side effects of drug. ... in the treatment of a variety of malignancies. ..... continuous exposure to cisplatin or paclitaxel.

  7. Linking Tengchong Terrane in SW Yunnan with Lhasa Terrane in southern Tibet through magmatic correlation

    Science.gov (United States)

    Xie, Jincheng; Zhu, Dicheng; Dong, Guochen; Zhao, Zhidan; Wang, Qing

    2016-04-01

    New zircon U-Pb data, along with the data reported in the literature, reveal five phases of magmatic activity in the Tengchong Terrane since the Early Paleozoic with spatial and temporal variations summarized as: Cambrian-Ordovician (500-460 Ma) to the eastern, minor Triassic (245-206 Ma) in the eastern and western, abundant Early Cretaceous (131-114 Ma) in the eastern, extensive Late Cretaceous (77-65 Ma) in the central, and Paleocene-Eocene (65-49 Ma) in the central and western Tengchong Terrane, in which the Cretaceous-Eocene magmatism was migrated from east to west (Xu et al., 2012). The increased zircon eHf(t) of the Early Cretaceous granitoids from -12.3 to -1.4 at ca. 131-122 Ma to -4.6 to +7.1 at ca. 122-114 Ma identified for the first time in this study and the magmatic flare-up at ca. 53 Ma in the central and western Tengchong Terrane (Wang et al., 2014, Ma et al., 2015) indicate the increased contributions from mantle- or juvenile crust-derived components. The spatial and temporal variations and changing magmatic compositions with time in the Tengchong Terrane closely resemble the Lhasa Terrane in southern Tibet. Such similarities, together with the data of stratigraphy and paleobiogeography (Zhang et al., 2013), enable us to propose that the Tengchong Terrane in SW Yunnan is most likely linked with the Lhasa Terrane in southern Tibet, both of which experience similar tectonomagmatic histories since the Early Paleozoic. References Ma, L.Y., Wang, Y.J., Fan, W.M., Geng, H.Y., Cai, Y.F., Zhong, H., Liu, H.C., Xing, X.W., 2014. Petrogenesis of the early Eocene I-type granites in west Yingjiang (SW Yunnan) and its implication for the eastern extension of the Gangdese batholiths. Gondwana Research 25, 401-419. Wang, Y.J., Zhang, L.M., Cawood, P.A., Ma, L.Y., Fan, W.M., Zhang, A.M., Zhang, Y.Z., Bi, X.W., 2014. Eocene supra-subduction zone mafic magmatism in the Sibumasu Block of SW Yunnan: Implications for Neotethyan subduction and India-Asia collision

  8. AHP 45: REVIEW: THE DAWN OF TIBET

    Directory of Open Access Journals (Sweden)

    Ivette M. Vargas-O'Bryan

    2017-03-01

    Full Text Available If you want to learn more about the pre-Buddhist heritage of Tibet and the Western Himalayas, one name stands out: John Vincent Bellezza. Unlike any other, we encounter a uniqueness in Bellezza's works, a breadth of detail, insight, and personal struggle that has been unsurpassed in archaeology and Tibetan Studies these days. Bellezza's numerous publications that include such groundbreaking works as Divine Dyads (1997, Calling Down the Gods (2005, the significant contributions of Zhang Zhung: Foundations of Civilization in Tibet (2008, Death and Beyond in Ancient Tibet, and the critical two volume set, Antiquities of Zhang Zhung (2010, have provided robust studies on Tibet's pre-Buddhist heritage in an unconventional style that at once incorporates his skills as an archaeologist with one of cultural historian, anthropologist, travel journalist, explorer, and storyteller.

  9. Comparison of broiler performance, carcass yields and intestinal ...

    African Journals Online (AJOL)

    Comparison of broiler performance, carcass yields and intestinal microflora when fed diets containing transgenic (Mon-40-3-2) and conventional soybean meal. Jianzhuang Tan, Shasha Liu, Zhe Sun, Hongfu Zhang, Yongwei wang, Dan Liu ...

  10. Hong et al., Afr J Tradit Complement Altern Med. (2013) 10(4):66-69 ...

    African Journals Online (AJOL)

    AJTCAM

    inflammation, annex inflammation, uterine prolapse, and neurasthenia. .... Research progress on pharmacological effects of Bidens bipinnata L. China Pharmacy. ... Clinic. 24 (3): 147-149. 8. Wang, Q., Zhang Y.N., Chen F.H. (2009). Research ...

  11. Genetics Home Reference: IRAK-4 deficiency

    Science.gov (United States)

    ... Blanco JC, Salkowski C, Zhang S, Arditi M, Gallin JI, Vogel SN. Distinct mutations in IRAK-4 confer ... Ghonaium A, Day-Good NK, Holland SM, Gallin JI, Chapel H, Speert DP, Rodriguez-Gallego C, Colino ...

  12. Effects of water stress and seed mass on germination and ...

    African Journals Online (AJOL)

    enoh

    2012-03-01

    Mar 1, 2012 ... polyvinylpyrrolidone; TCA, trichloroacetic acid; NBT, nitroblue tetrazolium; TBA ..... seeds had weaker resistances to moderate stress (-0.6. MPa) compared with .... Chen YN,Chen YP,Li WH,Zhang HF (2003). Response of ...

  13. Collision strengths for transitions in Ni XIX

    Indian Academy of Sciences (India)

    4l configurations of Ni XIX, for which flexible atomic code. (FAC) has been ... atomic data (namely energy levels, radiative rates, collision strengths, excitation rates, etc.) ... Zhang and Sampson, who adopted the Coulomb–Born-exchange.

  14. Multi region based image retrieval system

    Indian Academy of Sciences (India)

    data mining, information theory, statistics and psychology. ∗ .... ground complication and independent of image size and orientation (Zhang 2007). ..... Figure 2. Significant regions: (a) the input image, (b) the primary significant region, (c) the ...

  15. DIFLUORPHOS and SYNPHOS in asymmetric catalysis: Synthetic ...

    Indian Academy of Sciences (India)

    ture did not significantly affect the stereochemical out- come. For this process ..... economy concepts.36 In 2012, Zhang, Ratovelomanana-. Vidal and co-workers ..... broad spectrum cancer therapeutic agents.53 To this end, dynamic kinetic ...

  16. PREPARATION AND CHARACTERIZATION OF DIALDEHYDE ...

    African Journals Online (AJOL)

    User

    The results indicated that the higher the concentration of periodates, the higher the percentage of aldehyde .... measurement of intrinsic viscosity (Zhang, et al.,. 2011). ..... solubility using water and some organic solvents. The. Cross-linked ...

  17. 75 FR 30010 - Improving Market and Planning Efficiency Through Improved Software; Notice of Agenda and...

    Science.gov (United States)

    2010-05-28

    ..., Thomas[email protected] . Kimberly D. Bose, Secretary. Agenda for AD10-12 Staff Technical Conference on... Gribik and Li Zhang, Midwest ISO Gary Stern, Southern California Edison 9:25 a.m Session G--Variable...

  18. African Journal of Biotechnology - Vol 10, No 42 (2011)

    African Journals Online (AJOL)

    induced vascular endothelial growth factor expression in luteal cells · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. X Pang, Z Wang, D Yin, Z Zhang, 8227-8235 ...

  19. Analysis on the correlation between serum esterase polymorphism ...

    African Journals Online (AJOL)

    张德杨

    2013-02-01

    Feb 1, 2013 ... Junyan Bai*, Xiaoping Jia, Xiaohui Zhang, Yuqin Wang, Shujuan Zhao, Youbing Yang and Li. Hongwei ... genetic structure of livestocks, but also explore the .... bioche-mistry genetics in Xinjiang fine-wool sheep imported into.

  20. Assessing Maize Foliar Water Stress Levels Under Field Conditions ...

    African Journals Online (AJOL)

    spectroscopy with its numerous fine wavelengths and is non-destructive to .... outcomes (Zhang et al., 2012) whereas others previously realized only the .... in the leaf structure also accounts for the visualised difference around the NIR region.

  1. Seo et al., Afr J Tradit Complement Altern Med. (2013) 10 (1):113-123

    African Journals Online (AJOL)

    AJTCAM

    huo-tang, Jiin-koka-to, Simultaneous determination. Introduction. Many herbal formulae have been used to prevent and treat various diseases. Such herbal medicines have few side effects and exhibit multiple activities (Zhang et al., 2004; Jiang, ...

  2. Fulltext PDF

    Indian Academy of Sciences (India)

    Beiguang Zhang

    2017-07-27

    Jul 27, 2017 ... via shRNA inhibits cell proliferation in human ovarian cancer. BEIGUANG ZHANG .... wrote the informed consent and this research was approved by. Ethics Committee of Jilin Cancer Hospital, China. Ovarian cancer cell lines, ...

  3. Correlation effects driven by reduced dimensionality in magnetic ...

    Indian Academy of Sciences (India)

    2015-06-02

    Jun 2, 2015 ... Keywords. Magnetic surface alloys; electronic structure; surface reconstructions; correlation ..... While atomic multiplet effects are not directly visible as fine structure, they ..... [19] W L O' Brien, J Zhang and B P Tonner, J. Phys.

  4. Structure Variation from One-Dimensional Chain to Three ...

    Indian Academy of Sciences (India)

    WEN-XUAN LI, XIAO-MIN GU, WEN-LI ZHANG and LIANG NI. School of Chemistry ... Compound 1 possesses one-dimensional chain structure, and expands into ..... sis of fine chemicals and pharmaceuticals.30 The results were summarized ...

  5. The characterization of cytoplasmic ribosomal protein genes - AJOL

    African Journals Online (AJOL)

    USER

    2012-04-17

    weblogo.berkeley.edu/logo.cgi). ... method (Saitou and Nei, 1987) implemented in MEGA 4.0 program ..... (Figure 3), indicating selection for efficient recognition by ..... Akiyoshi DE, Morrison HG, Lei S, Feng X, Zhang Q, Corradi N, ...

  6. African Journal of Biotechnology - Vol 5, No 6 (2006)

    African Journals Online (AJOL)

    -related protein kinase2 · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Huawen Zou, Xiuhai Zhang, JiuRan Zhao, Qing Yang, Zhongyi Wu, Fengge Wang, Conglin Huang, 490-496 ...

  7. Effect of spin polarization on the structural properties and bond ...

    Indian Academy of Sciences (India)

    ties such as structural, hardness, Young modulus and frac- ture toughness ... measurements showed that hardness ranged between 14.5 and 19GPa ... the relative binding forces, is a useful fundamental property. ..... strength [36,39]. Zhang et ...

  8. Genes involved in sex determination process and the influence of ...

    African Journals Online (AJOL)

    DR. & MRS. TONY A. NLEWADIM

    2015-02-04

    Feb 4, 2015 ... Key words: Next-generation sequencing, simple sequence repeats, Rhamdia sp. .... individual genotypes were defined according to the standards of the bands. ..... Wang J, Yu X, Zhao K, Zhang Y, Tong J, Peng Z (2012).

  9. Dubbing SAGA unveils new epigenetic crosstalk.

    Science.gov (United States)

    Pijnappel, W W M Pim; Timmers, H Th Marc

    2008-02-01

    In a recent issue of Molecular Cell, two independent studies (Zhang et al., 2008; Zhao et al., 2008) provide compelling evidence that targeted deubiquitylation of histones is intimately linked to transcription activation, epigenetic regulation, and cancer progression.

  10. African Journal of Biotechnology - Vol 11, No 69 (2012)

    African Journals Online (AJOL)

    In silico comparative analysis of EST-SSRs in three cotton genomes · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Daojun Yuan, Shaoguang Liang, Zhongxu Lin, Xianlong Zhang, 13269-13371 ...

  11. Readings from Asia: Yuwai Hanji: The History of Publications and the Interchange of Literature in the Chinese Cultural Sphere

    Directory of Open Access Journals (Sweden)

    Yongchul Choe

    2012-09-01

    Full Text Available English synopsis of: Zhang Bowei 张伯伟, Yuwai Hanji yanjiu lunji 域外汉籍研究论集 [A Collection of Research Essays on Foreign Writings in Chinese]. Beijing: Beijing Daxue Chubanshe, 2011.

  12. Cloning and characterization of a nitrite reductase gene related to ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-03-01

    Mar 1, 2010 ... Alexander et al., 2005) and heme-type nitrite reductase gene (Smith and ... owing to a genotype-dependent response (Zhang et al.,. 1991; Sakhanokho et al., ..... Improvement of cell culture conditions for rice. Jpn. Agric. Res.

  13. Aldehyde Dehydrogenase 1 and Raf Kinase Inhibitor Protein ...

    African Journals Online (AJOL)

    Xiang-Xiu Sun1, Qing-Shan Ma2, Tian-Feng Liu1, Ying Chen1, Yan Dong1 and. Lin-Lin Zhang1* ... cancer was developed and studied by histological examination. Immunohistochemical and .... (diaminobenzidine) Kit. Western blot analysis.

  14. Understanding the efficacy of influent waste water on microbial ...

    African Journals Online (AJOL)

    acer

    composition on the species structure and the diversity of bacterial consortia. The community ... 2010; Kim et al., 2011; Ye et al., 2011; Zhang et al.,. 2011a; b), greatly ..... molecular fine scale analysis of natural ammonia-oxidizing populations.

  15. Phylogeography of Indian populations of Panax bipinnatifidus Seem

    African Journals Online (AJOL)

    ksu

    2011-11-16

    Nov 16, 2011 ... Renner, 2011; Ali et al., 2009; Kocyan et al., 2007; Zhang et al., 2006; Jeffrey, 2005; ... information on population structure and genetic variation of D. palmatus is lacking. ..... Fine scale geographic structure, intra-individual ...

  16. Association mapping for partial resistance to Phytophthora sojae in ...

    Indian Academy of Sciences (India)

    2014-08-22

    Aug 22, 2014 ... analysis of population structure (see table 2 in electronic sup- plementary ..... this study could provide a basis for further fine-mapping and genomewide ... Bradbury P. J., Zhang Z., Kroon D. E., Casstevens T. M., Ramdoss.

  17. Electron paramagnetic resonance parameters and local structure for ...

    Indian Academy of Sciences (India)

    HUA-MING ZHANG. 1. , GUANG-DUO LU. 1 ... the above ZFSs, the local structure information for the impurity Gd. 3+ is obtained, i.e., .... parameters, extended X-ray absorption fine-structure (EXAFS) measurements and crystal-field spectrum ...

  18. Dredging induced changes in zooplankton community and water ...

    African Journals Online (AJOL)

    user

    water characteristics and zooplankton community structure in Dal Lake. An assessment was done ... et al., 2007; Zhang et al., 2010). In aquatic ecosystems, .... generally high in fine grain sediment (Fisher et al., 1982;. Valiela, 1995). In post ...

  19. Bihamiltonian Cohomology of KdV Brackets

    NARCIS (Netherlands)

    Carlet, G.; Posthuma, H.; Shadrin, S.

    2016-01-01

    Using spectral sequences techniques we compute the bihamiltonian cohomology groups of the pencil of Poisson brackets of dispersionless KdV hierarchy. In particular, this proves a conjecture of Liu and Zhang about the vanishing of such cohomology groups.

  20. Diet-derived microRNAs: unicorn or silver bullet?

    Science.gov (United States)

    Witwer, Kenneth W; Zhang, Chen-Yu

    2017-01-01

    In ancient lore, a bullet cast from silver is the only effective weapon against monsters. The uptake of active diet-derived microRNAs (miRNAs) in consumers may be the silver bullet long sought after in nutrition and oral therapeutics. However, the majority of scientists consider the transfer and regulation of consumer's gene activity by these diet-derived miRNAs to be a fantasy akin to spotting a unicorn. Nevertheless, groups like Dr. Chen-Yu Zhang's lab in Nanjing University have stockpiled breathtaking amounts of data to shoot down these naysayers. Meanwhile, Dr. Ken Witwer at John Hopkins has steadfastly cautioned the field to beware of fallacies caused by contamination, technical artifacts, and confirmation bias. Here, Dr. Witwer and Dr. Zhang share their realities of dietary miRNAs by answering five questions related to this controversial field.

  1. Solution of generalized shifted linear systems with complex symmetric matrices

    International Nuclear Information System (INIS)

    Sogabe, Tomohiro; Hoshi, Takeo; Zhang, Shao-Liang; Fujiwara, Takeo

    2012-01-01

    We develop the shifted COCG method [R. Takayama, T. Hoshi, T. Sogabe, S.-L. Zhang, T. Fujiwara, Linear algebraic calculation of Green’s function for large-scale electronic structure theory, Phys. Rev. B 73 (165108) (2006) 1–9] and the shifted WQMR method [T. Sogabe, T. Hoshi, S.-L. Zhang, T. Fujiwara, On a weighted quasi-residual minimization strategy of the QMR method for solving complex symmetric shifted linear systems, Electron. Trans. Numer. Anal. 31 (2008) 126–140] for solving generalized shifted linear systems with complex symmetric matrices that arise from the electronic structure theory. The complex symmetric Lanczos process with a suitable bilinear form plays an important role in the development of the methods. The numerical examples indicate that the methods are highly attractive when the inner linear systems can efficiently be solved.

  2. A field experiment was conducted to evaluate the growth, yield and ...

    African Journals Online (AJOL)

    ScOrPiOnE

    2013-07-24

    Jul 24, 2013 ... tication. Cotton constitutes the most important textile plant in the world and is one of the most important crops for the production of oilseed (Zhang et al., 2007). ... components and fiber quality traits performance of cotton.

  3. Download this PDF file

    African Journals Online (AJOL)

    Negisho

    security and income generation in Ethiopia, the national ...... (1997) who reported that K balance was strongly negative .... likely to have a good storage quality or shelf life. Tuber N ... expenses required for the survey work. ... Zhang, X.Y. 2012.

  4. Effects of polysaccharide from Lycium barbarum in alloxan-induced ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-12-01

    8613170662021. (Zhi et al., 2004; Gan et al., 2004; Zhang et al., 2004). LBP have been recently studied for their physiological and pharmaceutical activities. The purpose of this study was to investigate the effect of LBP in alloxan-induced.

  5. Indexes to Volume 67

    Indian Academy of Sciences (India)

    Exact solutions to a class of nonlinear Schrödinger-type equations. Jin-Liang Zhang .... Determination of thorium and uranium contents in soil samples using. SSNTD's ... Direct determination of bulk etching rate for LR-115-II solid state nuclear.

  6. Great progress in the domesticated silkworm (Bombyx mori L.)

    African Journals Online (AJOL)

    akpobome

    2013-03-13

    Mar 13, 2013 ... silk materials. This review also presents the control technology of fine filament size and the regulatory ..... size and fine structure characteristics of the cocoon filament, and the .... Li YN, Shu HG, Men W, Zhang ZF (2009).

  7. A Cross-Scale Model for 3D Baroclinic Circulation in Estuary-Plume-Shelf Systems. 2. Application to the Columbia River

    National Research Council Canada - National Science Library

    Baptista, Antonio M; Zhang, Yinglong; Chawla, Arun; Zulauf, Mike; Seaton, Charles; Myers, III, Edward P; Kindle, John; Wilkin, Michael; Burla, Michaela; Turner, Paul J

    2005-01-01

    This article is the second of a two-part paper on ELCIRC, an Eulerian-Lagrangian finite difference/finite volume model designed to simulate 3D baroclinic circulation across river-to-ocean scales. In part one (Zhang et al., 2004...

  8. Detection and delineation of coal mine fire in Jharia coal field (JCF ...

    Indian Academy of Sciences (India)

    71

    Africa, Indonesia, Poland (Zhang et al. 2005; Kuenzer et al. .... is about 8 Km in west direction from Dhanbad Rrailway station. The location of the ...... International conference on Spontaneous coal seam fires: Mitigating a global. 543 disaster at ...

  9. Use of co-spray pyrolysis for synthesizing nitrogen-doped TiO2 films

    Indian Academy of Sciences (India)

    the photoelectrochemical solar cell (Guo et al 2011; Zhang et al 2011; Umar et al ... as photocatalytic mechanism, bandgap narrowing, N 1s XPS assignment were ..... This work was supported by the Vietnam National Founda- tion for Science ...

  10. Anti-Thrombotic Effect of Carthamus tinctorius Linn Extracts in Rats

    African Journals Online (AJOL)

    HP

    Safflower, Carthamus tinctorius Linne). Neurochem. Res. 2009; 34: 795–. 805. 8. Zhang SQ, Jiang LD. Effect of safflower injection on cardiac energy charge and anti-apoptosis gene bcl-2 in rats' heart.Chin. J. Integr. Tradit. West. Med. 2004;.

  11. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Hong Zhang Teng-Long Guo Qing-Lian Wang · More Details Abstract Fulltext PDF. Three transgenic cotton varieties (lines) were chosen for the study of inheritance and segregation of foreign Bt (Bacillus thuringiensis toxin) and tfdA genes in cotton.

  12. Determining the short-range spin correlations in the spin-chain Li.sub.2./sub.CuO.sub.2./sub. and CuGeO.sub.3./sub. compounds using resonant Inelastic X-ray scattering

    Czech Academy of Sciences Publication Activity Database

    Monney, C.; Bisogni, V.; Zhou, K.J.; Kraus, R.; Strocov, V.N.; Behr, G.; Málek, Jiří; Kuzian, R.; Drechsler, S.-L.; Johnston, S.; Revcolevschi, A.; Büchner, B.; Ronnow, H.M.; van den Brink, J.; Geck, J.; Schmitt, T.

    2013-01-01

    Roč. 110, č. 8 (2013), "087403-1"-"087403-5" ISSN 0031-9007 Institutional support: RVO:68378271 Keywords : RIXS * spin correlations * temperature dependence of Zhang- Rice singlet Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 7.728, year: 2013

  13. Reference: 438 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available ity and drought tolerance in Arabidopsis thaliana. 18 6902-12 16943431 2006 Sep Molecular and cellular bio...logy Chen Zhizhong|Gong Zhizhong|Hong Xuhui|Jablonowski Daniel|Ren Xiaozhi|Schaffrath Raffael|Zhang Hairong|Zhou Xiaofeng|Zhu Jian-Kang

  14. Multiple proteins of White spot syndrome virus involved in ...

    Indian Academy of Sciences (India)

    Author Affiliations. Jing-Yan Zhang1 2 Qing-Hui Liu1 Jie Huang1. Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao, 266071, P. R. China; Shanghai Ocean University, 999 Hucheng Ring Road, Pudong, Shanghai, China ...

  15. Subject Index

    Indian Academy of Sciences (India)

    user1

    Multi-Wavelength Studies on H2O Maser Host Galaxies (J. S. Zhang & J. .... N(HI) and Jet Power/Emission in AGNs (Zhongzu Wu, Minfeng Gu & Ming Zhu), 319 .... Emanuela Orrù, David Rafferty, Huub Röttgering, Anna Scaife, Aleksandar ...

  16. A comparative study of fingerprint thinning algorithms

    CSIR Research Space (South Africa)

    Khanyile, NP

    2011-08-01

    Full Text Available are compared in terms of the quality of the skeletons they produce (i.e. connectivity and spurious branches) as well as the time complexity associated with each algorithm. Results show that faster algorithms have difficulty preserving connectivity. Zhang...

  17. Dual affine isoperimetric inequalities

    Directory of Open Access Journals (Sweden)

    Bin Xiong

    2006-01-01

    Full Text Available We establish some inequalities for the dual -centroid bodies which are the dual forms of the results by Lutwak, Yang, and Zhang. Further, we establish a Brunn-Minkowski-type inequality for the polar of dual -centroid bodies.

  18. QTL Information Table: 499 [Q-TARO

    Lifescience Database Archive (English)

    Full Text Available 66 A RG476 RG214 pha Kamoshita, A., Zhang, J., Siopongco, J., Sarkarung, S., Nguyen, H.T., and Wade, L.J. (2002). Effects of Phenotyp...ing Environment on Identification of Quantitative Trait Loci for Rice Root Morpholo

  19. Luteoloside Inhibits Proliferation of Human Chronic Myeloid ...

    African Journals Online (AJOL)

    Purpose: To investigate the effects of luteoloside on the proliferation of human chronic ..... Zhang N, Wang D, Zhu Y, Wang J, Lin H. Inhibition ... Han X. Protection of Luteolin-7-O-Glucoside Against ... Hwang YJ, Lee EJ, Kim HR, Hwang KA.

  20. Extraction-condition Optimization of Baicalein and Schisandrin from ...

    African Journals Online (AJOL)

    effects of individual factors on extraction rates of baicalein and schisandrin determined by high performance liquid ..... Huang HL, Wang YJ, Zhang QY, Liu B, Wang FY, Li JJ,. Zhu RZ. ... Liu C, Zhao X, Fan Y, Han G, Nguyen T. Astragalus.

  1. African Journal of Biotechnology - Vol 10, No 37 (2011)

    African Journals Online (AJOL)

    7130 ... G Lu, Y Shen, W Qian, L Shen, Q Qiao, M Li, Z Wang, 7136-7142 ... LN Zhen, K Wang, YJ Zhang, H Zhou, 7161-7165 ... Effect of cadmium hyperaccumulation on antioxidative defense and proline accumulation of Solanum nigrumL.

  2. DEPOSITION DISTRICUTION AMONG THE PARALLEL PATHWAYS IN THE HUMAN LUNG CONDUCTING AIRWAY STRUCTURE.

    Science.gov (United States)

    DEPOSITION DISTRIBUTION AMONG THE PARALLEL PATHWAYS IN THE HUMAN LUNG CONDUCTING AIRWAY STRUCTURE. Chong S. Kim*, USEPA National Health and Environmental Effects Research Lab. RTP, NC 27711; Z. Zhang and C. Kleinstreuer, Department of Mechanical and Aerospace Engineering, North C...

  3. African Journal of Reproductive Health - Vol 17, No 4 (2013)

    African Journals Online (AJOL)

    Risk Factors for Premature Births: A Cross-Sectional Analysis of Hospital Records in a Cameroonian Health Facility. Andreas Chiabi, Evelyn M Mah, Nicole Mvondo, Seraphin Nguefack, Lawrence Mbuagbaw, Karen K Kamga, Shiyuan Zhang, Emile Mboudou, Pierre F Tchokoteu, Elie Mbonda ...

  4. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 130; Issue 2. Polynuclear and one-dimensional cyanide-bridged heterobimetallic complexes: synthesis, crystal structures and magnetic properties. JINGWEN SHI WENLONG LAN YIN ZHOU CHONGCHONG XUE QINGYUN LIU DAOPENG ZHANG. Volume 130 Issue ...

  5. Interdisciplinary in the Information Field

    DEFF Research Database (Denmark)

    Madsen, Dorte

    2012-01-01

    Interdisciplinarity and its implications for developing a conceptual framework for the Information Field is discussed, and Zhang & Benjamin’s (2007) paper Understanding Information Related Fields: A Conceptual Framework is examined. It is argued that the fundamental components of a framework must...

  6. A novel missense mutation of bovine lipase maturation factor 1 (LMF1)

    African Journals Online (AJOL)

    Jane

    2011-07-27

    Jul 27, 2011 ... used a mouse which has severe hypertriglyceridemia to prove the function of ... The gel was stained with 0.1% silver nitrate. (Zhang et al., 2007). .... and HL, and this situation would lead to severe hypertri- glyceridemia, and ...

  7. The Impact of Jumps and Leverage in Forecasting Co-Volatility

    NARCIS (Netherlands)

    M. Asai (Manabu); M.J. McAleer (Michael)

    2015-01-01

    markdownabstract__Abstract__ The paper investigates the impact of jumps in forecasting co-volatility, accommodating leverage effects. We modify the jump-robust two time scale covariance estimator of Boudt and Zhang (2013) such that the estimated matrix is positive definite. Using this

  8. A systematic analysis of the association studies between CASP8 ...

    Indian Academy of Sciences (India)

    Yinliang Zhang

    Yinliang Zhang and Wei Li contributed equally to this work. ... All original articles published in English that examined the ... goodness of fit is used to test deviation from HWE. Studies were considered to deviate from HWE at P < 0.05 (Guo.

  9. Photosynthesis and photoprotective systems of plants in response to ...

    African Journals Online (AJOL)

    Yomi

    2010-12-27

    Dec 27, 2010 ... al., 2008), photoprotective systems (Xiao et al., 2003a;. Chen et al., 2005a; Ali et al., .... et al., 1988) and soybean (Ying and Liu, 2005) and unaffected in beech ...... Goulding KW, Vitousek PM, Zhang FS (2010). Significant.

  10. Analysis of the microclimate and CO2 flux characteristics in arid ...

    Indian Academy of Sciences (India)

    Field site and methods. 2.1 Field site. The study was .... cal wind velocities were positive at the field site. (figure 2a). ..... micrometeorology: A guide for surface flux measurements; ... Zhang G S 2000 Research progress on trees and shrub.

  11. How consistent is the satellite derived SST-LHF relationship in comparison with observed values ?

    Digital Repository Service at National Institute of Oceanography (India)

    Muraleedharan, P.M.; Pankajakshan, T.

    Arabian Sea was generally above 27 degrees C, the satellite underestimation often produced SSTs less than 27 degrees C, thereby supporting a linear relationship with LHF, as suggested by Zhang and McPhaden. Similarly for SSTs higher than 28 degrees C...

  12. Improved affinity of a chicken single-chain antibody to avian ...

    African Journals Online (AJOL)

    linyuan

    2011-12-12

    Dec 12, 2011 ... Jianhua Wang. 1. , Ying Zhang ... et al., 1991; Dougan et al., 1998; Chang et al., 2009). The site-directed ... Analysis of the three-dimensional structure of the antigen-antibody ..... Altering the fine specificity of an anti-Legionella ...

  13. Structural studies of Nd1.85Ce0.15CuO4 + Ag superconducting ...

    Indian Academy of Sciences (India)

    Nd1.85Ce0.15CuO4, on its crystal structure and local structural features, using synchrotron X-ray diffraction. (SXRD) and ..... extended X-ray absorption fine structure (EXAFS). ... [1] Zhang and Chongmin 1991 Thesis, University of British.

  14. Thermally stimulated luminescence and photoluminescence ...

    Indian Academy of Sciences (India)

    2012-01-13

    Jan 13, 2012 ... red to ultraviolet, which depends on the crystal structure of host materials ..... to strong anisotropic nature of the fine structure (fs) transi- tion(s), other .... 39 2065. Pan Shilie, Wu Yicheng, Fu Peizhen, Zhang Guochun, Li Zhihua,.

  15. Structures, energetics and magnetic properties of AunSFem and ...

    African Journals Online (AJOL)

    Bheema

    relating the number of atoms needed to form a compact symmetric structure to an enhanced stability. If the d orbitals ...... This is in agreement with the experimental result of Zhang et al. (1996). .... Extended x-ray absorption fine structure study ...

  16. Influence of radio frequency power on structure and ionic ...

    Indian Academy of Sciences (India)

    Wintec

    frequency (rf) power on the structure and the ionic conductivity of LiPON thin films has been investigated. The morphology ... be used as a fine alternative to traditional sulfides and ... able lithium batteries (Kennedy and Zhang 1988; Ménétrier.

  17. A potential explanation for the effect of carbon source on the ...

    African Journals Online (AJOL)

    USER

    2010-08-16

    Aug 16, 2010 ... structure, mixed liquor suspended solids (MLSS), sludge volume index (SVI) .... Fine air bubbles for aeration were supplied through an air sparger at the ..... Ren TT, Liu L, Sheng GP, Liu XW, Yu HQ, Zhang MC, Zhu JR (2008).

  18. Genetic structure and diversity within and among six populations of ...

    African Journals Online (AJOL)

    Yomi

    2010-04-24

    Apr 24, 2010 ... Genetic structure and diversity within and among six populations of .... Lyopholized samples were ground to a fine powder. DNA extraction ..... 22(3): 287-292. Pei YL, Zou, YP, Yin Z, Wang XQ, Zhang ZX, Hong DY (1995).

  19. Growth, ion content and photosynthetic responses of two Elytrigia ...

    African Journals Online (AJOL)

    Jane

    2011-07-25

    Jul 25, 2011 ... Wang Zan, Zhang Geng, Wang Xue-min and Gao Hong-wen*. Institute of .... Dried leaf samples were ground to a fine powder and approximately. 0.1 g was .... structure and negative feedback by reduced sink activity. (Iyengar ...

  20. Structural investigation of V2O5–P2O5–K2O glass system with ...

    Indian Academy of Sciences (India)

    Metal ions such as cobalt and vanadium and their metal- complexes ... In this context, the new potassium–phosphate glass sys- ... A single 'glass water-extract' ..... [22] Zhang W G and Liang J H 2013 Synth. React. Inorg. Met-Org. Nano-Met.

  1. High energy transients: The millisecond domain

    Indian Academy of Sciences (India)

    A. R. RAO

    2018-02-09

    Feb 9, 2018 ... level, the GRB flux distribution is very flat (Fishman &. Meegan 1995)—there are ... the estimated all-sky rate is about one per day (Kumar. & Zhang 2015). ... and the mysterious GRBs possibly signalling the birth of black holes.

  2. TRANSPORT AND DEPOSITION OF NANO-SIZE PARTICLES IN THE UPPER HUMAN RESPIRATORY AIRWAYS

    Science.gov (United States)

    TRANSPORT AND DEPOSITION OF NANO-SIZE PARTICLES IN THE UPPER HUMAN RESPIRATORY AIRWAYS. Zhe Zhang*, Huawei Shi, Clement Kleinstreuer, Department of Mechanical and Aerospace Engineering, North Carolina State University, Raleigh, NC 27695-7910; Chong S. Kim, National Health and En...

  3. Multi-level anomaly detection: Relevance of big data analytics in ...

    Indian Academy of Sciences (India)

    The Internet has become a vital source of information; internal and exter- .... (iii) DDos detection: Distributed Denial of Service (DDoS) is a common malicious ...... Guirguis M, Bestavros A, Matta I and Zhang Y 2005a Reduction of quality (roq) ...

  4. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Xiuqiang Li1 Dong Zhang1 Peiying Zhu1 Chao Yang1. Key Laboratory of Advanced Civil Engineering Materials, Ministry of Education, College of Materials Science and Engineering, Tongji University, 4800 CaoAn Road, Shanghai 200092, China ...

  5. Risk Factors for Premature Births: A Cross-Sectional Analysis of ...

    African Journals Online (AJOL)

    Risk Factors for Premature Births: A Cross-Sectional Analysis of Hospital Records in a Cameroonian Health Facility. Andreas Chiabi, Evelyn M Mah, Nicole Mvondo, Seraphin Nguefack, Lawrence Mbuagbaw, Karen K Kamga, Shiyuan Zhang, Emile Mboudou, Pierre F Tchokoteu, Elie Mbonda ...

  6. Identification of forty-five gene-derived polymorphic microsatellite ...

    Indian Academy of Sciences (India)

    [Chen M., Gao L., Zhang W., You H., Sun Q. and Chang Y. 2013 Identification of forty-five ... including Japan, China, Korea and fareastern Russia (Chang et al. 2009). Because of ... tory using the Illumina HiSeq 2000 Sequencing Technology.

  7. Expression Pattern of Antioxidant Enzyme Genes in Embryonic Axes

    African Journals Online (AJOL)

    lin

    2012-07-17

    Jul 17, 2012 ... Yin Li, Yishun Zhang*, Shaowei Wei, Li Liu and Yunfeng Chen. Guangdong Key Laboratory of ... and tissues (Alscher et al., 1997; Mallick and Mohn, 2000; ... crop in some countries such as China, Japan and India. (Liu et al.

  8. Projection of extreme precipitation in the context of climate change ...

    Indian Academy of Sciences (India)

    tion, maximum 1-day precipitation and simple daily intensity to do ... The study area spans far and wide. It reaches .... design flood, and it is also an important purpose to study the ..... bridge University Press, Cambridge. Jinshan Zhang, Xingju ...

  9. Zhang et al., Afr J Tradit Complement Altern Med. (2016) 13(3):181 ...

    African Journals Online (AJOL)

    Drugs were administered orally daily for 7 days before modeling. ... this segment, including delivery of nutrients, removal of waste products, and ... cardiology as well as in other end-organ systems, such as cardiac diseases, ... Rats were anesthetized with 0.3% pentobarbital sodium (1ml/100g) by intramuscular injection.

  10. On the Superluminal Motion of Radio-Loud AGNs Zhi-Bin Zhang1,2 ...

    Indian Academy of Sciences (India)

    xies—radiation mechanisms: non-thermal—quasars: general. 1. Introduction. Rees (1966) predicted that the transverse velocity of an object moving relativistically in some special directions may appear to exceed the speed of light. The apparent superluminal motion (SM) is essentially a geometric effect or a light travel-time.

  11. Techno-Orientalism with Chinese Characteristics: Maureen F. McHugh’s China Mountain Zhang

    Directory of Open Access Journals (Sweden)

    Christopher T. Fan

    2015-03-01

    Full Text Available Christopher T. Fan argues that McHugh’s award-winning 1992 science fiction novel perceives the twilight of the American Century by offering a “critical realism,” to use Georg Lukács’s phrase, of postsocialist US–China interdependency. In other words, it offers a form in which we perceive ourselves as subjects and objects of the twenty-first century world-system’s most important bilateral relationship. Moreover, as a novel about US–China interdependency, it implicitly critiques the binary Orientalism that structures the rapidly growing body of work on “techno-Orientalist” formations. Fan's analysis thus extends arguments about American Orientalism’s non-Manichean formations (Christina Klein, Melani McAlister, Colleen Lye into the postsocialist era.The novel’s near-future, China-centric world analogizes McHugh’s personal crises of professional desire as a precarious laborer in New York City, with the massive reorientation of desires from Maoist politics to market-directed individuality that she witnessed among her students when she taught in China from 1987–1988. Chinese racial form plays a crucial mediating role in the novel because it reflects the revival of Confucian humanist discourse in reform-era China as a way to focus a national project of rapidly generating capitalist desire. Finally, by describing US–China interdependency, this article also generates a theory of US–China neoliberalism that corrects for universalist, Euro-American accounts of neoliberal subject formation (Lauren Berlant, as well as insufficiently subject-sensitive accounts (Aihwa Ong.

  12. Zhang et al., Afr J Tradit Complement Altern Med. (2014) 11(2):377 ...

    African Journals Online (AJOL)

    cadewumi

    Background: The Third Month Fair in Dali is a historical festival and fair. ... drawn people's attention owing to its congenital advantages such as fewer side effects and .... of local rhizotomists possessed obvious regional feature and study value.

  13. Li and Zhang., Afr J Tradit Complement Altern Med. (2016) 13(3):75 ...

    African Journals Online (AJOL)

    imbalance of Yin and Yang is the fundamental element leading to diseases. Qi is defined as the most ... All of the dryness symptoms are attributed to insufficiency of body fluid. Lack of tears .... Medsurg nursing : official journal of the Academy of.

  14. Zhang et al., Afr J Tradit Complement Altern Med. (2013) 10(2):258 ...

    African Journals Online (AJOL)

    AJTCAM

    Guangdong Pharmaceutical University, Guangzhou 510006, China. *E-mail: lujia6812@163.com. Abstract. Juglans mandshurica Maxim is a traditional herbal medicines in China, and its anti-tumor bioactivities are of research interest. Bioassay-guided fractionation method was employed to isolate anti-tumor compounds ...

  15. Zhang et al., Afr J Tradit Complement Altern Med. (2014) 11(2):367 ...

    African Journals Online (AJOL)

    cadewumi

    Ninjurin2 (Ninj2), firstly reported in 2000, is a homolog of a homophilic cellular adhesion molecule, which mediates cell-to-cell and cell-to-extracellular matrix interaction during development, differentiation and regeneration of nervous system (Araki and Milbrandt, 2000; Lin et al., 2011). Ninj2 was also reported to be a ...

  16. Astronomy Education for Physics Students JH Fan1,2,∗ , JS Zhang1

    Indian Academy of Sciences (India)

    2Astronomy Science and Technology Research Laboratory of Department of ... University, and how we are teaching astronomy to the students. Astro- physics ... graduate students, middle school students, and even primary school students. We.

  17. VizieR Online Data Catalog: Srg tidal tails red giants properties (Zhang+, 2017)

    Science.gov (United States)

    Zhang, X.; Shi, W. B.; Chen, Y. Q.; Zhao, G.; Carrell, K.; Zhao, J. K.; Ruan, G. P.; Liang, Y. C.; Zhou, L.; Ren, H. B.; Zhang, Y.; Hou, Y. H.; Wang, Y. F.

    2016-10-01

    The list of 1100 RGB stars in Sgr streams is selected from SDSS DR9 with Law & Majewski (2010ApJ...714..229L) model. For each star equatorial coordinates, [Fe/H], distance, Vgsr, Lambda, X, Y and Z are given. Each star is also marked with L1, L2, T1, T2 to show in which stream it locates. (1 data file).

  18. Multi-Wavelength Studies on H2O Maser Host Galaxies J. S. Zhang ...

    Indian Academy of Sciences (India)

    on two projects: X-ray data analysis of individual maser source using. X-ray penetrability to explore maser host obscured AGN; multi- wavelength ... Figure 1. Adaptively smoothed three-color image in 0.3–8.0keV and spectra with fitting ... It provides a perspective to improve the accuracy of the Hubble constant H0 and to.

  19. Zhang et al., Afr J Tradit Complement Altern Med. (2013) 10(5):401 ...

    African Journals Online (AJOL)

    cadewumi

    Stigma maydis polysaccharides can improve the symptoms of weight loss ... convergence activity, zeaxanthin that have vitamin A activity and other nutrient .... 2 d later, blood was sampled from caudal vein to determine the blood ... In comparison, mice in the normal control group had bright fur and hair, good spirit, normal.

  20. Zhang et al., Afr J Tradit Complement Altern Med., (2017) 14 (5): 41 ...

    African Journals Online (AJOL)

    Moreover, after mechanical injury the rupture of blood vessel activate the cytokines in the region of spinal cord. Inflammation is one of the major factors responsible for secondary injury to spinal cord. Evidences show the inflammatory mediators (TNFα and IL-6) and oxidative stress induces the process of apoptosis by ...

  1. Zhang et al., Afr J Tradit Complement Altern Med. (2015) 12(6):151 ...

    African Journals Online (AJOL)

    Proff.Adewunmi

    The goal of the present study is to test whether Artemisia Capillaris Formula protects ... It has been shown that ACF exhibits significant therapeutic effects on ... The remaining groups were fed a high‐fat diet (HFD) ad libitum for 8 weeks. ... at 4˚C. The primary antibodies used in this study were polyclonal rabbit anti-rat FAS, ...

  2. The 2nd International Conference on Agricultural and Biological Sciences (ABS 2016

    Directory of Open Access Journals (Sweden)

    Lei Pei

    2016-10-01

    Full Text Available Table of contents 01 The influence of soil salt content on the photosynthetic characteristics of spring wheat with trickle irrigation Lei Pei, Zhenhua Wang, Jinzhu Zhang, Wenhao Li 02 Comparing growth of fast-growing and slow-growing endophytes in plants via ergosterol quantification Adeline SY Ting, Yiing Y Chow, Sadequr Rahman 03 Transcriptome and digital gene expression analysis identifies putative triterpene saponin-biosynthetic genes of Panax notoginseng Rongchang Wei 04 Chitosan-assisted isolation and antioxidant evaluation of flavonoids from Sophora japonica L. Zhang Hu, Sidong Li, Chuyan Li, Zijuan Li 05 Two kinds of new characteristics of the ektexine ornamentation of ginkgo pollen Guoxia Wang, Yuzhen Yang, Gang Chen, Qing Luo 06 Analysis of nutrient and medicinal ingredients of Ginkgo pollen in different regions Guoxia Wang, Ruixia Liu, Yuzhen Yang, Lipei Chen 07 Photosynthetic performance of greening seedlings of seven species to drought stress Zhiyang Lie, Tongtong Zhou, Weilong Huang, Li Xue 08 Changes of fluorescence parameters of greening seedlings of seven species under drought stress Jie Li, Zhuomin Wang, Li Xue 09 Mammalian sex hormone affects regeneration capacity and enzymes activity of Triticale L in vitro culture Ismail Bezirganoglu, Pınar Uysal 10 Fractional Fourier entropy increases the recognition rate of fruit type detection Shuihua Wang, Zhihai Lu, Jiquan Yang, Yudong Zhang, John Liu, Ling Wei, Shufang Chen, Preetha Phillips, Zhengchao Dong 11 Banana-peanut intercropping reduces Fusarium wilt disease in banana from enhancing soil bacterial microorganisms and leaf nutrition Hong Li, Xutong Wang, Fengliang Zhao, Guisheng Yang 12 Manganese stress impairs stem ureide nitrogen fixation in yardlong-bean plants in the acidic environment Hong Li 13 A new pest control method for Rhytidodera bowringii Larvae Haijie Huang, Li Zhao, Weijian Huang, Jinhui Wang, Zhongrun Zhang 14 Research on the seed-like Fruits of Subg. Sclarea of

  3. Uncertainty in regional and zonal monthly mean downward surface irradiances from Edition 4.0 CERES Energy Balanced and Filled (EBAF) data product

    Science.gov (United States)

    Kato, S.; Rutan, D. A.; Rose, F. G.; Loeb, N. G.

    2017-12-01

    The surface of the Earth receives solar radiation (shortwave) and emission from the atmosphere (longwave). At a global and annual mean approximately 12% of solar radiation incident on the surface is reflected and the rest is absorbed by the surface. The surface emits radiation proportional to the forth power of the temperature. Although the uncertainty in global and annual mean surface irradiances is estimated in earlier studies (Zhang et al. 1995, 2004; L'Ecuyer et al. 2008; Stephens et al. 2012; Kato et al. 2012), only a few studies estimated the uncertainty in computed surface irradiances at smaller spatial and temporal scales (Zhang et al. 1995, 2004; Kato et al. 2012). We use surface observations at 46 buoys and 36 land sites and newly released the Edition 4.0 Clouds and the Earth's Radiant Energy System (CERES) Energy Balanced and Filled (EBAF)-surface data product to estimate the uncertainty in regional and zonal monthly mean downward shortwave and longwave surface irradiances. The root-mean-square difference of monthly mean computed and observed irradiances is used for the regional uncertainty. The uncertainty is separated into bias and spatially random components. The random component decreases when irradiances are averaged over a larger area, nearly inversely proportional to the number of surface observation sites. The presentation provides the uncertainty in the regional and zonal monthly mean downward surface irradiances over ocean and land. ReferencesKato, S. and N.G.Loeb, D. A.Rutan, F. G. Rose, S. Sun-Mack,W.F.Miller, and Y. Chen, 2012. Surv. Geophys., 33, 395-412, doi:10.1007/s10712-012-9179-x. L'Ecuyer, T. S., N. B. Wood, T. Haladay, G. L. Stephens, and P. W. Stackhouse Jr., 2008, J. Geophys. Res., 113, D00A15, doi:10.1029/2008JD009951. Stephens, G. L. and Coauthors, 2012, Nat. Geosci., 5, 691-696, doi:10.1038/ngeo1580. Zhang, Y., W. B. Rossow, A. A. Lacis, V. Oinas, and M. I. Mishchenko, 2004, J. Geophys. Res., 109, D19105, doi:10.1029/2003JD

  4. Evaluation of five dry particle deposition parameterizations for incorporation into atmospheric transport models

    Science.gov (United States)

    Khan, Tanvir R.; Perlinger, Judith A.

    2017-10-01

    Despite considerable effort to develop mechanistic dry particle deposition parameterizations for atmospheric transport models, current knowledge has been inadequate to propose quantitative measures of the relative performance of available parameterizations. In this study, we evaluated the performance of five dry particle deposition parameterizations developed by Zhang et al. (2001) (Z01), Petroff and Zhang (2010) (PZ10), Kouznetsov and Sofiev (2012) (KS12), Zhang and He (2014) (ZH14), and Zhang and Shao (2014) (ZS14), respectively. The evaluation was performed in three dimensions: model ability to reproduce observed deposition velocities, Vd (accuracy); the influence of imprecision in input parameter values on the modeled Vd (uncertainty); and identification of the most influential parameter(s) (sensitivity). The accuracy of the modeled Vd was evaluated using observations obtained from five land use categories (LUCs): grass, coniferous and deciduous forests, natural water, and ice/snow. To ascertain the uncertainty in modeled Vd, and quantify the influence of imprecision in key model input parameters, a Monte Carlo uncertainty analysis was performed. The Sobol' sensitivity analysis was conducted with the objective to determine the parameter ranking from the most to the least influential. Comparing the normalized mean bias factors (indicators of accuracy), we find that the ZH14 parameterization is the most accurate for all LUCs except for coniferous forest, for which it is second most accurate. From Monte Carlo simulations, the estimated mean normalized uncertainties in the modeled Vd obtained for seven particle sizes (ranging from 0.005 to 2.5 µm) for the five LUCs are 17, 12, 13, 16, and 27 % for the Z01, PZ10, KS12, ZH14, and ZS14 parameterizations, respectively. From the Sobol' sensitivity results, we suggest that the parameter rankings vary by particle size and LUC for a given parameterization. Overall, for dp = 0.001 to 1.0 µm, friction velocity was one of

  5. Validating the use of MODIS time series for salinity assessment over agricultural soils in California, USA

    Science.gov (United States)

    Testing soil salinity assessment methodologies over different regions is important for future continental and global scale applications. A novel regional-scale soil salinity modeling approach using plant-performance metrics was proposed by Zhang et al. (2015) for farmland in the Yellow River Delta, ...

  6. Beta vulgaris

    African Journals Online (AJOL)

    Vitamin C content was highest in Beetroot juice (44.34±2.84mgAAE/g) and lowest in heat ... human tumor cell proliferation (Lechner,2010;. Zhang et al. ... IV. Oven dried Beetroot. The peeled beetroot was grated and transferred to a sieve.

  7. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics. LEI ZHANG. Articles written in Journal of Genetics. Volume 93 Issue 3 December 2014 pp 699-707 Research Article. The complete mitochondrial genome of the yellow-browed bunting, Emberiza chrysophrys (Passeriformes: Emberizidae), and phylogenetic relationships within the ...

  8. The function of buffer layer in resistive switching device.

    Czech Academy of Sciences Publication Activity Database

    Zhang, B.; Prokop, V.; Střižík, L.; Zima, Vítězslav; Kutálek, P.; Vlček, Milan; Wágner, T.

    2017-01-01

    Roč. 14, č. 8 (2017), s. 291-295 ISSN 1584-8663 Institutional support: RVO:61389013 Keywords : resistive switching * chalcogenide glasses * buffer layer Subject RIV: CA - Inorganic Chemistry Impact factor: 0.732, year: 2016 http://www.chalcogen.ro/291_ZhangB.pdf

  9. Commutators of Integral Operators with Variable Kernels on Hardy ...

    Indian Academy of Sciences (India)

    Home; Journals; Proceedings – Mathematical Sciences; Volume 115; Issue 4. Commutators of Integral Operators with Variable Kernels on Hardy Spaces. Pu Zhang Kai Zhao. Volume 115 Issue 4 November 2005 pp 399-410 ... Keywords. Singular and fractional integrals; variable kernel; commutator; Hardy space.

  10. Mechanisms of all-trans retinoic acid-induced differentiation of acute ...

    Indian Academy of Sciences (India)

    Author Affiliations. Ji-Wang Zhang1 Jian Gu1 Zhen-Yi Wang1 Sai-Juan Chen1 Zhu Chen1. Shanghai Institute of Hematology, Ruijin Hospital Affiliated to Shanghai Second Medical University, 197 Ruijin Road II, Shanghai 200025, People's Republic of China ...

  11. 4 gene expression in hepatocellular carcinoma (HCC)

    African Journals Online (AJOL)

    Gamalat El Gedawy

    2016-06-06

    Jun 6, 2016 ... Subjects and methods: This study was conducted on 30 HCC patients, 20 chronic liver disease ...... [26] Huang CS, Yu W, Cui H, Wang YJ, Zhang L, Han F, et al. ... Y. Involvement of programmed cell death 4 in transforming.

  12. African Journal of Biotechnology - Vol 8, No 6 (2009)

    African Journals Online (AJOL)

    Single nucleotide polymorphism genotyping and its application on mapping and marker-assisted plant breeding ... HH Musa, Y Xu, B Dai, X Kang, C Zhu, G Zhu ... YJ Wang, ZQ Han, B Shui, GD Liu, TX Gao, SA Nwafili, S Watanabe, YP Zhang ...

  13. Estimation of improved resolution soil moisture in vegetated areas ...

    Indian Academy of Sciences (India)

    Mina Moradizadeh

    2018-03-06

    Mar 6, 2018 ... soil parameters have been obtained using Simultaneous Land Parameters Retrieval Model algorithm, the downscaling method has been applied to ... retrieving multiple land surface parameters using passive microwave remote .... spheric information that is not routinely available. (Zhang and Wegehenkel ...

  14. Erythropoietin protects the retinal pigment epithelial barrier against ...

    African Journals Online (AJOL)

    O2-induced hyperpermeability. H Zhang, Y Gong, X Wu, Y Shi, L Yin, Y Qiu. Abstract. Erythropoietin (EPO) is not limited to hematopoiesis; it may act as a protective cytokine. In this study, the retinal pigment epithelial (RPE) cell viability, cell ...

  15. An Integrated Multimedia Learning Model vs. the Traditional Face-to-Face Learning Model: An Examination of College Economics Classes

    Science.gov (United States)

    Son, Barbara; Simonian, Mark

    2016-01-01

    Multimedia learning tools can assist and help motivate students by supplementing traditional teaching modalities with learner-centered learning through application and practice. The overall effectiveness of multimedia learning has been documented (Son & Simonian, 2013; Son & Goldstone, 2012; Zhang, 2005). How are effective multimedia…

  16. Direct Nanoscale Conversion of Biomolecular Signals into Electronic Information

    Science.gov (United States)

    2008-09-22

    configuration. A transimpedance amplifier configuration with a small integration capacitor is widely used for low-noise sensing of sub-picoampere...Zhang, S. "Designed short peptide detergents stabilize the structure of photosystem I membrane protein complex," submitted (2004). 17. " Amplified

  17. Differences in the reproductive biology and diapause of two congeneric species of egg parasitoids (Hymenoptera:Encyrtidae) from northeast Asia: implications for biological control of the invasive emerald ash borer

    Science.gov (United States)

    Oobius primorskyensis Yao and Duan and Oobius agrili Zhang and Huang (Hymenoptera: Encyrtidae) constitute a cryptic species complex of egg parasitoids attacking the emerald ash borer Agrilus planipennis (Coleotpera: Buprestidae) in their native range of northeast Asia. While O. primorskyensis is c...

  18. The Impact of Jumps and Leverage in Forecasting Co-Volatility

    NARCIS (Netherlands)

    M. Asai (Manabu); M.J. McAleer (Michael)

    2015-01-01

    markdownabstract__Abstract__ The paper investigates the impact of jumps in forecasting co-volatility, accommodating leverage effects. We modify the jump-robust two time scale covariance estimator of Boudt and Zhang (2013)such that the estimated matrix is positive definite. Using this approach we

  19. Research Article Special Issue

    African Journals Online (AJOL)

    pc

    2018-03-07

    Mar 7, 2018 ... [32] Ren Y, Tang W. A service integrity assurance framework for .... [66] Liu C, Ranjan R, Zhang X, Yang C, Georgakopoulos D, Chen J. Public auditing for big ... [70] Berman J. J. Principles of big data: Preparing, sharing, and ...

  20. Advances in trifluoromethylation or trifluoromethylthiolation with ...

    Indian Academy of Sciences (India)

    CAI ZHANG

    2017-11-08

    Nov 8, 2017 ... target compounds 7 in 50–80% yields.23 The compound 8 reacted with ..... introduced to the market in the last decade Chem. Rev. 114 2432; (b) Zhang C .... strategy for the perfluoroalkylation of arenes and aryl- bromides by ...

  1. Maryam Moslemi, Sharghi, Mehdi Zahravi, Gholamreza Bakhshi ...

    African Journals Online (AJOL)

    01

    2013-08-21

    Aug 21, 2013 ... Briefly, Young leaves (100 mg) were ground to a fine powder in liquid nitrogen and ..... Yuan Z, Chen X, He T, Feng J, Feng T, Zhang C (2007b). Population genetic structure in apricot (Prunus armeniaca L.) cultivars revealed.

  2. Impact of interfacial interactions on optical and ammonia sensing in ...

    Indian Academy of Sciences (India)

    gas sensing. The hybrid ZnO/PANI structure was obtained by the addition of PANI on the surface of ZnO. The ... culty in fine particle distribution because of abnormal grain growth at .... the form of emeraldine salt (Zhang et al 2005; Mazeikiene.

  3. One-step hydrothermal synthesis of flower-like CoS ...

    Indian Academy of Sciences (India)

    2018-03-29

    Mar 29, 2018 ... of ethylenediamine as ligand and structure-directing agent. The structure and ..... a fine linearity between oxidation and reduction of IP against. V1/2. .... [9] Tao F, Zhao Y Q, Zhang G Q and Li H L 2007 Electrochem. Commun.

  4. Manyame River Basin, Zimbabwe

    African Journals Online (AJOL)

    2016-01-01

    Jan 1, 2016 ... an important driver of ecosystem structure and functions in reservoirs. ..... In Lake. Chivero, silt/clay consisting of fine organic substrates was the ..... LAI X, HUANG Q, ZHANG Y and JIANG J (2014) Impact of lake inflow and the ...

  5. Hydrogenation of Cinnamaldehyde over an Ionic Cobalt Promoted ...

    African Journals Online (AJOL)

    NICO

    useful transformation in organic synthesis to produce fine chemicals.1 To .... crystal structure of this compound is reported elsewhere.17. 2.2.2. Incipient Wet ..... 12 M. H. Chen, W. Chu, X. Y. Dai and X. W. Zhang, Catal. Today, 2004, 89,.

  6. Use of silane coupling agent for surface modification of zinc oxide as ...

    Indian Academy of Sciences (India)

    VI group of semiconductor having wurtzite structure and a direct wide bandgap of 3·37 ... et al 2007) and antibacterial activity (Zhang et al 2007; Jin et al 2009). ..... functionalized ZnO showed a fine dispersion in polymeric matrix. TGA results ...

  7. Research Article

    African Journals Online (AJOL)

    2017-01-01

    Jan 1, 2017 ... temperature to develop a fine, recrystallized billet microstructure consist largely of γ ... L12 crystal structure has Al atoms at the cube corner ..... Semiatin, S.L., Shank, J.M., Saurber, W.M., Pilchak, A.L., Ballard, D.L., Zhang.

  8. Studies of the g factors and the superhyperfine parameters for Ni3+ ...

    Indian Academy of Sciences (India)

    the g factors and the hyperfine structure constants of central metal ions. How- .... and extended X-ray absorption fine structure (EXAFS) measurements have ver- ified that the ..... [9] S R Zhang, H G Liu, G Q Qu and W C Zheng, Phys. Stat.

  9. Distribution spatiale intra-urbaine des particules fines : monitoring ...

    African Journals Online (AJOL)

    SARAH

    30 sept. 2014 ... En outre, l'accumulation des particules fines est faible pendant un mois pluvieux par rapport à un mois sec ..... benjamina, et la structure (tige, branches) des arborées ... par Zhang et al., (2006) sur des feuilles de Pinus pumila.

  10. Optimization of the alcoholic fermentation of blueberry juice by AS ...

    African Journals Online (AJOL)

    AJL

    2012-02-21

    Feb 21, 2012 ... Kraft TFB, Schmidt BM, Yousef GG, Knight CTG, Cuendet M, Kang YH,. Pezzuto JM, Seigler D, ... Su MS, Silva JL (2006). Antioxidant activity ... 104: 182-187. Tian RR, Pan QH, Zhan JC, Li JM, Wan SB, Zhang QH, Huang WD.

  11. Editorial: Serving the Optics and Photonics Community for 40 Years.

    Science.gov (United States)

    Zhang, Xi-Cheng

    2017-06-01

    Editor-in-Chief Xi-Cheng Zhang celebrates Optics Letters' 40th anniversary by discussing the Journal's success and clarifying an editorial policy that balances the Journal's high standards with the fulfillment of its mission to support the greater optics and photonics community.

  12. DNA damage and decrease of cellular oxidase activity in piglet ...

    African Journals Online (AJOL)

    DNA damage and decrease of cellular oxidase activity in piglet sertoli cells exposed to gossypol. Ming Zhang, Hui Yuan, Zuping He, Liyun Yuan, Jine Yi, Sijun Deng, Li Zhu, Chengzhi Guo, Yin Lu, Jing Wu, Lixin Wen, Qiang Wei, Liqun Xue ...

  13. Effect of calcination methods on electrochemical performance of NiO ...

    Indian Academy of Sciences (India)

    Administrator

    bility and long cycle life (Conway 1991; Zhang et al. 2009). Based on the different ... double-layer capacitors, mainly focusing on carbon mate- rials with a high specific ... a.c. electrode was used as negative electrode in 6 mol/L. KOH aqueous ...

  14. New St-chromosome-specific molecular markers for identifying ...

    Indian Academy of Sciences (India)

    et al. 1994) or JJsSt (Chen et al. 1998) was widely used in wheat breeding programme (Chen .... Japan). Table 1. The features of primers used in this study. Homologous ..... Redinbaugh M. G., Jones T. A. and Zhang Y. T. 2000 Ubiquity of.

  15. Jing Tong Yu Shu, a traditional Chinese medicine, suppresses IL-1β ...

    African Journals Online (AJOL)

    Zhang et al. 2953. Tropical ... Purpose: To evaluate the effect of a traditional Chinese medicine, Jing Tong Yu Shu (JTYS) on endometriosis in a ..... Flower A, Liu JP, Chen S, Lewith G, Little P. Chinese ... Mol Hum Reprod 2000; 6: 269-275. 18.

  16. Withaferin A Suppresses Liver Tumor Growth in a Nude Mouse ...

    African Journals Online (AJOL)

    tumor cell invasiveness in colon cancer [7] and is related to angiogenesis in ... Hsp90, phosphorylated STAT3 and annexin II. [18,20-24]. ..... Herbstritt CJ, Ruiz A, Zhang L, Hanson AD, Conner. BP, Rougas J, Pribluda VS. Withaferin A is a ...

  17. DVD. Alar Niineväli soovitab / Alar Niineväli

    Index Scriptorium Estoniae

    Niineväli, Alar

    2007-01-01

    Soome ja Hiina mütoloogiat ühendav 2006.a. fantaasiafilm "Igavese armastuse sõdalane - Jade Warrior" (Soome, Hiina, Hollandi ja Eesti ühistöö) : režissöör Antti-Jussi Annila : osades Tommi Eronen, Zhang Jingchu, Markku Peltola

  18. Electric Vehicle Sharing Planning and Operations

    Science.gov (United States)

    2018-02-01

    Dongfang Zhao (ORCID ID 0000-0002-5424-9915); Xiaopeng (Shaw) Li (ORCID ID 0000-0002-5264-3775); Yu Zhang (ORCID ID 0000-0003-1202-626X) This project includes literature review and proposing a model for EV planning and operations. We first conducted ...

  19. Lanthanide metal-organic frameworks

    International Nuclear Information System (INIS)

    Cheng, Peng

    2015-01-01

    This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).

  20. The beam diagnostic instruments in Beijing radioactive ion-beam facilities isotope separator on-line

    International Nuclear Information System (INIS)

    Ma, Y.; Cui, B.; Ma, R.; Tang, B.; Chen, L.; Huang, Q.; Jiang, W.

    2014-01-01

    The beam diagnostic instruments for Beijing Radioactive Ion-beam Facilities Isotope Separator On-Line are introduced [B. Q. Cui, Z. H. Peng, Y. J. Ma, R. G. Ma, B. Tang, T. Zhang, and W. S. Jiang, Nucl. Instrum. Methods 266, 4113 (2008); T. J. Zhang, X. L. Guan, and B. Q. Cui, in Proceedings of APAC 2004, Gyeongju, Korea, 2004, http://www.jacow.org , p. 267]. For low intensity ion beam [30–300 keV/1 pA–10 μA], the beam profile monitor, the emittance measurement unit, and the analyzing slit will be installed. For the primary proton beam [100 MeV/200 μA], the beam profile scanner will be installed. For identification of the nuclide, a beam identification unit will be installed. The details of prototype of the beam diagnostic units and some experiment results will be described in this article

  1. Lanthanide metal-organic frameworks

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Peng (ed.) [Nankai Univ., Tianjin (China). Dept. of Chemistry

    2015-03-01

    This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).

  2. Type I enteropathy-associated T-cell lymphoma in the colon of a 29-year-old patient and a brief literature review

    Directory of Open Access Journals (Sweden)

    Zhang JC

    2016-02-01

    Full Text Available Jiu-Cong Zhang, Yong Wang, Xiu-Feng Wang, Fang-Xin Zhang Department of Gastroenterology, Lanzhou General Hospital of Lanzhou Military Command, Lanzhou, People’s Republic of China Abstract: Enteropathy-associated T-cell lymphoma (EATL is a rare gastrointestinal non-Hodgkin’s lymphoma, originating from intraepithelial T-lymphocyte, which is specifically associated with celiac disease. EATL most commonly presents in the sixth and seventh decades of life. We report a unique case of type I EATL in the colon with liver metastasis, which was presented with nonspecific radiological findings and at a very young age (29 years old compared with previously published data. We suggest that EATL should be regarded as part of differential diagnosis in any patient presenting with abdominal pain, diarrhea, weight loss, and malabsorption because delay in treatment can result in an irreversible clinical outcome. Keywords: enteropathy-associated T-cell lymphoma, colon, ulcer, liver metastasis

  3. Engineering iodine-doped carbon dots as dual-modal probes for fluorescence and X-ray CT imaging

    Directory of Open Access Journals (Sweden)

    Zhang M

    2015-11-01

    Full Text Available Miaomiao Zhang,1,* Huixiang Ju,2,* Li Zhang,1,* Mingzhong Sun,2 Zhongwei Zhou,2 Zhenyu Dai,3 Lirong Zhang,1 Aihua Gong,1 Chaoyao Wu,1 Fengyi Du1 1School of Medicine, Jiangsu University, Zhenjiang, People’s Republic of China; 2Department of Clinical Laboratory, Affiliated Yancheng Hospital, School of Medicine, Southeast University, Yancheng, Jiangsu, People’s Republic of China; 3Radiology Department, Affiliated Yancheng Hospital, School of Medicine, Southeast University, Yancheng, Jiangsu, People’s Republic of China *These authors contributed equally to this work Abstract: X-ray computed tomography (CT is the most commonly used imaging technique for noninvasive diagnosis of disease. In order to improve tissue specificity and prevent adverse effects, we report the design and synthesis of iodine-doped carbon dots (I-doped CDs as efficient CT contrast agents and fluorescence probe by a facile bottom-up hydrothermal carbonization process. The as-prepared I-doped CDs are monodispersed spherical nanoparticles (a diameter of ~2.7 nm with favorable dispersibility and colloidal stability in water. The aqueous solution of I-doped CDs showed wavelength-dependent excitation and stable photoluminescence similar to traditional carbon quantum dots. Importantly, I-doped CDs displayed superior X-ray attenuation properties in vitro and excellent biocompatibility. After intravenous injection, I-doped CDs were distributed throughout the body and excreted by renal clearance. These findings validated that I-doped CDs with high X-ray attenuation potency and favorable photoluminescence show great promise for biomedical research and disease diagnosis. Keywords: carbon dots, contrast agents, iodine-doped, CT imaging

  4. EGFR-targeted delivery of DOX-loaded Fe3O4@polydopamine multifunctional nanocomposites for MRI and antitumor chemo-photothermal therapy

    Directory of Open Access Journals (Sweden)

    Mu X

    2017-04-01

    Full Text Available Xupeng Mu,1 Fuqiang Zhang,1 Chenfei Kong,1 Hongmei Zhang,1 Wenjing Zhang,1 Rui Ge,2 Yi Liu,2 Jinlan Jiang1 1Department of Central Laboratory, China-Japan Union Hospital, 2State Key Laboratory of Supramolecular Structure and Materials, College of Chemistry, Jilin University, Changchun, China Abstract: Multifunctional nanocomposites that have multiple therapeutic functions together with real-time imaging capabilities have attracted intensive concerns in the diagnosis and treatment of cancer. This study developed epidermal growth factor receptor (EGFR antibody-directed polydopamine-coated Fe3O4 nanoparticles (Fe3O4@PDA NPs for magnetic resonance imaging and antitumor chemo-photothermal therapy. The synthesized Fe3O4@PDA-PEG-EGFR-DOX NPs revealed high storage capacity for doxorubicin (DOX and high photothermal conversion efficiency. The cell viability assay of Fe3O4@PDA-PEG-EGFR NPs indicated that Fe3O4@PDA-PEG-EGFR NPs had no cell cytotoxicity. However, Fe3O4@PDA-PEG-EGFR-DOX NPs could significantly decrease cell viability (~5% of remaining cell viability because of both photothermal ablation and near-infrared light-triggered DOX release. Meanwhile, the EGFR-targeted Fe3O4@PDA-PEG-EGFR-DOX NPs significantly inhibited the growth of tumors, showing a prominent in vivo synergistic antitumor effect. This study demonstrated the potential of using Fe3O4@PDA NPs for combined cancer chemo-photothermal therapy with increased efficacy. Keywords: Fe3O4 nanoparticles, polydopamine, chemo-photothermal therapy, multifunctional nanocomposites, DOX

  5. Zfp206 regulates ES cell gene expression and differentiation.

    Science.gov (United States)

    Zhang, Wen; Walker, Emily; Tamplin, Owen J; Rossant, Janet; Stanford, William L; Hughes, Timothy R

    2006-01-01

    Understanding transcriptional regulation in early developmental stages is fundamental to understanding mammalian development and embryonic stem (ES) cell properties. Expression surveys suggest that the putative SCAN-Zinc finger transcription factor Zfp206 is expressed specifically in ES cells [Zhang,W., Morris,Q.D., Chang,R., Shai,O., Bakowski,M.A., Mitsakakis,N., Mohammad,N., Robinson,M.D., Zirngibl,R., Somogyi,E. et al., (2004) J. Biol., 3, 21; Brandenberger,R., Wei,H., Zhang,S., Lei,S., Murage,J., Fisk,G.J., Li,Y., Xu,C., Fang,R., Guegler,K. et al., (2004) Nat. Biotechnol., 22, 707-716]. Here, we confirm this observation, and we show that ZFP206 expression decreases rapidly upon differentiation of cultured mouse ES cells, and during development of mouse embryos. We find that there are at least six isoforms of the ZFP206 transcript, the longest being predominant. Overexpression and depletion experiments show that Zfp206 promotes formation of undifferentiated ES cell clones, and positively regulates abundance of a very small set of transcripts whose expression is also specific to ES cells and the two- to four-cell stages of preimplantation embryos. This set includes members of the Zscan4, Thoc4, Tcstv1 and eIF-1A gene families, none of which have been functionally characterized in vivo but whose members include apparent transcription factors, RNA-binding proteins and translation factors. Together, these data indicate that Zfp206 is a regulator of ES cell differentiation that controls a set of genes expressed very early in development, most of which themselves appear to be regulators.

  6. Author Details

    African Journals Online (AJOL)

    Zhang, Xiaoqi. Vol 15, No 2 (2016) - Articles Ameliorative Effect and Underlying Mechanisms of Total Triterpenoids from Psidium guajava Linn (Myrtaceae) Leaf on High-Fat Streptozotocin-induced Diabetic Peripheral Neuropathy in Rats Abstract PDF. ISSN: 1596-9827. AJOL African Journals Online. HOW TO USE AJOL.

  7. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics. HUAICHAO LUO. Articles written in Journal of Genetics. Volume 96 Issue 6 December 2017 pp 985-992 RESEARCH ARTICLE. Genetic variants influencing lipid levels and risk of dyslipidemia in Chinese population · HUAICHAO LUO XUEPING ZHANG PING SHUAI YUANYING MIAO ...

  8. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics. XIAOCUN ZHANG. Articles written in Journal of Genetics. Volume 96 Issue 4 September 2017 pp 563-570 RESEARCH ARTICLE. Molecular cloning and functional characterization of two novel high molecular weight glutenin subunit genes in Aegilops markgrafii · XUYE DU XIAOCUN ...

  9. The Relationship between the Employment of Part-Time Faculty and Student Degree and/or Certificate Completion in Two-Year Community Colleges

    Science.gov (United States)

    Yu, Hongwei; Campbell, Dale; Mendoza, Pilar

    2015-01-01

    Prior research studies associated the employment of part-time faculty with student degree and/or certificate completion (Benjamin, 2002; Ehrenberg & Zhang, 2005; Jacoby, 2006; Leslie & Gappa, 2002; Umbach, 2008; Umbach & Wawrzynski, 2005). To date, institutional-level data have been utilized to investigate whether such employment…

  10. A complete classification of minimal non-PS-groups

    Indian Academy of Sciences (India)

    Author Affiliations. Pengfei Guo1 2 Junxin Wang3 Hailiang Zhang4. School of Mathematics and Information Engineering, Lianyungang Normal College, Lianyungang 222006, People's Republic of China; Department of Civil and Architectural Engineering, City University of Hong Kong, Hong Kong 999077, People's Republic ...

  11. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 1. Genomewide survey and characterization of metacaspase gene family in rice (Oryza sativa). Likai Wang Hua Zhang. Research Article Volume 93 Issue 1 April ... Keywords. metacaspases; OsMC gene family; expression profiles; domestication; rice; Oryza sativa.

  12. PHOSPHORUS SORPTION ISOTHERMS AND EXTERNAL ...

    African Journals Online (AJOL)

    ACSS

    Zhang et al., 2005). For instance, in strongly acidic soils with pH<5.5 and high P sorbing soils, application of rock phosphate is more effective and cheaper than using TSP (Bationo et al., 2011). Moreover, it enables determination of the external P.

  13. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Yu-Song Guo Zhong-Duo Wang Cheng-Zhong Yan Yu-Lan Zhang Jin-Nan Zheng Yuan-Min Xu Tao Du Chu-Wu Liu · More Details Fulltext PDF ... Aifu Yang Dapeng Sun Shikai Liu Ying Dong Zhong Chen Zunchun Zhou · More Details Fulltext ...

  14. Linkage disequilibrium and association mapping of drought ...

    African Journals Online (AJOL)

    sunny t

    2016-11-16

    Nov 16, 2016 ... related to drought tolerance (YongSheng et al., 2009). Among the variety of ... (Li et al., 2013), yield (LiFang et al., 2010) and fibre traits. (Islam et al., 2014). ..... such molecular markers as SSRs (Bertini et al., 2006;. Zhang et al.

  15. Chiral and achiral helical coordination polymers of zinc and ...

    Indian Academy of Sciences (India)

    rality depends on formation of cis coordination geom- etry around the ..... lographic Data Centre via www.ccdc.cam.ac.uk/data_ .... 324; (b) Han L and Hong M 2005 Inorg. Chem. Com ... Kang Y, Chen S, Wang F, Zhang J and Bu X 2011 Chem.

  16. Reference: 612 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 612 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u17513484i Feng Haizh...1531-45 17513484 2007 Jul Plant physiology Chen Qingguo|Feng Haizhong|Feng Jian|Yang Xiaohui|Zhang Jian|Zuo Jianru

  17. Observation of the Unusual Aggregation Kinetics of Colloidal ...

    Indian Academy of Sciences (India)

    of Holthoff et al.,26 the coagulation rate constants can be obtained ... Rui Tian et al. Hofmeister ... work are nano-scale materials made up of one Al-O ..... and Ninham B 2006 J. Mol. Liq. ... Zhang Y, Furyk S, Bergbreiter D and Cremer P 2005.

  18. Items New to the Collection - Betty Petersen Memorial Library

    Science.gov (United States)

    computation and programming using Python : with application to understanding data. Hetland ML. 2005. Beginning , Guido S. 2016. Introduction to Machine Learning with Python : A Guide for Data Scientists. New York . 2017. Python programming : an introduction to computer science. Zhang Z. 2018. Multivariate time series

  19. Studies on nonvolatile resistance memory switching in ZnO thin films

    Indian Academy of Sciences (India)

    Administrator

    (Kund et al 2005), phase change random access memory. (PRAM) (Lai 2003) and ..... 2008) and can be explained in terms of the aforemen- tioned filamentary ... Zhang S, Long S, Guan W, Liu Q, Wang Q and Liu M 2009 J. Phys. D: Appl. Phys.

  20. Monitoring the establishment and flight phenology of egg and larval parasitoids of emerald ash borer (Coleoptera: Buprestidae) in Michigan, USA using sentinel eggs and larvae

    Science.gov (United States)

    Emerald ash borer (EAB), Agrilus planipennis Fairmaire, is an important invasive pest of ash (Fraxinus) trees in North America. Two larval parasitoids, Tetrastichus planipennisi Yang and Spathius agrili Yang, and one egg parasitoid, Oobius agrili Zhang and Huang, were introduced into the United Sta...

  1. Long-term monitoring of the introduced emerald ash borer (Coleoptera: Buprestidae) egg parasitoid, oobius agrili (Hymenoptera: Encyridae), in Michigan, USA and evaluation of a newly developed monitoring technique

    Science.gov (United States)

    Emerald ash borer (EAB), Agrilus planipennis Fairmaire (Coleoptera: Buprestidae), is a serious invasive pest of ash trees (Fraxinus spp.) in North America. The egg parasitoid Oobius agrili Zhang and Huang (Hymenoptera: Encyrtidae) was introduced as a biological control agent of this pest in Michiga...

  2. Pramana – Journal of Physics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    The extended (′/)-expansion method and travelling wave solutions for the perturbed nonlinear Schrödinger's equation with Kerr law nonlinearity · Zaiyun Zhang Jianhua Huang Juan Zhong .... pp 1075-1084 Research Articles. Performance evaluation of self-breakdown-based single-gap plasma cathode electron gun.

  3. Bagatellid : maailm / Mirjam Tally

    Index Scriptorium Estoniae

    Tally, Mirjam, 1976-

    2008-01-01

    Helilooja Judith Weir sai Briti maineka autasu. Daniel Barenboim võttis Palestiina kodakondsuse. Portos keskendutakse sel aastal Põhjamaade muusikale. Wigmore Halli resideerivaks heliloojaks sai Luke Bedford. Sony Classics annab välja Glenn Gouldi eksklusiivse "Kogutud teosed". Tõusev täht - hiina naisdirigent Xian Zhang

  4. A Comparative Study of Administrator and Special Education Teacher Perceptions of Special Education Teacher Attrition and Retention

    Science.gov (United States)

    Sheldrake, Danielle Angelina

    2013-01-01

    This mixed methods study identifies perceived causes of and solutions to the attrition of special education teachers. Researchers have documented that special education teaching positions encounter higher attrition rates than their general education peers (Katsiyannis, Zhang, & Conroy in Olivarez & Arnold, 2006; Mitchell & Arnold,…

  5. Computer aided cooling curve analysis for Al-5Si and Al-11Si alloys

    African Journals Online (AJOL)

    user

    fine fibrous form (Hess and Blackmun, 1975; Dahle et al., 2005). ..... grain structure in the casting (Apelian et al., 1984), which in turn are supported in the present work by a decreased ..... Liao H., Zhang M., Wu Q., Wang H. and Sun G., 2007.

  6. Effect of domains configuration on crystal structure in ferroelectric ...

    Indian Academy of Sciences (India)

    2017-09-09

    Sep 9, 2017 ... It is well known that domains and crystal structure control the physical properties of ferroelectrics. ... The as-prepared ceramics were crushed to fine pow- ders. ..... [1] Gao J, Xue D, Wang Y, Wang D, Zhang L, Wu H et al 2011.

  7. Structural characteristics of titanium coating on copper substrates

    Indian Academy of Sciences (India)

    Oya and Kusano 2009; Zhang et al 2009) and glass (Jin et al 2009; Oya and Kusano ... The objective of this work is to investigate the structure and interface of ..... nucleates and grows such that, a number of fine sized Ti crys- tallites appear ...

  8. Effect of varieties on physicochemical and pasting characteristics of ...

    African Journals Online (AJOL)

    User

    2013-03-13

    Mar 13, 2013 ... 80% of dry matter (Zhang and Oates, 1999; Shang et al.,. 2007). Root and .... noted before milling into very fine particle size by a micro mill, and kept in zip-lock .... Hence, flours of D. alata should show loose structure and less.

  9. Synthesis and microwave dielectric properties of Ca substituted ...

    Indian Academy of Sciences (India)

    Administrator

    sintered samples were crushed into fine powders. Phase analyses of the .... at the A-site of the perovskite structure decreases, the lattice strain decreases ... Fang L, Men S S, Zhang H, Liu Q and Liu H F 2008 J. Electro- ceram. 21 137. Fang L ...

  10. Cofactor interactions in the activation of tissue non-specific alkaline ...

    African Journals Online (AJOL)

    JTEkanem

    stabilization of protein structure and regulation of enzymatic ... structure of ALP at low and high concentrations respectively4,5. ..... Zhang, Y.X., Zhu, Y., Xi, H.W., Liu, Y.L. and Zhou, H.M. ... Garen, A. and Levinthal, C. (1960) A fine structure ...

  11. Morphology and anatomical structure of the larval salt gland of ...

    African Journals Online (AJOL)

    Ezedom Theresa

    2013-10-09

    Oct 9, 2013 ... the morphology and fine structure of the ion transporting epithelium ... The general structure of the salt gland of nauplii cultured at 180 g/L disappeared. ...... Wu G, Zhang H, Sun J, Liu F, Ge X, Chen WH, Yu, J, Wang W (2011).

  12. African Journal of Biotechnology - Vol 8, No 11 (2009)

    African Journals Online (AJOL)

    Sequence analysis and over-expression of ribosomal protein S28 gene (RPS28) from the Giant Panda · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. W Hou, Y Hou, Y Hao, Y Du, T Zhang, Z Peng ...

  13. Nicholas Gilroy | NREL

    Science.gov (United States)

    Nicholas Gilroy desc Nicholas Gilroy Geospatial Data Scientist II Nicholas.Gilroy@nrel.gov | 303 -384-7354 Nicholas Gilroy is a member of the Geospatial Data Science team within the Systems Modeling (AAG) Featured Publications Veda, Santosh, Zhang, Yingchen, Tan, Jin, Chartan, Erol Kevin, Gilroy

  14. 77 FR 40882 - Ocean Transportation Intermediary License; Applicants

    Science.gov (United States)

    2012-07-11

    ..., Director, Application Type: License Transfer & QI Change. Gulf Premier Logistics LLC (NVO & OFF), 340 N... & OFF), 1163 Fairway Drive, 106, City of Industry, CA 91789, Officer: XiuJi Zhang, President, (Qualifying Individual), Application Type: Add NVO Service. Simple Logistics Inc. (NVO), 147-35 Farmers...

  15. Construction of full-length cDNA library of white flower Salvia ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-05-18

    May 18, 2009 ... of S. miltiorrhiza bge (Yuan et al., 1990; Wang et al.,. 1998; Huang et al., 2000). Hairy roots and ... or A. tumefaciens strains (Chen et al., 1997; Song et al.,. 1997). ..... Chen H, Yuan JP, Chen F, Zhang YL, Song JY (1997).

  16. The effects of reciprocal cross on inheritance of DNA methylation in ...

    African Journals Online (AJOL)

    enoh

    2012-03-20

    Mar 20, 2012 ... DNA methylation plays an important role for regulation of gene expression. To study ... genes, and newly acquired epigenetic states of trans- ... GACTGCGTACCAATTCAGA(E6). ATCATGAGTCCTGCTCGGTAC(H6). GACTGCGTACCAATTCAGT(E7) ..... Chen XQ, Ma Y, Chen F, Song WQ, Zhang L (2009).

  17. USBeSafe: Applying One Class SVM for Effective USB Event Anomaly Detection

    Science.gov (United States)

    2016-04-25

    2012. [5] Phil Muncaster. Indian navy computers stormed by malware-ridden USBs. 2012. [6] Ponemon. 2011 Second Annual Cost of Cyber Crime Study...Zhang, and Shanshan Sun. “A mixed unsu- pervised clustering-based intrusion detection model”. In: Genetic and Evolutionary Computing, 2009. WGEC’09

  18. Biomarkers and Biological Spectral Imaging

    Science.gov (United States)

    2001-01-23

    G. Sowa, H. H. Mantsch, National Research Council Canada; S. L. Zhang, Unilever Research (USA) 85 Brain tissue charcterization using spectral imaging...image registration and of the expert staff of Hill Top Research in Winnipeg for hosting the hydration study. Financial assistance from Unilever Research

  19. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics. YUANYING MIAO. Articles written in Journal of Genetics. Volume 96 Issue 6 December 2017 pp 985-992 RESEARCH ARTICLE. Genetic variants influencing lipid levels and risk of dyslipidemia in Chinese population · HUAICHAO LUO XUEPING ZHANG PING SHUAI YUANYING MIAO ...

  20. Wealth & Immigration in Denmark

    DEFF Research Database (Denmark)

    Dreyer, Johannes Kabderian; Wolffsen, Poul; Mortensen, Mia

    2014-01-01

    Applying newly developed methods this paper quantifies human capital in Denmark and analyzes highly qualified immigration as a potential source of wealth generation. In order to quantify human capital, we use the methodology of Lettau and Ludvigson (2001, 2004), Zhang (2006) and Dreyer et al. (2013...