WorldWideScience

Sample records for zero-age main sequence

  1. ON THE MULTIPLICITY OF THE ZERO-AGE MAIN-SEQUENCE O STAR HERSCHEL 36

    International Nuclear Information System (INIS)

    Arias, Julia I.; Barba, Rodolfo H.; Gamen, Roberto C.; Morrell, Nidia I.; Apellaniz, Jesus MaIz; Alfaro, Emilio J.; Sota, Alfredo; Walborn, Nolan R.; Bidin, Christian Moni

    2010-01-01

    We present the analysis of high-resolution optical spectroscopic observations of the zero-age main-sequence O star Herschel 36 spanning six years. This star is definitely a multiple system, with at least three components detected in its spectrum. Based on our radial-velocity (RV) study, we propose a picture of a close massive binary and a more distant companion, most probably in wide orbit about each other. The orbital solution for the binary, whose components we identify as O9 V and B0.5 V, is characterized by a period of 1.5415 ± 0.0006 days. With a spectral type O7.5 V, the third body is the most luminous component of the system and also presents RV variations with a period close to 498 days. Some possible hypotheses to explain the variability are briefly addressed and further observations are suggested.

  2. Pleiades and the zero-age main sequence

    International Nuclear Information System (INIS)

    McNamara, B.J.

    1976-01-01

    New four-color uvby observations of the Pleiades are used to calibrate the ZAMS in the spectral range A2 to F5. Although the Pleiades c 0 versus (b - y) 0 calibration is in good agreement with the ZAMS calibration presented by Crawford, its m 0 versus (b - y) 0 relation shows a systematic difference from his values. This difference is believed to be caused by the higher mean rotational velocity of the Pleiades stars in comparison to field stars

  3. Main sequence mass loss

    International Nuclear Information System (INIS)

    Brunish, W.M.; Guzik, J.A.; Willson, L.A.; Bowen, G.

    1987-01-01

    It has been hypothesized that variable stars may experience mass loss, driven, at least in part, by oscillations. The class of stars we are discussing here are the δ Scuti variables. These are variable stars with masses between about 1.2 and 2.25 M/sub θ/, lying on or very near the main sequence. According to this theory, high rotation rates enhance the rate of mass loss, so main sequence stars born in this mass range would have a range of mass loss rates, depending on their initial rotation velocity and the amplitude of the oscillations. The stars would evolve rapidly down the main sequence until (at about 1.25 M/sub θ/) a surface convection zone began to form. The presence of this convective region would slow the rotation, perhaps allowing magnetic braking to occur, and thus sharply reduce the mass loss rate. 7 refs

  4. A main sequence for quasars

    Science.gov (United States)

    Marziani, Paola; Dultzin, Deborah; Sulentic, Jack W.; Del Olmo, Ascensión; Negrete, C. A.; Martínez-Aldama, Mary L.; D'Onofrio, Mauro; Bon, Edi; Bon, Natasa; Stirpe, Giovanna M.

    2018-03-01

    The last 25 years saw a major step forward in the analysis of optical and UV spectroscopic data of large quasar samples. Multivariate statistical approaches have led to the definition of systematic trends in observational properties that are the basis of physical and dynamical modeling of quasar structure. We discuss the empirical correlates of the so-called “main sequence” associated with the quasar Eigenvector 1, its governing physical parameters and several implications on our view of the quasar structure, as well as some luminosity effects associated with the virialized component of the line emitting regions. We also briefly discuss quasars in a segment of the main sequence that includes the strongest FeII emitters. These sources show a small dispersion around a well-defined Eddington ratio value, a property which makes them potential Eddington standard candles.

  5. A Main Sequence for Quasars

    Directory of Open Access Journals (Sweden)

    Paola Marziani

    2018-03-01

    Full Text Available The last 25 years saw a major step forward in the analysis of optical and UV spectroscopic data of large quasar samples. Multivariate statistical approaches have led to the definition of systematic trends in observational properties that are the basis of physical and dynamical modeling of quasar structure. We discuss the empirical correlates of the so-called “main sequence” associated with the quasar Eigenvector 1, its governing physical parameters and several implications on our view of the quasar structure, as well as some luminosity effects associated with the virialized component of the line emitting regions. We also briefly discuss quasars in a segment of the main sequence that includes the strongest FeII emitters. These sources show a small dispersion around a well-defined Eddington ratio value, a property which makes them potential Eddington standard candles.

  6. Pre-main sequence masses and the age spread in the Orion cluster

    International Nuclear Information System (INIS)

    McNamara, B.J.

    1975-01-01

    The spread in formation times for stars earlier than GO in the Orion cluster is investigated. The range of stellar ages in this cluster is found to extend from at least 10 6 years to about 10 7 years. On the basis of this evidence and the similarity of the color--magnitude diagrams of other young clusters to the Orion cluster, it is suggested that the current method of dating these clusters (from the point at which the most massive stars just reach the zero-age main sequence) might not be valid. The masses of forty-one pre-main sequence stars within the ranges 4.05 less than or equal to log(Te) less than or equal to 3.77 and 0.6 less than or equal to log (L/L/sub sun/) less than or equal to 2.1 are determined from observed effective temperatures, luminosities, and gravities. These masses were then compared with those expected from Iben's (1965) pre-main sequence evolutionary calculations. In most cases, the agreement between these values was found to be within the observational errors. Finally, the pre-main sequence stars possessing infrared excesses are found to be apparently among the most massive and youngest stars still contracting toward the zero-age main sequence

  7. Nitrogen chronology of massive main sequence stars

    NARCIS (Netherlands)

    Köhler, K.; Borzyszkowski, M.; Brott, I.; Langer, N.; de Koter, A.

    2012-01-01

    Context. Rotational mixing in massive main sequence stars is predicted to monotonically increase their surface nitrogen abundance with time. Aims. We use this effect to design a method for constraining the age and the inclination angle of massive main sequence stars, given their observed luminosity,

  8. The double main sequence of Omega Centauri

    Science.gov (United States)

    Bedin, L. R.; Piotto, G.; Anderson, J.; King, I. R.; Cassisi, S.; Momany, Y.

    Recent, high precision photometry of Omega Centauri, the biggest Galactic globular cluster, has been obtained with Hubble Space Telescope (HST). The color magnitude diagram reveals an unexpected bifurcation of colors in the main sequence (MS). The newly found double MS, the multiple turnoffs and subgiant branches, and other sequences discovered in the past along the red giant branch of this cluster add up to a fascinating but frustrating puzzle. Among the possible explanations for the blue main sequence an anomalous overabundance of helium is suggested. The hypothesis will be tested with a set of FLAMES@VLT data we have recently obtained (ESO DDT program), and with forthcoming ACS@HST images. Based on observations with the NASA/ESA Hubble Space Telescope, obtained at the Space Telescope Science Institute, which is operated by AURA, Inc., under NASA contract NAS 5-26555.

  9. Post-main-sequence planetary system evolution

    Science.gov (United States)

    Veras, Dimitri

    2016-01-01

    The fates of planetary systems provide unassailable insights into their formation and represent rich cross-disciplinary dynamical laboratories. Mounting observations of post-main-sequence planetary systems necessitate a complementary level of theoretical scrutiny. Here, I review the diverse dynamical processes which affect planets, asteroids, comets and pebbles as their parent stars evolve into giant branch, white dwarf and neutron stars. This reference provides a foundation for the interpretation and modelling of currently known systems and upcoming discoveries. PMID:26998326

  10. Main-sequence photometry in NGC 2808

    International Nuclear Information System (INIS)

    Buonanno, R.; Corsi, C.E.; Fusi Pecci, F.; Harris, W.E.

    1984-01-01

    We have obtained a color-magnitude diagram for the southern globular cluster NGC 2808, to V/sub lim/approx. =21 (about 2 mag below the main-sequence turnoff). The internal photographic errors are sigma/sub V/approx. =0.02, sigma/sub B/-Vapprox. =0.03, small enough to permit a precise definition of the turnoff region and an estimate of the ''cosmic scatter'' along the main sequence. Fitting of the CMD to VandenBerg's [Astrophys. J. Suppl. 51, 29 (1983)] isochrones shows that an excellent match to the observations is achieved for model parameters of Yapprox. =0.2, Zapprox. =0.003 ([Fe/H]approx. =-0.8), and an age of (16 +- 2) billion years. All these characteristics are within the expected range from other observational constraints; no new clues from the main-sequence data alone have arisen to help explain the presence of the anomalous blue horizontal-branch stars

  11. Rotation in moderate-mass pre-main-sequence radiative track G stars

    International Nuclear Information System (INIS)

    Mcnamara, B.

    1990-01-01

    Recent studies suggest that the observed high-mass radiative track velocity histograms for pre-main-sequence stars differ significantly. In the Vogel and Kuhi (1981) study, these stars were found to possess a rather broad distribution of rotational velocities with a moderate peak at low velocities. In contrast, Smith et al. (1983), found a very sharply peaked distribution located at low values of v sin i. The difference in these velocity distributions is shown to be due to inadequate allowance for field stars in the Smith, et al., work. Once these stars are removed, the high-mass velocity distributions of the two regions are remarkably similar. This result suggests that a unique velocity distribution might be used in modeling very young stars. Assuming that the Orion Ic proto-F stars continue to contract in a homologous fashion, their average current rotational velocity is in agreement with that expected for zero-age main sequence F stars. 27 refs

  12. Theoretical statistics of zero-age cataclysmic variables

    International Nuclear Information System (INIS)

    Politano, M.J.

    1988-01-01

    The distribution of the white dwarf masses, the distribution of the mass ratios and the distribution of the orbital periods in cataclysmic variables which are forming at the present time are calculated. These systems are referred to as zero-age cataclysmic variables. The results show that 60% of the systems being formed contain helium white dwarfs and 40% contain carbon-oxygen white dwarfs. The mean dwarf mass in those systems containing helium white dwarfs is 0.34. The mean white dwarf mass in those systems containing carbon-oxygen white dwarfs is 0.75. The orbital period distribution identifies four main classes of zero-age cataclysmic variables: (1) short-period systems containing helium white dwarfs, (2) systems containing carbon-oxygen white dwarfs whose secondaries are convectively stable against rapid mass transfer to the white dwarf, (3) systems containing carbon-oxygen white dwarfs whose secondaries are radiatively stable against rapid mass transfer to the white dwarf and (4) long period systems with evolved secondaries. The white dwarf mass distribution in zero-age cataclysmic variables has direct application to the calculation of the frequency of outburst in classical novae as a function of the mass of the white dwarf. The method developed in this thesis to calculate the distributions of the orbital parameters in zero-age cataclysmic variables can be used to calculate theoretical statistics of any class of binary systems. This method provides a theoretical framework from which to investigate the statistical properties and the evolution of the orbital parameters of binary systems

  13. Effects of mass loss on the evolution of massive stars. I. Main-sequence evolution

    International Nuclear Information System (INIS)

    Dearborn, D.S.P.; Blake, J.B.; Hainebach, K.L.; Schramm, D.N.

    1978-01-01

    The effect of mass loss on the evolution and surface composition of massive stars during main-sequence evolution are examined. While some details of the evolutionary track depend on the formula used for the mass loss, the results appear most sensitive to the total mass removed during the main-sequence lifetime. It was found that low mass-loss rates have very little effect on the evolution of a star; the track is slightly subluminous, but the lifetime is almost unaffected. High rates of mass loss lead to a hot, high-luminosity stellar model with a helium core surrounded by a hydrogen-deficient (Xapprox.0.1) envelope. The main-sequence lifetime is extended by a factor of 2--3. These models may be identified with Wolf-Rayet stars. Between these mass-loss extremes are intermediate models which appear as OBN stars on the main sequence. The mass-loss rates required for significant observable effects range from 8 x 10 -7 to 10 -5 M/sub sun/ yr -1 , depending on the initial stellar mass. It is found that observationally consistent mass-loss rates for stars with M> or =30 M/sub sun/ may be sufficiently high that these stars lose mass on a time scale more rapidly than their main-sequence core evolution time. This result implies that the helium cores resulting from the main-sequence evolution of these massive stars may all be very similar to that of a star of Mapprox.30 M/sub sun/ regardless of the zero-age mass

  14. The evolution of coronal activity in main sequence cool stars

    International Nuclear Information System (INIS)

    Stern, R.A.

    1984-01-01

    Stars spend most of their lifetime and show the least amount of nuclear evolution on the main sequence. However, the x-ray luminosities of cool star coronas change by orders of magnitude as a function of main sequence age. Such coronal evolution is discussed in relation to our knowledge of the solar corona, solar and stellar flares, stellar rotation and binarity. The relevance of X-ray observations to current speculations on stellar dynamos is also considered

  15. Main sequences defined by Hyades and field stars

    International Nuclear Information System (INIS)

    Upgren, A.R.

    1978-01-01

    The author reviews the main sequences defined by members of the Hyades cluster and by the field stars in the solar neighborhood. For this purpose, the discussion is limited primarily to the stars of the lower portions of the main sequence, especially those of spectral classes K and early M. There are two reasons for emphasis on the faint red dwarf stars. First, the value of a parallax depends on its size or, more accurately, on the error in parallax divided by the parallax itself. Large parallaxes of high precision occur in large numbers only for stars inhabiting the lower main sequence. Furthermore, brighter stars of earlier spectral classes are more likely to be influenced by evolutionary effects which may differ between the Hyades and field stars, and which are difficult to calibrate. (Auth.)

  16. Stochastically excited oscillations on the upper main sequence

    DEFF Research Database (Denmark)

    Antoci, Victoria

    2013-01-01

    Convective envelopes in stars on the main sequence are usually connected only with stars of spectral types F5 or later. However, observations as well as theory indicate that the convective outer layers in earlier stars, despite being shallow, are still effective and turbulent enough to stochastic......Convective envelopes in stars on the main sequence are usually connected only with stars of spectral types F5 or later. However, observations as well as theory indicate that the convective outer layers in earlier stars, despite being shallow, are still effective and turbulent enough...... Pulsating B and Be stars, all in the context of solar-like oscillations....

  17. Circumstellar Material on and off the Main Sequence

    Science.gov (United States)

    Steele, Amy; Debes, John H.; Deming, Drake

    2017-06-01

    There is evidence of circumstellar material around main sequence, giant, and white dwarf stars that originates from the small-body population of planetary systems. These bodies tell us something about the chemistry and evolution of protoplanetary disks and the planetary systems they form. What happens to this material as its host star evolves off the main sequence, and how does that inform our understanding of the typical chemistry of rocky bodies in planetary systems? In this talk, I will discuss the composition(s) of circumstellar material on and off the main sequence to begin to answer the question, “Is Earth normal?” In particular, I look at three types of debris disks to understand the typical chemistry of planetary systems—young debris disks, debris disks around giant stars, and dust around white dwarfs. I will review the current understanding on how to infer dust composition for each class of disk, and present new work on constraining dust composition from infrared excesses around main sequence and giant stars. Finally, dusty and polluted white dwarfs hold a unique key to our understanding of the composition of rocky bodies around other stars. In particular, I will discuss WD1145+017, which has a transiting, disintegrating planetesimal. I will review what we know about this system through high speed photometry and spectroscopy and present new work on understanding the complex interplay of physics that creates white dwarf pollution from the disintegration of rocky bodies.

  18. Domino effect in chemical accidents: main features and accident sequences.

    Science.gov (United States)

    Darbra, R M; Palacios, Adriana; Casal, Joaquim

    2010-11-15

    The main features of domino accidents in process/storage plants and in the transportation of hazardous materials were studied through an analysis of 225 accidents involving this effect. Data on these accidents, which occurred after 1961, were taken from several sources. Aspects analyzed included the accident scenario, the type of accident, the materials involved, the causes and consequences and the most common accident sequences. The analysis showed that the most frequent causes are external events (31%) and mechanical failure (29%). Storage areas (35%) and process plants (28%) are by far the most common settings for domino accidents. Eighty-nine per cent of the accidents involved flammable materials, the most frequent of which was LPG. The domino effect sequences were analyzed using relative probability event trees. The most frequent sequences were explosion→fire (27.6%), fire→explosion (27.5%) and fire→fire (17.8%). Copyright © 2010 Elsevier B.V. All rights reserved.

  19. Solar Luminosity on the Main Sequence, Standard Model and Variations

    Science.gov (United States)

    Ayukov, S. V.; Baturin, V. A.; Gorshkov, A. B.; Oreshina, A. V.

    2017-05-01

    Our Sun became Main Sequence star 4.6 Gyr ago according Standard Solar Model. At that time solar luminosity was 30% lower than current value. This conclusion is based on assumption that Sun is fueled by thermonuclear reactions. If Earth's albedo and emissivity in infrared are unchanged during Earth history, 2.3 Gyr ago oceans had to be frozen. This contradicts to geological data: there was liquid water 3.6-3.8 Gyr ago on Earth. This problem is known as Faint Young Sun Paradox. We analyze luminosity change in standard solar evolution theory. Increase of mean molecular weight in the central part of the Sun due to conversion of hydrogen to helium leads to gradual increase of luminosity with time on the Main Sequence. We also consider several exotic models: fully mixed Sun; drastic change of pp reaction rate; Sun consisting of hydrogen and helium only. Solar neutrino observations however exclude most non-standard solar models.

  20. Solar-Type Activity in Main-Sequence Stars

    CERN Document Server

    Gershberg, Roald E

    2005-01-01

    Solar-type activity over the whole range of the electromagnetic spectrum is a phenomenon inherent in the majority of low- and moderate-mass main sequence stars. In this monograph observational results are summarized in a systematic and comprehensive fashion. The analysis of the various manifestations of such stellar activity leads to the identification of these phenomena with macroscopic non-linear processes in a magnetized plasma. Comparative study of flare stars and the Sun has become increasingly fruitful and is presently an active field of research involving stellar and solar physicists, experts in plasma physics and high-energy astrophysicists. This book will provide them with both an introduction and overview of observational results from the first optical photometry and spectroscopy, from the satellite telescopes International Ultraviolet Explorer to Hubble Space Telescope, XMM-Newton and Chandra, as well as with the present physical interpretation of solar-type activity in main sequence stars. Gershbe...

  1. Additional measurements of pre-main-sequence stellar rotation

    International Nuclear Information System (INIS)

    Hartmann, L.; Stauffer, J.R.

    1989-01-01

    New rotational-velocity measurements for pre-main-sequence stars in the Taurus-Auriga molecular cloud are reported. Rotational velocities or upper limits of 10 km/s are now available for 90 percent of the T Tauri stars with V less than 14.7 in the catalog of Cohen and Kuhi. Measurements of 'continuum emission' stars, thought to be accreting high-angular-momentum material from a circumstellar disk, show that these objects are not especially rapid rotators. The results confirm earlier findings that angular-momentum loss proceeds very efficiently in the earliest stages of star formation, and suggest that stars older than about one million yr contract to the main sequence at nearly constant angular momentum. The slow rotation of T Tauri stars probably requires substantial angular-momentum loss via a magnetically coupled wind. 35 references

  2. On the Roche constants for main-sequence binaries

    International Nuclear Information System (INIS)

    Giannuzzi, M.A.

    1979-01-01

    The ratios C 1 /C 2 of the constants defining the equipotential surfaces which describe the external forms of the components of a close binary system have been calculated on the basis of evolutionary models. Theoretical systems have been considered allowing for a wide range of input parameters (masses and separation) and taking into account the evolutionary effects on the radii of the stars during their Main-Sequence lifetime. The systems have not undergone any transfer of matter and are representative of detached binaries with Main-sequence components. The ratios of the constants are confined in limited intervals and, for the highest values of the mass-ratios, they are clustered around the unit. (Auth.)

  3. Domino effect in chemical accidents: main features and accident sequences

    OpenAIRE

    Casal Fàbrega, Joaquim; Darbra Roman, Rosa Maria

    2010-01-01

    The main features of domino accidents in process/storage plants and in the transportation of hazardous materials were studied through an analysis of 225 accidents involving this effect. Data on these accidents, which occurred after 1961, were taken from several sources. Aspects analyzed included the accident scenario, the type of accident, the materials involved, the causes and consequences and the most common accident sequences. The analysis showed that the most frequent causes a...

  4. Three aspects of stellar evolution near the main sequence

    International Nuclear Information System (INIS)

    Morgan, J.C.

    1979-05-01

    Three problems of stellar evolution are considered: the gap in the HR diagram of M67, the evolutionary status of RS CVn binaries and the solar neutrino problem. The physical basis of the Eggleton stellar evolution computer program is described. The program was used to calculate a grid of evolutionary tracks for models with masses between 0.7 and 1.29 solar masses. The more massive stars considered here have expanding convective cores during their main sequence evolution. The isochrone of the old galactic cluster M67 has a gap at the top of its main sequence because of the rapid evolution of stars at hydrogen exhaustion. RS CVn binaries present a complex collection of observational phenomena although they appear to be detached binaries. Their evolutionary status has remained controversial because of their high space density. Here it is shown that a post main sequence interpretation is satisfactory. Models of the Sun with metal poor interiors have been proposed in an attempt to resolve the solar neutrino problem. Here the evolution of two such models is calculated in detail, including a gradual contamination of the surface convection zone to produce the observed metal abundance, giving fully consistent models of the Sun as it is observed. (author)

  5. Lithium depletion and rotation in main-sequence stars

    International Nuclear Information System (INIS)

    Balachandran, S.

    1990-01-01

    Lithium abundances were measured in nearly 200 old disk-population F stars to examine the effects of rotational braking on the depletion of Li. The sample was selected to be slightly evolved off the main sequence so that the stars have completed all the Li depletion they will undergo on the main sequence. A large scatter in Li abundances in the late F stars is found, indicating that the Li depletion is not related to age and spectral type alone. Conventional depletion mechanisms like convective overshoot and microscopic diffusion are unable to explain Li depletion in F stars with thin convective envelopes and are doubly taxed to explain such a scatter. No correlation is found between Li abundance and the present projected rotational velocity and some of the most rapid rotators are undepleted, ruling out meridional circulation as the cause of Li depletion. There is a somewhat larger spread in Li abundances in the spun-down late F stars compared to the early F stars which should remain rotationally unaltered on the main sequence. 85 refs

  6. Infrared photometry of upper main sequence stars in M39

    International Nuclear Information System (INIS)

    Manteiga, M.; Martinez-Roger, C.; Morales, C.; Sabau, L.

    1991-01-01

    Infrared photometry of 19 Main sequence stars in the open cluster M39 is presented. Infrared-infrared and optical-infrared colour-colour and colour-magnitude diagrams are presented and compared with mean intrinsic colours for Population I stars. An interstellar reddening of E(B - V) = 0.01 is obtained by analysis of the colour-colour diagrams. Comparison with a set of theoretical isochrones leads to an age estimate for the cluster between 2.4 and 4.8 x 10 8 years

  7. Infrared photometry of upper main sequence stars in M39

    Energy Technology Data Exchange (ETDEWEB)

    Manteiga, M.; Martinez-Roger, C. (Instituto de Astrofisica de Canarias, Tenerife, (ES)); Morales, C.; Sabau, L. (Instituto de Tecnica Aeroespacial, Madrid, (ES))

    1991-03-01

    Infrared photometry of 19 Main sequence stars in the open cluster M39 is presented. Infrared-infrared and optical-infrared colour-colour and colour-magnitude diagrams are presented and compared with mean intrinsic colours for Population I stars. An interstellar reddening of E(B - V) = 0.01 is obtained by analysis of the colour-colour diagrams. Comparison with a set of theoretical isochrones leads to an age estimate for the cluster between 2.4 and 4.8 x 10{sup 8} years.

  8. Environmental impact analysis for the main accidental sequences of ignitor

    International Nuclear Information System (INIS)

    Carpignano, A.; Francabandiera, S.; Vella, R.; Zucchetti, M.

    1996-01-01

    A safety analysis study has been applied to the Ignitor machine using Probabilistic Safety Assessment. The main initiating events have been identified, and accident sequences have been studied by means of traditional methods such as Failure Mode and Effect Analysis (FMEA), Fault Trees (FT) and Event Trees (ET). The consequences of the radioactive environmental releases have been assessed in terms of Effective Dose Equivalent (EDEs) to the Most Exposed Individuals (MEI) of the chosen site, by means of a population dose code. Results point out the low enviromental impact of the machine. 13 refs., 1 fig., 3 tabs

  9. Photometric monitoring of pre-main sequence stars - 2

    International Nuclear Information System (INIS)

    Evans, A.; Davies, J.K.; Kilkenny, D.; Bode, M.F.

    1989-01-01

    A discussion is presented of the infrared and optical photometric variability of the pre-main sequence stars BF Ori and UX Ori. In the former case, the reddening that occurs during decline, at both optical and infrared wavelengths, is consistent with variable extinction by circumstellar grains having an interstellar-like reddening law. While in the case of UX Ori, the data suggest variability due to starspots. In both cases, a study of the polarimetric variability would be valuable to confirm these conclusions. (author)

  10. DISSECTING THE QUASAR MAIN SEQUENCE: INSIGHT FROM HOST GALAXY PROPERTIES

    International Nuclear Information System (INIS)

    Sun, Jiayi; Shen, Yue

    2015-01-01

    The diverse properties of broad-line quasars appear to follow a well-defined main sequence along which the optical Fe ii strength increases. It has been suggested that this sequence is mainly driven by the Eddington ratio (L/L Edd ) of the black hole (BH) accretion. Shen and Ho demonstrated with quasar clustering analysis that the average BH mass decreases with increasing Fe ii strength when quasar luminosity is fixed, consistent with this suggestion. Here we perform an independent test by measuring the stellar velocity dispersion σ * (hence, the BH mass via the M–σ * relation) from decomposed host spectra in low-redshift Sloan Digital Sky Survey quasars. We found that at fixed quasar luminosity, σ * systematically decreases with increasing Fe ii strength, confirming that the Eddington ratio increases with Fe ii strength. We also found that at fixed luminosity and Fe ii strength, there is little dependence of σ * on the broad Hβ FWHM. These new results reinforce the framework that the Eddington ratio and orientation govern most of the diversity seen in broad-line quasar properties

  11. Pre-main sequence sun: a dynamic approach

    International Nuclear Information System (INIS)

    Newman, M.J.; Winkler, K.H.A.

    1979-01-01

    The classical pre-main sequence evolutionary behavior found by Hayashi and his coworkers for the Sun depends crucially on the choice of initial conditions. The Hayashi picture results from beginning the calculation with an already centrally condensed, highly Jeans unstable object not terribly far removed from the stellar state initially. The present calculation follows the work of Larson in investigating the hydrodynamic collapse and self-gravitational accretion of an initially uniform, just Jeans unstable interstellar gas-dust cloud. The resulting picture for the early history of the Sun is quite different from that found by Hayashi. A rather small (R approx. = 2 R/sub sun/), low-luminosity (L greater than or equal to L/sub sun/) protostellar core develops. A fully convective stellar core, characteristic of Hayashi's work, is not found during the accretion process, and can only develop, if at all, in the subsequent pre-main sequence Kelvin-Helmholtz contraction of the core. 3 figures, 1 table

  12. Pre-main-sequence disk accretion in Z Canis Majoris

    International Nuclear Information System (INIS)

    Hartmann, L.; Kenyon, S.J.; Hewett, R.; Edwards, S.; Strom, K.M.; Strom, S.E.; Stauffer, J.R.

    1989-01-01

    It is suggested that the pre-main-sequence object Z CMa is a luminous accretion disk, similar in many respects to the FU Orionis variables. Z CMa shows the broad, doubled optical absorption lines expected from a rapidly rotating accretion disk. The first overtone CO absorption detected in Z CMa is blue-shifted, suggesting line formation in a disk wind. Accretion at rates about 0.001 solar mass/yr over 100 yr is required to explain the luminosity of Z CMa. The large amount of material accreted (0.1 solar mass/yr) indicates that Z CMa is in a very early stage of stellar evolution, possibly in an initial phase of massive disk accretion. 41 references

  13. Main-sequence turnoff of the Draco dwarf galaxy

    International Nuclear Information System (INIS)

    Stetson, P.B.; Mcclure, R.D.; Vandenberg, D.A.; Victoria Univ., Canada)

    1985-01-01

    Deep photometry on the B,V system for 182 stars in the dwarf spheroidal galaxy in Draco was obtained with a CCD camera at the Cassegrain focus of the Canada-France-Hawaii 3.6-m telescope. Draco's main-sequence turnoff if found near V(to) = 23.5, which is about 3.4 magnitudes below the galaxy's horizontal branch. This leads to the interpretation that Draco is not measurably younger than the clusters or Ursa Minor: the age of Draco is about 18 Gyr according to current star-revolution chronologies. No blue stragglers are definitely detected in Draco, and it is concluded that any young population in Draco probably represents less than 10 percent of the total. 30 references

  14. Orbital motion in pre-main sequence binaries

    Energy Technology Data Exchange (ETDEWEB)

    Schaefer, G. H. [The CHARA Array of Georgia State University, Mount Wilson Observatory, Mount Wilson, CA 91023 (United States); Prato, L. [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States); Simon, M. [Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794 (United States); Patience, J., E-mail: schaefer@chara-array.org [Astrophysics Group, School of Physics, University of Exeter, Exeter, EX4 4QL (United Kingdom)

    2014-06-01

    We present results from our ongoing program to map the visual orbits of pre-main sequence (PMS) binaries in the Taurus star forming region using adaptive optics imaging at the Keck Observatory. We combine our results with measurements reported in the literature to analyze the orbital motion for each binary. We present preliminary orbits for DF Tau, T Tau S, ZZ Tau, and the Pleiades binary HBC 351. Seven additional binaries show curvature in their relative motion. Currently, we can place lower limits on the orbital periods for these systems; full solutions will be possible with more orbital coverage. Five other binaries show motion that is indistinguishable from linear motion. We suspect that these systems are bound and might show curvature with additional measurements in the future. The observations reported herein lay critical groundwork toward the goal of measuring precise masses for low-mass PMS stars.

  15. Pre-main-sequence disk accretion in Z Canis Majoris

    Science.gov (United States)

    Hartmann, L.; Kenyon, S. J.; Hewett, R.; Edwards, S.; Strom, K. M.; Strom, S. E.; Stauffer, J. R.

    1989-01-01

    It is suggested that the pre-main-sequence object Z CMa is a luminous accretion disk, similar in many respects to the FU Orionis variables. Z CMa shows the broad, doubled optical absorption lines expected from a rapidly rotating accretion disk. The first overtone CO absorption detected in Z CMa is blue-shifted, suggesting line formation in a disk wind. Accretion at rates about 0.001 solar mass/yr over 100 yr is required to explain the luminosity of Z CMa. The large amount of material accreted (0.1 solar mass/yr) indicates that Z CMa is in a very early stage of stellar evolution, possibly in an initial phase of massive disk accretion.

  16. Metallicity and ultraviolet excesses of late main sequence stars

    International Nuclear Information System (INIS)

    Suchkov, A.A.; Marsakov, V.A.; Shevelev, Yu.G.

    1987-01-01

    The comparison of the characteristics of ultraviolet (UV) excesses δ(U-B) and metallicity [Fe/H] distributions of F, G, and K dwarfs reveals a number of discrepancies. It is shown that they can be eliminated if we assume that UV excesses of K and late G dwarfs, and [Fe/H] values from detailed analysis for F dwarfs are underestimated. Such an assumption enables to account for low values of for F, K and late G dwarfs, and for the difference of the free terms in the metallicity - UV-excess relation for these stars as compared to early G dwarfs. In this case the F5-F9 dwarfs turn out to be more metal-rich (by 0.1 in [Fe/H]) than G and K dwarfs, and the metallicity of the Hyades cluster turns out to be larger than the solar one, [Fe/H] Hyades =+0.1. The ''conditional'' metallicity - UV-excess calibrations are obtained for four groups of main-sequence stars: F5-F9, G0-G4, G5-G9, K0-K5

  17. Pre-main-sequence evolution of the sun

    International Nuclear Information System (INIS)

    Gough, D.

    1980-01-01

    The phase of solar evolution after the dynamical collapse is considered. The physics of the Kelvin-Helmholtz phase of gravitational collapse is described, attention being given to the early stages of the star when it was completely convective. It is noted that subsequently, a radiative core developed and evolution was controlled by the rate at which heat can diffuse through it by radiative transfer. Since the study of the Kelvin-Helmholtz contraction alone does not give enough information regarding the state of the sun when it first settled down to approximate hydrostatic equilibrium, other stars are studied, and information on the sun is obtained by analogy. Many young solar-type stars, such as the T Tauri stars, are not in the completely convective Hayashi (1961) phase hence it is proposed that the sun was completely mixed soon after its formation, which has some bearing on the sun's chemical structure. It is suggested that the surface of the sun was very nonuniform compared with the photosphere of today. The simple solar evolution model presented gives a good guide to the general way in which the sun contracted to the main sequence

  18. On the Statistical Properties of the Lower Main Sequence

    International Nuclear Information System (INIS)

    Angelou, George C.; Bellinger, Earl P.; Hekker, Saskia; Basu, Sarbani

    2017-01-01

    Astronomy is in an era where all-sky surveys are mapping the Galaxy. The plethora of photometric, spectroscopic, asteroseismic, and astrometric data allows us to characterize the comprising stars in detail. Here we quantify to what extent precise stellar observations reveal information about the properties of a star, including properties that are unobserved, or even unobservable. We analyze the diagnostic potential of classical and asteroseismic observations for inferring stellar parameters such as age, mass, and radius from evolutionary tracks of solar-like oscillators on the lower main sequence. We perform rank correlation tests in order to determine the capacity of each observable quantity to probe structural components of stars and infer their evolutionary histories. We also analyze the principal components of classic and asteroseismic observables to highlight the degree of redundancy present in the measured quantities and demonstrate the extent to which information of the model parameters can be extracted. We perform multiple regression using combinations of observable quantities in a grid of evolutionary simulations and appraise the predictive utility of each combination in determining the properties of stars. We identify the combinations that are useful and provide limits to where each type of observable quantity can reveal information about a star. We investigate the accuracy with which targets in the upcoming TESS and PLATO missions can be characterized. We demonstrate that the combination of observations from GAIA and PLATO will allow us to tightly constrain stellar masses, ages, and radii with machine learning for the purposes of Galactic and planetary studies.

  19. HABITABLE ZONES OF POST-MAIN SEQUENCE STARS

    International Nuclear Information System (INIS)

    Ramirez, Ramses M.; Kaltenegger, Lisa

    2016-01-01

    Once a star leaves the main sequence and becomes a red giant, its Habitable Zone (HZ) moves outward, promoting detectable habitable conditions at larger orbital distances. We use a one-dimensional radiative-convective climate and stellar evolutionary models to calculate post-MS HZ distances for a grid of stars from 3700 to 10,000 K (∼M1 to A5 stellar types) for different stellar metallicities. The post-MS HZ limits are comparable to the distances of known directly imaged planets. We model the stellar as well as planetary atmospheric mass loss during the Red Giant Branch (RGB) and Asymptotic Giant Branch (AGB) phases for super-Moons to super-Earths. A planet can stay between 200 million years up to 9 Gyr in the post-MS HZ for our hottest and coldest grid stars, respectively, assuming solar metallicity. These numbers increase for increased stellar metallicity. Total atmospheric erosion only occurs for planets in close-in orbits. The post-MS HZ orbital distances are within detection capabilities of direct imaging techniques.

  20. HABITABLE ZONES OF POST-MAIN SEQUENCE STARS

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez, Ramses M.; Kaltenegger, Lisa [Carl Sagan Institute, Cornell University, Ithaca, NY (United States)

    2016-05-20

    Once a star leaves the main sequence and becomes a red giant, its Habitable Zone (HZ) moves outward, promoting detectable habitable conditions at larger orbital distances. We use a one-dimensional radiative-convective climate and stellar evolutionary models to calculate post-MS HZ distances for a grid of stars from 3700 to 10,000 K (∼M1 to A5 stellar types) for different stellar metallicities. The post-MS HZ limits are comparable to the distances of known directly imaged planets. We model the stellar as well as planetary atmospheric mass loss during the Red Giant Branch (RGB) and Asymptotic Giant Branch (AGB) phases for super-Moons to super-Earths. A planet can stay between 200 million years up to 9 Gyr in the post-MS HZ for our hottest and coldest grid stars, respectively, assuming solar metallicity. These numbers increase for increased stellar metallicity. Total atmospheric erosion only occurs for planets in close-in orbits. The post-MS HZ orbital distances are within detection capabilities of direct imaging techniques.

  1. On the Statistical Properties of the Lower Main Sequence

    Energy Technology Data Exchange (ETDEWEB)

    Angelou, George C.; Bellinger, Earl P.; Hekker, Saskia [Max-Planck-Institut für Sonnensystemforschung, Justus-von-Liebig-Weg 3, D-37077 Göttingen (Germany); Basu, Sarbani [Department of Astronomy, Yale University, New Haven, CT 06520 (United States)

    2017-04-20

    Astronomy is in an era where all-sky surveys are mapping the Galaxy. The plethora of photometric, spectroscopic, asteroseismic, and astrometric data allows us to characterize the comprising stars in detail. Here we quantify to what extent precise stellar observations reveal information about the properties of a star, including properties that are unobserved, or even unobservable. We analyze the diagnostic potential of classical and asteroseismic observations for inferring stellar parameters such as age, mass, and radius from evolutionary tracks of solar-like oscillators on the lower main sequence. We perform rank correlation tests in order to determine the capacity of each observable quantity to probe structural components of stars and infer their evolutionary histories. We also analyze the principal components of classic and asteroseismic observables to highlight the degree of redundancy present in the measured quantities and demonstrate the extent to which information of the model parameters can be extracted. We perform multiple regression using combinations of observable quantities in a grid of evolutionary simulations and appraise the predictive utility of each combination in determining the properties of stars. We identify the combinations that are useful and provide limits to where each type of observable quantity can reveal information about a star. We investigate the accuracy with which targets in the upcoming TESS and PLATO missions can be characterized. We demonstrate that the combination of observations from GAIA and PLATO will allow us to tightly constrain stellar masses, ages, and radii with machine learning for the purposes of Galactic and planetary studies.

  2. Common Warm Dust Temperatures Around Main Sequence Stars

    Science.gov (United States)

    Morales, Farisa; Rieke, George; Werner, Michael; Stapelfeldt, Karl; Bryden, Geoffrey; Su, Kate

    2011-01-01

    We compare the properties of warm dust emission from a sample of main-sequence A-type stars (B8-A7) to those of dust around solar-type stars (F5-KO) with similar Spitzer Space Telescope Infrared Spectrograph/MIPS data and similar ages. Both samples include stars with sources with infrared spectral energy distributions that show evidence of multiple components. Over the range of stellar types considered, we obtain nearly the same characteristic dust temperatures (∼ 190 K and ∼60 K for the inner and outer dust components, respectively)-slightly above the ice evaporation temperature for the inner belts. The warm inner dust temperature is readily explained if populations of small grains are being released by sublimation of ice from icy planetesimals. Evaporation of low-eccentricity icy bodies at ∼ 150 K can deposit particles into an inner/warm belt, where the small grains are heated to dust Temperatures of -190 K. Alternatively, enhanced collisional processing of an asteroid belt-like system of parent planetesimals just interior to the snow line may account for the observed uniformity in dust temperature. The similarity in temperature of the warmer dust across our B8-KO stellar sample strongly suggests that dust-producing planetesimals are not found at similar radial locations around all stars, but that dust production is favored at a characteristic temperature horizon.

  3. Lithium evolution in metal-poor stars: from Pre-Main Sequence to the Spite plateau

    OpenAIRE

    Fu, Xiaoting; Bressan, Alessandro; Molaro, Paolo; Marigo, Paola

    2015-01-01

    Lithium abundance derived in metal-poor main sequence stars is about three times lower than the value of primordial Li predicted by the standard Big Bang nucleosynthesis when the baryon density is taken from the CMB or the deuterium measurements. This disagreement is generally referred as the lithium problem. We here reconsider the stellar Li evolution from the pre-main sequence to the end of the main sequence phase by introducing the effects of convective overshooting and residual mass accre...

  4. Constraining the magnitude of the largest event in a foreshock-main shock-aftershock sequence

    Science.gov (United States)

    Shcherbakov, Robert; Zhuang, Jiancang; Ogata, Yosihiko

    2018-01-01

    Extreme value statistics and Bayesian methods are used to constrain the magnitudes of the largest expected earthquakes in a sequence governed by the parametric time-dependent occurrence rate and frequency-magnitude statistics. The Bayesian predictive distribution for the magnitude of the largest event in a sequence is derived. Two types of sequences are considered, that is, the classical aftershock sequences generated by large main shocks and the aftershocks generated by large foreshocks preceding a main shock. For the former sequences, the early aftershocks during a training time interval are used to constrain the magnitude of the future extreme event during the forecasting time interval. For the latter sequences, the earthquakes preceding the main shock are used to constrain the magnitudes of the subsequent extreme events including the main shock. The analysis is applied retrospectively to past prominent earthquake sequences.

  5. Pre-main-sequence depletion of Li-6 and Li-7

    International Nuclear Information System (INIS)

    Proffitt, C.R.; Michaud, G.

    1989-01-01

    Depletion of Li-6 and Li-7 during premain-sequence contraction has been calculated for several evolutionary sequences. Slightly greater Li-7 depletion was found than by other recent workers. On the premain sequence, Li-6 is depleted by a factor of at least 10 in the present models for stars with T(eff) lower than 6800 K on the main sequence. Because of the shorter destruction time scale for Li-6 as compared to Li-7, the determination of the abundances of these two isotopes would place strict constraints on the structure of premain-sequence stars. 39 refs

  6. Tracing early stellar evolution with asteroseismology: pre-main sequence stars in NGC 2264

    Directory of Open Access Journals (Sweden)

    Zwintz Konstanze

    2015-01-01

    Full Text Available Asteroseismology has been proven to be a successful tool to unravel details of the internal structure for different types of stars in various stages of their main sequence and post-main sequence evolution. Recently, we found a relation between the detected pulsation properties in a sample of 34 pre-main sequence (pre-MS δ Scuti stars and the relative phase in their pre-MS evolution. With this we are able to demonstrate that asteroseismology is similarly powerful if applied to stars in the earliest stages of evolution before the onset of hydrogen core burning.

  7. Magnetic fields in O-, B- and A-type stars on the main sequence

    Directory of Open Access Journals (Sweden)

    Briquet Maryline

    2015-01-01

    Full Text Available In this review, the latest observational results on magnetic fields in main-sequence stars with radiative envelopes are summarised together with the theoretical works aimed at explaining them.

  8. Did A Planet Survive A Post-Main Sequence Evolutionary Event?

    Science.gov (United States)

    Sorber, Rebecca; Jang-Condell, Hannah; Zimmerman, Mara

    2018-06-01

    The GL86 is star system approximately 10 pc away with a main sequence K- type ~ 0.77 M⊙ star (GL 86A) with a white dwarf ~0.49 M⊙ companion (GL86 B). The system has a ~ 18.4 AU semi-major axis, an orbital period of ~353 yrs, and an eccentricity of ~ 0.39. A 4.5 MJ planet orbits the main sequence star with a semi-major axis of 0.113 AU, an orbital period of 15.76 days, in a near circular orbit with an eccentricity of 0.046. If we assume that this planet was formed during the time when the white dwarf was a main sequence star, it would be difficult for the planet to have remained in a stable orbit during the post-main sequence evolution of GL86 B. The post-main sequence evolution with planet survival will be examined by modeling using the program Mercury (Chambers 1999). Using the model, we examine the origins of the planet: whether it formed before or after the post-main sequence evolution of GL86B. The modeling will give us insight into the dynamical evolution of, not only, the binary star system, but also the planet’s life cycle.

  9. Central limit theorems for sequences with m(n)-dependent main part

    NARCIS (Netherlands)

    Nieuwenhuis, G.

    1992-01-01

    Let (Xi(n); n ϵ N, 1⩽i⩽h(n)) be a double sequence of random variables with h(n)→∞ as n→∞. Suppose that the sequence can be split into two parts: an m(n)-dependent sequence (Xi,m(n); n ϵ N, 1⩽i⩽h(n)) of main terms and a sequence (Xi,m(n); n ϵ N, 1⩽i⩽h(n)) of residual terms. Here (m(n)) may be

  10. A tale of two anomalies: Depletion, dispersion, and the connection between the stellar lithium spread and inflated radii on the pre-main sequence

    Energy Technology Data Exchange (ETDEWEB)

    Somers, Garrett; Pinsonneault, Marc H., E-mail: somers@astronomy.ohio-state.edu, E-mail: pinsono@astronomy.ohio-state.edu [Department of Astronomy, The Ohio State University, 140 West 18th Avenue, Columbus, OH 43201 (United States)

    2014-07-20

    We investigate lithium depletion in standard stellar models (SSMs) and main sequence (MS) open clusters, and explore the origin of the Li dispersion in young, cool stars of equal mass, age, and composition. We first demonstrate that SSMs accurately predict the Li abundances of solar analogs at the zero-age main sequence (ZAMS) within theoretical uncertainties. We then measure the rate of MS Li depletion by removing the [Fe/H]-dependent ZAMS Li pattern from three well-studied clusters, and comparing the detrended data. MS depletion is found to be mass-dependent, in the sense of more depletion at low mass. A dispersion in Li abundance at fixed T{sub eff} is nearly universal, and sets in by ∼200 Myr. We discuss mass and age dispersion trends, and the pattern is mixed. We argue that metallicity impacts the ZAMS Li pattern, in agreement with theoretical expectations but contrary to the findings of some previous studies, and suggest Li as a test of cluster metallicity. Finally, we argue that a radius dispersion in stars of fixed mass and age, during the epoch of pre-MS Li destruction, is responsible for the spread in Li abundances and the correlation between rotation and Li in young cool stars, most well known in the Pleiades. We calculate stellar models, inflated to match observed radius anomalies in magnetically active systems, and the resulting range of Li abundances reproduces the observed patterns of young clusters. We discuss ramifications for pre-MS evolutionary tracks and age measurements of young clusters, and suggest an observational test.

  11. A tale of two anomalies: Depletion, dispersion, and the connection between the stellar lithium spread and inflated radii on the pre-main sequence

    International Nuclear Information System (INIS)

    Somers, Garrett; Pinsonneault, Marc H.

    2014-01-01

    We investigate lithium depletion in standard stellar models (SSMs) and main sequence (MS) open clusters, and explore the origin of the Li dispersion in young, cool stars of equal mass, age, and composition. We first demonstrate that SSMs accurately predict the Li abundances of solar analogs at the zero-age main sequence (ZAMS) within theoretical uncertainties. We then measure the rate of MS Li depletion by removing the [Fe/H]-dependent ZAMS Li pattern from three well-studied clusters, and comparing the detrended data. MS depletion is found to be mass-dependent, in the sense of more depletion at low mass. A dispersion in Li abundance at fixed T eff is nearly universal, and sets in by ∼200 Myr. We discuss mass and age dispersion trends, and the pattern is mixed. We argue that metallicity impacts the ZAMS Li pattern, in agreement with theoretical expectations but contrary to the findings of some previous studies, and suggest Li as a test of cluster metallicity. Finally, we argue that a radius dispersion in stars of fixed mass and age, during the epoch of pre-MS Li destruction, is responsible for the spread in Li abundances and the correlation between rotation and Li in young cool stars, most well known in the Pleiades. We calculate stellar models, inflated to match observed radius anomalies in magnetically active systems, and the resulting range of Li abundances reproduces the observed patterns of young clusters. We discuss ramifications for pre-MS evolutionary tracks and age measurements of young clusters, and suggest an observational test.

  12. 13-colour photometry of pre-main sequence stars: preliminary report and results

    Energy Technology Data Exchange (ETDEWEB)

    Chavarria-K, C; de Lara, E [Universidad Nacional Autonoma de Mexico, Mexico City. Inst. de Astronomia

    1981-01-01

    Broad (UBVRI) and intermediate (13-colour) band photometry of 160 stars selected mainly from the Herbig Rao catalogue are being carried on currently, mainly to complement the published data of these stars in the optical window (for example shortward of the Balmer and longward of the Paschen discontinuities). The 13-colour photometric system and its applications to pre-main sequences stars are briefly discussed. First results are presented.

  13. A near-infrared survey for pre-main sequence stars in Taurus

    Science.gov (United States)

    Gomez, Mercedes; Kenyon, Scott J.; Hartmann, Lee

    1994-01-01

    We present a near-infrared survey of approximately 2 sq deg covering parts of L1537, L1538, and Heiles cloud 2 in the Taurus-Auriga molecular cloud. Although this study is more sensitive than previous attempts to identify pre-main sequence stars in Taurus-Auriga, our survey regions contain only one new optically visible, young star. We did find several candidate embedded protostars; additional 10 micrometer photometry is necessary to verify the pre-main sequence nature of these sources. Our results--combined with those of previous surveys--show that the L1537/L1538 clouds contain no pre-main sequence stars. These two clouds are less dense than the active star formation sites in Taurus-Auriga, which suggests a cloud must achieve a threshold density to form stars.

  14. On precise ZAMSs, the solar color, and pre-main-sequence lithium depletion

    International Nuclear Information System (INIS)

    Vandenberg, D.A.; Poll, H.E.

    1989-01-01

    This paper describes a semiempirical main-sequence-fitting method for the determination of distances to stellar systems, which uses a ZAMS locus carefully normalized to the sun, and whose shape is defined by a quartic over the color range for (B-V)0 values between 0.2 and 1.0 such that the morphology of the Pleiades C-M diagram is accurately reproduced. Using this technique, distances were derived for a number of star clusters. It was found that the observed depletion of lithium among cool main-sequence stars in the Hyades and Pleiades can be matched quite well by the present models. Calculations also show that the depletion of Li at a fixed T(eff) along the main sequence is a sensitive function of Fe/H. 98 refs

  15. Effects of main-sequence mass loss on stellar and galactic chemical evolution

    International Nuclear Information System (INIS)

    Guzik, J.A.

    1988-01-01

    L.A. Willson, G.H. Bowen and C. Struck-Marcell have proposed that 1 to 3 solar mass stars may experience evolutionarily significant mass loss during the early part of their main-sequence phase. The suggested mass-loss mechanism is pulsation, facilitated by rapid rotation. Initial mass-loss rates may be as large as several times 10 -9 M mass of sun/yr, diminishing over several times 10 8 years. The author attempts to test this hypothesis by comparing some theoretical implications with observations. Three areas are addressed: Solar models, cluster HR diagrams, and galactic chemical evolution. Mass-losing solar models were evolved that match the Sun's luminosity and radius at its present age. The most extreme viable models have initial mass 2.0 M 0 , and mass-loss rates decreasing exponentially over 2-3 x 10 8 years. Evolution calculations incorporating main-sequence mass loss were completed for a grid of models with initial masses 1.25 to 2.0 M mass of sun and mass loss timescales 0.2 to 2.0 Gry. Cluster HR diagrams synthesized with these models confirm the potential for the hypothesis to explain observed spreads or bifurcations in the upper main sequence, blue stragglers, anomalous giants, and poor fits of main-sequence turnoffs by standard isochrones. Simple closed galactic chemical evolution models were used to test the effects of main-sequence mass loss on the F and G dwarf distribution. Stars between 3.0 M mass of sun and a metallicity-dependent lower mass are assumed to lose mass. The models produce a 30 to 60% increase in the stars to stars-plus-remnants ratio, with fewer early-F dwarfs and many more late-F dwarfs remaining on the main sequence to the present

  16. The Star-forming Main Sequence of Dwarf Low Surface Brightness Galaxies

    Science.gov (United States)

    McGaugh, Stacy S.; Schombert, James M.; Lelli, Federico

    2017-12-01

    We explore the star-forming properties of late-type, low surface brightness (LSB) galaxies. The star-forming main sequence ({SFR}-{M}* ) of LSB dwarfs has a steep slope, indistinguishable from unity (1.04 ± 0.06). They form a distinct sequence from more massive spirals, which exhibit a shallower slope. The break occurs around {M}* ≈ {10}10 {M}⊙ , and can also be seen in the gas mass—stellar mass plane. The global Kennicutt-Schmidt law ({SFR}-{M}g) has a slope of 1.47 ± 0.11 without the break seen in the main sequence. There is an ample supply of gas in LSB galaxies, which have gas depletion times well in excess of a Hubble time, and often tens of Hubble times. Only ˜ 3 % of this cold gas needs be in the form of molecular gas to sustain the observed star formation. In analogy with the faint, long-lived stars of the lower stellar main sequence, it may be appropriate to consider the main sequence of star-forming galaxies to be defined by thriving dwarfs (with {M}* {10}10 {M}⊙ ) are weary giants that constitute more of a turn-off population.

  17. AK Sco: a tidally induced atmospheric dynamo in a pre-main sequence binary?

    Science.gov (United States)

    Gómez de Castro, A. I.

    2009-02-01

    AK Sco is a unique source: a 10-30 Myrs old pre-main sequence spectroscopic binary composed by two nearly equal F5 stars that at periastron are separated by barely eleven stellar radii so, the stellar magnetospheres fill the Roche lobe at periastron. The orbit is not yet circularized (e = 0.47) and very strong tides are expected. This makes of AK Sco, the ideal laboratory to study the effect of gravitational tides in the stellar magnetic field building up during pre-main sequence evolution. Evidence of this effect is reported in this contribution.

  18. Reconciling mass functions with the star-forming main sequence via mergers

    Science.gov (United States)

    Steinhardt, Charles L.; Yurk, Dominic; Capak, Peter

    2017-06-01

    We combine star formation along the 'main sequence', quiescence and clustering and merging to produce an empirical model for the evolution of individual galaxies. Main-sequence star formation alone would significantly steepen the stellar mass function towards low redshift, in sharp conflict with observation. However, a combination of star formation and merging produces a consistent result for correct choice of the merger rate function. As a result, we are motivated to propose a model in which hierarchical merging is disconnected from environmentally independent star formation. This model can be tested via correlation functions and would produce new constraints on clustering and merging.

  19. Sequence of decommissioning of the main equipment in a central type VVER 440 V-230

    International Nuclear Information System (INIS)

    Andres, E.; Garcia Ruiz, R.

    2014-01-01

    IBERDROLA Ingenieria y Construccion S.A.U., leader of consortium with Empresarios Agrupados and INDRA, has developed the Basic Engineering for the decommissioning of contaminated systems and building of a VVER 440 V-230 Nuclear Power Plant, establishing the sequence and methodology for the main equipment fragmentation. For that, it has been designed dry and wet cutting zones to be set up in the area where steam generators, main cooling pumps and pressurizer are located; these components will be dismantled previously. (Author)

  20. The Lower Main Sequence of Stars in the Solar Neighborhood: Model Predictions Versus Observation

    Directory of Open Access Journals (Sweden)

    Bartašiūtė S.

    2012-09-01

    Full Text Available We have used the Simbad database and VizieR catalogue access tools to construct the observational color-absolute magnitude diagrams of nearby K-M dwarfs with precise Hipparcos parallaxes (σπ/π ≤ 0:05. Particular attention has been paid to removing unresolved double/multiple stars and variables. In addition to archival data, we have made use of nearly 2000 new radial-velocity measurements of K-M dwarfs to identify spectroscopic binary candidates. The main sequences, cleaned from unresolved binaries, variable stars, and old population stars which can also widen the sequence due to their presumably lower metallicity, were compared to available solar-metallicity models. Significant offsets of most of the model main-sequence lines are seen with respect to observational data, especially for the lower-mass stars. Only the location and slope of the Victoria-Regina and, partly, BaSTI isochrones match the data quite well.

  1. The main sequence of NGC 6231 and the calibration of absolute magnitudes

    International Nuclear Information System (INIS)

    Garrison, R.F.

    1978-01-01

    The author presents a discussion of a new approach to the calibration of absolute magnitudes for MK spectral types. With the addition of the NGC 6231 main sequence down to A0, the material for the cluster fitting method using very carefully determined MK types is complete. (Auth.)

  2. Oscillation mode linewidths of main-sequence and subgiant stars observed by Kepler

    DEFF Research Database (Denmark)

    Appourchaux, T.; Benomar, O.; Gruberbauer, M.

    2012-01-01

    Solar-like oscillations have been observed by {{\\it Kepler}} and CoRoT in several solar-type stars. We study the variations of stellar p-mode linewidth as a function of effective temperature. Time series of 9 months of Kepler data have been used. The power spectra of 42 cool main-sequence stars a...

  3. IRAS IDENTIFICATION OF PRE-MAIN-SEQUENCE STARS IN THE CHAMELEON-II ASSOCIATION

    NARCIS (Netherlands)

    PRUSTI, T; WHITTET, DCB; ASSENDORP, R; WESSELIUS, PR

    We report the results of a search for new pre-main sequence candidates in the Chamaeleon II dark cloud based on three IRAS catalogues (the Point Source Catalog, the Serendipitous Survey Catalog and the Faint Source Survey). A total of 30 sources were selected. Twelve of these display IRAS colours

  4. Relation of chromospheric activity to convection, rotation, and pre-main-sequence evolution

    International Nuclear Information System (INIS)

    Gilliland, R.L.

    1986-01-01

    Pre-main-sequence, or T Tauri, stars are characterized by much larger fluxes of nonradiative origin than their main-sequence counterparts. As a class, the T Tauri stars have only moderate rotation rates, making an explanation of their chromospheric properties based on rapid rotation problematic. The recent success of correlating nonradiative fluxes to the Rossby number, Ro = P/sub rot//tau/sub conv/, a central parameter of simple dynamo theories of magnetic field generation, has led to the suggestion that the same relation might be of use in explaining the pre-main-sequence (PMS) stars if tau/sub conv/ is very large. We show that tau/sub conv/ does depend strongly on evolutionary effects above the main sequence (MS), but that this dependence alone cannot account for the high observed nonradiative fluxes. The acoustic flux is also strongly dependent on PMS evolutionary state, and when coupled to the parameterization of magnetic activity based on Ro, these two mechanisms seem capable of explaining the high observed level of chromospheric activity in T Tauri stars. The moment of inertia decreases by two to three order of magnitude during PMS evolution. Since young MS stars do not rotate two to three orders of magnitude faster than PMS stars, rapid loss or redistribution of angular momentum must occur

  5. The SAMI Galaxy Survey: spatially resolving the main sequence of star formation

    Science.gov (United States)

    Medling, Anne M.; Cortese, Luca; Croom, Scott M.; Green, Andrew W.; Groves, Brent; Hampton, Elise; Ho, I.-Ting; Davies, Luke J. M.; Kewley, Lisa J.; Moffett, Amanda J.; Schaefer, Adam L.; Taylor, Edward; Zafar, Tayyaba; Bekki, Kenji; Bland-Hawthorn, Joss; Bloom, Jessica V.; Brough, Sarah; Bryant, Julia J.; Catinella, Barbara; Cecil, Gerald; Colless, Matthew; Couch, Warrick J.; Drinkwater, Michael J.; Driver, Simon P.; Federrath, Christoph; Foster, Caroline; Goldstein, Gregory; Goodwin, Michael; Hopkins, Andrew; Lawrence, J. S.; Leslie, Sarah K.; Lewis, Geraint F.; Lorente, Nuria P. F.; Owers, Matt S.; McDermid, Richard; Richards, Samuel N.; Sharp, Robert; Scott, Nicholas; Sweet, Sarah M.; Taranu, Dan S.; Tescari, Edoardo; Tonini, Chiara; van de Sande, Jesse; Walcher, C. Jakob; Wright, Angus

    2018-04-01

    We present the ˜800 star formation rate maps for the Sydney-AAO Multi-object Integral field spectrograph (SAMI) Galaxy Survey based on H α emission maps, corrected for dust attenuation via the Balmer decrement, that are included in the SAMI Public Data Release 1. We mask out spaxels contaminated by non-stellar emission using the [O III]/H β, [N II]/H α, [S II]/H α, and [O I]/H α line ratios. Using these maps, we examine the global and resolved star-forming main sequences of SAMI galaxies as a function of morphology, environmental density, and stellar mass. Galaxies further below the star-forming main sequence are more likely to have flatter star formation profiles. Early-type galaxies split into two populations with similar stellar masses and central stellar mass surface densities. The main-sequence population has centrally concentrated star formation similar to late-type galaxies, while galaxies >3σ below the main sequence show significantly reduced star formation most strikingly in the nuclear regions. The split populations support a two-step quenching mechanism, wherein halo mass first cuts off the gas supply and remaining gas continues to form stars until the local stellar mass surface density can stabilize the reduced remaining fuel against further star formation. Across all morphologies, galaxies in denser environments show a decreased specific star formation rate from the outside in, supporting an environmental cause for quenching, such as ram-pressure stripping or galaxy interactions.

  6. A consistency test of white dwarf and main sequence ages: NGC 6791

    Directory of Open Access Journals (Sweden)

    Córsico A.H.

    2013-03-01

    Full Text Available NGC 6791 is an open cluster that it is so close to us that can be imaged down to very faint luminosities. The main sequence turn-off age (∼8 Gyr and the age derived from the cut-off of the white dwarf luminosity function (∼6 Gyr were found to be significantly different. Here we demonstrate that the origin of this age discrepancy lies in an incorrect evaluation of the white dwarf cooling ages, and we show that when the relevant physical separation processes are included in the calculation of white dwarf sequences both ages are coincident.

  7. Effects of Main-Sequence Mass Loss on Stellar and Galactic Chemical Evolution.

    Science.gov (United States)

    Guzik, Joyce Ann

    1988-06-01

    L. A. Willson, G. H. Bowen and C. Struck -Marcell have proposed that 1 to 3 solar mass stars may experience evolutionarily significant mass loss during the early part of their main-sequence phase. The suggested mass-loss mechanism is pulsation, facilitated by rapid rotation. Initial mass-loss rates may be as large as several times 10^{-9}M o/yr, diminishing over several times 10^8 years. We attempted to test this hypothesis by comparing some theoretical implications with observations. Three areas are addressed: Solar models, cluster HR diagrams, and galactic chemical evolution. Mass-losing solar models were evolved that match the Sun's luminosity and radius at its present age. The most extreme viable models have initial mass 2.0 M o, and mass-loss rates decreasing exponentially over 2-3 times 10^8 years. Compared to a constant -mass model, these models require a reduced initial ^4He abundance, have deeper envelope convection zones and higher ^8B neutrino fluxes. Early processing of present surface layers at higher interior temperatures increases the surface ^3He abundance, destroys Li, Be and B, and decreases the surface C/N ratio following first dredge-up. Evolution calculations incorporating main-sequence mass loss were completed for a grid of models with initial masses 1.25 to 2.0 Mo and mass loss timescales 0.2 to 2.0 Gyr. Cluster HR diagrams synthesized with these models confirm the potential for the hypothesis to explain observed spreads or bifurcations in the upper main sequence, blue stragglers, anomalous giants, and poor fits of main-sequence turnoffs by standard isochrones. Simple closed galactic chemical evolution models were used to test the effects of main-sequence mass loss on the F and G dwarf distribution. Stars between 3.0 M o and a metallicity -dependent lower mass are assumed to lose mass. The models produce a 30 to 60% increase in the stars to stars-plus -remnants ratio, with fewer early-F dwarfs and many more late-F dwarfs remaining on the main

  8. SDSS-IV MaNGA: Spatially Resolved Star Formation Main Sequence and LI(N)ER Sequence

    Science.gov (United States)

    Hsieh, B. C.; Lin, Lihwai; Lin, J. H.; Pan, H. A.; Hsu, C. H.; Sánchez, S. F.; Cano-Díaz, M.; Zhang, K.; Yan, R.; Barrera-Ballesteros, J. K.; Boquien, M.; Riffel, R.; Brownstein, J.; Cruz-González, I.; Hagen, A.; Ibarra, H.; Pan, K.; Bizyaev, D.; Oravetz, D.; Simmons, A.

    2017-12-01

    We present our study on the spatially resolved Hα and M * relation for 536 star-forming and 424 quiescent galaxies taken from the MaNGA survey. We show that the star formation rate surface density ({{{Σ }}}{SFR}), derived based on the Hα emissions, is strongly correlated with the M * surface density ({{{Σ }}}* ) on kiloparsec scales for star-forming galaxies and can be directly connected to the global star-forming sequence. This suggests that the global main sequence may be a consequence of a more fundamental relation on small scales. On the other hand, our result suggests that ∼20% of quiescent galaxies in our sample still have star formation activities in the outer region with lower specific star formation rate (SSFR) than typical star-forming galaxies. Meanwhile, we also find a tight correlation between {{{Σ }}}{{H}α } and {{{Σ }}}* for LI(N)ER regions, named the resolved “LI(N)ER” sequence, in quiescent galaxies, which is consistent with the scenario that LI(N)ER emissions are primarily powered by the hot, evolved stars as suggested in the literature.

  9. BVI CCD photometry of the broad main-sequence globular cluster NGC 1851

    International Nuclear Information System (INIS)

    Alcaino, G.; Liller, W.; Alvarado, F.; Wenderoth, E.

    1990-01-01

    Three-color CCD C-M diagrams are presented for the globular cluster NGC 1851, showing an extreme breadth of the main-sequence, similar to that of Omega Centauri. It is found that the main-sequence turnoff points are located at V(TO) = 19.44 + or - 0.10, with colors at B-V = 0.54 + or - 0.02, V-I = 0.61 + or - 0.02, and B-I = 1.15 + or - 0.03. The best fit to the VandenBerg and Bell (1985) isochrones is shown to be all C-M diagrams with Y = 0.20, Fe/H abundance ratio = -1.27, and (m-M)v = 15.45. It is concluded that NGC 1851 has a Delta V(TO - HB) = 3.34 + or - 0.10 and an age of 16 + or - 2 Gyr. 29 refs

  10. Radio emission from pre-main-sequence stars in Corona Australis

    International Nuclear Information System (INIS)

    Brown, A.

    1987-01-01

    The central region of the Corona Australis molecular cloud surrounding the stars R and TY CrA has been studied using the VLA at 6 cm. Eleven radio sources are detected including five associated with pre-main-sequence objects. The most striking is associated with the near-IR source IRS 7 and shows a complex structure comprising two strong pointlike sources positioned either side of the deeply embedded IR source and two extended lobes of radio emission. The IRS 7 radio source appears to be similar to that associated with Lynds 1551 IRS 5 but has a considerably larger angular size. The other detected sources include the massive pre-main-sequence star TY CrA, the near-IR sources IRS 1 and IRS 5, and the Herbig-Haro object HH 101. The stars R and T CrA were not detected. 35 references

  11. Mass loss from pre-main-sequence accretion disks. I - The accelerating wind of FU Orionis

    Science.gov (United States)

    Calvet, Nuria; Hartmann, Lee; Kenyon, Scott J.

    1993-01-01

    We present evidence that the wind of the pre-main-sequence object FU Orionis arises from the surface of the luminous accretion disk. A disk wind model calculated assuming radiative equilibrium explains the differential behavior of the observed asymmetric absorption-line profiles. The model predicts that strong lines should be asymmetric and blueshifted, while weak lines should be symmetric and double-peaked due to disk rotation, in agreement with observations. We propose that many blueshifted 'shell' absorption features are not produced in a true shell of material, but rather form in a differentially expanding wind that is rapidly rotating. The inference of rapid rotation supports the proposal that pre-main-sequence disk winds are rotationally driven.

  12. Turbulence and the Li abundance in main sequence and giant stars

    International Nuclear Information System (INIS)

    Charbonneau, P.; Michaud, G.

    1990-01-01

    Calculations of Li burning via turbulent transport are conducted to determine the extent to which observed Li abundances in first ascent giants constrain the various turbulence parameterizations used to model the main-sequence surface Li abundance evolution. A full time-dependent solution to the transport equation is performed, including nuclear reaction terms and evolutionary effects. It is found that turbulence can lead to the extreme Li underabundances observed in giants of M67 and NGC 752. Consideration is given to the possibility of using observations of Li abundances to discriminate between turbulent particle transport and meridional circulation transport. Numerical solutions of the turbulent diffusion coefficient of Vauclair (1988) is used to model the Hyades Li abundance gap. The astrophysical implications of the results for main-sequence and giant stars are discussed. 36 refs

  13. RADIO AND MID-INFRARED PROPERTIES OF COMPACT STARBURSTS: DISTANCING THEMSELVES FROM THE MAIN SEQUENCE

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, E. J. [Observatories of the Carnegie Institution for Science, 813 Santa Barbara Street, Pasadena, CA 91101 (United States); Stierwalt, S.; Armus, L. [Spitzer Science Center, California Institute of Technology, MC 314-6, Pasadena, CA 91125 (United States); Condon, J. J. [National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA 22903 (United States); Evans, A. S., E-mail: emurphy@obs.carnegiescience.edu [Department of Astronomy, University of Virginia, 530 McCormick Road, Charlottesville, VA 22904 (United States)

    2013-05-01

    We investigate the relationship between 8.44 GHz brightness temperatures and 1.4 to 8.44 GHz radio spectral indices with 6.2 {mu}m polycyclic aromatic hydrocarbon (PAH) emission and 9.7 {mu}m silicate absorption features for a sample of 36 local luminous and ultraluminous infrared galaxies. We find that galaxies having small 6.2 {mu}m PAH equivalent widths (EQWs), which signal the presence of weak PAH emission and/or an excess of very hot dust, also have flat spectral indices. The three active galactic nuclei (AGN) identified through their excessively large 8.44 GHz brightness temperatures are also identified as AGN via their small 6.2 {mu}m PAH EQWs. We also find that the flattening of the radio spectrum increases with increasing silicate optical depth, 8.44 GHz brightness temperature, and decreasing size of the radio source even after removing potential AGN, supporting the idea that compact starbursts show spectral flattening as the result of increased free-free absorption. These correlations additionally suggest that the dust obscuration in these galaxies must largely be coming from the vicinity of the compact starburst itself, and is not distributed throughout the (foreground) disk of the galaxy. Finally, we investigate the location of these infrared-bright systems relative to the main sequence (star formation rate versus stellar mass) of star-forming galaxies in the local universe. We find that the radio spectral indices of galaxies flatten with increasing distance above the main sequence, or in other words, with increasing specific star formation rate. This indicates that galaxies located above the main sequence, having high specific star formation rates, are typically compact starbursts hosting deeply embedded star formation that becomes more optically thick in the radio and infrared with increased distance above the main sequence.

  14. On the mass-spectrum relation for the main sequence stars

    International Nuclear Information System (INIS)

    Svechnikov, M.A.; Tajdakova, T.A.

    1984-01-01

    From 240 main-sequence stars with well-determined masses, a new mass-spectrum relation is obtained, which differs appreciably in certain intervals of spectral types from the mass-spectrum relations of Allen and Trimble. The accuracy of mass determination for the components of eclipsing binary systems of different types from their spectra given in the General Catalogue of Variable Stars (3rd edition) and in its supplements is evaluated

  15. Possible evidence for metal accretion onto the surfaces of metal-poor main-sequence stars

    Energy Technology Data Exchange (ETDEWEB)

    Hattori, Kohei; Yoshii, Yuzuru [Institute of Astronomy, School of Science, University of Tokyo, 2-21-1 Osawa, Mitaka, Tokyo 181-0015 (Japan); Beers, Timothy C. [National Optical Astronomy Observatories, Tucson, AZ 85719 (United States); Carollo, Daniela [Department of Physics and Astronomy, Macquarie University, Sydney, 2109 NSW (Australia); Lee, Young Sun, E-mail: khattori@ioa.s.u-tokyo.ac.jp [Department of Astronomy, New Mexico State University, Las Cruces, NM 88003 (United States)

    2014-04-01

    The entire evolution of the Milky Way, including its mass-assembly and star-formation history, is imprinted onto the chemo-dynamical distribution function of its member stars, f(x, v, [X/H]), in the multi-dimensional phase space spanned by position, velocity, and elemental abundance ratios. In particular, the chemo-dynamical distribution functions for low-mass stars (e.g., G- or K-type dwarfs) are precious tracers of the earliest stages of the Milky Way's formation, since their main-sequence lifetimes approach or exceed the age of the universe. A basic tenet of essentially all previous analyses is that the stellar metallicity, usually parameterized as [Fe/H], is conserved over time for main-sequence stars (at least those that have not been polluted due to mass transfer from binary companions). If this holds true, any correlations between metallicity and kinematics for long-lived main-sequence stars of different masses, effective temperatures, or spectral types must strictly be the same, since they reflect the same mass-assembly and star-formation histories. By analyzing a sample of nearby metal-poor halo and thick-disk stars on the main sequence, taken from Data Release 8 of the Sloan Digital Sky Survey, we find that the median metallicity of G-type dwarfs is systematically higher (by about 0.2 dex) than that of K-type dwarfs having the same median rotational velocity about the Galactic center. If it can be confirmed, this finding may invalidate the long-accepted assumption that the atmospheric metallicities of long-lived stars are conserved over time.

  16. Carbon, nitrogen, and oxygen abundances in main-sequence stars. II. 20 F and G stars

    International Nuclear Information System (INIS)

    Clegg, R.E.S.; Lambert, D.L.; Tomkin, J.

    1981-01-01

    High-resolution Reticon spectra of red and near-infrared C I, N I, and O I lines have been analyzed to determine C, N, and O abundances in a sample of 20 F and G main-sequence stars. Their iron abundances, which have been determined from analysis of additional Reticon spectra of red Fe I lines, cover the range -0.9< or =[Fe/H]< or =+0.4. Sulfur abundances have also been obtained

  17. Spectroscopic and asteroseismic analysis of the remarkable main-sequence A star KIC 11145123

    DEFF Research Database (Denmark)

    Takada-Hidai, Masahide; Kurtz, Donald W.; Shibahashi, Hiromoto

    2017-01-01

    A spectroscopic analysis was carried out to clarify the properties of KIC 11145123 - the first main-sequence star with a directly measured core-to-surface rotation profile - based on spectra observed with the High Dispersion Spectrograph (HDS) of the Subaru telescope. The atmospheric parameters (T......-eff = 7600 K, log g = 4.2, xi = 3.1 kms(-1) and [Fe/H] = -0.71 dex), the radial and rotation velocities, and elemental abundances were obtained by analysing line strengths and fitting line profiles, which were calculated with a 1D LTE model atmosphere. The main properties of KIC 11145123 are: (1) a low [Fe...

  18. THE 'MAIN SEQUENCE' OF EXPLOSIVE SOLAR ACTIVE REGIONS: DISCOVERY AND INTERPRETATION

    Energy Technology Data Exchange (ETDEWEB)

    Falconer, David A; Moore, Ronald L; Adams, Mitzi [Space Science Office, VP62, Marshall Space Flight Center, Huntsville, AL 35812 (United States); Gary, G. Allen [Center for Space Plasma and Aeronomic Research, University of Alabama in Huntsville, Huntsville, AL 35899 (United States)], E-mail: David.falconer@msfc.nasa.gov

    2009-08-01

    We examine the location and distribution of the production of coronal mass ejections (CMEs) and major flares by sunspot active regions in the phase space of two whole-active-region magnetic quantities measured from 1897 SOHO/MDI magnetograms. These magnetograms track the evolution of 44 active regions across the central disk of radius 0.5 R {sub Sun}. The two quantities are {sup L}WL{sub SG}, a gauge of the total free energy in an active region's magnetic field, and {sup L}{phi}, a measure of the active region's total magnetic flux. From these data and each active region's history of production of CMEs, X flares, and M flares, we find (1) that CME/flare-productive active regions are concentrated in a straight-line 'main sequence' in (log {sup L}WL{sub SG}, log {sup L}{phi}) space, (2) that main-sequence active regions have nearly their maximum attainable free magnetic energy, and (3) evidence that this arrangement plausibly results from equilibrium between input of free energy to an explosive active region's magnetic field in the chromosphere and corona by contortion of the field via convection in and below the photosphere and loss of free energy via CMEs, flares, and coronal heating, an equilibrium between energy gain and loss that is analogous to that of the main sequence of hydrogen-burning stars in (mass, luminosity) space.

  19. THE 'MAIN SEQUENCE' OF EXPLOSIVE SOLAR ACTIVE REGIONS: DISCOVERY AND INTERPRETATION

    International Nuclear Information System (INIS)

    Falconer, David A.; Moore, Ronald L.; Adams, Mitzi; Gary, G. Allen

    2009-01-01

    We examine the location and distribution of the production of coronal mass ejections (CMEs) and major flares by sunspot active regions in the phase space of two whole-active-region magnetic quantities measured from 1897 SOHO/MDI magnetograms. These magnetograms track the evolution of 44 active regions across the central disk of radius 0.5 R Sun . The two quantities are L WL SG , a gauge of the total free energy in an active region's magnetic field, and L Φ, a measure of the active region's total magnetic flux. From these data and each active region's history of production of CMEs, X flares, and M flares, we find (1) that CME/flare-productive active regions are concentrated in a straight-line 'main sequence' in (log L WL SG , log L Φ) space, (2) that main-sequence active regions have nearly their maximum attainable free magnetic energy, and (3) evidence that this arrangement plausibly results from equilibrium between input of free energy to an explosive active region's magnetic field in the chromosphere and corona by contortion of the field via convection in and below the photosphere and loss of free energy via CMEs, flares, and coronal heating, an equilibrium between energy gain and loss that is analogous to that of the main sequence of hydrogen-burning stars in (mass, luminosity) space.

  20. Discovery of three x-ray luminous pre-main-sequence stars

    International Nuclear Information System (INIS)

    Feigelson, E.D.; Kriss, G.A.

    1981-01-01

    Three X-ray sources found serendipitously in Einstein images of the Taurus-Auriga cloud complex were observed at the McGraw-Hill Observatory and are found to be associated with approx.12 mag stars with weak Hα emission. The stars lie on the edges of dark clouds and are spectroscopically similar to the least active emission-line pre-main-sequence stars. Although they lie well above the ZAMS in the H-R diagram, they do not exhibit ultraviolet excess, strong optical variability, or evidence for mass outflow/inflow characteristics of the more active T Tauri stars. Their only unusual property is high X-ray luminosity (approx.10 30 ergs s1). It is suggested that the X-ray emission from pre-main-sequence stars is not closely linked to the conditions giving rise to their unusual spectroscopic properties. The emission may instead represent an enhanced form of the coronal activity producing X-rays observed in late-type main-sequence stars

  1. Elevation or Suppression? The Resolved Star Formation Main Sequence of Galaxies with Two Different Assembly Modes

    Science.gov (United States)

    Liu, Qing; Wang, Enci; Lin, Zesen; Gao, Yulong; Liu, Haiyang; Berhane Teklu, Berzaf; Kong, Xu

    2018-04-01

    We investigate the spatially resolved star formation main sequence in star-forming galaxies using Integral Field Spectroscopic observations from the Mapping Nearby Galaxies at the Apache Point Observatory survey. We demonstrate that the correlation between the stellar mass surface density (Σ*) and star formation rate surface density (ΣSFR) holds down to the sub-galactic scale, leading to the sub-galactic main sequence (SGMS). By dividing galaxies into two populations based on their recent mass assembly modes, we find the resolved main sequence in galaxies with the “outside-in” mode is steeper than that in galaxies with the “inside-out” mode. This is also confirmed on a galaxy-by-galaxy level, where we find the distributions of SGMS slopes for individual galaxies are clearly separated for the two populations. When normalizing and stacking the SGMS of individual galaxies on one panel for the two populations, we find that the inner regions of galaxies with the “inside-out” mode statistically exhibit a suppression in star formation, with a less significant trend in the outer regions of galaxies with the “outside-in” mode. In contrast, the inner regions of galaxies with “outside-in” mode and the outer regions of galaxies with “inside-out” mode follow a slightly sublinear scaling relation with a slope ∼0.9, which is in good agreement with previous findings, suggesting that they are experiencing a universal regulation without influences of additional physical processes.

  2. Binary pulsar PSR 1718-19 contains a stripped main-sequence turn-off star

    International Nuclear Information System (INIS)

    Zwitter, T.

    1993-05-01

    Lyne et al. (1993) have recently announced the discovery of a 1-second globular cluster pulsar, 1718-19, in a 6.2-hour binary system which is embedded in a cloud of material originating from the companion star. However the incident flux of the pulsar's radiation on the companion is too low to ablate it and a main sequence companion is too small to fill its Roche lobe. Here I argue that the companion is a stripped turn-off star of 0.2-0.4 solar masses (M sun ) and with approx. 0.1M sun helium core. It has approx. 1.8-times larger radius than a main sequence star of equal mass. Its position in the Hertzsprung-Russell diagram overlaps that of a ∼ 0.65M sun main-sequence star. The evolutionary state of the companion and the highly magnetized slowly rotating neutron star place the system on the verge of the low mass X-ray binary phase. (author). 19 refs, 2 figs

  3. The V Band Empirical Mass-Luminosity Relation for Main Sequence Stars

    Science.gov (United States)

    Xia, F.; Fu, Y. N.

    2010-01-01

    Stellar mass is an indispensable parameter in the studies of stellar physics and stellar dynamics. On the one hand, the most reliable way to determine the stellar dynamical mass is via orbital determination of binaries. On the other hand, however, most stellar masses have to be estimated by using the mass-luminosity relation (MLR). Therefore, it is important to obtain the empirical MLR through fitting the data of stellar dynamical mass and luminosity. The effect of metallicity can make this relation disperse in the V-band, but studies show that this is mainly limited to the case when the stellar mass is less than 0.6M⊙. Recently, many relevant data have been accumulated for main sequence stars with larger mass, which make it possible to significantly improve the corresponding MLR. Using a fitting method which can reasonably assign weight to the observational data including two quantities with different dimensions, we obtain a V-band MLR based on the dynamical masses and luminosities of 203 main sequence stars. Compared with the previous work, the improved MLR is statistically significant, and the relative error of mass estimation reaches about 5%. Therefore, our MLR is useful not only in studies of statistical nature, but also in studies of concrete stellar systems, such as the long-term dynamical study and the short-term positioning study of a specific multiple star system.

  4. The V-band Empirical Mass-luminosity Relation for Main Sequence Stars

    Science.gov (United States)

    Xia, Fang; Fu, Yan-Ning

    2010-07-01

    Stellar mass is an indispensable parameter in the studies of stellar physics and stellar dynamics. On the one hand, the most reliable way to determine the stellar dynamical mass is via orbital determinations of binaries. On the other hand, however, most stellar masses have to be estimated by using the mass luminosity relation (MLR). Therefore, it is important to obtain the empirical MLR through fitting the data of stellar dynamical mass and luminosity. The effect of metallicity can make this relation disperse in the V-band, but studies show that this is mainly limited to the case when the stellar mass is less than 0.6M⊙ Recently, many relevant data have been accumulated for main sequence stars with larger masses, which make it possible to significantly improve the corresponding MLR. Using a fitting method which can reasonably assign weights to the observational data including two quantities with different dimensions, we obtain a V-band MLR based on the dynamical masses and luminosities of 203 main sequence stars. In comparison with the previous work, the improved MLR is statistically significant, and the relative error of mass estimation reaches about 5%. Therefore, our MLR is useful not only in the studies of statistical nature, but also in the studies of concrete stellar systems, such as the long-term dynamical study and the short-term positioning study of a specific multiple star system.

  5. BVRI main-sequence photometry of the globular cluster M4

    International Nuclear Information System (INIS)

    Alcaino, G.; Liller, W.

    1984-01-01

    We present BV and RI photographic photometry of 1421 and 189 stars, respectively, in the intermediate metallicity globular cluster M4 (NGC 6121). This investigation includes the first results of RI main-sequence photometry of a globular cluster. The use of longer wavelengths and longer color baselines provides the potential of improved isochrone fittings and underscores the urgent need for calculations of RI synthetic isochrones to be compared with observations. The Pickering-Racine wedge was used with the ESO 3.6 m telescope, the Las Campanas 2.5 m du Pont telescope, and the CTIO 1 m Yale telescope to extend the photoelectric limit from Vroughly-equal16.1 to Vroughly-equal19.1. We have determined the position of the main-sequence turnoff to lie at V = 16.6 +- 0.2 (m.e.) and B-V = 0.80 +- 0.03 (m.e.). A comparison of our BV observations with the CCD data of Richer and Fahlman shows excellent agreement: the two fifucial main sequences agree at all points to within 0.025 mag and, on average, to 0.013 mag. For the cluster we derive a distance modulus (m-M)/sub V/ = 12.52 +- 0.2 and reddening E(B-V) = 0.44 +- 0.03, results which confirm that at a distance of 2 kpc, M4 is the closest globular clusters to the Sun. Using the isochrones of VandenBerg, we deduce an age 13 +- 2 Gyr. As noted in several other investigations, there is a striking deficiency of stars in certain parts of the color-magnitude diagram; in M4 we find a pronounced gap over approx.0.6 mag at the base of the subgiant branch

  6. Discovery and characterization of 3000+ main-sequence binaries from APOGEE spectra

    Science.gov (United States)

    El-Badry, Kareem; Ting, Yuan-Sen; Rix, Hans-Walter; Quataert, Eliot; Weisz, Daniel R.; Cargile, Phillip; Conroy, Charlie; Hogg, David W.; Bergemann, Maria; Liu, Chao

    2018-05-01

    We develop a data-driven spectral model for identifying and characterizing spatially unresolved multiple-star systems and apply it to APOGEE DR13 spectra of main-sequence stars. Binaries and triples are identified as targets whose spectra can be significantly better fit by a superposition of two or three model spectra, drawn from the same isochrone, than any single-star model. From an initial sample of ˜20 000 main-sequence targets, we identify ˜2500 binaries in which both the primary and secondary stars contribute detectably to the spectrum, simultaneously fitting for the velocities and stellar parameters of both components. We additionally identify and fit ˜200 triple systems, as well as ˜700 velocity-variable systems in which the secondary does not contribute detectably to the spectrum. Our model simplifies the process of simultaneously fitting single- or multi-epoch spectra with composite models and does not depend on a velocity offset between the two components of a binary, making it sensitive to traditionally undetectable systems with periods of hundreds or thousands of years. In agreement with conventional expectations, almost all the spectrally identified binaries with measured parallaxes fall above the main sequence in the colour-magnitude diagram. We find excellent agreement between spectrally and dynamically inferred mass ratios for the ˜600 binaries in which a dynamical mass ratio can be measured from multi-epoch radial velocities. We obtain full orbital solutions for 64 systems, including 14 close binaries within hierarchical triples. We make available catalogues of stellar parameters, abundances, mass ratios, and orbital parameters.

  7. Systematic main sequence photometry of globular cluster stars for age determination

    International Nuclear Information System (INIS)

    Alcaino, G.; Liller, W.

    1984-01-01

    The individual photometric study of the coeval stars in globular clusters presents one of the best observational tests of the stellar evolution theory. Our own globular cluster system provides fundamental clues to the dynamical and chemical evolutionary history of the galaxy, and the study of their ages give a lower limit to the age of the galaxy as well as to that of the universe. The authors have undertaken a systematic research program, and discuss the ages deduced by fitting main sequence photometry to theoretical isochrones of six galactic globular clusters: M4, M22, M30, NGC 288, NGC 3201 and NGC 6397. (Auth.)

  8. Asteroseismic measurement of surface-to-core rotation in a main-sequence star*

    Directory of Open Access Journals (Sweden)

    Kurtz Donald W.

    2015-01-01

    Full Text Available We have discovered rotationally split core g-mode triplets and surface p-mode triplets and quintuplets in a terminal age main-sequence A star, KIC 11145123, that shows both δ Sct p-mode pulsations and γ Dor g-mode pulsations. This gives the first robust determination of the rotation of the deep core and surface of a main-sequence star, essentially model-independently. We find its rotation to be nearly uniform with a period near 100 d, but we show with high confidence that the surface rotates slightly faster than the core. A strong angular momentum transfer mechanism must be operating to produce the nearly rigid rotation, and a mechanism other than viscosity must be operating to produce a more rapidly rotating surface than core. Our asteroseismic result, along with previous asteroseismic constraints on internal rotation in some B stars, and measurements of internal rotation in some subgiant, giant and white dwarf stars, has made angular momentum transport in stars throughout their lifetimes an observational science.

  9. ABSOLUTE PROPERTIES OF THE PRE-MAIN-SEQUENCE ECLIPSING BINARY STAR NP PERSEI

    Energy Technology Data Exchange (ETDEWEB)

    Lacy, Claud H. Sandberg [Physics Department, University of Arkansas, Fayetteville, AR 72701 (United States); Fekel, Francis C.; Muterspaugh, Matthew W. [Center of Excellence in Information Systems, Tennessee State University, Nashville, TN 37209 (United States); Pavlovski, Krešimir [Department of Physics, Faculty of Science, University of Zagreb, Bijenička cesta 32, 10000 Zagreb (Croatia); Torres, Guillermo, E-mail: clacy@uark.edu, E-mail: fekel@evans.tsuniv.edu, E-mail: pavlovski@phy.hr, E-mail: gtorres@cfa.harvard.edu, E-mail: matthew1@coe.tsuniv.edu [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)

    2016-07-01

    NP Per is a well-detached, 2.2 day eclipsing binary whose components are both pre-main-sequence stars that are still contracting toward the main-sequence phase of evolution. We report extensive photometric and spectroscopic observations with which we have determined their properties accurately. Their surface temperatures are quite different: 6420 ± 90 K for the larger F5 primary star and 4540 ± 160 K for the smaller K5e star. Their masses and radii are 1.3207 ± 0.0087 solar masses and 1.372 ± 0.013 solar radii for the primary, and 1.0456 ± 0.0046 solar masses and 1.229 ± 0.013 solar radii for the secondary. The orbital period is variable over long periods of time. A comparison of the observations with current stellar evolution models from MESA indicates that the stars cannot be fit at a single age: the secondary appears significantly younger than the primary. If the stars are assumed to be coeval and to have the age of the primary (17 Myr), then the secondary is larger and cooler than predicted by current models. The H α spectral line of the secondary component is completely filled by, presumably, chromospheric emission due to a magnetic activity cycle.

  10. Impacts of WIMP dark matter upon stellar evolution: main-sequence stars

    CERN Document Server

    Scott, Pat; Edsjo, Joakim

    2008-01-01

    The presence of large amounts of WIMP dark matter in stellar cores has been shown to have significant effects upon models of stellar evolution. We present a series of detailed grids of WIMP-influenced stellar models for main sequence stars, computed using the DarkStars code. We describe the changes in stellar structure and main sequence evolution which occur for masses ranging from 0.3 to 2.0 solar masses and metallicities from Z = 0.0003-0.02, as a function of the rate of energy injection by WIMPs. We then go on to show what rates of energy injection can be obtained using realistic orbital parameters for stars near supermassive black holes, including detailed considerations of dark matter halo velocity and density profiles. Capture and annihilation rates are strongly boosted when stars follow elliptical rather than circular orbits, causing WIMP annihilation to provide up to 100 times the energy of hydrogen fusion in stars at the Galactic centre.

  11. Characterizing Intermediate-Mass, Pre-Main-Sequence Stars via X-Ray Emision

    Science.gov (United States)

    Haze Nunez, Evan; Povich, Matthew Samuel; Binder, Breanna Arlene; Broos, Patrick; Townsley, Leisa K.

    2018-01-01

    The X-ray emission from intermediate-mass, pre-main-sequence stars (IMPS) can provide useful constraints on the ages of very young (${getting power from the gravitational contraction of the star. Main-sequence late-B and A-type stars are not expected to be strong X-ray emitters, because they lack the both strong winds of more massive stars and the magneto-coronal activity of lower-mass stars. There is, however, mounting evidence that IMPS are powerful intrinsic x-ray emitters during their convection-dominated early evolution, before the development and rapid growth of a radiation zone. We present our prime candidates for intrinsic, coronal X-ray emission from IMPS identified in the Chandra Carina Complex Project. The Carina massive star-forming complex is of special interest due to the wide variation of star formation stages within the region. Candidate IMPS were identified using infrared spectral energy distribution (SED) models. X-ray properties, including thermal plasma temperatures and absorption-corrected fluxes, were derived from XSPEC fits performed using absorption ($N_{H}$) constrained by the extinction values returned by the infrared SED fits. We find that IMPS have systematically higher X-ray luminosities compared to their lower-mass cousins, the TTauri stars.This work is supported by the National Science Foundation under grant CAREER-1454334 and by NASA through Chandra Award 18200040.

  12. Effects of main-sequence mass loss on the turnoff ages of globular clusters

    International Nuclear Information System (INIS)

    Guzik, J.A.

    1989-01-01

    Willson, Bowen, and Struck-Marcell have proposed that globular cluster main-sequence turnoff ages can be reconciled with the lower ages of the Galaxy and universe deduced from other methods by incorporating an epoch of early main-sequence mass-loss by stars of spectral types A through early-F. The proposed mass loss is pulsation-driven, and facilitated by rapid rotation. This paper presents stellar evolution calculations of Pop. II (Z = 0.001) mass-losing stars of initial mass 0.8 to 1.6 M circle dot , with exponentially-decreasing mass loss rates of e-folding times 0.5 to 2.0 Gyr, evolving to a final mass of 0.7 M circle dot . The calculations indicate that a globular cluster with apparent turnoff age 18 Gyr could have an actual age as low as ∼12 Gyr. Observational implications that may help to verify the hypothesis, e.g. low C/N abundance ratios among red giants following first dredge-up, blue stragglers, red giant deficiencies, and signatures in cluster mass/luminosity functions, are also discussed.25 refs., 4 figs., 3 tabs

  13. Discovery of Extended Main-sequence Turnoffs in Four Young Massive Clusters in the Magellanic Clouds

    Energy Technology Data Exchange (ETDEWEB)

    Li, Chengyuan [Department of Physics and Astronomy, Macquarie University, Sydney, NSW 2109 (Australia); De Grijs, Richard [Kavli Institute for Astronomy and Astrophysics and Department of Astronomy, Peking University, Yi He Yuan Lu 5, Hai Dian District, Beijing 100871 (China); Deng, Licai [Key Laboratory for Optical Astronomy, National Astronomical Observatories, Chinese Academy of Sciences, 20A Datun Road, Chaoyang District, Beijing 100012 (China); Milone, Antonino P. [Research School of Astronomy and Astrophysics, Australian National University, Mt. Stromlo Observatory, Cotter Road, Weston, ACT 2611 (Australia)

    2017-08-01

    An increasing number of young massive clusters (YMCs) in the Magellanic Clouds have been found to exhibit bimodal or extended main sequences (MSs) in their color–magnitude diagrams (CMDs). These features are usually interpreted in terms of a coeval stellar population with different stellar rotational rates, where the blue and red MS stars are populated by non- (or slowly) and rapidly rotating stellar populations, respectively. However, some studies have shown that an age spread of several million years is required to reproduce the observed wide turnoff regions in some YMCs. Here we present the ultraviolet–visual CMDs of four Large and Small Magellanic Cloud YMCs, NGC 330, NGC 1805, NGC 1818, and NGC 2164, based on high-precision Hubble Space Telescope photometry. We show that they all exhibit extended main-sequence turnoffs (MSTOs). The importance of age spreads and stellar rotation in reproducing the observations is investigated. The observed extended MSTOs cannot be explained by stellar rotation alone. Adopting an age spread of 35–50 Myr can alleviate this difficulty. We conclude that stars in these clusters are characterized by ranges in both their ages and rotation properties, but the origin of the age spread in these clusters remains unknown.

  14. The Physical Driver of the Optical Eigenvector 1 in Quasar Main Sequence

    Energy Technology Data Exchange (ETDEWEB)

    Panda, Swayamtrupta; Czerny, Bożena [Center for Theoretical Physics, Polish Academy of Sciences, Warsaw (Poland); Nicolaus Copernicus Astronomical Center, Polish Academy of Sciences, Warsaw (Poland); Wildy, Conor, E-mail: panda@cft.edu.pl [Center for Theoretical Physics, Polish Academy of Sciences, Warsaw (Poland)

    2017-11-07

    Quasars are complex sources, characterized by broad band spectra from radio through optical to X-ray band, with numerous emission and absorption features. This complexity leads to rich diagnostics. However, Boroson and Green (1992) used Principal Component Analysis (PCA), and with this analysis they were able to show significant correlations between the measured parameters. The leading component, related to Eigenvector 1 (EV1) was dominated by the anticorrelation between the FeII optical emission and [OIII] line and EV1 alone contained 30% of the total variance. It opened a way in defining a quasar main sequence, in close analogy to the stellar main sequence on the Hertzsprung-Russel (HR) diagram (Sulentic et al., 2001). The question still remains which of the basic theoretically motivated parameters of an active nucleus (Eddington ratio, black hole mass, accretion rate, spin, and viewing angle) is the main driver behind the EV1. Here we limit ourselves to the optical waveband, and concentrate on theoretical modeling the FeII to Hβ ratio, and we test the hypothesis that the physical driver of EV1 is the maximum of the accretion disk temperature, reflected in the shape of the spectral energy distribution (SED). We performed computations of the Hβ and optical FeII for a broad range of SED peak position using CLOUDY photoionisation code. We assumed that both Hβ and FeII emission come from the Broad Line Region represented as a constant density cloud in a plane-parallel geometry. We expected that a hotter disk continuum will lead to more efficient production of FeII but our computations show that the FeII to Hβ ratio actually drops with the rise of the disk temperature. Thus either hypothesis is incorrect, or approximations used in our paper for the description of the line emissivity is inadequate.

  15. The Physical Driver of the Optical Eigenvector 1 in Quasar Main Sequence

    Directory of Open Access Journals (Sweden)

    Swayamtrupta Panda

    2017-11-01

    Full Text Available Quasars are complex sources, characterized by broad band spectra from radio through optical to X-ray band, with numerous emission and absorption features. This complexity leads to rich diagnostics. However, Boroson and Green (1992 used Principal Component Analysis (PCA, and with this analysis they were able to show significant correlations between the measured parameters. The leading component, related to Eigenvector 1 (EV1 was dominated by the anticorrelation between the FeII optical emission and [OIII] line and EV1 alone contained 30% of the total variance. It opened a way in defining a quasar main sequence, in close analogy to the stellar main sequence on the Hertzsprung-Russel (HR diagram (Sulentic et al., 2001. The question still remains which of the basic theoretically motivated parameters of an active nucleus (Eddington ratio, black hole mass, accretion rate, spin, and viewing angle is the main driver behind the EV1. Here we limit ourselves to the optical waveband, and concentrate on theoretical modeling the FeII to Hβ ratio, and we test the hypothesis that the physical driver of EV1 is the maximum of the accretion disk temperature, reflected in the shape of the spectral energy distribution (SED. We performed computations of the Hβ and optical FeII for a broad range of SED peak position using CLOUDY photoionisation code. We assumed that both Hβ and FeII emission come from the Broad Line Region represented as a constant density cloud in a plane-parallel geometry. We expected that a hotter disk continuum will lead to more efficient production of FeII but our computations show that the FeII to Hβ ratio actually drops with the rise of the disk temperature. Thus either hypothesis is incorrect, or approximations used in our paper for the description of the line emissivity is inadequate.

  16. A Population Study of Wide-Separation Brown Dwarf Companions to Main Sequence Stars

    Science.gov (United States)

    Smith, Jeffrey J.

    2005-01-01

    Increased interest in infrared astronomy has opened the frontier to study cooler objects that shed significant light on the formation of planetary systems. Brown dwarf research provides a wealth of information useful for sorting through a myriad of proposed formation theories. Our study combines observational data from 2MASS with rigorous computer simulations to estimate the true population of long-range (greater than 1000 AU) brown dwarf companions in the solar neighborhood (less than 25 pc from Earth). Expanding on Gizis et al. (2001), we have found the margin of error in previous estimates to be significantly underestimated after we included orbit eccentricity, longitude of pericenter, angle of inclination, field star density, and primary and secondary luminosities as parameters influencing the companion systems in observational studies. We apply our simulation results to current L- and T-dwarf catalogs to provide updated estimates on the frequency of wide-separation brown dwarf companions to main sequence stars.

  17. Effect of Generalized Uncertainty Principle on Main-Sequence Stars and White Dwarfs

    Directory of Open Access Journals (Sweden)

    Mohamed Moussa

    2015-01-01

    Full Text Available This paper addresses the effect of generalized uncertainty principle, emerged from different approaches of quantum gravity within Planck scale, on thermodynamic properties of photon, nonrelativistic ideal gases, and degenerate fermions. A modification in pressure, particle number, and energy density are calculated. Astrophysical objects such as main-sequence stars and white dwarfs are examined and discussed as an application. A modification in Lane-Emden equation due to a change in a polytropic relation caused by the presence of quantum gravity is investigated. The applicable range of quantum gravity parameters is estimated. The bounds in the perturbed parameters are relatively large but they may be considered reasonable values in the astrophysical regime.

  18. New radio detections of early-type pre-main-sequence stars

    Science.gov (United States)

    Skinner, Stephen L.; Brown, Alexander; Linsky, Jeffrey L.

    1990-01-01

    Results of VLA radio continuum observations of 13 early-type pre-main-sequence stars selected from the 1984 catalog of Finkenzeller and Mundt are presented. The stars HD 259431 and MWC 1080 were detected at 3.6 cm, while HD 200775 and TY CrA were detected at both 3.6 and 6 cm. The flux density of HD 200775 has a frequency dependence consistent with the behavior expected for free-free emission originating in a fully ionized wind. However, an observation in A configuration suggests that the source geometry may not be spherically symmetric. In contrast, the spectral index of TY CrA is negative with a flux behavior implying nonthermal emission. The physical mechanism responsible for the nonthermal emission has not yet been identified, although gyrosynchrotron and synchrotron processes cannot be ruled out.

  19. THE DISCOVERY OF SOLAR-LIKE ACTIVITY CYCLES BEYOND THE END OF THE MAIN SEQUENCE?

    Energy Technology Data Exchange (ETDEWEB)

    Route, Matthew, E-mail: mroute@purdue.edu [Research Computing, Information Technology at Purdue, Purdue University, 155 S. Grant Street, West Lafayette, IN 47907 (United States)

    2016-10-20

    The long-term magnetic behavior of objects near the cooler end of the stellar main sequence is poorly understood. Most theoretical work on the generation of magnetism in these ultracool dwarfs (spectral type ≥M7 stars and brown dwarfs) suggests that their magnetic fields should not change in strength and direction. Using polarized radio emission measurements of their magnetic field orientations, I demonstrate that these cool, low-mass, fully convective objects appear to undergo magnetic polarity reversals analogous to those that occur on the Sun. This powerful new technique potentially indicates that the patterns of magnetic activity displayed by the Sun continue to exist, despite the fully convective interiors of these objects, in contravention of several leading theories of the generation of magnetic fields by internal dynamos.

  20. New radio detections of early-type pre-main-sequence stars

    International Nuclear Information System (INIS)

    Skinner, S.L.; Brown, A.; Linsky, J.L.

    1990-01-01

    Results of VLA radio continuum observations of 13 early-type pre-main-sequence stars selected from the 1984 catalog of Finkenzeller and Mundt are presented. The stars HD 259431 and MWC 1080 were detected at 3.6 cm, while HD 200775 and TY CrA were detected at both 3.6 and 6 cm. The flux density of HD 200775 has a frequency dependence consistent with the behavior expected for free-free emission originating in a fully ionized wind. However, an observation in A configuration suggests that the source geometry may not be spherically symmetric. In contrast, the spectral index of TY CrA is negative with a flux behavior implying nonthermal emission. The physical mechanism responsible for the nonthermal emission has not yet been identified, although gyrosynchrotron and synchrotron processes cannot be ruled out. 32 refs

  1. Making Sense of Atmospheric Models and Fundamental Stellar Properties at the Bottom of the Main Sequence

    Science.gov (United States)

    Dieterich, Sergio; Henry, Todd; Jao, W.-C.; Washington, Robert; Silverstein, Michele; Winters, J.; RECONS

    2018-01-01

    We present a detailed comparison of atmospheric model predictions and photometric observations for late M and L dwarfs. We discuss which wavelength regions are best for determining the fundamental properties of these cool stellar and substellar atmospheres and use this analysis to refine the HR diagram for the hydrogen burning limit first presented in 2014. We also add several new objects to the HR diagram and find little qualitative difference in the HR diagram's overall morphology when compared to our 2014 results. The L2 dwarf 2MASS 0523-1403 remains the smallest hydrogen burning star for which we calculated a radius, thus likely indicating the end of the stellar main sequence. This work is supported by the NSF Astronomy and Astrophysics Postdoctoral Fellowship program through grant AST-1400680.

  2. Globules, dark clouds, and low mass pre-main sequence stars

    International Nuclear Information System (INIS)

    Hyland, A.R.

    1981-01-01

    The current observational and theoretical literature on Bok globules and their relationship to star formation is reviewed. Recent observations of globules at optical, infrared, and far infrared wavelengths are shown to provide important constraints on their structure and evolutionary status, and the suggestion that many globules are gravitationally unstable is seriously questioned. Dark clouds associated with T associations are well-known sites of recent and continuing star formation. In recent years molecular observations and far infrared surveys have provided maps of such regions from which possible sites of star formation may be identified. Optical (Hα) and near infrared surveys have enabled a clear identification of pre-main sequence (PMS) objects within the clouds. Methods of distinguishing these from background objects and the nature of their infrared excesses are examined in the light of recent observations in the near and far infrared. The perennial question as to the existence of anomalous reddening within dark clouds is also investigated. (Auth.)

  3. New Insights into the Formation of the Blue Main Sequence in NGC 1850

    Science.gov (United States)

    Yang, Yujiao; Li, Chengyuan; Deng, Licai; de Grijs, Richard; Milone, Antonino P.

    2018-06-01

    Recent discoveries of bimodal main sequences (MSs) associated with young clusters (with ages ≲1 Gyr) in the Magellanic Clouds have drawn a lot of attention. One of the prevailing formation scenarios attributes these split MSs to a bimodal distribution in stellar rotation rates, with most stars belonging to a rapidly rotating population. In this scenario, only a small fraction of stars populating a secondary blue sequence are slowly or non-rotating stars. Here, we focus on the blue MS in the young cluster NGC 1850. We compare the cumulative number fraction of the observed blue-MS stars to that of the high-mass-ratio binary systems at different radii. The cumulative distributions of both populations exhibit a clear anti-correlation, characterized by a highly significant Pearson coefficient of ‑0.97. Our observations are consistent with the possibility that blue-MS stars are low-mass-ratio binaries, and therefore their dynamical disruption is still ongoing. High-mass-ratio binaries, on the other hand, are more centrally concentrated.

  4. Hubble Tarantula Treasury Project - VI. Identification of Pre-Main-Sequence Stars using Machine Learning techniques

    Science.gov (United States)

    Ksoll, Victor F.; Gouliermis, Dimitrios A.; Klessen, Ralf S.; Grebel, Eva K.; Sabbi, Elena; Anderson, Jay; Lennon, Daniel J.; Cignoni, Michele; de Marchi, Guido; Smith, Linda J.; Tosi, Monica; van der Marel, Roeland P.

    2018-05-01

    The Hubble Tarantula Treasury Project (HTTP) has provided an unprecedented photometric coverage of the entire star-burst region of 30 Doradus down to the half Solar mass limit. We use the deep stellar catalogue of HTTP to identify all the pre-main-sequence (PMS) stars of the region, i.e., stars that have not started their lives on the main-sequence yet. The photometric distinction of these stars from the more evolved populations is not a trivial task due to several factors that alter their colour-magnitude diagram positions. The identification of PMS stars requires, thus, sophisticated statistical methods. We employ Machine Learning Classification techniques on the HTTP survey of more than 800,000 sources to identify the PMS stellar content of the observed field. Our methodology consists of 1) carefully selecting the most probable low-mass PMS stellar population of the star-forming cluster NGC2070, 2) using this sample to train classification algorithms to build a predictive model for PMS stars, and 3) applying this model in order to identify the most probable PMS content across the entire Tarantula Nebula. We employ Decision Tree, Random Forest and Support Vector Machine classifiers to categorise the stars as PMS and Non-PMS. The Random Forest and Support Vector Machine provided the most accurate models, predicting about 20,000 sources with a candidateship probability higher than 50 percent, and almost 10,000 PMS candidates with a probability higher than 95 percent. This is the richest and most accurate photometric catalogue of extragalactic PMS candidates across the extent of a whole star-forming complex.

  5. Chemically Dissected Rotation Curves of the Galactic Bulge from Main-sequence Proper Motions

    Science.gov (United States)

    Clarkson, William I.; Calamida, Annalisa; Sahu, Kailash C.; Brown, Thomas M.; Gennaro, Mario; Avila, Roberto J.; Valenti, Jeff; Debattista, Victor P.; Rich, R. Michael; Minniti, Dante; Zoccali, Manuela; Aufdemberge, Emily R.

    2018-05-01

    We report results from an exploratory study implementing a new probe of Galactic evolution using archival Hubble Space Telescope imaging observations. Precise proper motions are combined with photometric relative metallicity and temperature indices, to produce the proper-motion rotation curves of the Galactic bulge separately for metal-poor and metal-rich main-sequence samples. This provides a “pencil-beam” complement to large-scale wide-field surveys, which to date have focused on the more traditional bright giant branch tracers. We find strong evidence that the Galactic bulge rotation curves drawn from “metal-rich” and “metal-poor” samples are indeed discrepant. The “metal-rich” sample shows greater rotation amplitude and a steeper gradient against line-of-sight distance, as well as possibly a stronger central concentration along the line of sight. This may represent a new detection of differing orbital anisotropy between metal-rich and metal-poor bulge objects. We also investigate selection effects that would be implied for the longitudinal proper-motion cut often used to isolate a “pure-bulge” sample. Extensive investigation of synthetic stellar populations suggests that instrumental and observational artifacts are unlikely to account for the observed rotation curve differences. Thus, proper-motion-based rotation curves can be used to probe chemodynamical correlations for main-sequence tracer stars, which are orders of magnitude more numerous in the Galactic bulge than the bright giant branch tracers. We discuss briefly the prospect of using this new tool to constrain detailed models of Galactic formation and evolution. Based on observations made with the NASA/ESA Hubble Space Telescope and obtained from the data archive at the Space Telescope Science Institute. STScI is operated by the Association of Universities for Research in Astronomy, Inc., under NASA contract NAS 5-26555.

  6. AN OBJECTIVE DEFINITION FOR THE MAIN SEQUENCE OF STAR-FORMING GALAXIES

    Energy Technology Data Exchange (ETDEWEB)

    Renzini, Alvio [INAF—Osservatorio Astronomico di Padova, Vicolo dell’Osservatorio 5, I-35122 Padova (Italy); Peng, Ying-jie, E-mail: alvio.renzini@oapd.inaf.it, E-mail: y.peng@mrao.cam.ac.uk [Cavendish Laboratory, University of Cambridge, 19 J. J. Thomson Avenue, Cambridge CB3 0HE (United Kingdom)

    2015-03-10

    The main sequence (MS) of star-forming (SF) galaxies plays a fundamental role in driving galaxy evolution and our efforts to understand it. However, different studies find significant differences in the normalization, slope, and shape of the MS. These discrepancies arise mainly from the different selection criteria adopted to isolate SF galaxies, which may include or exclude galaxies with a specific star formation rate (SFR) substantially below the MS value. To obviate this limitation of all current criteria, we propose an objective definition of the MS that does not rely at all on a pre-selection of SF galaxies. Constructing the 3D SFR–mass–number plot, the MS is then defined as the ridge line of the SF peak, as illustrated with various figures. The advantages of such a definition are manifold. If generally adopted, it will facilitate the inter-comparison of results from different groups using the same SFR and stellar mass diagnostics, or it will highlight the relative systematics of different diagnostics. All of this could help to understand MS galaxies as systems in a quasi-steady state equilibrium and would also provide a more objective criterion for identifying quenching galaxies.

  7. AN OBJECTIVE DEFINITION FOR THE MAIN SEQUENCE OF STAR-FORMING GALAXIES

    International Nuclear Information System (INIS)

    Renzini, Alvio; Peng, Ying-jie

    2015-01-01

    The main sequence (MS) of star-forming (SF) galaxies plays a fundamental role in driving galaxy evolution and our efforts to understand it. However, different studies find significant differences in the normalization, slope, and shape of the MS. These discrepancies arise mainly from the different selection criteria adopted to isolate SF galaxies, which may include or exclude galaxies with a specific star formation rate (SFR) substantially below the MS value. To obviate this limitation of all current criteria, we propose an objective definition of the MS that does not rely at all on a pre-selection of SF galaxies. Constructing the 3D SFR–mass–number plot, the MS is then defined as the ridge line of the SF peak, as illustrated with various figures. The advantages of such a definition are manifold. If generally adopted, it will facilitate the inter-comparison of results from different groups using the same SFR and stellar mass diagnostics, or it will highlight the relative systematics of different diagnostics. All of this could help to understand MS galaxies as systems in a quasi-steady state equilibrium and would also provide a more objective criterion for identifying quenching galaxies

  8. INTRINSIC COLORS, TEMPERATURES, AND BOLOMETRIC CORRECTIONS OF PRE-MAIN-SEQUENCE STARS

    Energy Technology Data Exchange (ETDEWEB)

    Pecaut, Mark J.; Mamajek, Eric E. [University of Rochester, Department of Physics and Astronomy, Rochester, NY 14627-0171 (United States)

    2013-09-01

    We present an analysis of the intrinsic colors and temperatures of 5-30 Myr old pre-main-sequence (pre-MS) stars using the F0- through M9-type members of nearby, negligibly reddened groups: the η Cha cluster, the TW Hydra Association, the β Pic Moving Group, and the Tucana-Horologium Association. To check the consistency of spectral types from the literature, we estimate new spectral types for 52 nearby pre-MS stars with spectral types F3 through M4 using optical spectra taken with the SMARTS 1.5 m telescope. Combining these new types with published spectral types and photometry from the literature (Johnson-Cousins BVI{sub C} , 2MASS JHK{sub S} and WISE W1, W2, W3, and W4), we derive a new empirical spectral type-color sequence for 5-30 Myr old pre-MS stars. Colors for pre-MS stars match dwarf colors for some spectral types and colors, but for other spectral types and colors, deviations can exceed 0.3 mag. We estimate effective temperatures (T {sub eff}) and bolometric corrections (BCs) for our pre-MS star sample through comparing their photometry to synthetic photometry generated using the BT-Settl grid of model atmosphere spectra. We derive a new T {sub eff} and BC scale for pre-MS stars, which should be a more appropriate match for T Tauri stars than often-adopted dwarf star scales. While our new T {sub eff} scale for pre-MS stars is within ≅100 K of dwarfs at a given spectral type for stars sequence for O9V-M9V MS stars based on an extensive literature survey, (2) a revised Q-method relation for dereddening UBV photometry of OB-type stars, and (3) introduce two candidate spectral standard stars as representatives of spectral types K8V and K9V.

  9. An extensive VLT/X-shooter library of photospheric templates of pre-main sequence stars

    Science.gov (United States)

    Manara, C. F.; Frasca, A.; Alcalá, J. M.; Natta, A.; Stelzer, B.; Testi, L.

    2017-09-01

    Context. Studies of the formation and evolution of young stars and their disks rely on knowledge of the stellar parameters of the young stars. The derivation of these parameters is commonly based on comparison with photospheric template spectra. Furthermore, chromospheric emission in young active stars impacts the measurement of mass accretion rates, a key quantity for studying disk evolution. Aims: Here we derive stellar properties of low-mass (M⋆≲ 2 M⊙) pre-main sequence stars without disks, which represent ideal photospheric templates for studies of young stars. We also use these spectra to constrain the impact of chromospheric emission on the measurements of mass accretion rates. The spectra are reduced, flux-calibrated, and corrected for telluric absorption, and are made available to the community. Methods: We derive the spectral type for our targets by analyzing the photospheric molecular features present in their VLT/X-shooter spectra by means of spectral indices and comparison of the relative strength of photospheric absorption features. We also measure effective temperature, gravity, projected rotational velocity, and radial velocity from our spectra by fitting them with synthetic spectra with the ROTFIT tool. The targets have negligible extinction (AVpresented in our previous publication. We perform synthetic photometry on the spectra to derive the typical colors of young stars in different filters. We measure the luminosity of the emission lines present in the spectra and estimate the noise due to chromospheric emission in the measurements of accretion luminosity in accreting stars. Results: We provide a calibration of the photospheric colors of young pre-main sequence stars as a function of their spectral type in a set of standard broad-band optical and near-infrared filters. The logarithm of the noise on the accretion luminosity normalized to the stellar luminosity is roughly constant and equal to -2.3 for targets with masses larger than 1 solar

  10. Galactic chemical evolution with main-sequence mass loss and the distribution of F and G dwarfs

    International Nuclear Information System (INIS)

    Guzik, J.A.; Struck-Marcell, C.

    1988-01-01

    Simple closed galactic chemical-evolution models incorporating early main-sequence stellar mass loss have been developed for disk ages of 5, 10, and 15 Gyr. Relative to models without stellar mass loss, the models are shown to produce a 30-60 percent increase in the present mass ratio of dwarfs to dwarfs plus remnants, and a 200-250 percent increase in the total mass of late F dwarfs remaining on the main sequence at the current disk age. For present disk ages 5 and 10 Gyr, the total mass of mid-F dwarfs remaining on the main sequence is also shown to increase by 90-120 percent. It is concluded that models with main-sequence mass loss have a slightly reduced gas metallicity and slightly increased gas fraction midway through the evolution. 30 references

  11. Spectroscopic and asteroseismic analysis of the remarkable main-sequence A star KIC 11145123

    Science.gov (United States)

    Takada-Hidai, Masahide; Kurtz, Donald W.; Shibahashi, Hiromoto; Murphy, Simon J.; Takata, Masao; Saio, Hideyuki; Sekii, Takashi

    2017-10-01

    A spectroscopic analysis was carried out to clarify the properties of KIC 11145123 - the first main-sequence star with a directly measured core-to-surface rotation profile - based on spectra observed with the High Dispersion Spectrograph (HDS) of the Subaru telescope. The atmospheric parameters (Teff = 7600 K, log g = 4.2, ξ = 3.1 km s-1 and [Fe/H] = -0.71 dex), the radial and rotation velocities, and elemental abundances were obtained by analysing line strengths and fitting line profiles, which were calculated with a 1D LTE model atmosphere. The main properties of KIC 11145123 are: (1) a low [Fe/H] = -0.71 ± 0.11 dex and a high radial velocity of -135.4 ± 0.2 km s-1. These are remarkable among late-A stars. Our best asteroseismic models with this low [Fe/H] have slightly high helium abundance and low masses of 1.4 M⊙. All of these results strongly suggest that KIC 11145123 is a Population II blue straggler; (2) the projected rotation velocity confirms the asteroseismically predicted slow rotation of the star; (3) comparisons of abundance patterns between KIC 11145123 and Am, Ap, and blue stragglers show that KIC 11145123 is neither an Am star nor an Ap star, but has abundances consistent with a blue straggler. We conclude that the remarkably long 100-d rotation period of this star is a consequence of it being a blue straggler, but both pathways for the formation of blue stragglers - merger and mass loss in a binary system - pose difficulties for our understanding of the exceedingly slow rotation. In particular, we show that there is no evidence of any secondary companion star, and we put stringent limits on the possible mass of any such purported companion through the phase modulation technique.

  12. WHITE-DWARF-MAIN-SEQUENCE BINARIES IDENTIFIED FROM THE LAMOST PILOT SURVEY

    International Nuclear Information System (INIS)

    Ren Juanjuan; Luo Ali; Li Yinbi; Wei Peng; Zhao Jingkun; Zhao Yongheng; Song Yihan; Zhao Gang

    2013-01-01

    We present a set of white-dwarf-main-sequence (WDMS) binaries identified spectroscopically from the Large sky Area Multi-Object fiber Spectroscopic Telescope (LAMOST, also called the Guo Shou Jing Telescope) pilot survey. We develop a color selection criteria based on what is so far the largest and most complete Sloan Digital Sky Survey (SDSS) DR7 WDMS binary catalog and identify 28 WDMS binaries within the LAMOST pilot survey. The primaries in our binary sample are mostly DA white dwarfs except for one DB white dwarf. We derive the stellar atmospheric parameters, masses, and radii for the two components of 10 of our binaries. We also provide cooling ages for the white dwarf primaries as well as the spectral types for the companion stars of these 10 WDMS binaries. These binaries tend to contain hot white dwarfs and early-type companions. Through cross-identification, we note that nine binaries in our sample have been published in the SDSS DR7 WDMS binary catalog. Nineteen spectroscopic WDMS binaries identified by the LAMOST pilot survey are new. Using the 3σ radial velocity variation as a criterion, we find two post-common-envelope binary candidates from our WDMS binary sample

  13. Verifying reddening and extinction for Gaia DR1 TGAS main sequence stars

    Science.gov (United States)

    Gontcharov, George A.; Mosenkov, Aleksandr V.

    2017-12-01

    We compare eight sources of reddening and extinction estimates for approximately 60 000 Gaia DR1 Tycho-Gaia Astrometric Solution (TGAS) main sequence stars younger than 3 Gyr with a relative error of the Gaia parallax less than 0.1. For the majority of the stars, the best 2D dust emission-based reddening maps show considerable differences between the reddening to infinity and the one calculated to the stellar distance using the barometric law of the dust distribution. This proves that the majority of the TGAS stars are embedded in the Galactic dust layer and a proper 3D treatment of the reddening/extinction is required to calculate their dereddened colours and absolute magnitudes reliably. Sources with 3D estimates of reddening are tested in their ability to put the stars among the PARSEC and MIST theoretical isochrones in the Hertzsprung-Russell diagram based on the precise Gaia, Tycho-2, 2MASS and WISE photometry. Only the reddening/extinction estimates by Arenou et al. and Gontcharov, being appropriate for nearby stars within 280 pc, provide both the minimal number of outliers bluer than any reasonable isochrone and the correct number of stars younger than 3 Gyr in agreement with the Besançon Galaxy model.

  14. Evolution Models of Helium White Dwarf–Main-sequence Star Merger Remnants

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xianfei; Bi, Shaolan [Department of Astronomy, Beijing Normal University, Beijing, 100875 (China); Hall, Philip D.; Jeffery, C. Simon, E-mail: zxf@bnu.edu.cn [Armagh Observatory, College Hill, Armagh BT61 9DG (United Kingdom)

    2017-02-01

    It is predicted that orbital decay by gravitational-wave radiation and tidal interaction will cause some close binary stars to merge within a Hubble time. The merger of a helium-core white dwarf with a main-sequence (MS) star can produce a red giant branch star that has a low-mass hydrogen envelope when helium is ignited and thus become a hot subdwarf. Because detailed calculations have not been made, we compute post-merger models with a stellar evolution code. We find the evolutionary paths available to merger remnants and find the pre-merger conditions that lead to the formation of hot subdwarfs. We find that some such mergers result in the formation of stars with intermediate helium-rich surfaces. These stars later develop helium-poor surfaces owing to diffusion. Combining our results with a model population and comparing to observed stars, we find that some observed intermediate helium-rich hot subdwarfs can be explained as the remnants of the mergers of helium-core white dwarfs with low-mass MS stars.

  15. MAGNETIC ACTIVITY ANALYSIS FOR A SAMPLE OF G-TYPE MAIN SEQUENCE KEPLER TARGETS

    Energy Technology Data Exchange (ETDEWEB)

    Mehrabi, Ahmad [Department of Physics, Bu Ali Sina University, 65178, 016016, Hamedan (Iran, Islamic Republic of); He, Han [National Astronomical Observatories, Chinese Academy of Sciences, Beijing (China); Khosroshahi, Habib, E-mail: mehrabi@basu.ac.ir [School of Astronomy, Institute for Research in Fundamental Sciences (IPM), 19395-5531, Tehran (Iran, Islamic Republic of)

    2017-01-10

    The variation of a stellar light curve owing to rotational modulation by magnetic features (starspots and faculae) on the star’s surface can be used to investigate the magnetic properties of the host star. In this paper, we use the periodicity and magnitude of the light-curve variation as two proxies to study the stellar magnetic properties for a large sample of G-type main sequence Kepler targets, for which the rotation periods were recently determined. By analyzing the correlation between the two magnetic proxies, it is found that: (1) the two proxies are positively correlated for most of the stars in our sample, and the percentages of negative, zero, and positive correlations are 4.27%, 6.81%, and 88.91%, respectively; (2) negative correlation stars cannot have a large magnitude of light-curve variation; and (3) with the increase of rotation period, the relative number of positive correlation stars decreases and the negative correlation one increases. These results indicate that stars with shorter rotation period tend to have positive correlation between the two proxies, and a good portion of the positive correlation stars have a larger magnitude of light-curve variation (and hence more intense magnetic activities) than negative correlation stars.

  16. THE MULTIPLE PRE-MAIN-SEQUENCE SYSTEM HBC 515 IN L1622

    International Nuclear Information System (INIS)

    Reipurth, Bo; Aspin, Colin; Herbig, George

    2010-01-01

    The bright pre-main-sequence star HBC 515 (HD 288313) located in the L1622 cometary cloud in Orion has been studied extensively with optical/infrared imaging and ultraviolet/optical/infrared spectroscopy. The spectra indicate that HBC 515 is a weakline T Tauri star (TTS) of spectral type K2V. Adaptive optics imaging in the K band reveals that HBC 515 is a binary with two equally bright components separated by 0.''5. A very faint third component is found 5'' to the northwest. Spitzer IRAC and MIPS observations show that at mid-infrared wavelengths this third source dominates the system, suggesting that it is a protostar still embedded in the nascent cloud of HBC 515. The close association of a weakline TTS with a newborn protostar in a multiple system is noteworthy. Two nearby TTSs are likely associated with the HBC 515 multiple system, and the dynamical evolution of the complex that would lead to such a configuration is considered.

  17. Evolution Models of Helium White Dwarf–Main-sequence Star Merger Remnants

    International Nuclear Information System (INIS)

    Zhang, Xianfei; Bi, Shaolan; Hall, Philip D.; Jeffery, C. Simon

    2017-01-01

    It is predicted that orbital decay by gravitational-wave radiation and tidal interaction will cause some close binary stars to merge within a Hubble time. The merger of a helium-core white dwarf with a main-sequence (MS) star can produce a red giant branch star that has a low-mass hydrogen envelope when helium is ignited and thus become a hot subdwarf. Because detailed calculations have not been made, we compute post-merger models with a stellar evolution code. We find the evolutionary paths available to merger remnants and find the pre-merger conditions that lead to the formation of hot subdwarfs. We find that some such mergers result in the formation of stars with intermediate helium-rich surfaces. These stars later develop helium-poor surfaces owing to diffusion. Combining our results with a model population and comparing to observed stars, we find that some observed intermediate helium-rich hot subdwarfs can be explained as the remnants of the mergers of helium-core white dwarfs with low-mass MS stars.

  18. Main sequence of the metal-poor globular cluster M30 (NGC 7099)

    International Nuclear Information System (INIS)

    Alcaino, G.; Liller, W.

    1980-01-01

    We present photographic photometry for 673 stars in the metal-poor globular cluster M30 (NGC 7099). The Racine wedge was used with the CTIO 1-m Yale telescope (Δm=3/sup m/.60), the CTIO 4-m telescope (Δm=6/sup m/.83), and the ESO 3.6-m telescope (Δm=4/sup m/.12) to extend the photoelectric limit from Vapprox. =16.3 to Vapprox. =20.4. For the main-sequence turn-off, we have determined its position to lie at V=18.4 +- 0.1 (m.e.) and B-V=0.49 +- 0.03 (m.e.). From these values, we calculate the intrinsic values M/sub v/ =3.87 and (B-V) 0 =0.47. For the cluster as a whole, we derive a distance modulus (m-M)/sub V/=14.53 +- 0.15 and reddening E(B-V)=0.02 +- 0.02. Using the models of Iben and Rood [Astrophys. J. 159, 605 (1970)] and the isochrones of Demarque and McClure [(1977), in Evolution of Galaxies and Stellar Populations, edited by B. Tinsley and R. B. Larson (Yale University Observatory, New Haven), p. 199], we deduce the cluster's age to be 14.5( +- 4.0) x 10 9 yr. The large uncertainty in this value emphasizes the dire need for more work on cluster evolution

  19. Phylogenetic reconstruction of Bantu kinship challenges Main Sequence Theory of human social evolution.

    Science.gov (United States)

    Opie, Christopher; Shultz, Susanne; Atkinson, Quentin D; Currie, Thomas; Mace, Ruth

    2014-12-09

    Kinship provides the fundamental structure of human society: descent determines the inheritance pattern between generations, whereas residence rules govern the location a couple moves to after they marry. In turn, descent and residence patterns determine other key relationships such as alliance, trade, and marriage partners. Hunter-gatherer kinship patterns are viewed as flexible, whereas agricultural societies are thought to have developed much more stable kinship patterns as they expanded during the Holocene. Among the Bantu farmers of sub-Saharan Africa, the ancestral kinship patterns present at the beginning of the expansion are hotly contested, with some arguing for matrilineal and matrilocal patterns, whereas others maintain that any kind of lineality or sex-biased dispersal only emerged much later. Here, we use Bayesian phylogenetic methods to uncover the history of Bantu kinship patterns and trace the interplay between descent and residence systems. The results suggest a number of switches in both descent and residence patterns as Bantu farming spread, but that the first Bantu populations were patrilocal with patrilineal descent. Across the phylogeny, a change in descent triggered a switch away from patrifocal kinship, whereas a change in residence triggered a switch back from matrifocal kinship. These results challenge "Main Sequence Theory," which maintains that changes in residence rules precede change in other social structures. We also indicate the trajectory of kinship change, shedding new light on how this fundamental structure of society developed as farming spread across the globe during the Neolithic.

  20. THE ORIGIN OF HVS17, AN UNBOUND MAIN SEQUENCE B STAR AT 50 kpc

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Warren R.; Geller, Margaret J.; Kenyon, Scott J. [Smithsonian Astrophysical Observatory, 60 Garden Street, Cambridge, MA 02138 (United States); Cohen, Judith G., E-mail: wbrown@cfa.harvard.edu, E-mail: mgeller@cfa.harvard.edu, E-mail: skenyon@cfa.harvard.edu, E-mail: jlc@astro.caltech.edu [Palomar Observatory, Mail Stop 249-17, California Institute of Technology, Pasadena, CA 91125 (United States)

    2013-09-20

    We analyze Keck Echellette Spectrograph and Imager spectroscopy of HVS17, a B-type star traveling with a Galactic rest frame radial velocity of +445 km s{sup –1} in the outer halo of the Milky Way. HVS17 has the projected rotation of a main sequence B star and is chemically peculiar, with solar iron abundance and sub-solar alpha abundance. Comparing measured T{sub eff} and log g with stellar evolution tracks implies that HVS17 is a 3.91 ± 0.09 M{sub ☉}, 153 ± 9 Myr old star at a Galactocentric distance of r = 48.5 ± 4.6 kpc. The time between its formation and ejection significantly exceeds 10 Myr and thus is difficult to reconcile with any Galactic disk runaway scenario involving massive stars. The observations are consistent, on the other hand, with a hypervelocity star ejection from the Galactic center. We show that Gaia proper motion measurements will easily discriminate between a disk and Galactic center origin, thus allowing us to use HVS17 as a test particle to probe the shape of the Milky Way's dark matter halo.

  1. THE ORIGIN OF HVS17, AN UNBOUND MAIN SEQUENCE B STAR AT 50 kpc

    International Nuclear Information System (INIS)

    Brown, Warren R.; Geller, Margaret J.; Kenyon, Scott J.; Cohen, Judith G.

    2013-01-01

    We analyze Keck Echellette Spectrograph and Imager spectroscopy of HVS17, a B-type star traveling with a Galactic rest frame radial velocity of +445 km s –1 in the outer halo of the Milky Way. HVS17 has the projected rotation of a main sequence B star and is chemically peculiar, with solar iron abundance and sub-solar alpha abundance. Comparing measured T eff and log g with stellar evolution tracks implies that HVS17 is a 3.91 ± 0.09 M ☉ , 153 ± 9 Myr old star at a Galactocentric distance of r = 48.5 ± 4.6 kpc. The time between its formation and ejection significantly exceeds 10 Myr and thus is difficult to reconcile with any Galactic disk runaway scenario involving massive stars. The observations are consistent, on the other hand, with a hypervelocity star ejection from the Galactic center. We show that Gaia proper motion measurements will easily discriminate between a disk and Galactic center origin, thus allowing us to use HVS17 as a test particle to probe the shape of the Milky Way's dark matter halo

  2. THE EVOLVED MAIN-SEQUENCE CHANNEL: HST AND LBT OBSERVATIONS OF CSS 120422:111127+571239

    Energy Technology Data Exchange (ETDEWEB)

    Kennedy, M.; Callanan, P. [Department of Physics, University College Cork, Cork (Ireland); Garnavich, P.; Littlefield, C. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States); Szkody, P. [Department of Astronomy, University of Washington, Seattle, WA (United States); Pogge, R. [Department of Astronomy, The Ohio State University, 140 W. 18th Avenue, Columbus, OH 43202 (United States)

    2015-12-20

    The “evolved main-sequence (EMS)” channel is thought to contribute significantly to the population of AM CVn-type systems in the Galaxy, and also to the number of cataclysmic variables (CVs) detected below the period minimum for hydrogen rich systems. CSS 120422:J111127+571239 was discovered by the Catalina Sky Survey in 2012 April. Its period was found to be 56 minutes, well below the minimum, and the optical spectrum is clearly depleted in hydrogen relative to helium, but still has two orders of magnitude more hydrogen than AM CVn stars. Doppler tomography of the Hα line hinted at a spiral structure existing in the disk. Here we present spectroscopy of CSS 120422:J111127+571239 using the Cosmic Origins Spectrograph FUV instrument on the Hubble Space Telescope and using the MODS spectrograph on the Large Binocular Telescope. The UV spectrum shows Si iv, N v, and He ii, but no detectable C iv. The anomalous nitrogen/carbon ratio is seen in a small number of other CVs and confirms a unique binary evolution. We also present and compare the optical spectrum of V418 Ser and advocate that it is also an EMS system.

  3. ULTRAVIOLET-SELECTED FIELD AND PRE-MAIN-SEQUENCE STARS TOWARD TAURUS AND UPPER SCORPIUS

    International Nuclear Information System (INIS)

    Findeisen, K.; Hillenbrand, L.

    2010-01-01

    We have carried out a Galaxy Evolution Explorer (GALEX) Cycle 1 guest investigator program covering 56 deg 2 near the Taurus T association and 12 deg 2 along the northern edge of the Upper Scorpius OB association. We combined photometry in the GALEX far-ultraviolet and near-ultraviolet bands with data from the Two Micron All Sky Survey to identify candidate young (∼<100 Myr old) stars as those with an ultraviolet excess relative to older main-sequence stars. Follow-up spectroscopy of a partial sample of these candidates suggests five new members of Taurus, with 8-20 expected from additional observations, and five new members of Upper Scorpius, with three to six expected from additional observations. These candidate new members appear to represent a distributed, non-clustered population in either region, although our sample statistics are as of yet too poor to constrain the nature or extent of this population. Rather, our study demonstrates the ability of GALEX observations to identify young stellar populations distributed over a wide area of the sky. We also highlight the necessity of a better understanding of the Galactic ultraviolet source population to support similar investigations. In particular, we report a large population of stars with an ultraviolet excess but no optical indicators of stellar activity or accretion, and briefly argue against several interpretations of these sources.

  4. STELLAR DIAMETERS AND TEMPERATURES. II. MAIN-SEQUENCE K- AND M-STARS

    Energy Technology Data Exchange (ETDEWEB)

    Boyajian, Tabetha S.; McAlister, Harold A.; Jones, Jeremy; White, Russel; Henry, Todd; Gies, Douglas; Jao, Wei-Chun; Parks, J. Robert [Center for High Angular Resolution Astronomy and Department of Physics and Astronomy, Georgia State University, P.O. Box 4106, Atlanta, GA 30302-4106 (United States); Von Braun, Kaspar; Kane, Stephen R.; Ciardi, David [NASA Exoplanet Science Institute, California Institute of Technology, MC 100-22, Pasadena, CA 91125 (United States); Van Belle, Gerard [Lowell Observatory, Flagstaff, AZ 86001 (United States); Ten Brummelaar, Theo A.; Schaefer, Gail; Sturmann, Laszlo; Sturmann, Judit [The CHARA Array, Mount Wilson Observatory, Mount Wilson, CA 91023 (United States); Muirhead, Philip S. [Department of Astronomy, California Institute of Technology, 1200 East California Boulevard, MC 249-17, Pasadena, CA 91125 (United States); Lopez-Morales, Mercedes [Institut de Ciencies de L' Espai (CSIC-IEEC), E-08193 Bellaterra (Spain); Ridgway, Stephen [National Optical Astronomy Observatory, P.O. Box 26732, Tucson, AZ 85726-6732 (United States); Rojas-Ayala, Barbara [Department of Astrophysics, Division of Physical Sciences, American Museum of Natural History, Central Park West at 79th Street, New York, NY 10024 (United States); and others

    2012-10-01

    We present interferometric angular diameter measurements of 21 low-mass, K- and M-dwarfs made with the CHARA Array. This sample is enhanced by adding a collection of radius measurements published in the literature to form a total data set of 33 K-M-dwarfs with diameters measured to better than 5%. We use these data in combination with the Hipparcos parallax and new measurements of the star's bolometric flux to compute absolute luminosities, linear radii, and effective temperatures for the stars. We develop empirical relations for {approx}K0 to M4 main-sequence stars that link the stellar temperature, radius, and luminosity to the observed (B - V), (V - R), (V - I), (V - J), (V - H), and (V - K) broadband color index and stellar metallicity [Fe/H]. These relations are valid for metallicities ranging from [Fe/H] = -0.5 to +0.1 dex and are accurate to {approx}2%, {approx}5%, and {approx}4% for temperature, radius, and luminosity, respectively. Our results show that it is necessary to use metallicity-dependent transformations in order to properly convert colors into stellar temperatures, radii, and luminosities. Alternatively, we find no sensitivity to metallicity on relations we construct to the global properties of a star omitting color information, e.g., temperature-radius and temperature-luminosity. Thus, we are able to empirically quantify to what order the star's observed color index is impacted by the stellar iron abundance. In addition to the empirical relations, we also provide a representative look-up table via stellar spectral classifications using this collection of data. Robust examinations of single star temperatures and radii compared to evolutionary model predictions on the luminosity-temperature and luminosity-radius planes reveal that models overestimate the temperatures of stars with surface temperatures <5000 K by {approx}3%, and underestimate the radii of stars with radii <0.7 R{sub Sun} by {approx}5%. These conclusions additionally

  5. White dwarf-main sequence binaries from LAMOST: the DR5 catalogue

    Science.gov (United States)

    Ren, J.-J.; Rebassa-Mansergas, A.; Parsons, S. G.; Liu, X.-W.; Luo, A.-L.; Kong, X.; Zhang, H.-T.

    2018-03-01

    We present the data release (DR) 5 catalogue of white dwarf-main sequence (WDMS) binaries from the Large Area Multi-Object fiber Spectroscopic Telescope (LAMOST). The catalogue contains 876 WDMS binaries, of which 757 are additions to our previous LAMOST DR1 sample and 357 are systems that have not been published before. We also describe a LAMOST-dedicated survey that aims at obtaining spectra of photometrically-selected WDMS binaries from the Sloan Digital Sky Survey (SDSS) that are expected to contain cool white dwarfs and/or early type M dwarf companions. This is a population under-represented in previous SDSS WDMS binary catalogues. We determine the stellar parameters (white dwarf effective temperatures, surface gravities and masses, and M dwarf spectral types) of the LAMOST DR5 WDMS binaries and make use of the parameter distributions to analyse the properties of the sample. We find that, despite our efforts, systems containing cool white dwarfs remain under-represented. Moreover, we make use of LAMOST DR5 and SDSS DR14 (when available) spectra to measure the Na I λλ 8183.27, 8194.81 absorption doublet and/or Hα emission radial velocities of our systems. This allows identifying 128 binaries displaying significant radial velocity variations, 76 of which are new. Finally, we cross-match our catalogue with the Catalina Surveys and identify 57 systems displaying light curve variations. These include 16 eclipsing systems, two of which are new, and nine binaries that are new eclipsing candidates. We calculate periodograms from the photometric data and measure (estimate) the orbital periods of 30 (15) WDMS binaries.

  6. Variations of the ISM conditions accross the Main Sequence of star forming galaxies: observations and simulations.

    Science.gov (United States)

    Martinez Galarza, Juan R.; Smith, Howard Alan; Lanz, Lauranne; Hayward, Christopher C.; Zezas, Andreas; Hung, Chao-Ling; Rosenthal, Lee; Weiner, Aaron

    2015-01-01

    A significant amount of evidence has been gathered that leads to the existence of a main sequence (MS) of star formation in galaxies. This MS is expressed in terms of a correlation between the SFR and the stellar mass of the form SFR ∝ M* and spans a few orders of magnitude in both quantities. Several ideas have been suggested to explain fundamental properties of the MS, such as its slope, its dispersion, and its evolution with redshift, but no consensus has been reached regarding its true nature, and whether the membership or not of particular galaxies to this MS underlies the existence of two different modes of star formation. In order to advance in the understanding of the MS, here we use a statistically robust Bayesian SED analysis method (CHIBURST) to consistently analyze the star-forming properties of a set of hydro-dynamical simulations of mergers, as well as observations of real mergers, both local and at intermediate redshift. We find a remarkable, very tight correlation between the specific star formation rate (sSFR) of galaxies, and the typical ISM conditions near their inernal star-forming regions, parametrized via a novel quantity: the compactness parameter (C). The evolution of mergers along this correlation explains the spread of the MS, and implies that the physical conditions of the ISM smoothly evolve between on-MS (secular) conditions and off-MS (coalescence/starburst) conditions. Furthermore, we show that the slope of the correlation can be interpreted in terms of the efficiency in the conversion of gas into stars, and that this efficiency remains unchanged along and across the MS. Finally, we discuss differences in the normalization of the correlation as a function of merger mass and redshift, and conclude that these differences imply the existence of two different modes of star formation, unrelated to the smooth evolution across the MS: a disk-like, low pressure mode and a compact nuclear-starburst mode.

  7. HABITABLE ZONES AROUND MAIN-SEQUENCE STARS: DEPENDENCE ON PLANETARY MASS

    International Nuclear Information System (INIS)

    Kopparapu, Ravi Kumar; Ramirez, Ramses M.; Kasting, James F.; SchottelKotte, James; Domagal-Goldman, Shawn; Eymet, Vincent

    2014-01-01

    The ongoing discoveries of extra-solar planets are unveiling a wide range of terrestrial mass (size) planets around their host stars. In this Letter, we present estimates of habitable zones (HZs) around stars with stellar effective temperatures in the range 2600 K-7200 K, for planetary masses between 0.1 M ⊕ and 5 M ⊕ . Assuming H 2 O-(inner HZ) and CO 2 -(outer HZ) dominated atmospheres, and scaling the background N 2 atmospheric pressure with the radius of the planet, our results indicate that larger planets have wider HZs than do smaller ones. Specifically, with the assumption that smaller planets will have less dense atmospheres, the inner edge of the HZ (runaway greenhouse limit) moves outward (∼10% lower than Earth flux) for low mass planets due to larger greenhouse effect arising from the increased H 2 O column depth. For larger planets, the H 2 O column depth is smaller, and higher temperatures are needed before water vapor completely dominates the outgoing longwave radiation. Hence the inner edge moves inward (∼7% higher than Earth's flux). The outer HZ changes little due to the competing effects of the greenhouse effect and an increase in albedo. New, three-dimensional climate model results from other groups are also summarized, and we argue that further, independent studies are needed to verify their predictions. Combined with our previous work, the results presented here provide refined estimates of HZs around main-sequence stars and provide a step toward a more comprehensive analysis of HZs

  8. YSOVAR: SIX PRE-MAIN-SEQUENCE ECLIPSING BINARIES IN THE ORION NEBULA CLUSTER

    Energy Technology Data Exchange (ETDEWEB)

    Morales-Calderon, M.; Stauffer, J. R.; Rebull, L. M. [Spitzer Science Center, California Institute of Technology, 1200 E California Blvd., Pasadena, CA 91125 (United States); Stassun, K. G. [Physics and Astronomy Department, Vanderbilt University, 1807 Station B, Nashville, TN 37235 (United States); Vrba, F. J. [U. S. Naval Observatory, Flagstaff Station, 10391 W. Naval Observatory Road, Flagstaff, AZ 86001-8521 (United States); Prato, L. [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States); Hillenbrand, L. A.; Carpenter, J. M. [Astronomy Department, California Institute of Technology, 1200 E California Blvd., Pasadena, CA 91125 (United States); Terebey, S.; Angione, J. [Department of Physics and Astronomy, California State University at Los Angeles, Los Angeles, CA 90032 (United States); Covey, K. R. [Department of Astronomy, Cornell University, 226 Space Sciences Building, Ithaca, NY 14853 (United States); Terndrup, D. M. [Department of Astronomy, The Ohio State University, 140 West 18th Avenue, Columbus, OH 43210 (United States); Gutermuth, R. [Department of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Song, I. [Physics and Astronomy Department, University of Georgia, Athens, GA 30602-2451 (United States); Plavchan, P. [NASA Exoplanet Science Institute, California Institute of Technology, Pasadena, CA 91125 (United States); Marchis, F. [SETI Institute, Carl Sagan Center, 189 N San Bernado Av, Mountain View, CA 94043 (United States); Garcia, E. V. [Department of Physics, Fisk University, 1000 17th Ave. N, Nashville, TN 37208 (United States); Margheim, S. [Gemini Observatory, Southern Operations Center, Casilla 603, La Serena (Chile); Luhman, K. L. [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States); Irwin, J. M., E-mail: mariamc@cab.inta-csic.es [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States)

    2012-07-10

    Eclipsing binaries (EBs) provide critical laboratories for empirically testing predictions of theoretical models of stellar structure and evolution. Pre-main-sequence (PMS) EBs are particularly valuable, both due to their rarity and the highly dynamic nature of PMS evolution, such that a dense grid of PMS EBs is required to properly calibrate theoretical PMS models. Analyzing multi-epoch, multi-color light curves for {approx}2400 candidate Orion Nebula Cluster (ONC) members from our Warm Spitzer Exploration Science Program YSOVAR, we have identified 12 stars whose light curves show eclipse features. Four of these 12 EBs are previously known. Supplementing our light curves with follow-up optical and near-infrared spectroscopy, we establish two of the candidates as likely field EBs lying behind the ONC. We confirm the remaining six candidate systems, however, as newly identified ONC PMS EBs. These systems increase the number of known PMS EBs by over 50% and include the highest mass ({theta}{sup 1} Ori E, for which we provide a complete set of well-determined parameters including component masses of 2.807 and 2.797 M{sub Sun }) and longest-period (ISOY J053505.71-052354.1, P {approx} 20 days) PMS EBs currently known. In two cases ({theta}{sup 1} Ori E and ISOY J053526.88-044730.7), enough photometric and spectroscopic data exist to attempt an orbit solution and derive the system parameters. For the remaining systems, we combine our data with literature information to provide a preliminary characterization sufficient to guide follow-up investigations of these rare, benchmark systems.

  9. Time Variability of the Dust Sublimation Zones in Pre-Main Sequence Disk Systems

    Science.gov (United States)

    Sitko, Michael L.; Carpenter, W. J.; Grady, C. A.; Russel, R. W.; Lynch, D. K.; Rudy, R. J.; Mazuk, S. M.; Venturini, C. C.; Kimes, R. L.; Beerman, L. C.; hide

    2007-01-01

    The dust sublimation zone (DSZ) is the region of pre-main sequence (PMS) disks where dust grains most easily anneal, sublime, and condense out of the gas. Because of this, it is a location where crystalline material may be enhanced and redistributed throughout the rest of the disk. A decade-long program to monitor the thermal emission of the grains located in this region demonstrates that large changes in emitted flux occur in many systems. Changes in the thermal emission between 3 and 13.5 microns were observed in HD 31648 (MWC 480), HD 163296 (MWC 275), and DG Tau. This emission is consistent with it being produced at the DSZ, where the transition from a disk of gas to one of gas+dust occurs. In the case of DG Tau, the outbursts were accompanied by increased emission on the 10 micron silicate band on one occasion, while on another occasion it went into absorption. This requires lofting of the material above the disk into the line of sight. Such changes will affect the determination of the inner disk structure obtained through interferometry measurements, and this has been confirmed in the case of HD 163296. Cyclic variations in the heating of the DSZ will lead to the annealing of large grains, the sublimation of smaller grains, possibly followed by re-condensation as the zone enters a cooling phase. Lofting of dust above the disk plane, and outward acceleration by stellar winds and radiation pressure, can re-distribute the processed material to cooler regions of the disk, where cometesimals form. This processing is consistent with the detection of the preferential concentration of large crystalline grains in the inner few AU of PMS disks using interferometric spectroscopy with the VLTI.

  10. THE QUADRUPLE PRE-MAIN-SEQUENCE SYSTEM LkCa 3: IMPLICATIONS FOR STELLAR EVOLUTION MODELS

    International Nuclear Information System (INIS)

    Torres, Guillermo; Latham, David W.; Ruíz-Rodríguez, Dary; Prato, L.; Wasserman, Lawrence H.; Badenas, Mariona; Schaefer, G. H.; Mathieu, Robert D.

    2013-01-01

    We report the discovery that the pre-main-sequence (PMS) object LkCa 3 in the Taurus-Auriga star-forming region is a hierarchical quadruple system of M stars. It was previously known to be a close (∼0.''5) visual pair, with one component being a moderately eccentric 12.94 day single-lined spectroscopic binary. A re-analysis of archival optical spectra complemented by new near-infrared (NIR) spectroscopy shows both visual components to be double lined; the second one has a period of 4.06 days and a circular orbit. In addition to the orbital elements, we determine optical and NIR flux ratios, effective temperatures, and projected rotational velocities for all four stars. Using existing photometric monitoring observations of the system that had previously revealed the rotational period of the primary in the longer-period binary, we also detect the rotational signal of the primary in the 4.06 day binary, which is synchronized with the orbital motion. With only the assumption of coevality, a comparison of all of these constraints with current stellar evolution models from the Dartmouth series points to an age of 1.4 Myr and a distance of 133 pc, consistent with previous estimates for the region and suggesting that the system is on the near side of the Taurus complex. Similar comparisons of the properties of LkCa 3 and the well-known quadruple PMS system GG Tau with the widely used models from the Lyon series for a mixing length parameter of α ML = 1.0 strongly favor the Dartmouth models

  11. YSOVAR: SIX PRE-MAIN-SEQUENCE ECLIPSING BINARIES IN THE ORION NEBULA CLUSTER

    International Nuclear Information System (INIS)

    Morales-Calderón, M.; Stauffer, J. R.; Rebull, L. M.; Stassun, K. G.; Vrba, F. J.; Prato, L.; Hillenbrand, L. A.; Carpenter, J. M.; Terebey, S.; Angione, J.; Covey, K. R.; Terndrup, D. M.; Gutermuth, R.; Song, I.; Plavchan, P.; Marchis, F.; García, E. V.; Margheim, S.; Luhman, K. L.; Irwin, J. M.

    2012-01-01

    Eclipsing binaries (EBs) provide critical laboratories for empirically testing predictions of theoretical models of stellar structure and evolution. Pre-main-sequence (PMS) EBs are particularly valuable, both due to their rarity and the highly dynamic nature of PMS evolution, such that a dense grid of PMS EBs is required to properly calibrate theoretical PMS models. Analyzing multi-epoch, multi-color light curves for ∼2400 candidate Orion Nebula Cluster (ONC) members from our Warm Spitzer Exploration Science Program YSOVAR, we have identified 12 stars whose light curves show eclipse features. Four of these 12 EBs are previously known. Supplementing our light curves with follow-up optical and near-infrared spectroscopy, we establish two of the candidates as likely field EBs lying behind the ONC. We confirm the remaining six candidate systems, however, as newly identified ONC PMS EBs. These systems increase the number of known PMS EBs by over 50% and include the highest mass (θ 1 Ori E, for which we provide a complete set of well-determined parameters including component masses of 2.807 and 2.797 M ☉ ) and longest-period (ISOY J053505.71–052354.1, P ∼ 20 days) PMS EBs currently known. In two cases (θ 1 Ori E and ISOY J053526.88–044730.7), enough photometric and spectroscopic data exist to attempt an orbit solution and derive the system parameters. For the remaining systems, we combine our data with literature information to provide a preliminary characterization sufficient to guide follow-up investigations of these rare, benchmark systems.

  12. Lithium abundances for 185 main-sequence stars: Galactic evolution and stellar depletion of lithium

    Science.gov (United States)

    Chen, Y. Q.; Nissen, P. E.; Benoni, T.; Zhao, G.

    2001-06-01

    We present a survey of lithium abundances in 185 main-sequence field stars with 5600 interesting result from this study is the presence of a large gap in the log varepsilon (Li) - Teff plane, which distinguishes ``Li-dip'' stars like those first identified in the Hyades cluster by Boesgaard & Tripicco (\\cite{Boesgaard86}) from other stars with a much higher Li abundance. The Li-dip stars concentrate on a certain mass, which decreases with metallicity from about 1.4 Msun at solar metallicity to 1.1 Msun at [Fe/H] =~ -1.0. Excluding the Li-dip stars and a small group of lower mass stars with Teff rate of angular momentum loss. It cannot be excluded, however, that a cosmic scatter of the Li abundance in the Galaxy at a given metallicity contributes to the dispersion in Li abundance. These problems make it difficult to determine the Galactic evolution of Li from the data, but a comparison of the upper envelope of the distribution of stars in the log varepsilon (Li) - [Fe/H] plane with recent Galactic evolutionary models by Romano et al. (\\cite{Romano99}) suggests that novae are a major source for the Li production in the Galactic disk; their occurrence seems to be the explanation for the steep increase of Li abundance at [Fe/H] =~ -0.4. Based on observations carried out at Beijing Astronomical Observatory (Xinglong, PR China) and European Southern Observatory, La Silla, Chile. Table 1 is only available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsweb.u-strasbg.fr/cgi-bin/qcat?J/A+A/371/943 and at http://www.edpsciences.org

  13. The Star Formation Main Sequence in the Hubble Space Telescope Frontier Fields

    Science.gov (United States)

    Santini, Paola; Fontana, Adriano; Castellano, Marco; Di Criscienzo, Marcella; Merlin, Emiliano; Amorin, Ricardo; Cullen, Fergus; Daddi, Emanuele; Dickinson, Mark; Dunlop, James S.; Grazian, Andrea; Lamastra, Alessandra; McLure, Ross J.; Michałowski, Michał. J.; Pentericci, Laura; Shu, Xinwen

    2017-09-01

    We investigate the relation between star formation rate (SFR) and stellar mass (M), I.e., the main sequence (MS) relation of star-forming galaxies, at 1.3≤slant zFrontier Fields, on the basis of rest-frame UV observations. Gravitational lensing combined with deep HST observations allows us to extend the analysis of the MS down to {log} M/{M}⊙ ˜ 7.5 at z≲ 4 and {log} M/{M}⊙ ˜ 8 at higher redshifts, a factor of ˜10 below most previous results. We perform an accurate simulation to take into account the effect of observational uncertainties and correct for the Eddington bias. This step allows us to reliably measure the MS and in particular its slope. While the normalization increases with redshift, we fit an unevolving and approximately linear slope. We nicely extend to lower masses the results of brighter surveys. Thanks to the large dynamic range in mass and by making use of the simulation, we analyzed any possible mass dependence of the dispersion around the MS. We find tentative evidence that the scatter decreases with increasing mass, suggesting a larger variety of star formation histories in low-mass galaxies. This trend agrees with theoretical predictions and is explained as either a consequence of the smaller number of progenitors of low-mass galaxies in a hierarchical scenario and/or of the efficient but intermittent stellar feedback processes in low-mass halos. Finally, we observe an increase in the SFR per unit stellar mass with redshift milder than predicted by theoretical models, implying a still incomplete understanding of the processes responsible for galaxy growth.

  14. Habitable Zones Around Main-Sequence Stars: Dependence on Planetary Mass

    Science.gov (United States)

    Kopparapu, Ravi Kumar; Ramirez, Ramses M.; Kotte, James Schottel; Kasting, James F.; Domagal-Goldman, Shawn; Eymet, Vincent

    2014-01-01

    The ongoing discoveries of extra-solar planets are unveiling a wide range of terrestrial mass (size) planets around their host stars. In this Letter, we present estimates of habitable zones (HZs) around stars with stellar effective temperatures in the range 2600 K-7200 K, for planetary masses between 0.1M and 5M. Assuming H2O-(inner HZ) and CO2-(outer HZ) dominated atmospheres, and scaling the background N2 atmospheric pressure with the radius of the planet, our results indicate that larger planets have wider HZs than do smaller ones. Specifically, with the assumption that smaller planets will have less dense atmospheres, the inner edge of the HZ (runaway greenhouse limit) moves outward (approx.10% lower than Earth flux) for low mass planets due to larger greenhouse effect arising from the increased H2O column depth. For larger planets, the H2O column depth is smaller, and higher temperatures are needed before water vapor completely dominates the outgoing long-wave radiation. Hence the inner edge moves inward (approx.7% higher than Earth's flux). The outer HZ changes little due to the competing effects of the greenhouse effect and an increase in albedo. New, three-dimensional climate model results from other groups are also summarized, and we argue that further, independent studies are needed to verify their predictions. Combined with our previous work, the results presented here provide refined estimates of HZs around main-sequence stars and provide a step toward a more comprehensive analysis of HZs.

  15. On the Use of the Main-sequence Knee (Saddle) to Measure Globular Cluster Ages

    Science.gov (United States)

    Saracino, S.; Dalessandro, E.; Ferraro, F. R.; Lanzoni, B.; Origlia, L.; Salaris, M.; Pietrinferni, A.; Geisler, D.; Kalirai, J. S.; Correnti, M.; Cohen, R. E.; Mauro, F.; Villanova, S.; Moni Bidin, C.

    2018-06-01

    In this paper, we review the operational definition of the so-called main-sequence knee (MS-knee), a feature in the color-magnitude diagram (CMD) occurring at the low-mass end of the MS. The magnitude of this feature is predicted to be independent of age at fixed chemical composition. For this reason, its difference in magnitude with respect to the MS turn-off (MS-TO) point has been suggested as a possible diagnostic to estimate absolute globular cluster (GC) ages. We first demonstrate that the operational definition of the MS-knee currently adopted in the literature refers to the inflection point of the MS (which we here more appropriately named MS-saddle), a feature that is well distinct from the knee and which cannot be used as its proxy. The MS-knee is only visible in near-infrared CMDs, while the MS-saddle can be also detected in optical–NIR CMDs. By using different sets of isochrones, we then demonstrate that the absolute magnitude of the MS-knee varies by a few tenths of a dex from one model to another, thus showing that at the moment stellar models may not capture the full systematic error in the method. We also demonstrate that while the absolute magnitude of the MS-saddle is almost coincident in different models, it has a systematic dependence on the adopted color combinations which is not predicted by stellar models. Hence, it cannot be used as a reliable reference for absolute age determination. Moreover, when statistical and systematic uncertainties are properly taken into account, the difference in magnitude between the MS-TO and the MS-saddle does not provide absolute ages with better accuracy than other methods like the MS-fitting.

  16. HABITABLE ZONES AROUND MAIN-SEQUENCE STARS: DEPENDENCE ON PLANETARY MASS

    Energy Technology Data Exchange (ETDEWEB)

    Kopparapu, Ravi Kumar; Ramirez, Ramses M.; Kasting, James F. [Department of Geosciences, Penn State University, 443 Deike Building, University Park, PA 16802 (United States); SchottelKotte, James [Department of Astronomy and Astrophysics, The Pennsylvania State University, 525 Davey Laboratory, University Park, PA 16802 (United States); Domagal-Goldman, Shawn [NASA Astrobiology Institute' s Virtual Planetary Laboratory, P.O. Box 351580, Seattle, WA 98195 (United States); Eymet, Vincent, E-mail: ruk15@psu.edu [Laboratoire d' Astrophysique de Bordeaux, Universite de Bordeaux 1, UMR 5804, F-33270 Floirac (France)

    2014-06-01

    The ongoing discoveries of extra-solar planets are unveiling a wide range of terrestrial mass (size) planets around their host stars. In this Letter, we present estimates of habitable zones (HZs) around stars with stellar effective temperatures in the range 2600 K-7200 K, for planetary masses between 0.1 M {sub ⊕} and 5 M {sub ⊕}. Assuming H{sub 2}O-(inner HZ) and CO{sub 2}-(outer HZ) dominated atmospheres, and scaling the background N{sub 2} atmospheric pressure with the radius of the planet, our results indicate that larger planets have wider HZs than do smaller ones. Specifically, with the assumption that smaller planets will have less dense atmospheres, the inner edge of the HZ (runaway greenhouse limit) moves outward (∼10% lower than Earth flux) for low mass planets due to larger greenhouse effect arising from the increased H{sub 2}O column depth. For larger planets, the H{sub 2}O column depth is smaller, and higher temperatures are needed before water vapor completely dominates the outgoing longwave radiation. Hence the inner edge moves inward (∼7% higher than Earth's flux). The outer HZ changes little due to the competing effects of the greenhouse effect and an increase in albedo. New, three-dimensional climate model results from other groups are also summarized, and we argue that further, independent studies are needed to verify their predictions. Combined with our previous work, the results presented here provide refined estimates of HZs around main-sequence stars and provide a step toward a more comprehensive analysis of HZs.

  17. Matrix based method for synthesis of main intensified and integrated distillation sequences

    International Nuclear Information System (INIS)

    Khalili-Garakani, Amirhossein; Kasiri, Norollah; Ivakpour, Javad

    2016-01-01

    The objective of many studies in this area has involved access to a column-sequencing algorithm enabling designers and researchers alike to generate a wide range of sequences in a broad search space, and be as mathematically and as automated as possible for programing purposes and with good generality. In the present work an algorithm previously developed by the authors, called the matrix method, has been developed much further. The new version of the algorithm includes thermally coupled, thermodynamically equivalent, intensified, simultaneous heat and mass integrated and divided-wall column sequences which are of gross application and provide vast saving potential both on capital investment, operating costs and energy usage in industrial applications. To demonstrate the much wider searchable space now accessible, a three component separation has been thoroughly examined as a case study, always resulting in an integrated sequence being proposed as the optimum.

  18. Empirical tests of pre-main-sequence stellar evolution models with eclipsing binaries

    Science.gov (United States)

    Stassun, Keivan G.; Feiden, Gregory A.; Torres, Guillermo

    2014-06-01

    We examine the performance of standard pre-main-sequence (PMS) stellar evolution models against the accurately measured properties of a benchmark sample of 26 PMS stars in 13 eclipsing binary (EB) systems having masses 0.04-4.0 M⊙ and nominal ages ≈1-20 Myr. We provide a definitive compilation of all fundamental properties for the EBs, with a careful and consistent reassessment of observational uncertainties. We also provide a definitive compilation of the various PMS model sets, including physical ingredients and limits of applicability. No set of model isochrones is able to successfully reproduce all of the measured properties of all of the EBs. In the H-R diagram, the masses inferred for the individual stars by the models are accurate to better than 10% at ≳1 M⊙, but below 1 M⊙ they are discrepant by 50-100%. Adjusting the observed radii and temperatures using empirical relations for the effects of magnetic activity helps to resolve the discrepancies in a few cases, but fails as a general solution. We find evidence that the failure of the models to match the data is linked to the triples in the EB sample; at least half of the EBs possess tertiary companions. Excluding the triples, the models reproduce the stellar masses to better than ∼10% in the H-R diagram, down to 0.5 M⊙, below which the current sample is fully contaminated by tertiaries. We consider several mechanisms by which a tertiary might cause changes in the EB properties and thus corrupt the agreement with stellar model predictions. We show that the energies of the tertiary orbits are comparable to that needed to potentially explain the scatter in the EB properties through injection of heat, perhaps involving tidal interaction. It seems from the evidence at hand that this mechanism, however it operates in detail, has more influence on the surface properties of the stars than on their internal structure, as the lithium abundances are broadly in good agreement with model predictions. The

  19. Transit detections of extrasolar planets around main-sequence stars. I. Sky maps for hot Jupiters

    Science.gov (United States)

    Heller, R.; Mislis, D.; Antoniadis, J.

    2009-12-01

    Context: The findings of more than 350 extrasolar planets, most of them nontransiting Hot Jupiters, have revealed correlations between the metallicity of the main-sequence (MS) host stars and planetary incidence. This connection can be used to calculate the planet formation probability around other stars, not yet known to have planetary companions. Numerous wide-field surveys have recently been initiated, aiming at the transit detection of extrasolar planets in front of their host stars. Depending on instrumental properties and the planetary distribution probability, the promising transit locations on the celestial plane will differ among these surveys. Aims: We want to locate the promising spots for transit surveys on the celestial plane and strive for absolute values of the expected number of transits in general. Our study will also clarify the impact of instrumental properties such as pixel size, field of view (FOV), and magnitude range on the detection probability. Methods: We used data of the Tycho catalog for ≈1 million objects to locate all the stars with 0^m~≲~m_V~≲~11.5m on the celestial plane. We took several empirical relations between the parameters listed in the Tycho catalog, such as distance to Earth, m_V, and (B-V), and those parameters needed to account for the probability of a star to host an observable, transiting exoplanet. The empirical relations between stellar metallicity and planet occurrence combined with geometrical considerations were used to yield transit probabilities for the MS stars in the Tycho catalog. Magnitude variations in the FOV were simulated to test whether this fluctuations would be detected by BEST, XO, SuperWASP and HATNet. Results: We present a sky map of the expected number of Hot Jupiter transit events on the basis of the Tycho catalog. Conditioned by the accumulation of stars towards the galactic plane, the zone of the highest number of transits follows the same trace, interrupted by spots of very low and high

  20. The SFR-M∗ main sequence archetypal star-formation history and analytical models

    Science.gov (United States)

    Ciesla, L.; Elbaz, D.; Fensch, J.

    2017-12-01

    The star-formation history (SFH) of galaxies is a key assumption to derive their physical properties and can lead to strong biases. In this work, we derive the SFH of main sequence (MS) galaxies and show how the peak SFH of a galaxy depends on its seed mass at, for example, z = 5. This seed mass reflects the galaxy's underlying dark matter (DM) halo environment. We show that, following the MS, galaxies undergo a drastic slow down of their stellar mass growth after reaching the peak of their SFH. According to abundance matching, these masses correspond to hot and massive DM halos which state could result in less efficient gas inflows on the galaxies and thus could be the origin of limited stellar mass growth. As a result, we show that galaxies, still on the MS, can enter the passive region of the UVJ diagram while still forming stars. The best fit to the MS SFH is provided by a right skew peak function for which we provide parameters depending on the seed mass of the galaxy. The ability of the classical analytical SFHs to retrieve the star-formation rate (SFR) of galaxies from spectral energy distribution (SED) fitting is studied. Due to mathematical limitations, the exponentially declining and delayed SFH struggle to model high SFR, which starts to be problematic at z > 2. The exponentially rising and log-normal SFHs exhibit the opposite behavior with the ability to reach very high SFR, and thus model starburst galaxies, but they are not able to model low values such as those expected at low redshift for massive galaxies. By simulating galaxies SED from the MS SFH, we show that these four analytical forms recover the SFR of MS galaxies with an error dependent on the model and the redshift. They are, however, sensitive enough to probe small variations of SFR within the MS, with an error ranging from 5 to 40% depending on the SFH assumption and redshift; but all the four fail to recover the SFR of rapidly quenched galaxies. However, these SFHs lead to an artificial

  1. Luminosity and Intrinsic Color Calibration of Main-Sequence Stars With 2Mass Photometry: All Sky Local Extinction

    Directory of Open Access Journals (Sweden)

    Knude Jens

    2003-12-01

    Full Text Available We present a new color index vs. absolute magnitude calibration of 2MASS JHK photometry. For the A0 to ~G5 and M segments of the main sequence information on the amount of interstellar extinction and its location in space may be obtained.

  2. The main challenges that remain in applying high-throughput sequencing to clinical diagnostics.

    Science.gov (United States)

    Loeffelholz, Michael; Fofanov, Yuriy

    2015-01-01

    Over the last 10 years, the quality, price and availability of high-throughput sequencing instruments have improved to the point that this technology may be close to becoming a routine tool in the diagnostic microbiology laboratory. Two groups of challenges, however, have to be resolved in order to move this powerful research technology into routine use in the clinical microbiology laboratory. The computational/bioinformatics challenges include data storage cost and privacy concerns, requiring analysis to be performed without access to cloud storage or expensive computational infrastructure. The logistical challenges include interpretation of complex results and acceptance and understanding of the advantages and limitations of this technology by the medical community. This article focuses on the approaches to address these challenges, such as file formats, algorithms, data collection, reporting and good laboratory practices.

  3. Testing Scaling Relations for Solar-like Oscillations from the Main Sequence to Red Giants Using Kepler Data

    DEFF Research Database (Denmark)

    Huber, D.; Bedding, T.R.; Stello, D.

    2011-01-01

    ), and oscillation amplitudes. We show that the difference of the Δν-νmax relation for unevolved and evolved stars can be explained by different distributions in effective temperature and stellar mass, in agreement with what is expected from scaling relations. For oscillation amplitudes, we show that neither (L/M) s......We have analyzed solar-like oscillations in ~1700 stars observed by the Kepler Mission, spanning from the main sequence to the red clump. Using evolutionary models, we test asteroseismic scaling relations for the frequency of maximum power (νmax), the large frequency separation (Δν...... scaling nor the revised scaling relation by Kjeldsen & Bedding is accurate for red-giant stars, and demonstrate that a revised scaling relation with a separate luminosity-mass dependence can be used to calculate amplitudes from the main sequence to red giants to a precision of ~25%. The residuals show...

  4. A catalog of pre-main-sequence emission-line stars with IRAS source associations

    International Nuclear Information System (INIS)

    Weintraub, D.A.

    1990-01-01

    To aid in finding premain-sequence (PMS) emission-line stars that might have dusty circumstellar environments, 361 PMS stars that are associated with 304 separate IRAS sources were identified. These stars include 200 classical T Tauri stars, 25 weak-lined (naked) T Tauri stars, 56 Herbig Ae/Be stars, six FU Orionis stars, and two SU Aurigae stars. All six of the FU Orionis stars surveyed by IRAS were detected. Of the PMS-IRAS Point Source Catalog (PSC) associations, 90 are new and are not noted in the PSC. The other 271 entries include 104 that are correctly identified in the PSC but have not yet appeared in the literature, 56 more that can be found in both the PSC and in the published and unpublished iterature, and 111 that are in the literature but not in the PSC. Spectral slope diagrams constructed from the 12-, 25-, and 60-micron flux densities reveal unique distributions for the different PMS subclasses; these diagrams may help identify the best candidate PMS stars for observations of circumstellar dust. 30 refs

  5. On the determination of the He abundance distribution in globular clusters from the width of the main sequence

    Science.gov (United States)

    Cassisi, Santi; Salaris, Maurizio; Pietrinferni, Adriano; Hyder, David

    2017-01-01

    One crucial piece of information to study the origin of multiple stellar populations in globular clusters is the range of initial helium abundances ΔY amongst the sub-populations hosted by each cluster. These estimates are commonly obtained by measuring the width in colour of the unevolved main sequence in an optical colour-magnitude diagram (CMD). The measured colour spread is then compared with predictions from theoretical stellar isochrones with varying initial He abundances to determine ΔY. The availability of UV/optical magnitudes, thanks to the Hubble Space Telescope UV Legacy Survey of Galactic GCs project, will allow the homogeneous determination of ΔY for a large Galactic globular cluster sample. From a theoretical point of view, accurate UV CMDs can efficiently disentangle the various sub-populations, and main sequence colour differences in the ACS F606W - (F606W - F814W) diagram allow an estimate of ΔY. We demonstrate that from a theoretical perspective, the (F606W - F814W) colour is an extremely reliable He-abundance indicator. The derivative dY/d(F606W - F814W), computed at a fixed luminosity along the unevolved main sequence, is largely insensitive to the physical assumptions made in stellar model computations, being more sensitive to the choice of the bolometric correction scale, and is only slightly dependent on the adopted set of stellar models. From a theoretical point of view, the (F606W - F814W) colour width of the cluster main sequence is therefore a robust diagnostic of the ΔY range.

  6. The age-metallicity relation in the solar neighbourhood from a pilot sample of white dwarf-main sequence binaries

    OpenAIRE

    Rebassa-Mansergas, A.; Anguiano, B.; García-Berro, E.; Freeman, K. C.; Cojocaru, R.; Manser, C. J.; Pala, A. F.; Gänsicke, B. T.; Liu, X. -W.

    2016-01-01

    The age–metallicity relation (AMR) is a fundamental observational constraint for understanding how the Galactic disc formed and evolved chemically in time. However, there is not yet an agreement on the observational properties of the AMR for the solar neighbourhood, primarily due to the difficulty in obtaining accurate stellar ages for individual field stars. We have started an observational campaign for providing the much needed observational input by using wide white-dwarf–main-sequence (WD...

  7. Magnetic inhibition of convection and the fundamental properties of low-mass stars. II. Fully convective main-sequence stars

    Energy Technology Data Exchange (ETDEWEB)

    Feiden, Gregory A. [Department of Physics and Astronomy, Uppsala University, Box 516, SE-751 20 Uppsala (Sweden); Chaboyer, Brian, E-mail: gregory.a.feiden@gmail.com, E-mail: brian.chaboyer@dartmouth.edu [Department of Physics and Astronomy, Dartmouth College, 6127 Wilder Laboratory, Hanover, NH 03755 (United States)

    2014-07-01

    We examine the hypothesis that magnetic fields are inflating the radii of fully convective main-sequence stars in detached eclipsing binaries (DEBs). The magnetic Dartmouth stellar evolution code is used to analyze two systems in particular: Kepler-16 and CM Draconis. Magneto-convection is treated assuming stabilization of convection and also by assuming reductions in convective efficiency due to a turbulent dynamo. We find that magnetic stellar models are unable to reproduce the properties of inflated fully convective main-sequence stars, unless strong interior magnetic fields in excess of 10 MG are present. Validation of the magnetic field hypothesis given the current generation of magnetic stellar evolution models therefore depends critically on whether the generation and maintenance of strong interior magnetic fields is physically possible. An examination of this requirement is provided. Additionally, an analysis of previous studies invoking the influence of star spots is presented to assess the suggestion that star spots are inflating stars and biasing light curve analyses toward larger radii. From our analysis, we find that there is not yet sufficient evidence to definitively support the hypothesis that magnetic fields are responsible for the observed inflation among fully convective main-sequence stars in DEBs.

  8. STELLAR AGES AND CONVECTIVE CORES IN FIELD MAIN-SEQUENCE STARS: FIRST ASTEROSEISMIC APPLICATION TO TWO KEPLER TARGETS

    Energy Technology Data Exchange (ETDEWEB)

    Silva Aguirre, V.; Christensen-Dalsgaard, J.; Chaplin, W. J. [Stellar Astrophysics Centre, Department of Physics and Astronomy, Aarhus University, Ny Munkegade 120, DK-8000 Aarhus C (Denmark); Basu, S.; Deheuvels, S. [Department of Astronomy, Yale University, P.O. Box 208101, New Haven, CT 06520-8101 (United States); Brandao, I. M.; Cunha, M. S.; Sousa, S. G. [Centro de Astrofisica and Faculdade de Ciencias, Universidade do Porto, Rua das Estrelas, 4150-762 Porto (Portugal); Dogan, G. [High Altitude Observatory, NCAR, P.O. Box 3000, Boulder, CO 80307 (United States); Metcalfe, T. S. [Space Science Institute, Boulder, CO 80301 (United States); Serenelli, A. M.; Garcia, R. A. [Kavli Institute for Theoretical Physics, Santa Barbara, CA 93106 (United States); Ballot, J. [Institut de Recherche en Astrophysique et Planetologie, CNRS, 14 avenue Edouard Belin, F-31400 Toulouse (France); Weiss, A. [Max Planck Institute for Astrophysics, Karl-Schwarzschild-Str. 1, D-85748 Garching bei Muenchen (Germany); Appourchaux, T. [Institut d' Astrophysique Spatiale, Universite Paris Sud-CNRS (UMR8617) Batiment 121, F-91405 Orsay Cedex (France); Casagrande, L. [Research School of Astronomy and Astrophysics, Mount Stromlo Observatory, The Australian National University, ACT 2611 (Australia); Cassisi, S. [INAF-Astronomical Observatory of Teramo, Via M. Maggini sn, I-64100 Teramo (Italy); Creevey, O. L. [Laboratoire Lagrange, Universite de Nice Sophia-Antipolis, CNRS, I-06300 Nice, France. (France); Lebreton, Y. [Observatoire de Paris, GEPI, CNRS UMR 8111, F-92195 Meudon (France); Noels, A. [Institute of Astrophysics and Geophysics, University of Liege, B-4000 Liege (Belgium); and others

    2013-06-01

    Using asteroseismic data and stellar evolution models we obtain the first detection of a convective core in a Kepler field main-sequence star, putting a stringent constraint on the total size of the mixed zone and showing that extra mixing beyond the formal convective boundary exists. In a slightly less massive target the presence of a convective core cannot be conclusively discarded, and thus its remaining main-sequence lifetime is uncertain. Our results reveal that best-fit models found solely by matching individual frequencies of oscillations corrected for surface effects do not always properly reproduce frequency combinations. Moreover, slightly different criteria to define what the best-fit model is can lead to solutions with similar global properties but very different interior structures. We argue that the use of frequency ratios is a more reliable way to obtain accurate stellar parameters, and show that our analysis in field main-sequence stars can yield an overall precision of 1.5%, 4%, and 10% in radius, mass, and age, respectively. We compare our results with those obtained from global oscillation properties, and discuss the possible sources of uncertainties in asteroseismic stellar modeling where further studies are still needed.

  9. POST-MAIN SEQUENCE EVOLUTION OF ICY MINOR PLANETS: IMPLICATIONS FOR WATER RETENTION AND WHITE DWARF POLLUTION

    Energy Technology Data Exchange (ETDEWEB)

    Malamud, Uri; Perets, Hagai B., E-mail: uri.mal@tx.technion.ac.il, E-mail: hperets@physics.technion.ac.il [Department of Physics, Technion (Israel)

    2016-12-01

    Most observations of polluted white dwarf atmospheres are consistent with accretion of water-depleted planetary material. Among tens of known cases, merely two involve accretion of objects that contain a considerable mass fraction of water. The purpose of this study is to investigate the relative scarcity of these detections. Based on a new and highly detailed model, we evaluate the retention of water inside icy minor planets during the high-luminosity stellar evolution that follows the main sequence. Our model fully considers the thermal, physical, and chemical evolution of icy bodies, following their internal differentiation as well as water depletion, from the moment of their birth and through all stellar evolution phases preceding the formation of the white dwarf. We also account for different initial compositions and formation times. Our results differ from previous studies, which have either underestimated or overestimated water retention. We show that water can survive in a variety of circumstances and in great quantities, and therefore other possibilities are discussed in order to explain the infrequency of water detection. We predict that the sequence of accretion is such that water accretes earlier, and more rapidly, than the rest of the silicate disk, considerably reducing the chance of its detection in H-dominated atmospheres. In He-dominated atmospheres, the scarcity of water detections could be observationally biased. It implies that the accreted material is typically intrinsically dry, which may be the result of the inside-out depopulation sequence of minor planets.

  10. POST-MAIN SEQUENCE EVOLUTION OF ICY MINOR PLANETS: IMPLICATIONS FOR WATER RETENTION AND WHITE DWARF POLLUTION

    International Nuclear Information System (INIS)

    Malamud, Uri; Perets, Hagai B.

    2016-01-01

    Most observations of polluted white dwarf atmospheres are consistent with accretion of water-depleted planetary material. Among tens of known cases, merely two involve accretion of objects that contain a considerable mass fraction of water. The purpose of this study is to investigate the relative scarcity of these detections. Based on a new and highly detailed model, we evaluate the retention of water inside icy minor planets during the high-luminosity stellar evolution that follows the main sequence. Our model fully considers the thermal, physical, and chemical evolution of icy bodies, following their internal differentiation as well as water depletion, from the moment of their birth and through all stellar evolution phases preceding the formation of the white dwarf. We also account for different initial compositions and formation times. Our results differ from previous studies, which have either underestimated or overestimated water retention. We show that water can survive in a variety of circumstances and in great quantities, and therefore other possibilities are discussed in order to explain the infrequency of water detection. We predict that the sequence of accretion is such that water accretes earlier, and more rapidly, than the rest of the silicate disk, considerably reducing the chance of its detection in H-dominated atmospheres. In He-dominated atmospheres, the scarcity of water detections could be observationally biased. It implies that the accreted material is typically intrinsically dry, which may be the result of the inside-out depopulation sequence of minor planets.

  11. AN M DWARF COMPANION TO AN F-TYPE STAR IN A YOUNG MAIN-SEQUENCE BINARY

    Energy Technology Data Exchange (ETDEWEB)

    Eigmüller, Ph.; Csizmadia, Sz.; Erikson, A.; Fridlund, M.; Pasternacki, Th.; Rauer, H. [Institute of Planetary Research, German Aerospace Center Rutherfordstr. 2, D-12489 Berlin (Germany); Eislöffel, J.; Lehmann, H.; Hartmann, M.; Hatzes, A. [Thüringer Landessternwarte Tautenburg Sternwarte 5, D-07778 Tautenburg (Germany); Tkachenko, A. [Instituut voor Sterrenkunde, KU Leuven Celestijnenlaan 200D, 3001 Leuven (Belgium); Voss, H., E-mail: philipp.eigmueller@dlr.de [Universitat de Barcelona, Department of Astronomy and Meteorology Martí i Franquès, 1, E-08028 Barcelona (Spain)

    2016-03-15

    Only a few well characterized very low-mass M dwarfs are known today. Our understanding of M dwarfs is vital as these are the most common stars in our solar neighborhood. We aim to characterize the properties of a rare F+dM stellar system for a better understanding of the low-mass end of the Hertzsprung–Russel diagram. We used photometric light curves and radial velocity follow-up measurements to study the binary. Spectroscopic analysis was used in combination with isochrone fitting to characterize the primary star. The primary star is an early F-type main-sequence star with a mass of (1.493 ± 0.073) M{sub ⊙} and a radius of (1.474 ± 0.040) R{sub ⊙}. The companion is an M dwarf with a mass of (0.188 ± 0.014) M{sub ⊙} and a radius of (0.234 ± 0.009) R{sub ⊙}. The orbital period is (1.35121 ± 0.00001) days. The secondary star is among the lowest-mass M dwarfs known to date. The binary has not reached a 1:1 spin–orbit synchronization. This indicates a young main-sequence binary with an age below ∼250 Myr. The mass–radius relation of both components are in agreement with this finding.

  12. TESTING SCALING RELATIONS FOR SOLAR-LIKE OSCILLATIONS FROM THE MAIN SEQUENCE TO RED GIANTS USING KEPLER DATA

    Energy Technology Data Exchange (ETDEWEB)

    Huber, D.; Bedding, T. R.; Stello, D. [Sydney Institute for Astronomy (SIfA), School of Physics, University of Sydney, NSW 2006 (Australia); Hekker, S. [Astronomical Institute ' Anton Pannekoek' , University of Amsterdam, Science Park 904, 1098 XH Amsterdam (Netherlands); Mathur, S. [High Altitude Observatory, NCAR, P.O. Box 3000, Boulder, CO 80307 (United States); Mosser, B. [LESIA, CNRS, Universite Pierre et Marie Curie, Universite Denis, Diderot, Observatoire de Paris, 92195 Meudon cedex (France); Verner, G. A.; Elsworth, Y. P.; Hale, S. J.; Chaplin, W. J. [School of Physics and Astronomy, University of Birmingham, Birmingham B15 2TT (United Kingdom); Bonanno, A. [INAF Osservatorio Astrofisico di Catania (Italy); Buzasi, D. L. [Eureka Scientific, 2452 Delmer Street Suite 100, Oakland, CA 94602-3017 (United States); Campante, T. L. [Centro de Astrofisica da Universidade do Porto, Rua das Estrelas, 4150-762 Porto (Portugal); Kallinger, T. [Department of Physics and Astronomy, University of British Columbia, Vancouver (Canada); Silva Aguirre, V. [Max-Planck-Institut fuer Astrophysik, Karl-Schwarzschild-Str. 1, 85748 Garching (Germany); De Ridder, J. [Instituut voor Sterrenkunde, K.U.Leuven (Belgium); Garcia, R. A. [Laboratoire AIM, CEA/DSM-CNRS, Universite Paris 7 Diderot, IRFU/SAp, Centre de Saclay, 91191, Gif-sur-Yvette (France); Appourchaux, T. [Institut d' Astrophysique Spatiale, UMR 8617, Universite Paris Sud, 91405 Orsay Cedex (France); Frandsen, S. [Danish AsteroSeismology Centre (DASC), Department of Physics and Astronomy, Aarhus University, DK-8000 Aarhus C (Denmark); Houdek, G., E-mail: dhuber@physics.usyd.edu.au [Institute of Astronomy, University of Vienna, 1180 Vienna (Austria); and others

    2011-12-20

    We have analyzed solar-like oscillations in {approx}1700 stars observed by the Kepler Mission, spanning from the main sequence to the red clump. Using evolutionary models, we test asteroseismic scaling relations for the frequency of maximum power ({nu}{sub max}), the large frequency separation ({Delta}{nu}), and oscillation amplitudes. We show that the difference of the {Delta}{nu}-{nu}{sub max} relation for unevolved and evolved stars can be explained by different distributions in effective temperature and stellar mass, in agreement with what is expected from scaling relations. For oscillation amplitudes, we show that neither (L/M){sup s} scaling nor the revised scaling relation by Kjeldsen and Bedding is accurate for red-giant stars, and demonstrate that a revised scaling relation with a separate luminosity-mass dependence can be used to calculate amplitudes from the main sequence to red giants to a precision of {approx}25%. The residuals show an offset particularly for unevolved stars, suggesting that an additional physical dependency is necessary to fully reproduce the observed amplitudes. We investigate correlations between amplitudes and stellar activity, and find evidence that the effect of amplitude suppression is most pronounced for subgiant stars. Finally, we test the location of the cool edge of the instability strip in the Hertzsprung-Russell diagram using solar-like oscillations and find the detections in the hottest stars compatible with a domain of hybrid stochastically excited and opacity driven pulsation.

  13. PRE-MAIN-SEQUENCE TURN-ON AS A CHRONOMETER FOR YOUNG CLUSTERS: NGC 346 AS A BENCHMARK

    International Nuclear Information System (INIS)

    Cignoni, M.; Tosi, M.; Sabbi, E.; Nota, A.; Degl'Innocenti, S.; Moroni, P. G. Prada; Gallagher, J. S.

    2010-01-01

    We present a novel approach to deriving the age of very young star clusters, by using the Turn-On (TOn). The TOn is the point in the color-magnitude diagram (CMD) where the pre-main sequence (PMS) joins the main sequence (MS). In the MS luminosity function (LF) of the cluster, the TOn is identified as a peak followed by a dip. We propose that by combining the CMD analysis with the monitoring of the spatial distribution of MS stars it is possible to reliably identify the TOn in extragalactic star-forming regions. Compared to alternative methods, this technique is complementary to the turnoff dating and avoids the systematic biases affecting the PMS phase. We describe the method and its uncertainties and apply it to the star-forming region NGC 346, which has been extensively imaged with the Hubble Space Telescope (HST). This study extends the LF approach in crowded extragalactic regions and opens the way for future studies with HST/WFC3, the James Webb Space Telescope and from the ground with adaptive optics.

  14. Grain temperature, radiation pressure and electric potential in the vicinity of main sequence and white dwarf stars

    Energy Technology Data Exchange (ETDEWEB)

    Leiknes, J.; Havnes, O. (University of Tromso, Auroral Observatory (Norway))

    1984-08-01

    We present results of calculations of the grain physical parameters temperature, lifetime against evaporation, radiation pressure and electric potential for spherical grains near main sequence stars, hydrogen type (DA) white dwarfs and helium type (DB) white dwarfs. These parameters are essential in determining the behaviour of grains near such stars. The grain temperature as a function of stellar distance is calculated for grains of sizes 0.1 and 1 ..mu.. (micron) for grain materials of silicate (obsidian), iron and graphite. The lifetime due to thermal evaporation as a function of grain temperature of these materials is also given. The radiation pressure is given for grain sizes from 0.01 to 10 ..mu.. for the same three grain materials. Grain potentials have been calculated as functions of stellar distance for one photoelectron high yield material (silicate) and one low yield material (graphite) for grains of radius 0.1 ..mu.. embedded in a thermal plasma of temperature T = 10/sup 4/ K.

  15. Radio-emission of pre-main sequence stars of the Rho Ophiuchi cloud: observations and interpretation

    International Nuclear Information System (INIS)

    Andre, P.

    1987-11-01

    Observations of the radio continuum emission of a young star population have been made at VLA on the whole molecular cloud Rho Ophiuchi, one of the closest site of star formation. A dozen of stellar sources have been detected. Radio emission of some identified objects seems to have a magnetic nature and be produced by gyrosynchrotron mechanism. In particular, one of the sources shows a radio radiation circularly polarized; two other stars have a radiation strongly variable probably due to magnetic eruptions more important than those detected in X radiation. More generally, radio observations select probably a specific population of young stars characterized by magnetic field presence extended on several stellar radii and by absence of dense circumstellar environment. Spatial distribution of these objects suggest, they are younger than most of the pre-main sequence stars [fr

  16. The Solar Neighborhood. XLI. A Study of the Wide Main Sequence for M Dwarfs—Long-term Photometric Variability

    Energy Technology Data Exchange (ETDEWEB)

    Clements, Tiffany D.; Jao, Wei-Chun; Silverstein, Michele L. [Department of Physics and Astronomy, Georgia State University, Atlanta, GA 30303 (United States); Henry, Todd J.; Hosey, Altonio D. [RECONS Institute, Chambersburg, PA 17201 (United States); Winters, Jennifer G. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Dieterich, Sergio B. [Carnegie Institution for Science, Washington, DC 20015 (United States); Riedel, Adric R., E-mail: pewett@astro.gsu.edu, E-mail: jao@astro.gsu.edu, E-mail: silverstein@astro.gsu.edu, E-mail: toddhenry28@gmail.com, E-mail: altoniohosey@gmail.com, E-mail: jennifer.winters@cfa.harvard.edu, E-mail: sdieterich@carnegiescience.edu, E-mail: adric.riedel@gmail.com [Space Telescope Science Institute, Baltimore, MD 21218 (United States)

    2017-09-01

    We report findings from a long-term photometric variability study of M dwarfs carried out at the SMARTS 0.9 m telescope at the Cerro Tololo Inter-American Observatory. As part of a multi-faceted effort to investigate the range of luminosities of M dwarfs of a given color on the Hertzsprung–Russell Diagram, 76 M dwarfs have been observed for 3–17 years in the Johnson–Kron–Cousins V band. We find that stars elevated above the center of the main sequence distribution tend to have higher levels of variability, likely caused by magnetic activity, than their fainter counterparts below the center. This study provides insight into how the long-term magnetic activity of these stars may be affecting their sizes, luminosities, and thus positions on the H-R Diagram.

  17. Lithium abundances and metallicities in stars near the main-sequence turnoff and a giant in M67

    International Nuclear Information System (INIS)

    Garcia Lopez, R.J.; Rebolo, R.; Beckman, J.E.

    1988-01-01

    The iron abundance of seven stars near the main-sequence (MS) turnoff and a giant in M67 are spectroscopically derived, and the results are discussed. The resulting mean iron abundance of the turnoff stars is (Fe/H) = 0.04 + or - 0.04. Taken together with previous determinations for younger clusters, this shows that there has been relatively little change of the iron abundance in the solar neighborhood during the last 5 Gyr. Lithium was detected in one unevolved star and marginally in the giant, while in the other MS stars only upper limits were found. The considerable differences in Li abundances for stars with similar surface temperature imply that there is at least one parameter affecting Li depletion apart from stellar mass and metallicity. Nonsimultaneous star formation in the cluster cloud explain the scatter in lithium abundances. 50 references

  18. X-ray sources in regions of star formation. II. The pre-main-sequence G star HDE 283572

    International Nuclear Information System (INIS)

    Walter, F.M.; Brown, A.; Linsky, J.L.; Rydgren, A.E.; Vrba, F.; Joint Institute for Laboratory Astrophysics, Boulder, CO; Computer Sciences Corp., El Segundo, CA; Naval Observatory, Flagstaff, AZ)

    1987-01-01

    This paper reports the detection of HDE 283572, a ninth-magnitude G star 8 arcmin south of RY Tau, as a bright X-ray source. The observations reveal this object to be a fairly massive (about 2 solar masses) pre-main-sequence star associated with the Taurus-Auriga star formation complex. It exhibits few of the characteristics of the classical T Tauri stars and is a good example of a naked T Tauri star. The star is a mid-G subgiant, of about three solar radii and rotates with a period of 1.5 d. The coronal and chromospheric surface fluxes are similar to those of the most active late type stars (excluding T Tauri stars). The X-ray and UV lines most likely arise in different atmospheric structures. Radiative losses are some 1000 times the quiet solar value and compare favorably with those of T Tauri stars. 49 references

  19. Stellar Variability at the Main-sequence Turnoff of the Intermediate-age LMC Cluster NGC 1846

    Science.gov (United States)

    Salinas, R.; Pajkos, M. A.; Vivas, A. K.; Strader, J.; Contreras Ramos, R.

    2018-04-01

    Intermediate-age (IA) star clusters in the Large Magellanic Cloud (LMC) present extended main-sequence turn-offs (MSTO) that have been attributed to either multiple stellar populations or an effect of stellar rotation. Recently it has been proposed that these extended main sequences can also be produced by ill-characterized stellar variability. Here we present Gemini-S/Gemini Multi-Object Spectrometer (GMOS) time series observations of the IA cluster NGC 1846. Using differential image analysis, we identified 73 new variable stars, with 55 of those being of the Delta Scuti type, that is, pulsating variables close the MSTO for the cluster age. Considering completeness and background contamination effects, we estimate the number of δ Sct belonging to the cluster between 40 and 60 members, although this number is based on the detection of a single δ Sct within the cluster half-light radius. This amount of variable stars at the MSTO level will not produce significant broadening of the MSTO, albeit higher-resolution imaging will be needed to rule out variable stars as a major contributor to the extended MSTO phenomenon. Though modest, this amount of δ Sct makes NGC 1846 the star cluster with the highest number of these variables ever discovered. Lastly, our results present a cautionary tale about the adequacy of shallow variability surveys in the LMC (like OGLE) to derive properties of its δ Sct population. Based on observations obtained at the Gemini Observatory, which is operated by the Association of Universities for Research in Astronomy, Inc., under a cooperative agreement with the NSF on behalf of the Gemini partnership: the National Science Foundation (United States), the National Research Council (Canada), CONICYT (Chile), Ministerio de Ciencia, Tecnología e Innovación Productiva (Argentina), and Ministério da Ciência, Tecnologia e Inovação (Brazil).

  20. MASS LOSS IN PRE-MAIN-SEQUENCE STARS VIA CORONAL MASS EJECTIONS AND IMPLICATIONS FOR ANGULAR MOMENTUM LOSS

    Energy Technology Data Exchange (ETDEWEB)

    Aarnio, Alicia N. [Astronomy Department, University of Michigan, 830 Dennison Building, 500 Church Street, Ann Arbor, MI 48109 (United States); Matt, Sean P. [Laboratoire AIM Paris-Saclay, CEA/Irfu Universite Paris-Diderot CNRS/INSU, F-91191 Gif-sur-Yvette (France); Stassun, Keivan G., E-mail: aarnio@umich.edu [Department of Physics and Astronomy, Vanderbilt University, Nashville, TN 37235 (United States)

    2012-11-20

    We develop an empirical model to estimate mass-loss rates via coronal mass ejections (CMEs) for solar-type pre-main-sequence (PMS) stars. Our method estimates the CME mass-loss rate from the observed energies of PMS X-ray flares, using our empirically determined relationship between solar X-ray flare energy and CME mass: log (M {sub CME}[g]) = 0.63 Multiplication-Sign log (E {sub flare}[erg]) - 2.57. Using masses determined for the largest flaring magnetic structures observed on PMS stars, we suggest that this solar-calibrated relationship may hold over 10 orders of magnitude in flare energy and 7 orders of magnitude in CME mass. The total CME mass-loss rate we calculate for typical solar-type PMS stars is in the range 10{sup -12}-10{sup -9} M {sub Sun} yr{sup -1}. We then use these CME mass-loss rate estimates to infer the attendant angular momentum loss leading up to the main sequence. Assuming that the CME outflow rate for a typical {approx}1 M {sub Sun} T Tauri star is <10{sup -10} M {sub Sun} yr{sup -1}, the resulting spin-down torque is too small during the first {approx}1 Myr to counteract the stellar spin-up due to contraction and accretion. However, if the CME mass-loss rate is {approx}> 10{sup -10} M {sub Sun} yr{sup -1}, as permitted by our calculations, then the CME spin-down torque may influence the stellar spin evolution after an age of a few Myr.

  1. Detection of [O III] at z ∼ 3: A Galaxy Above the Main Sequence, Rapidly Assembling Its Stellar Mass

    Science.gov (United States)

    Vishwas, Amit; Ferkinhoff, Carl; Nikola, Thomas; Parshley, Stephen C.; Schoenwald, Justin P.; Stacey, Gordon J.; Higdon, Sarah J. U.; Higdon, James L.; Weiss, Axel; Güsten, Rolf; Menten, Karl M.

    2018-04-01

    We detect bright emission in the far-infrared (far-IR) fine structure [O III] 88 μm line from a strong lensing candidate galaxy, H-ATLAS J113526.3-014605, hereafter G12v2.43, at z = 3.127, using the second-generation Redshift (z) and Early Universe Spectrometer (ZEUS-2) at the Atacama Pathfinder Experiment Telescope (APEX). This is only the fifth detection of this far-IR line from a submillimeter galaxy at the epoch of galaxy assembly. The observed [O III] luminosity of 7.1 × 109 ≤ft(\\tfrac{10}{μ }\\right) L ⊙ likely arises from H II regions around massive stars, and the amount of Lyman continuum photons required to support the ionization indicate the presence of (1.2–5.2) × 106 ≤ft(\\tfrac{10}{μ }\\right) equivalent O5.5 or higher stars, where μ would be the lensing magnification factor. The observed line luminosity also requires a minimum mass of ∼2 × 108 ≤ft(\\tfrac{10}{μ }\\right) M ⊙ in ionized gas, that is 0.33% of the estimated total molecular gas mass of 6 × 1010 ≤ft(\\tfrac{10}{μ }\\right) M ⊙. We compile multi-band photometry tracing rest-frame ultraviolet to millimeter continuum emission to further constrain the properties of this dusty high-redshift, star-forming galaxy. Via SED modeling we find G12v2.43 is forming stars at a rate of 916 ≤ft(\\tfrac{10}{μ }\\right) M ⊙ yr‑1 and already has a stellar mass of 8 × 1010 ≤ft(\\tfrac{10}{μ }\\right) M ⊙. We also constrain the age of the current starburst to be ≤slant 5 Myr, making G12v2.43 a gas-rich galaxy lying above the star-forming main sequence at z ∼ 3, undergoing a growth spurt, and it could be on the main sequence within the derived gas depletion timescale of ∼66 Myr.

  2. Post-main-sequence Evolution of Icy Minor Planets. II. Water Retention and White Dwarf Pollution around Massive Progenitor Stars

    Energy Technology Data Exchange (ETDEWEB)

    Malamud, Uri; Perets, Hagai B., E-mail: uri.mal@tx.technion.ac.il, E-mail: hperets@physics.technion.ac.il [Department of Physics, Technion (Israel)

    2017-06-10

    Most studies suggest that the pollution of white dwarf (WD) atmospheres arises from the accretion of minor planets, but the exact properties of polluting material, and in particular the evidence for water in some cases, are not yet understood. Here we study the water retention of small icy bodies in exo-solar planetary systems, as their respective host stars evolve through and off the main sequence and eventually become WDs. We explore, for the first time, a wide range of star masses and metallicities. We find that the mass of the WD progenitor star is of crucial importance for the retention of water, while its metallicity is relatively unimportant. We predict that minor planets around lower-mass WD progenitors would generally retain more water and would do so at closer distances from the WD than compared with high-mass progenitors. The dependence of water retention on progenitor mass and other parameters has direct implications for the origin of observed WD pollution, and we discuss how our results and predictions might be tested in the future as more observations of WDs with long cooling ages become available.

  3. Rotation-induced YORP break-up of small bodies to produce post-main-sequence debris

    Science.gov (United States)

    Veras, D.; Jacobson, S. A.; Gänsicke, B. T.

    2017-09-01

    We hypothesize that the in situ break-up of small bodies such as asteroids spun to fission during the giant branch phases of stellar evolution provides an important contribution to the debris orbiting and ultimately polluting white dwarfs. The YORP (Yarkovsky-O'Keefe-Radviesvki-Paddock) effect, which arises from radiation pressure, accelerates the spin rate of asymmetric asteroids, which can eventually shear themselves apart. This pressure is maintained and enhanced around dying stars because the outward push of an asteroid due to stellar mass loss is insignificant compared to the resulting stellar luminosity increase. Consequently, giant star radiation will destroy nearly all bodies with radii in the range 100 m-10 km that survive their parent star's main-sequence lifetime within a distance of about 7 au; smaller bodies are spun apart to their strongest, competent components. This estimate is conservative and would increase for highly asymmetric shapes or incorporation of the inward drag due to giant star stellar wind. The resulting debris field, which could extend to thousands of au, may be perturbed by remnant planetary systems to reproduce the observed dusty and gaseous discs which accompany polluted white dwarfs.

  4. THE EXTENDED MAIN-SEQUENCE TURNOFF CLUSTERS OF THE LARGE MAGELLANIC CLOUD-MISSING LINKS IN GLOBULAR CLUSTER EVOLUTION

    International Nuclear Information System (INIS)

    Keller, Stefan C.; Mackey, A. Dougal; Da Costa, Gary S.

    2011-01-01

    Recent observations of intermediate-age (1-3 Gyr) massive star clusters in the Large Magellanic Cloud have revealed that the majority possess bifurcated or extended main-sequence turnoff (EMSTO) morphologies. This effect can be understood to arise from subsequent star formation among the stellar population with age differences between constituent stars amounting to 50-300 Myr. Age spreads of this order are similarly invoked to explain the light-element abundance variations witnessed in ancient globular clusters (GCs). In this paper, we explore the proposition that the clusters exhibiting the EMSTO phenomenon are a general phase in the evolution of massive clusters, one that naturally leads to the particular chemical properties of the ancient GC population. We show that the isolation of EMSTO clusters to intermediate ages is the consequence of observational selection effects. In our proposed scenario, the EMSTO phenomenon is identical to that which establishes the light-element abundance variations that are ubiquitous in the ancient GC population. Our scenario makes a strong prediction: EMSTO clusters will exhibit abundance variations in the light-elements characteristic of the ancient GC population.

  5. AK SCO, FIRST DETECTION OF A HIGHLY DISTURBED ATMOSPHERE IN A PRE-MAIN-SEQUENCE CLOSE BINARY

    International Nuclear Information System (INIS)

    Gomez de Castro, Ana I.

    2009-01-01

    AK Sco is a unique source: a ∼10 Myr old pre-main-sequence (PMS) spectroscopic binary composed of two nearly equal F5 stars that at periastron are separated by barely 11 stellar radii, so the stellar magnetospheres fill the Roche lobe at periastron. The orbit is not yet circularized (e = 0.47) and very strong tides are expected. This makes AK Sco the ideal laboratory to study the effect of gravitational tides in the stellar magnetic field building up during PMS evolution. In this Letter, the detection of a highly disturbed (σ ≅ 100 km s -1 ) and very dense atmosphere (n e = 1.6 x 10 10 cm -3 ) is reported. Significant line broadening blurs any signs of ion belts or bow shocks in the spectrum of the atmospheric plasma. The radiative losses cannot be accounted for solely by the dissipation of energy from the tidal wave propagating in the stellar atmosphere or by the accreting material. The release of internal energy from the star seems to be the most likely source of the plasma heating. This is the first clear indication of a highly disturbed atmosphere surrounding a PMS close binary.

  6. AK Sco, First Detection of a Highly Disturbed Atmosphere in a Pre-Main-Sequence Close Binary

    Science.gov (United States)

    Gómez de Castro, Ana I.

    2009-06-01

    AK Sco is a unique source: a ~10 Myr old pre-main-sequence (PMS) spectroscopic binary composed of two nearly equal F5 stars that at periastron are separated by barely 11 stellar radii, so the stellar magnetospheres fill the Roche lobe at periastron. The orbit is not yet circularized (e = 0.47) and very strong tides are expected. This makes AK Sco the ideal laboratory to study the effect of gravitational tides in the stellar magnetic field building up during PMS evolution. In this Letter, the detection of a highly disturbed (σ sime 100 km s-1) and very dense atmosphere (n e = 1.6 × 1010 cm-3) is reported. Significant line broadening blurs any signs of ion belts or bow shocks in the spectrum of the atmospheric plasma. The radiative losses cannot be accounted for solely by the dissipation of energy from the tidal wave propagating in the stellar atmosphere or by the accreting material. The release of internal energy from the star seems to be the most likely source of the plasma heating. This is the first clear indication of a highly disturbed atmosphere surrounding a PMS close binary.

  7. 2D and 3D Models of Convective Turbulence and Oscillations in Intermediate-Mass Main-Sequence Stars

    Science.gov (United States)

    Guzik, Joyce Ann; Morgan, Taylor H.; Nelson, Nicholas J.; Lovekin, Catherine; Kitiashvili, Irina N.; Mansour, Nagi N.; Kosovichev, Alexander

    2015-08-01

    We present multidimensional modeling of convection and oscillations in main-sequence stars somewhat more massive than the sun, using three separate approaches: 1) Applying the spherical 3D MHD ASH (Anelastic Spherical Harmonics) code to simulate the core convection and radiative zone. Our goal is to determine whether core convection can excite low-frequency gravity modes, and thereby explain the presence of low frequencies for some hybrid gamma Dor/delta Sct variables for which the envelope convection zone is too shallow for the convective blocking mechanism to drive g modes; 2) Using the 3D planar ‘StellarBox’ radiation hydrodynamics code to model the envelope convection zone and part of the radiative zone. Our goals are to examine the interaction of stellar pulsations with turbulent convection in the envelope, excitation of acoustic modes, and the role of convective overshooting; 3) Applying the ROTORC 2D stellar evolution and dynamics code to calculate evolution with a variety of initial rotation rates and extents of core convective overshooting. The nonradial adiabatic pulsation frequencies of these nonspherical models will be calculated using the 2D pulsation code NRO of Clement. We will present new insights into gamma Dor and delta Sct pulsations gained by multidimensional modeling compared to 1D model expectations.

  8. EXTENDED MAGNETOSPHERES IN PRE-MAIN-SEQUENCE EVOLUTION: FROM T TAURI STARS TO THE BROWN DWARF LIMIT

    Energy Technology Data Exchange (ETDEWEB)

    Gomez de Castro, Ana I.; Marcos-Arenal, Pablo [Grupo de Investigacion Complutense AEGORA, Universidad Complutense de Madrid, 28040 Madrid (Spain)

    2012-04-20

    Low-mass pre-main-sequence stars, i.e., T Tauri stars (TTSs), strongly radiate at high energies, from X-rays to the ultraviolet (UV). This excess radiation with respect to main-sequence cool stars (MSCSs) is associated with the accretion process, i.e., it is produced in the extended magnetospheres, in the accretion shocks on the stellar surface, and in the outflows. Although evidence of accretion shocks and outflow contribution to the high-energy excess have been recently addressed, there is not an updated revision of the magnetospheric contribution. This article addresses this issue. The UV observations of the TTSs in the well-known Taurus region have been analyzed together with the XMM-Newton observations compiled in the XEST survey. For the first time the high sensitivity of the Hubble Space Telescope UV instrumentation has allowed measurement of the UV line fluxes of TTSs to M8 type. UV- and X-ray-normalized fluxes have been determined to study the extent and properties of the TTS magnetospheres as a class. They have been compared with the atmospheres of the MSCSs. The main results from this analysis are (1) the normalized fluxes of all the tracers are correlated; this correlation is independent of the broad mass range and the hardness of the X-ray radiation field; (2) the TTS correlations are different than the MSCS correlations; (3) there is a very significant excess emission in O I in the TTSs compared with MSCSs that seems to be caused by recombination radiation from the disk atmosphere after photoionization by extreme UV radiation; the Fe II/Mg II recombination continuum has also been detected in several TTSs and most prominently in AA Tau; and (4) the normalized flux of the UV tracers anticorrelates with the strength of the X-ray flux, i.e., the stronger the X-ray surface flux is, the weaker the observed UV flux. This last behavior is counterintuitive within the framework of stellar dynamo theory and suggests that UV emission can be produced in the

  9. The Problem of Hipparcos Distances to Open Clusters. Report 1; Constraints from Multicolor a Main-Sequence Fitting

    Science.gov (United States)

    Pinsonneault, Marc H.; Stauffer, John; Soderblom, David R.; King, Jeremy R.; Hanson, Robert B.

    1998-01-01

    Parallax data from the Hipparcos mission allow the direct distance to open clusters to be compared with the distance inferred from main-sequence (MS) fitting. There are surprising differences between the two distance measurements. indicating either the need for changes in the cluster compositions or reddening, underlying problems with the technique of MS fitting, or systematic errors in the Hipparcos parallaxes at the 1 mas level. We examine the different possibilities, focusing on MS fitting in both metallicity-sensitive B-V and metallicity-insensitive V-I for five well-studied systems (the Hyades, Pleiades, alpha Per, Praesepe, and Coma Ber). The Hipparcos distances to the Hyades and alpha Per are within 1 sigma of the MS-fitting distance in B-V and V-I, while the Hipparcos distances to Coma Ber and the Pleiades are in disagreement with the MS-fitting distance at more than the 3 sigma level. There are two Hipparcos measurements of the distance to Praesepe; one is in good agreement with the MS-fitting distance and the other disagrees at the 2 sigma level. The distance estimates from the different colors are in conflict with one another for Coma but in agreement for the Pleiades. Changes in the relative cluster metal abundances, age related effects, helium, and reddening are shown to be unlikely to explain the puzzling behavior of the Pleiades. We present evidence for spatially dependent systematic errors at the 1 mas level in the parallaxes of Pleiades stars. The implications of this result are discussed.

  10. ON THE RELIABILITY OF STELLAR AGES AND AGE SPREADS INFERRED FROM PRE-MAIN-SEQUENCE EVOLUTIONARY MODELS

    International Nuclear Information System (INIS)

    Hosokawa, Takashi; Offner, Stella S. R.; Krumholz, Mark R.

    2011-01-01

    We revisit the problem of low-mass pre-main-sequence stellar evolution and its observational consequences for where stars fall on the Hertzsprung-Russell diagram (HRD). In contrast to most previous work, our models follow stars as they grow from small masses via accretion, and we perform a systematic study of how the stars' HRD evolution is influenced by their initial radius, by the radiative properties of the accretion flow, and by the accretion history, using both simple idealized accretion histories and histories taken from numerical simulations of star cluster formation. We compare our numerical results to both non-accreting isochrones and to the positions of observed stars in the HRD, with a goal of determining whether both the absolute ages and the age dispersions inferred from non-accreting isochrones are reliable. We show that non-accreting isochrones can sometimes overestimate stellar ages for more massive stars (those with effective temperatures above ∼3500 K), thereby explaining why non-accreting isochrones often suggest a systematic age difference between more and less massive stars in the same cluster. However, we also find the only way to produce a similar overestimate for the ages of cooler stars is if these stars grow from ∼0.01 M sun seed protostars that are an order of magnitude smaller than predicted by current theoretical models, and if the size of the seed protostar correlates systematically with the final stellar mass at the end of accretion. We therefore conclude that, unless both of these conditions are met, inferred ages and age spreads for cool stars are reliable, at least to the extent that the observed bolometric luminosities and temperatures are accurate. Finally, we note that the time dependence of the mass accretion rate has remarkably little effect on low-mass stars' evolution on the HRD, and that such time dependence may be neglected for all stars except those with effective temperatures above ∼4000 K.

  11. OLD MAIN-SEQUENCE TURNOFF PHOTOMETRY IN THE SMALL MAGELLANIC CLOUD. II. STAR FORMATION HISTORY AND ITS SPATIAL GRADIENTS

    International Nuclear Information System (INIS)

    Noel, Noelia E. D.; Gallart, Carme; Hidalgo, Sebastian L.; Aparicio, Antonio; Costa, Edgardo; Mendez, Rene A.

    2009-01-01

    We present a quantitative analysis of the star formation history (SFH) of 12 fields in the Small Magellanic Cloud (SMC) based on unprecedented deep [(B - R), R] color-magnitude diagrams (CMDs). Our fields reach down to the oldest main-sequence turnoff with a high photometric accuracy, which is vital for obtaining accurate SFHs, particularly at intermediate and old ages. We use the IAC-pop code to obtain the SFH, using synthetic CMDs generated with IAC-star. We obtain the SFH as a function ψ(t, z) of age and metallicity. We also consider several auxiliary functions: the initial mass function (IMF), φ(m), and a function accounting for the frequency and relative mass distribution of binary stars, β(f, q). We find that there are several main periods of enhancement of star formation: a young one peaked at ∼0.2-0.5 Gyr old, only present in the eastern and in the central-most fields; two at intermediate ages present in all fields: a conspicuous one peaked at ∼4-5 Gyr, and a less significant one peaked at ∼1.5-2.5; and an old one, peaked at ∼10 Gyr in all fields but the western ones. In the western fields, this old enhancement splits into two, one peaked at ∼8 Gyr old and another at ∼12 Gyr old. This 'two-enhancement' zone is unaffected by our choice of stellar evolutionary library but more data covering other fields of the SMC are necessary in order to ascertain its significancy. Correlation between star formation rate enhancements and SMC-Milky Way encounters is not clear. Some correlation could exist with encounters taken from the orbit determination of Kallivayalil et al. But our results would also fit in a first pericenter passage scenario like the one claimed by Besla et al. For SMC-Large Magellanic Cloud encounters, we find a correlation only for the most recent encounter ∼0.2 Gyr ago. This coincides with the youngest ψ(t) enhancement peaked at these ages in our eastern fields. The population younger than 1 Gyr represents ∼7%-12% of the total

  12. How Dusty Is Alpha Centauri? Excess or Non-excess over the Infrared Photospheres of Main-sequence Stars

    Science.gov (United States)

    Wiegert, J.; Liseau, R.; Thebault, P.; Olofsson, G.; Mora, A.; Bryden, G.; Marshall, J. P.; Eiroa, C.; Montesinos, B.; Ardila, D.; hide

    2014-01-01

    Context. Debris discs around main-sequence stars indicate the presence of larger rocky bodies. The components of the nearby, solar-type binary Centauri have metallicities that are higher than solar, which is thought to promote giant planet formation. Aims. We aim to determine the level of emission from debris around the stars in the Cen system. This requires knowledge of their photospheres.Having already detected the temperature minimum, Tmin, of CenA at far-infrared wavelengths, we here attempt to do the same for the moreactive companion Cen B. Using the Cen stars as templates, we study the possible eects that Tmin may have on the detectability of unresolveddust discs around other stars. Methods.We used Herschel-PACS, Herschel-SPIRE, and APEX-LABOCA photometry to determine the stellar spectral energy distributions in thefar infrared and submillimetre. In addition, we used APEX-SHeFI observations for spectral line mapping to study the complex background around Cen seen in the photometric images. Models of stellar atmospheres and of particulate discs, based on particle simulations and in conjunctionwith radiative transfer calculations, were used to estimate the amount of debris around these stars. Results. For solar-type stars more distant than Cen, a fractional dust luminosity fd LdustLstar 2 107 could account for SEDs that do not exhibit the Tmin eect. This is comparable to estimates of fd for the Edgeworth-Kuiper belt of the solar system. In contrast to the far infrared,slight excesses at the 2:5 level are observed at 24 m for both CenA and B, which, if interpreted as due to zodiacal-type dust emission, wouldcorrespond to fd (13) 105, i.e. some 102 times that of the local zodiacal cloud. Assuming simple power-law size distributions of the dustgrains, dynamical disc modelling leads to rough mass estimates of the putative Zodi belts around the Cen stars, viz.4106 M$ of 4 to 1000 msize grains, distributed according to n(a) a3:5. Similarly, for filled-in Tmin

  13. A ChIP-Seq benchmark shows that sequence conservation mainly improves detection of strong transcription factor binding sites.

    Directory of Open Access Journals (Sweden)

    Tony Håndstad

    Full Text Available BACKGROUND: Transcription factors are important controllers of gene expression and mapping transcription factor binding sites (TFBS is key to inferring transcription factor regulatory networks. Several methods for predicting TFBS exist, but there are no standard genome-wide datasets on which to assess the performance of these prediction methods. Also, it is believed that information about sequence conservation across different genomes can generally improve accuracy of motif-based predictors, but it is not clear under what circumstances use of conservation is most beneficial. RESULTS: Here we use published ChIP-seq data and an improved peak detection method to create comprehensive benchmark datasets for prediction methods which use known descriptors or binding motifs to detect TFBS in genomic sequences. We use this benchmark to assess the performance of five different prediction methods and find that the methods that use information about sequence conservation generally perform better than simpler motif-scanning methods. The difference is greater on high-affinity peaks and when using short and information-poor motifs. However, if the motifs are specific and information-rich, we find that simple motif-scanning methods can perform better than conservation-based methods. CONCLUSIONS: Our benchmark provides a comprehensive test that can be used to rank the relative performance of transcription factor binding site prediction methods. Moreover, our results show that, contrary to previous reports, sequence conservation is better suited for predicting strong than weak transcription factor binding sites.

  14. The environmental impacts on the star formation main sequence: An Hα study of the newly discovered rich cluster at z = 1.52

    Energy Technology Data Exchange (ETDEWEB)

    Koyama, Yusei; Kodama, Tadayuki; Tadaki, Ken-ichi; Hayashi, Masao [National Astronomical Observatory of Japan, Mitaka, Tokyo 181-8588 (Japan); Tanaka, Ichi [Subaru Telescope, National Astronomical Observatory of Japan, 650 North A' ohoku Place, Hilo, HI 96720 (United States); Shimakawa, Rhythm, E-mail: koyama.yusei@nao.ac.jp [Department of Astronomical Science, The Graduate University for Advanced Studies, Mitaka, Tokyo 181-8588 (Japan)

    2014-07-01

    We report the discovery of a strong over-density of galaxies in the field of a radio galaxy at z = 1.52 (4C 65.22) based on our broadband and narrow-band (Hα) photometry with the Subaru Telescope. We find that Hα emitters are located in the outskirts of the density peak (cluster core) dominated by passive red-sequence galaxies. This resembles the situation in lower-redshift clusters, suggesting that the newly discovered structure is a well-evolved rich galaxy cluster at z = 1.5. Our data suggest that the color-density and stellar mass-density relations are already in place at z ∼ 1.5, mostly driven by the passive red massive galaxies residing within r{sub c} ≲ 200 kpc from the cluster core. These environmental trends almost disappear when we consider only star-forming (SF) galaxies. We do not find SFR-density or SSFR-density relations amongst SF galaxies, and the location of the SF main sequence does not significantly change with environment. Nevertheless, we find a tentative hint that star-bursting galaxies (up-scattered objects from the main sequence) are preferentially located in a small group at ∼1 Mpc away from the main body of the cluster. We also argue that the scatter of the SF main sequence could be dependent on the distance to the nearest neighboring galaxy.

  15. A search for pre-main-sequence stars in high-latitude molecular clouds. 3: A survey of the Einstein database

    Science.gov (United States)

    Caillault, Jean-Pierre; Magnani, Loris; Fryer, Chris

    1995-01-01

    In order to discern whether the high-latitude molecular clouds are regions of ongoing star formation, we have used X-ray emission as a tracer of youthful stars. The entire Einstein database yields 18 images which overlap 10 of the clouds mapped partially or completely in the CO (1-0) transition, providing a total of approximately 6 deg squared of overlap. Five previously unidentified X-ray sources were detected: one has an optical counterpart which is a pre-main-sequence (PMS) star, and two have normal main-sequence stellar counterparts, while the other two are probably extragalactic sources. The PMS star is located in a high Galactic latitude Lynds dark cloud, so this result is not too suprising. The translucent clouds, though, have yet to reveal any evidence of star formation.

  16. A search for pre-main sequence stars in the high-latitude molecular clouds. II - A survey of the Einstein database

    Science.gov (United States)

    Caillault, Jean-Pierre; Magnani, Loris

    1990-01-01

    The preliminary results are reported of a survey of every EINSTEIN image which overlaps any high-latitude molecular cloud in a search for X-ray emitting pre-main sequence stars. This survey, together with complementary KPNO and IRAS data, will allow the determination of how prevalent low mass star formation is in these clouds in general and, particularly, in the translucent molecular clouds.

  17. Evolution models of helium white dwarf-main-sequence star merger remnants: the mass distribution of single low-mass white dwarfs

    Science.gov (United States)

    Zhang, Xianfei; Hall, Philip D.; Jeffery, C. Simon; Bi, Shaolan

    2018-02-01

    It is not known how single white dwarfs with masses less than 0.5Msolar -- low-mass white dwarfs -- are formed. One way in which such a white dwarf might be formed is after the merger of a helium-core white dwarf with a main-sequence star that produces a red giant branch star and fails to ignite helium. We use a stellar-evolution code to compute models of the remnants of these mergers and find a relation between the pre-merger masses and the final white dwarf mass. Combining our results with a model population, we predict that the mass distribution of single low-mass white dwarfs formed through this channel spans the range 0.37 to 0.5Msolar and peaks between 0.45 and 0.46Msolar. Helium white dwarf--main-sequence star mergers can also lead to the formation of single helium white dwarfs with masses up to 0.51Msolar. In our model the Galactic formation rate of single low-mass white dwarfs through this channel is about 8.7X10^-3yr^-1. Comparing our models with observations, we find that the majority of single low-mass white dwarfs (<0.5Msolar) are formed from helium white dwarf--main-sequence star mergers, at a rate which is about $2$ per cent of the total white dwarf formation rate.

  18. THE CONTRIBUTIONS OF INTERACTIVE BINARY STARS TO DOUBLE MAIN-SEQUENCE TURNOFFS AND DUAL RED CLUMP OF INTERMEDIATE-AGE STAR CLUSTERS

    International Nuclear Information System (INIS)

    Yang Wuming; Bi Shaolan; Tian Zhijia; Li Tanda; Liu Kang; Meng Xiangcun

    2011-01-01

    Double or extended main-sequence turnoffs (DMSTOs) and dual red clump (RC) were observed in intermediate-age clusters, such as in NGC 1846 and 419. The DMSTOs are interpreted as that the cluster has two distinct stellar populations with differences in age of about 200-300 Myr but with the same metallicity. The dual RC is interpreted as a result of a prolonged star formation. Using a stellar population-synthesis method, we calculated the evolution of a binary-star stellar population. We found that binary interactions and merging can reproduce the dual RC in the color-magnitude diagrams of an intermediate-age cluster, whereas in actuality only a single population exists. Moreover, the binary interactions can lead to an extended main-sequence turnoff (MSTO) rather than DMSTOs. However, the rest of the main sequence, subgiant branch, and first giant branch are hardly spread by the binary interactions. Part of the observed dual RC and extended MSTO may be the results of binary interactions and mergers.

  19. STELLAR DIAMETERS AND TEMPERATURES. III. MAIN-SEQUENCE A, F, G, AND K STARS: ADDITIONAL HIGH-PRECISION MEASUREMENTS AND EMPIRICAL RELATIONS

    International Nuclear Information System (INIS)

    Boyajian, Tabetha S.; Jones, Jeremy; White, Russel; McAlister, Harold A.; Gies, Douglas; Von Braun, Kaspar; Van Belle, Gerard; Farrington, Chris; Schaefer, Gail; Ten Brummelaar, Theo A.; Sturmann, Laszlo; Sturmann, Judit; Turner, Nils H.; Goldfinger, P. J.; Vargas, Norm; Ridgway, Stephen

    2013-01-01

    Based on CHARA Array measurements, we present the angular diameters of 23 nearby, main-sequence stars, ranging from spectral types A7 to K0, 5 of which are exoplanet host stars. We derive linear radii, effective temperatures, and absolute luminosities of the stars using Hipparcos parallaxes and measured bolometric fluxes. The new data are combined with previously published values to create an Angular Diameter Anthology of measured angular diameters to main-sequence stars (luminosity classes V and IV). This compilation consists of 125 stars with diameter uncertainties of less than 5%, ranging in spectral types from A to M. The large quantity of empirical data is used to derive color-temperature relations to an assortment of color indices in the Johnson (BVR J I J JHK), Cousins (R C I C ), Kron (R K I K ), Sloan (griz), and WISE (W 3 W 4 ) photometric systems. These relations have an average standard deviation of ∼3% and are valid for stars with spectral types A0-M4. To derive even more accurate relations for Sun-like stars, we also determined these temperature relations omitting early-type stars (T eff > 6750 K) that may have biased luminosity estimates because of rapid rotation; for this subset the dispersion is only ∼2.5%. We find effective temperatures in agreement within a couple of percent for the interferometrically characterized sample of main-sequence stars compared to those derived via the infrared flux method and spectroscopic analysis.

  20. LINEAR RELATION FOR WIND-BLOWN BUBBLE SIZES OF MAIN-SEQUENCE OB STARS IN A MOLECULAR ENVIRONMENT AND IMPLICATION FOR SUPERNOVA PROGENITORS

    Energy Technology Data Exchange (ETDEWEB)

    Chen Yang; Zhou Ping [Department of Astronomy, Nanjing University, Nanjing 210093 (China); Chu Youhua [Department of Astronomy, University of Illinois at Urbana-Champaign, 1002 West Green Street, Urbana, IL 61801 (United States)

    2013-05-20

    We find a linear relationship between the size of a massive star's main-sequence bubble in a molecular environment and the star's initial mass: R{sub b} Almost-Equal-To 1.22 M/M{sub Sun} - 9.16 pc, assuming a constant interclump pressure. Since stars in the mass range of 8 to 25-30 M{sub Sun} will end their evolution in the red supergiant phase without launching a Wolf-Rayet wind, the main-sequence wind-blown bubbles are mainly responsible for the extent of molecular gas cavities, while the effect of the photoionization is comparatively small. This linear relation can thus be used to infer the masses of the massive star progenitors of supernova remnants (SNRs) that are discovered to evolve in molecular cavities, while few other means are available for inferring the properties of SNR progenitors. We have used this method to estimate the initial masses of the progenitors of eight SNRs: Kes 69, Kes 75, Kes 78, 3C 396, 3C 397, HC 40, Vela, and RX J1713-3946.

  1. STELLAR DIAMETERS AND TEMPERATURES. III. MAIN-SEQUENCE A, F, G, AND K STARS: ADDITIONAL HIGH-PRECISION MEASUREMENTS AND EMPIRICAL RELATIONS

    Energy Technology Data Exchange (ETDEWEB)

    Boyajian, Tabetha S.; Jones, Jeremy; White, Russel; McAlister, Harold A.; Gies, Douglas [Center for High Angular Resolution Astronomy and Department of Physics and Astronomy, Georgia State University, P.O. Box 4106, Atlanta, GA 30302-4106 (United States); Von Braun, Kaspar [NASA Exoplanet Science Institute, California Institute of Technology, MC 100-22, Pasadena, CA 91125 (United States); Van Belle, Gerard [Lowell Observatory, Flagstaff, AZ 86001 (United States); Farrington, Chris; Schaefer, Gail; Ten Brummelaar, Theo A.; Sturmann, Laszlo; Sturmann, Judit; Turner, Nils H.; Goldfinger, P. J.; Vargas, Norm [CHARA Array, Mount Wilson Observatory, Mount Wilson, CA 91023 (United States); Ridgway, Stephen [National Optical Astronomy Observatory, P.O. Box 26732, Tucson, AZ 85726-6732 (United States)

    2013-07-01

    Based on CHARA Array measurements, we present the angular diameters of 23 nearby, main-sequence stars, ranging from spectral types A7 to K0, 5 of which are exoplanet host stars. We derive linear radii, effective temperatures, and absolute luminosities of the stars using Hipparcos parallaxes and measured bolometric fluxes. The new data are combined with previously published values to create an Angular Diameter Anthology of measured angular diameters to main-sequence stars (luminosity classes V and IV). This compilation consists of 125 stars with diameter uncertainties of less than 5%, ranging in spectral types from A to M. The large quantity of empirical data is used to derive color-temperature relations to an assortment of color indices in the Johnson (BVR{sub J} I{sub J} JHK), Cousins (R{sub C} I{sub C}), Kron (R{sub K} I{sub K}), Sloan (griz), and WISE (W{sub 3} W{sub 4}) photometric systems. These relations have an average standard deviation of {approx}3% and are valid for stars with spectral types A0-M4. To derive even more accurate relations for Sun-like stars, we also determined these temperature relations omitting early-type stars (T{sub eff} > 6750 K) that may have biased luminosity estimates because of rapid rotation; for this subset the dispersion is only {approx}2.5%. We find effective temperatures in agreement within a couple of percent for the interferometrically characterized sample of main-sequence stars compared to those derived via the infrared flux method and spectroscopic analysis.

  2. Evolution models of helium white dwarf--main-sequence star merger remnants: the mass distribution of single low-mass white dwarfs

    OpenAIRE

    Zhang, Xianfei; Hall, Philip D.; Jeffery, C. Simon; Bi, Shaolan

    2017-01-01

    It is not known how single white dwarfs with masses less than 0.5Msolar -- low-mass white dwarfs -- are formed. One way in which such a white dwarf might be formed is after the merger of a helium-core white dwarf with a main-sequence star that produces a red giant branch star and fails to ignite helium. We use a stellar-evolution code to compute models of the remnants of these mergers and find a relation between the pre-merger masses and the final white dwarf mass. Combining our results with ...

  3. IRAS 18153-1651: an H II region with a possible wind bubble blown by a young main-sequence B star

    Science.gov (United States)

    Gvaramadze, V. V.; Mackey, J.; Kniazev, A. Y.; Langer, N.; Chené, A.-N.; Castro, N.; Haworth, T. J.; Grebel, E. K.

    2017-04-01

    We report the results of spectroscopic observations and numerical modelling of the H II region IRAS 18153-1651. Our study was motivated by the discovery of an optical arc and two main-sequence stars of spectral type B1 and B3 near the centre of IRAS 18153-1651. We interpret the arc as the edge of the wind bubble (blown by the B1 star), whose brightness is enhanced by the interaction with a photoevaporation flow from a nearby molecular cloud. This interpretation implies that we deal with a unique case of a young massive star (the most massive member of a recently formed low-mass star cluster) caught just tens of thousands of years after its stellar wind has begun to blow a bubble into the surrounding dense medium. Our 2D, radiation-hydrodynamics simulations of the wind bubble and the H II region around the B1 star provide a reasonable match to observations, both in terms of morphology and absolute brightness of the optical and mid-infrared emission, and verify the young age of IRAS 18153-1651. Taken together our results strongly suggest that we have revealed the first example of a wind bubble blown by a main-sequence B star.

  4. Mitochondrial import of human and yeast fumarase in live mammalian cells: Retrograde translocation of the yeast enzyme is mainly caused by its poor targeting sequence

    International Nuclear Information System (INIS)

    Singh, Bhag; Gupta, Radhey S.

    2006-01-01

    Studies on yeast fumarase provide the main evidence for dual localization of a protein in mitochondria and cytosol by means of retrograde translocation. We have examined the subcellular targeting of yeast and human fumarase in live cells to identify factors responsible for this. The cDNAs for mature yeast or human fumarase were fused to the gene for enhanced green fluorescent protein (eGFP) and they contained, at their N-terminus, a mitochondrial targeting sequence (MTS) derived from either yeast fumarase, human fumarase, or cytochrome c oxidase subunit VIII (COX) protein. Two nuclear localization sequences (2x NLS) were also added to these constructs to facilitate detection of any cytosolic protein by its targeting to nucleus. In Cos-1 cells transfected with these constructs, human fumarase with either the native or COX MTSs was detected exclusively in mitochondria in >98% of the cells, while the remainder 1-2% of the cells showed varying amounts of nuclear labeling. In contrast, when human fumarase was fused to the yeast MTS, >50% of the cells showed nuclear labeling. Similar studies with yeast fumarase showed that with its native MTS, nuclear labeling was seen in 80-85% of the cells, but upon fusion to either human or COX MTS, nuclear labeling was observed in only 10-15% of the cells. These results provide evidence that extramitochondrial presence of yeast fumarase is mainly caused by the poor mitochondrial targeting characteristics of its MTS (but also affected by its primary sequence), and that the retrograde translocation mechanism does not play a significant role in the extramitochondrial presence of mammalian fumarase

  5. Stress rotations due to the M6.5 foreshock and M7.3 main shock in the 2016 Kumamoto, SW Japan, earthquake sequence

    Science.gov (United States)

    Yoshida, Keisuke; Hasegawa, Akira; Saito, Tatsuhiko; Asano, Youichi; Tanaka, Sachiko; Sawazaki, Kaoru; Urata, Yumi; Fukuyama, Eiichi

    2016-10-01

    A shallow M7.3 event with a M6.5 foreshock occurred along the Futagawa-Hinagu fault zone in Kyushu, SW Japan. We investigated the spatiotemporal variation of the stress orientations in and around the source area of this 2016 Kumamoto earthquake sequence by inverting 1218 focal mechanisms. The results show that the σ3 axis in the vicinity of the fault plane significantly rotated counterclockwise after the M6.5 foreshock and rotated clockwise after the M7.3 main shock in the Hinagu fault segment. This observation indicates that a significant portion of the shear stress was released both by the M6.5 foreshock and M7.3 main shock. It is estimated that the stress release by the M6.5 foreshock occurred in the shallower part of the Hinagu fault segment, which brought the stress concentration in its deeper part. This might have caused the M7.3 main shock rupture mainly along the deeper part of the Hinagu fault segment after 28 h.

  6. POPULATION PARAMETERS OF INTERMEDIATE-AGE STAR CLUSTERS IN THE LARGE MAGELLANIC CLOUD. II. NEW INSIGHTS FROM EXTENDED MAIN-SEQUENCE TURNOFFS IN SEVEN STAR CLUSTERS

    International Nuclear Information System (INIS)

    Goudfrooij, Paul; Kozhurina-Platais, Vera; Puzia, Thomas H.; Chandar, Rupali

    2011-01-01

    We discuss new photometry from high-resolution images of seven intermediate-age (1-2 Gyr) star clusters in the Large Magellanic Cloud taken with the Advanced Camera for Surveys on board the Hubble Space Telescope. We fit color-magnitude diagrams (CMDs) with several different sets of theoretical isochrones and determine systematic uncertainties for population parameters when derived using any one set of isochrones. The cluster CMDs show several interesting features, including extended main-sequence turnoff (MSTO) regions, narrow red giant branches, and clear sequences of unresolved binary stars. We show that the extended MSTOs are not caused by photometric uncertainties, contamination by field stars, or the presence of binary stars. Enhanced helium abundances in a fraction of cluster stars are also ruled out as the reason for the extended MSTOs. Quantitative comparisons with simulations indicate that the MSTO regions are better described by a spread in ages than by a bimodal age distribution, although we cannot formally rule out the latter for the three lowest-mass clusters in our sample (which have masses lower than ∼3 x 10 4 M sun ). This conclusion differs from that of some previous works which suggested that the age distribution in massive clusters in our sample is bimodal. This suggests that any secondary star formation occurred in an extended fashion rather than through short bursts. We discuss these results in the context of the nature of multiple stellar populations in star clusters.

  7. Extended Main-sequence Turn-offs in Intermediate-age Star Clusters: Stellar Rotation Diminishes, but Does Not Eliminate, Age Spreads

    Energy Technology Data Exchange (ETDEWEB)

    Goudfrooij, Paul; Correnti, Matteo [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Girardi, Léo, E-mail: goudfroo@stsci.edu [Osservatorio Astronomico di Padova—INAF, Vicolo dell’Osservatorio 5, I-35122 Padova (Italy)

    2017-09-01

    Extended main-sequence turn-off (eMSTO) regions are a common feature in color–magnitude diagrams of young- and intermediate-age star clusters in the Magellanic Clouds. The nature of eMSTOs remains debated in the literature. The currently most popular scenarios are extended star formation activity and ranges of stellar rotation rates. Here we study details of differences in main-sequence turn-off (MSTO) morphology expected from spreads in age versus spreads in rotation rates, using Monte Carlo simulations with the Geneva syclist isochrone models that include the effects of stellar rotation. We confirm a recent finding of Niederhofer et al. that a distribution of stellar rotation velocities yields an MSTO extent that is proportional to the cluster age, as observed. However, we find that stellar rotation yields MSTO crosscut widths that are generally smaller than observed ones at a given age. We compare the simulations with high-quality Hubble Space Telescope data of NGC 1987 and NGC 2249, which are the two only relatively massive star clusters with an age of ∼1 Gyr for which such data is available. We find that the distribution of stars across the eMSTOs of these clusters cannot be explained solely by a distribution of stellar rotation velocities, unless the orientations of rapidly rotating stars are heavily biased toward an equator-on configuration. Under the assumption of random viewing angles, stellar rotation can account for ∼60% and ∼40% of the observed FWHM widths of the eMSTOs of NGC 1987 and NGC 2249, respectively. In contrast, a combination of distributions of stellar rotation velocities and stellar ages fits the observed eMSTO morphologies very well.

  8. The evolution of surface magnetic fields in young solar-type stars II: the early main sequence (250-650 Myr)

    Science.gov (United States)

    Folsom, C. P.; Bouvier, J.; Petit, P.; Lèbre, A.; Amard, L.; Palacios, A.; Morin, J.; Donati, J.-F.; Vidotto, A. A.

    2018-03-01

    There is a large change in surface rotation rates of sun-like stars on the pre-main sequence and early main sequence. Since these stars have dynamo-driven magnetic fields, this implies a strong evolution of their magnetic properties over this time period. The spin-down of these stars is controlled by interactions between stellar and magnetic fields, thus magnetic evolution in turn plays an important role in rotational evolution. We present here the second part of a study investigating the evolution of large-scale surface magnetic fields in this critical time period. We observed stars in open clusters and stellar associations with known ages between 120 and 650 Myr, and used spectropolarimetry and Zeeman Doppler Imaging to characterize their large-scale magnetic field strength and geometry. We report 15 stars with magnetic detections here. These stars have masses from 0.8 to 0.95 M⊙, rotation periods from 0.326 to 10.6 d, and we find large-scale magnetic field strengths from 8.5 to 195 G with a wide range of geometries. We find a clear trend towards decreasing magnetic field strength with age, and a power law decrease in magnetic field strength with Rossby number. There is some tentative evidence for saturation of the large-scale magnetic field strength at Rossby numbers below 0.1, although the saturation point is not yet well defined. Comparing to younger classical T Tauri stars, we support the hypothesis that differences in internal structure produce large differences in observed magnetic fields, however for weak-lined T Tauri stars this is less clear.

  9. PHIBSS: MOLECULAR GAS CONTENT AND SCALING RELATIONS IN z ∼ 1-3 MASSIVE, MAIN-SEQUENCE STAR-FORMING GALAXIES

    International Nuclear Information System (INIS)

    Tacconi, L. J.; Genzel, R.; Wuyts, S.; Förster Schreiber, N. M.; Gracia-Carpio, J.; Lutz, D.; Saintonge, A.; Neri, R.; Cox, P.; Combes, F.; Bolatto, A.; Cooper, M. C.; Bournaud, F.; Burkert, A.; Comerford, J.; Davis, M.; Newman, S.; García-Burillo, S.; Naab, T.; Omont, A.

    2013-01-01

    We present PHIBSS, the IRAM Plateau de Bure high-z blue sequence CO 3-2 survey of the molecular gas properties in massive, main-sequence star-forming galaxies (SFGs) near the cosmic star formation peak. PHIBSS provides 52 CO detections in two redshift slices at z ∼ 1.2 and 2.2, with log(M * (M ☉ )) ≥ 10.4 and log(SFR(M ☉ /yr)) ≥ 1.5. Including a correction for the incomplete coverage of the M * -SFR plane, and adopting a ''Galactic'' value for the CO-H 2 conversion factor, we infer average gas fractions of ∼0.33 at z ∼ 1.2 and ∼0.47 at z ∼ 2.2. Gas fractions drop with stellar mass, in agreement with cosmological simulations including strong star formation feedback. Most of the z ∼ 1-3 SFGs are rotationally supported turbulent disks. The sizes of CO and UV/optical emission are comparable. The molecular-gas-star-formation relation for the z = 1-3 SFGs is near-linear, with a ∼0.7 Gyr gas depletion timescale; changes in depletion time are only a secondary effect. Since this timescale is much less than the Hubble time in all SFGs between z ∼ 0 and 2, fresh gas must be supplied with a fairly high duty cycle over several billion years. At given z and M * , gas fractions correlate strongly with the specific star formation rate (sSFR). The variation of sSFR between z ∼ 0 and 3 is mainly controlled by the fraction of baryonic mass that resides in cold gas.

  10. THE CLUSTERED NATURE OF STAR FORMATION. PRE-MAIN-SEQUENCE CLUSTERS IN THE STAR-FORMING REGION NGC 602/N90 IN THE SMALL MAGELLANIC CLOUD

    International Nuclear Information System (INIS)

    Gouliermis, Dimitrios A.; Gennaro, Mario; Schmeja, Stefan; Dolphin, Andrew E.; Tognelli, Emanuele; Prada Moroni, Pier Giorgio

    2012-01-01

    Located at the tip of the wing of the Small Magellanic Cloud (SMC), the star-forming region NGC 602/N90 is characterized by the H II nebular ring N90 and the young cluster of pre-main-sequence (PMS) and early-type main-sequence stars NGC 602, located in the central area of the ring. We present a thorough cluster analysis of the stellar sample identified with Hubble Space Telescope/Advanced Camera for Surveys in the region. We show that apart from the central cluster low-mass PMS stars are congregated in 13 additional small, compact sub-clusters at the periphery of NGC 602, identified in terms of their higher stellar density with respect to the average background density derived from star counts. We find that the spatial distribution of the PMS stars is bimodal, with an unusually large fraction (∼60%) of the total population being clustered, while the remaining is diffusely distributed in the intercluster area, covering the whole central part of the region. From the corresponding color-magnitude diagrams we disentangle an age difference of ∼2.5 Myr between NGC 602 and the compact sub-clusters, which appear younger, on the basis of comparison of the brighter PMS stars with evolutionary models, which we accurately calculated for the metal abundance of the SMC. The diffuse PMS population appears to host stars as old as those in NGC 602. Almost all detected PMS sub-clusters appear to be centrally concentrated. When the complete PMS stellar sample, including both clustered and diffused stars, is considered in our cluster analysis, it appears as a single centrally concentrated stellar agglomeration, covering the whole central area of the region. Considering also the hot massive stars of the system, we find evidence that this agglomeration is hierarchically structured. Based on our findings, we propose a scenario according to which the region NGC 602/N90 experiences an active clustered star formation for the last ∼5 Myr. The central cluster NGC 602 was formed first

  11. GOODS-HERSCHEL: STAR FORMATION, DUST ATTENUATION, AND THE FIR–RADIO CORRELATION ON THE MAIN SEQUENCE OF STAR-FORMING GALAXIES UP TO z ≃ 4

    Energy Technology Data Exchange (ETDEWEB)

    Pannella, M.; Elbaz, D.; Daddi, E.; Hwang, H. S.; Schreiber, C.; Strazzullo, V.; Aussel, H.; Bethermin, M.; Cibinel, A.; Juneau, S.; Floc’h, E. Le; Leiton, R. [Laboratoire AIM-Paris-Saclay, CEA/DSM/Irfu—CNRS—Université Paris Diderot, CEA-Saclay, F-91191 Gif-sur-Yvette (France); Dickinson, M. [National Optical Astronomy Observatory, 950 North Cherry Avenue, Tucson, AZ 85719 (United States); Buat, V. [Aix-Marseille Université, CNRS, LAM (Laboratoire d’Astrophysique de Marseille) UMR7326, F-13388, Marseille (France); Charmandaris, V.; Magdis, G. [Institute for Astronomy, Astrophysics, Space Applications and Remote Sensing, National Observatory of Athens, 15236, Penteli (Greece); Ivison, R. J. [European Southern Observatory, Karl-Schwarzschild-Strasse 2, D-85748 Garching (Germany); Borgne, D. Le [Institut d’Astrophysique de Paris, UMR 7095, CNRS, 98bis boulevard Arago, F-75005 Paris (France); Lin, L. [Institute of Astronomy and Astrophysics, Academia Sinica, Taipei 106, Taiwan (China); Morrison, G. E. [Institute for Astronomy, University of Hawaii, Honolulu, Hawaii, HI-96822 (United States); and others

    2015-07-10

    We use deep panchromatic data sets in the GOODS-N field, from GALEX to the deepest Herschel far-infrared (FIR) and VLA radio continuum imaging, to explore the evolution of star-formation activity and dust attenuation properties of star-forming galaxies to z ≃ 4, using mass-complete samples. Our main results can be summarized as follows: (i) the slope of the star-formation rate–M{sub *} correlation is consistent with being constant ≃0.8 up to z ≃ 1.5, while its normalization keeps increasing with redshift; (ii) for the first time we are able to explore the FIR–radio correlation for a mass-selected sample of star-forming galaxies: the correlation does not evolve up to z ≃ 4; (iii) we confirm that galaxy stellar mass is a robust proxy for UV dust attenuation in star-forming galaxies, with more massive galaxies being more dust attenuated. Strikingly, we find that this attenuation relation evolves very weakly with redshift, with the amount of dust attenuation increasing by less than 0.3 mag over the redshift range [0.5–4] for a fixed stellar mass; (iv) the correlation between dust attenuation and the UV spectral slope evolves with redshift, with the median UV slope becoming bluer with redshift. By z ≃ 3, typical UV slopes are inconsistent, given the measured dust attenuations, with the predictions of commonly used empirical laws. (v) Finally, building on existing results, we show that gas reddening is marginally larger (by a factor of around 1.3) than the stellar reddening at all redshifts probed. Our results support a scenario where the ISM conditions of typical star-forming galaxies evolve with redshift, such that at z ≥ 1.5 Main Sequence galaxies have ISM conditions moving closer to those of local starbursts.

  12. Hydrodynamic ejection of bipolar flows from objects undergoing disk accretion: T Tauri stars, massive pre-main-sequence objects, and cataclysmic variables

    International Nuclear Information System (INIS)

    Torbett, M.V.

    1984-01-01

    A general mechanism is presented for generating pressure-driven winds that are intrinsically bipolar from objects undergoing disk accretion. The energy librated in a boundary layer shock as the disk matter impacts the central object is shown to be sufficient to eject a fraction βapprox.10 -2 to 10 -3 of the accreted mass. These winds are driven by a mechanism that accelerates the flow perpendicular to the plane of the disk and can therefore account for the bipolar geometry of the mass loss observed near young stars. The mass loss contained in these winds is comparable to that inferred for young stars. Thus, disk accretion-driven winds may constitute the T Tauri phase of stellar evolution. This mechanism is generally applicable, and thus massive pre-main-sequence objects as well as cataclysmic variables at times of enhanced accretion are predicted to eject bipolar outflows as well. Unmagnetized accreting neutron stas are also expected to eject bipolar flows. Since this mechanism requires stellar surfaces, however, it will not operate in disk accretion onto black holes

  13. The Gaia-ESO Survey: the present-day radial metallicity distribution of the Galactic disc probed by pre-main-sequence clusters

    Science.gov (United States)

    Spina, L.; Randich, S.; Magrini, L.; Jeffries, R. D.; Friel, E. D.; Sacco, G. G.; Pancino, E.; Bonito, R.; Bravi, L.; Franciosini, E.; Klutsch, A.; Montes, D.; Gilmore, G.; Vallenari, A.; Bensby, T.; Bragaglia, A.; Flaccomio, E.; Koposov, S. E.; Korn, A. J.; Lanzafame, A. C.; Smiljanic, R.; Bayo, A.; Carraro, G.; Casey, A. R.; Costado, M. T.; Damiani, F.; Donati, P.; Frasca, A.; Hourihane, A.; Jofré, P.; Lewis, J.; Lind, K.; Monaco, L.; Morbidelli, L.; Prisinzano, L.; Sousa, S. G.; Worley, C. C.; Zaggia, S.

    2017-05-01

    Context. The radial metallicity distribution in the Galactic thin disc represents a crucial constraint for modelling disc formation and evolution. Open star clusters allow us to derive both the radial metallicity distribution and its evolution over time. Aims: In this paper we perform the first investigation of the present-day radial metallicity distribution based on [Fe/H] determinations in late type members of pre-main-sequence clusters. Because of their youth, these clusters are therefore essential for tracing the current interstellar medium metallicity. Methods: We used the products of the Gaia-ESO Survey analysis of 12 young regions (age ages is not easily explained by the models. Our results reveal a complex interplay of several processes (e.g. star formation activity, initial mass function, supernova yields, gas flows) that controlled the recent evolution of the Milky Way. Based on observations made with the ESO/VLT, at Paranal Observatory, under program 188.B-3002 (The Gaia-ESO Public Spectroscopic Survey).Full Table 1 is only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/601/A70

  14. RADIO PROPERTIES OF THE BAT AGNs: THE FIR–RADIO RELATION, THE FUNDAMENTAL PLANE, AND THE MAIN SEQUENCE OF STAR FORMATION

    Energy Technology Data Exchange (ETDEWEB)

    Smith, Krista Lynne; Mushotzky, Richard F.; Vogel, Stuart; Shimizu, Thomas T. [Department of Astronomy, University of Maryland, College Park, MD 20742 (United States); Miller, Neal, E-mail: klsmith@astro.umd.edu [Department of Mathematics and Physics, Stevenson University, Stevenson, MD 21117 (United States)

    2016-12-01

    We conducted 22 GHz 1″ JVLA imaging of 70 radio-quiet active galactic nuclei (AGNs) from the Swift -BAT survey. We find radio cores in all but three objects. The radio morphologies of the sample fall into three groups: compact and core-dominated, extended, and jet-like. We spatially decompose each image into core flux and extended flux, and compare the extended radio emission with that predicted from previous Herschel observations using the canonical FIR–radio relation. After removing the AGN contribution to the FIR and radio flux densities, we find that the relation holds remarkably well despite the potentially different star formation physics in the circumnuclear environment. We also compare our core radio flux densities with predictions of coronal models and scale-invariant jet models for the origin of radio emission in radio-quiet AGNs, and find general consistency with both models. However, we find that the L {sub R}/ L {sub X} relation does not distinguish between star formation and non-relativistic AGN-driven outflows as the origin of radio emission in radio-quiet AGNs. Finally, we examine where objects with different radio morphologies fall in relation to the main sequence (MS) of star formation, and conclude that those AGNs that fall below the MS, as X-ray selected AGNs have been found to do, have core-dominated or jet-like 22 GHz morphologies.

  15. Escherichia coli Sequence Type 131 H30 Is the Main Driver of Emerging Extended-Spectrum-β-Lactamase-Producing E. coli at a Tertiary Care Center.

    Science.gov (United States)

    Johnson, James R; Johnston, Brian; Thuras, Paul; Launer, Bryn; Sokurenko, Evgeni V; Miller, Loren G

    2016-01-01

    The H 30 strain of Escherichia coli sequence type 131 (ST131- H 30) is a recently emerged, globally disseminated lineage associated with fluoroquinolone resistance and, via its H 30Rx subclone, the CTX-M-15 extended-spectrum beta-lactamase (ESBL). Here, we studied the clonal background and resistance characteristics of 109 consecutive recent E. coli clinical isolates (2015) and 41 historical ESBL-producing E. coli blood isolates (2004 to 2011) from a public tertiary care center in California with a rising prevalence of ESBL-producing E. coli isolates. Among the 2015 isolates, ST131, which was represented mainly by ST131- H 30, was the most common clonal lineage (23% overall). ST131- H 30 accounted for 47% (8/17) of ESBL-producing, 47% (14/30) of fluoroquinolone-resistant, and 33% (11/33) of multidrug-resistant isolates. ST131- H 30 also accounted for 53% (8/14) of dually fluoroquinolone-resistant, ESBL-producing isolates, with the remaining 47% comprised of diverse clonal groups that contributed a single isolate each. ST131- H 30Rx, with CTX-M-15, was the major ESBL producer (6/8) among ST131- H 30 isolates. ST131- H 30 and H 30Rx also dominated (46% and 37%, respectively) among the historical ESBL-producing isolates (2004 to 2011), without significant temporal shifts in relative prevalence. Thus, this medical center's recently emerging ESBL-producing E. coli strains, although multiclonal, are dominated by ST131- H 30 and H 30Rx, which are the only clonally expanded fluoroquinolone-resistant, ESBL-producing lineages. Measures to rapidly and effectively detect, treat, and control these highly successful lineages are needed. IMPORTANCE The ever-rising prevalence of resistance to first-line antibiotics among clinical Escherichia coli isolates leads to worse clinical outcomes and higher health care costs, thereby creating a need to discover its basis so that effective interventions can be developed. We found that the H 30 subset within E. coli sequence type 131

  16. EFFECT OF METALLICITY ON THE EVOLUTION OF THE HABITABLE ZONE FROM THE PRE-MAIN SEQUENCE TO THE ASYMPTOTIC GIANT BRANCH AND THE SEARCH FOR LIFE

    Energy Technology Data Exchange (ETDEWEB)

    Danchi, William C. [Exoplanets and Stellar Astrophysics Laboratory, NASA Goddard Space Flight Center, Code 667, Greenbelt, MD 20771 (United States); Lopez, Bruno, E-mail: william.c.danchi@nasa.gov, E-mail: bruno.lopez@oca.eu [Observatoire de la Cote d' Azur, Laboratoire Lagrange UMR 7293, BP 4229, F-06034 Nice Cedex 4 (France)

    2013-05-20

    During the course of stellar evolution, the location and width of the habitable zone changes as the luminosity and radius of the star evolves. The duration of habitability for a planet located at a given distance from a star is greatly affected by the characteristics of the host star. A quantification of these effects can be used observationally in the search for life around nearby stars. The longer the duration of habitability, the more likely it is that life has evolved. The preparation of observational techniques aimed at detecting life would benefit from the scientific requirements deduced from the evolution of the habitable zone. We present a study of the evolution of the habitable zone around stars of 1.0, 1.5, and 2.0 M{sub Sun} for metallicities ranging from Z = 0.0001 to Z = 0.070. We also consider the evolution of the habitable zone from the pre-main sequence until the asymptotic giant branch is reached. We find that metallicity strongly affects the duration of the habitable zone for a planet as well as the distance from the host star where the duration is maximized. For a 1.0 M{sub Sun} star with near solar metallicity, Z = 0.017, the duration of the habitable zone is >10 Gyr at distances 1.2-2.0 AU from the star, whereas the duration is >20 Gyr for high-metallicity stars (Z = 0.070) at distances of 0.7-1.8 AU, and {approx}4 Gyr at distances of 1.8-3.3 AU for low-metallicity stars (Z = 0.0001). Corresponding results have been obtained for stars of 1.5 and 2.0 solar masses.

  17. The State-of-the-art HST Astro-photometric Analysis of the Core of ω Centauri. III. The Main Sequence's Multiple Populations Galore

    Energy Technology Data Exchange (ETDEWEB)

    Bellini, A.; Anderson, J.; Van der Marel, R. P. [Space Telescope Science Institute, 3700 San Martin Dr., Baltimore, MD 21218 (United States); Milone, A. P.; Marino, A. F. [Research School of Astronomy and Astrophysics, Australian National University, Mt Stromlo Observatory, via Cotter Rd, Weston, ACT 2611 (Australia); Piotto, G.; Bedin, L. R. [Istituto Nazionale di Astrofisica, Osservatorio Astronomico di Padova, Vicolo dell’Osservatorio 5, Padova, I-35122 (Italy); King, I. R., E-mail: bellini@stsci.edu [Department of Astronomy, University of Washington, Box 351580, Seattle, WA 98195 (United States)

    2017-08-01

    We take advantage of the exquisite quality of the Hubble Space Telescope 26-filter astro-photometric catalog of the core of ω Cen presented in the first paper of this series and the empirical differential-reddening correction presented in the second paper in order to distill the main sequence into its constituent populations. To this end, we restrict ourselves to the five most useful filters: the magic “trio” of F275W, F336W, and F438W, along with F606W and F814W. We develop a strategy for identifying color systems where different populations stand out most distinctly, then we isolate those populations and examine them in other filters where their subpopulations also come to light. In this way, we have identified at least 15 subpopulations, each of which has a distinctive fiducial curve through our five-dimensional photometric space. We confirm the MSa to be split into two subcomponents, and find that both the bMS and the rMS are split into three subcomponents. Moreover, we have discovered two additional MS groups: the MSd (which has three subcomponents) shares similar properties with the bMS, and the MSe (which has four subcomponents) has properties more similar to those of the rMS. We examine the fiducial curves together and use synthetic spectra to infer relative heavy-element, light-element, and helium abundances for the populations. Our findings show that the stellar populations and star formation history of ω Cen are even more complex than inferred previously. Finally, we provide as a supplement to the original catalog a list that identifies for each star which population it is most likely associated with.

  18. A HIGHLY CONSISTENT FRAMEWORK FOR THE EVOLUTION OF THE STAR-FORMING ''MAIN SEQUENCE'' FROM z ∼ 0-6

    Energy Technology Data Exchange (ETDEWEB)

    Speagle, J. S. [Harvard University Department of Astronomy, 60 Garden Street, MS 46, Cambridge, MA 02138 (United States); Steinhardt, C. L.; Silverman, J. D. [Kavli IPMU, University of Tokyo, Kashiwanoha 5-1-5, Kashiwa-shi, Chiba 277-8583 (Japan); Capak, P. L., E-mail: jspeagle@cfa.harvard.edu [California Institute of Technology, MC 105-24, 1200 East California Boulevard, Pasadena, CA 91125 (United States)

    2014-10-01

    Using a compilation of 25 studies from the literature, we investigate the evolution of the star-forming galaxy (SFG) main sequence (MS) in stellar mass and star formation rate (SFR) out to z ∼ 6. After converting all observations to a common set of calibrations, we find a remarkable consensus among MS observations (∼0.1 dex 1σ interpublication scatter). By fitting for time evolution of the MS in bins of constant mass, we deconvolve the observed scatter about the MS within each observed redshift bin. After accounting for observed scatter between different SFR indicators, we find the width of the MS distribution is ∼0.2 dex and remains constant over cosmic time. Our best fits indicate the slope of the MS is likely time-dependent, with our best-fit log SFR(M {sub *}, t) = (0.84 ± 0.02 – 0.026 ± 0.003 × t)log M {sub *} – (6.51 ± 0.24 – 0.11 ± 0.03 × t), where t is the age of the universe in Gyr. We use our fits to create empirical evolutionary tracks in order to constrain MS galaxy star formation histories (SFHs), finding that (1) the most accurate representations of MS SFHs are given by delayed-τ models, (2) the decline in fractional stellar mass growth for a ''typical'' MS galaxy today is approximately linear for most of its lifetime, and (3) scatter about the MS can be generated by galaxies evolving along identical evolutionary tracks assuming an initial 1σ spread in formation times of ∼1.4 Gyr.

  19. Photometric Determination of the Mass Accretion Rates of Pre-main-sequence Stars. V. Recent Star Formation in the 30 Dor Nebula

    Science.gov (United States)

    De Marchi, Guido; Panagia, Nino; Beccari, Giacomo

    2017-09-01

    We report on the properties of the low-mass stars that recently formed in the central ˜ 2\\buildrel{ \\prime}\\over{.} 7× 2\\buildrel{ \\prime}\\over{.} 7 of 30 Dor, including the R136 cluster. Using the photometric catalog of De Marchi et al., based on observations with the Hubble Space Telescope, and the most recent extinction law for this field, we identify 1035 bona fide pre-main-sequence (PMS) stars showing {{H}}α excess emission at the 4σ level with an {{H}}α equivalent width of 20 Å or more. We find a wide spread in age spanning the range ˜ 0.1{--}50 {Myr}. We also find that the older PMS objects are placed in front of the R136 cluster and are separated from it by a conspicuous amount of absorbing material, indicating that star formation has proceeded from the periphery into the interior of the region. We derive physical parameters for all PMS stars, including masses m, ages t, and mass accretion rates {\\dot{M}}{acc}. To identify reliable correlations between these parameters, which are intertwined, we use a multivariate linear regression fit of the type {log}{\\dot{M}}{acc}=a× {log}t+b× {log}m+c. The values of a and b for 30 Dor are compatible with those found in NGC 346 and NGC 602. We extend the fit to a uniform sample of 1307 PMS stars with 0.5contract NAS5-26555.

  20. The State-of-the-art HST Astro-photometric Analysis of the Core of ω Centauri. III. The Main Sequence's Multiple Populations Galore

    Science.gov (United States)

    Bellini, A.; Milone, A. P.; Anderson, J.; Marino, A. F.; Piotto, G.; van der Marel, R. P.; Bedin, L. R.; King, I. R.

    2017-08-01

    We take advantage of the exquisite quality of the Hubble Space Telescope 26-filter astro-photometric catalog of the core of ω Cen presented in the first paper of this series and the empirical differential-reddening correction presented in the second paper in order to distill the main sequence into its constituent populations. To this end, we restrict ourselves to the five most useful filters: the magic “trio” of F275W, F336W, and F438W, along with F606W and F814W. We develop a strategy for identifying color systems where different populations stand out most distinctly, then we isolate those populations and examine them in other filters where their subpopulations also come to light. In this way, we have identified at least 15 subpopulations, each of which has a distinctive fiducial curve through our five-dimensional photometric space. We confirm the MSa to be split into two subcomponents, and find that both the bMS and the rMS are split into three subcomponents. Moreover, we have discovered two additional MS groups: the MSd (which has three subcomponents) shares similar properties with the bMS, and the MSe (which has four subcomponents) has properties more similar to those of the rMS. We examine the fiducial curves together and use synthetic spectra to infer relative heavy-element, light-element, and helium abundances for the populations. Our findings show that the stellar populations and star formation history of ω Cen are even more complex than inferred previously. Finally, we provide as a supplement to the original catalog a list that identifies for each star which population it is most likely associated with. Based on archival observations with the NASA/ESA Hubble Space Telescope, obtained at the Space Telescope Science Institute, which is operated by AURA, Inc., under NASA contract NAS 5-26555.

  1. A HIGHER EFFICIENCY OF CONVERTING GAS TO STARS PUSHES GALAXIES AT z ∼ 1.6 WELL ABOVE THE STAR-FORMING MAIN SEQUENCE

    Energy Technology Data Exchange (ETDEWEB)

    Silverman, J. D.; Rujopakarn, W. [Kavli Institute for the Physics and Mathematics of the Universe (WPI), The University of Tokyo Institutes for Advanced Study, The University of Tokyo, Kashiwa, Chiba 277-8583 (Japan); Daddi, E.; Liu, D. [Laboratoire AIM, CEA/DSM-CNRS-Universite Paris Diderot, Irfu/Service d’Astrophysique, CEA Saclay (France); Rodighiero, G. [Dipartimento di Fisica e Astronomia, Universita di Padova, vicolo Osservatorio, 3, I-35122 Padova (Italy); Sargent, M. [Astronomy Centre, Department of Physics and Astronomy, University of Sussex, Brighton BN1 9QH (United Kingdom); Renzini, A. [Instituto Nazionale de Astrofisica, Osservatorio Astronomico di Padova, v.co dell’Osservatorio 5, I-35122 Padova (Italy); Feruglio, C. [IRAM—Institut de RadioAstronomie Millimétrique, 300 rue de la Piscine, F-38406 Saint Martin d’Hères (France); Kashino, D. [Division of Particle and Astrophysical Science, Graduate School of Science, Nagoya University, Nagoya 464-8602 (Japan); Sanders, D. [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States); Kartaltepe, J. [National Optical Astronomy Observatory, 950 N. Cherry Avenue, Tucson, AZ 85719 (United States); Nagao, T. [Graduate School of Science and Engineering, Ehime University, 2-5 Bunkyo-cho, Matsuyama 790-8577 (Japan); Arimoto, N. [Subaru Telescope, 650 North A’ohoku Place, Hilo, HI-96720 (United States); Berta, S.; Lutz, D. [Max-Planck-Institut für extraterrestrische Physik, D-84571 Garching (Germany); Béthermin, M. [European Southern Observatory, Karl-Schwarzschild-Strasse 2, D-85748 Garching (Germany); Koekemoer, A., E-mail: john.silverman@ipmu.jp [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD, 21218 (United States); and others

    2015-10-20

    Local starbursts have a higher efficiency of converting gas into stars, as compared to typical star-forming galaxies at a given stellar mass, possibly indicative of different modes of star formation. With the peak epoch of galaxy formation occurring at z > 1, it remains to be established whether such an efficient mode of star formation is occurring at high redshift. To address this issue, we measure the molecular gas content of seven high-redshift (z ∼ 1.6) starburst galaxies with the Atacama Large Millimeter/submillimeter Array and IRAM/Plateau de Bure Interferometer. Our targets are selected from the sample of Herschel far-infrared-detected galaxies having star formation rates (∼300–800 M{sub ⊙} yr{sup −1}) elevated (≳4×) above the star-forming main sequence (MS) and included in the FMOS-COSMOS near-infrared spectroscopic survey of star-forming galaxies at z ∼ 1.6 with Subaru. We detect CO emission in all cases at high levels of significance, indicative of high gas fractions (∼30%–50%). Even more compelling, we firmly establish with a clean and systematic selection that starbursts, identified as MS outliers, at high redshift generally have a lower ratio of CO to total infrared luminosity as compared to typical MS star-forming galaxies, although with a smaller offset than expected based on past studies of local starbursts. We put forward a hypothesis that there exists a continuous increase in star formation efficiency with elevation from the MS with galaxy mergers as a possible physical driver. Along with a heightened star formation efficiency, our high-redshift sample is similar in other respects to local starbursts, such as being metal rich and having a higher ionization state of the interstellar medium.

  2. EFFECT OF METALLICITY ON THE EVOLUTION OF THE HABITABLE ZONE FROM THE PRE-MAIN SEQUENCE TO THE ASYMPTOTIC GIANT BRANCH AND THE SEARCH FOR LIFE

    International Nuclear Information System (INIS)

    Danchi, William C.; Lopez, Bruno

    2013-01-01

    During the course of stellar evolution, the location and width of the habitable zone changes as the luminosity and radius of the star evolves. The duration of habitability for a planet located at a given distance from a star is greatly affected by the characteristics of the host star. A quantification of these effects can be used observationally in the search for life around nearby stars. The longer the duration of habitability, the more likely it is that life has evolved. The preparation of observational techniques aimed at detecting life would benefit from the scientific requirements deduced from the evolution of the habitable zone. We present a study of the evolution of the habitable zone around stars of 1.0, 1.5, and 2.0 M ☉ for metallicities ranging from Z = 0.0001 to Z = 0.070. We also consider the evolution of the habitable zone from the pre-main sequence until the asymptotic giant branch is reached. We find that metallicity strongly affects the duration of the habitable zone for a planet as well as the distance from the host star where the duration is maximized. For a 1.0 M ☉ star with near solar metallicity, Z = 0.017, the duration of the habitable zone is >10 Gyr at distances 1.2-2.0 AU from the star, whereas the duration is >20 Gyr for high-metallicity stars (Z = 0.070) at distances of 0.7-1.8 AU, and ∼4 Gyr at distances of 1.8-3.3 AU for low-metallicity stars (Z = 0.0001). Corresponding results have been obtained for stars of 1.5 and 2.0 solar masses.

  3. A Constraint on the Formation Timescale of the Young Open Cluster NGC 2264: Lithium Abundance of Pre-main Sequence Stars

    Science.gov (United States)

    Lim, Beomdu; Sung, Hwankyung; Kim, Jinyoung S.; Bessell, Michael S.; Hwang, Narae; Park, Byeong-Gon

    2016-11-01

    The timescale of cluster formation is an essential parameter in order to understand the formation process of star clusters. Pre-main sequence (PMS) stars in nearby young open clusters reveal a large spread in brightness. If the spread were considered to be a result of a real spread in age, the corresponding cluster formation timescale would be about 5-20 Myr. Hence it could be interpreted that star formation in an open cluster is prolonged for up to a few tens of Myr. However, difficulties in reddening correction, observational errors, and systematic uncertainties introduced by imperfect evolutionary models for PMS stars can result in an artificial age spread. Alternatively, we can utilize Li abundance as a relative age indicator of PMS star to determine the cluster formation timescale. The optical spectra of 134 PMS stars in NGC 2264 have been obtained with MMT/Hectochelle. The equivalent widths have been measured for 86 PMS stars with a detectable Li line (3500\\lt {T}{eff}[{{K}}]≤slant 6500). Li abundance under the condition of local thermodynamic equilibrium (LTE) was derived using the conventional curve of growth method. After correction for non-LTE effects, we find that the initial Li abundance of NGC 2264 is A({Li})=3.2+/- 0.2. From the distribution of the Li abundances, the underlying age spread of the visible PMS stars is estimated to be about 3-4 Myr and this, together with the presence of embedded populations in NGC 2264, suggests that the cluster formed on a timescale shorter than 5 Myr.

  4. The Pisa pre-main sequence tracks and isochrones. A database covering a wide range of Z, Y, mass, and age values

    Science.gov (United States)

    Tognelli, E.; Prada Moroni, P. G.; Degl'Innocenti, S.

    2011-09-01

    Context. In recent years new observations of pre-main sequence stars (pre-MS) with Z ≤ Z⊙ have been made available. To take full advantage of the continuously growing amount of data of pre-MS stars in different environments, we need to develop updated pre-MS models for a wide range of metallicity to assign reliable ages and masses to the observed stars. Aims: We present updated evolutionary pre-MS models and isochrones for a fine grid of mass, age, metallicity, and helium values. Methods: We use a standard and well-tested stellar evolutionary code (i.e. FRANEC), that adopts outer boundary conditions from detailed and realistic atmosphere models. In this code, we incorporate additional improvements to the physical inputs related to the equation of state and the low temperature radiative opacities essential to computing low-mass stellar models. Results: We make available via internet a large database of pre-MS tracks and isochrones for a wide range of chemical compositions (Z = 0.0002-0.03), masses (M = 0.2-7.0 M⊙), and ages (1-100 Myr) for a solar-calibrated mixing length parameter α (i.e. 1.68). For each chemical composition, additional models were computed with two different mixing length values, namely α = 1.2 and 1.9. Moreover, for Z ≥ 0.008, we also provided models with two different initial deuterium abundances. The characteristics of the models have been discussed in detail and compared with other work in the literature. The main uncertainties affecting theoretical predictions have been critically discussed. Comparisons with selected data indicate that there is close agreement between theory and observation. Tracks and isochrones are available on the web at the http://astro.df.unipi.it/stellar-models/Tracks and isochrones are also available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/533/A109

  5. XMM-NEWTON MONITORING OF THE CLOSE PRE-MAIN-SEQUENCE BINARY AK SCO. EVIDENCE OF TIDE-DRIVEN FILLING OF THE INNER GAP IN THE CIRCUMBINARY DISK

    Energy Technology Data Exchange (ETDEWEB)

    Gomez de Castro, Ana Ines [S. D. Astronomia y Geodesia and Instituto de Matematica Interdisciplinar, Fac. de CC Matematicas, Universidad Complutense, E-28040 Madrid (Spain); Lopez-Santiago, Javier [Departamento de Astrofisica, Fac de CC Fisicas, Universidad Complutense, E-28040 Madrid (Spain); Talavera, Antonio [European Space Astronomy Center, Villanueva de la Canada, E-28691, Madrid (Spain); Sytov, A. Yu.; Bisikalo, D. [Institute of Astronomy of the Russian Academy of Sciences, Pyatnitskaya St. 48, 109017 Moscow (Russian Federation)

    2013-03-20

    AK Sco stands out among pre-main-sequence binaries because of its prominent ultraviolet excess, the high eccentricity of its orbit, and the strong tides driven by it. AK Sco consists of two F5-type stars that get as close as 11 R{sub *} at periastron passage. The presence of a dense (n{sub e} {approx} 10{sup 11} cm{sup -3}) extended envelope has been unveiled recently. In this article, we report the results from an XMM-Newton-based monitoring of the system. We show that at periastron, X-ray and UV fluxes are enhanced by a factor of {approx}3 with respect to the apastron values. The X-ray radiation is produced in an optically thin plasma with T {approx} 6.4 Multiplication-Sign 10{sup 6} K and it is found that the N{sub H} column density rises from 0.35 Multiplication-Sign 10{sup 21} cm{sup -2} at periastron to 1.11 Multiplication-Sign 10{sup 21} cm{sup -2} at apastron, in good agreement with previous polarimetric observations. The UV emission detected in the Optical Monitor band seems to be caused by the reprocessing of the high-energy magnetospheric radiation on the circumstellar material. Further evidence of the strong magnetospheric disturbances is provided by the detection of line broadening of 278.7 km s{sup -1} in the N V line with Hubble Space Telescope/Space Telescope Imaging Spectrograph. Numerical simulations of the mass flow from the circumbinary disk to the components have been carried out. They provide a consistent scenario with which to interpret AK Sco observations. We show that the eccentric orbit acts like a gravitational piston. At apastron, matter is dragged efficiently from the inner disk border, filling the inner gap and producing accretion streams that end as ring-like structures around each component of the system. At periastron, the ring-like structures come into contact, leading to angular momentum loss, and thus producing an accretion outburst.

  6. Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion.

    Science.gov (United States)

    Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David

    2018-03-19

    To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

  7. The evolution of stellar metallicity gradients of the Milky Way disk from LSS-GAC main sequence turn-off stars: a two-phase disk formation history?

    International Nuclear Information System (INIS)

    Xiang, Mao-Sheng; Liu, Xiao-Wei; Huang, Yang; Wang, Chun; Ren, Juan-Juan; Chen, Bing-Qiu; Sun, Ning-Chen; Zhang, Hua-Wei; Yuan, Hai-Bo; Rebassa-Mansergas, Alberto; Huo, Zhi-Ying

    2015-01-01

    Accurate measurements of stellar metallicity gradients in the radial and vertical directions of the disk and their temporal variations provide important constraints on the formation and evolution of the Milky Way disk. We use 297 042 main sequence turn-off stars selected from the LAMOST Spectroscopic Survey of the Galactic Anti-center (LSS-GAC) to determine the radial and vertical gradients of stellar metallicity, Δ[Fe/H]/ΔR and Δ[Fe/H]/Δ|Z| of the Milky Way disk in the direction of the anticenter. We determine ages of those turn-off stars by isochrone fitting and measure the temporal variations of metallicity gradients. We have carried out a detailed analysis of the selection effects resulting from the selection, observation and data reduction of LSS-GAC targets and the potential biases of a magnitude limited sample on the determinations of metallicity gradients. Our results show that the gradients, both in the radial and vertical directions, exhibit significant spatial and temporal variations. The radial gradients yielded by stars with the oldest ages (≳ 11 Gyr) are essentially zero at all heights from the disk midplane, while those given by younger stars are always negative. The vertical gradients deduced from stars with the oldest ages (≳ 11 Gyr) are negative and only show very weak variations with Galactocentric distance in the disk plane, R, while those yielded by younger stars show strong variations with R. After being essentially flat at the earliest epochs of disk formation, the radial gradients steepen as age decreases, reaching a maximum (steepest) at age 7–8 Gyr, and then they flatten again. Similar temporal trends are also found for the vertical gradients. We infer that the assembly of the Milky Way disk may have experienced at least two distinct phases. The earlier phase is probably related to a slow, pressure-supported collapse of gas, when the gas settles down to the disk mainly in the vertical direction. In the later phase, there are

  8. Sequencing of mitochondrial genomes of nine Aspergillus and Penicillium species identifies mobile introns and accessory genes as main sources of genome size variability.

    Science.gov (United States)

    Joardar, Vinita; Abrams, Natalie F; Hostetler, Jessica; Paukstelis, Paul J; Pakala, Suchitra; Pakala, Suman B; Zafar, Nikhat; Abolude, Olukemi O; Payne, Gary; Andrianopoulos, Alex; Denning, David W; Nierman, William C

    2012-12-12

    The genera Aspergillus and Penicillium include some of the most beneficial as well as the most harmful fungal species such as the penicillin-producer Penicillium chrysogenum and the human pathogen Aspergillus fumigatus, respectively. Their mitochondrial genomic sequences may hold vital clues into the mechanisms of their evolution, population genetics, and biology, yet only a handful of these genomes have been fully sequenced and annotated. Here we report the complete sequence and annotation of the mitochondrial genomes of six Aspergillus and three Penicillium species: A. fumigatus, A. clavatus, A. oryzae, A. flavus, Neosartorya fischeri (A. fischerianus), A. terreus, P. chrysogenum, P. marneffei, and Talaromyces stipitatus (P. stipitatum). The accompanying comparative analysis of these and related publicly available mitochondrial genomes reveals wide variation in size (25-36 Kb) among these closely related fungi. The sources of genome expansion include group I introns and accessory genes encoding putative homing endonucleases, DNA and RNA polymerases (presumed to be of plasmid origin) and hypothetical proteins. The two smallest sequenced genomes (A. terreus and P. chrysogenum) do not contain introns in protein-coding genes, whereas the largest genome (T. stipitatus), contains a total of eleven introns. All of the sequenced genomes have a group I intron in the large ribosomal subunit RNA gene, suggesting that this intron is fixed in these species. Subsequent analysis of several A. fumigatus strains showed low intraspecies variation. This study also includes a phylogenetic analysis based on 14 concatenated core mitochondrial proteins. The phylogenetic tree has a different topology from published multilocus trees, highlighting the challenges still facing the Aspergillus systematics. The study expands the genomic resources available to fungal biologists by providing mitochondrial genomes with consistent annotations for future genetic, evolutionary and population

  9. Pattern of phylogenetic diversification of the Cychrini ground beetles in the world as deduced mainly from sequence comparisons of the mitochondrial genes.

    Science.gov (United States)

    Su, Zhi-Hui; Imura, Yûki; Okamoto, Munehiro; Osawa, Syozo

    2004-02-04

    The phylogenetic position of the tribe Cychrini within the subfamily Carabinae (the family Carabidae) was estimated by comparing the nucleotide sequences of the mitochondrial NADH dehydrogenase subunit 5 (ND5) gene and the nuclear 28S ribosomal DNA (rDNA). The phylogenetic trees suggest that the Cychrini would most probably be the oldest line within the Carabinae. Phylogenetic trees were constructed by comparing the mitochondrial cytochrome C oxidase subunit I (COI) gene sequences from 33 species of the Cychrini from various localities that include the whole distribution ranges of the representative species within all the known genera in the world. The trees suggest that the Cychrini members radiated into a number of phylogenetic lineages within a short period, starting about 44 million years ago (MYA). Most of the phylogenetic lineages or sublineages are geographically linked, each consisting of a single or only a few species without scarce morphological differentiation in spite of their long evolutionary histories (silent or near-silent evolution [see Adv. Biophys. 36 (1999) 65; J. Mol. Evol. 53 (2001) 517]). The fact suggests that the geographic isolation per se did not bring about conspicuous morphological differentiation. The phylogenetic lineages of the Cychrini well correspond to the taxonomically defined genera and the subgenera.

  10. NEW COOLING SEQUENCES FOR OLD WHITE DWARFS

    International Nuclear Information System (INIS)

    Renedo, I.; Althaus, L. G.; GarcIa-Berro, E.; Miller Bertolami, M. M.; Romero, A. D.; Corsico, A. H.; Rohrmann, R. D.

    2010-01-01

    We present full evolutionary calculations appropriate for the study of hydrogen-rich DA white dwarfs. This is done by evolving white dwarf progenitors from the zero-age main sequence, through the core hydrogen-burning phase, the helium-burning phase, and the thermally pulsing asymptotic giant branch phase to the white dwarf stage. Complete evolutionary sequences are computed for a wide range of stellar masses and for two different metallicities, Z = 0.01, which is representative of the solar neighborhood, and Z = 0.001, which is appropriate for the study of old stellar systems, like globular clusters. During the white dwarf cooling stage, we self-consistently compute the phase in which nuclear reactions are still important, the diffusive evolution of the elements in the outer layers and, finally, we also take into account all the relevant energy sources in the deep interior of the white dwarf, such as the release of latent heat and the release of gravitational energy due to carbon-oxygen phase separation upon crystallization. We also provide colors and magnitudes for these sequences, based on a new set of improved non-gray white dwarf model atmospheres, which include the most up-to-date physical inputs like the Lyα quasi-molecular opacity. The calculations are extended down to an effective temperature of 2500 K. Our calculations provide a homogeneous set of evolutionary cooling tracks appropriate for mass and age determinations of old DA white dwarfs and for white dwarf cosmochronology of the different Galactic populations.

  11. Atypical yeasts identified as Saccharomyces cerevisiae by MALDI-TOF MS and gene sequencing are the main responsible of fermentation of chicha, a traditional beverage from Peru.

    Science.gov (United States)

    Vallejo, Juan Andrés; Miranda, Patricia; Flores-Félix, José David; Sánchez-Juanes, Fernando; Ageitos, José M; González-Buitrago, José Manuel; Velázquez, Encarna; Villa, Tomás G

    2013-12-01

    Chicha is a drink prepared in several Andean countries from Inca's times by maize fermentation. Currently this fermentation is carried out in familiar artesanal "chicherías" that make one of the most known types of chicha, the "chicha de jora". In this study we isolate and identify the yeasts mainly responsible of the fermentation process in this type of chicha in 10 traditional "chicherías" in Cusco region in Peru. We applied by first time MALDI-TOF MS analysis for the identification of yeast of non-clinic origin and the results showed that all of yeast strains isolated belong to the species Saccharomyces cerevisiae. These results agree with those obtained after the analysis of the D1/D2 and 5.8S-ITS regions. However the chicha strains have a phenotypic profile that differed in more than 40% as compared to that of current S. cerevisiae strains. To the best of our knowledge this is the first report concerning the yeasts involved in chicha fermentation. Copyright © 2013 Elsevier GmbH. All rights reserved.

  12. Genome Sequencing

    DEFF Research Database (Denmark)

    Sato, Shusei; Andersen, Stig Uggerhøj

    2014-01-01

    The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based on transcr......The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...

  13. Main Memory

    NARCIS (Netherlands)

    P.A. Boncz (Peter); L. Liu (Lei); M. Tamer Özsu

    2008-01-01

    htmlabstractPrimary storage, presently known as main memory, is the largest memory directly accessible to the CPU in the prevalent Von Neumann model and stores both data and instructions (program code). The CPU continuously reads instructions stored there and executes them. It is also called Random

  14. Main Memory

    OpenAIRE

    Boncz, Peter; Liu, Lei; Özsu, M.

    2008-01-01

    htmlabstractPrimary storage, presently known as main memory, is the largest memory directly accessible to the CPU in the prevalent Von Neumann model and stores both data and instructions (program code). The CPU continuously reads instructions stored there and executes them. It is also called Random Access Memory (RAM), to indicate that load/store instructions can access data at any location at the same cost, is usually implemented using DRAM chips, which are connected to the CPU and other per...

  15. Main findings

    International Nuclear Information System (INIS)

    2014-01-01

    Licensing regimes vary from country to country. When the license regime involves several regulators and several licenses, this may lead to complex situations. Identifying a leading organisation in charge of overall coordination including preparation of the licensing decision is a useful practice. Also, if a stepwise licensing process is implemented, it is important to fix in legislation decisions and/or time points and to identify the relevant actors. There is considerable experience in civil and mining engineering that can be applied when constructing a deep geological disposal facility. Specific challenges are, however, the minimization of disturbances to the host rock and the understanding of its long-term behavior. Construction activities may affect the geo-hydraulic and geochemical properties of the various system components which are important safety features of the repository system. Clearly defined technical specifications and an effective quality management plan are important in ensuring successful repository implementation which is consistent with safety requirements. Monitoring plan should also be defined in advance. The regulatory organization should prepare itself to the licensing review before construction by allocating sufficient resources. It should increase its competence, e.g., by interacting early with the implementer and through its own R and D. This will allow the regulator to define appropriate technical conditions associated to the construction license and to elaborate a relevant inspection plan of the construction work. After construction, obtaining the operational license is the most important and crucial step. Main challenges include (a) establishing sufficient confidence so that the methods for closing the individual disposal units comply with the safety objectives and (b) addressing the issue of ageing of materials during a 50-100 years operational period. This latter challenge is amplified when reversibility/retrievability is required

  16. Stellar evolution IV: evolution of a star of 1.5 M(S) from the main-sequence to the red-giant branch with and without overshooting from convective core

    International Nuclear Information System (INIS)

    Maeder, A.

    1975-01-01

    For a star of 1.5 M(S) with an initial composition given by X=0.70 and Z=0.03, three sets of evolutionary models are computed with different assumptions on the non-local effects characterizing the turbulent motions in the convective core. Some overshooting from the convective core may occur during Main-sequence evolution. The changes in the stellar structure, lifetimes and evolutionary tracks brought about by this process are studied. Some characteristics of the evolutionary tracks in the theoretical HR diagram have a very high sensitivity to the exact extent of the convective core, and this may provide powerful tests of events occurring in the deep stellar interior. (orig./BJ) [de

  17. A Search for Coronal Emission at the Bottom of the Main-Sequence: Stars and Brown Dwarf Candidates with Spectral Types Later than M7 and the Rotation-Activity Relation

    Science.gov (United States)

    Stringfellow, Guy

    2004-01-01

    This program intended to test whether the lowest mass stars at the bottom end of the main sequence and the lower mass brown dwarfs have coronae. If they have coronae, what are the coronal characteristics and what drives them? In the classical dynamo picture, the closed magnetic loop structure is generated near the boundary of the convective envelope and the radiative core. Stars with mass below 0.30 Msun however are fully convective, and the nature of the dynamo responsible for the generation of the coronae in this regime is poorly understood. Previous results from the ROSAT mission (e.g., Fleming et al. 1993, 1995; Schmitt et al. 1995) had confirmed three very important characteristics of M-star coronae: (1) a very high percentage of all M dwarfs have coronae (of order 85% in the local 7 pc sample), (2) those M dwarfs showing high chromospheric activity, such as having the Balmer series in emission or large/numerous optical flaring, indeed exhibit the highest coronal activity, and (3) that the maximum saturation boundary in X-ray luminosity, which amounts to 0.0001-0.001 for Lx/Lbol for the dMe stars, extends down to the current detection limit, through spectral types M7. It was likely that the incompleteness noted for result (1) above was simply a detection limit problem; for more distant sources, the X-ray fainter dM stars will drop below detection thresholds before the more X-ray luminous dMe stars. The latest stars for which direct detection of the corona had been successful were of spectral type dM7 (e.g., VB8, LHS 3003). This program proposed to obtain ROSAT HRI observations for a large number of the coolest known (at that time) stars at the bottom of the main-sequence, which had spectral types of M9 or later. Three stars were approved for observations with ROSAT-HRI totaling 180 ksec. The goal was to obtain X-ray detections or low upper limits for the three approved stars.

  18. Secuencia constructiva de las plazas en el Grupo Principal de El Palmar, Campeche, México Constructive Sequence of Plazas in the Main Group of El Palmar, Campeche, México

    Directory of Open Access Journals (Sweden)

    Kenichiro Tsukamoto

    2012-01-01

    Full Text Available La ubicación y dimensión de los espacios abiertos fueron aspectos considerados al planificar las ciudades de las Tierras Bajas Mayas en el periodo prehispánico. Las plazas eran los espacios políticos donde las élites gobernantes legitimaban a sus autoridades y manifestaban a otros participantes sus capacidades para comunicarse con los ancestros o deidades. Este trabajo se centra en la secuencia constructiva de ocho plazas en el Grupo Principal del sitio arqueológico de El Palmar, Campeche, México. Los resultados obtenidos durante las temporadas de campo en el 2007 y el 2009 indican que las grandes plazas fueron construidas durante la segunda mitad del Clásico Temprano (400-600 d.C. y que en ellas se celebraron ceremonias públicas inscritas en los monumentos conmemorativos.The location and dimension of open spaces were important aspects involved in Maya Lowlands planning during the prehispanic period. Plazas were political spaces in which ruling elites legitimated their authorities and manifested to other participants their capacities of communication with ancestors or deities. This paper focuses on the construction sequence of eight plazas at the Main Group of El Palmar, Campeche, Mexico. The results recovered from the 2007 and 2009 fieldwork seasons indicate that large plazas were build during the second part of the Early Classic period (400-600 AD, with the erection of commemorative monuments narrating public ceremonies.

  19. The Intrinsic Characteristics of Galaxies on the SFR–M ∗ Plane at 1.2 < z < 4: I. The Correlation between Stellar Age, Central Density, and Position Relative to the Main Sequence

    Science.gov (United States)

    Lee, Bomee; Giavalisco, Mauro; Whitaker, Katherine; Williams, Christina C.; Ferguson, Henry C.; Acquaviva, Viviana; Koekemoer, Anton M.; Straughn, Amber N.; Guo, Yicheng; Kartaltepe, Jeyhan S.; Lotz, Jennifer; Pacifici, Camilla; Croton, Darren J.; Somerville, Rachel S.; Lu, Yu

    2018-02-01

    We use the deep CANDELS observations in the GOODS North and South fields to revisit the correlations between stellar mass (M *), star formation rate (SFR) and morphology, and to introduce a fourth dimension, the mass-weighted stellar age, in galaxies at 1.2history for each galaxy. Like others, we find that the slope of the main sequence (MS) of star formation in the ({M}* ;{SFR}) plane bends at high mass. We observe clear morphological differences among galaxies across the MS, which also correlate with stellar age. At all redshifts, galaxies that are quenching or quenched, and thus old, have high {{{Σ }}}1 (the projected density within the central 1 kpc), while younger, star-forming galaxies span a much broader range of {{{Σ }}}1, which includes the high values observed for quenched galaxies, but also extends to much lower values. As galaxies age and quench, the stellar age and the dispersion of {{{Σ }}}1 for fixed values of M * shows two different regimes: one at the low-mass end, where quenching might be driven by causes external to the galaxies; the other at the high-mass end, where quenching is driven by internal causes, very likely the mass given the low scatter of {{{Σ }}}1 (mass quenching). We suggest that the monotonic increase of central density as galaxies grow is one manifestation of a more general phenomenon of structural transformation that galaxies undergo as they evolve.

  20. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  1. Main Memory DBMS

    NARCIS (Netherlands)

    P.A. Boncz (Peter); L. Liu (Lei); M. Tamer Özsu

    2008-01-01

    htmlabstractA main memory database system is a DBMS that primarily relies on main memory for computer data storage. In contrast, normal database management systems employ hard disk based persisntent storage.

  2. Cyanogen strengths of globular cluster post-main-sequence stars

    International Nuclear Information System (INIS)

    Hesser, J.E.; Hartwick, F.D.A.; McClure, R.D.

    1976-01-01

    CN strengths in the peculiar clusters ω Cen and M22 and the metal-rich clusters 47 Tuc, M71, and NGC 6352 are found to vary markedly from star to star. The strong variations in CN strength found earlier for ω Cen by Norris and Bessell and by Dickens and Bell are shown to extend to fainter stars, although expected correlations of CN strength with position in the color-magnitude (C-M) diagram are less evident in our sample. Several CN and metal-strong stars were also observed in M22. We conclude that CN, once it appears in globular clusters, can vary much more than it does in equivalent Population I samples, a result we briefly examine in light of current understanding regarding physical processes in the stars themselves and of models of galactic chemical evolution

  3. HABITABLE ZONES AROUND MAIN-SEQUENCE STARS: NEW ESTIMATES

    Energy Technology Data Exchange (ETDEWEB)

    Kopparapu, Ravi Kumar; Ramirez, Ramses; Kasting, James F. [Department of Geosciences, Penn State University, 443 Deike Building, University Park, PA 16802 (United States); Eymet, Vincent [Laboratoire d' Astrophysique de Bordeaux, Universite de Bordeaux 1, UMR 5804, F-33270 Floirac (France); Robinson, Tyler D.; Domagal-Goldman, Shawn; Meadows, Victoria [NASA Astrobiology Institute' s Virtual Planetary Laboratory (United States); Mahadevan, Suvrath; Terrien, Ryan C.; Deshpande, Rohit [Center for Exoplanets and Habitable Worlds, The Pennsylvania State University, University Park, PA 16802 (United States)

    2013-03-10

    Identifying terrestrial planets in the habitable zones (HZs) of other stars is one of the primary goals of ongoing radial velocity (RV) and transit exoplanet surveys and proposed future space missions. Most current estimates of the boundaries of the HZ are based on one-dimensional (1D), cloud-free, climate model calculations by Kasting et al. However, this model used band models that were based on older HITRAN and HITEMP line-by-line databases. The inner edge of the HZ in the Kasting et al. model was determined by loss of water, and the outer edge was determined by the maximum greenhouse provided by a CO{sub 2} atmosphere. A conservative estimate for the width of the HZ from this model in our solar system is 0.95-1.67 AU. Here an updated 1D radiative-convective, cloud-free climate model is used to obtain new estimates for HZ widths around F, G, K, and M stars. New H{sub 2}O and CO{sub 2} absorption coefficients, derived from the HITRAN 2008 and HITEMP 2010 line-by-line databases, are important improvements to the climate model. According to the new model, the water-loss (inner HZ) and maximum greenhouse (outer HZ) limits for our solar system are at 0.99 and 1.70 AU, respectively, suggesting that the present Earth lies near the inner edge. Additional calculations are performed for stars with effective temperatures between 2600 and 7200 K, and the results are presented in parametric form, making them easy to apply to actual stars. The new model indicates that, near the inner edge of the HZ, there is no clear distinction between runaway greenhouse and water-loss limits for stars with T{sub eff} {approx}< 5000 K, which has implications for ongoing planet searches around K and M stars. To assess the potential habitability of extrasolar terrestrial planets, we propose using stellar flux incident on a planet rather than equilibrium temperature. This removes the dependence on planetary (Bond) albedo, which varies depending on the host star's spectral type. We suggest that conservative estimates of the HZ (water-loss and maximum greenhouse limits) should be used for current RV surveys and Kepler mission to obtain a lower limit on {eta}{sub Circled-Plus }, so that future flagship missions like TPF-C and Darwin are not undersized. Our model does not include the radiative effects of clouds; thus, the actual HZ boundaries may extend further in both directions than the estimates just given.

  4. HABITABLE ZONES AROUND MAIN-SEQUENCE STARS: NEW ESTIMATES

    International Nuclear Information System (INIS)

    Kopparapu, Ravi Kumar; Ramirez, Ramses; Kasting, James F.; Eymet, Vincent; Robinson, Tyler D.; Domagal-Goldman, Shawn; Meadows, Victoria; Mahadevan, Suvrath; Terrien, Ryan C.; Deshpande, Rohit

    2013-01-01

    Identifying terrestrial planets in the habitable zones (HZs) of other stars is one of the primary goals of ongoing radial velocity (RV) and transit exoplanet surveys and proposed future space missions. Most current estimates of the boundaries of the HZ are based on one-dimensional (1D), cloud-free, climate model calculations by Kasting et al. However, this model used band models that were based on older HITRAN and HITEMP line-by-line databases. The inner edge of the HZ in the Kasting et al. model was determined by loss of water, and the outer edge was determined by the maximum greenhouse provided by a CO 2 atmosphere. A conservative estimate for the width of the HZ from this model in our solar system is 0.95-1.67 AU. Here an updated 1D radiative-convective, cloud-free climate model is used to obtain new estimates for HZ widths around F, G, K, and M stars. New H 2 O and CO 2 absorption coefficients, derived from the HITRAN 2008 and HITEMP 2010 line-by-line databases, are important improvements to the climate model. According to the new model, the water-loss (inner HZ) and maximum greenhouse (outer HZ) limits for our solar system are at 0.99 and 1.70 AU, respectively, suggesting that the present Earth lies near the inner edge. Additional calculations are performed for stars with effective temperatures between 2600 and 7200 K, and the results are presented in parametric form, making them easy to apply to actual stars. The new model indicates that, near the inner edge of the HZ, there is no clear distinction between runaway greenhouse and water-loss limits for stars with T eff ∼ ⊕ , so that future flagship missions like TPF-C and Darwin are not undersized. Our model does not include the radiative effects of clouds; thus, the actual HZ boundaries may extend further in both directions than the estimates just given.

  5. Be ABUNDANCES IN COOL MAIN-SEQUENCE STARS WITH EXOPLANETS

    Energy Technology Data Exchange (ETDEWEB)

    Delgado Mena, E.; Israelian, G.; Gonzalez Hernandez, J. I.; Rebolo, R. [Instituto de Astrofisica de Canarias, 38200 La Laguna, Tenerife (Spain); Santos, N. C., E-mail: edm@iac.es [Centro de Astrofisica, Universidade do Porto, Rua das Estrelas, 4150-762 Porto (Portugal)

    2012-02-10

    We present new Ultraviolet and Visual Echelle Spectrograph (UVES) spectra of a sample of 15 cool unevolved stars with and without detected planetary companions. Together with previous determinations, we study Be depletion and possible differences in Be abundances between the two groups of stars. We obtain a final sample of 89 and 40 stars with and without planets, respectively, which covers a wide range of effective temperatures, from 4700 K to 6400 K, and includes several cool dwarf stars for the first time. We determine Be abundances for these stars and find that for most of them (the coolest ones) the Be II resonance lines are often undetectable, implying significant Be depletion. While for hot stars Be abundances are approximately constant, with a slight fall as T{sub eff} decreases and the Li-Be gap around 6300 K, we find a steep drop of Be content as T{sub eff} decreases for T{sub eff} < 5500 K, confirming the results of previous papers. Therefore, for these stars there is an unknown mechanism destroying Be that is not reflected in current models of Be depletion. Moreover, this strong Be depletion in cool objects takes place for all the stars regardless of the presence of planets; thus, the effect of extra Li depletion in solar-type stars with planets when compared with stars without detected planets does not seem to be present for Be, although the number of stars at those temperatures is still small to reach a final conclusion.

  6. Dust discs around low-mass main-sequence stars

    International Nuclear Information System (INIS)

    Wolstencroft, R.D.; Walker, H.J.

    1988-01-01

    Current understanding of the formation of circumstellar discs as a natural accompaniment to the process of low-mass star formation is briefly reviewed. Models of the thermal emission from the dust discs around the prototype stars α Lyr, α PsA, β Pic and ε Eri are discussed, which indicate that the central regions of three of these discs are almost devoid of dust within radii ranging between 17 and 26 AU, with the temperature of the hottest dust lying between about 115 and 210 K. One possible explanation of the dust-free zones is the presence of a planet at the inner boundary of each cloud that sweeps up grains crossing its orbit. The colour, diameter and thickness of the optical image of β Pic, obtained by coronagraphic techniques, have provided further information on the size, radial distribution of number density and orbital inclination of the grains. The difference in surface brightness on the two sides of the disc is puzzling, but might be explained if the grains are elongated and aligned by the combined effects of a stellar wind and a magnetic field of spiral configuration. Finally, we discuss the orbital evolution and lifetimes of particles in these discs, which are governed primarily by radiation pressure, Poynting-Robertson drag and grain-grain collisions. (author)

  7. Effects of magnetic fields on main sequence stars

    International Nuclear Information System (INIS)

    Hubbard, E.N.

    1981-01-01

    A number of effects of low to medium strength ( 2 /8π) magnetic field pressure term so that the only effect of such a field may come from its inhibiting convection in the core. Isochrones of both convective and radiative core models of 2-5 M are presented. In the deep envelope, mixing of partially nuclear processed material driven by rising and falling magnetic flux tubes may be seen. The effects of this mixing will be brought to the surface during the deep convection phase of the star's tenure as a red giant. This model is used to predict a signature for magnetic mixing based on the CNO isotope and abundance ratios. In the outer envelope the gas pressure is low enough that one might expect to see a perturbation of the stellar structure due to the magnetic field pressure itself. This perturbation is calculated under several physical models for intermediate and high mass stars and it is determined that sufficient magnetic field energy may be available in the outer envelope to expand a star by about 20% over its unperturbed radius. Finally the evidence for the existence of non-magnetic neutron stars is considered, concluding that while no non-magnetic neutron stars have ever been positively identified, there is no evidence that prevents the existence of at least as many non-magnetic as magnetic neutron stars

  8. Acne at The Bottom Of The Main Sequence

    Science.gov (United States)

    Barnes, John; Haswell, C.; Jenkins, J.; Jeffers, S.; Jones, H. R. A.; Lohr, M.; Pavlenko, Y.

    2016-08-01

    Starspots are an important manifestation of stellar activity and yet their distribution patterns on the lowest mass stars is not well known. Time series spectra of fully convective M dwarfs taken in the red-optical with UVES reveal numerous line profile distortions which are interpreted as starspots. We derive Doppler images for four M4.5V - M9V stars and find that contrast ratios corresponding to photosphere-spot temperature differences of only 200-300 K are sufficient to model the timeseries spectra. Although more starspot structure is found at high latitudes, spots are reconstructed at a range of phases and latitudes with mean spot filling factors of only a few per cent. The occurrence of low-contrast spots at predominantly high latitudes is in general likely to be responsible for the low amplitude photometric variability seen in late-M dwarfs. The recovered starspot patterns are used to assess their effect on precision radial velocity surveys aimed at detecting planets around this population of stars.

  9. Be ABUNDANCES IN COOL MAIN-SEQUENCE STARS WITH EXOPLANETS

    International Nuclear Information System (INIS)

    Delgado Mena, E.; Israelian, G.; González Hernández, J. I.; Rebolo, R.; Santos, N. C.

    2012-01-01

    We present new Ultraviolet and Visual Echelle Spectrograph (UVES) spectra of a sample of 15 cool unevolved stars with and without detected planetary companions. Together with previous determinations, we study Be depletion and possible differences in Be abundances between the two groups of stars. We obtain a final sample of 89 and 40 stars with and without planets, respectively, which covers a wide range of effective temperatures, from 4700 K to 6400 K, and includes several cool dwarf stars for the first time. We determine Be abundances for these stars and find that for most of them (the coolest ones) the Be II resonance lines are often undetectable, implying significant Be depletion. While for hot stars Be abundances are approximately constant, with a slight fall as T eff decreases and the Li-Be gap around 6300 K, we find a steep drop of Be content as T eff decreases for T eff < 5500 K, confirming the results of previous papers. Therefore, for these stars there is an unknown mechanism destroying Be that is not reflected in current models of Be depletion. Moreover, this strong Be depletion in cool objects takes place for all the stars regardless of the presence of planets; thus, the effect of extra Li depletion in solar-type stars with planets when compared with stars without detected planets does not seem to be present for Be, although the number of stars at those temperatures is still small to reach a final conclusion.

  10. Maine's Employability Skills Program

    Science.gov (United States)

    McMahon, John M.; Wolffe, Karen E.; Wolfe, Judy; Brooker, Carrie

    2013-01-01

    This Practice Report describes the development and implementation of the "Maine Employability Skills Program," a model employment program developed by the Maine Division for the Blind and Visually Impaired (DBVI). The program was designed to support the efforts of the chronically unemployed or underemployed. These consumers were either…

  11. Turbine main engines

    CERN Document Server

    Main, John B; Herbert, C W; Bennett, A J S

    1965-01-01

    Turbine Main Engines deals with the principle of operation of turbine main engines. Topics covered include practical considerations that affect turbine design and efficiency; steam turbine rotors, blades, nozzles, and diaphragms; lubricating oil systems; and gas turbines for use with nuclear reactors. Gas turbines for naval boost propulsion, merchant ship propulsion, and naval main propulsion are also considered. This book is divided into three parts and begins with an overview of the basic mode of operation of the steam turbine engine and how it converts the pressure energy of the ingoing ste

  12. Maine highway safety plan

    Science.gov (United States)

    2010-01-01

    Each September 1, the MeBHS must provide NHTSA a comprehensive plan to reduce : traffic crashes and resulting deaths, injuries and property damage. The Highway Safety : Plan (HSP) serves as Maines application for available federal funds for these ...

  13. Maine Field Station

    Data.gov (United States)

    Federal Laboratory Consortium — In 2000 NOAA's National Marine Fisheries Service established the Maine Field Station in Orono, ME to have more direct involvement in the conservation of the living...

  14. Maine's forests 2008

    Science.gov (United States)

    George L. McCaskill; William H. McWilliams; Charles J. Barnett; Brett J. Butler; Mark A. Hatfield; Cassandra M. Kurtz; Randall S. Morin; W. Keith Moser; Charles H. Perry; Christopher W. Woodall

    2011-01-01

    The second annual inventory of Maine's forests was completed in 2008 after more than 3,160 forested plots were measured. Forest land occupies almost 17.7 million acres, which represents 82 percent of the total land area of Maine. The dominant forest-type groups are maple/beech/yellow birch, spruce/fir, white/red/jack pine, and aspen/white birch. Statewide volume...

  15. Maine Forests 2013

    Science.gov (United States)

    George L. McCaskill; Thomas Albright; Charles J. Barnett; Brett J. Butler; Susan J. Crocker; Cassandra M. Kurtz; William H. McWilliams; Patrick D. Miles; Randall S. Morin; Mark D. Nelson; Richard H. Widmann; Christopher W. Woodall

    2016-01-01

    The third 5-year annualized inventory of Maine's forests was completed in 2013 after more than 3170 forested plots were measured. Maine contains more than 17.6 million acres of forest land, an area that has been quite stable since 1960, covering more than 82 percent of the total land area. The number of live trees greater than 1 inch in diameter are approaching 24...

  16. FERMILAB: Main Injector

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    The Fermilab Main Injector (FMI) project is the centerpiece of the Laboratory's Fermilab III programme for the 1990s. Designed to support a luminosity of at least 5x10 31 cm -2 s -1 in the Tevatron collider, it will also provide new capabilities for rare neutral kaon decay and neutrino oscillation studies. The Fermilab Main Injector 8-150 GeV synchrotron is designed to replace the existing Main Ring which seriously limits beam intensities for the Tevatron and the antiproton production target. The project has passed several significant milestones and is now proceeding rapidly towards construction. The project received a $11.65M appropriation in 1992 and has been given $15M for the current fiscal year. Through the Energy Systems Acquisition Advisory Board (ESAAB) process, the US Department of Energy (DoE) has authorized funds for construction of the underground enclosure and service building where the Main Injector will touch the Tevatron, and to the preparation of bids for remaining project construction

  17. FERMILAB: Main Injector

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1993-06-15

    The Fermilab Main Injector (FMI) project is the centerpiece of the Laboratory's Fermilab III programme for the 1990s. Designed to support a luminosity of at least 5x10{sup 31} cm{sup -2} s{sup -1} in the Tevatron collider, it will also provide new capabilities for rare neutral kaon decay and neutrino oscillation studies. The Fermilab Main Injector 8-150 GeV synchrotron is designed to replace the existing Main Ring which seriously limits beam intensities for the Tevatron and the antiproton production target. The project has passed several significant milestones and is now proceeding rapidly towards construction. The project received a $11.65M appropriation in 1992 and has been given $15M for the current fiscal year. Through the Energy Systems Acquisition Advisory Board (ESAAB) process, the US Department of Energy (DoE) has authorized funds for construction of the underground enclosure and service building where the Main Injector will touch the Tevatron, and to the preparation of bids for remaining project construction.

  18. Main facts 1995

    International Nuclear Information System (INIS)

    1996-01-01

    This report presents the main facts of the studies carried out by the Direction des Etudes et Recherches (DER) of Electricite de France: new applications of electricity, classical and nuclear thermal power plants, electrical equipment, environment protection, monitoring and plants operations

  19. Main designations and attributions

    International Nuclear Information System (INIS)

    2010-01-01

    The chapter presents the main designations and attributions of the LNMRI - Brazilian National Laboratory of Metrology of Ionizing Radiation, the Cooperative Center in Radiation Protection and Medical Preparations for Accidents with Radiation; the Treaty for fully banning of nuclear tests and the Regional Center for Training of IAEA

  20. Maine Bouguer Gravity Grid

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — A 2 kilometer Bouguer anomaly grid for the state of Maine. Number of columns is 197 and number of rows is 292. The order of the data is from the lower left to the...

  1. Main facts 1993

    International Nuclear Information System (INIS)

    1994-01-01

    This report presents the main facts of the studies carried out by the Direction des Etudes et Recherches (DER) of Electricite de France: new applications of electricity, classical and nuclear thermal power plants, electrical equipment, environment protection, network analysis, information and informatic equipment

  2. Renovating the Main Building

    CERN Multimedia

    CERN Bulletin

    2010-01-01

    CERN's "Main Building" is exactly that. The Organization's central hub, with hundreds of staff and visitors passing through its doors every day, will soon be getting a well-earned facelift. Refurbishment work will proceed in phases, starting with the Salle des Pas Perdus, the concourse between the Council Chamber and the Main Auditorium. By the end of August, informal seating areas will be installed, electronic display panels will provide practical information and improved sound insulation will enhance conditions in the auditoria and surrounding meeting rooms.   In light green the area that will undergo the facelift. Work will start in July. The ground floor is home to the entrance to Restaurant No. 1, the bank, the post office, the travel agent, the Users Office, the Staff Association, the notice boards etc. Step up to the first floor to access CERN's largest lecture theatre, the Council Chamber and its "Pas Perdus" lobby. Everyone who works at or visits CERN i...

  3. Fermilab Main Injector plan

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1990-07-15

    The Fermilab Main Injector is the centrepiece of the 'Fermilab III' scheme to significantly upgrade the Laboratory's existing accelerator complex. The new accelerator is designed to provide increased particle beam levels to boost the collision rate in the Tevatron proton-antiproton collider (luminosity in excess of 5 x 10{sup 31} per sq cm per s) and, if approved, would provide increased flexibility in all areas of high energy physics research.

  4. Fermilab Main Injector plan

    International Nuclear Information System (INIS)

    Anon.

    1990-01-01

    The Fermilab Main Injector is the centrepiece of the 'Fermilab III' scheme to significantly upgrade the Laboratory's existing accelerator complex. The new accelerator is designed to provide increased particle beam levels to boost the collision rate in the Tevatron proton-antiproton collider (luminosity in excess of 5 x 10 31 per sq cm per s) and, if approved, would provide increased flexibility in all areas of high energy physics research

  5. Maine coast winds

    Energy Technology Data Exchange (ETDEWEB)

    Avery, Richard

    2000-01-28

    The Maine Coast Winds Project was proposed for four possible turbine locations. Significant progress has been made at the prime location, with a lease-power purchase contract for ten years for the installation of turbine equipment having been obtained. Most of the site planning and permitting have been completed. It is expect that the turbine will be installed in early May. The other three locations are less suitable for the project, and new locations are being considered.

  6. Project evaluation: main characteristics

    OpenAIRE

    Moutinho, Nuno

    2010-01-01

    — The evaluation process of real investment projects must consider not only the traditional financial approach, but also non-financial aspects. Non financial analysis can provide additional relevant information about projects. We investigate financial and non-financial areas most relevant in project appraisal. We present main critical success factors and areas of analysis that lead to the perception of project success. Finally, companies are segmented to verify its financial and non-financial...

  7. Marketing Maine Tablestock Potatoes

    OpenAIRE

    Berney, Gerald; Grajewski, Gregory; Hinman, Don; Prater, Marvin E.; Taylor, April

    2010-01-01

    The Marketing Services Division of USDA’s Agricultural Marketing Service (AMS) was asked by USDA’s Agricultural Research Service (ARS) National Program Leader and ARS’s New England Soil and Water Research Laboratory personnel to help with existing efforts to assist Maine fresh potato farmers in their search for alternative marketing strategies, and reverse the recent decline in the profitability of their operations. ARS researchers previously had conducted an exhaustive study defining possibl...

  8. Sequence assembly

    DEFF Research Database (Denmark)

    Scheibye-Alsing, Karsten; Hoffmann, S.; Frankel, Annett Maria

    2009-01-01

    Despite the rapidly increasing number of sequenced and re-sequenced genomes, many issues regarding the computational assembly of large-scale sequencing data have remain unresolved. Computational assembly is crucial in large genome projects as well for the evolving high-throughput technologies and...... in genomic DNA, highly expressed genes and alternative transcripts in EST sequences. We summarize existing comparisons of different assemblers and provide a detailed descriptions and directions for download of assembly programs at: http://genome.ku.dk/resources/assembly/methods.html....

  9. Summary of main points

    International Nuclear Information System (INIS)

    2006-01-01

    In conjunction with its 6. annual meeting, the WPDD in close co-operation with the FSC held a Topical session on 'Stakeholder Involvement in Decommissioning' on November 14, 2005. The session was attended by 36 participants totally representing 14 NEA member countries and 2 international organisations. Two keynote addresses were given at the Topical Session. The first one treated of what is needed for robust decisions and how to bring all stakeholders into the debate. In the second keynote address a summary was made on what have been said on stakeholder involvement in decommissioning during earlier meetings of the WPDD. The main part of the session was then devoted to views from different stakeholders regarding their role and their involvement. This part contained viewpoints from local communities (Kaevlinge in Sweden and Port Hope in Canada), authorities (Scottish Executive and CSNC) and operators (EDF from France and EWN from Germany). Case studies from the decommissioning of Dounrey in the UK and from Trojan and Main Yankee in the USA were presented in the end part of the Topical session followed by a summary and lessons learnt report by the Rapporteur. A detailed programme of the Topical session can be seen in Appendix 1

  10. TRIGA reactor main systems

    International Nuclear Information System (INIS)

    Boeck, H.; Villa, M.

    2007-01-01

    This module describes the main systems of low power (<2 MW) and higher power (≥2 MW) TRIGA reactors. The most significant difference between the two is that forced reactor cooling and an emergency core cooling system are generally required for the higher power TRIGA reactors. However, those TRIGA reactors that are designed to be operated above 3 MW also use a TRIGA fuel that is specifically designed for those higher power outputs (3 to 14 MW). Typical values are given for the respective systems although each TRIGA facility will have unique characteristics that may only be determined by the experienced facility operators. Due to the inherent wide scope of these research reactor facilities construction and missions, this training module covers those systems found at most operating TRIGA reactor facilities but may also discuss non-standard equipment that was found to be operationally useful although not necessarily required. (author)

  11. Installation Strategy for the LHC Main Dipoles

    CERN Multimedia

    Fartoukh, Stephane David

    2004-01-01

    All positions in the LHC machine are not equivalent in terms of beam requirements on the geometry and the field quality of the main dipoles. In the presence of slightly or strongly out-of tolerance magnets, a well-defined installation strategy will therefore contribute to preserve or even optimize the performance of the machine. Based on the present status of the production, we have anticipated a list of potential issues (geometry, transfer function, field direction and random b3) which, combined by order of priority, have been taken into account to define a simple but efficient installation algorithm for the LHC main dipoles. Its output is a prescription for installing the available dipoles in sequence while reducing to an absolute minimum the number of holes required by geometry or FQ issues.

  12. Main: AS1CAMV [PLACE

    Lifescience Database Archive (English)

    Full Text Available MV 35S promoter; from -85 to -58 (subdomain AI); Binding with ASF-1 (activation sequence factor 1) from pea ...and tobacco; Expression in root and leaf; CaMV 35S promoter; ASF-1; leaf; root; as-1; Cauliflower mosaic virus; CaMV; CCACTGACGTAAGGGATGACGCACAATCC ...

  13. Diagnosing in building main pipelines

    Energy Technology Data Exchange (ETDEWEB)

    Telegin, L.G.; Gorelov, A.S.; Kurepin, B.N.; Orekhov, V.I.; Vasil' yev, G.G.; Yakovlev, Ye. I.

    1984-01-01

    General principles are examined for technical diagnosis in building main pipelines. A technique is presented for diagnosis during construction, as well as diagnosis of the technical state of the pipeline-construction machines and mechanisms. The survey materials could be used to set up construction of main pipelines.

  14. Maine Agricultural Foods. Project SEED.

    Science.gov (United States)

    Beaulieu, Peter; Ossenfort, Pat

    This paper describes an activity-based program that teaches students in grades 4-12 about the importance of Maine agriculture in their lives. Specifically, the goal is to increase student awareness of how the foods they eat are planted, harvested, and processed. The emphasis is on crops grown in Maine such as potatoes, broccoli, peas, blueberries,…

  15. Main Propulsion Test Article (MPTA)

    Science.gov (United States)

    Snoddy, Cynthia

    2010-01-01

    Scope: The Main Propulsion Test Article integrated the main propulsion subsystem with the clustered Space Shuttle Main Engines, the External Tank and associated GSE. The test program consisted of cryogenic tanking tests and short- and long duration static firings including gimbaling and throttling. The test program was conducted on the S1-C test stand (Position B-2) at the National Space Technology Laboratories (NSTL)/Stennis Space Center. 3 tanking tests and 20 hot fire tests conducted between December 21 1 1977 and December 17, 1980 Configuration: The main propulsion test article consisted of the three space shuttle main engines, flightweight external tank, flightweight aft fuselage, interface section and a boilerplate mid/fwd fuselage truss structure.

  16. Left main percutaneous coronary intervention.

    Science.gov (United States)

    Teirstein, Paul S; Price, Matthew J

    2012-10-23

    The introduction of drug-eluting stents and advances in catheter techniques have led to increasing acceptance of percutaneous coronary intervention (PCI) as a viable alternative to coronary artery bypass graft (CABG) for unprotected left main disease. Current guidelines state that it is reasonable to consider unprotected left main PCI in patients with low to intermediate anatomic complexity who are at increased surgical risk. Data from randomized trials involving patients who are candidates for either treatment strategy provide novel insight into the relative safety and efficacy of PCI for this lesion subset. Herein, we review the current data comparing PCI with CABG for left main disease, summarize recent guideline recommendations, and provide an update on technical considerations that may optimize clinical outcomes in left main PCI. Copyright © 2012 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  17. Main: FEB3 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available nt to sterilization and rinsing - One of the main components of biofilms is polysaccharides - Some pit-formi...ng bacteria such as Sphingomonas species A1 possess superchannels that directly incorporate and decompose polysaccharides - Detai...e entrance of the superchannel have been elucidated - We have obtained the crystals of ABC importer complexe...of water pipes and dental plaque are examples of biofilms. One of the main components of biofilms is polysac

  18. Decontamination of main coolant pumps

    International Nuclear Information System (INIS)

    Roofthooft, R.

    1988-01-01

    Last year a number of main coolant pumps in Belgian nuclear power plants were decontaminated. A new method has been developed to reduce the time taken for decontamination and the volume of waste to be treated. The method comprises two phases: Oxidation with permanganate in nitric acid and dissolution in oxalic acid. The decontamination of main coolant pumps can now be achieved in less than one day. The decontamination factors attained range between 15 and 150. (orig.) [de

  19. Dog Y chromosomal DNA sequence: identification, sequencing and SNP discovery

    Directory of Open Access Journals (Sweden)

    Kirkness Ewen

    2006-10-01

    Full Text Available Abstract Background Population genetic studies of dogs have so far mainly been based on analysis of mitochondrial DNA, describing only the history of female dogs. To get a picture of the male history, as well as a second independent marker, there is a need for studies of biallelic Y-chromosome polymorphisms. However, there are no biallelic polymorphisms reported, and only 3200 bp of non-repetitive dog Y-chromosome sequence deposited in GenBank, necessitating the identification of dog Y chromosome sequence and the search for polymorphisms therein. The genome has been only partially sequenced for one male dog, disallowing mapping of the sequence into specific chromosomes. However, by comparing the male genome sequence to the complete female dog genome sequence, candidate Y-chromosome sequence may be identified by exclusion. Results The male dog genome sequence was analysed by Blast search against the human genome to identify sequences with a best match to the human Y chromosome and to the female dog genome to identify those absent in the female genome. Candidate sequences were then tested for male specificity by PCR of five male and five female dogs. 32 sequences from the male genome, with a total length of 24 kbp, were identified as male specific, based on a match to the human Y chromosome, absence in the female dog genome and male specific PCR results. 14437 bp were then sequenced for 10 male dogs originating from Europe, Southwest Asia, Siberia, East Asia, Africa and America. Nine haplotypes were found, which were defined by 14 substitutions. The genetic distance between the haplotypes indicates that they originate from at least five wolf haplotypes. There was no obvious trend in the geographic distribution of the haplotypes. Conclusion We have identified 24159 bp of dog Y-chromosome sequence to be used for population genetic studies. We sequenced 14437 bp in a worldwide collection of dogs, identifying 14 SNPs for future SNP analyses, and

  20. New Main Ring control system

    International Nuclear Information System (INIS)

    Seino, K.; Anderson, L.; Ducar, R.; Franck, A.; Gomilar, J.; Hendricks, B.; Smedinghoff, J.

    1990-03-01

    The Fermilab Main Ring control system has been operational for over sixteen years. Aging and obsolescence of the equipment make the maintenance difficult. Since the advent of the Tevatron, considerable upgrades have been made to the controls of all the Fermilab accelerators except the Main Ring. Modernization of the equipment and standardization of the hardware and software have thus become inevitable. The Tevatron CAMAC serial system has been chosen as a basic foundation in order to make the Main Ring control system compatible with the rest of the accelerator complex. New hardware pieces including intelligent CAMAC modules have been designed to satisfy unique requirements. Fiber optic cable and repeaters have been installed in order to accommodate new channel requirements onto the already saturated communication medium system. 8 refs., 2 figs

  1. Sequence Factorization with Multiple References.

    Directory of Open Access Journals (Sweden)

    Sebastian Wandelt

    Full Text Available The success of high-throughput sequencing has lead to an increasing number of projects which sequence large populations of a species. Storage and analysis of sequence data is a key challenge in these projects, because of the sheer size of the datasets. Compression is one simple technology to deal with this challenge. Referential factorization and compression schemes, which store only the differences between input sequence and a reference sequence, gained lots of interest in this field. Highly-similar sequences, e.g., Human genomes, can be compressed with a compression ratio of 1,000:1 and more, up to two orders of magnitude better than with standard compression techniques. Recently, it was shown that the compression against multiple references from the same species can boost the compression ratio up to 4,000:1. However, a detailed analysis of using multiple references is lacking, e.g., for main memory consumption and optimality. In this paper, we describe one key technique for the referential compression against multiple references: The factorization of sequences. Based on the notion of an optimal factorization, we propose optimization heuristics and identify parameter settings which greatly influence 1 the size of the factorization, 2 the time for factorization, and 3 the required amount of main memory. We evaluate a total of 30 setups with a varying number of references on data from three different species. Our results show a wide range of factorization sizes (optimal to an overhead of up to 300%, factorization speed (0.01 MB/s to more than 600 MB/s, and main memory usage (few dozen MB to dozens of GB. Based on our evaluation, we identify the best configurations for common use cases. Our evaluation shows that multi-reference factorization is much better than single-reference factorization.

  2. A random walk down Main Street

    Directory of Open Access Journals (Sweden)

    David Matthew Levinson

    2016-08-01

    Full Text Available US suburbs have often been characterized by their relatively low walk accessibility compared to more urban environments, and US urban environments have been char- acterized by low walk accessibility compared to cities in other countries. Lower overall density in the suburbs implies that activities, if spread out, would have a greater distance between them. But why should activities be spread out instead of developed contiguously? This brief research note builds a positive model for the emergence of contiguous development along “Main Street” to illustrate the trade-offs that result in the built environment we observe. It then suggests some policy interventions to place a “thumb on the scale” to choose which parcels will develop in which sequence to achieve socially preferred outcomes.

  3. Main: FBB2 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available ion of the c-ring - A subunit packing model of E. coli c-ring has been proposed - The main chain secondary s...tructure of thermophile c-ring has been obtained ATP synthase is a general term for an enzyme that can synth

  4. Main: FEA5 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available al or an anti-cancer drug, is the main cause of hospital-acquired infection - Dru...e will elucidate the entire structure of the transport machinery in action to understand its functions in detail. FEA5.csml ...

  5. Residential Energy Efficiency Potential: Maine

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, Eric J [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

    2017-11-02

    Energy used by Maine single-family homes that can be saved through cost-effective improvements. Prepared by Eric Wilson and Noel Merket, NREL, and Erin Boyd, U.S. Department of Energy Office of Energy Policy and Systems Analysis.

  6. CENTRE OF THE MAIN INTERESTS

    Directory of Open Access Journals (Sweden)

    DIANA DELEANU

    2013-05-01

    Full Text Available The centre of the main interests of the debtor is a legal tool meant to settle conflicts that can arise between jurisdictions in cross-border insolvencies, based on the principles of mutual recognition and co-operation.

  7. Shotgun protein sequencing.

    Energy Technology Data Exchange (ETDEWEB)

    Faulon, Jean-Loup Michel; Heffelfinger, Grant S.

    2009-06-01

    A novel experimental and computational technique based on multiple enzymatic digestion of a protein or protein mixture that reconstructs protein sequences from sequences of overlapping peptides is described in this SAND report. This approach, analogous to shotgun sequencing of DNA, is to be used to sequence alternative spliced proteins, to identify post-translational modifications, and to sequence genetically engineered proteins.

  8. ONKALO - Main drawings in 2007

    International Nuclear Information System (INIS)

    2008-05-01

    The first overall site characterisation programme for a Finnish repository of spent nuclear fuel was introduced in 1982. This programme already suggested that the site confirmation for a detailed repository design and safety assessment should include characterisation performed in an underground rock characterisation facility (URCF). This idea was confirmed during the detailed site characterisation. International views have also emphasised the importance of underground characterisation before the final decision to construct the repository is taken. The underground rock characterisation facility (ONKALO) is excavated at Olkiluoto in the municipality of Eurajoki. ONKALO should be constructed to allow characterisation work for site confirmation without jeopardising long-term safety of the repository site. It should also be possible to link ONKALO later to the repository as to a part of it. The construction of ONKALO was started in 2004 and will be completed in 2014. The characterisation work has started in ONKALO and will focus on the disposal depth. In the main drawings stage, ONKALO was described at the level of detail needed for a construction permit in 2003. This meant description of the location, final structures and final systems. This summary report describes the development of design to updated main drawings in 2007 at the same level of detail (no temporary arrangements are described). The main changes are the added exhaust air shaft and advancing the controlled area's inlet air shaft to the ONKALO phase. Also the layout and the depth of the characterisation levels have been updated according to the current bedrock information. Some buildings on the surface will house sets of equipment directly connected with underground facility and this equipment is described in this report. No buildings or other equipment are described in this report, because they are not directly connected with the underground facility. The main element of ONKALO is a system of

  9. At ISR Main Control Room

    CERN Multimedia

    1983-01-01

    After 13 years the exploitation of the Intersecting Storage Rings as a beam-beam collider went to an end. In this last year the demands were very exacting, both in terms of operating time and diversified running conditions (Annual Report 1983 p. 123). Before dismantelement the photographer made a last tour, see photos 8310889X --> 8310667X. This photo shows the Main Control Room.

  10. Multimodal sequence learning.

    Science.gov (United States)

    Kemény, Ferenc; Meier, Beat

    2016-02-01

    While sequence learning research models complex phenomena, previous studies have mostly focused on unimodal sequences. The goal of the current experiment is to put implicit sequence learning into a multimodal context: to test whether it can operate across different modalities. We used the Task Sequence Learning paradigm to test whether sequence learning varies across modalities, and whether participants are able to learn multimodal sequences. Our results show that implicit sequence learning is very similar regardless of the source modality. However, the presence of correlated task and response sequences was required for learning to take place. The experiment provides new evidence for implicit sequence learning of abstract conceptual representations. In general, the results suggest that correlated sequences are necessary for implicit sequence learning to occur. Moreover, they show that elements from different modalities can be automatically integrated into one unitary multimodal sequence. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Sequence Read Archive (SRA)

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Sequence Read Archive (SRA) stores raw sequencing data from the next generation of sequencing platforms including Roche 454 GS System®, Illumina Genome...

  12. Sir Robert Sidney’s Poems Revisited: the alternative sequence

    OpenAIRE

    Relvas, Maria de Jesus C.

    1997-01-01

    The essay approaches the lyric sequence written by Sir Robert Sidney (1563-1626) in the Elizabethan age, by mainly exploring its unique formal structure, which encloses an alternative sequence formed by a re-numbering of several poems.

  13. Methods for otpimum and near optimum disassembly sequencing

    NARCIS (Netherlands)

    Lambert, A.J.D.; Gupta, S.M.

    2008-01-01

    This paper considers disassembly sequencing problems subjected to sequence dependent disassembly costs. In practice, the methods for dealing with such problems rely mainly on metaheuristic and heuristic methods, which intrinsically generate suboptimum solutions. Exact methods are NP-hard and

  14. Pulsating low-mass white dwarfs in the frame of new evolutionary sequences. V. Asteroseismology of ELMV white dwarf stars

    Science.gov (United States)

    Calcaferro, Leila M.; Córsico, Alejandro H.; Althaus, Leandro G.

    2017-11-01

    Context. Many pulsating low-mass white dwarf stars have been detected in the past years in the field of our Galaxy. Some of them exhibit multiperiodic brightness variation, therefore it is possible to probe their interiors through asteroseismology. Aims: We present a detailed asteroseismological study of all the known low-mass variable white dwarf stars based on a complete set of fully evolutionary models that are representative of low-mass He-core white dwarf stars. Methods: We employed adiabatic radial and nonradial pulsation periods for low-mass white dwarf models with stellar masses ranging from 0.1554 to 0.4352 M⊙ that were derived by simulating the nonconservative evolution of a binary system consisting of an initially 1 M⊙ zero-age main-sequence (ZAMS) star and a 1.4 M⊙ neutron star companion. We estimated the mean period spacing for the stars under study (where this was possible), and then we constrained the stellar mass by comparing the observed period spacing with the average of the computed period spacings for our grid of models. We also employed the individual observed periods of every known pulsating low-mass white dwarf star to search for a representative seismological model. Results: We found that even though the stars under analysis exhibit few periods and the period fits show multiplicity of solutions, it is possible to find seismological models whose mass and effective temperature are in agreement with the values given by spectroscopy for most of the cases. Unfortunately, we were not able to constrain the stellar masses by employing the observed period spacing because, in general, only few periods are exhibited by these stars. In the two cases where we were able to extract the period spacing from the set of observed periods, this method led to stellar mass values that were substantially higher than expected for this type of stars. Conclusions: The results presented in this work show the need for further photometric searches, on the one hand

  15. JWST-MIRI spectrometer main optics design and main results

    Science.gov (United States)

    Navarro, Ramón; Schoenmaker, Ton; Kroes, Gabby; Oudenhuysen, Ad; Jager, Rieks; Venema, Lars

    2017-11-01

    MIRI ('Mid InfraRed Instrument') is the combined imager and integral field spectrometer for the 5-29 micron wavelength range under development for the James Webb Space Telescope JWST. The flight acceptance tests of the Spectrometer Main Optics flight models (SMO), part of the MIRI spectrometer, are completed in the summer of 2008 and the system is delivered to the MIRI-JWST consortium. The two SMO arms contain 14 mirrors and form the MIRI optical system together with 12 selectable gratings on grating wheels. The entire system operates at a temperature of 7 Kelvin and is designed on the basis of a 'no adjustments' philosophy. This means that the optical alignment precision depends strongly on the design, tolerance analysis and detailed knowledge of the manufacturing process. Because in principle no corrections are needed after assembly, continuous tracking of the alignment performance during the design and manufacturing phases is important. The flight hardware is inspected with respect to performance parameters like alignment and image quality. The stability of these parameters is investigated after exposure to various vibration levels and successive cryogenic cool downs. This paper describes the philosophy behind the acceptance tests, the chosen test strategy and reports the results of these tests. In addition the paper covers the design of the optical test setup, focusing on the simulation of the optical interfaces of the SMO. Also the relation to the SMO qualification and verification program is addressed.

  16. Main ring transition crossing simulations

    International Nuclear Information System (INIS)

    Kourbanis, I.; Ng, King-Yuen.

    1990-10-01

    We used ESME to simulate transition crossing in the Main Ring (MR). For the simulations, we followed the MR 29 cycle used currently for bar p production with a flat top of 120 GeV. In Sect. II, some inputs are discussed. In Sect. III, we present simulations with space charge turned off so that the effect of nonlinearity can be studied independently. When space charge is turned on in Sect. IV, we are faced with the problem of statistical errors due to binning, an analysis of which is given in the Appendices. Finally in Sects. V and VI, the results of simulations with space charge are presented and compared with the experimental measurements. 7 refs., 6 figs

  17. Improvement of main control room

    International Nuclear Information System (INIS)

    Chae, Sung Ki; Ham, Chang Sik; Kwon, Ki Chun

    1991-07-01

    Information display system, advanced alarm system and fiber optical communication system were developed to improve the main control room in nuclear power plant. Establishing the new hierachical information structure of plant operation data, plant overview status board(POSB) and digital indicator(DI) were designed and manufactured. The prototype advanced alarm system which employed the new alarm logics and algorithm compared with the conventional alarm system were developed and its effectiveness was proved. Optical communication system which has multi-drop feature and capability of upgrading to large-scale system by using BITBUS communication protocol which is proven technology, were developed. Reliability of that system was enhanced by using distributed control. (Author)

  18. The role of Main Institutions

    DEFF Research Database (Denmark)

    Persson, H Thomas R; Chabanet, Didier; Rakar, Fredrik

    2017-01-01

    ), in many countries the need emerged to understand the best methods to promote their establishment and continued success. In order to understand these issues, to contribute to the academic debate on SEs and to give useful policy advice on a truly enabling ecosystem, in November 2013 a consortium of 11...... Entrepreneurship”; to identify the “New Generation” of Social Entrepreneurs; to build an “Evolutionary Theory of Social Entrepreneurship”; to provide effective policy advices to stakeholders. In order to pursue and achieve these research objectives, the consortium implemented a complex research design...... in the social economy; - In the fifth chapter the authors address the role of the main institutions in developing (or hindering) social enterprises; - In the sixth chapter, stakeholder network maps are used to identify four ‘ecosystem types’ across the 10 partner countries; - The seventh chapter gives...

  19. Main injector synchronous timing system

    International Nuclear Information System (INIS)

    Blokland, W.; Steimel, J.

    1998-01-01

    The Synchronous Timing System is designed to provide sub-nanosecond timing to instrumentation during the acceleration of particles in the Main Injector. Increased energy of the beam particles leads to a small but significant increase in speed, reducing the time it takes to complete a full turn of the ring by 61 nanoseconds (or more than 3 rf buckets). In contrast, the reference signal, used to trigger instrumentation and transmitted over a cable, has a constant group delay. This difference leads to a phase slip during the ramp and prevents instrumentation such as dampers from properly operating without additional measures. The Synchronous Timing System corrects for this phase slip as well as signal propagation time changes due to temperature variations. A module at the LLRF system uses a 1.2 Gbit/s G-Link chip to transmit the rf clock and digital data (e.g. the current frequency) over a single mode fiber around the ring. Fiber optic couplers at service buildings split off part of this signal for a local module which reconstructs a synchronous beam reference signal. This paper describes the background, design and expected performance of the Synchronous Timing System. copyright 1998 American Institute of Physics

  20. Main injector synchronous timing system

    International Nuclear Information System (INIS)

    Blokland, Willem; Steimel, James

    1998-01-01

    The Synchronous Timing System is designed to provide sub-nanosecond timing to instrumentation during the acceleration of particles in the Main Injector. Increased energy of the beam particles leads to a small but significant increase in speed, reducing the time it takes to complete a full turn of the ring by 61 nanoseconds (or more than 3 rf buckets). In contrast, the reference signal, used to trigger instrumentation and transmitted over a cable, has a constant group delay. This difference leads to a phase slip during the ramp and prevents instrumentation such as dampers from properly operating without additional measures. The Synchronous Timing System corrects for this phase slip as well as signal propagation time changes due to temperature variations. A module at the LLRF system uses a 1.2 Gbit/s G-Link chip to transmit the rf clock and digital data (e.g. the current frequency) over a single mode fiber around the ring. Fiber optic couplers at service buildings split off part of this signal for a local module which reconstructs a synchronous beam reference signal. This paper describes the background, design and expected performance of the Synchronous Timing System

  1. Main technical topics in 1999

    International Nuclear Information System (INIS)

    2000-01-01

    This Safety Authority annual report strives to present current organizational provisions and future trends in nuclear safety supervision in France and to describe the most outstanding occurrences during the past year. A first part presents nine documents concerning the main topics of 1999: aging of nuclear installations, the Offsite Emergency Plans (PPI), the impact of nuclear activities on man and the environment, the criticality hazards, EDF in 1999, the EPR project, the Andra in 1999, the transport incidents, the nuclear safety in eastern Europe. The second part presents the missions and actions of the Nuclear Installations Safety in the domains of the liabilities, the organization of the nuclear safety control, the regulations of the INB, the public information, the international relations, the crisis management, the radioactive materials transportation, the radioactive wastes. The equipment, the radiation protection and the exploitation of the pressurized water reactors are also treated just as the experimental reactors, the fuel cycle installations and the the nuclear installations dismantling. (A.L.B.)

  2. Main challenges of residential areas

    Directory of Open Access Journals (Sweden)

    Oana Luca

    2017-06-01

    Full Text Available The present article is a position paper aiming to initiate a professional debate related to the aspects related to the urban dysfunctions leading to the wear of the residential areas. The paper proposes a definition of the wear process, identify the main causes leading to its occurrence and propose a number of solutions to neutralise the dysfunctions. The three wearing phases of residential areas components are emphasized, exploring their lifecycle. In order to perform the study of urban wear, the status of the residential areas components can be established and monitored, and also the variables of the function that can mathematically model the specific wear process may be considered. The paper is considered a first step for the model adjustment, to be tested and validated in the following steps. Based on the mathematical method and model, there can be created, in a potential future research, the possibility of determining the precarity degree for residential areas/neighbourhoods and cities, by minimising the subjective component of the analyses preceding the decision for renovation or regeneration.

  3. Research in auditing: main themes

    Directory of Open Access Journals (Sweden)

    Marcelo Porte

    Full Text Available ABSTRACT The passage of the Sarbanes-Oxley Act (SOX was a turning point in auditing and in auditors practice for the academic world. Research concerning the characterization of academic production related to auditing is in its third decade. Its analysis is accomplished by means of definition of keywords, abstracts or title, and information on thematic association within the academic production itself in auditing is undisclosed. In order to revise this gap in auditing literature, this study identified the main themes in auditing and their association in post-SOX era by analyzing the content of objectives and hypothesis of 1,650 publications in Web of Science (2002-2014. The findings in this study extended those from the study by Lesage and Wechtler (2012 from 16 auditing thematic typologies to 22. The results demonstrate that the themes audit report & financial statement users, corporate governance, audit market, external audit, socio-economic data of the company, international regulation, and fraud risk & audit risk were the most addressed in the publications about auditing. Corporate governance has a broader association with the other themes in the area. Future researches may use these themes and relate them to the methodologies applied to audit studies.

  4. Nonparametric combinatorial sequence models.

    Science.gov (United States)

    Wauthier, Fabian L; Jordan, Michael I; Jojic, Nebojsa

    2011-11-01

    This work considers biological sequences that exhibit combinatorial structures in their composition: groups of positions of the aligned sequences are "linked" and covary as one unit across sequences. If multiple such groups exist, complex interactions can emerge between them. Sequences of this kind arise frequently in biology but methodologies for analyzing them are still being developed. This article presents a nonparametric prior on sequences which allows combinatorial structures to emerge and which induces a posterior distribution over factorized sequence representations. We carry out experiments on three biological sequence families which indicate that combinatorial structures are indeed present and that combinatorial sequence models can more succinctly describe them than simpler mixture models. We conclude with an application to MHC binding prediction which highlights the utility of the posterior distribution over sequence representations induced by the prior. By integrating out the posterior, our method compares favorably to leading binding predictors.

  5. Genome Sequence Databases (Overview): Sequencing and Assembly

    Energy Technology Data Exchange (ETDEWEB)

    Lapidus, Alla L.

    2009-01-01

    From the date its role in heredity was discovered, DNA has been generating interest among scientists from different fields of knowledge: physicists have studied the three dimensional structure of the DNA molecule, biologists tried to decode the secrets of life hidden within these long molecules, and technologists invent and improve methods of DNA analysis. The analysis of the nucleotide sequence of DNA occupies a special place among the methods developed. Thanks to the variety of sequencing technologies available, the process of decoding the sequence of genomic DNA (or whole genome sequencing) has become robust and inexpensive. Meanwhile the assembly of whole genome sequences remains a challenging task. In addition to the need to assemble millions of DNA fragments of different length (from 35 bp (Solexa) to 800 bp (Sanger)), great interest in analysis of microbial communities (metagenomes) of different complexities raises new problems and pushes some new requirements for sequence assembly tools to the forefront. The genome assembly process can be divided into two steps: draft assembly and assembly improvement (finishing). Despite the fact that automatically performed assembly (or draft assembly) is capable of covering up to 98% of the genome, in most cases, it still contains incorrectly assembled reads. The error rate of the consensus sequence produced at this stage is about 1/2000 bp. A finished genome represents the genome assembly of much higher accuracy (with no gaps or incorrectly assembled areas) and quality ({approx}1 error/10,000 bp), validated through a number of computer and laboratory experiments.

  6. Long sequence correlation coprocessor

    Science.gov (United States)

    Gage, Douglas W.

    1994-09-01

    A long sequence correlation coprocessor (LSCC) accelerates the bitwise correlation of arbitrarily long digital sequences by calculating in parallel the correlation score for 16, for example, adjacent bit alignments between two binary sequences. The LSCC integrated circuit is incorporated into a computer system with memory storage buffers and a separate general purpose computer processor which serves as its controller. Each of the LSCC's set of sequential counters simultaneously tallies a separate correlation coefficient. During each LSCC clock cycle, computer enable logic associated with each counter compares one bit of a first sequence with one bit of a second sequence to increment the counter if the bits are the same. A shift register assures that the same bit of the first sequence is simultaneously compared to different bits of the second sequence to simultaneously calculate the correlation coefficient by the different counters to represent different alignments of the two sequences.

  7. Roles of repetitive sequences

    Energy Technology Data Exchange (ETDEWEB)

    Bell, G.I.

    1991-12-31

    The DNA of higher eukaryotes contains many repetitive sequences. The study of repetitive sequences is important, not only because many have important biological function, but also because they provide information on genome organization, evolution and dynamics. In this paper, I will first discuss some generic effects that repetitive sequences will have upon genome dynamics and evolution. In particular, it will be shown that repetitive sequences foster recombination among, and turnover of, the elements of a genome. I will then consider some examples of repetitive sequences, notably minisatellite sequences and telomere sequences as examples of tandem repeats, without and with respectively known function, and Alu sequences as an example of interspersed repeats. Some other examples will also be considered in less detail.

  8. Anomaly Detection in Sequences

    Data.gov (United States)

    National Aeronautics and Space Administration — We present a set of novel algorithms which we call sequenceMiner, that detect and characterize anomalies in large sets of high-dimensional symbol sequences that...

  9. DNA sequencing conference, 2

    Energy Technology Data Exchange (ETDEWEB)

    Cook-Deegan, R.M. [Georgetown Univ., Kennedy Inst. of Ethics, Washington, DC (United States); Venter, J.C. [National Inst. of Neurological Disorders and Strokes, Bethesda, MD (United States); Gilbert, W. [Harvard Univ., Cambridge, MA (United States); Mulligan, J. [Stanford Univ., CA (United States); Mansfield, B.K. [Oak Ridge National Lab., TN (United States)

    1991-06-19

    This conference focused on DNA sequencing, genetic linkage mapping, physical mapping, informatics and bioethics. Several were used to study this sequencing and mapping. This article also discusses computer hardware and software aiding in the mapping of genes.

  10. sequenceMiner algorithm

    Data.gov (United States)

    National Aeronautics and Space Administration — Detecting and describing anomalies in large repositories of discrete symbol sequences. sequenceMiner has been open-sourced! Download the file below to try it out....

  11. Effectiveness of Ninth-Grade Physics in Maine: Conceptual Understanding

    OpenAIRE

    O'Brien, Michael; Thompson, John

    2009-01-01

    The Physics First movement - teaching a true physics course to ninth grade students - is gaining popularity in high schools. There are several different rhetorical arguments for and against this movement, and it is quite controversial in physics education. However, there is no actual evidence to assess the success, or failure, of this substantial shift in the science teaching sequence. We have undertaken a comparison study of physics classes taught in ninth- and 12th grade classes in Maine. C...

  12. Tinkering at the main-ring lattice

    Energy Technology Data Exchange (ETDEWEB)

    Ohnuma, S.

    1982-08-23

    To improve production of usable antiprotons using the proton beam from the main ring and the lossless injection of cooled antiprotons into the main ring, modifications of the main ring lattice are recommended.

  13. Generalized locally Toeplitz sequences theory and applications

    CERN Document Server

    Garoni, Carlo

    2017-01-01

    Based on their research experience, the authors propose a reference textbook in two volumes on the theory of generalized locally Toeplitz sequences and their applications. This first volume focuses on the univariate version of the theory and the related applications in the unidimensional setting, while the second volume, which addresses the multivariate case, is mainly devoted to concrete PDE applications. This book systematically develops the theory of generalized locally Toeplitz (GLT) sequences and presents some of its main applications, with a particular focus on the numerical discretization of differential equations (DEs). It is the first book to address the relatively new field of GLT sequences, which occur in numerous scientific applications and are especially dominant in the context of DE discretizations. Written for applied mathematicians, engineers, physicists, and scientists who (perhaps unknowingly) encounter GLT sequences in their research, it is also of interest to those working in the fields of...

  14. Enhanced Dynamic Algorithm of Genome Sequence Alignments

    OpenAIRE

    Arabi E. keshk

    2014-01-01

    The merging of biology and computer science has created a new field called computational biology that explore the capacities of computers to gain knowledge from biological data, bioinformatics. Computational biology is rooted in life sciences as well as computers, information sciences, and technologies. The main problem in computational biology is sequence alignment that is a way of arranging the sequences of DNA, RNA or protein to identify the region of similarity and relationship between se...

  15. Stars of type MS with evidence of white dwarf companions. [IUE, Main Sequence (MS)

    Science.gov (United States)

    Peery, Benjamin F., Jr.

    1986-01-01

    A search for white dwarf companions of MS-type stars was conducted, using IUE. The overendowments of these stars in typical S-process nuclides suggest that they, like the Ba II stars, may owe their peculiar compositions to earlier mass transfer. Short-wavelength IUE spectra show striking emission line variability in HD35155, HD61913, and 4 Ori; HD35155 and 4 Ori show evidence of white dwarf companions.

  16. Some aspects of cool main sequence star ages derived from stellar rotation (gyrochronology)

    Science.gov (United States)

    Barnes, S. A.; Spada, F.; Weingrill, J.

    2016-09-01

    Rotation periods for cool stars can be measured with good precision by monitoring starspot light modulation. Observations have shown that the rotation periods of dwarf stars of roughly solar metallicity have such systematic dependencies on stellar age and mass that they can be used to derive reliable ages, a procedure called gyrochronology. We review the method and show illustrative cases, including recent ground- and space-based data. The age uncertainties approach 10 % in the best cases, making them a valuable complement to, and constraint on, asteroseismic or other ages. Edited, updated, and refereed version of a presentation at the WE-Heraeus-Seminar in Bad Honnef, Germany: Reconstructing the Milky Way's History: Spectroscopic Surveys, Asteroseismology and Chemodynamical Models

  17. THE DUSTIEST POST-MAIN SEQUENCE STARS IN THE MAGELLANIC CLOUDS

    Energy Technology Data Exchange (ETDEWEB)

    Jones, Olivia C.; Meixner, Margaret; Roman-Duval, Julia [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Sargent, Benjamin A. [Center for Imaging Science and Laboratory for Multiwavelength Astrophysics, Rochester Institute of Technology, 54 Lomb Memorial Drive, Rochester, NY 14623 (United States); Boyer, Martha L. [Observational Cosmology Lab, Code 665, NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Sewiło, Marta [The Johns Hopkins University, Department of Physics and Astronomy, 366 Bloomberg Center, 3400 N. Charles Street, Baltimore, MD 21218 (United States); Hony, Sacha [Institut für Theoretische Astrophysik, Zentrum für Astronomie, Universitt Heidelberg, Albert-Ueberle-Str. 2, D-69120 Heidelberg (Germany)

    2015-10-01

    Using observations from the Herschel Inventory of The Agents of Galaxy Evolution (HERITAGE) survey of the Magellanic Clouds (MC), we have found 35 evolved stars and stellar end products that are bright in the far-infrared. These 28 (LMC) and 7 (SMC) sources were selected from the 529 evolved star candidates in the HERITAGE far-infrared point source catalogs. Our source identification method is based on spectral confirmation, spectral energy distribution characteristics, careful examination of the multiwavelength images and includes constraints on the luminosity, resulting in a thoroughly vetted list of evolved stars. These sources span a wide range in luminosity and hence initial mass. We found 13 low- to intermediate-mass evolved stars, including asymptotic giant branch (AGB) stars, post-AGB stars, planetary nebulae, and a symbiotic star. We also identify 10 high mass stars, including 4 of the 15 known B[e] stars in the MC, 3 extreme red supergiants that are highly enshrouded by dust, a Luminous Blue Variable, a Wolf–Rayet star, and two supernova remnants. Further, we report the detection of 9 probable evolved objects which were previously undescribed in the literature. These sources are likely to be among the dustiest evolved objects in the MC. The Herschel emission may either be due to dust produced by the evolved star or it may arise from swept-up interstellar medium material.

  18. Prospects for detecting decreasing exoplanet frequency with main-sequence age using PLATO

    Science.gov (United States)

    Veras, D.; Brown, D. J. A.; Mustill, A. J.; Pollacco, D.

    2017-09-01

    The space mission PLATO will usher in a new era of exoplanetary science by expanding our current inventory of transiting systems and constraining host star ages, which are currently highly uncertain. This capability might allow PLATO to detect changes in planetary system architecture with time, particularly because planetary scattering due to Lagrange instability may be triggered long after the system was formed. Here, we utilize previously published instability time-scale prescriptions to determine PLATO's capability to detect a trend of decreasing planet frequency with age for systems with equal- mass planets. For two-planet systems, our results demonstrate that PLATO may detect a trend for planet masses which are at least as massive as super-Earths. For systems with three or more planets, we link their initial compactness to potentially detectable frequency trends in order to aid future investigations when these populations will be better characterized.

  19. Important consequences of atomic diffusion inside main-sequence stars: opacities, extra-mixing, oscillations

    Directory of Open Access Journals (Sweden)

    Deal M.

    2017-01-01

    Full Text Available Atomic diffusion, including the effects of radiative accelerations on individual elements, leads to important variations of the chemical composition inside stars. The accumulation of important elements in specific layers leads to a local increase of the average opacity and to hydrodynamic instabilities that modify the internal stellar structure. This can also have important consequences for asteroseismology.

  20. Intrinsic width and luminosity function of the M92 main sequence

    International Nuclear Information System (INIS)

    Sandage, A.; Katem, B.

    1983-01-01

    Measurements of B and V magnitudes of approx.475 identified stars in the magnitude interval 18.0 - 4 is too low. The luminosity function, obtained from the present data, is compared with that determined earlier by Tayler, by Hartwick, by van den Bergh, and with Fukuoka and Simoda, with good agreement. The evidence favors that phi(M/sub v/) flattens fainter than M/sub v/approx. =+6 as predicted in some dynamical models, due to loss of low mass stars

  1. Theory and evidence of global Rossby waves in upper main-sequence stars

    DEFF Research Database (Denmark)

    Saio, Hideyuki; Kurtz, Donald W.; Murphy, Simon J.

    2018-01-01

    in the observational frame by considering the visibility of these modes. We find that the frequencies of r modes of azimuthal order m appear as groups at slightly lower frequency than m times the rotation frequency. Comparing the visibility curves for r modes with Fourier amplitude spectra of Kepler light curves...

  2. Oscillation mode frequencies of 61 main-sequence and subgiant stars observed by Kepler

    DEFF Research Database (Denmark)

    Appourchaux, T.; Chaplin, W. J.; García, R. A.

    2012-01-01

    Solar-like oscillations have been observed by Kepler and CoRoT in several solar-type stars, thereby providing a way to probe the stars using asteroseismology Aims. We provide the mode frequencies of the oscillations of various stars required to perform a comparison with those obtained from stella...

  3. VizieR Online Data Catalog: Pisa pre-main sequence tracks and isochrones (Tognelli+, 2011)

    Science.gov (United States)

    Tognelli, E.; Prada Moroni, P. G.; Degl'Innocenti, S.

    2011-07-01

    Evolutionary tracks and Isochrones in the log L vs log Te plane, for the following chemical compositions: Z Y Y Y 2.00E-04 0.230 0.249 0.250 1.00E-03 0.232 0.251 0.254 2.00E-03 0.234 0.253 0.259 3.00E-03 0.236 0.254 0.263 4.00E-03 0.238 0.256 0.269 5.00E-03 0.240 0.258 0.273 6.00E-03 0.242 0.260 0.279 7.00E-03 0.244 0.262 0.283 8.00E-03 0.246 0.265 0.289 9.00E-03 0.248 0.267 0.294 1.00E-02 0.250 0.268 0.299 1.25E-02 0.255 0.274 0.311 1.50E-02 0.260 0.278 0.323 1.75E-02 0.265 0.284 0.336 2.00E-02 0.270 0.288 0.349 2.25E-02 0.275 0.294 0.361 2.50E-02 0.280 0.299 0.374 2.75E-02 0.285 0.304 0.386 3.00E-02 0.290 0.308 0.398 Each model is calculated with an initial Deuterium abundance XD=4.0E-05. For Z>=0.008, models with XD=2.0E-05 are available, too. Each model is calculated with three different values of the mixing length parameter alpha = 1.20, 1.68 (solar calibrated), 1.90. There is also a dataset for our Standard Solar Model parameters (Z=0.01377, Y=0.2533, alpha=1.68, XD=2.0E-05). (5 data files).

  4. Extreme value statistics for two-dimensional convective penetration in a pre-main sequence star

    Science.gov (United States)

    Pratt, J.; Baraffe, I.; Goffrey, T.; Constantino, T.; Viallet, M.; Popov, M. V.; Walder, R.; Folini, D.

    2017-08-01

    Context. In the interior of stars, a convectively unstable zone typically borders a zone that is stable to convection. Convective motions can penetrate the boundary between these zones, creating a layer characterized by intermittent convective mixing, and gradual erosion of the density and temperature stratification. Aims: We examine a penetration layer formed between a central radiative zone and a large convection zone in the deep interior of a young low-mass star. Using the Multidimensional Stellar Implicit Code (MUSIC) to simulate two-dimensional compressible stellar convection in a spherical geometry over long times, we produce statistics that characterize the extent and impact of convective penetration in this layer. Methods: We apply extreme value theory to the maximal extent of convective penetration at any time. We compare statistical results from simulations which treat non-local convection, throughout a large portion of the stellar radius, with simulations designed to treat local convection in a small region surrounding the penetration layer. For each of these situations, we compare simulations of different resolution, which have different velocity magnitudes. We also compare statistical results between simulations that radiate energy at a constant rate to those that allow energy to radiate from the stellar surface according to the local surface temperature. Results: Based on the frequency and depth of penetrating convective structures, we observe two distinct layers that form between the convection zone and the stable radiative zone. We show that the probability density function of the maximal depth of convective penetration at any time corresponds closely in space with the radial position where internal waves are excited. We find that the maximal penetration depth can be modeled by a Weibull distribution with a small shape parameter. Using these results, and building on established scalings for diffusion enhanced by large-scale convective motions, we propose a new form for the diffusion coefficient that may be used for one-dimensional stellar evolution calculations in the large Péclet number regime. These results should contribute to the 321D link.

  5. YSOVAR: Six Pre-main-sequence Eclipsing Binaries in the Orion Nebula Cluster

    Science.gov (United States)

    2012-06-25

    ISOY J053446.01−044922.1i V1448 Ori 17.43c 15.61c 13.88 13.26 12.95 12.73 12.66 12.91 . . . K5c 0.5424125 ISOY J053605.95−050041.2i 2MASS J05360595...identified 12 EB candidates. Four of them, 2MASS 05352184−0546085 (Stassun et al. 2006), V1174 Ori (Stassun et al. 2004), Par1802 (Cargile et al. 2008...Zero points for the photometry were established by reference to data for non-variable stars in our FOV from the Two Micron All Sky Survey ( 2MASS

  6. VizieR Online Data Catalog: Habitable zones around main-sequence stars (Kopparapu+, 2014)

    Science.gov (United States)

    Kopparapu, R. K.; Ramirez, R. M.; Schottelkotte, J.; Kasting, J. F.; Domagal-Goldman, S.; Eymet, V.

    2017-08-01

    Language: Fortran 90 Code tested under the following compilers/operating systems: ifort/CentOS linux Description of input data: No input necessary. Description of output data: Output files: HZs.dat, HZ_coefficients.dat System requirements: No major system requirement. Fortran compiler necessary. Calls to external routines: None. Additional comments: None (1 data file).

  7. Carbon Monoxide and the Potential for Prebiotic Chemistry on Habitable Planets Around Main Sequence M Stars

    Science.gov (United States)

    Nava-Sedeno, J. Manik; Ortiz-Cervantes, Adrian; Segura, Antigona; Domagal-Goldman, Shawn D.

    2016-01-01

    Lifeless planets with CO2 atmospheres produce CO by CO2 photolysis. On planets around M dwarfs, CO is a long-lived atmospheric compound, as long as UV emission due to the stars chromospheric activity lasts, and the sink of CO and O2 in seawater is small compared to its atmospheric production. Atmospheres containing reduced compounds, like CO, may undergo further energetic and chemical processing to give rise to organic compounds of potential importance for the origin of life. We calculated the yield of organic compounds from CO2-rich atmospheres of planets orbiting M dwarf stars, which were previously simulated by Domagal- Goldman et al. (2014) and Harman et al. (2015), by cosmic rays and lightning using results of experiments by Miyakawaet al. (2002) and Schlesinger and Miller (1983a, 1983b). Stellar protons from active stars may be important energy sources for abiotic synthesis and increase production rates of biological compounds by at least 2 orders of magnitude compared to cosmic rays. Simple compounds such as HCN and H2CO are more readily synthesized than more complex ones, such as amino acids and uracil (considered here as an example), resulting in higher yields for the former and lower yields for the latter. Electric discharges are most efficient when a reducing atmosphere is present. Nonetheless, atmospheres with high quantities of CO2 are capable of producing higher amounts of prebiotic compounds, given that CO is constantly produced in the atmosphere. Our results further support planetary systems around M dwarf stars as candidates for supporting life or its origin.

  8. Relative stellar occurrence of exoplanets in habitable zones of the main sequence F, G, K stars

    Czech Academy of Sciences Publication Activity Database

    Pintr, Pavel; Peřinová, V.; Lukš, A.; Pathak, A.

    2014-01-01

    Roč. 99, sept2014 (2014), s. 1-6 ISSN 0032-0633 R&D Projects: GA MŠk(CZ) ED2.1.00/03.0079 Institutional support: RVO:61389021 Keywords : Exoplanets * Methods: statistical * Stars: planetary systems Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 1.875, year: 2014 http://www.sciencedirect.com/science/article/pii/S003206331400172X#

  9. Apparent Brecciation Gradient, Mount Desert Island, Maine

    Science.gov (United States)

    Hawkins, A. T.; Johnson, S. E.

    2004-05-01

    Mount Desert Island, Maine, comprises a shallow level, Siluro-Devonian igneous complex surrounded by a distinctive breccia zone ("shatter zone" of Gilman and Chapman, 1988). The zone is very well exposed on the southern and eastern shores of the island and provides a unique opportunity to examine subvolcanic processes. The breccia of the Shatter Zone shows wide variation in percent matrix and clast, and may represent a spatial and temporal gradient in breccia formation due to a single eruptive or other catastrophic volcanic event. The shatter zone was divided into five developmental stages based on the extent of brecciation: Bar Harbor Formation, Sols Cliffs breccia, Seeley Road breccia, Dubois breccia, and Great Head breccia. A digital camera was employed to capture scale images of representative outcrops using a 0.5 m square Plexiglas frame. Individual images were joined in Adobe Photoshop to create a composite image of each outcrop. The composite photo was then exported to Adobe Illustrator, which was used to outline the clasts and produce a digital map of the outcrop for analysis. The fractal dimension (Fd) of each clast was calculated using NIH Image and a Euclidean distance mapping method described by Bérubé and Jébrak (1999) to quantify the morphology of the fragments, or the complexity of the outline. The more complex the fragment outline, the higher the fractal dimension, indicating that the fragment is less "mature" or has had less exposure to erosional processes, such as the injection of an igneous matrix. Sols Cliffs breccia has an average Fd of 1.125, whereas Great Head breccia has an average Fd of 1.040, with the stages between having intermediate values. The more complex clasts of the Sols Cliffs breccia with a small amount (26.38%) of matrix material suggests that it is the first stage in a sequence of brecciation ending at the more mature, matrix-supported (71.37%) breccia of Great Head. The results of this study will be used to guide isotopic

  10. 75 FR 27863 - Savings Bank of Maine, MHC and Savings Bank of Maine, Gardiner, Maine; Approval of Conversion...

    Science.gov (United States)

    2010-05-18

    ... DEPARTMENT OF THE TREASURY Office of Thrift Supervision [AC-38: OTS Nos. 06947 and H 4709] Savings Bank of Maine, MHC and Savings Bank of Maine, Gardiner, Maine; Approval of Conversion Application Notice is hereby given that on May 7, 2010, the Office of Thrift Supervision approved the application of...

  11. Sequences for Student Investigation

    Science.gov (United States)

    Barton, Jeffrey; Feil, David; Lartigue, David; Mullins, Bernadette

    2004-01-01

    We describe two classes of sequences that give rise to accessible problems for undergraduate research. These problems may be understood with virtually no prerequisites and are well suited for computer-aided investigation. The first sequence is a variation of one introduced by Stephen Wolfram in connection with his study of cellular automata. The…

  12. Quasi-periodic latitudinal shift of Saturn's main auroral emission

    Science.gov (United States)

    Roussos, E.; Palmaerts, B.; Grodent, D. C.; Radioti, K.; Krupp, N.; Yao, Z.

    2017-12-01

    The main component of the ultraviolet auroral emissions at Saturn consists in a ring of emission around each pole of the planet. This main ring of emission has been revealed to oscillate by a few degrees in the prenoon-premidnight direction with a period of 10.8h. This auroral oscillation is thought to be induced by a rotating external magnetospheric current system associated with the planetary period oscillations. Here we report, by means of auroral imaging sequences obtained with the Ultraviolet Imaging Spectrograph (UVIS) on board the Cassini spacecraft, the first direct observation of an additional motion of the main emission superimposed to this oscillation. The whole main emission ring exhibits step-like displacements in latitude mainly towards dayside, decoupled from the 10.8h oscillation. These latitude shifts recur around every hour, which is a typical short periodicity at Saturn previously identified in the aurora intensity, in the charged particle fluxes and in the magnetic field. This unique observation directly demonstrates what has been inferred from past in-situ and remote measurements: the 1-hour periodicities reveal a global and fundamental magnetospheric oscillation mode that acts independently of the local magnetospheric conditions. However, the magnetospheric mechanism responsible for these 1-hour auroral shifts is still unknown. It is possible that Alfvén waves inducing hourly magnetic fluctuations might also modify the place where the field-aligned electrons precipitate in the ionosphere and produce the main emission.

  13. Sequence History Update Tool

    Science.gov (United States)

    Khanampompan, Teerapat; Gladden, Roy; Fisher, Forest; DelGuercio, Chris

    2008-01-01

    The Sequence History Update Tool performs Web-based sequence statistics archiving for Mars Reconnaissance Orbiter (MRO). Using a single UNIX command, the software takes advantage of sequencing conventions to automatically extract the needed statistics from multiple files. This information is then used to populate a PHP database, which is then seamlessly formatted into a dynamic Web page. This tool replaces a previous tedious and error-prone process of manually editing HTML code to construct a Web-based table. Because the tool manages all of the statistics gathering and file delivery to and from multiple data sources spread across multiple servers, there is also a considerable time and effort savings. With the use of The Sequence History Update Tool what previously took minutes is now done in less than 30 seconds, and now provides a more accurate archival record of the sequence commanding for MRO.

  14. Sequence complexity and work extraction

    International Nuclear Information System (INIS)

    Merhav, Neri

    2015-01-01

    We consider a simplified version of a solvable model by Mandal and Jarzynski, which constructively demonstrates the interplay between work extraction and the increase of the Shannon entropy of an information reservoir which is in contact with a physical system. We extend Mandal and Jarzynski’s main findings in several directions: first, we allow sequences of correlated bits rather than just independent bits. Secondly, at least for the case of binary information, we show that, in fact, the Shannon entropy is only one measure of complexity of the information that must increase in order for work to be extracted. The extracted work can also be upper bounded in terms of the increase in other quantities that measure complexity, like the predictability of future bits from past ones. Third, we provide an extension to the case of non-binary information (i.e. a larger alphabet), and finally, we extend the scope to the case where the incoming bits (before the interaction) form an individual sequence, rather than a random one. In this case, the entropy before the interaction can be replaced by the Lempel–Ziv (LZ) complexity of the incoming sequence, a fact that gives rise to an entropic meaning of the LZ complexity, not only in information theory, but also in physics. (paper)

  15. 30 CFR 57.6160 - Main facilities.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Main facilities. 57.6160 Section 57.6160...-Underground Only § 57.6160 Main facilities. (a) Main facilities used to store explosive material underground... facilities will not prevent escape from the mine, or cause detonation of the contents of another storage...

  16. HIV Sequence Compendium 2015

    Energy Technology Data Exchange (ETDEWEB)

    Foley, Brian Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Leitner, Thomas Kenneth [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Apetrei, Cristian [Univ. of Pittsburgh, PA (United States); Hahn, Beatrice [Univ. of Pennsylvania, Philadelphia, PA (United States); Mizrachi, Ilene [National Center for Biotechnology Information, Bethesda, MD (United States); Mullins, James [Univ. of Washington, Seattle, WA (United States); Rambaut, Andrew [Univ. of Edinburgh, Scotland (United Kingdom); Wolinsky, Steven [Northwestern Univ., Evanston, IL (United States); Korber, Bette Tina Marie [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-10-05

    This compendium is an annual printed summary of the data contained in the HIV sequence database. We try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2015. Hence, though it is published in 2015 and called the 2015 Compendium, its contents correspond to the 2014 curated alignments on our website. The number of sequences in the HIV database is still increasing. In total, at the end of 2014, there were 624,121 sequences in the HIV Sequence Database, an increase of 7% since the previous year. This is the first year that the number of new sequences added to the database has decreased compared to the previous year. The number of near complete genomes (>7000 nucleotides) increased to 5834 by end of 2014. However, as in previous years, the compendium alignments contain only a fraction of these. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/ content/sequence/NEWALIGN/align.html As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.

  17. Mapping sequences by parts

    Directory of Open Access Journals (Sweden)

    Guziolowski Carito

    2007-09-01

    Full Text Available Abstract Background: We present the N-map method, a pairwise and asymmetrical approach which allows us to compare sequences by taking into account evolutionary events that produce shuffled, reversed or repeated elements. Basically, the optimal N-map of a sequence s over a sequence t is the best way of partitioning the first sequence into N parts and placing them, possibly complementary reversed, over the second sequence in order to maximize the sum of their gapless alignment scores. Results: We introduce an algorithm computing an optimal N-map with time complexity O (|s| × |t| × N using O (|s| × |t| × N memory space. Among all the numbers of parts taken in a reasonable range, we select the value N for which the optimal N-map has the most significant score. To evaluate this significance, we study the empirical distributions of the scores of optimal N-maps and show that they can be approximated by normal distributions with a reasonable accuracy. We test the functionality of the approach over random sequences on which we apply artificial evolutionary events. Practical Application: The method is illustrated with four case studies of pairs of sequences involving non-standard evolutionary events.

  18. The Colliding Beams Sequencer

    International Nuclear Information System (INIS)

    Johnson, D.E.; Johnson, R.P.

    1989-01-01

    The Colliding Beam Sequencer (CBS) is a computer program used to operate the pbar-p Collider by synchronizing the applications programs and simulating the activities of the accelerator operators during filling and storage. The Sequencer acts as a meta-program, running otherwise stand alone applications programs, to do the set-up, beam transfers, acceleration, low beta turn on, and diagnostics for the transfers and storage. The Sequencer and its operational performance will be described along with its special features which include a periodic scheduler and command logger. 14 refs., 3 figs

  19. Phylogenetic Trees From Sequences

    Science.gov (United States)

    Ryvkin, Paul; Wang, Li-San

    In this chapter, we review important concepts and approaches for phylogeny reconstruction from sequence data.We first cover some basic definitions and properties of phylogenetics, and briefly explain how scientists model sequence evolution and measure sequence divergence. We then discuss three major approaches for phylogenetic reconstruction: distance-based phylogenetic reconstruction, maximum parsimony, and maximum likelihood. In the third part of the chapter, we review how multiple phylogenies are compared by consensus methods and how to assess confidence using bootstrapping. At the end of the chapter are two sections that list popular software packages and additional reading.

  20. Isolators Including Main Spring Linear Guide Systems

    Science.gov (United States)

    Goold, Ryan (Inventor); Buchele, Paul (Inventor); Hindle, Timothy (Inventor); Ruebsamen, Dale Thomas (Inventor)

    2017-01-01

    Embodiments of isolators, such as three parameter isolators, including a main spring linear guide system are provided. In one embodiment, the isolator includes first and second opposing end portions, a main spring mechanically coupled between the first and second end portions, and a linear guide system extending from the first end portion, across the main spring, and toward the second end portion. The linear guide system expands and contracts in conjunction with deflection of the main spring along the working axis, while restricting displacement and rotation of the main spring along first and second axes orthogonal to the working axis.

  1. Supervised Sequence Labelling with Recurrent Neural Networks

    CERN Document Server

    Graves, Alex

    2012-01-01

    Supervised sequence labelling is a vital area of machine learning, encompassing tasks such as speech, handwriting and gesture recognition, protein secondary structure prediction and part-of-speech tagging. Recurrent neural networks are powerful sequence learning tools—robust to input noise and distortion, able to exploit long-range contextual information—that would seem ideally suited to such problems. However their role in large-scale sequence labelling systems has so far been auxiliary.    The goal of this book is a complete framework for classifying and transcribing sequential data with recurrent neural networks only. Three main innovations are introduced in order to realise this goal. Firstly, the connectionist temporal classification output layer allows the framework to be trained with unsegmented target sequences, such as phoneme-level speech transcriptions; this is in contrast to previous connectionist approaches, which were dependent on error-prone prior segmentation. Secondly, multidimensional...

  2. Inverted temperature sequences: role of deformation partitioning

    Science.gov (United States)

    Grujic, D.; Ashley, K. T.; Coble, M. A.; Coutand, I.; Kellett, D.; Whynot, N.

    2015-12-01

    The inverted metamorphism associated with the Main Central thrust zone in the Himalaya has been historically attributed to a number of tectonic processes. Here we show that there is actually a composite peak and deformation temperature sequence that formed in succession via different tectonic processes. The deformation partitioning seems to the have played a key role, and the magnitude of each process has varied along strike of the orogen. To explain the formation of the inverted metamorphic sequence across the Lesser Himalayan Sequence (LHS) in eastern Bhutan, we used Raman spectroscopy of carbonaceous material (RSCM) to determine the peak metamorphic temperatures and Ti-in-quartz thermobarometry to determine the deformation temperatures combined with thermochronology including published apatite and zircon U-Th/He and fission-track data and new 40Ar/39Ar dating of muscovite. The dataset was inverted using 3D-thermal-kinematic modeling to constrain the ranges of geological parameters such as fault geometry and slip rates, location and rates of localized basal accretion, and thermal properties of the crust. RSCM results indicate that there are two peak temperature sequences separated by a major thrust within the LHS. The internal temperature sequence shows an inverted peak temperature gradient of 12 °C/km; in the external (southern) sequence, the peak temperatures are constant across the structural sequence. Thermo-kinematic modeling suggest that the thermochronologic and thermobarometric data are compatible with a two-stage scenario: an Early-Middle Miocene phase of fast overthrusting of a hot hanging wall over a downgoing footwall and inversion of the synkinematic isotherms, followed by the formation of the external duplex developed by dominant underthrusting and basal accretion. To reconcile our observations with the experimental data, we suggest that pervasive ductile deformation within the upper LHS and along the Main Central thrust zone at its top stopped at

  3. Gomphid DNA sequence data

    Data.gov (United States)

    U.S. Environmental Protection Agency — DNA sequence data for several genetic loci. This dataset is not publicly accessible because: It's already publicly available on GenBank. It can be accessed through...

  4. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  5. A comparative evaluation of sequence classification programs

    Directory of Open Access Journals (Sweden)

    Bazinet Adam L

    2012-05-01

    Full Text Available Abstract Background A fundamental problem in modern genomics is to taxonomically or functionally classify DNA sequence fragments derived from environmental sampling (i.e., metagenomics. Several different methods have been proposed for doing this effectively and efficiently, and many have been implemented in software. In addition to varying their basic algorithmic approach to classification, some methods screen sequence reads for ’barcoding genes’ like 16S rRNA, or various types of protein-coding genes. Due to the sheer number and complexity of methods, it can be difficult for a researcher to choose one that is well-suited for a particular analysis. Results We divided the very large number of programs that have been released in recent years for solving the sequence classification problem into three main categories based on the general algorithm they use to compare a query sequence against a database of sequences. We also evaluated the performance of the leading programs in each category on data sets whose taxonomic and functional composition is known. Conclusions We found significant variability in classification accuracy, precision, and resource consumption of sequence classification programs when used to analyze various metagenomics data sets. However, we observe some general trends and patterns that will be useful to researchers who use sequence classification programs.

  6. Dynamic Sequence Assignment.

    Science.gov (United States)

    1983-12-01

    D-136 548 DYNAMIIC SEQUENCE ASSIGNMENT(U) ADVANCED INFORMATION AND 1/2 DECISION SYSTEMS MOUNTAIN YIELW CA C A 0 REILLY ET AL. UNCLSSIIED DEC 83 AI/DS...I ADVANCED INFORMATION & DECISION SYSTEMS Mountain View. CA 94040 84 u ,53 V,..’. Unclassified _____ SCURITY CLASSIFICATION OF THIS PAGE REPORT...reviews some important heuristic algorithms developed for fas- ter solution of the sequence assignment problem. 3.1. DINAMIC MOGRAMUNIG FORMULATION FOR

  7. HIV Sequence Compendium 2010

    Energy Technology Data Exchange (ETDEWEB)

    Kuiken, Carla [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Foley, Brian [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Leitner, Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Apetrei, Christian [Univ. of Pittsburgh, PA (United States); Hahn, Beatrice [Univ. of Alabama, Tuscaloosa, AL (United States); Mizrachi, Ilene [National Center for Biotechnology Information, Bethesda, MD (United States); Mullins, James [Univ. of Washington, Seattle, WA (United States); Rambaut, Andrew [Univ. of Edinburgh, Scotland (United Kingdom); Wolinsky, Steven [Northwestern Univ., Evanston, IL (United States); Korber, Bette [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2010-12-31

    This compendium is an annual printed summary of the data contained in the HIV sequence database. In these compendia we try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2010. Hence, though it is called the 2010 Compendium, its contents correspond to the 2009 curated alignments on our website. The number of sequences in the HIV database is still increasing exponentially. In total, at the time of printing, there were 339,306 sequences in the HIV Sequence Database, an increase of 45% since last year. The number of near complete genomes (>7000 nucleotides) increased to 2576 by end of 2009, reflecting a smaller increase than in previous years. However, as in previous years, the compendium alignments contain only a small fraction of these. Included in the alignments are a small number of sequences representing each of the subtypes and the more prevalent circulating recombinant forms (CRFs) such as 01 and 02, as well as a few outgroup sequences (group O and N and SIV-CPZ). Of the rarer CRFs we included one representative each. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/content/sequence/NEWALIGN/align.html. Reprints are available from our website in the form of both HTML and PDF files. As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.

  8. General LTE Sequence

    OpenAIRE

    Billal, Masum

    2015-01-01

    In this paper,we have characterized sequences which maintain the same property described in Lifting the Exponent Lemma. Lifting the Exponent Lemma is a very powerful tool in olympiad number theory and recently it has become very popular. We generalize it to all sequences that maintain a property like it i.e. if p^{\\alpha}||a_k and p^\\b{eta}||n, then p^{{\\alpha}+\\b{eta}}||a_{nk}.

  9. Pairwise Sequence Alignment Library

    Energy Technology Data Exchange (ETDEWEB)

    2015-05-20

    Vector extensions, such as SSE, have been part of the x86 CPU since the 1990s, with applications in graphics, signal processing, and scientific applications. Although many algorithms and applications can naturally benefit from automatic vectorization techniques, there are still many that are difficult to vectorize due to their dependence on irregular data structures, dense branch operations, or data dependencies. Sequence alignment, one of the most widely used operations in bioinformatics workflows, has a computational footprint that features complex data dependencies. The trend of widening vector registers adversely affects the state-of-the-art sequence alignment algorithm based on striped data layouts. Therefore, a novel SIMD implementation of a parallel scan-based sequence alignment algorithm that can better exploit wider SIMD units was implemented as part of the Parallel Sequence Alignment Library (parasail). Parasail features: Reference implementations of all known vectorized sequence alignment approaches. Implementations of Smith Waterman (SW), semi-global (SG), and Needleman Wunsch (NW) sequence alignment algorithms. Implementations across all modern CPU instruction sets including AVX2 and KNC. Language interfaces for C/C++ and Python.

  10. Main: OPAQUE2ZM22Z [PLACE

    Lifescience Database Archive (English)

    Full Text Available OPAQUE2ZM22Z S000017 17-May-2001 (last modified) uchi Opaque-2 (O2) target sequence...ene: maize 22-kD zein; transacting factor: 02; O2; opaque; 22-kD zein; seed; ACGT; opaque-2; maize (Zea mays) TCCACGTAGA ...

  11. Quantifying bleaching for zero-age fluvial sediment: A Bayesian approach

    International Nuclear Information System (INIS)

    Cunningham, Alastair C.; Evans, Mary; Knight, Jasper

    2015-01-01

    Luminescence dating of sediment requires the sand grains to have been exposed to sunlight prior to their most recent burial. Under fluvial transport, the amount of sunlight exposure may not always be sufficient to reset the luminescence signal, a phenomenon known as ‘partial bleaching'. The extent of bleaching is dependent on a combination of geomorphic, sedimentological and fluvial processes. If bleaching can be quantified, and the relationship with these processes understood, it could potentially be used as a new environmental proxy for changes in the dynamics of river systems. Here, we use a recently developed statistical model to evaluate the extent of bleaching, by inferring the proportion of well-bleached grains in the small-aliquot population. We sampled low-flow and flood deposits at a single site on the River Sabie, South Africa. We show that the low-flow sediment is almost perfectly bleached (>80% of grains well bleached), while sediment at flood elevations is partially bleached (20–70 % of grains well bleached). The degree of bleaching may show a relationship with flood magnitude as defined by elevation above normal river level, and we speculate on the causes of variability in bleaching between flood samples. - Highlights: • We sampled modern river sediment from low-flow and flood elevations. • The unbleached OSL dose was measured. • Bayesian methods can estimate the proportion of well-bleached grains. • Low-flow sediments are well bleached; flood deposits are poorly bleached.

  12. Adaptive Processing for Sequence Alignment

    KAUST Repository

    Zidan, Mohammed A.; Bonny, Talal; Salama, Khaled N.

    2012-01-01

    Disclosed are various embodiments for adaptive processing for sequence alignment. In one embodiment, among others, a method includes obtaining a query sequence and a plurality of database sequences. A first portion of the plurality of database sequences is distributed to a central processing unit (CPU) and a second portion of the plurality of database sequences is distributed to a graphical processing unit (GPU) based upon a predetermined splitting ratio associated with the plurality of database sequences, where the database sequences of the first portion are shorter than the database sequences of the second portion. A first alignment score for the query sequence is determined with the CPU based upon the first portion of the plurality of database sequences and a second alignment score for the query sequence is determined with the GPU based upon the second portion of the plurality of database sequences.

  13. Adaptive Processing for Sequence Alignment

    KAUST Repository

    Zidan, Mohammed A.

    2012-01-26

    Disclosed are various embodiments for adaptive processing for sequence alignment. In one embodiment, among others, a method includes obtaining a query sequence and a plurality of database sequences. A first portion of the plurality of database sequences is distributed to a central processing unit (CPU) and a second portion of the plurality of database sequences is distributed to a graphical processing unit (GPU) based upon a predetermined splitting ratio associated with the plurality of database sequences, where the database sequences of the first portion are shorter than the database sequences of the second portion. A first alignment score for the query sequence is determined with the CPU based upon the first portion of the plurality of database sequences and a second alignment score for the query sequence is determined with the GPU based upon the second portion of the plurality of database sequences.

  14. Main approaches to the study of loss

    Directory of Open Access Journals (Sweden)

    Burina E. A.

    2016-07-01

    Full Text Available this article presents the main approaches to the concepts of grief and loss study. The article describes the contribution of E. Lindemann, Z. Freud, J. Bowlby, F.E. Vasiluk, and E. Kubler-Ross. The research also contains the main forms of grief and some stadial models within the scope of problematics.

  15. Engineering Design of KSTAR tokamak main structure

    International Nuclear Information System (INIS)

    Im, K.H.; Cho, S.; Her, N.I.

    2001-01-01

    The main components of the KSTAR (Korea Superconducting Tokamak Advanced Research) tokamak including vacuum vessel, plasma facing components, cryostat, thermal shield and magnet supporting structure are in the final stage of engineering design. Hundai Heavy Industries (HHI) has been involved in the engineering design of these components. The current configuration and the final engineering design results for the KSTAR main structure are presented. (author)

  16. Riigikogu maine ja armastus / Aune Past

    Index Scriptorium Estoniae

    Past, Aune, 1954-

    2007-01-01

    Autor arutleb Riigikogu maine üle, toetudes TÜ ajakirjanduse ja kommunikatsiooni osakonna 2007. aastal tehtud uuringu tulemustele. Riigikogu liikmete maine paraneks, kui neil endil oleks selge, mis eesmärgil Toompeale mindi ja sellest siis ka rahvale kõneldaks

  17. Electricity sequence control

    International Nuclear Information System (INIS)

    Shin, Heung Ryeol

    2010-03-01

    The contents of the book are introduction of control system, like classification and control signal, introduction of electricity power switch, such as push-button and detection switch sensor for induction type and capacitance type machinery for control, solenoid valve, expression of sequence and type of electricity circuit about using diagram, time chart, marking and term, logic circuit like Yes, No, and, or and equivalence logic, basic electricity circuit, electricity sequence control, added condition, special program control about choice and jump of program, motor control, extra circuit on repeat circuit, pause circuit in a conveyer, safety regulations and rule about classification of electricity disaster and protective device for insulation.

  18. Next-generation sequencing

    DEFF Research Database (Denmark)

    Rieneck, Klaus; Bak, Mads; Jønson, Lars

    2013-01-01

    , Illumina); several millions of PCR sequences were analyzed. RESULTS: The results demonstrated the feasibility of diagnosing the fetal KEL1 or KEL2 blood group from cell-free DNA purified from maternal plasma. CONCLUSION: This method requires only one primer pair, and the large amount of sequence...... information obtained allows well for statistical analysis of the data. This general approach can be integrated into current laboratory practice and has numerous applications. Besides DNA-based predictions of blood group phenotypes, platelet phenotypes, or sickle cell anemia, and the determination of zygosity...

  19. On the Convexity of Step out - Step in Sequencing Games

    NARCIS (Netherlands)

    Musegaas, Marieke; Borm, Peter; Quant, Marieke

    2016-01-01

    The main result of this paper is the convexity of Step out - Step in (SoSi) sequencing games, a class of relaxed sequencing games first analyzed by Musegaas, Borm, and Quant (2015). The proof makes use of a polynomial time algorithm determining the value and an optimal processing order for an

  20. Output-Sensitive Pattern Extraction in Sequences

    DEFF Research Database (Denmark)

    Grossi, Roberto; Menconi, Giulia; Pisanti, Nadia

    2014-01-01

    Genomic Analysis, Plagiarism Detection, Data Mining, Intrusion Detection, Spam Fighting and Time Series Analysis are just some examples of applications where extraction of recurring patterns in sequences of objects is one of the main computational challenges. Several notions of patterns exist...... or extend them causes a loss of significant information (where the number of occurrences changes). Output-sensitive algorithms have been proposed to enumerate and list these patterns, taking polynomial time O(nc) per pattern for constant c > 1, which is impractical for massive sequences of very large length...

  1. Ancestral sequence reconstruction with Maximum Parsimony

    OpenAIRE

    Herbst, Lina; Fischer, Mareike

    2017-01-01

    One of the main aims in phylogenetics is the estimation of ancestral sequences based on present-day data like, for instance, DNA alignments. One way to estimate the data of the last common ancestor of a given set of species is to first reconstruct a phylogenetic tree with some tree inference method and then to use some method of ancestral state inference based on that tree. One of the best-known methods both for tree inference as well as for ancestral sequence inference is Maximum Parsimony (...

  2. Main: 1QN6 [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available itiation Factor Tfiid-1; Chain: A, B; Synonym: Tata-Box Factor 1, Tata Sequence-Binding Protein 1, Tbp1; Eng...ineered: Yes; Molecule: Dna (5'-D(*Gp*Cp*Tp*Ap*Tp*Ap*Ap*Tp*Ap*Gp*Gp*Gp*Cp*A)-3'); Chai...n: C, E; Molecule: Dna (5'-D(*Tp*Gp*Cp*Cp*Cp*Tp*Ap*Tp*Tp*Ap*Tp*Ap*Gp*C)-3'); Chain: D, F Tata Box-Bindi

  3. Main: 1QNB [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available itiation Factor Tfiid-1; Chain: A, B; Synonym: Tata-Box Factor 1, Tata Sequence-Binding Protein 1, Tbp1; Eng...ineered: Yes; Molecule: Dna (5'-D(*Gp*Cp*Tp*Ap*Tp*Ap*Ap*Ap*Tp*Gp*Gp*Gp*Cp*A)-3'); Chai...n: C, E; Molecule: Dna (5'-D(*Tp*Gp*Cp*Cp*Cp*Ap*Tp*Tp*Tp*Ap*Tp*Ap*Gp*C)-3'); Chain: D, F Tata Box-Bindi

  4. Main: 1QN5 [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available itiation Factor Tfiid-1; Chain: A, B; Synonym: Tata-Box Factor 1, Tata Sequence-Binding Protein 1, Tbp1; Eng...ineered: Yes; Molecule: Dna (5'-D(*Gp*Cp*Tp*Ap*Tp*Ap*Ap*Gp*Ap*Gp*Gp*Gp*Cp*A)-3'); Chai...n: C, E; Molecule: Dna (5'-D(*Tp*Gp*Cp*Cp*Cp*Tp*Cp*Tp*Tp*Ap*Tp*Ap*Gp*C)-3'); Chain: D, F Tata Box-Bindi

  5. Main: 1QNA [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available itiation Factor Tfiid-1; Chain: A, B; Synonym: Tata-Box Factor 1, Tata Sequence-Binding Protein 1, Tbp1; Eng...ineered: Yes; Molecule: Dna (5'-D(*Gp*Cp*Tp*Tp*Tp*Ap*Ap*Ap*Ap*Gp*Gp*Gp*Cp*A)-3'); Chai...n: C, E; Molecule: Dna (5'-D(*Tp*Gp*Cp*Cp*Cp*Tp*Tp*Tp*Tp*Ap*Ap*Ap*Gp*C)-3'); Chain: D, F Tata Box-Bindi

  6. The 2016 Kumamoto earthquake sequence.

    Science.gov (United States)

    Kato, Aitaro; Nakamura, Kouji; Hiyama, Yohei

    2016-01-01

    Beginning in April 2016, a series of shallow, moderate to large earthquakes with associated strong aftershocks struck the Kumamoto area of Kyushu, SW Japan. An M j 7.3 mainshock occurred on 16 April 2016, close to the epicenter of an M j 6.5 foreshock that occurred about 28 hours earlier. The intense seismicity released the accumulated elastic energy by right-lateral strike slip, mainly along two known, active faults. The mainshock rupture propagated along multiple fault segments with different geometries. The faulting style is reasonably consistent with regional deformation observed on geologic timescales and with the stress field estimated from seismic observations. One striking feature of this sequence is intense seismic activity, including a dynamically triggered earthquake in the Oita region. Following the mainshock rupture, postseismic deformation has been observed, as well as expansion of the seismicity front toward the southwest and northwest.

  7. The 2016 Kumamoto earthquake sequence

    Science.gov (United States)

    KATO, Aitaro; NAKAMURA, Kouji; HIYAMA, Yohei

    2016-01-01

    Beginning in April 2016, a series of shallow, moderate to large earthquakes with associated strong aftershocks struck the Kumamoto area of Kyushu, SW Japan. An Mj 7.3 mainshock occurred on 16 April 2016, close to the epicenter of an Mj 6.5 foreshock that occurred about 28 hours earlier. The intense seismicity released the accumulated elastic energy by right-lateral strike slip, mainly along two known, active faults. The mainshock rupture propagated along multiple fault segments with different geometries. The faulting style is reasonably consistent with regional deformation observed on geologic timescales and with the stress field estimated from seismic observations. One striking feature of this sequence is intense seismic activity, including a dynamically triggered earthquake in the Oita region. Following the mainshock rupture, postseismic deformation has been observed, as well as expansion of the seismicity front toward the southwest and northwest. PMID:27725474

  8. A neurocomputational model of automatic sequence production.

    Science.gov (United States)

    Helie, Sebastien; Roeder, Jessica L; Vucovich, Lauren; Rünger, Dennis; Ashby, F Gregory

    2015-07-01

    Most behaviors unfold in time and include a sequence of submovements or cognitive activities. In addition, most behaviors are automatic and repeated daily throughout life. Yet, relatively little is known about the neurobiology of automatic sequence production. Past research suggests a gradual transfer from the associative striatum to the sensorimotor striatum, but a number of more recent studies challenge this role of the BG in automatic sequence production. In this article, we propose a new neurocomputational model of automatic sequence production in which the main role of the BG is to train cortical-cortical connections within the premotor areas that are responsible for automatic sequence production. The new model is used to simulate four different data sets from human and nonhuman animals, including (1) behavioral data (e.g., RTs), (2) electrophysiology data (e.g., single-neuron recordings), (3) macrostructure data (e.g., TMS), and (4) neurological circuit data (e.g., inactivation studies). We conclude with a comparison of the new model with existing models of automatic sequence production and discuss a possible new role for the BG in automaticity and its implication for Parkinson's disease.

  9. Hillshades for the main 8 Hawaiian Islands

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — These hillshade datasets were derived from USGS 7.5' DEM Quads for the main 8 Hawaiian Islands. Individual DEM quads were first converted to a common datum, and...

  10. Nuclear power station main control room habitability

    International Nuclear Information System (INIS)

    Paschal, W.B.; Knous, W.S.

    1989-01-01

    The main control room at a nuclear power station must remain habitable during a variety of plant conditions and postulated events. The control room habitability requirement and the function of the heating, ventilating, air-conditioning, and air treatment system are to control environmental factors, such as temperature, pressure, humidity, radiation, and toxic gas. Habitability requirements provide for the safety of personnel and enable operation of equipment required to function in the main control room. Habitability as an issue has been gaining prominence with the Advisor Committee of Reactor Safeguards and the Nuclear Regulatory Commission since the incident at Three Mile Island. Their concern is the ability of the presently installed habitability systems to control the main control room environment after an accident. This paper discusses main control room HVAC systems; the concern, requirements, and results of NRC surveys and notices; and an approach to control room habitability reviews

  11. Seasonal Composite Chlorophyll Concentrations - Gulf of Maine

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This personal geodatabase contains raster images of chlorophyll concentrations in the Gulf of Maine. These raster images are seasonal composites, and were calculated...

  12. Collins' bypass for the main ring

    International Nuclear Information System (INIS)

    Ohnuma, S.

    1982-01-01

    Design of the bypass for the main ring at Fermilab is discussed. Specific design features discussed include space, path length, geometric closure, matching of betatron functions, and external dispersion. Bypass parameters are given

  13. Monthly Composite Chlorophyll Concentrations - Gulf of Maine

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This personal geodatabase contains raster images of chlorophyll concentrations in the Gulf of Maine. These raster images are monthly composites, and were calculated...

  14. 2015 City of Portland, Maine, Lidar

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — 2015 City of Portland Maine Lidar Data Acquisition and Processing Woolpert Order No. 75564 Contractor: Woolpert, Inc. This task is for a high resolution data set of...

  15. 2016 USGS Lidar DEM: Maine QL2

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Product: These are Digital Elevation Model (DEM) data for Franklin, Oxford, Piscataquis, and Somerset Counties, Maine as part of the required deliverables for the...

  16. Complete Genome Sequences of Isolates of Enterococcus faecium Sequence Type 117, a Globally Disseminated Multidrug-Resistant Clone

    Science.gov (United States)

    Tedim, Ana P.; Lanza, Val F.; Manrique, Marina; Pareja, Eduardo; Ruiz-Garbajosa, Patricia; Cantón, Rafael; Baquero, Fernando; Tobes, Raquel

    2017-01-01

    ABSTRACT The emergence of nosocomial infections by multidrug-resistant sequence type 117 (ST117) Enterococcus faecium has been reported in several European countries. ST117 has been detected in Spanish hospitals as one of the main causes of bloodstream infections. We analyzed genome variations of ST117 strains isolated in Madrid and describe the first ST117 closed genome sequences. PMID:28360174

  17. Biological sequence analysis

    DEFF Research Database (Denmark)

    Durbin, Richard; Eddy, Sean; Krogh, Anders Stærmose

    This book provides an up-to-date and tutorial-level overview of sequence analysis methods, with particular emphasis on probabilistic modelling. Discussed methods include pairwise alignment, hidden Markov models, multiple alignment, profile searches, RNA secondary structure analysis, and phylogene...

  18. THE RHIC SEQUENCER

    International Nuclear Information System (INIS)

    VAN ZEIJTS, J.; DOTTAVIO, T.; FRAK, B.; MICHNOFF, R.

    2001-01-01

    The Relativistic Heavy Ion Collider (RHIC) has a high level asynchronous time-line driven by a controlling program called the ''Sequencer''. Most high-level magnet and beam related issues are orchestrated by this system. The system also plays an important task in coordinated data acquisition and saving. We present the program, operator interface, operational impact and experience

  19. Twin anemia polycythemia sequence

    NARCIS (Netherlands)

    Slaghekke, Femke

    2014-01-01

    In this thesis we describe that Twin Anemia Polycythemia Sequence (TAPS) is a form of chronic feto-fetal transfusion in monochorionic (identical) twins based on a small amount of blood transfusion through very small anastomoses. For the antenatal diagnosis of TAPS, Middle Cerebral Artery – Peak

  20. simple sequence repeat (SSR)

    African Journals Online (AJOL)

    In the present study, 78 mapped simple sequence repeat (SSR) markers representing 11 linkage groups of adzuki bean were evaluated for transferability to mungbean and related Vigna spp. 41 markers amplified characteristic bands in at least one Vigna species. The transferability percentage across the genotypes ranged ...

  1. Molecular clusters of the main group elements

    CERN Document Server

    Driess, Matthias

    2008-01-01

    ""To summarize, Molecular Clusters of the Main Group Elements is certainly not a popular science book, nor is it a textbook; it is a very good, up-to-date collection of articles for the specialist. Als Fazit bleibt: Molecular Clusters of the Main Group Elements ist sicher kein populissenschaftliches Werk, auch kein Lehrbuch, aber eine gelungene, hoch aktuelle Zusammenstellung fen interessierten Fachmann."" -Michael Ruck, TU Dresden, Angewandte Chemie, 2004 - 116/36 + International Edition 2004 - 43/36

  2. Revisiting Reuse in Main Memory Database Systems

    OpenAIRE

    Dursun, Kayhan; Binnig, Carsten; Cetintemel, Ugur; Kraska, Tim

    2016-01-01

    Reusing intermediates in databases to speed-up analytical query processing has been studied in the past. Existing solutions typically require intermediate results of individual operators to be materialized into temporary tables to be considered for reuse in subsequent queries. However, these approaches are fundamentally ill-suited for use in modern main memory databases. The reason is that modern main memory DBMSs are typically limited by the bandwidth of the memory bus, thus query execution ...

  3. Targeted sequencing of plant genomes

    Science.gov (United States)

    Mark D. Huynh

    2014-01-01

    Next-generation sequencing (NGS) has revolutionized the field of genetics by providing a means for fast and relatively affordable sequencing. With the advancement of NGS, wholegenome sequencing (WGS) has become more commonplace. However, sequencing an entire genome is still not cost effective or even beneficial in all cases. In studies that do not require a whole-...

  4. Almost convergence of triple sequences

    OpenAIRE

    Ayhan Esi; M.Necdet Catalbas

    2013-01-01

    In this paper we introduce and study the concepts of almost convergence and almost Cauchy for triple sequences. Weshow that the set of almost convergent triple sequences of 0's and 1's is of the first category and also almost everytriple sequence of 0's and 1's is not almost convergent.Keywords: almost convergence, P-convergent, triple sequence.

  5. A few Smarandache Integer Sequences

    OpenAIRE

    Ibstedt, Henry

    2010-01-01

    This paper deals with the analysis of a few Smarandache Integer Sequences which first appeared in Properties or the Numbers, F. Smarandache, University or Craiova Archives, 1975. The first four sequences are recurrence generated sequences while the last three are concatenation sequences.

  6. Allele Re-sequencing Technologies

    DEFF Research Database (Denmark)

    Byrne, Stephen; Farrell, Jacqueline Danielle; Asp, Torben

    2013-01-01

    The development of next-generation sequencing technologies has made sequencing an affordable approach for detection of genetic variations associated with various traits. However, the cost of whole genome re-sequencing still remains too high to be feasible for many plant species with large...... alternative to whole genome re-sequencing to identify causative genetic variations in plants. One challenge, however, will be efficient bioinformatics strategies for data handling and analysis from the increasing amount of sequence information....

  7. In-service inspection robot for PFBR main vessel- concept

    Energy Technology Data Exchange (ETDEWEB)

    Rajendran, S; Ramakumar, M S [Bhabha Atomic Research Centre, Mumbai (India). Div. of Remote Handling and Robotics

    1994-12-31

    In-service inspection (ISI) of critical components in a nuclear reactor is one of the foremost and important tasks which reveals the state of health of the system, thereby ensuring the safety of the plant, personnel and environment. Prototype Fast Breeder Reactor (PFBR) is designed as a pool type reactor. A safety vessel is provided in the design which envelopes the main reactor vessel. The ISI of the main vessel is mandatory and will be carried out by a robot which will operate on this annular gap. The design of the robot is such that it can crawl around the vessel and into the gap at the bottom of the vessel relying on friction grip. The mobile robot will carry a CCTV camera and the inspection technique packages into the interspace, position and orient these to carry out the ISI of the main vessel. The paper discusses about the design features of the robot including the gripping mechanism and the crawling sequence to perform ISI of the reactor vessel. 3 figs.

  8. In-service inspection robot for PFBR main vessel- concept

    International Nuclear Information System (INIS)

    Rajendran, S.; Ramakumar, M.S.

    1994-01-01

    In-service inspection (ISI) of critical components in a nuclear reactor is one of the foremost and important tasks which reveals the state of health of the system, thereby ensuring the safety of the plant, personnel and environment. Prototype Fast Breeder Reactor (PFBR) is designed as a pool type reactor. A safety vessel is provided in the design which envelopes the main reactor vessel. The ISI of the main vessel is mandatory and will be carried out by a robot which will operate on this annular gap. The design of the robot is such that it can crawl around the vessel and into the gap at the bottom of the vessel relying on friction grip. The mobile robot will carry a CCTV camera and the inspection technique packages into the interspace, position and orient these to carry out the ISI of the main vessel. The paper discusses about the design features of the robot including the gripping mechanism and the crawling sequence to perform ISI of the reactor vessel. 3 figs

  9. Main building fire drill safely concluded

    CERN Document Server

    CERN Bulletin

    2015-01-01

    Last week, a simulated fire in the stairwell of the Main Building put CERN’s emergency response procedures to the test.   Firefighters descend the stairwell in the Main Building as the simulated fire rises.   At 2 p.m. on 22 September, alarms sounded around CERN’s Main Building as an evacuation exercise got underway. A simulated fire in the  stairwell, complete with very realistic smoke, led to the evacuation of one of the busiest places at CERN. The Main Building complex includes the Carlson Wagonlit travel agency, the post office, UBS, Uniqa, the Users Office, the Staff Association and the Novae restaurant as well as the Main Auditorium, the Council Chamber and the Charpak meeting room. It was impressive to see how quickly the smoke propagated in the staircase as well as into the corridors, and equally impressive to see how smoothly, quickly and efficiently the evacuation proceeded. The...

  10. Guide to the Main Ring DO overpass

    International Nuclear Information System (INIS)

    Turkot, F.

    1985-01-01

    The DO overpass is a modification of the beam orbit in Main Ring in order to better accommodate a Tevatron collider detector at DO. The orbit is moved up approx. 51 inches over most of the long straight section at DO, thus making the Main Ring the world's first non-planar proton synchrotron. A similar overpass, but with four times the displacement, is planned for the CDF detector at the BO straight section. The nominal separation between the beam orbit in the Main Ring and the orbit in the Tevatron is 25.5 inches. Early in the design study of a detector that would utilize the Tevatron is a anti pp collider, it was apparent that a larger separation at the detector was highly desirable. In 1981, Tom Collins proposed a specific lattice geometry in the Main Ring for achieving larger separation, called ''the screw beam''. His proposal has served as the basis for the design of both the BO and DO overpasses. The main purpose of this report is to describe in some detail the implementation of the DO overpass. Topics to be covered include: (a) geometry of the overpass orbit, (b) the new hardware in the tunnel, (c) the power supply system, (d) the control facility, (e) accelerator beam dynamics ramifications, and (f) commissioning experience. A secondary purpose is to provide a fairly complete ''bibliography'' to the sources of information on the overpass. 17 refs., 17 figs

  11. Main Coast Winds - Final Scientific Report

    Energy Technology Data Exchange (ETDEWEB)

    Jason Huckaby; Harley Lee

    2006-03-15

    The Maine Coast Wind Project was developed to investigate the cost-effectiveness of small, distributed wind systems on coastal sites in Maine. The restructuring of Maine's electric grid to support net metering allowed for the installation of small wind installations across the state (up to 100kW). The study performed adds insight to the difficulties of developing cost-effective distributed systems in coastal environments. The technical hurdles encountered with the chosen wind turbine, combined with the lower than expected wind speeds, did not provide a cost-effective return to make a distributed wind program economically feasible. While the turbine was accepted within the community, the low availability has been a negative.

  12. Space Shuttle main engine product improvement

    Science.gov (United States)

    Lucci, A. D.; Klatt, F. P.

    1985-01-01

    The current design of the Space Shuttle Main Engine has passed 11 certification cycles, amassed approximately a quarter million seconds of engine test time in 1200 tests and successfully launched the Space Shuttle 17 times of 51 engine launches through May 1985. Building on this extensive background, two development programs are underway at Rocketdyne to improve the flow of hot gas through the powerhead and evaluate the changes to increase the performance margins in the engine. These two programs, called Phase II+ and Technology Test Bed Precursor program are described. Phase II+ develops a two-tube hot-gas manifold that improves the component environment. The Precursor program will evaluate a larger throat main combustion chamber, conduct combustion stability testing of a baffleless main injector, fabricate an experimental weld-free heat exchanger tube, fabricate and test a high pressure oxidizer turbopump with an improved inlet, and develop and test methods for reducing temperature transients at start and shutdown.

  13. Transition crossing in the main injector

    International Nuclear Information System (INIS)

    Wei, J.

    1990-01-01

    This report summarizes the study of various longitudinal problems pertaining to the transition-energy crossing in the proposed Fermi Lab Main Injector. The theory indicates that the beam loss and bunch-area growth are mainly caused by the chromatic non-linear effect, which is enhanced by the space-charge force near transition. Computer simulation using the program TIBETAN shows that a ''γ T jump'' of about 1.5 unit within 1 ms is adequate to achieve a ''clean'' crossing in the currently proposed h=588 scenario. 19 refs., 4 figs

  14. The Fermilab Main Injector Technical Design Handbook

    Energy Technology Data Exchange (ETDEWEB)

    None, None

    1994-08-01

    This report contains a description of the design, cost estimate, and construction schedule of the Fermilab Main Injector (FMI) Project. The technical, cost, and schedule baselines for the FMI Project have already been established and may be found in the Fermilab Main Injector Title I Design Report, issued in August 1992. This report updates and expands upon the design and schedule for construction of all subsystem components and associated civil construction described in the Title I Design Report. The facilities described have been designed in conformance with DOE 6430.1A, "United States Department of Energy General Design Criteria."

  15. Current Russian patriotism: matter, features, main directions

    Directory of Open Access Journals (Sweden)

    Lutovinov Vladimir Ilich

    2013-11-01

    Full Text Available The article considers understanding and the main point of patriotism as one of high cultural values. The main approaches that reveal different sides of this phenomenon, its role and importance in a history of Russia in the 21st century are inferred from the analysis of viewpoints of Russian thinkers and contemporary researchers. The patriotism formation problems in Russian society and their condition are defined, the need of patriotic level rise as one of the conditions for great Russia rebirth is substantiated.

  16. Bunch coalescing in the Fermilab Main Ring

    International Nuclear Information System (INIS)

    Wildman, D.; Martin, P.; Meisner, K.; Miller, H.W.

    1987-01-01

    A new RF system has been installed in the Fermilab Main Ring to coalesce up to 13 individual bunches of protons or antiprotons into a single high-intensity bunch. The coalescing process consists of adiabatically reducing the h=1113 Main Ring RF voltage from 1 MV to less than 1 kV, capturing the debunched beam in a linearized h=53 and h=106 bucket, rotating for a quarter of a synchrotron oscillation period, and then recapturing the beam in a single h=1113 bucket. The new system is described and the results of recent coalescing experiments are compared with computer-generated particle tracking simulations

  17. Multilocus Sequence Typing

    OpenAIRE

    Belén, Ana; Pavón, Ibarz; Maiden, Martin C.J.

    2009-01-01

    Multilocus sequence typing (MLST) was first proposed in 1998 as a typing approach that enables the unambiguous characterization of bacterial isolates in a standardized, reproducible, and portable manner using the human pathogen Neisseria meningitidis as the exemplar organism. Since then, the approach has been applied to a large and growing number of organisms by public health laboratories and research institutions. MLST data, shared by investigators over the world via the Internet, have been ...

  18. Achalasia Carcinoma Sequence

    OpenAIRE

    Makmun, Dadang

    2001-01-01

    We report a case of carcinoma of the esophagus in a 58 years old woman with achalasia, who has been diagnosed since 30 years ago, which initiated by surgical treatment (myotomy) and the symptoms recurred since 3 years ago. According to the progress of the disease, Malignancy was strongly suspected due to prolonged stasis and mucosal irritation caused by achalasia (achalasia carcinoma sequence). Because of these contributing factors for the development of serious complications such as Malignan...

  19. Sequencing BPS spectra

    Energy Technology Data Exchange (ETDEWEB)

    Gukov, Sergei [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Max-Planck-Institut für Mathematik,Vivatsgasse 7, D-53111 Bonn (Germany); Nawata, Satoshi [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Centre for Quantum Geometry of Moduli Spaces, University of Aarhus,Nordre Ringgade 1, DK-8000 (Denmark); Saberi, Ingmar [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Stošić, Marko [CAMGSD, Departamento de Matemática, Instituto Superior Técnico,Av. Rovisco Pais, 1049-001 Lisbon (Portugal); Mathematical Institute SANU,Knez Mihajlova 36, 11000 Belgrade (Serbia); Sułkowski, Piotr [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Faculty of Physics, University of Warsaw,ul. Pasteura 5, 02-093 Warsaw (Poland)

    2016-03-02

    This paper provides both a detailed study of color-dependence of link homologies, as realized in physics as certain spaces of BPS states, and a broad study of the behavior of BPS states in general. We consider how the spectrum of BPS states varies as continuous parameters of a theory are perturbed. This question can be posed in a wide variety of physical contexts, and we answer it by proposing that the relationship between unperturbed and perturbed BPS spectra is described by a spectral sequence. These general considerations unify previous applications of spectral sequence techniques to physics, and explain from a physical standpoint the appearance of many spectral sequences relating various link homology theories to one another. We also study structural properties of colored HOMFLY homology for links and evaluate Poincaré polynomials in numerous examples. Among these structural properties is a novel “sliding” property, which can be explained by using (refined) modular S-matrix. This leads to the identification of modular transformations in Chern-Simons theory and 3d N=2 theory via the 3d/3d correspondence. Lastly, we introduce the notion of associated varieties as classical limits of recursion relations of colored superpolynomials of links, and study their properties.

  20. Sequencing BPS spectra

    International Nuclear Information System (INIS)

    Gukov, Sergei; Nawata, Satoshi; Saberi, Ingmar; Stošić, Marko; Sułkowski, Piotr

    2016-01-01

    This paper provides both a detailed study of color-dependence of link homologies, as realized in physics as certain spaces of BPS states, and a broad study of the behavior of BPS states in general. We consider how the spectrum of BPS states varies as continuous parameters of a theory are perturbed. This question can be posed in a wide variety of physical contexts, and we answer it by proposing that the relationship between unperturbed and perturbed BPS spectra is described by a spectral sequence. These general considerations unify previous applications of spectral sequence techniques to physics, and explain from a physical standpoint the appearance of many spectral sequences relating various link homology theories to one another. We also study structural properties of colored HOMFLY homology for links and evaluate Poincaré polynomials in numerous examples. Among these structural properties is a novel “sliding” property, which can be explained by using (refined) modular S-matrix. This leads to the identification of modular transformations in Chern-Simons theory and 3d N=2 theory via the 3d/3d correspondence. Lastly, we introduce the notion of associated varieties as classical limits of recursion relations of colored superpolynomials of links, and study their properties.

  1. Image sequence analysis

    CERN Document Server

    1981-01-01

    The processing of image sequences has a broad spectrum of important applica­ tions including target tracking, robot navigation, bandwidth compression of TV conferencing video signals, studying the motion of biological cells using microcinematography, cloud tracking, and highway traffic monitoring. Image sequence processing involves a large amount of data. However, because of the progress in computer, LSI, and VLSI technologies, we have now reached a stage when many useful processing tasks can be done in a reasonable amount of time. As a result, research and development activities in image sequence analysis have recently been growing at a rapid pace. An IEEE Computer Society Workshop on Computer Analysis of Time-Varying Imagery was held in Philadelphia, April 5-6, 1979. A related special issue of the IEEE Transactions on Pattern Anal­ ysis and Machine Intelligence was published in November 1980. The IEEE Com­ puter magazine has also published a special issue on the subject in 1981. The purpose of this book ...

  2. Main principles of development stationary training facilities

    International Nuclear Information System (INIS)

    Tsiptsyura, R.D.

    1986-01-01

    The designation of stationary training facilities is shown and the main requirements for them are formulated. When considering the above-mentioned requirements, special attention was paid to obligatory correspondence between training experience and practical skill of an operator. It is shown, that the switchboard block is the major unit of the training facility, which should develop skills and habits of an operator

  3. Live insertion method used for main renewal

    International Nuclear Information System (INIS)

    Solkowitz, M.

    1992-01-01

    Baltimore Gas and Electric's pilot project using the live insertion method to replace a cast iron main provided excellent results. Its use on Eastern Avenue, a major state highway, was cost effective, provided gas service to customers during the work, required relatively short construction time and resulted in only minor traffic disruptions. Gas service transfers to the new main were done at customer convenience and resulted in outages of only a few hours per customer. This paper reports that the project involved inserting a 6-in. plastic line inside an existing 10-in. cast iron main. Miller Pipeline Corp., Indianapolis, supplier of the Insertec left-angle R right-angle live insertion method was contracted for the job. Miller technicians assisted BG and E forces by providing a load analysis of the main, a pushing machine and related supplies, foaming equipment and pipe cutting tools. Company forces were responsible for all preparatory work, including opening all excavations, installing bypasses, and fusing and testing the plastic pipe. Service transfers and renewals were also completed by company employees

  4. Maine Project against Bullying. Final Report.

    Science.gov (United States)

    Saufler, Chuck; Gagne, Cyndi

    Noting that bullying among primary school-age children has become recognized as an antecedent to more violent behavior in later grades, the 3-year Maine Project Against Bullying examined currently available research on bullying and evaluated books, curricula, media materials, and programs to identify resources and strategies which can be applied…

  5. Modern Portfolio Theory: Some Main Results

    OpenAIRE

    Müller, Heinz H.

    2017-01-01

    This article summarizes some main results in modern portfolio theory. First, the Markowitz approach is presented. Then the capital asset pricing model is derived and its empirical testability is discussed. Afterwards Neumann-Morgenstern utility theory is applied to the portfolio problem. Finally, it is shown how optimal risk allocation in an economy may lead to portfolio insurance

  6. Enhancing training in the main control room

    International Nuclear Information System (INIS)

    McGuigan, K.; O'Leary, K.; Canavan, K.

    2004-01-01

    In 2003 Pickering B Nuclear of Ontario Power Generation installed a Desktop Simulator (DTS) in the Main Control Room (MCR) for training purposes. This paper will outline why this training enhancement was undertaken and the approach taken to secure its use in an active MCR environment while minimizing distractions to plant operations. (author)

  7. Main successes, achievements. Paths of development

    Directory of Open Access Journals (Sweden)

    A. A. Kubanova

    2015-01-01

    Full Text Available The article provides the overview of incidence of sexually transmitted infections and skin disorders over time in Russian Federation in 2004-2014 with its main positive tendencies; results of reorganisation of bed capacity of dermatovenerologic medical organizations; dermatovenerologic bed rates.

  8. Main facts 1995; Faits marquants 1995

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-11-01

    This report presents the main facts of the studies carried out by the Direction des Etudes et Recherches (DER) of Electricite de France: new applications of electricity, classical and nuclear thermal power plants, electrical equipment, environment protection, monitoring and plants operations.

  9. Space transportation main engine reliability and safety

    Science.gov (United States)

    Monk, Jan C.

    1991-01-01

    Viewgraphs are used to illustrate the reliability engineering and aerospace safety of the Space Transportation Main Engine (STME). A technology developed is called Total Quality Management (TQM). The goal is to develop a robust design. Reducing process variability produces a product with improved reliability and safety. Some engine system design characteristics are identified which improves reliability.

  10. Water Hammer in Pumped Sewer Mains

    DEFF Research Database (Denmark)

    Larsen, Torben

    This publication is intended for engineers seeking an introduction to the problem of water hammer in pumped pressure mains. This is a subject of increasing interest because of the development of larger and more integrated sewer systems. Consideration of water hammer is essential for structural...

  11. D.E.R. 91 main facts

    International Nuclear Information System (INIS)

    Schmidt, N.

    1991-01-01

    This report presents the main facts of the studies carried out by the Direction des Etudes et Recherches (DER) of Electricite de France: New applications of electricity, classical and nuclear thermal power plants, electrical equipment, environment protection, network analysis, information and informatic equipment

  12. VINKA, ten years on. Main scientific results

    International Nuclear Information System (INIS)

    1979-01-01

    The VINKA facility in the TRITON swimming-pool reactor at Fontenay-aux-Roses allows the irradiation of solids at low temperatures in order to study crystalline defects. After ten years of operation the main scientific results obtained in the fields of creep and growth (chapter I), point defects (chapter II), amorphisation (chapter III) and dechanneling of particles (chapter IV) are summarised [fr

  13. Results on Fermilab main injector dipole measurements

    International Nuclear Information System (INIS)

    Brown, B.C.; Baiod, R.; DiMarco, J.; Glass, H.D.; Harding, D.J.; Martin, P.S.; Mishra, S.; Mokhtarani, A.; Orris, D.F.; russell, O.A.; Tompkins, J.C.; Walbridge, D.G.C.

    1995-06-01

    Measurements of the Productions run of Fermilab Main Injector Dipole magnets is underway. Redundant strength measurements provide a set of data which one can fit to mechanical and magnetic properties of the assembly. Plots of the field contribution from the steel supplement the usual plots of transfer function (B/I) vs. I in providing insight into the measured results

  14. D.E.R. 92 - Main facts

    International Nuclear Information System (INIS)

    1992-01-01

    This report presents the main facts of the studies carried out by the Direction des Etudes et Recherches (DER) of Electricite de France: new applications of electricity, classical and nuclear thermal power plants, electrical equipment, environment protection, network analysis, information and informatic equipment

  15. Foundations of Sequence-to-Sequence Modeling for Time Series

    OpenAIRE

    Kuznetsov, Vitaly; Mariet, Zelda

    2018-01-01

    The availability of large amounts of time series data, paired with the performance of deep-learning algorithms on a broad class of problems, has recently led to significant interest in the use of sequence-to-sequence models for time series forecasting. We provide the first theoretical analysis of this time series forecasting framework. We include a comparison of sequence-to-sequence modeling to classical time series models, and as such our theory can serve as a quantitative guide for practiti...

  16. The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.

    Science.gov (United States)

    Khoe, Clairine V; Chung, Long H; Murray, Vincent

    2018-06-01

    The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

  17. Novel expressed sequence tag- simple sequence repeats (EST ...

    African Journals Online (AJOL)

    Using different bioinformatic criteria, the SUCEST database was used to mine for simple sequence repeat (SSR) markers. Among 42,189 clusters, 1,425 expressed sequence tag- simple sequence repeats (EST-SSRs) were identified in silico. Trinucleotide repeats were the most abundant SSRs detected. Of 212 primer pairs ...

  18. Condition monitoring of main coolant pumps, Dhruva

    International Nuclear Information System (INIS)

    Prasad, V.; Satheesh, C.; Acharya, V.N.; Tikku, A.C.; Mishra, S.K.

    2002-01-01

    Full text: Dhruva is a 100 MW research reactor with natural uranium fuel, heavy water as moderator and primary coolant. Three Centrifugal pumps circulate the primary coolant across the core and the heat exchangers. Each pump is coupled to a flywheel (FW) assembly in order to meet operational safety requirements. All the 3 main coolant pump (MCP) sets are required to operate during operation of the reactor. The pump-sets are in operation since the year 1984 and have logged more than 1,00,000 hrs. Frequent breakdowns of its FW bearings were experienced during initial years of operation. Condition monitoring of these pumps, largely on vibration based parameters, was initiated on regular basis. Break-downs of main coolant pumps reduced considerably due to the fair accurate predictions of incipient break-downs and timely maintenance efforts. An effort is made in this paper to share the experience

  19. Alarm system for ABWR main control panels

    Energy Technology Data Exchange (ETDEWEB)

    Kobayashi, Yuji; Saito, Koji [Toshiba Corp., Yokohoma (Japan)

    1997-09-01

    TOSHIBA has developed integrated digital control and instrumentation system for ABWR, which is the third-generation man machine interface system for main control room that we call A-PODIA (Advanced PODIA). A-Podia has been introduced the first actual ABWR plant in Japan. in A-PODIA, TOSHIBA has realized improvement of alarm system that all operator crews in the control room can recognize plant anomalies easily. The alarm system can recognize essential alarms for plant safety easily and understand annunciators with each integrated annunciators and their prioritized color easily by classifying alarms into plant-level essential annunciators, system-level integrated annunciators and equipment level individual annunciators with hierarchical structure. This paper describes conventional alarm system and the design philosophy, alarm system design and operation of ``Alarm System for ABWR Main Control Panels``. (author). 5 refs, 8 figs, 1 tab.

  20. Organization structure. Main activities of the Division

    International Nuclear Information System (INIS)

    2008-01-01

    In this chapter the organization structure as well as main activities of the Division for radiation safety, NPP decommissioning and radioactive waste management are presented. This Division of the VUJE, a.s. consists of the following sections and departments: Section for economic and technical services; Section for radiation protection of employees; Department for management of emergency situations and risk assessment; Department for implementation of nuclear power facilities decommissioning and RAW management; Department for personnel and environmental dosimetry; Department for preparation of NPP decommissioning; Department for RAW treatment technologies; Department for chemical regimes and physico-chemical analyses; Department for management of nuclear power facilities decommissioning and RAW management. Main activities of this Division are presented.

  1. Challenges of the ILC Main Linac

    International Nuclear Information System (INIS)

    Ross, Marc

    2007-01-01

    With the completion of the ILC Reference Design Report (RDR), we begin the next phase of the project - development of the Engineering Design. Our strategy and priorities come from the identification, contained in the RDR, of scientific and engineering challenges of the ILC. First among these is the cost of the main linac which, including the associated earthworks and cooling/power systems, amounts to 60% of the ILC total cost. Next is the challenge to reach the highest practical gradient since this R and D has the largest cost leverage of any of the ongoing programs. Finally, we have to understand the beam dynamics and beam tuning processes in the main linac, as we will not have the opportunity to do full (or even large) scale tests of these before the linac is constructed.

  2. Chromaticity compensation scheme for the Main Injector

    International Nuclear Information System (INIS)

    Bogacz, S.A.

    1993-05-01

    The current Main Injector lattice is studied in the context of full chromaticity compensation in the presence of the eddy current, saturation and the end-pack sextupole fields generated by the dipole magnets. Two families of correcting sextupole magnets are placed to compensate these fields and to adjust the chromaticity (in both planes) to some desired value. Variation of the dipole induced sextupole fields with the B-field (changing along a ramp) are modeled according to recent experimental measurements of the Main Injector dipole magnet Analysis of the required sextupole strengths is carried out along two realistic momentum ramps. The results of our calculation give quantitative insight into the requisite performance of the sextupole magnets

  3. The LHC Main Quadrupoles during Series Fabrication

    CERN Document Server

    Tortschanoff, Theodor; Durante, M; Hagen, P; Klein, U; Krischel, D; Payn, A; Rossi, L; Schellong, B; Schmidt, P; Simon, F; Schirm, K-M; Todesco, E

    2006-01-01

    By the end of August 2005 about 320 of the 400 main LHC quadrupole magnets have been fabricated and about 220 of them assembled into their cold masses, together with corrector magnets. About 130 of them have been cold tested in their cryostats and most of the quadrupoles exceeded their nominal excitation, i.e. 12,000 A, after no more than two training quenches. During this series fabrication, the quality of the magnets and cold masses was thoroughly monitored by means of warm magnetic field measurements, of strict geometrical checking, and of various electrical verifications. A number of modifications were introduced in order to improve the magnet fabrication, mainly correction of the coil geometry for achieving the specified field quality and measures for avoiding coil insulation problems. Further changes concern the electrical connectivity and insulation of instrumentation, and of the corrector magnets inside the cold masses. The contact resistances for the bus-bar connections to the quench protection diode...

  4. Alarm system for ABWR main control panels

    International Nuclear Information System (INIS)

    Kobayashi, Yuji; Saito, Koji

    1997-01-01

    TOSHIBA has developed integrated digital control and instrumentation system for ABWR, which is the third-generation man machine interface system for main control room that we call A-PODIA (Advanced PODIA). A-Podia has been introduced the first actual ABWR plant in Japan. in A-PODIA, TOSHIBA has realized improvement of alarm system that all operator crews in the control room can recognize plant anomalies easily. The alarm system can recognize essential alarms for plant safety easily and understand annunciators with each integrated annunciators and their prioritized color easily by classifying alarms into plant-level essential annunciators, system-level integrated annunciators and equipment level individual annunciators with hierarchical structure. This paper describes conventional alarm system and the design philosophy, alarm system design and operation of ''Alarm System for ABWR Main Control Panels''. (author). 5 refs, 8 figs, 1 tab

  5. INNOVATION DIFFUSION THEORY MAIN DEVELOPMENT STAGES

    Directory of Open Access Journals (Sweden)

    S. V. Lisafiev

    2011-01-01

    Full Text Available Abstract: Main innovation diffusion development theory stages are: Rogers model of moving new products to the market including characteristics of its segments; mathematic substantiation of this model by Bass; Moor model taking into account gaps between adjacent market segments; Goldenberg model making it possible to predict sales drops at new product life cycle initial stages. It is reasonable to use this theory while moving innovative products to the market.

  6. Space shuttle main engine vibration data base

    Science.gov (United States)

    Lewallen, Pat

    1986-01-01

    The Space Shuttle Main Engine Vibration Data Base is described. Included is a detailed description of the data base components, the data acquisition process, the more sophisticated software routines, and the future data acquisition methods. Several figures and plots are provided to illustrate the various output formats accessible to the user. The numerous vibration data recall and analysis capabilities available through automated data base techniques are revealed.

  7. The Main Properties of q-Functions

    OpenAIRE

    Nina O. Virchenko; Olena V. Ovcharenko

    2017-01-01

    Background.  The new generalization of the function of complex variable (q-function) is considered, its main properties are investigated. Such distributions have a special place among the special functions due to their widespread use in many areas of applied mathematics. Objective. The aim of the paper is to study the new generalization of the function of complex variable for application in applied sciences. Methods. To obtain scientific results the general methods of the mathematical a...

  8. Radiation shielding of the main injector

    International Nuclear Information System (INIS)

    Bhat, C.M.; Martin, P.S.

    1995-05-01

    The radiation shielding in the Fermilab Main Injector (FMI) complex has been carried out by adopting a number of prescribed stringent guidelines established by a previous safety analysis. Determination of the required amount of radiation shielding at various locations of the FMI has been done using Monte Carlo computations. A three dimensional ray tracing code as well as a code based upon empirical observations have been employed in certain cases

  9. The BTeV main spectrometer

    International Nuclear Information System (INIS)

    Sheldon, P.D.

    2001-01-01

    BTeV is a second generation B-factory experiment that will use a double-arm, forward spectrometer in the C0 experimental hall at the Fermilab Tevatron. I will describe the motivation and design of the 'main spectrometer', consisting of a ring-imaging Cherenkov system for charged particle identification, an electromagnetic calorimeter of lead-tungstate crystals, a proportional tube muon system with magnetized filtering steel, and a straw-tube and silicon strip charged particle tracking system

  10. Isolated systems with wind power. Main report

    Energy Technology Data Exchange (ETDEWEB)

    Lundsager, P.; Bindner, H.; Clausen, N.E.; Frandsen, S.; Hansen, L.H.; Hansen, J.C.

    2001-06-01

    The overall objective of this research project is to study the development of methods and guidelines rather than 'universal solutions' for the use of wind energy in isolated communities. The main specific objective of the project is to develop and present a more unified and generally applicable approach for assessing the technical and economical feasibility of isolated power supply systems with wind energy. As a part of the project the following tasks were carried out: Review of literature, field measurements in Egypt, development of an inventory of small isolated systems, overview of end-user demands, analysis of findings and development of proposed guidelines. The project is reported in one main report and four topical reports, all of them issued as Risoe reports. This is the Main Report Risoe-R-1256, summing up the activities and findings of the project and outlining an Implementation Strategy for Isolated Systems with Wind Power, applicable for international organisations such as donor agencies and development banks. (au)

  11. Infinite sequences and series

    CERN Document Server

    Knopp, Konrad

    1956-01-01

    One of the finest expositors in the field of modern mathematics, Dr. Konrad Knopp here concentrates on a topic that is of particular interest to 20th-century mathematicians and students. He develops the theory of infinite sequences and series from its beginnings to a point where the reader will be in a position to investigate more advanced stages on his own. The foundations of the theory are therefore presented with special care, while the developmental aspects are limited by the scope and purpose of the book. All definitions are clearly stated; all theorems are proved with enough detail to ma

  12. Fast global sequence alignment technique

    KAUST Repository

    Bonny, Mohamed Talal; Salama, Khaled N.

    2011-01-01

    fast alignment algorithm, called 'Alignment By Scanning' (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the wellknown sequence alignment algorithms, the 'GAP' (which is heuristic) and the 'Needleman

  13. Next-Generation Sequencing Platforms

    Science.gov (United States)

    Mardis, Elaine R.

    2013-06-01

    Automated DNA sequencing instruments embody an elegant interplay among chemistry, engineering, software, and molecular biology and have built upon Sanger's founding discovery of dideoxynucleotide sequencing to perform once-unfathomable tasks. Combined with innovative physical mapping approaches that helped to establish long-range relationships between cloned stretches of genomic DNA, fluorescent DNA sequencers produced reference genome sequences for model organisms and for the reference human genome. New types of sequencing instruments that permit amazing acceleration of data-collection rates for DNA sequencing have been developed. The ability to generate genome-scale data sets is now transforming the nature of biological inquiry. Here, I provide an historical perspective of the field, focusing on the fundamental developments that predated the advent of next-generation sequencing instruments and providing information about how these instruments work, their application to biological research, and the newest types of sequencers that can extract data from single DNA molecules.

  14. Towards predicting the encoding capability of MR fingerprinting sequences.

    Science.gov (United States)

    Sommer, K; Amthor, T; Doneva, M; Koken, P; Meineke, J; Börnert, P

    2017-09-01

    Sequence optimization and appropriate sequence selection is still an unmet need in magnetic resonance fingerprinting (MRF). The main challenge in MRF sequence design is the lack of an appropriate measure of the sequence's encoding capability. To find such a measure, three different candidates for judging the encoding capability have been investigated: local and global dot-product-based measures judging dictionary entry similarity as well as a Monte Carlo method that evaluates the noise propagation properties of an MRF sequence. Consistency of these measures for different sequence lengths as well as the capability to predict actual sequence performance in both phantom and in vivo measurements was analyzed. While the dot-product-based measures yielded inconsistent results for different sequence lengths, the Monte Carlo method was in a good agreement with phantom experiments. In particular, the Monte Carlo method could accurately predict the performance of different flip angle patterns in actual measurements. The proposed Monte Carlo method provides an appropriate measure of MRF sequence encoding capability and may be used for sequence optimization. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Rapid Polymer Sequencer

    Science.gov (United States)

    Stolc, Viktor (Inventor); Brock, Matthew W (Inventor)

    2013-01-01

    Method and system for rapid and accurate determination of each of a sequence of unknown polymer components, such as nucleic acid components. A self-assembling monolayer of a selected substance is optionally provided on an interior surface of a pipette tip, and the interior surface is immersed in a selected liquid. A selected electrical field is impressed in a longitudinal direction, or in a transverse direction, in the tip region, a polymer sequence is passed through the tip region, and a change in an electrical current signal is measured as each polymer component passes through the tip region. Each of the measured changes in electrical current signals is compared with a database of reference electrical change signals, with each reference signal corresponding to an identified polymer component, to identify the unknown polymer component with a reference polymer component. The nanopore preferably has a pore inner diameter of no more than about 40 nm and is prepared by heating and pulling a very small section of a glass tubing.

  16. The advantages of SMRT sequencing

    OpenAIRE

    Roberts, Richard J; Carneiro, Mauricio O; Schatz, Michael C

    2013-01-01

    Of the current next-generation sequencing technologies, SMRT sequencing is sometimes overlooked. However, attributes such as long reads, modified base detection and high accuracy make SMRT a useful technology and an ideal approach to the complete sequencing of small genomes.

  17. Putting instruction sequences into effect

    NARCIS (Netherlands)

    Bergstra, J.A.

    2011-01-01

    An attempt is made to define the concept of execution of an instruction sequence. It is found to be a special case of directly putting into effect of an instruction sequence. Directly putting into effect of an instruction sequences comprises interpretation as well as execution. Directly putting into

  18. Region segmentation along image sequence

    International Nuclear Information System (INIS)

    Monchal, L.; Aubry, P.

    1995-01-01

    A method to extract regions in sequence of images is proposed. Regions are not matched from one image to the following one. The result of a region segmentation is used as an initialization to segment the following and image to track the region along the sequence. The image sequence is exploited as a spatio-temporal event. (authors). 12 refs., 8 figs

  19. Rates of the main thermonuclear reactions

    International Nuclear Information System (INIS)

    Abramovich, S.N.; Guzhovskii, B.Ya.; Dunaeva, S.A.; Fomushkin, E.F.

    1992-01-01

    The data on the cross sections of main thermonuclear reactions have been estimated with an account of the latest experimental results in a form of S-factor spline presentation. Based on this estimation, the reates of these reactions in 0.0001-1 MeV temperature range in the supposition of Maxwell distribution of relative velocities have been computed. The Maxwell-Boltzmann averaged -factors were calculated according to the table values of the reaction rates. Then the -factors were approximated with the 3 order spline-function. The necessity of the account of electron shielding and intramolecular movement at low temperatures is discussed (orig.)

  20. Musculoskeletal disorders in main battle tank personnel

    DEFF Research Database (Denmark)

    Nissen, Lars Ravnborg; Guldager, Bernadette; Gyntelberg, Finn

    2009-01-01

    PURPOSE: To compare the prevalence of musculoskeletal disorders of personnel in the main battle tank (MBT) units in the Danish army with those of personnel in other types of army units, and to investigate associations between job function in the tank, military rank, and musculoskeletal problems......, and ankle. RESULTS AND CONCLUSIONS: There were only 4 women in the MBT group; as a consequence, female personnel were excluded from the study. The participation rate was 58.0% (n = 184) in the MBT group and 56.3% (n = 333) in the reference group. The pattern of musculoskeletal disorders among personnel...

  1. Main problems of modern radiation hygiene

    International Nuclear Information System (INIS)

    Il'in, L.A.; Buldakov, L.A.; Knizhnikov, V.A.

    1982-01-01

    The results of investigations carried out in 1980-81 in the field of radiation hygiene as well as plans for 1981-85 are considered. Three main groups of problems which the radiation hygiene is facing at the present time are discussed. The determination of levels and study of regularities of ionizing radiation dose formation in the population and personnel working with ionizing radiation sources in one of the promissing directions of the investigations. Delayed irradiation aftereffects andcontaminant action ofirradiation and chemical substances are no less important. The third important problem lies in the development of protective measures and arrangements on improving state sanitary inspection in the field of radiation hygiene

  2. Some peat deposits in Penobscot County, Maine

    Science.gov (United States)

    Cameron, Cornelia Clermont; Anderson, Walter A.

    1979-01-01

    Twenty of the peat deposits in Penobscot County, Maine contain an estimated 29,282,000 short tons air-dried peat. The peat is chiefly sphagnum moss and reed-sedge of high quality according to ASTM standards for agricultural and horticultural use. Analyses show that this same volume has high fuel value, low sulfur and high hydrogen contents compared with lignite and sub-bituminous coal, which may indicate that it also has potential for fuel use. On the basis of the metallic trace element content, one area within the region containing the 20 deposits has been delineated for further bedrock studies.

  3. Main-chain supramolecular block copolymers.

    Science.gov (United States)

    Yang, Si Kyung; Ambade, Ashootosh V; Weck, Marcus

    2011-01-01

    Block copolymers are key building blocks for a variety of applications ranging from electronic devices to drug delivery. The material properties of block copolymers can be tuned and potentially improved by introducing noncovalent interactions in place of covalent linkages between polymeric blocks resulting in the formation of supramolecular block copolymers. Such materials combine the microphase separation behavior inherent to block copolymers with the responsiveness of supramolecular materials thereby affording dynamic and reversible materials. This tutorial review covers recent advances in main-chain supramolecular block copolymers and describes the design principles, synthetic approaches, advantages, and potential applications.

  4. Additively Manufactured Main Fuel Valve Housing

    Science.gov (United States)

    Eddleman, David; Richard, Jim

    2015-01-01

    Selective Laser Melting (SLM) was utilized to fabricate a liquid hydrogen valve housing typical of those found in rocket engines and main propulsion systems. The SLM process allowed for a valve geometry that would be difficult, if not impossible to fabricate by traditional means. Several valve bodies were built by different SLM suppliers and assembled with valve internals. The assemblies were then tested with liquid nitrogen and operated as desired. One unit was also burst tested and sectioned for materials analysis. The design, test results, and planned testing are presented herein.

  5. Water Hammer in Pumped Sewer Mains

    DEFF Research Database (Denmark)

    Larsen, Torben

    of transients in pumped pipeline systems. This present publication can be understood as the second and revised edition of the pamphlet ”Transients in pumped sewer mains” (2006) which was published as a technical report by The EVA committee under The Danish Water Pollution Committee (The Danish Society......This publication is intended for students and engineers seeking an introduction to the problem of water transients in pumped sewer and water mains. This is a subject of increasing interest because of the development of larger and more integrated systems. Consideration of transients is essential...

  6. Space Shuttle Main Engine Public Test Firing

    Science.gov (United States)

    2000-01-01

    A new NASA Space Shuttle Main Engine (SSME) roars to the approval of more than 2,000 people who came to John C. Stennis Space Center in Hancock County, Miss., on July 25 for a flight-certification test of the SSME Block II configuration. The engine, a new and significantly upgraded shuttle engine, was delivered to NASA's Kennedy Space Center in Florida for use on future shuttle missions. Spectators were able to experience the 'shake, rattle and roar' of the engine, which ran for 520 seconds - the length of time it takes a shuttle to reach orbit.

  7. Main challenges in demulsifier research and application

    Science.gov (United States)

    Zhang, Fusheng; Liu, Guoliang; Ma, Junhan; Ouyang, Jian; Yi, Xiaoling; Su, Huimin

    2017-01-01

    Main challenges in demulsifier research, such as demulsification of ASP flooding produced liquid, demulsification of heavy oil produced liquid, low temperature demulsification and fast demulsification, are summarized. Some importance technology routes to solve the challenges are proposed according to demulsification mechanisms and emulsion characteristics. The proposed routes include increasing aromaticity, molecular weight and branch degree of demulsifiers, and introducing double-function groups to demulsifiers for W/O and O/W emulsions, or groups with alkyl matching with alkyl carbon number of the crude oil into demulsifier molecule. The demulsification mechanisms of the above-mentioned research routes are described in detail.

  8. Isolated systems with wind power. Main report

    DEFF Research Database (Denmark)

    Lundsager, P.; Bindner, Henrik W.; Clausen, Niels-Erik

    2001-01-01

    The overall objective of this research project is to study the development of methods and guidelines rather than "universal solutions" for the use of wind energy in isolated communities. The main specific objective of the project is to develop and present amore unified and generally applicable...... approach for assessing the technical and economical feasibility of isolated power supply systems with wind energy. As a part of the project the following tasks were carried out: Review of literature, fieldmeasurements in Egypt, development of an inventory of small isolated systems, overview of end...... for Isolated Systems with Wind Power, applicable for international organisations such as donoragencies and development banks....

  9. Forensic entomology and main challenges in Brazil.

    Science.gov (United States)

    Gomes, Leonardo; Von Zuben, Cláudio J

    2006-01-01

    Apart from an early case report from China (13th century), the first observations on insects and other arthropods as forensic indicators were documented in Germany and France during mass exhumations in the 1880s by Reinhard, who is considered a co-founder of the discipline. After the French publication of Mégnin's popular book on the applied aspects of forensic entomology, the concept quickly spread to Canada and United States. At that time, researchers recognized that the lack of systematic observations of insects of forensic importance jeopardized their use as indicators of postmortem interval. General advances in insect taxonomy and ecology helped to fill this gap over the following decades. After World Wars, few forensic entomology cases were reported in the scientific literature. From 1960s to the 1980s, Leclercq and Nuorteva were primarily responsible for maintaining the method in Central Europe, reporting isolated cases. Since then, basic research in the USA, Russia and Canada opened the way to the routine use of Entomology in forensic investigations. Identifications of insects associated with human cadavers are relatively few in the literature of the Neotropical region and have received little attention in Brazil. This article brings an overview of historic developments in this field, the recent studies and the main problems and challenges in South America and mainly in Brazil.

  10. Main Issues in Big Data Security

    Directory of Open Access Journals (Sweden)

    Julio Moreno

    2016-09-01

    Full Text Available Data is currently one of the most important assets for companies in every field. The continuous growth in the importance and volume of data has created a new problem: it cannot be handled by traditional analysis techniques. This problem was, therefore, solved through the creation of a new paradigm: Big Data. However, Big Data originated new issues related not only to the volume or the variety of the data, but also to data security and privacy. In order to obtain a full perspective of the problem, we decided to carry out an investigation with the objective of highlighting the main issues regarding Big Data security, and also the solutions proposed by the scientific community to solve them. In this paper, we explain the results obtained after applying a systematic mapping study to security in the Big Data ecosystem. It is almost impossible to carry out detailed research into the entire topic of security, and the outcome of this research is, therefore, a big picture of the main problems related to security in a Big Data system, along with the principal solutions to them proposed by the research community.

  11. Log-balanced combinatorial sequences

    Directory of Open Access Journals (Sweden)

    Tomislav Došlic

    2005-01-01

    Full Text Available We consider log-convex sequences that satisfy an additional constraint imposed on their rate of growth. We call such sequences log-balanced. It is shown that all such sequences satisfy a pair of double inequalities. Sufficient conditions for log-balancedness are given for the case when the sequence satisfies a two- (or more- term linear recurrence. It is shown that many combinatorially interesting sequences belong to this class, and, as a consequence, that the above-mentioned double inequalities are valid for all of them.

  12. New MR pulse sequence

    International Nuclear Information System (INIS)

    Harms, S.E.; Flamig, D.P.; Griffey, R.H.

    1990-01-01

    This paper describes a method for fat suppression for three-dimensional MR imaging. The FATS (fat-suppressed acquisition with echo time shortened) sequence employs a pair of opposing adiabatic half-passage RF pulses tuned on fat resonance. The imaging parameters are as follows: TR, 20 msec; TE, 21.7-3.2 msec; 1,024 x 128 x 128 acquired matrix; imaging time, approximately 11 minutes. A series of 54 examinations were performed. Excellent fat suppression with water excitation is achieved in all cases. The orbital images demonstrate superior resolution of small orbital lesions. The high signal-to-noise ratio (SNR) in cranial studies demonstrates excellent petrous bone and internal auditory canal anatomy

  13. Sequence of tenses: playing with possibilities

    Directory of Open Access Journals (Sweden)

    Bohdan Ulašin

    2012-12-01

    Full Text Available The aim of this article is to analyse the sequence of tenses in Spanish, a phenomenon typical of the Romance languages. Our purpose is to systematize and formulate the rules of use by means of examples with graphical representations. We focus on such cases of use of the sequence of tenses where it is possible to apply a “double-access interpretation”, i. e. which allows the possibility of choosing between reference points: with the actual time (the moment of speech or with the main clause. This double interpretation is to be found in all three types of time relationships: simultaneousness, priority and posteriority. Some pairs differ semantically; others are used according to the preferences of the speaker with no change of meaning. Most examples are subordinate noun clauses, nonetheless we included examples of other types of clauses as well (e.g. relative, reason clauses. We also analyze the problem of the sequence of tenses where the main verb is in the conditional tense.

  14. Mortise terrorism on the main pipelines

    Science.gov (United States)

    Komarov, V. A.; Nigrey, N. N.; Bronnikov, D. A.; Nigrey, A. A.

    2018-01-01

    The research aim of the work is to analyze the effectiveness of the methods of physical protection of main pipelines proposed in the article from the "mortise terrorism" A mathematical model has been developed that made it possible to predict the dynamics of "mortise terrorism" in the short term. An analysis of the effectiveness of physical protection methods proposed in the article to prevent unauthorized impacts on the objects under investigation is given. A variant of a video analytics system has been developed that allows detecting violators with recognition of the types of work they perform at a distance of 150 meters in conditions of complex natural backgrounds and precipitation. Probability of detection is 0.959.

  15. Siberian snakes for the Fermilab Main Injector

    International Nuclear Information System (INIS)

    Anferov, V.A.; Baiod, R.; Courant, E.D.

    1993-01-01

    Appropriate Siberian snakes were designed to maintain the proton beam polarization during acceleration in the Fermilab Main Injector from 8 to 150 GeV. Various snake designs were investigated to find one fitting into the 14 m straight section spaces with the required spin rotation axis and the minimum orbit excursion. The authors studied both cold and warm discrete magnet snakes as well as warm snakes with helical magnets. For the warm discrete magnet snake, obtaining small orbit excursions required a nearly longitudinal snake axis, while axes near ±45 degrees are needed when using two snakes in a ring. The authors found acceptable snakes either by using superconducting magnets or by using warm magnets with a helical dipole field

  16. CBA main magnet power supply ripple reduction

    International Nuclear Information System (INIS)

    Bagley, G.; Edwards, R.J.

    1983-01-01

    The preliminary results of a development program to minimize beam perturbation resulting from ripple current generated by the CBA Main Magnet Power Supply are presented. The assessment of the magnitude and causes of the ripple generated led to a modification of the SCR Gate Driver and the addition of a bandpass amplifier correction loop which gave significant improvement. A description of the changes made and the results obtained are included. A second design approach was developed in which the timing of the SCR gate pulses is directly determined by a VCO. The results reported with this VCO Loop indicate superior performance particularly at frequencies below 60 Hz. A shunt transistor regulator design is proposed to minimize higher SCR switching frequency harmonics

  17. BANKING ETHICS: MAIN CONCEPTIONS AND PROBLEMS

    Directory of Open Access Journals (Sweden)

    VALENTINA FETINIUC

    2014-10-01

    Full Text Available Banking ethics is a specialized set of ethical standards and rules that should be followed in the activities of financial institutions and employees of the banking sector. But despite the simplicity of the definition, in the modern world, this concept becomes complex and ambiguous. The importance of studying this subject is defined by the fact that the ethical behavior of the bank and bank employees promotes banking. At present there are several conceptions of banking ethics: general ethics, regulated ethics and ethical bank. The most common practice is to regulate internal and external relations of banks and bank workers with ethical codes. At the same time, studies show the existence of problems in the banking standards of ethics, which negatively affects the financial institution. This article is intended to reflect main tendencies and problems of banking ethics at international level and experience of Republic of Moldova in this field.

  18. Seismic risks at Elsie Lake Main Dam

    International Nuclear Information System (INIS)

    McCammon, N.R.; Momenzadeh, M.; Hawson, H.H.; Nielsen, N.M.

    1991-01-01

    The Elsie Lake dams are located on Vancouver Island in an area of high seismic risk. A safety review in 1986 indicated potential deficiencies in the earthfill main dam with respect to modern earthquake design standards. A detailed field investigation program comprising drilling and penetration tests was carried out and the results used in an assessment of seismic stability. A 0.8 m thick less dense layer in the granular shell of the dam, possibly caused by wet construction conditions, would likely liquefy in a major earthquake but sufficient residual strength would likely remain to prevent catastrophic failure. The dam shell might undergo some distortion, and an assessment was initiated to determine the requirements for reservoir drawdown following an extreme earthquake to ensure the timely lowering of the reservoir for inspection and repair. It was suggested that an adequate evacuation capability would be 25% and 50% drawdown in not more than 30 and 50 days, respectively. 9 refs., 11 figs., 1 tab

  19. Natural syntax : English interrogative main clauses

    Directory of Open Access Journals (Sweden)

    Janez Oresnik

    2007-12-01

    Full Text Available Natural Syntax is a developing deductive theory, a branch of Naturalness Theory. The naturalnessjudgements are couched in naturalness scales, whichfollow from the basic parameters (or «axioms» listed at the beginning of the paper. The predictions of the theory are calculated in deductions, whose chief components are apair of naturalness scales and the rules governing the alignment of corresponding naturalness values. Parallel and chiastic alignments are distinguished, in complementary distribution. Chiastic alignment is mandatory in deductions limited to unnatural environments. The paper deals with English interrogative main clauses. Within these, only the interrogatives containing wh-words exclusively insitu constitute an extremely unnatural environment and require chiastic alignment. Otherwiseparallel alignment is used. Earlier publications on Natural Syntax: Kavcic 2005a,b, Oresnik 1999, 2000a,b, 200la-f   2002, 2003a-c, 2002/03, 2004. This list cites only works written in English.

  20. PS main supply: motor-generator set.

    CERN Multimedia

    Maximilien Brice

    2002-01-01

    In picture 04 the motor is on the right in the background and the main view is of the generator. The peak power in each PS cycle drawn from the generator, up to 96 MW, is taken from the rotational kinetic energy of the rotor (a heavy-weight of 80 tons), which makes the rotational speed drop by only a few percent. The motor replenishes the average power of 2 to 4 MW. Photo 05: The motor-generator set is serviced every year and, in particular, bearings and slip-rings are carefully checked. To the left is the motor with its slip-rings visible. It has been detached from the axle and moved to the side, so that the rotor can be removed from the huge generator, looming at the right.

  1. VAT EVASION INLEBANON: CASES AND MAIN CAUSES

    Directory of Open Access Journals (Sweden)

    Rana Ismail

    2012-07-01

    Full Text Available The Value Added Tax (VAT is a very important source oftreasuryrevenuesinLebanon. It was initially introduced inLebanon in order to reduce the budgetdeficit and help contain the debt. However, VAT evasion growth inLebanon isleading to significant VAT revenue losses because of its size and frequency.In this paper, we will highlight the contribution of VAT to the treasury revenue. Inaddition, our research has led to figure out the most significant VAT evasion casesand the way tax payers evade paying their required VAT or try to have an illegalrefund. From these tax evasion cases, we will pinpoint the main causes of suchevasions and propose solutions to limit as much as possible VAT evasion inLebanon.

  2. Main clinical epidemiological features of lung cancer

    International Nuclear Information System (INIS)

    Costa Montane, Daniel Marino; Prado Lage, Yulien; Lozano Salazar; Jorge Luis

    2011-01-01

    A descriptive and cross-sectional study of 95 patients with lung cancer, discharged from Neumology Service at 'Dr Juan Bruno Zayas Alfonso' General Hospital in Santiago de Cuba, was carried out from January, 2008 to December, 2008 in order to identify the main clinical epidemiological features of the aforementioned disease. A malignancy predominance among men aged between 56 and 65 years old, belonging to urban areas and being heavy smoker (out of 30 cigarettes per day over 30 years ), was found. Those affected without a confirmed histological type and IV clinical stage epidermoid carcinoma were predominant. Most of them had the opportunity to be treated. Increasing and intensifying health promotion and disease prevention campaigns were recommended so as to achieve the population to avoid or quit the smoking habit. (author)

  3. Main heat transfer components for SNR-300

    International Nuclear Information System (INIS)

    De Haas Van Dorsser, A.H.

    1976-01-01

    Early in the joint German-Belgium-Dutch fast breeder programme it was decided that all main components should be tested, if possible at full scale, before fabrication of the actual SNR-300 components. Descriptions are given of the results of testing, and subsequent modifications, of the pumps, intermediate heat exchangers, and steam generators. A full scale model of the primary pump, free surface vertical shaft centrifugal type, was constructed and tested in the 5000 cubic metres per hour pump test facility erected at Bensberg. A 70 MW model of an intermediate heat exchanger, straight tube type with floating head, was tested in the 50 MW steam generator test station at Hengelo. Also tested in the Hengelo facility was an almost full scale straight tube 50 MW steam generator and subsequently a 50 MW helical tube evaporator. The latter tests were of more than 3000 h operation and resulted in minor changes in design and manufacturing operation. (U.K.)

  4. Multilocus Sequence Analysis and rpoB Sequencing of Mycobacterium abscessus (Sensu Lato) Strains▿

    Science.gov (United States)

    Macheras, Edouard; Roux, Anne-Laure; Bastian, Sylvaine; Leão, Sylvia Cardoso; Palaci, Moises; Sivadon-Tardy, Valérie; Gutierrez, Cristina; Richter, Elvira; Rüsch-Gerdes, Sabine; Pfyffer, Gaby; Bodmer, Thomas; Cambau, Emmanuelle; Gaillard, Jean-Louis; Heym, Beate

    2011-01-01

    Mycobacterium abscessus, Mycobacterium bolletii, and Mycobacterium massiliense (Mycobacterium abscessus sensu lato) are closely related species that currently are identified by the sequencing of the rpoB gene. However, recent studies show that rpoB sequencing alone is insufficient to discriminate between these species, and some authors have questioned their current taxonomic classification. We studied here a large collection of M. abscessus (sensu lato) strains by partial rpoB sequencing (752 bp) and multilocus sequence analysis (MLSA). The final MLSA scheme developed was based on the partial sequences of eight housekeeping genes: argH, cya, glpK, gnd, murC, pgm, pta, and purH. The strains studied included the three type strains (M. abscessus CIP 104536T, M. massiliense CIP 108297T, and M. bolletii CIP 108541T) and 120 isolates recovered between 1997 and 2007 in France, Germany, Switzerland, and Brazil. The rpoB phylogenetic tree confirmed the existence of three main clusters, each comprising the type strain of one species. However, divergence values between the M. massiliense and M. bolletii clusters all were below 3% and between the M. abscessus and M. massiliense clusters were from 2.66 to 3.59%. The tree produced using the concatenated MLSA gene sequences (4,071 bp) also showed three main clusters, each comprising the type strain of one species. The M. abscessus cluster had a bootstrap value of 100% and was mostly compact. Bootstrap values for the M. massiliense and M. bolletii branches were much lower (71 and 61%, respectively), with the M. massiliense cluster having a fuzzy aspect. Mean (range) divergence values were 2.17% (1.13 to 2.58%) between the M. abscessus and M. massiliense clusters, 2.37% (1.5 to 2.85%) between the M. abscessus and M. bolletii clusters, and 2.28% (0.86 to 2.68%) between the M. massiliense and M. bolletii clusters. Adding the rpoB sequence to the MLSA-concatenated sequence (total sequence, 4,823 bp) had little effect on the clustering

  5. Multilocus sequence analysis and rpoB sequencing of Mycobacterium abscessus (sensu lato) strains.

    Science.gov (United States)

    Macheras, Edouard; Roux, Anne-Laure; Bastian, Sylvaine; Leão, Sylvia Cardoso; Palaci, Moises; Sivadon-Tardy, Valérie; Gutierrez, Cristina; Richter, Elvira; Rüsch-Gerdes, Sabine; Pfyffer, Gaby; Bodmer, Thomas; Cambau, Emmanuelle; Gaillard, Jean-Louis; Heym, Beate

    2011-02-01

    Mycobacterium abscessus, Mycobacterium bolletii, and Mycobacterium massiliense (Mycobacterium abscessus sensu lato) are closely related species that currently are identified by the sequencing of the rpoB gene. However, recent studies show that rpoB sequencing alone is insufficient to discriminate between these species, and some authors have questioned their current taxonomic classification. We studied here a large collection of M. abscessus (sensu lato) strains by partial rpoB sequencing (752 bp) and multilocus sequence analysis (MLSA). The final MLSA scheme developed was based on the partial sequences of eight housekeeping genes: argH, cya, glpK, gnd, murC, pgm, pta, and purH. The strains studied included the three type strains (M. abscessus CIP 104536(T), M. massiliense CIP 108297(T), and M. bolletii CIP 108541(T)) and 120 isolates recovered between 1997 and 2007 in France, Germany, Switzerland, and Brazil. The rpoB phylogenetic tree confirmed the existence of three main clusters, each comprising the type strain of one species. However, divergence values between the M. massiliense and M. bolletii clusters all were below 3% and between the M. abscessus and M. massiliense clusters were from 2.66 to 3.59%. The tree produced using the concatenated MLSA gene sequences (4,071 bp) also showed three main clusters, each comprising the type strain of one species. The M. abscessus cluster had a bootstrap value of 100% and was mostly compact. Bootstrap values for the M. massiliense and M. bolletii branches were much lower (71 and 61%, respectively), with the M. massiliense cluster having a fuzzy aspect. Mean (range) divergence values were 2.17% (1.13 to 2.58%) between the M. abscessus and M. massiliense clusters, 2.37% (1.5 to 2.85%) between the M. abscessus and M. bolletii clusters, and 2.28% (0.86 to 2.68%) between the M. massiliense and M. bolletii clusters. Adding the rpoB sequence to the MLSA-concatenated sequence (total sequence, 4,823 bp) had little effect on the

  6. Solving Assembly Sequence Planning using Angle Modulated Simulated Kalman Filter

    Science.gov (United States)

    Mustapa, Ainizar; Yusof, Zulkifli Md.; Adam, Asrul; Muhammad, Badaruddin; Ibrahim, Zuwairie

    2018-03-01

    This paper presents an implementation of Simulated Kalman Filter (SKF) algorithm for optimizing an Assembly Sequence Planning (ASP) problem. The SKF search strategy contains three simple steps; predict-measure-estimate. The main objective of the ASP is to determine the sequence of component installation to shorten assembly time or save assembly costs. Initially, permutation sequence is generated to represent each agent. Each agent is then subjected to a precedence matrix constraint to produce feasible assembly sequence. Next, the Angle Modulated SKF (AMSKF) is proposed for solving ASP problem. The main idea of the angle modulated approach in solving combinatorial optimization problem is to use a function, g(x), to create a continuous signal. The performance of the proposed AMSKF is compared against previous works in solving ASP by applying BGSA, BPSO, and MSPSO. Using a case study of ASP, the results show that AMSKF outperformed all the algorithms in obtaining the best solution.

  7. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    Science.gov (United States)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  8. Trade practices are main factors involved in the transmission of viral haemorrhagic septicaemia

    DEFF Research Database (Denmark)

    Reichert, M.; Matras, M.; Skall, Helle Frank

    2013-01-01

    subgroups. The main source of outbreaks in European rainbow trout farming is sublineage Ia isolates. Recently, this group of isolates has been further subdivided in to two subclades of which the Ia-2 consists of isolates occurring mainly in Continental Europe outside of Denmark. In this study, we sequenced...... the full-length G-gene sequences of 24 VHSV isolates that caused VHS outbreaks in Polish trout farms between 2005 and 2009. All these isolates were identified as genotype Ia-2; they divided however into two genetically distinct subgroups, that we name Pol I and Pol II. The Pol I isolates mainly caused...... cause of virus transmission appears to be movement of fish. At least in Polish circumstances trading practices appear to have significant impact on spreading of VHSV infection....

  9. Universal sequence map (USM of arbitrary discrete sequences

    Directory of Open Access Journals (Sweden)

    Almeida Jonas S

    2002-02-01

    Full Text Available Abstract Background For over a decade the idea of representing biological sequences in a continuous coordinate space has maintained its appeal but not been fully realized. The basic idea is that any sequence of symbols may define trajectories in the continuous space conserving all its statistical properties. Ideally, such a representation would allow scale independent sequence analysis – without the context of fixed memory length. A simple example would consist on being able to infer the homology between two sequences solely by comparing the coordinates of any two homologous units. Results We have successfully identified such an iterative function for bijective mappingψ of discrete sequences into objects of continuous state space that enable scale-independent sequence analysis. The technique, named Universal Sequence Mapping (USM, is applicable to sequences with an arbitrary length and arbitrary number of unique units and generates a representation where map distance estimates sequence similarity. The novel USM procedure is based on earlier work by these and other authors on the properties of Chaos Game Representation (CGR. The latter enables the representation of 4 unit type sequences (like DNA as an order free Markov Chain transition table. The properties of USM are illustrated with test data and can be verified for other data by using the accompanying web-based tool:http://bioinformatics.musc.edu/~jonas/usm/. Conclusions USM is shown to enable a statistical mechanics approach to sequence analysis. The scale independent representation frees sequence analysis from the need to assume a memory length in the investigation of syntactic rules.

  10. Frequency characteristics of coordinate sequences of linear recurrences over Galois rings

    Science.gov (United States)

    Kamlovskii, O. V.

    2013-12-01

    We consider some properties of the coordinate sequences of linear recurrences over Galois rings which characterize the possibility of regarding them as pseudo-random sequences. We study the periodicity properties, linear complexity and frequency characteristics of these sequences. Up to now, these parameters have been studied mainly in the case when the linear recurring sequence has maximal possible period. We investigate the coordinate sequences of linear recurrences of not necessarily maximal period. We obtain sharpened and generalized estimates for the number of elements and r-patterns on the cycles and intervals of these sequences.

  11. Frequency characteristics of coordinate sequences of linear recurrences over Galois rings

    International Nuclear Information System (INIS)

    Certification Research Center, Moscow (Russian Federation))" data-affiliation=" (LLC Certification Research Center, Moscow (Russian Federation))" >Kamlovskii, O V

    2013-01-01

    We consider some properties of the coordinate sequences of linear recurrences over Galois rings which characterize the possibility of regarding them as pseudo-random sequences. We study the periodicity properties, linear complexity and frequency characteristics of these sequences. Up to now, these parameters have been studied mainly in the case when the linear recurring sequence has maximal possible period. We investigate the coordinate sequences of linear recurrences of not necessarily maximal period. We obtain sharpened and generalized estimates for the number of elements and r-patterns on the cycles and intervals of these sequences

  12. Main Findings: Lessons to be Learnt

    International Nuclear Information System (INIS)

    2010-01-01

    This section summarizes the main lessons to be learnt from the workshop: 1 - Workshop Methodology: This method of work has proven to be successful. Participants appreciated the high level of interaction with the other colleagues, especially in view of the variety of expertise that was represented at the workshop. The method also affords the participants the opportunity to learn about the status of waste management in the host country, and to come into contact with the main actors. Conversely, the method also affords the host country programme added visibility at the international level. 2 - National Regulations and International Guidance and Bases for Criteria and Regulatory Judgement: There is reasonable consensus amongst national regulations on fundamental regulatory objectives, but much less agreement on the most appropriate criteria. Consensus is nationally and internationally hampered by the lack of common definition of concepts and terms. International guidance is interpreted in different ways in each country. International guidance is rather difficult to interpret, understand and apply. It is important that stakeholders understand the bases for regulatory judgements. 3 - Optimisation: The fundamental goals of optimisation need to be clarified. Optimisation of long-term vs. short-term safety remains problematic. The process of performing optimisation is more important than the numerical or scientific result. A transparent, stepwise and iterative process of decision making is essential for optimisation. The basic, broad rules for decision making and involvement of stakeholders need to be defined in advance. 4 - Technical Indicators for Safe Performance: The relative importance of different safety indicators varies with timescale. There is still much to be done before reaching consensus on the relative importance of different time frames. More discussion is needed on time cut-offs for regulatory compliance. More discussion on the meaning and applicability of

  13. Logic verification system for power plant sequence diagrams

    International Nuclear Information System (INIS)

    Fukuda, Mitsuko; Yamada, Naoyuki; Teshima, Toshiaki; Kan, Ken-ichi; Utsunomiya, Mitsugu.

    1994-01-01

    A logic verification system for sequence diagrams of power plants has been developed. The system's main function is to verify correctness of the logic realized by sequence diagrams for power plant control systems. The verification is based on a symbolic comparison of the logic of the sequence diagrams with the logic of the corresponding IBDs (interlock Block Diagrams) in combination with reference to design knowledge. The developed system points out the sub-circuit which is responsible for any existing mismatches between the IBD logic and the logic realized by the sequence diagrams. Applications to the verification of actual sequence diagrams of power plants confirmed that the developed system is practical and effective. (author)

  14. What can we learn about lyssavirus genomes using 454 sequencing?

    Science.gov (United States)

    Höper, Dirk; Finke, Stefan; Freuling, Conrad M; Hoffmann, Bernd; Beer, Martin

    2012-01-01

    The main task of the individual project number four"Whole genome sequencing, virus-host adaptation, and molecular epidemiological analyses of lyssaviruses "within the network" Lyssaviruses--a potential re-emerging public health threat" is to provide high quality complete genome sequences from lyssaviruses. These sequences are analysed in-depth with regard to the diversity of the viral populations as to both quasi-species and so-called defective interfering RNAs. Moreover, the sequence data will facilitate further epidemiological analyses, will provide insight into the evolution of lyssaviruses and will be the basis for the design of novel nucleic acid based diagnostics. The first results presented here indicate that not only high quality full-length lyssavirus genome sequences can be generated, but indeed efficient analysis of the viral population gets feasible.

  15. Maine Environmental Vulnerability Index (EVI) Atlas, Maine - 2007, maps in portable document format (NODC Accession 0036827)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This four volume set of Environmental Vulnerability Index Maps depicts environmental resources along the coast of Maine most at risk from oil spilled into the marine...

  16. Sequencing of the Hepatitis C Virus: A Systematic Review.

    Directory of Open Access Journals (Sweden)

    Brendan Jacka

    Full Text Available Since the identification of hepatitis C virus (HCV, viral sequencing has been important in understanding HCV classification, epidemiology, evolution, transmission clustering, treatment response and natural history. The length and diversity of the HCV genome has resulted in analysis of certain regions of the virus, however there has been little standardisation of protocols. This systematic review was undertaken to map the location and frequency of sequencing on the HCV genome in peer reviewed publications, with the aim to produce a database of sequencing primers and amplicons to inform future research. Medline and Scopus databases were searched for English language publications based on keyword/MeSH terms related to sequence analysis (9 terms or HCV (3 terms, plus "primer" as a general search term. Exclusion criteria included non-HCV research, review articles, duplicate records, and incomplete description of HCV sequencing methods. The PCR primer locations of accepted publications were noted, and purpose of sequencing was determined. A total of 450 studies were accepted from the 2099 identified, with 629 HCV sequencing amplicons identified and mapped on the HCV genome. The most commonly sequenced region was the HVR-1 region, often utilised for studies of natural history, clustering/transmission, evolution and treatment response. Studies related to genotyping/classification or epidemiology of HCV genotype generally targeted the 5'UTR, Core and NS5B regions, while treatment response/resistance was assessed mainly in the NS3-NS5B region with emphasis on the Interferon sensitivity determining region (ISDR region of NS5A. While the sequencing of HCV is generally constricted to certain regions of the HCV genome there is little consistency in the positioning of sequencing primers, with the exception of a few highly referenced manuscripts. This study demonstrates the heterogeneity of HCV sequencing, providing a comprehensive database of previously

  17. Main attributes influencing spent nuclear fuel management

    International Nuclear Information System (INIS)

    Andreescu, N.; Ohai, D.

    1997-01-01

    All activities regarding nuclear fuel, following its discharge from the NPP, constitute the spent fuel management and are grouped in two possible back end variants, namely reprocessing (including HLW vitrification and geological disposal) and direct disposal of spent fuel. In order to select the appropriate variant it is necessary to analyse the aggregate fulfillment of the imposed requirements, particularly of the derived attributes, defined as distinguishing characteristics of the factors used in the decision making process. The main identified attributes are the following: - environmental impact, - availability of suitable sites, - non-proliferation degree, -strategy of energy, - technological complexity and technical maturity, -possible further technical improvements, - size of nuclear programme, - total costs, - public acceptance, - peculiarity of CANDU fuel. The significance of the attributes in the Romanian case, taking into consideration the present situation, as a low scenario and a high scenario corresponding to an important development of the nuclear power, after the year 2010, is presented. According to their importance the ranking of attributes is proposed . Subsequently, the ranking could be used for adequate weighing of attributes in order to realize a multi-criteria analysis and a relevant comparison of back end variants. (authors)

  18. EPR compared to international requirements (Mainly EUR)

    International Nuclear Information System (INIS)

    Broecker, B.

    1996-01-01

    A number of European Utilities have entered an agreement to write common requirements dedicated to future light water nuclear power plants to be built in Europe. The activities are known under the sign EUR (European Utilities Requirements). EPR, the future European Pressurized water Reactor, is the first installation of this type which will be operational from the year 2000 onwards, must fulfill the European requirements. EPR will serve as a test whether these requirements are realistic and well balanced. At the basic design stage of EPR, this paper concentrates on four main topics: the requirements which are new compared with existing reactors and which put a major challenge to the designer; the requirements today still open and the way they can be met by the EPR or not; the points for which already today the EPR special requirements exceed the EUR; the examples where the design of the EPR has given feedback which has led to a change of the EUR. EPR and EUR are different approaches to the reactor of the future. EUR is a set of requirements which leaves a flexibility to the designer while EPR is a real project which defines the technical solutions. EPR will fulfill the EUR and will at the same time serve as a test whether these requirements are realistic. EPR will also fulfill international requirements with minor changes. (J.S.). 7 figs

  19. CVD - main concepts, applications and restrictions

    International Nuclear Information System (INIS)

    Bliznakovska, B.; Milosevski, M.; Krawczynski, S.; Meixner, C.; Koetter, H.R.

    1993-01-01

    Despite of the fact that the existing literature covering the last two decades is plentiful with data related to CVD, this document is an attempt to provide to a reader a concise information about the nature of CVD technique at production of technologically important materials as well as to point at special references. The text is devided into three separate sections. The first section, The Main Features of CVD, is intended to give a complete comprehensive picture of the CVD technique through process description and characterization. The basic principles of thermodynamics, CVD chemical reactions classification, CVD chemical kinetics aspects and physics of CVD (with particular attention on the gas-flow phenomena) are included. As an additional aspect, in CVD unavoidable aspect however, the role of the coating/substrate compatibility on the overall process was outlined. The second section, CVD Equipment, concerns on the pecularities of the complete CVD unit pointing out the individual significances of the separate parts, i.e. pumping system, reactor chamber, control system. The aim of this section is to create to a reader a basic understanding of the arising problems but connected to be actual CVD performance. As a final goal of this review the reader's attention is turned upon the CVD applications for production of an up-to-date important class of coatings such as multilayer coatings. (orig.)

  20. Proposed Fermilab upgrade main injector project

    International Nuclear Information System (INIS)

    1992-04-01

    The US Department of Energy (DOE) proposes to construct and operate a ''Fermilab Main Injector'' (FMI), a 150 GeV proton injector accelerator, at the Fermi National Accelerator Laboratory (Fermilab) in Batavia, Illinois. The purpose and need for this action are given of this Environmental Assessment (EA). A description of the proposed FMI and construction activities are also given. The proposed FMI would be housed in an underground tunnel with a circumference of approximately 2.1 miles (3.4 kilometers), and the construction would affect approximately 135 acres of the 6,800 acre Fermilab site. The purpose of the proposed FMI is to construct and bring into operation a new 150 GeV proton injector accelerator. This addition to Fermilab's Tevatron would enable scientists to penetrate ever more deeply into the subatomic world through the detection of the super massive particles that can be created when a proton and antiproton collide head-on. The conversion of energy into matter in these collisions makes it possible to create particles that existed only an instant after the beginning of time. The proposed FMI would significantly extend the scientific reach of the Tevatron, the world's first superconducting accelerator and highest energy proton-antiproton collider

  1. Main prospects of EDF's nuclear program

    International Nuclear Information System (INIS)

    Pierre Bacher, M.; Jean Pierrard, M.

    1994-01-01

    Today, EDF is at a half way point in its third major standardized series, the N4 1400 MW series. The main objective agreed upon for this N4 series, was to improve the insertion of man in the control loop. After the TMI accident in 1979, selective improvements had already been introduced in the 900 series ; the 1300 series, which was the underway, was also the object of more significant improvements (for instance a digital control system) ; but it still seemed desirable that all the lessons to be learned from the accident be reflected in the third series : the fully computerized instrumentation and control system developed for the N4 series ?comparable to the one developed for Airbus ?is today the first of its kind in the world. The demand increase for electric energy dramatically stopped in 1993. However, the prospect for the coming years is more optimistic. Electricity consumption is expected to increase slowly by an average 2% per year. In this context, EDF is preparing its energy program for the nest century and takes into account that hydraulic generation capacity will remain stable and that the French thermal units fueled with coal are rather old and will have to be replaced.

  2. The two main theories on dental bruxism.

    Science.gov (United States)

    Behr, Michael; Hahnel, Sebastian; Faltermeier, Andreas; Bürgers, Ralf; Kolbeck, Carola; Handel, Gerhard; Proff, Peter

    2012-03-20

    Bruxism is characterized by non-functional contact of mandibular and maxillary teeth resulting in clenching or grating of teeth. Theories on factors causing bruxism are a matter of controversy in current literature. The dental profession has predominantly viewed peripheral local morphological disorders, such as malocclusion, as the cause of clenching and gnashing. This etiological model is based on the theory that occlusal maladjustment results in reduced masticatory muscle tone. In the absence of occlusal equilibration, motor neuron activity of masticatory muscles is triggered by periodontal receptors. The second theory assumes that central disturbances in the area of the basal ganglia are the main cause of bruxism. An imbalance in the circuit processing of the basal ganglia is supposed to be responsible for muscle hyperactivity during nocturnal dyskinesia such as bruxism. Some authors assume that bruxism constitutes sleep-related parafunctional activity (parasomnia). A recent model, which may explain the potential imbalance of the basal ganglia, is neuroplasticity. Neural plasticity is based on the ability of synapses to change the way they work. Activation of neural plasticity can change the relationship between inhibitory and excitatory neurons. It seems obvious that bruxism is not a symptom specific to just one disease. Many forms (and causes) of bruxism may exist simultaneously, as, for example, peripheral or central forms. Copyright © 2011 Elsevier GmbH. All rights reserved.

  3. Main physical problems of superhigh energy accelerators

    International Nuclear Information System (INIS)

    Lapidus, L.I.

    1979-01-01

    A survey is given of the state and prospects for the scientific researches to be carried out at the largest charged particle accelerators now under construction. The fundamental problems of the elementary particle physics are considered which can be solved on the base of experiments at high-energy accelerators. The problems to be solved involve development of the theory of various quark number, accurate determination of the charged and neutral intermediate vector boson masses in the Weinberg-Salam theory, the problem of production of t-quark, W -+ - and Z deg bosons, Higgs mesons and investigation of their interactions, examination of quark and lepton spectra, studies on the effects of strong interactions. As a result of the investigations on hadrons at maximum momentum transfers, the data on space-time structure at short distances can be obtained. It is emphasized that there are no engineering barriers to the construction of such accelerators. The main problem lies in financial investment. A conclusion is drawn that the next generation of accelerators will be developed on the base of cooperation between many countries [ru

  4. Prototype fast breeder reactor main options

    International Nuclear Information System (INIS)

    Bhoje, S.B.; Chellapandi, P.

    1996-01-01

    Fast reactor programme gets importance in the Indian energy market because of continuous growing demand of electricity and resources limited to only coal and FBR. India started its fast reactor programme with the construction of 40 MWt Fast Breeder Test Reactor (FBTR). The reactor attained its first criticality in October 1985. The reactor power will be raised to 40 MWt in near future. As a logical follow-up of FBTR, it was decided to build a prototype fast breeder reactor, PFBR. Considering significant effects of capital cost and construction period on economy, systematic efforts are made to reduce the same. The number of primary and secondary sodium loops and components have been reduced. Sodium coolant, pool type concept, oxide fuel, 20% CW D9, SS 316 LN and modified 9Cr-1Mo steel (T91) materials have been selected for PFBR. Based on the operating experience, the integrity of the high temperature components including fuel and cost optimization aspects, the plant temperatures are recommended. Steam temperature of 763 K at 16.6 MPa and a single TG of 500 MWe gross output have been decided. PFBR will be located at Kalpakkam site on the coast of Bay of Bengal. The plant life is designed for 30 y and 75% load factor. In this paper the justifications for the main options chosen are given in brief. (author). 2 figs, 2 tabs

  5. Brand new hall in the main building

    CERN Multimedia

    Corinne Pralavorio

    2014-01-01

    The renovation of the UNIQA and post office premises is getting under way, with their reopening scheduled for the spring.   The renovation of the large hall in the main building (Building 500) has finally reached the home straight. As of this week, building contractors will get to work on the last part – the offices of UNIQA and La Poste. In the last week of November, the two concessions moved their offices across Route Scherrer to the same part of Building 510 where UBS was temporarily housed during the bank’s refurbishment. Their services were therefore unavailable for one day. The renovation work will last until the spring, with the new offices expected to open in May 2015. Between now and then, the windows and insulation will be completely refitted, with a view to reducing heat loss considerably, and, above all, the premises will be modernised to improve customer reception and service. For example, UNIQA’s new premises will feature a confidential area, guarantee...

  6. Fusion reactor blanket-main design aspects

    International Nuclear Information System (INIS)

    Strebkov, Yu.; Sidorov, A.; Danilov, I.

    1994-01-01

    The main function of the fusion reactor blanket is ensuring tritium breeding and radiation shield. The blanket version depends on the reactor type (experimental, DEMO, commercial) and its parameters. Blanket operation conditions are defined with the heat flux, neutron load/fluence, cyclic operation, dynamic heating/force loading, MHD effects etc. DEMO/commercial blanket design is distinguished e.g. by rather high heat load and neutron fluence - up to 100 W/cm 2 and 7 MWa/m 2 accordingly. This conditions impose specific requirements for the materials, structure, maintenance of the blanket and its most loaded components - FW and limiter. The liquid Li-Pb eutectic is one of the possible breeder for different kinds of blanket in view of its advantages one of which is the blanket convertibility that allow to have shielding blanket (borated water) or breeding one (Li-Pb eutectic). Using Li-Pb eutectic for both ITER and DEMO blankets have been considered. In the conceptual ITER design the solid eutectic blanket was carried out. The liquid eutectic breeder/coolant is suggested also for the advanced (high parameter) blanket

  7. Short sequence motifs, overrepresented in mammalian conservednon-coding sequences

    Energy Technology Data Exchange (ETDEWEB)

    Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna

    2007-02-21

    Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by

  8. Genomic sequencing in clinical trials

    OpenAIRE

    Mestan, Karen K; Ilkhanoff, Leonard; Mouli, Samdeep; Lin, Simon

    2011-01-01

    Abstract Human genome sequencing is the process by which the exact order of nucleic acid base pairs in the 24 human chromosomes is determined. Since the completion of the Human Genome Project in 2003, genomic sequencing is rapidly becoming a major part of our translational research efforts to understand and improve human health and disease. This article reviews the current and future directions of clinical research with respect to genomic sequencing, a technology that is just beginning to fin...

  9. Biosensors for DNA sequence detection

    Science.gov (United States)

    Vercoutere, Wenonah; Akeson, Mark

    2002-01-01

    DNA biosensors are being developed as alternatives to conventional DNA microarrays. These devices couple signal transduction directly to sequence recognition. Some of the most sensitive and functional technologies use fibre optics or electrochemical sensors in combination with DNA hybridization. In a shift from sequence recognition by hybridization, two emerging single-molecule techniques read sequence composition using zero-mode waveguides or electrical impedance in nanoscale pores.

  10. Neural mechanisms of sequence generation in songbirds

    Science.gov (United States)

    Langford, Bruce

    Animal models in research are useful for studying more complex behavior. For example, motor sequence generation of actions requiring good muscle coordination such as writing with a pen, playing an instrument, or speaking, may involve the interaction of many areas in the brain, each a complex system in itself; thus it can be difficult to determine causal relationships between neural behavior and the behavior being studied. Birdsong, however, provides an excellent model behavior for motor sequence learning, memory, and generation. The song consists of learned sequences of notes that are spectrographically stereotyped over multiple renditions of the song, similar to syllables in human speech. The main areas of the songbird brain involve in singing are known, however, the mechanisms by which these systems store and produce song are not well understood. We used a custom built, head-mounted, miniature motorized microdrive to chronically record the neural firing patterns of identified neurons in HVC, a pre-motor cortical nucleus which has been shown to be important in song timing. These were done in Bengalese finch which generate a song made up of stereotyped notes but variable note sequences. We observed song related bursting in neurons projecting to Area X, a homologue to basal ganglia, and tonic firing in HVC interneurons. Interneuron had firing rate patterns that were consistent over multiple renditions of the same note sequence. We also designed and built a light-weight, low-powered wireless programmable neural stimulator using Bluetooth Low Energy Protocol. It was able to generate perturbations in the song when current pulses were administered to RA, which projects to the brainstem nucleus responsible for syringeal muscle control.

  11. Geology of the Cupsuptic quadrangle, Maine

    Science.gov (United States)

    Harwood, David S.

    1966-01-01

    The Cupsuptic quadrangle, in west-central Maine, lies in a relatively narrow belt of pre-Silurian rocks extending from the Connecticut River valley across northern New Hampshire to north-central Maine. The Albee Formation, composed of green, purple, and black phyllite with interbedded-quartzite, is exposed in the core of a regional anticlinorium overlain to the southeast by greenstone of the Oquossoc Formation which in turn is overlain by black slate of the Kamankeag Formation. In the northern part of the quadrangle the Albee Formation is overlain by black slate, feldspathic graywacke, and minor greenstone of the Dixville Formation. The Kamankeag Formation is dated as 1-ate Middle Ordovician by graptolites (zone 12) found near the base of the unit. The Dixville Formation is correlated with the Kamankeag Formation and Oquossoc Formation and is considered to be Middle Ordovician. The Albee Formation is considered to be Middle to Lower Ordovician from correlations with similar rocks in northeastern and southwestern Vermont. The Oquossoc and Kamankeag Formations are correlated with the Amonoosuc and Partridge Formations of northern New Hampshire. The pre-Silurian rocks are unconformably overlain by unnamed rocks of Silurian age in the southeast, west-central, and northwest ninths of the quadrangle. The basal Silurian units are boulder to cobble polymict conglomerate and quartz-pebble conglomerate of late Lower Silurian (Upper Llandovery) age. The overlying rocks are either well-bedded slate and quartzite, silty limestone, or arenaceous limestone. Thearenaceous limestone contains Upper Silurian (Lower Ludlow) brachiopods. The stratified rocks have been intruded by three stocks of biotite-muscovite quartz monzonite, a large body of metadiorite and associated serpentinite, smaller bodies of gabbro, granodiorite, and intrusive felsite, as well as numerous diabase and quartz monzonite dikes. The metadiorite and serpentinite, and possibly the gabbro and granodiorite are Late

  12. Main tendencies meeting future energy demands

    International Nuclear Information System (INIS)

    Flach, G.; Riesner, W.; Ufer, D.

    1989-09-01

    The economic development in the German Democratic Republic within the preceding 10 years has proved that future stable economic growth of about 4 to 4.5% per annum is only achievable by ways including methods of saving resources. This requires due to the close interdependences between the social development and the level of the development in the energy sector long-term growth rates of the national income of 4 to 4.5% per annum at primary energy growth rates of less than 1% per annum. It comprises three main tendencies: 1. Organization of a system with scientific-technical, technological, economic structural-political and educational measures ensuring in the long term less increase of the energy demand while keeping the economic growth at a constant level. 2. The long-term moderate extension and modernization of the GDR's energy basis is characterized by continuing use of the indigenous brown coal resources for the existing power plant capacities and for district heating. 3. The use of modern and safe nuclear power technologies defines a new and in future more and more important element of the energy basis. Currently about 10% of electricity in the GDR are covered by nuclear energy, in 2000 it will be one third, after 2000 the growth process will continue. The experience shows: If conditions of deepened scientific consideration of all technological processes and the use of modern diagnosis and computer technologies as well as permanent improvement of the safety-technological components and equipment are guaranteed an increasing use of such systems for the production of electricity and heat is socially acceptable. Ensuring a high level of education and technical training of everyone employed in the nuclear energy industry, strict safety restrictions and independent governmental control of these restrictions are important preconditions for the further development in this field. 3 refs, 5 tabs

  13. MAIN TRENDS OF MODERN ART EDUCATION

    Directory of Open Access Journals (Sweden)

    Alla Kozyr

    2016-04-01

    Full Text Available The article deals with the features of the development of art education in Ukraine from the standpoint of the philosophy of modern education. Requirements of educational training standards for future teachers are outlined. This requirements determine not only what teachers need to know, to be able to do, what skills have, but also to create a construction of teacher’s highly skilled work, focused on achieving acmeologic level with the fundamental principles of national identity, socio-cultural conformity, humanism, problematic, learner-centered approach and dialogization in the learning process. The importance of the problem of science-based strategy and tactics of the further development of teacher education as an integrated system of training highly qualified specialists are disclosed due to the modern issues of the educational process. The solution to this problem is aimed at improving the content of professional education of future teachers, which is associated with significant changes in the quality teachers training, which the present day requires. The possibility of improvement of this training can be realized thanks to the classification, validate and implement an integrated system of the formation of professional skills of future teachers, aimed at optimal achievement of the goal. Thus, the main trends of today’s art education are determined. Considering the professional skills of prospective music teachers can only be provided by methodological analysis of this concept, based on the provisions of the dialectical method, system approach and the theory of knowledge and research of the phenomenon of education as a condition of the formation of the perfect work of teachers, because it will justify the skill as a multifactorial and multifaceted phenomenon of education.

  14. Hotel Intercontinental, en Frankfurt-Main (Alemania

    Directory of Open Access Journals (Sweden)

    Apel, Otto

    1966-09-01

    Full Text Available This building has basements, and 21 storeys above the ground. The basements are occupied with the usual services, and a garage, for clients, capable of holding 500 cars. The concierge’s office, the reception office, main hall, restaurant and services are on the ground floor. On the first floor there is a large ball room, where 600 people can assemble, as well as other reception halls. On each of the 2nd to 18th floors there are thirty rooms of one type, and eighteen of another. A luxury apartment occupies the 19th floor, and a restaurant for 200 people as well as a bar is on the top floor. This hotel, which is slab shaped, fits well with its environment and is very pleasantly proportioned.Consta de: planta de sótanos, planta baja y 20 plantas de altura. La planta de sótano contiene las distintas instalaciones; dependencias del personal, etcétera, y un garaje, reservado para los viajeros, capaz de albergar 500 coches. La planta baja comprende: la conserjería, recepción, hall, restaurantes, etc. En la planta primera existe una gran sala de baile para 600 personas, salas de reuniones, etc. Las plantas, de la 2.ª a la 18.ª contienen treinta habitaciones de un tipo y dieciocho de otro, en cada planta. En la planta 19.ª hay un apartamento de lujo. Y en la última planta se distribuyen: un restaurante para 200 personas, bar, etc. El bloque, dentro de su configuración paralelepipédica, es de forma armónica y está perfectamente encajado en el paisaje urbano circundante.

  15. The AGS main magnet power supply upgrade

    International Nuclear Information System (INIS)

    Sandberg, J.N.; Casella, R.; Geller, J.; Marneris, I.; Soukas, A.; Schumburg, N.

    1995-01-01

    The AGS Main Magnet Power Supply consists of a group of thyristor controlled power converters that operate from full rectify to full invert. In order to minimize ripple during the critical periods of injection and extraction 24 pulse converters are used for these portions of the cycle. The maximum voltage available in this mode is nominally 2,000 volts. The converters that are functional during this portion of the cycle are called the flat-top bank or ''F'' bank modules. During acceleration and invert where voltages of up to 12,000 volts are needed and where the ripple requirements are less stringent, groups of twelve pulse converters are operational. These converters are called the Pulsed bank or ''P'' bank modules. The original controlled rectifier system consisted of 96 large mercury filled excitron tubes divided equally between the P bank and F bank converters. These devices were extremely durable and ran successfully for over twenty years. It was, decided to replace the excitron farm with multiple arrangements of three-phase, full-wave, bridge modules that utilize silicon controlled rectifiers (SCR's or thyristors) as the switching element. In order to match the existing transformer connections and buswork, eight identical modules were required; four for the P bank system and four for the F bank system. In order to reduce noise pickup and provide electrical isolation the high level SCR gate triggers are provided via fiberoptic cable. The status of various parameters such as water flow, auxiliary power supply performance, trigger circuitry failure, over voltage, overcurrent, and loss of phase reference are monitored via a programmable logic controller (PLCs). The PLCs use isolated input and output modules for various voltage levels from TTL to 150 Vdc to 125 Vac. These devices are extremely flexible and have allowed modifications and improvements that have enhanced the performance over any equivalent hard wired system

  16. ABS: Sequence alignment by scanning

    KAUST Repository

    Bonny, Mohamed Talal

    2011-08-01

    Sequence alignment is an essential tool in almost any computational biology research. It processes large database sequences and considered to be high consumers of computation time. Heuristic algorithms are used to get approximate but fast results. We introduce fast alignment algorithm, called Alignment By Scanning (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the well-known alignment algorithms, the FASTA (which is heuristic) and the \\'Needleman-Wunsch\\' (which is optimal). The proposed algorithm achieves up to 76% enhancement in alignment score when it is compared with the FASTA Algorithm. The evaluations are conducted using different lengths of DNA sequences. © 2011 IEEE.

  17. ABS: Sequence alignment by scanning

    KAUST Repository

    Bonny, Mohamed Talal; Salama, Khaled N.

    2011-01-01

    Sequence alignment is an essential tool in almost any computational biology research. It processes large database sequences and considered to be high consumers of computation time. Heuristic algorithms are used to get approximate but fast results. We introduce fast alignment algorithm, called Alignment By Scanning (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the well-known alignment algorithms, the FASTA (which is heuristic) and the 'Needleman-Wunsch' (which is optimal). The proposed algorithm achieves up to 76% enhancement in alignment score when it is compared with the FASTA Algorithm. The evaluations are conducted using different lengths of DNA sequences. © 2011 IEEE.

  18. Fast global sequence alignment technique

    KAUST Repository

    Bonny, Mohamed Talal

    2011-11-01

    Bioinformatics database is growing exponentially in size. Processing these large amount of data may take hours of time even if super computers are used. One of the most important processing tool in Bioinformatics is sequence alignment. We introduce fast alignment algorithm, called \\'Alignment By Scanning\\' (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the wellknown sequence alignment algorithms, the \\'GAP\\' (which is heuristic) and the \\'Needleman-Wunsch\\' (which is optimal). The proposed algorithm achieves up to 51% enhancement in alignment score when it is compared with the GAP Algorithm. The evaluations are conducted using different lengths of DNA sequences. © 2011 IEEE.

  19. Multilocus Sequence Typing of Total-Genome-Sequenced Bacteria

    DEFF Research Database (Denmark)

    Larsen, Mette Voldby; Cosentino, Salvatore; Rasmussen, Simon

    2012-01-01

    Accurate strain identification is essential for anyone working with bacteria. For many species, multilocus sequence typing (MLST) is considered the "gold standard" of typing, but it is traditionally performed in an expensive and time-consuming manner. As the costs of whole-genome sequencing (WGS...

  20. SVX Sequencer Board

    International Nuclear Information System (INIS)

    Utes, M.

    1997-01-01

    The SVX Sequencer boards are 9U by 280mm circuit boards that reside in slots 2 through 21 of each of eight Eurocard crates in the D0 Detector Platform. The basic purpose is to control the SVX chips for data acquisition and when a trigger occurs, to gather the SVX data and relay the data to the VRB boards in the Movable Counting House. Functions and features are as follows: (1) Initialization of eight SVX chip strings using the MIL-STD-1553 data bus; (2) Real time manipulation of the SVX control lines to effect data acquisition, digitization, and readout based on the NRZ/Clock signals from the Controller; (3) Conversion of 8-bit electrical SVX readout data to an optical signal operating at 1.062 Gbit/sec, sent to the VRB. Eight HDIs will be serviced per board; (4) Built-in logic analyzer which can record the most important control and data lines during a data acquisition cycle and put this recorded information onto the 1553 bus; (5) Identification header and end of data trailer tacked onto data stream; (6) 1553 register which can read the current values of the control and data lines; (7) 1553 register which can test the optical link; (8) 1553 registers for crossing pulse width, calibration pulse voltage, and calibration pipeline select; (9) 1553 register for reading the optical drivers status link; (10) 1553 register for power control of SVX chips and ignoring bad SVX strings; (11) Front panel displays and LEDs show the board status at a glance; (12) In-system programmable EPLDs are programmed via 1553 or Altera's 'Bitblaster'; (13) Automatic readout abort after 45us; (14) Supplies BUSY signal back to Trigger Framework; (15) Supports a heartbeat system to prevent excessive SVX current draw; and (16) Supports a SVX power trip feature if heartbeat failure occurs.

  1. Sequence Algebra, Sequence Decision Diagrams and Dynamic Fault Trees

    International Nuclear Information System (INIS)

    Rauzy, Antoine B.

    2011-01-01

    A large attention has been focused on the Dynamic Fault Trees in the past few years. By adding new gates to static (regular) Fault Trees, Dynamic Fault Trees aim to take into account dependencies among events. Merle et al. proposed recently an algebraic framework to give a formal interpretation to these gates. In this article, we extend Merle et al.'s work by adopting a slightly different perspective. We introduce Sequence Algebras that can be seen as Algebras of Basic Events, representing failures of non-repairable components. We show how to interpret Dynamic Fault Trees within this framework. Finally, we propose a new data structure to encode sets of sequences of Basic Events: Sequence Decision Diagrams. Sequence Decision Diagrams are very much inspired from Minato's Zero-Suppressed Binary Decision Diagrams. We show that all operations of Sequence Algebras can be performed on this data structure.

  2. Sequence protein identification by randomized sequence database and transcriptome mass spectrometry (SPIDER-TMS): from manual to automatic application of a 'de novo sequencing' approach.

    Science.gov (United States)

    Pascale, Raffaella; Grossi, Gerarda; Cruciani, Gabriele; Mecca, Giansalvatore; Santoro, Donatello; Sarli Calace, Renzo; Falabella, Patrizia; Bianco, Giuliana

    Sequence protein identification by a randomized sequence database and transcriptome mass spectrometry software package has been developed at the University of Basilicata in Potenza (Italy) and designed to facilitate the determination of the amino acid sequence of a peptide as well as an unequivocal identification of proteins in a high-throughput manner with enormous advantages of time, economical resource and expertise. The software package is a valid tool for the automation of a de novo sequencing approach, overcoming the main limits and a versatile platform useful in the proteomic field for an unequivocal identification of proteins, starting from tandem mass spectrometry data. The strength of this software is that it is a user-friendly and non-statistical approach, so protein identification can be considered unambiguous.

  3. Pleiades rapid rotators - evidence for an evolutionary sequence

    International Nuclear Information System (INIS)

    Butler, R.P.; Marcy, G.W.; Cohen, R.D.; Duncan, D.K.; California Univ., La Jolla; Space Telescope Science Institute, Baltimore, MD)

    1987-01-01

    Four rapidly rotating early-K dwarfs in the Pleiades are shown to contain an order of magnitude more Li than four slow rotators of the same spectral type, as would be expected if they were systematically younger. This supports the idea that late-type stars first arrive on the main sequence with V(rot) greater than about 100 km/s, that they spin down to V(rot) less than about 10 km/s in 10 to the 7th to 10 to the 8th yr, and that the Pleiades lower main sequence shows such an age spread. 14 references

  4. PLEIADES SYSTEM ARCHITECTURE AND MAIN PERFORMANCES

    Directory of Open Access Journals (Sweden)

    M. A. Gleyzes

    2012-07-01

    Full Text Available France, under the leadership of the French Space Agency (CNES, has set up a cooperative program with Austria, Belgium, Spain, Sweden, in order to develop a space Earth Observation system called PLEIADES. PLEIADES is a dual system, this means that it is intended to fulfill an extended panel of both civilian and Defense user’s needs.. This paper reports the status of the satellite after its launch and the in orbit commissioning, the PLEIADES satellite first model has been launched at the end of year 2011, the second model will be launched about 12 months later. It describes the main mission characteristics and performances status. It exposes how the system, satellite and ground segment have been designed in order to be compliant with a dual exploitation between civilian and defense partners. The system is based on the use of a set of newly European developed technologies to feature the satellite. In order to maximize the agility of the satellite, weight and inertia have been reduced using a compact hexagonal shape for the satellite bus. The optical mission consists in Earth optical observation composed of 0.7 m nadir resolution for the panchromatic band and 2.8 m nadir resolution for the four multi-spectral bands. The image swath is about 20 km. PLEIADES delivers optical high resolution products consisting in a Panchromatic image, into which is merged a four multispectral bands image, orthorectified on a Digital Terrain Model (DTM. Thanks to the huge satellite agility obtained with control momentum gyros as actuators, the optical system delivers as well instantaneous stereo images, under different stereoscopic conditions and mosaic images, issued from along the track thus enlarging the field of view. The ground segment is composed of a dual ground center located in CNES Toulouse premises in charge of preparing the dual mission command plan and of the real time contacts with the satellite through a control center. The dual ground center

  5. Main Achievements 2003-2004 - Nuclear Physics

    International Nuclear Information System (INIS)

    2005-01-01

    Two Departments of our Institute are engaged in nuclear studies, in the following areas: studies of the nuclear reaction mechanism at low, intermediate and high energies, studies of nuclear structure by means of gamma spectroscopy, and theoretical research concerning nuclear structure and reaction mechanisms. Most of these studies are carried out in the form of international collaborations with the world-leading nuclear physics experimental facilities. Our physicists usually play an important role in these collaborative projects and often lead them. Nuclear structure experiments were performed mainly within the following European Large Scale Facilities: ALPI-INFN-Legnaro, VIVITRONIReS-Strasbourg, UNILAC/SIS-GSI-Darmstadt, K100-Cyclotron-Jyvaeskylea with the use of the GASP, GARFIELD, EUROBALL, ICARE, RISING + FRS, RITU+JUROGAM systems and with the application of RFD, HECTOR, DIAMANT, EUCLIDES ancillary detectors. Experimental data were also obtained at the Argonne National Laboratory, USA, with the GAMMASPHERE array and the ATLAS accelerator. In addition, we are involved in planning the experiments for the project of international accelerator facility of the next generation FAIR (Facility for Antiproton and Ion Research) at GSI. The nuclear reaction experiments were performed at the Joint Institute of Nuclear Physics in Dubna (collaborations FASA and COMBAS), in GANIL in Caen, in the Forschungszentrum Juelich at the accelerator COSY in the framework of collaboration PISA, as well as at the Warsaw Laboratory of Heavy Ions. The hadronic nuclear physics experiments were carried out exclusively at the Forschungszentrum Juelich where we have participated in international collaborations COSY11, GEM and HIRES. Recently, we have joined international detector project WASA planned at Forschungszentrum Juelich and plan to participate in the project PANDA, being constructed in GSI Darmstadt. Both detectors will be devoted to low and intermediate hadronic physics. We also

  6. Seismic sequences in the Sombrero Seismic Zone

    Science.gov (United States)

    Pulliam, J.; Huerfano, V. A.; ten Brink, U.; von Hillebrandt, C.

    2007-05-01

    unrelated events in plots of the general catalog. One characteristic of these sequences is that their magnitudes tend to be consistently small (1.0 - 3.5 mb, with only five events greater than 3.5 mb) and they typically do not include an event that could confidently be identified as a "main" shock. Nevertheless, the numbers of events, temporal and geographic distribution of shocks in each sequence suggests that these are aftershock sequences, yet none includes an event that could confidently be identified as a "main" shock. This observation suggests several questions. Do these sequences truly represent aftershocks? If so, where are the main events? Are they perhaps related to "silent" or "slow" earthquakes in the subduction zone? If so, could such slow earthquakes be related to the dropping away of the subducting slab beneath the deep Puerto Rico Trench? Or do the sequences indicate tearing of the NA lithosphere of the North America plate as it subducts beneath the Caribbean plate?

  7. Description of the Main Features of the Series Production of the LHC Main Dipole Magnets

    CERN Document Server

    Savary, F; Chevret, P; de Rijk, G; Fessia, P; Liénard, P; Miles, J; Modena, M; Rossi, L; Tommasini, D; Vlogaert, J; Bresson, D; Grunblatt, G; Decoene, JF; Bressani, F; Drago, G; Gagliardi, P; Eysselein, F; Gärtner, W; Lublow, P

    2008-01-01

    The series production of the LHC main dipole magnets was completed in November 2006. This paper presents the organization implemented at CERN and the milestones fixed to fullfil the technical requirements and to respect the master schedule of the machine installation. The CERN organization for the production follow-up, the quality assurance and the magnet testing, as well as the organization of the three main contractors will be described. A description of the design work and procurement of most of the specific heavy tooling and key components will be given with emphasis on the advantages and drawbacks.

  8. Quantiprot - a Python package for quantitative analysis of protein sequences.

    Science.gov (United States)

    Konopka, Bogumił M; Marciniak, Marta; Dyrka, Witold

    2017-07-17

    The field of protein sequence analysis is dominated by tools rooted in substitution matrices and alignments. A complementary approach is provided by methods of quantitative characterization. A major advantage of the approach is that quantitative properties defines a multidimensional solution space, where sequences can be related to each other and differences can be meaningfully interpreted. Quantiprot is a software package in Python, which provides a simple and consistent interface to multiple methods for quantitative characterization of protein sequences. The package can be used to calculate dozens of characteristics directly from sequences or using physico-chemical properties of amino acids. Besides basic measures, Quantiprot performs quantitative analysis of recurrence and determinism in the sequence, calculates distribution of n-grams and computes the Zipf's law coefficient. We propose three main fields of application of the Quantiprot package. First, quantitative characteristics can be used in alignment-free similarity searches, and in clustering of large and/or divergent sequence sets. Second, a feature space defined by quantitative properties can be used in comparative studies of protein families and organisms. Third, the feature space can be used for evaluating generative models, where large number of sequences generated by the model can be compared to actually observed sequences.

  9. Radioecological monitoring of south Caucasus - main results

    International Nuclear Information System (INIS)

    Tsitskishvili, M.S; Chazaradze, R.E.; Katamadze, N.M.; Intskirveli, L.N.; Chxartishvili, A.G.; Gugushvili, B.S.; Tsitskishvili, N.B.; Saneblidze, O.I.

    2002-01-01

    Basing in surrounding ambience at present radioactive on its origin possible to split into two main groups: artificial and natural radioactive. How is obvious from the most names, natural based in the nature nearly with first days of its shaping and are its by the component. Artificial - not existed or not saved in the nature - having radioactive characteristics isotopes 'appeared' as a result artificial doing atoms. Getting into surrounding ambience as a result person activity artificial (systematically or episodic detectable there) possible conditionally split into three subgroups. Artificial radioactive isotopes, got into surrounding natural ambience as a result anthropogenic activity, in principal (ecological) are distinguished from the natural radioactive isotopes by fetters and particularities to migration on ecological chains, but, consequently, and nature 'influence'. Sufficiently remind that if in biosphere practically no ecological niches, in which goes an accumulation natural, capable to give significant dozing effect; for the artificial (isotopes of iodine, isotopes a strontium, caesium) exactly ability be accumulated in separate 'niches' ecological chain or in separate organs or weaving an organism (thyroid gland for the iodine) do artificial radioisotopes hygienic extremely dangerous. Location of Caucasus in the area of approximate location of firing ranges of test, (after the series 1961-1962 conducted by USSR in the North hemisphere this were test China) and damages on Chernobyl, in the area of most intensity stratosphere - troposphere exchange, manifests themselves: 1. Early approach spring-year maximum; 2. More clear maximum in the seasonal move; 3. The Greater fallout levels in contrast with other regions of country; 4. The Greater 'sensitivity' to 'fresh' products. Structure of global fallout on the under investigation region is stipulated: 1. Decreasing the fallout levels from the north on the south. 2. Vertical fallout levels (growth with the

  10. Chameleon sequences in neurodegenerative diseases

    International Nuclear Information System (INIS)

    Bahramali, Golnaz; Goliaei, Bahram; Minuchehr, Zarrin; Salari, Ali

    2016-01-01

    Chameleon sequences can adopt either alpha helix sheet or a coil conformation. Defining chameleon sequences in PDB (Protein Data Bank) may yield to an insight on defining peptides and proteins responsible in neurodegeneration. In this research, we benefitted from the large PDB and performed a sequence analysis on Chameleons, where we developed an algorithm to extract peptide segments with identical sequences, but different structures. In order to find new chameleon sequences, we extracted a set of 8315 non-redundant protein sequences from the PDB with an identity less than 25%. Our data was classified to “helix to strand (HE)”, “helix to coil (HC)” and “strand to coil (CE)” alterations. We also analyzed the occurrence of singlet and doublet amino acids and the solvent accessibility in the chameleon sequences; we then sorted out the proteins with the most number of chameleon sequences and named them Chameleon Flexible Proteins (CFPs) in our dataset. Our data revealed that Gly, Val, Ile, Tyr and Phe, are the major amino acids in Chameleons. We also found that there are proteins such as Insulin Degrading Enzyme IDE and GTP-binding nuclear protein Ran (RAN) with the most number of chameleons (640 and 405 respectively). These proteins have known roles in neurodegenerative diseases. Therefore it can be inferred that other CFP's can serve as key proteins in neurodegeneration, and a study on them can shed light on curing and preventing neurodegenerative diseases.

  11. Direct, rapid RNA sequence analysis

    International Nuclear Information System (INIS)

    Peattie, D.A.

    1987-01-01

    The original methods of RNA sequence analysis were based on enzymatic production and chromatographic separation of overlapping oligonucleotide fragments from within an RNA molecule followed by identification of the mononucleotides comprising the oligomer. Over the past decade the field of nucleic acid sequencing has changed dramatically, however, and RNA molecules now can be sequenced in a variety of more streamlined fashions. Most of the more recent advances in RNA sequencing have involved one-dimensional electrophoretic separation of 32 P-end-labeled oligoribonucleotides on polyacrylamide gels. In this chapter the author discusses two of these methods for determining the nucleotide sequences of RNA molecules rapidly: the chemical method and the enzymatic method. Both methods are direct and degradative, i.e., they rely on fragmatic and chemical approaches should be utilized. The single-strand-specific ribonucleases (A, T 1 , T 2 , and S 1 ) provide an efficient means to locate double-helical regions rapidly, and the chemical reactions provide a means to determine the RNA sequence within these regions. In addition, the chemical reactions allow one to assign interactions to specific atoms and to distinguish secondary interactions from tertiary ones. If the RNA molecule is small enough to be sequenced directly by the enzymatic or chemical method, the probing reactions can be done easily at the same time as sequencing reactions

  12. Chameleon sequences in neurodegenerative diseases.

    Science.gov (United States)

    Bahramali, Golnaz; Goliaei, Bahram; Minuchehr, Zarrin; Salari, Ali

    2016-03-25

    Chameleon sequences can adopt either alpha helix sheet or a coil conformation. Defining chameleon sequences in PDB (Protein Data Bank) may yield to an insight on defining peptides and proteins responsible in neurodegeneration. In this research, we benefitted from the large PDB and performed a sequence analysis on Chameleons, where we developed an algorithm to extract peptide segments with identical sequences, but different structures. In order to find new chameleon sequences, we extracted a set of 8315 non-redundant protein sequences from the PDB with an identity less than 25%. Our data was classified to "helix to strand (HE)", "helix to coil (HC)" and "strand to coil (CE)" alterations. We also analyzed the occurrence of singlet and doublet amino acids and the solvent accessibility in the chameleon sequences; we then sorted out the proteins with the most number of chameleon sequences and named them Chameleon Flexible Proteins (CFPs) in our dataset. Our data revealed that Gly, Val, Ile, Tyr and Phe, are the major amino acids in Chameleons. We also found that there are proteins such as Insulin Degrading Enzyme IDE and GTP-binding nuclear protein Ran (RAN) with the most number of chameleons (640 and 405 respectively). These proteins have known roles in neurodegenerative diseases. Therefore it can be inferred that other CFP's can serve as key proteins in neurodegeneration, and a study on them can shed light on curing and preventing neurodegenerative diseases. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Farey sequences and resistor networks

    Indian Academy of Sciences (India)

    Green's function, while the perturbation of a network is investigated in [3]. ... In Theorem 1 below, we employ the Farey sequence to establish a strict .... We next show that the Farey sequence method is applicable for circuits with n or fewer.

  14. DNA Sequencing by Capillary Electrophoresis

    Science.gov (United States)

    Karger, Barry L.; Guttman, Andras

    2009-01-01

    Sequencing of human and other genomes has been at the center of interest in the biomedical field over the past several decades and is now leading toward an era of personalized medicine. During this time, DNA sequencing methods have evolved from the labor intensive slab gel electrophoresis, through automated multicapillary electrophoresis systems using fluorophore labeling with multispectral imaging, to the “next generation” technologies of cyclic array, hybridization based, nanopore and single molecule sequencing. Deciphering the genetic blueprint and follow-up confirmatory sequencing of Homo sapiens and other genomes was only possible by the advent of modern sequencing technologies that was a result of step by step advances with a contribution of academics, medical personnel and instrument companies. While next generation sequencing is moving ahead at break-neck speed, the multicapillary electrophoretic systems played an essential role in the sequencing of the Human Genome, the foundation of the field of genomics. In this prospective, we wish to overview the role of capillary electrophoresis in DNA sequencing based in part of several of our articles in this journal. PMID:19517496

  15. Graphene nanodevices for DNA sequencing

    NARCIS (Netherlands)

    Heerema, S.J.; Dekker, C.

    2016-01-01

    Fast, cheap, and reliable DNA sequencing could be one of the most disruptive innovations of this decade, as it will pave the way for personalized medicine. In pursuit of such technology, a variety of nanotechnology-based approaches have been explored and established, including sequencing with

  16. Chameleon sequences in neurodegenerative diseases

    Energy Technology Data Exchange (ETDEWEB)

    Bahramali, Golnaz [Institute of Biochemistry and Biophysics, University of Tehran, Tehran (Iran, Islamic Republic of); Goliaei, Bahram, E-mail: goliaei@ut.ac.ir [Institute of Biochemistry and Biophysics, University of Tehran, Tehran (Iran, Islamic Republic of); Minuchehr, Zarrin, E-mail: minuchehr@nigeb.ac.ir [Department of Systems Biotechnology, National Institute of Genetic Engineering and Biotechnology, (NIGEB), Tehran (Iran, Islamic Republic of); Salari, Ali [Department of Systems Biotechnology, National Institute of Genetic Engineering and Biotechnology, (NIGEB), Tehran (Iran, Islamic Republic of)

    2016-03-25

    Chameleon sequences can adopt either alpha helix sheet or a coil conformation. Defining chameleon sequences in PDB (Protein Data Bank) may yield to an insight on defining peptides and proteins responsible in neurodegeneration. In this research, we benefitted from the large PDB and performed a sequence analysis on Chameleons, where we developed an algorithm to extract peptide segments with identical sequences, but different structures. In order to find new chameleon sequences, we extracted a set of 8315 non-redundant protein sequences from the PDB with an identity less than 25%. Our data was classified to “helix to strand (HE)”, “helix to coil (HC)” and “strand to coil (CE)” alterations. We also analyzed the occurrence of singlet and doublet amino acids and the solvent accessibility in the chameleon sequences; we then sorted out the proteins with the most number of chameleon sequences and named them Chameleon Flexible Proteins (CFPs) in our dataset. Our data revealed that Gly, Val, Ile, Tyr and Phe, are the major amino acids in Chameleons. We also found that there are proteins such as Insulin Degrading Enzyme IDE and GTP-binding nuclear protein Ran (RAN) with the most number of chameleons (640 and 405 respectively). These proteins have known roles in neurodegenerative diseases. Therefore it can be inferred that other CFP's can serve as key proteins in neurodegeneration, and a study on them can shed light on curing and preventing neurodegenerative diseases.

  17. Commercial Art: Scope and Sequence.

    Science.gov (United States)

    Nashville - Davidson County Metropolitan Public Schools, TN.

    This scope and sequence guide, developed for a commercial art vocational education program, represents an initial step in the development of a systemwide articulated curriculum sequence for all vocational programs within the Metropolitan Nashville Public School System. It was developed as a result of needs expressed by teachers, parents, and the…

  18. Rapid Diagnostics of Onboard Sequences

    Science.gov (United States)

    Starbird, Thomas W.; Morris, John R.; Shams, Khawaja S.; Maimone, Mark W.

    2012-01-01

    Keeping track of sequences onboard a spacecraft is challenging. When reviewing Event Verification Records (EVRs) of sequence executions on the Mars Exploration Rover (MER), operators often found themselves wondering which version of a named sequence the EVR corresponded to. The lack of this information drastically impacts the operators diagnostic capabilities as well as their situational awareness with respect to the commands the spacecraft has executed, since the EVRs do not provide argument values or explanatory comments. Having this information immediately available can be instrumental in diagnosing critical events and can significantly enhance the overall safety of the spacecraft. This software provides auditing capability that can eliminate that uncertainty while diagnosing critical conditions. Furthermore, the Restful interface provides a simple way for sequencing tools to automatically retrieve binary compiled sequence SCMFs (Space Command Message Files) on demand. It also enables developers to change the underlying database, while maintaining the same interface to the existing applications. The logging capabilities are also beneficial to operators when they are trying to recall how they solved a similar problem many days ago: this software enables automatic recovery of SCMF and RML (Robot Markup Language) sequence files directly from the command EVRs, eliminating the need for people to find and validate the corresponding sequences. To address the lack of auditing capability for sequences onboard a spacecraft during earlier missions, extensive logging support was added on the Mars Science Laboratory (MSL) sequencing server. This server is responsible for generating all MSL binary SCMFs from RML input sequences. The sequencing server logs every SCMF it generates into a MySQL database, as well as the high-level RML file and dictionary name inputs used to create the SCMF. The SCMF is then indexed by a hash value that is automatically included in all command

  19. Accident sequence quantification with KIRAP

    International Nuclear Information System (INIS)

    Kim, Tae Un; Han, Sang Hoon; Kim, Kil You; Yang, Jun Eon; Jeong, Won Dae; Chang, Seung Cheol; Sung, Tae Yong; Kang, Dae Il; Park, Jin Hee; Lee, Yoon Hwan; Hwang, Mi Jeong.

    1997-01-01

    The tasks of probabilistic safety assessment(PSA) consists of the identification of initiating events, the construction of event tree for each initiating event, construction of fault trees for event tree logics, the analysis of reliability data and finally the accident sequence quantification. In the PSA, the accident sequence quantification is to calculate the core damage frequency, importance analysis and uncertainty analysis. Accident sequence quantification requires to understand the whole model of the PSA because it has to combine all event tree and fault tree models, and requires the excellent computer code because it takes long computation time. Advanced Research Group of Korea Atomic Energy Research Institute(KAERI) has developed PSA workstation KIRAP(Korea Integrated Reliability Analysis Code Package) for the PSA work. This report describes the procedures to perform accident sequence quantification, the method to use KIRAP's cut set generator, and method to perform the accident sequence quantification with KIRAP. (author). 6 refs

  20. Accident sequence quantification with KIRAP

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Tae Un; Han, Sang Hoon; Kim, Kil You; Yang, Jun Eon; Jeong, Won Dae; Chang, Seung Cheol; Sung, Tae Yong; Kang, Dae Il; Park, Jin Hee; Lee, Yoon Hwan; Hwang, Mi Jeong

    1997-01-01

    The tasks of probabilistic safety assessment(PSA) consists of the identification of initiating events, the construction of event tree for each initiating event, construction of fault trees for event tree logics, the analysis of reliability data and finally the accident sequence quantification. In the PSA, the accident sequence quantification is to calculate the core damage frequency, importance analysis and uncertainty analysis. Accident sequence quantification requires to understand the whole model of the PSA because it has to combine all event tree and fault tree models, and requires the excellent computer code because it takes long computation time. Advanced Research Group of Korea Atomic Energy Research Institute(KAERI) has developed PSA workstation KIRAP(Korea Integrated Reliability Analysis Code Package) for the PSA work. This report describes the procedures to perform accident sequence quantification, the method to use KIRAP`s cut set generator, and method to perform the accident sequence quantification with KIRAP. (author). 6 refs.