WorldWideScience

Sample records for wu lingen chen

  1. KWL Lingen nuclear plant. Technical annual report 2016; KWL Kernkraftwerk Lingen. Technischer Jahresbericht 2016

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2017-07-01

    The technical annual report 2016 for KWL (Lingen nuclear plant) covers the following sections: dismantling project management and operation, monitoring and clearance; waste management, technical qualification, security and safety, central tasks; licensing and supervision procedures, operational data, radiation monitoring, radioactive materials, in-service inspections.

  2. H CHEN

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. H CHEN. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 51. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study · H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG · More Details ...

  3. Wu Chien-Shiung: A brief biography

    Science.gov (United States)

    Chiang, Tsai-Chien

    2015-12-01

    My first encounter with professor Wu Chien-Shiung, a leading experimental physicist, 31 years ago inspired me to write her biography. I received much encouragement when planning this biography, especially from Dr. Yang Chen Ning, whose biography I wrote later. The real challenges in writing Wu's biography were finding the balance between both sides of her life and overcoming the obstacle that, unlike theoretical physicists (such as Yang), experimental physicists are inclined more to deeds than to words.

  4. Chen Hengzhe

    DEFF Research Database (Denmark)

    Gimpel, Denise

    been the first to write children’s literature. In 1914 she was among the first group of women to gain a Boxer Indemnity grant to study in America. The reiteration of these many “firsts” has led to a rather stereotypical portrait of Chen Hengzhe in Chinese sources and, as a result, in most Western...

  5. Chen Hengzhe

    DEFF Research Database (Denmark)

    Gimpel, Denise

    Chen Hengzhe has been celebrated as China’s first female professor, first professor of Western history, first person to publish a history of the West that was not a translation into Chinese. She is moreover celebrated as one of the first to write fiction and poetry in the vernacular and to have......; they speak to important questions in China today. This study, then, is not a biography of a person; it is an attempt to understand the way in which foreign influences (narratives of being, organizing, thinking, writing) seep into a person’s life and work and meld with the “home” influences (narratives...

  6. Aspects of reactor dismantling planning following the safe entombment in the NPP Lingen (KWL); Aspekte der Abbauplanung nach dem Sicheren Einschluss im Kernkraftwerk Lingen (KWL)

    Energy Technology Data Exchange (ETDEWEB)

    Priesmeyer, U.; Rojahn, T.; Fries, B. [Kernkraftwerk Lingen GmbH (Germany)

    2009-07-01

    The NPP Lingen (KWL) was shut-down in 1977. Due to the fact that no final repository was available the safe entombment for 25 years was chosen following the decommissioning. The conventional plant components were dismantled and removed from the plant site. The licensing procedure for reactor dismantling with final disposal in Schacht Konrad has been started. The beginning of dismantling operation is scheduled for 2013. The authors describe the preparatory work, the boundary conditions for the dismantling, radiation protection considerations with respect to manual demolition work after the rather long decay time.

  7. Chen's inversion formula

    International Nuclear Information System (INIS)

    Hughes, B.D.; Frankel, N.E.; Ninham, B.W.

    1990-01-01

    An alternative view is presented of the Chen's generalization of a formula of classic algebraic number theory, based on the Mellin transformation and Reimann's zeta function. The advantages of the Mellin transform, as a method with a primary role in asymptotic analysis, are outlined. 10 refs

  8. An appraisal of subcooled boiling and slip ratio from measurements made in Lingen BWR

    International Nuclear Information System (INIS)

    Nash, G.

    1977-08-01

    Measurements of steam bubble velocities and voidage have been made in the relatively small Core B of Lingen BWR. The results of axial scanning in one radial position have produced experimental values of slip ratio, power (from a travelling incore probe), voidage and coolant mean density over the core height for this position. This one set of distributions has enabled us to test current UKAEA models of subcooled boiling and slip ratio against experiment. From the comparisons, it appears that we can predict the onset of voiding well, but the assumption that a constant fraction of the heat flux forms steam in the subcooled region needs modifying. Of four slip options tested, the current one used by HAMBO and JOSHUA III (Bankoff-Jones) predicts too high a slip ratio. A closer fit to experiment comes from the new Bryce flow-dependent slip option. Any changes in the modelling must be checked, however, with coupled thermal hydraulics-neutronics computations. (author)

  9. Horseshoes in modified Chen's attractors

    International Nuclear Information System (INIS)

    Huang Yan; Yang Xiaosong

    2005-01-01

    In this paper we study dynamics of a class of modified Chen's attractors, we show that these attractors are chaotic by giving a rigorous verification for existence of horseshoes in these systems. We prove that the Poincare maps derived from these modified Chen's attractors are semi-conjugate to the 2-shift map

  10. Publication of the planned erection and operation of a nuclear power plant near the town of Lingen, Emsland

    International Nuclear Information System (INIS)

    Anon.

    1979-01-01

    The nuclear power plant site is planned in the south Lingen industrial park in field 5 of the Darme district and in fields 34 and 35 of the Bramsche district, about 0.6 km nortn-east of the section between kilometers 139 and 140 of the Dortmund-Ems canal which shares the river bed of the Ems in this section. The nuclear power plant will have a PWR with a thermal power of 3765 MW, i.e. an electrical gross power of 1291 MWe during normal operation under design conditions. Heat removal from the turbine condenser will take place in closed recirculation cooling operation via a natural-draught cooling tower. (orig.) [de

  11. [Professor WU Zhongchao's experience of penetration needling].

    Science.gov (United States)

    Zhang, Ning; Wang, Bing; Zhou, Yu

    2016-08-12

    Professor WU Zhongchao has unique application of penetration needling in clinical treatment. Professor WU applies penetration needling along meridians, and the methods of penetration needling include self-meridian penetration, exterior-interior meridian penetration, identical-name meridian penetration, different meridian penetration. The meridian differentiation is performed according to different TCM syndromes, locations and natures of diseases and acupoint nature, so as to make a comprehensive assessment. The qi movement during acupuncture is focused. In addition, attention is paid on anatomy and long-needle penetration; the sequence and direction of acupuncture is essential, and the reinforcing and reducing methods have great originality, presented with holding, waiting, pressing and vibrating. Based on classical acupoint, the acupoint of penetration needling is flexible, forming unique combination of acupoints.

  12. Non-minimal Wu-Yang monopole

    International Nuclear Information System (INIS)

    Balakin, A.B.; Zayats, A.E.

    2007-01-01

    We discuss new exact spherically symmetric static solutions to non-minimally extended Einstein-Yang-Mills equations. The obtained solution to the Yang-Mills subsystem is interpreted as a non-minimal Wu-Yang monopole solution. We focus on the analysis of two classes of the exact solutions to the gravitational field equations. Solutions of the first class belong to the Reissner-Nordstroem type, i.e., they are characterized by horizons and by the singularity at the point of origin. The solutions of the second class are regular ones. The horizons and singularities of a new type, the non-minimal ones, are indicated

  13. Mechanical analysis of Chen chaotic system

    International Nuclear Information System (INIS)

    Liang, Xiyin; Qi, Guoyuan

    2017-01-01

    The Chen chaotic system is transformed into Kolmogorov type system, which is decomposed into four types of torques: inertial torque, internal torque, dissipation and external torque. By the combinations of different torques, five cases are studied to discover key factors of chaos generation and the physical meaning. The conversion among Hamiltonian energy, kinetic energy and potential energy is investigated in these five cases. The relationship between the energies and the parameters is studied. It concludes that the combination of these four types of torques is necessary conditions to produce chaos, and any combination of three types of torques cannot produce chaos in Chen system.

  14. Immunogenicity of novel sulfadimethoxide conjugates | Chen ...

    African Journals Online (AJOL)

    Immunogenicity of novel sulfadimethoxide conjugates. L Chen, J Su, X Zhang, L Li, X He. Abstract. Sulfadimethoxine (SDM) is an antibiotic commonly added to animal feeds. Anti-SDM antibodies are useful for the detection of residual SDM in foods, feeds and biological fluids by ELISA. In this study, we show that SDM is ...

  15. Titanisierung von Implantatoberflächen

    Science.gov (United States)

    Zimmermann, Hanngörg; Heinlein, Markus; Guldner, Norbert W.

    Titan gilt seit Jahrzehnten als einer der wichtigsten Implantatwerkstoffe in der Medizin. Neben den guten mechanischen Eigenschaften (Leichtigkeit, hohe Festigkeit etc.), besitzen Titanimplantate vor allem eine hervorragende Körperverträglichkeit, so dass die Implantate optimal in den humanen Organismus integriert werden [1]. Ist jedoch aufgrund der Anforderungen an das Implantat eine hohe Flexibilität und/ oder Elastizität gefragt, so scheidet der Werkstoff Titan aufgrund seiner spröden und unflexiblen Materialeigenschaften aus. Die Folge ist der Einsatz von Implantatmaterialien, sowohl künstlichen als auch biologischen Ursprungs, welche nicht selten eine unzureichende Biokompatibilität aufweisen und somit zu Fremdköper- und immunologischen Reaktionen und Einkapselung des Implantates führen können. Die Erhöhung der Körperverträglichkeit, eine Adaption an das biologische Umfeld und eine hohe Biokompatibilität sind demzufolge die wichtigsten Eigenschaften bei der bedarfsgerechten Herstellung von Implantaten und Implantatoberflächen. Zur Gestaltung von innovativen, biokompatiblen Oberflächen stehen unterschiedliche technische Lösungsansätze zur Verfügung. Zum einen besteht die Möglichkeit, geeignete Oberflächeneigenschaften aus dem Grundmaterial selbst zu optimieren. Dies geschieht unter anderem durch Modifikation der Werkstoffoberflächen in Form von Texturierungen und Oberflächenrauhigkeiten. Zum anderen können die Oberflächeneigenschaften unabhängig von denen des Trägermaterials gestaltet werden. Durch Funktionalisierung der Oberflächen mit geeigneten Beschichtungen oder der Zugabe von Medikamenten (Drug Eluting) werden die Kunststoffimplantate dahingehend verändert, dass eine Steigerung der Körperakzeptanz erreicht wird. Die Titanbeschichtung von Implantatoberflächen kombiniert die positiven Materialeigenschaften von Titan und Polymer.

  16. Chaos control of Chen chaotic dynamical system

    International Nuclear Information System (INIS)

    Yassen, M.T.

    2003-01-01

    This paper is devoted to study the problem of controlling chaos in Chen chaotic dynamical system. Two different methods of control, feedback and nonfeedback methods are used to suppress chaos to unstable equilibria or unstable periodic orbits (UPO). The Lyapunov direct method and Routh-Hurwitz criteria are used to study the conditions of the asymptotic stability of the steady states of the controlled system. Numerical simulations are presented to show these results

  17. Impulsive synchronization of Chen's hyperchaotic system

    International Nuclear Information System (INIS)

    Haeri, Mohammad; Dehghani, Mahsa

    2006-01-01

    In this Letter the impulsive synchronization of the Chen's hyperchaotic systems is discussed. Some new and sufficient conditions on varying impulsive distance are established in order to guarantee the synchronizabillity of the systems using the synchronization method. In particular, some simple conditions are derived in synchronizing the systems by equal impulsive distances. Two illustrative examples are provided to show the feasibility and the effectiveness of the proposed method. The boundaries of the stable regions are also estimated

  18. On soliton solutions of the Wu-Zhang system

    Directory of Open Access Journals (Sweden)

    Inc Mustafa

    2016-01-01

    Full Text Available In this paper, the extended tanh and hirota methods are used to construct soliton solutions for the WuZhang (WZ system. Singular solitary wave, periodic and multi soliton solutions of the WZ system are obtained.

  19. Stability analysis of distributed order fractional chen system.

    Science.gov (United States)

    Aminikhah, H; Refahi Sheikhani, A; Rezazadeh, H

    2013-01-01

    We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results.

  20. Stability Analysis of Distributed Order Fractional Chen System

    Science.gov (United States)

    Aminikhah, H.; Refahi Sheikhani, A.; Rezazadeh, H.

    2013-01-01

    We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results. PMID:24489508

  1. [The essence of Professor Wu Lian-Zhong's acupuncture manipulation].

    Science.gov (United States)

    Liu, Jing; Guo, Yi; Wu, Lian-Zhong

    2014-05-01

    The painless needle insertion technique, summarized by Professor WU Lian-zhong during his decades of acupuncture clinical practice is introduced in this article, which is characterized as soft, flexible, fast, plucking and activating antipathogenic qi. The Sancai (three layers) lifting and thrusting manipulation technique is adopted by Professor WU for getting the qi sensation. And features of 10 kinds of needling sensation such as soreness, numbness, heaviness, distension, pain, cold, hot, radiation, jumping and contracture are summarized. Finger force, amplitude, speed and time length are also taken as the basis of reinforcing and reducing manipulations. Moreover, examples are also given to explain the needling technique on some specific points which further embodies Professor WU's unique experiences and understandings on acupuncture.

  2. Adaptive synchronization of hyperchaotic Chen system with uncertain parameters

    International Nuclear Information System (INIS)

    Park, Ju H.

    2005-01-01

    This article addresses control for the chaos synchronization of hyperchaotic Chen system with five uncertain parameters. Based on the Lyapunov stability theory, an adaptive control law is derived to make the states of two identical hyperchaotic Chen systems asymptotically synchronized. Finally, a numerical simulations is presented to show the effectiveness of the proposed chaos synchronization scheme

  3. Chaos in the fractional order Chen system and its control

    International Nuclear Information System (INIS)

    Li Chunguang; Chen Guanrong

    2004-01-01

    In this letter, we study the chaotic behaviors in the fractional order Chen system. We found that chaos exists in the fractional order Chen system with order less than 3. The lowest order we found to have chaos in this system is 2.1. Linear feedback control of chaos in this system is also studied

  4. Complete synchronization of two Chen-Lee systems

    International Nuclear Information System (INIS)

    Sheu, L-J; Chen, J-H; Chen, H-K; Tam, L-M; Lao, S-K; Chen, W-C; Lin, K-T

    2008-01-01

    This study demonstrates that complete synchronization of two Chen-Lee chaotic systems can be easily achieved. The upper bound of the Chen-Lee chaotic system is estimated numerically. A controller is designed to synchronize two chaotic systems. Sufficient conditions for synchronization are obtained using Lyapunov's direct method. Two numerical examples are presented to verify the proposed synchronization approach

  5. Wu-Ling-San formula prophylaxis against recurrent calcium oxalate ...

    African Journals Online (AJOL)

    Wu-Ling-San (WLS) formula has been proved to prevent calcium oxalate nephrolithiasis both in vitro and in vivo. This is the first prospective, randomized and placebo-controlled clinical trial of WLS in calcium oxalate nephrolithiasis prevention. All patients who enrolled were asked to drink enough fluid to urinate at least 2 L ...

  6. Towards a Collective Intelligence: Transmediality and the Wu Ming Project

    Directory of Open Access Journals (Sweden)

    Melina Anne Masterson

    2014-11-01

    Full Text Available Dagli albori della Seconda Repubblica in Italia,  le strategie di dominio sui mass media dell’ex premier Silvio Berlusconi hanno avuto un effetto considerevole sull’immaginario culturale italiano. In un approccio multisensoriale e multimediale alla scrittura, il collettivo Wu Ming mette in questione i paradigmi culturali che negli ultimi venti anni sono diventati egemonici. L’esperienza di un romanzo dei Wu Ming va ben oltre la parola stampata poiché cerca di stimolare tutti i cinque sensi per arricchire il modo in cui il lettore vive quello che c’è sulla pagina, dimostrando esempi chiari della «convergence culture» coniata da Henry Jenkins. Questo saggio esamina l’interazione tra parola e immagine messa in atto dal collettivo tramite il sito Pinterest e illustra come questo aspetto del loro progetto rappresenti un microcosmo di un approccio complessivo alla creazione estetica e alla pratica culturale. Inoltre, questo saggio descrive in che modo il processo collettivo di consumo portato avanti dai Wu Ming contribuisca alla formazione delle «communities of sentiment» di Arjun Appadurai e alla «intelligenza collettiva» di Jenkins. Queste sono formazioni che rivitalizzano il concetto di cultura popolare per la nostra epoca digitale e offrono un’alternativa ad un immaginario culturale italiano sovra-determinato dalle pratiche del Berlusconismo.

  7. A simple observer of the generalized Chen chaotic systems

    International Nuclear Information System (INIS)

    Sun, Y.-J.

    2009-01-01

    In this paper, the generalized Chen chaotic system is considered and the state observation problem of such a system is investigated. Based on the time-domain approach, a simple observer for the generalized Chen chaotic system is proposed to guarantee the global exponential stability of the resulting error system. Furthermore, the guaranteed exponential convergence rate can be correctly estimated. Finally, a numerical example is provided to illustrate the use of the main result.

  8. Combinatorial interpretation of Haldane-Wu fractional exclusion statistics.

    Science.gov (United States)

    Aringazin, A K; Mazhitov, M I

    2002-08-01

    Assuming that the maximal allowed number of identical particles in a state is an integer parameter, q, we derive the statistical weight and analyze the associated equation that defines the statistical distribution. The derived distribution covers Fermi-Dirac and Bose-Einstein ones in the particular cases q=1 and q--> infinity (n(i)/q-->1), respectively. We show that the derived statistical weight provides a natural combinatorial interpretation of Haldane-Wu fractional exclusion statistics, and present exact solutions of the distribution equation.

  9. Comparing numerical methods for the solutions of the Chen system

    International Nuclear Information System (INIS)

    Noorani, M.S.M.; Hashim, I.; Ahmad, R.; Bakar, S.A.; Ismail, E.S.; Zakaria, A.M.

    2007-01-01

    In this paper, the Adomian decomposition method (ADM) is applied to the Chen system which is a three-dimensional system of ODEs with quadratic nonlinearities. The ADM yields an analytical solution in terms of a rapidly convergent infinite power series with easily computable terms. Comparisons between the decomposition solutions and the classical fourth-order Runge-Kutta (RK4) numerical solutions are made. In particular we look at the accuracy of the ADM as the Chen system changes from a non-chaotic system to a chaotic one. To highlight some computational difficulties due to a high Lyapunov exponent, a comparison with the Lorenz system is given

  10. The age grading and the Chen-Ruan cup product

    DEFF Research Database (Denmark)

    A. Hepworth, Richard

    2010-01-01

    We prove that the obstruction bundle used to define the cup-product in Chen-Ruan cohomology is determined by the so-called `age grading' or `degree-shifting numbers'. Indeed, the obstruction bundle can be directly computed using the age grading. We obtain a Kunneth Theorem for Chen-Ruan cohomology...... as a direct consequence of an elementary property of the age grading, and explain how several other results - including associativity of the cup-product - can be proved in a similar way....

  11. On a conjecture of Chen-Guo-Wang

    OpenAIRE

    Ning, Bo; Zheng, Yu

    2015-01-01

    Towards confirming Sun's conjecture on the strict log-concavity of combinatorial sequence involving the n$th$ Bernoulli number, Chen, Guo and Wang proposed a conjecture about the log-concavity of the function $\\theta(x)=\\sqrt[x]{2\\zeta(x)\\Gamma(x+1)}$ for $x\\in (6,\\infty)$, where $\\zeta(x)$ is the Riemann zeta function and $\\Gamma(x)$ is the Gamma function. In this paper, we first prove this conjecture along the spirit of Zhu's previous work. Second, we extend Chen et al.'s conjecture in the ...

  12. An equilibrium point stabilization strategy for the Chen system

    International Nuclear Information System (INIS)

    Alvarez-Ramirez, Jose; Cevantes, Ilse; Femat, Ricardo

    2004-01-01

    The aim of this Letter is to address the equilibrium point stabilization problem of the Chen system by employing a simple linear feedback controller derived from time-scaling the dynamics of a single variable. The controller has the advantage of being easy to implement and a rigorous stability proof is provided based on singular perturbation arguments. Results are illustrated via numerical simulations

  13. Dynamics of fractional-ordered Chen system with delay

    Indian Academy of Sciences (India)

    Though this subject has a history of more than 300 years, utility and applicability of fractional calculus to various branches of science and engineering have been real- ... variants of Chen system and see the qualitative changes in attractor and ...

  14. Generalized projective synchronization between Lorenz system and Chen's system

    International Nuclear Information System (INIS)

    Li Guohui

    2007-01-01

    On the basis of active backstepping design, this paper presents the generalized projective synchronization between two different chaotic systems: Lorenz system and Chen's system. The proposed method combines backstepping methods and active control without having to calculate the Lyapunov exponents and the eigenvalues of the Jacobian matrix, which makes it simple and convenient. Numerical simulations show that this method works very well

  15. Professor Ta-You Wu and his ideas of science

    International Nuclear Information System (INIS)

    Ye Minghan; Dai Nianzu

    2005-01-01

    The career of Professor Ta-You Wu and his contributions in the latter half of his life in Taiwan, China are briefly reviewed. The authors focus our discussion on some of his ideas in pushing forward the advancement of science and technology in Taiwan and in promoting scientific standards. These ideas include: emphasis on the importance of basic science and qualified personnel as the foundation for the development of science and technology, and while advocating applied science he pointed out that 'future profits depend on high technology'. Thus, he contributed greatly to the rise of the economy in Taiwan. His view of the dispute between Bohr and Einstein is also briefly reviewed, as well as his principles of leadership as the president of Academia Sinica, Taiwan. (author)

  16. Alternative implementation of the chaotic Chen-Lee system

    International Nuclear Information System (INIS)

    Sheu, L.-J.; Tam, L.-M.; Chen, H.-K.; Lao, S.-K.

    2009-01-01

    The chaotic Chen-Lee system was developed with a formalism based on the Euler equations for the motion of a rigid body. It was proved that this system is the governing set of equations for gyro motion with feedback control. Recently, studies were conducted to explore the dynamic behavior of this system, including fractional order behavior, the generation of hyperchaos and perturbation analysis, control and anti-control of chaos, synchronization, etc. In this study, we further explore (1) the stability of the equilibrium points and (2) the implementation of an electronic circuit using the Chen-Lee system. It is shown that not only is this system related to gyro motion but can also be applied to electronic circuits for encryption purposes.

  17. Chaos synchronization between Chen system and Genesio system

    International Nuclear Information System (INIS)

    Wu Xianyong; Guan Zhihong; Wu Zhengping; Li Tao

    2007-01-01

    This Letter presents two synchronization schemes between two different chaotic systems. Active control synchronization and adaptive synchronization between Chen system and Genesio system are studied, different controllers are designed to synchronize the drive and response systems, active control synchronization is used when system parameters are known; adaptive synchronization is employed when system parameters are unknown or uncertain. Simulation results show the effectiveness of the proposed schemes

  18. Effect of healthy Qigong “WuQinXi” exercise on peripheral blood T ...

    African Journals Online (AJOL)

    USER

    2010-07-19

    Jul 19, 2010 ... cell subgroups in elderly “WuQinXi” practitioners. Fifty healthy Chinese ... on health condition, diet, medical history, lifestyle and menstrual status, .... Mechanism of health-promotion of “WuQinXi” exercise created in East Hai ...

  19. We Can't Get No (Life) Satisfaction? Comment on Oswald and Wu (2010)

    Science.gov (United States)

    Pesta, Bryan J.; McDaniel, Michael A.; Bertsch, Sharon

    2010-01-01

    Oswald and Wu (2010; "Science") recently reported life satisfaction ranks for residents of the 50 U.S. states. Their rankings were framed as measures of "well-being," but were derived from responses to only a single survey item ("In general, how satisfied are you with your life?"). Here we contrast Oswald and Wu's subjective rankings with our…

  20. Governing Civil Service Pay in China, by Alfred M. Wu. Copenhagen: NIAS Press, 2014. xvi+236 pp

    DEFF Research Database (Denmark)

    Brødsgaard, Kjeld Erik

    2016-01-01

    Book review of: Governing Civil Service Pay in China by Alfred M. Wu. Copenhagen: NIAS Press, 2014.......Book review of: Governing Civil Service Pay in China by Alfred M. Wu. Copenhagen: NIAS Press, 2014....

  1. Chien-Shiung Wu: An Icon of Physicist and Woman Scientist in China

    Science.gov (United States)

    Zhu, Yuelin

    2014-03-01

    Chien-Shiung Wu, the first female president of APS, is a well-known figure in China, a figure who serves as an inspiration for youths, especially young women, to study science and particularly physics. In this presentation, a historical perspective will be used to show how such an icon was formed. Born in 1912, the year of the Republic Revolution, Wu was in the first generation of physicists in China and her college mentor was a student of Marie Curie. When Wu came to the U.S. for graduate studies in the 1930s, it was a ``golden age'' for nuclear physics, and the invention of the cyclotron by E. O. Lawrence put UC Berkeley at the frontier. Wu was trained there, with Lawrence as her advisor, and later became an expert in Beta-decay. In 1956, Wu conceived and initiated the experiment of Cobalt-60, which, together with other two experiments, eventually proved the asymmetry of parity in weak-interactions, a hypothesis proposed by T. D. Lee and C. N. Yang. The importance of the experiment gained Wu an enormous reputation which spread even to China, when this was a period of hostility in Sino-American relations, and near total isolation due to the Cold-War. Wu was the daughter of a revolutionary, and an activist in college in patriotic student movements, and she combined this background with her scientific career as the way of ``Saving China with Science,'' a common belief reflecting the Zeitgeist of her time. Although she spent most of her life in the U.S., Wu never wavered in her love for or loyalty to her motherland. Her patriotism, as well as her scientific achievement, made Wu a legend in China, being called ``the Chinese Madam Curie.'' Even during the Cultural Revolution, a novel supposedly taking Wu as the original model was very popular in underground circles, widely spread by hand-written-copies. From 1979-1988, the CUSPEA program enrolled hundreds of China's best graduate students into physics departments in American universities. Although Wu herself was not

  2. [Professor CHEN Xiuhua's experience in the treatment of atopic dermatitis].

    Science.gov (United States)

    Quan, Xiaohong; Li, Shuqian; Li, Ying

    2017-03-12

    Professor CHEN Xiuhua 's clinical experiences were introduced in the intervention on atopic dermatitis with external therapies of TCM acupuncture. On the basis of the theory as cultivating the earth and clearing the heart from professor CHEN Dacan and in terms of the disease stages and skin lesion characteristics, as well as in consideration of syndrome differen-tiation, the acupoints for strengthening the spleen and clearing heart fire are selected, such as Zhongwan (CV 12), Daheng (SP 15), Shuifen (CV 9), Tianshu (ST 25), Neiguan (PC 6) and Quchi (LI 11). For the repair of skin lesion, the integration of Chinese and western medicine is used, with the internal application and external use of Chinese herbal medicines involved. The topical ointments are selected rationally. The self-blood therapy is used with acupuncture, bleeding therapy and acupoint injection applied in combination on the basis of the theory of TCM zangfu organs and modern immunological mechanism, which stimulates the nonspecific immune response in the body and strengthens acupoint stimulus effects. Medical thread therapy of Guangxi Zhuang medicine is used in moxibustion for skin damage, which effectively stops itching and promotes wound healing and skin repair.

  3. Interlopers, Rogues, or Cosmopolitans? Wu Jianzhang and Early Modern Commercial Networks on the China Coast

    Directory of Open Access Journals (Sweden)

    Peter C. Perdue

    2017-12-01

    Full Text Available After the First Opium War (1839–1842, British and American merchants negotiated with Chinese officials in Shanghai to work out the framework of the new treaty port regime. One key player in these negotiations was Wu Jianzhang, a Cantonese merchant who became circuit intendant of the Shanghai region. Wu, however, also had links to Cantonese sailors and anti-Qing secret societies. When the Small Swords Society took Shanghai in 1853, he found himself entangled in conflicting responsibilities and networks. Foreign traders and Chinese officials regarded Wu, like other middlemen on the Chinese coast, with a mixture of respect and distrust. Wu’s situation, however, was not unique to the mid-nineteenth century. This article compares Wu to other intermediaries who played similar roles in the sixteenth and late nineteenth centuries, in order to show the ways in which Wu, his predecessors, and those who followed in his footsteps connected China to the wider world by navigating the treacherous waters of diplomacy, war, and commerce. The work of John K. Fairbank, who in the 1950s pioneered the study of such people as Wu Jianzhang, can find new meaning in the twenty-first century, enabling us to understand the transnational implications of China’s local social history.

  4. Lattice models and integrability: a special issue in honour of F Y Wu

    Science.gov (United States)

    Guttmann, A. J.; Jacobsen, J. L.

    2012-12-01

    Fa Yueh (Fred) Wu was born on 5 January 1932 in Nanking (now known as Nanjing), China, the capital of the Nationalist government. Wu began kindergarten in 1937 in a comfortable setting, as his father held a relatively high government position. But the Sino-Japanese war broke out in July 1937, and Nanking fell to Japanese hands in November. Fleeing the Japanese, his parents brought Wu to their hometown in Hunan, and then to the war capital Chungking (now Chongqing) in 1938, where they lived for eight years until the end of the war. Around that time the Japanese began bombing Chungking, and Wu's childhood memories were dominated by air raids, bombings and burning not dissimilar to those experienced by Londoners during the war. At times the air raids lasted for days disrupting everyday lives in Chungking, including Wu's schooling. One day during a fierce bombing raid, a bomb fell in their garden reducing a pavilion and the surrounding pond to a huge crater; another bomb fell just a few metres from the tunnel where his family took shelter, almost sealing the only entrance. The family moved the very next day to the countryside. As a result of the war, Wu attended seven schools before finishing his primary education. Fortunately, by the time he entered junior high school in 1943, the Japanese forces were on the wane and Wu entered the elite middle school, Nankai. His early academic performance in Nankai seemed to him mediocre, but he nevertheless impressed his geometry teacher by showing bursts of talent. With hindsight, this early interest in geometry may have led to his later insights in graphical analyses of statistical systems. The family returned to Nanking in 1946 after the Victory over Japan Day. By this time his father had become elected to the Legislative Yuan, the equivalent of the US Senate. Wu entered high school in Nanking in 1946. Since he came from an elite school in Chungking, he excelled in most of his classes, especially mathematics. Notwithstanding his

  5. Ray Wu as Fifth Business: Deconstructing collective memory in the history of DNA sequencing.

    Science.gov (United States)

    Onaga, Lisa A

    2014-06-01

    The concept of 'Fifth Business' is used to analyze a minority standpoint and bring serious attention to the role of scientists who play a galvanizing role in a science but for multiple reasons appear less prominently in more common recounts of any particular development. Biochemist Ray Wu (1928-2008) published a DNA sequencing experiment in March 1970 using DNA polymerase catalysis and specific nucleotide labeling, both of which are foundational to general sequencing methods today. The scant mention of Wu's work from textbooks, research articles, and other accounts of DNA sequencing calls into question how scientific collective memory forms. This alternative history seeks to understand why a key figure in nucleic acid sequence analysis has remained less visibly connected or peripheral to solidifying narratives about the history of DNA sequencing. The study resists predictable dismissals of Wu's work in order to seriously examine the formation of his nucleic acid sequence analysis research program and how he shared his knowledge of sequencing during a period of rapid advancement in the field. An analysis of Wu's work on sequencing the cohesive ends of lambda bacteriophage in the 1960s and 1970s exemplifies how a variety of individuals and groups attempted to develop protocol for sequencing the order of nucleotide base pairs comprising DNA. This historical examination of the sociality of scientific research suggests a way to understand how Wu and others contributed to the very collective memory of DNA sequencing that Wu eventually tried to repair. The study of Wu, who was a Chinese immigrant to the United States, provides a foundation for further critical scholarship on the heterogeneous histories of Asian American bioscientists, the sociality of their scientific works, and how the resulting knowledge produced is preserved, if not evenly, in a scientific field's collective memory. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Eine praktische Anwendung von CMC-Flächen in der Bionik

    OpenAIRE

    Apeltauer, Christian

    2011-01-01

    Die vorliegende Arbeit beschäftigt sich mit den theoretischen Grundlagen für die Entwicklung von Oberflächen, die unter Wasser möglichst lange eine Luftschicht an sich halten können. Ein natürliches Vorbild für solche Oberflächen ist die Pflanze Salvinia molesta; technisch interessieren solche Oberflächen zur Verringerung des Wasserwiderstandes von Schiffen und als Schutz vor Besiedlung durch Wasserorganismen. Wichtigste Gleichung bei der Entwicklung solcher Oberflächen ist...

  7. How Memory Is Tested Influences What Is Measured: Reply to Wyble and Chen (2017)

    Science.gov (United States)

    Swallow, Khena M.; Jiang, Yuhong V.; Tan, Deborah H.

    2017-01-01

    In this response to Wyble and Chen's (2017) commentary on attribute amnesia, we hope to achieve several goals. First, we clarify how our view diverges from that described by Wyble and Chen. We argue that because the surprise memory test is disruptive, it is an insensitive tool for measuring the persistence of recently attended target attributes in…

  8. The Hintermann-Merlini-Baxter-Wu and the infinite-coupling-limit Ashkin-Teller models

    Energy Technology Data Exchange (ETDEWEB)

    Huang Yuan, E-mail: huangy22@mail.ustc.edu.cn [Hefei National Laboratory for Physical Sciences at Microscale and Department of Modern Physics, University of Science and Technology of China, Hefei, Anhui 230026 (China); Deng Youjin, E-mail: yjdeng@ustc.edu.cn [Hefei National Laboratory for Physical Sciences at Microscale and Department of Modern Physics, University of Science and Technology of China, Hefei, Anhui 230026 (China); Jacobsen, Jesper Lykke, E-mail: jacobsen@lpt.ens.fr [Laboratoire de Physique Theorique, Ecole Normale Superieure, 24 rue Lhomond, 75231 Paris (France); Universite Pierre et Marie Curie, 4 place Jussieu, 75252 Paris (France); Salas, Jesus, E-mail: jsalas@math.uc3m.es [Grupo de Modelizacion, Simulacion Numerica y Matematica Industrial, Universidad Carlos III de Madrid, Avda. de la Universidad 30, 28911 Leganes (Spain); Grupo de Teorias de Campos y Fisica Estadistica, Instituto Gregorio Millan, Universidad Carlos III de Madrid, Unidad asociada al IEM-CSIC, Madrid (Spain)

    2013-03-11

    We show how the Hintermann-Merlini-Baxter-Wu model (which is a generalization of the well-known Baxter-Wu model to a general Eulerian triangulation) can be mapped onto a particular infinite-coupling-limit of the Ashkin-Teller model. We work out some mappings among these models, also including the standard and mixed Ashkin-Teller models. Finally, we compute the phase diagram of the infinite-coupling-limit Ashkin-Teller model on the square, triangular, hexagonal, and kagome lattices.

  9. On the de Rham–Wu decomposition for Riemannian and Lorentzian manifolds

    International Nuclear Information System (INIS)

    Galaev, Anton S

    2014-01-01

    It is explained how to find the de Rham decomposition of a Riemannian manifold and the Wu decomposition of a Lorentzian manifold. For that it is enough to find parallel symmetric bilinear forms on the manifold, and do some linear algebra. This result will allow to compute the connected holonomy group of an arbitrary Riemannian or Lorentzian manifold. (paper)

  10. Rap and Resistance: A Social Movement of the Wu-Tang Clan.

    Science.gov (United States)

    Chasteen, Amy L.; Shriver, Thomas

    1998-01-01

    Examines specific collective identity and political expression of the rap group the Wu-Tang Clan. Reveals a multi-layered political strategy that has been conscientiously designed and implemented to instigate a social movement. Prioritizes the voices of marginalized Black peoples and provides raw narratives about oppression. (MMU)

  11. Analysing the Wu metric on a class of eggs in Cn–II

    Indian Academy of Sciences (India)

    Home; Journals; Proceedings – Mathematical Sciences; Volume 127; Issue 3. Analysing the Wu metric on a class of eggs in C C n – I I .... G P BALAKUMAR1 PRACHI MAHAJAN2. Indian Statistical Institute, Chennai 600 113, India; Department of Mathematics, Indian Institute of Technology – Bombay, Mumbai 400 076, India ...

  12. Analysing the Wu metric on a class of eggs in ℂn – I

    Indian Academy of Sciences (India)

    G P BALAKUMAR

    An explicit description of the Wu metric on the Thullen domains (these are also ..... K(p,v), when p varies across Z. It suffices to focus attention on the case when p varies ... Substituting this into (6.3) and dividing throughout by ˜t2| ˆw|2p2. 1.

  13. Strength-based Supervision: Frameworks, Current Practice, and Future Directions A Wu-wei Method.

    Science.gov (United States)

    Edwards, Jeffrey K.; Chen, Mei-Whei

    1999-01-01

    Discusses a method of counseling supervision similar to the wu-wei practice in Zen and Taoism. Suggests that this strength-based method and an understanding of isomorphy in supervisory relationships are the preferred practice for the supervision of family counselors. States that this model of supervision potentiates the person-of-the-counselor.…

  14. Investigation of the Livengood–Wu integral for modelling autoignition in a high-pressure bomb

    NARCIS (Netherlands)

    Hu, Zhixin; Somers, Bart L.M.T.; Cracknell, Roger F.; Bradley, Derek

    2016-01-01

    The reaction progress variable, which is widely used in premixed and diffusion combustion studies, comprises a set of pre-selected intermediate species to denote reaction progress. Progress towards autoignition can also be traced by the Livengood–Wu (LW) integral. Autoignition occurs when the LW

  15. Forecasting Jakarta composite index (IHSG) based on chen fuzzy time series and firefly clustering algorithm

    Science.gov (United States)

    Ningrum, R. W.; Surarso, B.; Farikhin; Safarudin, Y. M.

    2018-03-01

    This paper proposes the combination of Firefly Algorithm (FA) and Chen Fuzzy Time Series Forecasting. Most of the existing fuzzy forecasting methods based on fuzzy time series use the static length of intervals. Therefore, we apply an artificial intelligence, i.e., Firefly Algorithm (FA) to set non-stationary length of intervals for each cluster on Chen Method. The method is evaluated by applying on the Jakarta Composite Index (IHSG) and compare with classical Chen Fuzzy Time Series Forecasting. Its performance verified through simulation using Matlab.

  16. Review of the genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae) with description of two new species.

    Science.gov (United States)

    Chang, Zhi-Min; Yang, Lin; Zhang, Zheng-Guang; Chen, Xiang-Sheng

    2015-12-11

    Two new species of the issid genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae): Neotetricodes longispinus Chang et Chen sp. nov. (China: Yunnan) and Neotetricodes xiphoideus Chang et Chen sp. nov. (China: Yunnan) are described and illustrated. The generic characteristic is redefined. A checklist and key to the species of the genus are provided. The female genitalia of the genus are firstly described.

  17. Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe

    OpenAIRE

    Spinner, Kaspar H.

    2014-01-01

    Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe. - In: Standardorientierung im Lese- und Literaturunterricht der Sekundarstufe I / Cornelia Rosebrock ; Heike Wirthwein. - Baltmannsweiler : Schneider-Verl. Hohengehren, 2014. - S. 126-132

  18. Mellin-Barnes regularization, Borel summation and the Bender-Wu asymptotics for the anharmonic oscillator

    International Nuclear Information System (INIS)

    Kowalenko, V.; Rawlinson, A.A.

    1998-01-01

    We introduce the numerical technique of Mellin-Barnes regularization, which can be used to evaluate both convergent and divergent series. The technique is shown to be numerically equivalent to the corresponding results obtained by Borel summation. Both techniques are then applied to the Bender-Wu formula, which represents an asymptotic expansion for the energy levels of the anharmonic oscillator. We find that this formula is unable to give accurate values for the ground state energy, particularly when the coupling is greater than 0.1. As a consequence, the inability of the Bender-Wu formula to yield exact values for the energy level of the anharmonic oscillator cannot be attributed to its asymptotic nature. (authors)

  19. The complete mitochondrial genome of a stonefly species, Kamimuria chungnanshana Wu, 1948 (Plecoptera: Perlidae).

    Science.gov (United States)

    Wang, Kai; Ding, Shuangmei; Yang, Ding

    2016-09-01

    This study determined the complete mitochondrial (mt) genome of the stonefly, Kamimuria chungnanshana Wu, 1948. The mt genome is 15, 943 bp in size and contains 37 canonical genes which include 22 transfer RNA genes, 13 protein-coding genes, and two ribosomal RNA genes, the control region is 1062 bp in length. The phylogenetic tree shows that Kamimuria chungnanshana is sister group of Kamimuria wangi.

  20. Madame Wu Chien-Shiung the first lady of physics research

    CERN Document Server

    Chiang, Tsai-Chien

    2014-01-01

    Narrating the well-lived life of the "Chinese Madame Curie" - a recipient of the first Wolf Prize in Physics (1978), the first woman to receive an honorary doctorate from Princeton University, as well as the first female president of the American Physics Society - this book provides a comprehensive and honest account of the life of Dr. Chien-Shiung Wu, an outstanding and leading experimental physicist of the 20th century.

  1. Sociology in Times of Crisis: Chen Da, National Salvation and the Indigenization of Knowledge

    Directory of Open Access Journals (Sweden)

    Ana Maria Candela

    2015-08-01

    Full Text Available Chen Da was one of the foremost sociologists of China from the 1920s to the 1940s. His intellectual habitus took shape from the long crisis that defined Chinese intellectual life from the mid-19th to mid-20th centuries, a period of continuous imperial assault on Chinese sovereignty. As China integrated into the capitalist world-system, neo-Confucian structures of knowledge came into question. Intellectuals took up sociology to guide China’s transition from an empire to a nation-state. Through his studies on labor, migration, and population, Chen Da contributed to the institutionalization of sociology in China. Chen sought to craft a theory of Chinese development that followed universal trajectories of progress but was also attuned to the complexity of Chinese society on the ground. Through his efforts to indigenize sociology, Chen developed a non-Marxist historical materialism, a deterritorialized and pluralistic conceptualization of China as a nation, and a theory of eugenic transformation centered on the concept of “mode of living.” The questions which Chen Da confronted are emblematic of the predicament faced by Chinese social scientists today, who again struggle with the dynamics of a deterritorialzied “Greater China,” rising social fragmentation, and refigured eugenic discourses and policies that aim to craft the Chinese people into ideal national subjects fit for post-socialist development.

  2. Hopf bifurcation analysis of Chen circuit with direct time delay feedback

    International Nuclear Information System (INIS)

    Hai-Peng, Ren; Wen-Chao, Li; Ding, Liu

    2010-01-01

    Direct time delay feedback can make non-chaotic Chen circuit chaotic. The chaotic Chen circuit with direct time delay feedback possesses rich and complex dynamical behaviours. To reach a deep and clear understanding of the dynamics of such circuits described by delay differential equations, Hopf bifurcation in the circuit is analysed using the Hopf bifurcation theory and the central manifold theorem in this paper. Bifurcation points and bifurcation directions are derived in detail, which prove to be consistent with the previous bifurcation diagram. Numerical simulations and experimental results are given to verify the theoretical analysis. Hopf bifurcation analysis can explain and predict the periodical orbit (oscillation) in Chen circuit with direct time delay feedback. Bifurcation boundaries are derived using the Hopf bifurcation analysis, which will be helpful for determining the parameters in the stabilisation of the originally chaotic circuit

  3. Synchronization and anti-synchronization coexist in Chen-Lee chaotic systems

    International Nuclear Information System (INIS)

    Chen, J.-H.; Chen, H.-K.; Lin, Y.-K.

    2009-01-01

    This study demonstrates that synchronization and anti-synchronization can coexist in Chen-Lee chaotic systems by direct linear coupling. Based on Lyapunov's direct method, a linear controller was designed to assure that two different types of synchronization can simultaneously be achieved. Further, the hybrid projective synchronization of Chen-Lee chaotic systems was studied using a nonlinear control scheme. The nonlinear controller was designed according to the Lyapunov stability theory to guarantee the hybrid projective synchronization, including synchronization, anti-synchronization, and projective synchronization. Finally, numerical examples are presented in order to illustrate the proposed synchronization approach.

  4. Phylogeography of Sophora moorcroftiana Supports Wu's Hypothesis on the Origin of Tibetan Alpine Flora.

    Science.gov (United States)

    Cheng, Shanmei; Qiong, La; Lu, Fan; Yonezawa, Takahiro; Yin, Ganqiang; Song, Zhiping; Wang, Yuguo; Yang, Ji; Zhang, Wenju

    2017-06-01

    Wu hypothesized that the Tibetan flora originated mostly from the paleotropical Tertiary flora in the Hengduan Mountains by adapting to the cold and arid environments associated with the strong uplift of the Qinghai-Tibet Plateau (QTP). Here, we combine the phylogeographic history of Sophora moorcroftiana with that of Sophora davidii to explore the speciation of S. moorcroftiana to test this hypothesis. We collected 151 individuals from 17 populations and sequenced 2 chloroplast fragments and the internal transcribed spacer of rDNA. Five chlorotypes and 9 ribotypes were detected but no significant phylogeographic structure was revealed. The integrated results of phylogeographic studies of these 2 species clearly support the progenitor-derivative relationship between them. We infer that the western peripheral population of S. davidii migrated westwards from the Hengduan Mountains to the middle reaches of the Yarlung Zangbo River and differentiated from its ancestor in the process of adaptation to increasingly cold and arid environments with the uplift of the QTP and finally evolved into S. moorcroftiana during the Late Pliocene. In addition, our findings shed light on the idea that natural selection, as imposed by climate differentiation (especially mean diurnal range and precipitation seasonality), directly drove this peripatric speciation event after geographic isolation. The speciation of S. moorcroftiana is a strong case supporting Wu's hypothesis about the origin of Tibet's flora. © The American Genetic Association 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Effects of electroacupuncture and electroacupuncture plus Tao Hong Si Wu Wan in treating primary dysmenorrhea.

    Science.gov (United States)

    Miao, Edwin Yong; Miao, Miranda Yi-mo; Kildea, Daniel George; Lao, Yi-Wen

    2014-02-01

    This study investigated the efficacies of electroacupuncture and electroacupuncture combined with Tao Hong Si Wu Wan in treating primary dysmenorrhea and compared the results with those obtained using conventional medical treatment. One treatment group, group 1, was administered Tao Hong Si Wu Wan (2625 mg) while the other, group 2, was administered a placebo (2625 mg) twice daily for 3 months. Electroacupuncture was used in both treatment groups: two sessions per menstrual cycle for three menstrual cycles. The reference group, group 3, was administered ibuprofen, 600 mg, twice daily, for five menstrual cycles. Uses of the herb, placebo and ibuprofen were blinded. A ridit analysis was used for testing and interpreting the effects of treatment. Pain intensity was determined using a qualitative grading method in a blinded manner. The ridit scores in groups 1 and 2 were significantly higher than those in reference group immediately after treatment and three months later. Twelve months after the treatment, group 1 had a higher ridit score than group 2. In comparison to the reference group, groups 1 and 2 achieved better menstrual pain relief both immediately and 3 months after treatment. In addition, group 1 had better long-term pain relief than group 2. Copyright © 2014. Published by Elsevier B.V.

  6. Ignition delay time correlation of fuel blends based on Livengood-Wu description

    KAUST Repository

    Khaled, Fathi

    2017-08-17

    In this work, a universal methodology for ignition delay time (IDT) correlation of multicomponent fuel mixtures is reported. The method is applicable over wide ranges of temperatures, pressures, and equivalence ratios. n-Heptane, iso-octane, toluene, ethanol and their blends are investigated in this study because of their relevance to gasoline surrogate formulation. The proposed methodology combines benefits from the Livengood-Wu integral, the cool flame characteristics and the Arrhenius behavior of the high-temperature ignition delay time to suggest a simple and comprehensive formulation for correlating the ignition delay times of pure components and blends. The IDTs of fuel blends usually have complex dependences on temperature, pressure, equivalence ratio and composition of the blend. The Livengood-Wu integral is applied here to relate the NTC region and the cool flame phenomenon. The integral is further extended to obtain a relation between the IDTs of fuel blends and pure components. Ignition delay times calculated using the proposed methodology are in excellent agreement with those simulated using a detailed chemical kinetic model for n-heptane, iso-octane, toluene, ethanol and blends of these components. Finally, very good agreement is also observed for combustion phasing in homogeneous charge compression ignition (HCCI) predictions between simulations performed with detailed chemistry and calculations using the developed ignition delay correlation.

  7. His Excellency Professor Jiaer Chen President, National Natural Science Foundation, People's Republic of China

    CERN Multimedia

    Maximilien Brice

    2002-01-01

    L. to r.: Dr Diether Blechschmidt, Adviser for Non Member States Relations, Dr Peter Jenni, Spokesman, ATLAS Experiment, Prof. Chen, Mr Jean-Luc Baldy, Head of the LHC Civil Engineering Group and Dr John Ellis, Adviser for Non Member States Relations.

  8. TEST OF THE CHEN-ROLL-ROSS MACROECONOMIC FACTOR MODEL: EVIDENCE FROM CROATIAN STOCK MARKET

    Directory of Open Access Journals (Sweden)

    Denis Dolinar

    2015-12-01

    Full Text Available This paper empirically examines the well-known Chen-Roll-Ross model on the Croatian stock market. Modifications of definitions of the Chen-Roll-Ross model variables showed as necessary because of doubtful availability and quality of input data needed. Namely, some macroeconomic and market variables are not available in the originally defined form or do not exist. In that sense this paper gives some alternative definitions for some model variables. Also, in order to improve statistical analysis, in this paper we have modified Fama-MacBeth technique in the way that second-pass regression was substituted with panel regression analysis. Based on the two-pass regression analysis of returns of 34 Croatian stocks on 4 macroeconomic variables during the seven-and-half-year observation period the following conclusion is made. In contrast to the results of Chen, Roll and Ross (1986 for the U.S. stock market, their model is not successful when describing a risk-return relation of Croatian stocks. Nevertheless, one observed version of the Chen-RollRoss model showed certain statistical significance. Namely, two risk factors in that version of the model were statistically significant: default premium, measured as risk premium for the corporate short-term bank loan financing, and term structure premium, measured on short-run basis.

  9. 76 FR 71048 - Sixth Annual Philip S. Chen, Jr. Distinguished Lecture on Innovation and Technology Transfer

    Science.gov (United States)

    2011-11-16

    ... present ``Treatment of Cancer with Recombinant Immunotoxins: From Technology Transfer to the Patient.'' Dr. Pastan is an NIH Distinguished Investigator and Chief, Laboratory of Molecular Biology, National Cancer Institute Center for Cancer Research. This annual series honors Dr. Philip S. Chen, Jr. for his almost 50...

  10. Orbinia wui, a new species from China, with redescription of O. dicrochaeta Wu, 1962 (Annelida, Orbiniidae).

    Science.gov (United States)

    Sun, Yue; Li, Xinzheng

    2018-04-04

    Two species of the genus Orbinia Quatrefages, 1865 are described including Orbinia dicrochaeta Wu, 1962 and Orbinia wui sp. n. The new species can easily be identified from other species in the genus by a combination of characters: branchiae first present from chaetiger 5, thoracic region with 14-16 chaetigers; first six thoracic neuropodia with 4-5 rows of uncini, with the last row short and curving ventral to anterior rows; subsequent thoracic neuropodia with four rows of subuluncini and one short row of uncini, arranged more densely than anterior chaetigers; both uncini and subuluncini surrounded by long sheath all of its length on concave side, sheath with developed transverse rows of barbs. This study suggests that the species of Orbinia may be divided into two groups. A taxonomic key and comparative table to all species of Orbinia is provided.

  11. Prof. Wu Xiaoqiu:China Is Striving for the World's Most Developed Capital Market

    Institute of Scientific and Technical Information of China (English)

    Sun Yongjian; Zhang Yue

    2007-01-01

    @@ China's capital market is a hot issue in the new year. The best strategy to develop the Chinese capital market in the coming 15 to 20 years was discussed in the China Capital Market Forum, which was held in China at Renmin University on January 13. Government officials, scholars, and entrepreneurs commented that by 2020, the Chinese capital market will develop into one of the best capital markets in the world,not only in terms of size, but also asset quality, liquidity and dynamic trade. Is this a realistic goal? What steps should we take to pursue this target? With these questions in mind, after the forum, China's Foreign Trade interviewed Prof. Wu Xiaoqiu, Vice President of Renmin University of China,and the Director of the Finance & Securities Institute of Renmin University.

  12. Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing

    Directory of Open Access Journals (Sweden)

    Richard K. Payne

    2016-03-01

    Full Text Available Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between the expectations of the dominant religious culture and the immigrant culture in terms of the ways in which religious leaders represent themselves. Both Billy Graham and the Dalai Lama present themselves in very humble terms, consistent with the expectations of the Pietist background to American popular religion. Yogi Chen on the contrary tends toward a self-aggrandizing style, which although consistent with the competitive nature of premodern Tibetan religious culture is not congruent with the expectations of American popular religion.

  13. Parametric study of the fractional-order Chen-Lee system

    Energy Technology Data Exchange (ETDEWEB)

    Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Tou, W.M.S. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)

    2008-08-15

    The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q{sub 1} = q{sub 2} = q{sub 3} = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found.

  14. Parametric study of the fractional-order Chen-Lee system

    International Nuclear Information System (INIS)

    Tam, L.M.; Tou, W.M.S.

    2008-01-01

    The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q 1 = q 2 = q 3 = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found

  15. A numeric-analytic method for approximating the chaotic Chen system

    International Nuclear Information System (INIS)

    Mossa Al-sawalha, M.; Noorani, M.S.M.

    2009-01-01

    The epitome of this paper centers on the application of the differential transformation method (DTM) the renowned Chen system which is described as a three-dimensional system of ODEs with quadratic nonlinearities. Numerical comparisons are made between the DTM and the classical fourth-order Runge-Kutta method (RK4). Our work showcases the precision of the DTM as the Chen system transforms from a non-chaotic system to a chaotic one. Since the Lyapunov exponent for this system is much higher compared to other chaotic systems, we shall highlight the difficulties of the simulations with respect to its accuracy. We wrap up our investigations to reveal that this direct symbolic-numeric scheme is effective and accurate.

  16. Software-Lösungen in B2B-Verkaufsgesprächen wirkungsvoll einsetzen

    OpenAIRE

    Thoma, Axel Michael

    2017-01-01

    Dieser Beitrag befasst sich mit dem Einsatz von Software-Lösungen in B2B-Verkaufsgesprächen (auf Englisch: Digital Sales Enablement). Anhand aktueller Beispiele aus der Geschäftswelt wird erklärt, wie solche Lösungen helfen (1) die Produktivität zu steigern, (2) Kunden zu aktivieren und (3) Neugeschäft zu entwickeln. Ebenfalls werden die Konzeption und Umsetzung solcher Lösungen behandelt.

  17. Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing

    OpenAIRE

    Richard K. Payne

    2016-01-01

    Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between ...

  18. Tensioned Fabric Structures with Surface in the Form of Chen-Gackstatter

    Directory of Open Access Journals (Sweden)

    Yee Hooi Min

    2016-01-01

    Full Text Available Form-finding has to be carried out for tensioned fabric structure in order to determine the initial equilibrium shape under prescribed support condition and prestress pattern. Tensioned fabric structures are normally designed to be in the form of equal tensioned surface. Tensioned fabric structure is highly suited to be used for realizing surfaces of complex or new forms. However, research study on a new form as a tensioned fabric structure has not attracted much attention. Another source of inspiration minimal surface which could be adopted as form for tensioned fabric structure is very crucial. The aim of this study is to propose initial equilibrium shape of tensioned fabric structures in the form of Chen-Gackstatter. Computational form-finding using nonlinear analysis method is used to determine the Chen-Gackstatter form of uniformly stressed surfaces. A tensioned fabric structure must curve equally in opposite directions to give the resulting surface a three dimensional stability. In an anticlastic doubly curved surface, the sum of all positive and all negative curvatures is zero. This study provides an alternative choice for structural designer to consider the Chen-Gackstatter applied in tensioned fabric structures. The results on factors affecting initial equilibrium shape can serve as a reference for proper selection of surface parameter for achieving a structurally viable surface.

  19. Ronald Malt or Chen Zhongwei: Who performed the first surgical replantation?

    Science.gov (United States)

    Fan, Ka-Wai

    2018-01-01

    This article discusses the contributions of the two pioneers of the surgical procedure of replantation-Ronald Malt in the US and Chen Zhongwei in China. Ronald Malt performed the reattachment surgery on a boy who had an accident in 1962, but he published his case report two years later in 1964. Chen Zhongwei performed a similar surgery on a worker who cut off his forearm in 1963, but he published his case report the same year. There is some debate about which one of these reputed surgeons should be given credit for being the first one to perform this breakthrough surgery, because although Malt was the first to perform the procedure, Zhongwei was the first to report it. To shed light on this controversy, criteria for scientific priority suggested by Ronald Vale and Anthony Hyman were applied. Although the criteria mainly favored Zhongwei as the pioneer of this procedure, he did not entirely fulfill one of the criteria. Therefore, the article could not present a definitive answer to the question, and it concludes by pointing out the highly commendable achievements and contributions of both Ronald Malt and Chen Zhongwei.

  20. A Response to Professor Wu Zongjie's "Interpretation, Autonomy, and Transformation: Chinese Pedagogic Discourse in a Cross-Cultural Perspective"

    Science.gov (United States)

    Curran, Thomas D.

    2014-01-01

    In response to an essay by Prof Wu Zongjie that was published in the "Journal of Curriculum Studies" [43(5), (2011), 569-590], I argue that, despite dramatic changes that have taken place in the language of Chinese academic discourse and pedagogy, evidence derived from the fields of psychology and the history of Chinese educational…

  1. 31 july 2014 - H. WU Ambassador Permanent Representative of the People's Republic of China to the United Nations

    CERN Multimedia

    Egli, Laurent

    2014-01-01

    His Excellency Mr Hailong WU Ambassador Permanent Representative of the People's Republic of China to the United Nations Office at Geneva and other international organizations in Switzerland visiting the ATLAS cavern with ATLAS Spokesperson D. Charlton and the LHC tunnel at Point 1 with Technology Department, Vacuum, Surfaces and Coatings Group P. Cruikshank.

  2. Time budgets of Snow Geese Chen caerulescens and Ross's Geese Chen rossii in mixed flocks: Implications of body size, ambient temperature and family associations

    Science.gov (United States)

    Jonsson, J.E.; Afton, A.D.

    2009-01-01

    Body size affects foraging and forage intake rates directly via energetic processes and indirectly through interactions with social status and social behaviour. Ambient temperature has a relatively greater effect on the energetics of smaller species, which also generally are more vulnerable to predator attacks than are larger species. We examined variability in an index of intake rates and an index of alertness in Lesser Snow Geese Chen caerulescens caerulescens and Ross's Geese Chen rossii wintering in southwest Louisiana. Specifically we examined variation in these response variables that could be attributed to species, age, family size and ambient temperature. We hypothesized that the smaller Ross's Geese would spend relatively more time feeding, exhibit relatively higher peck rates, spend more time alert or raise their heads up from feeding more frequently, and would respond to declining temperatures by increasing their proportion of time spent feeding. As predicted, we found that Ross's Geese spent more time feeding than did Snow Geese and had slightly higher peck rates than Snow Geese in one of two winters. Ross's Geese spent more time alert than did Snow Geese in one winter, but alert rates differed by family size, independent of species, in contrast to our prediction. In one winter, time spent foraging and walking was inversely related to average daily temperature, but both varied independently of species. Effects of age and family size on time budgets were generally independent of species and in accordance with previous studies. We conclude that body size is a key variable influencing time spent feeding in Ross's Geese, which may require a high time spent feeding at the expense of other activities. ?? 2008 The Authors.

  3. Why Study Chinese Classics and How to Go about It: Response to Zongjie Wu's "Interpretation, Autonomy, and Transformation--Chinese Pedagogic Discourse in Cross-Cultural Perspective"

    Science.gov (United States)

    Tan, Sor-Hoon

    2011-01-01

    This response to Zongjie Wu's "Interpretation, autonomy, and interpretation" focuses on the "battle between East and West" which contextualizes Wu's proposal to counter the current Western domination of Chinese pedagogic discourse with an "authentic language" recovered from the Chinese classics. It points out that it…

  4. Dark energy fingerprints in the nonminimal Wu-Yang wormhole structure

    Science.gov (United States)

    Balakin, Alexander B.; Zayats, Alexei E.

    2014-08-01

    We discuss new exact solutions to nonminimally extended Einstein-Yang-Mills equations describing spherically symmetric static wormholes supported by the gauge field of the Wu-Yang type in a dark energy environment. We focus on the analysis of three types of exact solutions to the gravitational field equations. Solutions of the first type relate to the model, in which the dark energy is anisotropic; i.e., the radial and tangential pressures do not coincide. Solutions of the second type correspond to the isotropic pressure tensor; in particular, we discuss the exact solution, for which the dark energy is characterized by the equation of state for a string gas. Solutions of the third type describe the dark energy model with constant pressure and energy density. For the solutions of the third type, we consider in detail the problem of horizons and find constraints for the parameters of nonminimal coupling and for the constitutive parameters of the dark energy equation of state, which guarantee that the nonminimal wormholes are traversable.

  5. Monte Carlo study of the pure and dilute Baxter-Wu model

    International Nuclear Information System (INIS)

    Schreiber, Nir; Adler, Joan

    2005-01-01

    We studied the pure and dilute Baxter-Wu (BW) models using the Wang-Landau (WL) sampling method to calculate the density-of-states (DOS). We first used the exact result for the DOS of the Ising model to test our code. Then we calculated the DOS of the dilute Ising model to obtain a phase diagram, in good agreement with previous studies. We calculated the energy distribution, together with its first, second and fourth moments, to give the specific heat and the energy fourth order cumulant, better known as the Binder parameter, for the pure BW model. For small samples, the energy distribution displayed a doubly peaked shape, and finite size scaling analysis showed the expected reciprocal scaling of the positions of the peaks with L. The energy distribution yielded the expected BW α = 2/3 critical exponent for the specific heat. The Binder parameter minimum appeared to scale with lattice size L with an exponent θ B equal to the specific heat exponent. Its location (temperature) showed a large correction-to-scaling term θ 1 = 0.248 ± 0.025. For the dilute BW model we found a clear crossover to a single peak in the energy distribution even for small sizes and the expected α = 0 was recovered

  6. Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation

    Energy Technology Data Exchange (ETDEWEB)

    Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Chen, J.H. [Department of Mechanical Engineering, Chung Hua University, Hsinchu, Taiwan (China); Chen, H.K. [Department of Mechanical Engineering, Hsiuping Institute of Technology, Taichung, Taiwan (China); Wai Meng Si Tou [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)

    2008-11-15

    A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, {epsilon}, and {omega}. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study.

  7. Security problems for a pseudorandom sequence generator based on the Chen chaotic system

    Science.gov (United States)

    Özkaynak, Fatih; Yavuz, Sırma

    2013-09-01

    Recently, a novel pseudorandom number generator scheme based on the Chen chaotic system was proposed. In this study, we analyze the security weaknesses of the proposed generator. By applying a brute force attack on a reduced key space, we show that 66% of the generated pseudorandom number sequences can be revealed. Executable C# code is given for the proposed attack. The computational complexity of this attack is O(n), where n is the sequence length. Both mathematical proofs and experimental results are presented to support the proposed attack.

  8. Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation

    International Nuclear Information System (INIS)

    Tam, L.M.; Chen, J.H.; Chen, H.K.; Wai Meng Si Tou

    2008-01-01

    A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, ε, and ω. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study

  9. Dark energy from cosmological fluids obeying a Shan-Chen non-ideal equation of state

    OpenAIRE

    Bini, Donato; Geralico, Andrea; Gregoris, Daniele; Succi, Sauro

    2014-01-01

    We consider a Friedmann-Robertson-Walker universe with a fluid source obeying a nonideal equation of state with ‘‘asymptotic freedom,’’ namely ideal gas behavior (pressure changes directly proportional to density changes) both at low and high density regimes, following a fluid dynamical model due to Shan and Chen. It is shown that, starting from an ordinary energy density component, such fluids naturally evolve towards a universe with a substantial ‘‘dark energy’’ component at the present tim...

  10. A new species of Nemoura (Plecoptera: Nemouridae) from Jiangsu Province, China, with new illustrations for Nemoura nankinensis Wu.

    Science.gov (United States)

    Chen, Zhi-Teng; DU, Yu-Zhou

    2017-04-12

    A new species of Nemoura (Plecoptera: Nemouridae), N. fusiformis sp. nov. from Jiangsu Province, China, is described and illustrated. The new species is characterized by a strongly sclerotized large hook formed by outer margin of the outer lobe of the paraproct and by the outer sclerite of cercus with a sub-triangular medial process. The new species is compared with similar taxa. Additionally, supplementary illustrations for N. nankinensis Wu, 1926 are also provided.

  11. PLE-wu, a new member of piggyBac transposon family from insect, is active in mammalian cells.

    Science.gov (United States)

    Wu, Chunxiao; Wang, Shu

    2014-10-01

    piggyBac, a highly active transposon in insect and mammalian cells, is a very useful tool in genome manipulation. A new piggyBac-like element (PLE), named PLE-wu, was identified from a mutant baculovirus cultured in sf9 insect cells. This new transposon is 2931 bp in length and encodes two active forms of transposase, a 708-amino acid-long transposase and a short 576-residue-long transposase translated from a downstream in-frame initiation codon. PLE-wu has asymmetric terminal structures, containing 6-bp inverted terminal repeats, 32-bp imperfect inverted and direct sub-terminal repeats. Similar to piggyBac, PLE-wu exhibits traceless excision activity in both insect and mammalian cells, restoring the original TTAA target sequence upon excision. It also retains the insertion activity in mammalian cells with a plasmid to chromosome transposition rate about 10-fold higher than random integration. Plasmid rescue assays revealed that the TTAA target sequence was duplicated at the junctions of the insertion site. Deletion of the terminal sequences including the sub-terminal repeats decreased the transposition activity of the 708-residue-long transposase, while the transposition activity of the short form of transposase was not affected. With its low sequence similarity to piggyBac, PLE-wu will contribute to the understanding the mechanism of PLE transposition, as well as design of new transposon systems with higher activity. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  12. Le jeu de la création : Le mangeur (2005 de Ying Chen

    Directory of Open Access Journals (Sweden)

    Nicole Dunham

    2013-11-01

    Full Text Available Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005 de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants : le ventre du père, les tableaux peints par ce dernier et l’espace-temps de A., et la fenêtre. Ces éléments deviennent des aires de jeu, remettant en question les concepts de l’intérieur et de l’extérieur et du créateur et de l’œuvre. En nous servant du texte « Le Tunnel » écrit par Ying Chen, nous démontrerons que cette notion du jeu s’applique également à l’ensemble de son œuvre.

  13. Theoretical and experimental study of Chen chaotic system with notch filter feedback control

    International Nuclear Information System (INIS)

    Ming, Zhang Xiao; Jian-Hua, Peng; Ju-Fang, Chen

    2010-01-01

    Since the past two decades, the time delay feedback control method has attracted more and more attention in chaos control studies because of its simplicity and efficiency compared with other chaos control schemes. Recently, it has been proposed to suppress low-dimensional chaos with the notch filter feedback control method, which can be implemented in a laser system. In this work, we have analytically determined the controllable conditions for notch filter feedback controlling of Chen chaotic system in terms of the Hopf bifurcation theory. The conditions for notch filter feedback controlled Chen chaoitc system having a stable limit cycle solution are given. Meanwhile, we also analysed the Hopf bifurcation direction, which is very important for parameter settings in notch filter feedback control applications. Finally, we apply the notch filter feedback control methods to the electronic circuit experiments and numerical simulations based on the theoretical analysis. The controlling results of notch filter feedback control method well prove the feasibility and reliability of the theoretical analysis. (general)

  14. Chen Jingrun, China's famous mathematician: devastated by brain injuries on the doorstep to solving a fundamental mathematical puzzle.

    Science.gov (United States)

    Lei, Ting; Belykh, Evgenii; Dru, Alexander B; Yagmurlu, Kaan; Elhadi, Ali M; Nakaji, Peter; Preul, Mark C

    2016-07-01

    Chen Jingrun (1933-1996), perhaps the most prodigious mathematician of his time, focused on the field of analytical number theory. His work on Waring's problem, Legendre's conjecture, and Goldbach's conjecture led to progress in analytical number theory in the form of "Chen's Theorem," which he published in 1966 and 1973. His early life was ravaged by the Second Sino-Japanese War and the Chinese Cultural Revolution. On the verge of solving Goldbach's conjecture in 1984, Chen was struck by a bicyclist while also bicycling and suffered severe brain trauma. During his hospitalization, he was also found to have Parkinson's disease. Chen suffered another serious brain concussion after a fall only a few months after recovering from the bicycle crash. With significant deficits, he remained hospitalized for several years without making progress while receiving modern Western medical therapies. In 1988 traditional Chinese medicine experts were called in to assist with his treatment. After a year of acupuncture and oxygen therapy, Chen could control his basic bowel and bladder functions, he could walk slowly, and his swallowing and speech improved. When Chen was unable to produce complex work or finish his final work on Goldbach's conjecture, his mathematical pursuits were taken up vigorously by his dedicated students. He was able to publish Youth Math, a mathematics book that became an inspiration in Chinese education. Although he died in 1996 at the age of 63 after surviving brutal political repression, being deprived of neurological function at the very peak of his genius, and having to be supported by his wife, Chen ironically became a symbol of dedication, perseverance, and motivation to his students and associates, to Chinese youth, to a nation, and to mathematicians and scientists worldwide.

  15. FORTRAN Code for Glandular Dose Calculation in Mammography Using Sobol-Wu Parameters

    Directory of Open Access Journals (Sweden)

    Mowlavi A A

    2007-07-01

    Full Text Available Background: Accurate computation of the radiation dose to the breast is essential to mammography. Various the thicknesses of breast, the composition of the breast tissue and other variables affect the optimal breast dose. Furthermore, the glandular fraction, which refers to the composition of the breasts, as partitioned between radiation-sensitive glandular tissue and the adipose tissue, also has an effect on this calculation. Fatty or fibrous breasts would have a lower value for the glandular fraction than dense breasts. Breast tissue composed of half glandular and half adipose tissue would have a glandular fraction in between that of fatty and dense breasts. Therefore, the use of a computational code for average glandular dose calculation in mammography is a more effective means of estimating the dose of radiation, and is accurate and fast. Methods: In the present work, the Sobol-Wu beam quality parameters are used to write a FORTRAN code for glandular dose calculation in molybdenum anode-molybdenum filter (Mo-Mo, molybdenum anode-rhodium filter (Mo-Rh and rhodium anode-rhodium filter (Rh-Rh target-filter combinations in mammograms. The input parameters of code are: tube voltage in kV, half-value layer (HVL of the incident x-ray spectrum in mm, breast thickness in cm (d, and glandular tissue fraction (g. Results: The average glandular dose (AGD variation against the voltage of the mammogram X-ray tube for d = 4 cm, HVL = 0.34 mm Al and g=0.5 for the three filter-target combinations, as well as its variation against the glandular fraction of breast tissue for kV=25, HVL=0.34, and d=4 cm has been calculated. The results related to the average glandular absorbed dose variation against HVL for kV = 28, d=4 cm and g= 0.6 are also presented. The results of this code are in good agreement with those previously reported in the literature. Conclusion: The code developed in this study calculates the glandular dose quickly, and it is complete and

  16. Pitchfork bifurcation and circuit implementation of a novel Chen hyper-chaotic system

    International Nuclear Information System (INIS)

    Dong En-Zeng; Chen Zeng-Qiang; Chen Zai-Ping; Ni Jian-Yun

    2012-01-01

    In this paper, a novel four dimensional hyper-chaotic system is coined based on the Chen system, which contains two quadratic terms and five system parameters. The proposed system can generate a hyper-chaotic attractor in wide parameters regions. By using the center manifold theorem and the local bifurcation theory, a pitchfork bifurcation is demonstrated to arise at the zero equilibrium point. Numerical analysis demonstrates that the hyper-chaotic system can generate complex dynamical behaviors, e.g., a direct transition from quasi-periodic behavior to hyper-chaotic behavior. Finally, an electronic circuit is designed to implement the hyper-chaotic system, the experimental results are consist with the numerical simulations, which verifies the existence of the hyper-chaotic attractor. Due to the complex dynamic behaviors, this new hyper-chaotic system is useful in the secure communication. (general)

  17. Le jeu de la création : Le mangeur (2005) de Ying Chen

    OpenAIRE

    Nicole Dunham

    2013-01-01

    Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005) de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants...

  18. Chen-Nester-Tung quasi-local energy and Wang-Yau quasi-local mass

    Science.gov (United States)

    Liu, Jian-Liang; Yu, Chengjie

    2017-10-01

    In this paper, we show that the Chen-Nester-Tung (CNT) quasi-local energy with 4D isometric matching references is closely related to the Wang-Yau (WY) quasi-local energy. As a particular example, we compute the second variation of the CNT quasi-local energy for axially symmetric Kerr-like spacetimes with axially symmetric embeddings at the obvious critical point (0 , 0) and find that it is a saddle critical point in most of the cases. Also, as a byproduct, we generalize a previous result about the coincidence of the CNT quasi-local energy and Brown-York mass for axially symmetric Kerr-like spacetimes by Tam and the first author Liu and Tam (2016) to general spacetimes.

  19. From Wang-Chen System with Only One Stable Equilibrium to a New Chaotic System Without Equilibrium

    Science.gov (United States)

    Pham, Viet-Thanh; Wang, Xiong; Jafari, Sajad; Volos, Christos; Kapitaniak, Tomasz

    2017-06-01

    Wang-Chen system with only one stable equilibrium as well as the coexistence of hidden attractors has attracted increasing interest due to its striking features. In this work, the effect of state feedback on Wang-Chen system is investigated by introducing a further state variable. It is worth noting that a new chaotic system without equilibrium is obtained. We believe that the system is an interesting example to illustrate the conversion of hidden attractors with one stable equilibrium to hidden attractors without equilibrium.

  20. Information Philosophy in China: Professor Wu Kun’s 30 Years of Academic Thinking in Information Philosophy

    Directory of Open Access Journals (Sweden)

    Guowu Li

    2011-10-01

    Full Text Available Professor Wu Kun, from Xi'an Jiaotong University of China, has been studying information philosophy for 30 years. He thinks information conception is one of the most fundamental areas in philosophy and has founded information philosophy. He has done original and pioneering research in information ontology, epistemology, social information theory, information production theory, information evolution theory, information value, and information thinking directions. He is the first scholar to develop a completely new view of theories, systems, and methods about information philosophy.

  1. His Excellency Mr Ken WU Ambassador Extraordinary and Plenipotentiary of the People’s Republic of China to Switzerland

    CERN Multimedia

    Jean Claude Gadmer

    2011-01-01

    Photo 1-5:The delegation visiting the ATLAS visitor Center with P.Jenni, ATLAS Collaboration former Spokesperson Photo 6-14,15-20:visiting the ATLAS experimental area Photo 15:Y. YANG,Attaché-Q. WAN,First Secretary-Z. Ren,ATLAS Collaboration,High Energy Group,Shandong University-H.E. Mr K. Wu-P. Jenni-R. Voss,Adviser for the People’s Republic of China-H. FENG,Counsellor Photo 21-38:Signature of the Guest Book with CERN Director-General R. Heuer

  2. Modern process study on Chen Co and Ranwu Lake of Tibetan Plateau

    Science.gov (United States)

    Ju, J.

    2013-12-01

    Lakes are important junctions of geospheres. There are many lakes distributed on the Tibetan Plateau (TP). Lake sediment is one of the important media for retrieving the past environmental changes. Because of the uniqueness of environment of the TP, sediment, water and ecological system in lakes has local characteristic inevitably. Modern process research on different lakes will benefit interpreting the proxies more accurately. The development of observation station makes the observation and sampling more convenient. Modern process of lakes can be fulfilled in two ways, spatial or seasonal variation study, with a same aim finding out the dominant factors controlling the variations. Chen Co is a closed lake locating at inland area of southern Tibet. Ranwu Lake is an open lake locating at outflow area of SE Tibet. In this study, I studied the spatial and (or) seasonal variation of lake water and sediment in the two distinct types of lakes to make clear the mechanism of modern process. Particular attention was given to the pattern and degree of influence of rivers supplied by glaciers on lakes. Preliminary conclusions are outlined as follow: (1) In the lakes with glacier melt supplying rivers, the patterns of supply of the rivers to the lake are different. In close lake Chen Co, the influence of glacier melt is mainly reflected in the south lake area. In the open lake Ranwu Lake, the influence is comprehensive and direct. This difference influencing patterns how the lake sediments reflected the glacier melt under the past environmental changes. (2) The supply of Kaluxiong Qu River, supplied mainly by glacier melt, to Chen co has North-South difference: more directly to south lake area, reflecting by lower value of conductivity and pH, finer grain size and west to east transporting trend, greater deposition rate, more allogenic fine sediments, not obvious biological and endogenic deposition there. This enlightens the site selection for lake cores and interpretation of

  3. The impact of systematic landscape conservation planning on ecosystem: Chen Youlan river watershed

    Science.gov (United States)

    Chen, Chi-ju

    2017-04-01

    Heraclitus said that "no man ever steps in the same river twice." Everything continues to change. Land use change will keep redefine itself and subject the Earth and humankind to collateral changes. Humankind benefits from ecosystem in many ways. The ecosystem provides people with nutrients, enriches soil with sediment, and sustains all living organisms with water; these benefits are known as ecosystem services. In Taiwan, land use change has impacted ecosystem and biodiversity on various levels. Thus, we took six land use scenarios from 1999 to 2005 in Chen Youlan river watershed as our case study, intending to observe the course of ecosystem and biodiversity changes and the cause of it. Systematic Landscape conservation planning (SLCP) framework can be adopted when designing land use policy to safeguard human interests and ecosystem. This study use SLCP to develop ecosystem services and biodiversity protection strategies. Several strategies were designed by using 1999 to 2005 data as provision to protect the intactness of future ecosystem services and biodiversity. This research explores the potential and possible impacts of different land use protection strategies in the future. It is possible to identify the conservation priority of a certain region by using the Zonation meta-algorithm. This study selects the zonation critical protection area (Joint set of Yushan National Park) as strategy A, B and C. Strategy D takes Yushan National Park as a protected area; unstable hot spots in 1999/03 (Joint set of Yushan National Park) are selected as strategy E. Next, we used Kappa statistical method to find the minimal ecosystem services change and biodiversity hotspots change of the five aforementioned strategies and compared with those from 1999/03. By the Kappa statistical method, we further prioritized the important conservation areas by strategy A, B, C, E in the future. The results can not only serve as management reference for government agencies, but also develop

  4. [Professor WU Zhongchao's experience in the treatment of bi syndrome with fire needling therapy at lower he-sea points].

    Science.gov (United States)

    Zhou, Yu; Chen, Zhongjie; Liu, Chun; Wang, Bing; Zhang, Ning; Li, Caifen; Xie, Qian

    2016-07-12

    Bi syndrome is classified into five categories. Based on the syndrome differentiation of meridians and collaterals and zangfu theories, Professor WU Zhongchao proposed the fire needling therapy at the lower he -sea points for five types of bi syndromes. Professor WU stresses on the flexible application of fire needling therapy for bi syndrome at the lower he -sea points and innovated the unique five techniques of fire needling therapy, named lifting and threating needle of small amplitude at the lower he -sea points, the stimulation along the relevant meri-dians before fire needling, detecting the sensitive sites by gentle pressing the relevant lower he -sea points, combining the movement of affected upper limb or joint during fire needling, or combining with contralateral needling technique, and controlling the depth of fire needling based on the duration of sickness and depth of affected site. He pointed out that Shangjuxu (ST 37) is for skin bi syndrome, Zusanli (ST 36) for muscle bi syndrome, Yanglingquan (GB 34) for tendon bi syndrome, Weizhong (BL 40) for bone bi syndrome and Xiajuxu (ST 39) for vessel bi syndrome.

  5. Wormholes supported by phantom energy from Shan-Chen cosmological fluids

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Deng [Nankai University, Theoretical Physics Division, Chern Institute of Mathematics, Tianjin (China); Meng, Xin-He [Nankai University, Department of Physics, Tianjin (China); Institute of Theoretical Physics, CAS, State key Lab of Theoretical Physics, Beijing (China)

    2016-03-15

    In the present paper, the exact solutions of spherically symmetrical Einstein field equations describing wormholes supported by phantom energy that violates the null energy condition from Shan-Chen background fluid are obtained. We have considered the important case of the model parameter ψ ∼ 1, which corresponds to the ''saturation effect'', and this regime corresponds to an effective form of ''asymptotic freedom'' for the fluids, but occurring at cosmological rather than subnuclear scales. Then we investigate the allowed range for the values of the model parameters g and ω when the spacetime metrics describe wormholes and discuss the possible singularities of the solutions, finding that the obtained spacetimes are geodesically complete. Furthermore, we construct two traversable wormholes through matching our obtained interior solutions to the exterior Schwarzschild solutions and analyze the traversabilities of the wormholes. Finally, we consider the case of anisotropic pressure and discover that the transverse pressure also crosses the phantom divide -1 with the growth of the wormhole dimension, and it tends to be the same as the radial pressure with the growth of the wormhole radius. (orig.)

  6. Psychometric properties of the Revised Chen Internet Addiction Scale (CIAS-R) in Chinese adolescents.

    Science.gov (United States)

    Mak, Kwok-Kei; Lai, Ching-Man; Ko, Chih-Hung; Chou, Chien; Kim, Dong-Il; Watanabe, Hiroko; Ho, Roger C M

    2014-10-01

    The Revised Chen Internet Addiction Scale (CIAS-R) was developed to assess Internet addiction in Chinese populations, but its psychometric properties in adolescents have not been examined. This study aimed to evaluate the factor structure and psychometric properties of CIAS-R in Hong Kong Chinese adolescents. 860 Grade 7 to 13 students (38 % boys) completed the CIAS-R, the Young's Internet Addiction Test (IAT), and the Health of the Nation Outcome Scales for Children and Adolescents (HoNOSCA) in a survey. The prevalence of Internet addiction as assessed by CIAS-R was 18 %. High internal consistency and inter-item correlations were reported for the CIAS-R. Results from the confirmatory factor analysis suggested a four-factor structure of Compulsive Use and Withdrawal, Tolerance, Interpersonal and Health-related Problems, and Time Management Problems. Moreover, results of hierarchical multiple regression supported the incremental validity of the CIAS-R to predict mental health outcomes beyond the effects of demographic differences and self-reported time spent online. The CIAS is a reliable and valid measure of internet addiction problems in Hong Kong adolescents. Future study is warranted to validate the cutoffs of the CIAS-R for identification of adolescents with Internet use problems who may have mental health needs.

  7. Writing Beyond the Wall: Translation, Cross-cultural Exchange, and Chen Ran's 'A Private Life'

    Directory of Open Access Journals (Sweden)

    Kay Schaffer

    2006-09-01

    Full Text Available The past decade has witnessed an unprecedented rise in the global flow of knowledge, nowhere more apparent in the exchange of ideas between China and modern western democracies. Our interest concerns one aspect of this global flow— the translation of Chinese women’s autobiographical writing into English. Taking Chen Ran’s A Private Life (English edition, 2004 as a point of departure, the paper explores issues of translingual practice and cross-cultural exchange. It considers what escapes or is lost in translation as well as the additive potential of the host text. It is sometimes the case that the translation can deliberately make certain ambiguities visible—whether from pragmatic, market-driven motivations or from more complex political, historical and cultural considerations. These negotiations of meaning that occur in the translation process can reverberate on the critical reception of texts in both the ‘guest’ and ‘host’ languages (Liu 1995, with open-ended, incomplete and indeterminate effects. The paper examines the effects of the omission of a brief parenthetical section of three paragraphs from one chapter of the Chinese edition of A Private Life. Yet, even that small emendation changes the original text as a cultural object and alters potential modes of its reception. In this case, the translation results in a loss of ambiguity, irony, philosophic and rhetorical sophistication while also offering additive potentials that enhance the generation of new meanings in the translingual exchange, here with reference Tiananmen and contemporary feminism in China. The translation process provides new channels for readers, writers and theorists to dialogue and communicate across gaps of difference, despite inhibiting factors like the imposition of local restraints, the universalising pressures of western modernity, and asymmetrical relations of power between guest and host language contexts.

  8. Politics in the Western Maya Region (I: Ajawil/Ajawlel and Ch'e'n

    Directory of Open Access Journals (Sweden)

    Péter Bíró

    2011-01-01

    Full Text Available In a series of articles I reflect on the use of various expressions which are connected to what we call the political in the inscriptions of the Classic Maya Western Region. These words express concepts which help to understand the intricate details of the interactions between the political entities and their internal organisations in the Classic Maya Lowlands. Words such as 7ajawil, 7ajawlel, the kennings built on the base of ch'e7n (cave, pond, the emblem glyphs and titles will be examined in light of what they tell us about the functioning of the political organisation of the Classic Period in a constrained region.En una serie de artículos como éste investigo el uso de varias palabras en las inscripciones mayas de la época Clásica de la Región Occidental vinculadas con lo que nosotros llamamos "política". Estas palabras expresan conceptos que ayudan a entender los matices de las relaciones entre las entidades políticas de las Tierras Bajas Mayas y su organización interna. Términos como ajaw'ü I ajawlel, los difrasismos con base ch'e'n (cueva, pozo, los glifos emblemas y los títulos serán examinados tomando en cuenta la información que nos proporcionan sobre el funcionamiento de la organización política de la época Clásica en una región restringida.

  9. Biodesulfurization of Naphthothiophene and Benzothiophene through Selective Cleavage of Carbon-Sulfur Bonds by Rhodococcus sp. Strain WU-K2R

    Science.gov (United States)

    Kirimura, Kohtaro; Furuya, Toshiki; Sato, Rika; Ishii, Yoshitaka; Kino, Kuniki; Usami, Shoji

    2002-01-01

    Naphtho[2,1-b]thiophene (NTH) is an asymmetric structural isomer of dibenzothiophene (DBT), and in addition to DBT derivatives, NTH derivatives can also be detected in diesel oil following hydrodesulfurization treatment. Rhodococcus sp. strain WU-K2R was newly isolated from soil for its ability to grow in a medium with NTH as the sole source of sulfur, and growing cells of WU-K2R degraded 0.27 mM NTH within 7 days. WU-K2R could also grow in the medium with NTH sulfone, benzothiophene (BTH), 3-methyl-BTH, or 5-methyl-BTH as the sole source of sulfur but could not utilize DBT, DBT sulfone, or 4,6-dimethyl-DBT. On the other hand, WU-K2R did not utilize NTH or BTH as the sole source of carbon. By gas chromatography-mass spectrometry analysis, desulfurized NTH metabolites were identified as NTH sulfone, 2′-hydroxynaphthylethene, and naphtho[2,1-b]furan. Moreover, since desulfurized BTH metabolites were identified as BTH sulfone, benzo[c][1,2]oxathiin S-oxide, benzo[c][1,2]oxathiin S,S-dioxide, o-hydroxystyrene, 2-(2′-hydroxyphenyl)ethan-1-al, and benzofuran, it was concluded that WU-K2R desulfurized NTH and BTH through the sulfur-specific degradation pathways with the selective cleavage of carbon-sulfur bonds. Therefore, Rhodococcus sp. strain WU-K2R, which could preferentially desulfurize asymmetric heterocyclic sulfur compounds such as NTH and BTH through the sulfur-specific degradation pathways, is a unique desulfurizing biocatalyst showing properties different from those of DBT-desulfurizing bacteria. PMID:12147483

  10. [Academic thoughts on Practice of acupuncture and moxibustion written by CHEN Jingwen, the acupuncture master in the Republic of China].

    Science.gov (United States)

    Huang, Weiping; Li, Naiqi

    2015-03-01

    Through the collection of Practice of acupuncture and moxibustion written by CHEN Jingwen, the acupuncture master in the Republic of China, the academic characteristics on acupuncture and moxibusiton were analyzed. The literature comparison method was adopted to compare the works of LUO Zhaoju, ZENG Tianzhi and LI Wenxian, etc. at the same period. It was discovered that CHEN Jingwen was the medical master who systematicly brought up the theory of acupoint properties earlier in the modern times. Classifying drugs based on acupoints was his academic feature. Additionally, the compatibility therapy of Chinese medicine was introduced to explain the essential ideas on the acupoints combination. The treatment was determined on the basis of zangxiang theory and the reinforcing and reducing therapy of acupuncture was emphasized in the determination of treatment and prescription. CHEN Jingwen's theory of acupoint property had been stressed and spread among the medical scholars in the Republic of China and he had made the beneficial exploration for the development of modern acupuncture and moxibustion therapy.

  11. Identification and comparative quantification of bio-active phthalides in essential oils from si-wu-tang, fo-shou-san, radix angelica and rhizoma chuanxiong.

    Science.gov (United States)

    Tang, Yuping; Zhu, Min; Yu, Sheng; Hua, Yongqing; Duan, Jin-Ao; Su, Shulan; Zhang, Xu; Lu, Yin; Ding, Anwei

    2010-01-15

    Phthalides are important bio-active constituents in Si-Wu-Tang and Fo-Shou-San, two commonly used Traditional Chinese Medicine (TCM) combined prescriptions mainly derived from Radix Angelica and Rhizoma Chuanxiong. In this paper, the contents of eight phthalides, including Z-ligustilide, E-ligustilide, Z-butylenephthalide, E-butylene-phthalide, 3-butylphthalide, neocnidilide and senkyunolide A were determined or estimated by gas chromatography-mass spectrometry (GC-MS). The results showed GC-MS was a simple, rapid, and high sensitive method for analyzing phthalides in Si-Wu-Tang, Fo-Shou-San, Radix Angelica and Rhizoma Chuanxiong, and the extractable contents of each phthalides including Z-ligustilide, E-ligustilide, Z-butylenephthalide, etc. varied after Radix Angelica, Rhizoma Chuanxiong were combined into a formulation, such as Si-Wu-Tang and Fo-Shou-San. Furthermore, inhibition activity of essential oils from Si-Wu-Tang, Fo-Shou-San, Radix Angelica and Rhizoma Chuanxiong on uterine contraction was tested in an in vitro assay, and the results showed that the activity of the essential oil is higher as the content of the phthalides increase, which demonstrated that phthalides are possibly main active components inhibiting mice uterine contraction in vitro. All of the results suggested that comparative analysis of chemical components and pharmacological activities of each herb and formula is possibly helpful to elucidate the active components in traditional Chinese medicine, and to reveal the compatibility mechanism of TCM formulae.

  12. I Know You Are, But What Am I? : Anti-Individualism in the Development of Intellectual Humility and Wu-Wei

    NARCIS (Netherlands)

    Robinson, Brian; Alfano, M.R.

    2016-01-01

    Virtues are acquirable, so if intellectual humility is a virtue, it’s acquirable. But there is something deeply problematic—perhaps even paradoxical—about aiming to be intellectually humble. Drawing on Edward Slingerland’s analysis of the paradoxical virtue of wu-wei in Trying Not To Try, we argue

  13. Traditional uses, botany, phytochemistry, pharmacology and toxicology of Panax notoginseng (Burk.) F.H. Chen: A review.

    Science.gov (United States)

    Wang, Ting; Guo, Rixin; Zhou, Guohong; Zhou, Xidan; Kou, Zhenzhen; Sui, Feng; Li, Chun; Tang, Liying; Wang, Zhuju

    2016-07-21

    Panax notoginseng (Burk.) F.H. Chen is a widely used traditional Chinese medicine known as Sanqi or Tianqi in China. This plant, which is distributed primarily in the southwest of China, has wide-ranging pharmacological effects and can be used to treat cardiovascular diseases, pain, inflammation and trauma as well as internal and external bleeding due to injury. This paper provides up-to-date information on investigations of this plant, including its botany, ethnopharmacology, phytochemistry, pharmacology and toxicology. The possible uses and perspectives for future investigation of this plant are also discussed. The relevant information on Panax notoginseng (Burk.) F.H. Chen was collected from numerous resources, including classic books about Chinese herbal medicine, and scientific databases, including Pubmed, SciFinder, ACS, Ebsco, Elsevier, Taylor, Wiley and CNKI. More than 200 chemical compounds have been isolated from Panax notoginseng (Burk.) F.H. Chen, including saponins, flavonoids and cyclopeptides. The plant has pharmacological effects on the cardiovascular system, immune system as well as anti-inflammatory, anti-atherosclerotic, haemostatic and anti-tumour activities, etc. Panax notoginseng is a valuable traditional Chinese medical herb with multiple pharmacological effects. This review summarizes the botany, ethnopharmacology, phytochemistry, pharmacology and toxicology of P. notoginseng, and presents the constituents and their corresponding chemical structures found in P. notoginseng comprehensively for the first time. Future research into its phytochemistry of bio-active components should be performed by using bioactivity-guided isolation strategies. Further work on elucidation of the structure-function relationship among saponins, understanding of multi-target network pharmacology of P. notoginseng, as well as developing its new clinical usage and comprehensive utilize will enhance the therapeutic potentials of P. notoginseng. Copyright © 2016

  14. Wu-Tou Decoction Inhibits Chronic Inflammatory Pain in Mice: Participation of TRPV1 and TRPA1 Ion Channels

    Directory of Open Access Journals (Sweden)

    Chao Wang

    2015-01-01

    Full Text Available Wu-tou decoction (WTD is a classic traditional Chinese medicine formula and has been used effectively to treat joint diseases clinically. Previous reports indicated that WTD possesses anti-inflammatory activity; however, its actions on pain have not been clarified. Here, we investigated the antinociceptive activity of WTD in CFA-induced mice, and its possible mechanism of the action associated with transient receptor potential (TRP ion channels was also explored. Our results showed that 1.58, 3.15, and 6.30 g/kg WTD significantly attenuated mechanical, cold, and heat hypersensitivities. Moreover, WTD effectively inhibited spontaneous nociceptive responses to intraplantar injections of capsaicin and cinnamaldehyde, respectively. WTD also effectively suppressed jumping and wet-dog-shake behaviors to intraperitoneal injection of icilin. Additionally, WTD significantly reduced protein expression of TRPV1 and TRPA1 in dorsal root ganglia and skins of injured paw. Collectively, our data demonstrate firstly that WTD exerts antinociceptive activity in inflammatory conditions by attenuating mechanical, cold, and heat hypersensitivities. This antinociceptive effect may result in part from inhibiting the activities of TRPV1, TRPA1, and TRPM8, and the suppression of TRPV1 and TRPA1 protein by WTD was also highly effective. These findings suggest that WTD might be an attractive and suitable therapeutic agent for the management of chronic inflammatory pain.

  15. The complete mitochondrial genome and its remarkable secondary structure for a stonefly Acroneuria hainana Wu (Insecta: Plecoptera, Perlidae).

    Science.gov (United States)

    Huang, Mingchao; Wang, Yuyu; Liu, Xingyue; Li, Weihai; Kang, Zehui; Wang, Kai; Li, Xuankun; Yang, Ding

    2015-02-15

    The Plecoptera (stoneflies) is a hemimetabolous order of insects, whose larvae are usually used as indicators for fresh water biomonitoring. Herein, we describe the complete mitochondrial (mt) genome of a stonefly species, namely Acroneuria hainana Wu belonging to the family Perlidae. This mt genome contains 13 PCGs, 22 tRNA-coding genes and 2 rRNA-coding genes that are conserved in most insect mt genomes, and it also has the identical gene order with the insect ancestral gene order. However, there are three special initiation codons of ND1, ND5 and COI in PCGs: TTG, GTG and CGA, coding for L, V and R, respectively. Additionally, the 899-bp control region, with 73.30% A+T content, has two long repeated sequences which are found at the 3'-end closing to the tRNA(Ile) gene. Both of them can be folded into a stem-loop structure, whose adjacent upstream and downstream sequences can be also folded into stem-loop structures. It is presumed that the four special structures in series could be associated with the D-loop replication. It might be able to adjust the replication speed of two replicate directions. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. [A Study on the quotations in the Wu xing da yi (The Gist of Five Phases) cited from Nei jing (Inner Canon)].

    Science.gov (United States)

    Wang, Zheng-Shan; Zhang, Qi-Cheng

    2013-07-01

    In the Wu xing da yi (The Gist of Five Phases), written by Xiao Ji of the Sui Dynasty, there were 9 quotations cited from Huang di nei jing (Inner Canon of Huangdi). By comparison with current version of Huang di nei jing, most of the descriptions are similar, yet still with some differences, such as yin-yang nature of the five zang visceras, the liver being the root of "pi ji", the spleen being the root of "cang lin" etc. Wu xing da yi epitomizes the books about yin-yang and five phases before the Sui Dynasty, while Xiao Ji's quotations from Huang di nei jing interpreted from the views of yin-yang and five phases, are different from the annotations of later ages.

  17. Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige

    OpenAIRE

    Giafferri, Xiaomin

    2008-01-01

    Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authen...

  18. [A molecular epidemiological study of KI polyomavirus and WU polyomavirus in children with acute respiratory infection in Tianjin, China].

    Science.gov (United States)

    Lin, Shu-Xiang; Wang, Wei; Guo, Wei; Yang, Hong-Jiang; Ma, Bai-Cheng; Fang, Yu-Lian; Xu, Yong-Sheng

    2017-07-01

    To investigate the relationship of KI polyomavirus (KIPyV) and WU polyomavirus (WUPyV) with acute respiratory infection in children in Tianjin, China. A total of 3 730 nasopharyngeal secretions were collected from hospitalized children with acute respiratory infection in Tianjin Children's Hospital from January 2011 to December 2013. Viral nucleic acid was extracted, and virus infection (KIPyV and WUPyV) was determined by PCR. Some KIPyV-positive and WUPyV-positive PCR products were subjected to sequencing. Sequencing results were aligned with the known gene sequences of KIPyV and WUPyV to construct a phylogenetic tree. Amplified VP1 fragments of KIPyV were inserted into the cloning vector (PUCm-T) transformed into E. coli competent cells. Positive clones were identified by PCR and sequencing. The nucleotide sequences were submitted to GenBank. In addition, another seven common respiratory viruses in all samples were detected by direct immunofluorescence assay. In the 3 730 specimens, the KIPyV-positive rate was 12.14% (453/3 730) and the WUPyV-positive rate was 1.69% (63/3 730). The mean infection rate of KIPyV was significantly higher in June and July, while the mean infection rate of WUPyV peaked in February and March. Most of the KIPyV-positive or WUPyV-positive children were infections with KIPyV, WUPyV, and other respiratory viruses were observed in the children. The co-infection rate was 2.31% (86/3 730) and there were nine cases of co-infections with WUPyV and KIPyV. Thirty-five KIPyV-positive and twelve WUPyV-positive PCR products were sequenced and the alignment analysis showed that they had high homology with the known sequences (94%-100% vs 95%-100%). The VP1 gene sequences obtained from two KIPyV strains in this study were recorded in GenBank with the accession numbers of KY465925 and KY465926. For some children with acute respiratory infection in Tianjin, China, the acute respiratory infection may be associated with KIPyV and WUPy

  19. Activation energy and R. Chen frequency factor in the Randall and Wilkins original equation for second order kinetics. Emission curve simulated in Microsoft Excel algebra

    International Nuclear Information System (INIS)

    Moreno M, A.; Moreno B, A.

    2000-01-01

    In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)

  20. Ultra high performance liquid chromatography coupled with electrospray ionization/quadrupole time-of-flight mass spectrometry for the rapid analysis of constituents in the traditional Chinese medicine formula Wu Ji Bai Feng Pill.

    Science.gov (United States)

    Duan, Shengnan; Qi, Wen; Zhang, Siwen; Huang, Kunkun; Yuan, Dan

    2017-10-01

    An ultra high performance liquid chromatography coupled with electrospray ionization quadrupole time-of-flight mass spectrometry method in both positive and negative ion modes was established in order to comprehensively investigate the major constituents in Wu Ji Bai Feng Pill. Briefly, a Waters ACQUITY UPLC HSS C 18 column was used to separate the aqueous extract of Wu Ji Bai Feng Pill. A total of 0.1% formic acid in acetonitrile and 0.1% aqueous formic acid v/v were used as the mobile phase. All analytes were determined using quadrupole time-of-flight mass spectrometry with electrospray ionization source in positive and negative ion modes. At length, a total of 173 components including flavones and their glycosides, monoterpene glycosides, triterpene saponins, phenethylalchohol glycosides, iridoid glycosides, phthalides, tanshinones, phenolic acids, sesquiterpenoids and cyclopeptides were identified or tentatively characterized in Wu Ji Bai Feng Pill in an analysis of 16.0 min based on the accurate mass and tandem mass spectrometry behaviors. The developed method is rapid and highly sensitive to characterize the chemical constituents of Wu Ji Bai Feng Pill, which could not only be used for chemical standardization and quality control of Wu Ji Bai Feng Pill, but also be helpful for further study in vivo metabolism of Wu Ji Bai Feng Pill. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Temporal Courses in EEG Theta and Alpha Activity in the Dynamic Health Qigong Techniques Wu Qin Xi and Liu Zi Jue

    Directory of Open Access Journals (Sweden)

    Diana Henz

    2018-01-01

    Full Text Available Health Qigong is a common technique of Traditional Chinese Medicine applied to strengthen mental and physical health. Several studies report increases in EEG theta and alpha activity after meditative Qigong techniques indicating a relaxed state of mind. To date, little is known on the effects of dynamic Health Qigong techniques that comprise bodily movements on brain activity. In the current study, we compared effects of two dynamic Health Qigong techniques on EEG brain activity. Subjects performed the techniques Wu Qin Xi (five animals play and Liu Zi Jue (six healing sounds in a within-subjects design. Eyes-open and eyes-closed resting EEG was recorded before and immediately after each 15-min practice block. Additionally, the Profile of Mood States (POMS questionnaire was administered at pretest, and after each 15-min practice block. Results show a decrease in alpha activity after 15 min, followed by an increase after 30 min in the Health Qigong technique Liu Zi Jue. Theta activity was decreased after 15 min, followed by an increase after 30 min in the technique Wu Qin Xi. Results of the POMS indicated an increased vigor-activity level with decreased fatigue and tension-anxiety levels in both techniques after 30 min of practice. Our results demonstrate different temporal dynamics in EEG theta and alpha activity for the Health Qigong techniques Wu Qin Xi and Liu Zi Jue. We hypothesize that the found brain activation patterns result from different attentional focusing styles and breathing techniques performed during the investigated Health Qigong techniques.

  2. Enzymatic characterization and gene identification of aconitate isomerase, an enzyme involved in assimilation of trans-aconitic acid, from Pseudomonas sp. WU-0701.

    Science.gov (United States)

    Yuhara, Kahori; Yonehara, Hiromi; Hattori, Takasumi; Kobayashi, Keiichi; Kirimura, Kohtaro

    2015-11-01

    trans-Aconitic acid is an unsaturated organic acid that is present in some plants such as soybean and wheat; however, it remains unclear how trans-aconitic acid is degraded and/or assimilated by living cells in nature. From soil, we isolated Pseudomonas sp. WU-0701 assimilating trans-aconitic acid as a sole carbon source. In the cell-free extract of Pseudomonas sp. WU-0701, aconitate isomerase (AI; EC 5.3.3.7) activity was detected. Therefore, it seems likely that strain Pseudomonas sp. WU-0701 converts trans-aconitic acid to cis-aconitic acid with AI, and assimilates this via the tricarboxylic acid cycle. For the characterization of AI from Pseudomonas sp. WU-0701, we performed purification, determination of enzymatic properties and gene identification of AI. The molecular mass of AI purified from cell-free extract was estimated to be ~ 25 kDa by both SDS/PAGE and gel filtration analyses, indicating that AI is a monomeric enzyme. The optimal pH and temperature of purified AI for the reaction were 6.0 °C and 37 °C, respectively. The gene ais encoding AI was cloned on the basis of the N-terminal amino acid sequence of the protein, and Southern blot analysis revealed that only one copy of ais is located on the bacterial genome. The gene ais contains an ORF of 786 bp, encoding a polypeptide of 262 amino acids, including the N-terminal 22 amino acids as a putative periplasm-targeting signal peptide. It is noteworthy that the amino acid sequence of AI shows 90% and 74% identity with molybdenum ABC transporter substrate-binding proteins of Pseudomonas psychrotolerans and Xanthomonas albilineans, respectively. This is the first report on purification to homogeneity, characterization and gene identification of AI. The nucleotide sequence of ais described in this article is available in the DDBJ/EMBL/GenBank nucleotide sequence databases under the Accession No. LC010980. © 2015 FEBS.

  3. New contributions to the knowledge of Chinese flea beetle fauna (III): Revision of Meishania Chen & Wang with description of five new species (Coleoptera: Chrysomelidae: Galerucinae)

    Science.gov (United States)

    The flea beetle genus Meishania Chen & Wang is revised and five new species - M. cangshanensis sp. nov., M. flavipennis sp. nov., M. fulvotigera sp. nov., and M. sichuanica sp. nov. from China and M. bhutanensis sp. nov. from Bhutan - are described. All species of Meishania are illustrated and a key...

  4. Debris flow run off simulation and verification ‒ case study of Chen-You-Lan Watershed, Taiwan

    Directory of Open Access Journals (Sweden)

    M.-L. Lin

    2005-01-01

    Full Text Available In 1996 typhoon Herb struck the central Taiwan area, causing severe debris flow in many subwatersheds of the Chen-You-Lan river watershed. More severe cases of debris flow occurred following Chi-Chi earthquake, 1999. In order to identify the potentially affected area and its severity, the ability to simulate the flow route of debris is desirable. In this research numerical simulation of debris flow deposition process had been carried out using FLO-2D adopting Chui-Sue river watershed as the study area. Sensitivity study of parameters used in the numerical model was conducted and adjustments were made empirically. The micro-geomorphic database of Chui-Sue river watershed was generated and analyzed to understand the terrain variations caused by the debris flow. Based on the micro-geomorphic analysis, the debris deposition in the Chui-Sue river watershed in the downstream area, and the position and volume of debris deposition were determined. The simulated results appeared to agree fairly well with the results of micro-geomorphic study of the area when not affected by other inflow rivers, and the trends of debris distribution in the study area appeared to be fairly consistent.

  5. Satellite-derived land covers for runoff estimation using SCS-CN method in Chen-You-Lan Watershed, Taiwan

    Science.gov (United States)

    Zhang, Wen-Yan; Lin, Chao-Yuan

    2017-04-01

    The Soil Conservation Service Curve Number (SCS-CN) method, which was originally developed by the USDA Natural Resources Conservation Service, is widely used to estimate direct runoff volume from rainfall. The runoff Curve Number (CN) parameter is based on the hydrologic soil group and land use factors. In Taiwan, the national land use maps were interpreted from aerial photos in 1995 and 2008. Rapid updating of post-disaster land use map is limited due to the high cost of production, so the classification of satellite images is the alternative method to obtain the land use map. In this study, Normalized Difference Vegetation Index (NDVI) in Chen-You-Lan Watershed was derived from dry and wet season of Landsat imageries during 2003 - 2008. Land covers were interpreted from mean value and standard deviation of NDVI and were categorized into 4 groups i.e. forest, grassland, agriculture and bare land. Then, the runoff volume of typhoon events during 2005 - 2009 were estimated using SCS-CN method and verified with the measured runoff data. The result showed that the model efficiency coefficient is 90.77%. Therefore, estimating runoff by using the land cover map classified from satellite images is practicable.

  6. Plasma biochemistry values in emperor geese (Chen canagica) in Alaska: comparisons among age, sex, incubation, and molt.

    Science.gov (United States)

    Franson, J. Christian; Hoffman, D.J.; Schmutz, J.A.

    2009-01-01

    Reduced populations of emperor geese (Chen canagica), a Bering Sea endemic, provided the need to assess plasma biochemistry values as indicators of population health. A precursory step to such an investigation was to evaluate patterns of variability in plasma biochemistry values among age, sex, and reproductive period. Plasma from 63 emperor geese was collected on their breeding grounds on the Yukon-Kuskokwim Delta in western Alaska, USA. The geese sampled included 18 incubating adult females captured, in mid June, on their nests by using bow nets, and 30 adults and 15 goslings captured in corral traps in late July and early August, when the adults were molting their wing feathers and the goslings were 5-6 weeks old. Plasma was evaluated for 15 biochemical parameters, by comparing results among age, sex, and sampling period (incubation versus wing-feather molt). Ten of the 15 biochemical parameters assayed differed among adults during incubation, the adults during molt, and the goslings at molt, whereas sex differences were noted in few parameters.

  7. A variational numerical method based on finite elements for the nonlinear solution characteristics of the periodically forced Chen system

    Science.gov (United States)

    Khan, Sabeel M.; Sunny, D. A.; Aqeel, M.

    2017-09-01

    Nonlinear dynamical systems and their solutions are very sensitive to initial conditions and therefore need to be approximated carefully. In this article, we present and analyze nonlinear solution characteristics of the periodically forced Chen system with the application of a variational method based on the concept of finite time-elements. Our approach is based on the discretization of physical time space into finite elements where each time-element is mapped to a natural time space. The solution of the system is then determined in natural time space using a set of suitable basis functions. The numerical algorithm is presented and implemented to compute and analyze nonlinear behavior at different time-step sizes. The obtained results show an excellent agreement with the classical RK-4 and RK-5 methods. The accuracy and convergence of the method is shown by comparing numerically computed results with the exact solution for a test problem. The presented method has shown a great potential in dealing with the solutions of nonlinear dynamical systems and thus can be utilized in delineating different features and characteristics of their solutions.

  8. Screening for Internet Addiction: An Empirical Study on Cut-off Points for the Chen Internet Addiction Scale

    Directory of Open Access Journals (Sweden)

    Chih-Hung Ko

    2005-12-01

    Full Text Available The aim of this study was to establish the optimal cut-off points of the Chen Internet Addiction Scale (CIAS, to screen for and diagnose Internet addiction among adolescents in the community by using the well- established diagnostic criteria of Internet addiction. This survey of 454 adolescents used screening (57/58 and diagnostic (63/64 cut-off points of the CIAS, a self-reported instrument, based on the results of systematic diagnostic interviews by psychiatrists. The area under the curve of the receiver operating characteristic curve revealed that CIAS has good diagnostic accuracy (89.6%. The screening cut-off point had high sensitivity (85.6% and the diagnostic cut-off point had the highest diagnostic accuracy, classifying 87.6% of participants correctly. Accordingly, the screening point of the CIAS could provide a screening function in two-stage diagnosis, and the diagnostic point could serve as a diagnostic criterion in one-stage massive epidemiologic research.

  9. Ground-state magnetization of the Ising spin glass: A recursive numerical method and Chen-Ma scaling

    Science.gov (United States)

    Sepehrinia, Reza; Chalangari, Fartash

    2018-03-01

    The ground-state properties of quasi-one-dimensional (Q1D) Ising spin glass are investigated using an exact numerical approach and analytical arguments. A set of coupled recursive equations for the ground-state energy are introduced and solved numerically. For various types of coupling distribution, we obtain accurate results for magnetization, particularly in the presence of a weak external magnetic field. We show that in the weak magnetic field limit, similar to the 1D model, magnetization exhibits a singular power-law behavior with divergent susceptibility. Remarkably, the spectrum of magnetic exponents is markedly different from that of the 1D system even in the case of two coupled chains. The magnetic exponent makes a crossover from being dependent on a distribution function to a constant value independent of distribution. We provide an analytic theory for these observations by extending the Chen-Ma argument to the Q1D case. We derive an analytical formula for the exponent which is in perfect agreement with the numerical results.

  10. Serum Metabolomic Characterization of Liver Fibrosis in Rats and Anti-Fibrotic Effects of Yin-Chen-Hao-Tang

    Directory of Open Access Journals (Sweden)

    Hongyang Zhang

    2016-01-01

    Full Text Available Yin-Chen-Hao-Tang (YCHT is a famous Chinese medicine formula which has long been used in clinical practice for treating various liver diseases, such as liver fibrosis. However, to date, the mechanism for its anti-fibrotic effects remains unclear. In this paper, an ultra-performance liquid chromatography-time-of-flight mass spectrometry (UPLC-TOF-MS-based metabolomic study was performed to characterize dimethylnitrosamine (DMN-induced liver fibrosis in rats and evaluate the therapeutic effects of YCHT. Partial least squares-discriminant analysis (PLS-DA showed that the model group was well separated from the control group, whereas the YCHT-treated group exhibited a tendency to restore to the controls. Seven significantly changed fibrosis-related metabolites, including unsaturated fatty acids and lysophosphatidylcholines (Lyso-PCs, were identified. Moreover, statistical analysis demonstrated that YCHT treatment could reverse the levels of most metabolites close to the normal levels. These results, along with histological and biochemical examinations, indicate that YCHT has anti-fibrotic effects, which may be due to the suppression of oxidative stress and resulting lipid peroxidation involved in hepatic fibrogenesis. This study offers new opportunities to improve our understanding of liver fibrosis and the anti-fibrotic mechanisms of YCHT.

  11. Body mass of prefledging Emperor Geese Chen canagica: Large-scale effects of interspecific densities and food availability

    Science.gov (United States)

    Lake, B.C.; Schmutz, J.A.; Lindberg, M.S.; Ely, Craig R.; Eldridge, W.D.; Broerman, F.J.

    2008-01-01

    We studied body mass of prefledging Emperor Geese Chen canagica at three locations across the Yukon-Kuskokwim Delta, Alaska, during 1990-2004 to investigate whether large-scale variation in body mass was related to interspecific competition for food. From 1990 to 2004, densities of Cackling Geese Branta hutchinsii minima more than doubled and were c. 2-5?? greater than densities of Emperor Geese, which were relatively constant over time. Body mass of prefledging Emperor Geese was strongly related (negatively) to interspecific densities of geese (combined density of Cackling and Emperor Geese) and positively related to measures of food availability (grazing lawn extent and net above-ground primary productivity (NAPP)). Grazing by geese resulted in consumption of ??? 90% of the NAPP that occurred in grazing lawns during the brood-rearing period, suggesting that density-dependent interspecific competition was from exploitation of common food resources. Efforts to increase the population size of Emperor Geese would benefit from considering competitive interactions among goose species and with forage plants. ?? 2008 The Authors.

  12. Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige

    Directory of Open Access Journals (Sweden)

    Xiaomin Giafferri

    2008-12-01

    Full Text Available Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authenticité s’établit à travers les mécanismes de la fictionnalisation de l’Histoire. L’observation de leur manifestation est amenée à considérer deux axes principaux : l’organisation du récit et la mise en scène des personnages.

  13. Overexpression of the NADP+-specific isocitrate dehydrogenase gene (icdA) in citric acid-producing Aspergillus niger WU-2223L.

    Science.gov (United States)

    Kobayashi, Keiichi; Hattori, Takasumi; Hayashi, Rie; Kirimura, Kohtaro

    2014-01-01

    In the tricarboxylic acid (TCA) cycle, NADP(+)-specific isocitrate dehydrogenase (NADP(+)-ICDH) catalyzes oxidative decarboxylation of isocitric acid to form α-ketoglutaric acid with NADP(+) as a cofactor. We constructed an NADP(+)-ICDH gene (icdA)-overexpressing strain (OPI-1) using Aspergillus niger WU-2223L as a host and examined the effects of increase in NADP(+)-ICDH activity on citric acid production. Under citric acid-producing conditions with glucose as the carbon source, the amounts of citric acid produced and glucose consumed by OPI-1 for the 12-d cultivation period decreased by 18.7 and 10.5%, respectively, compared with those by WU-2223L. These results indicate that the amount of citric acid produced by A. niger can be altered with the NADP(+)-ICDH activity. Therefore, NADP(+)-ICDH is an important regulator of citric acid production in the TCA cycle of A. niger. Thus, we propose that the icdA gene is a potentially valuable tool for modulating citric acid production by metabolic engineering.

  14. Wu-Chia-Pi Solution Attenuates Carbon Tetrachloride-Induced Hepatic Injury through the Antioxidative Abilities of Its Components Acteoside and Quercetin

    Directory of Open Access Journals (Sweden)

    Ching-Chiung Wang

    2012-12-01

    Full Text Available Wu-Chia-Pi medicated wine, composed nine Chinese medicines soaked in 35% alcohol, is widely used in Asia for its health-promoting functions. However, long-term consumption of alcohol could result in liver dysfunction. In this study, Wu-Chia-Pi solution (WCPS and extract (WCPE were prepared by modification of the principals given by the Committee on Chinese Medicine and Pharmacy in Taiwan. The aim of this study was to explore the protective effect of WCPS against carbon tetrachloride (CCl4-induced liver injury and to clarify its active component(s. Antioxidative effects of the test samples were evaluated via MDA inhibition, catalase activity and DPPH-scavenging assays. HPLC was used to analysis the active components. Results showed that WCPS (1 and 5 mL/kg significantly prevented CCl4-induced liver injury without chronic liver toxicity. Referring to the antioxidative activities, WCPE displayed significant MDA inhibitory and DPPH-scavenging activities with IC50 values of 0.91 ± 0.03 and 0.60 ± 0.04 mg/mL, respectively. Catalase activity was also enhanced by treatment of WCPE, acteoside and quercetin. Therefore, we suggest that acteoside and quercetin are the major contributors to the antioxidative and hepatoprotective activities of WCPS, and a possible mechanism could be mediated through reduction of oxidative stress.

  15. Tentative characterization of precursor compounds and co-factors of pigment formation in production of 'wu mi' from Vaccinium bracteatum Thunb. Leaves.

    Science.gov (United States)

    Fan, Mingcong; Fan, Yihui; Huang, Weiping; Wang, Li; Li, Yan; Qian, Haifeng; Zhang, Hui; Qi, Xiguang

    2018-10-01

    Vaccinium bracteatum leaves (VBTL) are traditionally used in China to dye rice grains, which assume a deep blue color, named 'Wu mi'. Information on the mechanism of pigment formation is limited. In this study, CIELAB color space parameters were used to represent the color of 'Wu mi'. Precursor compounds of pigments formed during the dyeing process were identified by UPLC Q-TOF MS analysis. The changes in co-factors for pigment formation in VBTL were measured at different growth stages. The L ∗ and b ∗ values of dyed rice increased as the leaves aged, whereas a ∗ values showed irregular changes. Six compounds were tentatively identified as pigment precursors by UPLC Q-TOF MS analysis. The pH and β-glucosidase activity at different growth stages of VBTL were indicated to be crucial co-factors for pigment formation. A tentative hypothesis is presented that iridoid glycosides are hydrolyzed by acids and β-glucosidases to form a dialdehyde structure that binds covalently with amino residues of lysine side chains in rice protein molecules. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. Activation energy and R. Chen frequency factor in the Randall and Wilkins original equation for second order kinetics. Emission curve simulated in Microsoft Excel algebra; Energia de activacion y factor de frecuencia de R. Chen en la ecuacion original de Randall y Wilkins para cinetica de segundo orden. Curva de emision simulada en algebra de Microsoft Excel

    Energy Technology Data Exchange (ETDEWEB)

    Moreno M, A. [Departamento de Apoyo en Ciencias Aplicadas, Benemerita Universidad Autonoma de Puebla, 4 Sur 104, Centro Historico, 72000 Puebla (Mexico); Moreno B, A

    2000-07-01

    In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)

  17. Variation in foraging behavior and body mass in broods of Emperor Geese (Chen canagica): Evidence for interspecific density dependence

    Science.gov (United States)

    Schmutz, J.A.; Laing, K.K.

    2002-01-01

    Broods of geese spend time feeding according to availability and quality of food plants, subject to inherent foraging and digestive constraints. We studied behavioral patterns of broods of Emperor Geese (Chen canagica) on the Yukon–Kuskokwim Delta, Alaska, and examined how feeding and alert behavior varied in relation to habitat and goose density. During 1994–1996, time spent feeding by Emperor Goose goslings and adult females was positively related to multispecies goose densities near observation blinds, and not to just Emperor Goose density. Similarly, body mass of Emperor Goose goslings was more strongly related (negatively) to multispecies goose densities than intraspecific densities. A grazing experiment in 1995 indicated that most above ground primary production by Carex subspathacea, a preferred food plant, was consumed by grazing geese. Those results demonstrate that interspecific competition for food occurred, with greatest support for goslings whose behavioral repertoire is limited primarily to feeding, digesting, and resting. Although the more abundant Cackling Canada Geese (Branta canadensis minima) differed from Emperor Geese in their preferred use of habitats during brooding rearing (Schmutz 2001), the two species occurred in equal abundance in habitats preferred by Emperor Goose broods. Thus, Cackling Canada Geese were a numerically significant competitor with Emperor Geese. Comparing these results to an earlier study, time spent feeding by goslings, adult females, and adult males were greater during 1993–1996 than during 1985–1986. During the interval between those studies, densities of Cackling Canada Geese increased two to three times whereas Emperor Goose numbers remained approximately stable, which implies that interspecific competition affected foraging behavior over a long time period. These density-dependent changes in foraging behavior and body mass indicate that interspecific competition affects nutrient acquisition and gosling

  18. [Textual research on Chen Ye and his Jia cang jing yan fang (Family-preserved Empirical Recipes) of the Song Dynasty].

    Science.gov (United States)

    Zhang, Xuedan; Zhang, Ruqing; Chen, Dexing

    2014-01-01

    Chen Ye, an official of the Southern Song Dynasty, also known as Chen Rihua as his styled name, was born in Changle, Fuzhou in the reign of Shaoxing, and died during the reign of Duanping. He had been consecutively in the positions of Jiang shi lang (Court Gentleman for Ceremonial Service), Zhi zhou (Prefect) of Lingding, the Ti xing (Judicial Commissioner) of Guangdong, the Zong ling (Overseer-general) of Sichuan, Shan ding (Reviser), Shu lin and other positions in Tongzhou, Yuanzhou. His works included 1 volume of Gu ling xian sheng nian pu (Mr. Guling's Chronological Biography), 1 volume of Tan xie (On Humor), 1 volume of Shi hua (Poetry), 8 volumes of Jin yuan li shu (Jin Yuan's Smart Technique), 3 volumes of Yi jian zhi lei bian (Classified Compilation of Yijian's Annals), (Zeng guang) Suo sui lu (Augmented Records of Trivial Matters), 5 volumes of Jia cang jing yan fang (Family-preserved Empirical Recipes). He also compiled the 8-volume Yin jiang zhi (Yinjiang's Annals), published the 2-volume Jia cang ji yao fang (Collected Essential Recipes from Family Preservation), and other proses and poetry. Jia cang jing yan fang was a formulary compiled by Chen Ye, which was lost. Altogether 74 of its recipes were cited in Fu ren da quan liang fang (Complete Effective Prescriptions for Women's Diseases), Shou qin yang lao shu (A Book for Pursuing Seniors' Longevity and Healthcare), Pu ji fang (Prescriptions for Universal Relief) and Yong le da dian (Yongle Encyclopedia).

  19. Discovery of estrogen receptor α modulators from natural compounds in Si-Wu-Tang series decoctions using estrogen-responsive MCF-7 breast cancer cells.

    Science.gov (United States)

    Liu, Li; Ma, Hongyue; Tang, Yuping; Chen, Wenxing; Lu, Yin; Guo, Jianming; Duan, Jin-Ao

    2012-01-01

    The binding between the estrogen receptor α (ER-α) and a variety of compounds in traditional Chinese formulae, Si-Wu-Tang (SWT) series decoctions, was studied using a stably-transfected human breast cancer cell line (MVLN). In 38 compounds tested from SWT series decoctions, the estrogen-like activity of 22 compounds was above 60% in 20 μg mL(-1). Furthermore, theoretical affinity of these compounds was certificated using the functional virtual screen of ER-α modulators by FlexX-Pharm. The accuracy of functional virtual screening of ER-α modulators could reach to 77.27%. The results showed that some compounds, such as organic acids and flavones in SWT series decoctions could be used as selective estrogen receptor modulators (SERMs) and could be selected for further development as potential agents for estrogen related diseases. Copyright © 2011 Elsevier Ltd. All rights reserved.

  20. Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.

    CERN Multimedia

    Maximilien Brice

    2007-01-01

    Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.

  1. 21 October 2008 - LHC Inauguration - IHEP Beijing representative Prof. Chen, People's Republic of China, welcomed by CERN Director-General R. Aymar, CERN Chief Scientific Officer J. Engelen and CERN Financial Officer S. Lettow.

    CERN Multimedia

    CERN Photo Service

    2008-01-01

    21 October 2008 - LHC Inauguration - IHEP Beijing representative Prof. Chen, People's Republic of China, welcomed by CERN Director-General R. Aymar, CERN Chief Scientific Officer J. Engelen and CERN Financial Officer S. Lettow.

  2. 6 June 2012 - Chinese Nanjing University President J.Chen in the ATLAS visitor centre with Member of the ATLAS Collaboration I. Wingerter and International Relations Office Adviser E. Tsesmelis. M. Qi, Nanjing University and ATLAS Collaboration, accompanies the delegation.

    CERN Multimedia

    Maximilien Brice

    2012-01-01

    6 June 2012 - Chinese Nanjing University President J.Chen in the ATLAS visitor centre with Member of the ATLAS Collaboration I. Wingerter and International Relations Office Adviser E. Tsesmelis. M. Qi, Nanjing University and ATLAS Collaboration, accompanies the delegation.

  3. Two new genera and three new species of Epipaschiinae Meyrick from China (Lepidoptera, Pyralidae

    Directory of Open Access Journals (Sweden)

    Mingqiang Wang

    2017-12-01

    Full Text Available Two new genera of Epipaschiinae are described. The genus Arcanusa Wang, Chen & Wu, gen. n. is established for Ar. apexiarcanusa Wang, Chen & Wu, sp. n. and Ar. sinuosa (Moore, 1888, comb. n., described in Scopocera Moore, 1888 (junior synonym of Stericta Lederer, 1863. The female genitalia of Ar. sinuosa (Moore, 1888, comb. n. are described for the first time. Androconia Wang, Chen & Wu, gen. n. is erected, including two new species, An. rallusa Wang, Chen & Wu, sp. n. and An. morulusa Wang, Chen & Wu, sp. n. Illustrations of all adults and their genitalia, and a key to the two new genera are provided.

  4. Structural and Biochemical Characterization of BdsA from Bacillus subtilis WU-S2B, a Key Enzyme in the “4S” Desulfurization Pathway

    Directory of Open Access Journals (Sweden)

    Tiantian Su

    2018-02-01

    Full Text Available Dibenzothiophene (DBT and their derivatives, accounting for the major part of the sulfur components in crude oil, make one of the most significant pollution sources. The DBT sulfone monooxygenase BdsA, one of the key enzymes in the “4S” desulfurization pathway, catalyzes the oxidation of DBT sulfone to 2′-hydroxybiphenyl 2-sulfonic acid (HBPSi. Here, we determined the crystal structure of BdsA from Bacillus subtilis WU-S2B, at the resolution of 2.2 Å, and the structure of the BdsA-FMN complex at 2.4 Å. BdsA and the BdsA-FMN complex exist as tetramers. DBT sulfone was placed into the active site by molecular docking. Seven residues (Phe12, His20, Phe56, Phe246, Val248, His316, and Val372 are found to be involved in the binding of DBT sulfone. The importance of these residues is supported by the study of the catalytic activity of the active site variants. Structural analysis and enzyme activity assay confirmed the importance of the right position and orientation of FMN and DBT sulfone, as well as the involvement of Ser139 as a nucleophile in catalysis. This work combined with our previous structure of DszC provides a systematic structural basis for the development of engineered desulfurization enzymes with higher efficiency and stability.

  5. The complete mitochondrial genome of the styloperlid stonefly species Styloperla spinicercia Wu (Insecta: Plecoptera) with family-level phylogenetic analyses of the Pteronarcyoidea.

    Science.gov (United States)

    Wang, Ying; Cao, Jinjun; Li, Weihai

    2017-03-13

    We present the complete mitochondrial (mt) genome sequence of the stonefly, Styloperla spinicercia Wu, 1935 (Plecoptera: Styloperlidae), the type species of the genus Styloperla and the first complete mt genome for the family Styloperlidae. The genome is circular, 16,129 base pairs long, has an A+T content of 70.7%, and contains 37 genes including the large and small ribosomal RNA (rRNA) subunits, 13 protein coding genes (PCGs), 22 tRNA genes and a large non-coding region (CR). All of the PCGs use the standard initiation codon ATN except ND1 and ND5, which start with TTG and GTG. Twelve of the PCGs stop with conventional terminal codons TAA and TAG, except ND5 which shows an incomplete terminator signal T. All tRNAs have the classic clover-leaf structures with the dihydrouridine (DHU) arm of tRNASer(AGN) forming a simple loop. Secondary structures of the two ribosomal RNAs are presented with reference to previous models. The structural elements and the variable numbers of tandem repeats are described within the control region. Phylogenetic analyses using both Bayesian (BI) and Maximum Likelihood (ML) methods support the previous hypotheses regarding family level relationships within the Pteronarcyoidea. The genetic distance calculated based on 13 PCGs and two rRNAs between Styloperla sp. and S. spinicercia is provided and interspecific divergence is discussed.

  6. Si-Wu-tang extract stimulates bone formation through PI3K/Akt/NF-κB signaling pathways in osteoblasts.

    Science.gov (United States)

    Wu, Chi-Ming; Chen, Po-Chun; Li, Te-Mao; Fong, Yi-Chin; Tang, Chih-Hsin

    2013-10-24

    Si-Wu-Tang (SWT), a Traditional Chinese Medicine (TCM) formula, is widely used for the treatment of gynopathies diseases such as menstrual discomfort, climacteric syndrome, dysmenorrhea, and other estrogen-related diseases. Recent studies have shown that SWT can treat primary dysmenorrhea, have anti-pruritic anti-inflammatory effects, and protect against radiation-induced bone marrow damage in an animal model. It has been reported that anti-inflammatory and anti-oxidant agents have the potential to treat osteoporosis by increasing bone formation and/or suppressing bone resorption. However, the effect of SWT on bone cell function has not yet been reported. Alkaline phosphatase (ALP), bone morphogenetic proteins (BMP)-2, and osteopontin (OPN) mRNA expression was analyzed by qPCR. The mechanism of action of SWT extract was investigated using western blotting. The in vivo anti-osteoporotic effect of SWT extract was assessed in ovariectomized mice. Here, we report that SWT increases ALP, BMP-2, and OPN expression as well as bone mineralization. In addition, we show that the PI3K, Akt, and NF-κB signaling pathways may be involved in the SWT-mediated increase in gene expression and bone mineralization. Notably, treatment of mice with SWT extract prevented bone loss induced by ovariectomy in vivo. SWT may be used to stimulate bone formation for the treatment of osteoporosis.

  7. Identification of Multiple Ingredients for a Traditional Chinese Medicine Preparation (Bu-yang-huan-wu-tang by Liquid Chromatography Coupled with Tandem Mass Spectrometry

    Directory of Open Access Journals (Sweden)

    Tung-Hu Tsai

    2013-09-01

    Full Text Available Bu-yang-huan-wu-tang (BYHWT is a popular Traditional Chinese Medicine formula consisting of seven herbal medicines (Astragalus membranaceus, Angelica sinensis, Paeonia lactiflora, Ligusticum chuanxiong, Carthamus tinctorius, Amygdalus persica and Pheretima aspergillum, that has been used in China for centuries to overcome stroke-induced disability. To ensure the consistency of quality, a reliable analytical method is required, therefore, we developed a liquid chromatography with tandem mass spectrometry (LC-MS/MS method for quantitative analysis of the major constituents in BYHWT. The herbal ingredients consisting of the cycloartane-type triterpene glycosides of astragaloside I, astragaloside II and astragaloside IV; isoflavones of formononetin, ononin calycosin, calycosin-7-O-β-d-glucoside; ligustilide and paeoniflorin were separated on a C18 column with gradient elution of methanol/10 mM ammonium acetate buffer–formic acid (100:0.1, v/v. This study was performed by a mass spectrometer using electrospray ionization (ESI with positive ionization ions monitored in the multiple reaction-monitoring (MRM mode. The linearity, accuracy, precision, limit of detection (LOD and lower limit of quantification (LLOQ were validated for this quantification method, and the sensitivity, reliability and reproducibility were all confirmed. The experiments provided a good method for analyzing BYHWT extracts. This study also quantitated the active components in various brands of commercially available products. The results indicated that the pharmaceutical industrial products of BYHWT exhibited considerable variation in their contents of the herbal compounds.

  8. Contamination and Human Health Risk Assessment of Polycyclic Aromatic Hydrocarbons (PAHs) in Oysters After the Wu Yi San Oil Spill in Korea.

    Science.gov (United States)

    Loh, Andrew; Yim, Un Hyuk; Ha, Sung Yong; An, Joon Geon; Kim, Moonkoo

    2017-07-01

    After the collision of the Singapore-registered oil tanker M/V Wu Yi San into the oil terminal of Yeosu, Korea on January 31, 2014, approximately 900 m 3 of oil and oil mixture were released from the ruptured pipelines. The oil affected more than 10 km of coastline along Gwangyang Bay. Emergency oil spill responses recovered bulk oil at sea and cleaned up the stranded oil on shore. As part of an emergency environmental impact assessment, region-wide monitoring of oil contamination in oyster had been conducted for 2 months. Highly elevated concentrations of polycyclic aromatic hydrocarbons (PAHs) were detected at most of the spill affected sites. Four days after the spill, the levels of PAHs in oysters increased dramatically to 627-81,000 ng/g, the average of which was 20 times higher than those found before the spill (321-4040 ng/g). The level of PAHs in these oysters increased until 10 days after the spill and then decreased. Due to the strong tidal current and easterly winter winds, the eastern part of the Bay-the Namhae region-was heavily contaminated compared with other regions. The accumulation and depuration of spilled oil in oyster corresponded with the duration and intensity of the cleanup activities, which is the first field observation in oil spill cases. Human health risk assessments showed that benzo[a]pyrene equivalent concentrations exceeded levels of concern in the highly contaminated sites, even 60 days after the spill.

  9. Pharmacokinetic determination of ephedrine in Herba Ephedrae and Wu Tou Tang decoctions in rats using ultra performance liquid chromatography tandem mass spectrometry.

    Science.gov (United States)

    Zheng, Zhijie; Yan, Tongmeng; Chen, Weiying; Ye, Ling; Tang, Lan; Liu, Zhongqiu

    2012-08-01

    A rapid and sensitive ultra performance liquid chromatography tandem mass spectrometry method was developed and validated for the determination and quantification of ephedrine in rat plasma samples. An Acquity UPLC BEH C18 column (1.7 μm, 2.1 mm × 50 mm) was used for chromatographic separation. Electrospray ionization in the positive mode was used, and the precursor-fragment ion pairs of m/z 166/148 and m/z 289/97 were adopted to characterize ephedrine and testosterone (internal standard), respectively. The method was validated using 10, 100 and 500 ng/mL of ephedrine. It demonstrated adequate levels of precision and accuracy, matrix effect, extraction recovery and stability. Linearity over the concentration range of 0.5-2000 ng/mL was acceptable with a correlation coefficient (r²) better than 0.990. To determine the pharmacokinetic behaviour of this sympathomimetic compound in the Sprague-Dawley rats, ephedrine hydrochloride, Herba Ephedrae single-herb and Wu Tou Tang decoctions were administered orally, and ephedrine hydrochloride was also administered by intravenous injection, and blood samples were collected over 24 h. Ephedrine was measured in plasma and pharmacokinetic parameters were determined by using the standard non-compartmental method and calculated by using Practical Pharmacokinetic Program-Version 87/97. The AUC(0-t) and T(max) values were significantly different (p Tang decoction compared to the other oral treatments, suggesting that some components in the decoction may reduce the bioavailability of ephedrine.

  10. Inhibition of Neoplastic Transformation and Chemically-Induced Skin Hyperplasia in Mice by Traditional Chinese Medicinal Formula Si-Wu-Tang

    Directory of Open Access Journals (Sweden)

    Mandy M. Liu

    2017-03-01

    Full Text Available Exploring traditional medicines may lead to the development of low-cost and non-toxic cancer preventive agents. Si-Wu-Tang (SWT, comprising the combination of four herbs, Rehmanniae, Angelica, Chuanxiong, and Paeoniae, is one of the most popular traditional Chinese medicines for women’s diseases. In our previous studies, the antioxidant Nrf2 pathways were strongly induced by SWT in vitro and in vivo. Since Nrf2 activation has been associated with anticarcinogenic effects, the purpose of this study is to evaluate SWT’s activity of cancer prevention. In the Ames test, SWT demonstrated an antimutagenic activity against mutagenicity induced by the chemical carcinogen 7,12-dimethylbenz(aanthracene (DMBA. In JB6 P+ cells, a non-cancerous murine epidermal model for studying tumor promotion, SWT inhibited epidermal growth factor (EGF-induced neoplastic transformation. The luciferase reporter gene assays demonstrated that SWT suppressed EGF-induced AP-1 and TNF-α-induced NF-κB activation, which are essential factors involved in skin carcinogenesis. In a DMBA-induced skin hyperplasia assay in ‘Sensitivity to Carcinogenesis’ (SENCAR mice, both topical and oral SWT inhibited DMBA-induced epidermal hyperplasia, expression of the proliferation marker Proliferating cell nuclear antigen (PCNA, and H-ras mutations. These findings demonstrate, for the first time, that SWT prevents tumor promoter and chemical-induced carcinogenesis in vitro and in vivo, partly by inhibiting DNA damage and blocking the activation of AP-1 and NF-κB.

  11. The prevalence and pathogenicity of gizzard nematodes of the genera Amidostomum and Epomidiostomum (Trichostrongylidae) in the lesser snow goose (Chen caerulescens caerulescens)

    Science.gov (United States)

    Tuggle, B.N.; Crites, John L.

    1984-01-01

    Three species of trichostrongylid nematodes were removed from the gizzards of 25 lesser snow geese, Chen caerulescens caerulescens, collected at Winisk, Ont. A 100% prevalence of infection was noted in the sampled population with each bird harboring two or more of the following species: Epomidiostomum crami (prevalence, 92%; mean intensity, 18.7 ± 13.3), Amidostomum anseris (prevalence, 84%; mean intensity, 9.6 ± 9.8), and Amidostomum spatulatum (prevalence, 84%; mean intensity, 11.2 ± 9.8). When large burdens (>30) of both A. anseris and A. spatulatum were present in the mucosal lining of the gizzard, progressive degeneration of the epithilium and koilin linings was noted in 16% of the geese examined. Severe necrotic granulomata observed in the gizzard muscle of 36% of the geese were associated with sizable burdens (>25) of E. crami which were found burrowed in the gizzard muscle.

  12. Chlorpromazine-induced perturbations of bile acids and free fatty acids in cholestatic liver injury prevented by the Chinese herbal compound Yin-Chen-Hao-Tang.

    Science.gov (United States)

    Yang, Qiaoling; Yang, Fan; Tang, Xiaowen; Ding, Lili; Xu, Ying; Xiong, Yinhua; Wang, Zhengtao; Yang, Li

    2015-04-16

    Yin-Chen-Hao-Tang (YCHT), a commonly used as a traditional chinese medicine for liver disease. Several studies indicated that YCHT may improving hepatic triglyceride metabolism and anti-apoptotic response as well as decreasing oxidative stress .However, little is known about the role of YCHT in chlorpromazine (CPZ) -induced chlolestatic liver injury. Therefore, we aimed to facilitate the understanding of the pathogenesis of cholestatic liver injury and evaluate the effect of Yin-Chen-Hao-Tang (YCHT) on chlorpromazine (CPZ)-induced cholestatic liver injury in rats based on the change of bile acids (BAs) and free fatty acids (FFAs) alone with the biochemical indicators and histological examination. We conducted an experiment on CPZ-induced cholestatic liver injury in Wistar rats with and without YCHT for nine consecutive days. Serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB), total bilirubin (TBIL), total cholesterol (TC), triglycerides (TG), low density lipoprotein-cholesterol (LDL-C) were measured to evaluate the protective effect of YCHT against chlorpromazine (CPZ)-induced cholestatic liver injury. Histopathology of the liver tissue showed that pathological injuries were relieved after YCHT pretreatment. In addition, ultra-performance lipid chromatography coupled with quadrupole mass spectrometry (UPLC-MS) and gas chromatography coupled with mass spectrometry (GC-MS) was applied to determine the content of bile acids, free fatty acids, respectively. Obtained data showed that YCHT attenuated the effect of CPZ-induced cholestatic liver injury, which was manifested by the serum biochemical parameters and histopathology of the liver tissue. YCHT regulated the lipid levels as indicated by the reversed serum levels of TC, TG, and LDL-C. YCHT also regulated the disorder of BA and FFA metabolism by CPZ induction. Results indicated that YCHT exerted a protective effect on CPZ-induced cholestasis liver injury. The variance of

  13. Sadhana | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Sadhana. Kang Ma. Articles written in Sadhana. Volume 34 Issue 5 October 2009 pp 851-864. Profit rate performance optimization for a generalized irreversible combined refrigeration cycle · Kang Ma Lingen Chen Fengrui Sun · More Details Abstract Fulltext PDF. Finite-time exergoeconomic performance ...

  14. Fengrui Sun

    Indian Academy of Sciences (India)

    Home; Journals; Sadhana. Fengrui Sun. Articles written in Sadhana. Volume 34 Issue 5 October 2009 pp 851-864. Profit rate performance optimization for a generalized irreversible combined refrigeration cycle · Kang Ma Lingen Chen Fengrui Sun · More Details Abstract Fulltext PDF. Finite-time exergoeconomic ...

  15. [Reiner Nürnberg, Ekkehard Höxtermann, Martina Voigt. Elisabeth Schiemann 1881-1972. Vom AußBruch der Genetik und der Frauen in den UmBrüchen des 20. Jahrhunderts] / Monika von Hirschheydt

    Index Scriptorium Estoniae

    Hirschheydt, Monika von

    2015-01-01

    Arvustus: Nürnberg, Reiner, Höxtermann, Ekkehard, Voigt, Martina. Elisabeth Schiemann 1881-1972. Vom AußBruch der Genetik und der Frauen in den UmBrüchen des 20. Jahrhunderts. Beiträge eines Symposiums zum 200. Gründungsjubiläum der Humboldt-Universität Berlin. Rangsdorf: Basilisken-Presse 2014

  16. Wu Shangshi: One of the outstanding founders of Chinese modern geography%吴尚时对中国近代地理学的贡献与学术思想探讨

    Institute of Scientific and Technical Information of China (English)

    陈吉余; 吴超羽; 司徒尚纪

    2017-01-01

    Wu Shangshi (1904-1947) is considered one of the outstanding modem geographers emerging in the early 20th century in China.It is partly a result of the introduction of modem sciences from the West.Wu graduated as a gold medalist in Sun Yat-sen University (SYU) in 1928.He was then granted scholarship to study geography in France.He studied at the University of Lyon and the University of Grenoble under the supervision of A.Allix,M.Pardé and R.Blanchard,who was one of the best known students of V.de la Blanche.In 1934,Wu finished his study in France and returned to SYU to serve as a professor of geography.He was head of the department in 1939-1945,the most difficult and perilous period during the Japanese invasion.The university moved constantly to flee the flames of war.The thousands of miles across south and south-west China became Wu's research field.To continue one's work under such circumstances required an extraordinary determination and dedication to science.Excessive hard work in tough environments ruined his health.Wu died in 1947 at the age of 43.Among the second generation of Chinese modem geographers,Wu was a rare example of an integrated geographer.He combined comprehensive and complex geographic thought with a balanced approach between holistic perspective and detailed research.In addition,he possessed an outstanding ability to conduct field work.As such,many of his research findings have withstood the test of time and remain relevant to this day.For instance,Wu proposed "one belt and three arcs" to summarize the distribution of the mountain ranges in China.On the long debates of the stratigraphic sequence of the red bed formations "Danxia" and "Nanxiong",Wu suggested an alternative viewpoint that the two formations could be deposited at approximately the same time but in different faces and it has been confirmed by modem geologic investigation some 50 years later.Both contributions were listed on the "Great Geographical Discoveries of China in 100

  17. "Is political behavior a viable coping strategy to perceived organizational politics? Unveiling the underlying resource dynamics": Correction to Sun and Chen (2017).

    Science.gov (United States)

    2017-10-01

    Reports an error in "Is Political Behavior a Viable Coping Strategy to Perceived Organizational Politics? Unveiling the Underlying Resource Dynamics" by Shuhua Sun and Huaizhong Chen ( Journal of Applied Psychology , Advanced Online Publication, May 22, 2017, np). In the article, Table 1 contained a formatting error. Correlation coefficient values in the last four cells of column 6 were misplaced with correlation coefficient values in the last four cells of column 7. All versions of this article have been corrected. (The following abstract of the original article appeared in record 2017-22542-001.) We conduct a theory-driven empirical investigation on whether political behavior, as a coping strategy to perceived organizational politics, creates resource trade-offs in moderating the relationship between perceived organizational politics and task performance. Drawing on conservation of resources theory, we hypothesize that political behavior mitigates the adverse effect of perceived organizational politics on task performance via psychological empowerment, yet exacerbates its adverse effect on task performance via emotional exhaustion. Three-wave multisource data from a sample of 222 employees and their 75 supervisors were collected for hypothesis testing. Findings supported our hypotheses. Our study enhances understandings of the complex resource dynamics of using political behavior to cope with perceived organizational politics and highlights the need to move stress-coping research from a focus on the stress-buffering effect of coping on outcomes to a focus on the underlying competing resource dynamics. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  18. Molecular diversity analysis of Tetradium ruticarpum (WuZhuYu) in China based on inter-primer binding site (iPBS) markers and inter-simple sequence repeat (ISSR) markers.

    Science.gov (United States)

    Xu, Jing-Yuan; Zhu, Yan; Yi, Ze; Wu, Gang; Xie, Guo-Yong; Qin, Min-Jian

    2018-01-01

    "Wu zhu yu", which is obtained from the dried unripe fruits of Tetradium ruticarpum (A. Jussieu) T. G. Hartley, has been used as a traditional Chinese medicine for treatment of headaches, abdominal colic, and hypertension for thousands of years. The present study was designed to assess the molecular genetic diversity among 25 collected accessions of T. ruticarpum (Wu zhu yu in Chinese) from different areas of China, based on inter-primer binding site (iPBS) markers and inter-simple sequence repeat (ISSR) markers. Thirteen ISSR primers generated 151 amplification bands, of which 130 were polymorphic. Out of 165 bands that were amplified using 10 iPBS primers, 152 were polymorphic. The iPBS markers displayed a higher proportion of polymorphic loci (PPL = 92.5%) than the ISSR markers (PPL = 84.9%). The results showed that T. ruticarpum possessed high loci polymorphism and genetic differentiation occurred in this plant. The combined data of iPBS and ISSR markers scored on 25 accessions produced five clusters that approximately matched the geographic distribution of the species. The results indicated that both iPBS and ISSR markers were reliable and effective tools for analyzing the genetic diversity in T. ruticarpum. Copyright © 2018 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  19. Overview of the KwaZulu-Natal sardine run | van der Lingen | African ...

    African Journals Online (AJOL)

    This paper provides an introduction to, and overview of, the natural phenomenon known as the KwaZulu-Natal sardine run. Previous literature on this topic and hypotheses about the reasons why, and the mechanisms how, the run occurs are briefly synthesised and described. Papers contributing to this suite that detail more ...

  20. Un imaginaire dévoilé/déphasé. Stratégies narratives et mémoire culturelle dans le roman 54 des Wu Ming

    Directory of Open Access Journals (Sweden)

    Matteo Martelli

    2015-02-01

    Full Text Available This essay analyses the narrative strategies through which cultural memory is portrayed in 54, a novel in which Wu Ming (a collective of four Italian fiction writers suggests a literary mapping of the Fifties. This is obtained by a recovery of a shared imaginary tradition which is close to the reader, mixing fictional and historical characters, films, books, different genres of popular literature. Nevertheless, the rewriting of these imaginary traditions involves their displacement, a presentation which is constantly created from an unusual point of view. Thus, shifting the image of what is already known, the text inquires into several modalities of a questioning about cultural memory and its redefinition in relation to contemporary culture. By focusing on these elements, this study proposes an analysis which starts from the construction of the characters, the role of suspense and the adoption of multiple traditions of novel writing.

  1. Two phases of droplet evaporation during plasma arc spraying: reply to Chen's comment about the 'rocket' effect under conditions of thermal plasma spraying

    Energy Technology Data Exchange (ETDEWEB)

    Nemchinsky, V A [Key College, 225 Dania Beach Blvd, Dania Beach, FL 33040 (United States)

    2007-07-07

    The heating history of a droplet during its flight can be divided into two phases: (a) the initial phase when evaporation, although it occurs, does not change the heat balance of the droplet much (the case considered in our previous paper and (b) the final phase when the cooling due to evaporation balances the heat flux from the plasma. The later phase is considered in Chen's comment. In our reply, a very straightforward consideration demonstrates that even in the final phase of the droplet flight, the 'rocket' effect can be significant. (reply)

  2. Redescription of the Indo-West Pacific scorpionfish (Scorpaenidae), Neomerinthe erostris (Alcock 1896), a senior synonym of Scorpaena gibbifrons Fowler 1938, N. rotunda Chen 1981, and N. bathyperimensis Zajonz & Klausewitz 2002.

    Science.gov (United States)

    Motomura, Hiroyuki; Causse, Romain; Béarez, Philippe; Mishra, Subhrendu Sekhar

    2015-09-29

    The Indo-West Pacific species, Neomerinthe erostris (Alcock 1896), originally described as Scorpaena erostris, is redescribed as a senior synonym of Scorpaena gibbifrons Fowler 1938, N. rotunda Chen 1981, and N. bathyperimensis Zajonz & Klausewitz 2002. Although the latter three nominal species have been regarded as valid species and N. erostris has not been reported since 1898, examinations of type specimens of the four nominal species revealed that they represent a single species. A lectotype of Scorpaena erostris is herein designated. Neomerinthe erostris is characterized by having a distinct longitudinal ridge on the lateral surface of the maxilla and a strongly rounded dorsal profile of the head.

  3. Simultaneous determination of bioactive components in essential oil of Xiang-Fu-Si-Wu Formula in Beagle dog plasma by UPLC-MS/MS and its application to pharmacokinetics.

    Science.gov (United States)

    Liu, Pei; Li, Zhenhao; Qian, Dawei; Li, Wei; Shang, Er-Xin; Duan, Jin-Ao

    2013-06-15

    A highly sensitive and rapid ultraperformance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) has been developed and validated for simultaneous quantification of the three main bioactive compounds, i.e., ligustilide, dehydrocostuslactone and α-cyperone in dog plasma after oral administration of the essential oil of Xiang-Fu-Si-Wu Formula (XEO). Clarithromycin was used as an internal standard (IS). Plasma samples were processed by protein precipitation with methanol. The separation was performed on an Acquity BEH C18 column (100mm×2.1mm, 1.7μm) at a flow rate of 0.4mLmin(-1), using 0.1% formic acid-acetonitrile as mobile phase. The MS/MS ion transit ions monitored were 190.5→90.9 for ligustilide, 231.1→185.1 for dehydrocostuslactone, 219.2→123.0 for α-cyperone and 748.5→158.1 for IS. Method validation was performed as per Food and Drug Administration guidelines and the results met the acceptance criteria. The lower limit of quantification (LLOQ) achieved was 5.12ng/mL for ligustilide, 1.06ng/mL for dehydrocostuslactone and 1.89ng/mL for α-cyperone, respectively, and the calibration curves obtained were linear (r>0.99) over the concentration range approximately 1-1000ng/mL. The intra- and inter-day precision was less than 15% and the accuracy was within ±9.2%. After validation, this method was successfully applied to a pharmacokinetic study where dogs were orally given 0.3g/kg XEO, equivalent to 183.6mg/kg of ligustilide, 5.0mg/kg of dehydrocostuslactone and 26.2mg/kg of α-cyperone, respectively. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Comparisons of pharmacokinetic and tissue distribution profile of four major bioactive components after oral administration of Xiang-Fu-Si-Wu Decoction effective fraction in normal and dysmenorrheal symptom rats.

    Science.gov (United States)

    Liu, Pei; Li, Wei; Li, Zhen-hao; Qian, Da-wei; Guo, Jian-ming; Shang, Er-xin; Su, Shu-lan; Tang, Yu-ping; Duan, Jin-ao

    2014-07-03

    Xiang-Fu-Si-Wu Decoction (XFSWD) has been widely used to treat primary dysmenorrhea in clinical practice for hundreds of years and shown great efficacy. One fraction of XFSWD, which was an elution product by macroporous adsorption resin from aqueous extract solution with 60% ethanol (XFSWE), showed great analgesic effect. The present study was conducted to investigate the possible pharmacokinetic and tissue distribution profiles of four major bioactive constituents (berberine, protopine, tetrahydrocoptisine and tetrahydropalmatine) after oral administration of XFSWE in dysmenorrheal symptom rats, and to compare the difference between normal and dysmenorrheal symptom rats. Estradiol benzoate and oxytocin were used to produce dysmenorrheal symptom rat model. The experimental period was seven days. At the final day of experimental period, both normal and dysmenorrheal symptom rats were orally administrated with XFSWE, and then the blood and tissues samples were collected at different time points. Berberine, protopine, tetrahydrocoptisine and tetrahydropalmatine in blood and tissue samples were determined by LC-MS/MS. Pharmacokinetic parameters were calculated from the plasma concentration-time data using non-compartmental methods. The differences of pharmacokinetic parameters among groups were tested by one-way analysis of variance (ANOVA). There were statistically significant differences (Pnormal and dysmenorrheal symptom rats that orally administered with same dosage of XFSWE. In tissue distribution study, the results showed that the overall trend was C(Spleen)>C(Liver)>C(Kidney)>C(Uterus)>C(Heart)>C(Lung)>C(Ovary)>C(Brain)>C(Thymus), C(M-60 min)>C(M-120 min)>C(M-30 min)>C(C-60 min)>C(C-120 min)>C(C-30 min). The contents of protopine in liver, spleen and uterus were more than that in other tissues of dysmenorrheal symptom rats. Compared to normal rats, partial contents of the compounds in dysmenorrheal symptom rats׳ tissues at different time points had significant

  5. Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007

    CERN Multimedia

    Maximilien Brice

    2007-01-01

    Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007

  6. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Chen Bin1 Zeng Zhirong1 Wu Xiaoqin1 Chen Minhu1 Li Mei1 Gao Xiang1 Chen Baili1 Hu Pinjin1. Department of Gastroenterology, the First Affiliated Hospital, Sun Yat-sen University, 58 Zhongshan II Road, Guangzhou 510080, People's Republic of China ...

  7. Tropical Journal of Pharmaceutical Research - Vol 15, No 3 (2016)

    African Journals Online (AJOL)

    Wan Wu, Wei Chen, Qiong Jin, 447-451 ... Chung-Shih Chen, Mei-Lin Wang, Rosa Huang Liu, Shih-Pin Chen, Tsong-Ming Lu, Wei-Yu Tsai, Chien-Fu Huang, ... Yan-Qiong Li, Rui Hu, Li-Hui Zhong, Qian Sun, You-Ping Yan, 527-533.

  8. Sadhana | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Influence of free water content on the compressive mechanical behaviour of cement mortar under high strain rate · Jikai Zhou Xudong Chen Longqiang Wu Xiaowei Kan ... pp 111-117. Mechanical properties of concrete to cyclic uniaxial tensile loading using variable waveforms · YUZHI CHEN XUDONG CHEN JINGWU BU.

  9. Calycosin regulates glucocorticoid-induced apoptosis via Nrf2/ARE ...

    African Journals Online (AJOL)

    Lifeng Fu1, WeiLiang Wu2, Jian Zhu2, Shu Qiang2, Jansong Chen2* ... Results: CA reduced the apoptosis and accumulation of ROS in DEX-treated cells. ..... its downstream effectors (Figure 5 A-C). However .... Cao J, Chen Z, Zhu Y, Li Y, Guo C, Gao K, Chen L, Shi ... Hong W. Experimental study on the effect of Calycosin.

  10. Blazar Sequence in Fermi Era Liang Chen

    Indian Academy of Sciences (India)

    Abstract. In this paper, we review the latest research results on the topic of blazar sequence. It seems that the blazar sequence is phenomenally ruled out, while the theoretical blazar sequence still holds. We point out that black hole mass is a dominated parameter accounting for high-power- high-synchrotron-peaked and ...

  11. MARGA_Chen et al_2016

    Data.gov (United States)

    U.S. Environmental Protection Agency — These data describe the chromatography characteristics of the MARGA instrument software as compared to an alternative, independent technique for chromatogram...

  12. T'ai Chi

    Science.gov (United States)

    ... are different styles of t'ai chi, including: Chen style Hao (or Wu Shi) style Hu Lei ... medical advice, diagnoses, and treatment, consult your doctor. © 1995- The Nemours Foundation. All rights reserved. Images provided ...

  13. The effects of growth time on the quality of graphene synthesized by ...

    Indian Academy of Sciences (India)

    by LPCVD. A JAFARI, R ALIPOUR∗ and M GHORANNEVISS ..... Li T, Hass J, Marchenkoy A N, Conrad E H, First P N and de ... Ni Z H, Chen W, Fan X F, Kuo J L, Yu T, Wee A T S ... Chen S, Cai W, Piner R D, Suk J W, Wu Y, Ren Y, Kang Y.

  14. Three novel antioxidants from Cinnamomum plants | Cheng | African ...

    African Journals Online (AJOL)

    Three novel antioxidants from Cinnamomum plants. K-C Cheng, H-A Chen, P-F Wu, W-L Yang, H-M Wang, C-Y Chen. Abstract. In this study, we identified three novel antioxidants, subamolide C (1), subamolide E (2) and isokotomolide A (3) from the constitutes of Cinnamomum subavenium and Cinnamomum kotoense.

  15. The Frontier National Society Viewed by WU Luzhen:Case of East Simeng Survey in Inner Mongolia%吴禄贞视野中的边疆民族社会①--以内蒙古东四盟调查为例

    Institute of Scientific and Technical Information of China (English)

    王鹏辉

    2015-01-01

    Inner Mongolia Dongsimeng region formed Mongolian and Han mixed pattern of survival in Qing Dynasty, and formed an in-terdependent community of destiny. WU lu-zhen survey showing the internal crisis of Inner Mongolia Dongsimeng borderland ethnic society, involving many aspects,such as politics, livelihoods and economies, religion and customs, which showed its domestic policy and internation-al aggression interaction mechanism of social contradictions and resulted in the frontier ethnic society in Modern China.%有清一代,内蒙古东四盟地域已经形成蒙汉杂居的生存格局,并且结成相互依存的命运共同体。吴禄贞的调查呈现出内蒙古东四盟边疆民族社会的内在危机,涉及政治、生计与经济、宗教与风俗诸多方面,显现其国内新政与国际侵略互动的社会矛盾机制。内蒙古东四盟身处清末国内国际两种交冲的力量与历史传统的碰撞,逐渐生成中国近代的边疆民族社会。

  16. The Role of Retinal Determination Gene Network (RDGN) in Hormone Signaling Transduction and Prostate Tumorigenesis

    Science.gov (United States)

    2013-10-01

    Wu K, Wang L, Jiao X, Ju X, Li Z, Ertel A, Addya S, McCue P, Lisanti MP, Wang C, Davis RJ, Mardon G, Pestell RG. Androgen therapy resistant...Li Z, Hu J, Chen K, Wu J, Pestell RG. DACH1 inhibited prostate cancer cellular proliferation and Interleukon-6 signaling. AACR 103rd Annual Meeting...March 31 – April 4, 2012, Chicago, IL.  Wang J, Cai S, Chen K, Sun Y, Li S, Pestell RG, Wu K. Regulation of AR transcriptional activity and

  17. 古今中西之間--陳垣與20世紀中國史學%Between the Ancient and the Present and between China and the West:Prof. Chen Yuan and Chinese Historiography in the 20 th Century

    Institute of Scientific and Technical Information of China (English)

    陳智超

    2010-01-01

    Every historian should answer two questions related to each other, i. e. what is the relationship between history and reality and what is that between historiography and reality. Moreover, Chinese historians should answer other two questions also re-lated to each other, namely what is the relationship between China and the West and what is that between Chinese culture and Western culture. Based on their own outlook on the ancient and the present as well as on China and the West, every conscious Chinese historian of the 20 th century was bound to cherish a definite sense of responsi-bility and determined what role they played and what way they chose when taking on this responsibility. The present paper expounds Prof. Chen Yuan’ s answers to the above questions andhis practice concerned with them in the four stages of his lifetime.

  18. SYNTHESES, STRUCTURES AND PROPERTIES Jian Wu1*, Fu

    African Journals Online (AJOL)

    Preferred Customer

    Printed in Ethiopia. © 2014 Chemical Society of Ethiopia ... 1Guangxi Key Laboratory of Chemistry and Engineering of Forest Products, Guangxi University ... The O–H···O and C–H···Cl hydrogen-bonding interactions play a significant role in.

  19. Supply chain management in selected clothing retail businesses / Jianling Wu

    OpenAIRE

    Wu, Jianling

    2004-01-01

    In today's highly competitive, global market place the pressure on organizations to find new ways to create and deliver value to customers grows ever strong. At the same time, market maturity combined with new sources of global competition has led to over-capacity in many industries leading to an inevitable pressure on price. Managers are increasingly interested in actively managing their supply chains because of environmental changes. The study is aimed to identify the importa...

  20. 对格里埃尔《声乐协奏曲》的两种演唱诠释---吴碧霞与德赛演唱的《声乐协奏曲》之比较%Interpretation of Two Types of Singing Performance of Gliere's"Vocal Concerto":A Comparison of"Vocal Con-certo"Sung by Wu Bixia and Natalie Dessay

    Institute of Scientific and Technical Information of China (English)

    张艳

    2015-01-01

    吴碧霞被誉为“中西合璧”的夜莺,无论在美声唱法还是民族唱法领域都有一定的造诣,演唱的歌曲都有丰富的表现力与感染力。纳塔利·德赛同样也被誉为20世纪末的“声音奇迹”,两个来自不同国度的歌唱家在演绎这首《声乐协奏曲》时,也有着不同的演唱风格与音响效果。通过对吴碧霞与德赛演唱的这首《声乐协奏曲》的比较分析,让我们更加清楚地认识到我国声乐发展的前景,并对两种风格的演唱进行文化的理解与思考。%Wu Bixia is hailed as a "nightingale" integrating the East and the West, as she has certain attainments in both bel canto and nazionale cantanti, and the songs sung by her are all highly expressive and attractive. Natalie Dessay is honored as a"vocal marvel" at the end of the 20th century. The two singers from two different countries have different singing styles and vo-cal effects when they sing"Vocal Concerto". Through a compara-tive analysis on"Vocal Concerto"sung by Wu Bixia and Natalie Dessay, we can more clearly learn about the prospect of the de-velopment of vocal music in China, thus understanding and re-flecting more about the cultures of the two styles.

  1. Food Fortification to Prevent and Control Iron Deficiency | Chen ...

    African Journals Online (AJOL)

    It is essential to prevent the fortification iron from reacting with the absorption inhibitors. To ensure adequate absorption therefore, various factors must be considered before initiating a fortification programme. These include cost effectiveness of fortification in increasing absorbable iron, palatability of the fortified food and the ...

  2. Lateral strukturierte Oberflächen zur THz-Strahlmanipulation

    OpenAIRE

    Jahn, David; Koch, Martin (Prof. Dr.)

    2018-01-01

    Die Terahertz-Zeitbereichsspektroskopie ist mittlerweile eine etablierte spektroskopische Methode im Frequenzbereich von 0;2 THz bis etwa 5 THz. Mit der stetigen Verbesserung von Zeitbereichs-Spektrometern, in den letzten Jahren hauptsächlich vorangetrieben durch die Verbesserung der Materialsysteme sowohl im photoleitenden Emitter als auch im Detektor sind heute Systeme mit bis zu 90 dB SNR und 4;5 THz Brandbreite verfügbar. Auch der Einfluss anderer Systemkomponenten, deren Beitrag zum...

  3. Massive Star Formation: Accreting from Companion X. Chen1 ...

    Indian Academy of Sciences (India)

    Abstract. We report the possible accretion from companion in the mas- sive star forming region (G350.69–0.49). This region seems to be a binary system composed of a diffuse object (possible nebulae or UC HII region) and a Massive Young Stellar Object (MYSO) seen in Spitzer IRAC image. The diffuse object and MYSO ...

  4. Initiation and Propagation of Coronal Mass Ejections P. F. Chen

    Indian Academy of Sciences (India)

    Introduction. Coronal mass ejections (CMEs) have been observed for over 30 years. They keep being an intriguing research topic, not only because they are now realized to be the major driver for space weather disturbances, which are intimately connected to human activities, but also because they themselves are full of ...

  5. Mitochondrial genome of Taiwan pig ( Sus Scrofa ) | Chen | African ...

    African Journals Online (AJOL)

    The purpose of this study is to investigate the complete nucleotide sequence of the mitochondrial genome of the Taiwan Lanyu pig (Sus scrofa) and its phylogenetic relationships with other pig breeds. Thirty-four forward and reverse primers were designed. Sequencing was performed in both directions. The results showed ...

  6. Chemische Reaktionen auf Oberflächen - eine SFG Studie

    OpenAIRE

    Kirsch, Harald

    2014-01-01

    This thesis focused on the investigation of chemical reactions on surfaces by usage of Sum Frequency Generation (SFG) spectroscopy and Thermal Desorption Spectroscopy (TDS). Understanding of chemical reactions on surfaces is of critical importance for modification and optimization of a variety of environmental and industrial processes, but the complexity of the ongoing reactions under "realistic" conditions often hinders an understanding on a molecular level. The aim of this work was to get i...

  7. C. Huang , G. Zhao , HW Zhang & YQ Chen

    Indian Academy of Sciences (India)

    the host stars' birth cloud with higher abundance of Si will make the cloud ... with the metallicity distribution of nearby field F, G, or K stars which are known to .... In the early stage of planetesimal accumulation, the rate of growth of planetesimal.

  8. Chaos synchronization of the fractional-order Chen's system

    International Nuclear Information System (INIS)

    Zhu Hao; Zhou Shangbo; He Zhongshi

    2009-01-01

    In this paper, based on the stability theorem of linear fractional systems, a necessary condition is given to check the chaos synchronization of fractional systems with incommensurate order. Chaos synchronization is studied by utilizing the Pecora-Carroll (PC) method and the coupling method. The necessary condition can also be used as a tool to confirm results of a numerical simulation. Numerical simulation results show the effectiveness of the necessary condition.

  9. Relación heterófilo/linfocito, frecuencia espontánea de eritrocitos micronucleados y prolongaciones nucleares en el ganso nevado (Chen caerulescens: Una propuesta como posible biomonitor de estrés y genotóxicos ambientales

    Directory of Open Access Journals (Sweden)

    Martha C. Martínez Quintanilla

    2017-04-01

    Full Text Available Existen organismos silvestres que son altamente vulnerables ante estresores antropogénicos y naturales, estos organismos pueden ser de utilidad para evaluar la salud ambiental mediante diferentes indicadores confiables, sencillos, rápidos, económicos para determinar y si es posible reducir estos efectos negativos. En este estudio proponemos al ganso nevado (Chen caerulescens como posible biomonitor de estrés y genotóxicos ambientales mediante la relación heterófilo/linfocito (H/L, la prueba de micronúcleos (EMN, prolongaciones nucleares en eritrocitos (EPN y eritrocitos policromáticos (EPC. Durante la temporada de caza (2012-2013 en el humedal de Málaga, Durango, México, colectamos 18 organismos. Los eritrocitos fueron las células más abundantes, de núcleo y morfología elípticos, de tamaño 12.68 ± 0.89 µm. Observamos heterófilos (11.07±1.32 µm, eosinófilos (9.67±1.26 µm, basófilos (5.75 ± 0.78 µm, monocitos (10.49±1.36 µm y linfocitos (6.53±1.0 µm. No identificamos alteración en las proporciones ni en la morfología de leucocitos, sin embargo, es necesario un mayor número de organismos para establecer los parámetros sanguíneos de base normal para esta especie. La relación h/l fue de 0.41 ± 0.11 este valor es similar a lo reportado para esta y otras especies de aves consideradas como sanas. Establecimos la frecuencia basal de EMN (2.6±1.45, epn (249.2 ± 89.74 y EPC (156.5 ± 50. El ganso nevado es un organismo que se perfila como buen candidato a biomonitor ambiental debido a la frecuencia basal de su relación H/L, EMN, EPN y EPC, pero debe probarse en condiciones estandarizadas y a través de estudios en zonas con y sin contaminación.

  10. Development of liposomal pemetrexed for enhanced therapy against multidrug resistance mediated by ABCC5 in breast cancer

    OpenAIRE

    Bai,Fang; Yin,You; Chen,Ting; Chen,Jihui; Ge,Meixin; Lu,Yunshu; Xie,Fangyuan; Zhang,Jian; Wu,Kejin; Liu,Yan

    2018-01-01

    Fang Bai,1–3,* You Yin,4,* Ting Chen,1,* Jihui Chen,1 Meixin Ge,2 Yunshu Lu,2 Fangyuan Xie,5 Jian Zhang,1 Kejin Wu,3 Yan Liu1,6 1Department of Pharmacy, Xinhua Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, 2Department of General Surgery, Xinhua Hospital, Affiliated to Shanghai Jiao Tong University, School of Medicine, Shanghai, 3Department of Breast Surgery, Obstetrics and Gynaecology Hospital, Fudan University, Shanghai, 4Department of Neurology, Changzheng...

  11. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Ping Chen1 2 Qing-Sheng Wu1 Ya-Ping Ding3 Pin-Shi Yuan1. Department of Chemistry, Tongji University, 1239 Siping Road, Shanghai 200092, P.R. China; Department of Chemistry, Chizhou College, Chizhou, Anhui 247000, P.R. China; Department of Chemistry, Shanghai University, Shanghai 200436, P.R. China ...

  12. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Yu-Song Guo Zhong-Duo Wang Cheng-Zhong Yan Yu-Lan Zhang Jin-Nan Zheng Yuan-Min Xu Tao Du Chu-Wu Liu · More Details Fulltext PDF ... Aifu Yang Dapeng Sun Shikai Liu Ying Dong Zhong Chen Zunchun Zhou · More Details Fulltext ...

  13. Morphology and anatomical structure of the larval salt gland of ...

    African Journals Online (AJOL)

    Ezedom Theresa

    2013-10-09

    Oct 9, 2013 ... the morphology and fine structure of the ion transporting epithelium ... The general structure of the salt gland of nauplii cultured at 180 g/L disappeared. ...... Wu G, Zhang H, Sun J, Liu F, Ge X, Chen WH, Yu, J, Wang W (2011).

  14. Anti-inflammatory Effects of Magnolia sieboldii Extract in ...

    African Journals Online (AJOL)

    Hao Li4 and Kang-Duk Choi1*. 1Genomic ... Methods: The whole plant of M. sieboldii was extracted with methanol at room temperature. The in vitro ... action of M. sieboldii in inflammation. Magnolia ..... Shih HC, Hwang TL, Chen HC, Kuo PC, Lee EJ, Lee. KH, Wu TS. ... Fu JY, Masferrer JL, Seibert K, Raz A, Needleman P.

  15. Browse Title Index

    African Journals Online (AJOL)

    Items 501 - 550 of 1309 ... HH Tamboura, B Bayala, M Lompo, IP Guissou, L Sawadogo ... X Wang, Y-G Chen, L Ma, Z-H Li, J-Y Li, X-G Liu, J-L Zou, J-H Wu. Vol 11, No 2 ... Zhi-Jiang Wang, Wei Xu, Jian-Wen Liang, Cai-Sheng Wang, Yani Kang.

  16. Fulltext PDF

    Indian Academy of Sciences (India)

    [7] Mahdhi H, Ben Ayadi Z, Gauffier J L, Djessas K and Alaya S. 2015 Opt. Mater. ... [23] Wu D W, Yang M, Huang Z B, Yin G F, Liao X M, Kang Y. Q, Chen X F and ... [42] Lee P A, Said G, Davis R and Lim T H 1969 J. Phys. Chem. Solids 30 ...

  17. Genetic diversity of bitter taste receptor gene family in Sichuan

    Indian Academy of Sciences (India)

    Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE Volume 95 Issue 3 September 2016 pp 675-681 ...

  18. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    ... Refresher Courses · Symposia · Live Streaming. Home; Journals; Bulletin of Materials Science; Volume 36; Issue 4. Enhanced high temperature performance of LiMn2O4 coated with Li3BO3 solid electrolyte. Liu Jinlian Wu Xianming Chen Shang Liu Jianben He Zeqiang. Volume 36 Issue 4 August 2013 pp 687-691 ...

  19. (nanoclay and CaSiO3)-reinforced E-glass-reinforced epoxy

    Indian Academy of Sciences (India)

    For instance, Zhang et al. [6] have prepared 30 types of epoxy matrix reinforced with ... the resin in a high-speed metal blade rotation medium. The .... Tests were run for .... Figure 2. Mean effect plots showing the influence of load, nanoclay content and speed on ..... [8] Wang K, Chen L, Wu J, Toh M L, He C and Yee A F 2005.

  20. Flowers with Yeast α-Glucosidase Inhibitory Activity

    African Journals Online (AJOL)

    Cholesterol in Hamsters Fed High-Fat Diets. Supplemented with Blueberry Peels and Peel. Extract. J Agric Food Chem 2010; 58: 3984-3991. 7. Xie C, Kang J, Chen JR, Nagarajan S, Badger TM, Wu X. Phenolic Acids Are in Vivo Atheroprotective. Compounds Appearing in the Serum of Rats after. Blueberry Consumption.

  1. Profit rate performance optimization for a generalized irreversible ...

    Indian Academy of Sciences (India)

    fer law system generalized irreversible combined refrigeration cycle model with finite-rate heat ...... Chen L, Sun F, Wu C 2004b Optimum allocation of heat exchanger area for refrigeration and air conditioning plants. Appl. Energy 77(3): 339– ...

  2. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences. Min Xu. Articles written in Journal of Chemical Sciences. Volume 126 Issue 6 November 2014 pp 1623-1627 Rapid Communications. Synthesis and properties of a dual responsive hydrogel by inverse microemulsion polymerization · Tao Wan Min Xu Liyi Chen Daqing Wu ...

  3. Effects of traditional Chinese medicine on rats with Type II diabetes ...

    African Journals Online (AJOL)

    Effects of traditional Chinese medicine on rats with Type II diabetes induced by high-fat diet and streptozotocin: A urine metabonomic study. H Zhao, Z Li, G Tian, K Gao, Li Zhiyong, B Zhao, J Wang, L Luo, Q Pan, W Zhang, Z Wu, J Chen, W Wang ...

  4. Biological Responses in Rats Exposed to Cigarette Smoke and Middle East Sand (Dust)

    Science.gov (United States)

    2012-01-01

    Bergren DR. 2001. Chronic tobacco smoke exposure increases airway sensitivity to capsaicin in awake guinea pigs . J Appl Physiol 90:695–704. Bhalla DK...human health. Inhal Toxicol 21:1–31. Chu HW, Thaikoottathil J, Rino JG, Zhang G, Wu Q, Moss T, Refaeli Y, Bowler R, Wenzel SE, Chen Z, Zdunek J, Breed R

  5. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences. SONG XUE. Articles written in Journal of Biosciences. Volume 41 Issue 2 June 2016 pp 229-236 Article. Silencing of HMGA2 promotes apoptosis and inhibits migration and invasion of prostate cancer cells · Zhan Shi Ding Wu Run Tang Xiang Li Renfu Chen Song Xue Chengjing ...

  6. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences; Volume 31; Issue 5. Combinative effects of a bacterial type-III effector and a biocontrol bacterium on rice growth and disease resistance. Haiying Ren Ganyu Gu Juying Long Qian Yin Tingquan Wu Tao Song Shujian Zhang Zhiyi Chen Hansong Dong. Reviews Volume 31 Issue 5 ...

  7. High Serum 25-hydroxyvitamin D is Associated with Low Incidence of Stress Fractures

    Science.gov (United States)

    2011-06-01

    of Family and Preventive Medicine, School of Medicine, University of California, San Diego, La Jolla, California 3 Osteoporosis Research Center...surveillance. Am J Public Health. 2002 Dec;92(12):1900-4. 19. Beck TJ, Petit MA, Wu G, LeBoff MS, Cauley JA, Chen Z. Does obesity really make the

  8. Leaf Extract in ICR Mice Fed High-Fat Diet

    African Journals Online (AJOL)

    Chen1,2, Rong-Ji Dai1,2, Yu-Lin Deng1,2 and Chong-Ming Wu3*. 1School of Life Science, Beijing Institute of Technology, Beijing 100081, 2Beijing BIT&GY Pharmaceutical R&D, Beijing 100081,. 3Institute of Medicinal Plant Development, Chinese Academy of Medical Science & Peking Union Medical College, Beijing.

  9. cDNA cloning and primary structure analysis of invariant chain in ...

    African Journals Online (AJOL)

    cDNA cloning and primary structure analysis of invariant chain in Chinese Pengze crucian carp. X Liu, W Yu, J Li, F Chen, S Liu, C Wu, J Xu. Abstract. Invariant chain (Ii) plays an important role in MHC class II molecules assembly and exogenous peptide presentation in vertebrates. Although mammalian Ii has been ...

  10. to view fulltext PDF

    Indian Academy of Sciences (India)

    2013-02-09

    Feb 9, 2013 ... potential invading pathogens and mount successful defences ...... methyl-SA strongly suggest that SA is not the mobile signal. (Vernooij et al. 1994 ...... Wang WH, Yi XQ, Han AD, Liu TW, Chen J, Wu FH, Dong XJ,. He JX, Pei ...

  11. Wu et al., Afr J Tradit Complement Altern Med., (2018) 15 (1): 151 ...

    African Journals Online (AJOL)

    asdasd

    2017-12-29

    Dec 29, 2017 ... 1Department of Science and Technology and 2School of Biological Science and .... collected from Lu-mountain (Zibo, China) , and identified by the expert of plant taxonomy, Professor Shoujin FAN .... Biological Chemistry, 391, ... 21st century natural product research and drug development and traditional.

  12. Molecular epidemiology of WU polyomavirus in hospitalized children with acute respiratory tract infection in China.

    Science.gov (United States)

    Zhu, Teng; Lu, Qing-Bin; Zhang, Shu-Yan; Wo, Ying; Zhuang, Lu; Zhang, Pan-He; Zhang, Xiao-Ai; Wei, Wei; Liu, Wei

    2017-05-01

    To explore the molecular epidemiology and clinical characteristics of Washington University polyomavirus (WUPyV) infection in pediatric patients with acute respiratory tract infections in China. A laboratory surveillance was performed to recruit pediatric patients with acute respiratory tract infections. WUPyV was detected using real-time PCR and complete genome was sequenced for randomly selected positive nasopharyngeal aspirate. Altogether 122 (7.5%) of 1617 children found to be infected with WUPyV and 88 (72.1%) were coinfected with other viruses during 2012-2015. The phylogenetic analysis showed that 14 strains from our study formed two new clusters (Id and IIIc) within the Branch I and Branch III, respectively. WUPyV is persistently circulating in China. Surveillance on WUPyV infection in wider areas and long persistence is warranted.

  13. Reworked crustal of early Paleozoic WuYi Orogen revealed by receiver function data

    Science.gov (United States)

    Wei, Y.; Duan, Y.; Tian, X.; Zhao, Y.

    2017-12-01

    Intraplate orogenic belt, which occurs at the rigid and undeformable plate interiors, is a distinct new type of orogen rather than an interplate or plate marginal orogenic belt, whose deformation occurs exclusively at plate margins. Therefore, intraplate orogenic belts are the most obvious exception to the plate-tectonic paradigm, they are uncommon in Earth's history. The early Paleozoic Wuyi orogen in South China is one of the few examples of intraplate orogen, and is a key to understanding the process of intraplate orogenesis and global early Paleozoic geodynamics. In this study, we select teleseismic records from 45 mobile linear seismic stations deployed in Wuyi Mountain and 58 permanent stations setting in Jiangxi and Fujian provinces, from January 2011 to December 2012, and calculate the crustal thickness and average crustal Vp/Vs ratio using the H-κ stacking method. The main results include the following: 1) the crustal average Poission's ratio shows an increase tendency from land to sea, the interior of Wuyi orogen belt with an low ration less than 0.23, and the coastline with high ration which is up to 0.28, which indicate a very heterogeneous crustal structure and composition in Wuyi orogen and coast belt. 2) the crustal thickness ranges 28-34 km and shows a tendency of thinning from inland to coast in the region of SE China margin, which maight mean the eastern Eurasia lithospheric is extension and thinning induced by the subducted paleo-Pacific slab. To conclusion, we assume that Wuyi orogen experienced upper crustal thickening, lower crust and lithosphere delamination during the early Paleozoic orogeny, and lithosphere extension in Mesozoic. This research is founded by the Natural Science Foundation of China (41174052 and 41604048).

  14. Effect of Zhen-wu decoction on chronic heart failure in rats

    African Journals Online (AJOL)

    ... has been an increased hospitalization burden, and makes HF a global public health problem. The most effective and commonly used drugs for treatment of HF are angiotensin-converting enzyme (ACE) inhibitors, β-adrenoceptor blockers, and digitalis [5-7]. The American Heart. Association (AHA) and European Society of ...

  15. Selected Articles From Wu-Li T’Ung-Pao (Physics Bulletin) (Number 5, 1960)

    Science.gov (United States)

    1960-12-07

    seisstific research. W© had m©t eonstdsrabl© eueeeas.-’ Our ohe»ieal ®agi&®£>riag department had extracted’ rayos fsom the oomjs stock* Our...won. pi our ’diffusion process our *ch*in~^h.|tt~ X ^i"was.&böVO 85 percent and the saa responsible» for this iaehi&ic&l woxic vms only a high school

  16. and Jet Power/Emission in AGNs Zhongzu Wu1,∗ , Minfeng Gu2 ...

    Indian Academy of Sciences (India)

    Abstract. Neutral hydrogen (HI) 21-cm absorption has been detected against very powerful radio jets. In this paper, based on Gupta's sample. (Gupta et al. 2006), we present our preliminary study of the correlations between the HI column density N(HI) and the jet power, N(HI) versus the low frequency luminosity at 408 MHz, ...

  17. Effect of Zhen-wu decoction on chronic heart failure in rats | Liu ...

    African Journals Online (AJOL)

    Results: Compared with normal control group, ZWD group showed decreased arterial systolic pressure (SBP, 89.16 ± 17.27 mmHg), diastolic pressure (DBP, 72.54 ± 22.36 mmHg), mean arterial pressure (MAP, 72.64 ± 11.87 mmHg), heart rate (HR, 368.25 ± 39.12 beats/min), left ventricular systolic peak (LVSP, 105.27 ...

  18. Ignition delay time correlation of fuel blends based on Livengood-Wu description

    KAUST Repository

    Khaled, Fathi; Badra, Jihad; Farooq, Aamir

    2017-01-01

    observed for combustion phasing in homogeneous charge compression ignition (HCCI) predictions between simulations performed with detailed chemistry and calculations using the developed ignition delay correlation.

  19. Reviving ancient Chinese mathematics mathematics, history and politics in the work of Wu Wen-Tsun

    CERN Document Server

    Hudecek, Jiri

    2014-01-01

    Twentieth-century China has been caught between a desire to increase its wealth and power in line with other advanced nations, which, by implication, means copying their institutions, practices and values, whilst simultaneously seeking to preserve China's independence and historically formed identity. Over time, Chinese philosophers, writers, artists and politicians have all sought to reconcile these goals and this book shows how this search for a Chinese way penetrated even the most central, least contested area of modernity: science.Reviving Ancient Chinese Mathematics is a study of the life

  20. People’s Republic of China Scientific Abstracts, Number 195.

    Science.gov (United States)

    1978-08-01

    76 15 CHIH-WU HSUEH-PAO [ACTA BOTANICA SINICA] No 1, March 1978 16 TI-CHEN CHAN-HSIEN [EARTHQUAKE FRONT] No 2, April 1978 26 K𔃺-HSUEH...steril^UMs! and Consolidate the contradiction between the hsien and 6168 CSO: 8111/1528 15 ACTA BOTANICA SINICA AUTHOR: CHANG Te-i [l72B 1795...of Cultured Tobacco Cells" SOURCE: Peking CHIH-WU H5UEH-PA0 [_ACTA BOTANICA SINICÄ] in Chinese No 1, Mar 78 pp 1-5 TEXT OF ENGLISH ABSTRACT

  1. Development of a General Conceptual-numerical Model to Simulate the Fate and Subsurface Transport of Explosives, and the Moisture and Temperature Signatures Around Land Mines

    Science.gov (United States)

    2008-12-01

    Chen, J. Gan, J. Šimůnek, A. C. Chang, and L. Wu, Leaching risk of N-nitrosodimethylamine ( NDMA ) in soil receiving reclaimed wastewater, Highlighted...Abstracts, published on a CD-ROM as abstract 5043, ASA, Madison, 2005. Haruta, S., J. Gan, and J. Šimunek, Numerical Analyses of NDMA Leaching Risk in...Gan, J. Šimůnek, A. C. Chang, and L. Wu, Leaching risk of N- nitrosodimethylamine ( NDMA ) in soil receiving reclaimed wastewater, Highlighted article

  2. Five newly recorded Cyprinid fish (Teleostei: Cypriniformes) in Myanmar

    Science.gov (United States)

    Qin, Tao; Chen, Zhi-Ying; Xu, Lu-Lu; Zaw, Paing; Kyaw, Yunn Mi Mi; Maung, Kyaw Win; Chen, Xiao-Yong

    2017-01-01

    Freshwater fish from the Putao and Myitkyina areas were collected in three ichthyofaunal surveys of the Mali Hka River and tributaries in and around Khakaborazi National Park and Hponkanrazi Wildlife Sanctuary, Kachin State, from 2014-2016. Tor yingjiangensis Chen et Yang 2004, Tor qiaojiensis Wu et al. 1977, Garra qiaojiensis Wu et al. 1977, Garra bispinosa Zhang 2005, and Schizothorax oligolepis Huang 1985, originally described from the upper Irrawaddy (Ayeyarwaddy) River in China, are first reported herein as new records to Myanmar. Counts, measurements, descriptions, photographs, and distributions of the specimens of the five newly recorded species are provided. PMID:29181904

  3. Commentary on "Integrative clinical genomics of advanced prostate cancer". Robinson D, Van Allen EM, Wu YM, Schultz N, Lonigro RJ, Mosquera JM, Montgomery B, Taplin ME, Pritchard CC, Attard G, Beltran H, Abida W, Bradley RK, Vinson J, Cao X, Vats P, Kunju LP, Hussain M, Feng FY, Tomlins SA, Cooney KA, Smith DC, Brennan C, Siddiqui J, Mehra R, Chen Y, Rathkopf DE, Morris MJ, Solomon SB, Durack JC, Reuter VE, Gopalan A, Gao J, Loda M, Lis RT, Bowden M, Balk SP, Gaviola G, Sougnez C, Gupta M, Yu EY, Mostaghel EA, Cheng HH, Mulcahy H, True LD, Plymate SR, Dvinge H, Ferraldeschi R, Flohr P, Miranda S, Zafeiriou Z, Tunariu N, Mateo J, Perez-Lopez R, Demichelis F, Robinson BD, Schiffman M, Nanus DM, Tagawa ST, Sigaras A, Eng KW, Elemento O, Sboner A, Heath EI, Scher HI, Pienta KJ, Kantoff P, de Bono JS, Rubin MA, Nelson PS, Garraway LA, Sawyers CL, Chinnaiyan AM.Cell. 21 May 2015;161(5):1215-1228.

    Science.gov (United States)

    Freedland, Stephen J; Aronson, William J

    2017-08-01

    Toward development of a precision medicine framework for metastatic, castration-resistant prostate cancer (mCRPC), we established a multi-institutional clinical sequencing infrastructure to conduct prospective whole-exome and transcriptome sequencing of bone or soft tissue tumor biopsies from a cohort of 150 mCRPC affected individuals. Aberrations of AR, ETS genes, TP53, and PTEN were frequent (40%-60% of cases), with TP53 and AR alterations enriched in mCRPC compared to primary prostate cancer. We identified new genomic alterations in PIK3CA/B, R-spondin, BRAF/RAF1, APC, β-catenin, and ZBTB16/PLZF. Moreover, aberrations of BRCA2, BRCA1, and ATM were observed at substantially higher frequencies (19.3% overall) compared to those in primary prostate cancers. A total of 89% of affected individuals harbored a clinically actionable aberration, including 62.7% with aberrations in AR, 65% in other cancer-related genes, and 8% with actionable pathogenic germline alterations. This cohort study provides clinically actionable information that could affect treatment decisions for these affected individuals. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Reforming China’s Criminal Procedure Law

    OpenAIRE

    Winckler, Hugo

    2014-01-01

    Sources:- Wang Jianxun, “The provisions of the reform of criminal procedural law legalising secret investigations are a step backwards,” Caijing wang, 5 September 2011.- Chen Youxi, “The legalisation of secret investigations is an important violation of political integrity,” Zhongguo wangluo dianshitai – CNTV web site, Opinion section, 27 November 2011.- Wu Zhehua, “Chen Weidong discusses reform of the criminal procedure law: Behind each article there is a story,” Zhongguoguangbo wang, 8 Marc...

  5. How Managers Sense and Seize “Hyped” Technologies

    DEFF Research Database (Denmark)

    Schiele, Kristen; Rydén, Pernille

    A rapid proliferation of online consumer review systems has become common in diverse industries, such as tourism (Xiang and Gretzel 2010), box office movies (Duan, Gu, andWhinston 2008; Dellarocas, Zhang and Awad 2007), online books (Chevalier and Mayzlin 2006;Chen, Wu, and Yoon 2004), and video ...... (Dellarocas 2003), and the popularity of online reviews has increased acknowledgement of the potential of social media to provide the organization with information, resources, and networks (Constantinides and Fountain 2008).......A rapid proliferation of online consumer review systems has become common in diverse industries, such as tourism (Xiang and Gretzel 2010), box office movies (Duan, Gu, andWhinston 2008; Dellarocas, Zhang and Awad 2007), online books (Chevalier and Mayzlin 2006;Chen, Wu, and Yoon 2004), and video...

  6. Chen et al., Afr J Tradit Complement Altern Med. (2012) 9(2):234 ...

    African Journals Online (AJOL)

    AJTCAM

    E-mail: qidongfanjian@sina.com .... under an inverted microscope. ... Stars image analyzing equipment (Shanghai, P.R. China) was used to analyze the image ... Inverted microscope: The cultured neurons in the control group grew well and ...

  7. Critical node lifetimes in random networks via the Chen-Stein method

    NARCIS (Netherlands)

    Franceschetti, M.; Meester, R.W.J.

    2006-01-01

    This correspondence considers networks where nodes are connected randomly and can fail at random times. It provides scaling laws that allow to find the critical time at which isolated nodes begin to appear in the system as its size tends to infinity. Applications are in the areas of sensor and

  8. Chen et al., Afr J Tradit Complement Altern Med. (2016) 13(1):25-32 ...

    African Journals Online (AJOL)

    PROF ADEWUNMI

    The phosphorylation of PKA substrate was not activated after 48 hours of treatment with ephedrine and anisodamine. Conclusion: Ephedrine and anisodamine inhibit the proliferation of SKBR3 cells via a significantly change of intracellular cAMP concentration. Key words: anisodamine, breast cancer, cyclic adenosine ...

  9. Q. Shen1, X. Chen1, Jiyune Yi2, DR Jiang1 & YJ Yun3

    Indian Academy of Sciences (India)

    imately six months to cover the 2-yr pulsation cycle of VX Sgr. We used a special phase referencing ... but the υ = 2 line has relatively few maser features, most of which reside in the. Southern and Northern parts. ... stronger masers of both the lines appear, among which the main features reside in the inner shell and show ...

  10. Chen and Xiaodong Afr J Tradit Complement Altern Med. (2013) 10 ...

    African Journals Online (AJOL)

    AJTCAM

    As an ancient medicine, Solanum nigrum Linne has been playing an important role in the treatment of cancer in China since ancient times. It is reported in the literatures that Solanum nigrum Linne can inhibit tumour cell growth and promote apoptosis of tumour cells, and has immunomodulatory and cytotoxic effects (Son et ...

  11. In search of low cost titanium: the Fray Farthing Chen (FFC) Cambridge process

    CSIR Research Space (South Africa)

    Oosthuizen, SJ

    2010-10-01

    Full Text Available delivering a sponge product, aimed at replacing Kroll sponge alone, does not have potential for large reduction in overall titanium cost. Significant cost savings can only be achieved by also reducing the large number of process steps required to process... the sponge to mill product, including sponge purification, comminution, electrode forming, Vacuum Arc Re-melting, Hot and cold rolling. Presently, economy of scale in the production of titanium dictates that it is most cost effective to cast the largest...

  12. In search of low cost titanium: the fray farthing chen (FFC) cambridge process

    CSIR Research Space (South Africa)

    Oosthuizen, SJ

    2011-03-01

    Full Text Available delivering a sponge product, aimed at replacing Kroll sponge alone, does not have potential for large reduction in overall titanium cost. Significant cost savings can be achieved only by also reducing the large number of process steps required... to process the sponge to mill product, including sponge purification, comminution, electrode forming, vacuum arc re-melting, and hot and cold rolling. Presently, economy of scale in the production of titanium dictates that it is most cost...

  13. Chen et al., Afr J Tradit Complement Altern Med. (2014) 11(1):15-22

    African Journals Online (AJOL)

    cadewumi

    x300mm,Japan ) column. The columns were eluted with 0.1M nitric acid and calibrated with ..... Mushiake, H, Tsunoda, T, Nukatsuka,M, Shimao K, Fukushima M, Tahara H. (2005). Dendritic cells might be one of key factors for eliciting antitumor ...

  14. Calibrating the Shan-Chen lattice Boltzmann model for immiscible displacement in porous media

    DEFF Research Database (Denmark)

    Christensen, Britt Stenhøj Baun; Schaap, M.G.; Wildenschild, D.

    2006-01-01

    The lattice Boltzmann (LB) modeling technique is increasingly being applied in a variety of fields where computational fluid dynamics are investigated. In our field of interest, environmentally related flow processes in porous media, the use of the LB method is still not common. For the LB...

  15. Beiträge zur Beugungstheorie elektromagnetischer Wellen an Kanten vollkommen leitender Flächen

    OpenAIRE

    Zinal, Sherko

    2011-01-01

    Den Kern der vorliegenden Arbeit bilden die Untersuchung sowie die Formulierung von Lösungsansätzen für ein elementares, elektromagnetisches Beugungsproblem; einer undendlich langen Schlitzleitung mit einseitig begrenzter etallisierungsplatte (Abschnitt 1.2). Motiviert wird dieses Beugungsproblem im Hinblick auf die Beugungsproblematik planarer Strahler (Antennen) mit endlich ausgedehnter Grundmetallisierung (Abschnitt 1.1). In Kapitel 2 wird ein Stromlinien-Modell zur Formulierung des Beugun...

  16. VizieR Online Data Catalog: IRS spectra with features of crystalline silicates (Chen+, 2016)

    Science.gov (United States)

    Chen, R.; Luo, A.; Liu, J.; Jiang, B.

    2018-04-01

    Spectra taken by the IRS (Houck et al. 2004ApJS..154...18H) on the Spitzer space telescope (Werner et al. 2004ApJS..154....1W) are now publicly available. These spectra are produced using the bksub.tbl products from SL and LL modules of final SSC pipeline, version 18.18. From the IRS data archive, we found a collection of 16986 low-resolution spectra. The spectra are merged by four slits: SL2 (5.21-7.56 μm), SL1 (7.57-14.28 μm), LL2 (14.29-20.66 μm), and LL1 (20.67-38.00 μm). As crystalline silicates have no features in the SL2 band, we choose the spectra that include all the other three bands: SL1, LL2, and LL1 so that the object has a continuous spectrum from about 7.5-38 μm. In this way, five of the seven infrared complexes of crystalline silicates are covered, i.e., the 10, 18, 23, 28, and 33 μm complexes. (5 data files).

  17. Die Beifuß-Ambrosie auf Ackerflächen - ein Problem?

    Directory of Open Access Journals (Sweden)

    Verschwele, Arnd

    2014-07-01

    Full Text Available Common ragweed (Ambrosia artemisiifolia is spreading on agricultural fields in Germany, mainly in Brandenburg and Bayern. Competitive crops like winter cereals and oilseed-rape can reduce growth of this plant better than spring crops. In maize or cereals a chemical control is possible, but problems may arise because of the late emergence of ragweed and its high ability to regrowth. In crops like sunflower or lupines herbicide choice is limited and thus preventive control measures are crucial. An integrated approach is needed in order to avoid yield losses and to stop the spreading of ragweed in Germany.

  18. Effects of different cleaning treatments on heavy metal removal of Panax notoginseng (Burk) F. H. Chen.

    Science.gov (United States)

    Dahui, Liu; Na, Xu; Li, Wang; Xiuming, Cui; Lanping, Guo; Zhihui, Zhang; Jiajin, Wang; Ye, Yang

    2014-01-01

    The quality and safety of Panax notoginseng products has become a focus of concern in recent years. Contamination with heavy metals is one of the important factors as to P. notoginseng safety. Cleaning treatments can remove dust, soil, impurities or even heavy metals and pesticide residues on agricultural products. But effects of cleaning treatments on the heavy metal content of P. notoginseng roots have still not been studied. In order to elucidate this issue, the effects of five different cleaning treatments (CK, no treatment; T1, warm water (50°C) washing; T2, tap water (10°C) washing; T3, drying followed by polishing; and T4, drying followed by tap water (10°C) washing) on P. notoginseng roots' heavy metal (Cu, Pb, Cd, As and Hg) contents were studied. The results showed that heavy metal (all five) content in the three parts all followed the order of hair root > rhizome > root tuber under the same treatment. Heavy metal removals were in the order of Hg > As > Pb > Cu > Cd. Removal efficiencies of the four treatments were in the order of T2 > T1 > T3 > T4. Treatments (T1-T4) could decrease the contents of heavy metal in P. notoginseng root significantly. Compared with the requirements of WM/T2-2004, P. notoginseng roots' heavy metal contents of Cu, Pb, As and Hg were safe under treatments T1 and T2. In conclusion, the cleaning process after production was necessary and could reduce the content of heavy metals significantly. Fresh P. notoginseng root washed with warm water (T2) was the most efficient treatment to remove heavy metal and should be applied in production.

  19. Chen et al., Afr J Tradit Complement Altern Med. (2011) 8(4):467-476

    African Journals Online (AJOL)

    AJTCAM

    Keywords: Shen-qi-di-huang decoction, proteinuria, nephrin, adriamycin nephropathy. Introduction. Proteinuria is a clinical signature of podocyte injury resulting in many renal diseases. The slit diaphragm (SD) which connects neighboring foot processes of podocytes represents a critical structure of protein filtration (Tarabra ...

  20. AtCCX1 transports Na + and K + in Pitch pastoris | Chen | African ...

    African Journals Online (AJOL)

    Compartmentation of Na+ into vacuoles is an important way for cells to avoid the toxic effects of salt. Here, Arabidopsis AtCCX1 was studied in Pitch pastoris GS115. Yeast expressing AtCCX1 grew better in high H+ concentration medium and high salt medium than original strain and increased Na+ accumulation and ...

  1. First record of molluscs naturally infected with Angiostrongylus cantonensis (Chen, 1935 (Nematoda: Metastrongylidae in Brazil

    Directory of Open Access Journals (Sweden)

    Roberta Lima Caldeira

    2007-11-01

    Full Text Available Seeking the identification of Angiostrongylus cantonensis as a potential etiological agent of three clinical cases of eosinophilic meningitis, mollusc specimens were collected in the state of Espírito Santo, Brazil. The snails were identified as Sarasinula marginata (45 specimens, Subulina octona (157, Achatina fulica (45 and Bradybaena similaris (23. Larvae obtained were submitted to polymerase chain reaction and restriction fragment length polymorphism diagnosis. Their genetic profile were corresponded to A. cantonensis. Rattus norvegicus experimentally infected with third-stage larvae, developed menigoencephalitis, and parasites became sexually mature in the lungs. Additionally, larvae obtained from A. fulica snails, from São Vicente, state of São Paulo, also showed genetic profiles of this nematode. This is the first record of Brazilian molluscs infected with this nematode species.

  2. VizieR Online Data Catalog: YSO candidates in the Magellanic Bridge (Chen+, 2014)

    Science.gov (United States)

    Chen, C.-H. R.; Indebetouw, R.; Muller, E.; Kawamura, A.; Gordon, K. D.; Sewilo, M.; Whitney, B. A.; Fukui, Y.; Madden, S. C.; Meade, M. R.; Meixner, M.; Oliveira, J. M.; Robitaille, T. P.; Seale, J. P.; Shiao, B.; van Loon, J. Th.

    2017-06-01

    The Spitzer observations of the Bridge were obtained as part of the Legacy Program "Surveying the Agents of Galaxy Evolution in the Tidally-Stripped, Low-Metallicity Small Magellanic Cloud" (SAGE-SMC; Gordon et al. 2011AJ....142..102G). These observations included images taken at 3.6, 4.5, 5.8, and 8.0 um bands with the InfraRed Array Camera (IRAC) and at 24, 70, and 160 um bands with the Multiband Imaging Photometer for Spitzer (MIPS). The details of data processing are given in Gordon et al. (2011AJ....142..102G). To construct multi-wavelength SEDs for sources in the Spitzer catalog, we have expanded it by adding photometry from optical and NIR surveys covering the Bridge, i.e., BRI photometry from the Super COSMOS Sky Surveys (SSS; Hambly et al. 2001MNRAS.326.1279H) and JHKs photometry from the Two Micron All Sky Survey (2MASS; Skrutskie et al. 2006AJ....131.1163S, Cat. VII/233). (5 data files).

  3. Was kommt nach dem Handel? Umnutzung von Einzelhandelsflächen und deren Beitrag zur Stadtentwicklung

    OpenAIRE

    Sperle, Tilman

    2012-01-01

    In der Stadt europäischen Typs sind Stadt und Handel eng miteinander verwoben. Die Bedeutung des Handels geht weit über dessen originäre Versorgungsfunktion hinaus. Für die städtischen Zentren und Nebenzentren übernimmt er sowohl gestaltende als auch soziale Funktionen und trägt mit seiner belebenden Wirkung maßgeblich zum urbanen Leben bei. Mit dem tief greifenden Strukturwandel im Einzelhandel verändert sich diese Beziehung zwischen Stadt und Handel dramatisch, Trading-down-Prozesse geh...

  4. VizieR Online Data Catalog: Sample of Fermi Blazars (Chen+, 2016)

    Science.gov (United States)

    Chen, Y.-Y.; Zhang, X.; Xiong, D.-R.; Wang, S.-J.; Yu, X.-L.

    2016-04-01

    We tried to select a large number of blazars with reliable redshift, radio core and extended radio luminosity at 1.4GHz. Firstly, we considered the following samples of blazars to get the radio core luminosity and extended luminosity at 1.4GHz: Kharb et al. (2010, J/ApJ/710/764), Antonucci & Ulvestad (1985ApJ...294..158A), Cassaro et al. (1999A&AS..139..601C), Murphy et al. (1993MNRAS.264..298M), Landt & Bignall (2008MNRAS.391..967L), Caccianiga & Marcha (2004, Cat. J/MNRAS/348/973), Giroletti et al. (2004). We cross-correlated these samples with the Fermi LAT Third Source Catalog (3FGL), and we acquired the 3FGL spectral index and energy flux at 0.1-100GeV from clean sources in 3FGL (Fermi-LAT Collaboration 2015, J/ApJS/218/23) Using these catalogs, we compiled 201 Fermi blazars. (1 data file).

  5. Diskrepanz: Die EU-Frauenpolitik zwischen Deregulierung und Gleichheitsansprüchen

    Directory of Open Access Journals (Sweden)

    Ingrid Biermann

    2003-03-01

    Full Text Available In von neun Autorinnen verfassten Beiträgen gibt der Band Einblicke in zentrale Felder der EU-Politik: die europäische Wirtschafts- und Währungsunion (EWWU, die Strukturpolitik, die Gleichstellungspolitik und das Gender Mainstreaming, die Osterweiterung sowie die Ausarbeitung einer europäischen Verfassung. Damit werden wesentliche Teile des Maastricht-Vertrags (1992, des Amsterdamer Vertrags (1997 und des Nizza-Vertrags (2000 behandelt. Hierdurch bildet dieser Band eine wichtige Grundlage für die Diskussion über die Frauenpolitik der EU.

  6. VizieR Online Data Catalog: Quasars narrow absorption lines from SDSS (Chen+, 2015)

    Science.gov (United States)

    Chen, Z.-F.; Gu, Q.-S.; Chen, Y.-M.; Cao, Y.

    2017-11-01

    The Baryon Oscillation Spectroscopic Survey (BOSS: Eisenstein et al. 2011AJ....142...72E; Paris et al. 2012, Cat. VII/269) is the main dark-time legacy survey of the third stage of the SDSS, which used the same 2.5-m telescope (Gunn et al. 2006AJ....131.2332G; Ross et al. 2012, J/ApJS/199/3) as the first and second stages of the SDSS (hereafter SDSS-I/II). SDSS-I/II spectra have a wavelength coverage from 3800-9200Å with a spectral resolution of 1800-2200 (e.g. York et al. 2000AJ....120.1579Y). BOSS spectra span a range from 3600-10500Å at a resolution of 1300-2500 (Paris et al. 2012, Cat. VII/269). During the first two years, BOSS detected 87822 quasars over an area of 3275 deg2, including 7932 quasars that were observed by SDSS-I/II as well. Quasars observed by both SDSS-I/II and BOSS provide a remarkable chance to study the variabilities of absorption lines in a large population. Throughout this work, we take the quasar emission redshifts provided by Hewett & Wild (2010, J/MNRAS/405/2302, http://das.sdss.org/va/HewettWilddr7qso_newz/) directly. (2 data files).

  7. REVIEW: LOVE IN LHASA Lhasa hong chen 拉萨红尘

    Directory of Open Access Journals (Sweden)

    Reviewed by Wu Jing 吴晶

    2018-05-01

    Full Text Available Published in 2002, Love in Lhasa is Baima's first novel. The background is the 1980s at a time when China was engaging in fast-paced development of industrialization and commercialization as part of the Reform and Opening Up that began in the late 1970s. Most of the novel's episodes are set on the Tibetan Plateau where local Tibetans are affected by the trend of modernization. Young people in particular have increased opportunities to go out and see the world and also experience more challenges in dealing with issues of self-identity, and exploring the meaning of their existence. Against such a fast-changing social background, Tibetan women are faced with poignant life choices, especially as compared to traditional women. The novel's plot unfolds with the parallel life trajectories of the two female characters, Langsa and Yama, who are classmates and close friends at Tibet Military College. After graduation, the two young women leave the army and work in non-military areas as nurses. Langsa, the narrator, falls in love with a pilgrim, Varma, who comes from an isolated part of Tibet where Tibetan, Hui, and Han nationalities live together. They enjoy their otherworldly, extremely romantic relationship, and in the end, choose to live a reclusive life in the unknown hinterlands of Tibet. In contrast, Yama, the heroine, undergoes more complicated love experiences. Yama is the focus of this novel, embodying qualities of a "lost girl," such as beauty, rebelliousness, freedom-loving, desire, dreamer, degradation, and despair. After a pre-marriage affair with Di, a young Han man, she marries Zedan, a Tibetan, and her first real love. Disappointed by domestic life, she succumbs to temptation and has an extra-marital affair with Xu Nan in Shanghai. ...

  8. Purification and in vitro antioxidant activities of tellurium-containing phycobiliproteins from tellurium-enriched Spirulina platensis

    OpenAIRE

    Chen, Tianfeng; Yang,Fang; Wong,Ka-Hing; Yang,Yufeng; Li,Xiaoling; Jiang,Jie; Wu,Hualian; Zheng,Wenjie

    2014-01-01

    Fang Yang,1 Ka-Hing Wong,2 Yufeng Yang,3 Xiaoling Li,1 Jie Jiang,1 Wenjie Zheng,1 Hualian Wu,1 Tianfeng Chen1 1Department of Chemistry, Jinan University, Guangzhou, People’s Republic of China; 2Department of Applied Biology and Chemical Technology, The Hong Kong Polytechnic University, Hong Kong, People’s Republic of China; 3Institute of Hydrobiology, College of Life Science and Technology, Jinan University, Guangzhou, People’s Republic of China Abstract: Tellu...

  9. Hydrothermal synthesis of porous Co(OH)2 nanoflake array film and ...

    Indian Academy of Sciences (India)

    sented discharge current and M (mg), V (V) and t (s) designate mass of ..... Chang Z R, Li H J, Tang H W, Yuan X Z and Wang H J 2009 Int. J. Hydrogen. Energy ... Interfaces 3 99. Kong L B, Liu M C, Lang J W, Liu M, Luo Y C and Kang L 2011 ... Yuan Y F, Xia X H, Wu J B, Yang J L, Chen Y B and Guo S Y 2011. Electrochim.

  10. A novel therapeutic strategy for cartilage diseases based on lipid nanoparticle-RNAi delivery system

    OpenAIRE

    Wang, Shaowei; Wei, Xiaochun; Sun, Xiaojuan; Chen, Chongwei; Zhou, Jingming; Zhang, Ge; Wu, Heng; Guo, Baosheng; Wei, Lei

    2018-01-01

    Shaowei Wang,1 Xiaochun Wei,1 Xiaojuan Sun,1 Chongwei Chen,1 Jingming Zhou,2 Ge Zhang,3 Heng Wu,3 Baosheng Guo,3 Lei Wei1,2 1Department of Orthopaedics, The 2nd Hospital of Shanxi Medical University, Taiyuan, Shanxi, China; 2Department of Orthopaedics, Rhode Island Hospital, The Warren Alpert Medical School of Brown University, Providence, RI, USA; 3Integrated Traditional Chinese and Western Medicine, School of Chinese Medicine, Hong Kong Baptist University, Hong Kong Background: C...

  11. Berlinale tõstab kilbile "Teekonna Guatanamosse" / Grete Nootre

    Index Scriptorium Estoniae

    Nootre, Grete

    2006-01-01

    56. Berliini filmifestivali programmidest ja filmidest - Suurbritannia poliitiline mängufilm "Teekond Guatanamosse" ("The Road to Guatanamo") : režissöörid Michael Winterbottom, Mat Whitecross, Hiina mängufilm "Lubadus" ("Wu ji") : režissöör Chen Kaige, Suurbritannia - Saksamaa "V nagu vendette" ("V for Vendette") : režissöör James McTeigue

  12. Magnetic resonance in superparamagnetic zinc ferrite

    Indian Academy of Sciences (India)

    in magnetization for smaller sized systems (Roy et al 2006;. Xue et al 2007; Singh et ... state (Chinnasamy et al 2000; Lee et al 2002; Shim et al. ∗. Author for .... Singh J P, Dixit G, Srivastava R C, Agrawal H M, Reddy V R and. Gupta A 2012 J. ... Wu K H, Chang Y C, Chen H B, Yang C C and Horng D N 2004. J. Magn. Magn.

  13. Lanthanide metal-organic frameworks

    International Nuclear Information System (INIS)

    Cheng, Peng

    2015-01-01

    This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).

  14. Lanthanide metal-organic frameworks

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Peng (ed.) [Nankai Univ., Tianjin (China). Dept. of Chemistry

    2015-03-01

    This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).

  15. Methods and strategy for modeling daily global solar radiation with measured meteorological data - A case study in Nanchang station, China

    International Nuclear Information System (INIS)

    Wu, Guofeng; Liu, Yaolin; Wang, Tiejun

    2007-01-01

    Solar radiation is a primary driver for many physical, chemical and biological processes on the earth's surface, and complete and accurate solar radiation data at a specific region are quite indispensable to the solar energy related researches. This study, with Nanchang station, China, as a case study, aimed to calibrate existing models and develop new models for estimating missing global solar radiation data using commonly measured meteorological data and to propose a strategy for selecting the optimal models under different situations of available meteorological data. Using daily global radiation, sunshine hours, temperature, total precipitation and dew point data covering the years from 1994 to 2005, we calibrated or developed and evaluated seven existing models and two new models. Validation criteria included intercept, slope, coefficient of determination, mean bias error and root mean square error. The best result (R 2 = 0.93) was derived from Chen model 2, which uses sunshine hours and temperature as predictors. The Bahel model, which only uses sunshine hours, was almost as good, explaining 92% of the solar radiation variance. Temperature based models (Bristow and Campbell, Allen, Hargreaves and Chen 1 models) provided less accurate results, of which the best one (R 2 = 0.69) is the Bristow and Campbell model. The temperature based models were improved by adding other variables (daily mean total precipitation and mean dew point). Two such models could explain 77% (Wu model 1) and 80% (Wu model 2) of the solar radiation variance. We, thus, propose a strategy for selecting an optimal method for calculating missing daily values of global solar radiation: (1) when sunshine hour and temperature data are available, use Chen model 2; (2) when only sunshine hour data are available, use Bahel model; (3) when temperature, total precipitation and dew point data are available but not sunshine hours, use Wu model 2; (4) when only temperature and total precipitation are

  16. 實徵研究/Information Literacy in the Workplace: A Cross-cultural Perspective/Yuhfen Diana Wu

    Directory of Open Access Journals (Sweden)

    Yuhfen Diana Wu Yuhfen Diana Wu

    2012-04-01

    Full Text Available This cross-cultural study has two main purposes: to investigate how information literacy is perceived in the workplace and to discover how employees obtain information to carry out their jobs in an effective and timely fashion. This project applies a mix of research methods, including site visits, interviews, and a survey. More than 120 participants from forty companies were involved in this study. They were from a wide variety of industries in Taiwan and Silicon Valley, in Northern California, where many companies base offices or operations from around the world. Major obstacles in conducting cross-continent research are cost, time demands, scheduling, and adaptation to local culture. In this global economy, cross-cultural and cross-border research will help educators, such as librarians, understand the complexity of skills expected in the workplace. Much has been written on information literacy, yet very few can relate how information literacy is applied in the workplace. This primary study sheds some light to help academic librarians reposition themselves as researchers-educators integral to student success. 本論文為一跨文化性的研究,具有兩個主要目的:一是探討在職場中對於資訊素養的認知;二是探討員工如何及時有效的獲取和應用資訊來執行自己的任務。本研究採用混合式研究方法,包括實地考察、訪談和問卷調查。研究對象來自北加州矽谷和臺灣40家企業的120多名員工,他們分別從事不同行業。其中許多世界級的跨國企業選擇矽谷或臺灣作為公司總部或世界營運樞紐。進行跨洲研究的主要阻礙包括經費、時間、行程安排與適應當地的文化。跨文化和跨國界的研究將有助於教育工作者,如圖書館員,了解職場上所需技能的複雜性。目前已出版許多關於資訊素養的文獻,僅少涉及職場上資訊素養的應用。由於學術圖書館員在學生的學習過程中扮演不可或缺的角色,此初步研究,可幫助學術圖書館員重新為自己定位。 頁次:84-104

  17. A computational exploration of the McCoy-Tracy-Wu solutions of the third Painlevé equation

    Science.gov (United States)

    Fasondini, Marco; Fornberg, Bengt; Weideman, J. A. C.

    2018-01-01

    The method recently developed by the authors for the computation of the multivalued Painlevé transcendents on their Riemann surfaces (Fasondini et al., 2017) is used to explore families of solutions to the third Painlevé equation that were identified by McCoy et al. (1977) and which contain a pole-free sector. Limiting cases, in which the solutions are singular functions of the parameters, are also investigated and it is shown that a particular set of limiting solutions is expressible in terms of special functions. Solutions that are single-valued, logarithmically (infinitely) branched and algebraically branched, with any number of distinct sheets, are encountered. The algebraically branched solutions have multiple pole-free sectors on their Riemann surfaces that are accounted for by using asymptotic formulae and Bäcklund transformations.

  18. Die Erfassung von städtischen Oberflächen mittels EDV-gestützter Luftbildauswertung : ein Beitrag zur klimatologischen und luftklimatischen Bewertung von städtischen Teilflächen

    Directory of Open Access Journals (Sweden)

    M. Sandtner

    Full Text Available The article shows that the computer-aided, analogous-visual, stereometric interpretation of large-scale colour-infrared (CIR aerial photographs and subsequent data processing in a Geographical Information System (GIS can provide fundamental data necessary to describe aspects of urban ecology in a scale relevant for city-planning. This is exemplified by an evaluation of urban areas concerning their climates and airpollution using maps of urban surfaces (scale1:2500. An argumentation relying on such detailed and current basic data can stress the importance of environmental aspects in contrast to competing public and private interests in the process of city planning.

  19. Erste Erfahrungen mit RDA an wissenschaftlichen Universalbibliotheken in Deutschland - Ergebnisse aus Fokusgruppengesprächen mit Katalogisierenden

    Directory of Open Access Journals (Sweden)

    Heidrun Wiesenmüller

    2017-04-01

    Full Text Available Einige Monate nach dem Umstieg auf das neue Regelwerk "Resource Description and Access" (RDA wurden an 18 großen deutschen wissenschaftlichen Universalbibliotheken Fokusgruppengespräche mit Katalogisierererinnen und Katalogisierern durchgeführt. Die Katalogisierenden wurden u.a. befragt, wie sicher sie sich bei der Anwendung von RDA fühlen, was sie am neuen Regelwerk gut oder schlecht finden, wie sie den Aufwand im Vergleich zum früheren Regelwerk RAK einschätzen, welche Informations- und Hilfsmittel sie verwenden und wie sie zu den regelmäßigen Änderungen im Standard stehen. Der vorliegende Aufsatz dokumentiert die Ergebnisse der Gespräche.   Several months after the introduction of the new cataloging standard "Resource Description and Access" (RDA, focus-group interviews with catalogers were conducted at 18 large academic and state libraries in Germany. Among other things, the catalogers were asked how confident they feel in applying RDA, which aspects of the new cataloging code they like or do not like, how they estimate the expenditure of time in comparison to the former cataloging code RAK, which sources they use to get help or information, and what they think about the frequent changes to the new standard. The paper presents the results of these interviews.

  20. Organisation der Lektoratsarbeit in Öffentlichen Bibliotheken, ihre Stärken und Schwächen

    OpenAIRE

    Umlauf, Konrad

    2011-01-01

    Die Praxis der Lektoratsarbeit an Öffentlichen Bibliotheken wurde 2010 mit einer Online-Befragung unter Biblothekspersonal erhoben. Die Fragen richten sich auf die Aufbauorganisation (Anteil der Lektoren unter dem Personal, den am Bestandsaufbau beteiligten Personalgruppen, die Lektoratsaufgaben im Einzelnen, typische Aufgaben der Lektoren neben den Lektoratsaufgaben, insbes. Verbindung von Lektoratsaufgaben mit Auskunftsdienst), die Ablauforganisation (Entscheidungsablauf und Kaufsitzungen, ...

  1. Chem TV: Choices I, v. 1.5.1 (by B. A. Luceigh, P. Ngo, and J. Chen)

    Science.gov (United States)

    Kraig Steffen, L.

    1999-08-01

    CHEM TV: Sunland, CA, 1998. 24.95, students; 59.95, faculty. This CD-ROM presents a series of interactive overviews and drills for students of organic chemistry. The material covered is generally taught in the first semester. This suite is much more than a simple presentation of material and, for students sufficiently motivated to take the time and work with the problems, will provide valuable review. Five interactive spaces are provided: concentration drills that emphasize recall of related structures/names, reagents/reactions, and stereochemistry; a structural review based on epinephrine; interactive synthesis projects; arcade game reagent review; and a set of timed self-tests. The CD-ROM installed and ran without problem on a Power PC Mac and on a Pentium running Windows 95. The program did fail to run when a student reviewing it switched to a very new version of Windows Quick Time. Most of the drills ran without a problem, although at times it was unclear how to respond to queries. I turned off the music, which would be much less annoying if the loops were simply longer. Publishers are flooding the market with add-on computer-based materials for the various levels of chemistry. Many constitute little more than a stack of overheads. This is one that may be of sufficient value to warrant the extra cost. A large number of examples are provided for many of the areas covered. Most of the graphical interfaces are clear and easy to manipulate, with the exception of a couple of mechanistic screens that had hard-to-figure-out arrows. Two sections, or modules, are of special note. The first of these is the synthesis challenges, where students must choose reactants, reagents, and reaction conditions for a particular reaction. These synthesis problems are well thought out and can be challenging. It is unfortunate that there are only five of them. The Self-Tests module is also of great practical value, forcing students to work through a variety of topics (200 problems) with limited time allotted per test. The structures are clear and easy to view and include a large number of three-dimensional molecular models that help make the connection between simple line drawings and actual molecules. More feedback information on incorrect answers would be nice, although it is obvious that this can balloon into an unworkable situation if every possible "wrong" answer is considered. The structure summary, which uses a single complicated molecule to review a large range of structural topics, is a good integrated look at bonding, stereochemistry, and conformational analysis. The concentration game is informative, albeit a bit obtuse on a few of the answers! The selection drills, a shooting gallery game with various chemical targets, seems a bit silly, but then if one can learn to recognize all the major reducing agents by snagging butterflies with faux nets than this could be helpful! With its varying levels of difficulty, this set of modules should be accessible even to weaker students and yet will provide a challenge for the more advanced. A great future addition would be an interactive module builder that allows faculty to modify existing questions and add their own. How can one effectively use this program? The relatively low cost does make it accessible for individual students to purchase, perhaps as a "recommended" item for the class. Another very practical option is to purchase 5-10 copies (assuming a class size of around 30-40) and make them available through a common computer laboratory (or an appropriate network site-license arrangement) or for check-out to small groups of students. One drawback is that only about 1/3 of the major topics that fill the year in organic are covered. I have used some of the drills as in-class interactive examples with a projector and laptop. This type of interactive tutorial-quiz-based program is a welcome change from the simple textbook on a CD-ROM approach. Given easy access to computers and an environment that encourages individual and small-group interactions, I believe this program can be a worthwhile aid for students of organic chemistry.

  2. Helical Magnetic Fields in AGN Jets Y. J. Chen1,2,∗ , G.-Y. Zhao1,2 ...

    Indian Academy of Sciences (India)

    Abstract. We establish a simple model to describe the helical mag- netic fields in AGN jets projected on the sky plane and the line-of-sight. This kind of profile has been detected in the polarimetric VLBI observa- tion of many blazar objects, suggesting the existence of helical magnetic fields in these sources. Key words.

  3. VizieR Online Data Catalog: New IR photometric study of Ap and Am stars (Chen+, 2017)

    Science.gov (United States)

    Chen, P. S.; Liu, J. Y.; Shan, H. G.

    2018-05-01

    In the General Catalog of Ap and Am stars (Renson & Manfroid 2009, Cat. III/260) 8265 stars are included in which, as Renson & Manfroid (2009, Cat. III/260) described, only 426 stars are of the "well known confirmed sample". We take these 426 stars as our working sample. The cross-identifications of 2MASS/WISE counterparts for all Ap, Am, and HgMn stars listed in this paper are made from Cutri et al. (2012, Cat. II/311) by using the radius of 2 arcsec. All 426 Ap, Am, and HgMn stars have 2MASS and/or WISE counterparts, which are listed in Table 3. The cross-identifications of IRAS counterparts are made according to the positional error ellipse of the source, because it has a 95% confidence level (IRAS Explanatory Supplement, Beichman et al. 1988, Cat. II/274). Finally, 202 stars are found to have the IRAS counterparts from IRAS PSC/FSC, which is listed in Table 4. (5 data files).

  4. J. Chen1, Z.-Q. Shen1, H. Sudou3, S. Iguchi4, Y. Murata5

    Indian Academy of Sciences (India)

    4National Astronomical Observatory of Japan, Tokyo 181-8588, Japan. 5The Institute of Space and Astronautical Science, JAXA, Kanagawa 229-8510, Japan. 6Research Center for Space and Cosmic Evolution, Ehime University,. Matsuyama 790-8577, Japan. ∗ e-mail: gyzhao@shao.ac.cn. Abstract. It was argued that 3C ...

  5. X-ray Time Lags in TeV Blazars X. Chen1,∗ , G. Fossati1, E. Liang1 ...

    Indian Academy of Sciences (India)

    Abstract. We use Monte Carlo/Fokker–Planck simulations to study the. X-ray time lags. Our results show that soft lags will be observed as long as the decay of the flare is dominated by radiative cooling, even when acceleration and cooling time scales are similar. Hard lags can be pro- duced in the presence of a competitive ...

  6. Trichodina nobilis Chen, 1963 and Trichodina reticulata Hirschmann et Partsch, 1955 from ornamental freshwater fishes in Brazil

    Directory of Open Access Journals (Sweden)

    ML Martins

    Full Text Available In the present work Trichodina reticulata and T. nobilis (Ciliophora: Trichodinidae are morphologically characterised from ornamental freshwater fish culture in the State of Santa Catarina, Brazil. The prevalence of infection and a list of comparative measurements are discussed. We examined "southern platyfish" Xiphophorus maculatus (n = 35, "goldfish" Carassius auratus (n = 31, "guppy" Poecilia reticulata (n = 20, "sailfin molly" Poecilia latipinna (n = 6, "beta" Betta splendens (n = 2 and "spotted headstander" Chilodus punctatus (n = 1. After being anesthetised in a benzocaine solution, fishes were examined for parasitological evaluation. A total of 51.57% fishes were parasitised by Trichodina spp. Carassius auratus was the most parasitised species, followed by X. maculatus and P. reticulata. Beta splendens, C. punctatus and P. latipinna were not parasitised by any trichodinid species. Two species of Trichodina were collected from the skin of fish: T. nobilis was found in C. auratus, P. reticulata and X. maculatus and T. reticulata was only observed in C. auratus. The importance of adequate handling in ornamental fish culture are also discussed.

  7. A new species of Neoperla (Plecoptera: Perlidae) from Zhejiang Province of China.

    Science.gov (United States)

    Chen, Zhi-Teng

    2016-03-24

    The stonefly genus Neoperla Needham (1905) is primarily distributed in eastern North America, Tropical and Temperate Asia and central Africa, with at least 297 species known (Illies 1966, Zwick 1973, Stark & Gaufin 1976, DeWalt et al. 2016). Contributions to Chinese species of Neoperla were made by Chu (1929), Wu & Claassen (1934), Wu (1935, 1938, 1948, 1962, 1973), Yang & Yang (1992, 1995, 1998), Du (1999, 2000a, 2000b), Du et al. (1999, 2001), Du & Sivec (2004, 2005), Du & Wang (2005, 2007), Sivec & Zwick (1987), Li & Wang (2011), Li et al. (2011a, 2011b, 2012a, 2012b, 2013a, 2013b, 2014a, 2014b), Qin et al. (2013), Wang et al. (2013a, 2013b), Li & Zhang (2014), Kong et al. (2014), Wang et al. (2014), Chen & Du (2015). Herein, a new species of this genus is described from Taizhou, Zhejiang Province, of eastern coastal China.

  8. Reversal of multidrug resistance by magnetic Fe3O4 nanoparticle copolymerizating daunorubicin and 5-bromotetrandrine in xenograft nude-mice

    OpenAIRE

    Chen, Baoan

    2009-01-01

    Baoan Chen1,* Jian Cheng1,* Yanan Wu1, Feng Gao1, Wenlin Xu2, et al 1Department of Hematology;2Department of Hematology, The Affiliated People’s Hospital, Jiangsu University, Zhenjiang, PR China *These authors have contributed equally to this workAbstract: In this paper we establish the xenograft leukemia model with stable multidrug resistance in nude mice and to investigate the reversal effect of 5-bromotetrandrine (5-BrTet) and magnetic nanoparticle of Fe3O4 (MNP-Fe3O4) c...

  9. Association between MDM2 SNP309 T>G polymorphism and the risk of bladder cancer: new data in a Chinese population and an updated meta-analysis

    OpenAIRE

    Xie, Linguo; Sun, Yan; Chen, Tao; Tian, Dawei; Li, Yujuan; Zhang, Yu; Ding, Na; Shen, Zhonghua; Xu, Hao; Nian, Xuewu; Sha, Nan; Han, Ruifa; Hu, Hailong; Wu, Changli

    2015-01-01

    Linguo Xie,1,2,* Yan Sun,2,* Tao Chen,1,2,* Dawei Tian,1,2 Yujuan Li,3 Yu Zhang,1,2 Na Ding,2 Zhonghua Shen,1,2 Hao Xu,1,2 Xuewu Nian,4 Nan Sha,1,2 Ruifa Han,1,2 Hailong Hu,1,2 Changli Wu1,2 Objective: Human murine double minute 2 protein (MDM2) is mainly a negative regulator of p53 tumor suppressor pathway. We aimed to investigate the association between MDM2 SNP309 polymorphism and bladder cancer risk. Methods: A total of 535 bladder cancer patients and 649 health controls were recruited f...

  10. A novel imidazopyridine derivative, X22, attenuates sepsis-induced lung and liver injury by inhibiting the inflammatory response in vitro and in vivo

    OpenAIRE

    Ge, Xiangting; Feng, Zhiguo; Xu, Tingting; Wu, Beibei; Chen, Hongjin; Xu, Fengli; Fu, Lili; Shan, Xiaoou; Dai, Yuanrong; Zhang, Yali; Liang, Guang

    2016-01-01

    Xiangting Ge,1,2,* Zhiguo Feng,1,* Tingting Xu,2 Beibei Wu,3 Hongjin Chen,1 Fengli Xu,3 Lili Fu,1 Xiaoou Shan,3 Yuanrong Dai,2 Yali Zhang,1 Guang Liang11Chemical Biology Research Center, School of Pharmaceutical Sciences, 2Department of Pulmonary Medicine, The 2nd Affiliated Hospital, 3Department of Pediatrics, The 2nd Affiliated Hospital, Wenzhou Medical University, Wenzhou, People’s Republic of China*These authors contributed equally to this workAbstract: Sepsis remains a leading ...

  11. Role of Mitochondrial Inheritance on Prostate Cancer Outcome in African American Men. Addendum

    Science.gov (United States)

    2016-11-01

    RK, Tan DJ. Comprehensive scanning of the entire mitochondrial genome for mutations. Clin Chem. 2002; 48:1901-12. 3. Zhang W, Cui H, Wong L-J...Yang J, Price R, Nicolas A, Nalls M, Tranah G, Franceschini N, Xu Z, Schulte C, Alonso A, Cummings S, Fornage M, Zaykin D, Li L, Huang X, Kritchevsky S...L, Liu X, Liu L, Xu P, Han B, Bai C, Zhao Y, Zhang H, Yan Y, Amos CI, Chen F, Tan W, Jin L, Wu T, Lin D, Shen H. Association analyses identify

  12. Fighting words: Four new document finds reignite old debates in Taijiquan historiography

    OpenAIRE

    Wile, Douglas

    2017-01-01

    Martial arts historiography has been at the center of China’s culture wars and a cause célèbre between traditionalists and modernizers for the better part of a century. Nowhere are the stakes higher than with the iconic art of taijiquan, where, based on a handful of documents in the Chen, Wu, and Yang lineages, traditionalists have mythologized the origins of taijiquan, claiming the Daoist immortal Zhang Sanfeng as progenitor, while modernizers won official government approval by tracing th...

  13. Photoluminescent (PL) or electroluminescent (EL) quantum dots for display, lighting, and photomedicine (Conference Presentation)

    Science.gov (United States)

    Dong, Yajie

    2017-02-01

    Quantum dots (QDs) have gone through a long journey before finding their ways into the display field. This talk will briefly touch on the history before trying to answer several key questions related to QDs applications in display: What are QDs? How are they made? What properties do they have and Why? How can these properties be used to improve color and efficiency of display, in either photoluminescence (PL) or electroluminescence (EL) mode? And what are the remaining challenges for QDs wide adoption in display industry? Lastly, some most recent progresses in our UCF lab at both PL and EL fronts will be highlighted. For PL, a cadmium-free perovskite-polymer composite films with exceptionally narrow emission green peaks (FWHM 20 nm) and good water and thermal stability will be reported. Together with red quantum dots or PFS/KSF phosphors as down-converters for blue LEDs, a white-light source with 95% Rec. 2020 color gamut was demonstrated [1]. For EL, red quantum dot light emitting devices (QLEDs) with record luminance of 165,000 Cd/m2 has been obtained at a current density of 1000 mA/cm2 with a low driving voltage of 5.8 V and CIE coordinates of (0.69, 0.31). [2] The potential of using these QLEDs for light sources for integrated sensing platform [3] or high efficiency, high color quality hybrid white OLED [4] will be discussed. [1] Y. N. Wang, J. He, H. Chen, J. S. Chen, R. D. Zhu, P. Ma, A. Towers, Y. Lin, A. J. Gesquiere, S. T. Wu, Y. J. Dong. Ultrastable, Highly Luminescent Organic-Inorganic Perovskite - Polymer Composite Films, Advanced Materials, accepted, (2016). [2] Y. J. Dong, J.M. Caruge, Z. Q. Zhou, C. Hamilton, Z. Popovic, J. Ho, M. Stevenson, G. Liu, V. Bulovic, M. Bawendi, P. T. Kazlas, S. Coe-Sullivan, and J. Steckel Ultra-bright, Highly Efficient, Low Roll-off Inverted Quantum-Dot Light Emitting Devices (QLEDs). SID Symp. Dig. Tech. Pap. 46, 270-273 (2015). [3] J. He, H. Chen, S. T. Wu, and Y. J. Dong, Integrated Sensing Platform Based on Quantum

  14. Review of the East Palaearctic and North Oriental Psyttalia Walker, with the description of three new species (Hymenoptera, Braconidae, Opiinae).

    Science.gov (United States)

    Wu, Qiong; van Achterberg, Cornelis; Tan, Jiang-Li; Chen, Xue-Xin

    2016-01-01

    The East Palaearctic and North Oriental species of the genus Psyttalia Walker (Hymenoptera, Braconidae, Opiinae) are reviewed. Three new species are described and illustrated: Psyttalia latinervis Wu & van Achterberg, sp. n . and Psyttalia majocellata Wu & van Achterberg, sp. n . from China, and Psyttalia spectabilis van Achterberg, sp. n. from Japan. Coeloreuteus formosanus Watanabe, 1934, Opius (Lissosema) proclivis Papp, 1981, Opius (Psyttalia) subcyclogaster Tobias, 1998, Opius (Psyttalia) darasunicus Tobias, 1998, Opius (Psyttalia) cyclogastroides Tobias, 1998, Psyttalia extensa Weng & Chen, 2001, and Rhogadopsis longicaudifera Li & van Achterberg, 2013, are new synonyms of Psyttalia cyclogaster (Thomson, 1895); Opius (Psyttalia) ophthalmicus Tobias, 1977, and Opius (Psyttalia) brevitemporalis Tobias, 1998, of Psyttalia carinata (Thomson, 1895) and both Opius (Psyttalia) vacuus Tobias, 1998, and Opius (Lissosema) longurius Chen & Weng, 1995, of Rhogadopsis mediocarinata (Fischer, 1963). Phaedrotoma daghestanicum (Telenga, 1950), Rhogadopsis mediocarinata (Fischer, 1963) and Rhogadopsis mystica (Fischer, 1963) are new combinations. New records are Psyttalia carinata (Thomson, 1895) from The Netherlands and Norway, and Psyttalia cyclogaster (Thomson, 1895) from Japan. A lectotype is designated for Psyttalia carinata (Thomson, 1895) and Psyttalia cyclogaster (Thomson, 1895). A key to the East Palaearctic and North Oriental species of the genus Psyttalia Walker is included.

  15. Review of the East Palaearctic and North Oriental Psyttalia Walker, with the description of three new species (Hymenoptera, Braconidae, Opiinae

    Directory of Open Access Journals (Sweden)

    Qiong Wu

    2016-11-01

    Full Text Available The East Palaearctic and North Oriental species of the genus Psyttalia Walker (Hymenoptera, Braconidae, Opiinae are reviewed. Three new species are described and illustrated: P. latinervis Wu & van Achterberg, sp. n. and P. majocellata Wu & van Achterberg, sp. n. from China, and P. spectabilis van Achterberg, sp. n. from Japan. Coeloreuteus formosanus Watanabe, 1934, Opius (Lissosema proclivis Papp, 1981, O. (Psyttalia subcyclogaster Tobias, 1998, O. (P. darasunicus Tobias, 1998, O. (P. cyclogastroides Tobias, 1998, Psyttalia extensa Weng & Chen, 2001, and Rhogadopsis longicaudifera Li & van Achterberg, 2013, are new synonyms of Psyttalia cyclogaster (Thomson, 1895; Opius (Psyttalia ophthalmicus Tobias, 1977, and O. (P. brevitemporalis Tobias, 1998, of Psyttalia carinata (Thomson, 1895 and both O. (P. vacuus Tobias, 1998, and O. (Lissosema longurius Chen & Weng, 1995, of Rhogadopsis mediocarinata (Fischer, 1963. Phaedrotoma daghestanicum (Telenga, 1950, Rhogadopsis mediocarinata (Fischer, 1963 and R. mystica (Fischer, 1963 are new combinations. New records are Psyttalia carinata (Thomson, 1895 from The Netherlands and Norway, and P. cyclogaster (Thomson, 1895 from Japan. A lectotype is designated for Psyttalia carinata (Thomson, 1895 and P. cyclogaster (Thomson, 1895. A key to the East Palaearctic and North Oriental species of the genus Psyttalia Walker is included.

  16. A hard-knock life: the foraging ecology of Cape cormorants amidst ...

    African Journals Online (AJOL)

    A hard-knock life: the foraging ecology of Cape cormorants amidst shifting prey resources and industrial fishing pressure. MH Hamann, D Grémillet, PG Ryan, F Bonadonna, CD van der Lingen, L Pichegru ...

  17. 圖書館事業與交流/The Relationship of Leadership Development and Learning Organization Dimensions/Connie K. Haley, Yuhfen Diana Wu

    Directory of Open Access Journals (Sweden)

    Connie K. Haley, Yuhfen Diana Wu Connie K. Haley, Yuhfen Diana Wu

    2011-10-01

    Full Text Available This research examined the relationship among learning organization dimensions, leadership development, employee development, and their interactions with two demographic variables (gender and ethnicity in the context of libraries. The researchers conducted a multivariate analysis of the variance to assess the differences by leadership training groups (low training hours vs. high training hours, or by gender; and by workplace training groups (low vs. high, or by ethnicity (white vs. all others on a linear combination of the seven dimensions of the learning organization. A conclusive summary is provided along with contributive discussion. Implications and contributions to librarians are discussed in addition to future research recommendations. Also included are conclusive final thoughts accompanied by the limitations of this research. 本研究旨在探討美國圖書館界學習型組織,領導智能與員工發展之間的關系,以及它們與兩項人口變量(性別、種族)的相互作用。作者採用線性組合研究了學習型組織的七個範疇,並且使用多變量變異數分析方法來評估領導智能培訓組的差異(培訓時數多寡對比),在職培訓組的差異(培訓時數多寡對比),及種族的差異(白人或其他族裔對比)。除了討論未來研究方向的建議,作者並提供人力資源發展工作者和圖書館員一些啟示。研究最後提出作者的想法及本研究的侷限性。 頁次:146-165

  18. Impacts of land use change scenarios on hydrology and land use patterns in the Wu-Tu watershed in Northern Taiwan

    NARCIS (Netherlands)

    Lin Yu-Pin,; Hong Nien-Ming,; Wu Pei-Jung,; Wu Chen-Fa,; Verburg, P.H.

    2007-01-01

    Developing an approach for simulating and assessing land use changes and their effects on land use patterns and hydrological processes at the watershed level is essential in land use and water resource planning and management. This study provided a novel approach that combines a land use change

  19. The Review on Leveraging Success of Young Scholars in Business Discipline edited by Maciej Mitręga, CeDeWu, Warszawa 2014

    Directory of Open Access Journals (Sweden)

    Peter Kovacs

    2017-04-01

    Full Text Available The study aims to give a comprehensive review of young business scholars in the Visegrad countries (Poland, the Czech Republic, Slovakia and Hungary, describing their scientific performance, prospects and possibilities. The study provides a detailed analysis of the specific situation of the Visegrad countries through examining young scholars facing the challenge of 'publish or perish' in a changing academic world.(fragment of text

  20. Hyaluronic acid-coated bovine serum albumin nanoparticles loaded with brucine as selective nanovectors for intra-articular injection

    Directory of Open Access Journals (Sweden)

    Chen Z

    2013-10-01

    Full Text Available Zhipeng Chen,* Juan Chen,* Li Wu, Weidong Li, Jun Chen, Haibo Cheng, Jinhuo Pan, Baochang CaiDepartment of Pharmacy, Nanjing University of Chinese Medicine, Nanjing, People's Republic of China*These authors contributed equally to this workObjective: To evaluate the potential of hyaluronic acid (HA-coated bovine serum albumin nanoparticles (BSANPs as a novel chondrocyte-targeting drug-delivery nanomedicine.Methods: The HA-BSANPs were characterized by dynamic light scattering, transmission electron microscopy, differential scanning calorimetry, and X-ray diffraction. Fluorescence imaging was used to visualize the distribution of nanoparticles after intra-articular injection. The chondrocyte-targeting efficiency and cellular uptake mechanism of HA-BSANPs were investigated using endocytic inhibitors.Results: HA-BSANPs were successfully prepared with HA coating the surface and amorphous drug in the core. Compared with BSANPs, HA-BSANPs exhibited improved uptake by chondrocytes through a receptor-mediated active uptake mechanism. The endocytosis process of BSANPs and HA-BSANPs involved clathrin-mediated endocytosis, caveolae-mediated endocytosis, and macropinocytosis. No apparent thickening or hyperplasia of the synovium was observed in either BSANPs or HA-BSANPs. The HA-BSANPs could reside in the articular cavity of rats for more than 14 days, which was significantly longer than BSANPs.Conclusion: HA-BSANPs are a promising carrier for articular-related diseases due to elongated articular residence and improved chondrocytic accumulation.Keywords: chondrocyte, intra-articular injection, hyaluronic acid, BSA, nanoparticles

  1. On Meng Chen-shun's Romance Theory and His Opera and Drama Greation%孟称舜"传情"理论及其戏曲创作

    Institute of Scientific and Technical Information of China (English)

    刘伟

    2002-01-01

    孟称舜戏曲深受汤显祖的影响,前期剧作和"传情"理论表现出对"至情"的赞颂和对封建礼教的批判.作为生活在明清易代时期的落魄文人,他又与那个时代和环境紧密相连,由于受到当时社会、思想等多种因素的影响,其传情理论和戏曲创作都发生了很大的变化.他以"诚"为主体,他"情正"与"言道"结合的"言情"倾向,是他的特色,也是他的局限.

  2. 论陈亮事功主义伦理思想的基本特征%On Chen Liang's Essential Features of Utilitarian Ethics

    Institute of Scientific and Technical Information of China (English)

    朱晓鹏

    2005-01-01

    陈亮是永康学派的创始人.他的事功主义伦理思想的基本特征是"理欲统一"的道德观、"义利合一"的价值观和"学为成人"的人生观.这种事功主义伦理思想具有创新精神,对中国传统的伦理观是一种挑战,对后世产生了深远的影响.

  3. Diskrepanz: Die EU-Frauenpolitik zwischen Deregulierung und Gleichheitsansprüchen Internal Discrepancies: EU Women’s Policies between Deregulation and Claims to Equality

    Directory of Open Access Journals (Sweden)

    Ingrid Biermann

    2003-03-01

    Full Text Available In von neun Autorinnen verfassten Beiträgen gibt der Band Einblicke in zentrale Felder der EU-Politik: die europäische Wirtschafts- und Währungsunion (EWWU, die Strukturpolitik, die Gleichstellungspolitik und das Gender Mainstreaming, die Osterweiterung sowie die Ausarbeitung einer europäischen Verfassung. Damit werden wesentliche Teile des Maastricht-Vertrags (1992, des Amsterdamer Vertrags (1997 und des Nizza-Vertrags (2000 behandelt. Hierdurch bildet dieser Band eine wichtige Grundlage für die Diskussion über die Frauenpolitik der EU.This anthology, consisting of nine essays written by women authors, offers insights into central areas of EU politics: the European Economic and Currency Union, structural policies, policies dealing with gender equality, the expansion of the EU, as well as the creation of a new European constitution. These policies include relevant parts of the 1992 Maastricht Treaty, the 1997 Treaty of Amsterdam, and the 2000 Treaty of Nizza. The information and insights presented here make this book an important basis for any discussions about EU women’s policies.

  4. Bya rog prog zhu, The raven crest : the life and teachings of bDe chen 'od gsal rdo rje treasure revealer of contemporary Tibet

    NARCIS (Netherlands)

    Terrone, Antonio

    2010-01-01

    This research starts from the historical assertion that notwithstanding their claim of increased religious tolerance, the dramatic post-Mao political campaigns have continued to weaken the pervasive force of religious faith, traditional monastery-centered religious power, religious leadership, and

  5. Discussion of “Nanoscale Fluid Mechanics and Energy Conversion” (Chen, X., Xu, B., and Liu, L., 2014, ASME Appl. Mech. Rev., 66(5), p. 050803)

    NARCIS (Netherlands)

    Eijkel, Jan C.T.

    2014-01-01

    The authors of the paper “Nanoscale Fluid Mechanics and Energy Conversion” have presented an overview of recent applications of nanofluidic phenomena for energy conversion and storage. The discussion given here aims to place this paper in a broader context of literature and theory.

  6. Redescription of Paragaleus tengi (Chen, 1963) (Carcharhiniformes: Hemigaleidae) and first record of Paragaleus randalli Compagno, Krupp & Carpenter, 1996 from the western North Pacific.

    Science.gov (United States)

    White, William T; Harris, Mark

    2013-01-01

    Paragaleus tengi was previously considered to be the only member of this genus occurring in the Western Pacific, with Paragaleus randalli occurring in the Indian Ocean and allopatric in distribution. Recent molecular and morphological studies showed that P. randalli also occurs in the Western Pacific with records from Thailand, Malaysia and Indonesia previously mostly incorrectly attributed to P. tengi. This paper provides a redescription of P. tengi and confirms the presence of P. randalli from off Taiwan in the western North Pacific. These two species are morphologically very similar in appearance but differ in meristics, dentition, some coloration attributes and minor morphological characters. The conservation status of these two species needs to be reassessed based on this new information.

  7. How Structural Deficiencies Hamper Estonia’s Catching-up Process. Strukturschwächen als Hemmnis für Estlands Aufholprozess

    Directory of Open Access Journals (Sweden)

    Klaus Schrader

    2016-10-01

    Full Text Available Estonia is widely regarded as a paramount example for a successful transformation of a socialist economic system to a functioning market economy. Against the backdrop of this positive image which contrasts strongly with the crisis scenarios in Southern Europe the remaining problems of Estonia are often ignored. Estonia has hardly succeeded in catching-up economically with the richer countries of the EU. In this paper the authors raise the question why the catching-up process of Estonia is not as successful as it could have been expected from the policy performance during the last decades. It turns out that Estonia faces a serious productivity problem, particularly in the manufacturing sector producing tradable goods which is normally the driving engine behind economic and technological catching-up. The Estonian economy has failed to undergo the necessary structural change towards technologically more advanced employment structures and export patterns. Accordingly, Estonian economic policy needs to create a suitable business environment to support this kind of structural change.

  8. New World species of the genus Calliscelio Ashmead (Hymenoptera, Platygastridae, Scelioninae

    Directory of Open Access Journals (Sweden)

    Hua-yan Chen

    2017-01-01

    Full Text Available The genus Calliscelio Ashmead is presumed to be a diverse group of parasitoids of the eggs of crickets (Orthoptera: Gryllidae. A least one species has been found to be an important factor in depressing cricket pest populations. The New World species of Calliscelio are revised. Forty-two species are recognized, 3 are redescribed: C. bisulcatus (Kieffer, C. laticinctus Ashmead, C. rubriclavus (Ashmead, comb. n.; and 38 are described as new: C. absconditum Chen & Johnson, sp. n., C. absum Chen & Johnson, sp. n., C. alcoa Chen & Masner, sp. n., C. amadoi Chen & Johnson, sp. n., C. armila Chen & Masner, sp. n., C. bidens Chen & Masner, sp. n., C. brachys Chen & Johnson, sp. n., C. brevinotaulus Chen & Johnson, sp. n., C. brevitas Chen & Johnson, sp. n., C. carinigena Chen & Johnson, sp. n., C. crater Chen & Johnson, sp. n., C. crena Chen & Johnson, sp. n., C. eboris Chen & Johnson, sp. n., C. extenuatus Chen & Johnson, sp. n., C. flavicauda Chen & Johnson, sp. n., C. foveolatus Chen & Johnson, sp. n., C. gatineau Chen & Johnson, sp. n., C. glaber Chen & Masner, sp. n., C. granulatus Chen & Masner, sp. n., C. latifrons Chen & Johnson, sp. n., C. levis Chen & Johnson, sp. n., C. longius Chen & Johnson, sp. n., C. magnificus Chen & Masner, sp. n., C. migma Chen & Johnson, sp. n., C. minutia Chen & Johnson, sp. n., C. paraglaber Chen & Johnson, sp. n., C. pararemigio Chen & Masner, sp. n., C. prolixus Chen & Johnson, sp. n., C. punctatifrons Chen & Johnson, sp. n., C. remigio Chen & Masner, sp. n., C. ruga Chen & Johnson, sp. n., C. rugicoxa Chen & Masner, sp. n., C. sfina Chen & Johnson, sp. n., C. storea Chen & Johnson, sp. n., C. suni Chen & Johnson, sp. n., C. telum Chen & Johnson, sp. n., C. torqueo Chen & Johnson, sp. n., C. virga Chen & Johnson, sp. n. Four species are treated as junior synonyms of Calliscelio rubriclavus (Ashmead: Anteris nigriceps Ashmead, syn. n., Caloteleia marlattii Ashmead, syn. n., Caloteleia grenadensis Ashmead, syn. n

  9. Information systems and computing technology

    CERN Document Server

    Zhang, Lei

    2013-01-01

    Invited papersIncorporating the multi-cross-sectional temporal effect in Geographically Weighted Logit Regression K. Wu, B. Liu, B. Huang & Z. LeiOne shot learning human actions recognition using key posesW.H. Zou, S.G. Li, Z. Lei & N. DaiBand grouping pansharpening for WorldView-2 satellite images X. LiResearch on GIS based haze trajectory data analysis system Y. Wang, J. Chen, J. Shu & X. WangRegular papersA warning model of systemic financial risks W. Xu & Q. WangResearch on smart mobile phone user experience with grounded theory J.P. Wan & Y.H. ZhuThe software reliability analysis based on

  10. Phyllanthus coi (Phyllanthaceae, a new herbaceous species from the Philippines

    Directory of Open Access Journals (Sweden)

    Ming-Jou WU

    2017-11-01

    Full Text Available Phyllanthus coi M.J. Wu, Ferreras & Y.J. Chen, a new species from Benguet Province, Island of Luzon, the Philippines, is described and illustrated. Compared to its congeners in the same section, P. coi can be differentiated by having long plagiotropic branchlets with up to 30 leaves per side, seeds with sharp honey-comb-like ridges on the dorsal side, and three free styles that are not lying flat on the top of the ovary. The floral, seed and some vegetative features that distinguish this new species from its nearest morphologically related species, P. erythrotrichus C.B. Rob., P. urinaria L. and P. hookeri Müll. Arg. are provided.

  11. Commentary on: "An integrated metabolic atlas of clear cell renal cell carcinoma." Hakimi AA, Reznik E, Lee CH, Creighton CJ, Brannon AR, Luna A, Aksoy BA, Liu EM, Shen R, Lee W, Chen Y, Stirdivant SM, Russo P, Chen YB, Tickoo SK, Reuter VE, Cheng EH, Sander C, Hsieh JJ.: Cancer Cell. 2016 Jan 11;29(1):104-16.

    Science.gov (United States)

    Lee, Byron H

    2017-09-01

    Dysregulated metabolism is a hallmark of cancer, manifested through alterations in metabolites. We performed metabolomic profiling on 138 matched clear cell renal cell carcinoma (ccRCC)/normal tissue pairs and found that ccRCC is characterized by broad shifts in central carbon metabolism, one-carbon metabolism, and antioxidant response. Tumor progression and metastasis were associated with metabolite increases in glutathione and cysteine/methionine metabolism pathways. We develop an analytic pipeline and visualization tool (metabolograms) to bridge the gap between TCGA transcriptomic profiling and our metabolomic data, which enables us to assemble an integrated pathway-level metabolic atlas and to demonstrate discordance between transcriptome and metabolome. Lastly, expression profiling was performed on a high-glutathione cluster, which corresponds to a poor-survival subgroup in the ccRCC TCGA cohort. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Uso de plâncton silvestre, fermento fresco e levedura desidratada na alimentação de larvas do cascudo chinelo, Loricariichthys platymetopon (Isbrüchen & Nijssen, 1979 (Osteichthyes, Loricariidae Natural plankton, fresh ferment and dehydrated yeast utilization at Loricariichthys platymetopon (Isbrüchen & Nijssen, 1979 (Osteichthyes, Loricariidae, cascudo chinelo, fry feeding

    Directory of Open Access Journals (Sweden)

    Claudemir Martins Soares

    2002-05-01

    Full Text Available Objetivando avaliar a utilização de diferentes alimentos para larvas do cascudo chinelo Loricariichthys platymetopon (Osteichthyes, Loricariidae, 240 larvas com cinco dias pós-eclosão foram distribuídas em 20 aquários (12 L. Foram utilizados cinco tratamentos com quatro repetições cada, os quais consistiram do emprego de diferentes tipos de alimentos como: plâncton (P, fermento (F, levedura desidratada (LD e as combinações P+F e P+LD por 15 dias consecutivos. O F e a LD foram fornecidos à vontade três vezes ao dia, enquanto o P foi fornecido pela manhã, após os aquários serem sifonados. Os valores da temperatura, pH, condutividade elétrica e oxigênio dissolvido se mantiveram dentro de níveis aceitáveis para a aquicultura. Os valores de biomassa/aquário das larvas alimentadas com P+LD foram superiores aos dos alimentados com P, F e P+F, entretanto não diferiram daqueles com o uso de LD. As larvas alimentadas com P+LD apresentaram valores de peso final médio superiores às dos demais tratamentos, sendo que F levou a valores de peso final médio inferiores em comparação ao uso de P, LD e P+F. Observou-se menor sobrevivência com o uso de P em comparação a LD e P+LD. Conclui-se que se pode utilizar P+LD na criação do cascudo chinelo em suas fases iniciais de desenvolvimento.Aiming to evaluate different foods effects in the rearing of Loricariichthys platymetopon (Osteichthyes, Loricariidae fry, 240 5-day-after-hatch specimens were distributed in 20 aquarium glasses (12 L. Five treatments, with four repetitions each, were tested, consisting in: plankton (P, fresh ferment (F, dehydrated yeast (DY and the combinations P+F and P+DY, for 15 days. F and DY were given ad libitum three times a day, and P only in the morning, after the aquariums siphoning. Temperature, pH, electric conductivity and dissolved oxygen were in levels acceptable for fish. The fry biomass per aquarium values were higher for the P + DY treatment, when compared to P, F and P+F, but equal to DY. Also, P +DY-fed fry showed higher mean final weight than all the other treatments. F-treated fry showed mean final weight lower than the ones treated with P, DY and P+F. The P treatment showed lower survival rate than DY and P+DY. The results indicate that P + DY can be used for Loricariichthys platymetopon fry rearing during their initial development phases.

  13. 研究/電子資源使用統計標準與規範之探討/陳雪華;許嘉珍;朱雅琦 | Study of the Electronic Resources Usage Statistics Standards and Guidelines/ Hsueh-Hua Chen;Chia-Chen Hsu;Ya-Chi Chu

    Directory of Open Access Journals (Sweden)

    陳雪華、許嘉珍、朱雅琦

    2007-04-01

    Full Text Available

    近年來,由於資訊科技的進步,圖書館中的電子資源數量快速增加,所佔預算金額比例也大幅增長。圖書館希望能夠透過評鑑電子資源的使用,以便能夠在電 子資源館藏發展等方面做出正確的決策。由於體認到電子資源使用統計之重要性,圖書館界與相關組織紛紛發展或修訂圖書館統計標準,增列電子資源使用統計的項 目以充分反映圖書館電子資源使用之狀況。本文主要採用文獻分析法以及內容分析法,收集探討並比較近軍來國內外電子資源使用統計之相關規範及標準,包含 ISO 2789、 ICOLC Guidelines、州ANSI/NISO Z39.7、CNS13151、ARL E-Metrlcs、E-Measures Project、以及Project COUNTER等。

    Recently, due to the advances of information technology, electronic resources are gradually replacing print resources as the largest consumer of library acquisition budgets. Logically, libraries want to evaluate the usage of electronic resources and incorporate the results into their decision making regarding electronic resource acquisition. Over these years, there is a general awareness among libraries to develop statistics standards and guidelines for library electronic resources usage. In this paper, literature review and content analysis methods are used to compare several library statistics standards, including: ISO 2789 、ICOLC Guidelines、ANSI/NISO Z39.7、CNS13151、ARL E-Metrics、E-Measures Project、and Project COUNTER etc.

    頁次:89-102

  14. Dissolving and biodegradable microneedle technologies for transdermal sustained delivery of drug and vaccine

    Directory of Open Access Journals (Sweden)

    Hong X

    2013-09-01

    Full Text Available Xiaoyun Hong,1,2,* Liangming Wei,3,* Fei Wu,2,* Zaozhan Wu,2 Lizhu Chen,2 Zhenguo Liu,1 Weien Yuan2 1Department of Neurology, Xinhua Hospital, Shanghai, People's Republic of China; 2School of Pharmacy, Shanghai JiaoTong University, Shanghai, People's Republic of China; 3Research Institute of Micro/Nano Science and Technology, Shanghai JiaoTong University, Shanghai, People's Republic of China *These authors contributed equally to this work Abstract: Microneedles were first conceptualized for drug delivery many decades ago, overcoming the shortages and preserving the advantages of hypodermic needle and conventional transdermal drug-delivery systems to some extent. Dissolving and biodegradable microneedle technologies have been used for transdermal sustained deliveries of different drugs and vaccines. This review describes microneedle geometry and the representative dissolving and biodegradable microneedle delivery methods via the skin, followed by the fabricating methods. Finally, this review puts forward some perspectives that require further investigation. Keywords: microneedle, dissolving, biodegradable, sustained release

  15. Orbital stability of solitary waves for Kundu equation

    Science.gov (United States)

    Zhang, Weiguo; Qin, Yinghao; Zhao, Yan; Guo, Boling

    In this paper, we consider the Kundu equation which is not a standard Hamiltonian system. The abstract orbital stability theory proposed by Grillakis et al. (1987, 1990) cannot be applied directly to study orbital stability of solitary waves for this equation. Motivated by the idea of Guo and Wu (1995), we construct three invariants of motion and use detailed spectral analysis to obtain orbital stability of solitary waves for Kundu equation. Since Kundu equation is more complex than the derivative Schrödinger equation, we utilize some techniques to overcome some difficulties in this paper. It should be pointed out that the results obtained in this paper are more general than those obtained by Guo and Wu (1995). We present a sufficient condition under which solitary waves are orbitally stable for 2c+sυ1995) only considered the case 2c+sυ>0. We obtain the results on orbital stability of solitary waves for the derivative Schrödinger equation given by Colin and Ohta (2006) as a corollary in this paper. Furthermore, we obtain orbital stability of solitary waves for Chen-Lee-Lin equation and Gerdjikov-Ivanov equation, respectively.

  16. The potential of follicle-stimulating hormone peptide-modified triptolide-loaded nanoparticles to induce a mouse model of premature ovarian insufficiency

    Directory of Open Access Journals (Sweden)

    Chen XY

    2015-04-01

    Full Text Available Xiu-Ying Chen,1–3 Wu-Lian Chen,4 Min Ma,1–3 Chao Gu,1,2 Xi-Rong Xiao,1,2 Bin Li1,2 1Obstetrics and Gynecology Hospital, Fudan University, 2Department of Obstetrics and Gynecology of Shanghai Medical College, Fudan University, 3Shanghai Key Laboratory of Female Reproductive Endocrine Related Diseases, 4State Key Laboratory of Molecular Engineering of Polymers, Department of Macromolecular Science, Fudan University, Shanghai, People’s Republic of ChinaAbstract: The use of triptolide (TP is limited by its poor water solubility and severe toxicity. In this study, we developed an active drug delivery system (TP-loaded nanoparticles that could help improve the water solubility of TP and decrease its toxicity. Then, we investigated whether TP-loaded nanoparticles could be used to establish a novel premature ovarian insufficiency mouse model. The mice treated with TP-loaded nanoparticles for 35 days displayed normal growth, decreased serum antimullerian hormone, prominent ovarian fibrosis and vacuolar changes, fewer follicles and corpus lutea, increased collapsed oocytes and follicle apoptosis, and sterility. In conclusion, this model appears to show the reproductive characteristics associated with premature ovarian insufficiency in women and will allow us to study the mechanism of the effects of traditional Chinese medicine on gonadal toxicity. Keywords: peptide, nanoparticles, drug delivery, premature ovarian insufficiency, animal model

  17. Energy transfer ultraviolet photodetector with 8-hydroxyquinoline derivative-metal complexes as acceptors

    International Nuclear Information System (INIS)

    Wu Shuang-Hong; Chen Zhi; Li Shi-Bin; Wang Xiao-Hui; Wei Xiong-Bang; Li Wen-Lian

    2015-01-01

    We choose 8-hydroxyquinoline derivative-metal complexes (Beq, Mgq, and Znq) as the acceptors (A) and 4,4',4”-tri-(2-methylphenyl phenylamino) triphenylaine (m-MTDATA) as the donor (D) respectively to study the existing energy transfer process in the organic ultraviolet (UV) photodetector (PD), which has an important influence on the sensitivity of PDs. The energy transfer process from D to A without exciplex formation is discussed, differing from the working mechanism of previous PDs with Gaq [Zisheng Su, Wenlian Li, Bei Chu, Tianle Li, Jianzhuo Zhu, Guang Zhang, Fei Yan, Xiao Li, Yiren Chen and Chun-Sing Lee 2008 Appl. Phys. Lett. 93 103309)] and REq [J. B. Wang, W. L. Li, B. Chu, L. L. Chen, G. Zhang, Z. S. Su, Y. R. Chen, D. F. Yang, J. Z. Zhu, S. H. Wu, F. Yan, H. H. Liu, C. S. Lee 2010 Org. Electron. 11 1301] used as an A material. Under 365-nm UV irradiation with an intensity of 1.2 mW/cm 2 , the m-MTDATA:Beq blend device with a weight ratio of 1:1 shows a response of 192 mA/W with a detectivity of 6.5× 10 11 Jones, which exceeds those of PDs based on Mgq (146 mA/W) and Znq (182 mA/W) due to better energy level alignment between m-MTDATA/Beq and lower radiative decay. More photophysics processes of the PDs involved are discussed in detail. (paper)

  18. Energy transfer ultraviolet photodetector with 8-hydroxyquinoline derivative-metal complexes as acceptors

    Science.gov (United States)

    Wu, Shuang-Hong; Li, Wen-Lian; Chen, Zhi; Li, Shi-Bin; Wang, Xiao-Hui; Wei, Xiong-Bang

    2015-02-01

    We choose 8-hydroxyquinoline derivative-metal complexes (Beq, Mgq, and Znq) as the acceptors (A) and 4,4',4”-tri-(2-methylphenyl phenylamino) triphenylaine (m-MTDATA) as the donor (D) respectively to study the existing energy transfer process in the organic ultraviolet (UV) photodetector (PD), which has an important influence on the sensitivity of PDs. The energy transfer process from D to A without exciplex formation is discussed, differing from the working mechanism of previous PDs with Gaq [Zisheng Su, Wenlian Li, Bei Chu, Tianle Li, Jianzhuo Zhu, Guang Zhang, Fei Yan, Xiao Li, Yiren Chen and Chun-Sing Lee 2008 Appl. Phys. Lett. 93 103309)] and REq [J. B. Wang, W. L. Li, B. Chu, L. L. Chen, G. Zhang, Z. S. Su, Y. R. Chen, D. F. Yang, J. Z. Zhu, S. H. Wu, F. Yan, H. H. Liu, C. S. Lee 2010 Org. Electron. 11 1301] used as an A material. Under 365-nm UV irradiation with an intensity of 1.2 mW/cm2, the m-MTDATA:Beq blend device with a weight ratio of 1:1 shows a response of 192 mA/W with a detectivity of 6.5× 1011 Jones, which exceeds those of PDs based on Mgq (146 mA/W) and Znq (182 mA/W) due to better energy level alignment between m-MTDATA/Beq and lower radiative decay. More photophysics processes of the PDs involved are discussed in detail. Project supported by the National Natural Science Foundation of China (Grant Nos. 61371046, 61405026, 61474016, and 61421002) and China Postdoctoral Science Foundation (Grant No. 2014M552330).

  19. Indole and synthetic derivative activate chaperone expression to reduce polyQ aggregation in SCA17 neuronal cell and slice culture models

    Directory of Open Access Journals (Sweden)

    Kung PJ

    2014-10-01

    Full Text Available Pin-Jui Kung,1,* Yu-Chen Tao,1,* Ho-Chiang Hsu,1 Wan-Ling Chen,1 Te-Hsien Lin,1 Donala Janreddy,2 Ching-Fa Yao,2 Kuo-Hsuan Chang,3 Jung-Yaw Lin,1 Ming-Tsan Su,1 Chung-Hsin Wu,1 Guey-Jen Lee-Chen,1 Hsiu-Mei Hsieh-Li1 1Department of Life Science, 2Department of Chemistry, National Taiwan Normal University, Taipei, Taiwan; 3Department of Neurology, Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Taipei, Taiwan *These authors contributed equally to this work Abstract: In spinocerebellar ataxia type 17 (SCA17, the expansion of a translated CAG repeat in the TATA box binding protein (TBP gene results in a long polyglutamine (polyQ tract in the TBP protein, leading to intracellular accumulation of aggregated TBP and cell death. The molecular chaperones act in preventing protein aggregation to ameliorate downstream harmful events. In this study, we used Tet-On SH-SY5Y cells with inducible SCA17 TBP/Q79-green fluorescent protein (GFP expression to test indole and synthetic derivative NC001-8 for neuroprotection. We found that indole and NC001-8 up-regulated chaperone expression to reduce polyQ aggregation in neuronal differentiated TBP/Q79 cells. The effects on promoting neurite outgrowth and on reduction of aggregation on Purkinje cells were also confirmed with cerebellar primary and slice cultures of SCA17 transgenic mice. Our results demonstrate how indole and derivative NC001-8 reduce polyQ aggregation to support their therapeutic potentials in SCA17 treatment. Keywords: spinocerebellar ataxia type 17, TATA box binding protein, polyQ aggregation, indole and derivative, therapeutics

  20. The 2nd International Conference on Water Resource and Environment (WRE 2016

    Directory of Open Access Journals (Sweden)

    Zhouli Liu

    2016-11-01

    Full Text Available Table of contents 01 The eco-toxicological effects of cadmium stress on five ornamental plants Zhouli Liu, Wei Chen, Xingyuan He, Shuai Yu, Weihang Ding 02 Study on the formation and release mechanisms of hydrogen sulfide in Longtan coal mine Jianjun Liu, Yuliang Wu, Kaixiang Fan 03 Coral bleaching in the North Reef of China’s Xisha Islands in 2014 Yuanchao Li, Xinqing Zheng, Shiquan Chen, Haiqun Xie 04 Soil chemical characteristics in a Cunninghamia lanceolata stand suffering from ice-snow damage Jie Li, Zhuomin Wang, Li Xue 05 Diversity of understory vegetation was under a Cunninghamia lanceolata stand suffering from ice-snow damage Zhiyang Lie, Weilong Huang, Tongtong Zhou, Li Xue 06 The effect of water, nitrogen and harvesting time on yield and biomass allocation of Helianthus tuberosus L. Kai Gao, Tiexia Zhu 07 The vertical variation of microbial communities in the sediment of sea cucumber pond Weiteng Mao, Pei Yu, Xinfang Lv, Yunchun Li 08 Indicating significances of alpine plant functional groups to environmental change Peixi Su, Rui Shi 09 Research on the daily CH4 fluxes of soil in summer mangrove community at Yingluogang of Guangxi, China Yong Jiang, Xingbin Chen, Shichu liang 10 Beach protection structures in middle and lower reaches of Yangtze River Junfeng Xu 11 Social responsibility management of large dam project with owner as core: an empirical case in China Jiwei Zhu, Zhao Zhai, Linan Zhou, Yun Le, Li Cao 12 The ecological function value assessment analysis of urban waterfront Jiwei Zhu, Ping Lu, Zhiqian Huang, Bei Zhou 13 Mechanism of diurnal osmotic potential changes and adjustment of three Caragana species in different habitats of the Inner Mongolia Plateau Zhirong Zheng, Shihai Lv, Chaoyang Feng 14 Biodiversity of phytoplankton and environmental influences analysis of Longfeng Wetland, China Nan Song, Yan Liu, Xinxin Lu, Yawen Fan 15 The effect of human activities on culturable soil microbes from Yaoquan Mountain in

  1. Supplementary catalogue of the Anthomyiidae (Diptera of China

    Directory of Open Access Journals (Sweden)

    Mengmeng Wang

    2014-11-01

    Full Text Available The present catalogue of Anthomyiidae attempts to list all species (173 described or recorded from mainland China (165 and Taiwan (8 that for various reasons are not treated in “Flies of China” from 1998. The catalogue further lists Chinese species that are presently standing in new generic combinations compared to those of “Flies of China”, species that have changed name because of synonymy or misidentification, and species upgraded from subspecies to species. Regional distribution by province is specified for all species. Literature sources to descriptions or records of anthomyiid species from China are only given for those 173 species not covered by “Flies of China”. Four new combinations are proposed: Enneastigma fulva (Malloch, 1934, Enneastigma henanensis (Ge & Fan, 1982, Enneastigma lengshanensis (Xue, 2001 and Hylemya qinghaiensis (Fan, Chen & Ma, 1989. Eremomyia turbida Huckett, 1951 is revived from synonymy with Chortophila triticiperda Stein, 1900 (current name Eutrichota turbida. One subspecies is upgraded to species: Adia asiatica Fan, 1988. The following eight new synonymies are proposed: Delia pectinator fuscilateralis Fan in Fan & Zheng, 1992 with Delia pectinator Suwa, 1984; Eremomyia pilimana pilimarginata Fan & Qian in Fan, Chen, Ma & Ge, 1982 with Eremomyia turbida Huckett, 1951 (current name Eutrichota turbida; Lopesohylemya Fan, Chen & Ma, 1989 with Hylemya Robineau-Desvoidy, 1830; Deliomyia Fan in Fan et al., 1988 with Subhylemyia Ringdahl, 1933; Hydrophoria disticrassa Xue & Bai, 2009 with Hydrophoria pullata Wu, Liu & Wei, 1995 (current name Zaphne pullata; Heteroterma Wei, 2006 with Scathophaga Meigen, 1803; Heteroterma fanjingensis Wei, 2006 with Scathophaga curtipilata Feng, 2002; Scatomyza fansipanicola Ozerov in Ozerov & Krivosheina, 2011 with Scathophaga curtipilata Feng, 2002. The genus Heteroterma Wei, 2006 and species Heteroterma fanjingensis Wei, 2006 are reassigned from Anthomyiidae to

  2. for treatment of lupus nephritis with persistent proteinuria. Clinical Experimental Rheumatology 2010;28:6-12. Fei Y, Wu Q, Zhang W, Chen H, Hou Y, Xu D, Li M, Zhang X, Zhao Y, Zeng X, Zhang F. Low dose tacrolimus in treating lupus nephritis refractory to cyclophosphamide: a prospective cohort study. Clin Exp Rheumatol 2013;31:62-68. Gordon S, Denunzio T, Uy A. Success using tacrolimus in patients with proliferative and membranous lupus nephritis and refractory proteinuria. Hawaii J Med Public Health 2013;72:18-23. Wang S, Li X, Qu L, Wang R, Chen Y, Li Q, He X, Zhang X, Wang H, Wu J, Xu Y, Chen J. Tacrolimus versus cyclophosphamide as treatment for diffuse proliferative or membranous lupus nephritis: a non-randomized prospective cohort study. Lupus 2012;21:1025-1035. Deng J, Huo D, Wu Q, Yang Z, Liao Y. A meta-analysis of randomized controlled trials comparing tacrolimus with intravenous cyclophosphamide in the induction treatment for lupus nephritis. Tohoku J Exp Med 2012;227:281-288. Chen W, Liu Q, Chen W, Tang X, Fu P, Liu F, Liao Y, Yang Z, Zhang J, Chen J, Lou T, Fu J, Kong Y, Liu Z, Li Z, Yu X. Outcomes of maintenance therapy with tacrolimus versus azathioprine for active lupus nephritis: a multicenter randomized clinical trial. Lupus 2012;21:944-952. Full Text: PDF (Español (España PDF DOI: 10.22265/acnef.1.2.179 Refbacks There are currently no refbacks. Copyright (c User Username Password Remember me This journal follows the principles and procedures given by the Committee on Publication Ethics (COPE www.publicationethics.org Instructions for authors How to submit an article How to upload a modified version Instructions for reviewers How to review an article Instructions for associate editors How to send it to reviewers How to send corrections to authors Language Select Language Journal Content Search Search Scope Browse By Issue By Author By Title About The Authors César Augusto Restrepo Valencia Facultad de Ciencias para la Salud, Departamento de

    Directory of Open Access Journals (Sweden)

    César Augusto Restrepo Valencia

    2014-10-01

    Full Text Available Objective: To evaluate the effectiveness of calcineurin ciclosporin and tacrolimus inhibitors to induce remission in patients with refractory lupus nephritis. Patients, materials and methods: Patients with lupus nephritis class IV-G who despite receiving the rapy with high doses of steroid and with a cytostatic (cyclophosphamide or mycophenolate for 3 months had not been able to induce some kind of remission.The exclusion criteria were creatinine levels greater than 3 mg / dl, pregnancy, previous history of exposure to calcineurin inhibitors, cancer, active infections, uncontrolled hypertension, and negligence with medication intake. The recommended dose of cyclosporine was 3 mg / kg / day and tacrolimus 0.1 mg / kg / day, in joint with prednisone 0.3 mg / kg / day, cyclophosphamide 1 mg / kg / day or mycophenolate mofetil 1 gram every 12 hours. The cyclophosphamide was administered only during 6 months, after which it was changed to azathioprine at doses of 1 mg / kg / day. Still, mycophenolate was continued at the same dose. All patients completed a minimum period of 12 months follow-up, it was considered that patients achieved partial remission when proteinuria decreased by 50% of the baseline value or its value decreased to less than 1 gram in 24 hours, decrease of leukocytes count and red blood cells in urine of 50%, and creatinine values were stable. A complete remission was considered when there was a reduction in proteinuria in a value less than 300 mg per 24 hours, urinary sediment with less than 3 red blood cells, less than 5 leukocyte for each high power microscopic field, and a creatinine value reduction by 50% or reaching a normal value. Results: Twelve patients met the inclusion criteria and initiated the calcineurin inhibitor protocol. Two presented accelerated deterioration in their function and required chronic dialysis therapy. Ten patients with active treatment completed 12 months of followup, of which 4 (40% had partial remission (PR, 5 (50% complete remission (RC. One patient had no significant modification to his baseline values. The following findings were made for all the patients with any significant degree of remission: their creatinine levels were reduced significantly from an average value of 1,34 +/-0,7 mg/dl to an average of 0,96 +/- 0,3 mg/dl and 0,97 +/- 0,24 mg/dl for measurements taken 6 and 12 months respectively after the start of the treatment (p<0,05. The protein levels in the urine in a timeframe of 24 hours changed from a baseline value of 2865 +/- 2586.7 milligrams to 824 +/- 981.9 milligrams at 6 months, and 488 +/- 697.7 milligrams at 12 months (p <0.05. On average, in both PR and CR patients, the C3 levels raised unlike the values for antinuclear antibodies that were diminished. No patients died, nor were there significant side effects trigge red by medications. No patient presented relapses during the follow-up time. Conclusion: The calcineurin inhibitors at low doses are an important alternative to induce partial or complete remission in patients with refractory lupus nephritis compared to classic steroid and cytostatic treatment. It is required to do a long-term follow-up to establish its safety profile at low doses and relapse rate after suspension.

  3. Regular-, irregular-, and pseudo-character processing in Chinese: The regularity effect in normal adult readers

    Directory of Open Access Journals (Sweden)

    Dustin Kai Yan Lau

    2014-03-01

    Full Text Available Background Unlike alphabetic languages, Chinese uses a logographic script. However, the pronunciation of many character’s phonetic radical has the same pronunciation as the character as a whole. These are considered regular characters and can be read through a lexical non-semantic route (Weekes & Chen, 1999. Pseudocharacters are another way to study this non-semantic route. A pseudocharacter is the combination of existing semantic and phonetic radicals in their legal positions resulting in a non-existing character (Ho, Chan, Chung, Lee, & Tsang, 2007. Pseudocharacters can be pronounced by direct derivation from the sound of its phonetic radical. Conversely, if the pronunciation of a character does not follow that of the phonetic radical, it is considered as irregular and can only be correctly read through the lexical-semantic route. The aim of the current investigation was to examine reading aloud in normal adults. We hypothesized that the regularity effect, previously described for alphabetical scripts and acquired dyslexic patients of Chinese (Weekes & Chen, 1999; Wu, Liu, Sun, Chromik, & Zhang, 2014, would also be present in normal adult Chinese readers. Method Participants. Thirty (50% female native Hong Kong Cantonese speakers with a mean age of 19.6 years and a mean education of 12.9 years. Stimuli. Sixty regular-, 60 irregular-, and 60 pseudo-characters (with at least 75% of name agreement in Chinese were matched by initial phoneme, number of strokes and family size. Additionally, regular- and irregular-characters were matched by frequency (low and consistency. Procedure. Each participant was asked to read aloud the stimuli presented on a laptop using the DMDX software. The order of stimuli presentation was randomized. Data analysis. ANOVAs were carried out by participants and items with RTs and errors as dependent variables and type of stimuli (regular-, irregular- and pseudo-character as repeated measures (F1 or between subject

  4. Parental Choice of School, Class Strategies, and Educational Inequality: An Essay Review of "School Choice in China--A Different Tale?" (X. Wu, New York, NY: Routledge, 2014, 168 pp. ISBN 978-0-415-81769-1)

    Science.gov (United States)

    Liu, Shuning; Apple, Michael W.

    2016-01-01

    Given the increasingly global nature of marketized school choice policies, this makes it even more crucial to investigate how the multiple scales, forms, and emphases of school choice in different countries are influenced by particular political, economic, and cultural conditions. While much of the critical research on school choice policies has…

  5. 石头的记忆--吴少雄《惠安女人》舞剧音乐印象%Memory of Stones:Impressions of the Music of Wu Shaoxiong's Dance Drama Women of Huian

    Institute of Scientific and Technical Information of China (English)

    宋瑾

    2004-01-01

    @@ 2003年12月,由文化部主办的第三届全国舞剧观摩演出(比赛)在福州举行.由吴少雄作曲的荣获最佳作曲奖.这是作曲家继1992年(沈阳)第一届全国舞剧观摩演出(比赛)其作品(合作)获得作曲第一名之后,时隔11年再度捧冠.

  6. Russian olive - a suitable target for classical biological control in North America? In: Wu, Yun; Johnson, Tracy; Sing, Sharlene; Raghu, S.; Wheeler, Greg; Pratt, Paul; Warner, Keith; Center, Ted; Goolsby, John; Reardon, Richard, eds

    Science.gov (United States)

    K. Delaney; E. Espeland; A. Norton; S. Sing; K. Keever; J. L. Baker; M. Cristofaro; R. Jashenko; J. Gaskin; U. Schaffner

    2013-01-01

    Projects to develop biological control solutions against invasive plants are midto long-term endeavors that require considerable financial support over several years. Discussions of concerns and potential conflicts of interests often occur when biological control agents are first being proposed for release into the environment. Such late discussion, which in some cases...

  7. Correction: Wentao Wu, et al. Evolution Analysis of the Aux/IAA Gene Family in Plants Shows Dual Origins and Variable Nuclear Localization Signals. Int. J. Mol. Sci. 2017, 18, 2107

    Directory of Open Access Journals (Sweden)

    Wentao Wu

    2018-01-01

    Full Text Available The authors would like to insert some websites and citations in the following sentence, “First, the complete proteomes of these species were downloaded from the Phytozome website (Version 11; Available online: www.phytozome.org” in the “Materials and Methods” section on page 13, paragraph 3.1 of their paper published in the International Journal of Molecular Sciences [1].[...

  8. Appendiks. Skolestøtte til børn i familiepleje – delrapport I

    DEFF Research Database (Denmark)

    Eiberg, Misja; Andersen, Luna Kragh; Scavenius Sonne-Schmidt, Christoffer

    anden er en hjemmebaseret tutor-indsats kaldet ”Forældre som lektiehjælpere” (FsL). Dette appendiks indeholder tre analysedele: • En sammenligning af kontrol- og indsatsgrupper i forhold til plejeforældrenes baggrund/ud¬gangspunkt ved førmålingen • En sammenligning af kontrol- og indsatsgrupper i...

  9. African Journal of Marine Science - Vol 29, No 3 (2007)

    African Journals Online (AJOL)

    Abrupt environmental shift associated with changes in the distribution of Cape anchovy Engraulis encrasicolus spawners in the southern Benguela · EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. C Roy, CD van der Lingen, JC Coetzee, JRE Lutjeharms, 309-319.

  10. heT BoeK PrediKer: een verrAssende en uiTdAgende sTem in de ...

    African Journals Online (AJOL)

    Precies in deze context moeten qohelet's bespiege lingen over de 'ijdelheid' van de dingen begrepen worden. 10 cf. delitzsch (1875:197): “Wenn das buch Koheleth altsalomonisch ware, so gäbe es keine geschichte der hebräischen sprache”. 11 voor een omstandiger bespreking van en uitgebreide bibliografie omtrent de ...

  11. Lippe-Ems GmbH nuclear power stations. Annual report 1992

    International Nuclear Information System (INIS)

    1993-01-01

    The Nuclear power company Lippe-Ems GmbH (KLE) runs the Emsland Nuclear Power Station (KKE) in Lingen (Ems) with a 1300 MW pressurized Water reactor. Partners of KLE are VEW and Elektromark. This 1992 annual report reveals numerous financial data of the operator (balance sheet, profit and loss account.) (orig./UA) [de

  12. African Journal of Marine Science - Vol 27, No 1 (2005)

    African Journals Online (AJOL)

    Estimating the lipid content of pelagic fish in the southern Benguela by visual assessment of their mesenteric fat · EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. C D van der Lingen, L Hutchings, 45-53. http://dx.doi.org/10.2989/18142320509504067 ...

  13. Solar heating in Greenland

    DEFF Research Database (Denmark)

    Dragsted, Janne

    Energi fra solen er en ren og naturlig energikilde. Solstrålingen på jordens overflade – inklusive i det Arktiske klima – er så stor, at det er muligt at udnytte solens energi i stor skala. Ved at udnytte solens energi nedsættes brugen af fossile brændstoffer. Anvendelsen af solenergi varierer fr...

  14. Browse Title Index

    African Journals Online (AJOL)

    Items 151 - 200 of 1038 ... Issue, Title. Vol 31, No 2 (2009), Assessing the utility of a continuous, underway fish egg sampler (CUFES) for sampling zooplankton, Abstract. S Sono, CL Moloney, CD van der Lingen. Vol 38, No 4 (2016), Assessing trophic adaptability is critical for understanding the response of predatory fishes to ...

  15. Bestimmung des Bodenreibungsbeiwertes und der Oberflächenreibung eisbedeckter Wasserflächen im Meiningenstrom der Darß-Zingster Boddenkette und Anwendung auf vertikal integrierte hydronumerische Modelle

    OpenAIRE

    Schönfeldt, Hans-Jürgen; Raabe, Armin; Baudler, Henning

    2016-01-01

    In einem hydronumerischen Modell zur Prognose des Strömungs- und Wasserstandsfeldes flacher Gewässer wird eine auf der Turbulenztheorie basierende Tiefenkorrektur für den Bodenreibungsbeiwertwert eingeführt und auf der Basis von Berechnungen für die DarßZingster Boddenkette überprüft. Für einen ausgewählten Meßpunkt der Darß-Zingster Boddenkette wurde der Reibungsbeiwert sowohl am Boden als auch unter einer Eisschicht experimentell bestimmt. Die Auswirkungen einer Tiefenkorrektur des Reibungs...

  16. Das Usutu-Virus als Ursache von Massensterben bei Amseln Turdus merula und anderen Vogelarten in Europa: Erfahrungen aus fünf Ausbrüchen zwischen 2001 und 2011

    OpenAIRE

    Bosch, Stefan; Schmidt-Chanasit, Jonas; Fiedler, Wolfgang

    2012-01-01

    Das Usutu-Virus (USUV) ist ein durch Stechmücken der Gattung Culex übertragenes Flavivirus. Es wurde wahrscheinlich durch Zugvögel oder Stechmücken nach Europa eingeschleppt und hat sich inzwischen dauerhaft in der einheimischen Stechmücken-und Vogelfauna etabliert. Seit seinem Erstnachweis 2001 in Österreich hat das USUV fünf größere Ausbrüche mit USUV-assoziierten Vogelsterben, vor allem unter Amseln und in Volieren gehaltenen Eulen, sowie vermutlich kleinere Ausbrüche ohne augenfälliges Vo...

  17. Monitoring Protein Conformation Changes as an Activating Step for Protein Interactions with Cross-linking/MS Analysis. / Chen, Zhuo; Rasmussen, Morten; Tahir, Salman; Clark, C.A.C; Barlow, Paul; Rappsilber, Juri

    DEFF Research Database (Denmark)

    Rasmussen, Morten

    of C3 to its active form C3b. C3 (187kDa) is a twelve domain protein (ANA, CUB, TED and MG1 to MG9). During the conversion of C3 to C3b, one domain, ANA (99 residues), is proteolytically removed and a number of domains change their position. This exposes protein-binding sites for downstream...... interactions in the complement response.   Methods 250 pmol of C3 and C3b were both cross-linked with a 1000X excess of cross-linkers. BS2G, BS3, and sulfo-EGS were applied respectively. The cross-linking products were separated with 1D-PAGE gel. Monomer bands were sliced and digested with trypsin. Cross......-terminus. The TED domain relocates as is revealed by three cross-links to the ANA domain in C3 and four cross-links to the MG1 domain in C3b, a domain that is remote in C3. In C3b case, a cross-link within the CUB domain suggests a folded structure of this domain, a matter of dispute in the competing crystal...

  18. Intravenous chemotherapy combined with intravesical chemotherapy to treat T1G3 bladder urothelial carcinoma after transurethral resection of bladder tumor: results of a retrospective study

    Directory of Open Access Journals (Sweden)

    Zhang Y

    2016-01-01

    Full Text Available Yu Zhang,1,* Linguo Xie,1,* Tao Chen,1,* Wanqin Xie,2 Zhouliang Wu,1 Hao Xu,1 Chen Xing,1 Nan Sha,1 Zhonghua Shen,1 Yunkai Qie,1 Xiaoteng Liu,1 Hailong Hu,1 Changli Wu1 1Department of Urology, The Second Hospital of Tianjin Medical University, Tianjin Institute of Urology, Tianjin, 2Key Laboratory of Genetics and Birth Health of Hunan Province, The Family Planning Research Institute of Hunan Province, Changsha, People’s Republic of China *These authors contributed equally to this work Objective: The management of stage 1 and grade 3 (T1G3 bladder cancer continues to be controversial. Although the transurethral resection of bladder tumor (TURBT followed by intravesical chemotherapy is a conservative strategy for treatment of T1G3 bladder cancer, a relatively high risk of tumor recurrence and progression remains regarding the therapy. This study aimed to compare the efficacy of intravenous chemotherapy combined with intravesical chemotherapy versus intravesical chemotherapy alone for T1G3 bladder cancer after TURBT surgery. Methods: We retrospectively reviewed the cases of 457 patients who were newly diagnosed with T1G3 bladder urothelial carcinoma between January 2009 and March 2014. After TURBT, 281 patients received intravesical chemotherapy alone, whereas 176 patients underwent intravesical chemotherapy in combination with intravenous chemotherapy. Tumor recurrence and progression were monitored periodically by urine cytology and cystoscopy in follow-up. Recurrence-free survival and progression-free survival of the two chemotherapy strategies following TURBT were analyzed. Univariable and multivariable Cox hazards analyses were performed to predict the prognostic factors for tumor recurrence and progression. Results: The tumor recurrence rate was 36.7% for patients who received intravesical chemotherapy alone after TURBT, compared with 19.9% for patients who received intravenous chemotherapy combined with intravesical chemotherapy after

  19. Impact of lymphovascular invasion on recurrence and progression rates in patients with pT1 urothelial carcinoma of bladder after transurethral resection

    Directory of Open Access Journals (Sweden)

    Sha N

    2015-11-01

    Full Text Available Nan Sha,* Linguo Xie,* Tao Chen,* Chen Xing, Xiaoteng Liu, Yu Zhang, Zhonghua Shen, Hao Xu, Zhouliang Wu, Hailong Hu, Changli Wu Department of Urology, Tianjin Key Laboratory of Urology, Tianjin Institute of Urology, Second Hospital of Tianjin Medical University, Tianjin, People’s Republic of China *These authors contributed equally to this work Objective: To evaluate the clinical significance of lymphovascular invasion (LVI on recurrence and progression rates in patients with pT1 urothelial carcinoma of bladder after transurethral resection.Methods: This retrospective study was performed with 155 patients with newly diagnosed pT1 urothelial carcinoma of bladder who were treated with transurethral resection of bladder tumor at our institution from January 2006 to January 2010. The presence or absence of LVI was examined by pathologists. Chi-square test was performed to identify the correlations between LVI and other clinical and pathological features. Kaplan–Meier method was used to estimate the recurrence-free survival (RFS and progression-free survival curves and difference was determined by the log-rank test. Univariate and multivariate analyses were performed to determine the predictive factors through a Cox proportional hazards analysis model.Results: LVI was detected in a total of 34 patients (21.9%. While LVI was associated with high-grade tumors (P<0.001 and intravesical therapy (P=0.009. Correlations with age (P=0.227, sex (P=0.376, tumor size (P=0.969, tumor multiplicity (P=0.196, carcinoma in situ (P=0.321, and smoking (P=0.438 were not statistically significant. There was a statistically significant tendency toward higher recurrence rate and shorter RFS time in LVI-positive patients. However, no statistically significant differences were observed in progression rate between the two groups. Moreover, multivariate Cox proportional hazards analysis revealed that LVI, tumor size, and smoking were independent prognostic predictors of

  20. Nanoemulsion as a strategy for improving the oral bioavailability and anti-inflammatory activity of andrographolide

    Directory of Open Access Journals (Sweden)

    Yen CC

    2018-01-01

    Full Text Available Ching-Chi Yen,1 Yi-Chen Chen,1 Ming-Tsang Wu,2 Chia-Chi Wang,1,3 Yu-Tse Wu1,4 1School of Pharmacy, College of Pharmacy, Kaohsiung Medical University, Kaohsiung, Taiwan; 2Chinese Medicine Department, Ditmanson Medical Foundation, Chiayi Christian Hospital, Chiayi City, Taiwan; 3PhD Program in Toxicology, College of Pharmacy, Kaohsiung Medical University, Kaohsiung, Taiwan; 4Department of Medical Research, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan Background: Andrographolide (AG, a compound with low water solubility, possesses various pharmacological activities, particularly anti-inflammatory activity. However, its low oral bioavailability is a major obstacle to its potential use. This study developed and optimized an AG-loaded nanoemulsion (AG-NE formulation to improve AG oral bioavailability and its protective effects against inflammatory bowel disease. Methods: A high-pressure homogenization technique was used to prepare the AG-NE and solubility, viscosity, and droplet size tests were conducted to develop the optimized AG-NE composed of α-tocopherol, ethanol, Cremophor EL, and water. The permeability was assessed using everted rat gut sac method and in vivo absorption and anti-inflammatory effect in rats was also evaluated. The plasma concentration of AG was determined using our validated high performance liquid chromatography method, which was used to generate a linear calibration curve over the concentration range of 0.1–25 µg/mL in rat plasma (R2>0.999.Results: The optimized AG-NE had a droplet size of 122±11 nm confirmed using transmission electron microscopy and a viscosity of 28 centipoise (cps. It was stable at 4 and 25°C for 90 days. An ex vitro intestinal permeability study indicated that the jejunum was the optimal site for AG absorption from the optimized AG-NE, which was 8.21 and 1.40 times higher than that from an AG suspension and AG ethanol solution, respectively. The pharmacokinetic results indicate that

  1. Proceedings of the 2016 China Cancer Immunotherapy Workshop

    Directory of Open Access Journals (Sweden)

    Bin Xue

    2016-10-01

    Full Text Available Table of contents A1 Proceedings of 2016 China Cancer Immunotherapy Workshop, Beijing, China Bin Xue, Jiaqi Xu, Wenru Song, Zhimin Yang, Ke Liu, Zihai Li A2 Set the stage: fundamental immunology in forty minutes Zihai Li A3 What have we learnt from the anti-PD-1/PD-L1 therapy of advanced human cancer? Lieping Chen A4 Immune checkpoint inhibitors in lung cancer Edward B. Garon A5 Mechanisms of response and resistance to checkpoint inhibitors in melanoma Siwen Hu-Lieskovan A6 Checkpoint inhibitor immunotherapy in lymphoid malignancies Wei Ding A7 Translational research to improve the efficacy of immunotherapy in genitourinary malignancies Chong-Xian Pan A8 Immune checkpoint inhibitors in gastrointestinal malignancies Weijing Sun A9 What’s next beyond PD-1/PDL1? Yong-Jun Liu A10 Cancer vaccines: new insights into the oldest immunotherapy strategy Lei Zheng A11 Bispecific antibodies for cancer immunotherapy Delong Liu A12 Updates on CAR-T immunotherapy Michel Sadelain A13 Adoptive T cell therapy: personalizing cancer treatment Cassian Yee A14 Immune targets and neoantigens for cancer immunotherapy Rongfu Wang A15 Phase I/IIa trial of chimeric antigen receptor modified T cells against CD133 in patients with advanced and metastatic solid tumors Meixia Chen, Yao Wang, Zhiqiang Wu, Hanren Dai, Can Luo, Yang Liu, Chuan Tong, Yelei Guo, Qingming Yang, Weidong Han A16 Cancer immunotherapy biomarkers: progress and issues Lisa H. Butterfield A17 Shaping of immunotherapy response by cancer genomes Timothy A. Chan A18 Unique development consideration for cancer immunotherapy Wenru Song A19 Immunotherapy combination Ruirong Yuan A20 Immunotherapy combination with radiotherapy Bo Lu A21 Cancer immunotherapy: past, present and future Ke Liu A22 Breakthrough therapy designation drug development and approval Max Ning A23 Current European regulation of innovative oncology medicines: opportunities for immunotherapy Harald Enzmann, Heinz Zwierzina

  2. Wake-up radio systems : design, development, performance evaluation and comparison to conventional medium access control protocols for wireless sensor networks

    OpenAIRE

    Oller i Bosch, Joaquim

    2015-01-01

    During the recent years, the research related to Wake-up Radio (WuR) systems has gained noticeable interest. In WuR systems, a node initiating a communication first sends a Wake-up Call (WuC) by means of its Wake-up Transmitter (WuTx), to the Wake-up Receiver (WuRx) of a remote node to activate it in an on-demand manner. Until the reception of the WuC, the node's MCU and main data transceiver are in sleep mode. Hence, WuR drastically reduce the power required by wireless nodes. This thesis...

  3. Taxonomic notes on Neoperla (Plecoptera: Perlidae) from Sichuan Province of China with the description of two new species.

    Science.gov (United States)

    Li, Weihai; Wang, Ying; Wang, Rongfeng

    2017-01-17

    Species of the perlid genus Neoperla from Sichuan Province, China are reviewed. Two new species are described, Neoperla caii Li & Wang, sp. nov. and N. emeishana Li & Wang, sp. nov. The new species are compared with related congeners. Available types of several known Neoperla species from Sichuan Province were studied and complementary descriptions or brief taxonomic comments are presented for N. bilineata Wu & Claassen, N. chui Wu & Claassen, N. microtumida Wu & Claassen, N. quadrata Wu & Claassen and N. truncata Wu.

  4. 125I brachytherapy of locally advanced non-small-cell lung cancer after one cycle of first-line chemotherapy:a comparison with best supportive care

    Directory of Open Access Journals (Sweden)

    Song J

    2017-03-01

    Full Text Available Jingjing Song* Xiaoxi Fan* Zhongwei Zhao* Minjiang Chen* Weiqian Chen, Fazong Wu, Dengke Zhang, Li Chen, Jianfei Tu, Jiansong Ji Department of Interventional Radiology, Zhejiang University Lishui Hospital, The Fifth Affiliated Hospital of Wenzhou Medical University, Lishui Central Hospital, Lishui, Zhejiang, People’s Republic of China *These authors have contributed equally to this work Objectives: The objective of this study was to assess the efficacy of computed tomography (CT-guided 125I brachytherapy alone in improving the survival and quality of life of patients with unresectable locally advanced non-small-cell lung cancer (NSCLC after one cycle of first-line chemotherapy.Patients and methods: Sixteen patients with locally advanced NSCLC were treated with CT-guided 125I brachytherapy after one cycle of first-line chemotherapy (group A. Sixteen patients who received only best supportive care (group B were matched up with the patients in group A. Primary end point included survival, and secondary end point included assessment of safety, effectiveness of CT-guided 125I brachytherapy, and improvement in the quality of life.Results: The two groups were well balanced in terms of age, disease histology, tumor stage, tumor location, and performance status (P>0.05. The median follow-up time was 16 months (range, 3–30. The total tumor response rate was 75.0% in group A, which was significantly higher than that in group B (0.0% (P<0.01. The median progression-free survival time was 4.80 months for patients in group A and 1.35 months for patients in group B (P<0.001. Kaplan–Meier survival analysis showed that the median survival time of group A was 9.4±0.3 months versus 8.4±0.1 months in group B (P=0.013. Tumor-related symptoms of patients were significantly relieved, and the quality of life was markedly improved in group A than in group B.Conclusion: CT-guided 125I brachytherapy improved the survival of patients with locally advanced

  5. JPRS Report, China

    National Research Council Canada - National Science Library

    1993-01-01

    ...; AGRICULTURE - Further Reform of Grain Circulation, Prices Advocated, Chen Yaobang on Market Challenges Facing Agriculture, Chen Yaobang on Restructuring of Crop Planting, MILITARY, PUBLIC SECURITY...

  6. Mobile Authoring of Open Educational Resources as Reusable Learning Objects

    Directory of Open Access Journals (Sweden)

    Dr Kinshuk

    2013-06-01

    Full Text Available E-learning technologies have allowed authoring and playback of standardized reusable learning objects (RLO for several years. Effective mobile learning requires similar functionality at both design time and runtime. Mobile devices can play RLO using applications like SMILE, mobile access to a learning management system (LMS, or other systems which deploy content to mobile learners (Castillo & Ayala, 2008; Chu, Hwang, & Tseng, 2010; Hsu & Chen, 2010; Nakabayashi, 2009; Zualkernan, Nikkhah, & Al-Sabah, 2009. However, implementations which author content in a mobile context do not typically permit reuse across multiple contexts due to a lack of standardization. Standards based (IMS and SCORM authoring implementations exist for non-mobile platforms (Gonzalez-Barbone & Anido-Rifon, 2008; Griffiths, Beauvoir, Liber, & Barrett-Baxendale, 2009; Téllez, 2010; Yang, Chiu, Tsai, & Wu, 2004. However, this paradigm precludes capturing learning where and when it occurs. Consequently, RLO authored for e-learning lack learner generated content, especially with timely, relevant, and location aware examples.

  7. Parameter identification of chaos system based on unknown parameter observer

    International Nuclear Information System (INIS)

    Wang Shaoming; Luo Haigeng; Yue Chaoyuan; Liao Xiaoxin

    2008-01-01

    Parameter identification of chaos system based on unknown parameter observer is discussed generally. Based on the work of Guan et al. [X.P. Guan, H.P. Peng, L.X. Li, et al., Acta Phys. Sinica 50 (2001) 26], the design of unknown parameter observer is improved. The application of the improved approach is extended greatly. The works in some literatures [X.P. Guan, H.P. Peng, L.X. Li, et al., Acta Phys. Sinica 50 (2001) 26; J.H. Lue, S.C. Zhang, Phys. Lett. A 286 (2001) 148; X.Q. Wu, J.A. Lu, Chaos Solitons Fractals 18 (2003) 721; J. Liu, S.H. Chen, J. Xie, Chaos Solitons Fractals 19 (2004) 533] are only the special cases of our Corollaries 1 and 2. Some observers for Lue system and a new chaos system are designed to test our improved method, and simulations results demonstrate the effectiveness and feasibility of the improved approach

  8. Stepwise encapsulation and controlled two-stage release system for cis-Diamminediiodoplatinum

    Directory of Open Access Journals (Sweden)

    Chen Y

    2014-06-01

    Full Text Available Yun Chen,1,* Qian Li,1,2,* Qingsheng Wu1 1Department of Chemistry, Key Laboratory of Yangtze River Water Environment, Ministry of Education, Tongji University, Shanghai; 2Shanghai Institute of Quality Inspection and Technical Research, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: cis-Diamminediiodoplatinum (cis-DIDP is a cisplatin-like anticancer drug with higher anticancer activity, but lower stability and price than cisplatin. In this study, a cis-DIDP carrier system based on micro-sized stearic acid was prepared by an emulsion solvent evaporation method. The maximum drug loading capacity of cis-DIDP-loaded solid lipid nanoparticles was 22.03%, and their encapsulation efficiency was 97.24%. In vitro drug release in phosphate-buffered saline (pH =7.4 at 37.5°C exhibited a unique two-stage process, which could prove beneficial for patients with tumors and malignancies. MTT (3-[4,5-dimethylthiazol-2-yl]-2, 5-diphenyltetrazolium bromide assay results showed that cis-DIDP released from cis-DIDP-loaded solid lipid nanoparticles had better inhibition activity than cis-DIDP that had not been loaded. Keywords: stearic acid, emulsion solvent evaporation method, drug delivery, cis-DIDP, in vitro

  9. A Disseminação das Estratégias Corporativas Baseadas no Balanced Scorecard: Um Estudo de Caso em uma Empresa de Prestação de Serviços Ambientais

    Directory of Open Access Journals (Sweden)

    Maria do Carmo Assis Todorov

    2015-01-01

    Full Text Available  O balanced scorecard (BSC é uma ferramenta de medição de desempenho, desenvolvida por Norton e Kaplan (1997. Segundo Wu e Chen (2012, Zangoueinezhad e Moshabaki, (2011 e Galas e Forte (2005, o BSC é um método inovador de avaliação de desempenho empresarial, mas a disseminação de seus conceitos e indicadores para todos os níveis hierárquicos da organização, segundo Kaplan e Norton (1999, é um dos fatores críticos na sua implantação. Dentro desse contexto, esta pesquisa teve como objetivo analisar como ocorre a disseminação das estratégias corporativas baseadas no BSC por meio de um estudo de caso em uma empresa de prestação de serviços ambientais. Como resultado, destaca-se que a empresa estudada dissemina as estratégias corporativas por meio de um método organizacional inovador, o Prêmio de Excelência em Gestão, levando em conta as três dimensões da sustentabilidade (econômica, social e ambiental.  

  10. Nanotechnology in the targeted drug delivery for bone diseases and bone regeneration

    Directory of Open Access Journals (Sweden)

    Gu W

    2013-06-01

    Full Text Available Wenyi Gu,1,2 Chengtie Wu,3 Jiezhong Chen,1 Yin Xiao1 1Institute of Health and Biomedical Innovation, Queensland University of Technology, Brisbane, QLD, Australia; 2Australian Institute for Bioengineering and Nanotechnology, The University of Queensland, Brisbane, QLD, Australia; 3State Key Laboratory of High Performance Ceramics and Superfine Microstructure, Shanghai Institute of Ceramics, Chinese Academy of Sciences, Shanghai, People's Republic of China Abstract: Nanotechnology is a vigorous research area and one of its important applications is in biomedical sciences. Among biomedical applications, targeted drug delivery is one of the most extensively studied subjects. Nanostructured particles and scaffolds have been widely studied for increasing treatment efficacy and specificity of present treatment approaches. Similarly, this technique has been used for treating bone diseases including bone regeneration. In this review, we have summarized and highlighted the recent advancement of nanostructured particles and scaffolds for the treatment of cancer bone metastasis, osteosarcoma, bone infections and inflammatory diseases, osteoarthritis, as well as for bone regeneration. Nanoparticles used to deliver deoxyribonucleic acid and ribonucleic acid molecules to specific bone sites for gene therapies are also included. The investigation of the implications of nanoparticles in bone diseases have just begun, and has already shown some promising potential. Further studies have to be conducted, aimed specifically at assessing targeted delivery and bioactive scaffolds to further improve their efficacy before they can be used clinically. Keywords: nanoparticles, nanostructured scaffold, cancer bone metastasis, bone diseases, target drug delivery, bone regeneration

  11. Two days of films

    CERN Document Server

    2011-01-01

    The Chinese community at CERN and the CERN CineClub, on the occasion of the Chinese New Year, invite everyone to two days of films Thursday 3 February 2011 at 20:30 - CERN Council Chamber Eat drink man woman Directed by Ang LEE (Taiwan, 1994) 122 min. With Sihung Lung, Yu-Wen Wang, Chien-Lien Wu, Kuei-Mei Yang Senior Master Chef Chu lives in a large house in Taipei with his three unmarried daughters, Jia-Jen, a chemistry teacher converted to Christianity, Jia-Chien, an airline executive, and Jia-Ning, a student who also works in a fast food restaurant. Life in the house revolves around the ritual of an elaborate dinner each Sunday, and the love lives of all the family members. Original version Mandarin with English subtitles Friday 4 February 2011 at 19:30 - CERN Council Chamber Adieu, ma concubine Directed by Chen KAIGE (China / Hong Kong, 1993) 171 min. With Leslie Cheung, Fengyi Zhang, Li Gong "Farewell, My Concubine" is a movie with two parallel, intertwined stories. It is the story of two performers in t...

  12. Dating young tephras - a distal solution to proximal controversy

    Science.gov (United States)

    Chen, Xuanyu; Blockley, Simon; Xu, Yigang; Menzies, Martin

    2017-04-01

    In-situ dating of young volcanic rocks (environmental data. Assessment of the temporal and spatial variations of such climatic events will help us better understand the dynamics of these rapid and short-lived climatic episodes. References: Broecker, W.S., 2001. Was the Medieval Warm Period Global? Science, 291(5508): 1497-1499. Chen, X.-Y., Blockley, S.P.E., Tarasov, P.E., Xu, Y.-G., McLean, D., Tomlinson, E.L., Albert, P.G., Liu, J.-Q., Müller, S., Wagner, M. and Menzies, M.A., 2016. Clarifying the distal to proximal tephrochronology of the Millennium (B-Tm) eruption, Changbaishan Volcano, northeast China. Quat. Geochronol., 33: 61-75. Ge, Q. and Wu, W., 2011. Climate during the Medieval Climate Anomaly in China. PAGES news, 19: 24-26. Sun, C., Plunkett, G., Liu, J., Zhao, H., Sigl, M., McConnell, J.R., Pilcher, J.R., Vinther, B., Steffensen, J.P. and Hall, V., 2014. Ash from Changbaishan Millennium eruption recorded in Greenland ice: Implications for determining the eruption's timing and impact. Geophys. Res. Lett., 2013GL058642.

  13. S1P transporter SPNS2 regulates proper postnatal retinal morphogenesis.

    Science.gov (United States)

    Fang, Chao; Bian, Ganlan; Ren, Pan; Xiang, Jie; Song, Jun; Yu, Caiyong; Zhang, Qian; Liu, Ling; Chen, Kun; Liu, Fangfang; Zhang, Kun; Wu, Chunfeng; Sun, Ruixia; Hu, Dan; Ju, Gong; Wang, Jian

    2018-02-08

    Spinster homolog 2 (SPNS2) is the membrane transporter of sphingosine-1-phosphate (S1P), and it participates in several physiologic processes by activating different S1P receptors (S1PRs). However, its functions in the nervous system remain largely unclear. We explored the important role of SPNS2 in the process of retinal morphogenesis using a spns2-deficient rat model. In the absence of the functional SPNS2 transporter, we observed progressively aggravating laminar disorganization of the epithelium at the postnatal stage of retinal development. Disrupted cell polarity, delayed cell-cycle exit of retinal progenitor cells, and insufficient migration of newborn neurons were proposed in this study as potential mechanisms accounting for this structural disorder. In addition, we analyzed the expression profiles of spns2 and s1prs, and proposed that SPNS2 regulated retinal morphogenesis by establishing the S1P level in the eye and activating S1PR3 signaling. These data indicate that SPNS2 is indispensable for normal retinal morphogenesis and provide new insights on the role of S1P in the developing retina using an established in vivo model.-Fang, C., Bian, G., Ren, P., Xiang, J., Song, J., Yu, C., Zhang, Q., Liu, L., Chen, K., Liu, F., Zhang, K., Wu, C., Sun, R., Hu, D., Ju, G., Wang, J. S1P transporter SPNS2 regulates proper postnatal retinal morphogenesis.

  14. Diversity and uses of Zingiberaceae in Nam Nao National Park, Chaiyaphum and Phetchabun provinces, Thailand, with a new record for Thailand

    Directory of Open Access Journals (Sweden)

    Surapon Saensouk

    2016-11-01

    Full Text Available Three tribes, 12 genera and 38 species of the ginger family (Zingiberaceae along five routes in Nam Nao National Park were surveyed between January 2012 and December 2013 to determine their diversity, ecological data, phenology, uses and conservation status. The highest diversity was found in the tribe Zingibereae (6 genera and 21 species, of which the genera Curcuma and Zingiber comprised the highest number species (eight species each. A species key was constructed based on morphology. The ginger family was found in four forest-types—deciduous dipterocarp forest, mixed deciduous forest, dry evergreen forest and pine forest. The most flowering bloom of the ginger family in Nam Nao National Park was during March to August and the most fruiting bloom was during June to September. The popular uses of Zingiberaceae were as a food, spice, in medicine, as ornamentation and in rituals. Eight species have been evaluated as of least concern and are presented in the IUCN Red List, while two rare species were reported in Thailand Red Data: Plants, while six rare Zingiberaceae species were identified based on the evaluation criteria of Saensouk (2011. Four species were endemic to Thailand. Moreover, Etlingera yunnanensis (T. L. Wu & S. J. Chen R. M. Smith was a new record for Thailand.

  15. Bose-Einstein condensate in an optical lattice with Raman-assisted two-dimensional spin-orbit coupling

    Science.gov (United States)

    Pan, Jian-Song; Zhang, Wei; Yi, Wei; Guo, Guang-Can

    2016-10-01

    In a recent experiment (Z. Wu, L. Zhang, W. Sun, X.-T. Xu, B.-Z. Wang, S.-C. Ji, Y. Deng, S. Chen, X.-J. Liu, and J.-W. Pan, arXiv:1511.08170 [cond-mat.quant-gas]), a Raman-assisted two-dimensional spin-orbit coupling has been realized for a Bose-Einstein condensate in an optical lattice potential. In light of this exciting progress, we study in detail key properties of the system. As the Raman lasers inevitably couple atoms to high-lying bands, the behaviors of the system in both the single- and many-particle sectors are significantly affected. In particular, the high-band effects enhance the plane-wave phase and lead to the emergence of "roton" gaps at low Zeeman fields. Furthermore, we identify high-band-induced topological phase boundaries in both the single-particle and the quasiparticle spectra. We then derive an effective two-band model, which captures the high-band physics in the experimentally relevant regime. Our results not only offer valuable insights into the two-dimensional lattice spin-orbit coupling, but also provide a systematic formalism to model high-band effects in lattice systems with Raman-assisted spin-orbit couplings.

  16. Status and perspectives of the dismantling of nuclear power plants in Germany (Dismantling monitoring 2015); Stand und Perspektiven des Rueckbaus von Kernkraftwerken in Deutschland (''Rueckbau-Monitoring 2015'')

    Energy Technology Data Exchange (ETDEWEB)

    Wealer, Ben; Seidel, Jan Paul [Technische Univ. Berlin (Germany); Gerbaulet, Clemens; Hirschhausen, Christian von [Technische Univ. Berlin (Germany); Deutsches Institut fuer Wirtschaftsforschung, Berlin (Germany)

    2015-11-15

    The dismantling monitoring 2015 covers the nuclear power plants HDR Grosswelzheim, Niederaichbach (KKN), MZFR Karlsruhe, Lingen (KWL), Gundremmingen unit A (KRB-A), VAK Kahl, Muehlheim-Kaerlich (KMK), THTR-300 Hamm-Uentrop, AVR Juelich, Greifswald (KGR 1-5), KNK II Karlsruhe, Rheinsberg (KKR), Wuergassen (KWW), Stade (KKS), Obrigheim (KWO), SNR 300. The post-operational phase activities of other shut-down nuclear power plants and the active companies are summarized.

  17. Nomenclatural corrections to the taxonomic revision of The Old World species of Boehmeria (Urticaceae, tribus Boehmeriae) by Wilmot-Dear and Friis (2013)

    DEFF Research Database (Denmark)

    Wilmot-Dear, Christine Melanie; Friis, Ib; Govaerts, R. H. A.

    2014-01-01

    (H. Lév.) C.J. Chen in Chen et al. as the correct name for the variety named in the revision as B. zollingeriana Wedd. var. podocarpa (W.T. Wang) W.T. Wang & C.J. Chen in Chen et al., (3) that the combination B. spicata (Thunb.) Thunb., based on Urtica spicata Thunb., is not illegitimate, as stated...

  18. Categorizing renal oncocytic neoplasms on core needle biopsy: a morphologic and immunophenotypic study of 144 cases with clinical follow-up. Alderman MA, Daignault S, Wolf JS Jr, Palapattu GS, Weizer AZ, Hafez KS, Kunju LP, Wu AJ. Hum Pathol.September 2016;55:1-10.

    Science.gov (United States)

    Kryvenko, Oleksandr N

    2017-06-01

    There is limited literature on renal oncocytic neoplasms diagnosed on core biopsy. All renal oncocytic neoplasm core biopsies from 2006 to 2013 were, retrospectively, reviewed. Morphologic features and an immunohistochemical panel of CK7, c-KIT, and S100A1 were assessed. Concordance with resection diagnosis, statistical analysis including a random forest classification, and follow-up were recorded. The postimmunohistochemical diagnoses of 144 renal oncocytic core biopsies were favor oncocytoma (67%), favor renal cell carcinoma (RCC) (12%), and cannot exclude RCC (21%). Diagnosis was revised following immunohistochemistry in 7% of cases. The most common features for oncocytoma (excluding dense granular cytoplasm) were nested architecture, edematous stroma, binucleation and tubular architecture; the most common features for favor RCC were sheet-like architecture, nuclear pleomorphism, papillary architecture, and prominent cell borders. High nuclear grade, necrosis, extensive papillary architecture, raisinoid nuclei, and frequent mitoses were not seen in oncocytomas. Comparing the pathologist and random forest classification, the overall out-of-bag estimate of classification error dropped from 23% to 13% when favor RCC and cannot exclude RCC was combined into 1 category. Resection was performed in 19% (28 cases) with a 94% concordance (100% of favor RCC biopsies and 90% of cannot exclude RCC biopsies confirmed as RCC; 83% of favor oncocytomas confirmed); ablation in 23%; and surveillance in 46%. Follow-up was available in 92% (median follow-up, 33 months) with no adverse outcomes. Renal oncocytic neoplasms comprise a significant subset (16%) of all core biopsies, and the majority (78%) can be classified as favor oncocytoma or favor RCC. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Commentary on "tissue-specific mutagenesis by N-butyl-N-(4-hydroxybutyl) nitrosamine as the basis for urothelial cell carcinogenesis." He Z, Kosinska W, Zhao ZL, Wu XR, Guttenplan JB, Department of Basic Science, New York University Dental College, NY, USA.: Mutat Res 2012;742(1-2):92-5 [Epub 2011 Dec 4].

    Science.gov (United States)

    Scherr, Douglas S

    2014-02-01

    Bladder cancer is one of the few cancers that have been linked to carcinogens in the environment and tobacco smoke. Of the carcinogens tested in mouse chemical carcinogenesis models, N-butyl-N-(4-hydroxybutyl)nitrosamine (BBN) is one that reproducibly causes high-grade, invasive cancers in the urinary bladder, but not in any other tissues. However, the basis for such a high-level tissue-specificity has not been explored. Using mutagenesis in lacI (Big Blue™) mice, we show here that BBN is a potent mutagen and it causes high-level of mutagenesis specifically in the epithelial cells (urothelial) of the urinary bladder. After a 2-6-week treatment of 0.05% BBN in the drinking water, mutagenesis in urothelial cells of male and female mice was about two orders of magnitude greater than the spontaneous mutation background. In contrast, mutagenesis in smooth muscle cells of the urinary bladder was about five times lower than in urothelial tissue. No appreciable increase in mutagenesis was observed in kidney, ureter, liver or forestomach. In lacI (Big Blue™) rats, BBN mutagenesis was also elevated in urothelial cells, albeit not nearly as profoundly as in mice. This provides a potential explanation as to why rats are less prone than mice to the formation of aggressive form of bladder cancer induced by BBN. Our results suggest that the propensity to BBN-triggered mutagenesis of urothelial cells underlies its heightened susceptibility to this carcinogen and that mutagenesis induced by BBN represents a novel model for initiation of bladder carcinogenesis. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. 專論/台灣圖書館史數位圖書館建構之研究/王梅玲;蔡明月;陳志銘;柯雲娥;蔡佳縈;陳勇汀;林怡甄 | A Digital Library Pilot Study on Taiwan Libraries' History / Mei-Ling Wang; Ming-Yueh Tsay; Chih-Ming Chen; Yun-Er Ke; Chia-Ying Tsai; Yong-Ting Chen; Yi-Jen Lin

    Directory of Open Access Journals (Sweden)

    王梅玲、蔡明月、陳志銘、柯雲娥、蔡佳縈、陳勇汀、林怡甄

    2008-04-01

    Full Text Available

    圖書館是保存與詮釋人類文化重要的機構,1990 年代開始,網際網路的進步,促成數位圖書館蓬勃發展,有人預測它就是未來的圖書館,因此,圖書館界與教育界積極參與相關研究。台灣地區歷經日據時期、重建 時期、成長時期及茁壯時期四階段,建設許多圖書館,有其豐富的主題與素材值得發展成為數位圖書館。政治大學圖書資訊與檔案學研究所有鑑於此,提出「『台灣 百無圖書館史』數位圖書館」的構想,並獲得政大「發展國際一流大學及頂尖研究中心計畫」經費支持。本研究計畫目的包括:(1探索以台彎圖書館事業史為主 題的數位圖書館建構模式;(2建構數位圖書館以支援圖書資訊學教育與研究;(3研訂圖書館事業史料文獻的Metadata與數位資料格式;(4將圖 書文獻與文物數位化以建構數位館藏;(5發展數位圖書館系統與技術;(6研發數位圖書館網站的瀏覽與檢索功能;(7探討數位圖書館支援數位學習的模 式。計畫成果共研訂六種 Metadata標準:建置746筆數位化資料;以Dspace系統平台,依據需求設計台灣百年圖書館史系統架構與網站,最後提出結論與建議。

    Libraries are important social institutions that preserve and communicate human culture and knowledge. From the beginning of 1990s, the digital library has grown up rapidly based on the progress of the Internet. Libraries and educational institutions should be actively involved in digital library research and development. The Taiwan libraries’ history can be divided into four stages: Japanese occupation period, reconstruction period, growth period and strong period. In these processes, many events and libraries with rich materials that can be developed into a digital library. Graduate Institute of Library, Information and Archival Studies, National Chengchi University, planned the Digital Library Pilot Study on Taiwan Libraries’ History and got the university support. The pilot study objectives include: (1 exploring the digital library model on Taiwan libraries' history; (2 constructing digital library to support education and research in information and library science; (3 developing Metadata standards of library documents and heritage; (4 digitalizing documents and heritage to build digital collections (5 developing digital library systems and technology; (6 researching browsing and search functions of the digital library; (7 exploring the model of the digital library supports e-learning. In this pilot study, we developed six Metadata standards, built 746 digital resources, constructed a digital library system and web site, and proposed the conclusions and suggestions finally.

    頁次:15-38

  1. China Report, Political, Sociological and Military Affairs, No. 445.

    Science.gov (United States)

    1983-08-11

    2052 0981], Chen Dingming [7115 7844 6900], Jin Xiulan [6855 4423 5695] (F, Mongolian), Zhao Nanqi [6392 0589 6386] Korean), Suo Jingxian [4792...Pen Center and the Guangzhou Pen Center will be headed by Chen Huangmei, another vice-president of the China center and a noted critic. The...1728 4426 6311], Zhang Tengxiao [1728 7506 7197], Chen Dingmou [7115 0002 5399], Chen Lunfen [7115 0243 5358] (F), Chen Xitong [7115 1585 0681

  2. Technical Digest of the 1998 Summer Topical Meeting on Organic Optics and Optoelectronics

    Science.gov (United States)

    1998-07-01

    Larry Dalton, University of Southern California, Los Angeles, CA Harold Fetterman , University of California, Los Angeles, CA Steve Forrest...OPTIC MODULATORS H. Fetterman , D. Chen, A. Udupa. D. Bhattachaya, B. Tsap University of Califonia, Los Angeles 90024 S. Lee, A. Chen, J. Chen, W...Chen, H.R. Fetterman , A. Chen, W.H. Steier, and L. R. Dalton, Appl. Phys. Lett. 70, (1997). 2. T.A. Tumolillo and P.R. Ashley, Appl. Phys. Lett. 62

  3. The 2nd International Conference on Agricultural and Biological Sciences (ABS 2016

    Directory of Open Access Journals (Sweden)

    Lei Pei

    2016-10-01

    Salvia of Labiatae in China Xiaojuan Li, Ning Xu, Guofu Zhou, Ming Wan, Qi Lin, Fanyun Meng, Jianxiu Li 15 Three pulling resistance models of pioneer plant in landslide area Yichang Chen, Koayung Yu, Chunpin Chang 16 The comparison of physiological and biochemical mechanisms of Reaumuria soongorica and Salsola passerine in different growth pattern Zijuan Zhou, Peixi Su, Rui Shi, Tingting Xie 17 Resources use efficiency of the cosmopolitan plant Potentilla anserina L. in different alpine habitats in China Rui Shi, Peixi Su, Zijuan Zhou 18 Cloning of PPDK gene from Red Amaranand transformation of Alfalfa Xuelan Liu, Yan Zhang, Xiangfa Wei 19 Variation and cluster analysis of morphological characters and nutrient content of Chucrasia tabularis seed Chong Wu, Yanlei Yin, Lijuan Feng, Xuemei Yang, Fei Wang 20 Effect of the planting density of the areca nut on the growth of intercropped Vanilla Hua Wang, Huifa Zhuang, Zihui Zhu, Hui Wang

  4. Annexin A1 is elevated in patients with COPD and affects lung fibroblast function

    Directory of Open Access Journals (Sweden)

    Lai TW

    2018-02-01

    Full Text Available Tianwen Lai,1,* Yanyu Li,1,* Zongjiong Mai,2 Xiaoxia Wen,1 Yingying Lv,1 Zhanqing Xie,3 Quanchao Lv,1 Min Chen,1 Dong Wu,1 Bin Wu1 1Department of Respiratory and Critical Care Medicine, 2Department of Oncology, 3Department of Thoracic Surgery, The Affiliated Hospital of Guangdong Medical University, Zhanjiang, People’s Republic of China *These authors contributed equally to this work Purpose: Fibrosis in peripheral airways is responsible for airflow limitation in chronic obstructive pulmonary disease (COPD. Annexin A1 modulates several key biological events during inflammation. However, little is known about its role in airway fibrosis in COPD. We investigated whether levels of Annexin A1 were upregulated in patients with COPD, and whether it promoted airway fibrosis.Methods: We quantified serum Annexin A1 levels in never-smokers (n=12, smokers without COPD (n=11, and smokers with COPD (n=22. Correlations between Annexin A1 expression and clinical indicators (eg, lung function were assessed. In vitro, human bronchial epithelial (HBE cells were exposed to cigarette smoke extract (CSE and Annexin A1 expression was assessed. Primary human lung fibroblasts were isolated from patients with COPD and effects of Annexin A1 on fibrotic deposition of lung fibroblasts were evaluated.Results: Serum Annexin A1 was significantly higher in patients with Global Initiative for Chronic Obstructive Lung Disease (GOLD guidelines stage III or IV than in those with GOLD stages I or II (12.8±0.8 ng/mL versus 9.8±0.7 ng/mL; p=0.016. Annexin A1 expression was negatively associated with airflow obstruction (forced expiratory volume in one second % predicted; r=−0.72, p<0.001. In vitro, Annexin A1 was significantly increased in CSE-exposed HBE cells in a time- and concentration-dependent manner. Annexin A1 promoted lung fibroblasts proliferation, migration, differentiation, and collagen deposition via the ERK1/2 and p38 mitogen-activated protein kinase pathways

  5. Effect of Contract Compliance Rate to a Fourth-Generation Telehealth Program on the Risk of Hospitalization in Patients With Chronic Kidney Disease: Retrospective Cohort Study.

    Science.gov (United States)

    Hung, Chi-Sheng; Lee, Jenkuang; Chen, Ying-Hsien; Huang, Ching-Chang; Wu, Vin-Cent; Wu, Hui-Wen; Chuang, Pao-Yu; Ho, Yi-Lwun

    2018-01-24

    telehealth program and risk of hospitalization. Renal function status was associated with risk of hospitalization among these patients, and there was a significant interaction with contract compliance rate. ©Chi-Sheng Hung, Jenkuang Lee, Ying-Hsien Chen, Ching-Chang Huang, Vin-Cent Wu, Hui-Wen Wu, Pao-Yu Chuang, Yi-Lwun Ho. Originally published in the Journal of Medical Internet Research (http://www.jmir.org), 24.01.2018.

  6. Prevalence and related factors of psychological distress among cancer inpatients using routine Distress Thermometer and Chinese Health Questionnaire screening

    Directory of Open Access Journals (Sweden)

    Chiou YJ

    2016-10-01

    Full Text Available Yu-Jie Chiou,1 Nien-Mu Chiu,1 Liang-Jen Wang,2 Shau-Hsuan Li,3 Chun-Yi Lee,1 Ming-Kung Wu,1 Chien-Chih Chen,1 Yi-Shan Wu,1 Yu Lee1 1Department of Psychiatry, 2Department of Child and Adolescent Psychiatry, 3Department of Hematology-Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan, Republic of China Background: Clinical practice guidelines suggest routine screening for distress among cancer patients for immediate early psychiatric care. However, previous studies focusing on routine screening for psychological distress among cancer inpatients in Taiwan are scant. Thus, the aim of this study was to evaluate the prevalence and related factors of psychological distress and mental illness among cancer inpatients in Taiwan. Patients and methods: This study was conducted as a retrospective chart review in a general hospital in southern Taiwan. Cancer inpatients were regularly screened by nursing staff using the Distress Thermometer and the 12-item Chinese Health Questionnaire. Positive screening results on either instrument were followed by a non-commanded referral to psychiatrists for clinical psychiatric diagnosis and treatment. Results: Of the 810 participants in this study, 179 (22.1% were recognized as having psychological distress. Younger age (odds ratio [OR] =1.82, having head and neck cancer (OR =2.43, and having not received chemotherapy (OR =1.58 were significantly related to psychological distress. Among the 56 patients (31.3% with psychological distress who were referred to psychiatrists, the most common mental illness was adjustment disorder (n=22, 39.2%, followed by major depressive disorder (n=13, 23.2%, depressive disorder not otherwise specified (n=6, 10.7%, and anxiety disorder not otherwise specified (n=4, 7.1%. Conclusion: Our study indicated that cancer inpatients with psychological distress were more likely to be younger in age, have head and neck cancer, and have not

  7. Antimicrobial activity and the mechanism of silver nanoparticle thermosensitive gel

    Directory of Open Access Journals (Sweden)

    Chen M

    2011-11-01

    Full Text Available Meiwan Chen1,2,‡, Zhiwen Yang1,‡, Hongmei Wu1, Xin Pan1, Xiaobao Xie3, Chuanbin Wu11Research and Development Center of Pharmaceutical Engineering, School of Pharmaceutical Sciences, Sun Yat-sen University, Guangzhou, China; 2State Key Laboratory of Quality Research in Chinese Medicine, Institute of Chinese Medical Sciences, University of Macau, Macau, China; 3Guangdong Provincial Key Laboratory of Microbial Culture Collection and Application, Guangzhou, China ‡These authors contributed equally to this workPurpose: The purpose of the present study was to elucidate the antimicrobial activity and mechanism of silver nanoparticles incorporated into thermosensitive gel (S-T-Gel on Staphylococcus aureus, Escherichia coli, and Pseudomonas aeruginosa.Patients and methods: This study investigated the growth, permeability, and morphology of Staphylococcus aureus, Escherichia coli, and Pseudomonas aeruginosa cells in order to observe the action of S-T-Gel on the membrane structure of these three bacteria. The cell morphology of normal and treated bacteria cells was assessed by transmission electron microscopy (TEM, and the effects of S-T-Gel on genome DNA of bacterial cells were evaluated by agarose gel electrophoresis.Results: S-T-Gel showed promising activity against Staphylococcus aureus and moderate activity against Escherichia coli and Pseudomonas aeruginosa. The observation with TEM suggested that S-T-Gel may destroy the structure of bacterial cell membranes in order to enter the bacterial cell. S-T-Gel then condensed DNA and combined and coagulated with the cytoplasm of the damaged bacteria, resulting in the leakage of the cytoplasmic component and the eventual death of these three bacteria. In addition, the analysis of agarose gel electrophoresis demonstrated that S-T-Gel could increase the decomposability of genome DNA.Conclusion: These results about promising antimicrobial activity and mechanism of S-T-Gel may be useful for further research

  8. Rural older people had lower mortality after accidental falls than non-rural older people

    Directory of Open Access Journals (Sweden)

    Huang JW

    2017-01-01

    Full Text Available Jen-Wu Huang,1,2 Yi-Ying Lin,2,3 Nai-Yuan Wu,4 Yu-Chun Chen5–7 1Department of Surgery, National Yang-Ming University Hospital, National Yang-Ming University, Yilan, Taiwan; 2Institute of Emergency and Critical Care Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan; 3Department of Pediatrics, Heping Fuyou Branch, Taipei City Hospital, Taipei, Taiwan; 4Institute of Biomedical Informatics, National Yang-Ming University, Taipei, Taiwan; 5Department of Medical Research and Education, National Yang-Ming University Hospital, Yilan, Taiwan; 6Faculty of Medicine and School of Medicine, National Yang-Ming University, Taipei, Taiwan; 7Institute of Hospital and Health Care Administration, School of Medicine, National Yang-Ming University, Taipei, Taiwan Objective: This study aimed to investigate the mortality rate after falls of rural and non-rural older people and to explore the risk factors of mortality after falls among older people. Patients and methods: This population-based case–control study identified two groups from a nationwide claim database (National Health Insurance Research Database in Taiwan: a rural group and a non-rural group, which included 3,897 and 5,541 older people, respectively, who were hospitalized for accidental falls (The International Classification of Diseases, Ninth Revision, Clinical Modification: E880–E888 during 2006–2009. Both groups were followed up for 4 years after falls. Four-year cumulative all-cause mortality rate after falls was calculated, and the demographic factor, comorbidity, and medications were considered as the potential risk factors of mortality after falls. Results: The rural group had a significantly higher frequency of fall-related hospitalizations (7.4% vs 4.3%, P<0.001, but a lower 4-year cumulative all-cause mortality rate after falls than the non-rural group (8.8% vs 23.4%, P<0.001. After adjusting for age, gender, comorbidity, and medication use, the rural group had

  9. Dual tumor-targeted poly(lactic-co-glycolic acid–polyethylene glycol–folic acid nanoparticles: a novel biodegradable nanocarrier for secure and efficient antitumor drug delivery

    Directory of Open Access Journals (Sweden)

    Chen J

    2017-08-01

    Full Text Available Jia Chen,1,2,* Qi Wu,1,* Li Luo,1 Yi Wang,1 Yuan Zhong,1 Han-Bin Dai,1 Da Sun,1,3 Mao-Ling Luo,4 Wei Wu,1 Gui-Xue Wang1 1Key Laboratory for Biorheological Science and Technology, Ministry of Education, State and Local Joint Engineering Laboratory for Vascular Implants, Bioengineering College, Chongqing University, Chongqing, 2Institute of Laboratory Animals, Sichuan Academy of Medical Science, Sichuan Provincial People’s Hospital, Chengdu, 3Institute of Life Sciences, Wenzhou University, Wenzhou, 4School of Medicine, Wuhan University, Wuhan, China *These authors contributed equally to this work Abstract: Further specific target-ability development of biodegradable nanocarriers is extremely important to promote their security and efficiency in antitumor drug-delivery applications. In this study, a facilely prepared poly(lactic-co-glycolic acid (PLGA–polyethylene glycol (PEG–folic acid (FA copolymer was able to self-assemble into nanoparticles with favorable hydrodynamic diameters of around 100 nm and negative surface charge in aqueous solution, which was expected to enhance intracellular antitumor drug delivery by advanced dual tumor-target effects, ie, enhanced permeability and retention induced the passive target, and FA mediated the positive target. Fluorescence-activated cell-sorting and confocal laser-scanning microscopy results confirmed that doxorubicin (model drug loaded into PLGA-PEG-FA nanoparticles was able to be delivered efficiently into tumor cells and accumulated at nuclei. In addition, all hemolysis, 3-(4,5-dimethylthiazol-2-yl-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl-2H-tetrazolium, and zebrafish-development experiments demonstrated that PLGA-PEG-FA nanoparticles were biocompatible and secure for biomedical applications, even at high polymer concentration (0.1 mg/mL, both in vitro and in vivo. Therefore, PLGA-PEG-FA nanoparticles provide a feasible controlled-release platform for secure and efficient antitumor drug

  10. Top five medical innovations in China mainland since Xinhai revolution [1911]: results of AME survey-002.

    Science.gov (United States)

    Wáng, Yì-Xiáng J; Xiao, Fan

    2015-06-01

    This survey aims to scrutinize important medical innovations in Chinese mainland since Xinhai (Hsin-hai) revolution in 1911, which marked the end of Manchurian imperial rule and the beginning of China's republican era. An online cross-sectional survey was carried out during the period of Dec 29, 2014 to Feb 5, 2015, totaling 37 days. The survey was conducted on the platform provided by DXY (www.dxy.cn), which is the largest medical and paramedical related website in China. An email was sent to all DXY registered users to invite them to participate in a 5-minute survey. The participants were asked to nominate up to four important medical innovations in China mainland since Xinhai revolution. The participant could select 'zero' which means he/she felt there was no important medical innovations, or he/she did not know important medical innovations. It was noted that important medical innovations refer to (I) those with practical and almost immediate significance to improve healthcare; (II) should not only be introducing western technique to China, but those involve major improvement of existing western techniques count; (III) should not be those with important theoretical discovery but did not have almost immediate significance to improve healthcare. In total 1,513 DXY users participated in the voting. Totally 489 (32.3%), 441 (29.1%), 342 (22.6%), 150 (9.9%), 91 (6.0%) participants provided 0, 1, 2, 3, 4 nominations respectively. (I) Artemisine (Qinghaosu) for malaria treatment (Project 523 team, 1972); (II) arsenic Trioxide (As2O3) for acute promyelocytic leukemia (APL) treatment (ZHANG Ting-Dong and colleagues, 1970s); (III) limb re-plantation (CHEN Zhong-Wei and colleagues, 1963); (IV) all-trans retinoic acid (ATRA) for APL treatment (WANG Zhen-Yi and colleagues, 1988); and (V) Wu's mask for plague prevention (WU Lien-The, 1910), were voted as the top five innovations in China mainland since Xinhai revolution, with 375, 96, 91, 53, and 8 votes respectively. In

  11. Anti-tumor activity of polysaccharides extracted from Senecio ...

    African Journals Online (AJOL)

    *, Bao Zhang, Mingming Han, Xin Jin, Liyuan Sun and Tao Li. Department of ..... Yang J, Li X, Xue Y, Wang N, Liu W. Anti-hepatoma activity and mechanism of corn ... Peng W, Wu JG, Jiang YB, Liu YJ, Sun T, Wu N, Wu CJ. Antitumor activity of ...

  12. Effects of HGF gene polymorphisms and protein expression on transhepatic arterial chemotherapeutic embolism efficacy and prognosis in patients with primary liver cancer

    Directory of Open Access Journals (Sweden)

    Chen HY

    2017-02-01

    Full Text Available Hai-Yong Chen,1,2 Yao-Min Chen,3 Jian Wu,1,2 Fu-Chun Yang,1,2 Zhen Lv,1,2 Yi-Gang Qian,1,2 Shu-Sen Zheng1,2 1Department of Surgery, Division of Hepatobiliary and Pancreatic Surgery, The First Affiliated Hospital, Zhejiang University, 2Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, 3Department of Breast Surgery, The First Affiliated Hospital, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China Objective: To investigate the correlations of two hepatocyte growth factor (HGF gene polymorphisms (rs5745652 and rs2074725 and their protein expression levels with the efficacy of transhepatic arterial chemotherapeutic embolism (TACE and prognosis in patients with primary liver cancer (PLC. Methods: From March 2011 to June 2012, 109 PLC patients (the case group who chose TACE as primary treatment and 80 healthy people (the control group who had undergone physical examination in The First Affiliated Hospital, Zhejiang University were selected during the same period. Gene polymorphisms of HGF rs5745652 and HGF rs2074725 were detected. Serum HGF level, treating efficacy, survival quality, and 3-year survival rate for PLC patients who received TACE were observed. Results: There were significant differences in genotype and allele frequencies of HGF rs5745652 and HGF rs2074725, between the case and control groups (all P<0.05. Compared with CT+TT genotype of HGF rs5745652, patients carrying CC genotype had lower serum HGF levels, higher efficacy, better survival quality, and prolonged 3-year survival rate (all P<0.05. In rs2074725, patients carrying CA+AA genotype had lower serum HGF levels, higher efficacy, better survival quality, and prolonged 3-year survival rate compared with patients carrying rs2074725 CC genotype (all P<0.05. Gene polymorphisms of HGF rs5745652 and HGF rs2074725, tumor size, and Barcelona Clinic Liver Cancer stage were independent prognostic factors for PLC (P<0.05. Conclusion: Our

  13. Development of liposomal pemetrexed for enhanced therapy against multidrug resistance mediated by ABCC5 in breast cancer

    Directory of Open Access Journals (Sweden)

    Bai F

    2018-03-01

    Full Text Available Fang Bai,1–3,* You Yin,4,* Ting Chen,1,* Jihui Chen,1 Meixin Ge,2 Yunshu Lu,2 Fangyuan Xie,5 Jian Zhang,1 Kejin Wu,3 Yan Liu1,6 1Department of Pharmacy, Xinhua Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, 2Department of General Surgery, Xinhua Hospital, Affiliated to Shanghai Jiao Tong University, School of Medicine, Shanghai, 3Department of Breast Surgery, Obstetrics and Gynaecology Hospital, Fudan University, Shanghai, 4Department of Neurology, Changzheng Hospital Affiliated to Second Military Medical University, Shanghai, 5Department of Pharmacy, Shanghai Eastern Hepatobiliary Surgery Hospital, Shanghai, 6Department of Pharmacy, Changzheng Hospital Affiliated to Second Military Medical University, Shanghai, People’s Republic of China *These authors contributed equally to this work Purpose: Breast cancer is the most common cancer among women. Pemetrexed, a new generation antifolate drug, is one of the primary treatments for breast cancer. However, multidrug resistance (MDR in breast cancer greatly hampers the therapeutic efficacy of chemotherapies such as pemetrexed. Nanomedicine is emerging as a promising alternative technique to overcome cancer MDR. Thus, pemetrexed-loaded d-alpha tocopheryl polyethylene glycol 1000 succinate (vitamin E TPGS liposomes (liposomal pemetrexed were developed as a strategy to overcome MDR to pemetrexed in breast cancer. Materials and methods: Liposomal pemetrexed was developed using the calcium acetate gradient method. The cytotoxic effects, apoptosis-inducing activity, in vivo distribution, and antitumor activity of liposomal pemetrexed were investigated. Results: Liposomal pemetrexed was small in size (160.77 nm, with a small polydispersity of <0.1. The encapsulation efficacy of liposomal pemetrexed was 63.5%, which is rather high for water-soluble drugs in liposomes. The IC50 of liposomal pemetrexed following treatment with MDR breast cancer cells (MCF-7 cells overexpressing ABCC5

  14. Stereotactic body radiation therapy via helical tomotherapy to replace brachytherapy for brachytherapy-unsuitable cervical cancer patients – a preliminary result

    Directory of Open Access Journals (Sweden)

    Hsieh CH

    2013-02-01

    Full Text Available Chen-Hsi Hsieh,1–3 Hui-Ju Tien,1 Sheng-Mou Hsiao,4 Ming-Chow Wei,4 Wen-Yih Wu,4 Hsu-Dong Sun,4 Li-Ying Wang,5 Yen-Ping Hsieh,6 Yu-Jen Chen,3,7–9 Pei-Wei Shueng1,101Department of Radiation Oncology, Far Eastern Memorial Hospital, Taipei, Taiwan; 2Department of Medicine, 3Institute of Traditional Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan; 4Department of Obstetrics and Gynecology, Far Eastern Memorial Hospital, Taipei, Taiwan; 5School and Graduate Institute of Physical Therapy, College of Medicine, National Taiwan University, Taipei, Taiwan; 6Department of Senior Citizen Service Management, National Taichung University of Science and Technology, Taichung, Taiwan; 7Department of Radiation Oncology, 8Department of Medical Research, Mackay Memorial Hospital, Taipei, Taiwan; 9Graduate Institute of Sport Coaching Science, Chinese Culture University, Taipei, Taiwan; 10Department of Radiation Oncology, National Defense Medical Center, Taipei, TaiwanAim: To review the experience and to evaluate the results of stereotactic body radiation therapy (SBRT via helical tomotherapy (HT, for the treatment of brachytherapy-unsuitable cervical cancer.Methods: Between September 1, 2008 to January 31, 2012, nine cervical cancer patients unsuitable for brachytherapy were enrolled. All of the patients received definitive whole pelvic radiotherapy with or without chemotherapy, followed by SBRT via HT.Results: The actuarial locoregional control rate at 3 years was 78%. The mean biological equivalent dose in 2-Gy fractions of the tumor, rectum, bladder, and intestines was 76.0 ± 7.3, 73.8 ± 13.2, 70.5 ± 10.0, and 43.1 ± 7.1, respectively. Only two had residual tumors after treatment, and the others were tumor-free. Two patients experienced grade 3 acute toxicity: one had diarrhea; and another experienced thrombocytopenia. There were no grade 3 or 4 subacute toxicities. Three patients suffered from manageable rectal bleeding in

  15. Incidence, risk factors, and phenomenological characteristics of postoperative delirium in patients receiving intravenous patient-controlled analgesia: a prospective cohort study

    Directory of Open Access Journals (Sweden)

    Lin YT

    2016-12-01

    Full Text Available Yao Tsung Lin,1 Kuo Mao Lan,1 Li-Kai Wang,1 Chin-Chen Chu,1 Su-Zhen Wu,1 Chia-Yu Chang,2 Jen-Yin Chen1,3 1Department of Anesthesiology, 2Department of Neurology, Chi Mei Medical Center, 3Department of the Senior Citizen Service Management, Chia Nan University of Pharmacy and Science, Tainan, Taiwan Background: Intravenous patient-controlled analgesia (IVPCA is a common method of relieving pain which is a risk factor of postoperative delirium (POD. However, research concerning POD in IVPCA patients is limited. Objective: We aimed to determine the incidence, risk factors, and phenomenological characteristics of POD in patients receiving IVPCA. Methods: A prospective, cohort study was conducted in post-general anesthesia IVPCA patients aged ≥60 years. POD was measured by the Nursing Delirium Screening Scale (NuDESC; 0–10. Delirium, pain severity at rest and/or on movement, and side effects of IVPCA during 3 postoperative days were examined twice-daily by the acute pain service team. Pain severity is measured by an 11-point verbal numerical rating scale (11-point VNRS (0–10. An 11-point VNRS >3 was considered inadequate pain relief. If POD (detected by NuDESC ≥1 is suspected, consulting a neurologist or a psychiatrist to confirm suspected POD is required. Results: In total, 1,608 patients were included. The incidence rate of POD was 2.2%. Age ≥70 years and American Society of Anesthesiologists physical status >III were the risk factors of POD in IVPCA patients. Approximately three-quarters of all POD cases occurred within the first 2 postoperative days. For pain at rest, patients with inadequate pain relief had significantly greater rates of POD than patients with adequate pain relief (day 1, 8.4% vs 1.5%, P<0.001; day 2, 9.6% vs 2.0%, P=0.028; day 3, 4.1% vs 2.1%, P=0.412. However, the incidence of POD was not associated with movement-evoked pain relief. Most (79.9% POD cases in IVPCA patients showed either one or two symptoms. The

  16. Liposome-based polymer complex as a novel adjuvant: enhancement of specific antibody production and isotype switch

    Directory of Open Access Journals (Sweden)

    Chen CH

    2012-02-01

    Full Text Available Chia-Hung Chen1,*, Yu-Ling Lin1,*, Yen-Ku Liu1, Pei-Juin He2, Ching-Min Lin1, Yi-Han Chiu2, Chang-Jer Wu3, Tian-Lu Cheng4, Shih-Jen Liu5,6,**, Kuang-Wen Liao1,2,**1Institute of Molecular Medicine and Bioengineering, 2Department of Biological Science and Technology, National Chiao Tung University, Hsinchu, 3Department of Food Science, National Taiwan Ocean University, Keelung, 4Department of Biomedical Science and Environmental Biology, Kaohsiung Medical University, Kaohsiung, 5National Institute of Infectious Diseases and Vaccinology, National Health Research Institutes, Miaoli, 6Graduate Institute of Immunology, China Medical University, Taichung, Taiwan, , *Chia-Hung Chen and Yu-Ling Lin contributed equally to this work**Kuang-Wen Liao and Shih-Jen Liu contributed equally to this workAbstract: The aim of vaccination is to induce appropriate immunity against pathogens. Antibody-mediated immunity is critical for protection against many virus diseases, although it is becoming more evident that coordinated, multifunctional immune responses lead to the most effective defense. Specific antibody (Ab isotypes are more efficient at protecting against pathogen invasion in different locations in the body. For example, compared to other Ab isotypes, immunoglobulin (Ig A provides more protection at mucosal areas. In this study, we developed a cationic lipopolymer (liposome-polyethylene glycol-polyethyleneimine complex [LPPC] adjuvant that strongly adsorbs antigens or immunomodulators onto its surface to enhance or switch immune responses. The results demonstrate that LPPC enhances uptake ability, surface marker expression, proinflammatory cytokine release, and antigen presentation in mouse phagocytes. In contrast to Freund's adjuvant, LPPC preferentially activates Th1-immunity against antigens in vivo. With lipopolysaccharides or CpG oligodeoxynucleotides, LPPC dramatically enhances the IgA or IgG2A proportion of total Ig, even in hosts that have developed

  17. Clinical effectiveness, toxicity, and failure patterns of helical tomotherapy for postoperative oral cavity cancer patients

    Directory of Open Access Journals (Sweden)

    Hsieh CH

    2014-03-01

    Full Text Available Chen-Hsi Hsieh,1–3 Pei-Wei Shueng,1,4 Li-Ying Wang,5 Li-Jen Liao,6 Yu-Chin Lin,7 Ying-Shiung Kuo,8 Wu-Chia Lo,6 Chien-Fu Tseng,8 Hui-Ju Tien,1 Hsiu-Ling Chou,9,10 Yen-Ping Hsieh,11 Le-Jung Wu,1 Yu-Jen Chen3,12–14 1Department of Radiation Oncology, Far Eastern Memorial Hospital, 2Department of Medicine, 3Institute of Traditional Medicine, School of Medicine, National Yang-Ming University, 4Department of Radiation Oncology, National Defense Medical Center, 5School and Graduate Institute of Physical Therapy, College of Medicine, National Taiwan University, 6Department of Otolaryngology, 7Division of Medical Oncology and Hematology, Department of Internal Medicine, 8Department of Dentistry and Oral Surgery, 9Department of Nursing, Far Eastern Memorial Hospital, 10Department of Nursing, Oriental Institute of Technology, Taipei, 11Department of Senior Citizen Service Management, National Taichung University of Science and Technology, Taichung, 12Department of Radiation Oncology, 13Department of Medical Research, Mackay Memorial Hospital, 14Graduate Institute of Sport Coaching Science, Chinese Culture University, Taipei, Taiwan Background: The outcome of postoperative high- and intermediate-risk oral cavity cancer (OCC patients receiving helical tomotherapy (HT remains limited. Materials and methods: Between November 2006 and November 2012, 53 postoperative high- and intermediate-risk OCC patients treated with HT were enrolled. Results: The 4-year locoregional, local, and regional control rates were 66%, 76.4%, and 94.3%, respectively. The 4-year locoregional control rates of oral tongue and buccal mucosa cancer were 88.3% and 37.1%, respectively (P=0.012. Eleven (20.8% patients experienced locoregional failure. In-field failure occurred in six of 53 (11.3% in the primary area and three of 53 (5.7% in the regional lymph-node area. No marginal failure was noted. Two of 53 (3.8% experienced out-of-field failure. The rates of grade 3 dermatitis

  18. Use of epoxidized natural rubber as a compatibilizer in silica-filled natural rubber tire tread compounds ; Verwendung von epoxydiertem Naturkautschuk als Verträglichkeitsvermittler in Zusammensetzungen aus kieselsäuregefülltem Naturkautschuk für Reifenlaufflächen

    NARCIS (Netherlands)

    Sengloyluan, K.; Sahakaro, Kannika; Noordermeer, Jacobus W.M.

    2012-01-01

    Silica-reinforced natural rubber (NR) tire tread compounds with epoxidized natural rubber (ENR) as a compatibilizer are investigated. ENR contents of 2.5-15.0 phr, with epoxide levels of 10, 38 and 51 mol%, are used. The addition of ENRs, especially ENR-38 and ENR-51, as compatibilizers decreases

  19. 热河生物群凌源东方叶肢介的软体构造及其分类意义%SOFT BODY PRESERVATION IN THE CONCHOSTRACAN EOSESTHERIA LINGYUANENSIS CHEN FROM THE JEHOL BIOTA AND ITS TAXONOMIC SIGNIFICANCE

    Institute of Scientific and Technical Information of China (English)

    沈炎彬

    2011-01-01

    东方叶肢介(Eosestheria)是著名热河生物群中最为常见的一类甲壳动物,关于它的形态、壳瓣结构及微细纹饰特征的研究已相当详尽,但一直没有关于其软体构造的报道。本文描述的凌源东方叶肢介(Eosestheria lingyuanensis)采自辽宁北票市尖山沟村,产于下白垩统义县组的尖山沟夹层。这些软体构造包括:头部形态、眼、闭壳肌痕、雄性执握肢、体节、消化道及尾节等。通过与现生叶肢介软体形态构造比较,显示其与刺尾亚目的蚌壳虫科的代表最为亲近。从而为探讨化石与现生叶肢介之间的演化关系及建立高一级的统一分类,提供了有价值的依据。%The clam shrimp Eosestheria is an extraordinarily abundant and important member of the con-chostracan fauna from the famous Jehol Biota. Here the occurrence of partial soft body preservation in E. Lingyuanensis is reported for the first time, occurring as impressions, inside the valve, of the head, eye, adductor muscle scar, male claspers, digestive tube, and telson.The exceptionally preserved specimens were found in the Lower Cretaceous Yixian Formation at Jianshangou village, near Beipiao, in Liaoning Province of NE China. The preservation of soft parts in conchostracans is significant partly because its occurrence is very rare-known previously only from about 16 species . Worldwide and several of which are actually much less complete than the present material. Soft body characteristics are also important for accurate taxonomic determination and assessment of relationships. For example, all conchostracan males have the first pair of trunk limbs modified to form so called 'claspers', which hold to the female during mating. Some modification of the second pair of trunk limbs is seen in lae-vicaudatan conchostracans, two species of which are also known as fossils with soft body parts, butthe second pair appears not to be clasper-like in form. Eosestheria lingyuanensis on the other hand has two pairs of clearly defined claspers as in spini-caudatan conchostracans. Furthermore in its more distinct growth lines and acute rostrum as well as its two pairs of claspers it clearly belongs to the suborder Spinicaudata. Within that group, although it is similar to the Cyzicidae in its rostrum lacking an apical spine and in its short stout telson, it differs in its less developed occipital notch and larger palp with a row of pores.Although the name Conchostraca is commonly used in fossil and extant literature, recent molecular and morphological analyses show that the 'Conchostraca' appears not to be a monophyletic group. As such it has no taxonomic meaning. It has therefore been abandoned as a taxonomic unit by many authors. However, Shen et al. (2006) retain use of the 'Conchostraca', which include five suborders. Laevicaudata, Spinicaudata, Cycles-therida, Leaiina and Estheriellina. The two latter are distinct extinct groups and their soft bodies were found recently in several specimens. Leaiina with 1-5 radial carina on the carapace valve ranges from the Devonian to Permian and Estheriellina with 3-16 radial costae on the carapace valve appears in the Triassic to Cretaceous interval.

  20. Comments on X. Yin, A. Wen, Y. Chen, and T. Wang, `Studies in an optical millimeter-wave generation scheme via two parallel dual-parallel Mach-Zehnder modulators', Journal of Modern Optics, 58(8), 2011, pp. 665-673

    Science.gov (United States)

    Hasan, Mehedi; Maldonado-Basilio, Ramón; Hall, Trevor J.

    2015-04-01

    Yin et al. have described an innovative filter-less optical millimeter-wave generation scheme for octotupling of a 10 GHz RF oscillator, or sedecimtupling of a 5 GHz RF oscillator using two parallel dual-parallel Mach-Zehnder modulators (DP-MZMs). The great merit of their design is the suppression of all harmonics except those of order ? (octotupling) or all harmonics except those of order ? (sedecimtupling), where ? is an integer. A demerit of their scheme is the requirement to set a precise RF signal modulation index in order to suppress the zeroth order optical carrier. The purpose of this comment is to show that, in the case of the octotupling function, all harmonics may be suppressed except those of order ?, where ? is an odd integer, by the simple addition of an optical ? phase shift between the two DP-MZMs and an adjustment of the RF drive phases. Since the carrier is suppressed in the modified architecture, the octotupling circuit is thereby released of the strict requirement to set the drive level to a precise value without any significant increase in circuit complexity.

  1. 專論/以關鍵詞網絡探討動態性知識管理議題/陳良駒;張正宏 | Exploring Dynamic Knowledge Management Research Issues: A Keyword Network Analysis / Liang-Chu Chen; Jeng-Horng Chang

    Directory of Open Access Journals (Sweden)

    陳良駒、張正宏

    2007-10-01

    Full Text Available

    知識管理是企業邁向知識經濟時代的實務顯學,也是學術界近年來持續探討的重要研究議題。然而知識管理的面向是一種多維度的呈現,如何快速而正確的瞭 解知識管理議題的發展,是許多組織知識工作者及學術研究學者努力的目標。許多學者提出知識管理內容的架構及分類,但卻都是屬於一種由上而下的靜態設計。社 會網絡分析是呈現及量測網絡實體成員互動的技術,適合建構關係網絡的動態性。本文嘗試以關鍵詞網絡來分析國內資訊相關系所從事知識管理研究的主題及脈絡, 並透過關鍵詞的連結來建構一套動態性的知識管理研究範疇。研究成果除驗證知識管理學域中的研究重點,更透過網絡關係來連結多樣性的研究構想,進而提供產官 學界更宏觀且動態的知識管理研究建議。

    Knowledge management (KM is an important practice in a corporation and an essential issue that academic scholars intend to explore continuously in the era of knowledge economy. However, KM presents a variety of perspectives that are still undefined for many knowledge workers and academic researchers. Many scholars propose a few categories and frameworks about KM, but a static outcome. Social network analysis (SNA is a method to present and measure the interaction among network entities and it is suitable to construct the dynamic relationship networks. The purpose of this study is to acquire the research issues and contexts of KM within information-related graduate schools based on a keyword network analysis. Moreover, we build a dynamic KM research network through these linkages with keywords. The results of this study confirm the essential research perspectives in a KM domain and suggest a variety of KM research ideas which provide the industries, governments, and academic communities with a macro and dynamic KM research viewpoint.

    頁次:81-94

  2. Response to the comment by C. Kisielowski, H.A. Calderon, F.R. Chen, S. Helveg, J.R. Jinschek, P. Specht, D. Van Dyck on the article "On the influence of the electron dose-rate on the HRTEM image contrast" by J. Barthel, M. Lentzen, A. Thust, Ultramicroscopy 176 (2017) 37-45.

    Science.gov (United States)

    Barthel, Juri; Lentzen, Markus; Thust, Andreas

    2017-08-01

    In a recent article [1] we examined the influence of the applied electron dose rate on the magnitude of the image contrast in high-resolution transmission electron microscopy (HRTEM). We concluded that the magnitude of the image contrast is not substantially affected by the applied electron dose rate. This result is in obvious contradiction to numerous earlier publications by Kisielowski and coworkers [2-7], who commented our recent article due to this contradiction. The present short communication is a response to the comment of Kisielowski and coworkers on our recent article, where we provide additional arguments supporting our initial findings and conclusions on the magnitude of the image contrast in HRTEM. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. 實徵研究/國小教師以CREATER模式推動資訊素養創新課程之歷程/謝佩紋;林菁|The Process of Elementary School Teachers Implementing an Innovation Curriculum of Information Literacy with CREATER Model/Pei-Wen Hsieh; Lin Ching Chen

    Directory of Open Access Journals (Sweden)

    謝佩紋、林菁 Pei-Wen Hsieh; Lin Ching Chen

    2009-04-01

    Full Text Available 本研究旨在探究國小教師推動資訊素養創新課程的歷程,並以CREATER革新模式的七個階段為架構,深入瞭解教師作為創新推動者在每個階段的經歷及結果,以提供有意推動資訊素養理念或其它創新的教育工作者參考。本研究採個案研究,以南部一所國小為研究個案,研究時間歷時一年半,透過觀察、訪談、文件分析等方法進行資料的蒐集。研究結果發現,國小教師推動資訊素養課程的歷程大致與CREATER模式的七個階段相符,但「關心」、「連結」與「檢視」階段並無明顯次序,教師以組織內成員的角色推動創新,能有效地將創新理念化為行動,但行動能否持續及發揮效果,還有賴團隊組成的完整性、教師的持續更新力及組織內掌握實權者的支持與參與。The purpose of this study was to explore the change process of implementing an information literacy curriculum by elementary school teachers. Based on the CREATER model, this study investigated the teachers’ experiences as change agents in each stage of the process. The research results could provide guidelines for educators who are devoted to promote the information literacy or other innovations. The method of case study was used to design this study. The subjects of this study were the teachers who voluntarily implemented the information literacy curriculum in an elementary school in the southern part of Taiwan. The methods for collecting research data were observations, interviews, and document analyses. The research results showed that the change process of implementing the information literacy curriculum corresponded to the seven stages of the CREATER model. However, the stages of “care,” “relate,” and “examine,” did not obviously happen in sequence. As members of the organization, the teachers could transform effectively the innovative concept into an action, but whether the innovation could be persistent depended on team relationships, teachers’ self-renewal capacity, and approvals and participation of the leaders who really managed the organization.頁次:70-89

  4. Fortschritt als Fraktur im frühen Science Fiction Film. Metaphorologische Überlegungen zu Auf- und Einbrüchen in LE VOYAGE DANS LA LUNE und LE VOYAGE À TRAVERS L`IMPOSSIBLE von G. Méliès

    Directory of Open Access Journals (Sweden)

    Hartmann, Jörg

    2009-09-01

    Full Text Available Fantasies of man travelling into space form a main part of the popular movie genre ‘Science Fiction’. These celluloid visions are not only fantasies of improving transport, they also convey a meaning in a figurative sense. They can be seen as a modern adoption of one of humanities oldest metaphors, ‘life as a sea fare voyage’: the meaning, which was once expressed by this ‘nautical metaphor’, has been transferred and can nowadays be found in films, which show astro-nauts crossing the frontier from known space into the unknown space. In order to conclude on their attitude towards technological progress in the early 20th century, the two oldest space travel movies, Le Voyage dans la Lune (F 1902 and Le Voyage a Travers L’Impossible (F 1904 will be analyzed.

  5. Web Usability Policies/Standards/Guidelines Do Not Influence Practices at ARL Academic Libraries. A Review of: Chen, Yu‐Hui, Carol Anne Germain and Huahai Yang. “An Exploration into the Practices of Library Web Usability in ARL Academic Libraries.” Journal of the American Society for Information Science and Technology 60.5 (2009: 953‐68.

    Directory of Open Access Journals (Sweden)

    Shandra Protzko

    2009-12-01

    Full Text Available Objective – To survey the current status of Web usability Policies/Standards/Guidelines (PSGs found in academic libraries of the Association of Research Libraries (ARL. Researchers sought to investigate whether PSGs are in place, the levels of difficulty surrounding implementation, the impact of PSGs on design, testing, and resource allocation, and the relationship between ARL ranking and usability practice or PSGs.Design – Survey.Setting – North America.Subjects – Academic libraries of the ARL.Methods – An 18‐question survey consisting of multiple choice, Likert scale, and open‐ended questions was sent to all 113 ARL libraries in November 2007. Survey recipients were selected as the person in charge of Web site usability by visiting library Web sites and phone inquiry. The survey was concluded in January 2008 with a response rate of 74% (84 institutions. The researchers used t‐test to detect any difference in ARL library ranking between libraries with and without PSGs. Pair‐wise t‐tests were conducted to identify gaps in difficulty implementing PSGs. In addition, they used Pearson’s Correlation to investigate any significant correlations between variables such as ARL rank and resource allocation.Main Results – Of the 84 respondents, 34 (40% have general library Web PSGs and 25 (30% have specific usability PSGs; 41 (49% have at least one type of in‐library PSG. Of the 43 (51% libraries that do not have PSGs, 30 (36% are at universities with institutional Web usability PSGs; 26 (87% follow those guidelines. There was no statistically significant relationship between ARL ranking and PSG status (see Table 1. The authors asked about difficulty in implementing PSGs. Of the 32 libraries responding to a question about general library Web PSGs, most had slight or moderate difficulty. Twenty‐three libraries with specific usability PSGs identified difficulty levels; some had no difficulty, but a majority had moderate difficulty. For the 26 libraries using institutional Web usability PSGs, most had no or slight difficulty. Pair‐wise t‐tests showed that library Web usability PSGs were significantly more difficult to implement than university Web usability PSGs. Enforcement/agreement issues were reported as the primary difficulty in implementing in‐library PSGs. Technical issues and ambiguity were obstacles at the institutional level. More than half of the 84 libraries have Web advisory committees and about one third have usability committees or Web usability subcommittees. Several libraries answered that they have none of these committees, but indicated that they have some sort of ad hoc committee or user study group to address usability issues. Of the 84 respondents, 71 (85% have conducted usability testing. Sixty‐two libraries (73.8% rated usability testing as important, very important, or extremely important: the rate given for the importance of usability testing did not correlate with ARL ranking. Cited most often in open ended questioningwere the importance of iterative testing, library wide buy‐in, and staff and resource availability. Main web pages were tested most frequently. Fifty‐three libraries (74.6% tested their lower level pages at least once. OPACs were tested the least often. The amount of testing was impacted neither by the existence of library Web PSGs nor usability PSGs. The top two testing methods were in‐person observation and think aloud protocol.Of the 84 libraries, 24 (28% reported having staff dedicated to Web usability issues; twenty full‐time staff and four part‐time staff. There was a weak association between ARL ranking and hours worked by dedicated staff; no association existed for regular staff who take on Web responsibilities. Fifty‐one (60% of libraries had regular staff whose duties included Web usability; forty‐six full‐time and five part‐time. Training did not correlate to amount of testing methods used. There was a weak link between ALR ranking and availability of resources and, the authors showed, more testing was done as resources increased. In response to a query about future Web usability plans, the focus was on usability testing and site redesign, with only three libraries planning to refine or establish usability PSGs.Conclusion – The authors hypothesized that “web usability PSGs would influence usability practice within libraries and other institutions” (953. The data show that PSGs do not influence practices. The authors conclude that there is no significant relationship between PSGs and testing practices or PSGs and the availability of resources. Likewise, ARL ranking had no effect on the establishment of usability PSGs. Most libraries are conducting usability testing, and there was a weak link between ARL ranking and availability of testing resources. Highlighted in the open‐ended questions is the lack of usability expertise among stakeholders. Workload, inadequate human resources, and lack of organizational cohesion are also cited as barriers to the adoption of Web usability PSGs. The authors speculate that Web professionals likely use their own working knowledge and internalized guidelines without having formal documentation. The authors further speculate that the difficulty related to creating mental models that adequately represent library tasks may hinder the use of formal usability PSGs. Additionally, libraries may not regard the lack of usability PSGs as a liability, especially in light of the lack of government mandates or standards. The authors recommend educational efforts for key players on the value of Web usability, support for hiring dedicated staff, and formal documentation to guide design practice. The authors plan to compare the collected PSGs in an upcoming project. Future research could focus on non‐ARL libraries, the relationship between PSGs and user experience, and Content Management System (CMS usability characteristics.

  6. Endothelial cell SHP-2 negatively regulates neutrophil adhesion and promotes transmigration by enhancing ICAM-1-VE-cadherin interaction.

    Science.gov (United States)

    Yan, Meiping; Zhang, Xinhua; Chen, Ao; Gu, Wei; Liu, Jie; Ren, Xiaojiao; Zhang, Jianping; Wu, Xiaoxiong; Place, Aaron T; Minshall, Richard D; Liu, Guoquan

    2017-11-01

    Intercellular adhesion molecule-1 (ICAM-1) mediates the firm adhesion of leukocytes to endothelial cells and initiates subsequent signaling that promotes their transendothelial migration (TEM). Vascular endothelial (VE)-cadherin plays a critical role in endothelial cell-cell adhesion, thereby controlling endothelial permeability and leukocyte transmigration. This study aimed to determine the molecular signaling events that originate from the ICAM-1-mediated firm adhesion of neutrophils that regulate VE-cadherin's role as a negative regulator of leukocyte transmigration. We observed that ICAM-1 interacts with Src homology domain 2-containing phosphatase-2 (SHP-2), and SHP-2 down-regulation via silencing of small interfering RNA in endothelial cells enhanced neutrophil adhesion to endothelial cells but inhibited neutrophil transmigration. We also found that VE-cadherin associated with the ICAM-1-SHP-2 complex. Moreover, whereas the activation of ICAM-1 leads to VE-cadherin dissociation from ICAM-1 and VE-cadherin association with actin, SHP-2 down-regulation prevented ICAM-1-VE-cadherin association and promoted VE-cadherin-actin association. Furthermore, SHP-2 down-regulation in vivo promoted LPS-induced neutrophil recruitment in mouse lung but delayed neutrophil extravasation. These results suggest that SHP-2- via association with ICAM-1-mediates ICAM-1-induced Src activation and modulates VE-cadherin switching association with ICAM-1 or actin, thereby negatively regulating neutrophil adhesion to endothelial cells and enhancing their TEM.-Yan, M., Zhang, X., Chen, A., Gu, W., Liu, J., Ren, X., Zhang, J., Wu, X., Place, A. T., Minshall, R. D., Liu, G. Endothelial cell SHP-2 negatively regulates neutrophil adhesion and promotes transmigration by enhancing ICAM-1-VE-cadherin interaction. © FASEB.

  7. Dysfunction of different cellular degradation pathways contributes to specific β-amyloid42-induced pathologies.

    Science.gov (United States)

    Ji, Xuan-Ru; Cheng, Kuan-Chung; Chen, Yu-Ru; Lin, Tzu-Yu; Cheung, Chun Hei Antonio; Wu, Chia-Lin; Chiang, Hsueh-Cheng

    2018-03-01

    The endosomal-lysosomal system (ELS), autophagy, and ubiquitin-proteasome system (UPS) are cellular degradation pathways that each play a critical role in the removal of misfolded proteins and the prevention of the accumulation of abnormal proteins. Recent studies on Alzheimer's disease (AD) pathogenesis have suggested that accumulation of aggregated β-amyloid (Aβ) peptides in the AD brain results from a dysfunction in these cellular clearance systems. However, the specific roles of these pathways in the removal of Aβ peptides and the pathogenesis underlying AD are unclear. Our in vitro and in vivo genetic approaches revealed that ELS mainly removed monomeric β-amyloid42 (Aβ42), while autophagy and UPS clear oligomeric Aβ42. Although overproduction of phosphatidylinositol 4-phosphate-5 increased Aβ42 clearance, it reduced the life span of Aβ42 transgenic flies. Our behavioral studies further demonstrated impaired autophagy and UPS-enhanced Aβ42-induced learning and memory deficits, but there was no effect on Aβ42-induced reduction in life span. Results from genetic fluorescence imaging showed that these pathways were damaged in the following order: UPS, autophagy, and finally ELS. The results of our study demonstrate that different degradation pathways play distinct roles in the removal of Aβ42 aggregates and in disease progression. These findings also suggest that pharmacologic treatments that are designed to stimulate cellular degradation pathways in patients with AD should be used with caution.-Ji, X.-R., Cheng, K.-C., Chen, Y.-R., Lin, T.-Y., Cheung, C. H. A., Wu, C.-L., Chiang, H.-C. Dysfunction of different cellular degradation pathways contributes to specific β-amyloid42-induced pathologies.

  8. Purification and in vitro antioxidant activities of tellurium-containing phycobiliproteins from tellurium-enriched Spirulina platensis

    Directory of Open Access Journals (Sweden)

    Yang F

    2014-10-01

    Full Text Available Fang Yang,1 Ka-Hing Wong,2 Yufeng Yang,3 Xiaoling Li,1 Jie Jiang,1 Wenjie Zheng,1 Hualian Wu,1 Tianfeng Chen1 1Department of Chemistry, Jinan University, Guangzhou, People’s Republic of China; 2Department of Applied Biology and Chemical Technology, The Hong Kong Polytechnic University, Hong Kong, People’s Republic of China; 3Institute of Hydrobiology, College of Life Science and Technology, Jinan University, Guangzhou, People’s Republic of China Abstract: Tellurium-containing phycocyanin (Te-PC and allophycocyanin (Te-APC, two organic tellurium (Te species, were purified from tellurium-enriched Spirulina platensis by a fast protein liquid chromatographic method. It was found that the incorporation of Te into the peptides enhanced the antioxidant activities of both phycobiliproteins. With fractionation by ammonium sulfate precipitation and hydroxylapatite chromatography, Te-PC and Te-APC could be effectively separated with high purity, and Te concentrations were 611.1 and 625.3 µg g-1 protein in Te-PC and Te-APC, respectively. The subunits in the proteins were identified by using MALDI-TOF-TOF mass spectrometry. Te incorporation enhanced the antioxidant activities of both phycobiliproteins, as examined by 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid assay. Moreover, Te-PC and Te-APC showed dose-dependent protection on erythrocytes against the water-soluble free radical initiator 2,2'-azo(2-asmidinopropanedihydrochloride-induced hemolysis. In the hepatoprotective model, apoptotic cell death and nuclear condensation induced by tert-butyl hydroperoxide in HepG2 cells was significantly attenuated by Te-PC and Te-APC. Taken together, these results suggest that Te-PC and Te-APC are promising Te-containing proteins with application potential for treatment of diseases related to oxidative stress. Keywords: tellurium, phycocyanin, allophycocyanin, purification, antioxidant activity

  9. Platelet–lymphocyte ratios: a potential marker for pulmonary tuberculosis diagnosis in COPD patients

    Directory of Open Access Journals (Sweden)

    Chen G

    2016-11-01

    Full Text Available Guozhong Chen, Chunling Wu, Zhiying Luo, Yiming Teng, Suping Mao Department of Respiratory Medicine, Yiwu Central Hospital, Yiwu, Zhejiang Province, People’s Republic of China Background: In recent decades, morbidity and mortality have been found to be significantly increased in patients with chronic obstructive pulmonary disease (COPD complicated with pulmonary tuberculosis (PTB. Platelet–lymphocyte ratio (PLR is an indicator for inflammatory diseases. This study aims to investigate whether PLR could act as a potential marker for patients with COPD complicated with PTB.Methods: In this retrospective study, laboratory characteristics of 87 COPD patients complicated with PTB (determined by Mycobacterium tuberculosis positive culture from sputum or bronchial lavage fluid and 83 COPD patients (as the control group, determined by M. tuberculosis culture negativity from sputum or bronchial lavage fluid were investigated. Data obtained on the day of admission were analyzed.Results: PLR >216.82 was identified as the optimal cutoff value for discriminating COPD patients with PTB (sensitivity 92.4%, specificity 84.5%, positive-predictive value 91.6%, negative-predictive value 86.2%, and area under the curve [AUC] was 0.87 from patients with COPD alone. The AUC of PLR was significantly greater than that of neutrophil–lymphocyte count ratio (AUC, 0.74; 95% confidence interval, 0.67–0.81; P<0.01.Conclusion: PLR could be developed as a valuable maker for identifying tuberculosis infection in COPD patients. Keywords: platelet to lymphocyte ratio, pulmonary tuberculosis, chronic obstructive pulmonary disease

  10. Association between muscle atrophy/weakness and health care costs and utilization among patients receiving total knee replacement surgery: a retrospective cohort study

    Directory of Open Access Journals (Sweden)

    Chen SY

    2013-08-01

    Full Text Available Shih-Yin Chen,1 Ning Wu,1 Yuan-Chi Lee,1 Yang Zhao21Health Economics and Epidemiology, Evidera, Lexington, Massachusetts, 2Health Economics and Outcomes Research, Novartis Pharmaceuticals Corporation, East Hanover, New Jersey, USAPurpose: The aim of the study reported here was to examine health care resource utilization, costs, and risk of rehospitalization for total knee replacement (TKR patients with and without muscle atrophy/weakness (MAW.Patients and methods: Individuals aged 50–64 years with commercial insurance or 65+ years with Medicare Supplemental Insurance (Medicare who had a hospitalization for TKR between January 1, 2006 and September 30, 2009 were identified from a large US claims database. First hospitalization for TKR was defined as the index stay. All patients were classified into three cohorts according to when MAW was diagnosed relative to TKR: pre-MAW, post-MAW, and no MAW. The association between MAW and health care costs over the 12-month post-index period and the probability of rehospitalization were assessed via multivariate regressions.Results: The study sample included 53,696 Medicare and 46,058 commercial insurance TKR patients. Controlling for cross-cohort differences, both the pre- and post-MAW cohorts had significantly higher total health care costs (Medicare US$4,201 and US$9,404 higher, commercial insurance US$2,737 and US$6,640 higher, respectively than the no MAW cohort (all P < 0.05. The post-MAW cohort in both populations was also more likely to have any all-cause or replacement-related rehospitalization compared with the no MAW cohort.Conclusion: Among US patients undergoing TKR, those with MAW had higher health care utilization and costs than patients without MAW.Keywords: rehospitalization, resource utilization, Medicare, health insurance, USA

  11. The History, Status, Gaps, and Future Directions of Neurotoxicology in China.

    Science.gov (United States)

    Cai, Tongjian; Luo, Wenjing; Ruan, Diyun; Wu, Yi-Jun; Fox, Donald A; Chen, Jingyuan

    2016-06-01

    Rapid economic development in China has produced serious ecological, environmental, and health problems. Neurotoxicity has been recognized as a major public health problem. The Chinese government, research institutes, and scientists conducted extensive studies concerning the source, characteristics, and mechanisms of neurotoxicants. This paper presents, for the first time, a comprehensive history and review of major sources of neurotoxicants, national bodies/legislation engaged, and major neurotoxicology research in China. Peer-reviewed research and pollution studies by Chinese scientists from 1991 to 2015 were examined. PubMed, Web of Science and Chinese National Knowledge Infrastructure (CNKI) were the major search tools. The central problem is an increased exposure to neurotoxicants from air and water, food contamination, e-waste recycling, and manufacturing of household products. China formulated an institutional framework and standards system for management of major neurotoxicants. Basic and applied research was initiated, and international cooperation was achieved. The annual number of peer-reviewed neurotoxicology papers from Chinese authors increased almost 30-fold since 2001. Despite extensive efforts, neurotoxicity remains a significant public health problem. This provides great challenges and opportunities. We identified 10 significant areas that require major educational, environmental, governmental, and research efforts, as well as attention to public awareness. For example, there is a need to increase efforts to utilize new in vivo and in vitro models, determine the potential neurotoxicity and mechanisms involved in newly emerging pollutants, and examine the effects and mechanisms of mixtures. In the future, we anticipate working with scientists worldwide to accomplish these goals and eliminate, prevent and treat neurotoxicity. Cai T, Luo W, Ruan D, Wu YJ, Fox DA, Chen J. 2016. The history, status, gaps, and future directions of neurotoxicology in

  12. Research on simulation and experiment of noninvasive intracranial pressure monitoring based on acoustoelasticity effects

    Directory of Open Access Journals (Sweden)

    Wu J

    2013-08-01

    Full Text Available Jun Wu1, Wei He2, Wei-min Chen1, Lian Zhu21Key Laboratory of Optoelectronic Technology and Systems, 2State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing, People’s Republic of ChinaAbstract: The real-time monitoring of intracranial pressure (ICP is very important for craniocerebrally critically ill patients, but it is very difficult to realize long-time monitoring for the traditional invasive method, which very easily infects patients. Many noninvasive methods have emerged, but these have not been able to monitor ICP for long periods in real time, and they are not ready for clinical application. In order to realize long-time, online, real-time, noninvasive monitoring for ICP, a new method based on acoustoelasticity of ultrasound is herein proposed. Experimental models were devised to research the new method for experiment and simulation. Polymethyl methacrylate and hydrogel were adopted for the experiment, and their mechanical properties were very close to the real brain. A numerical solution for acoustoelasticity theory was acquired by simulating calculation based on a finite-element method. This was compared to the experimental value. The results showed a consistent match between theoretical solution and experimental value, with maximum error at most 5%. Thus, the effectiveness of the new method was verified. Theoretical and practical foundation is provided for this new method, and it could be used for animal experimentation or clinical testing in further research.Keywords: medical instruments, noninvasive, intracranial pressure, ultrasonic, acoustoelasticity, biomechanics

  13. A novel imidazopyridine derivative, X22, attenuates sepsis-induced lung and liver injury by inhibiting the inflammatory response in vitro and in vivo

    Directory of Open Access Journals (Sweden)

    Ge X

    2016-06-01

    Full Text Available Xiangting Ge,1,2,* Zhiguo Feng,1,* Tingting Xu,2 Beibei Wu,3 Hongjin Chen,1 Fengli Xu,3 Lili Fu,1 Xiaoou Shan,3 Yuanrong Dai,2 Yali Zhang,1 Guang Liang11Chemical Biology Research Center, School of Pharmaceutical Sciences, 2Department of Pulmonary Medicine, The 2nd Affiliated Hospital, 3Department of Pediatrics, The 2nd Affiliated Hospital, Wenzhou Medical University, Wenzhou, People’s Republic of China*These authors contributed equally to this workAbstract: Sepsis remains a leading cause of death worldwide. Despite years of extensive research, effective drugs to treat sepsis in the clinic are lacking. In this study, we found a novel imidazopyridine derivative, X22, which has powerful anti-inflammatory activity. X22 dose-dependently inhibited lipopolysaccharide (LPS-induced proinflammatory cytokine production in mouse primary peritoneal macrophages and RAW 264.7 macrophages. X22 also downregulated the LPS-induced proinflammatory gene expression in vitro. In vivo, X22 exhibited a significant protection against LPS-induced death. Pretreatment or treatment with X22 attenuated the sepsis-induced lung and liver injury by inhibiting the inflammatory response. In addition, X22 showed protection against LPS-induced acute lung injury. We additionally found that pretreatment with X22 reduced the inflammatory pain in the acetic acid and formalin models and reduced the dimethylbenzene-induced ear swelling and acetic acid-increased vascular permeability. Together, these data confirmed that X22 has multiple anti-inflammatory effects and may be a potential therapeutic option in the treatment of inflammatory diseases.Keywords: LPS, imidazopyridine derivative, sepsis, acute lung injury, inflammation

  14. Propylthiouracil-induced liver failure and artificial liver support systems: a case report and review of the literature

    Directory of Open Access Journals (Sweden)

    Wu DB

    2017-01-01

    Full Text Available Dong-Bo Wu,1,2 En-Qiang Chen,1,2 Lang Bai,1,2 Hong Tang1,2 1Center of Infectious Diseases, West China Hospital of Sichuan University, 2Division of Molecular Biology of Infectious Diseases, State Key Laboratory of Biotherapy, Sichuan University, Chengdu, People’s Republic of China Background: Antithyroid drugs carry a potential risk of hepatotoxicity. Propylthiouracil (PTU is commonly prescribed for patients with hyperthyroidism. PTU, however, can induce liver injury, ranging from mild asymptomatic elevation of aminotransferases to acute liver failure (ALF.Case presentation: This case reports on a 16-year-old Chinese girl with hyperthyroidism, who was admitted to our hospital for jaundice, nausea, and fatigue associated with severe hyperbilirubinemia and coagulopathy. She had been prescribed PTU 5 months earlier. There was no history of hypersensitivity to drugs, viral liver diseases, blood transfusion, or surgery. On the basis of her symptoms and the clinical data, she was diagnosed with PTU-induced ALF. Due to the limited number of available donor organs for liver transplantation, she was started on treatment with artificial liver support system (ALSS. After four sessions of ALSS, her clinical signs and symptoms were found to be markedly improved, and she was discharged 25 days after admission. Four months later, her liver function normalized.Conclusion: Although PTU-induced liver failure is rare in clinical practice, liver function should be appropriately monitored during treatment with PTU. PTU-induced ALF in this patient was successfully managed with an ALSS, suggesting that the latter may be an alternative to liver transplantation. Keywords: propylthiouracil, liver injury, acute liver failure, artificial liver support systems 

  15. Possible association between phantom vibration syndrome and occupational burnout

    Directory of Open Access Journals (Sweden)

    Chen CP

    2014-12-01

    Full Text Available Chao-Pen Chen,1 Chi-Cheng Wu,2 Li-Ren Chang,3 Yu-Hsuan Lin4 1Department of Education, National Taiwan University Hospital, 2Department of Family Medicine, Min-Sheng General Hospital, Taoyuan City, 3Department of Psychiatry, National Taiwan University, College of Medicine, 4Institute of Brain Science, National Yang-Ming University, Taipei, Taiwan Background: Phantom vibration syndrome (PVS and phantom ringing syndrome (PRS occur in many cell phone users. Previous studies have indicated an association between PVS/PRS and job stress. The aim of this study was to determine if PVS/PRS were also associated with occupational burnout.Methods: This was a cross-sectional study of 384 employees of a high-tech company in northern Taiwan. They all completed a phantom vibration and ringing questionnaire, the Hospital Anxiety and Depression Scale, and the Chinese version of the Occupational Burnout Inventory.Results: Significantly more women and people with at least a college education were in the population with PRS and PVS, respectively. Anxiety and depression had no associations with PVS/PRS. Higher scores for personal fatigue, job fatigue, and service target fatigue had an independent impact on the presence of PVS, but only a higher score for service target fatigue had an independent impact on the presence of PRS.Conclusion: The independent association between work-related burnout and PVS/PRS suggests that PVS/PRS may be a harbinger of mental stress or a component of the clinical burnout syndrome, and may even be a more convenient and accurate predictor of occupational burnout. Keywords: phantom vibration syndrome, phantom ringing syndrome, occupational burnout

  16. Elliptic Curve Integral Points on y2 = x3 + 3x ‑ 14

    Science.gov (United States)

    Zhao, Jianhong

    2018-03-01

    The positive integer points and integral points of elliptic curves are very important in the theory of number and arithmetic algebra, it has a wide range of applications in cryptography and other fields. There are some results of positive integer points of elliptic curve y 2 = x 3 + ax + b, a, b ∈ Z In 1987, D. Zagier submit the question of the integer points on y 2 = x 3 ‑ 27x + 62, it count a great deal to the study of the arithmetic properties of elliptic curves. In 2009, Zhu H L and Chen J H solved the problem of the integer points on y 2 = x 3 ‑ 27x + 62 by using algebraic number theory and P-adic analysis method. In 2010, By using the elementary method, Wu H M obtain all the integral points of elliptic curves y 2 = x 3 ‑ 27x ‑ 62. In 2015, Li Y Z and Cui B J solved the problem of the integer points on y 2 = x 3 ‑ 21x ‑ 90 By using the elementary method. In 2016, Guo J solved the problem of the integer points on y 2 = x 3 + 27x + 62 by using the elementary method. In 2017, Guo J proved that y 2 = x 3 ‑ 21x + 90 has no integer points by using the elementary method. Up to now, there is no relevant conclusions on the integral points of elliptic curves y 2 = x 3 + 3x ‑ 14, which is the subject of this paper. By using congruence and Legendre Symbol, it can be proved that elliptic curve y 2 = x 3 + 3x ‑ 14 has only one integer point: (x, y) = (2, 0).

  17. Female Contributions in Nuclear Science: Experiences at the Brazilian Commission for Nuclear Energy (CNEN/LAPOC)

    International Nuclear Information System (INIS)

    Carrijo da Silva Dias, D.; Leandro Bonifácio, R.; Augusto da Silva Alfenas, R.

    2015-01-01

    Female professional contributions in nuclear science and technology are no longer a novelty. Names such as Marie Curie, Chen Shiung Wu and Rosalyn Yalow are evidence of the incessant, worldwide efforts of women to take part in fields largely reserved for men. Although society has witnessed high level female achievements as early as in the 1800s, female scientists and technicians still face a long journey ahead in empowering themselves into full and equal participation in these areas. Today, the Laboratory of Poços de Caldas of the Brazilian Commission for Nuclear Energy (CNEN/LAPOC) experiences a process of women empowerment at all levels of the institution. At the Technical Section, two of the seven research departments are headed by female researchers who play essential roles in the institution’s quest for excellence. Today, their work include coordination of a major environmental research project involving most researchers at LAPOC, successful participations on international intercomparisons of radiometric analysis and development of new methodologies in nuclear field applications. At the administrative level, female collaborators lead the Administration Section, improving several aspects of internal management, promoting further interaction at the workplace and strengthening cooperation among all departments. Regarding the capacitation level, the Commission has a long tradition of welcoming students and junior researchers through institutional programmes of training and collaboration in several projects. Today CNEN/LAPOC works with twenty scholarship grantees — half of which are women. Not only the Laboratory has reached equality in participation, but unarguably the female participants have demonstrated the most remarkable achievements among the group, attested by their continuous academic pursuit through Master’s and Doctoral degrees, full collaboration in scientific publishing and attendance in training programmes at international level. The purpose

  18. Effect of magnetic nanoparticles on apoptosis and cell cycle induced by wogonin in Raji cells

    Directory of Open Access Journals (Sweden)

    Wang XM

    2012-02-01

    Full Text Available Lei Wang1,2,*, Haijun Zhang1,2,*, Baoan Chen1,2, Guohua Xia1,2, Shuai Wang1,2, Jian Cheng1,2, Zeye Shao1,2, Chong Gao1,2, Wen Bao1,2, Liang Tian1,2, Yanyan Ren1,2, Peipei Xu1,2, Xiaohui Cai1,2, Ran Liu1,2, Xuemei Wang3 1Department of Hematology and Oncology, Zhongda Hospital, Medical School, 2Faculty of Oncology, Medical School, 3State Key Laboratory of Bioelectronics (Chien-Shiung Wu Laboratory, Southeast University, Nanjing, China*These authors contributed equally to this workAbstract: Traditional Chinese medicine is gradually becoming a new source of anticancer drugs. One such example is wogonin, which is cytotoxic to various cancer cell lines in vitro. However, due to its low water solubility, wogonin is restricted to clinical administration. Recently, the application of drug-coated magnetic nanoparticles (MNPs to increase water solubility of the drug and to enhance its chemotherapeutic efficiency has attracted much attention. In this study, wogonin was conjugated with the drug delivery system of MNPs by mechanical absorption polymerization to fabricate wogonin-loaded MNPs. It was demonstrated that MNPs could strengthen wogonin-induced cell inhibition, apoptosis, and cell cycle arrest in Raji cells by methylthiazol tetrazolium assay, flow cytometer assay, and nuclear 4',6-diamidino-2-phenylindole staining. Furthermore, the molecular mechanisms of these phenomena were explored by western blot, in which the protein levels of caspase 8 and caspase 3 were increased significantly while those of survivin and cyclin E were decreased significantly in wogonin-MNPs group. These findings suggest that the combination of wogonin and MNPs provides a promising strategy for lymphoma therapy.Keywords: wogonin, magnetic nanoparticles, Raji cell, apoptosis, cell cycle, caspase 8, caspase 3, survivin, cyclin E

  19. The preparation and characterization of gold-conjugated polyphenol nanoparticles as a novel delivery system

    Directory of Open Access Journals (Sweden)

    Hsieh DS

    2012-03-01

    Full Text Available Dar-Shih Hsieh1,2, Hsiu-Chin Lu5, Cheng-Cheung Chen1,3, Chang-Jer Wu1,*, Ming-Kung Yeh4,* 1Department of Food Science, National Taiwan Ocean University, Keelung, Taiwan; 2Division of Urology, 3Department of Pathology, Tri-Service General Hospital, 4Institute of Preventive Medicine, National Defence Medical Center, Taipei, Taiwan; 5Department of Laboratory Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan*These authors contributed equally to this workAbstract: Nanogold particles are commonly used in nanomedicine. We generated physical nanogold (pNG conjugated with different ratios of epigallocatechin-3-gallate (EGCG and evaluated its physicochemical properties, antioxidant activity, and cytotoxicity in vitro as well as anticancer activity in vivo. Results showed that the EGCG-pNG conjugates were successfully prepared at ratios between 23:1 and 23:5, with the percentage of EGCG content increasing with the EGCG:pNG ratio from 23:1 (2.0% ± 0.02% to 23:5 (28% ± 0.3%. EGCG-pNG particles at ratios of 23:1 and 23:5 demonstrated significantly decreased size from 500 to 20 nm and decreasing zeta potentials of 21 mV to –22 mV, respectively. At a ratio of 23:2.5, the EGCG-pNG particles (27% EGCG, 50 nm in size, zeta potential of –8 mV showed longer EGCG activity half-life (110 days vs 5 hours, controlled release (2 hours vs 30 minutes, and higher antioxidant activity (four times, as well as inhibition of tumor cell growth, than controls. The present study indicated that EGCG-pNG possesses promising therapeutic potential, based on its strong free-radical scavenging and anticancer activities.Keywords: EGCG, nanoparticles, antioxidant, antitumor activity, nanogold

  20. Insights into the therapeutic potential of hypoxia-inducible factor-1α small interfering RNA in malignant melanoma delivered via folate-decorated cationic liposomes

    Directory of Open Access Journals (Sweden)

    Chen Z

    2016-03-01

    Full Text Available Zhongjian Chen,1,* Tianpeng Zhang,2,* Baojian Wu,2 Xingwang Zhang2 1Department of Pharmaceutics, Shanghai Dermatology Hospital, 2Division of Pharmaceutics, College of Pharmacy, Jinan University, Gangzhou, People’s Republic of China *These authors contributed equally to this work Abstract: Malignant melanoma (MM represents the most dangerous form of skin cancer, and its incidence is expected to rise in the coming time. However, therapy for MM is limited by low topical drug concentration and multidrug resistance. This article aimed to develop folate-decorated cationic liposomes (fc-LPs for hypoxia-inducible factor-1α (HIF-1α small interfering (siRNA delivery, and to evaluate the potential of such siRNA/liposome complexes in MM therapy. HIF-1α siRNA-loaded fc-LPs (siRNA-fc-LPs were prepared by a film hydration method followed by siRNA incubation. Folate decoration of liposomes was achieved by incorporation of folate/oleic acid-diacylated oligochitosans. The resulting siRNA-fc-LPs were 95.3 nm in size with a ζ potential of 2.41 mV. The liposomal vectors exhibited excellent loading capacity and protective effect toward siRNA. The in vitro cell transfection efficiency was almost parallel to the commercially available Lipofectamine™ 2000. Moreover, the anti-melanoma activity of HIF-1α siRNA was significantly enhanced through fc-LPs. Western blot analysis and apoptosis test demonstrated that siRNA-fc-LPs substantially reduced the production of HIF-1α-associated protein and induced the apoptosis of hypoxia-tolerant melanoma cells. Our designed liposomal vectors might be applicable as siRNA delivery vehicle to systemically or topically treat MM. Keywords: malignant melanoma, HIF-1α siRNA, chitosan, cationic liposomes, gene therapy

  1. Combining structure-based pharmacophore modeling, virtual screening, and in silico ADMET analysis to discover novel tetrahydro-quinoline based pyruvate kinase isozyme M2 activators with antitumor activity

    Directory of Open Access Journals (Sweden)

    Chen C

    2014-09-01

    Full Text Available Can Chen,1,2,* Ting Wang,1,3,* Fengbo Wu,1,* Wei Huang,4 Gu He,1 Liang Ouyang,1 Mingli Xiang,1 Cheng Peng,4 Qinglin Jiang1,2 1State Key Laboratory of Biotherapy and Department of Pharmacy, West China Hospital, Sichuan University, Chengdu, 2College of Pharmacy and the First Affiliated Hospital, Chengdu Medical College, Chengdu, 3Department of Cardiology, Genenal Hospital of Chengdu Military Command, Chengdu, 4State Key Laboratory Breeding Base of Systematic Research, Development and Utilization of Chinese Medicine, Chengdu University of Traditional Chinese Medicine, Chengdu, People’s Republic of China*These authors contributed equally to this workAbstract: Compared with normal differentiated cells, cancer cells upregulate the expression of pyruvate kinase isozyme M2 (PKM2 to support glycolytic intermediates for anabolic processes, including the synthesis of nucleic acids, amino acids, and lipids. In this study, a combination of the structure-based pharmacophore modeling and a hybrid protocol of virtual screening methods comprised of pharmacophore model-based virtual screening, docking-based virtual screening, and in silico ADMET (absorption, distribution, metabolism, excretion and toxicity analysis were used to retrieve novel PKM2 activators from commercially available chemical databases. Tetrahydroquinoline derivatives were identified as potential scaffolds of PKM2 activators. Thus, the hybrid virtual screening approach was applied to screen the focused tetrahydroquinoline derivatives embedded in the ZINC database. Six hit compounds were selected from the final hits and experimental studies were then performed. Compound 8 displayed a potent inhibitory effect on human lung cancer cells. Following treatment with Compound 8, cell viability, apoptosis, and reactive oxygen species (ROS production were examined in A549 cells. Finally, we evaluated the effects of Compound 8 on mice xenograft tumor models in vivo. These results may provide important

  2. Effects of PEGylated lipid nanoparticles on the oral absorption of one BCS II drug: a mechanistic investigation

    Directory of Open Access Journals (Sweden)

    Zhang XW

    2014-11-01

    Full Text Available Xingwang Zhang,* Guijiang Chen,* Tianpeng Zhang, Zhiguo Ma, Baojian WuDivision of Pharmaceutics, College of Pharmacy, Jinan University, Guangzhou, People’s Republic of China*These authors contributed equally to this workAbstract: Lipid nanocarriers are becoming a versatile platform for oral delivery of lipophilic drugs. In this article, we aimed to explore the gastrointestinal behaviors of lipid nanoparticles and the effect of PEGylation on oral absorption of fenofibrate (FN, a Biopharmaceutics Classification System (BCS II model drug. FN-loaded PEGylated lipid nanoparticles (FN-PLNs were prepared by the solvent-diffusion method and characterized by particle size distribution, morphology, Fourier transform infrared spectroscopy, and drug release. Lipolytic experiments were performed to assess the resistance of lipid nanoparticles against pancreatic lipase. Pharmacokinetics was evaluated in rats after oral administration of FN preparations. The obtained FN-PLNs were 186.7 nm in size with an entrapment efficiency of >95%. Compared to conventional lipid nanoparticles, PLNs exhibited slower drug release in the lipase-containing medium, strikingly reduced mucin binding, and suppressed lipolysis in vitro. Further, oral absorption of FN was significantly enhanced using PLNs with relative bioavailability of 123.9% and 157.0% to conventional lipid nanoparticles and a commercial formulation (Lipanthyl®, respectively. It was demonstrated that reduced mucin trapping, suppressed lipolysis, and/or improved mucosal permeability were responsible for increased oral absorption. These results facilitated a better understanding of the in vivo fate of lipid nanoparticles, and suggested the potential of PLNs as oral carriers of BCS II drugs.Keywords: fenofibrate, lipid nanoparticles, PEGylation, oral bioavailability, absorption mechanism

  3. To the analysis of reactor noise in boiling water reactors

    International Nuclear Information System (INIS)

    Seifritz, W.

    1972-01-01

    The paper contains some basic thoughts on the problem of neutron flux oscillations in power reactors. The advantages of self-powered detectors and their function are explained. In addition, noise measurements of the boiling water reactors at Lingen and Holden are described, and the possibilities of an employment of vanadium detectors for the analysis of reactor noise are discussed. The final pages of the paper contain a complete list of the author's publications in the field of reactor noise analysis. (RW/AK) [de

  4. Atrium and HTP fuel elements for the U.S. market

    International Nuclear Information System (INIS)

    Morgan, J.N.; Krebs, W.D.

    1994-01-01

    The international acitivities of Siemens in the nuclear fuel sector are the responsibility of the Nuclear Fuel Cycle Unit of the Power Generation Division (KWU) in Germany, the Nuclear Dividion of Siemens Power Corporation (SPC) in the Unites States, and the German Siemens subsidiaries, ANF GmbH (fuel element fabrication) in Lingen and NRG - Nuklearrohr Gesellschaft mbH (cladding tube production) in Duisburg. The requirements of the U.S. market for light water reactor fuel elements are met by products from the European market. (orig.) [de

  5. Tilfredshedsundersøgelse af Palliativt Team Fyn

    DEFF Research Database (Denmark)

    Paulsen, Maja Skov

    2007-01-01

    Behandling af døende patienter i eget hjem kan være en vanskelig og udfor­ drende opgave. Målet med behand­ lingen skifter fra kurativt til lindrende, hvilket udfordrer selvopfattelsen som be­ handler, og samtidig vil palliativ behand­ ling ofte rumme komplicerede medicinsk faglige problemstillin...... problemstillinger samt eksisten­ tielle spørgsmål. Gennem de senere år er der etableret specialiserede palliative teams med udgående funktioner som støtte til de primære behandlere af dø­ ende mennesker....

  6. Real-world hospital costs for nonchemotherapy drugs and nondrug care associated with platinum-based doublets in the first-line setting for advanced nonsquamous non-small-cell lung cancer in Chinese patients: a retrospective cohort study

    Directory of Open Access Journals (Sweden)

    Chen JH

    2016-04-01

    Full Text Available Jianhua Chen,1 Shengqi Wu,2 Chenping Hu,3 Yicheng Yang,4 Narayan Rajan,5 Yun Chen,4 Canjuan Yang,6 Jianfeng Li,6 Wendong Chen7 1Department of Medical Oncology, 2Department of Research and Education, Hunan Province Tumor Hospital, 3Department of Respiratory, Xiangya Hospital, Central South University, Changsha, Hunan, 4Lilly Suzhou Pharmaceutical Co., Ltd. Shanghai Branch, Shanghai, People's Republic of China; 5Global Health Outcomes Research, Eli Lilly and Co, Indianapolis, IN, USA; 6Division of Health Outcome Research, Normin Health Changsha Representative Office, Changsha, Hunan, People's Republic of China; 7Normin Health, Toronto, ON, Canada Objective: The objective of this study was to compare hospital costs per treatment cycle (HCTC for nonchemotherapy drugs and nondrug care associated with platinum-based doublets in the first-line setting for advanced nonsquamous non-small-cell lung cancer (AdvNS-NSCLC in Chinese patients. Methods: Patients receiving platinum-based doublets in the first-line setting for AdvNS-NSCLC from 2010 to 2012 in two Chinese tertiary hospitals were identified to create the retrospective study cohort. Propensity score methods were used to create matched treatment groups for head-to-head comparisons on HCTC between pemetrexed–platinum and other platinum-based doublets. Multiple linear regression analyses were performed to rank studied platinum-based doublets for their associations with the log10 scale of HCTC for nonchemotherapy drugs and nondrug care. Results: Propensity score methods created matched treatment groups for pemetrexed–platinum versus docetaxel–platinum (61 pairs, paclitaxel–platinum (39 pairs, gemcitabine–platinum (93 pairs, and vinorelbine–platinum (73 pairs, respectively. Even though the log10 scale of HCTC for nonchemotherapy drugs and nondrug care associated with pemetrexed–platinum was ranked lowest in all patients (coefficient –0.174, P=0.015, which included patients experiencing

  7. PREFACE: Dynamic crossover phenomena in water and other glass-forming liquids Dynamic crossover phenomena in water and other glass-forming liquids

    Science.gov (United States)

    Chen, Sow-Hsin; Baglioni, Piero

    2012-02-01

    protein hydration water Francesco Mallamace, Carmelo Corsaro, Piero Baglioni, Emiliano Fratini and Sow-Hsin Chen Common features in the microscopic dynamics of hydration water on organic and inorganic surfacesE Mamontov, H O'Neill, Q Zhang, W Wang and D J Wesolowski Water dynamics as affected by interaction with biomolecules and change of thermodynamic state: a neutron scattering studyA Orecchini, A Paciaroni, C Petrillo, F Sebastiani, A De Francesco and F Sacchetti Temperature dependence of structure and density for D2O confined in MCM-41-SWilliam A Kamitakahara, Antonio Faraone, Kao-Hsiang Liu and Chung-Yuan Mou Density profile of water confined in cylindrical pores in MCM-41 silicaAlan K Soper Dynamic crossover in hydration water of curing cement paste: the effect of superplasticizerHua Li, Wei-Shan Chiang, Emiliano Fratini, Francesca Ridi, Francesco Bausi, Piero Baglioni, Madhu Tyagi and Sow-Hsin Chen Water confined in MCM-41: a mode coupling theory analysisP Gallo, M Rovere and S-H Chen Computer simulations of dynamic crossover phenomena in nanoconfined waterG B Suffritti, P Demontis, J Gulín-Gonźlez and M Masia Hydrophobic nanoconfinement suppresses fluctuations in supercooled waterE G Strekalova, M G Mazza, H E Stanley and G Franzese Other glass-forming liquids Quasi-elastic neutron scattering studies of the slow dynamics of supercooled and glassy aspirinYang Zhang, Madhusudan Tyagi, Eugene Mamontov and Sow-Hsin Chen Colloids Phase diagram of trivalent and pentavalent patchy particlesFlavio Romano, Eduardo Sanz, Piero Tartaglia and Francesco Sciortino Distinguishing the monomer to cluster phase transition in concentrated lysozyme solutions by studying the temperature dependence of the short-time dynamicsPéter Falus, Lionel Porcar, Emiliano Fratini, Wei-Ren Chen, Antonio Faraone, Kunlun Hong, Piero Baglioni and Yun Liu Contrast variation in spin-echo small angle neutron scatteringXin Li, Bin Wu, Yun Liu, Roger Pynn, Chwen-Yang Shew, Gregory S Smith, Kenneth W

  8. Effects of water stress and seed mass on germination and ...

    African Journals Online (AJOL)

    enoh

    2012-03-01

    Mar 1, 2012 ... polyvinylpyrrolidone; TCA, trichloroacetic acid; NBT, nitroblue tetrazolium; TBA ..... seeds had weaker resistances to moderate stress (-0.6. MPa) compared with .... Chen YN,Chen YP,Li WH,Zhang HF (2003). Response of ...

  9. How Many Women Are Affected by or at Risk of Preeclampsia?

    Science.gov (United States)

    ... pregnancy outcomes: Differences among 4 racial/ethnic groups. American Journal of Public Health, 95 (9), 1545–1551. Lin, H. C., Chen, S. F., Lin, H. C., & Chen, Y. H. (2010). Increased risk of adverse pregnancy outcomes ...

  10. Proceedings – Mathematical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Yanheng Chen1 2 Guiyun Chen1. School of Mathematics and Statistics, Southwest University, Chongqing 400715, People's Republic of China; School of Mathematics and Statistics, Chongqing Three Gorges University, Chongqing 404100, People's Republic of China ...

  11. Kinetic investigation on enantioselective hydrolytic resolution of ...

    African Journals Online (AJOL)

    Kinetic investigation on enantioselective hydrolytic resolution of epichlorohydrin by crude epoxide hydrolase from domestic duck liver. X Ling, D Lu, J Wang, J Chen, L Ding, J Chen, H Chai, P Ouyang ...

  12. 77 FR 11620 - Notice of Request for the Extension of a Currently Approved Information Collection

    Science.gov (United States)

    2012-02-27

    ... Reduction Act of 1995, this notice announces the intention of the Federal Transit Administration (FTA) to... INFORMATION CONTACT: Roy Chen, FTA Office of Technology, (202) 366-0462, or email: royweishun.chen@dot.gov...

  13. Reference: 291 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 291 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16244906i Chai Mao-Feng...d chloroplast protection. 4 553-64 16244906 2005 Nov Plant molecular biology An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Chen Ye-Miao|Wang Xue-Chen

  14. PREFACE: The 15th International Conference on X-ray Absorption Fine Structure (XAFS15)

    Science.gov (United States)

    Wu, Z. Y.

    2013-04-01

    Committees and Staff Chair of the Conference Ziyu Wu International Advisory Committee Adam Hitchcock, Canada Adriano Filipponi, Italy Alain Manceau, France Alexander Soldatov, Russia Andrea Di Cicco, Italy Britt Hedman, USA Bruce Bunker, USA Calogero R. Natoli, Italy Christopher T. Chantler, Australia Frank M. F. De Groot, Netherlands Hiroyuki Oyanagi, Japan Ingolf Lindau, USA J. Mustre de Leon, México James E Penner-Hahn, USA Joaquin Garcia Ruiz, Spain John Evans, UK John J. Rehr, USA Kiyotaka Asakura, Japan Majed Chergui, Switzerland Mark Newton, UK Shiqiang Wei, P. R. China Tsun-Kong Sham, Canada Ziyu Wu, P. R. China International Program Committee Antonio Bianconi, Italy Augusto Marcelli, Italy Emad Flear Aziz, Germany Jinghua Guo, USA Joly Yves, France Masaharu Nomura, Japan Maurizio Benfatto, Italy Pieter Glatzel, France Shiqiang Wei, China Tiandou Hu, China Toshihiko Yokoyama, Japan Way-Faung Pong, Taiwan Xinyi Zhang, China Yi Xie, China Yuying Huang, China Zhonghua Wu, China Ziyu Wu, China Local Organizing Committee Bo He Fengchun Hu Haifeng Zhao Jing Zhang Meijuan Yu Qin Yu Shuo Zhang Wangsheng Chu Wei He Wei Xu Wensheng Yan Xiaomei Gong Xing Chen Yang Zou Yi Xia Zheng Jiang Zhi Xie Zhihu Sun Zhiyun Pan Additional Staff Chengxun Liu

  15. EDITORIAL: Focus on Iron-Based Superconductors FOCUS ON IRON-BASED SUPERCONDUCTORS

    Science.gov (United States)

    Hosono, Hideo; Ren, Zhi-An

    2009-02-01

    -L Drechsler, N Kozlova, M Bartkowiak, J E Hamann-Borrero, G Behr, K Nenkov, H-H Klauss, H Maeter, A Amato, H Luetkens, A Kwadrin, R Khasanov, J Freudenberger, A Köhler, M Knupfer, E Arushanov, H Rosner, B Büchner and L Schultz Low-energy spin dynamics in the antiferromagnetic phase of CaFe2As2 N J Curro, A P Dioguardi, N ApRoberts-Warren, A C Shockley and P Klavins Muon spin rotation study of magnetism and superconductivity in BaFe2-xCoxAs2 and Pr1-xSrxFeAsO C Bernhard, A J Drew, L Schulz, V K Malik, M Rössle, Ch Niedermayer, Th Wolf, G D Varma, G Mu, H-H Wen, H Liu, G Wu and X H Chen Magnetic impurities in the pnictide superconductor Ba1-xKxFe2As2 Sutirtha Mukhopadhyay, Sangwon Oh, A M Mounce, Moohee Lee, W P Halperin, N Ni, S L Bud'ko, P C Canfield, A P Reyes and P L Kuhns Neutron scattering investigation of the magnetic order in single crystalline BaFe2As2 M Kofu, Y Qiu, Wei Bao, S-H Lee, S Chang, T Wu, G Wu and X H Chen An NMR study on the F-doping evolution of the iron oxypnictide LaFeAs(O1-xFx) Y Nakai, S Kitagawa, K Ishida, Y Kamihara, M Hirano and H Hosono The peculiar physical properties and phase diagram of BaFe2-xCoxAs2 single crystals X F Wang, T Wu, G Wu, R H Liu, H Chen, Y L Xie and X H Chen Synthesis of LnFeAsO1-y superconductors (Ln=La and Nd) using the high-pressure technique Kiichi Miyazawa, Kunihiro Kihou, Motoyuki Ishikado, Parasharam M Shirage, Chul-Ho Lee, Nao Takeshita, Hiroshi Eisaki, Hijiri Kito and Akira Iyo Correlation effects in the iron pnictides Qimiao Si, Elihu Abrahams, Jianhui Dai and Jian-Xin Zhu Competition/coexisitence of magnetism and superconductivity in iron pnictides probed by muon spin rotation Soshi Takeshita and Ryosuke Kadono Impurity-induced in-gap state and Tc in sign-reversing s-wave superconductors: analysis of iron oxypnictide superconductors Yuko Senga and Hiroshi Kontani Intrinsic magnetic properties of the superconductor NdFeAsO0.9F0.1 from local and global measurements R Prozorov, M E Tillman, E D Mun and P C Canfield

  16. Untitled

    Indian Academy of Sciences (India)

    Beak P and Chen C W 1985 Tetrahedron Lett. 4979. Boatman R J, Whitlock B J and Whitlock H W 1977 J. An. Chen. Soc. 99 4822. Diamond S E, Szalkiewicz A and Mares F 1979 J. Ann. Chen. Soc. 101 490. Ellefson C R 1979 J. Org. Chem. 44 1533. Gschwend H W and Rodriguez H R 1979 Organic reactions 26 Chapter I.

  17. Untitled

    Indian Academy of Sciences (India)

    Smith and Carson ... Z. Physikal. Chenn., 1908, 6, 200. 13. Ephraim ... Z. anord. Chen., 190S, 58, 33S. 14. Wright ... J. Chen. Soc, 1915, 107, 1527. 15. Amadori ... Gazetta, 1922, 1, 52, 387. 16. Mori ... J. Chen. Soc., Japa), 1923, 44, 730. 17. Waradachari and Subra- Proc. Ind. Acad, Sci., 1936, 3 A, 428. Ilala. 18. Hervey and ...

  18. Three new species of the genus Gnamptogenys (Hymenoptera, Formicidae from southern China with a key to the known Chinese species

    Directory of Open Access Journals (Sweden)

    Zhilin Chen

    2017-02-01

    Full Text Available Three new species of the genus Gnamptogenys Roger, 1863 are described from southern China: Gnamptogenys dentihumera Chen, Lattke & Zhou, sp. n., Gnamptogenys nanlingensis Chen, Lattke & Zhou, sp. n. and Gnamptogenys quadrutinodules Chen, Lattke & Zhou, sp. n. A distribution map and an identification key to workers for the known species of China are provided.

  19. Construction of full-length cDNA library of white flower Salvia ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-05-18

    May 18, 2009 ... of S. miltiorrhiza bge (Yuan et al., 1990; Wang et al.,. 1998; Huang et al., 2000). Hairy roots and ... or A. tumefaciens strains (Chen et al., 1997; Song et al.,. 1997). ..... Chen H, Yuan JP, Chen F, Zhang YL, Song JY (1997).

  20. Commentary on "Patient-reported outcomes after 3-dimensional conformal, intensity-modulated, or proton beam radiotherapy for localized prostate cancer." Gray PJ, Paly JJ, Yeap BY, Sanda MG, Sandler HM, Michalski JM, Talcott JA, Coen JJ, Hamstra DA, Shipley WU, Hahn SM, Zietman AL, Bekelman JE, Efstathiou JA. Harvard Radiation Oncology Program, Boston, MA.: Cancer 2013;119(9):1729-35. doi: 10.1002/cncr.27956. [Epub 2013 Feb 22].

    Science.gov (United States)

    Gottschalk, Alexander

    2014-04-01

    Recent studies have suggested differing toxicity patterns for patients with prostate cancer who receive treatment with 3-dimensional conformal radiotherapy (3DCRT), intensity-modulated radiotherapy (IMRT), or proton beam therapy (PBT). The authors reviewed patient-reported outcomes data collected prospectively using validated instruments that assessed bowel and urinary quality of life (QOL) for patients with localized prostate cancer who received 3DCRT (n = 123), IMRT (n = 153) or PBT (n = 95). Clinically meaningful differences in mean QOL scores were defined as those exceeding half the standard deviation of the baseline mean value. Changes from baseline were compared within groups at the first post-treatment follow-up (2-3 months from the start of treatment) and at 12 months and 24 months. At the first post-treatment follow-up, patients who received 3DCRT and IMRT, but not those who received PBT, reported a clinically meaningful decrement in bowel QOL. At 12 months and 24 months, all 3 cohorts reported clinically meaningful decrements in bowel QOL. Patients who received IMRT reported clinically meaningful decrements in the domains of urinary irritation/obstruction and incontinence at the first post-treatment follow-up. At 12 months, patients who received PBT, but not those who received IMRT or 3DCRT, reported a clinically meaningful decrement in the urinary irritation/obstruction domain. At 24 months, none of the 3 cohorts reported clinically meaningful changes in urinary QOL. Patients who received 3DCRT, IMRT, or PBT reported distinct patterns of treatment-related QOL. Although the timing of toxicity varied between the cohorts, patients reported similar modest QOL decrements in the bowel domain and minimal QOL decrements in the urinary domains at 24 months. Prospective randomized trials are needed to further examine these differences. © 2013 Published by Elsevier Inc.

  1. Extreme soil erosion rates in citrus slope plantations and control strategies. A literature review

    Science.gov (United States)

    Cerdà, Artemi; Ángel González Peñaloza, Félix; Pereira, Paulo; Reyes Ruiz Gallardo, José; García Orenes, Fuensanta; Burguet, María

    2013-04-01

    approach. Catena, 85 (3), 231-236. Cerdà, A., Jurgensen, M.F., Bodi, M.B. 2009. Effects of ants on water and soil losses from organically-managed citrus orchards in eastern Spain. Biologia, 64 (3), 527-531. Cerdà, A., Morera, A.G., Bodí, M.B. 2009. Soil and water losses from new citrus orchards growing on sloped soils in the western Mediterranean basin. Earth Surface Processes and Landforms, 34 (13), 1822-1830. Lavigne, C., Achard, R., Tixier, P., Lesueur Jannoyer, M. 2012. How to integrate cover crops to enhance sustainability in banana and citrus cropping systems. Acta Horticulturae, 928, 351-358. Le Bellec, F., Damas, O., Boullenger, G., Vannière, H., Lesueur Jannoyer, M., Tournebize, R., Ozier Lafontaine, H. 2012. Weed control with a cover crop (Neonotonia wightii) in mandarin orchards in Guadeloupe (FWI). Acta Horticulturae, 928, 359-366. Liu, Y., Tao, Y., Wan, K.Y., Zhang, G.S., Liu, D.B., Xiong, G.Y., Chen, F. 2012. Runoff and nutrient losses in citrus orchards on sloping land subjected to different surface mulching practices in the Danjiangkou Reservoir area of China. Agricultural Water Management, 110, 34-40. Lu, J., Wilson, M.J., Yu, J. 1997. Effects of trench planting and soil chiselling on soil properties and citrus production in hilly ultisols of China Soil and Tillage Research, 43 (3-4), 309-318. Lü, W., Zhang, H., Wu, Y., Cheng, J., Li, J., Wang, X. 2012. The impact of plant hedgerow in Three Gorges on the soil chemicophysical properties and soil erosion. Key Engineering Materials, 500, 142-148. Wang, L., Tang, L., Wang, X., Chen, F. 2010. Effects of alley crop planting on soil and nutrient losses in the citrus orchards of the Three Gorges Region. Soil and Tillage Research, 110 (2), 243-250. Wu J., Li Q., Yan L. 1997. Effect of intercropping on soil erosion in young citrus plantation - a simulation study. Chinese Journal of Applied Ecology, 8 (2), 143-146. Wu, D.-M., Yu, Y.-C., Xia, L.-Z., Yin, S.-X., Yang, L.-Z. 2011. Soil fertility indices of citrus

  2. People’s Republic of China Scientific Abstracts No. 178

    Science.gov (United States)

    1977-10-27

    of hepatic colls were observed by eleotron microscopy after carbon tetrachloride intoxication in mice . The hepatic cellular injuries were protected...administration in [continuation of SHENG-WU HUA-HSUEH YU SHENG-WU WU-LI-HSUEH-PAO Vol 8, No A, Dec 76 pp 333-340] mice . It is transformed from lipid...preparations for monopolizing the technique by capi- talist and revisionist countries. In a socialist country, the author claims, the purpose of developing

  3. Effects of three warm-up regimens of equal distance on VO2 kinetics during supramaximal exercise in Thoroughbred horses.

    Science.gov (United States)

    Mukai, K; Hiraga, A; Takahashi, T; Ohmura, H; Jones, J H

    2010-11-01

    Several studies have indicated that even low-intensity warm-up increases O(2) transport kinetics and that high-intensity warm-up may not be needed in horses. However, conventional warm-up exercise for Thoroughbred races is more intense than those utilised in previous studies of equine warm-up responses. To test the hypothesis that warm-up exercise at different intensities alters the kinetics and total contribution of aerobic power to total metabolic power in subsequent supramaximal (sprint) exercise in Thoroughbred horses. Nine well-trained Thoroughbreds ran until fatigue at 115% of maximal oxygen consumption (VO2max) 10 min after warming-up under each of 3 protocols of equal running distance: 400 s at 30% VO2max (LoWU), 200 s at 60% VO2max (MoWU) and 120 s at 100% VO2max (HiWU). Variables measured during exercise were rates of O(2) and CO(2) consumption/production (VO2,VO2), respiratory exchange ratio (RER), heart rate, blood lactate concentration and accumulation rate and blood gas variables. VO2 was significantly higher in HiWU than in LoWU at the onset of the sprint exercise and HR was significantly higher in HiWU than in LoWU throughout the sprint. Accumulation of blood lactate, RER, P(a)CO(2) and PvCO2 in the first 60 s were significantly lower in HiWU than in LoWU and MoWU. There were no significant differences in stroke volume, run time or arterial-mixed venous O(2) concentration. These results suggest HiWU accelerates kinetics and reduces reliance on net anaerobic power compared with LoWU at the onset of the subsequent sprint. © 2010 EVJ Ltd.

  4. Abstracts from the 15th International Myopia Conference

    Directory of Open Access Journals (Sweden)

    Alexandra Benavente-Perez

    2016-11-01

    Full Text Available Table of contents O1 Changes in peripheral refraction associated with decreased ocular axial growth rate in marmosets Alexandra Benavente-Perez, Ann Nour, Tobin Ansel, Kathleen Abarr, Luying Yan, Keisha Roden, David Troilo O2 PPARα activation suppresses myopia development by increasing scleral collagen synthesis--a new drug target to suppress myopia development Chanyi Lu, Miaozhen Pan, Min Zheng, Jia Qu, Xiangtian Zhou O3 Evidence and possibilities for local ocular growth regulating signal pathways Christine F Wildsoet O4 Myopia researches at Eye Hospital of Wenzhou Medical University Fan Lu, Xiangtian Zhou, Jie Chen, Jinhua Bao, Liang Hu, Qinmei Wang, Zibing Jin, Jia Qu O5 Color, temporal contrast and myopia Frances Rucker, Stephanie Britton, Stephan Hanowsky, Molly Spatcher O6 The impact of atropine usage on visual function and reading performance in myopic school children in Taiwan Hui-Ying Kuo, Ching-Hsiu Ke, I-Hsin Kuo, Chien-Chun Peng, Han-Yin Sun O7 Increased time outdoors prevents the onset of myopia: evidence from randomised clinical trials Ian G Morgan O8 Environmental risk factors and gene-environment interactions for myopia in the ALSPAC cohort Jeremy A. Guggenheim, Rupal L. Shah, Cathy Williams O9 Retinal metabolic profiling identifies declines in FP receptor-linked signaling as contributors to form-deprived myopic development in guinea pigs Jinglei Yang, Peter S. Reinach, Sen Zhang, Miaozhen Pan, Wenfeng Sun, Bo Liu, Xiangtian Zhou O10 The study of peripheral refraction in moderate and high myopes after one month of wearing orthokeratology lens Jun Jiang, Haoran Wu, Fan Lu O11 Axial length of school children around the earth’s equatorial area and factors affecting the axial length Kazuo Tsubota, Hiroko Ozawa, Hidemasa Torii, Shigemasa Takamizawa, Toshihide Kurihara, Kazuno Negishi O12 Processing of defocus in the chicken retina by retinal ganglion cells Klaus Graef, Daniel Rathbun, Frank Schaeffel O13 Blue SAD light protects

  5. Revision of the subfamily Opiinae (Hymenoptera, Braconidae from Hunan (China, including thirty-six new species and two new genera

    Directory of Open Access Journals (Sweden)

    Li Xi-Ying

    2013-02-01

    postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915, O. ambiguus Weng & Chen, 2005 (not Wesmael, 1835 and O. mitis Chen & Weng, 2005 (not Fischer, 1963 are primary homonyms and are renamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. and O. wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005 comb. n., Diachasmimorpha longicaudata (Ashmead, 1905 and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957 comb. n. is new for China and Hunan; Xynobius maculipennis (Enderlein, 1912 comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005 comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005 comb. n., A. tracta (Weng & Chen, 2005 comb. n., Areotetes laevigatus (Weng & Chen, 2005 comb. n., Phaedrotoma dimidia (Chen & Weng, 2005 comb. n., P. improcera (Weng & Chen, 2005 comb. n., P. amputata (Weng & Chen, 2005 comb. n., P. larga (Weng & Chen, 2005 comb. n., P. osculas (Weng & Chen, 2005 comb. n., P. postuma (Chen & Weng, 2005 comb. n., P. rugulosa (Chen & Weng, 2005 comb. n., P. tabularis (Weng & Chen, 2005 comb. n., Rhogadopsis apii (Chen & Weng, 2005 comb. n., R. dimidia (Chen & Weng, 2005 comb. n., R. diutia (Chen & Weng, 2005 comb. n., R. longuria (Chen & Weng, 2005 comb. n., R. pratellae (Weng & Chen, 2005 comb. n., R. pratensis (Weng & Chen, 2005 comb. n., R. sculpta (Chen & Weng, 2005 comb. n., R. sulcifer (Fischer, 1975 comb. n., R. tabidula (Weng & Chen, 2005 comb. n., Xynobius complexus (Weng & Chen, 2005 comb. n

  6. Electrospun fibrous scaffolds combined with nanoscale hydroxyapatite induce osteogenic differentiation of human periodontal ligament cells

    Directory of Open Access Journals (Sweden)

    Wu XN

    2014-08-01

    Full Text Available Xiaonan Wu,1 Leiying Miao,2,# Yingfang Yao,3 Wenlei Wu,1 Yu Liu,1 Xiaofeng Chen,1 Weibin Sun1,# 1Department of Periodontology, Hospital of Stomatology, Medical School of Nanjing University, Nanjing, People’s Republic of China; 2Department of Cariology and Endodontics, Hospital of Stomatology, Medical School of Nanjing University, Nanjing, People’s Republic of China; 3Eco-materials and Renewable Energy Research Center, Department of Materials Science and Engineering, National Laboratory of Solid State Microstructures, Nanjing University, Nanjing, People’s Republic of China #These authors contributed equally to this work Abstract: Periodontal repair is a complex process in which regeneration of alveolar bone is a vital component. The aim of this study was to develop a biodegradable scaffold with good biocompatibility and osteoinductive ability. Two types of composite fibrous scaffolds were produced by electrospinning, ie, type I collagen/poly(є-caprolactone (COL/PCL and type I collagen/poly(є-caprolactone/nanoscale hydroxyapatite (COL/PCL/nHA with an average fiber diameter of about 377 nm. After a simulated body fluid (SBF immersion test, the COL/PCL/nHA-SBF scaffold developed a rough surface because of the calcium phosphate deposited on the fibers, suggesting that the presence of nHA promoted the mineralization potential of the scaffold. Energy dispersive X-ray spectroscopy clearly showed the calcium and phosphorus content in the COL/PCL/nHA and COL/PCL/nHA-SBF scaffolds, confirming the findings of nHA and calcium phosphate precipitation on scanning electron micrographs. Water contact analysis revealed that nHA could improve the hydrophilic nature of the COL/PCL/nHA-SBF scaffold. The morphology of periodontal ligament cells cultured on COL/PCL-SBF and COL/PCL/nHA-SBF was evaluated by scanning electron microscopy. The results showed that cells adhered to either type of scaffold and were slightly spindle-shaped in the beginning, then

  7. Influence of mycorhization and soil organic matters on lead and antimony transfers to vegetables cultivated in urban gardens: environmental and sanitary consequences

    Science.gov (United States)

    Pierart, Antoine; Braud, Armelle; Lebeau, Thierry; Séjalon-Delmas, Nathalie; Dumat, Camille

    2014-05-01

    . References: Feng, R., Wei, C., Tu, S., Ding, Y., Wang, R., Guo, J., 2013. The uptake and detoxification of antimony by plants: a review. Environ. Exp. Bot. 96, 28-34. Foucault, Y., Lévêque, T., Xiong, T., Schreck, E., Austruy, A., Shahid, M., Dumat, C., 2013. Green manure plants for remediation of soils polluted by metals and metalloids: Ecotoxicity and human bioavailability assessment. Chemosphere 93, 1430-1435. Gu, H.H., Li, F.P., Yu, Q., Gao, Y.Q., Yuan, X.T., 2013. The Roles of Arbuscular Mycorrhizal Fungus Glomus mosseae and Festuca arundinacea in Phytostabilization of Lead/Zinc Tailings. Adv. Mater. Res. 699, 245-250. Lebeau, T., Braud, A., Jézéquel, K., 2008. Performance of bioaugmentation-assisted phytoextraction applied to metal contaminated soils: A review. Environ. Pollut. 153, 497-522. Sharma, A., Sharma, H., 2013. Role of Vesicular Arbuscular Mycorrhiza in the Mycoremediation of Heavy Toxic Metals From Soil. Int J LifeSc Bt Pharm Res 2, 2418-2431. Wu, F., Fu, Z., Liu, B., Mo, C., Chen, B., Corns, W., Liao, H., 2011. Health risk associated with dietary co-exposure to high levels of antimony and arsenic in the world's largest antimony mine area. Sci. Total Environ. 409, 3344-3351. Xiong, T., Austruy, A., Dappe, V., Leveque, T., Sobanska, S., Foucault, Y., Dumat, C., 2013. Phytotoxicity and bioaccessibility of metals for vegetables exposed to atmosphere fine particles in polluted urban areas". Urban Environmental Pollution, Asian Edition, 17-20, Beijing, China.

  8. Cisplatin induces protective autophagy through activation of BECN1 in human bladder cancer cells

    Directory of Open Access Journals (Sweden)

    Lin JF

    2017-05-01

    Full Text Available Ji-Fan Lin,1 Yi-Chia Lin,2 Te-Fu Tsai,2,3 Hung-En Chen,2 Kuang-Yu Chou,2,3 Thomas I-Sheng Hwang2–4 1Central Laboratory, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, 2Division of Urology, School of Medicine, Fu-Jen Catholic University, New Taipei, 3Division of Urology, Department of Surgery, Shin Kong Wu Ho-Su Memorial Hospital, 4Department of Urology, Taipei Medical University, Taipei, Taiwan Purpose: Cisplatin-based chemotherapy is the first line treatment for several cancers including bladder cancer (BC. Autophagy induction has been implied to contribute to cisplatin resistance in ovarian cancer; and a high basal level of autophagy has been demonstrated in human bladder tumors. Therefore, it is reasonable to speculate that autophagy may account for the failure of cisplatin single treatment in BC. This study investigated whether cisplatin induces autophagy and the mechanism involved using human BC cell lines.Materials and methods: Human BC cells (5637 and T24 were used in this study. Cell viability was detected using water soluble tetrazolium-8 reagents. Autophagy induction was detected by monitoring the levels of light chain 3 (LC3-II and p62 by Western blot, LC3-positive puncta formation by immunofluorescence, and direct observation of the autophagolysosome (AL formation by transmission electron microscopy. Inhibitors including bafilomycin A1 (Baf A1, chloroquine (CQ, and shRNA-based lentivirus against autophagy-related genes (ATG7 and ATG12 were utilized. Apoptosis level was detected by caspase 3/7 activity and DNA fragmentation.Results: Cisplatin decreased cell viability and induced apoptosis of 5637 and T24 cells in a dose- and time-dependent manner. The increased LC3-II accumulation, p62 clearance, the number of LC3-positive puncta, and ALs in cisplatin-treated cells suggested that cisplatin indeed induces autophagy. Inhibition of cisplatin-induced autophagy using Baf A1, CQ, or ATG7/ATG12 shRNAs significantly enhanced cytotoxicity of

  9. Beneficial effects of prolonged blood pressure control after carotid artery stenting

    Directory of Open Access Journals (Sweden)

    Chang A

    2017-01-01

    Full Text Available Anna Chang,1 Huei-Fong Hung,2 Fang-I Hsieh,3 Wei-Hung Chen,1,4 Hsu-Ling Yeh,1,5 Jiann-Horng Yeh,1,6 Hou-Chang Chiu,1,6 Li-Ming Lien1,4 1Department of Neurology, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, 2Department of Cardiology, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, 3School of Public Health, College of Public Health, Taipei Medical University, Taipei, 4School of Medicine, College of Medicine, Taipei Medical University, Taipei, 5Institute of Public Health, National Yang-Ming University, Taipei, 6School of Medicine, College of Medicine, Fu Jen Catholic University, Taipei, Taiwan Objectives: The main purpose of this study was to investigate whether carotid artery stenting (CAS plus medicine in patients with severe carotid artery stenosis provide a better long-term blood pressure (BP control compared to other medical treatments alone. The other aim was to explore the correlation between post-CAS hypotension within 6 h and long-term BP reductions after CAS. Materials and methods: Patients with severe carotid stenosis were recruited either in the CAS group or in the medication group. BPs and the number of classes of antihypertensive agents were recorded at baseline, 6, and 12 months. Extra BP information was collected at 6 h, 3 days, and 1 month after CAS. Univariate and multivariate linear regressions were performed to test the relationship of BP changes among CAS and medication groups after 6 and 12 months of follow-up. Univariate linear regressions were also used to determine the correlations between the mean or maximal systolic BP (SBP reductions at 6 h and 1 year post-CAS. Results: In total, 72 members in the CAS group and 82 members in the medication group were recruited. Compared with the medication group, patients in the CAS group had greater BP reductions at 6 and 12 months of follow-up after adjusting for confounding factors (13.56 mmHg at 6 months, P=0.0002; 16.98 mmHg at 12 months, P<0.0001. This study also shows significant

  10. Real-world treatment patterns and opioid use in chronic low back pain patients initiating duloxetine versus standard of care

    Directory of Open Access Journals (Sweden)

    Andrews JS

    2013-11-01

    Full Text Available Jeffrey Scott Andrews,1 Ning Wu,2 Shih-Yin Chen,2 Xia Yu,2 Xiaomei Peng,1 Diego Novick1 1Global Health Outcomes, Eli Lilly and Company, Indianapolis, IN, USA; 2Evidera, Lexington, MA, USA Abstract: To describe the use of pain medications in patients with chronic low back pain (CLBP after initiating duloxetine or standard of care (SOC [muscle relaxants, gabapentin, pregabalin, venlafaxine, and tricyclic antidepressants] for pain management, pharmacy and medical claims from Surveillance Data, Inc (SDI Health were analyzed. Adult patients with CLBP who initiated duloxetine or SOC between November 2010 and April 2011 were identified. Treatment initiation was defined as no pill coverage for duloxetine or SOC in the previous 90 days. Included patients had no opioid use in the 90 days before initiation. Propensity score matching was used to select patients with similar baseline demographic and clinical characteristics for duloxetine and SOC cohorts. Compliance with index medication was assessed via medication possession ratio (MPR and proportion of days covered (PDC for 6 months after initiation. The proportion of patients receiving opioids and days on opioids after index date were assessed, and regression models were estimated to compare opioid use between cohorts. A total of 766 patients initiated duloxetine and 6,206 patients initiated SOC. After matching, 743 patients were selected for the duloxetine (mean age 57 years; female 74% and SOC (mean age 57 years; female 75% cohorts, respectively. Of the duloxetine cohort, 92% started on or below recommended daily dose (≤60 mg. The duloxetine cohort had significantly higher MPR (0.78 versus [vs] 0.60 and PDC (0.50 vs 0.31, were less likely to use opioids (45% vs 61%, and had fewer days on opioids (median 0 vs 7 days than the SOC cohort (all P < 0.001. After adjusting for demographic and clinical characteristics, the duloxetine cohort initiated opioids later than the SOC cohort (hazard ratio 0.77, 95

  11. The Integration of Chuji Calendars in the Late Western Zhou Dynasty

    Science.gov (United States)

    Li, Y.

    2017-03-01

    In this paper, we investigate 23 four-element-materials contained Chuji (characters usually on bronze vessels, perhaps represent the moon phase) in the late Western Zhou Dynasty. It is assumed that all 5 elder-year data (kings' year>25 yr) should belong to the periods of king Li or king Xuan. At the same time, in order to guarantee the completeness, compatibility, and objectivity of these kinds of calendars, in the paper we build up them respectively according to the 24 characters of Chinese ancient calendar. We use the transformation platform for Chinese ancient dates to finish the calendars, consider the five different first years when both kings took their powers, set the moon age of Chuji cover any day in a lunar month, and as far as possible give every result for each material as in different kings' period. As a result, we totally derive 13 calendars according to different combinations of the characters of ancient calendars. When subdivided by the different combinations of the kings' periods, 33 solutions are obtained, but the moon phases of Chuji are usually in the second half month. The best result, with Jian Mao and the leap month in the end of the year, is related with the BC878 (BC827) as the first year of king Li (king Xuan). The coincidence rate of 23 data is 100%, and average moon phases are 19.84 days. The suboptimum choices have four solutions; the coincidence rate is 95.7%, respectively with Jian Chen and the leap month in the middle of the year; together with Jian Wu and the leap month in the middle or end of the year. We point out that these results may constitute and link respectively with other materials (even with other moon phases) as long as have the same calendar features. After adopting more materials and higher qualification, the scope of the solutions can be further limited and narrow. In addition, the different researchers can easily obtain or intercept their needed results respectively from this paper.

  12. TU-EF-204-02: Hiigh Quality and Sub-MSv Cerebral CT Perfusion Imaging

    International Nuclear Information System (INIS)

    Li, Ke; Niu, Kai; Wu, Yijing; Chen, Guang-Hong

    2015-01-01

    Purpose: CT Perfusion (CTP) imaging is of great importance in acute ischemic stroke management due to its potential to detect hypoperfused yet salvageable tissue and distinguish it from definitely unsalvageable tissue. However, current CTP imaging suffers from poor image quality and high radiation dose (up to 5 mSv). The purpose of this work was to demonstrate that technical innovations such as Prior Image Constrained Compressed Sensing (PICCS) have the potential to address these challenges and achieve high quality and sub-mSv CTP imaging. Methods: (1) A spatial-temporal 4D cascaded system model was developed to indentify the bottlenecks in the current CTP technology; (2) A task-based framework was developed to optimize the CTP system parameters; (3) Guided by (1) and (2), PICCS was customized for the reconstruction of CTP source images. Digital anthropomorphic perfusion phantoms, animal studies, and preliminary human subject studies were used to validate and evaluate the potentials of using these innovations to advance the CTP technology. Results: The 4D cascaded model was validated in both phantom and canine stroke models. Based upon this cascaded model, it has been discovered that, as long as the spatial resolution and noise properties of the 4D source CT images are given, the 3D MTF and NPS of the final CTP maps can be analytically derived for a given set of processing methods and parameters. The cascaded model analysis also identified that the most critical technical factor in CTP is how to acquire and reconstruct high quality source images; it has very little to do with the denoising techniques often used after parametric perfusion calculations. This explained why PICCS resulted in a five-fold dose reduction or substantial improvement in image quality. Conclusion: Technical innovations generated promising results towards achieving high quality and sub-mSv CTP imaging for reliable and safe assessment of acute ischemic strokes. K. Li, K. Niu, Y. Wu: Nothing to

  13. Changes in definition lead to changes in the clinical characteristics across COPD categories according to GOLD 2017: a national cross-sectional survey in China

    Directory of Open Access Journals (Sweden)

    Sun LN

    2017-10-01

    Full Text Available Lina Sun,* Yahong Chen,* Rui Wu, Ming Lu, Wanzhen Yao Department of Pulmonary and Critical Care Medicine, Peking University Third Hospital, Beijing, China *These authors contributed equally to this work Purpose: To investigate how the changes of definition in assessment of Global Initiative for Chronic Obstructive Lung Disease (GOLD stratification 2017 lead to changes of chronic obstructive pulmonary disease (COPD patient clinical characteristics across categories in China.Patients and methods: COPD patients from 11 medical centers in China were stratified into old and new groups A–D twice according to the GOLD 2011 and 2017 comprehensive assessment. Demography and clinical characteristics were compared between old and new groups A–D.Results: In 1,532 COPD patients, the distribution from group A to D was 330 (21.5%, 132 (8.6%, 411 (26.8%, 659 (43.0% and 557 (36.4%, 405 (26.4%, 184 (12.0%, 386 (25.2%, respectively according to GOLD 2011 and 2017. 46.7% (500/1,070 patients in high-risk groups were regrouped to low-risk groups. Compared to the old groups A and B, the new groups A and B had a higher proportion of males, lower body mass index, higher modified Medical Research Council (mMRC grade, poor pulmonary function, more patients with chronic bronchitis, and fewer patients with coronary heart disease and hypertension disease. Compared to the old groups C and D, the new groups C and D had older patients, fewer men, better pulmonary functions, frequent acute exacerbations in the previous year, and more patients with chronic bronchitis, coronary heart disease, or diabetes mellitus. The new group D had more patients with stroke than the old group D.Conclusion: In China, GOLD 2017 shifted the overall COPD comprehensive assessments distribution to more low-risk groups. The new high-risk groups had more characteristics associated with high risk of acute exacerbation and mortality. Some of the changes in demography and clinical characteristics of

  14. Mesoporous bioactive glass surface modified poly(lactic-co-glycolic acid electrospun fibrous scaffold for bone regeneration

    Directory of Open Access Journals (Sweden)

    Chen SJ

    2015-06-01

    Full Text Available Shijie Chen,1,* Zhiyuan Jian,2,* Linsheng Huang,2,* Wei Xu,3,* Shaohua Liu,4 Dajiang Song,3 Zongmiao Wan,3 Amanda Vaughn,5 Ruisen Zhan,1 Chaoyue Zhang,1 Song Wu,1 Minghua Hu,6 Jinsong Li1 1Department of Orthopaedics, The Third Xiangya Hospital of Central South University, Changsha, Hunan, People’s Republic of China; 2The First General Surgery Department of Shiyan Taihe Hospital Affiliated to Hubei University of Medicine, Shiyan, People’s Republic of China; 3Department of Orthopedic Oncology, Changzheng Hospital, The Second Military Medical University, Shanghai, People’s Republic of China; 4Department of Spine Surgery, Xiangya Hospital of Central South University, Changsha, Hunan, People’s Republic of China; 5Department of Molecular Biosciences, Institute of Cellular and Molecular Biology, The University of Texas at Austin, Austin, TX, USA; 6Department of Anthropotomy, Changsha Medical College, Changsha, Hunan, People’s Republic of China *These authors contributed equally to this work Abstract: A mesoporous bioactive glass (MBG surface modified with poly(lactic-co-glycolic acid (PLGA electrospun fibrous scaffold for bone regeneration was prepared by dip-coating a PLGA electrospun fibrous scaffold into MBG precursor solution. Different surface structures and properties were acquired by different coating times. Surface morphology, chemical composition, microstructure, pore size distribution, and hydrophilicity of the PLGA-MBG scaffold were characterized. Results of scanning electron microscopy indicated that MBG surface coating made the scaffold rougher with the increase of MBG content. Scaffolds after MBG modification possessed mesoporous architecture on the surface. The measurements of the water contact angles suggested that the incorporation of MBG into the PLGA scaffold improved the surface hydrophilicity. An energy dispersive spectrometer evidenced that calcium-deficient carbonated hydroxyapatite formed on the PLGA-MBG scaffolds

  15. Hyaluronic acid–nimesulide conjugates as anticancer drugs against CD44-overexpressing HT-29 colorectal cancer in vitro and in vivo

    Directory of Open Access Journals (Sweden)

    Jian YS

    2017-03-01

    Full Text Available You-Sin Jian,1 Ching-Wen Chen,1 Chih-An Lin,2 Hsiu-Ping Yu,1 Hua-Yang Lin,3 Ming-Yuan Liao,1 Shu-Huan Wu,1 Yan-Fu Lin,1 Ping-Shan Lai1,2,4,5 1Department of Chemistry, 2PhD Program in Tissue Engineering and Regenerative Medicine, National Chung Hsing University, Taichung, 3Preclinical Development Research Department, Holy Stone Healthcare Co., Ltd., Taipei, 4Research Center for Sustainable Energy and Nanotechnology, 5Rong Hsing Research Center for Translational Medicine, National Chung Hsing University, Taichung, Taiwan Abstract: Carrier-mediated drug delivery systems are promising therapeutics for targeted delivery and improved efficacy and safety of potent cytotoxic drugs. Nimesulide is a multifactorial cyclooxygenase 2 nonsteroidal anti-inflammatory drug with analgesic, antipyretic and potent anticancer properties; however, the low solubility of nimesulide limits its applications. Drugs conjugated with hyaluronic acid (HA are innovative carrier-mediated drug delivery systems characterized by CD44-mediated endocytosis of HA and intracellular drug release. In this study, hydrophobic nimesulide was conjugated to HA of two different molecular weights (360 kDa as HA with high molecular weight [HAH] and 43kDa as HA with low molecular weight [HAL] to improve its tumor-targeting ability and hydrophilicity. Our results showed that hydrogenated nimesulide (N-[4-amino-2-phenoxyphenyl]methanesulfonamide was successfully conjugated with both HA types by carbodiimide coupling and the degree of substitution of nimesulide was 1%, which was characterized by 1H nuclear magnetic resonance 400 MHz and total correlation spectroscopy. Both Alexa Fluor® 647 labeled HAH and HAL could selectively accumulate in CD44-overexpressing HT-29 colorectal tumor area in vivo, as observed by in vivo imaging system. In the in vitro cytotoxic test, HA–nimesulide conjugate displayed >46% cell killing ability at a nimesulide concentration of 400 µM in HT-29 cells, whereas

  16. Preparation, characterization, and in vitro and in vivo investigation of chitosan-coated poly (d,l-lactide-co-glycolide nanoparticles for intestinal delivery of exendin-4

    Directory of Open Access Journals (Sweden)

    Wang M

    2013-03-01

    Full Text Available Mengshu Wang,1* Yong Zhang,1* Jiao Feng,1 Tiejun Gu,1 Qingguang Dong,1 Xu Yang,2 Yanan Sun,1 Yongge Wu,1 Yan Chen,1 Wei Kong1 1National Engineering Laboratory for AIDS Vaccine, College of Life Science, Jilin University, Changchun, People’s Republic of China; 2BCHT Biopharm Co, Ltd, Changchun, People’s Republic of China*These authors contributed equally to this workBackground: Exendin-4 is an incretin mimetic agent approved for type 2 diabetes treatment. However, the required frequent injections restrict its clinical application. Here, the potential use of chitosan-coated poly (d,l-lactide-co-glycolide (CS-PLGA nanoparticles was investigated for intestinal delivery of exendin-4.Methods and results: Nanoparticles were prepared using a modified water–oil–water (w/o/w emulsion solvent-evaporation method, followed by coating with chitosan. The physical properties, particle size, and cell toxicity of the nanoparticles were examined. The cellular uptake mechanism and transmembrane permeability were performed in Madin-Darby canine kidney-cell monolayers. Furthermore, in vivo intraduodenal administration of exendin-4-loaded nanoparticles was carried out in rats. The PLGA nanoparticle coating with chitosan led to a significant change in zeta potential, from negative to positive, accompanied by an increase in particle size of ~30 nm. Increases in both the molecular weight and degree of deacetylation of chitosan resulted in an observable increase in zeta potential but no apparent change in the particle size of ~300 nm. Both unmodified PLGA and chitosan-coated nanoparticles showed only slight cytotoxicity. Use of different temperatures and energy depletion suggested that the cellular uptake of both types of nanoparticles was energy-dependent. Further investigation revealed that the uptake of PLGA nanoparticles occurred via caveolin-mediated endocytosis and that of CS-PLGA nanoparticles involved both macropinocytosis and clathrin-mediated endocytosis

  17. Reversal of multidrug resistance by magnetic Fe3O4 nanoparticle copolymerizating daunorubicin and 5-bromotetrandrine in xenograft nude-mice

    Directory of Open Access Journals (Sweden)

    Baoan Chen

    2009-03-01

    Full Text Available Baoan Chen1,* Jian Cheng1,* Yanan Wu1, Feng Gao1, Wenlin Xu2, et al 1Department of Hematology;2Department of Hematology, The Affiliated People’s Hospital, Jiangsu University, Zhenjiang, PR China *These authors have contributed equally to this workAbstract: In this paper we establish the xenograft leukemia model with stable multidrug resistance in nude mice and to investigate the reversal effect of 5-bromotetrandrine (5-BrTet and magnetic nanoparticle of Fe3O4 (MNP-Fe3O4 combined with daunorubicin (DNR in vivo. Two subclones of K562 and K562/A02 cells were inoculated subcutaneously into the back of athymic nude mice (1 × 107 cells/each respectively to establish leukemia xenograft models. Drug-resistant and sensitive tumor-bearing nude mice were assigned randomly into five groups which were treated with normal saline; DNR; NP-Fe3O4 combined with DNR; 5-BrTet combined with DNR; 5-BrTet and MNP-Fe3O4 combined with DNR, respectively. The incidence of formation, growth characteristics, weight, and volume of tumors were observed. The histopathologic examination of tumors and organs were detected. For resistant tumors, the protein levels of Bcl-2, and BAX were detected by Western blot. Bcl-2, BAX, and caspase-3 genes were also detected. For K562/A02 cells xenograft tumors, 5-BrTet and MNP-Fe3O4 combined with DNR significantly suppressed growth of tumor. A histopathologic examination of tumors clearly showed necrosis of the tumors. Application of 5-BrTet and MNP-Fe3O4 inhibited the expression of Bcl-2 protein and upregulated the expression of BAX and caspase-3 proteins in K562/A02 cells xenograft tumor. It is concluded that 5-BrTet and MNP-Fe3O4 combined with DNR had a significant tumor-suppressing effect on a MDR leukemia cells xenograft model.Keywords: 5-bromotetrandrine, magnetic nanoparticle of Fe3O4, multidrug-resistance, xenograft model

  18. Association between MDM2 SNP309 T>G polymorphism and the risk of bladder cancer: new data in a Chinese population and an updated meta-analysis

    Directory of Open Access Journals (Sweden)

    Xie LG

    2015-12-01

    Full Text Available Linguo Xie,1,2,* Yan Sun,2,* Tao Chen,1,2,* Dawei Tian,1,2 Yujuan Li,3 Yu Zhang,1,2 Na Ding,2 Zhonghua Shen,1,2 Hao Xu,1,2 Xuewu Nian,4 Nan Sha,1,2 Ruifa Han,1,2 Hailong Hu,1,2 Changli Wu1,2 Objective: Human murine double minute 2 protein (MDM2 is mainly a negative regulator of p53 tumor suppressor pathway. We aimed to investigate the association between MDM2 SNP309 polymorphism and bladder cancer risk. Methods: A total of 535 bladder cancer patients and 649 health controls were recruited for our study. MDM2 SNP309 T>G polymorphism was genotyped by polymerase chain reaction-ligase detection reaction method. Logistic regression was used to analyze the relationship between the genotype and susceptibility of bladder cancer. Kaplan–Meier estimates and log-rank test were obtained to analyze the association between the genotype and risk of recrudesce in nonmuscle-invasive bladder cancer patients. A multivariable Cox proportional hazards model was fitted to identify independent prognostic factors. To further investigate the association, we conducted a meta-analysis including six studies. Results: The frequency of the MDM2 SNP309 T>G polymorphism showed no significant difference between cases and controls (all P>0.05. In the stratification analysis, the results showed that G allele carriers were prone to have a significant decrease in risk of low-grade bladder cancer (adjusted odds ratio: 0.613, 95% confidence interval: 0.427–0.881, and G variant was associated with a significantly reduced risk of recurrence in nonmuscle-invasive bladder cancer patients with or without chemotherapy (P<0.05. The results of the meta-analysis showed that G allele and GG genotype of MDM2 SNP309 polymorphism were significantly associated with increased risk of bladder cancer in Caucasians (both P<0.05, and no association was observed in total populations and Asians (P>0.05. Conclusion: MDM2 SNP309 T>G polymorphism has no influence on bladder cancer risk in Asians, but

  19. A novel therapeutic strategy for cartilage diseases based on lipid nanoparticle-RNAi delivery system

    Directory of Open Access Journals (Sweden)

    Wang S

    2018-01-01

    Full Text Available Shaowei Wang,1 Xiaochun Wei,1 Xiaojuan Sun,1 Chongwei Chen,1 Jingming Zhou,2 Ge Zhang,3 Heng Wu,3 Baosheng Guo,3 Lei Wei1,2 1Department of Orthopaedics, The 2nd Hospital of Shanxi Medical University, Taiyuan, Shanxi, China; 2Department of Orthopaedics, Rhode Island Hospital, The Warren Alpert Medical School of Brown University, Providence, RI, USA; 3Integrated Traditional Chinese and Western Medicine, School of Chinese Medicine, Hong Kong Baptist University, Hong Kong Background: Cartilage degeneration affects millions of people but preventing its degeneration is a big challenge. Although RNA interference (RNAi has been used in human trials via silencing specific genes, the cartilage RNAi has not been possible to date because the cartilage is an avascular and very dense tissue with very low permeability. Purpose: The objective of this study was to develop and validate a novel lipid nanoparticle (LNP-siRNA delivery system that can prevent cartilage degeneration by knocking down specific genes. Methods: LNP transfection efficiency was evaluated in vitro and ex vivo. Indian Hedgehog (Ihh has been correlated with cartilage degeneration. The in vivo effects of LNP-Ihh siRNA complexes on cartilage degeneration were evaluated in a rat model of surgery-induced osteoarthritis (OA. Results: In vitro, 100% of chondrocytes were transfected with siRNA in the LNP-siRNA group. In accordance with the cell culture results, red positive signals could be detected even in the deep layer of cartilage tissue cultures treated by LNP-beacon. In vivo data showed that LNP is specific for cartilage, since positive signals were detected by fluorescence molecular tomography and confocal microscopy in joint cartilage injected with LNP-beacon, but not on the surface of the synovium. In the rat model of OA, intraarticular injection of LNP-Ihh siRNA attenuated OA progression, and PCR results showed LNP-Ihh siRNA exerted a positive impact on anabolic metabolism and negative

  20. Polyetherimide-grafted Fe3O4@SiO2 nanoparticles as theranostic agents for simultaneous VEGF siRNA delivery and magnetic resonance cell imaging

    Directory of Open Access Journals (Sweden)

    Li T

    2015-07-01

    Full Text Available Tingting Li,1 Xue Shen,1 Yin Chen,1 Chengchen Zhang,1 Jie Yan,1 Hong Yang,1 Chunhui Wu,1,2 Hongjun Zeng,1,2 Yiyao Liu1,21Department of Biophysics, School of Life Science and Technology, 2Center for Information in Biomedicine, University of Electronic Science and Technology of China, Chengdu, Sichuan, People’s Republic of ChinaAbstract: Engineering a safe and high-efficiency delivery system for efficient RNA interference is critical for successful gene therapy. In this study, we designed a novel nanocarrier system of polyethyleneimine (PEI-modified Fe3O4@SiO2, which allows high efficient loading of VEGF small hairpin (shRNA to form Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites for VEGF gene silencing as well as magnetic resonance (MR imaging. The size, morphology, particle stability, magnetic properties, and gene-binding capacity and protection were determined. Low cytotoxicity and hemolyticity against human red blood cells showed the excellent biocompatibility of the multifunctional nanocomposites, and also no significant coagulation was observed. The nanocomposites maintain their superparamagnetic property at room temperature and no appreciable change in magnetism, even after PEI modification. The qualitative and quantitative analysis of cellular internalization into MCF-7 human breast cancer cells by Prussian blue staining and inductively coupled plasma atomic emission spectroscopy analysis, respectively, demonstrated that the Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites could be easily internalized by MCF-7 cells, and they exhibited significant inhibition of VEGF gene expression. Furthermore, the MR cellular images showed that the superparamagnetic iron oxide core of our Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites could also act as a T2-weighted contrast agent for cancer MR imaging. Our data highlight multifunctional Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites as a potential platform for simultaneous gene delivery and MR cell imaging, which are promising

  1. Vitamin E succinate-conjugated F68 micelles for mitoxantrone delivery in enhancing anticancer activity

    Directory of Open Access Journals (Sweden)

    Liu Y

    2016-07-01

    Full Text Available Yuling Liu,1,* Yingqi Xu,2,* Minghui Wu,3 Lijiao Fan,1 Chengwei He,2 Jian-Bo Wan,2 Peng Li,2 Meiwan Chen,2 Hui Li11Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences, Beijing, People’s Republic of China; 2State Key Laboratory of Quality Research in Chinese Medicine, Institute of Chinese Medical Sciences, University of Macau, Macau, People’s Republic of China; 3Department of Cell Biology and Anatomy, School of Medicine, University of Florida, Gainesville, FL, USA *These authors contributed equally to this work Abstract: Mitoxantrone (MIT is a chemotherapeutic agent with promising anticancer efficacy. In this study, Pluronic F68-vitamine E succinate (F68-VES amphiphilic polymer micelles were developed for delivering MIT and enhancing its anticancer activity. MIT-loaded F68–VES (F68–VES/MIT micelles were prepared via the solvent evaporation method with self-assembly under aqueous conditions. F68–VES/MIT micelles were found to be of optimal particle size with the narrow size distribution. Transmission electron microscopy images of F68–VES/MIT micelles showed homogeneous spherical shapes and smooth surfaces. F68–VES micelles had a low critical micelle concentration value of 3.311 mg/L, as well as high encapsulation efficiency and drug loading. Moreover, F68–VES/MIT micelles were stable in the presence of fetal bovine serum for 24 hours and maintained sustained drug release in vitro. Remarkably, the half maximal inhibitory concentration (IC50 value of F68–VES/MIT micelles was lower than that of free MIT in both MDA-MB-231 and MCF-7 cells (two human breast cancer cell lines. In addition, compared with free MIT, there was an increased trend of apoptosis and cellular uptake of F68–VES/MIT micelles in MDA-MB-231 cells. Taken together, these results indicated that F68–VES polymer micelles were able to effectively deliver MIT and largely improve its potency in cancer therapy. Keywords: F68, vitamin E

  2. TU-EF-204-02: Hiigh Quality and Sub-MSv Cerebral CT Perfusion Imaging

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ke; Niu, Kai; Wu, Yijing; Chen, Guang-Hong [University of Wisconsin, Madison, WI (United States)

    2015-06-15

    Purpose: CT Perfusion (CTP) imaging is of great importance in acute ischemic stroke management due to its potential to detect hypoperfused yet salvageable tissue and distinguish it from definitely unsalvageable tissue. However, current CTP imaging suffers from poor image quality and high radiation dose (up to 5 mSv). The purpose of this work was to demonstrate that technical innovations such as Prior Image Constrained Compressed Sensing (PICCS) have the potential to address these challenges and achieve high quality and sub-mSv CTP imaging. Methods: (1) A spatial-temporal 4D cascaded system model was developed to indentify the bottlenecks in the current CTP technology; (2) A task-based framework was developed to optimize the CTP system parameters; (3) Guided by (1) and (2), PICCS was customized for the reconstruction of CTP source images. Digital anthropomorphic perfusion phantoms, animal studies, and preliminary human subject studies were used to validate and evaluate the potentials of using these innovations to advance the CTP technology. Results: The 4D cascaded model was validated in both phantom and canine stroke models. Based upon this cascaded model, it has been discovered that, as long as the spatial resolution and noise properties of the 4D source CT images are given, the 3D MTF and NPS of the final CTP maps can be analytically derived for a given set of processing methods and parameters. The cascaded model analysis also identified that the most critical technical factor in CTP is how to acquire and reconstruct high quality source images; it has very little to do with the denoising techniques often used after parametric perfusion calculations. This explained why PICCS resulted in a five-fold dose reduction or substantial improvement in image quality. Conclusion: Technical innovations generated promising results towards achieving high quality and sub-mSv CTP imaging for reliable and safe assessment of acute ischemic strokes. K. Li, K. Niu, Y. Wu: Nothing to

  3. Depression, 5HTTLPR and BDNF Val66Met polymorphisms, and plasma BDNF levels in hemodialysis patients with chronic renal failure

    Directory of Open Access Journals (Sweden)

    Wang LJ

    2014-07-01

    Full Text Available Liang-Jen Wang,1,* Chih-Ken Chen,2,3,* Heng-Jung Hsu,3,4 I-Wen Wu,3,4 Chiao-Yin Sun,3,4 Chin-Chan Lee3,41Department of Child and Adolescent Psychiatry, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Kaohsiung, Taiwan; 2Department of Psychiatry, Chang Gung Memorial Hospital, Keelung, Taiwan; 3Chang Gung University School of Medicine, Taoyuan, Taiwan; 4Department of Nephrology, Chang Gung Memorial Hospital, Keelung, Taiwan *LJW and CKC are joint first authors and contributed equally to this manuscriptObjective: Depression is the most prevalent comorbid psychiatric disease among hemodialysis patients with end-stage renal disease. This cross-sectional study investigated whether depression in hemodialysis patients is associated with the polymorphism of the 5' flanking transcriptional region (5-HTTLPR of the serotonin transporter gene, the valine (Val-to-methionine (Met substitution at codon 66 (Val66Met polymorphism of the brain-derived neurotrophic factor (BDNF gene, or plasma BDNF levels.Methods: A total of 188 participants (mean age: 58.5±14.0 years; 89 men and 99 women receiving hemodialysis at the Chang Gung Memorial Hospital were recruited. The diagnosis of major depressive disorder (MDD was confirmed using the Chinese version of the Mini International Neuropsychiatric Interview. The genotypes of 5-HTTLPR and BDNF Val66Met were conducted using polymerase chain reactions plus restriction fragment length polymorphism analysis. The plasma BDNF levels were measured using an enzyme-linked immunosorbent assay kit.Results: Forty-five (23.9% patients fulfilled the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV-TR criteria for a MDD. There were no significant effects of the 5-HTTLPR or BDNF Val66Met gene polymorphism on MDD among the hemodialysis patients. The plasma BDNF levels correlated significantly with age (P=0.003 and sex (P=0.047 but not with depression, the genotypes of 5

  4. Association between the biochemical profiles in blood and bone mineral density in Chinese Han population: findings from a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Chen HX

    2016-11-01

    Full Text Available Hong-Xia Chen,1,2,* Li-Bing Wu,3,* Zhong-Ji Meng1 1Institute of Biomedicine, Taihe Hospital, Hubei University of Medicine, Shiyan, Hubei Province, People’s Republic of China; 2Department of Environmental, Agricultural, & Occupational Health, College of Public Health, University of Nebraska Medical Center, Omaha, NE, USA; 3Department of Nuclear Medicine, Taihe Hospital, Hubei University of Medicine, Shiyan, Hubei Province, People’s Republic of China *These authors contributed equally to this work. Abstract: This study investigated the possible correlation between blood biochemical profiles and bone mineral density (BMD in the Chinese Han population. We conducted a cross-sectional analysis using participants randomly selected from the Health Screening Center of Taihe Hospital, Hubei University of Medicine, which included a total of 285 individuals, varied in ages from 31 years to 63 years. The height, weight, and body mass index (BMI of each subject were measured, as well as fasting blood glucose (FBG, triglycerides, total cholesterol, blood uric acid (UA, blood urea nitrogen, and blood creatinine. We evaluated BMD at the wrist (grams per centimeter square using a dual-energy X-ray absorptiometry scan. The mean ages of female and male groups were 45.32±8.24 years and 46.76±9.01 years, respectively. The mean age of the study population was 46.14±8.79 years, which is similar to the general population. The mean BMI values were 22.08±2.38 kg/m2 and 24.50±2.67 kg/m2 in the female and male population, respectively, representing a statistically significant difference (P<0.05. No significant differences in levels of FBG total cholesterol, or triglycerides were seen among the male and female population. Multiple linear regression analysis was performed using BMD as outcome variables and BMI, blood UA, FBG, total cholesterol, triglycerides, urea nitrogen, and blood creatinine as covariates, and the regression equation was established as Y=0

  5. Postoperative radiotherapy for invasive micropapillary carcinoma of the breast: an analysis of Surveillance, Epidemiology, and End Results database

    Directory of Open Access Journals (Sweden)

    Wu SG

    2017-10-01

    Full Text Available San-Gang Wu,1,* Wen-Wen Zhang,2,* Jia-Yuan Sun,2 Feng-Yan Li,2 Yong-Xiong Chen,3 Zhen-Yu He2 1Department of Radiation Oncology, Xiamen Cancer Hospital, The First Affiliated Hospital of Xiamen University, Xiamen, 2Department of Radiation Oncology, Sun Yat-sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center of Cancer Medicine, Guangzhou, 3Eye Institute of Xiamen University, Fujian Provincial Key Laboratory of Ophthalmology and Visual Science, Medical College, Xiamen University, Xiamen, People’s Republic of China *These authors contributed equally to this work Introduction: Invasive micropapillary carcinoma (IMPC of the breast poses a high risk of locoregional recurrence, and postoperative radiotherapy (PORT may be beneficial in IMPC. Hence, we determined the clinical value of PORT in IMPC patients. Patients and methods: We assessed clinicopathological factors extracted from the Surveillance, Epidemiology, and End Results database (2004–2013. Univariate and multivariate Cox proportional hazards regressions were performed to assess the independent prognostic factors on breast cancer-specific survival (BCSS and overall survival (OS. Results: Of the 881 study patients, 444 (50.4% and 437 (49.6% underwent breast-conserving surgery (BCS and mastectomy (MAST, respectively, of whom 357 (80.4% and 153 (35.0% underwent PORT, respectively. Patients with young age, large tumor size, or advanced nodal stage were more likely to undergo MAST and PORT compared with MAST alone. Patients with progesterone receptor-positive disease were more likely to receive BCS and PORT compared with BCS alone. The 5-year BCSS and OS were 95.7% and 90.9%, respectively. On multivariate analyses, tumor size, histological grade, and estrogen receptor status were independent predictors of BCSS and OS. The types of surgical procedures (MAST vs. BCS were not an independent predictor of survival outcomes. Patients who

  6. Effectiveness of high-intensity interval training on the mental and physical health of people with chronic schizophrenia

    Directory of Open Access Journals (Sweden)

    Wu MH

    2015-05-01

    Full Text Available Meng Hsiu Wu,1,2 Chin Pang Lee,1–3 Shih Chieh Hsu,1,3 Chia Ming Chang,1,3 Ching Yen Chen1–3 1Department of Psychiatry, Chang Gung Memorial Hospital, Linkou, Taiwan; 2Men’s Health Center, Chang Gung Memorial Hospital, Linkou, Taiwan; 3School of Medicine, Chang Gung University, Taoyuan, Taiwan Background: Low-volume high-intensity interval training (HIIT is emerging as a time-efficient exercise strategy for improving cardiorespiratory fitness and for controlling blood sugar levels and hypertension. In addition, patient acceptance of HIIT may improve adherence to exercise programs. This study evaluated the effectiveness of HIIT for improving the mental and physical health of people with chronic schizophrenia. Methods: Twenty patients attending a psychiatric day care unit volunteered for an 8-week program of HIIT. Blood pressure, resting heart rate, body weight, body mass index, waist and hip circumference, and waist-to-hip ratio were measured weekly. The Positive and Negative Syndrome Scale score was recorded at baseline and at the end of the study. Beck Depression Inventory (BDI and Beck Anxiety Inventory (BAI scores were recorded every 2 weeks. Results: Statistically significant changes occurred in the physical and mental parameters measured in the 18 patients who completed the study. Body weight, body mass index, resting heart rate, and pulse pressure decreased significantly. Mean arterial pressure and diastolic blood pressure increased significantly. Mental health scores improved, with the Negative Scale score decreasing from 31.17±5.95 to 27.78±3.57 (P<0.01 and the General Psychopathology Scale score from 14.28±2.16 to 13.00±1.72 (P<0.01. Positive Scale scores changed, but not significantly, from 12.28±2.27 to 12.33±2.00 (P=0.729. Scores on the BDI (from 19.56±15.28 to 15.89±14.33, P<0.001 and BAI (from 13.67±13.83 to 10.06±11.18, P=0.003 both improved significantly. Conclusion: This study demonstrated that HIIT has positive

  7. Efficacy and safety of immunosuppressive therapy in the treatment of seronegative hepatitis associated aplastic anemia

    Directory of Open Access Journals (Sweden)

    Chen HF

    2014-09-01

    Full Text Available Hai-Fei Chen,* Bin-Xian Xu, Hong-Shi Shen,* Zheng-Yang Li, Ling-Juan Jin, Jie-Qing Tang, Jing Wang, Jing-Jing Zhu, Long-Mei Qin, Qing-Ya Cui, Yong-Ya Ren, Tian-Qin Wu Department of hematology, 100th hospital of People’s Liberation Army, Suzhou, Jiangsu province, The People’s Republic of China *These authors have contributed equally to this paper Objective: To investigate the clinical characteristics of seronegative hepatitis-associated aplastic anemia (AA (SNHAA and hepatitis B virus (HBV infection complicating AA (HBVAA, and thereby compare the efficacy of immunosuppressive therapy (IST.Methods: An analysis was conducted on the clinical data of ten patients with SNHAA out of 332 cases of AA from our center at AA diagnosis, and on the efficacy of IST. This was compared to 22 cases of HBVAA at AA onset as well as the associated IST outcomes.Results: Nine patients with SNHAA developed severe aplastic anemia, with a median age of 18 years. After IST, six (60% of the SNHAA patients achieved complete remission and two achieved partial remission. The patients with HBVAA had a total response rate of 82.3%. The disease recurred in two HBVAA patients. No statistically significant differences were observed in response rate, mortality, and recurrence rate between both groups. As compared with HBVAA, patients with SNHAA had a shorter interval from the acute episode of hepatitis to AA onset (4 months versus 92 months, P=0.00, a quicker response to IST (2.5 months versus 4.5 months, P=0.018, a lower proportion of bone marrow hematopoietic tissues (20.6% versus 23.6%, P=0.03, and lower white blood cell and absolute neutrophil count (0.8×109/L versus 1.23×109/L and 0.26×109/L versus 0.58×109/L, P=0.026 and P=0.0009, respectively. No significant liver damage or hepatitis B fulminant infection was observed in either group during the follow-up. Conclusion: The prevalence of SNHAA is 3.01%. SNHAA often presents as severe AA and responds to IST quickly

  8. Functionalized milk-protein-coated magnetic nanoparticles for MRI-monitored targeted therapy of pancreatic cancer

    Directory of Open Access Journals (Sweden)

    Huang J

    2016-07-01

    Full Text Available Jing Huang,1,2 Weiping Qian,3 Liya Wang,1,2 Hui Wu,1 Hongyu Zhou,3 Andrew Yongqiang Wang,4 Hongbo Chen,5 Lily Yang,3 Hui Mao1,2 1Department of Radiology and Imaging Sciences, 2Center for Systems Imaging, 3Department of Surgery, Emory University School of Medicine, Atlanta, GA, USA; 4Ocean Nanotech LLC, Springdale, AR, USA; 5School of Life and Environmental Sciences, Guilin University of Electronic Technology, Guilin, Guangxi, People’s Republic of China Abstract: Engineered nanocarriers have emerged as a promising platform for cancer therapy. However, the therapeutic efficacy is limited by low drug loading efficiency, poor passive targeting to tumors, and severe systemic side effects. Herein, we report a new class of nanoconstructs based on milk protein (casein-coated magnetic iron oxide (CNIO nanoparticles for targeted and image-guided pancreatic cancer treatment. The tumor-targeting amino-terminal fragment (ATF of urokinase plasminogen activator and the antitumor drug cisplatin (CDDP were engineered on this nanoplatform. High drug loading (~25 wt% and sustained release at physiological conditions were achieved through the exchange and encapsulation strategy. These ATF-CNIO-CDDP nanoparticles demonstrated actively targeted delivery of CDDP to orthotopic pancreatic tumors in mice. The effective accumulation and distribution of ATF-CNIO-CDDP was evidenced by magnetic resonance imaging, based on the T2-weighted contrast resulting from the specific accumulation of ATF-CNIO-CDDP in the tumor. Actively targeted delivery of ATF-CNIO-CDDP led to improved therapeutic efficacy in comparison with free CDDP and nontargeted CNIO-CDDP treatment. Meanwhile, less systemic side effects were observed in the nanocarrier-treated groups than that in the group treated with free CDDP. Hematoxylin and Eosin and Sirius Red staining of tumor sections revealed the possible disruption of stroma during the treatment with ATF-CNIO-CDDP. Overall, our results suggest that

  9. Functional cortical changes in relapsing-remitting multiple sclerosis at amplitude configuration: a resting-state fMRI study

    Directory of Open Access Journals (Sweden)

    Liu H

    2016-11-01

    Full Text Available Heng Liu,1,* Hua Chen,1,* Bo Wu,1 Tijiang Zhang,1 Jinhui Wang,2,3 Kexin Huang,1 Ganjun Song,1 Jian Zhan4 1Department of Radiology, Affiliated Hospital of Zunyi Medical University, Medical Imaging Center of Guizhou Province, Zunyi, Guizhou, 2Department of Psychology, Hangzhou Normal University, 3Zhejiang Key Laboratory for Research in Assessment of Cognitive Impairments, Hangzhou, 4Department of Neurology, Affiliated Hospital of Zunyi Medical University, Zunyi, Guizhou, People’s Republic of China *These authors contributed equally to this work Objective: The aim of this study was to explore the amplitude of spontaneous brain activity fluctuations in patients with relapsing–remitting multiple sclerosis (RRMS using the amplitude of low-frequency fluctuation (ALFF method. Methods: ALFF and SPM8 were utilized to assess alterations in regional spontaneous brain activities in patients with RRMS in comparison with healthy controls (HCs. The beta values of altered brain regions between patients with RRMS and HCs were extracted, and a receiver operating characteristic (ROC curve was generated to calculate the sensitivities and specificities of these different brain areas for distinguishing patients with RRMS from HCs. Pearson correlation analyses were applied to assess the relationships between the beta values of altered brain regions and disease duration and Expanded Disability Status Scale (EDSS score. Patients and participants: A total of 18 patients with RRMS (13 females; five males and 18 sex-, age-, and education-matched HCs (14 females; four males were recruited for this study. Measurements and results: Compared with HCs, patients with RRMS showed higher ALFF responses in the right fusiform gyrus (Brodmann area [BA] 37 and lower ALFF responses in the bilateral anterior cingulate cortices (BA 24 and 32, bilateral heads of the caudate nuclei, and bilateral brainstem. The ROC analysis revealed that the beta values of these abnormal brain areas

  10. NVP-BEZ235 overcomes gefitinib-acquired resistance by down-regulating PI3K/AKT/ mTOR phosphorylation

    Directory of Open Access Journals (Sweden)

    Sun ZH

    2015-01-01

    Full Text Available Zhihua Sun,2,* Qiuhui li,1,* Sheng Zhang,1 Jing Chen,1 Lili Huang,3 Jinghua Ren,1 Yu Chang,1 Yichen Liang,1 Gang Wu1 1Cancer Center, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei, People’s Republic of China; 2Oncology department, Xiangyang central Hospital, Xiangyang, Hubei, People’s Republic of China; 3Radiation Oncology Department, Fifth Affiliated Hospital of Sun Yat-sen University, Zhuhai, Guangdong, People's Republic of China *These authors contributed equally to this work Background: Patients harboring activating mutations in epidermal growth factor receptors (EGFR are particularly sensitive to EGFR tyrosine kinase inhibitors (TKIs. However, most patients develop an acquired resistance after a period of about 10 months. This study focuses on the therapeutic effect of NVP-BEZ235, a dual inhibitor of phosphatidylinositol- 3-kinase/mammalian target of rapamycin (PI3K/mTOR, in gefitinib-resistant non-small cell lung cancer. Methods: H1975 cell line was validated as a gefitinib-resistant cell model by the nucleotide-sequence analysis. We used the 3-(4,5-Dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay to detect the growth of H1975 cell line in vitro. H1975 cells' migration was detected by the migration assay. Xenograft models were used to investigate the growth of gefitinib-resistant non-small cell lung cancer in vivo. Western blot and immunohistochemical analysis were used to investigate the level of PI3K/protein kinase B(AKT/mTOR signaling pathway proteins. Results: We show that NVP-BEZ235 effectively inhibited the growth of H1975 cells in vivo as well as in vitro. Similarly, H1975 cell migration was reduced by NVP-BEZ235. Further experiments revealed that NVP-BEZ235 attenuated the phosphorylation of PI3K/AKT/mTOR signaling pathway proteins. Conclusion: Taken together, we suggest that NVP-BEZ235 inhibits gefitinib-resistant tumor growth by downregulating PI3K

  11. Divergence of substrate specificity and function in the Escherichia coli hotdog-fold thioesterase paralogs YdiI and YbdB.

    Science.gov (United States)

    Latham, John A; Chen, Danqi; Allen, Karen N; Dunaway-Mariano, Debra

    2014-07-29

    The work described in this paper, and its companion paper (Wu, R., Latham, J. A., Chen, D., Farelli, J., Zhao, H., Matthews, K. Allen, K. N., and Dunaway-Mariano, D. (2014) Structure and Catalysis in the Escherichia coli Hotdog-fold Thioesterase Paralogs YdiI and YbdB. Biochemistry, DOI: 10.1021/bi500334v), focuses on the evolution of a pair of paralogous hotdog-fold superfamily thioesterases of E. coli, YbdB and YdiI, which share a high level of sequence identity but perform different biological functions (viz., proofreader of 2,3-dihydroxybenzoyl-holoEntB in the enterobactin biosynthetic pathway and catalyst of the 1,4-dihydoxynapthoyl-CoA hydrolysis step in the menaquinone biosynthetic pathway, respectively). In vitro substrate activity screening of a library of thioester metabolites showed that YbdB displays high activity with benzoyl-holoEntB and benzoyl-CoA substrates, marginal activity with acyl-CoA thioesters, and no activity with 1,4-dihydoxynapthoyl-CoA. YdiI, on the other hand, showed a high level of activity with its physiological substrate, significant activity toward a wide range of acyl-CoA thioesters, and minimal activity toward benzoyl-holoEntB. These results were interpreted as evidence for substrate promiscuity that facilitates YbdB and YdiI evolvability, and divergence in substrate preference, which correlates with their assumed biological function. YdiI support of the menaquinone biosynthetic pathway was confirmed by demonstrating reduced anaerobic growth of the E. coli ydiI-knockout mutant (vs wild-type E. coli) on glucose in the presence of the electron acceptor fumarate. Bioinformatic analysis revealed that a small biological range exists for YbdB orthologs (i.e., limited to Enterobacteriales) relative to that of YdiI orthologs. The divergence in YbdB and YdiI substrate specificity detailed in this paper set the stage for their structural analyses reported in the companion paper.

  12. Correlation between radioactivity and chemotherapeutics of the 111In-VNB-liposome in pharmacokinetics and biodistribution in rats

    Directory of Open Access Journals (Sweden)

    Tsai TH

    2012-02-01

    Full Text Available Wen-Chuan Lee1,*, Chih-Hsien Chang2,3,*, Chih-Min Huang1, Yu-Tse Wu1, Liang-Cheng Chen2, Chung-Li Ho2, Tsui-Jung Chang2, Te-Wei Lee2, Tung-Hu Tsai1,41Institute of Traditional Medicine, School of Medicine, National Yang-Ming University, Taipei, 2Division of Isotope Application, Institute of Nuclear Energy Research, Taoyuan, 3Department of Biomedical Imaging and Radiological Sciences, National Yang-Ming University, Taipei, 4Department of Education and Research, Taipei City Hospital, Taipei, Taiwan*These authors contributed equally to this workBackground: The combination of a radioisotope with a chemotherapeutic agent in a liposomal carrier (ie, Indium-111-labeled polyethylene glycol pegylated liposomal vinorelbine, [111In-VNB-liposome] has been reported to show better therapeutic efficiency in tumor growth suppression. Nevertheless, the challenge remains as to whether this therapeutic effect is attributable to the combination of a radioisotope with chemotherapeutics. The goal of this study was to investigate the pharmacokinetics, biodistribution, and correlation of Indium-111 radioactivity and vinorelbine concentration in the 111In-VNB-liposome.Methods: The VNB-liposome and 111In-VNB-liposome were administered to rats. Blood, liver, and spleen tissue were collected to determine the distribution profile of the 111In-VNB-liposome. A liquid chromatography tandem mass spectrometry system and gamma counter were used to analyze the concentration of vinorelbine and radioactivity of Indium-111.Results: High uptake of the 111In-VNB-liposome in the liver and spleen demonstrated the properties of a nanosized drug delivery system. Linear regression showed a good correlation (r = 0.97 between Indium-111 radioactivity and vinorelbine concentration in the plasma of rats administered the 111In-VNB-liposome.Conclusion: A significant positive correlation between the pharmacokinetics and biodistribution of 111Indium radioactivity and vinorelbine in blood, spleen

  13. A role of Yueju in fast-onset antidepressant action on major depressive disorder and serum BDNF expression: a randomly double-blind, fluoxetine-adjunct, placebo-controlled, pilot clinical study

    Directory of Open Access Journals (Sweden)

    Wu R

    2015-08-01

    Full Text Available Ruyan Wu,1,* Dandan Zhu,1,* Youchun Xia,2,* Haosen Wang,2 Weiwei Tao,1 Wenda Xue,1 Baomei Xia,1 Li Ren,1 Xin Zhou,1 Guochun Li,3 Gang Chen1 1Center for Translational Systems Biology and Neuroscience, Key Laboratory of Integrative Biomedicine of Brain Diseases, Nanjing University of Chinese Medicine, Nanjing, People’s Republic of China; 2The Fourth People’s Hospital of Taizhou, Taizhou, People’s Republic of China; 3School of Basic Chinese Medicine, Nanjing University of Chinese Medicine, Nanjing, People’s Republic of China *These authors contributed equally to this work Introduction: Conventional antidepressants, including fluoxetine, have a major disadvantage in delayed onset of efficacy. Yueju, an herbal medicine used to treat mood disorders was recently found to exhibit rapid antidepressant effects. The present study was conducted to evaluate the role of Yueju in rapidly acting on major depressive disorder (MDD.Methods: Participants were MDD patients with scores of 24-item Hamilton Depression Rating Scale (HDRS-24 ≥20 and without history of antidepressant use. They randomly received daily oral doses of Yueju (23 g/day plus fluoxetine (20 mg/day (experimental group or placebo plus fluoxetine (control group for 7 days. HDRS-24 was used as the primary outcome measurement at baseline, and on days 1, 3, 5, and 7. Concentrations of serum brain-derived neurotrophic factor (BDNF were assessed at baseline and on days 1 and 7.Results: In all, 18 participants met the criteria for data analysis. Compared to baseline level, only experimental group showed significant decrease of HDRS-24 score from day 3 to day 7 (P<0.05. Experimental group also showed significant improvement compared with control group from day 3 to day 7 (P<0.05. No correlation between treatment outcomes with serum BDNF levels was observed. However, experimental group showed significant correlation for serum BDNF level on day 1 with day 7 (r=0.721, P=0.028, whereas the control

  14. Intravenous moxifloxacin in routine hospital treatment of respiratory tract infections in China: results of a multicenter, noninterventional study

    Directory of Open Access Journals (Sweden)

    Chen R

    2011-04-01

    Full Text Available Rongchang Chen1, Wenjiang Ma2, Xuezhong Yu3, Xinmin Liu4, Jihong Zhu5, Hong Liang6, Xiaomei Wu7, Tao Guo81State Key Laboratory of Respiratory Disease, First Affiliated Hospital of Guangzhou Medical University, China; 2Respiratory Department, The First Affiliated Hospital of Medical School of Zhejiang University, China; 3Emergency Department, Peking Union Medical College Hospital, China; 4Geriatric Department, Peking University First Hospital, China; 5Emergency Department, Peking University People's Hospital, China; 6Respiratory Department, Huadong Hospital Affiliated to Fudan University, China; 7Respiratory Department, The Second Affiliated Hospital of Harbin Medical University, China; 8Hematology Department, Wuhan Union Hospital, ChinaObjective: To investigate the effectiveness, safety, and tolerability of moxifloxacin (MXF (intravenous [IV] or sequential therapy [IV followed by oral] under daily treatment conditions in a large number of patients with respiratory tract infections.Design: Patients with a diagnosis of respiratory tract infection should be treated with MXF IV and/or tablets 400 mg once daily for a duration at the physician's discretion. For each patient, the physician documented data at an initial visit and at the end of therapy (EOT visit and/or, in the case of sequential therapy, an interim visit when the patient switched to oral treatment.Results: A total of 1953 patients treated with MXF were documented and were valid for an effectiveness and safety evaluation. An improvement was observed in 98.1% (n = 1911/1949 of patients treated with MXF. Recovery was documented in 89.9% (n = 1754/1951 of the patients. At the EOT visit, severity of infection was assessed to be "relieved" or at least "improved" in 96.5% (n = 1873/1940 of the patients. Physicians assessed overall effectiveness as "good" or "very good" in 93.3% (n = 1822/1953 of all patients. The physicians' overall tolerability rating was "very good" or "good" in 93.5% (n

  15. Patterns of persistence with pharmacological treatment among patients with current depressive episode and their impact on long-term outcome: a naturalistic study with 5-year follow-up

    Directory of Open Access Journals (Sweden)

    Li K

    2018-05-01

    Full Text Available Kanglai Li,1,* Jiong Tao,2,* Yuemei Li,3 Minhua Chen,2 Xiuhua Wu,2 Yingtao Liao,2 Xiaolan Lin,4 Zhaoyu Gan2 1Department of Very Important Patient, the 3rd Affiliated Hospital of Sun Yat-sen University, Guangzhou, People’s Republic of China; 2Department of Psychiatry, the 3rd Affiliated Hospital of Sun Yat-sen University, Guangzhou, People’s Republic of China; 3Department of Obstetrics, Wuzhou Gongren Hospital, Wuzhou, People’s Republic of China; 4Department of Infectious Diseases, the 3rd Affiliated Hospital of Sun Yat-Sen University, Guangzhou, People’s Republic of China *These authors contributed equally to this work Background: The aim of the study was to describe and compare the patterns of medication persistence among patients with unipolar depression (UD or bipolar depression in a 5-year follow-up, and explore their impact on long-term outcome. Patients and methods: A total of 333 eligible patients with current major depressive episode were observed and followed up from the first index prescription for 5 years. Lack of persistence or treatment interruption was defined as a gap of at least 2 consecutive months without taking any medication. Time to lack of persistence in the first (TLP1 and the second (TLP2 episode of treatment, number of visits before the first treatment interruption (NV and number of treatment interruptions (NTI were measured. Results: During the 5-year follow-up, nearly 50% of patients experienced at least two times of treatment interruption. Pattern of medication persistence did not significantly differ between UD and bipolar disorder (BD patients. TLP1 was positively associated with TLP2. Shorter TLP1 predicted a higher possibility of subsequent visits because of recurrence or relapse and more NTI meant a lower likelihood of achieving full remission in the fifth year for both UD and BD patients. For UD patients, shorter TLP1 or less NV predicted a lower chance of achieving remission, while for BD patients

  16. Construction and characterization of an anti-CD20 mAb nanocomb with exceptionally excellent lymphoma-suppressing activity

    Directory of Open Access Journals (Sweden)

    Li H

    2015-07-01

    Full Text Available Hua-Fei Li,1–3,* Cong Wu,4,* Ting Chen,5,* Ge Zhang,1 He Zhao,1 Chang-Hong Ke,1 Zheng Xu21International Joint Cancer Institute, Translation Medicine Institute, 2Planning Division, Scientific Research Department, 3Tumor Immunology and Gene Therapy Center, Eastern Hepatobiliary Surgery Hospital, 4Department of Laboratory Diagnosis, Changhai Hospital, 5Department of Cardiology, Changhai Hospital, the Second Military Medical University, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: The CD20-directed monoclonal antibody rituximab (RTX established a new era in the treatment of non-Hodgkin lymphoma (NHL; however, suboptimal response and/or resistance to RTX still limit its clinical merits. Although four effector mechanisms are validated to participate in CD20-based immunotherapy, including complement-dependent cytotoxicity, antibody-dependent cell-mediated cytotoxicity, caspase-dependent apoptosis, and lysosome-mediated programmed cell death (PCD, they could hardly be synchronously activated by any anti-CD20 mAb or mAb derivative until now. Herein, a novel mAb nanocomb (polyethylenimine polymer–RTX–tositumomab [PPRT nanocomb] was firstly constructed through mass arming two different anti-CD20 mAbs (RTX and tositumomab to one polymer by nanotechnology. Comparing with free mAbs, PPRT nanocomb possesses a comparable binding ability and reduced “off-rate” to surface CD20 of NHL cells. When treated by PPRT nanocomb, the caspase-dependent apoptosis was remarkably enhanced except for concurrently eliciting complement-dependent cytotoxicity, antibody-dependent cell-mediated cytotoxicity, and lysosome-mediated PCD. Besides, “cross-cell link”-assisted homotypic adhesion by PPRT nanocomb further enhanced the susceptibility to PCD of lymphoma cells. Pharmacokinetic assays revealed that PPRT nanocomb experienced a relatively reduced clearance from peripheral blood compared with free antibodies. With

  17. Size-dependent cytotoxicity of Fe3O4 nanoparticles induced by biphasic regulation of oxidative stress in different human hepatoma cells

    Directory of Open Access Journals (Sweden)

    Xie Y

    2016-07-01

    Full Text Available Yuexia Xie,1,2,* Dejun Liu,3,* Chenlei Cai,1,* Xiaojing Chen,1 Yan Zhou,1 Liangliang Wu,1 Yongwei Sun,3 Huili Dai,1,2 Xianming Kong,1,2 Peifeng Liu1,2 1Central Laboratory, 2State Key Laboratory of Oncogenes and Related Genes, Shanghai Cancer Institute, 3Department of Biliary-Pancreatic Surgery, Renji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: The application of Fe3O4 nanoparticles (NPs has made great progress in the diagnosis of disease and in the drug delivery system for cancer therapy, but the relative mecha­nisms of potential toxicity induced by Fe3O4 have not kept pace with its development in the application, which has hampered its further clinical application. In this article, we used two kinds of human hepatoma cell lines, SK-Hep-1 and Hep3B, to investigate the cytotoxic effects and the involved mechanisms of small Fe3O4 NPs with different diameters (6 nm, 9 nm, and 14 nm. Results showed that the size of NPs effectively influences the cytotoxicity of hepatoma cells: 6 nm Fe3O4 NPs exhibited negligible cytotoxicity and 9 nm Fe3O4 NPs affected cytotoxicity via cellular mitochondrial dysfunction and by inducing necrosis mediated through the mitochondria-dependent intracellular reactive oxygen species generation. Meanwhile, 14 nm Fe3O4 NPs induced cytotoxicity by impairing the integrity of plasma membrane and promoting massive lactate dehydrogenase leakage. These results explain the detailed mechanism of different diameters of small Fe3O4 NPs-induced cytotoxicity. We anticipate that this study will provide different insights into the cytotoxicity mechanism of Fe3O4 NPs, so as to make them safer to use in clinical application. Keywords: hepatoma cells, nanoparticles, cytotoxicity, mechanism, oxidative stress

  18. The incidence of postoperative radiotherapy-induced acute dermatitis in breast cancer and its influencing factors for Chinese women

    Directory of Open Access Journals (Sweden)

    Ding J

    2018-03-01

    Full Text Available Jingxian Ding,1,2,* Yonghong Guo,3,* Qingge Li,1 Jun Chen,4 Pinghua Hu,4 Qiuming Liu,4 Yali Cao,4 Jiong Wu5,6 1Department of Radiation Oncology, The Third Hospital of Nanchang, Nanchang, China; 2Department of Oncology, Fudan University Shanghai Cancer Center, Shanghai, China; 3Department of Radiation Oncology, The Fourth Affiliated Hospital of Nanchang University, Nanchang, China; 4Department of Breast Surgery, The Third Hospital of Nanchang, Nanchang, China; 5Department of Breast Surgery, Fudan University Shanghai Cancer Center, Shanghai, China; 6Department of Oncology, Shanghai Medical College, Fudan University, Shanghai, China *These authors contributed equally to this work Purpose: To investigate the incidence of skin acute reaction and its influencing factors in postoperative breast cancer radiotherapy patients. Methods: One hundred and seventy three cases of breast cancer patients treated with postoperative radiotherapy were consecutively enrolled from June 1, 2016 to July 31, 2017 in our breast cancer center. Irradiation technology includes conformal intensity-modulated radiotherapy and a conventional two-dimensional one with conventional fraction. Any acute radiation dermatitis was recorded and the influencing factors were analyzed at the end of the radiation treatment. Results: Radiotherapy-induced acute dermatitis in patients with breast-conserving surgery was relatively mild. Among the 173 patients, 33 cases had no obvious changes in the skin (grade 0; 121 cases had grade 1 skin reactions, manifested as local dark erythema and dry peeling; 29 cases had grade 2 skin reactions, characterized by edema, hyperemia, or erosion part; no grade 3 cases of skin reactions were observed. The incidence of grade 0, grade 1, and grade 2 reactions in all patients was 19.1%, 69.9%, and 11.0%, respectively. The severity of skin acute reaction is independent of the tumor sites, molecular subtypes, patients’ age, and irradiation modalities, but it

  19. Peer review statement

    Science.gov (United States)

    2012-11-01

    All papers published in this volume of Journal of Physics: Conference Series have been peer reviewed through processes administered by the editors of the 26th IAHR Symposium on Hydraulic Machinery and Systems proceedings. Reviews were conducted by expert referees from the International Technical Committee to the professional and scientific standards expected of a proceedings journal published by IOP Publishing. The members of the Scientific Committee who selected and reviewed the papers included in the Proceedings of the 26th IAHR Symposium on Hydraulic Machinery and Systems are: Yulin WU Tsinghua University China François AVELLAN EPFL-LMH Switzerland (principal) Xingqi LUO Xi'an University of Sci & Tech China Martin BÖHLE Kaiserslautern University Germany Gerard BOIS Arts et Métiers ParisTech France Luca D'AGOSTINO University of Pisa Italy Eduard EGUSQUIZA Polytechnical University Catalonia Spain Richard FISHER Voith Hydro Inc USA Regiane FORTES-PATELLA Institute Polytechnique de Grenoble France Aleksandar GAJIC University of Belgrade Serbia Wei YANG China Agriculture University China YinLu YOUNG University of Michigan USA Adrian LUNGU Dunarea de Jos University of Galati Romania Arpad FAY University of Miskolcz Hungary José GONZÁLEZ Universidad de Oviedo Spain Baoshan ZHU Tsinghua University China Hongxun CHEN Shanghai University China Chisachi KATO University of Tokyo Japan Zhenyue MA Dalian University of Sci & Tech China Honggang FAN Tsinghua University China François GUIBAULT Ecole Polytechnique de Montreal Canada Pengcheng GUO Xian University of Technology China Leqing WANG Zhejiang University China Toshiaki IKOHAGI Tohoku University Japan Jiandong YANG Wuhan University China Jianzhong ZHOU Huazhong University of Sci & Tech China Jinwei LI NULL China Rennian LI Lanzhou University of Sci & Tech China Houlin LIU NULL China Juan LIU Tsinghua University China Shuhong LIU Tsinghua University China Xianwu LUO Tsinghua University China Michihiro NISHI Tsinghua

  20. pH-sensitive degradable nanoparticles for highly efficient intracellular delivery of exogenous protein

    Directory of Open Access Journals (Sweden)

    Xu D

    2013-09-01

    Full Text Available Dan Xu,1 Fei Wu,1 Yinghui Chen,2,* Liangming Wei,3,* Weien Yuan1,* 1School of Pharmacy, Shanghai Jiao Tong University, Shanghai, 2Department of Neurology, Jinshan Hospital, Fudan University, Shanghai, 3Key Laboratory for Thin Film and Microfabrication of the Ministry of Education, Institute of Micro/Nano Science and Technology, Shanghai Jiao Tong University, Shanghai, People's Republic of China*These authors contributed equally to this workBackground: Encapsulating exogenous proteins into a nanosized particulate system for delivery into cells is a great challenge. To address this issue, we developed a novel nanoparticle delivery method that differs from the nanoparticles reported to date because its core was composed of cross-linked dextran glassy nanoparticles which had pH in endosome-responsive environment and the protein was loaded in the core of cross-linked dextran glassy nanoparticles.Methods: In this study, dextran in a poly(ethylene glycol aqueous two-phase system created a different chemical environment in which proteins were encapsulated very efficiently (84.3% and 89.6% for enhanced green fluorescent protein and bovine serum albumin, respectively by thermodynamically favored partition. The structures of the nanoparticles were confirmed by confocal laser scanning microscopy and scanning electron microscopy.Results: The nanoparticles had a normal size distribution and a mean diameter of 186 nm. MTT assays showed that the nanoparticles were nontoxic up to a concentration of 2000 µg/mL in human hepatocarcinoma cell line SMMC-7721, HeLa, and BRL-3A cells. Of note, confocal laser scanning microscopy studies showed that nanoparticles loaded with fluorescein isothiocyanate-bovine serum albumin were efficiently delivered and released proteins into the cytoplasm of HeLa cells. Flow cytometry and terminal deoxynucleotidyl transferase dUTP nick end labeling assays showed that nanoparticles with a functional protein (apoptin efficiently induced

  1. Cyanobacterial crust induction using two non-previously tested cyanobacterial inoculants: crusting capability and role of EPSs

    Science.gov (United States)

    Mugnai, Gianmarco; Rossi, Federico; De Philippis, Roberto

    2017-04-01

    stable (tightly bound EPSs, TB-EPSs), which were deemed having different functions (Chen et al., 2014). The results demonstrated how differently (and complementarily in some ways) these two strains behave when applied on a poor sandy substrate, producing cyanobacterial crusts having different morphology. The outcomes of this study suggest the potential of Schizothrix AMPL1601 and Leptolyngbia ohadii as valid biotechnological tools for improving the properties of poor arid soils, allowing to design proper rehabilitation or restoration models. In addition, this study provided new insight on the characteristics of the cyanobacterial EPSs, secreted under a constrained condition, compared to a non-nutrient limited and optimal one. Chen, L., Rossi, F., Deng, S., Liu, Y., Wang, G., Adessi, A., De Philippis, R., 2014. Macromolecular and chemical features of the excreted extracellular polysaccharides in induced biological soil crusts of different ages. Soil Biology and Biochemistry 78, 1-9. doi:10.1016/j.soilbio.2014.07.004 Lan, S., Zhang, Q., Wu, L., Liu, Y., Zhang, D., Hu, C., 2014. Artificially Accelerating the Reversal of Desertification: Cyanobacterial Inoculation Facilitates the Succession of Vegetation Communities. Environmental Science & Technology 48, 307-315. doi:10.1021/es403785j

  2. What to Build for Middle-Agers to Come? Attractive and Necessary Functions of Exercise-Promotion Mobile Phone Apps: A Cross-Sectional Study.

    Science.gov (United States)

    Liao, Gen-Yih; Chien, Yu-Tai; Chen, Yu-Jen; Hsiung, Hsiao-Fang; Chen, Hsiao-Jung; Hsieh, Meng-Hua; Wu, Wen-Jie

    2017-05-25

    with 14 design features, medium level with 6 features, whereas low-level participants are recommended with 1 feature. The analysis suggests that the implementation of demanded features could be low, as the average prevalence of demanded design features is 20% (4.3/21). Surprisingly, social comparison and social support, most implemented features in current apps, were categorized into the indifferent category. The magnitude of effect is larger for MPSE because it effects quality perception of more design features than PA. Delving into the 52 regression models revealed that high MPSE more likely induces attractive or one- dimensional categorization, suggesting the importance of technological self-efficacy on eHealth care promotion. This study is the first to propose middle-agers' needs in relation to mobile phone exercise-promotion. In addition to the tailor-made recommendations, suggestions are offered to app designers to enhance the performance of persuasive features. An interesting finding on change of quality perception attributed to MPSE is proposed as future research. ©Gen-Yih Liao, Yu-Tai Chien, Yu-Jen Chen, Hsiao-Fang Hsiung, Hsiao-Jung Chen, Meng-Hua Hsieh, Wen-Jie Wu. Originally published in JMIR Mhealth and Uhealth (http://mhealth.jmir.org), 25.05.2017.

  3. Nimotuzumab combined with radiotherapy for esophageal cancer: preliminary study of a Phase II clinical trial

    Directory of Open Access Journals (Sweden)

    Liang J

    2013-11-01

    Full Text Available Jun Liang,1 Mingyan E,2 Gang Wu,3 Lujun Zhao,4 Xia Li,5 Xia Xiu,6 Ning Li,1 Bo Chen,1 Zhouguang Hui,1 Jima Lv,1 Hui Fang,1 Yu Tang,1 Nan Bi,1 Wenqing Wang,1 Yirui Zhai,1 Tao Li,1 Dongfu Chen,1 Shuangmei Zou,7 Ning Lu,7 Rolando Perez-Rodríguez,8 Junqi Zheng,9 Luhua Wang11Department of Radiotherapy, Cancer Hospital, Chinese Academy of Medical Sciences, Beijing, People's Republic of China; 2Department of Radiotherapy, Cancer Hospital of Harbin Medical University, Harbin, People's Republic of China; 3Department of Radiotherapy, Tongji Cancer Center Hospital, Wuhan, People's Republic of China; 4Department of Radiotherapy, Cancer Hospital of Tianjin Medical University, Tianjin, People's Republic of China; 5Department of Radiotherapy, LiaoNing Province Cancer Hospital, Shenyang, People's Republic of China; 6Department of Radiotherapy, Beijing Hospital, Beijing, People's Republic of China; 7Department of Pathology, Cancer Hospital, Chinese Academy of Medical Sciences, Beijing, People's Republic of China; 8Center of Molecular Immunology, Havana, Cuba; 9School of Medicine, Tongji University, Shanghai, People's Republic of ChinaObjective: To determine the safety and therapeutic effects of nimotuzumab (h-R3 combined with radiotherapy in esophageal cancer.Methods: This Phase II clinical trial involved 42 patients with stage II (inoperable or refused surgery to stage IV (supraclavicular lymph node metastasis only esophageal cancers treated between November 2008 and July 2010. All patients had squamous cell carcinomas, and all received three-dimensional conformal radiotherapy and 200 mg nimotuzumab per week during radiotherapy.Results: There were 9, 25, and 8 patients with stage II, III and IV disease, respectively. All except two patients received 50–70 Gy radiation; 37 patients (88.1% received more than five nimotuzumab doses. Grade III toxicities (21.4% of all adverse events included esophagitis and gastrointestinal, dermatological and hematological

  4. Supplementation of omega 3 fatty acids may improve hyperactivity, lethargy, and stereotypy in children with autism spectrum disorders: a meta-analysis of randomized controlled trials

    Directory of Open Access Journals (Sweden)

    Cheng YS

    2017-10-01

    Full Text Available Yu-Shian Cheng,1 Ping-Tao Tseng,1,2 Yen-Wen Chen,3 Brendon Stubbs,4–6 Wei-Chieh Yang,7 Tien-Yu Chen,8,9 Ching-Kuan Wu,1 Pao-Yen Lin10,11 1Department of Psychiatry, Tsyr-Huey Mental Hospital, Kaohsiung Jen-Ai’s Home, 2WinShine Clinics in Specialty of Psychiatry, 3Prospect Clinic for Otorhinolaryngology & Neurology, Kaohsiung, Taiwan, Republic of China; 4Physiotherapy Department, South London and Maudsley NHS Foundation Trust, 5Health Service and Population Research Department, Institute of Psychiatry, Psychology and Neuroscience, King’s College London, London, 6Faculty of Health, Social Care and Education, Anglia Ruskin University, Chelmsford, UK; 7Department of Pediatrics, DA-AN Women and Children Hospital, Tainan, 8Department of Psychiatry, Tri-Service General Hospital, Taipei, 9School of Medicine, National Defense Medical Center, Taipei, 10Department of Psychiatry, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, 11Institute for Translational Research in Biomedical Sciences, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung, Taiwan, Republic of China Aim: Deficiency of omega 3 fatty acids may be linked to autism spectrum disorder (ASD. Evidence about the potential therapeutic effects of supplementation of omega 3 fatty acids is lacking in ASD patients.Methods: We searched major electronic databases from inception to June 21, 2017, for randomized clinical trials, which compared treatment outcomes between supplementation of omega 3 fatty acids and placebo in patients with ASD. An exploratory random-effects meta-analysis of the included studies was undertaken.Results and conclusion: Six trials were included (n=194. Meta-analysis showed that supplementation of omega 3 fatty acids improved hyperactivity (difference in means =-2.692, 95% confidence interval [CI] =-5.364 to -0.020, P=0.048, studies =4, n=109, lethargy (difference in means =-1.969, 95% CI =-3.566 to -0.372, P=0.016, studies =4, n=109, and

  5. Safety of high-dose daptomycin in patients with severe renal impairment

    Directory of Open Access Journals (Sweden)

    Tai CH

    2018-03-01

    Full Text Available Chih-Hsun Tai,1 Chi-Hao Shao,2 Chen-You Chen,2 Shu-Wen Lin,1–3 Chien-Chih Wu1,2 1Department of Pharmacy, National Taiwan University Hospital, College of Medicine, National Taiwan University, Taipei, Taiwan; 2School of Pharmacy, College of Medicine, National Taiwan University, Taipei, Taiwan; 3Graduate Institute of Clinical Pharmacy, College of Medicine, National Taiwan University, Taipei, Taiwan Background: Treatment options are limited for infections due to multidrug-resistant Gram-positive pathogens. Daptomycin is a lipopeptide antibiotic with concentration-dependent killing characteristic and dose-dependent post-antibiotic effect. To achieve optimized pharmacodynamic effect, some experts advocated using a high dose of daptomycin (≥9 mg/kg for severe infections. However, the safety of high-dose therapy in patients with renal impairment remains unknown. This study was aimed to evaluate the safety of daptomycin in patients with severe renal impairment. Methods: This was a retrospective study performed by reviewing electronic medical records. Patients with severe renal impairment who were treated with daptomycin in a tertiary teaching hospital between January 1, 2013, and June 30, 2016, were included for evaluation. The incidence rates of creatine kinase (CK elevation between high-dose (≥9 mg/kg and standard-dose (<9 mg/kg groups were compared. Results: Overall, 164 patients met the inclusion criteria, and 114 (69.5% of them were on renal replacement therapy. Vancomycin-resistant enterococci were the most common pathogens (61.3% of the patients with documented pathogens. The treatment success rate was 51.6% in the 91 patients with bacteremia. The average dose of daptomycin was 8.0±2.3 mg/kg, and 37 (22.6% patients received ≥9 mg/kg. CK levels were followed in 108 (65.9% patients. Significantly higher incidence of CK elevation was found in the high-dose group compared with that in the standard-dose group (10.8% vs 1.6%, P<0.05. Moreover

  6. In vivo tumor targeting and imaging with anti-vascular endothelial growth factor antibody-conjugated dextran-coated iron oxide nanoparticles

    Directory of Open Access Journals (Sweden)

    Hsieh WJ

    2012-06-01

    Full Text Available Wan-Ju Hsieh,1 Chan-Jung Liang,1 Jen-Jie Chieh,4 Shu-Huei Wang,1 I-Rue Lai,1 Jyh-Horng Chen,2 Fu-Hsiung Chang,3 Wei-Kung Tseng,4–6 Shieh-Yueh Yang,4 Chau-Chung Wu,7 Yuh-Lien Chen11Institute of Anatomy and Cell Biology, College of Medicine, 2Department of Electrical Engineering, 3Institute of Biochemistry and Molecular Biology, National Taiwan University, Taipei, Taiwan; 4Institute of Electro-Optical Science and Technology, National Taiwan Normal University, Taipei, Taiwan; 5Division of Cardiology, Department of Internal Medicine, E-Da Hospital, Taipei, Taiwan; 6Department of Medical Imaging and Radiological Sciences, I-Shou University, Taipei, Taiwan; 7Department of Internal Medicine and Primary Care Medicine, National Taiwan University Hospital, Taipei, TaiwanBackground: Active targeting by specific antibodies combined with nanoparticles is a promising technology for cancer imaging and detection by magnetic resonance imaging (MRI. The aim of the present study is to investigate whether the systemic delivery of antivascular endothelial growth factor antibodies conjugating to the surface of functionalized supermagnetic iron oxide nanoparticles (anti-VEGF-NPs led to target-specific accumulation in the tumor.Methods: The VEGF expression in human colon cancer and in Balb/c mice bearing colon cancers was examined by immunohistochemistry. The distribution of these anti-VEGF-NPs particles or NPs particles were evaluated by MRI at days 1, 2, or 9 after the injection into the jugular vein of Balb/c mice bearing colon cancers. Tumor and normal tissues (liver, spleen, lung, and kidney were collected and were examined by Prussian blue staining to determine the presence and distribution of NPs in the tissue sections.Results: VEGF is highly expressed in human and mouse colon cancer tissues. MRI showed significant changes in the T*2 signal and T2 relaxation in the anti-VEGF-NP- injected-mice, but not in mice injected with NP alone. Examination of paraffin

  7. Zhu Qing Wang

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences. Zhu Qing Wang. Articles written in Journal of Chemical Sciences. Volume 121 Issue 4 July 2009 pp 543-548. Highly sensitive optical chemosensor for the detection of Cu using a rhodamine B spirolatam · Gen Hua Wu Dong Xiang Wang Da Yu Wu Yuan Gao Zhu Qing Wang.

  8. Biisofraxidin on Apoptosis of Human Gastric Cancer BGC-823 Cells

    African Journals Online (AJOL)

    Wu et al. Trop J Pharm Res, October 2015; 14(10): 1803. Tropical Journal of Pharmaceutical Research ... Jian-Tao Wu1,2*, She-Min Lv1, Chun-Hui Lu1, Jun Gong1 and Jian-Bo An3 ..... Zhu AK, Zhou H, Xia JZ, Jin HC, Wang K, Yan J, Zuo JB,.

  9. Developing institutional collaboration between Wageningen university and the Chinese academy of agricultural sciences

    NARCIS (Netherlands)

    Bonnema, A.B.; Lin, Z.; Qu, L.; Jacobsen, E.

    2006-01-01

    Scientific co-operation between the Chinese Academy of Agricultural Sciences (CAAS) and Wageningen University (WU) has been underway since 1990, especially in the field of plant sciences. In 2001, CAAS and WU initiated a formal joint PhD training programme to further structure their co-operation.

  10. African Journal of Biotechnology - Vol 9, No 15 (2010)

    African Journals Online (AJOL)

    cDNA, genomic sequence cloning and overexpression of ribosomal protein S16 gene (RPS16) from the Giant Panda · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. W Hou, Y Hou, Y Hao, T Zhang, Z Peng, Y Wu, G Wu, 2185-2191 ...

  11. Synthesis of agarose–metal/semiconductor nanoparticles having ...

    Indian Academy of Sciences (India)

    Wintec

    Jawaharlal Nehru Centre for Advanced Scientific Research, Jakkur PO, Bangalore 560 064 b. Molecular Biology and Genetics Unit, Jawaharlal Nehru Centre for Advanced Scientific ..... Li P, Li J, Wu C, Wu Q and Li J 2005 Nanotechno- logy. 16 1912. 18. Gadi B and Jeffrey G 2005 Curr. Med. Chem. 12 2163. 19. Gadi B and ...

  12. ACUTE EFFECTS OF STATIC STRETCHING, DYNAMIC EXERCISES, AND HIGH VOLUME UPPER EXTREMITY PLYOMETRIC ACTIVITY ON TENNIS SERVE PERFORMANCE

    Directory of Open Access Journals (Sweden)

    Ertugrul Gelen

    2012-12-01

    Full Text Available The purpose of this study was to compare the acute effects of static stretching; dynamic exercises and high volume upper extremity plyometric activity on tennis serve performance. Twenty-six elite young tennis players (15.1 ± 4.2 years, 167.9 ± 5.8 cm and 61.6 ± 8.1 kg performed 4 different warm-up (WU routines in a random order on non-consecutive days. The WU methods consisted of traditional WU (jogging, rally and serve practice (TRAD; traditional WU and static stretching (TRSS; traditional WU and dynamic exercise (TRDE; and traditional WU and high volume upper extremity plyometric activity (TRPLYP. Following each WU session, subjects were tested on a tennis serve ball speed test. TRAD, TRSS, TRDE and TRPLYO were compared by repeated measurement analyses of variance and post-hoc comparisons. In this study a 1 to 3 percent increase in tennis serve ball speed was recorded in TRDE and TRPLYO when compared to TRAD (p 0.05. ICCs for ball speed showed strong reliability (0.82 to 0.93 for the ball speed measurements.The results of this study indicate that dynamic and high volume upper extremity plyometric WU activities are likely beneficial to serve speed of elite junior tennis players.

  13. Women in physics

    CERN Document Server

    Indovino, Shaina

    2013-01-01

    What does it take to be a physicist? Lise Meitner, Katharine Blodgett, Maria Goeppert-Mayer, Chien-Shiung Wu, Ursula Franklin, Argelia Velez-Rodriguez, Sau Lan Wu, Shirley Ann Jackson, Lisa Randall and opportunities for women in physics today.

  14. DMPD: Mechanism of age-associated up-regulation in macrophage PGE2 synthesis. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 15331118 Mechanism of age-associated up-regulation in macrophage PGE2 synthesis. Wu...e-associated up-regulation in macrophage PGE2 synthesis. PubmedID 15331118 Title Mechanism of age-associated... up-regulation in macrophage PGE2 synthesis. Authors Wu D, Meydani SN. Publicatio

  15. Spectrum-effect relationships between high performance liquid ...

    African Journals Online (AJOL)

    promoting effect on contractility of intestinal smooth was carried out to ... addition, the equation of spectrum-effect relationships {Y = 3.818 - 1.126X1 + ..... Peng W, Liu YJ, Wu N, Sun T, He XY, Gao YX, Wu CJ. ... Zheng QF, Zhao YL, Wang JB, Liu TT, Zhang B, Gong ... Zhao HY, Han X. Research thoughts and application.

  16. Download this PDF file

    African Journals Online (AJOL)

    pc

    2017-11-10

    Nov 10, 2017 ... ts of alkyl chain length on particles morphology were primarily studied ..... [3] Li Z, Yu L, Zheng L, Li N, Han S, Li G. Characterization studies on the ionic ... [4] Chiang YD, Lian HY, Leo SY, Wang SG, Yamauchi Y, Wu KC. ... [20] Yu YJ, Xing JL, Pang JL, Jiang SH, Lam KF, Yang TQ, Xue QS, Zhang K, Wu P.

  17. Fundamental Investigations into the Infrared Properties of Carbon Nanotubes

    Science.gov (United States)

    2013-01-23

    Vallejo , Rongtao Lu, Judy Wu. Development of Textured Magnesium Oxide Templates on Amorphous Polymer SurfacesUsing Ion-Beam-Assisted Deposition, Applied...Applied Physics Letters 99, 023111 (2011) 18. A. Elliot, Vallejo , R.T. Lu, and J.Z. Wu, “Development of Textured Magnesium Oxides Templates on

  18. Vegetation Impact on Soil Strength: A State of the Knowledge Review

    Science.gov (United States)

    2017-06-20

    CRREL SR-17-2 3 soil layers. However, their more thorough look at the Wu (1976) and Wal- dron (1977) root–soil model for soil cohesion indicated a...trafficability and mobility simulations (Wu 1976; Waldron 1977; Wal- dron and Dakessian 1981 as cited in Pirnazarov and Sellgren 2015). Figure 6. Maximum

  19. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. Anhua Wu. Articles written in Bulletin of Materials Science. Volume 27 Issue 4 August 2004 pp 333-336 Crystal Growth. Bridgman growth and defects of Nd : Sr3Ga2Ge4O14 laser crystals · Jiaxuan Ding Anhua Wu Jiayue Xu · More Details Abstract Fulltext PDF.

  20. Organic photovoltaics

    Science.gov (United States)

    Demming, Anna; Krebs, Frederik C.; Chen, Hongzheng

    2013-12-01

    X, Jin Z, Li K, Wang S, Wang H and Ma W 2013 Low-temperature, solution-processed alumina for organic solar cells Nanotechnology 24 484010 [12] Chen F, Chen Q, Mao L, Wang Y, Huang X, Lu W, Wang B and Chen L 2013 Tuning ITO work function with solution-processed alkali carbonate interfacial layers for high-efficiency inverted organic photovoltaic cells Nanotechnology 24 484011 [13] Wu Z, Song T, Xia Z, Wei H and Sun B 2013 Enhanced performance of polymer solar cell with ZnO nanoparticle electron transporting layer passivated by in situ cross-linked three-dimensional polymer network Nanotechnology 24 484012 [14] Urbina A, Park J-S, Lee J-M, Kim S-O and Kim J-S 2013 Work function engineering of ZnO electrodes by using p-type and n-type doped carbon nanotubes Nanotechnology 24 484013 [15] van de Wiel H J et al 2013 R2R embedded conductive structures integrated into OPV devices Nanotechnology 24 484014

  1. Browse Title Index

    African Journals Online (AJOL)

    Items 51 - 100 of 1309 ... Li-Long Liu, Kai Xu, Lu-Mei Kang, Shu-Ping Jiang, Qing-Hua Wang, ... CR Sewani-Rusike, JE Iputo, EJ Ndebia, M Gondwe, DR Kamadyaapa ... K-M Man, W-C Chen, H-M Wang, H-Y Chen, J-L Shen, L-D Chen, F-J Tsai, ...

  2. Soil Behavior Under Blast Loading

    Science.gov (United States)

    2010-12-01

    in detail (Lade 2005, Prevost and Popescu 1996, Chen and Baladi 1985). Models that are appropriate to be implemented into finite element programs...Chen and Baladi 1985). As the soil strain hardens, both the cone and the end cap expand. This concept of cap envelope was a major step forward...hardening cap model (Chen and Baladi 1985) 17 The modified Cam-clay model was developed at Cambridge University by Roscoe et al. (1963). This

  3. Reference: 418 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 418 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16856986i Chai Mao-Feng...cid responses in Arabidopsis. 5 665-74 16856986 2006 Sep The Plant journal An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Wang Xue-Chen|Wei Peng-Cheng|Yang Shuhua

  4. Taiwan in 2004: Elections, Referenda, and Other Democratic Challenges

    National Research Council Canada - National Science Library

    Dumbaugh, Kerry

    2005-01-01

    .... In both the presidential and legislative election campaigns, Chen emphasized gaining a separate international identity for Taiwan -- an emphasis to which Beijing strenuously objected as dangerously...

  5. 77 FR 28880 - Ocean Transportation Intermediary License Applicants

    Science.gov (United States)

    2012-05-16

    ... (NVO & OFF), 332 Hindry Avenue, Inglewood, CA 90301, Officers: Edison Chen, Manager (Qualifying..., Schiller Park, IL 60176, Officers: Scott A. Case, Vice President (Qualifying Individual), Thomas C. Case...

  6. Committees

    Science.gov (United States)

    2012-11-01

    -RESIGA Politehnica University of Timisoara Romania Kazuhiro TANAKA Kyushu Institute of Technology Japan Yoshinobu TSUJIMOTO Osaka University Japan Local Organizing Committee Chairman Yulin WU Tsinghua University Beijing Executive Chairman Zhengwei WANG Tsinghua University Beijing Members Shuliang CAO Tsinghua University Beijing Cichang CHEN South West University of Petroleum Chengdu Hongxun CHEN Shanghai University Shanghai Jiang DAI China Sanxia General Co Yichang Huashu DOU National University of Singapore Singapore Fengqin HAN Huanan University of Sci & Tech Guangzhou Kun LI Hefei Inst of General Machinery Hefei Rennian LI Lanzhou University of Sci & Tech Lanzhou Wanhong LI National Natural Science Foundation of China Beijing Chao LIU Yangzhou University Yangzhou Li LU China Inst of Water Resources and Hydropower Research Beijing Xingqi LUO Xi'an University of Tech Xi'an Zhenyue MA Dalian University of Sci & Tech Dalian Jiegang MU Zhejiang University of Tech Hangzhou Daqing QIN Harbin Electric Machinery Group Harbin Fujun WANG China Agriculture University Beijing Guoyu WANG Beijing Institute of Technology (BIT) Beijing Leqin WANG Zhejiang University Hangzhou Yuzhen WU NERCSPV Beijing Hongyuan XU Tsinghua University Beijing Jiandong YANG Wuhan University Wuhan Minguan YANG Jiangsu University Zhenjiang Shouqi YUAN Jiangsu University Zhenjiang Lefu ZHANG Harbin Electric Machinery Group Harbin Lixiang ZHANG Yunnan University of Sci & Tech Kunming Shengchang ZHANG Zhejiang University of Tech Hangzhou Kun ZHAO China Water & Electric Consulting Corp Beijing Yuan ZHENG Hehai University Nanjing Jianzhong ZHOU Huazhong University of Sci & Tech Wuhan Lingjiu ZHOU China Agriculture University Beijing Hongwu ZHU China Petroleum University Beijing Zuchao ZHU Zhejiang Sci-Tech University Hangzhou Secretaries Shuhong LIU (Academic), liushuhong@tsinghua.edu.cn Xianwu LUO (Registration), luoxw@tsinghua.edu.cn Baoshan ZHU (Finance), bszhu@mail.tsinghua.edu.cn

  7. How the rock fabrics can control the physical properties - A contribution to the understanding of carbonate reservoirs

    Energy Technology Data Exchange (ETDEWEB)

    Duerrast, H.; Siegesmund, S. [Goettingen Univ. (Germany)

    1998-12-31

    The correlation between microfabrics and physical properties will be illustrated in detail on three dolomitic carbonate reservoir rocks with different porosity. For this study core segments from the Zechstein Ca2-layer (Permian) of the Northwest German Basin were kindly provided by the Preussag Energie GmbH, Lingen. The mineral composition was determined by using the X-ray diffraction method. Petrographic and detailed investigation of the microfabrics, including the distribution and orientation of the cracks were done macroscopally (core segments) and microscopally with the optical microscope and the Scanning Electron Microscope (thin sections in three orthogonally to each other oriented directions). Different kinds of petrophysical measurements were carried out, e.g. porosity, permeability, electrical conductivity, seismic velocities. (orig.)

  8. Et felteksperiment med Kærlighed i Kaos

    DEFF Research Database (Denmark)

    Christensen, Christiane Præstgaard; Scavenius Sonne-Schmidt, Christoffer

    Som et nyt tilbud til danske forældre med børn med ADHD og ADHD-lignende vanskeligheder har ADHDforeningen udviklet forældretræningsprogrammet Kærlighed i Kaos, hvor frivillige hjælper forældre til børn med ADHD, der står med et særligt vanskeligt opdragelsesarbejde. Denne rapport har til formål......, når forældrene stiller krav til børnene. Resultaterne i denne rapport har interesse for fagpersoner, behandlere, undervisere, beslutningstagere, frivillige organisationer, foreninger og de mange nuværende og kommende familier, som dagligt kæmper med adfærdsvanskeligheder – såsom ADHD. Effektmålingen...

  9. KWL annual report 1984

    International Nuclear Information System (INIS)

    1985-01-01

    The application for decommissioning the Lingen reactor has been filed on June 13, 1983. Response by the competent authority is expected to come in by mid-1985 at the earliest. At the beginning of 1985, preparatory work for the decommissioning phase has been started in the reactor containment, as e.g. removal of fuel elements, blow out of primary cooling circuit and evacuation of fuel storage pond. The number of personnel working at KWL reactor has been reduced to 108 in the period under review. The annual report 1984 has been worked out according to legal provisions; the profit and loss account is balanced at DM 35,43 millions. (orig./HSCH) [de

  10. Actual Situation and Further Development of Interim Storage of Spent Nuclear Fuel (SNF) and Highly Active Waste (HAW) from the View of the Competent Authority in the Field of section 6

    International Nuclear Information System (INIS)

    Gastl, Christoph; Drobniewski, Christian

    2014-01-01

    According to the German atomic law the storage of nuclear material has to be licensed following section 6 by the competent authority in this field, which is the Federal Office for Radiation Protection. Interim storage in its actual form started in 2002 in the interim storage facility next to the NPP Lingen. Since this time each NPP erected its own storage facilities and three central storage facilities have been built. The spent nuclear fuel (SNF) and the vitrified high level waste (HAW) will be stored there until final disposal. The time span from now on to the point of opening of a final disposal facility shall be presented from a regulators point of view, divided into different phase which could spread from years to decades. Special attention shall be drawn on the different aspects influencing the licensing process and its duration at the moment and in future including the capabilities of the competent authority. (authors)

  11. Compilation of data on the release of radioactive substances in the vent air of nuclear power plants in the Federal Republic of Germany in 1975

    International Nuclear Information System (INIS)

    Winkelmann, I.; Endrulat, H.J.; Haubelt, R.; Westpfahl, U.

    1976-04-01

    The present compilation of data on the release of radioactive substances in the vent air of nuclear power plants in the FRG is a continuation of a report series on aerosol filter and iodine filter samples from the exhaust air control systems of the nuclear power plants Gundremmingen, Obrigheim, Wuergassen, Stade, Lingen and Biblis A. The reports have been issued by the Federal public health office since 1972. This report is supplemented by annual release values on radioactive noble gases, on short- and long-lived aerosols, and on gaseous 131 I, supplied by the individual nuclear power plants as in previous years on uniform questionnaires. Data on the release of tritium are also available from some nuclear power plants. (orig.) [de

  12. Precooling and Warm-Up Effects on Time Trial Cycling During Heat Stress.

    Science.gov (United States)

    Al-Horani, Ramzi A; Wingo, Jonathan E; Ng, Jason; Bishop, Phillip; Richardson, Mark

    2018-02-01

    Heat stress limits endurance exercise performance. Combining precooling and warm-up prior to endurance exercise in the heat may exploit the benefits of both strategies while avoiding the potential negative consequences of each. This study tested the hypothesis that precooling combined with warm-up improves time trial cycling performance in the heat relative to either treatment alone. Nine healthy men completed three 16.1-km time trials in 33°C after: 1) precooling (ice slurry and ice vest) alone (PREC); 2) warm-up alone (WU); or 3) PREC plus WU (COMBO). Tre was lower after PREC compared to WU throughout exercise and lower than COMBO for the first 12 km; COMBO was lower than WU for the first 4 km. Tsk during PREC was lower than COMBO and WU for the first 8 km, and lower in COMBO than WU for the first 4 km. PREC lowered pre-exercise heart rate relative to COMBO and WU (68 ± 10, 106 ± 12, 101 ± 13 bpm, respectively), but it increased similarly during exercise. Local sweat rate (SR) was lower in PREC (0.1 ± 0.1 mg · cm-2 · min-1) than COMBO (0.5 ± 0.2 mg · cm-2 · min-1) and WU (0.6 ± 0.2 mg · cm-2 · min-1) for the first 4 km. Treatments did not differentially affect performance (PREC = 31.9 ± 1.9 min, COMBO = 32.6 ± 2.7 min, WU = 33.1 ± 2.9 min). We conclude precooling alone or with warm-up mitigated thermal strain during exercise, but did not significantly improve 16.1-km cycling time trial performance.Al-horani RA, Wingo JE, Ng J, Bishop P, Richardson M. Precooling and warm-up effects on time trial cycling during heat stress. Aerosp Med Hum Perform. 2018; 89(2):87-93.

  13. People’s Republic of China Scientific Abstracts, Number 177

    Science.gov (United States)

    1977-10-06

    PAO [ARCHITECTURAL JOURNAL] No 2, June 1977 1 CHIH-WU HSUEH-PAO [ACTA BOTANICA SINICA] No 4, December 1976 13 CHIH-WU TSA-CHIH [JOURNAL OF BOTANY...10424 CSO: 4009 12 ACTA BOTANICA SINICA AUTHOR: None ORG: Three-in-one Combination Experimental Group of Peking Ch’ung-wen Vegetable Station...Physiological Processes of Stored Tomatoes" SOURCE: Peking CHIH-WU HSUEH-PAO [ACTA BOTANICA SINICA] in Chinese Vol 18, No 4, Dec 76 pp 278-283 TEXT OF

  14. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences. Chen Fang. Articles written in Journal of Biosciences. Volume 30 Issue 3 June 2005 pp 351-357 Articles. Expression of a ribosome inactivating protein (curcin 2) in Jatropha curcas is induced by stress · Wei Qin Huang Ming-Xing Xu Ying Zhang Xin-Shen Chen Fang · More Details ...

  15. Evaluation of effectiveness in a novel wound healing ointment ...

    African Journals Online (AJOL)

    Evaluation of effectiveness in a novel wound healing ointment-crocodile oil burn ointment. Hua-Liang Li, Yi-Tao Deng, Zi-Ran Zhang, Qi-Rui Fu, Ya-Hui Zheng, Xing-Mei Cao, Jing Nie, Li-Wen Fu, Li-Ping Chen, You-Xiong Xiong, Dong-Yan Shen, Qing-Xi Chen ...

  16. Enhanced Thermal Transport of Surfaces with Superhydrophobic Coatings

    Science.gov (United States)

    2015-07-01

    resistance conferred by superhydrophobic fluorinated polyacrylate-silica composite coatings on cold-rolled steel. Journal of Applied Polymer Science... thiolates on metals as a form of nanotechnology. ChemInform. 2005:36. doi: 10.1002/chin.200532281. 9. Chen C-H, Cai Q, Tsai C, Chen C-L, Xiong G

  17. Advances in SCA and RF-DNA Fingerprinting Through Enhanced Linear Regression Attacks and Application of Random Forest Classifiers

    Science.gov (United States)

    2014-09-18

    22:477– 505 , 2007. [21] Bushnell, Michael L. and Vishwani Agrawal. Essentials of Electronic Testing for Digital, Memory, and Mixed-Signal VLSI...Investigation”. Knowledge and information systems, 10(4):453–472, 2006. [68] Liang, Nia -Chiang, Ping-Chieh Chen, Tony Sun, Guang Yang, Ling-Jyh Chen

  18. A comparative study assessing a new tool for occluding ...

    African Journals Online (AJOL)

    0.630, p=0.068 and p=0.047, respectively) (Table 2). A comparative study assessing a new tool for occluding parenchymal blood flow during liver resection for hepatocellular carcinoma. S Zhou, X-J Xue, R-R Li, D-F Chen, W-Y Chen, G-X Liu, ...

  19. (DEPSCOR FY 09) Obfuscation and Deobfuscation of Intent of Computer Programs

    Science.gov (United States)

    2012-12-21

    increased as the malware distribution mechanism has moved to the web through infected sites. In this use a site is hacked so as to distribute malware to...Simpósio Brasileiro em Segurança da Informaçao e de Sistemas Computacionais (2009). (Chen et al., 2012) Jundong Chen, Matthias R. Brust, Vir V. Phoha

  20. The roles of electronic books in the transformation of learning and instruction

    NARCIS (Netherlands)

    Huang, Ronghuai; Chen, Nian-Shing; Kang, Myunghee; McKenney, Susan; Churchill, Daniel

    2014-01-01

    Huang, R., Chen, N., Kang, M. McKenney, S. & Churchill, D. (2013). The roles of electronic books in the transformation of learning and instruction. In N. Chen, R. Huang, Kinshuk, Y. Li, D. G. Sampson (Eds.) Proceedings of the IEEE 13th International Conference on Advanced Learning Technologies

  1. African Journal of Biotechnology - Vol 10, No 60 (2011)

    African Journals Online (AJOL)

    Microsatellite variability reveals significant genetic differentiation of giant pandas (Ailuropoda melanoleuca) in the Minshan A habitat · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Yang, R Hou, F Shen, X Yang, L Zhang, L Chen, W Chen, W Zhang, Q Zhu, Z Zhang ...

  2. Trend analysis and change point detection of annual and seasonal ...

    Indian Academy of Sciences (India)

    elevation ranges from 0 m in the coastal areas of the. Persian Gulf to over ... been explained by Kang and Yusof (2012); Dhorde ...... J L 2004 Detection of statistically significant trends in ... Sun H, Chen Y, Li W, Li F, Chen Y, Hao X and Yang Y.

  3. Genome-Wide Chromosomal Targets of Oncogenic Transcription Factors

    Science.gov (United States)

    2008-04-01

    Altman, W.E., Attiya, S., Bader, J.S., Bemben, L.A., Berka , J., Braverman, M.S., Chen, Y.J., Chen, Z., et al. 2005. Genome sequencing in microfabricated...software after filtering to exclude bad spots. qPCR validation. Primer pairs used in Figure 1 were designed to cover three peaks and three troughs in

  4. The Response of Small Scale Rigid Targets to Shallow Buried Explosive Detonations

    Science.gov (United States)

    2011-09-01

    properties as applied in this work was based on some of the standard defini- tions of soil constitutive properties as found in, e.g., Chen and Baladi [18...Technology Corporation; 2007. [18] Chen WF, Baladi GY. Soil plasticity: theory and implementation. New York: Elsevier Science; 1985. [19] Zimmerman

  5. Application of an Arbitrary Lagrangian Eulerian Method to Describe High Velocity Gas-Particle Flow Behavior

    Science.gov (United States)

    2011-09-01

    applied in this work was based on some of the standard definitions of soil constitutive properties as found in, e.g., Chen and Baladi [20], and...Livermore, CA. [20] Chen, W. F., and Baladi , G. Y., 1985. Soil Plasticity: Theory and Implementation. Elsevier Science, New York. [21] Zimmerman, H.D

  6. Untitled

    Indian Academy of Sciences (India)

    20. Nevill GA and Cook D 1969 Can. J. Chen. 47 743. 21. Glasel GA 1969 Org. Magn. Reson. 1481. 22. Soundarajan S 1958 Trans. Faraday Soc. 54147. 23. Rein R 1971 Int. J. Quant. Chem., Symp, 4341. 24. Woet D 1972.J. Am. Chen, Soc. 94.8213. 25. Bideau.JP, Huong PV and Toure S 1976 Acta Crystallogr. B32481.

  7. Mechanisms of all-trans retinoic acid-induced differentiation of acute ...

    Indian Academy of Sciences (India)

    Author Affiliations. Ji-Wang Zhang1 Jian Gu1 Zhen-Yi Wang1 Sai-Juan Chen1 Zhu Chen1. Shanghai Institute of Hematology, Ruijin Hospital Affiliated to Shanghai Second Medical University, 197 Ruijin Road II, Shanghai 200025, People's Republic of China ...

  8. A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBand EFHC2gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN SONG YULAI ...

  9. WAIS-IV and WISC-IV Structural Validity: Alternate Methods, Alternate Results. Commentary on Weiss et al. (2013a) and Weiss et al. (2013b)

    Science.gov (United States)

    Canivez, Gary L.; Kush, Joseph C.

    2013-01-01

    Weiss, Keith, Zhu, and Chen (2013a) and Weiss, Keith, Zhu, and Chen (2013b), this issue, report examinations of the factor structure of the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) and Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV), respectively; comparing Wechsler Hierarchical Model (W-HM) and…

  10. A reviewof the pharmacologicalmechanism of traditional Chinese ...

    African Journals Online (AJOL)

    A reviewof the pharmacologicalmechanism of traditional Chinese medicine in the intervention of coronary heart disease and stroke. W Zhang, K Gao, K Gao, J Liu, J Liu, H Zhao, H Zhao, J Wang, J Wang, Y Li, Y Li, G Murtaza, G Murtaza, J Chen, J Chen, W Wang, W Wang ...

  11. African Journal of Traditional, Complementary and Alternative ...

    African Journals Online (AJOL)

    Anti-tumour effects of polysaccharides isolated from Artemisia Annua L by inducing cell apoptosis and immunomodulatory anti-hepatoma effects of polysaccharides · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Chen, J Chen, X Wang, C Liu, 15-22.

  12. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    ... Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 95; Issue 1. Novel NPHS1 gene mutations in a Chinese family with congenital nephrotic syndrome. Fengjie Yang Yaxian Chen Yu Zhang Liru Qiu Yu Chen Jianhua Zhou. Research Note Volume 95 Issue 1 March 2016 pp 161- ...

  13. Impacts of DNAPL Source Treatment: Experimental and Modeling Assessment of the Benefits of Partial DNAPL Source Removal

    Science.gov (United States)

    2009-09-01

    this project: A. Noman M. Ahsanuzzaman, Steve Acree, Nandita Basu, Sten Berglund, Carol Bratt, Gordon Brown, Xaisong Chen, Jaehyun Cho, Pat Clark...A.S.C. Chen (eds). Chapelle, F.H., J.S. Widdowson, J.S. Bruner, E. Mendez , and C.C. Casey (2003). Methodology for Estimating Times of Remediation

  14. Enhancement of Radiation Therapy in Prostate Cancer by DNA-PKcs Inhibitor

    Science.gov (United States)

    2015-09-01

    Center, Urology Habib , Amyn; UTSouthwestern Medical Center, Neurology & Neurotherapeutics Chen, Benjamin; UTSouthwestern Medical Center, Radiation...Tsong Hsieh 3,5,7 , Amyn A. Habib 4,5,6 , Benjamin Chen 1,4 and Debabrata Saha 1,4 1 Department of Radiation Oncology, 3 Department of Urology, 4

  15. A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBitalic> and EFHC2italic> gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN ...

  16. Browse Title Index

    African Journals Online (AJOL)

    Vol 9, No 1 (2006), Splenectomy in a rural surgical practice, Abstract PDF. E Alufohai, OO Odusanya. Vol 20, No 9 (2017), Spontaneous Retropharyngeal Emphysema: A Case Report, Abstract PDF. T-H Chi, C-C Hung, R-F Chen, C-H Yuan, J-C Chen. Vol 5, No 2 (2002), Spontaneous Rupture Of A Massive Hydrocephalus ...

  17. 75 FR 7358 - Addition of Certain Persons to the Entity List: Addition of Persons Acting Contrary to the...

    Science.gov (United States)

    2010-02-19

    ... Company Ltd., 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan; and (4) Yi-Lan Chen, a.k.a., Kevin Chen, 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan, and 7th Floor, Number 17... the requirements of the Paperwork Reduction Act of 1995 (44 U.S.C. 3501 et seq.) (PRA), unless that...

  18. 75 FR 4509 - Uniform Criteria for State Observational Surveys of Seat Belt Use

    Science.gov (United States)

    2010-01-28

    ... statistical issues: Ms. Chou-Lin Chen, Chief, Mathematical Analysis Division, National Center for Statistics..., Washington, DC 20590. Telephone number: 202-366-1048; E- mail: Chou-Lin.Chen@dot.gov . For legal issues: Ms..., and reduce burden. E. Paperwork Reduction Act Under the Paperwork Reduction Act of 1995, a person is...

  19. The effects of reciprocal cross on inheritance of DNA methylation in ...

    African Journals Online (AJOL)

    enoh

    2012-03-20

    Mar 20, 2012 ... DNA methylation plays an important role for regulation of gene expression. To study ... genes, and newly acquired epigenetic states of trans- ... GACTGCGTACCAATTCAGA(E6). ATCATGAGTCCTGCTCGGTAC(H6). GACTGCGTACCAATTCAGT(E7) ..... Chen XQ, Ma Y, Chen F, Song WQ, Zhang L (2009).

  20. Sadhana | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    YUZHI CHEN1 2 XUDONG CHEN2 JINGWU BU3. Architectural Engineering Institute, Jinling Institute of Technology, Nanjing 211169, China; College of Civil and Transportation Engineering, Hobai University, Nanjing 210098, China; College of Water Conservancy and Hydropower Engineering, Hohai University, Nanjing ...