WorldWideScience

Sample records for Chen Zhang Pot historical relic manufacturing technology

  1. Review of the genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae) with description of two new species.

    Science.gov (United States)

    Chang, Zhi-Min; Yang, Lin; Zhang, Zheng-Guang; Chen, Xiang-Sheng

    2015-12-11

    Two new species of the issid genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae): Neotetricodes longispinus Chang et Chen sp. nov. (China: Yunnan) and Neotetricodes xiphoideus Chang et Chen sp. nov. (China: Yunnan) are described and illustrated. The generic characteristic is redefined. A checklist and key to the species of the genus are provided. The female genitalia of the genus are firstly described.

  2. H CHEN

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. H CHEN. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 51. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study · H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG · More Details ...

  3. w zhang

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. W ZHANG. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 51. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study · H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG · More Details ...

  4. p zhang

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. P ZHANG. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 51. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study · H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG · More Details ...

  5. Immunogenicity of novel sulfadimethoxide conjugates | Chen ...

    African Journals Online (AJOL)

    Immunogenicity of novel sulfadimethoxide conjugates. L Chen, J Su, X Zhang, L Li, X He. Abstract. Sulfadimethoxine (SDM) is an antibiotic commonly added to animal feeds. Anti-SDM antibodies are useful for the detection of residual SDM in foods, feeds and biological fluids by ELISA. In this study, we show that SDM is ...

  6. a Review of Digital Watermarking and Copyright Control Technology for Cultural Relics

    Science.gov (United States)

    Liu, H.; Hou, M.; Hu, Y.

    2018-04-01

    With the rapid growth of the application and sharing of the 3-D model data in the protection of cultural relics, the problem of Shared security and copyright control of the three-dimensional model of cultural relics is becoming increasingly prominent. Followed by a digital watermarking copyright control has become the frontier technology of 3-D model security protection of cultural relics and effective means, related technology research and application in recent years also got further development. 3-D model based on cultural relics digital watermarking and copyright control technology, introduces the research background and demand, its unique characteristics were described, and its development and application of the algorithm are discussed, and the prospects of the future development trend and some problems and the solution.

  7. Detection of lead (pb and aluminum (Al metal as contaminant in food prepared by using locally manufactured cooked pots (Hala in Kosti City, Sudan

    Directory of Open Access Journals (Sweden)

    EI Salah

    2015-06-01

    Full Text Available The objectives of this study are to assess the quantities of Aluminu m; lead released into the food from locally manufactured cooked pots (Aluminium pots in Kosti market. Seven types of pots (Pistons, Cartels, Kettles, Kettles + trays, Pepsi cans, Atmonia and Steel which is locally manufactured cooked pots (Hala were used. Amount of Al and Pb that leaked into the food from locally manufactured cooked pots were assessed by using Atomic Absorption Spectroscopy. The results were indicated that highly significance amount of Aluminum and lead which were leaked into the food that prepared by locally manufactured cooked pots (Hala.The analysis of urine for 10 selected randomly individuals that used locally manufactured cooked pots (Hala for preparation their food were indicated highly amount of Aluminum and Lead in their urine. DOI: http://dx.doi.org/10.3126/ije.v4i2.12621 International Journal of Environment Vol.4(2 2015: 19-26

  8. Analysis on the environment of cultural relic as tourist attraction--take Yungang Grottoes as an example

    Science.gov (United States)

    Xiangdong, Zhu; Jie, Bai

    2018-03-01

    Cultural relic resources are precious non-renewable resources and an important cornerstone for the development of cultural relic tourism. With the rapid development of tourism industry, the native environment of cultural relics is being squeezed constantly. Meanwhile, under the economic interests, cultural relic’s protection and heritage tourism contradictions continue to intensify. The present era which the architectural style is convergence, cultural relics protection is simplistic, restore historical sites blindly and other. In the historical process of economic development and the acceleration of new-type urbanization, the heritage industry faces the dual tasks and development challenges. As cultural relic protection workers, investigation of the utilization of cultural relic’s tourist attractions, investigation and analysis of the Yungang Grottoes, indicating cultural relics as a tourist attraction, not only to strengthen the protection of ontology, also should attach importance to the coordinated development of the protection of cultural relics and the utilization of tourism.

  9. Advances in research on protection of stone relics by science and technology methods%石质文物科技保护研究进展

    Institute of Scientific and Technical Information of China (English)

    叶良; 李强强; 孙平平

    2016-01-01

    总结了石质文物病害机理研究及病害检测技术、石质文物清洗方法、石质文物保护材料、石质文物监测方法、现代化信息技术,在石质文物科技保护中的应用等方面的研究现状和取得的重要成就,并针对石质文物科技保护在保护材料、仪器设备等方面现存的问题提出了一些建议。%This paper summarized research situation and great achievements obtained in stone cultural relics disease mechanism research and disease detection technology ,stone cultural relics cleaning method ,materials for stone cultural relics conservation ,stone cultural relics monitoring method ,the application of modern information technology in stone cultural relics protection . Based on that ,some suggestions are put forward for the problems existed in protection of stone relics by science and technology methods in protective materials ,equipment and other aspects .

  10. Research on Splicing Method of Digital Relic Fragment Model

    Science.gov (United States)

    Yan, X.; Hu, Y.; Hou, M.

    2018-04-01

    In the course of archaeological excavation, a large number of pieces of cultural relics were unearthed, and the restoration of these fragments was done manually by traditional arts and crafts experts. In this process, cultural relics experts often try to splice the existing cultural relics, and then use adhesive to stick together the fragments of correct location, which will cause irreversible secondary damage to cultural relics. In order to minimize such damage, the surveyors combine 3D laser scanning with computer technology, and use the method of establishing digital cultural relics fragments model to make virtual splicing of cultural relics. The 3D software on the common market can basically achieve the model translation and rotation, using this two functions can be achieved manually splicing between models, mosaic records after the completion of the specific location of each piece of fragments, so as to effectively reduce the damage to the relics had tried splicing process.

  11. Application of 3d Model of Cultural Relics in Virtual Restoration

    Science.gov (United States)

    Zhao, S.; Hou, M.; Hu, Y.; Zhao, Q.

    2018-04-01

    In the traditional cultural relics splicing process, in order to identify the correct spatial location of the cultural relics debris, experts need to manually splice the existing debris. The repeated contact between debris can easily cause secondary damage to the cultural relics. In this paper, the application process of 3D model of cultural relic in virtual restoration is put forward, and the relevant processes and ideas are verified with the example of Terracotta Warriors data. Through the combination of traditional cultural relics restoration methods and computer virtual reality technology, virtual restoration of high-precision 3D models of cultural relics can provide a scientific reference for virtual restoration, avoiding the secondary damage to the cultural relics caused by improper restoration. The efficiency and safety of the preservation and restoration of cultural relics have been improved.

  12. APPLICATION OF 3D MODEL OF CULTURAL RELICS IN VIRTUAL RESTORATION

    Directory of Open Access Journals (Sweden)

    S. Zhao

    2018-04-01

    Full Text Available In the traditional cultural relics splicing process, in order to identify the correct spatial location of the cultural relics debris, experts need to manually splice the existing debris. The repeated contact between debris can easily cause secondary damage to the cultural relics. In this paper, the application process of 3D model of cultural relic in virtual restoration is put forward, and the relevant processes and ideas are verified with the example of Terracotta Warriors data. Through the combination of traditional cultural relics restoration methods and computer virtual reality technology, virtual restoration of high-precision 3D models of cultural relics can provide a scientific reference for virtual restoration, avoiding the secondary damage to the cultural relics caused by improper restoration. The efficiency and safety of the preservation and restoration of cultural relics have been improved.

  13. Mortal Ancestors, Immortal Images: Zhang Dai’s Biographical Portraits

    Directory of Open Access Journals (Sweden)

    Duncan M. Campbell

    2012-11-01

    Full Text Available Towards the end of his long life, the prolific late-Ming historian and essayist Zhang Dai 張岱 (1597-?1684 completed a book that he had been working on for many years. Entitled Portraits of the Eminent and Worthy Immortals of Zhejiang During the Ming Dynasty (You Ming yuyue san bu xiu tuzan 有明於越三不朽名賢圖贊 the book included the short biographies (with poetic panegyrics and portraits of 109 men and women of Zhang Dai’s hometown of Shaoxing, one of the epicentres of China’s élite cultural life. The book was organised according to the “Three Immortalities of Life”: moral force, meritorious service, and wise words. Zhang also included a number of his own friends and family members in this collection. This paper discusses aspects the relationship between text and image in this late-imperial Chinese work, both in the context of Zhang Dai’s practice as a biographer who had a strong visual sense and in regard to his particular historical plight as someone who had survived the collapse of one dynasty and who had lived on under its successor regime.

  14. zhang xiurong

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. ZHANG XIURONG. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 48. Structures and electronic properties of W m Cu n ( n + m ≤ 7 ) clusters · YU ZHICHENG ZHANG XIURONG HUO PEIYING GAO KUN · More Details Abstract Fulltext PDF.

  15. Terrestrial photovoltaic technologies - Recent progress in manufacturing R&D

    Energy Technology Data Exchange (ETDEWEB)

    Witt, C. E.; Surek, T.; Mitchell, R. L.; Symko-Davies, M.; Thomas, H. P.

    2000-05-15

    This paper describes photovoltaics (PV) as used for energy generation in terrestrial applications. A brief historical perspective of PV development is provided. Solar-to-electricity conversion efficiencies for various photovoltaic materials are presented, as well as expectations for further material improvements. Recent progress in reducing manufacturing costs through process R&D and product improvements are described. Applications that are most suitable for the different technologies are discussed. Finally, manufacturing capacities and current and projected module manufacturing costs are presented.

  16. Advanced Manufacturing Technologies

    Science.gov (United States)

    Fikes, John

    2016-01-01

    Advanced Manufacturing Technologies (AMT) is developing and maturing innovative and advanced manufacturing technologies that will enable more capable and lower-cost spacecraft, launch vehicles and infrastructure to enable exploration missions. The technologies will utilize cutting edge materials and emerging capabilities including metallic processes, additive manufacturing, composites, and digital manufacturing. The AMT project supports the National Manufacturing Initiative involving collaboration with other government agencies.

  17. 76 FR 71048 - Sixth Annual Philip S. Chen, Jr. Distinguished Lecture on Innovation and Technology Transfer

    Science.gov (United States)

    2011-11-16

    ... present ``Treatment of Cancer with Recombinant Immunotoxins: From Technology Transfer to the Patient.'' Dr. Pastan is an NIH Distinguished Investigator and Chief, Laboratory of Molecular Biology, National Cancer Institute Center for Cancer Research. This annual series honors Dr. Philip S. Chen, Jr. for his almost 50...

  18. “The Godly Greedy Appetite”: New Relic Circulation in the Early Modern World

    Directory of Open Access Journals (Sweden)

    Igor Pérez Tostado

    2017-05-01

    Full Text Available Having lost all monasteries and a good deal of its medieval Christian movable assets, England became one of the greatest producers of new Catholic relics during the sixteenth and seventeenth centuries. This article aims to look, from a material point of view, at the circulation and consumption of English relics on the Catholic continent. In this case, these products were created because of violence and circulated as an answer to it. Gifts and the exchange of relics served to obtain support for the exiled Catholics and for the institutions providing for their education created in the continent, and allowed them to participate in the necropolitics of the Spanish Monarchy. Relics, artifacts and printed and manuscript narratives brought back from all over the world helped construct a selfimage of an English Catholic as a necrocommunity imbued by a sense of historical continuity and connected to a global imagined community.

  19. Discussion of impact of relics activation on protection and utilization approaches-take the old summer palace as an example

    Science.gov (United States)

    Xiaoqi, J.

    2015-08-01

    As the popularization of cultural relics and the rapid development of cultural tourism industry, a large number of cultural relic tourism resources goes into public eyes. Activation of relics has became an important way for tourist to contact and understand culture relics. The way of how to properly interpret the historical sense and cultural uniqueness to the masses of tourists in order to achieve social service functions of relic resources has always been research focal point of site protection and utilization, so nowadays it has important significance to protection and utilization of heritage resources in our country. From the point of activation of relics and based on the analysis of resource characteristic, the paper in depth discuss ways of activation of relics of the Old Summer Palace, in order to provide reference for sustainable development of sites tourism in China.

  20. Historical Financial Data - Domestic Automobile Manufacturers

    Science.gov (United States)

    1979-01-01

    A historical financial data base was developed for the four major U.S. automobile manufacturers, focusing on the specific operations associated with production and marketing of automobiles and light trucks. The years subject to analysis were 1967-197...

  1. Corrosion Testing of Hybrid Welded Stainless Steel Pot

    DEFF Research Database (Denmark)

    Sondrup, Lars de Caldas; Bagger, Claus; Olsen, Flemming Ove

    2004-01-01

    Investigation of the use of hybrid welding by preparation of tailored blanks for the manufacturing of a deep drawn pot.......Investigation of the use of hybrid welding by preparation of tailored blanks for the manufacturing of a deep drawn pot....

  2. How Managers Sense and Seize “Hyped” Technologies

    DEFF Research Database (Denmark)

    Schiele, Kristen; Rydén, Pernille

    A rapid proliferation of online consumer review systems has become common in diverse industries, such as tourism (Xiang and Gretzel 2010), box office movies (Duan, Gu, andWhinston 2008; Dellarocas, Zhang and Awad 2007), online books (Chevalier and Mayzlin 2006;Chen, Wu, and Yoon 2004), and video ...... (Dellarocas 2003), and the popularity of online reviews has increased acknowledgement of the potential of social media to provide the organization with information, resources, and networks (Constantinides and Fountain 2008).......A rapid proliferation of online consumer review systems has become common in diverse industries, such as tourism (Xiang and Gretzel 2010), box office movies (Duan, Gu, andWhinston 2008; Dellarocas, Zhang and Awad 2007), online books (Chevalier and Mayzlin 2006;Chen, Wu, and Yoon 2004), and video...

  3. Space and Intermediality in Jia Zhang-ke’s Still Life

    Directory of Open Access Journals (Sweden)

    Cecília Mello

    2014-07-01

    Full Text Available This article is dedicated to an analysis of Chinese director Jia Zhang-ke’s film Still Life (San Xia Hao Ren 三峡好人, 2006 from the point of view of its intermedial relationship with Chinese landscape painting. As I will suggest, Jia’s discovery of a real landscape and a vanishing cityscape in this film, shot on location in the region of the Three Gorges of the Yangtze River, springs from a realist impulse and from an original aesthetic response to a new historical and social conjuncture. But while it seems firmly located in the landscape of contemporary China, the film also shares aesthetic qualities with the tradition of Chinese landscape painting, mounted on hanging or hand scrolls. A focus on this particular instance of intermediality leads to a reflection on cinema’s spatial organization in light of current revisions in film and audiovisual theory, which suggest that filmic space and its spectatorial experience should be considered above all from the point of view of touch and movement. It also allows for a broader understanding of the political implications of intermediality in Jia Zhang-ke’s oeuvre, fruit of an organic link between form and content that brings a historical resonance to a contemporary perspective.

  4. The physics of relic neutrinos

    International Nuclear Information System (INIS)

    Dighe, A.; Pastor, S.; Smirnov, A.

    1998-12-01

    We report on the main results presented at the workshop on the Physics of Relic Neutrinos. The study of relic neutrinos involves a broad spectrum of problems in particle physics, astrophysics and cosmology. Features of baryogenesis and leptogenesis could be imprinted in the properties of the relic neutrino sea. Relic neutrinos played a crucial role in the big bang nucleosynthesis. Being the hot component of the dark matter, they have participated in the structure formation in the universe. Although the direct detection of the sea seems impossible at this stage, there could be various indirect manifestations of these neutrinos which would allow us to study the properties of the sea both in the past and at the present epoch. (author)

  5. Polyethylenimine-based micro/nanoparticles as vaccine adjuvants [Corrigendum

    Directory of Open Access Journals (Sweden)

    Shen C

    2017-10-01

    Full Text Available Shen C, Li J, Zhang Y, et al. Int J Nano. 2017;12:5443–5460.The affiliations were presented as:Chen Shen1Jun Li1Yi Zhang1Yuce Li2Guanxin Shen3Jintao Zhu2Juan Tao11Department of Dermatology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China; 2School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan, China; 3Department of Immunology, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, ChinaThe affiliations should have contained the postcodes and are corrected here:Chen Shen1Jun Li1Yi Zhang1Yuce Li2Guanxin Shen3Jintao Zhu2Juan Tao11Department of Dermatology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China; 2School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074, China; 3Department of Immunology, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, ChinaRead the original article

  6. The Shroud of Turin: Relic or icon?

    International Nuclear Information System (INIS)

    Dale, W.S.A.

    1987-01-01

    The Shroud of Turin, a linen cloth on which appear the imprints of the front and back of a crucified man, can be historically traced to ca. 1354 A.D. Many believe it to be a true relic of the Passion of Christ. Many others regard it as a fake. This paper suggests a third alternative, that it is an icon dating from the 11th century. If future scientific tests, of which radiocarbon dating will be the most important, support this theory, the Shroud of Turin may well be recognized as one of the masterpieces of Christian art. (orig.)

  7. "Pipa Fairy Maiden" Zhang Hongyan

    Institute of Scientific and Technical Information of China (English)

    1995-01-01

    WHEN Zhang Hongyan plays the completely traditional Chinese musical instrument, the pipa, she is called a "pipa fairy maiden" by her audiences, "the pipa queen with outstanding talent and appearance" by the Hong Kong press and "a national flower of the Women Philharmonic Orchestra" in Singapore. Having completed her master’s degree program at the folk music department of the Central Conservatory of Music. Zhang is continuing there as a teacher. On the unforgettable night of June 9, 1992, Zhang Hongyan presented her first solo concerto concert at the Beijing Concert Hall, in cooperation with the celebrated Central Philharmonic Orchestra based in Beijing and its famous conductor Hu Yongyan. This concert made her the first folk musical instrument player to present a special concerto concert in cooperation with a Western style orchestra. It is the result of many years of effort. Zhang was born in Shengxian County, Zhejiang Province, famous as the home of Yue Opera. Her father is a musician with a Yue Opera

  8. Manufacturing technologies

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-09-01

    The Manufacturing Technologies Center is an integral part of Sandia National Laboratories, a multiprogram engineering and science laboratory, operated for the Department of Energy (DOE) with major facilities at Albuquerque, New Mexico, and Livermore, California. Our Center is at the core of Sandia`s Advanced Manufacturing effort which spans the entire product realization process.

  9. Advanced manufacturing: Technology diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Tesar, A.

    1995-12-01

    In this paper we examine how manufacturing technology diffuses rom the developers of technology across national borders to those who do not have the capability or resources to develop advanced technology on their own. None of the wide variety of technology diffusion mechanisms discussed in this paper are new, yet the opportunities to apply these mechanisms are growing. A dramatic increase in technology diffusion occurred over the last decade. The two major trends which probably drive this increase are a worldwide inclination towards ``freer`` markets and diminishing isolation. Technology is most rapidly diffusing from the US In fact, the US is supplying technology for the rest of the world. The value of the technology supplied by the US more than doubled from 1985 to 1992 (see the Introduction for details). History shows us that technology diffusion is inevitable. It is the rates at which technologies diffuse to other countries which can vary considerably. Manufacturers in these countries are increasingly able to absorb technology. Their manufacturing efficiency is expected to progress as technology becomes increasingly available and utilized.

  10. Relics in galaxy clusters at high radio frequencies

    Science.gov (United States)

    Kierdorf, M.; Beck, R.; Hoeft, M.; Klein, U.; van Weeren, R. J.; Forman, W. R.; Jones, C.

    2017-04-01

    Aims: We investigated the magnetic properties of radio relics located at the peripheries of galaxy clusters at high radio frequencies, where the emission is expected to be free of Faraday depolarization. The degree of polarization is a measure of the magnetic field compression and, hence, the Mach number. Polarization observations can also be used to confirm relic candidates. Methods: We observed three radio relics in galaxy clusters and one radio relic candidate at 4.85 and 8.35 GHz in total emission and linearly polarized emission with the Effelsberg 100-m telescope. In addition, we observed one radio relic candidate in X-rays with the Chandra telescope. We derived maps of polarization angle, polarization degree, and Faraday rotation measures. Results: The radio spectra of the integrated emission below 8.35 GHz can be well fitted by single power laws for all four relics. The flat spectra (spectral indices of 0.9 and 1.0) for the so-called Sausage relic in cluster CIZA J2242+53 and the so-called Toothbrush relic in cluster 1RXS 06+42 indicate that models describing the origin of relics have to include effects beyond the assumptions of diffuse shock acceleration. The spectra of the radio relics in ZwCl 0008+52 and in Abell 1612 are steep, as expected from weak shocks (Mach number ≈2.4). Polarization observations of radio relics offer a method of measuring the strength and geometry of the shock front. We find polarization degrees of more than 50% in the two prominent Mpc-sized radio relics, the Sausage and the Toothbrush, which are among the highest percentages of linear polarization detected in any extragalactic radio source to date. This is remarkable because the large beam size of the Effelsberg single-dish telescope corresponds to linear extensions of about 300 kpc at 8.35 GHz at the distances of the relics. The high degree of polarization indicates that the magnetic field vectors are almost perfectly aligned along the relic structure, as expected for shock

  11. Overview of the Photovoltaic Manufacturing Technology (PVMaT) project

    International Nuclear Information System (INIS)

    Witt, C.E.; Mitchell, R.L.; Mooney, G.D.

    1993-08-01

    The Photovoltaic Manufacturing Technology (PVMaT) project is a historic government/industry photovoltaic (PV) manufacturing R ampersand D partnership composed of joint efforts between the federal government (through the US Department of Energy) and members of the US PV industry. The project's ultimate goal is to ensure that the US industry retains and extends its world leadership role in the manufacture and commercial development of PV components and systems. PVMaT is designed to do this by helping the US PV industry improve manufacturing processes, accelerate manufacturing cost reductions for PV modules, improve commercial product performance, and lay the groundwork for a substantial scale-up of US-based PV manufacturing capacities. Phase 1 of the project, the problem identification phase, was completed in early 1991. Phase 2, the problem solution phase, which addresses process-specific problems of specific manufacturers, is now underway with an expected duration of 5 years. Phase 3 addresses R ampersand D problems that are relatively common to a number of PV companies or the PV industry as a whole. These ''generic'' problem areas are being addressed through a teamed research approach

  12. Manufacturing engineering and technology

    CERN Document Server

    Kalpakjian, Serope; Vijai Sekar, K S

    2014-01-01

    For courses in manufacturing processes at two- or four-year schools. An up-to-date text that provides a solid background in manufacturing processes. Manufacturing Engineering and Technology, SI Edition, 7e, presents a mostly qualitative description of the science, technology, and practice of manufacturing. This includes detailed descriptions of manufacturing processes and the manufacturing enterprise that will help introduce students to important concepts. With a total of 120 examples and case studies, up-to-date and comprehensive coverage of all topics, and superior two-color graphics, this text provides a solid background for manufacturing students and serves as a valuable reference text for professionals. Teaching and Learning Experience To provide a better teaching and learning experience, for both instructors and students, this program will: * Apply Theory and/or Research: An excellent overview of manufacturing conceptswith a balance of relevant fundamentals and real-world practices. * Engage Students: E...

  13. The Smell of Relics: Authenticating Saintly Bones and the Role of Scent in the Sensory Experience of Medieval Christian Veneration

    Directory of Open Access Journals (Sweden)

    Paul Anthony Brazinski

    2013-09-01

    Full Text Available ''The archaeology of smell is a burgeoning field in recent scholarship. This paper adds to existing literature by investigating the function of smell in relation to relic sales and veneration in medieval Europe, a hitherto understudied area of research. Collating historical texts concerning the translatio of saintly relics in Western Europe and the Byzantine Empire with archaeological sources associated with relic veneration and religious worship (including ampullae, unguentaria, sarcophagi, holy oils, pillow graves, and silk, this paper suggests that (1 smell was used in the medieval world as a means to challenge or confirm a relic’s authenticity, and (2 olfactory liquids that imbued or permeated material objects in the context of worship functioned as a means of focusing attention on relic veneration and were an essential part of the cult and/or pilgrimage experience.

  14. Sociology in Times of Crisis: Chen Da, National Salvation and the Indigenization of Knowledge

    Directory of Open Access Journals (Sweden)

    Ana Maria Candela

    2015-08-01

    Full Text Available Chen Da was one of the foremost sociologists of China from the 1920s to the 1940s. His intellectual habitus took shape from the long crisis that defined Chinese intellectual life from the mid-19th to mid-20th centuries, a period of continuous imperial assault on Chinese sovereignty. As China integrated into the capitalist world-system, neo-Confucian structures of knowledge came into question. Intellectuals took up sociology to guide China’s transition from an empire to a nation-state. Through his studies on labor, migration, and population, Chen Da contributed to the institutionalization of sociology in China. Chen sought to craft a theory of Chinese development that followed universal trajectories of progress but was also attuned to the complexity of Chinese society on the ground. Through his efforts to indigenize sociology, Chen developed a non-Marxist historical materialism, a deterritorialized and pluralistic conceptualization of China as a nation, and a theory of eugenic transformation centered on the concept of “mode of living.” The questions which Chen Da confronted are emblematic of the predicament faced by Chinese social scientists today, who again struggle with the dynamics of a deterritorialzied “Greater China,” rising social fragmentation, and refigured eugenic discourses and policies that aim to craft the Chinese people into ideal national subjects fit for post-socialist development.

  15. dujuan zhang

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. DUJUAN ZHANG. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 59. In vitro bioactivity evaluation of α -calcium sulphate hemihydrate and bioactive glass composites for their potential use in bone regeneration · YANYAN ZHENG CHENGDONG ...

  16. Cloud manufacturing distributed computing technologies for global and sustainable manufacturing

    CERN Document Server

    Mehnen, Jörn

    2013-01-01

    Global networks, which are the primary pillars of the modern manufacturing industry and supply chains, can only cope with the new challenges, requirements and demands when supported by new computing and Internet-based technologies. Cloud Manufacturing: Distributed Computing Technologies for Global and Sustainable Manufacturing introduces a new paradigm for scalable service-oriented sustainable and globally distributed manufacturing systems.   The eleven chapters in this book provide an updated overview of the latest technological development and applications in relevant research areas.  Following an introduction to the essential features of Cloud Computing, chapters cover a range of methods and applications such as the factors that actually affect adoption of the Cloud Computing technology in manufacturing companies and new geometrical simplification method to stream 3-Dimensional design and manufacturing data via the Internet. This is further supported case studies and real life data for Waste Electrical ...

  17. Composites Manufacturing Education and Technology Facility Expedites Manufacturing Innovation

    Energy Technology Data Exchange (ETDEWEB)

    2017-01-01

    The Composites Manufacturing Education and Technology facility (CoMET) at the National Wind Technology Center at the National Renewable Energy Laboratory (NREL) paves the way for innovative wind turbine components and accelerated manufacturing. Available for use by industry partners and university researchers, the 10,000-square-foot facility expands NREL's composite manufacturing research capabilities by enabling researchers to design, prototype, and test composite wind turbine blades and other components -- and then manufacture them onsite. Designed to work in conjunction with NREL's design, analysis, and structural testing capabilities, the CoMET facility expedites manufacturing innovation.

  18. Energetics Manufacturing Technology Center (EMTC)

    Data.gov (United States)

    Federal Laboratory Consortium — The Energetics Manufacturing Technology Center (EMTC), established in 1994 by the Office of Naval Research (ONR) Manufacturing Technology (ManTech) Program, is Navy...

  19. Tribology in Manufacturing Technology

    CERN Document Server

    2013-01-01

    The present book aims to provide research advances on tribology in manufacturing technology for modern industry. This book can be used as a research book for final undergraduate engineering course (for example, mechanical, manufacturing, materials, etc) or as a subject on manufacturing at the postgraduate level. Also, this book can serve as a useful reference for academics, manufacturing and tribology researchers, mechanical, mechanical, manufacturing and materials engineers, professionals in related industries with manufacturing and tribology.

  20. Relic gravitational waves and cosmology

    International Nuclear Information System (INIS)

    Grishchuk, Leonid P

    2005-01-01

    The paper begins with a brief recollection of interactions of the author with Ya B Zeldovich in the context of the study of relic gravitational waves. The principles and early results on the quantum-mechanical generation of cosmological perturbations are then summarized. The expected amplitudes of relic gravitational waves differ in various frequency windows, and therefore the techniques and prospects of their detection are distinct. One section of the paper describes the present state of efforts in direct detection of relic gravitational waves. Another section is devoted to indirect detection via the anisotropy and polarization measurements of the cosmic microwave background (CMB) radiation. It is emphasized throughout the paper that the inference about the existence and expected amount of relic gravitational waves is based on a solid theoretical foundation and the best available cosmological observations. It is also explained in great detail what went wrong with the so-called 'inflationary gravitational waves', whose amount is predicted by inflationary theorists to be negligibly small, thus depriving them of any observational significance. (reviews of topical problems)

  1. Training for New Manufacturing Technologies.

    Science.gov (United States)

    Jacobs, James

    1988-01-01

    Examines the effects of computer-based manufacturing technologies on employment opportunities and job skills. Describes the establishment of the Industrial Technology Institute in Michigan to develop and utilize advanced manufacturing technologies, and the institute's relationship to the state's community colleges. Reviews lessons learned from…

  2. Ping Zhang

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. PING ZHANG. Articles written in Bulletin of Materials Science. Volume 36 Issue 6 November 2013 pp 1073-1077. Intrinsic structure and friction properties of graphene and graphene oxide nanosheets studied by scanning probe microscopy · Yan-Huai Ding Hu-Ming Ren Fei-Hu ...

  3. Technological dispute for manufacturing population

    Directory of Open Access Journals (Sweden)

    B.M. Hevko

    2017-12-01

    Full Text Available New designs of technological equipment are presented – a variegated unit for adjusting the machine for precise manufacturing of a cut or on a tool of a tester, or on a workpiece, and also a design of a control device for measuring average diameters of taps. An important element in the manufacture of cutting tools is the manufacture of appropriate technological equipment. So for the manufacture of taps, it is necessary to develop the design of technological equipment for the adjustment of the necessary design parameters, as well as the design of control devices for their parameters. To provide these operations to instruments are the requirements of accuracy, productivity, stability, cost of production and a number of others. The new design of the technological equipment for the adjustment of the machine for precise manufacturing of the cutting is presented. The design of the control device for measuring the average diameter of the taps is also given. The advantages of the device include improving the quality of processing and working out the design on the technological.

  4. New Jurassic tettigarctid cicadas from China with a novel example of disruptive coloration

    Directory of Open Access Journals (Sweden)

    Jun Chen

    2016-12-01

    Full Text Available Tettigarctidae is the most primitive family of Cicadoidea, with only two relict species. Although they are relatively well known from Eurasia, Australia, Africa, and South America, their Mesozoic examples are typically preserved only as isolated forewings. Herein, a new genus Sanmai Chen, Zhang, and B. Wang with three new species (Sanmai kongi Chen, Zhang, and B. Wang, S. mengi Chen, Zhang, and B. Wang, and S. xuni Chen, Zhang, and B. Wang are described based on fossil specimens from the Middle–Upper Jurassic of northeastern China, with well-preserved body structures, forewing and hindwing venations, making it the hitherto best known extinct tettigarctid taxon. The new genus, provisionally assigned to the tribe Turutanoviini, provides some new information about the evolution and palaeobiogeography of Mesozoic Tettigarctidae. The genus Paraprosbole is synonymized with Shuraboprosbole. In addition, the coloration pattern of forewing, prominent on some specimens of Sanmai kongi Chen, Zhang, and B. Wang sp. nov. and Sanmai xuni Chen, Zhang, and B. Wang sp. nov., represents a novel example of disruptive coloration in Tettigarctidae, which can effectively break up the body outline as well as surface, and so likely enabled these cicadas to reduce the detectability of potential predators.

  5. Horseshoes in modified Chen's attractors

    International Nuclear Information System (INIS)

    Huang Yan; Yang Xiaosong

    2005-01-01

    In this paper we study dynamics of a class of modified Chen's attractors, we show that these attractors are chaotic by giving a rigorous verification for existence of horseshoes in these systems. We prove that the Poincare maps derived from these modified Chen's attractors are semi-conjugate to the 2-shift map

  6. Experience Scaling Up Manufacturing of Emerging Photovoltaic Technologies

    Energy Technology Data Exchange (ETDEWEB)

    Braun, G. W.; Skinner, D. E.

    2007-01-01

    This report examines two important generic photovoltaic technologies at particularly revealing stages of development, i.e., the stages between R&D and stable commercial production and profitable sales. Based on two historical cases, it attempts to shed light on the difference between: (1) costs and schedules validated by actual manufacturing and market experience, and (2) estimated costs and schedules that rely on technology forecasts and engineering estimates. The amorphous Silicon case also identifies some of the costs that are incurred in meeting specific market requirements, while the Cadmium Telluride case identifies many of the operational challenges involved in transferring R&D results to production. The transition between R&D and commercial success takes a great deal of time and money for emerging energy conversion technologies in general. The experience reported here can be instructive to those managing comparable efforts, and to their investors. It can also be instructive to R&D managers responsible for positioning such new technologies for commercial success.

  7. Technological assessment of local manufacturers for wind turbine blade manufacturing in Pakistan

    Science.gov (United States)

    Mahmood, Khurram; Haroon, General

    2012-11-01

    Composite materials manufacturing industry is one of the world's hi-tech industry. Manufacturing of wind turbine blades is one of the specialized fields requiring high degree of precision and composite manufacturing techniques. This paper identifies the industries specializing in the composite manufacturing and is able to manufacture wind turbines blades in Pakistan. In the second phase, their technology readiness level is determined, based on some factors and then a readiness level are assigned to them. The assigned technology readiness level will depict the absorptive capacity of each manufacturing unit and its capability to take on such projects. The individual readiness level of manufacturing unit will then be used to establish combined technology readiness level of Pakistan particularly for wind turbine blades manufacturing. The composite manufacturing industry provides many spin offs and a diverse range of products can be manufactured using this facility. This research will be helpful to categorize the strong points and flaws of local industry for the gap analysis. It can also be used as a prerequisite study before the evaluation of technologies and specialties to improve the industry of the country for the most favorable results. This will form a basic data base which can be used for the decision making related to transfer of technology, training of local skilled workers and general up-gradation of the local manufacturing units.

  8. African Journal of Biotechnology - Vol 10, No 60 (2011)

    African Journals Online (AJOL)

    Microsatellite variability reveals significant genetic differentiation of giant pandas (Ailuropoda melanoleuca) in the Minshan A habitat · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Yang, R Hou, F Shen, X Yang, L Zhang, L Chen, W Chen, W Zhang, Q Zhu, Z Zhang ...

  9. AMS radiocarbon dating of medieval textile relics: The frocks and the pillow of St. Francis of Assisi

    Energy Technology Data Exchange (ETDEWEB)

    Fedi, M.E. [Dipartimento di Fisica dell' Universita di Firenze and INFN Sezione di Firenze, via Sansone 1, 50019 Sesto Fiorentino (Italy)], E-mail: fedi@fi.infn.it; Cartocci, A.; Taccetti, F.; Mando, P.A. [Dipartimento di Fisica dell' Universita di Firenze and INFN Sezione di Firenze, via Sansone 1, 50019 Sesto Fiorentino (Italy)

    2008-05-15

    Since natural textiles usually originate from short-lived organisms, they can represent a useful material to date samples from historical periods with a good accuracy. In this work, we present a set of radiocarbon measurements on medieval textile relics: two woollen habits and a pillow traditionally associated with St. Francis of Assisi, the saint patron of Italy. The strategy in choosing samples for radiocarbon dating is first discussed and the procedures for measurements - performed at the 3 MV Tandetron accelerator of Laboratorio di Tecniche Nucleari per i Beni Culturali (LABEC), Florence - are described; AMS results for the two frocks showed that only one of them, presently kept in the church of St. Francis in Cortona, is compatible with the Saint's period of life, as is the pillow also kept in Cortona. Another frock attributed to St. Francis appears to date from at least 80 years after his death. However, the goal of these measurements was not a bare authentication/disconfirmation of the relics; they just represent an example of how scientific analysis can integrate with humanistic studies. Indeed, AMS results, combined with a thorough analysis of the textiles typologies, confirmed the historical hypotheses based on documentary studies and on tradition. The overall conclusions contributed to the decisions taken for conservation, and have as a whole enhanced the religious importance of the relics.

  10. AMS radiocarbon dating of medieval textile relics: The frocks and the pillow of St. Francis of Assisi

    International Nuclear Information System (INIS)

    Fedi, M.E.; Cartocci, A.; Taccetti, F.; Mando, P.A.

    2008-01-01

    Since natural textiles usually originate from short-lived organisms, they can represent a useful material to date samples from historical periods with a good accuracy. In this work, we present a set of radiocarbon measurements on medieval textile relics: two woollen habits and a pillow traditionally associated with St. Francis of Assisi, the saint patron of Italy. The strategy in choosing samples for radiocarbon dating is first discussed and the procedures for measurements - performed at the 3 MV Tandetron accelerator of Laboratorio di Tecniche Nucleari per i Beni Culturali (LABEC), Florence - are described; AMS results for the two frocks showed that only one of them, presently kept in the church of St. Francis in Cortona, is compatible with the Saint's period of life, as is the pillow also kept in Cortona. Another frock attributed to St. Francis appears to date from at least 80 years after his death. However, the goal of these measurements was not a bare authentication/disconfirmation of the relics; they just represent an example of how scientific analysis can integrate with humanistic studies. Indeed, AMS results, combined with a thorough analysis of the textiles typologies, confirmed the historical hypotheses based on documentary studies and on tradition. The overall conclusions contributed to the decisions taken for conservation, and have as a whole enhanced the religious importance of the relics

  11. AMS radiocarbon dating of medieval textile relics: The frocks and the pillow of St. Francis of Assisi

    Science.gov (United States)

    Fedi, M. E.; Cartocci, A.; Taccetti, F.; Mandò, P. A.

    2008-05-01

    Since natural textiles usually originate from short-lived organisms, they can represent a useful material to date samples from historical periods with a good accuracy. In this work, we present a set of radiocarbon measurements on medieval textile relics: two woollen habits and a pillow traditionally associated with St. Francis of Assisi, the saint patron of Italy. The strategy in choosing samples for radiocarbon dating is first discussed and the procedures for measurements - performed at the 3 MV Tandetron accelerator of Laboratorio di Tecniche Nucleari per i Beni Culturali (LABEC), Florence - are described; AMS results for the two frocks showed that only one of them, presently kept in the church of St. Francis in Cortona, is compatible with the Saint's period of life, as is the pillow also kept in Cortona. Another frock attributed to St. Francis appears to date from at least 80 years after his death. However, the goal of these measurements was not a bare authentication/disconfirmation of the relics; they just represent an example of how scientific analysis can integrate with humanistic studies. Indeed, AMS results, combined with a thorough analysis of the textiles typologies, confirmed the historical hypotheses based on documentary studies and on tradition. The overall conclusions contributed to the decisions taken for conservation, and have as a whole enhanced the religious importance of the relics.

  12. Using Innovative Technologies for Manufacturing Rocket Engine Hardware

    Science.gov (United States)

    Betts, E. M.; Eddleman, D. E.; Reynolds, D. C.; Hardin, N. A.

    2011-01-01

    Many of the manufacturing techniques that are currently used for rocket engine component production are traditional methods that have been proven through years of experience and historical precedence. As the United States enters into the next space age where new launch vehicles are being designed and propulsion systems are being improved upon, it is sometimes necessary to adopt innovative techniques for manufacturing hardware. With a heavy emphasis on cost reduction and improvements in manufacturing time, rapid manufacturing techniques such as Direct Metal Laser Sintering (DMLS) are being adopted and evaluated for their use on NASA s Space Launch System (SLS) upper stage engine, J-2X, with hopes of employing this technology on a wide variety of future projects. DMLS has the potential to significantly reduce the processing time and cost of engine hardware, while achieving desirable material properties by using a layered powder metal manufacturing process in order to produce complex part geometries. Marshall Space Flight Center (MSFC) has recently hot-fire tested a J-2X gas generator (GG) discharge duct that was manufactured using DMLS. The duct was inspected and proof tested prior to the hot-fire test. Using a workhorse gas generator (WHGG) test fixture at MSFC's East Test Area, the duct was subjected to extreme J-2X hot gas environments during 7 tests for a total of 537 seconds of hot-fire time. The duct underwent extensive post-test evaluation and showed no signs of degradation. DMLS manufacturing has proven to be a viable option for manufacturing rocket engine hardware, and further development and use of this manufacturing method is recommended.

  13. Zhang functions and various models

    CERN Document Server

    Zhang, Yunong

    2015-01-01

    This book focuses on solving different types of time-varying problems. It presents various Zhang dynamics (ZD) models by defining various Zhang functions (ZFs) in real and complex domains. It then provides theoretical analyses of such ZD models and illustrates their results. It also uses simulations to substantiate their efficacy and show the feasibility of the presented ZD approach (i.e., different ZFs leading to different ZD models), which is further applied to the repetitive motion planning (RMP) of redundant robots, showing its application potential.

  14. Using Innovative Technologies for Manufacturing and Evaluating Rocket Engine Hardware

    Science.gov (United States)

    Betts, Erin M.; Hardin, Andy

    2011-01-01

    Many of the manufacturing and evaluation techniques that are currently used for rocket engine component production are traditional methods that have been proven through years of experience and historical precedence. As we enter into a new space age where new launch vehicles are being designed and propulsion systems are being improved upon, it is sometimes necessary to adopt new and innovative techniques for manufacturing and evaluating hardware. With a heavy emphasis on cost reduction and improvements in manufacturing time, manufacturing techniques such as Direct Metal Laser Sintering (DMLS) and white light scanning are being adopted and evaluated for their use on J-2X, with hopes of employing both technologies on a wide variety of future projects. DMLS has the potential to significantly reduce the processing time and cost of engine hardware, while achieving desirable material properties by using a layered powdered metal manufacturing process in order to produce complex part geometries. The white light technique is a non-invasive method that can be used to inspect for geometric feature alignment. Both the DMLS manufacturing method and the white light scanning technique have proven to be viable options for manufacturing and evaluating rocket engine hardware, and further development and use of these techniques is recommended.

  15. Challenges in teaching modern manufacturing technologies

    Science.gov (United States)

    Ngaile, Gracious; Wang, Jyhwen; Gau, Jenn-Terng

    2015-07-01

    Teaching of manufacturing courses for undergraduate engineering students has become a challenge due to industrial globalisation coupled with influx of new innovations, technologies, customer-driven products. This paper discusses development of a modern manufacturing course taught concurrently in three institutions where students collaborate in executing various projects. Lectures are developed to contain materials featuring advanced manufacturing technologies, R&D trends in manufacturing. Pre- and post-surveys were conducted by an external evaluator to assess the impact of the course on increase in student's knowledge of manufacturing; increase students' preparedness and confidence in effective communication and; increase students' interest in pursuing additional academic studies and/or a career path in manufacturing and high technology. The surveyed data indicate that the students perceived significant gains in manufacturing knowledge and preparedness in effective communication. The study also shows that implementation of a collaborative course within multiple institutions requires a robust and collective communication platform.

  16. Emerging technologies in arthroplasty: additive manufacturing.

    Science.gov (United States)

    Banerjee, Samik; Kulesha, Gene; Kester, Mark; Mont, Michael A

    2014-06-01

    Additive manufacturing is an industrial technology whereby three-dimensional visual computer models are fabricated into physical components by selectively curing, depositing, or consolidating various materials in consecutive layers. Although initially developed for production of simulated models, the technology has undergone vast improvements and is currently increasingly being used for the production of end-use components in various aerospace, automotive, and biomedical specialties. The ability of this technology to be used for the manufacture of solid-mesh-foam monolithic and coated components of complex geometries previously considered unmanufacturable has attracted the attention of implant manufacturers, bioengineers, and orthopedic surgeons. Currently, there is a paucity of reports describing this fabrication method in the orthopedic literature. Therefore, we aimed to briefly describe this technology, some of the applications in other orthopedic subspecialties, its present use in hip and knee arthroplasty, and concerns with the present form of the technology. As there are few reports of clinical trials presently available, the true benefits of this technology can only be realized when studies evaluating the clinical and radiographic outcomes of cementless implants manufactured with additive manufacturing report durable fixation, less stress shielding, and better implant survivorship. Nevertheless, the authors believe that this technology holds great promise and may potentially change the conventional methods of casting, machining, and tooling for implant manufacturing in the future. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

  17. Titanisierung von Implantatoberflächen

    Science.gov (United States)

    Zimmermann, Hanngörg; Heinlein, Markus; Guldner, Norbert W.

    Titan gilt seit Jahrzehnten als einer der wichtigsten Implantatwerkstoffe in der Medizin. Neben den guten mechanischen Eigenschaften (Leichtigkeit, hohe Festigkeit etc.), besitzen Titanimplantate vor allem eine hervorragende Körperverträglichkeit, so dass die Implantate optimal in den humanen Organismus integriert werden [1]. Ist jedoch aufgrund der Anforderungen an das Implantat eine hohe Flexibilität und/ oder Elastizität gefragt, so scheidet der Werkstoff Titan aufgrund seiner spröden und unflexiblen Materialeigenschaften aus. Die Folge ist der Einsatz von Implantatmaterialien, sowohl künstlichen als auch biologischen Ursprungs, welche nicht selten eine unzureichende Biokompatibilität aufweisen und somit zu Fremdköper- und immunologischen Reaktionen und Einkapselung des Implantates führen können. Die Erhöhung der Körperverträglichkeit, eine Adaption an das biologische Umfeld und eine hohe Biokompatibilität sind demzufolge die wichtigsten Eigenschaften bei der bedarfsgerechten Herstellung von Implantaten und Implantatoberflächen. Zur Gestaltung von innovativen, biokompatiblen Oberflächen stehen unterschiedliche technische Lösungsansätze zur Verfügung. Zum einen besteht die Möglichkeit, geeignete Oberflächeneigenschaften aus dem Grundmaterial selbst zu optimieren. Dies geschieht unter anderem durch Modifikation der Werkstoffoberflächen in Form von Texturierungen und Oberflächenrauhigkeiten. Zum anderen können die Oberflächeneigenschaften unabhängig von denen des Trägermaterials gestaltet werden. Durch Funktionalisierung der Oberflächen mit geeigneten Beschichtungen oder der Zugabe von Medikamenten (Drug Eluting) werden die Kunststoffimplantate dahingehend verändert, dass eine Steigerung der Körperakzeptanz erreicht wird. Die Titanbeschichtung von Implantatoberflächen kombiniert die positiven Materialeigenschaften von Titan und Polymer.

  18. Chen Hengzhe

    DEFF Research Database (Denmark)

    Gimpel, Denise

    been the first to write children’s literature. In 1914 she was among the first group of women to gain a Boxer Indemnity grant to study in America. The reiteration of these many “firsts” has led to a rather stereotypical portrait of Chen Hengzhe in Chinese sources and, as a result, in most Western...

  19. A New Probiotic Cheddar Cheese with High ACE-Inhibitory Activity and γ-Aminobutyric Acid Content Produced with Koumiss-Derived Lactobacillus casei Zhang

    Directory of Open Access Journals (Sweden)

    Hai Kuan Wang

    2010-01-01

    Full Text Available Cheddar cheese has been manufactured with Lactobacillus casei Zhang as the dairy starter adjunct. L. casei Zhang had previously been isolated from koumiss collected from Xilin Guole in Inner Mongolia and characterized in detail with regard to their probiotic potential. The addition of L. casei Zhang to Cheddar cheese had no adverse effects on sensory criteria. The cheese made with 0.1, 1 and 2 % of the probiotic strain L. casei Zhang adjuncts contained high levels of the Lactobacillus after 6 months of ripening with final counts of 9.6·10^7, 7.7·10^7 and 1.02·10^8 CFU/g, respectively. In the ripe control cheese, without the addition of probiotic strain L. casei Zhang, the number of Lactobacillus reached 5.7·107 CFU/g. Enterobacterial repetitive intergenic consensus PCR (ERIC-PCR analysis was used to distinguish the added L. casei Zhang from the natural flora of the cheese and to determine whether L. casei Zhang grew in the cheese. ACE-inhibitory activity and γ-aminobutyric acid (GABA concentrations in the cheese were measured. Compared with control cheese, experimental cheese with 0.1, 1 and 2 % of probiotic strain L. casei Zhang revealed some increase in ACE-inhibitory activity and GABA mass fraction. In the present study, the production of both ACE-inhibitory activity and GABA in the probiotic cheese with the L. casei Zhang adjunct isolated from koumiss has been found for the first time. The results suggest that cheese with the probiotic strain L. casei Zhang showed good potential for application in the management of hypertension.

  20. An Assessment of Advanced Manufacturing Technologies Implementation in Manufacturing Enterprises

    Directory of Open Access Journals (Sweden)

    Ghulam Yasin Shaikh

    2011-04-01

    Full Text Available The implementation of AMTs (Advanced Manufacturing Technologies has always been the high interest and core issue for the manufacturing enterprises to get rapid production for global market place. The developed countries have achieved its competitive advantage by implementing this unique model of technologies with full range of systems. In developing countries, the implementation of such technologies is not much common due to so many reasons, (political, social, economical and technical but entrepreneurs of growing economies are contemplating to reshape long term strategy to adopt Computer systems oriented technologies in their manufacturing companies to meet the growing needs of their indigenous market on one hand and to make a place in the international market on the other. Although, very few manufacturing organization do meet the global market requirements. But there is still lot of efforts to be taken for world class competition. An attempt has been made in this paper to develop a conceptual model taking in to account the three parameters such as, Direct, Indirect and Administrative AMTs. This research work further attempts to present an empirical data analysis conducted in the manufacturing enterprises in province of Sindh, Pakistan. The overall indigenous progress of manufacturing enterprises as according to the data collected from 60 companies reveals that the AMTs systems are partially understood and practiced that is also one of the cause towards slow progress of national exchequer.

  1. Smart Manufacturing.

    Science.gov (United States)

    Davis, Jim; Edgar, Thomas; Graybill, Robert; Korambath, Prakashan; Schott, Brian; Swink, Denise; Wang, Jianwu; Wetzel, Jim

    2015-01-01

    Historic manufacturing enterprises based on vertically optimized companies, practices, market share, and competitiveness are giving way to enterprises that are responsive across an entire value chain to demand dynamic markets and customized product value adds; increased expectations for environmental sustainability, reduced energy usage, and zero incidents; and faster technology and product adoption. Agile innovation and manufacturing combined with radically increased productivity become engines for competitiveness and reinvestment, not simply for decreased cost. A focus on agility, productivity, energy, and environmental sustainability produces opportunities that are far beyond reducing market volatility. Agility directly impacts innovation, time-to-market, and faster, broader exploration of the trade space. These changes, the forces driving them, and new network-based information technologies offering unprecedented insights and analysis are motivating the advent of smart manufacturing and new information technology infrastructure for manufacturing.

  2. Handbook of manufacturing engineering and technology

    CERN Document Server

    2015-01-01

    The Springer Reference Work Handbook of Manufacturing Engineering and Technology provides overviews and in-depth and authoritative analyses on the basic and cutting-edge manufacturing technologies and sciences across a broad spectrum of areas. These topics are commonly encountered in industries as well as in academia. Manufacturing engineering curricula across universities are now essential topics covered in major universities worldwide.

  3. Zhang Qing and His Meticulous Chinese Paintings

    Institute of Scientific and Technical Information of China (English)

    JULIE; M.SEGRAVES

    2002-01-01

    ZHANG Qing was initially drawn to the bird and flower paint-ings of the Tang and Song dynasties (7th-12th centuries). Later,Qing Dynasty (1644-1911) artist Ren Bonian, famous for hispaintings of figures, also became an important influence.Although Zhang Qing considers his style to be firmly rooted in tradi-

  4. Advanced manufacturing: Technology and international competitiveness

    Energy Technology Data Exchange (ETDEWEB)

    Tesar, A.

    1995-02-01

    Dramatic changes in the competitiveness of German and Japanese manufacturing have been most evident since 1988. All three countries are now facing similar challenges, and these challenges are clearly observed in human capital issues. Our comparison of human capital issues in German, Japanese, and US manufacturing leads us to the following key judgments: Manufacturing workforces are undergoing significant changes due to advanced manufacturing technologies. As companies are forced to develop and apply these technologies, the constituency of the manufacturing workforce (especially educational requirements, contingent labor, job content, and continuing knowledge development) is being dramatically and irreversibly altered. The new workforce requirements which result due to advanced manufacturing require a higher level of worker sophistication and responsibility.

  5. [Research Progress of Raman Spectroscopy on Dyestuff Identification of Ancient Relics and Artifacts].

    Science.gov (United States)

    He, Qiu-ju; Wang, Li-qin

    2016-02-01

    As the birthplace of Silk Road, China has a long dyeing history. The valuable information about the production time, the source of dyeing material, dyeing process and preservation status were existed in organic dyestuff deriving from cultural relics and artifacts. However, because of the low contents, complex compositions and easily degraded of dyestuff, it is always a challenging task to identify the dyestuff in relics analyzing field. As a finger-print spectrum, Raman spectroscopy owns unique superiorities in dyestuff identification. Thus, the principle, characteristic, limitation, progress and development direction of micro-Raman spectroscopy (MRS/µ-Raman), near infrared reflection and Fourier transform Raman spectroscopy (NIR-FT-Raman), surface-enhanced Raman spectroscopy (SERS) and resonance raman spectroscopy (RRS) have been introduced in this paper. Furthermore, the features of Raman spectra of gardenia, curcumin and other natural dyestuffs were classified by MRS technology, and then the fluorescence phenomena of purpurin excitated with different wavelength laser was compared and analyzed. At last, gray green silver colloidal particles were made as the base, then the colorant of madder was identified combining with thin layer chromatography (TLC) separation technology and SERS, the result showed that the surface enhancement effect of silver colloidal particles could significantly reduce fluorescence background of the Raman spectra. It is pointed out that Raman spectroscopy is a rapid and convenient molecular structure qualitative methodology, which has broad application prospect in dyestuff analysis of cultural relics and artifacts. We propose that the combination of multi-Raman spectroscopy, separation technology and long distance transmission technology are the development trends of Raman spectroscopy.

  6. ENABLING SMART MANUFACTURING TECHNOLOGIES FOR DECISION-MAKING SUPPORT

    Science.gov (United States)

    Helu, Moneer; Libes, Don; Lubell, Joshua; Lyons, Kevin; Morris, KC

    2017-01-01

    Smart manufacturing combines advanced manufacturing capabilities and digital technologies throughout the product lifecycle. These technologies can provide decision-making support to manufacturers through improved monitoring, analysis, modeling, and simulation that generate more and better intelligence about manufacturing systems. However, challenges and barriers have impeded the adoption of smart manufacturing technologies. To begin to address this need, this paper defines requirements for data-driven decision making in manufacturing based on a generalized description of decision making. Using these requirements, we then focus on identifying key barriers that prevent the development and use of data-driven decision making in industry as well as examples of technologies and standards that have the potential to overcome these barriers. The goal of this research is to promote a common understanding among the manufacturing community that can enable standardization efforts and innovation needed to continue adoption and use of smart manufacturing technologies. PMID:28649678

  7. Advances in 3D printing & additive manufacturing technologies

    CERN Document Server

    Pandey, Pulak; Kumar, L

    2017-01-01

    This edited volume comprises select chapters on advanced technologies for 3D printing and additive manufacturing and how these technologies have changed the face of direct, digital technologies for rapid production of models, prototypes and patterns. Because of its wide applications, 3D printing and additive manufacturing technology has become a powerful new industrial revolution in the field of manufacturing. The evolution of 3D printing and additive manufacturing technologies has changed design, engineering and manufacturing processes across industries such as consumer products, aerospace, medical devices and automotives. The objective of this book is to help designers, R&D personnel, and practicing engineers understand the state-of-the-art developments in the field of 3D Printing and Additive Manufacturing. .

  8. Polyethylenimine-based micro/nanoparticles as vaccine adjuvants [Corrigendum

    OpenAIRE

    2017-01-01

    Shen C, Li J, Zhang Y, et al. Int J Nano. 2017;12:5443–5460.The affiliations were presented as:Chen Shen1Jun Li1Yi Zhang1Yuce Li2Guanxin Shen3Jintao Zhu2Juan Tao11Department of Dermatology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China; 2School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan, China; 3Department of Immunology, Tongji Medical College, Huazhong University of Science and Te...

  9. Integrative Genomic and Proteomic Analysis of the Response of Lactobacillus casei Zhang to Glucose Restriction.

    Science.gov (United States)

    Yu, Jie; Hui, Wenyan; Cao, Chenxia; Pan, Lin; Zhang, Heping; Zhang, Wenyi

    2018-03-02

    Nutrient starvation is an important survival challenge for bacteria during industrial production of functional foods. As next-generation sequencing technology has greatly advanced, we performed proteomic and genomic analysis to investigate the response of Lactobacillus casei Zhang to a glucose-restricted environment. L. casei Zhang strains were permitted to evolve in glucose-restricted or normal medium from a common ancestor over a 3 year period, and they were sampled at 1000, 2000, 3000, 4000, 5000, 6000, 7000, and 8000 generations and subjected to proteomic and genomic analyses. Genomic resequencing data revealed different point mutations and other mutational events in each selected generation of L. casei Zhang under glucose restriction stress. The differentially expressed proteins induced by glucose restriction were mostly related to fructose and mannose metabolism, carbohydrate metabolic processes, lyase activity, and amino-acid-transporting ATPase activity. Integrative proteomic and genomic analysis revealed that the mutations protected L. casei Zhang against glucose starvation by regulating other cellular carbohydrate, fatty acid, and amino acid catabolism; phosphoenolpyruvate system pathway activation; glycogen synthesis; ATP consumption; pyruvate metabolism; and general stress-response protein expression. The results help reveal the mechanisms of adapting to glucose starvation and provide new strategies for enhancing the industrial utility of L. casei Zhang.

  10. High flow ceramic pot filters

    NARCIS (Netherlands)

    van Halem, D.; van der Laan, H.; Soppe, A. I.A.; Heijman, S.G.J.

    2017-01-01

    Ceramic pot filters are considered safe, robust and appropriate technologies, but there is a general consensus that water revenues are limited due to clogging of the ceramic element. The objective of this study was to investigate the potential of high flow ceramic pot filters to produce more

  11. Composite fuselage crown panel manufacturing technology

    Science.gov (United States)

    Willden, Kurtis; Metschan, S.; Grant, C.; Brown, T.

    1992-01-01

    Commercial fuselage structures contain significant challenges in attempting to save manufacturing costs with advanced composite technology. Assembly issues, material costs, and fabrication of elements with complex geometry are each expected to drive the cost of composite fuselage structures. Boeing's efforts under the NASA ACT program have pursued key technologies for low-cost, large crown panel fabrication. An intricate bond panel design and manufacturing concepts were selected based on the efforts of the Design Build Team (DBT). The manufacturing processes selected for the intricate bond design include multiple large panel fabrication with the Advanced Tow Placement (ATP) process, innovative cure tooling concepts, resin transfer molding of long fuselage frames, and utilization of low-cost material forms. The process optimization for final design/manufacturing configuration included factory simulations and hardware demonstrations. These efforts and other optimization tasks were instrumental in reducing cost by 18 percent and weight by 45 percent relative to an aluminum baseline. The qualitative and quantitative results of the manufacturing demonstrations were used to assess manufacturing risks and technology readiness.

  12. Japan's technology and manufacturing infrastructure

    Science.gov (United States)

    Boulton, William R.; Meieran, Eugene S.; Tummala, Rao R.

    1995-02-01

    The JTEC panel found that, after four decades of development in electronics and manufacturing technologies, Japanese electronics companies are leaders in the development, support, and management of complex, low-cost packaging and assembly technologies used in the production of a broad range of consumer electronics products. The electronics industry's suppliers provide basic materials and equipment required for electronic packaging applications. Panelists concluded that some Japanese firms could be leading U.S. competitors by as much as a decade in these areas. Japan's technology and manufacturing infrastructure is an integral part of its microelectronics industry's success.

  13. Exploration and implementation of ontology-based cultural relic knowledge map integration platform

    Science.gov (United States)

    Yang, Weiqiang; Dong, Yiqiang

    2018-05-01

    To help designers to better carry out creative design and improve the ability of searching traditional cultural relic information, the ontology-based knowledge map construction method was explored and an integrated platform for cultural relic knowledge map was developed. First of all, the construction method of the ontology of cultural relics was put forward, and the construction of the knowledge map of cultural relics was completed based on the constructed cultural relic otology. Then, a personalized semantic retrieval framework for creative design was proposed. Finally, the integrated platform of the knowledge map of cultural relics was designed and realized. The platform was divided into two parts. One was the foreground display system, which was used for designers to search and browse cultural relics. The other was the background management system, which was for cultural experts to manage cultural relics' knowledge. The research results showed that the platform designed could improve the retrieval ability of cultural relic information. To sum up, the platform can provide a good support for the designer's creative design.

  14. 48 CFR 235.006-70 - Manufacturing Technology Program.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Manufacturing Technology... CONTRACTING 235.006-70 Manufacturing Technology Program. In accordance with 10 U.S.C. 2521(d), for acquisitions under the Manufacturing Technology Program— (a) Award all contracts using competitive procedures...

  15. Chen's inversion formula

    International Nuclear Information System (INIS)

    Hughes, B.D.; Frankel, N.E.; Ninham, B.W.

    1990-01-01

    An alternative view is presented of the Chen's generalization of a formula of classic algebraic number theory, based on the Mellin transformation and Reimann's zeta function. The advantages of the Mellin transform, as a method with a primary role in asymptotic analysis, are outlined. 10 refs

  16. Identification of forty-five gene-derived polymorphic microsatellite ...

    Indian Academy of Sciences (India)

    [Chen M., Gao L., Zhang W., You H., Sun Q. and Chang Y. 2013 Identification of forty-five ... including Japan, China, Korea and fareastern Russia (Chang et al. 2009). Because of ... tory using the Illumina HiSeq 2000 Sequencing Technology.

  17. Stability analysis of distributed order fractional chen system.

    Science.gov (United States)

    Aminikhah, H; Refahi Sheikhani, A; Rezazadeh, H

    2013-01-01

    We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results.

  18. Stability Analysis of Distributed Order Fractional Chen System

    Science.gov (United States)

    Aminikhah, H.; Refahi Sheikhani, A.; Rezazadeh, H.

    2013-01-01

    We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results. PMID:24489508

  19. High flow ceramic pot filters

    OpenAIRE

    van Halem, D.; van der Laan, H.; Soppe, A. I.A.; Heijman, S.G.J.

    2017-01-01

    Ceramic pot filters are considered safe, robust and appropriate technologies, but there is a general consensus that water revenues are limited due to clogging of the ceramic element. The objective of this study was to investigate the potential of high flow ceramic pot filters to produce more water without sacrificing their microbial removal efficacy. High flow pot filters, produced by increasing the rice husk content, had a higher initial flow rate (6–19 L h−1), but initial LRVs for E. coli o...

  20. Organizational Considerations for Advanced Manufacturing Technology

    Science.gov (United States)

    DeRuntz, Bruce D.; Turner, Roger M.

    2003-01-01

    In the last several decades, the United States has experienced a decline in productivity, while the world has seen a maturation of the global marketplace. Nations have moved manufacturing strategy and process technology issues to the top of management priority lists. The issues surrounding manufacturing technologies and their implementations have…

  1. Nano Manufacturing - Products and Technologies

    DEFF Research Database (Denmark)

    Hansen, Hans Nørgaard; Alting, Leo

    2004-01-01

    The use of micro and nano technologies in components and products not only sets new demands to the manufacturing technologies. Product concepts have to be rethought and redefined in order to implement the micro and nano technologies into functional systems. Both a technology driven and a product ...

  2. SCRMS: An RFID and Sensor Web-Enabled Smart Cultural Relics Management System.

    Science.gov (United States)

    Xiao, Changjiang; Chen, Nengcheng; Li, Dandan; Lv, You; Gong, Jianya

    2016-12-30

    Cultural relics represent national or even global resources of inestimable value. How to efficiently manage and preserve these cultural relics is a vitally important issue. To achieve this goal, this study proposed, designed, and implemented an RFID and Sensor Web-enabled smart cultural relics management system (SCRMS). In this system, active photovoltaic subtle energy-powered Radio Frequency Identification (RFID) is used for long-range contactless identification and lifecycle management of cultural relics during their storage and circulation. In addition, different types of ambient sensors are integrated with the RFID tags and deployed around cultural relics to monitor their environmental parameters, helping to ensure that they remain in good condition. An Android-based smart mobile application, as middleware, is used in collaboration with RFID readers to collect information and provide convenient management for the circulation of cultural relics. Moreover, multiple sensing techniques are taken advantage of simultaneously for preservation of cultural relics. The proposed system was successfully applied to a museum in the Yongding District, Fujian Province, China, demonstrating its feasibility and advantages for smart and efficient management and preservation of cultural relics.

  3. Stochastic backgrounds of relic gravitons: a theoretical appraisal

    CERN Document Server

    Giovannini, Massimo

    2010-01-01

    Stochastic backgrounds or relic gravitons, if ever detected, will constitute a prima facie evidence of physical processes taking place during the earliest stages of the evolution of the plasma. The essentials of the stochastic backgrounds of relic gravitons are hereby introduced and reviewed. The pivotal observables customarily employed to infer the properties of the relic gravitons are discussed both in the framework of the $\\Lambda$CDM paradigm as well as in neighboring contexts. The complementarity between experiments measuring the polarization of the Cosmic Microwave Background (such as, for instance, WMAP, Capmap, Quad, Cbi, just to mention a few) and wide band interferometers (e.g. Virgo, Ligo, Geo, Tama) is emphasized. While the analysis of the microwave sky strongly constrains the low-frequency tail of the relic graviton spectrum, wide-band detectors are sensitive to much higher frequencies where the spectral energy density depends chiefly upon the (poorly known) rate of post-inflationary expansion.

  4. Additive manufacturing technologies 3D printing, rapid prototyping, and direct digital manufacturing

    CERN Document Server

    Gibson, Ian; Stucker, Brent

    2015-01-01

    This book covers in detail the various aspects of joining materials to form parts. A conceptual overview of rapid prototyping and layered manufacturing is given,  beginning with the fundamentals so that readers can get up to speed quickly. Unusual and emerging applications such as micro-scale manufacturing, medical applications, aerospace, and rapid manufacturing are also discussed. This book provides a comprehensive overview of rapid prototyping technologies as well as support technologies such as software systems, vacuum casting, investment casting, plating, infiltration and other systems. This book also: Reflects recent developments and trends and adheres to the ASTM, SI, and other standards Includes chapters on automotive technology, aerospace technology and low-cost AM technologies Provides a broad range of technical questions to ensure comprehensive understanding of the concepts covered  

  5. Risk calculations in the manufacturing technology selection process

    DEFF Research Database (Denmark)

    Farooq, S.; O'Brien, C.

    2010-01-01

    Purpose - The purpose of this paper is to present result obtained from a developed technology selection framework and provide a detailed insight into the risk calculations and their implications in manufacturing technology selection process. Design/methodology/approach - The results illustrated...... in the paper are the outcome of an action research study that was conducted in an aerospace company. Findings - The paper highlights the role of risk calculations in manufacturing technology selection process by elaborating the contribution of risk associated with manufacturing technology alternatives...... in the shape of opportunities and threats in different decision-making environments. Practical implications - The research quantifies the risk associated with different available manufacturing technology alternatives. This quantification of risk crystallises the process of technology selection decision making...

  6. Complete synchronization of two Chen-Lee systems

    International Nuclear Information System (INIS)

    Sheu, L-J; Chen, J-H; Chen, H-K; Tam, L-M; Lao, S-K; Chen, W-C; Lin, K-T

    2008-01-01

    This study demonstrates that complete synchronization of two Chen-Lee chaotic systems can be easily achieved. The upper bound of the Chen-Lee chaotic system is estimated numerically. A controller is designed to synchronize two chaotic systems. Sufficient conditions for synchronization are obtained using Lyapunov's direct method. Two numerical examples are presented to verify the proposed synchronization approach

  7. Copper Disk Manufactured at the Space Optics Manufacturing and Technology Center

    Science.gov (United States)

    2001-01-01

    This photograph shows Wes Brown, Marshall Space Flight Center's (MSFC's) lead diamond tuner, an expert in the science of using diamond-tipped tools to cut metal, inspecting the mold's physical characteristics to ensure the uniformity of its more than 6,000 grooves. This king-size copper disk, manufactured at the Space Optics Manufacturing and Technology Center (SOMTC) at MSFC, is a special mold for making high resolution monitor screens. This master mold will be used to make several other molds, each capable of forming hundreds of screens that have a type of lens called a fresnel lens. Weighing much less than conventional optics, fresnel lenses have multiple concentric grooves, each formed to a precise angle, that together create the curvature needed to focus and project images. The MSFC leads NASA's space optics manufacturing technology development as a technology leader for diamond turning. The machine used to manufacture this mold is among many one-of-a-kind pieces of equipment of MSFC's SOMTC.

  8. USABILITY OF ADDITIVE MANUFACTURING (THREEDIMENSIONAL PRINTING) TECHNOLOGIES IN EDUCATION

    OpenAIRE

    ÖZSOY, KORAY; DUMAN, BURHAN

    2017-01-01

    Additive manufacturing technologies which are emerge in 1980’s years, they are using for prototip production in first time for that reason their denomination rapid prototyping . Nowadays it called additive manufacturing because of it using for end use functional part’s production. In additive manufacturing, the basic rationales the same, but many different technologies have been developed to manufacture with different approaches. The most common additive manufacturing technologies are stereol...

  9. Single-use disposable technologies for biopharmaceutical manufacturing.

    Science.gov (United States)

    Shukla, Abhinav A; Gottschalk, Uwe

    2013-03-01

    The manufacture of protein biopharmaceuticals is conducted under current good manufacturing practice (cGMP) and involves multiple unit operations for upstream production and downstream purification. Until recently, production facilities relied on the use of relatively inflexible, hard-piped equipment including large stainless steel bioreactors and tanks to hold product intermediates and buffers. However, there is an increasing trend towards the adoption of single-use technologies across the manufacturing process. Technical advances have now made an end-to-end single-use manufacturing facility possible, but several aspects of single-use technology require further improvement and are continually evolving. This article provides a perspective on the current state-of-the-art in single-use technologies and highlights trends that will improve performance and increase the market penetration of disposable manufacturing in the future. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. SCRMS: An RFID and Sensor Web-Enabled Smart Cultural Relics Management System

    Directory of Open Access Journals (Sweden)

    Changjiang Xiao

    2016-12-01

    Full Text Available Cultural relics represent national or even global resources of inestimable value. How to efficiently manage and preserve these cultural relics is a vitally important issue. To achieve this goal, this study proposed, designed, and implemented an RFID and Sensor Web–enabled smart cultural relics management system (SCRMS. In this system, active photovoltaic subtle energy-powered Radio Frequency Identification (RFID is used for long-range contactless identification and lifecycle management of cultural relics during their storage and circulation. In addition, different types of ambient sensors are integrated with the RFID tags and deployed around cultural relics to monitor their environmental parameters, helping to ensure that they remain in good condition. An Android-based smart mobile application, as middleware, is used in collaboration with RFID readers to collect information and provide convenient management for the circulation of cultural relics. Moreover, multiple sensing techniques are taken advantage of simultaneously for preservation of cultural relics. The proposed system was successfully applied to a museum in the Yongding District, Fujian Province, China, demonstrating its feasibility and advantages for smart and efficient management and preservation of cultural relics.

  11. Development of zirconium alloy tube manufacturing technology

    International Nuclear Information System (INIS)

    Kim, In Kyu; Park, Chan Hyun; Lee, Seung Hwan; Chung, Sun Kyo

    2009-01-01

    In late 2004, Korea Nuclear Fuel Company (KNF) launched a government funded joint development program with Westinghouse Electric Co. (WEC) to establish zirconium alloy tube manufacturing technology in Korea. Through this program, KNF and WEC have developed a state of the art facility to manufacture high quality nuclear tubes. KNF performed equipment qualification tests for each manufacturing machine with the support of WEC, and independently carried out product qualification tests for each tube product to be commercially produced. Apart from those tests, characterization test program consisting of specification test and characterization test was developed by KNF and WEC to demonstrate to customers of KNF the quality equivalency of products manufactured by KNF and WEC plants respectively. As part of establishment of performance evaluation technology for zirconium alloy tube in Korea, KNF carried out analyses of materials produced for the characterization test program using the most advanced techniques. Thanks to the accomplishment of the development of zirconium alloy tube manufacturing technology, KNF is expected to acquire positive spin off benefits in terms of technology and economy in the near future

  12. Relic abundance of WIMPs in non-standard cosmological scenarios

    Energy Technology Data Exchange (ETDEWEB)

    Yimingniyazi, W.

    2007-08-06

    In this thesis we study the relic density n{sub {chi}} of non--relativistic long--lived or stable particles {chi} in various non--standard cosmological scenarios. First, we discuss the relic density in the non--standard cosmological scenario in which the temperature is too low for the particles {chi} to achieve full chemical equilibrium. We also investigated the case where {chi} particles are non--thermally produced from the decay of heavier particles in addition to the usual thermal production. In low temperature scenario, we calculate the relic abundance starting from arbitrary initial temperatures T{sub 0} of the radiation--dominated epoch and derive approximate solutions for the temperature dependence of the relic density which can accurately reproduces numerical results when full thermal equilibrium is not achieved. If full equilibrium is reached, our ansatz no longer reproduces the correct temperature dependence of the {chi} number density. However, we can contrive a semi-analytic formula which gives the correct final relic density, to an accuracy of about 3% or better, for all cross sections and initial temperatures. We also derive the lower bound on the initial temperature T{sub 0}, assuming that the relic particle accounts for the dark matter energy density in the universe. The observed cold dark matter abundance constrains the initial temperature T{sub 0} {>=}m{sub {chi}}/23, where m{sub {chi}} is the mass of {chi}. Second, we discuss the {chi} density in the scenario where the the Hubble parameter is modified. Even in this case, an approximate formula similar to the standard one is found to be capable of predicting the final relic abundance correctly. Choosing the {chi} annihilation cross section such that the observed cold dark matter abundance is reproduced in standard cosmology, we constrain possible modifications of the expansion rate at T {proportional_to}m{sub {chi}}/20, well before Big Bang Nucleosynthesis. (orig.)

  13. Relic abundance of WIMPs in non-standard cosmological scenarios

    International Nuclear Information System (INIS)

    Yimingniyazi, W.

    2007-01-01

    In this thesis we study the relic density n χ of non--relativistic long--lived or stable particles χ in various non--standard cosmological scenarios. First, we discuss the relic density in the non--standard cosmological scenario in which the temperature is too low for the particles χ to achieve full chemical equilibrium. We also investigated the case where χ particles are non--thermally produced from the decay of heavier particles in addition to the usual thermal production. In low temperature scenario, we calculate the relic abundance starting from arbitrary initial temperatures T 0 of the radiation--dominated epoch and derive approximate solutions for the temperature dependence of the relic density which can accurately reproduces numerical results when full thermal equilibrium is not achieved. If full equilibrium is reached, our ansatz no longer reproduces the correct temperature dependence of the χ number density. However, we can contrive a semi-analytic formula which gives the correct final relic density, to an accuracy of about 3% or better, for all cross sections and initial temperatures. We also derive the lower bound on the initial temperature T 0 , assuming that the relic particle accounts for the dark matter energy density in the universe. The observed cold dark matter abundance constrains the initial temperature T 0 ≥m χ /23, where m χ is the mass of χ. Second, we discuss the χ density in the scenario where the the Hubble parameter is modified. Even in this case, an approximate formula similar to the standard one is found to be capable of predicting the final relic abundance correctly. Choosing the χ annihilation cross section such that the observed cold dark matter abundance is reproduced in standard cosmology, we constrain possible modifications of the expansion rate at T ∝m χ /20, well before Big Bang Nucleosynthesis. (orig.)

  14. C. Huang , G. Zhao , HW Zhang & YQ Chen

    Indian Academy of Sciences (India)

    the host stars' birth cloud with higher abundance of Si will make the cloud ... with the metallicity distribution of nearby field F, G, or K stars which are known to .... In the early stage of planetesimal accumulation, the rate of growth of planetesimal.

  15. High energy beam manufacturing technologies

    International Nuclear Information System (INIS)

    Geskin, E.S.; Leu, M.C.

    1989-01-01

    Technological progress continues to enable us to utilize ever widening ranges of physical and chemical conditions for material processing. The increasing cost of energy, raw materials and environmental control make implementation of advanced technologies inevitable. One of the principal avenues in the development of material processing is the increase of the intensity, accuracy, flexibility and stability of energy flow to the processing site. The use of different forms of energy beams is an effective way to meet these sometimes incompatible requirements. The first important technological applications of high energy beams were welding and flame cutting. Subsequently a number of different kinds of beams have been used to solve different problems of part geometry control and improvement of surface characteristics. Properties and applications of different specific beams were subjects of a number of fundamental studies. It is important now to develop a generic theory of beam based manufacturing. The creation of a theory dealing with general principles of beam generation and beam-material interaction will enhance manufacturing science as well as practice. For example, such a theory will provide a format approach for selection and integration of different kinds of beams for a particular application. And obviously, this theory will enable us to integrate the knowledge bases of different manufacturing technologies. The War of the Worlds by H. G. Wells, as well as a number of more technical, although less exciting, publications demonstrate both the feasibility and effectiveness of the generic approach to the description of beam oriented technology. Without any attempt to compete with Wells, we still hope that this volume will contribute to the creation of the theory of beam oriented manufacturing

  16. Nature of Technology: Implications for design, development, and enactment of technological tools in school science classrooms

    Science.gov (United States)

    Waight, Noemi; Abd-El-Khalick, Fouad

    2012-12-01

    This position paper provides a theory-based explanation informed by philosophy of technology (PoT) of the recurrent documented patterns often associated with attempts to enact technology-supported, inquiry-based approaches in precollege science classrooms. Understandings derived from the history of technological development in other domains (e.g. medicine, transportation, and warfare) reveal numerous parallels that help to explain these recurrent patterns. Historical analyses of major technologies reveal a conglomerate of factors that interact to produce benefits, as well as intended and unintended consequences. On a macro-scale, PoT facilitates understandings of how technologies interact and are impacted by individuals, society, institutions, economy, politics, and culture. At the micro-level, and most relevant to science education, PoT engages the inherent nature of technology along a number of key dimensions: role of culture and values, notions of technological progression, technology as part of systems, technological diffusion, technology as a fix, and the notions of expertise. Overall, the present analysis has implications for the design, development, implementation, and adoption of technological tools for use in precollege science education, and highlights the role of technology as both artifact and process.

  17. Twin radio relics in the nearby low-mass galaxy cluster Abell 168

    Science.gov (United States)

    Dwarakanath, K. S.; Parekh, V.; Kale, R.; George, L. T.

    2018-06-01

    We report the discovery of twin radio relics in the outskirts of the low-mass merging galaxy cluster Abell 168 (redshift=0.045). One of the relics is elongated with a linear extent ˜800 kpc and projected width of ˜80 kpc and is located ˜900 kpc towards the north of the cluster centre, oriented roughly perpendicular to the major axis of the X-ray emission. The second relic is ring-shaped with a size ˜220 kpc and is located near the inner edge of the elongated relic at a distance of ˜600 kpc from the cluster centre. These radio sources were imaged at 323 and 608 MHz with the Giant Meterwave Radio Telescope and at 1520 MHz with the Karl G. Jansky Very Large Array (VLA). The elongated relic was detected at all frequencies, with a radio power of 1.38 ± 0.14 × 1023 W Hz-1 at 1.4 GHz and a power law in the frequency range 70-1500 MHz (S ∝ να, α = -1.1 ± 0.04). This radio power is in good agreement with that expected from the known empirical relation between the radio powers of relics and host cluster masses. This is the lowest mass (M500 = 1.24 × 1014 M⊙) cluster in which relics due to merger shocks are detected. The ring-shaped relic has a steeper spectral index (α) of -1.74 ± 0.29 in the frequency range 100-600 MHz. We propose this relic to be an old plasma, revived due to adiabatic compression by the outgoing shock that produced the elongated relic.

  18. Measures of International Manufacturing and Trade of Clean Energy Technologies

    Energy Technology Data Exchange (ETDEWEB)

    Engel-Cox, Jill; Sandor, Debbie; Keyser, David; Mann, Margaret

    2017-05-25

    The technologies that produce clean energy, such as solar photovoltaic panels and lithium ion batteries for electric vehicles, are globally manufactured and traded. As demand and deployment of these technologies grows exponentially, the innovation to reach significant economies of scale and drive down energy production costs becomes less in the technology and more in the manufacturing of the technology. Manufacturing innovations and other manufacturing decisions can reduce costs of labor, materials, equipment, operating costs, and transportation, across all the links in the supply chain. To better understand the manufacturing aspect of the clean energy economy, we have developed key metrics for systematically measuring and benchmarking international manufacturing of clean energy technologies. The metrics are: trade, market size, manufacturing value-added, and manufacturing capacity and production. These metrics were applied to twelve global economies and four representative technologies: wind turbine components, crystalline silicon solar photovoltaic modules, vehicle lithium ion battery cells, and light emitting diode packages for efficient lighting and other consumer products. The results indicated that clean energy technologies are being developed via complex, dynamic, and global supply chains, with individual economies benefiting from different technologies and links in the supply chain, through both domestic manufacturing and global trade.

  19. Development of Advanced Ceramic Manufacturing Technology; FINAL

    International Nuclear Information System (INIS)

    Pujari, V.K.

    2001-01-01

    Advanced structural ceramics are enabling materials for new transportation engine systems that have the potential for significantly reducing energy consumption and pollution in automobiles and heavy vehicles. Ceramic component reliability and performance have been demonstrated in previous U.S. DOE initiatives, but high manufacturing cost was recognized as a major barrier to commercialization. Norton Advanced Ceramics (NAC), a division of Saint-Gobain Industrial Ceramics, Inc. (SGIC), was selected to perform a major Advanced Ceramics Manufacturing Technology (ACMT) Program. The overall objectives of NAC's program were to design, develop, and demonstrate advanced manufacturing technology for the production of ceramic exhaust valves for diesel engines. The specific objectives were (1) to reduce the manufacturing cost by an order of magnitude, (2) to develop and demonstrate process capability and reproducibility, and (3) to validate ceramic valve performance, durability, and reliability. I n order to achieve these objectives, NAC, a leading U.S. advanced ceramics component manufacturer, assembled a multidisciplinary, vertically integrated team. This team included: a major diesel engine builder, Detroit Diesel Corporation (DDC); a corporate ceramics research division, SGIC's Northboro R and D Center; intelligent processing system developers, BDM Federal/MATSYS; a furnace equipment company, Centorr/Vacuum Industries; a sintering expert, Wittmer Consultants; a production OEM, Deco-Grand; a wheel manufacturer and grinding operation developer, Norton Company's Higgins Grinding Technology Center (HGTC); a ceramic machine shop, Chand Kare Technical Ceramics; and a manufacturing cost consultant, IBIS Associates. The program was divided into four major tasks: Component Design and Specification, Component Manufacturing Technology Development, Inspection and Testing, and Process Demonstration

  20. Manufacturing technology for practical Josephson voltage normals

    International Nuclear Information System (INIS)

    Kohlmann, Johannes; Kieler, Oliver

    2016-01-01

    In this contribution we present the manufacturing technology for the fabrication of integrated superconducting Josephson serial circuits for voltage normals. First we summarize some foundations for Josephson voltage normals and sketch the concept and the setup of the circuits, before we describe the manufacturing technology form modern practical Josephson voltage normals.

  1. Multilayer Integrated Film Bulk Acoustic Resonators

    CERN Document Server

    Zhang, Yafei

    2013-01-01

    Multilayer Integrated Film Bulk Acoustic Resonators mainly introduces the theory, design, fabrication technology and application of a recently developed new type of device, multilayer integrated film bulk acoustic resonators, at the micro and nano scale involving microelectronic devices, integrated circuits, optical devices, sensors and actuators, acoustic resonators, micro-nano manufacturing, multilayer integration, device theory and design principles, etc. These devices can work at very high frequencies by using the newly developed theory, design, and fabrication technology of nano and micro devices. Readers in fields of IC, electronic devices, sensors, materials, and films etc. will benefit from this book by learning the detailed fundamentals and potential applications of these advanced devices. Prof. Yafei Zhang is the director of the Ministry of Education’s Key Laboratory for Thin Films and Microfabrication Technology, PRC; Dr. Da Chen was a PhD student in Prof. Yafei Zhang’s research group.

  2. “Viimne reliikvia” ja “Kolme katku vahel”: ruumist eesti ajalookirjanduse ekraniseeringutes / The Last Relic and Between Three Plagues: On Space in Film Adaptations of Estonian Historical Fiction

    Directory of Open Access Journals (Sweden)

    Eva Näripea

    2015-06-01

    Full Text Available Teesid: Artikkel keskendub kahele ajalooromaani ekraniseeringule Nõukogude Eesti filmikunstis: „Viimne reliikvia“ (1969, rež Grigori Kromanov, Tallinnfilm, mis põhineb Eduard Bornhöhe romaanil „Vürst Gabriel ehk Pirita kloostri viimsed päevad“ (1893, ning „Kolme katku vahel“ (1970, rež Virve Aruoja, Eesti Telefilm, mille seosed oma kirjandusliku allikaga (Jaan Krossi samanimelise romaaniga on oluliselt keerulisemad. Ekraniseeringuid käsitletakse ruumirepresentatsioonide perspektiivist, uurides, missuguseid strateegiaid kasutati filmiruumide loomisel, kuidas suhestuti kirjandusliku (lähtematerjaliga ning millised ajaloonarratiivi ja rahvusliku identiteedi vahekorrad neis kangastuvad. SU M M A R Y This article examines two Soviet Estonian screen adaptations of historical novels: The Last Relic (Viimne reliikvia, Tallinnfilm, 1969, directed by Grigori Kromanov, based on Eduard Bornhöhe’s novel Prince Gabriel or The Last Days of Pirita Monastery (1893, which became a box-office hit throughout the Soviet Union and even beyond; and Between Three Plagues (Kolme katku vahel, Eesti Telefilm, 1970, directed by Virve Aruoja which reached much more limited TV-audiences; the connections between this film and its literary „source“ (a novel of the same name by Jaan Kross are much more complicated. These screen adaptations are considered from the perspective of spatial representations. I examine which strategies and devices the scriptwriters, directors and production designers drew upon when constructing these cinematic spaces and how they related to their literary hypotexts. As generally for adaptations of historical novels to other media, both The Last Relic and Between Three Plagues speak (perhaps even primarily about their time of production, about the present rather than the past. In this regard, it is important to recall the role of Tallinn’s Old Town as a locus of resistance in Soviet Estonian culture. Arguably

  3. Eine praktische Anwendung von CMC-Flächen in der Bionik

    OpenAIRE

    Apeltauer, Christian

    2011-01-01

    Die vorliegende Arbeit beschäftigt sich mit den theoretischen Grundlagen für die Entwicklung von Oberflächen, die unter Wasser möglichst lange eine Luftschicht an sich halten können. Ein natürliches Vorbild für solche Oberflächen ist die Pflanze Salvinia molesta; technisch interessieren solche Oberflächen zur Verringerung des Wasserwiderstandes von Schiffen und als Schutz vor Besiedlung durch Wasserorganismen. Wichtigste Gleichung bei der Entwicklung solcher Oberflächen ist...

  4. Information technology in fuel manufacturing

    International Nuclear Information System (INIS)

    Seshagiri Rao, G.R.; Arora, U.K.; Mohanty, Deepak; Siva Kumar, G.V.S.M.; Banerjee, P.K.

    2012-01-01

    NFC, Hyderabad is engaged in manufacturing of fuel assemblies required for Indian Nuclear Power Programme. During the manufacturing process, the basic Uranium Fuel and Zirconium alloy cladding tubes travels through several work centers, machines and exposes to various process parameters. For analyzing the fuel performance these parameters are indicators and is a requirement to record such history by both manufacturer and customer. NFC has planned to deploy Information Technology (IT) Systems from MDU/UOC Dissolution to Finished Fuel Assembly dispatch stage by using Radio Frequency IDentification (RFID)/Barcode Technologies. IT Systems are connected to electronic weigh balances to acquire material weight data automatically. The IT Systems are also designed to receive data from small Island Systems like Helium leak testing equipments. As a pilot project the system is initially implemented from empty tube Tray preparation stage to Fuel Assembly Packing and dispatch stage, containing about more than 14 processes. The system was built using open source technology platform and was deployed on a cost effective Hardware environment. The present paper describes the development process of the system, Implementation challenges faced and change management. The paper also discusses about fruits of implementation and productivity improvements. (author)

  5. Isolation and identification of two galangin metabolites from rat urine ...

    African Journals Online (AJOL)

    Isolation and identification of two galangin metabolites from rat urine and determination of their in vitro hypolipidemic activity. Xuguang Zhang, Shouqian Cheng, Hailong Li, Xiaopo Zhang, Feng Chen, Youbin Li, Junqing Zhang, Yinfeng Tan ...

  6. Multimedia Image Technology and Computer Aided Manufacturing Engineering Analysis

    Science.gov (United States)

    Nan, Song

    2018-03-01

    Since the reform and opening up, with the continuous development of science and technology in China, more and more advanced science and technology have emerged under the trend of diversification. Multimedia imaging technology, for example, has a significant and positive impact on computer aided manufacturing engineering in China. From the perspective of scientific and technological advancement and development, the multimedia image technology has a very positive influence on the application and development of computer-aided manufacturing engineering, whether in function or function play. Therefore, this paper mainly starts from the concept of multimedia image technology to analyze the application of multimedia image technology in computer aided manufacturing engineering.

  7. Challenges in Teaching Modern Manufacturing Technologies

    Science.gov (United States)

    Ngaile, Gracious; Wang, Jyhwen; Gau, Jenn-Terng

    2015-01-01

    Teaching of manufacturing courses for undergraduate engineering students has become a challenge due to industrial globalisation coupled with influx of new innovations, technologies, customer-driven products. This paper discusses development of a modern manufacturing course taught concurrently in three institutions where students collaborate in…

  8. Contemporary design and manufacturing technology

    CERN Document Server

    Wang, Taiyong; Zuo, Dunwen

    2013-01-01

    The special topic volume communicates the latest progress and research results of new theory, new technology, method, equipment and so on in Engineering Technology, and to grasp the updated technological and research trends in internationally. The major topics covered by the special volumes include Advanced Materials and Manufacturing Technologies, Control, Automation and Detection Systems, Advanced Design Technology, Optimization and Modeling. In 80 invited and peer-reviewed papers, mechanical and other engineers describe their recent and current research and results in advanced materials and

  9. Mechanical analysis of Chen chaotic system

    International Nuclear Information System (INIS)

    Liang, Xiyin; Qi, Guoyuan

    2017-01-01

    The Chen chaotic system is transformed into Kolmogorov type system, which is decomposed into four types of torques: inertial torque, internal torque, dissipation and external torque. By the combinations of different torques, five cases are studied to discover key factors of chaos generation and the physical meaning. The conversion among Hamiltonian energy, kinetic energy and potential energy is investigated in these five cases. The relationship between the energies and the parameters is studied. It concludes that the combination of these four types of torques is necessary conditions to produce chaos, and any combination of three types of torques cannot produce chaos in Chen system.

  10. The Historical Development of Vaccine Technology: Exploring the Relationship between Science and Technology

    Science.gov (United States)

    Lee, Yeung Chung; Kwok, Ping Wai

    2017-01-01

    This paper examines the feasibility of using historical case studies to contextualise the learning of the nature of science and technology in a biology lesson. Through exploring the historical development of vaccine technology, students were expected to understand the complexity of the relationships between technology and science beyond the…

  11. On a conjecture of Chen-Guo-Wang

    OpenAIRE

    Ning, Bo; Zheng, Yu

    2015-01-01

    Towards confirming Sun's conjecture on the strict log-concavity of combinatorial sequence involving the n$th$ Bernoulli number, Chen, Guo and Wang proposed a conjecture about the log-concavity of the function $\\theta(x)=\\sqrt[x]{2\\zeta(x)\\Gamma(x+1)}$ for $x\\in (6,\\infty)$, where $\\zeta(x)$ is the Riemann zeta function and $\\Gamma(x)$ is the Gamma function. In this paper, we first prove this conjecture along the spirit of Zhu's previous work. Second, we extend Chen et al.'s conjecture in the ...

  12. Prototyping of Individual Ankle Orthosis Using Additive Manufacturing Technologies

    Directory of Open Access Journals (Sweden)

    Natalia Wierzbicka

    2017-09-01

    Full Text Available The paper presents design and manufacturing process of an individualized ankle orthosis using additive manufacturing technologies and reverse engineering. Conventional processes of manufacturing of orthosesareexpensive and time consuming -an alternative method was proposed. The patient’s leg was 3D scanned and the orthosis was designed using a CAD system. It was then manufactured using the Fused Deposition Modelling technology, assembled and fully tested. Positive results were obtained.

  13. Selection of Technology in Global Manufacturing Industries

    DEFF Research Database (Denmark)

    Bruun, Peter

    1997-01-01

    not work well. The host country's business and cultural environment must be taken into account in designing a production system which requires attention to the management elements of technology transfer. This paper presents a model for transfer of manufacturing technology to a foreign site based......Transferring a manufacturing system to another country has proven to be problematic for most multinational firms. Selection of the appropriate production process and technology is a critical decision as transplantation of an existing system from another country without adaptation usually does...... on a sociotechnical system approach. It views the decisions for selecting and implementing a production system as a five stage process. The first step is determining the strategic goals of the foreign plant followed by selection of the production process and manufacturing system types. The last stages involve...

  14. Manufacturing Technology Information Analysis Center: Knowledge Is Strength

    Science.gov (United States)

    Safar, Michal

    1992-01-01

    The Center's primary function is to facilitate technology transfer within DoD, other government agencies and industry. The DoD has recognized the importance of technology transfer, not only to support specific weapon system manufacture, but to strengthen the industrial base that sustains DoD. MTIAC uses an experienced technical staff of engineers and information specialists to acquire, analyze, and disseminate technical information. Besides ManTech project data, MTIAC collects manufacturing technology from other government agencies, commercial publications, proceedings, and various international sources. MTIAC has various means of disseminating this information. Much of the technical data is on user accessible data bases. The Center researches and writes a number of technical reports each year and publishes a newsletter monthly. Customized research is performed in response to specific inquiries from government and industry. MTIAC serves as a link between Government and Industry to strengthen the manufacturing technology base through the dissemination of advanced manufacturing information.

  15. 10 CFR 611.202 - Advanced Technology Vehicle Manufacturing Facility Award Program.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Advanced Technology Vehicle Manufacturing Facility Award... TECHNOLOGY VEHICLES MANUFACTURER ASSISTANCE PROGRAM Facility/Funding Awards § 611.202 Advanced Technology Vehicle Manufacturing Facility Award Program. DOE may issue, under the Advanced Technology Vehicle...

  16. A Zoo of Radio Relics: Cluster Cores to Filaments Ruta Kale1,2 ...

    Indian Academy of Sciences (India)

    Abstract. Radio relics in galaxy clusters can be electrons accelerated at cluster merger shocks or adiabatically compressed fossil radio cocoons or dying radio galaxies. The spectral evolution of radio relics is affected by the surrounding thermal plasma. We present a low frequency study of three radio relics representing ...

  17. Space Technology Mission Directorate Game Changing Development Program FY2015 Annual Program Review: Advanced Manufacturing Technology

    Science.gov (United States)

    Vickers, John; Fikes, John

    2015-01-01

    The Advance Manufacturing Technology (AMT) Project supports multiple activities within the Administration's National Manufacturing Initiative. A key component of the Initiative is the Advanced Manufacturing National Program Office (AMNPO), which includes participation from all federal agencies involved in U.S. manufacturing. In support of the AMNPO the AMT Project supports building and Growing the National Network for Manufacturing Innovation through a public-private partnership designed to help the industrial community accelerate manufacturing innovation. Integration with other projects/programs and partnerships: STMD (Space Technology Mission Directorate), HEOMD, other Centers; Industry, Academia; OGA's (e.g., DOD, DOE, DOC, USDA, NASA, NSF); Office of Science and Technology Policy, NIST Advanced Manufacturing Program Office; Generate insight within NASA and cross-agency for technology development priorities and investments. Technology Infusion Plan: PC; Potential customer infusion (TDM, HEOMD, SMD, OGA, Industry); Leverage; Collaborate with other Agencies, Industry and Academia; NASA roadmap. Initiatives include: Advanced Near Net Shape Technology Integrally Stiffened Cylinder Process Development (launch vehicles, sounding rockets); Materials Genome; Low Cost Upper Stage-Class Propulsion; Additive Construction with Mobile Emplacement (ACME); National Center for Advanced Manufacturing.

  18. Chen Hengzhe

    DEFF Research Database (Denmark)

    Gimpel, Denise

    Chen Hengzhe has been celebrated as China’s first female professor, first professor of Western history, first person to publish a history of the West that was not a translation into Chinese. She is moreover celebrated as one of the first to write fiction and poetry in the vernacular and to have......; they speak to important questions in China today. This study, then, is not a biography of a person; it is an attempt to understand the way in which foreign influences (narratives of being, organizing, thinking, writing) seep into a person’s life and work and meld with the “home” influences (narratives...

  19. Hiina tänapäeva arhitektuur - karmiilmeline, aga põnev / Zhang Ke, Zhang Hong, Xiaodu Liu ; interv. Hanna Läkk ja Ene Läkk

    Index Scriptorium Estoniae

    Zhang Ke

    2006-01-01

    Intervjuu Hiina arhitektuuribüroo Standardarchitecture arhitektide Zhang Ke ja Zhang Hongiga ning arhitektuuribüroo Urbanus arhitekti Xiaodu Liuga Hollandis Hiina tänapäeva tutvustaval näitusel. Hiina arhitektide haridusest, oma arhitektuuribüroode töödest, tänapäeva hiina arhitektuurist, põhiprobleemidest

  20. Supernova relic electron neutrinos and anti-neutrinos in future large-scale observatories

    International Nuclear Information System (INIS)

    Volpe, C.; Welzel, J.

    2007-01-01

    We investigate the signal from supernova relic neutrinos in future large scale observatories, such as MEMPHYS (UNO, Hyper-K), LENA and GLACIER, at present under study. We discuss that complementary information might be gained from the observation of supernova relic electron antineutrinos and neutrinos using the scattering on protons on one hand, and on nuclei such as oxygen, carbon or argon on the other hand. When determining the relic neutrino fluxes we also include, for the first time, the coupling of the neutrino magnetic moment to magnetic fields within the core collapse supernova. We present numerical results on both the relic ν e and ν-bar e fluxes and on the number of events for ν e + C 12 , ν e + O 16 , ν e + Ar 40 and ν-bar e + p for various oscillation scenarios. The observation of supernova relic neutrinos might provide us with unique information on core-collapse supernova explosions, on the star formation history and on neutrino properties, that still remain unknown. (authors)

  1. Development of steam generator manufacturing technology

    International Nuclear Information System (INIS)

    Grant, J.A.

    1979-01-01

    In 1968 Babcock and Wilcox (Operations) Ltd., received an order from the CEGB to design, manufacture, install and commission 16 Steam Generators for 2 x 660 Mw (e) Advanced Gas Cooled Reactor Power Station at Hartlepool. This order was followed in 1970 by a similar order for the Heysham Power Station. The design and manufacture of the Steam Generators represented a major advance in technology and the paper discusses the methods by which a manufacturing facility was developed, by the Production Division of Babcock, to produce components to a quality, complexity and accuracy unique in the U.K. commercial boilermaking industry. The discussion includes a brief design background, a description of the Steam Generators and a view of the Production Division background. This is followed by a description of the organisation of the technological development and a consideration of the results. (author)

  2. Twist of Magnetic Fields in Solar Active Regions Hongqi Zhang ...

    Indian Academy of Sciences (India)

    tribpo

    in active regions also shows the butterfly pattern through the solar cycle. And, less than 30% of the active regions do not follow the general trend (Zhang & Bao 1998). The longitudinal distribution of current helicity parameter h|| of active regions in both the hemispheres in the last decade was presented by Zhang & Bao ...

  3. Adaptive synchronization of hyperchaotic Chen system with uncertain parameters

    International Nuclear Information System (INIS)

    Park, Ju H.

    2005-01-01

    This article addresses control for the chaos synchronization of hyperchaotic Chen system with five uncertain parameters. Based on the Lyapunov stability theory, an adaptive control law is derived to make the states of two identical hyperchaotic Chen systems asymptotically synchronized. Finally, a numerical simulations is presented to show the effectiveness of the proposed chaos synchronization scheme

  4. Turbine airfoil manufacturing technology

    Energy Technology Data Exchange (ETDEWEB)

    Kortovich, C. [PCC Airfoils, Inc., Beachwood, OH (United States)

    1995-12-31

    The specific goal of this program is to define manufacturing methods that will allow single crystal technology to be applied to complex-cored airfoils components for power generation applications. Tasks addressed include: alloy melt practice to reduce the sulfur content; improvement of casting process; core materials design; and grain orientation control.

  5. Evaluation of the Efficiency of Clay Pots in Removal of Water Impurities

    Directory of Open Access Journals (Sweden)

    K Naddafi , AH Mahvi, S Nasseri, M Mokhtari, H Zeraati

    2005-04-01

    Full Text Available Recently, inexpensive technologies for drinking water supply in small communities are highly considered in developing countries. One of these technologies is the application of ceramic filters that are usually made of diatomaceous earth or clay soil. This research was carried out to determine the efficiency of clay pots (as a filter in removing water impurities. Pilot and the related clay parts were manufactured and its efficiency in removing TDS, hardness, NO3-, color and turbidity was measured by passing water through the clay pipes. The results showed that the clay filters had not the potential to remove hardness, EC, TDS and nitrate of water. However, they showed excellent efficiency in turbidity removal (≥ 90% and could significantly decrease the color of the water (≥ 60%.

  6. Use of digital technologies for nasal prosthesis manufacturing.

    Science.gov (United States)

    Palousek, David; Rosicky, Jiri; Koutny, Daniel

    2014-04-01

    Digital technology is becoming more accessible for common use in medical applications; however, their expansion in prosthetic and orthotic laboratories is not large because of the persistent image of difficult applicability to real patients. This article aims to offer real example in the area of human facial prostheses. This article describes the utilization of optical digitization, computational modelling, rapid prototyping, mould fabrication and manufacturing of a nasal silicone prosthesis. This technical note defines the key points of the methodology and aspires to contribute to the introduction of a certified manufacturing procedure. The results show that the used technologies reduce the manufacturing time, reflect patient's requirements and allow the manufacture of high-quality prostheses for missing facial asymmetric parts. The methodology provides a good position for further development issues and is usable for clinical practice. Clinical relevance Utilization of digital technologies in facial prosthesis manufacturing process can be a good contribution for higher patient comfort and higher production efficiency but with higher initial investment and demands for experience with software tools.

  7. Aesthetic Function Realized in the Selected Modern Chinese Essays by Zhang Peiji

    Institute of Scientific and Technical Information of China (English)

    罗丹

    2014-01-01

    The selected modern Chinese essays translated by Zhang Peiji is a masterpiece for Chinese scholars to do translation research. Prof. Zhang not only excels at translating the Chinese works accurately but also conveys the aesthetic value in the translated version. This paper wil analyse the aesthetic function used in Zhang Peiji’s selected modern Chinese essays from five aspects, music value, rhythm value, ful-grownness value, conciseness value and artistic conception value.

  8. Introduction to semiconductor manufacturing technology

    CERN Document Server

    2012-01-01

    IC chip manufacturing processes, such as photolithography, etch, CVD, PVD, CMP, ion implantation, RTP, inspection, and metrology, are complex methods that draw upon many disciplines. [i]Introduction to Semiconductor Manufacturing Technologies, Second Edition[/i] thoroughly describes the complicated processes with minimal mathematics, chemistry, and physics; it covers advanced concepts while keeping the contents accessible to readers without advanced degrees. Designed as a textbook for college students, this book provides a realistic picture of the semiconductor industry and an in-depth discuss

  9. The number density of a charged relic

    Energy Technology Data Exchange (ETDEWEB)

    Berger, C.F. [Massachusetts Institute of Technology, Cambridge, MA (United States). Center for Theoretical Physics]|[California Univ., Santa Barbara, CA (United States). Kavli Inst. for Theoretical Physics; Covi, L. [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Kraml, S. [CNRS/IN2P3, Grenoble (France). Lab. de Physique Subatomique et de Cosmologie; Palorini, F. [Lyon Univ., UCBL, CNRS/IN2P3, Villeurbanne (France). IPN de Lyon

    2008-07-15

    We investigate scenarios in which a charged, long-lived scalar particle decouples from the primordial plasma in the Early Universe. We compute the number density at time of freeze-out considering both the cases of abelian and non-abelian interactions and including the effect of Sommerfeld enhancement at low initial velocity. We also discuss as extreme case the maximal cross section that fulfils the unitarity bound. We then compare these number densities to the exotic nuclei searches for stable relics and to the BBN bounds on unstable relics and draw conclusions for the cases of a stau or stop NLSP in supersymmetric models with a gravitino or axino LSP. (orig.)

  10. The number density of a charged relic

    International Nuclear Information System (INIS)

    Berger, C.F.; Kraml, S.; Palorini, F.

    2008-07-01

    We investigate scenarios in which a charged, long-lived scalar particle decouples from the primordial plasma in the Early Universe. We compute the number density at time of freeze-out considering both the cases of abelian and non-abelian interactions and including the effect of Sommerfeld enhancement at low initial velocity. We also discuss as extreme case the maximal cross section that fulfils the unitarity bound. We then compare these number densities to the exotic nuclei searches for stable relics and to the BBN bounds on unstable relics and draw conclusions for the cases of a stau or stop NLSP in supersymmetric models with a gravitino or axino LSP. (orig.)

  11. Toward a Historical Archaeology of West African Borderlands

    African Journals Online (AJOL)

    user

    Keywords: African History; Borderlands Studies; Historical Archaeology; ... Thus, the analysis of cultural heritage in the region has been .... In a similar development, ... arrived on the coast, West Africa was already linked by trade networks that ... For instance, in the ancient city of Badagry, the 'relics of the enslavement ...

  12. Radio observations of the double-relic galaxy cluster Abell 1240

    Science.gov (United States)

    Hoang, D. N.; Shimwell, T. W.; van Weeren, R. J.; Intema, H. T.; Röttgering, H. J. A.; Andrade-Santos, F.; Akamatsu, H.; Bonafede, A.; Brunetti, G.; Dawson, W. A.; Golovich, N.; Best, P. N.; Botteon, A.; Brüggen, M.; Cassano, R.; de Gasperin, F.; Hoeft, M.; Stroe, A.; White, G. J.

    2018-05-01

    We present LOFAR 120 - 168 MHz images of the merging galaxy cluster Abell 1240 that hosts double radio relics. In combination with the GMRT 595 - 629 MHz and VLA 2 - 4 GHz data, we characterised the spectral and polarimetric properties of the radio emission. The spectral indices for the relics steepen from their outer edges towards the cluster centre and the electric field vectors are approximately perpendicular to the major axes of the relics. The results are consistent with the picture that these relics trace large-scale shocks propagating outwards during the merger. Assuming diffusive shock acceleration (DSA), we obtain shock Mach numbers of M=2.4 and 2.3 for the northern and southern shocks, respectively. For M≲ 3 shocks, a pre-existing population of mildly relativistic electrons is required to explain the brightness of the relics due to the high (>10 per cent) particle acceleration efficiency required. However, for M≳ 4 shocks the required efficiency is ≳ 1% and ≳ 0.5%, respectively, which is low enough for shock acceleration directly from the thermal pool. We used the fractional polarization to constrain the viewing angle to ≥53 ± 3° and ≥39 ± 5° for the northern and southern shocks, respectively. We found no evidence for diffuse emission in the cluster central region. If the halo spans the entire region between the relics (˜1.8 Mpc) our upper limit on the power is P1.4GHz = (1.4 ± 0.6) × 1023 W Hz-1 which is approximately equal to the anticipated flux from a cluster of this mass. However, if the halo is smaller than this, our constraints on the power imply that the halo is underluminous.

  13. Development of Advanced Ceramic Manufacturing Technology

    Energy Technology Data Exchange (ETDEWEB)

    Pujari, V.K.

    2001-04-05

    Advanced structural ceramics are enabling materials for new transportation engine systems that have the potential for significantly reducing energy consumption and pollution in automobiles and heavy vehicles. Ceramic component reliability and performance have been demonstrated in previous U.S. DOE initiatives, but high manufacturing cost was recognized as a major barrier to commercialization. Norton Advanced Ceramics (NAC), a division of Saint-Gobain Industrial Ceramics, Inc. (SGIC), was selected to perform a major Advanced Ceramics Manufacturing Technology (ACMT) Program. The overall objectives of NAC's program were to design, develop, and demonstrate advanced manufacturing technology for the production of ceramic exhaust valves for diesel engines. The specific objectives were (1) to reduce the manufacturing cost by an order of magnitude, (2) to develop and demonstrate process capability and reproducibility, and (3) to validate ceramic valve performance, durability, and reliability. The program was divided into four major tasks: Component Design and Specification, Component Manufacturing Technology Development, Inspection and Testing, and Process Demonstration. A high-power diesel engine valve for the DDC Series 149 engine was chosen as the demonstration part for this program. This was determined to be an ideal component type to demonstrate cost-effective process enhancements, the beneficial impact of advanced ceramics on transportation systems, and near-term commercialization potential. The baseline valve material was NAC's NT451 SiAION. It was replaced, later in the program, by an alternate silicon nitride composition (NT551), which utilized a lower cost raw material and a simplified powder-processing approach. The material specifications were defined based on DDC's engine requirements, and the initial and final component design tasks were completed.

  14. Additive Manufacturing Technology for Biomedical Components: A review

    Science.gov (United States)

    Aimi Zaharin, Haizum; Rani, Ahmad Majdi Abdul; Lenggo Ginta, Turnad; Azam, Farooq I.

    2018-03-01

    Over the last decades, additive manufacturing has shown potential application in ranging fields. No longer a prototyping technology, it is now being utilised as a manufacturing technology for giant industries such as the automotive, aircraft and recently in the medical industry. It is a very successful method that provides health-care solution in biomedical sectors by producing patient-specific prosthetics, improve tissues engineering and facilitate pre-operating session. This paper thus presents a brief overview of the most commercially important additive manufacturing technologies, which is currently available for fabricating biomedical components such as Stereolithography (SLA), Selective Laser Sintering (SLS), Selective Laser Melting (SLM), Fused Deposition Modelling (FDM) and Electron Beam Melting (EBM). It introduces the basic principles of the main process, highlights some of the beneficial applications in medical industry and the current limitation of applied technology.

  15. An Account of Translation of Relics: the Writings of Alonso de Cartagena

    Directory of Open Access Journals (Sweden)

    Luis Fernández Gallardo

    2018-01-01

    Full Text Available The narratives of translation of relics is a genre of devotional literature that didn´t develop extensively in Medieval Castile. But Alonso de Cartagena contributed to it remarkably. In 1453, during a pastoral visit, he decided to move the relics of St. Juliana to a more honorable place. He wrote an account of these facts that adjusts strictly to the features of the genre. This vernacular text contains an exposition about the cult of saints and their relics, which has an intense Thomist inspiration: it sets theological questions with precision and clarity. The provisions on the decoration of the chapel of the relics offer an interesting testimony of the debate on religious image which is then developed in Castile.

  16. Radiological data acquisition, investigation and evaluation of mining relics

    International Nuclear Information System (INIS)

    1992-01-01

    Within the scope of a Federal Project, the environmental radioactivity and the radon concentration in buildings caused by mining relics in the new Federal Lands of Germany are investigated. In the first phase of the project, about 8000 relics of former mining were identified by analysing existing documents, categorised, and recorded in a special data bank. Thereby, 'areas of suspicion' of 1500 km 2 spaciously defined in the beginning could be reduced to 'areas of investigation' of 250 km 2 now to be examined in close coordination with the land and district authorities by a programme gradually adapted to the radiological significance of the relics. Experience with site-specific measuring programmes have already been gained through three pilot projects at typical sites of former mining activities. Recommendations of the German Radiation Protection Commission serve for the evaluation of the results. By the measuring programme for radon in buildings of mining and geological predestined regions more than 25000 buildings of 210 communities have been investigated. The results confirm the expected prevailing influence of the geologic underground on the radon concentration. Extreme values are observed where direct connections additionally exist to mining relics in the ground. (orig./HP) With 11 figs. in annex [de

  17. Supernova relic electron neutrinos and anti-neutrinos in future large-scale observatories

    Energy Technology Data Exchange (ETDEWEB)

    Volpe, C.; Welzel, J. [Institut de Physique Nuclueaire, 91 - Orsay (France)

    2007-07-01

    We investigate the signal from supernova relic neutrinos in future large scale observatories, such as MEMPHYS (UNO, Hyper-K), LENA and GLACIER, at present under study. We discuss that complementary information might be gained from the observation of supernova relic electron antineutrinos and neutrinos using the scattering on protons on one hand, and on nuclei such as oxygen, carbon or argon on the other hand. When determining the relic neutrino fluxes we also include, for the first time, the coupling of the neutrino magnetic moment to magnetic fields within the core collapse supernova. We present numerical results on both the relic {nu}{sub e} and {nu}-bar{sub e} fluxes and on the number of events for {nu}{sub e} + C{sup 12}, {nu}{sub e} + O{sup 16}, {nu}{sub e} + Ar{sup 40} and {nu}-bar{sub e} + p for various oscillation scenarios. The observation of supernova relic neutrinos might provide us with unique information on core-collapse supernova explosions, on the star formation history and on neutrino properties, that still remain unknown. (authors)

  18. Advanced manufacturing technologies for improved competitiveness of the South African manufacturing industry

    CSIR Research Space (South Africa)

    Tlale, NS

    2008-11-01

    Full Text Available In this paper the manufacturing environment with regards to technology and market is discussed. Both the South African and global view are given, together with technology management strategies. Value added products are described and determined...

  19. Construction of full-length cDNA library of white flower Salvia ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-05-18

    May 18, 2009 ... of S. miltiorrhiza bge (Yuan et al., 1990; Wang et al.,. 1998; Huang et al., 2000). Hairy roots and ... or A. tumefaciens strains (Chen et al., 1997; Song et al.,. 1997). ..... Chen H, Yuan JP, Chen F, Zhang YL, Song JY (1997).

  20. Photovoltaic industry manufacturing technology. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Vanecek, D.; Diver, M.; Fernandez, R. [Automation and Robotics Research Inst., Fort Worth, TX (United States)

    1998-08-01

    This report contains the results of the Photovoltaic (PV) Industry Manufacturing Technology Assessment performed by the Automation and Robotics Research Institute (ARRI) of the University of Texas at Arlington for the National Renewable Energy laboratory. ARRI surveyed eleven companies to determine their state-of-manufacturing in the areas of engineering design, operations management, manufacturing technology, equipment maintenance, quality management, and plant conditions. Interviews with company personnel and plant tours at each of the facilities were conducted and the information compiled. The report is divided into two main segments. The first part of the report presents how the industry as a whole conforms to ``World Class`` manufacturing practices. Conclusions are drawn from the results of a survey as to the areas that the PV industry can improve on to become more competitive in the industry and World Class. Appendix A contains the questions asked in the survey, a brief description of the benefits to performing this task and the aggregate response to the questions. Each company participating in the assessment process received the results of their own facility to compare against the industry as a whole. The second part of the report outlines opportunities that exist on the shop floor for improving Process Equipment and Automation Strategies. Appendix B contains the survey that was used to assess each of the manufacturing processes.

  1. Additive manufacturing technology in reconstructive surgery.

    Science.gov (United States)

    Fuller, Scott C; Moore, Michael G

    2016-10-01

    Technological advances have been part and parcel of modern reconstructive surgery, in that practitioners of this discipline are continually looking for innovative ways to perfect their craft and improve patient outcomes. We are currently in a technological climate wherein advances in computers, imaging, and science have coalesced with resulting innovative breakthroughs that are not merely limited to improved outcomes and enhanced patient care, but may provide novel approaches to training the next generation of reconstructive surgeons. New developments in software and modeling platforms, imaging modalities, tissue engineering, additive manufacturing, and customization of implants are poised to revolutionize the field of reconstructive surgery. The interface between technological advances and reconstructive surgery continues to expand. Additive manufacturing techniques continue to evolve in an effort to improve patient outcomes, decrease operative time, and serve as instructional tools for the training of reconstructive surgeons.

  2. Advanced Manufacturing Technologies (AMT): Advanced Near Net Shape Technology

    Data.gov (United States)

    National Aeronautics and Space Administration — The objective of the Advanced Near Net Shape Technology (ANNST) project is to radically improve near net shape manufacturing methods from the current...

  3. Recent Advances in Precision Machinery and Manufacturing Technology

    DEFF Research Database (Denmark)

    Liu, Chien-Hung; Hsieh, Wen-Hsiang; Chang, Zong-Yu

    2014-01-01

    Precision machinery and manufacturing technology are be- coming more important in current and future technologies. New knowledge in this field will aid in the advancement of various technologies that are needed to gain industrial competitiveness. To this end, the special issue aims to disseminate...... the latest advancements of relevant fundamental and applied research works of high quality to the inter- national community. The topics of the accepted articles in the special issue include precision manufacturing pro- cesses, measurements and control, robotics and automation, machine tools, advanced...

  4. Relic excavated in western India is probably of Georgian Queen Ketevan.

    Science.gov (United States)

    Rai, Niraj; Taher, Nizamuddin; Singh, Manvendra; Chaubey, Gyaneshwer; Jha, Aditya Nath; Singh, Lalji; Thangaraj, Kumarasamy

    2014-01-01

    History has well documented the execution of Queen Ketevan of Georgia by the Persian Emperor of modern day Iran. Based on historical records, in 1624 two Augustinian friars unearthed the queen's remains and one of them brought the relic to the St. Augustine convent in Goa, India. We carried out ancient DNA analysis on the human bone remains excavated from the St. Augustine convent by sequencing and genotyping of the mitochondrial DNA. The investigations of the remains revealed a unique mtDNA haplogroup U1b, which is absent in India, but present in Georgia and surrounding regions. Since our genetic analysis corroborates archaeological and literary evidence, it is likely that the excavated bone belongs to Queen Ketevan of Georgia. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Survey of Laboratories and Implementation of the Federal Defense Laboratory Diversification Program. Annex B. Department of the Navy Domestic Technology Transfer

    Science.gov (United States)

    1993-10-01

    overseas laboratories. Dental capabilities include oral microbiology, manufacturing technology for unique (dental prosthetic ) items, dental materials...with the National Center of Excellence in Metalworking to rectify production problems in manufacturing low loss, high pressure valves used in...34 Proceedings of the ASTE Fifth Symposium on Composite Materials: Fatigue and Fracture , May 1993. Chen, J. S. J., T. J. Praisner, L. A. Fields, R. T. Norhold and

  6. Field investigation of arsenic in ceramic pot filter-treated drinking water.

    Science.gov (United States)

    Archer, A R; Elmore, A C; Bell, E; Rozycki, C

    2011-01-01

    Ceramic pot filters (CPFs) is one of several household water treatment technologies that is used to treat drinking water in developing areas. The filters have the advantage of being able to be manufactured using primarily locally available materials and local labor. However, naturally-occurring arsenic present in the clay used to make the filters has the potential to contaminate the water in excess of the World Health Organization drinking water standard of 0.01 mg/L. A manufacturing facility in Guatemala routinely rinses filters to reduce arsenic concentrations prior to distribution to consumers. A systemic study was performed to evaluate the change in arsenic concentrations with increasing volumes of rinse water. Arsenic field kit results were compared to standard method laboratory results, and dissolved versus suspended arsenic concentrations in CPF-treated water were evaluated. The results of the study suggest that rinsing is an effective means of mitigating arsenic leached from the filters, and that even in the absence of a formal rinsing program, routine consumer use may result in the rapid decline of arsenic concentrations. More importantly, the results indicate that filter manufacturers should give strong consideration to implementing an arsenic testing program.

  7. High flow ceramic pot filters.

    Science.gov (United States)

    van Halem, D; van der Laan, H; Soppe, A I A; Heijman, S G J

    2017-11-01

    Ceramic pot filters are considered safe, robust and appropriate technologies, but there is a general consensus that water revenues are limited due to clogging of the ceramic element. The objective of this study was to investigate the potential of high flow ceramic pot filters to produce more water without sacrificing their microbial removal efficacy. High flow pot filters, produced by increasing the rice husk content, had a higher initial flow rate (6-19 L h -1 ), but initial LRVs for E. coli of high flow filters was slightly lower than for regular ceramic pot filters. This disadvantage was, however, only temporarily as the clogging in high flow filters had a positive effect on the LRV for E. coli (from below 1 to 2-3 after clogging). Therefore, it can be carefully concluded that regular ceramic pot filters perform better initially, but after clogging, the high flow filters have a higher flow rate as well as a higher LRV for E. coli. To improve the initial performance of new high flow filters, it is recommended to further utilize residence time of the water in the receptacle, since additional E. coli inactivation was observed during overnight storage. Although a relationship was observed between flow rate and LRV of MS2 bacteriophages, both regular and high flow filters were unable to reach over 2 LRV. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Virtual CIM and Digital Manufacturing

    Institute of Scientific and Technical Information of China (English)

    Sev V.Nagalingam; Grier C.I.Lin

    2006-01-01

    Manufacturing enterprises play an important role in improving the economic environment of a country.Today, the capability to produce high quality products with shorter delivery time and the ability to produce according to the diverse customer requirements has become the characteristics of successful manufacturing industries. Application of intelligent manufacturing systems and Computer integrated manufacturing (CIM) are the most effective methods for overcoming the issues faced by present day manufactures while retaining the employment level and revenue of a country in today's highly competitive global market. With the developments taking place in CIM and its related technologies, the application of CIM in manufacturing enterprises has become a reality from the dream. This paper highlights the historical developments towards automation and the need for CIM systems. Furthermore, it analyses some new terms such as agile manufacturing, digital manufacturing, agent-based manufacturing and others, which have been emerging recently, and argues all these new technologies are the subsystems of CIM. In addition, this paper provides a new direction in CIM to fulfil the emerging challenges in today's global market and to satisfy the emerging need of virtual enterprises in the form of Virtual CIM.

  9. Advanced Manufacturing Office Clean Water Processing Technologies

    Energy Technology Data Exchange (ETDEWEB)

    None

    2018-03-01

    The DOE Office of Energy Efficiency and Renewable Energy (EERE)’s Advanced Manufacturing Office partners with industry, small business, universities, and other stakeholders to identify and invest in emerging technologies with the potential to create high-quality domestic manufacturing jobs and enhance the global competitiveness of the United States.

  10. Cosmic relics from the big bang

    International Nuclear Information System (INIS)

    Hall, L.J.

    1988-12-01

    A brief introduction to the big bang picture of the early universe is given. Dark matter is discussed; particularly its implications for elementary particle physics. A classification scheme for dark matter relics is given. 21 refs., 11 figs., 1 tab

  11. Cosmic relics from the big bang

    Energy Technology Data Exchange (ETDEWEB)

    Hall, L.J.

    1988-12-01

    A brief introduction to the big bang picture of the early universe is given. Dark matter is discussed; particularly its implications for elementary particle physics. A classification scheme for dark matter relics is given. 21 refs., 11 figs., 1 tab.

  12. Another shock for the Bullet cluster, and the source of seed electrons for radio relics

    Science.gov (United States)

    Shimwell, Timothy W.; Markevitch, Maxim; Brown, Shea; Feretti, Luigina; Gaensler, B. M.; Johnston-Hollitt, M.; Lage, Craig; Srinivasan, Raghav

    2015-05-01

    With Australia Telescope Compact Array observations, we detect a highly elongated Mpc-scale diffuse radio source on the eastern periphery of the Bullet cluster 1E 0657-55.8, which we argue has the positional, spectral and polarimetric characteristics of a radio relic. This powerful relic (2.3 ± 0.1 × 1025 W Hz-1) consists of a bright northern bulb and a faint linear tail. The bulb emits 94 per cent of the observed radio flux and has the highest surface brightness of any known relic. Exactly coincident with the linear tail, we find a sharp X-ray surface brightness edge in the deep Chandra image of the cluster - a signature of a shock front in the hot intracluster medium (ICM), located on the opposite side of the cluster to the famous bow shock. This new example of an X-ray shock coincident with a relic further supports the hypothesis that shocks in the outer regions of clusters can form relics via diffusive shock (re-)acceleration. Intriguingly, our new relic suggests that seed electrons for reacceleration are coming from a local remnant of a radio galaxy, which we are lucky to catch before its complete disruption. If this scenario, in which a relic forms when a shock crosses a well-defined region of the ICM polluted with aged relativistic plasma - as opposed to the usual assumption that seeds are uniformly mixed in the ICM - is also the case for other relics, this may explain a number of peculiar properties of peripheral relics.

  13. Chaos in the fractional order Chen system and its control

    International Nuclear Information System (INIS)

    Li Chunguang; Chen Guanrong

    2004-01-01

    In this letter, we study the chaotic behaviors in the fractional order Chen system. We found that chaos exists in the fractional order Chen system with order less than 3. The lowest order we found to have chaos in this system is 2.1. Linear feedback control of chaos in this system is also studied

  14. Relic gravitons and viscous cosmologies

    International Nuclear Information System (INIS)

    Cataldo, Mauricio; Mella, Patricio

    2006-01-01

    Previously it was shown that there exists a class of viscous cosmological models which violate the dominant energy condition for a limited amount of time after which they are smoothly connected to the ordinary radiation era (which preserves the dominant energy conditions). This violation of the dominant energy condition at an early cosmological epoch may influence the slopes of energy spectra of relic gravitons that might be of experimental relevance. However, the bulk viscosity coefficient of these cosmologies became negative during the ordinary radiation era, and then the entropy of the sources driving the geometry decreases with time. We show that in the presence of viscous sources with a linear barotropic equation of state p=γρ we get viscous cosmological models with positive bulk viscous stress during all their evolution, and hence the matter entropy increases with the expansion time. In other words, in the framework of viscous cosmologies, there exist isotropic models compatible with the standard second law of thermodynamics which also may influence the slopes of energy spectra of relic gravitons

  15. Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.

    CERN Multimedia

    Maximilien Brice

    2007-01-01

    Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.

  16. Technology transfer and international development: Materials and manufacturing technology

    Science.gov (United States)

    1982-01-01

    Policy oriented studies on technological development in several relatively advanced developing countries were conducted. Priority sectors defined in terms of technological sophistication, capital intensity, value added, and export potential were studied in Brazil, Venezuela, Israel, and Korea. The development of technological policy alternatives for the sponsoring country is assessed. Much emphasis is placed on understanding the dynamics of the sectors through structured interviews with a large sample of firms in the leading manufacturing and materials processing sectors.

  17. A simple observer of the generalized Chen chaotic systems

    International Nuclear Information System (INIS)

    Sun, Y.-J.

    2009-01-01

    In this paper, the generalized Chen chaotic system is considered and the state observation problem of such a system is investigated. Based on the time-domain approach, a simple observer for the generalized Chen chaotic system is proposed to guarantee the global exponential stability of the resulting error system. Furthermore, the guaranteed exponential convergence rate can be correctly estimated. Finally, a numerical example is provided to illustrate the use of the main result.

  18. Intelligent Processing Equipment Developments Within the Navy's Manufacturing Technology Centers of Excellence

    Science.gov (United States)

    Nanzetta, Philip

    1992-01-01

    The U.S. Navy has had an active Manufacturing Technology (MANTECH) Program aimed at developing advanced production processes and equipment since the late-1960's. During the past decade, however, the resources of the MANTECH program were concentrated in Centers of Excellence. Today, the Navy sponsors four manufacturing technology Centers of Excellence: the Automated Manufacturing Research Facility (AMRF); the Electronics Manufacturing Productivity Facility (EMPF); the National Center for Excellence in Metalworking Technology (NCEMT); and the Center of Excellence for Composites Manufacturing Technology (CECMT). This paper briefly describes each of the centers and summarizes typical Intelligent Equipment Processing (IEP) projects that were undertaken.

  19. 2015 Summer Design Challenge: Team A&E (2241) Additively Manufactured Discriminator.

    Energy Technology Data Exchange (ETDEWEB)

    Miller, Sarah E. [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Moore, Brandon James [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States)

    2016-11-01

    Current discriminator designs are based on historical designs and traditional manufacturing methods. The goal of this project was to form non-traditional groups to create novel discriminator designs by taking advantage of additive manufacturing. These designs would expand current discriminator designs and provide insight on the applicability of additive manufacturing for future projects. Our design stretched the current abilities of additive manufacturing and noted desired improvements for the future. Through collaboration with NSC, we noted several additional technologies which work well with additive manufacturing such as topology optimization and CT scanning and determined how these technologies could be improved to better combine with additive manufacturing.

  20. Relating the baryon asymmetry to the thermal relic dark matter density

    International Nuclear Information System (INIS)

    McDonald, John

    2011-01-01

    We present a generic framework, baryomorphosis, which modifies the baryon asymmetry to be naturally of the order of a typical thermal relic weakly interacting massive particle (WIMP) density. We consider a simple scalar-based model to show how this is possible. This model introduces a sector in which a large initial baryon asymmetry is injected into particles ('annihilons'), φ B , φ-circumflex B , of mass ∼100 GeV-1 TeV. φ B φ-circumflex B annihilations convert the initial φ B , φ-circumflex B asymmetry to a final asymmetry with a thermal relic WIMP-like density. This subsequently decays to a conventional baryon asymmetry whose magnitude is naturally related to the density of thermal relic WIMP dark matter. In this way the two coincidences of baryons and dark matter, i.e. why their densities are similar to each other and why they are both similar to a WIMP thermal relic density (the 'WIMP miracle'), may be understood. The model may be tested by the production of annihilons at colliders.

  1. Imprints of relic gravitational waves in cosmic microwave background radiation

    International Nuclear Information System (INIS)

    Baskaran, D.; Grishchuk, L. P.; Polnarev, A. G.

    2006-01-01

    A strong variable gravitational field of the very early Universe inevitably generates relic gravitational waves by amplifying their zero-point quantum oscillations. We begin our discussion by contrasting the concepts of relic gravitational waves and inflationary 'tensor modes'. We explain and summarize the properties of relic gravitational waves that are needed to derive their effects on cosmic microwave background (CMB) temperature and polarization anisotropies. The radiation field is characterized by four invariants I, V, E, B. We reduce the radiative transfer equations to a single integral equation of Voltairre type and solve it analytically and numerically. We formulate the correlation functions C l XX ' for X, X ' =T, E, B and derive their amplitudes, shapes and oscillatory features. Although all of our main conclusions are supported by exact numerical calculations, we obtain them, in effect, analytically by developing and using accurate approximations. We show that the TE correlation at lower l's must be negative (i.e. an anticorrelation), if it is caused by gravitational waves, and positive if it is caused by density perturbations. This difference in TE correlation may be a signature more valuable observationally than the lack or presence of the BB correlation, since the TE signal is about 100 times stronger than the expected BB signal. We discuss the detection by WMAP of the TE anticorrelation at l≅30 and show that such an anticorrelation is possible only in the presence of a significant amount of relic gravitational waves (within the framework of all other common assumptions). We propose models containing considerable amounts of relic gravitational waves that are consistent with the measured TT, TE and EE correlations

  2. TURBULENT COSMIC-RAY REACCELERATION AT RADIO RELICS AND HALOS IN CLUSTERS OF GALAXIES

    International Nuclear Information System (INIS)

    Fujita, Yutaka; Takizawa, Motokazu; Yamazaki, Ryo; Akamatsu, Hiroki; Ohno, Hiroshi

    2015-01-01

    Radio relics are synchrotron emission found on the periphery of galaxy clusters. From the position and the morphology, it is often believed that the relics are generated by cosmic-ray (CR) electrons accelerated at shocks through a diffusive shock acceleration (DSA) mechanism. However, some radio relics have harder spectra than the prediction of the standard DSA model. One example is observed in the cluster 1RXS J0603.3+4214, which is often called the “Toothbrush Cluster.” Interestingly, the position of the relic is shifted from that of a possible shock. In this study, we show that these discrepancies in the spectrum and the position can be solved if turbulent (re)acceleration is very effective behind the shock. This means that for some relics turbulent reacceleration may be the main mechanism to produce high-energy electrons, contrary to the common belief that it is the DSA. Moreover, we show that for efficient reacceleration, the effective mean free path of the electrons has to be much smaller than their Coulomb mean free path. We also study the merging cluster 1E 0657−56, or the “Bullet Cluster,” in which a radio relic has not been found at the position of the prominent shock ahead of the bullet. We indicate that a possible relic at the shock is obscured by the observed large radio halo that is generated by strong turbulence behind the shock. We propose a simple explanation of the morphological differences of radio emission among the Toothbrush, the Bullet, and the Sausage (CIZA J2242.8+5301) Clusters

  3. Thermal relic dark matter beyond the unitarity limit

    Energy Technology Data Exchange (ETDEWEB)

    Harigaya, Keisuke [Berkeley Center for Theoretical Physics, Department of Physics, University of California,Berkeley, CA 94720 (United States); Theoretical Physics Group, Lawrence Berkeley National Laboratory,Berkeley, CA 94720 (United States); Ibe, Masahiro [Kavli IPMU (WPI), UTIAS, The University of Tokyo,Kashiwa, Chiba 277-8583 (Japan); ICRR, The University of Tokyo,Kashiwa, Chiba 277-8582 (Japan); Kaneta, Kunio [Center for Theoretical Physics of the Universe, Institute for Basic Science (IBS),Daejeon 34051 (Korea, Republic of); Nakano, Wakutaka; Suzuki, Motoo [Kavli IPMU (WPI), UTIAS, The University of Tokyo,Kashiwa, Chiba 277-8583 (Japan); ICRR, The University of Tokyo,Kashiwa, Chiba 277-8582 (Japan)

    2016-08-25

    We discuss a simple model of thermal relic dark matter whose mass can be much larger than the so-called unitarity limit on the mass of point-like particle dark matter. The model consists of new strong dynamics with one flavor of fermions in the fundamental representation which is much heavier than the dynamical scale of the new strong dynamics. Dark matter is identified with the lightest baryonic hadron of the new dynamics. The baryonic hadrons annihilate into the mesonic hadrons of the new strong dynamics when they have large radii. Resultantly, thermal relic dark matter with a mass in the PeV range is possible.

  4. Dark matter relic abundance and light sterile neutrinos

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Yi-Lei [Center for High Energy Physics,Peking University, Beijing 100871 (China); Zhu, Shou-hua [Center for High Energy Physics,Peking University, Beijing 100871 (China); Institute of Theoretical Physics & State Key Laboratory of Nuclear Physics and Technology,Peking University, Beijing 100871 (China); Collaborative Innovation Center of Quantum Matter,Beijing 100871 (China)

    2017-01-09

    In this paper, we calculate the relic abundance of the dark matter particles when they can annihilate into sterile neutrinos with the mass ≲100 GeV in a simple model. Unlike the usual standard calculations, the sterile neutrino may fall out of the thermal equilibrium with the thermal bath before the dark matter freezes out. In such a case, if the Yukawa coupling y{sub N} between the Higgs and the sterile neutrino is small, this process gives rise to a larger Ω{sub DM}h{sup 2} so we need a larger coupling between the dark matter and the sterile neutrino for a correct relic abundance.

  5. Photovoltaic technology, performance, manufacturing cost and markets

    International Nuclear Information System (INIS)

    Maycock, P.D.

    1999-01-01

    A comprehensive discussion of key aspects of photovoltaic energy conversion systems will provide the basis for forecasting PV module shipments from 1999 to 2010. Principal areas covered include: (1) Technology and Performance Status: The module efficiency and performance are described for commercial cell technologies including single crystal silicon, polycrystal silicon, ribbon silicon, film silicon on low cost substrate, amorphous silicon, copper indium diselenide, and cadmium telluride; (2) Manufacturing cost: 1999 costs for PV technologies in production (single crystal silicon, polycrystal silicon, and amorphous silicon) are developed. Manufacturing costs for 10--25 MW plants and 100 MW plants will be estimated; (3) The world PV market is summarized by region, top ten companies, and technology; and (4) Forecast of the World Market (seven market sectors) to 2010 will be presented. Key assumptions, price of modules, incentive programs, price of competing electricity generation will be detailed

  6. Micro-manufacturing technologies and their applications a theoretical and practical guide

    CERN Document Server

    Shipley, David

    2017-01-01

    This book provides in-depth theoretical and practical information on recent advances in micro-manufacturing technologies and processes, covering such topics as micro-injection moulding, micro-cutting, micro-EDM, micro-assembly, micro-additive manufacturing, moulded interconnected devices, and microscale metrology. It is designed to provide complementary material for the related e-learning platform on micro-manufacturing developed within the framework of the Leonardo da Vinci project 2013-3748/542424: MIMAN-T: Micro-Manufacturing Training System for SMEs. The book is mainly addressed to technicians and prospective professionals in the sector and will serve as an easily usable tool to facilitate the translation of micro-manufacturing technologies into tangible industrial benefits. Numerous examples are included to assist readers in learning and implementing the described technologies. In addition, an individual chapter is devoted to technological foresight, addressing market analysis and business models for mic...

  7. Conservation of leather historical object by nano technology in ...

    African Journals Online (AJOL)

    This paper examines the conservation of Antibacterial by Nano materials in the manufacture of leather and the implication of such a processes deteriorated of aging leather. As a sample study to improve this process historical cover book is used. Experimental methods are SEM EDX, Cultural Bacterial, Nano materials such ...

  8. Effects of water stress and seed mass on germination and ...

    African Journals Online (AJOL)

    enoh

    2012-03-01

    Mar 1, 2012 ... polyvinylpyrrolidone; TCA, trichloroacetic acid; NBT, nitroblue tetrazolium; TBA ..... seeds had weaker resistances to moderate stress (-0.6. MPa) compared with .... Chen YN,Chen YP,Li WH,Zhang HF (2003). Response of ...

  9. The 'relics of Joan of Arc'

    DEFF Research Database (Denmark)

    Charlier, P.; Poupon, J.; Eb, A.

    2010-01-01

    Archaeological remains can provide concrete cases, making it possible to develop, refine or validate medico-legal techniques. In the case of the so-called 'Joan of Arc's relics' (a group of bone and archaeological remains known as the 'Bottle of Chinon'), 14 specialists analysed the samples such ...

  10. Mortal Ancestors, Immortal Images: Zhang Dai’s Biographical Portraits

    OpenAIRE

    Duncan M. Campbell

    2012-01-01

    Towards the end of his long life, the prolific late-Ming historian and essayist Zhang Dai 張岱 (1597-?1684) completed a book that he had been working on for many years. Entitled Portraits of the Eminent and Worthy Immortals of Zhejiang During the Ming Dynasty (You Ming yuyue san bu xiu tuzan 有明於越三不朽名賢圖贊) the book included the short biographies (with poetic panegyrics) and portraits of 109 men and women of Zhang Dai’s hometown of Shaoxing, one of the epicentres of China’s élite cultural life. Th...

  11. The age grading and the Chen-Ruan cup product

    DEFF Research Database (Denmark)

    A. Hepworth, Richard

    2010-01-01

    We prove that the obstruction bundle used to define the cup-product in Chen-Ruan cohomology is determined by the so-called `age grading' or `degree-shifting numbers'. Indeed, the obstruction bundle can be directly computed using the age grading. We obtain a Kunneth Theorem for Chen-Ruan cohomology...... as a direct consequence of an elementary property of the age grading, and explain how several other results - including associativity of the cup-product - can be proved in a similar way....

  12. China Report, Political, Sociological and Military Affairs, No. 445.

    Science.gov (United States)

    1983-08-11

    2052 0981], Chen Dingming [7115 7844 6900], Jin Xiulan [6855 4423 5695] (F, Mongolian), Zhao Nanqi [6392 0589 6386] Korean), Suo Jingxian [4792...Pen Center and the Guangzhou Pen Center will be headed by Chen Huangmei, another vice-president of the China center and a noted critic. The...1728 4426 6311], Zhang Tengxiao [1728 7506 7197], Chen Dingmou [7115 0002 5399], Chen Lunfen [7115 0243 5358] (F), Chen Xitong [7115 1585 0681

  13. A review of the Technologies Enabling Agile Manufacturing program

    Energy Technology Data Exchange (ETDEWEB)

    Gray, W.H.; Neal, R.E.; Cobb, C.K.

    1996-10-01

    Addressing a technical plan developed in consideration with major US manufacturers, software and hardware providers, and government representatives, the Technologies Enabling Agile Manufacturing (TEAM) program is leveraging the expertise and resources of industry, universities, and federal agencies to develop, integrate, and deploy leap-ahead manufacturing technologies. One of the TEAM program`s goals is to transition products from design to production faster, more efficiently, and at less cost. TEAM`s technology development strategy also provides all participants with early experience in establishing and working within an electronic enterprise that includes access to high-speed networks and high-performance computing and storage systems. The TEAM program uses the cross-cutting tools it collects, develops, and integrates to demonstrate and deploy agile manufacturing capabilities for three high-priority processes identified by industry: material removal, sheet metal forming, electro-mechanical assembly. This paper reviews the current status of the TEAM program with emphasis upon TEAM`s information infrastructure.

  14. Implementing the South African additive manufacturing technology roadmap - the role of an additive manufacturing centre of competence

    Directory of Open Access Journals (Sweden)

    Du Preez, Willie Bouwer

    2015-08-01

    Full Text Available The Rapid Product Development Association of South Africa (RAPDASA expressed the need for a national Additive Manufacturing Roadmap. Consequentially, the South African Department of Science and Technology commissioned the development of a South African Additive Manufacturing Technology Roadmap. This was intended to guide role-players in identifying business opportunities, addressing technology gaps, focusing development programmes, and informing investment decisions that would enable local companies and industry sectors to become global leaders in selected areas of additive manufacturing. The challenge remains now for South Africa to decide on an implementation approach that will maximize the impact in the shortest possible time. This article introduces the concept of a national Additive Manufacturing Centre of Competence (AMCoC as a primary implementation vehicle for the roadmap. The support of the current leading players in additive manufacturing in South Africa for such a centre of competence is shared and their key roles are indicated. A summary of the investments that the leading players have already made in the focus areas of the AMCoC over the past two decades is given as confirmation of their commitment towards the advancement of the additive manufacturing technology. An exposition is given of how the AMCoC could indeed become the primary initiative for achieving the agreed national goals on additive manufacturing. The conclusion is that investment by public and private institutions in an AMCoC would be the next step towards ensuring South Africa’s continued progress in the field.

  15. Immunological evaluation of Lactobacillus casei Zhang: a newly isolated strain from koumiss in Inner Mongolia, China

    Directory of Open Access Journals (Sweden)

    Du Ruiting

    2008-11-01

    Full Text Available Abstract Background There is increasing evidence to suggest an immunomodulation function both within the intestines and systemically upon consuming probiotic species. We recently isolated a novel LAB, Lactobacillus caseiZhang (LcZhang from koumiss. LcZhang exhibited favorable probiotic properties, such as acid resistance, bile resistance, gastrointestinal (GI colonization ability, etc. In order to examine the immunomodulatory qualities of LcZhang, we administered LcZhang to healthy mice with varying doses of either live or heat-killed LcZhang and measured various parameters of the host immune response. Results The study was performed in four separate experiments via oral administration of live and heat-killed LcZhang to BALB/c mice for several consecutive days. We investigated the immunomodulating capacity of LcZhang in vivo by analyzing the profile of cytokines, T cell subpopulations, and immunoglobulin concentrations induced in blood serum and intestinal fluid in BALB/c mice. Only live bacteria elicited a wide range of immune responses, which include the increased production of interferon-γ (IFN-γ, and depression of tumor necrosis factor-α (TNF-α levels. In addition, interleukin-2 (IL-2 and IL-2 receptor gene transcription increased significantly, but the proportion of T cell subsets appeared to be unaffected. We also observed that LcZhang was capable of inducing gut mucosal responses by enhancing the production of secretory Immunoglobulin A (sIgA as well influencing the systemic immunity via the cytokines released to the circulating blood. Conclusion The present work shows that the dose-dependent administration of LcZhang is capable of influencing immune responses, implying that it may be a valuable strain for probiotic use in humans.

  16. Dr.Zhang Ren's Experience in Acupuncture Treatment of Obstinate Eye Diseases

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    @@ Dr.Zhang Ren (張仁), the board chairman of Shanghai Acupuncture Association, has been engaging in acupuncture treatment for more than 30years, during which he has kept on exploring the acupuncture therapies for obstinate diseases,especially for the obstinate eye diseases, ant summed up rich experience in this aspect. The following is a summary of what the author has learned from Dr. Zhang Ren.

  17. Research on the historic preservation of Zhaojiashan village

    Science.gov (United States)

    Ling, Li

    2018-03-01

    Through field investigation and field visiting, we studied and analyzed the ancient villages of Zhaojiashan in Jiancaoping District, Taiyuan City of Shanxi Province. We learned that Zhaojiashan Village is on the only way of the Shanxi Merchants The Tea Road starting from Taiyuan to Xinzhou. It occupies an indispensable and important position in camel road. There are many historical and cultural relics in the village. The analysis of the historical value and the environment of the village has provided the basis for the protection and exploitation of ancient villages.

  18. Manufacturing and joining technologies for helium cooled divertors

    International Nuclear Information System (INIS)

    Aktaa, J.; Basuki, W.W.; Weber, T.; Norajitra, P.; Krauss, W.; Konys, J.

    2014-01-01

    Highlights: • The manufacturing and joining technologies developed at KIT for helium cooled divertors are reviewed and critically discussed. • Various technologies have been pursued and further developed aiming divertor components with very high quality and sufficient reliability. • Very promising routes have been found for which however still R and D works are necessary. • Technologies developed are also useful for other divertor and even blanket concepts, particularly those with tungsten armor. - Abstract: In the helium cooled (HC) divertor, developed at KIT for a fusion power plant, tungsten has been selected as armor as well as structural material due to its crucial properties: high melting point, very low sputtering yield, good thermal conductivity, high temperature strength, low thermal expansion and low activation. Thereby the armor tungsten is attached to the structural tungsten by thermally conductive joint. Due to the brittleness of tungsten at low temperatures its use as structural material is limited to the high temperature part of the component and a structural joint to the reduced activation ferritic martensitic steel EUROFER97 is foreseen. Hence, to realize the selected hybrid material concept reliable tungsten–steel and tungsten–tungsten joints have been developed and will be reported in this paper. In addition, the modular design of the HC divertor requires tungsten armor tiles and tungsten structural thimbles to be manufactured in high numbers with very high quality. Due to the high strength and low temperature brittleness of tungsten special manufacturing techniques need to be developed for the production of parts with no cavities inside and/or surface flaws. The main achievement in developing the respective manufacturing technologies will be presented and discussed. To achieve the objectives mentioned above various manufacturing and joining technologies are pursued. Their later applicability depends on the level of development

  19. Science and technology from global and historical perspectives

    CERN Document Server

    Karagözoğlu, Bahattin

    2017-01-01

    This book provides science and technology ethos to a literate person. It starts with a rather detailed treatment of basic concepts in human values, educational status and domains of education, development of science and technology and their contributions to the welfare of society. It describes ways and means of scientific progresses and technological advancements with their historical perspectives including scientific viewpoints of contributing scientists and technologists. The technical, social, and cultural dimensions are surveyed in relation to acquisition and application of science, and advantages and hindrances of technological developments. Science and Technology is currently taught as a college course in many universities with the intention to introduce topics from a global historical perspective so that the reader shall stretch his/her vision by mapping the past to the future. The book can also serve as a primary reference for such courses.

  20. African Journal of Biotechnology - Vol 11, No 14 (2012)

    African Journals Online (AJOL)

    DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. HD Ding, HJ Zhang, XH Zhu, H Liu, JS Liang, B Lu, 3259-3269 ... DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Y Hanying, X Wei, G Xingxi, 3370-3378 ... FULL TEXT DOWNLOAD FULL TEXT. J Zhang, YC Huang, Q Zhang, ZP Hong, YC Zhou, WL Chen, 3388-3393 ...

  1. On the absence of radio haloes in clusters with double relics

    Science.gov (United States)

    Bonafede, A.; Cassano, R.; Brüggen, M.; Ogrean, G. A.; Riseley, C. J.; Cuciti, V.; de Gasperin, F.; Golovich, N.; Kale, R.; Venturi, T.; van Weeren, R. J.; Wik, D. R.; Wittman, D.

    2017-09-01

    Pairs of radio relics are believed to form during cluster mergers, and are best observed when the merger occurs in the plane of the sky. Mergers can also produce radio haloes, through complex processes likely linked to turbulent re-acceleration of cosmic ray electrons. However, only some clusters with double relics also show a radio halo. Here, we present a novel method to derive upper limits on the radio halo emission, and analyse archival X-ray Chandra data, as well as galaxy velocity dispersions and lensing data, in order to understand the key parameter that switches on radio halo emission. We place upper limits on the halo power below the P1.4 GHz-M500 correlation for some clusters, confirming that clusters with double relics have different radio properties. Computing X-ray morphological indicators, we find that clusters with double relics are associated with the most disturbed clusters. We also investigate the role of different mass-ratios and time-since-merger. Data do not indicate that the merger mass-ratio has an impact on the presence or absence of radio haloes (the null hypothesis that the clusters belong to the same group cannot be rejected). However, the data suggest that the absence of radio haloes could be associated with early and late mergers, but the sample is too small to perform a statistical test. Our study is limited by the small number of clusters with double relics. Future surveys with LOFAR, ASKAP, MeerKat and SKA will provide larger samples to better address this issue.

  2. Additive Biotech-Chances, challenges, and recent applications of additive manufacturing technologies in biotechnology.

    Science.gov (United States)

    Krujatz, Felix; Lode, Anja; Seidel, Julia; Bley, Thomas; Gelinsky, Michael; Steingroewer, Juliane

    2017-10-25

    The diversity and complexity of biotechnological applications are constantly increasing, with ever expanding ranges of production hosts, cultivation conditions and measurement tasks. Consequently, many analytical and cultivation systems for biotechnology and bioprocess engineering, such as microfluidic devices or bioreactors, are tailor-made to precisely satisfy the requirements of specific measurements or cultivation tasks. Additive manufacturing (AM) technologies offer the possibility of fabricating tailor-made 3D laboratory equipment directly from CAD designs with previously inaccessible levels of freedom in terms of structural complexity. This review discusses the historical background of these technologies, their most promising current implementations and the associated workflows, fabrication processes and material specifications, together with some of the major challenges associated with using AM in biotechnology/bioprocess engineering. To illustrate the great potential of AM, selected examples in microfluidic devices, 3D-bioprinting/biofabrication and bioprocess engineering are highlighted. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Cyber physical systems role in manufacturing technologies

    Science.gov (United States)

    Al-Ali, A. R.; Gupta, Ragini; Nabulsi, Ahmad Al

    2018-04-01

    Empowered by the recent development in single System-on-Chip, Internet of Things, and cloud computing technologies, cyber physical systems are evolving as a major controller during and post the manufacturing products process. In additional to their real physical space, cyber products nowadays have a virtual space. A product virtual space is a digital twin that is attached to it to enable manufacturers and their clients to better manufacture, monitor, maintain and operate it throughout its life time cycles, i.e. from the product manufacturing date, through operation and to the end of its lifespan. Each product is equipped with a tiny microcontroller that has a unique identification number, access code and WiFi conductivity to access it anytime and anywhere during its life cycle. This paper presents the cyber physical systems architecture and its role in manufacturing. Also, it highlights the role of Internet of Things and cloud computing in industrial manufacturing and factory automation.

  4. Tests for manufacturing technology of disposal canisters for nuclear spent fuel

    International Nuclear Information System (INIS)

    Raiko, H.; Salonen, T.; Meuronen, I.; Lehto, K.

    1999-06-01

    The summary and status of the results of the manufacturing technology programmes concerning the disposal canister for spent nuclear fuel conducted by Posiva Oy are given in this report. Posiva has maintained a draft plan for a disposal canister design and an assessment of potential manufacturing technologies for about ten years in Finland. Now, during the year 1999, the first full scale demonstration canister is manufactured in Finland. The technology used for manufacturing of this prototype is developed by Posiva Oy mainly in co-operation with domestic industry. The main partner in developing the manufacturing technology for the copper shell has been Outokumpu Poricopper Oy, Pori, Finland, and the main partner in developing the technology for the iron insert of the canister has been Valmet Oyj Rautpohja Foundry, Jyvaeskylae, Finland. In both areas many subcontractors have been used, predominantly domestic engineering workshops, but also some foreign subcontractors, e.g. for EB-welding, who have had large enough welding equipment. This report describes the developing programmes for canister manufacturing, evaluates the results and presents some alternative methods, and tries to evaluate the pros and contras of them. In addition, the adequacy of the achieved technological know-how is assessed in respect of the required quality of the disposal canister. The following manufacturing technologies have been the concrete topics of the development programme: Electron beam welding technology development for thick-walled copper, Casting of massive copper billets, Hot rolling of thick-walled copper plates, Hot pressing and forging in lid manufacture, Extrusion and drawing of copper tubes, Bending of copper plates by roller or press, Machining of copper, Residual stress removal by heat treatment, Non-destructive testing, Long-term strength of EB-welds, Casting and machining of the iron insert of the canister The specialists from all the main developing partner companies have

  5. Technology, International Trade, and Pollution from US Manufacturing

    OpenAIRE

    Arik Levinson

    2009-01-01

    Pollution emitted by US manufacturers declined markedly over the past several decades, even as real manufacturing output increased. I first show that most of the decline in US manufacturing pollution has resulted from changing production processes ("technology"), rather than changes in the mix of goods produced. I then show that increased net imports of polluting goods ("international trade") accounts for only a small portion of the pollution reductions from the changing mix of goods. Togethe...

  6. Advanced Manufacturing Technologies (AMT): Composites Integrated Modeling

    Data.gov (United States)

    National Aeronautics and Space Administration — The Composites Integrated Modeling (CIM) Element developed low cost, lightweight, and efficient composite structures, materials and manufacturing technologies with...

  7. 27 CFR 29.47 - Notice requirement; manufacture of stills.

    Science.gov (United States)

    2010-04-01

    ...; manufacture of stills. 29.47 Section 29.47 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND... Notice requirement; manufacture of stills. (a) General. When required by letter issued by the appropriate... manufactures any still, boiler (double or pot still), condenser, or other apparatus to be used for the purpose...

  8. Centers for manufacturing technology: Industrial Advisory Committee Review

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-10-01

    An advisory committee, composed of senior managers form industrial- sector companies and major manufacturing trade associations and representatives from appropriate educational institutions, meets semi-annually to review and advise the Oak Ridge Centers for Manufacturing Technology (ORCMT) on its economic security program. Individual papers have been indexed separately for the database.

  9. Fermentation characteristics and transit tolerance of probiotic Lactobacillus casei Zhang in soymilk and bovine milk during storage.

    Science.gov (United States)

    Wang, J; Guo, Z; Zhang, Q; Yan, L; Chen, W; Liu, X-M; Zhang, H-P

    2009-06-01

    Lactobacillus casei Zhang is a novel strain that was screened out of koumiss collected in Inner Mongolia, and our previous research showed that L. casei Zhang has health benefits such as cholesterol-reducing and immunomodulating effects. The fermentation characteristics of L. casei Zhang in soymilk and bovine milk and the transit tolerance of L. casei Zhang in fermented milk products during refrigerated storage for 28 d were assessed. A faster decrease in pH and faster growth of L. casei Zhang during fermentation were observed in soymilk compared with bovine milk at various inoculation rates, probably because of the low pH buffering capacity of soymilk. The fermented bovine milk samples had much higher final titratable acidity (TA) values (between 0.80 and 0.93%) than the soymilk samples (between 0.40 and 0.46%). Dramatic increases in TA values in the fermented soymilk samples during storage were observed, and the TA values of the fermented soymilk samples changed from survival rates of freshly prepared cultures of L. casei Zhang in simulated gastric juice at pH 2.0 and 2.5 were 31 and 69%, respectively, and the delivery of L. casei Zhang through fermented soymilk and bovine milk significantly improved the viability of L. casei Zhang in simulated gastric transit. Lactobacillus casei Zhang showed good tolerance to simulated gastric juice and intestinal juice in the fermented soymilk and bovine milk samples, and maintained high viability (>10(8) cfu/g) during storage at 4 degrees C for 28 d. Our results indicated that both soymilk and bovine milk could serve as vehicles for delivery of probiotic L. casei Zhang, and further research is needed to elucidate the mechanism of the change in pH and TA of L. casei Zhang in fermented milk samples during fermentation and storage and to understand the difference between soy- and milk-based systems.

  10. Spatial Integration Analysis of Provincial Historical and Cultural Heritage Resources Based on Geographic Information System (gis) — a Case Study of Spatial Integration Analysis of Historical and Cultural Heritage Resources in Zhejiang Province

    Science.gov (United States)

    Luo, W.; Zhang, J.; Wu, Q.; Chen, J.; Huo, X.; Zhang, J.; Zhang, Y.; Wang, T.

    2017-08-01

    In China historical and cultural heritage resources include historically and culturally famous cities, towns, villages, blocks, immovable cultural relics and the scenic spots with cultural connotation. The spatial distribution laws of these resources are always directly connected to the regional physical geography, historical development and historical traffic geography and have high research values. Meanwhile, the exhibition and use of these resources are greatly influenced by traffic and tourism and other plans at the provincial level, and it is of great realistic significance to offer proposals on traffic and so on that are beneficial to the exhibition of heritage resources based on the research of province distribution laws. This paper takes the spatial analysis of Geographic Information System (GIS) as the basic technological means and all historical and cultural resources in China's Zhejiang Province as research objects, and finds out in the space the accumulation areas and accumulation belts of Zhejiang Province's historic cities and cultural resources through overlay analysis and density analysis, etc. It then discusses the reasons of the formation of these accumulation areas and accumulation belts by combining with the analysis of physical geography and historical geography and so on, and in the end, linking the tourism planning and traffic planning at the provincial level, it provides suggestions on the exhibition and use of accumulation areas and accumulation belts of historic cities and cultural resources.

  11. Prospects for relic neutrino detection

    International Nuclear Information System (INIS)

    Smith, P.F.

    1991-03-01

    The standard big bang model predicts a universal background of relic neutrinos, comparable in number density to the background microwave photons. This neutrino background is undetectable at the present time firstly because the neutrino energy is very low (10 -4 -10 -5 eV) resulting in a very low energy transfer to any conceivable detector, and secondly the low energy gives a lower interaction cross section and hence a very low event rate per unit mass. These obstacles have so far precluded any realistic proposal for relic neutrino detection. The aim of this paper is to illustrate the difficulties in detecting these neutrinos by summarizing six detection ideas which have been previously considered, indicating in each case the problems which have prevented the idea being developed into an experimental proposal. The most promising direction for further study would appear to be that of coherent interactions. So far, no investigations of this idea have resulted in a practical detection scheme, but in this paper one new variation is suggested which could in principle give an observable effect, if the necessary stringent experimental conditions could be created. It is suggested that this may become possible with the aid of foreseeable 21st century developments in nanotechnology. (author)

  12. Composites Materials and Manufacturing Technologies for Space Applications

    Science.gov (United States)

    Vickers, J. H.; Tate, L. C.; Gaddis, S. W.; Neal, R. E.

    2016-01-01

    Composite materials offer significant advantages in space applications. Weight reduction is imperative for deep space systems. However, the pathway to deployment of composites alternatives is problematic. Improvements in the materials and processes are needed, and extensive testing is required to validate the performance, qualify the materials and processes, and certify components. Addressing these challenges could lead to the confident adoption of composites in space applications and provide spin-off technical capabilities for the aerospace and other industries. To address the issues associated with composites applications in space systems, NASA sponsored a Technical Interchange Meeting (TIM) entitled, "Composites Materials and Manufacturing Technologies for Space Applications," the proceedings of which are summarized in this Conference Publication. The NASA Space Technology Mission Directorate and the Game Changing Program chartered the meeting. The meeting was hosted by the National Center for Advanced Manufacturing (NCAM)-a public/private partnership between NASA, the State of Louisiana, Louisiana State University, industry, and academia, in association with the American Composites Manufacturers Association. The Louisiana Center for Manufacturing Sciences served as the coordinator for the TIM.

  13. On soliton solutions of the Wu-Zhang system

    Directory of Open Access Journals (Sweden)

    Inc Mustafa

    2016-01-01

    Full Text Available In this paper, the extended tanh and hirota methods are used to construct soliton solutions for the WuZhang (WZ system. Singular solitary wave, periodic and multi soliton solutions of the WZ system are obtained.

  14. A new application for food customization with additive manufacturing technologies

    Science.gov (United States)

    Serenó, L.; Vallicrosa, G.; Delgado, J.; Ciurana, J.

    2012-04-01

    Additive Manufacturing (AM) technologies have emerged as a freeform approach capable of producing almost any complete three dimensional (3D) objects from computer-aided design (CAD) data by successively adding material layer by layer. Despite the broad range of possibilities, commercial AM technologies remain complex and expensive, making them suitable only for niche applications. The developments of the Fab@Home system as an open AM technology discovered a new range of possibilities of processing different materials such as edible products. The main objective of this work is to analyze and optimize the manufacturing capacity of this system when producing 3D edible objects. A new heated syringe deposition tool was developed and several process parameters were optimized to adapt this technology to consumers' needs. The results revealed in this study show the potential of this system to produce customized edible objects without qualified personnel knowledge, therefore saving manufacturing costs compared to traditional technologies.

  15. A feasibility study for a manufacturing technology deployment center

    Energy Technology Data Exchange (ETDEWEB)

    1994-10-31

    The Automation & Robotics Research Institute (ARRI) and the Texas Engineering Extension Service (TEEX) were funded by the U.S. Department of Energy to determine the feasibility of a regional industrial technology institute to be located at the Superconducting Super Collider (SSC) Central Facility in Waxahachie, Texas. In response to this opportunity, ARRI and TEEX teamed with the DOE Kansas City Plant (managed by Allied Signal, Inc.), Los Alamos National Laboratory (managed by the University of California), Vought Aircraft Company, National Center for Manufacturing Sciences (NCMS), SSC Laboratory, KPMG Peat Marwick, Dallas County Community College, Navarro Community College, Texas Department of Commerce (TDOC), Texas Manufacturing Assistance Center (TMAC), Oklahoma Center for the Advancement of Science and Technology, Arkansas Science and Technology Authority, Louisiana Productivity Center, and the NASA Mid-Continent Technology Transfer Center (MCTTC) to develop a series of options, perform the feasibility analysis and secure industrial reviews of the selected concepts. The final report for this study is presented in three sections: Executive Summary, Business Plan, and Technical Plan. The results from the analysis of the proposed concept support the recommendation of creating a regional technology alliance formed by the states of Texas, New Mexico, Oklahoma, Arkansas and Louisiana through the conversion of the SSC Central facility into a Manufacturing Technology Deployment Center (MTDC).

  16. Manufacturing technology and process for BWR fuel

    International Nuclear Information System (INIS)

    Kato, Shigeru

    1996-01-01

    Following recent advanced technologies, processes and requests of the design changes of BWR fuel, Nuclear Fuel Industries, Ltd. (NFI) has upgraded the manufacturing technology and honed its own skills to complete its brand-new automated facility in Tokai in the latter half of 1980's. The plant uses various forms of automation throughout the manufacturing process: the acceptance of uranium dioxide powder, pelletizing, fuel rod assembling, fuel bundle assembling and shipment. All processes are well computerized and linked together to establish the integrated control system with three levels of Production and Quality Control, Process Control and Process Automation. This multi-level system plays an important role in the quality assurance system which generates the highest quality of fuels and other benefits. (author)

  17. Using datamining approaches to selectacupoints in acupuncture ...

    African Journals Online (AJOL)

    Using datamining approaches to selectacupoints in acupuncture and Moxibustion for knee osteoarthritis. Changyan Liu, Youxin Su, Jian He, Yanan Li, Shaoqing Chen, Yingjie Zhang, Ziyi Zhang, Meili Lu, Zhen He, Wenting Wang, Yiru Wang, Lu Sheng, Zhengxuan Zhan, Xu Wang, Naixi Zheng ...

  18. Alternative implementation of the chaotic Chen-Lee system

    International Nuclear Information System (INIS)

    Sheu, L.-J.; Tam, L.-M.; Chen, H.-K.; Lao, S.-K.

    2009-01-01

    The chaotic Chen-Lee system was developed with a formalism based on the Euler equations for the motion of a rigid body. It was proved that this system is the governing set of equations for gyro motion with feedback control. Recently, studies were conducted to explore the dynamic behavior of this system, including fractional order behavior, the generation of hyperchaos and perturbation analysis, control and anti-control of chaos, synchronization, etc. In this study, we further explore (1) the stability of the equilibrium points and (2) the implementation of an electronic circuit using the Chen-Lee system. It is shown that not only is this system related to gyro motion but can also be applied to electronic circuits for encryption purposes.

  19. Research on Digital Product Modeling Key Technologies of Digital Manufacturing

    Institute of Scientific and Technical Information of China (English)

    DING Guoping; ZHOU Zude; HU Yefa; ZHAO Liang

    2006-01-01

    With the globalization and diversification of the market and the rapid development of Information Technology (IT) and Artificial Intelligence (AI), the digital revolution of manufacturing is coming. One of the key technologies in digital manufacturing is product digital modeling. This paper firstly analyzes the information and features of the product digital model during each stage in the product whole lifecycle, then researches on the three critical technologies of digital modeling in digital manufacturing-product modeling, standard for the exchange of product model data and digital product data management. And the potential signification of the product digital model during the process of digital manufacturing is concluded-product digital model integrates primary features of each stage during the product whole lifecycle based on graphic features, applies STEP as data exchange mechanism, and establishes PDM system to manage the large amount, complicated and dynamic product data to implement the product digital model data exchange, sharing and integration.

  20. Exploring the evolution of investment pattern on advanced manufacturing technology

    DEFF Research Database (Denmark)

    Yang, Cheng; Matthiesen, Rikke Vestergaard; Johansen, John

    2014-01-01

    This paper explores the evolution of investment pattern on advanced manufacturing technology in a manner that builds on a longitudinal perspective. Based on the data of investments in AMTs from 567 manufacturing companies this paper develops a longitudinal taxonomy defined by the evolution of inv...... of technology management, which is comprised primarily of cross-sectional studies that do not address the dynamic nature of investments in AMTs.......This paper explores the evolution of investment pattern on advanced manufacturing technology in a manner that builds on a longitudinal perspective. Based on the data of investments in AMTs from 567 manufacturing companies this paper develops a longitudinal taxonomy defined by the evolution...... of investment patterns on AMT followed by companies over time; identifies the possible evolutionary features of different groups of companies; and suggests the possible explanatory and outcome factors on the evolution of investment pattern on AMTs. By doing so, this study seeks to fill a void in the area...

  1. Mechanisms of all-trans retinoic acid-induced differentiation of acute ...

    Indian Academy of Sciences (India)

    Author Affiliations. Ji-Wang Zhang1 Jian Gu1 Zhen-Yi Wang1 Sai-Juan Chen1 Zhu Chen1. Shanghai Institute of Hematology, Ruijin Hospital Affiliated to Shanghai Second Medical University, 197 Ruijin Road II, Shanghai 200025, People's Republic of China ...

  2. New St-chromosome-specific molecular markers for identifying ...

    Indian Academy of Sciences (India)

    et al. 1994) or JJsSt (Chen et al. 1998) was widely used in wheat breeding programme (Chen .... Japan). Table 1. The features of primers used in this study. Homologous ..... Redinbaugh M. G., Jones T. A. and Zhang Y. T. 2000 Ubiquity of.

  3. An efficient catalytic reductive amination: A facile one-pot access to ...

    Indian Academy of Sciences (India)

    An efficient catalytic reductive amination: A facile one-pot access to ... itors and in the manufacture of detergents and plastics.1 ... ammoniaborane/Ti(OiPr)4,5e ... demonstrated the first method for synthesis of 1,2- ... and column chromatography (Silica gel, n-hexane/ethyl .... supporting information at www.ias.ac.in/chemsci.

  4. Raman spectroscopy as a process analytical technology for pharmaceutical manufacturing and bioprocessing.

    Science.gov (United States)

    Esmonde-White, Karen A; Cuellar, Maryann; Uerpmann, Carsten; Lenain, Bruno; Lewis, Ian R

    2017-01-01

    Adoption of Quality by Design (QbD) principles, regulatory support of QbD, process analytical technology (PAT), and continuous manufacturing are major factors effecting new approaches to pharmaceutical manufacturing and bioprocessing. In this review, we highlight new technology developments, data analysis models, and applications of Raman spectroscopy, which have expanded the scope of Raman spectroscopy as a process analytical technology. Emerging technologies such as transmission and enhanced reflection Raman, and new approaches to using available technologies, expand the scope of Raman spectroscopy in pharmaceutical manufacturing, and now Raman spectroscopy is successfully integrated into real-time release testing, continuous manufacturing, and statistical process control. Since the last major review of Raman as a pharmaceutical PAT in 2010, many new Raman applications in bioprocessing have emerged. Exciting reports of in situ Raman spectroscopy in bioprocesses complement a growing scientific field of biological and biomedical Raman spectroscopy. Raman spectroscopy has made a positive impact as a process analytical and control tool for pharmaceutical manufacturing and bioprocessing, with demonstrated scientific and financial benefits throughout a product's lifecycle.

  5. Advanced Manufacturing Technology: The Perceived Impact on Producer’s Value

    Directory of Open Access Journals (Sweden)

    Rohani Abdullah

    2012-09-01

    Full Text Available The purpose of this study is to determine which AMT has the greatest perceived impact on producer’s value and to identify which AMTs has been most successfully employed. The study population consists of senior manufacturing executives in electrical and electronic firms located in the northern region of Malaysia. The study addresses the senior manufacturing executives’ perceptions on how well specific AMTs have achieved the expectation of the firms implementing them. They are selected as respondents because of their understanding of the technology and their effects, and because as top manufacturing decision makers, their opinions are likely to shape the future technology of the organization. This study found that the type of AMT that perceived the greatest impact on producer’s value is Flexible Manufacturing System, due to its high effects on two dimensions of producer’s value: quality and cost while Just-in-Time is found to be the most successfully employed AMT among respondents. The findings of this study are significant as they contribute to the AMT literature especially in the context of Electrical and Electronic firms. Keywords: advanced manufacturing technology, producer’s value

  6. THE BIODEGRADABILITY AND MECHANICAL STRENGTH OF NUTRITIVE POTS FOR VEGETABLE PLANTING BASED ON LIGNOCELLULOSE COMPOSITE MATERIALS

    OpenAIRE

    Petronela Nechita; Elena Dobrin; Florin Ciolacu; Elena Bobu

    2010-01-01

    Considering the mild degradation strength and the fact that it may be an organic matter reserve for the soil, in the past years lignocellulosic materials have been used as fibrous raw materials in the manufacture of biodegradable nutritive pots for the seedling in vegetable containerized production. This paper analyses the behavior of the nutritive pots made from biodegradable composites for the vegetable seedling production process, focusing on their mechanical strength properties and biodeg...

  7. Neutrino Coannihilation on Dark-Matter Relics?

    Energy Technology Data Exchange (ETDEWEB)

    Barenboim, Gabriela; /Valencia U.; Mena Requejo, Olga; Quigg, Chris; /Fermilab

    2006-04-01

    High-energy neutrinos may resonate with relic background neutralinos to form short-lived sneutrinos. In some circumstances, the decay chain that leads back to the lightest supersymmetric particle would yield few-GeV gamma rays or charged-particle signals. Although resonant coannihilation would occur at an appreciable rate in our galaxy, the signal in any foreseeable detector is unobservably small.

  8. A Technology Selection Framework for Integrating Manufacturing within a Supply Chain

    DEFF Research Database (Denmark)

    Farooq, Sami; O' Brien, Chris

    2012-01-01

    This paper describes a structured analytical approach for selecting a manufacturing technology. A framework consisting of six integrated steps is proposed by considering the growing importance of supply chains in manufacturing organisations. The framework makes use of Analytical Hierarchy (AHP......) approach combined with Strategic Assessment Model (SAM) to evaluate and select the technologies appropriate for providing overall competitive advantage. The framework is intended to assist industrial managers in promoting manufacturing and supply chain collaboration and coordination by including intra...

  9. Thirty-seven transcription factor genes differentially respond to a ...

    Indian Academy of Sciences (India)

    Plant transcription factors and insect defence si. Thirty-seven transcription factor genes differentially respond to a harpin protein and affect resistance to the green peach aphid in Arabidopsis. HUNLIN. PIN. RUOXUE LIŲ, BEIBEI LÜ, XIAOMENG WANG, CHUNLING ZHANG, SHUPING ZHANG, JUN QIAN, LEI CHEN,.

  10. Preparation and characterization of water-absorbing composite ...

    African Journals Online (AJOL)

    ABCO

    2012-08-16

    Aug 16, 2012 ... 2007; Doorkosh et al., 2000), and natural polymers (Yu et al., 2009; Doorkosh et al., ... Zhang et al., 2007; Lee and Chen, 2005; Neaman et al.,. 2004; Lin et al., 2001). ..... Li A, Zhang JP, Wang AQ (2007). Utilization of starch ...

  11. Comparative analysis of the gene expression profile of probiotic Lactobacillus casei Zhang with and without fermented milk as a vehicle during transit in a simulated gastrointestinal tract.

    Science.gov (United States)

    Wang, Jicheng; Zhong, Zhi; Zhang, Wenyi; Bao, Qiuhua; Wei, Aibin; Meng, He; Zhang, Heping

    2012-06-01

    Studies have found that the survival of probiotics could be strongly enhanced with dairy products as delivery vehicles, but the molecular mechanism by which this might occur has seldom been mentioned. In this study, microarray technology was used to detect the gene expression profile of Lactobacillus casei Zhang with and without fermented milk used as a delivery vehicle during transit in simulated gastrointestinal juice. Numerous genes of L. casei Zhang in strain suspension were upregulated compared to those from L. casei Zhang in fermented milk. These data might indicate that L. casei Zhang is stimulated directly without the protection of fermented milk, and the high-level gene expression observed here may be a stress response at the transcriptional level. A large proportion of genes involved in translation and cell division were downregulated in the bacteria that were in strain suspension during transit in simulated intestinal juice. This may impede protein biosynthesis and cell division and partially explain the lower viability of L. casei Zhang during transit in the gastrointestinal tract without the delivery vehicle. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  12. The Clean Energy Manufacturing Analysis Center (CEMAC): Providing Analysis and Insights on Clean Technology Manufacturing

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, Nicholi S [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

    2017-09-28

    The U.S. Department of Energy's Clean Energy Manufacturing Analysis Center (CEMAC) provides objective analysis and up-to-date data on global supply chains and manufacturing of clean energy technologies. Policymakers and industry leaders seek CEMAC insights to inform choices to promote economic growth and the transition to a clean energy economy.

  13. Small Scale Turbopump Manufacturing Technology and Material Processes

    Science.gov (United States)

    Alvarez, Erika; Morgan, Kristin; Wells, Doug; Zimmerman, Frank

    2011-01-01

    As part of an internal research and development project, NASA Marshall Space Flight Center (MSFC) has been developing a high specific impulse 9,000-lbf LOX/LH2 pump-fed engine testbed with the capability to throttle 10:1. A Fuel Turbopump (FTP) with the ability to operate across a speed range of 30,000-rpm to 100,000-rpm was developed and analyzed. This small size and flight-like Fuel Turbopump has completed the design and analysis phase and is currently in the manufacturing phase. This paper highlights the manufacturing and processes efforts to fabricate an approximately 20-lb turbopump with small flow passages, intricately bladed components and approximately 3-in diameter impellers. As a result of the small scale and tight tolerances of the hardware on this turbopump, several unique manufacturing and material challenges were encountered. Some of the technologies highlighted in this paper include the use of powder metallurgy technology to manufacture small impellers, electron beam welding of a turbine blisk shroud, and casting challenges. The use of risk reduction efforts such as non-destructive testing (NDT) and evaluation (NDE), fractography, material testing, and component spin testing are also discussed in this paper.

  14. The effects of reciprocal cross on inheritance of DNA methylation in ...

    African Journals Online (AJOL)

    enoh

    2012-03-20

    Mar 20, 2012 ... DNA methylation plays an important role for regulation of gene expression. To study ... genes, and newly acquired epigenetic states of trans- ... GACTGCGTACCAATTCAGA(E6). ATCATGAGTCCTGCTCGGTAC(H6). GACTGCGTACCAATTCAGT(E7) ..... Chen XQ, Ma Y, Chen F, Song WQ, Zhang L (2009).

  15. Factors influencing the technology upgrading and catch-up of Chinese wind turbine manufacturers: Technology acquisition mechanisms and government policies

    International Nuclear Information System (INIS)

    Qiu, Yueming; Ortolano, Leonard; David Wang, Yi

    2013-01-01

    This paper uses firm level data for the Chinese wind turbine manufacturing industry from 1998 to 2009 to quantify the effects of technology acquisition mechanisms – purchasing production licenses from foreign manufacturers, joint design with foreign design firms, joint-ventures and domestic R and D – on wind turbine manufacturers' technology levels (as measured by turbine size, in megawatts). It also examines the impacts of government policies on manufacturer technology levels. Technology upgrading (measured by increase of turbine size) and catch-up (measured by decrease in the distance to the world technology frontier in terms of turbine size) are used to measure advances in technology level. Results from econometric modeling studies indicate that firms' technology acquisition mechanisms and degree of business diversification are statistically significant factors in influencing technology upgrading. Similar results were found for the catch-up variable (i.e., distance to the world technology frontier). The influence of government policies is significant for technology upgrading but not catch-up. These and other modeling results are shown to have implications for both policymakers and wind turbine manufacturers. - Highlights: ► Technology acquired through joint design has the highest level. ► Technology acquired through purchasing production license has the lowest level. ► Technology acquired through domestic R and D has the level in between. ► A firm with related other businesses tends to have a higher level of technology. ► The influence of policies is significant for technology upgrade but not catch-up

  16. Hopf bifurcation analysis of Chen circuit with direct time delay feedback

    International Nuclear Information System (INIS)

    Hai-Peng, Ren; Wen-Chao, Li; Ding, Liu

    2010-01-01

    Direct time delay feedback can make non-chaotic Chen circuit chaotic. The chaotic Chen circuit with direct time delay feedback possesses rich and complex dynamical behaviours. To reach a deep and clear understanding of the dynamics of such circuits described by delay differential equations, Hopf bifurcation in the circuit is analysed using the Hopf bifurcation theory and the central manifold theorem in this paper. Bifurcation points and bifurcation directions are derived in detail, which prove to be consistent with the previous bifurcation diagram. Numerical simulations and experimental results are given to verify the theoretical analysis. Hopf bifurcation analysis can explain and predict the periodical orbit (oscillation) in Chen circuit with direct time delay feedback. Bifurcation boundaries are derived using the Hopf bifurcation analysis, which will be helpful for determining the parameters in the stabilisation of the originally chaotic circuit

  17. Synchronization and anti-synchronization coexist in Chen-Lee chaotic systems

    International Nuclear Information System (INIS)

    Chen, J.-H.; Chen, H.-K.; Lin, Y.-K.

    2009-01-01

    This study demonstrates that synchronization and anti-synchronization can coexist in Chen-Lee chaotic systems by direct linear coupling. Based on Lyapunov's direct method, a linear controller was designed to assure that two different types of synchronization can simultaneously be achieved. Further, the hybrid projective synchronization of Chen-Lee chaotic systems was studied using a nonlinear control scheme. The nonlinear controller was designed according to the Lyapunov stability theory to guarantee the hybrid projective synchronization, including synchronization, anti-synchronization, and projective synchronization. Finally, numerical examples are presented in order to illustrate the proposed synchronization approach.

  18. Mapping the ecological dimensions and potential distributions of endangered relic shrubs in western Ordos biodiversity center.

    Science.gov (United States)

    Zhu, Geng-Ping; Li, Hui-Qi; Zhao, Li; Man, Liang; Liu, Qiang

    2016-05-20

    Potential distributions of endemic relic shrubs in western Ordos were poorly mapped, which hindered our implementation of proper conservation. Here we investigated the applicability of ecological niche modeling for endangered relic shrubs to detect areas of priority for biodiversity conservation and analyze differences in ecological niche spaces used by relic shrubs. We applied ordination and niche modeling techniques to assess main environmental drivers of five endemic relic shrubs in western Ordos, namely, Ammopiptanthus mongolicus, Amygdalus mongolica, Helianthemum songaricum, Potaninia mongolica, and Tetraena mongolica. We calculated niche overlap metrics in gridded environmental spaces and compared geographical projections of ecological niches to determine similarities and differences of niches occupied by relic shrubs. All studied taxa presented different responses to environmental factors, which resulted in a unique combination of niche conditions. Precipitation availability and soil quality characteristics play important roles in the distributions of most shrubs. Each relic shrub is constrained by a unique set of environmental conditions, the distribution of one species cannot be implied by the distribution of another, highlighting the inadequacy of one-fits-all type of conservation measure. Our stacked habitat suitability maps revealed regions around Yellow River, which are highly suitable for most species, thereby providing high conservation value.

  19. MULTI-FREQUENCY STUDIES OF RADIO RELICS IN THE GALAXY CLUSTERS A4038, A1664, AND A786

    Energy Technology Data Exchange (ETDEWEB)

    Kale, Ruta; Dwarakanath, K. S., E-mail: ruta@iucaa.ernet.in [Raman Research Institute, C. V. Raman Avenue, Sadashivanagar, Bangalore 560 080 (India)

    2012-01-01

    We present a multi-frequency study of radio relics associated with the galaxy clusters A4038, A1664, and A786. Radio images, integrated spectra, spectral index maps, and fits to the integrated spectra in the framework of the adiabatic compression model are presented. Images of the relic in A4038 at 150, 240, and 606 MHz with the Giant Meterwave Radio Telescope have revealed extended ultra-steep spectrum ({alpha} {approx} -1.8 to -2.7) emission of extent 210 Multiplication-Sign 80 kpc{sup 2}. The model of passively evolving radio lobes compressed by a shock fits the integrated spectrum best. The relic with a circular morphology at the outskirts of the cluster A1664 has an integrated spectral index of {approx} - 1.10 {+-} 0.06 and is best fit by the model of radio lobes lurking for {approx}4 Multiplication-Sign 10{sup 7} yr. The relic near A786 has a curved spectrum and is best fit by a model of radio lobes lurking for {approx}3 Multiplication-Sign 10{sup 7} yr. At 4.7 GHz, a compact radio source, possibly the progenitor of the A786 relic, is detected near the center of the radio relic. The A786 radio relic is thus likely a lurking radio galaxy rather than a site of cosmological shock as has been considered in earlier studies.

  20. CSIR R&D in emerging manufacturing technologies

    CSIR Research Space (South Africa)

    Trollip, Neil

    2017-10-01

    Full Text Available This presentation discusses Advanced Robotics and Emerging manufacturing technologies by Dr Neil Trollip, at the 6th CSIR Conference: Ideas that work for industrial development, 5-6 October 2017, CSIR International Convention Centre, Pretoria...

  1. Technological innovation capability in Malaysian-owned resource-based manufacturing companies: Early findings

    Science.gov (United States)

    Razali, Nur Fhathyhah; Mohd Suradi, Nur Riza; Ahmad Shahabuddin, Faridatul Azna; Ismail, Wan Rosmanira; Abidin, Norkisme Zainal; Ahmad, Nor Amalina; Mustafa, Zainol

    2013-04-01

    This study aims to identify the determinants of technological innovation capability of Malaysian-owned companies in the resources-based manufacturing, to identify the relationship between technological innovation capability (TIC) and technological innovation performance (TIP) for the resource-based manufacturing. Furthermore, this study also aims to identify innovation capability factors that need more emphasis and improvements from the respective authority. The scope of the study covers four industries which are petrochemical industries, pharmaceutical industries, palm oil-based industries and food processing industries which are located in the state of Selangor. Descriptive analysis, correlation analysis and performance capability analysis were used in this study. It was found that, technological innovation capabilities (TIC) for companies in the resource-based manufacturing are moderate. Factors such as policies capability, human resources capability and facilities capability have a positive relationship with the performance of technological innovation (TIP). These findings will help the government in making decisions and better implementation of policies to strengthen the competitiveness of the company, particularly in resource-based manufacturing.

  2. Additive manufacturing technologies of porous metal implants

    Directory of Open Access Journals (Sweden)

    Yang Quanzhan

    2014-06-01

    Full Text Available Biomedical metal materials with good corrosion resistance and mechanical properties are widely used in orthopedic surgery and dental implant materials, but they can easily cause stress shielding due to the significant difference in elastic modulus between the implant and human bones. The elastic modulus of porous metals is lower than that of dense metals. Therefore, it is possible to adjust the pore parameters to make the elastic modulus of porous metals match or be comparable with that of the bone tissue. At the same time, the open porous metals with pores connected to each other could provide the structural condition for bone ingrowth, which is helpful in strengthening the biological combination of bone tissue with the implants. Therefore, the preparation technologies of porous metal implants and related research have been drawing more and more attention due to the excellent features of porous metals. Selective laser melting (SLM and electron beam melting technology (EBM are important research fields of additive manufacturing. They have the advantages of directly forming arbitrarily complex shaped metal parts which are suitable for the preparation of porous metal implants with complex shape and fine structure. As new manufacturing technologies, the applications of SLM and EBM for porous metal implants have just begun. This paper aims to understand the technology status of SLM and EBM, the research progress of porous metal implants preparation by using SLM and EBM, and the biological compatibility of the materials, individual design and manufacturing requirements. The existing problems and future research directions for porous metal implants prepared by SLM and EBM methods are discussed in the last paragraph.

  3. Historical hydronuclear testing: Characterization and remediation technologies

    Energy Technology Data Exchange (ETDEWEB)

    Shaulis, L.; Wilson, G.; Jacobson, R.

    1997-09-01

    This report examines the most current literature and information available on characterization and remediation technologies that could be used on the Nevada Test Site (NTS) historical hydronuclear test areas. Historical hydronuclear tests use high explosives and a small amount of plutonium. The explosion scatters plutonium within a contained subsurface environment. There is currently a need to characterize these test areas to determine the spatial extent of plutonium in the subsurface and whether geohydrologic processes are transporting the plutonium away from the event site. Three technologies were identified to assist in the characterization of the sites. These technologies are the Pipe Explorer{trademark}, cone penetrometer, and drilling. If the characterization results indicate that remediation is needed, three remediation technologies were identified that should be appropriate, namely: capping or sealing the surface, in situ grouting, and in situ vitrification. Capping the surface would prevent vertical infiltration of water into the soil column, but would not restrict lateral movement of vadose zone water. Both the in situ grouting and vitrification techniques would attempt to immobilize the radioactive contaminants to restrict or prevent leaching of the radioactive contaminants into the groundwater. In situ grouting uses penetrometers or boreholes to inject the soil below the contaminant zone with low permeability grout. In situ vitrification melts the soil containing contaminants into a solid block. This technique would provide a significantly longer contaminant immobilization, but some research and development would be required to re-engineer existing systems for use at deep soil depths. Currently, equipment can only handle shallow depth vitrification. After existing documentation on the historical hydronuclear tests have been reviewed and the sites have been visited, more specific recommendations will be made.

  4. Historical hydronuclear testing: Characterization and remediation technologies

    International Nuclear Information System (INIS)

    Shaulis, L.; Wilson, G.; Jacobson, R.

    1997-09-01

    This report examines the most current literature and information available on characterization and remediation technologies that could be used on the Nevada Test Site (NTS) historical hydronuclear test areas. Historical hydronuclear tests use high explosives and a small amount of plutonium. The explosion scatters plutonium within a contained subsurface environment. There is currently a need to characterize these test areas to determine the spatial extent of plutonium in the subsurface and whether geohydrologic processes are transporting the plutonium away from the event site. Three technologies were identified to assist in the characterization of the sites. These technologies are the Pipe Explorer trademark, cone penetrometer, and drilling. If the characterization results indicate that remediation is needed, three remediation technologies were identified that should be appropriate, namely: capping or sealing the surface, in situ grouting, and in situ vitrification. Capping the surface would prevent vertical infiltration of water into the soil column, but would not restrict lateral movement of vadose zone water. Both the in situ grouting and vitrification techniques would attempt to immobilize the radioactive contaminants to restrict or prevent leaching of the radioactive contaminants into the groundwater. In situ grouting uses penetrometers or boreholes to inject the soil below the contaminant zone with low permeability grout. In situ vitrification melts the soil containing contaminants into a solid block. This technique would provide a significantly longer contaminant immobilization, but some research and development would be required to re-engineer existing systems for use at deep soil depths. Currently, equipment can only handle shallow depth vitrification. After existing documentation on the historical hydronuclear tests have been reviewed and the sites have been visited, more specific recommendations will be made

  5. ‘A Special Zone for Confucianism’? Theses of the Academician Zhang Xianglong on Traditional Chinese Culture”

    Directory of Open Access Journals (Sweden)

    Monika GÄNßBAUER

    2014-05-01

    Full Text Available This article introduces the work of the academician Zhang Xianglong (b. 1949, focussing on his idea of establishing a “special zone for Confucianism” in China. Zhang argues that special protection is needed for Confucian traditions which he perceives as the leading culture of China. Confucian culture should find its way out of the museum, says Zhang. He also refers to the political concept of “one country, two systems” that was implemented when Hongkong was restored to Chinese rule. Zhang applies this to his idea of a “special zone for Confucianism”, suggesting that this political concept could be extended to “one country, three systems”. In my view Zhang is developing new, creative ideas for possible experimental fields dealing with Confucianism in the context of the People’s Republic of China. In the end it is my argument that it would be helpful to conduct in-depth research on the possible role of Confucianism in today’s China.

  6. The application of welding technology in power plant manufacture

    International Nuclear Information System (INIS)

    Price, A.T.; Chew, B.

    1989-02-01

    A strategy is presented for the application of welding technology in the manufacture of power plant. A flow chart description is adopted in the present paper to provide a general framework outlining the sequence of activities leading to manufacture. The broad chronological order of events is treated under the three headings, Component Design, Welding Development, and Implementation. Important factors that have to be considered at each of these stages are shown in subsidiary flow charts together with short notes to provide context and an aide memoire for those involved in welding technology. (author)

  7. Injection technologies for the repair of damaged concrete structures

    CERN Document Server

    Panasyuk, V V; Sylovanyuk, V P

    2014-01-01

    This book analyzes the most important achievements in science and engineering practice concerning operational factors that cause damage to concrete and reinforced concrete structures. It includes methods for assessing their strength and service life, especially those that are based on modern concepts of the fracture mechanics of materials. It also includes basic approaches to the prediction of the remaining service life for long-term operational structures. Much attention is paid to injection technologies for restoring the serviceability of damaged concrete and reinforced concrete structures. In particular, technologies for remedying holes, cracks, corrosion damages etc. The books contains sample cases in which the above technologies have been used to restore structural integrity and extend the reliable service life of concrete and reinforced concrete constructions, especially NPPs, underground railways, bridges, seaports and historical relics.

  8. Parametric study of the fractional-order Chen-Lee system

    International Nuclear Information System (INIS)

    Tam, L.M.; Tou, W.M.S.

    2008-01-01

    The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q 1 = q 2 = q 3 = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found

  9. Parametric study of the fractional-order Chen-Lee system

    Energy Technology Data Exchange (ETDEWEB)

    Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Tou, W.M.S. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)

    2008-08-15

    The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q{sub 1} = q{sub 2} = q{sub 3} = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found.

  10. Welding and manufacture technology of three-layer bellows

    International Nuclear Information System (INIS)

    Dou Zhengping; Jiang Yunbo; Xie Zhiqiang; Pei Qiusheng; Wang Jindong; Zhang Zhiqiang

    2005-01-01

    Using argon tungsten arc welding the technology research and manufacture was carried out for three-layer bellows with the diameter of 350 mm or 230 mm. The theory rigidity and fatigue intensity of welded bellows were experimentally confirmed, the reasonable welding parameters was selected, and three-layer welded bellows with the diameter of 350 mm or 230 mm were manufactured. Quality of welded bellows accords with techniques standard. (authors)

  11. PV Cz silicon manufacturing technology improvements

    Science.gov (United States)

    Jester, T.

    1995-09-01

    This describes work done in the final phase of a 3-y, 3-phase contract to demonstrate cost reductions and improvements in manufacturing technology. The work focused on near-term projects in the SSI (Siemens Solar Industries) Czochralski (Cz) manufacturing facility in Camarillo, CA; the final phase was concentrated in areas of crystal growth, wafer technology, and environmental, safety, and health issues. During this period: (1) The crystal-growing operation improved with increased growth capacity; (2) Wafer processing with wire saws continued to progress; the wire saws yielded almost 50 percent more wafers per inch in production. The wire saws needs less etching, too; (3) Cell processing improvements focused on better handling and higher mechanical yield. The cell electrical distribution improved with a smaller standard deviation in the distribution; and (4) Module designs for lower material and labor costs continued, with focus on a new junction box, larger modules with larger cells, and less costly framing techniques. Two modules demonstrating these cost reductions were delivered during this phase.

  12. Advances in solid dosage form manufacturing technology.

    Science.gov (United States)

    Andrews, Gavin P

    2007-12-15

    Currently, the pharmaceutical and healthcare industries are moving through a period of unparalleled change. Major multinational pharmaceutical companies are restructuring, consolidating, merging and more importantly critically assessing their competitiveness to ensure constant growth in an ever-more demanding market where the cost of developing novel products is continuously increasing. The pharmaceutical manufacturing processes currently in existence for the production of solid oral dosage forms are associated with significant disadvantages and in many instances provide many processing problems. Therefore, it is well accepted that there is an increasing need for alternative processes to dramatically improve powder processing, and more importantly to ensure that acceptable, reproducible solid dosage forms can be manufactured. Consequently, pharmaceutical companies are beginning to invest in innovative processes capable of producing solid dosage forms that better meet the needs of the patient while providing efficient manufacturing operations. This article discusses two emerging solid dosage form manufacturing technologies, namely hot-melt extrusion and fluidized hot-melt granulation.

  13. Changing Manufacturing Technology and Jobs in Defense Industries.

    Science.gov (United States)

    Oliver, Richard P.

    1983-01-01

    Provides information on the current status of computer-assisted manufacturing, current employment, and plans for new technology in three defense-related industries: aircraft, shipbuilding, and ordnance. (SK)

  14. Factors that influence the rejection of new manufacturing technologies and concepts

    Science.gov (United States)

    Kristen G. Hoff; Timothy J. Greene; Timothy J. Greene

    1998-01-01

    New manufacturing technologies or concepts often are adopted to improve a firm's competitive advantage over other firms in the same industry. The benefits that a firm expects to receive as a result of that adoption are presumed to outweigh the risk factors that accompany the adoption of a new manufacturing technology. Much research has been conducted to...

  15. Further investigations on a question of Zhang and Lü

    Directory of Open Access Journals (Sweden)

    Abhijit Banerjee

    2015-09-01

    Full Text Available In the paper taking the question of Zhang and Lü [15] into background, wepresent one theorem which will improve and extend results of Banerjee-Majumdar [2] and arecent result of Li-Huang [9].

  16. Development of Manufacturing Technology to Accelerate Cost Reduction of Low Concentration and

    Energy Technology Data Exchange (ETDEWEB)

    Detrick, Adam [The Solaria Corporation, Fremont, CA (United States)

    2017-09-27

    The purpose of this project was to accelerate deployment of cost-effective US-based manufacturing of Solaria’s unique c-Si module technology. This effort successfully resulted in the development of US-based manufacturing technology to support two highly-differentiated, market leading product platforms. The project was initially predicated on developing Solaria’s low-concentration PV (LCPV) module technology which at the time of the award was uniquely positioned to exceed the SunShot price goal of $0.50/Wp for standard c-Si modules. The Solaria LCPV module is a 2.5x concentrator that leverages proven, high-reliability PV module materials and low silicon cell usage into a technology package that already had the lowest direct material cost and leading Levelized Cost of Electricity (LCOE). With over 25 MW commercially deployed globally, the Solaria module was well positioned to continue to lead in PV module cost reduction. Throughout the term of the contract, market conditions changed dramatically and so to did Solaria’s product offerings to support this. However, the manufacturing technology developed for the LCPV module was successfully leveraged and optimized to support two new and different product platforms. BIPV “PowerVision” and High-efficiency “PowerXT” modules. The primary barrier to enabling high-volume PV module manufacturing in the US is the high manual labor component in certain unique aspects of our manufacturing process. The funding was used to develop unique manufacturing automation which makes the manual labor components of these key processes more efficient and increase throughput. At the core of Solaria’s product offerings are its unique and proprietary techniques for dicing and re-arranging solar cells into modules with highly-differentiated characteristics that address key gaps in the c-Si market. It is these techniques that were successfully evolved and deployed into US-based manufacturing site with SunShot funding. Today, Solaria

  17. Sustainable In-Space Manufacturing through Rapid Prototyping Technology

    Data.gov (United States)

    National Aeronautics and Space Administration — In space manufacturing is crucial to humanity’s continued exploration and habitation of space. While new spacecraft and propulsion technologies promise higher...

  18. State-of-the-art of fiber-reinforced polymers in additive manufacturing technologies

    DEFF Research Database (Denmark)

    Hofstätter, Thomas; Pedersen, David Bue; Tosello, Guido

    2017-01-01

    Additive manufacturing technologies have received a lot of attention in recent years for their use in multiple materials such as metals, ceramics, and polymers. The aim of this review article is to analyze the technology of fiber-reinforced polymers and its implementation with additive...... manufacturing. This article reviews recent developments, ideas, and state-of-the-art technologies in this field. Moreover, it gives an overview of the materials currently available for fiber-reinforced material technology....

  19. Make disruptive technological change happen - The case of additive manufacturing

    DEFF Research Database (Denmark)

    Maresch, Daniela; Gartner, Johannes

    2018-01-01

    Disruptive technological change can contribute to a more abundant world. However, potentially disruptive technologies often struggle to significantly influence practice. One prominent example is additive manufacturing (AM). Although AM is often regarded as the next great technological revolution...

  20. Advanced Manufacturing Technology Adoption In SMEs: An Integrative Model

    Directory of Open Access Journals (Sweden)

    Mirmahdi Darbanhosseiniamirkhiz

    2012-12-01

    Full Text Available The objective of this study is to assess the critical factors which influence adoption of  Advanced Manufacturing Technologies (AMTs and identify hurdles and barriers which prevent small- and medium-sized enterprises (SMEs from accomplishing the desired goals of AMTs utilization. The proposed framework has synthesized previous studies and integrated related studies through conducting a comprehensive literature review. This paper is a theoretical construction that synthesizes previous studies, and centers on three context (Environmental, Organizational, and Technological which influence  adoption of AMTs. This model can provide managers with practical solutions through granting in-depth understanding of whole internal, external, and technological environments, and awarding empirical insight into overcoming barriers to the adoption and implementation of AMT and other process innovations in manufacturing organizations.

  1. Dynamics of fractional-ordered Chen system with delay

    Indian Academy of Sciences (India)

    Though this subject has a history of more than 300 years, utility and applicability of fractional calculus to various branches of science and engineering have been real- ... variants of Chen system and see the qualitative changes in attractor and ...

  2. Relational demography in coach-athlete dyads | Zhang | African ...

    African Journals Online (AJOL)

    This study used an adapted version of Zhang's (2004) trust questionnaire to examine perceived characteristic and trust differences between coach and athlete dyads that differ in gender or ethnicity as well as in dyads that were similar. The four different gender dyad groups were male athlete with male coach (MAMC), ...

  3. A state of the Art report on Manufacturing technology of high burn-up fuel cladding

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kyeong Ho; Nam, Cheol; Baek, Jong Hyuk; Choi, Byung Kwon; Park, Sang Yoon; Lee, Myung Ho; Jeong, Yong Hwan

    1999-09-01

    In order to manufacturing the prototype fuel cladding, overall manufacturing processes and technologies should be thoroughly understood on the manufacturing processes and technologies of foreign cladding tubes. Generally, the important technology related to fuel cladding tube manufacturing processes for PWRs/PHWRs is divided into three stages. The first stage is to produce the zirconium sponge from zirconium sand, the second stage is to produce the zircaloy shell or TREX from zirconium sponge ingot and finally, cladding is produced from TREX or zircaloy shell. Therefore, the manufacturing processes including the first and second stages are described in brief in this technology report in order to understand the whole fuel cladding manufacturing processes. (author)

  4. Additive Manufacturing and Casting Technology Comparison: Mechanical Properties, Productivity and Cost Benchmark

    Science.gov (United States)

    Vevers, A.; Kromanis, A.; Gerins, E.; Ozolins, J.

    2018-04-01

    The casting technology is one of the oldest production technologies in the world but in the recent years metal additive manufacturing also known as metal 3D printing has been evolving with huge steps. Both technologies have capabilities to produce parts with internal holes and at first glance surface roughness is similar for both technologies, which means that for precise dimensions parts have to be machined in places where precise fit is necessary. Benchmark tests have been made to find out if parts which are produced with metal additive manufacturing can be used to replace parts which are produced with casting technology. Most of the comparative tests have been made with GJS-400-15 grade which is one of the most popular cast iron grades. To compare mechanical properties samples have been produced using additive manufacturing and tested for tensile strength, hardness, surface roughness and microstructure and then the results have been compared with the samples produced with casting technology. In addition, both technologies have been compared in terms of the production time and production costs to see if additive manufacturing is competitive with the casting technology. The original paper has been written in the Latvian language as part of the Master Thesis within the framework of the production technology study programme at Riga Technical University.

  5. Manufacturing capability as a technological development indicator in the pharmaceutical industry

    Directory of Open Access Journals (Sweden)

    John Jairo Gallo Castro

    2010-01-01

    Full Text Available The pharmaceutical industrial has five subsectors: medicines, cosmetics, phytotherapeutics, cleaning products and medical devices. The medicine subsector consists of organisations producing, importing and selling these products. Most studies about this industry have been guided by economic interests without assessing technological aspects of production. This article was aimed at proposing a methodology for assessing and describing the medicine sector according to its technological development by using the manufacturing capability concept. The main information was taken from the Colombian Medicaments and Food Surveillance Institute’s (Instituto Nacional de Vigilancia de Medicamentos y Alimentos - INVIMA databases related to pharmaceutical plant production in Bogotá, including material transformation facilities. This study led to three characteristics being identified for defining the pharmaceutical industry’s manufacturing capability: that related to the pharmacological group to which active pharmaceutical ingredients belong, that linked to specifications regarding medicines’ sterility and that related to the technology required for manufacturing each pharmaceutical product. An analysis of these features has thus been presented and some technologies have been identified which have not been transferred or assimilated by the organisations being studied. It was found that manufacturing capability should be considered as being an indicator of the degree of technological development in these subsectors in Colombia.

  6. Evaluation of effectiveness in a novel wound healing ointment ...

    African Journals Online (AJOL)

    Evaluation of effectiveness in a novel wound healing ointment-crocodile oil burn ointment. Hua-Liang Li, Yi-Tao Deng, Zi-Ran Zhang, Qi-Rui Fu, Ya-Hui Zheng, Xing-Mei Cao, Jing Nie, Li-Wen Fu, Li-Ping Chen, You-Xiong Xiong, Dong-Yan Shen, Qing-Xi Chen ...

  7. [Learning experience of acupuncture technique from professor ZHANG Jin].

    Science.gov (United States)

    Xue, Hongsheng; Zhang, Jin

    2017-08-12

    As a famous acupuncturist in the world, professor ZHANG Jin believes the key of acupuncture technique is the use of force, and the understanding of the "concentrating the force into needle body" is essential to understand the essence of acupuncture technique. With deep study of Huangdi Neijing ( The Inner Canon of Huangdi ) and Zhenjiu Dacheng ( Compendium of Acupuncture and Moxibustion ), the author further learned professor ZHANG Jin 's theory and operation specification of "concentrating force into needle body, so the force arriving before and together with needle". The whole-body force should be subtly focused on the tip of needle, and gentle force at tip of needle could get significant reinforcing and reducing effect. In addition, proper timing at tip of needle could start reinforcing and reducing effect, lead qi to disease location, and achieve superior clinical efficacy.

  8. Quantifying Adoption Rates and Energy Savings Over Time for Advanced Manufacturing Technologies

    Energy Technology Data Exchange (ETDEWEB)

    Hanes, Rebecca [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Carpenter Petri, Alberta C [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Riddle, Matt [Argonne National Laboratory; Graziano, Diane [Argonne National Laboratory

    2017-10-09

    Energy-efficient manufacturing technologies can reduce energy consumption and lower operating costs for an individual manufacturing facility, but increased process complexity and the resulting risk of disruption means that manufacturers may be reluctant to adopt such technologies. In order to quantify potential energy savings at scales larger than a single facility, it is necessary to account for how quickly and how widely the technology will be adopted by manufacturers. This work develops a methodology for estimating energy-efficient manufacturing technology adoption rates using quantitative, objectively measurable technology characteristics, including energetic, economic and technical criteria. Twelve technology characteristics are considered, and each characteristic is assigned an importance weight that reflects its impact on the overall technology adoption rate. Technology characteristic data and importance weights are used to calculate the adoption score, a number between 0 and 1 that represents how quickly the technology is likely to be adopted. The adoption score is then used to estimate parameters for the Bass diffusion curve, which quantifies the change in the number of new technology adopters in a population over time. Finally, energy savings at the sector level are calculated over time by multiplying the number of new technology adopters at each time step with the technology's facility-level energy savings. The proposed methodology will be applied to five state-of-the-art energy-efficient technologies in the carbon fiber composites sector, with technology data obtained from the Department of Energy's 2016 bandwidth study. Because the importance weights used in estimating the Bass curve parameters are subjective, a sensitivity analysis will be performed on the weights to obtain a range of parameters for each technology. The potential energy savings for each technology and the rate at which each technology is adopted in the sector are quantified

  9. Emerging technology: A key enabler for modernizing pharmaceutical manufacturing and advancing product quality.

    Science.gov (United States)

    O'Connor, Thomas F; Yu, Lawrence X; Lee, Sau L

    2016-07-25

    Issues in product quality have produced recalls and caused drug shortages in United States (U.S.) in the past few years. These quality issues were often due to outdated manufacturing technologies and equipment as well as lack of an effective quality management system. To ensure consistent supply of safe, effective and high-quality drug products available to the patients, the U.S. Food and Drug Administration (FDA) supports modernizing pharmaceutical manufacturing for improvements in product quality. Specifically, five new initiatives are proposed here to achieve this goal. They include: (i) advancing regulatory science for pharmaceutical manufacturing; (ii) establishing a public-private institute for pharmaceutical manufacturing innovation; (iii) creating incentives for investment in the technological upgrade of manufacturing processes and facilities; (iv) leveraging external expertise for regulatory quality assessment of emerging technologies; and (v) promoting the international harmonization of approaches for expediting the global adoption of emerging technologies. Published by Elsevier B.V.

  10. The Effect of the Implementation of Advanced Manufacturing Technologies on Training in the Manufacturing Sector

    Science.gov (United States)

    Castrillon, Isabel Dieguez; Cantorna, Ana I. Sinde

    2005-01-01

    Purpose: The aim of this article is to gain insight into some of the factors that determine personnel-training efforts in companies introducing advanced manufacturing technologies (AMTs). The study provides empirical evidence from a sector with high rates of technological modernisation. Design/methodology/approach: "Ad hoc" survey of 90…

  11. Effect of LongZhang Gargle on Biofilm Formation and Acidogenicity of Streptococcus mutans In Vitro

    Directory of Open Access Journals (Sweden)

    Yutao Yang

    2016-01-01

    Full Text Available Streptococcus mutans, with the ability of high-rate acid production and strong biofilm formation, is considered the predominant bacterial species in the pathogenesis of human dental caries. Natural products which may be bioactive against S. mutans have become a hot spot to researches to control dental caries. LongZhang Gargle, completely made from Chinese herbs, was investigated for its effects on acid production and biofilm formation by S. mutans in this study. The results showed an antimicrobial activity of LongZhang Gargle against S. mutans planktonic growth at the minimum inhibitory concentration (MIC of 16% and minimum bactericidal concentration (MBC of 32%. Acid production was significantly inhibited at sub-MIC concentrations. Biofilm formation was also significantly disrupted, and 8% was the minimum concentration that resulted in at least 50% inhibition of biofilm formation (MBIC50. A scanning electron microscopy (SEM showed an effective disruption of LongZhang Gargle on S. mutans biofilm integrity. In addition, a confocal laser scanning microscopy (CLSM suggested that the extracellular polysaccharides (EPS synthesis could be inhibited by LongZhang Gargle at a relatively low concentration. These findings suggest that LongZhang Gargle may be a promising natural anticariogenic agent in that it suppresses planktonic growth, acid production, and biofilm formation against S. mutans.

  12. Crossword Puzzle Makes It Fun: Introduce Green Manufacturing in Wood Technology Courses

    Science.gov (United States)

    Iley, John L.; Hague, Doug

    2012-01-01

    Sustainable, or "green," manufacturing and its practices are becoming more and more a part of today's industry, including wood product manufacturing. This article provides introductory information on green manufacturing in wood technology and a crossword puzzle based on green manufacturing terms. The authors use the puzzle at the college level to…

  13. Locally manufactured wind power technology for sustainable rural electrification

    International Nuclear Information System (INIS)

    Leary, J.; While, A.; Howell, R.

    2012-01-01

    To date, the use of wind power for rural electrification has been limited. However the fact that micro-wind turbines can be manufactured using only basic workshop tools, techniques and materials, and therefore can be produced locally is often overlooked. Local manufacture has the potential to boost the local economy, build local capacity, reduce costs and produce resilient and flexible energy systems. However, locally manufactured technology must be seen as socially embedded due to the variety of local knowledge, skills, equipment and materials needed to construct and maintain such systems, as well as the organisational structures needed to ensure their long term sustainability. Evidence from successful initiatives suggests that stable institutional support from intermediaries such as the local/national government or NGOs is necessary to foster the development of a wind power industry based on local manufacture. The roles of these intermediaries include identifying and targeting windy areas with favourable environmental conditions, conducting research and development, collecting feedback from end users, creating supply chains for new parts and materials and developing relevant knowledge and skills. In this paper, three case studies of specific initiatives are analysed to draw out the social, economic and technical factors that could facilitate wider adoption of the technology. - Highlights: ► Local manufacture of wind turbines often overlooked for rural electrification. ► Flexible to adapt to local context and benefits local economy, capacity and supply chain. ► Development of technology discussed and 3 case studies of dissemination analysed. ► Critical factors: institutional support, system level planning, continuity of supply. ► Dissemination successful in Inner Mongolia; work continues elsewhere.

  14. arXiv Squeezed relic photons beyond the horizon

    CERN Document Server

    Giovannini, Massimo

    2017-11-14

    Owing to the analogy with the ordinary photons in the visible range of the electromagnetic spectrum, the Glauber theory is generalized to address the quantum coherence of the gauge field fluctuations parametrically amplified during an inflationary stage of expansion. The first and second degrees of quantum coherence of relic photons are then computed beyond the effective horizon defined by the evolution of the susceptibility. In the zero-delay limit the Hanbury Brown-Twiss correlations exhibit a super-Poissonian statistics which is however different from the conventional results of the single-mode approximation customarily employed, in quantum optics, to classify the coherence properties of visible light. While in the case of large-scale curvature perturbations the degrees of quantum coherence coincide with the naive expectation of the single-mode approximation, the net degree of second-order coherence computed for the relic photons diminishes thanks to the effect of the polarizations. We suggest that the Han...

  15. Making the most of the relic density for dark matter searches at the LHC 14 TeV Run

    International Nuclear Information System (INIS)

    Busoni, Giorgio; Simone, Andrea De; Jacques, Thomas; Morgante, Enrico; Riotto, Antonio

    2015-01-01

    As the LHC continues to search for new weakly interacting particles, it is important to remember that the search is strongly motivated by the existence of dark matter. In view of a possible positive signal, it is essential to ask whether the newly discovered weakly interacting particle can be be assigned the label 'dark matter'. Within a given set of simplified models and modest working assumptions, we reinterpret the relic abundance bound as a relic abundance range, and compare the parameter space yielding the correct relic abundance with projections of the Run II exclusion regions. Assuming that dark matter is within the reach of the LHC, we also make the comparison with the potential 5σ discovery regions. Reversing the logic, relic density calculations can be used to optimize dark matter searches by motivating choices of parameters where the LHC can probe most deeply into the dark matter parameter space. In the event that DM is seen outside of the region giving the correct relic abundance, we will learn that either thermal relic DM is ruled out in that model, or the DM-quark coupling is suppressed relative to the DM coupling strength to other SM particles

  16. Comparing numerical methods for the solutions of the Chen system

    International Nuclear Information System (INIS)

    Noorani, M.S.M.; Hashim, I.; Ahmad, R.; Bakar, S.A.; Ismail, E.S.; Zakaria, A.M.

    2007-01-01

    In this paper, the Adomian decomposition method (ADM) is applied to the Chen system which is a three-dimensional system of ODEs with quadratic nonlinearities. The ADM yields an analytical solution in terms of a rapidly convergent infinite power series with easily computable terms. Comparisons between the decomposition solutions and the classical fourth-order Runge-Kutta (RK4) numerical solutions are made. In particular we look at the accuracy of the ADM as the Chen system changes from a non-chaotic system to a chaotic one. To highlight some computational difficulties due to a high Lyapunov exponent, a comparison with the Lorenz system is given

  17. Manufacturing technology for practical Josephson voltage normals; Fertigungstechnologie fuer praxistaugliche Josephson-Spannungsnormale

    Energy Technology Data Exchange (ETDEWEB)

    Kohlmann, Johannes; Kieler, Oliver [Physikalisch-Technische Bundesanstalt (PTB), Braunschweig (Germany). Arbeitsgruppe 2.43 ' ' Josephson-Schaltungen' '

    2016-09-15

    In this contribution we present the manufacturing technology for the fabrication of integrated superconducting Josephson serial circuits for voltage normals. First we summarize some foundations for Josephson voltage normals and sketch the concept and the setup of the circuits, before we describe the manufacturing technology form modern practical Josephson voltage normals.

  18. Manufacturing technologies for direct methanol fuel cells (DMFCs)

    Energy Technology Data Exchange (ETDEWEB)

    Gluesen, Andreas; Mueller, Martin; Kimiaie, Nicola; Konradi, Irene; Mergel, Juergen; Stolten, Detlef [Forschungszentrum Juelich (Germany). Inst. of Energy Research - IEF-3: Fuel Cells

    2010-07-01

    Fuel cell research is focussing on increasing power density and lifetime and reducing costs of the whole fuel cell system. In order to reach these aims, it is necessary to develop appropriately designed components outgoing from high quality materials, a suitable manufacturing process and a well balanced system. To make use of the advantages that can be obtained by developing production technology, we are mainly improving the coating and assembling techniques for polymer electrolyte fuel cells, especially Direct Methanol Fuel Cells (DMFCs). Coating is used for making fuel cell electrodes as well as highly conductive contacts. Assembling is used to join larger components like membrane electrode assemblies (MEAs) and bipolar units consisting of flow fields and the separator plate, as well as entire stacks. On the one hand a reproducible manufacturing process is required to study fine differences in fuel cell performance affected by new materials or new designs. On the other hand a change in each parameter of the manufacturing process itself can change product properties and therefore affect fuel cell performance. As a result, gas diffusion electrodes (GDEs) are now produced automatically in square-meter batches, the hot-pressing of MEAs is a fully automated process and by pre-assembling the number of parts that have to be assembled in a stack was reduced by a factor of 10. These achievements make DMFC manufacturing more reproducible and less error-prone. All these and further developments of manufacturing technology are necessary to make DMFCs ready for the market. (orig.)

  19. Ramp Technology and Intelligent Processing in Small Manufacturing

    Science.gov (United States)

    Rentz, Richard E.

    1992-01-01

    To address the issues of excessive inventories and increasing procurement lead times, the Navy is actively pursuing flexible computer integrated manufacturing (FCIM) technologies, integrated by communication networks to respond rapidly to its requirements for parts. The Rapid Acquisition of Manufactured Parts (RAMP) program, initiated in 1986, is an integral part of this effort. The RAMP program's goal is to reduce the current average production lead times experienced by the Navy's inventory control points by a factor of 90 percent. The manufacturing engineering component of the RAMP architecture utilizes an intelligent processing technology built around a knowledge-based shell provided by ICAD, Inc. Rules and data bases in the software simulate an expert manufacturing planner's knowledge of shop processes and equipment. This expert system can use Product Data Exchange using STEP (PDES) data to determine what features the required part has, what material is required to manufacture it, what machines and tools are needed, and how the part should be held (fixtured) for machining, among other factors. The program's rule base then indicates, for example, how to make each feature, in what order to make it, and to which machines on the shop floor the part should be routed for processing. This information becomes part of the shop work order. The process planning function under RAMP greatly reduces the time and effort required to complete a process plan. Since the PDES file that drives the intelligent processing is 100 percent complete and accurate to start with, the potential for costly errors is greatly diminished.

  20. Ubiquitous Robotic Technology for Smart Manufacturing System.

    Science.gov (United States)

    Wang, Wenshan; Zhu, Xiaoxiao; Wang, Liyu; Qiu, Qiang; Cao, Qixin

    2016-01-01

    As the manufacturing tasks become more individualized and more flexible, the machines in smart factory are required to do variable tasks collaboratively without reprogramming. This paper for the first time discusses the similarity between smart manufacturing systems and the ubiquitous robotic systems and makes an effort on deploying ubiquitous robotic technology to the smart factory. Specifically, a component based framework is proposed in order to enable the communication and cooperation of the heterogeneous robotic devices. Further, compared to the service robotic domain, the smart manufacturing systems are often in larger size. So a hierarchical planning method was implemented to improve the planning efficiency. A test bed of smart factory is developed. It demonstrates that the proposed framework is suitable for industrial domain, and the hierarchical planning method is able to solve large problems intractable with flat methods.

  1. Problems and Instruments of Product and Technological Diversification of Manufacturing

    Directory of Open Access Journals (Sweden)

    Kuzmin Oleg Ye.

    2015-03-01

    Full Text Available The purpose of the article involves identification of objectives and development of instruments for product and technological diversification aimed at updating the range of products and introducing innovative technologies, which will ensure a high level of competitiveness and create preconditions for steady development of the enterprise. As a result of studying the literary sources the objectives and instruments for development of enterprises by means of product and technological diversification have been defined. The article suggests effective instruments of product and technological diversification of manufacturing, namely: the model of expansion of the product range, multi-criteria model of optimization of the product range, a modified model of Kantorovich-Koopmans for implementing new production technologies with set limits on the product output. Further research relate to formation of instruments for manufacturing diversification by means of introducing new types of production.

  2. Finger of a saint, thumb of a priest: medieval relics in the Diocese of Turku, and the archaeology of lived bodies

    Directory of Open Access Journals (Sweden)

    Visa Immonen

    2011-01-01

    Full Text Available The relics of Turku Cathedral are remains belonging to the bodies of holy persons, different from ours, even today, although the cathedral is the see for the archbishop of the Evangelical Lutheran Church of Finland, and relics are not on public display. Among the relics of the cathedral, there is a fragment of a radius, which according to its authentica, belongs to St Henry. Relics and reliquaries were in the core of medieval piety, and the cult of saints had infused throughout the society. Due to their central position in culture, relics offer glimpses at a range of material, social and cultural phenomena related to medieval embodiment.The Department of Archaeology at the University of Turku began to study the finger relic of St Eric and other items in the assemblage of Turku Cathedral in 2007. Relics and reliquaries are being opened and documented and organic as well as inorganic samples are being taken for a range of scientific analyses. So far the project has concentrated on building a chronological chart of individual artefacts. The majority of the relics date to the fourteenth century, although much more recent datings have also been obtained. The challenge of the project is not to stop when a better understanding of materials, their origins and age has been accomplished, but to use the results as a steppingstone into a study of the practices of medieval relic veneration. Medieval bodies and those material processes which authenticate relics, or distinguish saints’ bodies from other human remains, are thus at the heart of this article discussing embodiment.

  3. SUPPLIER SELECTION STRATEGY AND MANUFACTURING FLEXIBILITY: IMPACT OF QUALITY AND TECHNOLOGY ROADMAPS

    Directory of Open Access Journals (Sweden)

    Muhamad Jantan

    2006-01-01

    Full Text Available The study evaluates the relationship between technology, quality, cost and delivery performance-based, supplier selection strategies, and manufacturing flexibilities namely, product flexibility, launch flexibility, and volume flexibility. Moreover, the moderating impact of supplier management strategies, namely quality roadmap and technology roadmap on the above relationships were also explored. The data for the study was drawn from a sample of companies listed in the factory directory published by the Penang Development Corporation (PDC. A postal survey of 120 manufacturers provided a return of 92 usable responses. The results reveal that the selection of suppliers based on technological and quality performance positively affects all the three dimensions of manufacturing flexibility, with complementary effects of good technology and quality roadmaps. Technology and quality roadmaps act as predictors for product and volume flexibilities. However, when launch flexibility is the focus, both technology and quality roadmaps moderate the impact of supplier selection strategies. Details of the findings, theoretical and practical implications, and the research limitation are discussed.

  4. Impulsive synchronization of Chen's hyperchaotic system

    International Nuclear Information System (INIS)

    Haeri, Mohammad; Dehghani, Mahsa

    2006-01-01

    In this Letter the impulsive synchronization of the Chen's hyperchaotic systems is discussed. Some new and sufficient conditions on varying impulsive distance are established in order to guarantee the synchronizabillity of the systems using the synchronization method. In particular, some simple conditions are derived in synchronizing the systems by equal impulsive distances. Two illustrative examples are provided to show the feasibility and the effectiveness of the proposed method. The boundaries of the stable regions are also estimated

  5. Forecasting Jakarta composite index (IHSG) based on chen fuzzy time series and firefly clustering algorithm

    Science.gov (United States)

    Ningrum, R. W.; Surarso, B.; Farikhin; Safarudin, Y. M.

    2018-03-01

    This paper proposes the combination of Firefly Algorithm (FA) and Chen Fuzzy Time Series Forecasting. Most of the existing fuzzy forecasting methods based on fuzzy time series use the static length of intervals. Therefore, we apply an artificial intelligence, i.e., Firefly Algorithm (FA) to set non-stationary length of intervals for each cluster on Chen Method. The method is evaluated by applying on the Jakarta Composite Index (IHSG) and compare with classical Chen Fuzzy Time Series Forecasting. Its performance verified through simulation using Matlab.

  6. Manufacturing Concepts of the Future – Upcoming Technologies Solving Upcoming Challenges

    DEFF Research Database (Denmark)

    Hadar, Ronen; Bilberg, Arne

    concepts and technologies that are being developed today which may be used to solve manufacturing challenges in the future, such as: (self) reconfigurable manufacturing systems, (focused) flexible manufacturing systems, and AI inspired manufacturing. The paper will try to offer a critical point of view......This paper presents an examination of Western European manufacturers’ future challenges as can be predicted today. Some of the challenges analyzed in the paper are: globalization, individualism and customization and agility challenges. Hereafter, the paper presents a broad analysis on manufacturing...

  7. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Ruoxue Liu1 Beibei Lü1 Xiaomeng Wang1 Chunling Zhang1 Shuping Zhang1 Jun Qian1 Lei Chen1 Haojie Shi1 Hansong Dong1. State Ministry of Agriculture Key Laboratory of Monitoring and Management of Crop Pathogens and Insect Pests, Nanjing Agricultural University, Nanjing 210095, China ...

  8. The Role of SIRT1 In Breast Cancer Stem Cells

    Science.gov (United States)

    2016-09-01

    2009;9:123-8. 56. Ma W, Xiao GG, Mao J, Lu Y, Song B, Wang L, Fan S, Fan P, Hou Z, Li J, Yu X, 20 Wang B, Wang H, Wang H, Xu F, Li Y, Liu Q, Li L...Int J Biol Sci. 2010;6:599-612. 63. Zhang Y, Zhang M, Dong H, Yong S, Li X, Olashaw N, Kruk PA, Cheng JQ, Bai W, Chen J, Nicosia SV, Zhang X

  9. Present Status and Future Growth of Advanced Maintenance Technology and Strategy in US Manufacturing.

    Science.gov (United States)

    Jin, Xiaoning; Weiss, Brian A; Siegel, David; Lee, Jay

    2016-01-01

    The goals of this paper are to 1) examine the current practices of diagnostics, prognostics, and maintenance employed by United States (U.S.) manufacturers to achieve productivity and quality targets and 2) to understand the present level of maintenance technologies and strategies that are being incorporated into these practices. A study is performed to contrast the impact of various industry-specific factors on the effectiveness and profitability of the implementation of prognostics and health management technologies, and maintenance strategies using both surveys and case studies on a sample of U.S. manufacturing firms ranging from small to mid-sized enterprises (SMEs) to large-sized manufacturing enterprises in various industries. The results obtained provide important insights on the different impacts of specific factors on the successful adoption of these technologies between SMEs and large manufacturing enterprises. The varying degrees of success with respect to current maintenance programs highlight the opportunity for larger manufacturers to improve maintenance practices and consider the use of advanced prognostics and health management (PHM) technology. This paper also provides the existing gaps, barriers, future trends, and roadmaps for manufacturing PHM technology and maintenance strategy.

  10. Adapted Technology for Small-scale Manufacture of Caerphilly-Type ...

    African Journals Online (AJOL)

    Adapted Technology for Small-scale Manufacture of Caerphilly-Type Cheese from Cow's Milk in the Western Highlands Region of Cameroon. ... The production of the cheese should be encouraged at the household level. The Journal of Food Technology in Africa Volume 5 Number 4 (October - December 2000), pp. 120- ...

  11. Forecasting the Success of Implementing Sensors Advanced Manufacturing Technology

    OpenAIRE

    Cheng-Shih Su; Shu-Chen Hsu

    2014-01-01

    This paper is presented fuzzy preference relations approach to forecast the success of implementing sensors advanced manufacturing technology (AMT). In the manufacturing environment, performance measurement is based on different quantitative and qualitative factors. This study proposes an analytic hierarchical prediction model based on fuzzy preference relations to help the organizations become aware of the essential factors affecting the AMT implementation, forecasting the chance of successf...

  12. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    ... Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 95; Issue 1. Novel NPHS1 gene mutations in a Chinese family with congenital nephrotic syndrome. Fengjie Yang Yaxian Chen Yu Zhang Liru Qiu Yu Chen Jianhua Zhou. Research Note Volume 95 Issue 1 March 2016 pp 161- ...

  13. A reviewof the pharmacologicalmechanism of traditional Chinese ...

    African Journals Online (AJOL)

    A reviewof the pharmacologicalmechanism of traditional Chinese medicine in the intervention of coronary heart disease and stroke. W Zhang, K Gao, K Gao, J Liu, J Liu, H Zhao, H Zhao, J Wang, J Wang, Y Li, Y Li, G Murtaza, G Murtaza, J Chen, J Chen, W Wang, W Wang ...

  14. Bound-state formation for thermal relic dark matter and unitarity

    International Nuclear Information System (INIS)

    Harling, Benedict von; Petraki, Kalliopi

    2014-01-01

    We show that the relic abundance of thermal dark matter annihilating via a long-range interaction, is significantly affected by the formation and decay of dark matter bound states in the early universe, if the dark matter mass is above a few TeV . We determine the coupling required to obtain the observed dark matter density, taking into account both the direct 2-to-2 annihilations and the formation of bound states, and provide an analytical fit. We argue that the unitarity limit on the inelastic cross-section is realized only if dark matter annihilates via a long-range interaction, and we determine the upper bound on the mass of thermal-relic dark matter to be about 197 (139) TeV for (non)-self-conjugate dark matter

  15. Tests of a Roman Pot Prototype for the TOTEM Experiment

    OpenAIRE

    Deile, M.; Alagoz, E.; Anelli, G.M.; Antchev, G.A.; Ayache, M.; Caspers, F.; Dimovasili, E.; Dinapoli, R.; Drouhin, F.D.; Eggert, K.; Escourrou, L.; Fochler, O.; Gill, K.; Grabit, R.; Haug, F.

    2005-01-01

    The TOTEM collaboration has developed and tested the first prototype of its Roman Pots to be operated in the LHC. TOTEM Roman Pots contain stacks of 10 silicon detectors with strips oriented in two orthogonal directions. To measure proton scattering angles of a few microradians, the detectors will approach the beam centre to a distance of 10 sigma + 0.5 mm (= 1.3 mm). Dead space near the detector edge is minimised by using two novel "edgeless" detector technologies. The silicon detectors are ...

  16. The first observations of wide-band interferometers and the spectra of relic gravitons

    CERN Document Server

    Giovannini, Massimo

    2016-01-01

    Stochastic backgrounds of relic gravitons of cosmological origin extend from frequencies of the order of the aHz up to the GHz range. Since the temperature and polarization anisotropies constrain the low frequency normalization of the spectra, in the concordance paradigm the strain amplitude corresponding to the frequency window of wide-band interferometers turns out to be, approximately, nine orders of magnitude smaller than the astounding signal recently reported and attributed to a binary black hole merger. The backgrounds of relic gravitons expected from the early Universe are compared with the stochastic foregrounds stemming from the estimated multiplicity of the astrophysical sources. It is suggested that while the astrophysical foregrounds are likely to dominate between few Hz and 10 kHz, relic gravitons with frequencies exceeding 100 kHz represent a potentially uncontaminated signal for the next generation of high-frequency detectors currently under scrutiny.

  17. A numeric-analytic method for approximating the chaotic Chen system

    International Nuclear Information System (INIS)

    Mossa Al-sawalha, M.; Noorani, M.S.M.

    2009-01-01

    The epitome of this paper centers on the application of the differential transformation method (DTM) the renowned Chen system which is described as a three-dimensional system of ODEs with quadratic nonlinearities. Numerical comparisons are made between the DTM and the classical fourth-order Runge-Kutta method (RK4). Our work showcases the precision of the DTM as the Chen system transforms from a non-chaotic system to a chaotic one. Since the Lyapunov exponent for this system is much higher compared to other chaotic systems, we shall highlight the difficulties of the simulations with respect to its accuracy. We wrap up our investigations to reveal that this direct symbolic-numeric scheme is effective and accurate.

  18. Advanced excimer laser technologies enable green semiconductor manufacturing

    Science.gov (United States)

    Fukuda, Hitomi; Yoo, Youngsun; Minegishi, Yuji; Hisanaga, Naoto; Enami, Tatsuo

    2014-03-01

    "Green" has fast become an important and pervasive topic throughout many industries worldwide. Many companies, especially in the manufacturing industries, have taken steps to integrate green initiatives into their high-level corporate strategies. Governments have also been active in implementing various initiatives designed to increase corporate responsibility and accountability towards environmental issues. In the semiconductor manufacturing industry, there are growing concerns over future environmental impact as enormous fabs expand and new generation of equipments become larger and more powerful. To address these concerns, Gigaphoton has implemented various green initiatives for many years under the EcoPhoton™ program. The objective of this program is to drive innovations in technology and services that enable manufacturers to significantly reduce both the financial and environmental "green cost" of laser operations in high-volume manufacturing environment (HVM) - primarily focusing on electricity, gas and heat management costs. One example of such innovation is Gigaphoton's Injection-Lock system, which reduces electricity and gas utilization costs of the laser by up to 50%. Furthermore, to support the industry's transition from 300mm to the next generation 450mm wafers, technologies are being developed to create lasers that offer double the output power from 60W to 120W, but reducing electricity and gas consumption by another 50%. This means that the efficiency of lasers can be improve by up to 4 times in 450mm wafer production environments. Other future innovations include the introduction of totally Heliumfree Excimer lasers that utilize Nitrogen gas as its replacement for optical module purging. This paper discusses these and other innovations by Gigaphoton to enable green manufacturing.

  19. Analysis of Liu Zhiji Theory of Historians' and Zhang Xuecheng' s Cultivation Comparison%刘知几与章学诚的史家修养理论比较研究

    Institute of Scientific and Technical Information of China (English)

    董传岭

    2012-01-01

    Liu Zhiji and Zhang Xuecheng are famous for their historical theory in ancient China. They all put forward the theory of historian historians' cultivation which has important sense to improve historian self-cultivation and historical development. Liu Zhiji argued that historians should have "ability, learning, knowledge", Zhang Xuecheng further put forward historian moral on the basis of the Liu Zhiji~s theory,enriched and developed the theory of the historians~ cultiva- tion. They all emphasize "ability,learning, knowledge", Liu Zhiji emphasize "knowledge" mostly, but Zhang Xuecheng relied heavily on "moral". Comparison and analysis on Liu Zhiji and Zhang Xuecheng's theory of self-cultivation,not only enable us to find their theories difference, under- standing the theory deeply, but also has certain enlightenment function on the contemporary historiography development.%我国古代史学理论大家刘知几、章学诚均提出了有关史家修养的理论,刘知几认为史家应具备"才、学、识",章学诚在继承刘知几史家修养理论的基础上,进一步提出"史德",丰富和发展了史家修养理论。刘知几、章学诚均重视"才、学、识",但刘知几最重"史识",章学诚尤重"史德"。比较和分析二者的史家修养理论,不仅能使我们发现他们理论的异同,深刻理解史家修养理论,而且对当今史学发展也具有一定的启示功用。

  20. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 41; Issue 2. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study. H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG. Volume 41 Issue 2 April 2018 Article ID 51 ...

  1. a Method of 3d Measurement and Reconstruction for Cultural Relics in Museums

    Science.gov (United States)

    Zheng, S.; Zhou, Y.; Huang, R.; Zhou, L.; Xu, X.; Wang, C.

    2012-07-01

    Three-dimensional measurement and reconstruction during conservation and restoration of cultural relics have become an essential part of a modem museum regular work. Although many kinds of methods including laser scanning, computer vision and close-range photogrammetry have been put forward, but problems still exist, such as contradiction between cost and good result, time and fine effect. Aimed at these problems, this paper proposed a structure-light based method for 3D measurement and reconstruction of cultural relics in museums. Firstly, based on structure-light principle, digitalization hardware has been built and with its help, dense point cloud of cultural relics' surface can be easily acquired. To produce accurate 3D geometry model from point cloud data, multi processing algorithms have been developed and corresponding software has been implemented whose functions include blunder detection and removal, point cloud alignment and merge, 3D mesh construction and simplification. Finally, high-resolution images are captured and the alignment of these images and 3D geometry model is conducted and realistic, accurate 3D model is constructed. Based on such method, a complete system including hardware and software are built. Multi-kinds of cultural relics have been used to test this method and results prove its own feature such as high efficiency, high accuracy, easy operation and so on.

  2. Detecting relic gravitational waves in the CMB: Optimal parameters and their constraints

    International Nuclear Information System (INIS)

    Zhao, W.; Baskaran, D.

    2009-01-01

    The prospect of detecting relic gravitational waves, through their imprint in the cosmic microwave background radiation, provides an excellent opportunity to study the very early Universe. In the simplest viable theoretical models the relic gravitational wave background is characterized by two parameters, the tensor-to-scalar ratio r and the tensor spectral index n t . In this paper, we analyze the potential joint constraints on these two parameters, r and n t , using the data from the upcoming cosmic microwave background radiation experiments. Introducing the notion of the best-pivot multipole l t *, we find that at this pivot multipole the parameters r and n t are uncorrelated, and have the smallest variances. We derive the analytical formulas for the best-pivot multipole number l t *, and the variances of the parameters r and n t . We verify these analytical calculations using numerical simulation methods, and find agreement to within 20%. The analytical results provide a simple way to estimate the detection ability for the relic gravitational waves by the future observations of the cosmic microwave background radiation.

  3. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences. Chen Fang. Articles written in Journal of Biosciences. Volume 30 Issue 3 June 2005 pp 351-357 Articles. Expression of a ribosome inactivating protein (curcin 2) in Jatropha curcas is induced by stress · Wei Qin Huang Ming-Xing Xu Ying Zhang Xin-Shen Chen Fang · More Details ...

  4. A bandwidth correction to the Allegri-Zhang solution for accelerated random vibration testing

    Directory of Open Access Journals (Sweden)

    Benasciutti Denis

    2018-01-01

    Full Text Available In 2008, Allegri and Zhang published a study [Int. J. Fatigue. 2008, 30(6:967-977] in which they provided an exact analytical solution to the inverse scaling law for accelerated vibration tests of linear systems submitted to stationary Gaussian excitations By combining finite element analysis with multiaxial spectral methods defined in the frequency-domain, their solution generalised the simple inverse power law model suggested in some standards. The solution adopted the “equivalent von Mises stress” multiaxial criterion combined with the narrow-band damage expression. This work aims to propose a bandwidth correction to the original Allegri-Zhang solution to account for the actual spectral banwidth of the local multiaxial stress. The corrected Allegri-Zhang solution is also extended to another multiaxial spectral method, namely the “Projection-by-Projection” criterion. A numerical example is finally discussed, in which the corrected solution is applied to an L-shaped beam submitted to random accelerations.

  5. Manufacturing technology development for vacuum vessel and plasma facing components

    International Nuclear Information System (INIS)

    Laitinen, Arttu; Liimatainen, Jari; Hallila, Pentti

    2005-01-01

    Vacuum vessel and plasma facing components of the ITER construction including shield modules and primary first wall panels have great impact on the production costs and reliability of the installation. From the manufacturing technology point of view, accuracy of shape, properties of the various austenitic stainless steel/austenitic stainless steel interfaces or CuCrZr/austenitic stainless steel interfaces as well as those of the base materials are crucial for technical reliability of the construction. The current approach in plasma facing components has been utilisation of solid-HIP technology and solid-powder-HIP technology. Due to the large size of especially shield modules shape, control of the internal cavities and cooling channels is extremely demanding. This requires strict control of the raw materials and manufacturing parameters

  6. Emerging Materials Technologies That Matter to Manufacturers

    Science.gov (United States)

    Misra, Ajay K.

    2015-01-01

    A brief overview of emerging materials technologies. Exploring the weight reduction benefit of replacing Carbon Fiber with Carbon Nanotube (CNT) in Polymer Composites. Review of the benign purification method developed for CNT sheets. The future of manufacturing will include the integration of computational material design and big data analytics, along with Nanomaterials as building blocks.

  7. 5th International Conference on Advanced Manufacturing Engineering and Technologies

    CERN Document Server

    Jakovljevic, Zivana; NEWTECH2017

    2017-01-01

    This book presents the proceedings from the 5th NEWTECH conference (Belgrade, Serbia, 5–9 June 2017), the latest in a series of high-level conferences that bring together experts from academia and industry in order to exchange knowledge, ideas, experiences, research results, and information in the field of manufacturing. The range of topics addressed is wide, including, for example, machine tool research and in-machine measurements, progress in CAD/CAM technologies, rapid prototyping and reverse engineering, nanomanufacturing, advanced material processing, functional and protective surfaces, and cyber-physical and reconfigurable manufacturing systems. The book will benefit readers by providing updates on key issues and recent progress in manufacturing engineering and technologies and will aid the transfer of valuable knowledge to the next generation of academics and practitioners. It will appeal to all who work or conduct research in this rapidly evolving field.

  8. Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007

    CERN Multimedia

    Maximilien Brice

    2007-01-01

    Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007

  9. How Memory Is Tested Influences What Is Measured: Reply to Wyble and Chen (2017)

    Science.gov (United States)

    Swallow, Khena M.; Jiang, Yuhong V.; Tan, Deborah H.

    2017-01-01

    In this response to Wyble and Chen's (2017) commentary on attribute amnesia, we hope to achieve several goals. First, we clarify how our view diverges from that described by Wyble and Chen. We argue that because the surprise memory test is disruptive, it is an insensitive tool for measuring the persistence of recently attended target attributes in…

  10. Development of Self-Luminous Glass Tube (SLGT) Manufacturing Technology

    International Nuclear Information System (INIS)

    Kim, Kwang Sin; Kim, Kyeong Sook; Chung, Eun Su; Song, Kyu Min; Lee, Sook Kyung; Son, Soon Hwan

    2005-01-01

    Tritium produced from the Wolsong Tritium Removal Facility (WTRF) will be a radioactive waste when it is stored in the vault inside the WTRF, which requires maintenance cost and is a troublesome waste such that it cannot be sent to the radioactive waste disposal facility. However, when tritium is utilized it can be valuable resource for many applications. As a starting point to utilize tritium we tried to domesticate the selfluminous glass tube (SLGT) manufacturing technology. As a hydrogen isotope, tritium has similar chemical properties to hydrogen but slightly different physical properties. Due to its unstable nature, tritium emits beta rays, which are streams of electrons, with 0∼18.6 keV (5.7 keV in average) energies and 12.323 years of a half-life. The energy level of tritium is relatively low and the biological effects of tritium to the human body are not significant, which makes tritium a popular radioactive isotope for use in industries. The electrons in a beta ray collide with phosphor to produce light so that tritium sealed in phosphor coated glass tubes can make the tubes glow without an external supply of energy. To manufacture these SLGTs, 4 core technologies are needed: coating technology, tritium injection technology, laser sealing/cutting technology and tritium handling technology

  11. Late Quaternary sea level and environmental changes from relic ...

    Indian Academy of Sciences (India)

    Relic carbonate deposits along the western margin of India occur as dolomite crusts, aragonite sands (pelletal / oolitic) and aragonite-cemented limestones, oyster shells, corals, encrusted coralline algal and foraminiferal-dominated nodules. The petrology and mineralogy of the deposits indicate that except for aragonite ...

  12. antimycobacterial and cytotoxicity evaluation of the constituents of ...

    African Journals Online (AJOL)

    nb

    AKT/mTOR pathway and S phase cell cycle arrest in HepG2 cells. Food. Chem. 138: 1034-1041. Chen T, He J, Zhang J, Li X, Zhang H, Hao. J, Li L 2012 The isolation and identification of two compounds with predominant radical scavenging activity in hempseed (seed of Cannabis sativa. L.). Food Chem. 134: 1030-1037.

  13. Benefits from the U.S. photovoltaic manufacturing technology project

    Energy Technology Data Exchange (ETDEWEB)

    Mitchell, R.L.; Witt, C.E.; Thomas, H.P. [National Renewable Energy Lab., Golden, CO (United States)] [and others

    1996-05-01

    This paper examines the goals of the Photovoltaic Manufacturing Technology (PVMaT) project and its achievements in recapturing the investment by the photovoltaic (PV) industry and the public in this research. The PVMaT project was initiated in 1990 with the goal of enhancing the world-wide competitiveness of the U.S. PV industry. Based on the authors analysis, PVMaT has contributed to PV module manufacturing process improvements, increased product value, and reductions in the price of today`s PV products. An evaluation of success in this project was conducted using data collected from 10 of the PVMaT industrial participants in late fiscal year (FY) 1995. These data indicate a reduction of 56% in the weighted average module manufacturing costs from 1992 to 1996. During this same period, U.S. module manufacturing capacity has increased by more than a factor of 6. Finally, the analysis indicates that both the public and the manufacturers will recapture the funds expended in R&D manufacturing improvements well before the year 2000.

  14. Additive manufacturing technology in spare parts supply chain

    DEFF Research Database (Denmark)

    Li, Yao; Jia, Guozhu; Yang, Cheng

    2017-01-01

    Additive Manufacturing (AM) technology has the potential to significantly improve supply chain dynamics. The purpose of this paper is to investigate the impact of AM on spare parts supply chain. Three supply chain scenarios are investigated in this paper, namely conventional supply chain...

  15. Stochastic Background of Relic Scalar Gravitational Waves tuned by Extended Gravity

    International Nuclear Information System (INIS)

    De Laurentis, Mariafelicia; Capozziello, Salvatore

    2009-01-01

    A stochastic background of relic gravitational waves is achieved by the so called adiabatically-amplified zero-point fluctuations process derived from early inflation. It provides a distinctive spectrum of relic gravitational waves. In the framework of scalar-tensor gravity, we discuss the scalar modes of gravitational waves and the primordial production of this scalar component which is generated beside tensorial one. Then analyze seven different viable f(R)-gravities towards the Solar System tests and stochastic gravitational waves background. It is demonstrated that seven viable f(R)-gravities under consideration not only satisfy the local tests, but additionally, pass the above PPN-and stochastic gravitational waves bounds for large classes of parameters.

  16. Additive manufacturing of metals the technology, materials, design and production

    CERN Document Server

    Yang, Li; Baughman, Brian; Godfrey, Donald; Medina, Francisco; Menon, Mamballykalathil; Wiener, Soeren

    2017-01-01

    This book offers a unique guide to the three-dimensional (3D) printing of metals. It covers various aspects of additive, subtractive, and joining processes used to form three-dimensional parts with applications ranging from prototyping to production. Examining a variety of manufacturing technologies and their ability to produce both prototypes and functional production-quality parts, the individual chapters address metal components and discuss some of the important research challenges associated with the use of these technologies. As well as exploring the latest technologies currently under development, the book features unique sections on electron beam melting technology, material lifting, and the importance this science has in the engineering context. Presenting unique real-life case studies from industry, this book is also the first to offer the perspective of engineers who work in the field of aerospace and transportation systems, and who design components and manufacturing networks. Written by the leadin...

  17. Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe

    OpenAIRE

    Spinner, Kaspar H.

    2014-01-01

    Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe. - In: Standardorientierung im Lese- und Literaturunterricht der Sekundarstufe I / Cornelia Rosebrock ; Heike Wirthwein. - Baltmannsweiler : Schneider-Verl. Hohengehren, 2014. - S. 126-132

  18. Relic gravitational waves and the generalized second law

    International Nuclear Information System (INIS)

    Izquierdo, German; Pavon, Diego

    2004-01-01

    The generalized second law of gravitational thermodynamics is applied to the present era of accelerated expansion of the Universe. In spite of the fact that the entropy of matter and relic gravitational waves inside the event horizon diminish, the mentioned law is fulfilled provided that the expression for the entropy density of the gravitational waves satisfies a certain condition

  19. Ronald Malt or Chen Zhongwei: Who performed the first surgical replantation?

    Science.gov (United States)

    Fan, Ka-Wai

    2018-01-01

    This article discusses the contributions of the two pioneers of the surgical procedure of replantation-Ronald Malt in the US and Chen Zhongwei in China. Ronald Malt performed the reattachment surgery on a boy who had an accident in 1962, but he published his case report two years later in 1964. Chen Zhongwei performed a similar surgery on a worker who cut off his forearm in 1963, but he published his case report the same year. There is some debate about which one of these reputed surgeons should be given credit for being the first one to perform this breakthrough surgery, because although Malt was the first to perform the procedure, Zhongwei was the first to report it. To shed light on this controversy, criteria for scientific priority suggested by Ronald Vale and Anthony Hyman were applied. Although the criteria mainly favored Zhongwei as the pioneer of this procedure, he did not entirely fulfill one of the criteria. Therefore, the article could not present a definitive answer to the question, and it concludes by pointing out the highly commendable achievements and contributions of both Ronald Malt and Chen Zhongwei.

  20. Lanthanide metal-organic frameworks

    International Nuclear Information System (INIS)

    Cheng, Peng

    2015-01-01

    This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).

  1. Lanthanide metal-organic frameworks

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Peng (ed.) [Nankai Univ., Tianjin (China). Dept. of Chemistry

    2015-03-01

    This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).

  2. An Introduction to Intelligent Processing Programs Developed by the Air Force Manufacturing Technology Directorate

    Science.gov (United States)

    Sampson, Paul G.; Sny, Linda C.

    1992-01-01

    The Air Force has numerous on-going manufacturing and integration development programs (machine tools, composites, metals, assembly, and electronics) which are instrumental in improving productivity in the aerospace industry, but more importantly, have identified strategies and technologies required for the integration of advanced processing equipment. An introduction to four current Air Force Manufacturing Technology Directorate (ManTech) manufacturing areas is provided. Research is being carried out in the following areas: (1) machining initiatives for aerospace subcontractors which provide for advanced technology and innovative manufacturing strategies to increase the capabilities of small shops; (2) innovative approaches to advance machine tool products and manufacturing processes; (3) innovative approaches to advance sensors for process control in machine tools; and (4) efforts currently underway to develop, with the support of industry, the Next Generation Workstation/Machine Controller (Low-End Controller Task).

  3. Cold dark matter plus not-so-clumpy dark relics

    NARCIS (Netherlands)

    Diamanti, R.; Ando, S.; Gariazzo, S.; Mena, O.; Weniger, C.

    Various particle physics models suggest that, besides the (nearly) cold dark matter that accounts for current observations, additional but sub-dominant dark relics might exist. These could be warm, hot, or even contribute as dark radiation. We present here a comprehensive study of two-component dark

  4. Perspectives for Detection of a Higgsino-like Relic Neutralino

    CERN Document Server

    Bottino, A; Mignola, G; Olechowski, M; Scopel, S

    1996-01-01

    It has been conjectured by Ambrosanio, Kane, Kribs, Martin and Mrenna (AKM) that the CDF event $p \\bar p \\to e^+ e^- \\gamma \\gamma + missing E_T$ is due to a decay chain involving two neutralino states (the lightest and the next-to-lightest ones). The lightest neutralino ($\\chi_{AKM}$) has been further considered by Kane and Wells as a candidate for cold dark matter. In this paper we examine the properties of relic $\\chi_{AKM}$'s in their full parameter space, and examine the perspectives for detection by comparing theoretical predictions to sensitivities of various experimental searches. We find that for most regions of the parameter space the detectability of a relic $\\chi_{AKM}$ would require quite substantial improvements in current experimental sensitivities. The measurements of neutrino fluxes from the center of the Earth and of an excess of $\\bar{p}/p$ in cosmic rays are shown to offer some favorable perspectives for investigating a region of the the model.

  5. Postural Orthostatic Tachycardia Syndrome (POTS) in Denmark

    DEFF Research Database (Denmark)

    Brinth, Louise; Pors, Kirsten; Spahic, Jasmina Medic

    2018-01-01

    " 1997-2014 was retrieved from PubMed and related to yearly POTS incidence. RESULTS: Eight-hundred-and-seventy-five tests with suspected POTS were thoroughly evaluated. The reclassification of test results yielded 243 POTS diagnoses (age, 27.0 ± 11.8 years). An increase in total number of POTS diagnoses...... was observed but the proportion of POTS-positive tests per year was relatively constant (≈2-3%) except for the period 2013-2014 (≈7%). The increase in POTS diagnoses was preceded by an increase in number of POTS-related papers in PubMed. CONCLUSION: The proportion of POTS diagnoses among patients investigated...... for suspected syncope and/or orthostatic intolerance was relatively constant 1997-2012. The growing number of POTS-related publications in PubMed preceded the steep increase in diagnostic rate of POTS observed after 2012....

  6. The Air Force Manufacturing Technology (MANTECH): Technology transfer methodology as exemplified by the radar transmit/receive module program

    Science.gov (United States)

    Houpt, Tracy; Ridgely, Margaret

    1991-01-01

    The Air Force Manufacturing Technology program is involved with the improvement of radar transmit/receive modules for use in active phased array radars for advanced fighter aircraft. Improvements in all areas of manufacture and test of these modules resulting in order of magnitude improvements in the cost of and the rate of production are addressed, as well as the ongoing transfer of this technology to the Navy.

  7. Development of High Temperature Capacitor Technology and Manufacturing Capability

    Energy Technology Data Exchange (ETDEWEB)

    None, None

    2011-05-15

    The goal of the Development of High Temperature Capacitor Technology and Manufacturing Capability program was to mature a production-ready supply chain for reliable 250°C FPE (fluorinated polyester) film capacitors by 2011. These high-temperature film capacitors enable both the down hole drilling and aerospace industries by enabling a variety of benefits including: - Deeper oil exploration in higher temperature and pressure environments - Enabling power electronic and control equipment to operate in higher temperature environments - Enabling reduced cooling requirements of electronics - Increasing reliability and life of capacitors operating below rated temperature - Enabling capacitors to handle higher electrical losses without overheating. The key challenges to bringing the FPE film capacitors to market have been manufacturing challenges including: - FPE Film is difficult to handle and wind, resulting in poor yields - Voltage breakdown strength decreases when the film is wound into capacitors (~70% decrease) - Encapsulation technologies must be improved to enable higher perature operation - Manufacturing and test cycle time is very long As a direct result of this program most of the manufacturing challenges have been met. The FPE film production metalization and winding yield has increased to over 82% from 70%, and the voltage breakdown strength of the wound capacitors has increased 270% to 189 V/μm. The high temperature packaging concepts are showing significant progress including promising results for lead attachments and hermetic packages at 200°C and non-hermetic packages at 250°C. Manufacturing and test cycle time will decrease as the market for FPE capacitors develops.

  8. Chaos control of Chen chaotic dynamical system

    International Nuclear Information System (INIS)

    Yassen, M.T.

    2003-01-01

    This paper is devoted to study the problem of controlling chaos in Chen chaotic dynamical system. Two different methods of control, feedback and nonfeedback methods are used to suppress chaos to unstable equilibria or unstable periodic orbits (UPO). The Lyapunov direct method and Routh-Hurwitz criteria are used to study the conditions of the asymptotic stability of the steady states of the controlled system. Numerical simulations are presented to show these results

  9. National Survey of Computer Aided Manufacturing in Industrial Technology Programs.

    Science.gov (United States)

    Heidari, Farzin

    The current status of computer-aided manufacturing in the 4-year industrial technology programs in the United States was studied. All industrial technology department chairs were mailed a questionnaire divided into program information, equipment information, and general comments sections. The questionnaire was designed to determine the subjects…

  10. The Influence Of Globalisation And Modern Technological Changes On Manufacturing Industries In Libya

    Directory of Open Access Journals (Sweden)

    Nuri M. Triki

    2017-05-01

    Full Text Available Globalisation and new technologies are having an intense impact on the manufacturing industries. This is affecting business global and might demand new strategies and policies for manufacturing companies. Libya like several other countries in the Middle East and also is among the few developing African economies has been facing problems related to its productivity in industrial sector. Manufacturing industries in Libya was reared to offer better products and services as part of the government plans to reconstruct their economy and improve its industrial companies. So as to face these problems manufacturing sectors need to increase their production and they also require a clear strategy and policies towards an efficient supply chain about modern technology. A new technology is one of the improvement initiatives that can be used to enhance industrial performance competitiveness and decrease its costs by eliminating of waste and increasing added value activities. The significance of new technology and modern systems in the industrial world has enhanced in this decade because of the benefits that they bring to the factories and companies. The aims of this research is to investigate new technology strategies that will enable the Libyan manufacturing industries to shift towards an increase production and reduce its costs as well as to quantify the modern technological changes and the role of globalisation in addition to declaration of its effect on the growth additionally development of the Libyan industrial sector and competitiveness lastly moreover this survey make a recommendations to establish systems that improve the emergent needs of the national industrial sector.

  11. Heat transfer and evaporative cooling in the function of pot-in-pot coolers

    Science.gov (United States)

    Chemin, Arsène; Levy Dit Vehel, Victor; Caussarieu, Aude; Plihon, Nicolas; Taberlet, Nicolas

    2018-03-01

    A pot-in-pot cooler is an affordable electricity-free refrigerator which uses the latent heat of vaporization of water to maintain a low temperature inside an inner compartment. In this article, we experimentally investigate the influence of the main physical parameters in model pot-in-pot coolers. The effect of the wind on the evaporation rate of the cooling fluid is studied in model experiments while the influence of the fluid properties (thermal conductivity, specific heat, and latent heat) is elucidated using a variety of cooling fluids (water, ethanol, and ether). A model based on a simplified heat conduction equation is proposed and is shown to be in good quantitative agreement with the experimental measurements.

  12. Relic abundance of mass-varying cold dark matter particles

    International Nuclear Information System (INIS)

    Rosenfeld, Rogerio

    2005-01-01

    In models of coupled dark energy and dark matter the mass of the dark matter particle depends on the cosmological evolution of the dark energy field. In this Letter we exemplify in a simple model the effects of this mass variation on the relic abundance of cold dark matter

  13. Relic gravitational waves and extended inflation

    International Nuclear Information System (INIS)

    Turner, M.S.; Wilczek, F.

    1990-01-01

    In extended inflation, a new version of inflation where the transition from an inflationary to a radiation-dominated Universe is accomplished by bubble nucleation, bubble collisions supply a potent---and potentially detectable---source of gravitational waves. The energy density in relic gravitons from bubble collisions is expected to be about 10 -5 of closure density. Their characteristic wavelength depends upon the reheating temperature T RH: λ∼(10 4 cm)[(10 14 GeV)/T RH ]. If black holes are produced by bubble collisions, they will evaporate producing shorter-wavelength gravitons

  14. Agile manufacturing and technology transfer to industrialising countries

    NARCIS (Netherlands)

    Steenhuis, H.J.; de Boer, S.J.

    2003-01-01

    One of the requirements of agile manufacturing, the necessity to gain flexibility, can be reached by using a supplier network. A possible way to develop a supplier network is by subcontracting to parties in industrialising countries. In most cases, it is necessary to transfer technology. The

  15. RELIC: a novel dye-bias correction method for Illumina Methylation BeadChip.

    Science.gov (United States)

    Xu, Zongli; Langie, Sabine A S; De Boever, Patrick; Taylor, Jack A; Niu, Liang

    2017-01-03

    The Illumina Infinium HumanMethylation450 BeadChip and its successor, Infinium MethylationEPIC BeadChip, have been extensively utilized in epigenome-wide association studies. Both arrays use two fluorescent dyes (Cy3-green/Cy5-red) to measure methylation level at CpG sites. However, performance difference between dyes can result in biased estimates of methylation levels. Here we describe a novel method, called REgression on Logarithm of Internal Control probes (RELIC) to correct for dye bias on whole array by utilizing the intensity values of paired internal control probes that monitor the two color channels. We evaluate the method in several datasets against other widely used dye-bias correction methods. Results on data quality improvement showed that RELIC correction statistically significantly outperforms alternative dye-bias correction methods. We incorporated the method into the R package ENmix, which is freely available from the Bioconductor website ( https://www.bioconductor.org/packages/release/bioc/html/ENmix.html ). RELIC is an efficient and robust method to correct for dye-bias in Illumina Methylation BeadChip data. It outperforms other alternative methods and conveniently implemented in R package ENmix to facilitate DNA methylation studies.

  16. Overview of NASA/OAST efforts related to manufacturing technology

    Science.gov (United States)

    Saunders, N. T.

    1976-01-01

    An overview of some of NASA's current efforts related to manufacturing technology and some possible directions for the future are presented. The topics discussed are: computer-aided design, composite structures, and turbine engine components.

  17. Cold dark matter plus not-so-clumpy dark relics

    International Nuclear Information System (INIS)

    Diamanti, Roberta; Ando, Shin'ichiro; Weniger, Christoph; Gariazzo, Stefano; Mena, Olga

    2017-01-01

    Various particle physics models suggest that, besides the (nearly) cold dark matter that accounts for current observations, additional but sub-dominant dark relics might exist. These could be warm, hot, or even contribute as dark radiation. We present here a comprehensive study of two-component dark matter scenarios, where the first component is assumed to be cold, and the second is a non-cold thermal relic. Considering the cases where the non-cold dark matter species could be either a fermion or a boson, we derive consistent upper limits on the non-cold dark relic energy density for a very large range of velocity dispersions, covering the entire range from dark radiation to cold dark matter. To this end, we employ the latest Planck Cosmic Microwave Background data, the recent BOSS DR11 and other Baryon Acoustic Oscillation measurements, and also constraints on the number of Milky Way satellites, the latter of which provides a measure of the suppression of the matter power spectrum at the smallest scales due to the free-streaming of the non-cold dark matter component. We present the results on the fraction f ncdm of non-cold dark matter with respect to the total dark matter for different ranges of the non-cold dark matter masses. We find that the 2σ limits for non-cold dark matter particles with masses in the range 1–10 keV are f ncdm ≤0.29 (0.23) for fermions (bosons), and for masses in the 10–100 keV range they are f ncdm ≤0.43 (0.45), respectively.

  18. Cold dark matter plus not-so-clumpy dark relics

    Energy Technology Data Exchange (ETDEWEB)

    Diamanti, Roberta; Ando, Shin' ichiro; Weniger, Christoph [GRAPPA, Institute of Physics, University of Amsterdam, Science Park 904, 1098 XH Amsterdam (Netherlands); Gariazzo, Stefano; Mena, Olga, E-mail: r.diamanti@uva.nl, E-mail: s.ando@uva.nl, E-mail: gariazzo@to.infn.it, E-mail: omena@ific.uv.es, E-mail: c.weniger@uva.nl [Instituto de Física Corpuscular (IFIC), CSIC-Universitat de Valencia, Apartado de Correos 22085, E-46071, Valencia (Spain)

    2017-06-01

    Various particle physics models suggest that, besides the (nearly) cold dark matter that accounts for current observations, additional but sub-dominant dark relics might exist. These could be warm, hot, or even contribute as dark radiation. We present here a comprehensive study of two-component dark matter scenarios, where the first component is assumed to be cold, and the second is a non-cold thermal relic. Considering the cases where the non-cold dark matter species could be either a fermion or a boson, we derive consistent upper limits on the non-cold dark relic energy density for a very large range of velocity dispersions, covering the entire range from dark radiation to cold dark matter. To this end, we employ the latest Planck Cosmic Microwave Background data, the recent BOSS DR11 and other Baryon Acoustic Oscillation measurements, and also constraints on the number of Milky Way satellites, the latter of which provides a measure of the suppression of the matter power spectrum at the smallest scales due to the free-streaming of the non-cold dark matter component. We present the results on the fraction f {sub ncdm} of non-cold dark matter with respect to the total dark matter for different ranges of the non-cold dark matter masses. We find that the 2σ limits for non-cold dark matter particles with masses in the range 1–10 keV are f {sub ncdm}≤0.29 (0.23) for fermions (bosons), and for masses in the 10–100 keV range they are f {sub ncdm}≤0.43 (0.45), respectively.

  19. Advanced manufacturing technology effectiveness: A review of literature and some issues

    Science.gov (United States)

    Goyal, Sanjeev; Grover, Sandeep

    2012-09-01

    Advanced manufacturing technology (AMT) provides advantages to manufacturing managers in terms of flexibility, quality, reduced delivery times, and global competitiveness. Although a large number of publications had presented the importance of this technology, only a few had delved into related literature review. Considering the importance of this technology and the recent contributions by various authors, the present paper conducts a more comprehensive review. Literature was reviewed in a way that will help researchers, academicians, and practitioners to take a closer look at the implementation, evaluation, and justification of the AMT. The authors reviewed various papers, proposed a different classification scheme, and identified certain gaps that will provide hints for further research in AMT management.

  20. A manufacturing method for multi-layer polysilicon surface-micromachining technology

    Energy Technology Data Exchange (ETDEWEB)

    Sniegowski, J.J.; Rodgers, M.S.

    1998-01-01

    An advanced manufacturing technology which provides multi-layered polysilicon surface micromachining technology for advanced weapon systems is presented. Specifically, the addition of another design layer to a 4 levels process to create a 5 levels process allows consideration of fundamentally new architecture in designs for weapon advanced surety components.

  1. Innovative Technologies for the Protection of Historical Structures against Earthquakes

    Directory of Open Access Journals (Sweden)

    Fuat Aras

    2016-01-01

    This study aims to represent innovative technologies and strategies to preserve the cultural heritage structures against earthquake effect. In particular, the application of fibre reinforced polymers and structural control systems are explained. Suitability of the strategies to architectural, historical and structural features and reversibility aspects are evaluated. As a case study the application of these strategies to a historical building in Istanbul is discussed.

  2. Towards a Lifecycle Information Framework and Technology in Manufacturing.

    Science.gov (United States)

    Hedberg, Thomas; Feeney, Allison Barnard; Helu, Moneer; Camelio, Jaime A

    2017-06-01

    Industry has been chasing the dream of integrating and linking data across the product lifecycle and enterprises for decades. However, industry has been challenged by the fact that the context in which data is used varies based on the function / role in the product lifecycle that is interacting with the data. Holistically, the data across the product lifecycle must be considered an unstructured data-set because multiple data repositories and domain-specific schema exist in each phase of the lifecycle. This paper explores a concept called the Lifecycle Information Framework and Technology (LIFT). LIFT is a conceptual framework for lifecycle information management and the integration of emerging and existing technologies, which together form the basis of a research agenda for dynamic information modeling in support of digital-data curation and reuse in manufacturing. This paper provides a discussion of the existing technologies and activities that the LIFT concept leverages. Also, the paper describes the motivation for applying such work to the domain of manufacturing. Then, the LIFT concept is discussed in detail, while underlying technologies are further examined and a use case is detailed. Lastly, potential impacts are explored.

  3. Propulsion Control Technology Development in the United States A Historical Perspective

    Science.gov (United States)

    Jaw, Link C.a; Garg, Sanjay

    2005-01-01

    This paper presents a historical perspective of the advancement of control technologies for aircraft gas turbine engines. The paper primarily covers technology advances in the United States in the last 60 years (1940 to approximately 2002). The paper emphasizes the pioneering technologies that have been tested or implemented during this period, assimilating knowledge and experience from industry experts, including personal interviews with both current and retired experts. Since the first United States-built aircraft gas turbine engine was flown in 1942, engine control technology has evolved from a simple hydro-mechanical fuel metering valve to a full-authority digital electronic control system (FADEC) that is common to all modern aircraft propulsion systems. At the same time, control systems have provided engine diagnostic functions. Engine diagnostic capabilities have also evolved from pilot observation of engine gauges to the automated on-board diagnostic system that uses mathematical models to assess engine health and assist in post-flight troubleshooting and maintenance. Using system complexity and capability as a measure, we can break the historical development of control systems down to four phases: (1) the start-up phase (1942 to 1949), (2) the growth phase (1950 to 1969), (3) the electronic phase (1970 to 1989), and (4) the integration phase (1990 to 2002). In each phase, the state-of-the-art control technology is described and the engines that have become historical landmarks, from the control and diagnostic standpoint, are identified. Finally, a historical perspective of engine controls in the last 60 years is presented in terms of control system complexity, number of sensors, number of lines of software (or embedded code), and other factors.

  4. Superpixel segmentation and pigment identification of colored relics based on visible spectral image

    Science.gov (United States)

    Li, Junfeng; Wan, Xiaoxia

    2018-01-01

    To enrich the contents of digital archive and to guide the copy and restoration of colored relics, non-invasive methods for extraction of painting boundary and identification of pigment composition are proposed in this study based on the visible spectral images of colored relics. Superpixel concept is applied for the first time to the field of oversegmentation of visible spectral images and implemented on the visible spectral images of colored relics to extract their painting boundary. Since different pigments are characterized by their own spectrum and the same kind of pigment has the similar geometric profile in spectrum, an automatic identification method is established by comparing the proximity between the geometric profiles of the unknown spectrum from each superpixel and the pre-known spectrum from a deliberately prepared database. The methods are validated using the visible spectral images of the ancient wall paintings in Mogao Grottoes. By the way, the visible spectral images are captured by a multispectral imaging system consisting of two broadband filters and a RGB camera with high spatial resolution.

  5. Manufacturing technologies for nanocomposite ceramic structural materials and coatings

    Energy Technology Data Exchange (ETDEWEB)

    Gadow, R. [Universitaet Stuttgart, Institut fuer Fertigungstechnik keramischer Bauteile, D-70569 Stuttgart, Allmandring 7b (Germany)], E-mail: rainer.gadow@ifkb.uni-stuttgart.de; Kern, F.; Killinger, A. [Universitaet Stuttgart, Institut fuer Fertigungstechnik keramischer Bauteile, D-70569 Stuttgart, Allmandring 7b (Germany)

    2008-02-25

    The new material class of ceramic nanocomposites, containing at least one phase in nanometric dimension, has achieved special interest in previous years. While earlier research was focused on materials science and microstructural details in laboratory scale the subject of developing suitable manufacturing technologies in technical scale is the challenge for the manufacturing engineer. The same high-performance features which make the nanocomposite materials so interesting in their properties are absolutely detrimental if it comes to production of these materials. Extreme hardness, toughness and abrasion resistance make the state of the art cutting-and-machining operations extremely cost intensive so that, from a manufacturing point of view, true near-net-shape manufacturing is mandatory to accomplish reasonable cost targets. Ceramic feedstocks with both, high solid content to reduce shrinkage and warping and stable processing conditions are required to accomplish this aim of near-net-shape processing. Stable and reproducible processing conditions, e.g. favourable rheological properties for injection moulding are essentials for the manufacturing engineer. These prerequisites of ceramic production technologies cannot be reached with pure nanopowders in the 10-20 nm range but materials with a micro-nano architecture can fulfill these requirements, using a mixture of a submicron-sized matrix in the 100-200 nm range and smaller nanosized additives in <20% content which contribute the desired functionality. By using these micro-nanocomposites near-net-shape ceramic forming technologies such as injection moulding, gel casting and slip casting have been developed which lead to high-performance materials at affordable production cost. Advanced surface technologies include nanoceramic coatings made by thermokinetic deposition processes. Modern ceramic processing, i.e. spray drying leads to fine granulated nanopowders with appropriate flowability for subsequent APS plasma or

  6. Relic neutrino asymmetry evolution from first principles

    International Nuclear Information System (INIS)

    Bell, N.F.; Volkas, R.R.; Wong, Y.Y.Y.

    1998-09-01

    The exact Quantum Kinetic Equations for a two-flavour active-sterile neutrino system are used to provide a systematic derivation of approximate evolution equations for the relic neutrino asymmetry. An extension of the adiabatic approximation for matter-affected neutrino oscillations is developed which incorporates decoherence due to collisions. Exact and approximate expressions for the decoherence and repopulation functions are discussed. A first pass is made over the exact treatment of multi-flavour partially incoherent oscillations. (authors)

  7. Quantum state correction of relic gravitons from quantum gravity

    OpenAIRE

    Rosales, Jose-Luis

    1996-01-01

    The semiclassical approach to quantum gravity would yield the Schroedinger formalism for the wave function of metric perturbations or gravitons plus quantum gravity correcting terms in pure gravity; thus, in the inflationary scenario, we should expect correcting effects to the relic graviton (Zel'dovich) spectrum of the order (H/mPl)^2.

  8. The Environmental Impact of Advanced Manufacturing Technologies: Examples from Hungary

    OpenAIRE

    Andrea Szalavetz

    2017-01-01

    The purpose of the paper is to demonstrate the beneficial impact of advanced manufacturing technologies (AMT) on firms’ environmental performance. Drawing on interviews conducted with 16 Hungarian manufacturing subsidiaries on their experience with AMT, we find three functional areas, where industry 4.0 solutions can not only enhance operational excellence and cost-efficiency, but they can also improve eco-efficiency, but they can also improve eco-efficiency, namely in the f...

  9. Cranioplasty prosthesis manufacturing based on reverse engineering technology

    Science.gov (United States)

    Chrzan, Robert; Urbanik, Andrzej; Karbowski, Krzysztof; Moskała, Marek; Polak, Jarosław; Pyrich, Marek

    2012-01-01

    Summary Background Most patients with large focal skull bone loss after craniectomy are referred for cranioplasty. Reverse engineering is a technology which creates a computer-aided design (CAD) model of a real structure. Rapid prototyping is a technology which produces physical objects from virtual CAD models. The aim of this study was to assess the clinical usefulness of these technologies in cranioplasty prosthesis manufacturing. Material/Methods CT was performed on 19 patients with focal skull bone loss after craniectomy, using a dedicated protocol. A material model of skull deficit was produced using computer numerical control (CNC) milling, and individually pre-operatively adjusted polypropylene-polyester prosthesis was prepared. In a control group of 20 patients a prosthesis was manually adjusted to each patient by a neurosurgeon during surgery, without using CT-based reverse engineering/rapid prototyping. In each case, the prosthesis was implanted into the patient. The mean operating times in both groups were compared. Results In the group of patients with reverse engineering/rapid prototyping-based cranioplasty, the mean operating time was shorter (120.3 min) compared to that in the control group (136.5 min). The neurosurgeons found the new technology particularly useful in more complicated bone deficits with different curvatures in various planes. Conclusions Reverse engineering and rapid prototyping may reduce the time needed for cranioplasty neurosurgery and improve the prosthesis fitting. Such technologies may utilize data obtained by commonly used spiral CT scanners. The manufacturing of individually adjusted prostheses should be commonly used in patients planned for cranioplasty with synthetic material. PMID:22207125

  10. A Historical Perspective on Student Affairs Professionals' Use of Digital Technology

    Science.gov (United States)

    Cabellon, Edmund T.; Payne-Kirchmeier, Julie

    2016-01-01

    This chapter provides a historical perspective of student affairs professionals' use of digital and social technologies in their work on college campuses. The purpose of the chapter is to describe how digital technology tools have evolved since 2005, demonstrate how student affairs technology shifted and changed during this time, and shape student…

  11. Development of granular powder manufacturing technology by spray pyrolysis

    International Nuclear Information System (INIS)

    Katoh, Yoshiyuki; Kawase, Keiichi; Takahashi, Yoshiharu; Todokoro, Akio

    1996-01-01

    For shortening of mixed-oxide (MOX) fuel manufacturing process and improvement in treatment of MOX-powder, we have been developing the granular powder production technology. Since the granular powders have excellent fluidity owing to the spherical shape, there is the possibility of modifying scattering and adcering of the powder in the process equipment. In this paper, spray pyrolysis process in adopted as the process of manufacturing the granular powders and the basic feasibility study has been carried out. The experimental results show that the manufactured granular powders have excellent fluidity and the diameter of the powders is controllable. Furthermore, high density pellets are formed by sintering the powders. Thus, it is clarified that this process is promising for the actual MOX fuel fabrication. (author)

  12. TEST OF THE CHEN-ROLL-ROSS MACROECONOMIC FACTOR MODEL: EVIDENCE FROM CROATIAN STOCK MARKET

    Directory of Open Access Journals (Sweden)

    Denis Dolinar

    2015-12-01

    Full Text Available This paper empirically examines the well-known Chen-Roll-Ross model on the Croatian stock market. Modifications of definitions of the Chen-Roll-Ross model variables showed as necessary because of doubtful availability and quality of input data needed. Namely, some macroeconomic and market variables are not available in the originally defined form or do not exist. In that sense this paper gives some alternative definitions for some model variables. Also, in order to improve statistical analysis, in this paper we have modified Fama-MacBeth technique in the way that second-pass regression was substituted with panel regression analysis. Based on the two-pass regression analysis of returns of 34 Croatian stocks on 4 macroeconomic variables during the seven-and-half-year observation period the following conclusion is made. In contrast to the results of Chen, Roll and Ross (1986 for the U.S. stock market, their model is not successful when describing a risk-return relation of Croatian stocks. Nevertheless, one observed version of the Chen-RollRoss model showed certain statistical significance. Namely, two risk factors in that version of the model were statistically significant: default premium, measured as risk premium for the corporate short-term bank loan financing, and term structure premium, measured on short-run basis.

  13. Treatment responses in adult depressive patients treated with ...

    African Journals Online (AJOL)

    with dexamethasone/corticotrophin-releasing hormone. Lina Zhang1*, Yanbo Chen2, ... Keywords: stress, depressive patients, hormonal response, hormonal dysregulation, sertraline, ..... interactions in depression: will cause inform cure. Mol.

  14. English Water Meadows: historic relics or focus for environmental management and inter-disciplinary research?

    Science.gov (United States)

    Cook, Hadrian

    2015-04-01

    Irrigated water meadows are found across Europe, from southern Scandinavia to Spain and in the Alpine regions and Italy. While the practice of engineering 'floated' meadow land for deliberate irrigation on hillsides and floodplains is widespread and ancient, since about 1600 AD the practice was widely adopted on floodplains in southern England where they improved the timing and productivity of grazing land and produced hay crops. They also became a part of English consciousness through art and literature. To some, water meadows are a relic of an agrarian past, to others they are the object of a range of foci for conservation, education, sustainable grass production, community engagement and recent research suggests water returned from meadow irrigation is beneficial to river water quality. Historically floodplain 'bedwork' water meadows grew from, and were integral in, the farming system of 'Wessex' involving sheep which produced dung for arable land and later supporting dairy and beef production, as well as hay. Where systems remain, this is largely due to the whim of individuals, the outcome of agri-environmental schemes. Water meadows may be managed by public, voluntary or private sector bodies. What is needed is a fresh look at how land owners, or communities, might micro-target them for heritage, habitat and grassland management. There are therefore interesting questions concerning their future: Who might invest in their restoration and maintenance? How might they be integrated into commercial farming? Are they of sufficient interest to restore en masse to become (once more) a major feature of the English chalk stream valleys? Do they provide a way into academic and public perception, combining environmental science, history, cultural heritage and environmental management? How might restoration and management become vehicles for public engagement? While each of these questions represents a major topic for discussion, this paper is an attempt to consolidate

  15. Study on manufacturing technology of fuel guide tube using HANA alloys

    International Nuclear Information System (INIS)

    Kim, Hyungil; Jung, Yangil; Park, Dongjun; Park, Jeongyong; Kim, Ilhyun; Choi, Byungkwon; Jeong, Yonghwan; Park, Sangyoon

    2013-04-01

    This research was focused on the study for the manufacturing technology of HANA alloys to crease the corrosion resistance of 30% as well as the to improve the strength of 10% when compared to the commercial zirconium alloys. The new manufacturing concept having higher corrosion resistance and strength than commercial alloy performance can be obtained in this research. This result was transferred to the KNF and, that will be commercialized. This research result can be summarized like this; Ο Parameter study to increase formability of HANA alloy tube - Study on alloy element and heat-treatment effect - Study on texture development mechanism - Study on final annealing effect Ο Out-of-pile performance evaluation of HANA alloy tube - Corrosion performance evaluation of HANA alloy manufactured at KNF - Mechanical performance evaluation of HANA alloy manufactured at KNF - Recrystallization behavior evaluation of HANA alloy manufactured at KNF - Texture characterization of HANA alloy manufactured at KNF - Microstructure characterization of HANA alloy manufactured at KNF Ο Manufacturing guideline setup to increase formability of HANA alloy tube - Manufacturing guideline setup to decrease surface defect - Manufacturing guideline setup to increase strength and corrosion resistance - Manufacturing guideline setup to control texture

  16. Chaos synchronization between Chen system and Genesio system

    International Nuclear Information System (INIS)

    Wu Xianyong; Guan Zhihong; Wu Zhengping; Li Tao

    2007-01-01

    This Letter presents two synchronization schemes between two different chaotic systems. Active control synchronization and adaptive synchronization between Chen system and Genesio system are studied, different controllers are designed to synchronize the drive and response systems, active control synchronization is used when system parameters are known; adaptive synchronization is employed when system parameters are unknown or uncertain. Simulation results show the effectiveness of the proposed schemes

  17. Quintessential inflation on the brane and the relic gravity wave background

    International Nuclear Information System (INIS)

    Sami, M.; Sahni, V.

    2004-01-01

    Quintessential inflation describes a scenario in which both inflation and dark energy (quintessence) are described by the same scalar field. In conventional braneworld models of quintessential inflation gravitational particle-production is used to reheat the universe. This reheating mechanism is very inefficient and results in an excessive production of gravity waves which violate nucleosynthesis constraints and invalidate the model. We describe a new method of realizing quintessential inflation on the brane in which inflation is followed by 'instant preheating' (Felder, Kofman and Linde 1999). The larger reheating temperature in this model results in a smaller amplitude of relic gravity waves which is consistent with nucleosynthesis bounds. The relic gravity wave background has a 'blue' spectrum at high frequencies and is a generic byproduct of successful quintessential inflation on the brane

  18. Microbiological effectiveness of mineral pot filters in Cambodia.

    Science.gov (United States)

    Brown, Joe; Chai, Ratana; Wang, Alice; Sobsey, Mark D

    2012-11-06

    Mineral pot filters (MPFs) are household water treatment (HWT) devices that are manufactured and distributed by the private sector, with millions of users in Southeast Asia. Their effectiveness in reducing waterborne microbes has not been previously investigated. We purchased three types of MPFs available on the Cambodian market for systematic evaluation of bacteria, virus, and protozoan surrogate microbial reduction in laboratory challenge experiments following WHO recommended performance testing protocols. Results over the total 1500 L testing period per filter indicate that the devices tested were highly effective in reducing Esherichia coli (99.99%+), moderately effective in reducing bacteriophage MS2 (99%+), and somewhat effective against Bacillus atrophaeus, a spore-forming bacterium we used as a surrogate for protozoa (88%+). Treatment mechanisms for all filters included porous ceramic and activated carbon filtration. Our results suggest that these commercially available filters may be at least as effective against waterborne pathogens as other, locally available treatment options such as ceramic pot filters or boiling. More research is needed on the role these devices may play as interim solutions to the problem of unsafe drinking water in Cambodia and globally.

  19. Technology and Manufacturing Readiness of Early Market Motive and Non-Motive Hydrogen Storage Technologies for Fuel Cell Applications

    Energy Technology Data Exchange (ETDEWEB)

    Ronnebro, Ewa

    2012-06-16

    PNNL’s objective in this report is to provide DOE with a technology and manufacturing readiness assessment to identify hydrogen storage technologies’ maturity levels for early market motive and non-motive applications and to provide a path forward toward commercialization. PNNL’s Technology Readiness Assessment (TRA) is based on a combination of Technology Readiness Level (TRL) and Manufacturing Readiness Level (MRL) designations that enable evaluation of hydrogen storage technologies in varying levels of development. This approach provides a logical methodology and roadmap to enable the identification of hydrogen storage technologies, their advantages/disadvantages, gaps and R&D needs on an unbiased and transparent scale that is easily communicated to interagency partners. The TRA report documents the process used to conduct the TRA, reports the TRL and MRL for each assessed technology and provides recommendations based on the findings.

  20. False become true: Christie's catalogue of Zhang Hongtu

    Directory of Open Access Journals (Sweden)

    Sandra Valenzuela Arellano

    2013-06-01

    Full Text Available By analyzing the series Christie’s Catalogue Project by the artist Zhang Hongtu, this essay traces relationships between: Cultural heritance, national identity, fakeness, popular culture and legitimacy of power structures, within contemporary China. Contemporary art creates assemblies of meanings related to its time, sometimes relating the present with history, high with vernacular culture, soft power with the construction of collective memory. This essay aims to reconstruct with words, through textual and visual analysis, those visual assemblies.

  1. Modelling of teeth of a gear transmission for modern manufacturing technologies

    Science.gov (United States)

    Monica, Z.; Banaś, W.; Ćwikla, G.; Topolska, S.

    2017-08-01

    The technological process of manufacturing of gear wheels is influenced by many factors. It is designated depending on the type of material from which the gear is to be produced, its heat treatment parameters, the required accuracy, the geometrical form and the modifications of the tooth. Therefor the parameters selection process is not easy and moreover it is unambiguous. Another important stage of the technological process is the selection of appropriate tools to properly machine teeth in the operations of both roughing and finishing. In the presented work the focus is put first of all on modern production methods of gears using technologically advanced instruments in comparison with conventional tools. Conventional processing tools such as gear hobbing cutters or Fellows gear-shaper cutters are used from the beginning of the machines for the production of gear wheels. With the development of technology and the creation of CNC machines designated for machining of gears wheel it was also developed the manufacturing technology as well as the design knowledge concerning the technological tools. Leading manufacturers of cutting tools extended the range of tools designated for machining of gears on the so-called hobbing cutters with inserted cemented carbide tips. The same have be introduced to Fellows gear-shaper cutters. The results of tests show that is advantaged to use hobbing cutters with inserted cemented carbide tips for milling gear wheels with a high number of teeth, where the time gains are very high, in relation to the use of conventional milling cutters.

  2. Development in fiscal 1999 of technologies to put photovoltaic power generation systems into practical use. Development of thin film solar cell manufacturing technologies (Development of low-cost large-area module manufacturing technologies, next generation thin film solar cell module manufacturing technologies, development of CIS solar cell module manufacturing technologies); 1999 nendo taiyoko hatsuden system jitsuyoka gijutsu kaihatsu seika hokokusho. Usumaku taiyo denchi no seizo gijutsu kaihatsu (tei cost daimenseki module seizo gijutsu kaihatsu (jisedai usumaku taiyo denchi no seizo gijutsu kaihtsu (CIS taiyo denchi module no seizo gijutsu kaihatsu))

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    Research and development has been performed on a technology to manufacture CIS-based thin film solar cells. This paper summarizes the achievements in fiscal 1999. In the research of a large-area light absorbing layer manufacturing technology, investigation was made on light absorbing layers in manufacturing sub-modules with a size of 30 cm times 30 cm. With regard to the temperature condition in the light absorbing layer forming process, it was found that the cooling rate affects particularly the adhesion in the connecting interface of the light absorbing layer and the Mo rear electrode layer. In addition, it was revealed that the sulfur take-in amount can be increases by extending the retention time at the sulfurizing temperature and by decreasing the temperature to turn the gas phase into selenium. In the research of elementary technologies to establish the mass production process, developments were performed on the high-resistance buffer layer manufacturing technology, the high-quality window layer film manufacturing technology, and the technology to manufacture rear electrode layer made of high-quality metals. In developing the patterning technology, two kinds of the existing patterning devices were modified and adjusted for patterning the substrates with a size of 30 cm times 30 cm. In addition, a processing device was installed in the conventional manually operated process for module finishing. (NEDO)

  3. Proto-ribosome: a theoretical approach based on RNA relics

    OpenAIRE

    Demongeot, Jacques

    2017-01-01

    We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.

  4. Innovative High-Performance Deposition Technology for Low-Cost Manufacturing of OLED Lighting

    Energy Technology Data Exchange (ETDEWEB)

    Scott, David; Hamer, John

    2017-06-30

    In this project, OLEDWorks developed and demonstrated the innovative high-performance deposition technology required to deliver dramatic reductions in the cost of manufacturing OLED lighting in production equipment. The current high manufacturing cost of OLED lighting is the most urgent barrier to its market acceptance. The new deposition technology delivers solutions to the two largest parts of the manufacturing cost problem – the expense per area of good product for organic materials and for the capital cost and depreciation of the equipment. Organic materials cost is the largest expense item in the bill of materials and is predicted to remain so through 2020. The high-performance deposition technology developed in this project, also known as the next generation source (NGS), increases material usage efficiency from 25% found in current Gen2 deposition technology to 60%. This improvement alone results in a reduction of approximately $25/m2 of good product in organic materials costs, independent of production volumes. Additionally, this innovative deposition technology reduces the total depreciation cost from the estimated value of approximately $780/m2 of good product for state-of-the-art G2 lines (at capacity, 5-year straight line depreciation) to $170/m2 of good product from the OLEDWorks production line.

  5. Agent Technology in Agile Multiparallel Manufacturing and Product Support

    NARCIS (Netherlands)

    van Moergestel, L.J.M.

    2014-01-01

    The thesis describes the application of agent technology in product manufacturing and product support. Important issues in the requirements of modern production are short time to market, requirement-driven production and low cost small quantity production. To meet these requirements special low cost

  6. Continuous manufacturing of active pharmaceutical ingredients via flow technology

    NARCIS (Netherlands)

    Borukhova, S.; Hessel, V.; Kleinbudde, P.; Khinast, J.; Rantanen, J.

    2017-01-01

    The main drivers to implement continuous manufacturing are aspects related to logistics, quality of the final product, chemistry to be implemented, process and safety concerns. Flow technology offers a platform to realize those drivers. This chapter introduces the reader to a relatively new

  7. Piezoelectric Transformers: An Historical Review

    Directory of Open Access Journals (Sweden)

    Alfredo Vazquez Carazo

    2016-04-01

    Full Text Available Piezoelectric transformers (PTs are solid-state devices that transform electrical energy into electrical energy by means of a mechanical vibration. These devices are manufactured using piezoelectric materials that are driven at resonance. With appropriate design and circuitry, it is possible to step up and step down the voltages between the input and output sections of the piezoelectric transformer, without making use of magnetic materials and obtaining excellent conversion efficiencies. The initial concept of a piezoelectric ceramic transformer was proposed by Charles A. Rosen in 1954. Since then, the evolution of piezoelectric transformers through history has been linked to the relevant work of some excellent researchers as well as to the evolution in materials, manufacturing processes, and driving circuit techniques. This paper summarizes the historical evolution of the technology.

  8. Evolution of ESR Technology and Equipment for Long Hollow Ingots Manufacture

    Science.gov (United States)

    Medovar, Lev; Stovpchenko, Ganna; Dudka, Grigory; Kozminskiy, Alexander; Fedorovskii, Borys; Lebid, Vitalii; Gusiev, Iaroslav

    In this paper development of both ESR technology and equipment for hollow ingot manufacture review and analysis are presented. The real complications of hollow ingot manufacture and some tendentious issues which restrict process dissemination are discussed. An actual data of modern manufacture of as-cast pipes for heat and power engineering by traditional ESR with consumable electrode are given. Results of microstructure and nonmetal inclusion investigations have shown the high quality of as-cast ESR pipes. On the basis of these results the possibility to produce huge ESR hollows (up 5000 mm in dia) with final goal drastically to reduce setting ratio on forged shells and rings or even replace it by ESR hollows as-cast is grounded. Two new ESR technologies — consumable electrodes change and liquid metal usage — have passed pilot tests for heavy hollow production and shown very prospective results to be presented.

  9. Y H DING

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. Y H DING. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 51. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study · H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG · More Details ...

  10. X Q TANG

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. X Q TANG. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 51. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study · H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG · More Details ...

  11. The Temporal Limits of Technological Advantage

    Science.gov (United States)

    2017-06-01

    technologically advanced capabilities. “ Technology , in fact, is one of the keys to understanding relations between Hitler’s regime and the German business ...strategy sought to “leverage US advantages in technologies 2 like big data, stealth, advanced manufacturing (e.g. 3-D printing), robotics, and... history has had different parameters and different results, examining historical situations in which a technological advantage has been achieved

  12. Tensioned Fabric Structures with Surface in the Form of Chen-Gackstatter

    Directory of Open Access Journals (Sweden)

    Yee Hooi Min

    2016-01-01

    Full Text Available Form-finding has to be carried out for tensioned fabric structure in order to determine the initial equilibrium shape under prescribed support condition and prestress pattern. Tensioned fabric structures are normally designed to be in the form of equal tensioned surface. Tensioned fabric structure is highly suited to be used for realizing surfaces of complex or new forms. However, research study on a new form as a tensioned fabric structure has not attracted much attention. Another source of inspiration minimal surface which could be adopted as form for tensioned fabric structure is very crucial. The aim of this study is to propose initial equilibrium shape of tensioned fabric structures in the form of Chen-Gackstatter. Computational form-finding using nonlinear analysis method is used to determine the Chen-Gackstatter form of uniformly stressed surfaces. A tensioned fabric structure must curve equally in opposite directions to give the resulting surface a three dimensional stability. In an anticlastic doubly curved surface, the sum of all positive and all negative curvatures is zero. This study provides an alternative choice for structural designer to consider the Chen-Gackstatter applied in tensioned fabric structures. The results on factors affecting initial equilibrium shape can serve as a reference for proper selection of surface parameter for achieving a structurally viable surface.

  13. Technology demonstration of starshade manufacturing for NASA's Exoplanet mission program

    Science.gov (United States)

    Kasdin, N. J.; Lisman, D.; Shaklan, S.; Thomson, M.; Cady, E.; Martin, S.; Marchen, L.; Vanderbei, R. J.; Macintosh, B.; Rudd, R. E.; Savransky, D.; Mikula, J.; Lynch, D.

    2012-09-01

    It is likely that the coming decade will see the development of a large visible light telescope with enabling technology for imaging exosolar Earthlike planets in the habitable zone of nearby stars. One such technology utilizes an external occulter, a satellite flying far from the telescope and employing a large screen, or starshade, to suppress the incoming starlight suffciently for detecting and characterizing exoplanets. This trades the added complexity of building the precisely shaped starshade and flying it in formation against simplifications in the telescope since extremely precise wavefront control is no longer necessary. In this paper we present the results of our project to design, manufacture, and measure a prototype occulter petal as part of NASA's first Technology Development for Exoplanet Missions program. We describe the mechanical design of the starshade and petal, the precision manufacturing tolerances, and the metrology approach. We demonstrate that the prototype petal meets the requirements and is consistent with a full-size occulter achieving better than 10-10 contrast.

  14. The strategic relevance of manufacturing technology: An overall quality concept to promote innovation preventing drug shortage.

    Science.gov (United States)

    Panzitta, Michele; Ponti, Mauro; Bruno, Giorgio; Cois, Giancarlo; D'Arpino, Alessandro; Minghetti, Paola; Mendicino, Francesca Romana; Perioli, Luana; Ricci, Maurizio

    2017-01-10

    Manufacturing is the bridge between research and patient: without product, there is no clinical outcome. Shortage has a variety of causes, in this paper we analyse only causes related to manufacturing technology and we use shortage as a paradigm highliting the relevance of Pharmaceutical Technology. Product and process complexity and capacity issues are the main challenge for the Pharmaceutical Industry Supply chain. Manufacturing Technology should be acknowledged as a R&D step and as a very important matter during University degree in Pharmacy and related disciplines, promoting collaboration between Academia and Industry, measured during HTA step and rewarded in terms of price and reimbursement. The above elements are not yet properly recognised, and manufacturing technology is taken in to consideration only when a shortage is in place. In a previous work, Panzitta et al. proposed to perform a full technology assessment at the Health Technological Assessment stage, evaluating three main technical aspects of a medicine: manufacturing process, physicochemical properties, and formulation characteristics. In this paper, we develop the concept of manufacturing appraisal, providing a technical overview of upcoming challenges, a risk based approach and an economic picture of shortage costs. We develop also an overall quality concept, not limited to GMP factors but broaden to all elements leading to a robust supply and promoting technical innovation. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Technology Sharing in Manufacturing Business Groups

    DEFF Research Database (Denmark)

    Sköld, Martin; Karlsson, Christer

    2012-01-01

    , consultants, partners, and others. However, the distinction between the focal firm, on the one hand, and networks, on the other, is in this paper argued to be too extensive without intermediating nuances. Less focus is given to an in-between perspective configured by business groups or concerns here defined...... as parent corporations with subsidiary companies. It is this perspective of business groups with characteristics between individual firms and open networks that is of interest in this paper. The focus is on manufacturing business groups in which the companies will typically have individual as well as common......Technology represents the primordial force for companies and organizations in securing long-term competitiveness. In the intensive search to access new technology, organizations are more and more looking beyond the borders of the focal firm and becoming involved in various networks with suppliers...

  16. Virus removal efficiency of Cambodian ceramic pot water purifiers.

    Science.gov (United States)

    Salsali, Hamidreza; McBean, Edward; Brunsting, Joseph

    2011-06-01

    Virus removal efficiency is described for three types of silver-impregnated, ceramic water filters (CWFs) produced in Cambodia. The tests were completed using freshly scrubbed filters and de-ionized (DI) water as an evaluation of the removal efficiency of the virus in isolation with no other interacting water quality variables. Removal efficiencies between 0.21 and 0.45 log are evidenced, which is significantly lower than results obtained in testing of similar filters by other investigators utilizing surface or rain water and a less frequent cleaning regime. Other experiments generally found virus removal efficiencies greater than 1.0 log. This difference may be because of the association of viruses with suspended solids, and subsequent removal of these solids during filtration. Variability in virus removal efficiencies between pots of the same manufacturer, and observed flow rates outside the manufacturer's specifications, suggest tighter quality control and consistency may be needed during production.

  17. Adaptation of Lactobacillus casei Zhang to Gentamycin Involves an Alkaline Shock Protein

    Directory of Open Access Journals (Sweden)

    Wenyi Zhang

    2017-11-01

    Full Text Available Lactobacillus (L. casei Zhang is a koumiss-originated probiotic strain, which was used as a model in a long-term antibiotics-driven evolution experiment to reveal bacterial evolutionary dynamics; and we isolated gentamycin-resistant L. casei Zhang descendents. To decipher the gentamycin resistance mechanism, here we cultivated the parental L. casei Zhang and its descendent cells in an antibiotics-containing environment to compare their global protein expression profiles using the iTRAQ-based proteomic approach. A total of 72 proteins were significantly up-regulated (>2.0-fold, P < 0.05, whilst 32 proteins were significantly down-regulated <−2.0-fold, P < 0.05 in the descendent line. The gentamycin-resistant descendent line showed elevated expression in some carbohydrates, amino acids, and purine metabolic pathways. Several stress-related proteins were also differentially expressed. Among them, one alkaline shock protein, asp23, was up-regulated most in the gentamycin-resistant strain (21.9-fold increase compared with the parental strain. The asp23 gene disruption mutant was significantly more sensitive to gentamycin compared with the wild type, suggesting an important role of this gene in developing the gentamycin-resistant phenotype in L. casei. Our report has described the adaptation of a probiotic strain that has acquired antibiotics resistance through long-term antibiotics exposure at the proteome level, and we revealed a novel mechanism of gentamycin resistance.

  18. Manufacturing technology of high-quality pressure castings

    Directory of Open Access Journals (Sweden)

    S. Pietrowski

    2011-10-01

    Full Text Available The paper presents manufacturing technology of pressure castings made of Al-Si alloy without porosity or with low microporosity of castings. It has been shown that the greatest impact on the porosity of the castings and the concentration of hydrogen has had the charge to the melting furnace. Liquidation or occurrence of a small microporosity of castings provides refining with solid refiners, nitrogen and modification of liquid alloy after various operations of preparing process. The liquid alloy stored in holding furnace should be refined once every 2 h with nitrogen. Authors developed a computer program of Al-Si alloys inspection with using of TDA method. The developed technology was verified under production conditions.

  19. 3D Printing, Additive Manufacturing, and Solid Freeform Fabrication: The Technologies of the Past, Present and Future

    Science.gov (United States)

    Beaman, Joseph

    2015-03-01

    Starting in the late 1980's, several new technologies were created that have the potential to revolutionize manufacturing. These technologies are, for the most part, additive processes that build up parts layer by layer. In addition, the processes that are being touted for hard-core manufacturing are primarily laser or e-beam based processes. This presentation gives a brief history of Additive Manufacturing and gives an assessment for these technologies. These technologies initially grew out of a commercial need for rapid prototyping. This market has a different requirement for process and quality control than traditional manufacturing. The relatively poor process control of the existing commercial Additive Manufacturing equipment is a vestige of this history. This presentation discusses this history and improvements in quality over time. The emphasis will be on Additive Manufacturing processes that are being considered for direct manufacturing, which is a different market than the 3D Printing ``Makerbot'' market. Topics discussed include past and present machine sensors, materials, and operational methods that were used in the past and those that are used today to create manufactured parts. Finally, a discussion of new methods and future directions of AM is presented.

  20. Inkjet printing for biosensor fabrication: combining chemistry and technology for advanced manufacturing.

    Science.gov (United States)

    Li, Jia; Rossignol, Fabrice; Macdonald, Joanne

    2015-06-21

    Inkjet printing is emerging at the forefront of biosensor fabrication technologies. Parallel advances in both ink chemistry and printers have led to a biosensor manufacturing approach that is simple, rapid, flexible, high resolution, low cost, efficient for mass production, and extends the capabilities of devices beyond other manufacturing technologies. Here we review for the first time the factors behind successful inkjet biosensor fabrication, including printers, inks, patterning methods, and matrix types. We discuss technical considerations that are important when moving beyond theoretical knowledge to practical implementation. We also highlight significant advances in biosensor functionality that have been realised through inkjet printing. Finally, we consider future possibilities for biosensors enabled by this novel combination of chemistry and technology.

  1. Characterisation of a Proto-historic bronze collection by micro-EDXRF

    International Nuclear Information System (INIS)

    Figueiredo, Elin; Araújo, M. Fátima; Silva, Rui J.C.; Vilaça, Raquel

    2013-01-01

    Highlights: ► A collection of Proto-historic metal artefacts was analysed by micro-EDXRF. ► Composition of major and minor elements has been determined. ► Artefacts were manufactured in a bronze alloy with a low impurity pattern. ► The alloy shows parallels with indigenous Late Bronze Age Iberian productions. -- Abstract: Studies concerning European Proto-historic metallic artefacts can provide important clues about technological transfers during a period of time characterised by diverse cultural interactions. A collection of Proto-historic metallic artefacts from Medronhal (western Iberian Peninsula) composed by rings, bracelets and a fibula related to different cultural affiliations were investigated by micro-EDXRF to provide a major and a minor elemental characterisation. Results show that the Medronhal collection was manufactured in a Cu–Sn alloy (binary bronze) with similar Sn contents among the various types of artefacts and a low impurity pattern. Results of the type and quality of metal were compared to other artefact collections to infer about metallurgical parallels. Strong parallels with indigenous Late Bronze Age Iberian metallurgical productions were found

  2. Characterisation of a Proto-historic bronze collection by micro-EDXRF

    Energy Technology Data Exchange (ETDEWEB)

    Figueiredo, Elin, E-mail: elin@itn.pt [IST/ITN, Instituto Superior Técnico, Universidade Técnica de Lisboa, Estrada Nacional 10, 2686-953 Sacavém (Portugal); CENIMAT/I3N, Departamento de Ciência dos Materiais, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal); Araújo, M. Fátima [IST/ITN, Instituto Superior Técnico, Universidade Técnica de Lisboa, Estrada Nacional 10, 2686-953 Sacavém (Portugal); Silva, Rui J.C. [CENIMAT/I3N, Departamento de Ciência dos Materiais, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal); Vilaça, Raquel [CEAUCP-FCT, Instituto de Arqueologia, Departamento de História, Arqueologia e Artes, Faculdade de Letras, Universidade de Coimbra, Palácio de Sub-Ripas, 3000-395 Coimbra (Portugal)

    2013-02-01

    Highlights: ► A collection of Proto-historic metal artefacts was analysed by micro-EDXRF. ► Composition of major and minor elements has been determined. ► Artefacts were manufactured in a bronze alloy with a low impurity pattern. ► The alloy shows parallels with indigenous Late Bronze Age Iberian productions. -- Abstract: Studies concerning European Proto-historic metallic artefacts can provide important clues about technological transfers during a period of time characterised by diverse cultural interactions. A collection of Proto-historic metallic artefacts from Medronhal (western Iberian Peninsula) composed by rings, bracelets and a fibula related to different cultural affiliations were investigated by micro-EDXRF to provide a major and a minor elemental characterisation. Results show that the Medronhal collection was manufactured in a Cu–Sn alloy (binary bronze) with similar Sn contents among the various types of artefacts and a low impurity pattern. Results of the type and quality of metal were compared to other artefact collections to infer about metallurgical parallels. Strong parallels with indigenous Late Bronze Age Iberian metallurgical productions were found.

  3. Manufacturing the Future: Federal Priorities for Manufacturing Research and Development. Report of the Interagency Working Group on Manufacturing R&D, Committee on Technology, National Science and Technology Council

    Science.gov (United States)

    2008-03-01

    coolant manifolds are constructed on-site. Each connector must be separately cut, prepared, and joined to the subsystem. Prefabrication of...to prepare students for careers in the Manufacturing and Science, Technology, Engineering, and Mathematics career clusters. EPA Ecological and...nanomaterials, along with exposures of human and other species in natural ecosystems to nanomaterials, and industrial ecology related to nanomaterials

  4. On the Relics of Scytho-Sarmato-Alanian Vocabulary in the Toponymy of Ossetia Voprosy onomastiki, 2018, Volume 15, Issu

    Directory of Open Access Journals (Sweden)

    Yuri A. Dzitstsoity

    2018-03-01

    Full Text Available The article undertakes to pick out the oldest Scythian-Sarmatian-Alanian element in Ossetian toponymy where the appellative lexis that was lost in the language is partly retained. The reconstruction of the ancient Iranian etymons is based on strict data recordings of historical phonetics and historical morphology of the Ossetian language. As a result of the work carried out, such stems as *æf- ‘water, river’, *æfsæn- ‘the top of a mountain’, *dæj- ‘settlement’, *fi jjag- ‘(wild onion’, *fi jjag- ‘running (about water’, *ke- ‘house’, *mærg- ‘meadow’, *zæræ- ‘grass’ and others were reconstructed. Some of them are also present in the appellative lexis as elements of compounds. The analyzed information verifi es the remarkable capacity of toponymy as a keeper of the ancient lexis. And although this line of research is barely touched upon, it is already clear that the relics of the ancient Iranian lexis in the Ossetian toponymy are important both for the history of the Ossetian language and the ethnic history of Ossetia. Common Iranian lexis retained in the Ossetian toponymy came out of use at different times and for various reasons. In most cases, it was replaced by Ossetian neologisms, but some of these stems were substituted by ancient Iranian lexemes which had the status of dialectical words in the ancestor language. Therefore, the Ossetian toponymy, along with compounds and the Nart Epic language, is one of the sources for reconstruction of the ancient Iranian lexis. The geography of relic lexis is another feature of interest: these word forms are equally distributed all over the Ossetian mountain zone, regardless of the contemporary dialect variations of the Ossetian language: the toponym Zæræmæg is present both in Digoria and the Alagir gorge, the hydronym Æræf is attested in Digoria and in South Ossetia.

  5. Technology Clubs and Growth Patterns: Evidence from EU Manufacturing

    NARCIS (Netherlands)

    Bos, J.W.B.; Economidou, C.; Koetter, M.

    This paper investigates the forces driving output change in a panel of EU manufacturing industries. A flexible modeling strategy is adopted that accounts for (i) inefficient use of resources, and (ii) differences in the production technology across industries. With our model we are able to identify

  6. POT: Planning, Organisation and Tele-Information

    DEFF Research Database (Denmark)

    Vidal, Rene Victor Valqui

    1996-01-01

    The main purpose of this paper is to introduce the framwork of a research project carried out at the Technical University of Denmark dealing with 'holistic' and interdisciplinary (systems oriented)methods for strategic planning and organisational re-design in connection with the introduction...... of tele-information technologies and hte new demands of hte so-called information society, the POT proejct. Three specirfic projects are shortly introduced: planning in networked firms, strategic approaches to climate change and strategies for the schools of the future....

  7. Chen Jingrun, China's famous mathematician: devastated by brain injuries on the doorstep to solving a fundamental mathematical puzzle.

    Science.gov (United States)

    Lei, Ting; Belykh, Evgenii; Dru, Alexander B; Yagmurlu, Kaan; Elhadi, Ali M; Nakaji, Peter; Preul, Mark C

    2016-07-01

    Chen Jingrun (1933-1996), perhaps the most prodigious mathematician of his time, focused on the field of analytical number theory. His work on Waring's problem, Legendre's conjecture, and Goldbach's conjecture led to progress in analytical number theory in the form of "Chen's Theorem," which he published in 1966 and 1973. His early life was ravaged by the Second Sino-Japanese War and the Chinese Cultural Revolution. On the verge of solving Goldbach's conjecture in 1984, Chen was struck by a bicyclist while also bicycling and suffered severe brain trauma. During his hospitalization, he was also found to have Parkinson's disease. Chen suffered another serious brain concussion after a fall only a few months after recovering from the bicycle crash. With significant deficits, he remained hospitalized for several years without making progress while receiving modern Western medical therapies. In 1988 traditional Chinese medicine experts were called in to assist with his treatment. After a year of acupuncture and oxygen therapy, Chen could control his basic bowel and bladder functions, he could walk slowly, and his swallowing and speech improved. When Chen was unable to produce complex work or finish his final work on Goldbach's conjecture, his mathematical pursuits were taken up vigorously by his dedicated students. He was able to publish Youth Math, a mathematics book that became an inspiration in Chinese education. Although he died in 1996 at the age of 63 after surviving brutal political repression, being deprived of neurological function at the very peak of his genius, and having to be supported by his wife, Chen ironically became a symbol of dedication, perseverance, and motivation to his students and associates, to Chinese youth, to a nation, and to mathematicians and scientists worldwide.

  8. Gender differences on the job satisfaction in the phase of implementing advanced manufacturing technology in the Chinese manufacturing firms.

    Science.gov (United States)

    Yu, Na; Shen, Li Ming; Lewark, Siegfried

    2012-01-01

    This research gave an effort to study on gender differences in the job satisfaction for technological innovation at Chinese manufacturing firm. The exploratory study was conducted in four Chinese furniture manufacturing firms, which are all in the phases of introducing advanced manufacturing system. The results of statistical analysis show that general satisfaction of female employees to their jobs is significantly higher than male employees. In addition, supervisory satisfaction of female employees is significantly higher than male employees. The findings of the study reveal that activities are suggested to be carried out to increase the job satisfaction of male employees, especially improve communication and relationship between the managerial and the non-managerial levels in the innovation process. In addition, the higher job satisfaction of female employees could be considered a positive factor for the successful implementation of AMT in the technological innovation, although male employees are still dominated work force in the case study firms.

  9. An equilibrium point stabilization strategy for the Chen system

    International Nuclear Information System (INIS)

    Alvarez-Ramirez, Jose; Cevantes, Ilse; Femat, Ricardo

    2004-01-01

    The aim of this Letter is to address the equilibrium point stabilization problem of the Chen system by employing a simple linear feedback controller derived from time-scaling the dynamics of a single variable. The controller has the advantage of being easy to implement and a rigorous stability proof is provided based on singular perturbation arguments. Results are illustrated via numerical simulations

  10. Generalized projective synchronization between Lorenz system and Chen's system

    International Nuclear Information System (INIS)

    Li Guohui

    2007-01-01

    On the basis of active backstepping design, this paper presents the generalized projective synchronization between two different chaotic systems: Lorenz system and Chen's system. The proposed method combines backstepping methods and active control without having to calculate the Lyapunov exponents and the eigenvalues of the Jacobian matrix, which makes it simple and convenient. Numerical simulations show that this method works very well

  11. Learning to Innovate vs. Learning to Manufacture: Towards an Alternative Technology Strategy

    OpenAIRE

    Tyabji, Nasir

    2003-01-01

    India's diversified and sophisticated manufacturing base contrasts strongly with the near complete absence of visible innovative capabilities. This article examines the Indian "National System of Innovation" in order to address the question of the evident distinction between the ability to make and the ability to make better.The article examines the historical record of industrialisation and innovation in India, and argues that the distinction between the knowledge of “how to make” (manufactu...

  12. Tests of a Roman Pot Prototype for the TOTEM Experiment

    CERN Document Server

    Deile, M.; Anelli, G.M.; Antchev, G.A.; Ayache, M.; Caspers, F.; Dimovasili, E.; Dinapoli, R.; Drouhin, F.D.; Eggert, K.; Escourrou, L.; Fochler, O.; Gill, K.; Grabit, R.; Haug, F.; Jarron, P.; Kaplon, J.; Kroyer, T.; Luntama, T.; Macina, D.; Mattelon, E.; Mirabito, L.; Niewiadomski, H.; Noschis, E.P.; Oriunno, M.; Park, A.; Perrot, A.L.; Pirotte, O.; Quetsch, J.M.; Regnier, F.; Ruggiero, G.; Saramad, S.; Siegrist, P.; Snoeys, W.; Souissi, T.; Szczygiel, R.; Troska, J.; Vasey, F.; Verdier, A.; Avati, V.; Jarvinen, M.; Kalliokoski, M.; Kalliopuska, J.; Kurvinen, K.; Lauhakangas, R.; Oljemark, F.; Orava, R.; Palmieri, V.; Saarikko, H.; Soininen, A.; Osterberg, K.; Berardi, V.; Catanesi, M.G.; Radicioni, E.; Boccone, V.; Bozzo, M.; Buzzo, A.; Cuneo, S.; Ferro, F.; Macri, M.; Minutoli, S.; Morelli, A.; Musico, P.; Negri, M.; Santroni, A.; Sette, G.; Sobol, A.; Da Via, C.; Hasi, J.; Kok, A.; Watts, S.; Kasper, J.; Kundrat, V.; Lokajicek, M.; Smotlacha, J.

    2005-01-01

    The TOTEM collaboration has developed and tested the first prototype of its Roman Pots to be operated in the LHC. TOTEM Roman Pots contain stacks of 10 silicon detectors with strips oriented in two orthogonal directions. To measure proton scattering angles of a few microradians, the detectors will approach the beam centre to a distance of 10 sigma + 0.5 mm (= 1.3 mm). Dead space near the detector edge is minimised by using two novel "edgeless" detector technologies. The silicon detectors are used both for precise track reconstruction and for triggering. The first full-sized prototypes of both detector technologies as well as their read-out electronics have been developed, built and operated. The tests took place first in a fixed-target muon beam at CERN's SPS, and then in the proton beam-line of the SPS accelerator ring. We present the test beam results demonstrating the successful functionality of the system despite slight technical shortcomings to be improved in the near future.

  13. Tests of a Roman Pot prototype for the TOTEM experiment

    Science.gov (United States)

    Deile, M.; Alagoz, E.; Anelli, G.; Antchev, G.; Ayache, M.; Caspers, F.; Dimovasili, E.; Dinapoli, R.; Drouhin, F.; Eggert, K.; Escourrou, J.L; Fochler, O.; Gill, K.; Grabit, R.; Haung, F.; Jarron, P.; Kaplon, J.; Kroyer, T.; Luntama, T.; Macina, D.; Mattelon, E.; Niewiadomski, H.; Mirabito, L.; Noschis, E.P.; Oriunno, M.; Park, a.; Perrot, A.-L.; Pirotte, O.; Quetsch, J.M.; Regnier, F.; Ruggiero, G.; Saramad, S.; Siegrist, P.; Snoeys, W.; sSouissi, T.; Szczygiel, R.; Troska, J.; Vasey, F.; Verdier, A.; Da Vià, C.; Hasi, J.; Kok, A.; Watts, S.; Kašpar, J.; Kundrát, V.; Lokajíček, M.V.; Smotlacha, J.; Avati, V.; Järvinen, M.; Kalliokoski, M.; Kalliopuska, J.; Kurvinen, K.; Lauhakangas, R.; Oljemark, F.; Orava, R.; Österberg, K.; Palmieri, V.; Saarikko, H.; Soininen, A.; Boccone, V.; Bozzo, M.; Buzzo, A.; Cuneo, S.; Ferro, F.; Macrí, M.; Minutoli, S.; Morelli, A.; Musico, P.; Negri, M.; Santroni, A.; Sette, G.; Sobol, A.; sBerardi, V.; Catanesi, M.G.; Radicioni, E.

    The TOTEM collaboration has developed and tested the first prototype of its Roman Pots to be operated in the LHC. TOTEM Roman Pots contain stacks of 10 silicon detectors with strips oriented in two orthogonal directions. To measure proton scattering angles of a few microradians, the detectors will approach the beam centre to a distance of 10 sigma + 0.5 mm (= 1.3 mm). Dead space near the detector edge is minimised by using two novel "edgeless" detector technologies. The silicon detectors are used both for precise track reconstruction and for triggering. The first full-sized prototypes of both detector technologies as well as their read-out electronics have been developed, built and operated. The tests took place first in a fixed-target muon beam at CERN's SPS, and then in the proton beam-line of the SPS accelerator ring. We present the test beam results demonstrating the successful functionality of the system despite slight technical shortcomings to be improved in the near future.

  14. Manufacturing microsystems-on-a-chip with 5-level surface micromachining technology

    Energy Technology Data Exchange (ETDEWEB)

    Sniegowski, J.; Rodgers, M.S.

    1998-05-01

    An agile microsystem manufacturing technology has been developed that provides unprecedented 5 levels of independent polysilicon surface-micromachine films for the designer. Typical surface-micromachining processes offer a maximum of 3 levels, making this the most complex surface-micromachining process technology developed to date. Leveraged from the extensive infrastructure present in the microelectronics industry, the manufacturing method of polysilicon surface-micromachining offers similar advantages of high-volume, high-reliability, and batch-fabrication to microelectromechanical systems (MEMS) as has been accomplished with integrated circuits (ICs). These systems, comprised of microscopic-sized mechanical elements, are laying the foundation for a rapidly expanding, multi-billion dollar industry 2 which impacts the automotive, consumer product, and medical industries to name only a few.

  15. A historical overview of magnetic resonance imaging, focusing on technological innovations.

    Science.gov (United States)

    Ai, Tao; Morelli, John N; Hu, Xuemei; Hao, Dapeng; Goerner, Frank L; Ager, Bryan; Runge, Val M

    2012-12-01

    Magnetic resonance imaging (MRI) has now been used clinically for more than 30 years. Today, MRI serves as the primary diagnostic modality for many clinical problems. In this article, historical developments in the field of MRI will be discussed with a focus on technological innovations. Topics include the initial discoveries in nuclear magnetic resonance that allowed for the advent of MRI as well as the development of whole-body, high field strength, and open MRI systems. Dedicated imaging coils, basic pulse sequences, contrast-enhanced, and functional imaging techniques will also be discussed in a historical context. This article describes important technological innovations in the field of MRI, together with their clinical applicability today, providing critical insights into future developments.

  16. Manufacturing footprint optimisation: a necessity for manufacturing network in changing business environment

    DEFF Research Database (Denmark)

    Yang, Cheng; Farooq, Sami; Johansen, John

    2010-01-01

    Facing the unpredictable financial crisis, optimising the footprint can be the biggest and most important transformation a manufacturer can undertake. In order to realise the optimisation, fundamental understanding on manufacturing footprint is required. Different elements of manufacturing...... footprint have been investigated independently in the existing literature. In this paper, for the purpose of relationship exploration between different elements, manufacturing footprints of three industrial companies are traced historically. Based on them, four reasons for the transformation...

  17. Promoting Secondary Analysis of Electronic Medical Records in China: Summary of the PLAGH-MIT Critical Data Conference and Health Datathon.

    Science.gov (United States)

    Li, Peiyao; Xie, Chen; Pollard, Tom; Johnson, Alistair Edward William; Cao, Desen; Kang, Hongjun; Liang, Hong; Zhang, Yuezhou; Liu, Xiaoli; Fan, Yong; Zhang, Yuan; Xue, Wanguo; Xie, Lixin; Celi, Leo Anthony; Zhang, Zhengbo

    2017-11-14

    Electronic health records (EHRs) have been widely adopted among modern hospitals to collect and track clinical data. Secondary analysis of EHRs could complement the traditional randomized control trial (RCT) research model. However, most researchers in China lack either the technical expertise or the resources needed to utilize EHRs as a resource. In addition, a climate of cross-disciplinary collaboration to gain insights from EHRs, a crucial component of a learning healthcare system, is not prevalent. To address these issues, members from the Massachusetts Institute of Technology (MIT) and the People's Liberation Army General Hospital (PLAGH) organized the first clinical data conference and health datathon in China, which provided a platform for clinicians, statisticians, and data scientists to team up and address information gaps in the intensive care unit (ICU). ©Peiyao Li, Chen Xie, Tom Pollard, Alistair Edward William Johnson, Desen Cao, Hongjun Kang, Hong Liang, Yuezhou Zhang, Xiaoli Liu, Yong Fan, Yuan Zhang, Wanguo Xue, Lixin Xie, Leo Anthony Celi, Zhengbo Zhang. Originally published in JMIR Medical Informatics (http://medinform.jmir.org), 14.11.2017.

  18. Dark matter relics and the expansion rate in scalar-tensor theories

    Energy Technology Data Exchange (ETDEWEB)

    Dutta, Bhaskar; Jimenez, Esteban [Mitchell Institute for Fundamental Physics and Astronomy, Department of Physics and Astronomy, Texas A and M University, College Station, TX 77843 (United States); Zavala, Ivonne, E-mail: dutta@physics.tamu.edu, E-mail: este1985@physics.tamu.edu, E-mail: e.i.zavalacarrasco@swansea.ac.uk [Department of Physics, Swansea University, Singleton Park, Swansea, SA2 8PP (United Kingdom)

    2017-06-01

    We study the impact of a modified expansion rate on the dark matter relic abundance in a class of scalar-tensor theories. The scalar-tensor theories we consider are motivated from string theory constructions, which have conformal as well as disformally coupled matter to the scalar. We investigate the effects of such a conformal coupling to the dark matter relic abundance for a wide range of initial conditions, masses and cross-sections. We find that exploiting all possible initial conditions, the annihilation cross-section required to satisfy the dark matter content can differ from the thermal average cross-section in the standard case. We also study the expansion rate in the disformal case and find that physically relevant solutions require a nontrivial relation between the conformal and disformal functions. We study the effects of the disformal coupling in an explicit example where the disformal function is quadratic.

  19. A Study on Expression and Tyrosine 705 phosphorylation of STAT3 ...

    African Journals Online (AJOL)

    Fas- and Bcl-2-positive cells counts on the one hand, and apoptosis-positive nerve cells count in IP and. IC, on the ..... Chen Z, Li L, Mo X, Zhang L, Xie Y, Guo Q, Wang Y. Non-invasive ... Du W, Hong J, Wang YC, Zhang YJ, Wang P, Su YW,. Lin YW, Lu R, ... Jo M, Park MH, Kollipara PS, An BJ, Song HS, Han SB,. Kim JH ...

  20. Distribution of genes associated with yield potential and water ...

    Indian Academy of Sciences (India)

    on the FMs related to yield and water saving in wheat. Till date, six loci ..... Hu Y., Moiwo J. P., Yang Y., Han S. and Yang Y. 2010 Agricul- tural water-saving ... Lyu L., Hu Y., Li Y. and Wang P. 2007 Effect of irrigation treatment on water use ... Zhang Y. J., Fan P. S., Zhang X., Chen C. J. and Zhou M. G. 2009. Quantification of ...

  1. Electrospun Fibers for Composites Applications

    Science.gov (United States)

    2014-02-01

    in traditional woven mat composites. Nanofibrous interlayers were used to increase the impact and shear performance of a prepregged carbon fiber...Nylon 66 Nanofibrilmat Interleaved Carbon/Epoxy Laminates . Polymer Composites 2011, 32, 1781–1789. 21 13. Chen, Q.; Zhang, L.; Rahman, A.; Zhou...Resistance in Laminated Composites With Electrospun Nano-Interlayers. Comp. Sci. Tech. 2008, 68, 673– 683. 15. Zhang, J.; Lin, T.; Wang, X. Electrospun

  2. Handbook on advanced design and manufacturing technologies for biomedical devices

    CERN Document Server

    2013-01-01

    The last decades have seen remarkable advances in computer-aided design, engineering and manufacturing technologies, multi-variable simulation tools, medical imaging, biomimetic design, rapid prototyping, micro and nanomanufacturing methods and information management resources, all of which provide new horizons for the Biomedical Engineering fields and the Medical Device Industry. Handbook on Advanced Design and Manufacturing Technologies for Biomedical Devices covers such topics in depth, with an applied perspective and providing several case studies that help to analyze and understand the key factors of the different stages linked to the development of a novel biomedical device, from the conceptual and design steps, to the prototyping and industrialization phases. Main research challenges and future potentials are also discussed, taking into account relevant social demands and a growing market already exceeding billions of dollars. In time, advanced biomedical devices will decisively change methods and resu...

  3. X-ray fluorescence in investigations of cultural relics and archaeological finds

    Energy Technology Data Exchange (ETDEWEB)

    Musilek, Ladislav, E-mail: musilek@fjfi.cvut.cz [Czech Technical University in Prague, Faculty of Nuclear Sciences and Physical Engineering, Brehova 7, 115 19 Praha 1 (Czech Republic); Cechak, Tomas; Trojek, Tomas [Czech Technical University in Prague, Faculty of Nuclear Sciences and Physical Engineering, Brehova 7, 115 19 Praha 1 (Czech Republic)

    2012-07-15

    Some characteristic features of X-ray fluorescence (XRF) analysis make it an ideal method for investigations of cultural relics and archaeological finds. It has therefore become a standard method used in archaeometry. Paintings, frescos, manuscripts, pottery, metalwork, glass, and many other objects are analysed with the aim of recognising their materials, production technologies and origin, and for identifying counterfeits. This paper reviews various techniques used in XRF analyses of works of art, summarises the advantages and limitations of the method, and presents some typical examples of its use. The general review is supplemented by some techniques used and some results achieved at CTU-FNSPE in Prague. - Highlights: Black-Right-Pointing-Pointer Review of XRF analysis in archaeometry. Black-Right-Pointing-Pointer Instrumentation for XRF analysis with various sources of radiation. Black-Right-Pointing-Pointer Materials and artefacts, which can be measured and information, which can be obtained. Black-Right-Pointing-Pointer XRF analysis of artworks at the CTU Prague.

  4. Mechanical Behavior of Additive Manufactured Layered Materials, Part 2: Stainless Steels

    Science.gov (United States)

    2015-04-30

    materials. Elsevier, Oxford; 2007: 416 -420. [19] Deng, D., Chen, R., Sun, Q. and Li, X. Microstructural study of 17-4PH stainless steel after plasma...1 Mechanical Behavior of Additive Manufactured Layered Materials, Part 2: Stainless Steels * Todd M. Mower † and Michael J. Long M.I.T. Lincoln... stainless steel alloys produced with Direct Metal Laser Sintering (DMLS) was measured and is compared to that of similar conventional materials

  5. Cosmic selection rule for the glueball dark matter relic density

    Science.gov (United States)

    Soni, Amarjit; Xiao, Huangyu; Zhang, Yue

    2017-10-01

    We point out a unique mechanism to produce the relic abundance for the glueball dark matter from a gauged SU (N )d hidden sector which is bridged to the standard model sector through heavy vectorlike quarks colored under gauge interactions from both sides. A necessary ingredient of our assumption is that the vectorlike quarks, produced either thermally or nonthermally, are abundant enough to dominate the universe for some time in the early universe. They later undergo dark color confinement and form unstable vectorlike-quarkonium states which annihilate decay and reheat the visible and dark sectors. The ratio of entropy dumped into two sectors and the final energy budget in the dark glueballs is only determined by low energy parameters, including the intrinsic scale of the dark SU (N )d , Λd, and number of dark colors, Nd, but depend weakly on parameters in the ultraviolet such as the vectorlike quark mass or the initial condition. We call this a cosmic selection rule for the glueball dark matter relic density.

  6. Investigation of the technology of conductive yarns manufacturing

    Science.gov (United States)

    Ryklin, Dzmitry; Medvetski, Sergey

    2017-10-01

    The paper is devoted to development of technology of electrically conductive yarn production. This technology allows manufacturing conductive yarns of copper wire and polyester filament yarns. Method of the predicting of the conductive yarn breaking force was developed on the base of analysing of load-elongation curves of each strand of the yarn. Also the method of the predicting of the conductive yarn diameter was offered. Investigation shows that conductive yarns can be integrated into the textiles structure using sewing or embroidery equipment. Application of developed conductive yarn is wearable electronics creating with wide range of functions, for example, for specific health issue monitoring, navigation tools or communication gadgets.

  7. Critical parameters in the production of ceramic pot filters for household water treatment in developing countries.

    Science.gov (United States)

    Soppe, A I A; Heijman, S G J; Gensburger, I; Shantz, A; van Halem, D; Kroesbergen, J; Wubbels, G H; Smeets, P W M H

    2015-06-01

    The need to improve the access to safe water is generally recognized for the benefit of public health in developing countries. This study's objective was to identify critical parameters which are essential for improving the performance of ceramic pot filters (CPFs) as a point-of-use water treatment system. Defining critical production parameters was also relevant to confirm that CPFs with high-flow rates may have the same disinfection capacity as pots with normal flow rates. A pilot unit was built in Cambodia to produce CPFs under controlled and constant conditions. Pots were manufactured from a mixture of clay, laterite and rice husk in a small-scale, gas-fired, temperature-controlled kiln and tested for flow rate, removal efficiency of bacteria and material strength. Flow rate can be increased by increasing pore sizes and by increasing porosity. Pore sizes were increased by using larger rice husk particles and porosity was increased with larger proportions of rice husk in the clay mixture. The main conclusions: larger pore size decreases the removal efficiency of bacteria; higher porosity does not affect the removal efficiency of bacteria, but does influence the strength of pots; flow rates of CPFs can be raised to 10-20 L/hour without a significant decrease in bacterial removal efficiency.

  8. The radio relics and halo of El Gordo, a massive z = 0.870 cluster merger

    Energy Technology Data Exchange (ETDEWEB)

    Lindner, Robert R.; Baker, Andrew J.; Hughes, John P. [Rutgers, The State University of New Jersey, 136 Frelinghuysen Road, Piscataway, NJ 08854-8019 (United States); Battaglia, Nick [McWilliams Center for Cosmology, Wean Hall, Carnegie Mellon University, 5000 Forbes Ave., Pittsburgh, PA 15213 (United States); Gupta, Neeraj [ASTRON, the Netherlands Institute for Radio Astronomy, Postbus 2, 7990 AA Dwingeloo (Netherlands); Knowles, Kenda; Moodley, Kavilan [Astrophysics and Cosmology Research Unit, University of KwaZulu-Natal, Durban 4041 (South Africa); Marriage, Tobias A. [Department of Physics and Astronomy, Johns Hopkins University, 3400 North Charles Street, Baltimore, MD 21218-2686 (United States); Menanteau, Felipe [National Center for Supercomputing Applications, University of Illinois at Urbana-Champaign, 1205 W. Clark St., Urbana, IL 61801 (United States); Reese, Erik D. [Department of Physics and Astronomy, University of Pennsylvania, 209 South 33rd St., Philadelphia, PA 19104 (United States); Srianand, Raghunathan, E-mail: rlindner@astro.wisc.edu [IUCAA, Ganeshkhind, Pune 411007 (India)

    2014-05-01

    We present 610 MHz and 2.1 GHz imaging of the massive Sunyaev-Zel'dovich Effect selected z = 0.870 cluster merger ACT-CL J0102–4915 ({sup E}l Gordo{sup )}, obtained with the Giant Metrewave Radio Telescope and the Australia Telescope Compact Array (ATCA), respectively. We detect two complexes of radio relics separated by 3.'4 (1.6 Mpc) along the system's northwest-to-southeast collision axis that have high integrated polarization fractions (33%) and steep spectral indices (α between 1 and 2; S {sub ν}∝ν{sup –α}), consistent with creation via Fermi acceleration by shocks in the intracluster medium triggered by the cluster collision. From the spectral index of the relics, we compute a Mach number M=2.5{sub −0.3}{sup +0.7} and shock speed of 2500{sub −300}{sup +400} km s{sup −1}. With our wide-bandwidth, full-polarization ATCA data, we compute the Faraday depth φ across the northwest relic and find a range of values spanning Δφ = 30 rad m{sup –2}, with a mean value of (φ) = 11 rad m{sup –2} and standard deviation σ{sub φ} = 6 rad m{sup –2}. With the integrated line-of-sight gas density derived from new Chandra X-ray observations, our Faraday depth measurement implies B {sub ∥} ∼ 0.01 μG in the cluster outskirts. The extremely narrow shock widths in the relics (d {sub shock} ≤ 23 kpc), caused by the short synchrotron cooling timescale of relativistic electrons at z = 0.870, prevent us from placing a meaningful constraint on the magnetic field strength B using cooling time arguments. In addition to the relics, we detect a large (r {sub H} ≅ 1.1 Mpc radius), powerful (log (L {sub 1.4}/W Hz{sup –1}) = 25.66 ± 0.12) radio halo with a shape similar to El Gordo's 'bullet'-like X-ray morphology. The spatially resolved spectral-index map of the halo shows the synchrotron spectrum is flattest near the relics, along the system's collision axis, and in regions of high T {sub gas}, all locations associated

  9. Ultra-cold WIMPs relics of non-standard pre-BBN cosmologies

    CERN Document Server

    Gelmini, Graciela B

    2008-01-01

    We point out that in scenarios in which the Universe evolves in a non-standard manner during and after the kinetic decoupling of weakly interacting massive particles (WIMPs), these relics can be much colder than in standard cosmological scenarios (i.e. can be ultra-cold), possibly leading to the formation of smaller first objects in hierarchical structure formation scenarios.

  10. Dusty Relic to Shining Treasure: Embedded in a Multicultural Environment

    Science.gov (United States)

    Avery, Beth Fuseler; Batman, Cindy

    2014-01-01

    Far from being dusty old relics who are guardians of the book, embedded librarians need to be proactively leading students through the digital maze of the virtual library. Working with students more than 7,000 miles away changed perceptions of how to teach and learn, and how people interact online. We will share how as embedded librarians we…

  11. Theorizing about technological development of manufacturing companies

    DEFF Research Database (Denmark)

    Matthiesen, Rikke Vestergaard

    2012-01-01

    The aim of the paper is to apply metatriangulation and theory building to strengthen our theorizing on technological development of manufacturing firms. AMT literature is reviewed and by means of bracketing, the paper identifies a set of problematic assumptions embedded within traditional AMT...... research. A case study is used to emphasize how a process perspective enriches the traditional structural perspective. Finally, through first attempts at theory building, a set of propositions is suggested in order to overcome long-standing problems found in AMT research....

  12. STRUCTURAL ALTERNATIVES OF RUSSIAN MANUFACTURING INDUSTRIES AND ARCHITECTURE OF TECHNOLOGICAL MODERNIZATION. PART 1

    Directory of Open Access Journals (Sweden)

    Izryadnova O. I.

    2014-06-01

    Full Text Available Continuing stagnation in the Russian economy makes a compelling case for structural reforms and transition to new technologies in non-financial sector. Given the backdrop of investor choice to wait out the situation and pause their investments, stagnation threatens to remain for longer. The biggest concerns are related to the slowdown in the range of high-tech non-resource manufacturing industries. These industries should become the cornerstone to foster the development of scientific, technical, and innovative potential of the country, overcoming the technical deficit, and implementation of modern technologies of the sixth technological generation. The article assesses the place and role of manufacturing industries in Russia’s economy and presents an analysis of dynamic shifts in their structure during the business cycle. The article demonstrates the results of empirical study of monitoring of innovative receptiveness of manufacturing industries. We discuss the directions of expanded cooperation between business and state. We also outline opportunities for correcting policies and tools directed at activating innovative functioning of the manufacturing sector in the view of the growth of geopolitical tensions, forms and methods of effective institutional management of the modernization of business units. It appears that the issues of investment maneuver to single out some types of economic activities, which manufacture products and services with high added value and increasing competitiveness of the Russian economy, call for the change in the model of economic development.

  13. STRUCTURAL ALTERNATIVES OF RUSSIAN MANUFACTURING INDUSTRIES AND ARCHITECTURE OF TECHNOLOGICAL MODERNIZATION. PART 2

    Directory of Open Access Journals (Sweden)

    Izryadnova O. I.

    2014-09-01

    Full Text Available Continuing stagnation in the Russian economy makes a compelling case for structural reforms and transition to new technologies in non-financial sector. Given the backdrop of investor choice to wait out the situation and pause their investments, stagnation threatens to remain for longer. The biggest concerns are related to the slowdown in the range of high-tech non-resource manufacturing industries. These industries should become the cornerstone to foster the development of scientific, technical, and innovative potential of the country, overcoming the technical deficit, and implementation of modern technologies of the sixth technological generation. The article assesses the place and role of manufacturing industries in Russia’s economy and presents an analysis of dynamic shifts in their structure during the business cycle. The article demonstrates the results of empirical study of monitoring of innovative receptiveness of manufacturing industries. We discuss the directions of expanded cooperation between business and state. We also outline opportunities for correcting policies and tools directed at activating innovative functioning of the manufacturing sector in the view of the growth of geopolitical tensions, forms and methods of effective institutional management of the modernization of business units. It appears that the issues of investment maneuver to single out some types of economic activities, which manufacture products and services with high added value and increasing competitiveness of the Russian economy, call for the change in the model of economic development.

  14. 5th International and 26th All India Manufacturing Technology, Design and Research Conference

    CERN Document Server

    Dixit, Uday

    2015-01-01

    This book presents selected research papers of the AIMTDR 2014 conference on application of laser technology for various manufacturing processes such as cutting, forming, welding, sintering, cladding and micro-machining. State-of-the-art of these technologies in terms of numerical modeling, experimental studies and industrial case studies are presented. This book will enrich the knowledge of budding technocrats, graduate students of mechanical and manufacturing engineering, and researchers working in this area.  

  15. Achieving continuous manufacturing: technologies and approaches for synthesis, workup, and isolation of drug substance. May 20-21, 2014 Continuous Manufacturing Symposium.

    Science.gov (United States)

    Baxendale, Ian R; Braatz, Richard D; Hodnett, Benjamin K; Jensen, Klavs F; Johnson, Martin D; Sharratt, Paul; Sherlock, Jon-Paul; Florence, Alastair J

    2015-03-01

    This whitepaper highlights current challenges and opportunities associated with continuous synthesis, workup, and crystallization of active pharmaceutical ingredients (drug substances). We describe the technologies and requirements at each stage and emphasize the different considerations for developing continuous processes compared with batch. In addition to the specific sequence of operations required to deliver the necessary chemical and physical transformations for continuous drug substance manufacture, consideration is also given to how adoption of continuous technologies may impact different manufacturing stages in development from discovery, process development, through scale-up and into full scale production. The impact of continuous manufacture on drug substance quality and the associated challenges for control and for process safety are also emphasized. In addition to the technology and operational considerations necessary for the adoption of continuous manufacturing (CM), this whitepaper also addresses the cultural, as well as skills and training, challenges that will need to be met by support from organizations in order to accommodate the new work flows. Specific action items for industry leaders are: Develop flow chemistry toolboxes, exploiting the advantages of flow processing and including highly selective chemistries that allow use of simple and effective continuous workup technologies. Availability of modular or plug and play type equipment especially for workup to assist in straightforward deployment in the laboratory. As with learning from other industries, standardization is highly desirable and will require cooperation across industry and academia to develop and implement. Implement and exploit process analytical technologies (PAT) for real-time dynamic control of continuous processes. Develop modeling and simulation techniques to support continuous process development and control. Progress is required in multiphase systems such as

  16. Advantage Management Strategy in Competition via Technological Race Perspective: Empirical Evidence from the Taiwanese Manufacturing Industry

    OpenAIRE

    Tsu-Yi Hung; Yu-Ju Hsiao; Shih-Wei Wu

    2014-01-01

    This study investigated the advantage management strategies of a firm regarding the technological race in the manufacturing sector. This is to reveal whether firms adopt a catch-up or leapfrogging strategy in the competition for innovation. The results show that competition is fierce in the Taiwanese manufacturing industry. Taiwanese manufacturing firms (mostly SMEs) tend to adopt the “catch-up” strategy to keep up with their competitors in order to remain in the technological race. The resu...

  17. The Environmental Impact of Advanced Manufacturing Technologies: Examples from Hungary

    Directory of Open Access Journals (Sweden)

    Andrea Szalavetz

    2017-06-01

    Full Text Available The purpose of the paper is to demonstrate the beneficial impact of advanced manufacturing technologies (AMT on firms’ environmental performance. Drawing on interviews conducted with 16 Hungarian manufacturing subsidiaries on their experience with AMT, we find three functional areas, where industry 4.0 solutions can not only enhance operational excellence and cost-efficiency, but they can also improve eco-efficiency, but they can also improve eco-efficiency, namely in the field of quality management (through smart production control, data analytics and predictive modelling solutions; process optimization (through capacity planning and production scheduling solutions; and product and process engineering (through advanced virtual technologies. We also find that AMT adoption facilitated subsidiary upgrading along various dimensions. The main managerial implication is that subsidiaries need to be proactive, and emphasize also the benefits stemming from energy and resource efficiency improvement when lobbying for investment in AMT.

  18. Duo_2-Steel cermet manufacturing technology for PWR Spent Nuclear Fuel (SNF) casks

    International Nuclear Information System (INIS)

    Siti Alimah; Budiarto

    2005-01-01

    Assessment of DUO_2-Steel cermet manufacturing technology for PWR SNF casks has been done. DUO_2-Steel cermet consisting of DUO_2 particulates and other particulates, embedded in a steel matrix. Cermet SNF casks have the potential for superior performance compared with casks constructed of other materials. The addition of DUO_2 ceramic particulates can increase SNF cask capacity, improve of repository performance and disposal of excess depleted uranium as potential waste. Two sets of cermet manufacturing technologies are casting and powder metallurgy. Three casting methods are infusion casting, traditional casting and centrifugal casting. While for powder metallurgy methods there are traditional method and new method. DUO_2-Steel cermet have traditionally been produced by powder metallurgy methods. The production of a cask, however, presents special requirements: the manufacture of an annular object with weights up to 100 tons, and methods are being not to manufacture a cermet of this size and geometry. A new powder metallurgy method, is a method for manufacturing cermet for PWR SNF cask. This powder metallurgy techniques have potentials low costs and provides greater freedom In the design of the cermet cask by allowing variable cermet properties. (author)

  19. Hong et al., Afr J Tradit Complement Altern Med. (2013) 10(4):66-69 ...

    African Journals Online (AJOL)

    AJTCAM

    inflammation, annex inflammation, uterine prolapse, and neurasthenia. .... Research progress on pharmacological effects of Bidens bipinnata L. China Pharmacy. ... Clinic. 24 (3): 147-149. 8. Wang, Q., Zhang Y.N., Chen F.H. (2009). Research ...

  20. Aspects regarding manufacturing technologies of composite materials for brake pad application

    Science.gov (United States)

    Craciun, A. L.; Hepuţ, T.; Pinca-Bretotean, C.

    2018-01-01

    Current needs in road safety, requires the development of new technical solutions for automotive braking system. Their safe operation is subject to following factors: concept design, materials used and electronic control. Among the factors previously listed, choice of materials and manufacturing processes are difficult stage but very important for achieving technical performance and getting a relatively small cost of constituting parts of brake system. The choice is based on the promotion of organic composite material, popular in areas where the weight of materials plays an important role. The brake system is composed of many different parts including brake pads, a master cylinder, wheel cylinders and a hydraulic control system. The brake pads are an important component in the braking system of automotive. These are of different types, suitable for different types of automotive and engines. Brake pads are designed for friction stability, durability, minimization of noise and vibration. The typology of the brake pads depends on the material which they are made. The aim of this paper is to presents the manufacturing technologies for ten recipes of composite material used in brake pads applications. In this work will be done: choosing the constituents of the recipes, investigation of their basic characteristics, setting the proportions of components, obtaining the composite materials in laboratory, establishing the parameters of manufacturing technology and technological analysis.

  1. Hydrothermal growth of ZnO nanoflowers and their photocatalyst ...

    Indian Academy of Sciences (India)

    JINCHENG FAN1,∗, TENGFEI LI1 and HANG HENG2,3. 1School of Materials ... In this paper, the fabrication of ZnO nanoflowers on Si substrate by the ..... [21] Bae J, Han J B, Zhang X-M, Wei M, Duan X, Zhang Y and. Wang Z L 2009 J. ... 142 570. [31] Sun Y J, Wang L, Yu X G and Chen K Z 2012 CrystEngComm. 14 3199.

  2. Robustness analysis of the Zhang neural network for online time-varying quadratic optimization

    International Nuclear Information System (INIS)

    Zhang Yunong; Ruan Gongqin; Li Kene; Yang Yiwen

    2010-01-01

    A general type of recurrent neural network (termed as Zhang neural network, ZNN) has recently been proposed by Zhang et al for the online solution of time-varying quadratic-minimization (QM) and quadratic-programming (QP) problems. Global exponential convergence of the ZNN could be achieved theoretically in an ideal error-free situation. In this paper, with the normal differentiation and dynamics-implementation errors considered, the robustness properties of the ZNN model are investigated for solving these time-varying problems. In addition, linear activation functions and power-sigmoid activation functions could be applied to such a perturbed ZNN model. Both theoretical-analysis and computer-simulation results demonstrate the good ZNN robustness and superior performance for online time-varying QM and QP problem solving, especially when using power-sigmoid activation functions.

  3. Development of materials and manufacturing technologies for Indian fast reactor programme

    International Nuclear Information System (INIS)

    Raj, Baldev; Jayakumar, T.; Bhaduri, A.K.; Mandal, Sumantra

    2010-01-01

    Fast Breeder Reactors (FBRs) are vital towards meeting security and sustainability of energy for the growing economy of India. The development of FBRs necessitates extensive research and development in domains of materials and manufacturing technologies in association with a wide spectrum of disciplines and their inter-twining to meet the challenging technology. The paper highlight the work and the approaches adopted for the successful deployment of materials, manufacturing and inspection technologies for the in-core and structural components of current and future Indian Fast Breeder Reactor Programme. Indigenous development of in-core materials viz. Titanium modified austenitic stainless steel (Alloy D9) and its variants, ferritic/martensitic oxide-dispersion strengthened (ODS) steels as well as structural materials viz. 316L(N) stainless steel and modified 9Cr-1Mo have been achieved through synergistic interactions between Indira Gandhi Centre for Atomic Research (IGCAR), education and research institutes and industries. Robust manufacturing technology has been established for forming and joining of various components of 500 MWe Prototype Fast Breeder Reactor (PFBR) through 'science-based technology' approach. To achieve the strict quality standards of formed parts in terms of geometrical tolerances, residual stresses and microstructural defects, FEM-based modelling and experimental validation was carried out for estimation of spring-back during forming of multiple curvature thick plantes. Optimization of grain boundary character distribution in Alloy D9 was carried out by adopting the grain boundary engineering approach to reduce radiation induced segregation. Extensive welding is involved in the fabrication of reactor vessels, piping, steam generators, fuel sub-assemblies etc. Activated Tungsten Inert Gas Welding process along with activated flux developed at IGCAR has been successfully used in fabrication of dummy fuel subassemblies (DFSA) required for testing

  4. Development of materials and manufacturing technologies for Indian fast reactor programme

    Energy Technology Data Exchange (ETDEWEB)

    Raj, Baldev; Jayakumar, T.; Bhaduri, A.K.; Mandal, Sumantra [Indira Gandhi Centre for Atomic Research, Kalpakkam (India)

    2010-07-01

    Fast Breeder Reactors (FBRs) are vital towards meeting security and sustainability of energy for the growing economy of India. The development of FBRs necessitates extensive research and development in domains of materials and manufacturing technologies in association with a wide spectrum of disciplines and their inter-twining to meet the challenging technology. The paper highlight the work and the approaches adopted for the successful deployment of materials, manufacturing and inspection technologies for the in-core and structural components of current and future Indian Fast Breeder Reactor Programme. Indigenous development of in-core materials viz. Titanium modified austenitic stainless steel (Alloy D9) and its variants, ferritic/martensitic oxide-dispersion strengthened (ODS) steels as well as structural materials viz. 316L(N) stainless steel and modified 9Cr-1Mo have been achieved through synergistic interactions between Indira Gandhi Centre for Atomic Research (IGCAR), education and research institutes and industries. Robust manufacturing technology has been established for forming and joining of various components of 500 MWe Prototype Fast Breeder Reactor (PFBR) through 'science-based technology' approach. To achieve the strict quality standards of formed parts in terms of geometrical tolerances, residual stresses and microstructural defects, FEM-based modelling and experimental validation was carried out for estimation of spring-back during forming of multiple curvature thick plantes. Optimization of grain boundary character distribution in Alloy D9 was carried out by adopting the grain boundary engineering approach to reduce radiation induced segregation. Extensive welding is involved in the fabrication of reactor vessels, piping, steam generators, fuel sub-assemblies etc. Activated Tungsten Inert Gas Welding process along with activated flux developed at IGCAR has been successfully used in fabrication of dummy fuel subassemblies (DFSA) required

  5. Development of technology and properties investigation of steel/bronze joints proposed for ITER HHF components manufacturing

    International Nuclear Information System (INIS)

    Kalinin, G.; Krestnikov, N.S.; Strebkov, Y.S.; Abramov, V.Y.; Gervash, A.; Mazul, I.; Zolotarev, V.B.; Fabritsiev, S.A.

    2007-01-01

    Full text of publication follows: During the development of ITER HHF components manufacturing it is necessary to provide reliable joints between heat sink material made of CuCrZr bronze and the supporting construction made of austenitic steel. Four different methods have been tried out: - Hot Isostatic Pressing (HIP), - HIP assisted brazing, - furnace assisted brazing, - Casting. The investigation of structure and properties of joints show that HIP and casting provide the better results than the other technologies. However, HIP is relatively expensive technology, and big size HIP furnace is required for the full scale components manufacturing that are not available n RF now. Therefore, casting was selected as a reference manufacturing technology for the primary wall of ITER modules n RF. The paper summarizes the results of bronze/steel joints manufacturing and investigation of their properties. (authors)

  6. Current state-of-the-art manufacturing technology for He-cooled divertor finger

    Science.gov (United States)

    Norajitra, P.; Antusch, S.; Giniyatulin, R.; Mazul, I.; Ritz, G.; Ritzhaupt-Kleissl, H.-J.; Spatafora, L.

    2011-10-01

    A divertor concept for DEMO has been investigated at Karlsruhe Institute of Technology (KIT) which has to withstand a heat flux of 10 MW/m 2. The design utilizes small finger module composed of a small tungsten tile brazed on a thimble made from tungsten alloy. The divertor finger is cooled by helium jet impingement at 10 MPa and 600 °C. The subject of this paper is technological studies on machining and braze joining the divertor components. Goal of this task, which is considered an important R&D issue, is to find out appropriate manufacturing methods to ensure high functionality and high reliability of the divertor as well as to meet the economic aspect. One of the major requirements for manufacturing is micro-crack-free surface of tungsten parts, since crack propagations in tungsten were observed in the previous high-heat-flux tests at Efremov. Different manufacturing methods and the corresponding results are discussed in the following report.

  7. The Adoption of Additive Manufacturing Technology in Sweden

    OpenAIRE

    Kianian, Babak; Tavassoli, Sam; Larsson, Tobias; Diegel, Olaf

    2015-01-01

    This article analyzes the adoption of additive manufacturing (AM) technologies in Sweden. The data set consists of a recent and representative sample of Swedish AM users (companies, universities, and research institutes). The authors investigate two questions. First, what are the current applications of AM in Sweden (e.g., rapid prototyping [RP], production)? Second, what are the factors that can explain the variation in AM adoption among the users? Using a regression analysis technique, the ...

  8. Advantage Management Strategy in Competition via Technological Race Perspective: Empirical Evidence from the Taiwanese Manufacturing Industry

    Directory of Open Access Journals (Sweden)

    Tsu-Yi Hung

    2014-01-01

    Full Text Available This study investigated the advantage management strategies of a firm regarding the technological race in the manufacturing sector. This is to reveal whether firms adopt a catch-up or leapfrogging strategy in the competition for innovation. The results show that competition is fierce in the Taiwanese manufacturing industry. Taiwanese manufacturing firms (mostly SMEs tend to adopt the “catch-up” strategy to keep up with their competitors in order to remain in the technological race. The result indicates that, under financial constraints, Taiwanese manufacturing firms attempt to invest in R&D to catch up with their rivals or to avoid being eliminated from the race.

  9. Advantage management strategy in competition via technological race perspective: empirical evidence from the Taiwanese manufacturing industry.

    Science.gov (United States)

    Hung, Tsu-Yi; Hsiao, Yu-Ju; Wu, Shih-Wei

    2014-01-01

    This study investigated the advantage management strategies of a firm regarding the technological race in the manufacturing sector. This is to reveal whether firms adopt a catch-up or leapfrogging strategy in the competition for innovation. The results show that competition is fierce in the Taiwanese manufacturing industry. Taiwanese manufacturing firms (mostly SMEs) tend to adopt the "catch-up" strategy to keep up with their competitors in order to remain in the technological race. The result indicates that, under financial constraints, Taiwanese manufacturing firms attempt to invest in R&D to catch up with their rivals or to avoid being eliminated from the race.

  10. Advantage Management Strategy in Competition via Technological Race Perspective: Empirical Evidence from the Taiwanese Manufacturing Industry

    Science.gov (United States)

    Hung, Tsu-Yi; Hsiao, Yu-Ju; Wu, Shih-Wei

    2014-01-01

    This study investigated the advantage management strategies of a firm regarding the technological race in the manufacturing sector. This is to reveal whether firms adopt a catch-up or leapfrogging strategy in the competition for innovation. The results show that competition is fierce in the Taiwanese manufacturing industry. Taiwanese manufacturing firms (mostly SMEs) tend to adopt the “catch-up” strategy to keep up with their competitors in order to remain in the technological race. The result indicates that, under financial constraints, Taiwanese manufacturing firms attempt to invest in R&D to catch up with their rivals or to avoid being eliminated from the race. PMID:25295307

  11. COMMERCIAL DEMONSTRATION OF THE MANUFACTURED AGGREGATE PROCESSING TECHNOLOGY UTILIZING SPRAY DRYER ASH

    Energy Technology Data Exchange (ETDEWEB)

    Roy Scandrol

    2003-10-01

    Universal Aggregates, LLC proposes to design, construct and operate a lightweight aggregate manufacturing plant at the Birchwood Power Facility in King George, Virginia. The installation and start-up expenses for the Birchwood Aggregate Facility are $19.5 million. The DOE share is $7.2 million (37%) and the Universal Aggregates share is $12.3 (63%). The project team consists of CONSOL Energy Inc., P.J. Dick, Inc., SynAggs, LLC, and Universal Aggregates, LLC. The Birchwood Facility will transform 115,000 tons per year of spray dryer by-products that are currently being disposed of in an offsite landfill into 167,000 tons of a useful product, lightweight aggregates that can be used to manufacture lightweight aggregates that can be used to manufacture lightweight and medium weight masonry blocks. In addition to the environmental benefits, the Birchwood Facility will create nine (9) manufacturing jobs plus additional employment in the local trucking industry to deliver the aggregate to customers or reagents to the facility. A successful demonstration would lead to additional lightweight aggregate manufacturing facilities in the United States. There are currently twenty-one (21) spray dryer facilities operating in the United States that produce an adequate amount of spray dryer by-product to economically justify the installation of a lightweight aggregate manufacturing facility. Industry sources believe that as additional scrubbing is required, dry FGD technologies will be the technology of choice. Letters from potential lightweight aggregate customers indicate that there is a market for the product once the commercialization barriers are eliminated by this demonstration project.

  12. COMMERCIAL DEMONSTRATION OF THE MANUFACTURED AGGREGATE PROCESSING TECHNOLOGY UTILIZING SPRAY DRYER ASH

    Energy Technology Data Exchange (ETDEWEB)

    Roy Scandrol

    2003-04-01

    Universal Aggregates, LLC proposes to design, construct and operate a lightweight aggregate manufacturing plant at the Birchwood Power Facility in King George, Virginia. The installation and start-up expenses for the Birchwood Aggregate Facility are $19.5 million. The DOE share is $7.2 million (37%) and the Universal Aggregates share is $12.3 (63%). The project team consists of CONSOL Energy Inc., P.J. Dick, Inc., SynAggs, LLC, and Universal Aggregates, LLC. The Birchwood Facility will transform 115,000 tons per year of spray dryer by-products that are currently being disposed of in an offsite landfill into 167,000 tons of a useful product, lightweight aggregates that can be used to manufacture lightweight aggregates that can be used to manufacture lightweight and medium weight masonry blocks. In addition to the environmental benefits, the Birchwood Facility will create eight (8) manufacturing jobs plus additional employment in the local trucking industry to deliver the aggregate to customers or reagents to the facility. A successful demonstration would lead to additional lightweight aggregate manufacturing facilities in the United States. There are currently twenty-one (21) spray dryer facilities operating in the United States that produce an adequate amount of spray dryer by-product to economically justify the installation of a lightweight aggregate manufacturing facility. Industry sources believe that as additional scrubbing is required, dry flue gas desulfurization (FGD) technologies will be the technology of choice. Letters from potential lightweight aggregate customers indicate that there is a market for the product once the commercialization barriers are eliminated by this demonstration project.

  13. Cosmological constraints on the amplitude of relic gravitational waves

    International Nuclear Information System (INIS)

    Novosyadlij, B.; Apunevich, S.

    2005-01-01

    The evolution of the amplitude of relic gravitational waves (RGW) generated in early Universe has been analyzed. The analytical approximation is presented for angular power spectrum of cosmic microwave background anisotropies caused by gravitational waves through Sachs-Wolfe effect. The estimate of the most probable value for this amplitude was obtained on the basis of observation data on cosmic microwave background anisotropies from COBE, WMAP and BOOMERanG experiments along with large-scale structure observations

  14. Cladding tube manufacturing technology

    International Nuclear Information System (INIS)

    Hahn, R.; Jeong, Y. H.; Baek, B. J.; Kim, K. H.; Kim, S. J.; Choi, B. K.; Kim, J. M.

    1999-04-01

    This report gives an overview of the manufacturing routine of PWR cladding tubes. The routine essentially consists of a series of deformation and annealing processes which are necessary to transform the ingot geometry to tube dimensions. By changing shape, microstructure and structure-related properties are altered simultaneously. First, a short overview of the basics of that part of deformation geometry is given which is related to tube reducing operations. Then those processes of the manufacturing routine which change the microstructure are depicted, and the influence of certain process parameters on microstructure and material properties are shown. The influence of the resulting microstructure on material properties is not discussed in detail, since it is described in my previous report A lloy Development for High Burnup Cladding . Because of their paramount importance still up to now, and because manufacturing data and their influence on properties for other alloys are not so well established or published, the descriptions are mostly related to Zry4 tube manufacturing, and are only in short for other alloys. (author). 9 refs., 46 figs

  15. Cladding tube manufacturing technology

    Energy Technology Data Exchange (ETDEWEB)

    Hahn, R. [Kraftwerk Union AG, Mulheim (Germany); Jeong, Y.H.; Baek, B.J.; Kim, K.H.; Kim, S.J.; Choi, B.K.; Kim, J.M. [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

    1999-04-01

    This report gives an overview of the manufacturing routine of PWR cladding tubes. The routine essentially consists of a series of deformation and annealing processes which are necessary to transform the ingot geometry to tube dimensions. By changing shape, microstructure and structure-related properties are altered simultaneously. First, a short overview of the basics of that part of deformation geometry is given which is related to tube reducing operations. Then those processes of the manufacturing routine which change the microstructure are depicted, and the influence of certain process parameters on microstructure and material properties are shown. The influence of the resulting microstructure on material properties is not discussed in detail, since it is described in my previous report 'Alloy Development for High Burnup Cladding.' Because of their paramount importance still up to now, and because manufacturing data and their influence on properties for other alloys are not so well established or published, the descriptions are mostly related to Zry4 tube manufacturing, and are only in short for other alloys. (author). 9 refs., 46 figs.

  16. Scalar modes of the relic gravitons

    CERN Document Server

    Giovannini, Massimo

    2015-01-01

    In conformally flat background geometries the long wavelength gravitons can be described in the fluid approximation and they induce scalar fluctuations both during inflation and in the subsequent radiation-dominated epoch. While this effect is minute and suppressed for a de Sitter stage of expansion, the fluctuations of the energy-momentum pseudo-tensor of the graviton fluid lead to curvature perturbations that increase with time all along the post-inflationary evolution. An explicit calculation of these effects is presented for a standard thermal history and it is shown that the growth of the curvature perturbations caused by the long wavelength modes is approximately compensated by the slope of the power spectra of the energy density, pressure and anisotropic stress of the relic gravitons.

  17. Short communication: Protection of lyophilized milk starter Lactobacillus casei Zhang by glutathione.

    Science.gov (United States)

    Zhang, Juan; Liu, Qian; Chen, Wei; Du, Guocheng; Chen, Jian

    2016-03-01

    Lyophilization is considered an effective way to preserve the activity of milk starters, such as lactic acid bacteria, in which proper protective agents play key roles. In this study, Lactobacillus casei Zhang, a probiotic bacterium applied as a milk starter in China, was used to investigate the effects of various cryoprotectants according to cell survival rate and physiological characteristics. The result showed a significant survival improvement to 86.6% when glutathione (GSH) was added as an ideal cryoprotectant. Further study revealed that GSH plays a key role on maintaining higher unsaturation ratio of cell membrane and shorter chain length of saturated fatty acids. In this case, the intact cell structure can be obtained. These findings will contribute not only to deepen the understanding of cells during lyophilization but also to improve the industrial performance of certain milk starters such as L. casei Zhang by application of GSH as cryoprotectant. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  18. MECHANICAL PROPERTIES OF PARTS OF MEDICAL PRODUCTS PRODUCED USING ADDITIVE MANUFACTURING TECHNOLOGIES

    Directory of Open Access Journals (Sweden)

    Filip Górski

    2017-06-01

    Full Text Available The paper presents results of tests conducted on the elements of medical devices - slings used with medical lifts - manufactured using additive technologies. Project assumptions were: to produce 100 samples of clips with varying design, material and orientation parameter. Samples were manufactured using FDM and SLA processes and then tested for mechanical strength, load transmission and functionality, using certified equipment. Paper shows full methodology and obtained test results.

  19. The transfer to technology to manufacture the disk of X-band accelerator structure

    International Nuclear Information System (INIS)

    Ueno, Kenji; Kawamata, Hiroshi; Takatomi, Toshikazu; Kume, Tatsuya; Funahashi, Yoshisato

    2005-01-01

    We research the transfer of manufacturing technology on X-band structure disks. From this issue we confirm that the venders will be able to manufacture disks when they get the process sheet method and drawings. More it is clear that we have to consider the automation process in order to get the repeatability of the disks. (author)

  20. Higgs enhancement for the dark matter relic density

    Science.gov (United States)

    Harz, Julia; Petraki, Kalliopi

    2018-04-01

    We consider the long-range effect of the Higgs on the density of thermal-relic dark matter. While the electroweak gauge boson and gluon exchange have been previously studied, the Higgs is typically thought to mediate only contact interactions. We show that the Sommerfeld enhancement due to a 125 GeV Higgs can deplete TeV-scale dark matter significantly and describe how the interplay between the Higgs and other mediators influences this effect. We discuss the importance of the Higgs enhancement in the minimal supersymmetric standard model and its implications for experiments.

  1. Measuring Manufacturing Innovativeness

    DEFF Research Database (Denmark)

    Blichfeldt, Henrik; Knudsen, Mette Præst

    2017-01-01

    Globalization and customization increases the pressure on manufacturing companies, and the ability to provide innovativeness is a potential source of competitive advantage. This paper positions the manufacturing entity in the innovation process, and investigates the relation between innovation vers...... technology and organizational concepts. Based on Danish survey data from the European Manufacturing Survey (EMS-2015) this paper finds that there is a relation between innovative companies, and their level of technology and use of organizational concepts. Technology and organizational concepts act...... as manufacturing levers to support the manufacturing and production system to provide innovativeness. The managerial implication lies in building manufacturing capabilities to support the innovative process, by standardization, optimization and creating stability in combination with automation and advanced...

  2. Honeycomb technology materials, design, manufacturing, applications and testing

    CERN Document Server

    Bitzer, Tom

    1997-01-01

    Honeycomb Technology is a guide to honeycomb cores and honeycomb sandwich panels, from the manufacturing methods by which they are produced, to the different types of design, applications for usage and methods of testing the materials. It explains the different types of honeycomb cores available and provides tabulated data of their properties. The author has been involved in the testing and design of honeycomb cores and sandwich panels for nearly 30 years. Honeycomb Technology reflects this by emphasizing a `hands-on' approach and discusses procedures for designing sandwich panels, explaining the necessary equations. Also included is a section on how to design honeycomb energy absorbers and one full chapter discussing honeycomb core and sandwich panel testing. Honeycomb Technology will be of interest to engineers in the aircraft, aerospace and building industries. It will also be of great use to engineering students interested in basic sandwich panel design.

  3. Fact Sheet for Friction Materials Manufacturing Facilities Residual Risk and Technology Review

    Science.gov (United States)

    proposed amendments to the National Emission Standards for Hazardous Air Pollutants (NESHAP) for Friction Materials Manufacturing Facilities to address the results of the residual risk and technology review

  4. High Throughput Manufacturing of Thin-Film CdTe Photovoltaic Materials; Final Subcontract Report, 16 November 1993-31 December 1998

    International Nuclear Information System (INIS)

    Sandwisch, D.W.

    1999-01-01

    This report describes work performed by Solar Cells, Inc. (SCI), during this Photovoltaic Manufacturing Technology (PVMaT) subcontract. Cadmium telluride (CdTe) is recognized as one of the leading materials for low-cost photovoltaic modules. SCI has developed this technology and is preparing to scale its pilot production capabilities to a multi-megawatt level. This four-phase PVMaT subcontract supports these efforts. The work was related to product definition, process definition, equipment engineering, and support programs development. In the area of product definition and demonstration, two products were specified and demonstrated-a grid-connected, frameless, high-voltage product that incorporates a pigtail potting design and a remote low-voltage product that may be framed and may incorporate a junction box. SCI produced a 60.3-W thin-film CdTe module with total-area efficiency of 8.4%; SCI also improved module pass rate on the interim qualification test protocol from less than 20% to 100% as a result of work related to the subcontract. In the manufacturing process definition area, the multi-megawatt manufacturing process was defined, several of the key processes were demonstrated, and the process was refined and proven on a 100-kW pilot line that now operates as a 250-kW line. In the area of multi-megawatt manufacturing-line conceptual design review, SCI completed a conceptual layout of the multi-megawatt lines. The layout models the manufacturing line and predicts manufacturing costs. SCI projected an optimized capacity, two-shift/day operation of greater than 25 MW at a manufacturing cost of below$1.00/W

  5. High Throughput Manufacturing of Thin-Film CdTe Photovoltaic Materials; Final Subcontract Report, 16 November 1993-31 December 1998

    Energy Technology Data Exchange (ETDEWEB)

    Sandwisch, D. W. (Solar Cells, Inc.)

    1999-09-02

    This report describes work performed by Solar Cells, Inc. (SCI), during this Photovoltaic Manufacturing Technology (PVMaT) subcontract. Cadmium telluride (CdTe) is recognized as one of the leading materials for low-cost photovoltaic modules. SCI has developed this technology and is preparing to scale its pilot production capabilities to a multi-megawatt level. This four-phase PVMaT subcontract supports these efforts. The work was related to product definition, process definition, equipment engineering, and support programs development. In the area of product definition and demonstration, two products were specified and demonstrated-a grid-connected, frameless, high-voltage product that incorporates a pigtail potting design and a remote low-voltage product that may be framed and may incorporate a junction box. SCI produced a 60.3-W thin-film CdTe module with total-area efficiency of 8.4%; SCI also improved module pass rate on the interim qualification test protocol from less than 20% to 100% as a result of work related to the subcontract. In the manufacturing process definition area, the multi-megawatt manufacturing process was defined, several of the key processes were demonstrated, and the process was refined and proven on a 100-kW pilot line that now operates as a 250-kW line. In the area of multi-megawatt manufacturing-line conceptual design review, SCI completed a conceptual layout of the multi-megawatt lines. The layout models the manufacturing line and predicts manufacturing costs. SCI projected an optimized capacity, two-shift/day operation of greater than 25 MW at a manufacturing cost of below $1.00/W.

  6. Wafer-level manufacturing technology of glass microlenses

    Science.gov (United States)

    Gossner, U.; Hoeftmann, T.; Wieland, R.; Hansch, W.

    2014-08-01

    In high-tech products, there is an increasing demand to integrate glass lenses into complex micro systems. Especially in the lighting industry LEDs and laser diodes used for automotive applications require encapsulated micro lenses. To enable low-cost production, manufacturing of micro lenses on wafer level base using a replication technology is a key technology. This requires accurate forming of thousands of lenses with a diameter of 1-2 mm on a 200 mm wafer compliant with mass production. The article will discuss the technical aspects of a lens manufacturing replication process and the challenges, which need to be solved: choice of an appropriate master for replication, thermally robust interlayer coating, choice of replica glass, bonding and separation procedure. A promising approach for the master substrate material is based on a lens structured high-quality glass wafer with high melting point covered by a coating layer of amorphous silicon or germanium. This layer serves as an interlayer for the glass bonding process. Low pressure chemical vapor deposition and plasma enhanced chemical vapor deposition processes allow a deposition of layer coatings with different hydrogen and doping content influencing their chemical and physical behavior. A time reduced molding process using a float glass enables the formation of high quality lenses while preserving the recyclability of the mother substrate. The challenge is the separation of the replica from the master mold. An overview of chemical methods based on optimized etching of coating layer through small channels will be given and the impact of glass etching on surface roughness is discussed.

  7. A review on recent technologies for the manufacture of pulmonary drugs.

    Science.gov (United States)

    Hadiwinoto, Gabriela Daisy; Lip Kwok, Philip Chi; Lakerveld, Richard

    2018-01-01

    This review discusses recent developments in the manufacture of inhalable dry powder formulations. Pulmonary drugs have distinct advantages compared with other drug administration routes. However, requirements of drugs properties complicate the manufacture. Control over crystallization to make particles with the desired properties in a single step is often infeasible, which calls for micronization techniques. Although spray drying produces particles in the desired size range, a stable solid state may not be attainable. Supercritical fluids may be used as a solvent or antisolvent, which significantly reduces solvent waste. Future directions include application areas such as biopharmaceuticals for dry powder inhalers and new processing strategies to improve the control over particle formation such as continuous manufacturing with in-line process analytical technologies.

  8. Lactobacillus casei Zhang and vitamin K2 prevent intestinal tumorigenesis in mice via adiponectin-elevated different signaling pathways.

    Science.gov (United States)

    Zhang, Yong; Ma, Chen; Zhao, Jie; Xu, Haiyan; Hou, Qiangchuan; Zhang, Heping

    2017-04-11

    The incidence of colon cancer has increased considerably and the intestinal microbiota participate in the development of colon cancer. We showed that the L. casei Zhang or vitamin K2 (Menaquinone-7) intervention significantly alleviated intestinal tumor burden in mice. This was associated with increased serum adiponectin levels in both treatments. But osteocalcin level was only increased by L. casei Zhang. Furthermore, the anti-carcinogenic actions of L. casei Zhang were mediated by hepatic Chloride channel-3(CLCN3)/Nuclear Factor Kappa B(NF-κB) and intestinal Claudin15/Chloride intracellular channel 4(CLIC4)/Transforming Growth Factor Beta(TGF-β) signaling, while the vitamin K2 effect involved a hepatic Vitamin D Receptor(VDR)-phosphorylated AMPK signaling pathway. Fecal DNA sequencing by the Pacbio RSII method revealed there was significantly lower Helicobacter apodemus, Helicobacter mesocricetorum, Allobaculum stercoricanis and Adlercreutzia equolifaciens following both interventions compared to the model group. Moreover, different caecum acetic acid and butyric acid levels and enrichment of other specific microbes also determined the activity of the different regulatory pathways. Together these data show that L. casei Zhang and Vitamin K2 can suppress gut risk microbes and promote beneficial microbial metabolites to reduce colonic tumor development in mice.

  9. Aldehyde Dehydrogenase 1 and Raf Kinase Inhibitor Protein ...

    African Journals Online (AJOL)

    Xiang-Xiu Sun1, Qing-Shan Ma2, Tian-Feng Liu1, Ying Chen1, Yan Dong1 and. Lin-Lin Zhang1* ... cancer was developed and studied by histological examination. Immunohistochemical and .... (diaminobenzidine) Kit. Western blot analysis.

  10. NGC 1277: A MASSIVE COMPACT RELIC GALAXY IN THE NEARBY UNIVERSE

    Energy Technology Data Exchange (ETDEWEB)

    Trujillo, Ignacio; Vazdekis, Alexandre [Instituto de Astrofísica de Canarias, c/Vía Láctea s/n, E-38205-La Laguna, Tenerife (Spain); Ferré-Mateu, Anna [Subaru Telescope, 650 North A' ohoku Place, Hilo, HI 96720 (United States); Balcells, Marc [Isaac Newton Group of Telescopes, E-38700 Santa Cruz de La Palma, Canary Islands (Spain); Sánchez-Blázquez, Patricia, E-mail: trujillo@iac.es [Departamento de Física Teórica, Universidad Autónoma de Madrid, E-28049, Cantoblanco, Madrid (Spain)

    2014-01-10

    As early as 10 Gyr ago, galaxies with more than 10{sup 11} M {sub ☉} of stars already existed. While most of these massive galaxies must have subsequently transformed through on-going star formation and mergers with other galaxies, a small fraction (≲0.1%) may have survived untouched until today. Searches for such relic galaxies, useful windows to explore the early universe, have been inconclusive to date: galaxies with masses and sizes like those observed at high redshift (M {sub *} ≳ 10{sup 11} M {sub ☉}; R{sub e} ≲ 1.5 kpc) have been found in the local universe, but their stars are far too young for the galaxy to be a relic galaxy. This paper explores the first case of a nearby galaxy, NGC 1277 (at a distance of 73 Mpc in the Perseus galaxy cluster), which fulfills many criteria to be considered a relic galaxy. Using deep optical spectroscopy, we derive the star formation history along the structure of the galaxy: the stellar populations are uniformly old (>10 Gyr) with no evidence for more recent star formation episodes. The metallicity of their stars is super-solar ([Fe/H] = 0.20 ± 0.04 with a smooth decline toward the outer regions) and α-enriched ([α/Fe] = 0.4 ± 0.1). This suggests a very short formation time scale for the bulk of the stars in this galaxy. This object also rotates very fast (V {sub rot} ∼ 300 km s{sup –1}) and has a large central velocity dispersion (σ > 300 km s{sup –1}). NGC 1277 allows the exploration in full detail of properties such as the structure, internal dynamics, metallicity, and initial mass function as they were at ∼10-12 Gyr ago when the first massive galaxies were built.

  11. Could unstable relic particles distort the microwave background radiation?

    International Nuclear Information System (INIS)

    Dar, A.; Loeb, A.; Nussinov, S.

    1989-01-01

    Three general classes of possible scenarios for the recently reported distortion of the microwave background radiation (MBR) via decaying relic weakly interacting particles are analyzed. The analysis shows that such particles could not reheat the universe and cause the spectral distortion of the MBR. Gravitational processes such as the early formation of massive black holes may still be plausible energy sources for producing the reported spectral distortion of the MBR at an early cosmological epoch. 24 references

  12. Manufacturing technology for advanced jet engines; Jisedai jetto engine no seizo gijutsu

    Energy Technology Data Exchange (ETDEWEB)

    Hirakawa, H [Kawasaki Heavy Industries Ltd., Kobe (Japan)

    1997-04-05

    A part of the latest production technologies for aircraft jet engines is introduced. Outline of the turbofan engine, turbo-prop engine, and turbo-shaft engine are given. Every one of them employs a gas turbine engine comprising a compressor, combustor, and a turbine as the output generator. Increase in the turbine inlet temperature is effective for making the gas turbine engine more efficient. The development tread of heat resisting materials for realizing higher temperature is shown. The current status and future aspect of the manufacturing technology is discussed for each main component of the engine. Technological development for decreasing weight is important because the weight of the fan member increases when the fan diameter is increased to increase the bypass ratio. FRP is adopted for the blades and casing to decrease the weight of the compressor, and studies have been made on fiber reinforced materials to reduce the weight of the disks. The outlines of the latest manufacturing technologies for the combustor and turbine are introduced. 2 refs., 9 figs.

  13. From Wang-Chen System with Only One Stable Equilibrium to a New Chaotic System Without Equilibrium

    Science.gov (United States)

    Pham, Viet-Thanh; Wang, Xiong; Jafari, Sajad; Volos, Christos; Kapitaniak, Tomasz

    2017-06-01

    Wang-Chen system with only one stable equilibrium as well as the coexistence of hidden attractors has attracted increasing interest due to its striking features. In this work, the effect of state feedback on Wang-Chen system is investigated by introducing a further state variable. It is worth noting that a new chaotic system without equilibrium is obtained. We believe that the system is an interesting example to illustrate the conversion of hidden attractors with one stable equilibrium to hidden attractors without equilibrium.

  14. [Professor CHEN Xiuhua's experience in the treatment of atopic dermatitis].

    Science.gov (United States)

    Quan, Xiaohong; Li, Shuqian; Li, Ying

    2017-03-12

    Professor CHEN Xiuhua 's clinical experiences were introduced in the intervention on atopic dermatitis with external therapies of TCM acupuncture. On the basis of the theory as cultivating the earth and clearing the heart from professor CHEN Dacan and in terms of the disease stages and skin lesion characteristics, as well as in consideration of syndrome differen-tiation, the acupoints for strengthening the spleen and clearing heart fire are selected, such as Zhongwan (CV 12), Daheng (SP 15), Shuifen (CV 9), Tianshu (ST 25), Neiguan (PC 6) and Quchi (LI 11). For the repair of skin lesion, the integration of Chinese and western medicine is used, with the internal application and external use of Chinese herbal medicines involved. The topical ointments are selected rationally. The self-blood therapy is used with acupuncture, bleeding therapy and acupoint injection applied in combination on the basis of the theory of TCM zangfu organs and modern immunological mechanism, which stimulates the nonspecific immune response in the body and strengthens acupoint stimulus effects. Medical thread therapy of Guangxi Zhuang medicine is used in moxibustion for skin damage, which effectively stops itching and promotes wound healing and skin repair.

  15. Novel interactive virtual showcase based on 3D multitouch technology

    Science.gov (United States)

    Yang, Tao; Liu, Yue; Lu, You; Wang, Yongtian

    2009-11-01

    A new interactive virtual showcase is proposed in this paper. With the help of virtual reality technology, the user of the proposed system can watch the virtual objects floating in the air from all four sides and interact with the virtual objects by touching the four surfaces of the virtual showcase. Unlike traditional multitouch system, this system cannot only realize multi-touch on a plane to implement 2D translation, 2D scaling, and 2D rotation of the objects; it can also realize the 3D interaction of the virtual objects by recognizing and analyzing the multi-touch that can be simultaneously captured from the four planes. Experimental results show the potential of the proposed system to be applied in the exhibition of historical relics and other precious goods.

  16. Astragalus polysaccharides protect cardiac stem and progenitor cells by the inhibition of oxidative stress-mediated apoptosis in diabetic hearts

    OpenAIRE

    Chen,Wei; Ju,Jing; Yang,Yehong; Wang,Hao; Chen,Wenjie; Zhao,Xuelan; Ye,Hongying; Zhang,Yu

    2018-01-01

    Wei Chen,1 Jing Ju,1 Yehong Yang,2 Hao Wang,3 Wenjie Chen,1 Xuelan Zhao,1 Hongying Ye,2 Yu Zhang1 1Department of Geriatrics, Huashan Hospital, Fudan University, Shanghai, China; 2Department of Endocrinology, Huashan Hospital, Fudan University, Shanghai, China; 3Core Center of Animal Facility, School of Medicine, Fudan University, Shanghai, China Introduction: Diabetic cardiomyopathy is characterized by an imbalance between myocyte death and regeneration mediated by the progressive loss of c...

  17. A high performance, high precision, low cost rapid prototyping and manufacturing technology

    OpenAIRE

    Viacheslav R. Shulunov

    2014-01-01

    A novel roll powder sintering (RPS) technology is proposed for processing real plastic, ceramic, metal and other 3-D objects 1m³ (or more) in volume directly from a CAD model within several hours. The breakthrough advantages of the technology are compared to the dominant rapid prototyping and manufacturing (RP&M) processes that are currently on the market.

  18. Cost-Effective Additive Manufacturing in Space: HELIOS Technology Challenge Guide

    Science.gov (United States)

    DeVieneni, Alayna; Velez, Carlos Andres; Benjamin, David; Hollenbeck, Jay

    2012-01-01

    Welcome to the HELIOS Technology Challenge Guide. This document is intended to serve as a general road map for participants of the HELIOS Technology Challenge [HTC] Program and the associated inaugural challenge: HTC-01: Cost-Effective Additive Manufacturing in Space. Please note that this guide is not a rule book and is not meant to hinder the development of innovative ideas. Its primary goal is to highlight the objectives of the HTC-01 Challenge and to describe possible solution routes and pitfalls that such technology may encounter in space. Please also note that participants wishing to demonstrate any hardware developed under this program during any future HELIOS Technology Challenge showcase event(s) may be subject to event regulations to be published separately at a later date.

  19. Relics of short distance effects for the neutron electric dipole moment

    International Nuclear Information System (INIS)

    Eeg, J.O.

    1982-12-01

    The Feynman diagrams which dominate the estimates of the electric dipole moment of the neutron with Kobayashi-Maskawa CP violation are considered. The extracted long distance contributions and the relics of short distance contributions are shown to be complementary and of the same magnitude, resulting in mod(Dsub(n)/e) approximately = (10 - 31 - 10 - 30 ) cm. (Auth.)

  20. Application of virtual surgical planning with computer assisted design and manufacturing technology to cranio-maxillofacial surgery.

    Science.gov (United States)

    Zhao, Linping; Patel, Pravin K; Cohen, Mimis

    2012-07-01

    Computer aided design and manufacturing (CAD/CAM) technology today is the standard in manufacturing industry. The application of the CAD/CAM technology, together with the emerging 3D medical images based virtual surgical planning (VSP) technology, to craniomaxillofacial reconstruction has been gaining increasing attention to reconstructive surgeons. This article illustrates the components, system and clinical management of the VSP and CAD/CAM technology including: data acquisition, virtual surgical and treatment planning, individual implant design and fabrication, and outcome assessment. It focuses primarily on the technical aspects of the VSP and CAD/CAM system to improve the predictability of the planning and outcome.

  1. New technologies on eggs manufacturing; Innovazione tecnologica nell`industria di lavorazione delle uova

    Energy Technology Data Exchange (ETDEWEB)

    Pizzichini, M.; Serse, A. [ENEA, Centro Ricerche Casaccia, Rome (Italy). Dip. Innovazione; Marcolini, P.; Erbisti, P. [Soc. Coop. Avicola Lessinia, Pigozzo, Verona (Italy)

    1996-10-01

    Objective of this paper is innovate the industrial manufacturing process, up grading the white egg commercial value according the following points: - improve the albumen rheological properties (whippability); - concentrate the white eggs without damaging the protein functional properties; - fractionate eggs white proteins to improve the useful application range in the pharmaceutical industry. The albumen chemical-physical properties and the protein separation technologies, based mainly on membrane techniques, are discussed. This paper represents a first technical overview on eggs manufacturing, carried out by ENEA (Italian Agency for New Technologies, Energy and the Environment) and the Avicola Lessinia, with the objective to develop a new production process.

  2. THE THERMOELECTRIC VACUUM CROCK-POT AND THE AUTOMATED WORKPLACE FOR ITS RESEARCH AS A CONTROL OBJECT

    Directory of Open Access Journals (Sweden)

    S. Hudz

    2017-08-01

    Full Text Available The technologies of thermal treatment in vacuum are widely used in various fields of production, in particular in the food industry, but their application at farms, hotels or a for domestic purposes is limited because of the big sizes, high cost of processing equipment and complexity of its management at realization of foodstuff processing. Products, made with use of vacuum technologies, keep much more useful substances because they aren't exposed to high-temperature processing and oxidation while preparation. Development and production of the small-sized equipment for realization of heat treatment processes of foodstuff in vacuum would create technical and economic conditions for implementation of temperature processing processes of foodstuff at farms, hotels and even at home that would promote creation of new food, development of new recipes and, in general, development of the new direction in cookery. So the article describes the problem of equipment construction for the process of thermal processing of food in vacuum such as cooking jam, concentration of juices and dairy products, distillation, drying, pickling, and the possibility of building inexpensive compact vacuum unit for the implementation of these processes (crock-pot for use at hotels, farms and even for domestic purposes. The analysis of technological schemes for energy efficient evaporation process in vacuum crock-pot is provided. The developed technological scheme of vacuum crock-pot with thermoelectric converters and principle of its operation are considered. Microprocessor block diagram of a multichannel data acquisition system consisting workstation for investigation of thermoelectric vacuum crock-pot as a control object is presented and control algorithms helping to reduce energy consumption and to increase operational reliability in implementing processes and the quality of ready-made products are provided.

  3. Advances for prosthetic technology from historical perspective to current status to future application

    CERN Document Server

    LeMoyne, Robert

    2016-01-01

    This book focuses on the advances in transtibial prosthetic technology and targets research in the evolution of the powered prosthesis such as the BiOM, which was derived from considerable research and development at the Massachusetts Institute of Technology. The concept of the book spans the historical evolution of prosthetic applications from passive to new and futuristic robotic prosthetic technologies.  The author describes the reasons for amputation, surgical procedures, and an historical perspective of the prosthesis for the lower limb. He also addresses the phases and sub-phases of gait and compensatory mechanisms arising for a transtibial prosthesis and links the compensatory mechanisms to long-term morbidities.  The general technologies for gait analysis central to prosthetic design and the inherent biomechanics foundations for analysis are also explored.  The book reports on recent-past to current-term applications with passive elastic prostheses.  The core of the book deals with futuristic robo...

  4. The new technology for manufacturing polymer Nanopowder. Part 2

    Directory of Open Access Journals (Sweden)

    GRYAZNOV Igor Vasilevich

    2016-01-01

    Full Text Available The authors studied the problem of pollution by waste polymers. The research is dedicated to the methods of recycling of polymers, in particular PTFE. It was shown that the most environmentally friendly disposal methods with the lowest cost are the methods based on stepwise mechanical dispersion. Technologies and devices based on the principles of abrasive vortex dispersion polymers have been developed and tested. To protect the intellectual property of the author the staff of LLC TARK (Ukraine and the Science and Technology Center Polymate (Israel registered patent «Method and apparatus for manufacturing submicron polymer powder» USA No. 12 / 981.202 of 29.12.2010.

  5. The new technology for manufacturing polymer Nanopowder. Part 1

    Directory of Open Access Journals (Sweden)

    GRYAZNOV Igor Vasilevich

    2015-10-01

    Full Text Available The authors studied the problem of pollution by waste polymers. The research is dedicated to the methods of recycling of polymers, in particular PTFE. It was shown that the most environmentally friendly disposal methods with the lowest cost are the methods based on stepwise mechanical dispersion. Technologies and devices based on the principles of abrasive vortex dispersion polymers have been developed and tested. To protect the intellectual property of the author the staff of LLC TARK (Ukraine and the Science and Technology Center Polymate (Israel registered patent «Method and apparatus for manufacturing submicron polymer powder» USA No. 12 / 981.202 of 29.12.2010.

  6. New Technologies and New Paradigms in Historical Research

    Directory of Open Access Journals (Sweden)

    Antonio Cartelli

    2001-01-01

    Full Text Available After a short introduction on media evolution and its implication on human history, the paper presents an account of two experiences the authors had while using new technologies in disseminating bibliographical and historical information. The first experience concerns the Web publication of a bibliography on Beneventan manuscripts and arose from the need to overcome the long de-lays in publishing printed information. The Web publication also serves as an online resource for all researchers involved in studies on the South Italian book script in the Middle Ages. The second one relates to recent studies on women copyists in the Middle Ages and uses an online database to disseminate findings on this subject. The paper then analyzes similarities and differences between the two experiences and suggests they can be seen as a source of online information for scholars. Thus, they represent a first step towards the construction of new paradigms of knowledge and research in historical studies.

  7. Reference: 438 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available ity and drought tolerance in Arabidopsis thaliana. 18 6902-12 16943431 2006 Sep Molecular and cellular bio...logy Chen Zhizhong|Gong Zhizhong|Hong Xuhui|Jablonowski Daniel|Ren Xiaozhi|Schaffrath Raffael|Zhang Hairong|Zhou Xiaofeng|Zhu Jian-Kang

  8. Photosynthesis and photoprotective systems of plants in response to ...

    African Journals Online (AJOL)

    Yomi

    2010-12-27

    Dec 27, 2010 ... al., 2008), photoprotective systems (Xiao et al., 2003a;. Chen et al., 2005a; Ali et al., .... et al., 1988) and soybean (Ying and Liu, 2005) and unaffected in beech ...... Goulding KW, Vitousek PM, Zhang FS (2010). Significant.

  9. Expression Pattern of Antioxidant Enzyme Genes in Embryonic Axes

    African Journals Online (AJOL)

    lin

    2012-07-17

    Jul 17, 2012 ... Yin Li, Yishun Zhang*, Shaowei Wei, Li Liu and Yunfeng Chen. Guangdong Key Laboratory of ... and tissues (Alscher et al., 1997; Mallick and Mohn, 2000; ... crop in some countries such as China, Japan and India. (Liu et al.

  10. From technology transfer to local manufacturing: China's emergence in the global wind power industry

    Science.gov (United States)

    Lewis, Joanna Ingram

    This dissertation examines the development of China's large wind turbine industry, including the players, the status of the technology, and the strategies used to develop turbines for the Chinese market. The primary goals of this research project are to identify the models of international technology transfer that have been used among firms in China's wind power industry; examine to what extent these technology transfers have contributed to China's ability to locally manufacture large wind turbine technology; and evaluate China's ability to become a major player in the global wind industry. China is a particularly important place to study the opportunities for and dynamics of clean energy development due to its role in global energy consumption. China is the largest coal consuming and producing nation in the world, and consequently the second largest national emitter of carbon dioxide after only the United States. Energy consumption and carbon emissions are growing rapidly, and China is expected to surpass the US and become the largest energy consuming nation and carbon dioxide emitter in coming decades. The central finding of this dissertation is that even though each firm involved in the large wind turbine manufacturing industry in China has followed a very different pathway of technology procurement for the Chinese market, all of the firms are increasing the utilization of locally-manufactured components, and many are doing so without transferring turbine technology or the associated intellectual property. Only one fully Chinese-owned firm, Goldwind, has succeeded in developing a commercially available large wind turbine for the Chinese market. No Chinese firms or foreign firms are manufacturing turbines in China for export overseas, though many have stated plans to do so. There already exists a possible niche market for the smaller turbines that are currently being made in China, particularly in less developed countries that are looking for less expensive

  11. THE BIODEGRADABILITY AND MECHANICAL STRENGTH OF NUTRITIVE POTS FOR VEGETABLE PLANTING BASED ON LIGNOCELLULOSE COMPOSITE MATERIALS

    Directory of Open Access Journals (Sweden)

    Petronela Nechita

    2010-04-01

    Full Text Available Considering the mild degradation strength and the fact that it may be an organic matter reserve for the soil, in the past years lignocellulosic materials have been used as fibrous raw materials in the manufacture of biodegradable nutritive pots for the seedling in vegetable containerized production. This paper analyses the behavior of the nutritive pots made from biodegradable composites for the vegetable seedling production process, focusing on their mechanical strength properties and biodegradability. It was found that the biodegradability of composite materials obtained from a mixture of secondary cellulosic fibers, peat, and additives, is strongly influenced by the presence or absence of the rhizosphere effect and the synergistic relations set in the culture substrate between the plant roots and microorganisms, which develop permanently the recycling and solubilization of mineral nutrients. The results showed that the presence in the substrate of some complex populations made by heterotrophic bacteria favors full degradation of the pulp and lignin contained in the substrate and pots composition. Therefore, unlike the reference sample (plant-free, cultivated versions exhibited an intense biodegradation on the account of rhizosphere effect.

  12. [Chinese medicine industry 4.0:advancing digital pharmaceutical manufacture toward intelligent pharmaceutical manufacture].

    Science.gov (United States)

    Cheng, Yi-Yu; Qu, Hai-Bin; Zhang, Bo-Li

    2016-01-01

    A perspective analysis on the technological innovation in pharmaceutical engineering of Chinese medicine unveils a vision on "Future Factory" of Chinese medicine industry in mind. The strategy as well as the technical roadmap of "Chinese medicine industry 4.0" is proposed, with the projection of related core technology system. It is clarified that the technical development path of Chinese medicine industry from digital manufacture to intelligent manufacture. On the basis of precisely defining technical terms such as process control, on-line detection and process quality monitoring for Chinese medicine manufacture, the technical concepts and characteristics of intelligent pharmaceutical manufacture as well as digital pharmaceutical manufacture are elaborated. Promoting wide applications of digital manufacturing technology of Chinese medicine is strongly recommended. Through completely informationized manufacturing processes and multi-discipline cluster innovation, intelligent manufacturing technology of Chinese medicine should be developed, which would provide a new driving force for Chinese medicine industry in technology upgrade, product quality enhancement and efficiency improvement. Copyright© by the Chinese Pharmaceutical Association.

  13. THE SCALING RELATIONS AND THE FUNDAMENTAL PLANE FOR RADIO HALOS AND RELICS OF GALAXY CLUSTERS

    International Nuclear Information System (INIS)

    Yuan, Z. S.; Han, J. L.; Wen, Z. L.

    2015-01-01

    Diffuse radio emission in galaxy clusters is known to be related to cluster mass and cluster dynamical state. We collect the observed fluxes of radio halos, relics, and mini-halos for a sample of galaxy clusters from the literature, and calculate their radio powers. We then obtain the values of cluster mass or mass proxies from previous observations, and also obtain the various dynamical parameters of these galaxy clusters from optical and X-ray data. The radio powers of relics, halos, and mini-halos are correlated with the cluster masses or mass proxies, as found by previous authors, while the correlations concerning giant radio halos are in general the strongest. We found that the inclusion of dynamical parameters as the third dimension can significantly reduce the data scatter for the scaling relations, especially for radio halos. We therefore conclude that the substructures in X-ray images of galaxy clusters and the irregular distributions of optical brightness of member galaxies can be used to quantitatively characterize the shock waves and turbulence in the intracluster medium responsible for re-accelerating particles to generate the observed diffuse radio emission. The power of radio halos and relics is correlated with cluster mass proxies and dynamical parameters in the form of a fundamental plane

  14. Technological review of the HRP manufacturing process R and D activity

    International Nuclear Information System (INIS)

    Visca, Eliseo; Pizzuto, A.; Gavila, P.; Riccardi, B.; Roccella, S.; Candura, D.; Sanguinetti, G.P.

    2013-01-01

    Highlights: • R and D activities for the manufacturing of ITER divertor high heat flux plasma-facing components (HHFC). • ENEA and Ansaldo have jointly manufactured several actively cooled monoblock mock-ups and prototypical components. • Successful manufacturing by HRP (hot radial pressing) and PBC (pre-brazed casting) of both W and CFC armoured small and medium scale mockups. • ENEA-ANSALDO participate to the European programme for the qualification of the manufacturing technology for the ITER divertor IVT. • A qualification divertor inner vertical target prototype successfully tested at ITER relevant thermal heat fluxes. -- Abstract: ENEA and Ansaldo Nucleare S.p.A. have been deeply involved in the European International Thermonuclear Experimental Reactor (ITER) R and D activities for the manufacturing of high heat flux plasma-facing components (HHFC), and in particular for the inner vertical target (IVT) of the ITER divertor. This component has to be manufactured by using both armour and structural materials whose properties are defined by ITER. Their physical properties prevent the use of standard joining techniques. The reference armour materials are tungsten and carbon/carbon fibre composite (CFC). The cooling pipe is made of copper alloy (CuCrZr-IG). During the last years ENEA and Ansaldo have jointly manufactured several actively cooled monoblock mock-ups and prototypical components of different length, geometry and materials, by using innovative processes: HRP (hot radial pressing) and PBC (pre-brazed casting). The history of the technical issues solved during the R and D phase and the improvements implemented to the assembling tools and equipments are reviewed in the paper together with the testing results. The optimization of the processes started from the successful manufacturing of both W and CFC armoured small scale mockups thermal fatigue tested in the worst ITER operating condition (20 MW/m 2 ) through the achievement of record

  15. Technological review of the HRP manufacturing process R and D activity

    Energy Technology Data Exchange (ETDEWEB)

    Visca, Eliseo, E-mail: eliseo.visca@enea.it [Associazione EURATOM-ENEA sulla Fusione, C.R. Frascati, Via E. Fermi 45, IT-00044 Frascati (Italy); Pizzuto, A. [Associazione EURATOM-ENEA sulla Fusione, C.R. Frascati, Via E. Fermi 45, IT-00044 Frascati (Italy); Gavila, P.; Riccardi, B. [Fusion For Energy, C. Josep Pla 2, ES-08019 Barcelona (Spain); Roccella, S. [Associazione EURATOM-ENEA sulla Fusione, C.R. Frascati, Via E. Fermi 45, IT-00044 Frascati (Italy); Candura, D.; Sanguinetti, G.P. [Ansaldo Nucleare S.p.A., Corso Perrone 25, IT-16121 Genova (Italy)

    2013-10-15

    Highlights: • R and D activities for the manufacturing of ITER divertor high heat flux plasma-facing components (HHFC). • ENEA and Ansaldo have jointly manufactured several actively cooled monoblock mock-ups and prototypical components. • Successful manufacturing by HRP (hot radial pressing) and PBC (pre-brazed casting) of both W and CFC armoured small and medium scale mockups. • ENEA-ANSALDO participate to the European programme for the qualification of the manufacturing technology for the ITER divertor IVT. • A qualification divertor inner vertical target prototype successfully tested at ITER relevant thermal heat fluxes. -- Abstract: ENEA and Ansaldo Nucleare S.p.A. have been deeply involved in the European International Thermonuclear Experimental Reactor (ITER) R and D activities for the manufacturing of high heat flux plasma-facing components (HHFC), and in particular for the inner vertical target (IVT) of the ITER divertor. This component has to be manufactured by using both armour and structural materials whose properties are defined by ITER. Their physical properties prevent the use of standard joining techniques. The reference armour materials are tungsten and carbon/carbon fibre composite (CFC). The cooling pipe is made of copper alloy (CuCrZr-IG). During the last years ENEA and Ansaldo have jointly manufactured several actively cooled monoblock mock-ups and prototypical components of different length, geometry and materials, by using innovative processes: HRP (hot radial pressing) and PBC (pre-brazed casting). The history of the technical issues solved during the R and D phase and the improvements implemented to the assembling tools and equipments are reviewed in the paper together with the testing results. The optimization of the processes started from the successful manufacturing of both W and CFC armoured small scale mockups thermal fatigue tested in the worst ITER operating condition (20 MW/m{sup 2}) through the achievement of record

  16. Investigation of laser cleaning on bronze cultural relics

    International Nuclear Information System (INIS)

    Ling, Xiulan; Wang, Gao; Zhang, Chen

    2016-01-01

    The effects of laser cleaning on the corrosion layers of bronze cultural relics were studied using a pulsed fiber laser. The laser cleaning threshold value of the corrosion layers was obtained. It was found that the corrosion layer was removed successfully by employing a laser fluence value of 0.32 J cm −2 and scanning for three times. To obtain experimental evidence, laser con-focal scanning microscopy, scanning electron microscopy (SEM), energy dispersive x-ray spectroscopy (EDS), laser induced breakdown spectroscopy (LIBS) and laser Raman spectroscopy were employed to investigate the cleaning efficiency of corrosion layers on specimens. (paper)

  17. Spent Pot Lining Characterization Framework

    Science.gov (United States)

    Ospina, Gustavo; Hassan, Mohamed I.

    2017-09-01

    Spent pot lining (SPL) management represents a major concern for aluminum smelters. There are two key elements for spent pot lining management: recycling and safe storage. Spent pot lining waste can potentially have beneficial uses in co-firing in cement plants. Also, safe storage of SPL is of utmost importance. Gas generation of SPL reaction with water and ignition sensitivity must be studied. However, determining the feasibility of SPL co-firing and developing the required procedures for safe storage rely on determining experimentally all the necessary SPL properties along with the appropriate test methods, recognized by emissions standards and fire safety design codes. The applicable regulations and relevant SPL properties for this purpose are presented along with the corresponding test methods.

  18. Human proton/oligopeptide transporter (POT) genes

    DEFF Research Database (Denmark)

    Botka, C. W.; Wittig, T. W.; Graul, R. C.

    2000-01-01

    The proton-dependent oligopeptide transporters (POT) gene family currently consists of approximately 70 cloned cDNAs derived from diverse organisms. In mammals, two genes encoding peptide transporters, PepT1 and PepT2 have been cloned in several species including humans, in addition to a rat...... histidine/peptide transporter (rPHT1). Because the Candida elegans genome contains five putative POT genes, we searched the available protein and nucleic acid databases for additional mammalian/human POT genes, using iterative BLAST runs and the human expressed sequence tags (EST) database. The apparent...... and introns of the likely human orthologue (termed hPHT2). Northern analyses with EST clones indicated that hPHT1 is primarily expressed in skeletal muscle and spleen, whereas hPHT2 is found in spleen, placenta, lung, leukocytes, and heart. These results suggest considerable complexity of the human POT gene...

  19. NASA's Additive Manufacturing Development Materials Science to Technology Infusion - Connecting the Digital Dots

    Science.gov (United States)

    Vickers, John

    2017-01-01

    At NASA, the first steps of the Journey to Mars are well underway with the development of NASA's next generation launch system and investments in research and technologies that should increase the affordability, capability, and safety of exploration activities. Additive Manufacturing presents a disruptive opportunity for NASA to design and manufacture hardware with new materials at dramatically reduced cost and schedule. Opportunities to incorporate additive manufacturing align very well with NASA missions and with most NASA programs related to space, science, and aeronautics. The Agency also relies on many partnerships with other government agencies, industry and academia.

  20. Advanced manufacturing technologies modern machining, advanced joining, sustainable manufacturing

    CERN Document Server

    2017-01-01

    This book provides details and collective information on working principle, process mechanism, salient features, and unique applications of various advanced manufacturing techniques and processes belong. The book is divided in three sessions covering modern machining methods, advanced repair and joining techniques and, finally, sustainable manufacturing. The latest trends and research aspects of those fields are highlighted.

  1. Development of liposomal pemetrexed for enhanced therapy against multidrug resistance mediated by ABCC5 in breast cancer

    OpenAIRE

    Bai,Fang; Yin,You; Chen,Ting; Chen,Jihui; Ge,Meixin; Lu,Yunshu; Xie,Fangyuan; Zhang,Jian; Wu,Kejin; Liu,Yan

    2018-01-01

    Fang Bai,1–3,* You Yin,4,* Ting Chen,1,* Jihui Chen,1 Meixin Ge,2 Yunshu Lu,2 Fangyuan Xie,5 Jian Zhang,1 Kejin Wu,3 Yan Liu1,6 1Department of Pharmacy, Xinhua Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, 2Department of General Surgery, Xinhua Hospital, Affiliated to Shanghai Jiao Tong University, School of Medicine, Shanghai, 3Department of Breast Surgery, Obstetrics and Gynaecology Hospital, Fudan University, Shanghai, 4Department of Neurology, Changzheng...

  2. miR-139-5p regulates proliferation, apoptosis, and cell cycle of uterine leiomyoma cells by targeting TPD52

    OpenAIRE

    Chen,Hong; Xu,Hong; Meng,Yugang; Zhang,Yun; Chen,Junying; Wei,Xiaoning

    2016-01-01

    Hong Chen,1 Hong Xu,1 Yu-gang Meng,1 Yun Zhang,2 Jun-ying Chen,1 Xiao-ning Wei1 1Department of Gynaecology, The First Affiliated Hospital of Guangxi Medical University, Nanning, Guangxi, 2Department of Gynaecology, The People’s Hospital of Suzhou High Tech District, Suzhou, Jiangsu, People’s Republic of China Background: Uterine leiomyoma is one of the most common benign tumors in women. It dramatically decreases the quality of life in the affected women. However, there ...

  3. Carbon fiber manufacturing via plasma technology

    Science.gov (United States)

    Paulauskas, Felix L.; Yarborough, Kenneth D.; Meek, Thomas T.

    2002-01-01

    The disclosed invention introduces a novel method of manufacturing carbon and/or graphite fibers that avoids the high costs associated with conventional carbonization processes. The method of the present invention avoids these costs by utilizing plasma technology in connection with electromagnetic radiation to produce carbon and/or graphite fibers from fully or partially stabilized carbon fiber precursors. In general, the stabilized or partially stabilized carbon fiber precursors are placed under slight tension, in an oxygen-free atmosphere, and carbonized using a plasma and electromagnetic radiation having a power input which is increased as the fibers become more carbonized and progress towards a final carbon or graphite product. In an additional step, the final carbon or graphite product may be surface treated with an oxygen-plasma treatment to enhance adhesion to matrix materials.

  4. Reversible sympathetic vasomotor dysfunction in POTS patients.

    Science.gov (United States)

    Freitas, J; Santos, R; Azevedo, E; Costa, O; Carvalho, M; de Freitas, A F

    2000-11-01

    Orthostatic intolerance refers to the development upon assuming an upright posture of disabling symptoms, which are partly relieved by resuming the supine position. Postural tachycardia syndrome (POTS) is an orthostatic intolerance syndrome characterized by palpitations due to excessive orthostatic sinus tachycardia, lightheadedness, tremor, and near-syncope. Patients usually undergo extensive medical, cardiac, endocrine, neurological and psychiatric evaluation, which usually fails to identify a specific abnormality. We investigated the autonomic and hemodynamic profile of POTS patients and the efficacy of bisoprolol and or fludrocortisone. We evaluated eleven female patients with POTS before and after medical treatment with a cardio-selective beta blocker (bisoprolol) and/or fludrocortisone, and eleven age-matched controls. Variability of heart rate and systolic blood pressure was assessed by Fast Fourier Transform, and spontaneous baroreceptor gain by temporal sequences slope and alpha index. Modelflow was used to quantify hemodynamics. All patients improved greatly after medication. The autonomic and hemodynamic impairment observed in patients with POTS, particularly after orthostatic stress, is treated effectively with bisoprolol and/or fludrocortisone. These results need further confirmation in a controlled double-blind study. Proper medical treatment dramatically improves the clinical and autonomic/hemodynamic disturbances observed in patients with POTS. The data support the hypothesis that POTS is due to a hyperadrenergic activation and/or hypovolemia during orthostasis.

  5. Does external technology acquisition determine export performance? Evidence from Chinese manufacturing firms

    DEFF Research Database (Denmark)

    Wang, Yuandi; Cao, Wei; Zhou, Zhao

    2013-01-01

    understanding of the determinants of export performance by examining the impact of the inter-organizational dimension of innovation strategy to export performance, which has been ignored in the prevailing “strategy tripod” perspective of exporting research. This study is based on a sample of 141 Chinese...... indigenous manufacturing firms that engaged in inward technology licensing between 2000 and 2003. The empirical results indicate that external technology acquisitions positively influence Chinese firms’ export performance. Moreover the exporting performance of using external technology varies depending...

  6. Forecasting the Success of Implementing Sensors Advanced Manufacturing Technology

    Directory of Open Access Journals (Sweden)

    Cheng-Shih Su

    2014-08-01

    Full Text Available This paper is presented fuzzy preference relations approach to forecast the success of implementing sensors advanced manufacturing technology (AMT. In the manufacturing environment, performance measurement is based on different quantitative and qualitative factors. This study proposes an analytic hierarchical prediction model based on fuzzy preference relations to help the organizations become aware of the essential factors affecting the AMT implementation, forecasting the chance of successful implementing sensors AMT, as well as identifying the actions necessary before implementing sensors AMT. Then predicted success/failure values are obtained to enable organizations to decide whether to initiate sensors AMT, inhibit adoption or take remedial actions to increase the possibility of successful sensors AMT initiatives. This proposed approach is demonstrated with a real case study involving six influential factors assessed by nine evaluators solicited from a semiconductor engineering incorporation located in Taiwan.

  7. An optical method for characterizing carbon content in ceramic pot filters.

    Science.gov (United States)

    Goodwin, J Y; Elmore, A C; Salvinelli, C; Reidmeyer, Mary R

    2017-08-01

    Ceramic pot filter (CPF) technology is a relatively common means of household water treatment in developing areas, and performance characteristics of CPFs have been characterized using production CPFs, experimental CPFs fabricated in research laboratories, and ceramic disks intended to be CPF surrogates. There is evidence that CPF manufacturers do not always fire their products according to best practices and the result is incomplete combustion of the pore forming material and the creation of a carbon core in the final CPFs. Researchers seldom acknowledge the existence of potential existence of carbon cores, and at least one CPF producer has postulated that the carbon may be beneficial in terms of final water quality because of the presence of activated carbon in consumer filters marketed in the Western world. An initial step in characterizing the presence and impact of carbon cores is the characterization of those cores. An optical method which may be more viable to producers relative to off-site laboratory analysis of carbon content has been developed and verified. The use of the optical method is demonstrated via preliminary disinfection and flowrate studies, and the results of these studies indicate that the method may be of use in studying production kiln operation.

  8. Technology clubs, R&D and growth patterns : Evidence from EU manufacturing

    NARCIS (Netherlands)

    Bos, J. W. B.; Economidou, C.; Koetter, M.

    This paper investigates the forces driving output change in a panel of EU manufacturing industries. A flexible modeling strategy is adopted that accounts for: (i) inefficient use of resources and (ii) differences in the production technology across industries. With Our model we are able to identify

  9. Relic gravitational waves and extended inflation

    International Nuclear Information System (INIS)

    Turner, M.S.; Wilczek, F.

    1990-08-01

    In extended inflation, a new version of inflation where the transition from the false-vacuum phase to a radiation-dominated Universe is accomplished by bubble nucleation and percolation, bubble collisions supply a potent-and potentially detectable-source of gravitational waves. The present energy density in relic gravity waves from bubble collisions is expected to be about 10(exp -5) of closure density-many orders of magnitude greater than that of the gravity waves produced by quantum fluctuations. Their characteristic wavelength depends upon the reheating temperature T(sub RH): lambda is approximately 10(exp 4) cm (10(exp 14) GeV/T(sub RH)). If large numbers of black holes are produced, a not implausible outcome, they will evaporate producing comparable amounts of shorter wavelength waves, lambda is approximately 10(exp -6) cm (T(sub RH)/10(exp 14) GeV)

  10. Limitations to CO2-induced growth enhancement in pot studies.

    Science.gov (United States)

    McConnaughay, K D M; Berntson, G M; Bazzaz, F A

    1993-07-01

    Recently, it has been suggested that small pots may reduce or eliminate plant responses to enriched CO 2 atmospheres due to root restriction. While smaller pot volumes provide less physical space available for root growth, they also provide less nutrients. Reduced nutrient availability alone may reduce growth enhancement under elevated CO 2 . To investigate the relative importance of limited physical rooting space separate from and in conjunction with soil nutrients, we grew plants at ambient and double-ambient CO 2 levels in growth containers of varied volume, shape, nutrient concentration, and total nutrient content. Two species (Abutilon theophrasti, a C 3 dicot with a deep tap root andSetaria faberii, a C 4 monocot with a shallow diffuse root system) were selected for their contrasting physiology and root architecture. Shoot demography was determined weekly and biomass was determined after eight and ten weeks of growth. Increasing total nutrients, either by increasing nutrient concentration or by increasing pot size, increased plant growth. Further, increasing pot size while maintaining equal total nutrients per pot resulted in increased total biomass for both species. CO 2 -induced growth and reproductive yield enhancements were greatest in pots with high nutrient concentrations, regardless of total nutrient content or pot size, and were also mediated by the shape of the pot. CO 2 -induced growth and reproductive yield enhancements were unaffected by pot size (growth) or were greater in small pots (reproductive yield), regardless of total nutrient content, contrary to predictions based on earlier studies. These results suggest that several aspects of growth conditions within pots may influence the CO 2 responses of plants; pot size, pot shape, the concentration and total amount of nutrient additions to pots may lead to over-or underestimates of the CO 2 responses of real-world plants.

  11. Benchmarks of Global Clean Energy Manufacturing

    Energy Technology Data Exchange (ETDEWEB)

    Sandor, Debra [National Renewable Energy Lab. (NREL), Golden, CO (United States); Chung, Donald [National Renewable Energy Lab. (NREL), Golden, CO (United States); Keyser, David [National Renewable Energy Lab. (NREL), Golden, CO (United States); Mann, Margaret [National Renewable Energy Lab. (NREL), Golden, CO (United States); Engel-Cox, Jill [National Renewable Energy Lab. (NREL), Golden, CO (United States)

    2017-01-01

    The Clean Energy Manufacturing Analysis Center (CEMAC), sponsored by the U.S. Department of Energy (DOE) Office of Energy Efficiency and Renewable Energy (EERE), provides objective analysis and up-to-date data on global supply chains and manufacturing of clean energy technologies. Benchmarks of Global Clean Energy Manufacturing sheds light on several fundamental questions about the global clean technology manufacturing enterprise: How does clean energy technology manufacturing impact national economies? What are the economic opportunities across the manufacturing supply chain? What are the global dynamics of clean energy technology manufacturing?

  12. A review on manufacturing technology for long-lived radionuclide fuel compounds

    International Nuclear Information System (INIS)

    Hwang, Doo Seong; Park, Jin Ho; Kim, Eung Ho; Chung, Won Myung; Lee, Kui Ill; Woo, Moon Sik; Kim, Yeon Ku; Yoo, Jae Hyung

    1998-03-01

    Thermal neutron reactor (LWR), fast neutron reactor (FBR), accelerator-driven subcritical system have been studied as the potential transmutation devices. The fuel types can be classified according to the concept of each reactor. Oxide fuel is considered in LWR and metal, oxide, and nitride fuels are studied in FBR. In accelerator-driven subcritical system molten salt, metal, and oxide fuels are considered. This review focused on characteristics according to transmutation system, and manufacturing technologies of each fuels. Accelerator-driven system is being proposed as the most reasonable concept in recent, since it has merits in terms of stability and free control of nuclides composition rate in charge of long-lived nuclides. Fluorides molten salt fuel is better chemically stable and corrosion resistant, and lower vapor pressure than chloride molten salt and metal in the fuel type of accelerator-driven system. And then the detail manufacturing technology of fluorides molten salt were reviewed. (author). 62 refs., 23 tabs., 37 figs

  13. An esthetics rehabilitation with computer-aided design/ computer-aided manufacturing technology.

    Science.gov (United States)

    Mazaro, Josá Vitor Quinelli; de Mello, Caroline Cantieri; Zavanelli, Adriana Cristina; Santiago, Joel Ferreira; Amoroso, Andressa Paschoal; Pellizzer, Eduardo Piza

    2014-07-01

    This paper describes a case of a rehabilitation involving Computer Aided Design/Computer Aided Manufacturing (CAD-CAM) system in implant supported and dental supported prostheses using zirconia as framework. The CAD-CAM technology has developed considerably over last few years, becoming a reality in dental practice. Among the widely used systems are the systems based on zirconia which demonstrate important physical and mechanical properties of high strength, adequate fracture toughness, biocompatibility and esthetics, and are indicated for unitary prosthetic restorations and posterior and anterior framework. All the modeling was performed by using CAD-CAM system and prostheses were cemented using resin cement best suited for each situation. The rehabilitation of the maxillary arch using zirconia framework demonstrated satisfactory esthetic and functional results after a 12-month control and revealed no biological and technical complications. This article shows the important of use technology CAD/CAM in the manufacture of dental prosthesis and implant-supported.

  14. Evaluation of Technological Trends and Demands of the Manufacturing Industry to a Center of R&D&I

    Directory of Open Access Journals (Sweden)

    Leone Peter Correia da Silva Andrade

    2015-10-01

    Full Text Available The manufacturing industry is fairly representative in the Brazilian economy. The research activities in technology, development and innovation promoted by technology centers are of great importance to boost the competitiveness of this segment. In this context, this work aims presenting the development of the strategic planning for a Center of R&D&I (Research & Development & Innovation, looking 20 years ahead, on a macro level, creating a master plan which summarizes the future focus areas of competence for technology research, development and innovation, coping with manufacturing trends, using a participative workshop approach. Thus, it is expected that this center offer integrated technological solutions with high added value that promote the development and competitiveness of the manufacturing industry, in the prospects for medium and long term. In order to achieve the project objectives taking the principle of strategic planning was followed. On the one hand, focus was placed on the internal perspective analyzing the current status of the Center. On the other hand, the environment of the Center (external perspective was analyzed. Matching the analysis results regarding both perspectives future competence areas were derived, according to global technological trends as well as national and local industrial demand. Thus, the competencies required to be developed by a technology center to meet the manufacturing industry over the next twenty years would be derived.

  15. Behind the development of technology: The transition of innovation modes in China’s wind turbine manufacturing industry

    International Nuclear Information System (INIS)

    Ru Peng; Zhi Qiang; Zhang Fang; Zhong Xiaotian; Li Jianqiang; Su Jun

    2012-01-01

    The market scale of China’s wind turbine manufacturing industry has grown immensely. Despite China still having a limited capacity in terms of technology innovation, the institutional support has promoted the technology capability development of the wind turbine manufacturing industry. This paper explores the driving forces underlying this development by reviewing the transition of the innovation modes and the dynamic interactions among the technology capability, innovation modes, market formation, and wind energy policy. The innovation mode in China began with imitative innovation, then transitioned to cooperative innovation, and has more recently set its sights on attaining truly indigenous innovation. Public policy serves as a key driving force for the evolution of innovation modes, as well as the development of the market. The policy focus has evolved in the following sequence: 1. building the foundation for technological innovation; 2. encouraging technology transfer; 3. enhancing local R and D and manufacturing capabilities; 4. enlarging the domestic market; and 5. cultivating an open environment for global competition and sustainable market development in China. - Highlights: ► New data were provided for China’s wind turbine manufacturing industry. ► The transition of innovation modes in the industry is reviewed. ► The interaction among the technology, market, policy, and innovation mode is explored. ► Public policies are the key driving forces for the transition.

  16. Research Article Special Issue

    African Journals Online (AJOL)

    pc

    2018-03-07

    Mar 7, 2018 ... [32] Ren Y, Tang W. A service integrity assurance framework for .... [66] Liu C, Ranjan R, Zhang X, Yang C, Georgakopoulos D, Chen J. Public auditing for big ... [70] Berman J. J. Principles of big data: Preparing, sharing, and ...

  17. Maryam Moslemi, Sharghi, Mehdi Zahravi, Gholamreza Bakhshi ...

    African Journals Online (AJOL)

    01

    2013-08-21

    Aug 21, 2013 ... Briefly, Young leaves (100 mg) were ground to a fine powder in liquid nitrogen and ..... Yuan Z, Chen X, He T, Feng J, Feng T, Zhang C (2007b). Population genetic structure in apricot (Prunus armeniaca L.) cultivars revealed.

  18. Hydrogenation of Cinnamaldehyde over an Ionic Cobalt Promoted ...

    African Journals Online (AJOL)

    NICO

    useful transformation in organic synthesis to produce fine chemicals.1 To .... crystal structure of this compound is reported elsewhere.17. 2.2.2. Incipient Wet ..... 12 M. H. Chen, W. Chu, X. Y. Dai and X. W. Zhang, Catal. Today, 2004, 89,.

  19. Jing Tong Yu Shu, a traditional Chinese medicine, suppresses IL-1β ...

    African Journals Online (AJOL)

    Zhang et al. 2953. Tropical ... Purpose: To evaluate the effect of a traditional Chinese medicine, Jing Tong Yu Shu (JTYS) on endometriosis in a ..... Flower A, Liu JP, Chen S, Lewith G, Little P. Chinese ... Mol Hum Reprod 2000; 6: 269-275. 18.

  20. Flower symbolism and the cult of relics in medieval Serbia

    Directory of Open Access Journals (Sweden)

    Popović Danica

    2008-01-01

    Full Text Available The Life of archbishop Eustathios I [Jevstatije] (1279-1286, deserving head of the medieval Serbian Church and a saint, is a very interesting source for studying the cult of relics with the Serbs. This is not surprising considering that the Life was penned by one of the most illustrious of Eustathios' successors on the church throne, Daniel II [Danilo], a learned Athonite and unquestionable master of the hagiographie literary genre. In his account of the life of his distinguished predecessor, Daniel describes extensively the events constituting the key stage in the glorification of a saint, namely Eustathios' death and posthumous occurrences at his grave. As most holy men, Eustathios foresaw his own death, and he departed from this world serenely. He was buried, with due honours, in the 'marble grave' he had prepared for himself in the cathedral church of Holy Saviour at Žiča. In keeping with the well-established saint-making process, a few years after the funeral 'extraordinary signs' began to occur at the archbishop's grave, in this particular case, candlelight and a multitude of murmuring voices followed by the miraculous cure of an incurably ill person. These occurrences preceded the great miracle which, to the best of my knowledge, is unparalleled in the medieval Serbian practice of relic veneration. Namely, 'one day they found growing from his marble grave three flowers endowed with wondrous beauty and impossible to liken to anything else. For, indeed, they were not of earthly humidity or of union with flowers that grow from earth; but, o wonder, how a dry stone standing for so long in the church could send forth fragrant flowers, to the renewal of the sanctified one's body'. Flower metaphors occur in the Service to the holy archbishop Eustathios, yet another piece penned by Daniel II, notably in his paraphrases of Psalm 92, 12-14 ('The righteous shall flourish like the palm tree: he shall grow like a cedar in Lebanon. These that be

  1. PEMBERDAYAAN PEREMPUAN MELALUI PEMBUDIDAYAAN TANAMAN SAYURAN DALAM POT BERBASIS APLIKASI TEKNOLOGI BOKASHI ECENG GONDOK

    Directory of Open Access Journals (Sweden)

    Gusti Irya Ichriani Kambang Vetrani Asie Siti Zubaidah, Dan Syahrudin

    2013-12-01

    Full Text Available Vegetables cultivation in the pot based on Eichhornia crassipes bokashi technology application is the activity toempower women synergized with the natural resources around them. The purposed of IbM program implementationwere (1 empower and provide skills to the women group in order to utilize of natural resources (Eichhorniacrassipes, sawdust and alluvial soil and obtain vitamines, minerals and fiber for households through the vegetablescultivation in the pot and utilization of Eichhornia crassipes bokashi as growing mixture media; (2 as effort tosave on household spending and to creating entrepreneurship. This program was carried out with two groupsof women (the RW I women group and RW II women group from Cemara Labat, Palangka Raya, Central ofKalimantan. Socialization, training and coaching about cultivation of vegetables in the pot and making of Eichhorniacrassipes bokashi has given the ability and skills to the women group for utilizing natural resources around them.This IbM programme has sustainability. It is caused the women groups from RW I and RW II Cemara Labatwant to continue planting vegetables in the pot using Eichhornia crassipes bokashi, to meet needs of householdvegetables daily and it has raised a family entrepreneurship.

  2. Automotive Manufacturers' Cost/Revenue, Financial and Risk Analysis : Projected Impact of Automobile Manufacturing on the Plastics Industry

    Science.gov (United States)

    1979-08-01

    The report is part of a study to update the historical and projected cost/revenue analysis of the U.S. domestic automobile manufacturers. It includes the evaluation of the historical and projected financial data to assess the corporate financial posi...

  3. The Postural Tachycardia Syndrome (POTS: Pathophysiology, Diagnosis & Management

    Directory of Open Access Journals (Sweden)

    Satish R Raj

    2006-04-01

    Full Text Available Postural tachycardia syndrome (POTS, characterized by orthostatic tachycardia in the absence of orthostatic hypotension, has been the focus of increasing clinical interest over the last 15 years 1. Patients with POTS complain of symptoms of tachycardia, exercise intolerance, lightheadedness, extreme fatigue, headache and mental clouding. Patients with POTS demonstrate a heart rate increase of ≥30 bpm with prolonged standing (5-30 minutes, often have high levels of upright plasma norepinephrine (reflecting sympathetic nervous system activation, and many patients have a low blood volume. POTS can be associated with a high degree of functional disability. Therapies aimed at correcting the hypovolemia and the autonomic imbalance may help relieve the severity of the symptoms. This review outlines the present understanding of the pathophysiology, diagnosis, and management of POTS.

  4. Possible market entry of a firm with an additive manufacturing technology

    NARCIS (Netherlands)

    Hartl, R.F.; Kort, Peter

    2017-01-01

    One of the principle characteristics of additive manufacturing is that customers get access to their own design, i.e., they need not choose from a small number of standard products. The paper considers a framework where an incumbent with a standard technology produces a limited number of standard

  5. Relics of the Past

    DEFF Research Database (Denmark)

    Eskildsen, Kasper Risbjerg

    2016-01-01

    , they insisted, were not only more reliable than eyewitness accounts, but also better historical evidence than all other material remains of the past. The use of these sources in historical research also helped shape the modern ideal of the historian as an archival researcher. To illustrate these changes......, the paper focuses upon the example of the Göttingen historian Johann Christoph Gatterer, who is often considered one of the founders of modern critical historical research....

  6. Direct detection of projectile relics from the end of the lunar basin-forming epoch.

    Science.gov (United States)

    Joy, Katherine H; Zolensky, Michael E; Nagashima, Kazuhide; Huss, Gary R; Ross, D Kent; McKay, David S; Kring, David A

    2012-06-15

    The lunar surface, a key proxy for the early Earth, contains relics of asteroids and comets that have pummeled terrestrial planetary surfaces. Surviving fragments of projectiles in the lunar regolith provide a direct measure of the types and thus the sources of exogenous material delivered to the Earth-Moon system. In ancient [>3.4 billion years ago (Ga)] regolith breccias from the Apollo 16 landing site, we located mineral and lithologic relics of magnesian chondrules from chondritic impactors. These ancient impactor fragments are not nearly as diverse as those found in younger (3.4 Ga to today) regolith breccias and soils from the Moon or that presently fall as meteorites to Earth. This suggests that primitive chondritic asteroids, originating from a similar source region, were common Earth-Moon-crossing impactors during the latter stages of the basin-forming epoch.

  7. Detecting relic gravitational waves in the CMB: The contamination caused by the cosmological birefringence

    Directory of Open Access Journals (Sweden)

    Wen Zhao

    2014-10-01

    Full Text Available The B-mode polarization of the cosmic microwave background (CMB radiation is an excellent information channel for the detection of relic gravitational waves. However, the detection is contaminated by the B-mode polarization generated by some other effects. In this paper, we discuss the contaminations caused by the cosmological birefringence, which converts the CMB E-mode to the B-mode, and forms the effective noise for the detection of gravitational waves. We find that this contamination is significant, if the rotation angle is large. However, this kind of B-mode can be properly de-rotated, and the effective noises can be greatly reduced. We find that, comparing with the contaminations caused by cosmic weak lensing, the residual polarization generated by the cosmological birefringence is negligible for the detection of relic gravitational waves in the CMB.

  8. Combat Ration Network for Technology Implementation. Polymeric Tray Manufacturability, Part 2 (Short Term Project - STP1002B)

    National Research Council Canada - National Science Library

    Bruins, Henderikus

    1999-01-01

    .... Therefore, a second Polymeric Tray Manufacturability at the CORANET Demonstration Site at Rutgers University Food Manufacturing Technology Facility was conducted on June 9-10, 1998 to specifically address these issues...

  9. Design for manufacturability from 1D to 4D for 90-22 nm technology nodes

    CERN Document Server

    Balasinski, Artur

    2013-01-01

    This book explains integrated circuit design for manufacturability (DfM) at the product level (packaging, applications) and applies engineering DfM principles to the latest standards of product development at 22 nm technology nodes.  It is a valuable guide for layout designers, packaging engineers and quality engineers, covering DfM development from 1D to 4D, involving IC design flow setup, best practices, links to manufacturing and product definition, for process technologies down to 22 nm node, and product families including memories, logic, system-on-chip and system-in-package.

  10. Virtual Manufacturing Techniques Designed and Applied to Manufacturing Activities in the Manufacturing Integration and Technology Branch

    Science.gov (United States)

    Shearrow, Charles A.

    1999-01-01

    One of the identified goals of EM3 is to implement virtual manufacturing by the time the year 2000 has ended. To realize this goal of a true virtual manufacturing enterprise the initial development of a machinability database and the infrastructure must be completed. This will consist of the containment of the existing EM-NET problems and developing machine, tooling, and common materials databases. To integrate the virtual manufacturing enterprise with normal day to day operations the development of a parallel virtual manufacturing machinability database, virtual manufacturing database, virtual manufacturing paradigm, implementation/integration procedure, and testable verification models must be constructed. Common and virtual machinability databases will include the four distinct areas of machine tools, available tooling, common machine tool loads, and a materials database. The machine tools database will include the machine envelope, special machine attachments, tooling capacity, location within NASA-JSC or with a contractor, and availability/scheduling. The tooling database will include available standard tooling, custom in-house tooling, tool properties, and availability. The common materials database will include materials thickness ranges, strengths, types, and their availability. The virtual manufacturing databases will consist of virtual machines and virtual tooling directly related to the common and machinability databases. The items to be completed are the design and construction of the machinability databases, virtual manufacturing paradigm for NASA-JSC, implementation timeline, VNC model of one bridge mill and troubleshoot existing software and hardware problems with EN4NET. The final step of this virtual manufacturing project will be to integrate other production sites into the databases bringing JSC's EM3 into a position of becoming a clearing house for NASA's digital manufacturing needs creating a true virtual manufacturing enterprise.

  11. Thermomechanical Impact of Polyurethane Potting on Gun Launched Electronics

    Directory of Open Access Journals (Sweden)

    A. S. Haynes

    2013-01-01

    Full Text Available Electronics packages in precision guided munitions are used in guidance and control units, mission computers, and fuze-safe-and-arm devices. They are subjected to high g-loads during gun launch, pyrotechnic shocks during flight, and high g-loads upon impact with hard targets. To enhance survivability, many electronics packages are potted after assembly. The purpose of the potting is to provide additional structural support and shock damping. Researchers at the US Army recently completed a series of dynamic mechanical tests on a urethane-based potting material to assess its behavior in an electronics assembly during gun launch and under varying thermal launch conditions. This paper will discuss the thermomechanical properties of the potting material as well as simulation efforts to determine the suitability of this potting compound for gun launched electronics. Simulation results will compare stresses and displacements for a simplified electronics package with and without full potting. An evaluation of the advantages and consequences of potting electronics in munitions systems will also be discussed.

  12. RPA and POT1: friends or foes at telomeres?

    Science.gov (United States)

    Flynn, Rachel Litman; Chang, Sandy; Zou, Lee

    2012-02-15

    Telomere maintenance in cycling cells relies on both DNA replication and capping by the protein complex shelterin. Two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomere 1 (POT1) play critical roles in DNA replication and telomere capping, respectively. While RPA binds to ssDNA in a non-sequence-specific manner, POT1 specifically recognizes singlestranded TTAGGG telomeric repeats. Loss of POT1 leads to aberrant accumulation of RPA at telomeres and activation of the ataxia telangiectasia and Rad3-related kinase (ATR)-mediated checkpoint response, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. The requirement for both POT1 and RPA in telomere maintenance and the antagonism between the two proteins raises the important question of how they function in concert on telomeric ssDNA. Two interesting models were proposed by recent studies to explain the regulation of POT1 and RPA at telomeres. Here, we discuss how these models help unravel the coordination, and also the antagonism, between POT1 and RPA during the cell cycle.

  13. Micro/Nano manufacturing

    DEFF Research Database (Denmark)

    Tosello, Guido

    2017-01-01

    Micro- and nano-scale manufacturing has been the subject of an increasing amount of interest and research effort worldwide in both academia and industry over the past 10 years.Traditional (MEMS) manufacturing, but also precision manufacturing technologies have been developed to cover micro......-scale dimensions and accuracies. Furthermore, these fundamentally different technology ecosystems are currently combined in order to exploit strengths of both platforms. One example is the use of lithography-based technologies to establish nanostructures that are subsequently transferred to 3D geometries via...

  14. Results from a beam test of silicon strip sensors manufactured by Infineon Technologies AG

    Energy Technology Data Exchange (ETDEWEB)

    Dragicevic, M., E-mail: marko.dragicevic@oeaw.ac.at [Institute of High Energy Physics, Austrian Academy of Sciences, Vienna (Austria); Auzinger, G. [Institute of High Energy Physics, Austrian Academy of Sciences, Vienna (Austria); CERN, Geneva (Switzerland); Bartl, U. [Infineon Technologies Austria AG, Villach (Austria); Bergauer, T. [Institute of High Energy Physics, Austrian Academy of Sciences, Vienna (Austria); Gamerith, S.; Hacker, J. [Infineon Technologies Austria AG, Villach (Austria); König, A. [Institute of High Energy Physics, Austrian Academy of Sciences, Vienna (Austria); Infineon Technologies Austria AG, Villach (Austria); Kröner, F.; Kucher, E.; Moser, J.; Neidhart, T. [Infineon Technologies Austria AG, Villach (Austria); Schulze, H.-J. [Infineon Technologies AG, Munich (Germany); Schustereder, W. [Infineon Technologies Austria AG, Villach (Austria); Treberspurg, W. [Institute of High Energy Physics, Austrian Academy of Sciences, Vienna (Austria); Wübben, T. [Infineon Technologies Austria AG, Villach (Austria)

    2014-11-21

    Most modern particle physics experiments use silicon based sensors for their tracking systems. These sensors are able to detect particles generated in high energy collisions with high spatial resolution and therefore allow the precise reconstruction of particle tracks. So far only a few vendors were capable of producing silicon strip sensors with the quality needed in particle physics experiments. Together with the European-based semiconductor manufacturer Infineon Technologies AG (Infineon) the Institute of High Energy Physics of the Austrian Academy of Sciences (HEPHY) developed planar silicon strip sensors in p-on-n technology. This work presents the first results from a beam test of strip sensors manufactured by Infineon.

  15. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Yu-Song Guo Zhong-Duo Wang Cheng-Zhong Yan Yu-Lan Zhang Jin-Nan Zheng Yuan-Min Xu Tao Du Chu-Wu Liu · More Details Fulltext PDF ... Aifu Yang Dapeng Sun Shikai Liu Ying Dong Zhong Chen Zunchun Zhou · More Details Fulltext ...

  16. Chiral and achiral helical coordination polymers of zinc and ...

    Indian Academy of Sciences (India)

    rality depends on formation of cis coordination geom- etry around the ..... lographic Data Centre via www.ccdc.cam.ac.uk/data_ .... 324; (b) Han L and Hong M 2005 Inorg. Chem. Com ... Kang Y, Chen S, Wang F, Zhang J and Bu X 2011 Chem.

  17. Reference: 612 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 612 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u17513484i Feng Haizh...1531-45 17513484 2007 Jul Plant physiology Chen Qingguo|Feng Haizhong|Feng Jian|Yang Xiaohui|Zhang Jian|Zuo Jianru

  18. Morphology and anatomical structure of the larval salt gland of ...

    African Journals Online (AJOL)

    Ezedom Theresa

    2013-10-09

    Oct 9, 2013 ... the morphology and fine structure of the ion transporting epithelium ... The general structure of the salt gland of nauplii cultured at 180 g/L disappeared. ...... Wu G, Zhang H, Sun J, Liu F, Ge X, Chen WH, Yu, J, Wang W (2011).

  19. The refractive index of relic gravitons

    CERN Document Server

    Giovannini, Massimo

    2016-01-01

    The dynamical evolution of the refractive index of the tensor modes of the geometry produces a specific class of power spectra characterized by a blue (i.e. slightly increasing) slope which is directly determined by the competition of the slow-roll parameter and of the rate of variation of the refractive index. Throughout the conventional stages of the inflationary and post-inflationary evolution, the microwave background anisotropies measurements, the pulsar timing limits and the big-bang nucleosythesis constraints set stringent bounds on the refractive index and on its rate of variation. Within the physically allowed region of the parameter space the cosmic background of relic gravitons leads to a potentially large signal for the ground based detectors (in their advanced version) and for the proposed space-borne interferometers. Conversely, the lack of direct detection of the signal will set a qualitatively new bound on the dynamical variation of the refractive index.

  20. Size-controlled fabrication of zein nano/microparticles by modified anti-solvent precipitation with/without sodium caseinate

    OpenAIRE

    Li, Feng; Chen, Yan; Liu, Shubo; Qi, Jian; Wang, Weiying; Wang, Chenhua; Zhong, Ruiyue; Chen, Zhijun; Li, Xiaoming; Guan, Yuanzhou; Kong, Wei; Zhang, Yong

    2017-01-01

    Feng Li,1 Yan Chen,1,2 Shubo Liu,1 Jian Qi,1 Weiying Wang,1 Chenhua Wang,1 Ruiyue Zhong,1 Zhijun Chen,1 Xiaoming Li,1 Yuanzhou Guan,1 Wei Kong,1,2 Yong Zhang1,2 1National Engineering Laboratory for AIDS Vaccine, School of Life Sciences, Jilin University, Changchun, 2Key Laboratory for Molecular Enzymology and Engineering, the Ministry of Education, School of Life Sciences, Jilin University, Changchun, China Abstract: Zein-based nano/microparticles have been demonstrated to be promising carr...