Eine praktische Anwendung von CMC-Flächen in der Bionik

OpenAIRE

Apeltauer, Christian

2011-01-01

Die vorliegende Arbeit beschäftigt sich mit den theoretischen Grundlagen für die Entwicklung von Oberflächen, die unter Wasser möglichst lange eine Luftschicht an sich halten können. Ein natürliches Vorbild für solche Oberflächen ist die Pflanze Salvinia molesta; technisch interessieren solche Oberflächen zur Verringerung des Wasserwiderstandes von Schiffen und als Schutz vor Besiedlung durch Wasserorganismen. Wichtigste Gleichung bei der Entwicklung solcher Oberflächen ist...

Lattice models and integrability: a special issue in honour of F Y Wu

Science.gov (United States)

Guttmann, A. J.; Jacobsen, J. L.

2012-12-01

Fa Yueh (Fred) Wu was born on 5 January 1932 in Nanking (now known as Nanjing), China, the capital of the Nationalist government. Wu began kindergarten in 1937 in a comfortable setting, as his father held a relatively high government position. But the Sino-Japanese war broke out in July 1937, and Nanking fell to Japanese hands in November. Fleeing the Japanese, his parents brought Wu to their hometown in Hunan, and then to the war capital Chungking (now Chongqing) in 1938, where they lived for eight years until the end of the war. Around that time the Japanese began bombing Chungking, and Wu's childhood memories were dominated by air raids, bombings and burning not dissimilar to those experienced by Londoners during the war. At times the air raids lasted for days disrupting everyday lives in Chungking, including Wu's schooling. One day during a fierce bombing raid, a bomb fell in their garden reducing a pavilion and the surrounding pond to a huge crater; another bomb fell just a few metres from the tunnel where his family took shelter, almost sealing the only entrance. The family moved the very next day to the countryside. As a result of the war, Wu attended seven schools before finishing his primary education. Fortunately, by the time he entered junior high school in 1943, the Japanese forces were on the wane and Wu entered the elite middle school, Nankai. His early academic performance in Nankai seemed to him mediocre, but he nevertheless impressed his geometry teacher by showing bursts of talent. With hindsight, this early interest in geometry may have led to his later insights in graphical analyses of statistical systems. The family returned to Nanking in 1946 after the Victory over Japan Day. By this time his father had become elected to the Legislative Yuan, the equivalent of the US Senate. Wu entered high school in Nanking in 1946. Since he came from an elite school in Chungking, he excelled in most of his classes, especially mathematics. Notwithstanding his

Tropical Journal of Pharmaceutical Research - Vol 15, No 3 (2016)

African Journals Online (AJOL)

Wan Wu, Wei Chen, Qiong Jin, 447-451 ... Chung-Shih Chen, Mei-Lin Wang, Rosa Huang Liu, Shih-Pin Chen, Tsong-Ming Lu, Wei-Yu Tsai, Chien-Fu Huang, ... Yan-Qiong Li, Rui Hu, Li-Hui Zhong, Qian Sun, You-Ping Yan, 527-533.

Mechanical analysis of Chen chaotic system

International Nuclear Information System (INIS)

Liang, Xiyin; Qi, Guoyuan

2017-01-01

The Chen chaotic system is transformed into Kolmogorov type system, which is decomposed into four types of torques: inertial torque, internal torque, dissipation and external torque. By the combinations of different torques, five cases are studied to discover key factors of chaos generation and the physical meaning. The conversion among Hamiltonian energy, kinetic energy and potential energy is investigated in these five cases. The relationship between the energies and the parameters is studied. It concludes that the combination of these four types of torques is necessary conditions to produce chaos, and any combination of three types of torques cannot produce chaos in Chen system.

On a conjecture of Chen-Guo-Wang

OpenAIRE

Ning, Bo; Zheng, Yu

2015-01-01

Towards confirming Sun's conjecture on the strict log-concavity of combinatorial sequence involving the n$th$ Bernoulli number, Chen, Guo and Wang proposed a conjecture about the log-concavity of the function $\\theta(x)=\\sqrt[x]{2\\zeta(x)\\Gamma(x+1)}$ for $x\\in (6,\\infty)$, where $\\zeta(x)$ is the Riemann zeta function and $\\Gamma(x)$ is the Gamma function. In this paper, we first prove this conjecture along the spirit of Zhu's previous work. Second, we extend Chen et al.'s conjecture in the ...

Journal of Genetics | Indian Academy of Sciences

Indian Academy of Sciences (India)

Author Affiliations. Chen Bin1 Zeng Zhirong1 Wu Xiaoqin1 Chen Minhu1 Li Mei1 Gao Xiang1 Chen Baili1 Hu Pinjin1. Department of Gastroenterology, the First Affiliated Hospital, Sun Yat-sen University, 58 Zhongshan II Road, Guangzhou 510080, People's Republic of China ...

Sadhana | Indian Academy of Sciences

Indian Academy of Sciences (India)

Influence of free water content on the compressive mechanical behaviour of cement mortar under high strain rate · Jikai Zhou Xudong Chen Longqiang Wu Xiaowei Kan ... pp 111-117. Mechanical properties of concrete to cyclic uniaxial tensile loading using variable waveforms · YUZHI CHEN XUDONG CHEN JINGWU BU.

Chen Hengzhe

DEFF Research Database (Denmark)

Gimpel, Denise

Chen Hengzhe has been celebrated as China’s first female professor, first professor of Western history, first person to publish a history of the West that was not a translation into Chinese. She is moreover celebrated as one of the first to write fiction and poetry in the vernacular and to have......; they speak to important questions in China today. This study, then, is not a biography of a person; it is an attempt to understand the way in which foreign influences (narratives of being, organizing, thinking, writing) seep into a person’s life and work and meld with the “home” influences (narratives...

Effect of healthy Qigong “WuQinXi” exercise on peripheral blood T ...

African Journals Online (AJOL)

USER

2010-07-19

Jul 19, 2010 ... cell subgroups in elderly “WuQinXi” practitioners. Fifty healthy Chinese ... on health condition, diet, medical history, lifestyle and menstrual status, .... Mechanism of health-promotion of “WuQinXi” exercise created in East Hai ...

Adaptive synchronization of hyperchaotic Chen system with uncertain parameters

International Nuclear Information System (INIS)

Park, Ju H.

2005-01-01

This article addresses control for the chaos synchronization of hyperchaotic Chen system with five uncertain parameters. Based on the Lyapunov stability theory, an adaptive control law is derived to make the states of two identical hyperchaotic Chen systems asymptotically synchronized. Finally, a numerical simulations is presented to show the effectiveness of the proposed chaos synchronization scheme

Ray Wu as Fifth Business: Deconstructing collective memory in the history of DNA sequencing.

Science.gov (United States)

Onaga, Lisa A

2014-06-01

The concept of 'Fifth Business' is used to analyze a minority standpoint and bring serious attention to the role of scientists who play a galvanizing role in a science but for multiple reasons appear less prominently in more common recounts of any particular development. Biochemist Ray Wu (1928-2008) published a DNA sequencing experiment in March 1970 using DNA polymerase catalysis and specific nucleotide labeling, both of which are foundational to general sequencing methods today. The scant mention of Wu's work from textbooks, research articles, and other accounts of DNA sequencing calls into question how scientific collective memory forms. This alternative history seeks to understand why a key figure in nucleic acid sequence analysis has remained less visibly connected or peripheral to solidifying narratives about the history of DNA sequencing. The study resists predictable dismissals of Wu's work in order to seriously examine the formation of his nucleic acid sequence analysis research program and how he shared his knowledge of sequencing during a period of rapid advancement in the field. An analysis of Wu's work on sequencing the cohesive ends of lambda bacteriophage in the 1960s and 1970s exemplifies how a variety of individuals and groups attempted to develop protocol for sequencing the order of nucleotide base pairs comprising DNA. This historical examination of the sociality of scientific research suggests a way to understand how Wu and others contributed to the very collective memory of DNA sequencing that Wu eventually tried to repair. The study of Wu, who was a Chinese immigrant to the United States, provides a foundation for further critical scholarship on the heterogeneous histories of Asian American bioscientists, the sociality of their scientific works, and how the resulting knowledge produced is preserved, if not evenly, in a scientific field's collective memory. Copyright © 2014 Elsevier Ltd. All rights reserved.

Interlopers, Rogues, or Cosmopolitans? Wu Jianzhang and Early Modern Commercial Networks on the China Coast

Directory of Open Access Journals (Sweden)

Peter C. Perdue

2017-12-01

Full Text Available After the First Opium War (1839–1842, British and American merchants negotiated with Chinese officials in Shanghai to work out the framework of the new treaty port regime. One key player in these negotiations was Wu Jianzhang, a Cantonese merchant who became circuit intendant of the Shanghai region. Wu, however, also had links to Cantonese sailors and anti-Qing secret societies. When the Small Swords Society took Shanghai in 1853, he found himself entangled in conflicting responsibilities and networks. Foreign traders and Chinese officials regarded Wu, like other middlemen on the Chinese coast, with a mixture of respect and distrust. Wu’s situation, however, was not unique to the mid-nineteenth century. This article compares Wu to other intermediaries who played similar roles in the sixteenth and late nineteenth centuries, in order to show the ways in which Wu, his predecessors, and those who followed in his footsteps connected China to the wider world by navigating the treacherous waters of diplomacy, war, and commerce. The work of John K. Fairbank, who in the 1950s pioneered the study of such people as Wu Jianzhang, can find new meaning in the twenty-first century, enabling us to understand the transnational implications of China’s local social history.

On soliton solutions of the Wu-Zhang system

Directory of Open Access Journals (Sweden)

Inc Mustafa

2016-01-01

Full Text Available In this paper, the extended tanh and hirota methods are used to construct soliton solutions for the WuZhang (WZ system. Singular solitary wave, periodic and multi soliton solutions of the WZ system are obtained.

We Can't Get No (Life) Satisfaction? Comment on Oswald and Wu (2010)

Science.gov (United States)

Pesta, Bryan J.; McDaniel, Michael A.; Bertsch, Sharon

2010-01-01

Oswald and Wu (2010; "Science") recently reported life satisfaction ranks for residents of the 50 U.S. states. Their rankings were framed as measures of "well-being," but were derived from responses to only a single survey item ("In general, how satisfied are you with your life?"). Here we contrast Oswald and Wu's subjective rankings with our…

Chaos in the fractional order Chen system and its control

International Nuclear Information System (INIS)

Li Chunguang; Chen Guanrong

2004-01-01

In this letter, we study the chaotic behaviors in the fractional order Chen system. We found that chaos exists in the fractional order Chen system with order less than 3. The lowest order we found to have chaos in this system is 2.1. Linear feedback control of chaos in this system is also studied

A simple observer of the generalized Chen chaotic systems

International Nuclear Information System (INIS)

Sun, Y.-J.

2009-01-01

In this paper, the generalized Chen chaotic system is considered and the state observation problem of such a system is investigated. Based on the time-domain approach, a simple observer for the generalized Chen chaotic system is proposed to guarantee the global exponential stability of the resulting error system. Furthermore, the guaranteed exponential convergence rate can be correctly estimated. Finally, a numerical example is provided to illustrate the use of the main result.

Calycosin regulates glucocorticoid-induced apoptosis via Nrf2/ARE ...

African Journals Online (AJOL)

Lifeng Fu1, WeiLiang Wu2, Jian Zhu2, Shu Qiang2, Jansong Chen2* ... Results: CA reduced the apoptosis and accumulation of ROS in DEX-treated cells. ..... its downstream effectors (Figure 5 A-C). However .... Cao J, Chen Z, Zhu Y, Li Y, Guo C, Gao K, Chen L, Shi ... Hong W. Experimental study on the effect of Calycosin.

Non-minimal Wu-Yang monopole

International Nuclear Information System (INIS)

Balakin, A.B.; Zayats, A.E.

2007-01-01

We discuss new exact spherically symmetric static solutions to non-minimally extended Einstein-Yang-Mills equations. The obtained solution to the Yang-Mills subsystem is interpreted as a non-minimal Wu-Yang monopole solution. We focus on the analysis of two classes of the exact solutions to the gravitational field equations. Solutions of the first class belong to the Reissner-Nordstroem type, i.e., they are characterized by horizons and by the singularity at the point of origin. The solutions of the second class are regular ones. The horizons and singularities of a new type, the non-minimal ones, are indicated

The age grading and the Chen-Ruan cup product

DEFF Research Database (Denmark)

A. Hepworth, Richard

2010-01-01

We prove that the obstruction bundle used to define the cup-product in Chen-Ruan cohomology is determined by the so-called `age grading' or `degree-shifting numbers'. Indeed, the obstruction bundle can be directly computed using the age grading. We obtain a Kunneth Theorem for Chen-Ruan cohomology...... as a direct consequence of an elementary property of the age grading, and explain how several other results - including associativity of the cup-product - can be proved in a similar way....

Towards a Collective Intelligence: Transmediality and the Wu Ming Project

Directory of Open Access Journals (Sweden)

Melina Anne Masterson

2014-11-01

Full Text Available Dagli albori della Seconda Repubblica in Italia,  le strategie di dominio sui mass media dell’ex premier Silvio Berlusconi hanno avuto un effetto considerevole sull’immaginario culturale italiano. In un approccio multisensoriale e multimediale alla scrittura, il collettivo Wu Ming mette in questione i paradigmi culturali che negli ultimi venti anni sono diventati egemonici. L’esperienza di un romanzo dei Wu Ming va ben oltre la parola stampata poiché cerca di stimolare tutti i cinque sensi per arricchire il modo in cui il lettore vive quello che c’è sulla pagina, dimostrando esempi chiari della «convergence culture» coniata da Henry Jenkins. Questo saggio esamina l’interazione tra parola e immagine messa in atto dal collettivo tramite il sito Pinterest e illustra come questo aspetto del loro progetto rappresenti un microcosmo di un approccio complessivo alla creazione estetica e alla pratica culturale. Inoltre, questo saggio descrive in che modo il processo collettivo di consumo portato avanti dai Wu Ming contribuisca alla formazione delle «communities of sentiment» di Arjun Appadurai e alla «intelligenza collettiva» di Jenkins. Queste sono formazioni che rivitalizzano il concetto di cultura popolare per la nostra epoca digitale e offrono un’alternativa ad un immaginario culturale italiano sovra-determinato dalle pratiche del Berlusconismo.

The Hintermann-Merlini-Baxter-Wu and the infinite-coupling-limit Ashkin-Teller models

Energy Technology Data Exchange (ETDEWEB)

Huang Yuan, E-mail: huangy22@mail.ustc.edu.cn [Hefei National Laboratory for Physical Sciences at Microscale and Department of Modern Physics, University of Science and Technology of China, Hefei, Anhui 230026 (China); Deng Youjin, E-mail: yjdeng@ustc.edu.cn [Hefei National Laboratory for Physical Sciences at Microscale and Department of Modern Physics, University of Science and Technology of China, Hefei, Anhui 230026 (China); Jacobsen, Jesper Lykke, E-mail: jacobsen@lpt.ens.fr [Laboratoire de Physique Theorique, Ecole Normale Superieure, 24 rue Lhomond, 75231 Paris (France); Universite Pierre et Marie Curie, 4 place Jussieu, 75252 Paris (France); Salas, Jesus, E-mail: jsalas@math.uc3m.es [Grupo de Modelizacion, Simulacion Numerica y Matematica Industrial, Universidad Carlos III de Madrid, Avda. de la Universidad 30, 28911 Leganes (Spain); Grupo de Teorias de Campos y Fisica Estadistica, Instituto Gregorio Millan, Universidad Carlos III de Madrid, Unidad asociada al IEM-CSIC, Madrid (Spain)

2013-03-11

We show how the Hintermann-Merlini-Baxter-Wu model (which is a generalization of the well-known Baxter-Wu model to a general Eulerian triangulation) can be mapped onto a particular infinite-coupling-limit of the Ashkin-Teller model. We work out some mappings among these models, also including the standard and mixed Ashkin-Teller models. Finally, we compute the phase diagram of the infinite-coupling-limit Ashkin-Teller model on the square, triangular, hexagonal, and kagome lattices.

Immunogenicity of novel sulfadimethoxide conjugates | Chen ...

African Journals Online (AJOL)

Immunogenicity of novel sulfadimethoxide conjugates. L Chen, J Su, X Zhang, L Li, X He. Abstract. Sulfadimethoxine (SDM) is an antibiotic commonly added to animal feeds. Anti-SDM antibodies are useful for the detection of residual SDM in foods, feeds and biological fluids by ELISA. In this study, we show that SDM is ...

Governing Civil Service Pay in China, by Alfred M. Wu. Copenhagen: NIAS Press, 2014. xvi+236 pp

DEFF Research Database (Denmark)

Brødsgaard, Kjeld Erik

2016-01-01

Book review of: Governing Civil Service Pay in China by Alfred M. Wu. Copenhagen: NIAS Press, 2014.......Book review of: Governing Civil Service Pay in China by Alfred M. Wu. Copenhagen: NIAS Press, 2014....

Alternative implementation of the chaotic Chen-Lee system

International Nuclear Information System (INIS)

Sheu, L.-J.; Tam, L.-M.; Chen, H.-K.; Lao, S.-K.

2009-01-01

The chaotic Chen-Lee system was developed with a formalism based on the Euler equations for the motion of a rigid body. It was proved that this system is the governing set of equations for gyro motion with feedback control. Recently, studies were conducted to explore the dynamic behavior of this system, including fractional order behavior, the generation of hyperchaos and perturbation analysis, control and anti-control of chaos, synchronization, etc. In this study, we further explore (1) the stability of the equilibrium points and (2) the implementation of an electronic circuit using the Chen-Lee system. It is shown that not only is this system related to gyro motion but can also be applied to electronic circuits for encryption purposes.

Three novel antioxidants from Cinnamomum plants | Cheng | African ...

African Journals Online (AJOL)

Three novel antioxidants from Cinnamomum plants. K-C Cheng, H-A Chen, P-F Wu, W-L Yang, H-M Wang, C-Y Chen. Abstract. In this study, we identified three novel antioxidants, subamolide C (1), subamolide E (2) and isokotomolide A (3) from the constitutes of Cinnamomum subavenium and Cinnamomum kotoense.

Hopf bifurcation analysis of Chen circuit with direct time delay feedback

International Nuclear Information System (INIS)

Hai-Peng, Ren; Wen-Chao, Li; Ding, Liu

2010-01-01

Direct time delay feedback can make non-chaotic Chen circuit chaotic. The chaotic Chen circuit with direct time delay feedback possesses rich and complex dynamical behaviours. To reach a deep and clear understanding of the dynamics of such circuits described by delay differential equations, Hopf bifurcation in the circuit is analysed using the Hopf bifurcation theory and the central manifold theorem in this paper. Bifurcation points and bifurcation directions are derived in detail, which prove to be consistent with the previous bifurcation diagram. Numerical simulations and experimental results are given to verify the theoretical analysis. Hopf bifurcation analysis can explain and predict the periodical orbit (oscillation) in Chen circuit with direct time delay feedback. Bifurcation boundaries are derived using the Hopf bifurcation analysis, which will be helpful for determining the parameters in the stabilisation of the originally chaotic circuit

Synchronization and anti-synchronization coexist in Chen-Lee chaotic systems

International Nuclear Information System (INIS)

Chen, J.-H.; Chen, H.-K.; Lin, Y.-K.

2009-01-01

This study demonstrates that synchronization and anti-synchronization can coexist in Chen-Lee chaotic systems by direct linear coupling. Based on Lyapunov's direct method, a linear controller was designed to assure that two different types of synchronization can simultaneously be achieved. Further, the hybrid projective synchronization of Chen-Lee chaotic systems was studied using a nonlinear control scheme. The nonlinear controller was designed according to the Lyapunov stability theory to guarantee the hybrid projective synchronization, including synchronization, anti-synchronization, and projective synchronization. Finally, numerical examples are presented in order to illustrate the proposed synchronization approach.

Wu-Ling-San formula prophylaxis against recurrent calcium oxalate ...

African Journals Online (AJOL)

Wu-Ling-San (WLS) formula has been proved to prevent calcium oxalate nephrolithiasis both in vitro and in vivo. This is the first prospective, randomized and placebo-controlled clinical trial of WLS in calcium oxalate nephrolithiasis prevention. All patients who enrolled were asked to drink enough fluid to urinate at least 2 L ...

Parametric study of the fractional-order Chen-Lee system

International Nuclear Information System (INIS)

Tam, L.M.; Tou, W.M.S.

2008-01-01

The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q 1 = q 2 = q 3 = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found

Parametric study of the fractional-order Chen-Lee system

Energy Technology Data Exchange (ETDEWEB)

Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Tou, W.M.S. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)

2008-08-15

The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q{sub 1} = q{sub 2} = q{sub 3} = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found.

Dynamics of fractional-ordered Chen system with delay

Indian Academy of Sciences (India)

Though this subject has a history of more than 300 years, utility and applicability of fractional calculus to various branches of science and engineering have been real- ... variants of Chen system and see the qualitative changes in attractor and ...

The effects of growth time on the quality of graphene synthesized by ...

Indian Academy of Sciences (India)

by LPCVD. A JAFARI, R ALIPOUR∗ and M GHORANNEVISS ..... Li T, Hass J, Marchenkoy A N, Conrad E H, First P N and de ... Ni Z H, Chen W, Fan X F, Kuo J L, Yu T, Wee A T S ... Chen S, Cai W, Piner R D, Suk J W, Wu Y, Ren Y, Kang Y.

Comparing numerical methods for the solutions of the Chen system

International Nuclear Information System (INIS)

Noorani, M.S.M.; Hashim, I.; Ahmad, R.; Bakar, S.A.; Ismail, E.S.; Zakaria, A.M.

2007-01-01

In this paper, the Adomian decomposition method (ADM) is applied to the Chen system which is a three-dimensional system of ODEs with quadratic nonlinearities. The ADM yields an analytical solution in terms of a rapidly convergent infinite power series with easily computable terms. Comparisons between the decomposition solutions and the classical fourth-order Runge-Kutta (RK4) numerical solutions are made. In particular we look at the accuracy of the ADM as the Chen system changes from a non-chaotic system to a chaotic one. To highlight some computational difficulties due to a high Lyapunov exponent, a comparison with the Lorenz system is given

Impulsive synchronization of Chen's hyperchaotic system

International Nuclear Information System (INIS)

Haeri, Mohammad; Dehghani, Mahsa

2006-01-01

In this Letter the impulsive synchronization of the Chen's hyperchaotic systems is discussed. Some new and sufficient conditions on varying impulsive distance are established in order to guarantee the synchronizabillity of the systems using the synchronization method. In particular, some simple conditions are derived in synchronizing the systems by equal impulsive distances. Two illustrative examples are provided to show the feasibility and the effectiveness of the proposed method. The boundaries of the stable regions are also estimated

Forecasting Jakarta composite index (IHSG) based on chen fuzzy time series and firefly clustering algorithm

Science.gov (United States)

Ningrum, R. W.; Surarso, B.; Farikhin; Safarudin, Y. M.

2018-03-01

This paper proposes the combination of Firefly Algorithm (FA) and Chen Fuzzy Time Series Forecasting. Most of the existing fuzzy forecasting methods based on fuzzy time series use the static length of intervals. Therefore, we apply an artificial intelligence, i.e., Firefly Algorithm (FA) to set non-stationary length of intervals for each cluster on Chen Method. The method is evaluated by applying on the Jakarta Composite Index (IHSG) and compare with classical Chen Fuzzy Time Series Forecasting. Its performance verified through simulation using Matlab.

Combinatorial interpretation of Haldane-Wu fractional exclusion statistics.

Science.gov (United States)

Aringazin, A K; Mazhitov, M I

2002-08-01

Assuming that the maximal allowed number of identical particles in a state is an integer parameter, q, we derive the statistical weight and analyze the associated equation that defines the statistical distribution. The derived distribution covers Fermi-Dirac and Bose-Einstein ones in the particular cases q=1 and q--> infinity (n(i)/q-->1), respectively. We show that the derived statistical weight provides a natural combinatorial interpretation of Haldane-Wu fractional exclusion statistics, and present exact solutions of the distribution equation.

Sociology in Times of Crisis: Chen Da, National Salvation and the Indigenization of Knowledge

Directory of Open Access Journals (Sweden)

Ana Maria Candela

2015-08-01

Full Text Available Chen Da was one of the foremost sociologists of China from the 1920s to the 1940s. His intellectual habitus took shape from the long crisis that defined Chinese intellectual life from the mid-19th to mid-20th centuries, a period of continuous imperial assault on Chinese sovereignty. As China integrated into the capitalist world-system, neo-Confucian structures of knowledge came into question. Intellectuals took up sociology to guide China’s transition from an empire to a nation-state. Through his studies on labor, migration, and population, Chen Da contributed to the institutionalization of sociology in China. Chen sought to craft a theory of Chinese development that followed universal trajectories of progress but was also attuned to the complexity of Chinese society on the ground. Through his efforts to indigenize sociology, Chen developed a non-Marxist historical materialism, a deterritorialized and pluralistic conceptualization of China as a nation, and a theory of eugenic transformation centered on the concept of “mode of living.” The questions which Chen Da confronted are emblematic of the predicament faced by Chinese social scientists today, who again struggle with the dynamics of a deterritorialzied “Greater China,” rising social fragmentation, and refigured eugenic discourses and policies that aim to craft the Chinese people into ideal national subjects fit for post-socialist development.

A numeric-analytic method for approximating the chaotic Chen system

International Nuclear Information System (INIS)

Mossa Al-sawalha, M.; Noorani, M.S.M.

2009-01-01

The epitome of this paper centers on the application of the differential transformation method (DTM) the renowned Chen system which is described as a three-dimensional system of ODEs with quadratic nonlinearities. Numerical comparisons are made between the DTM and the classical fourth-order Runge-Kutta method (RK4). Our work showcases the precision of the DTM as the Chen system transforms from a non-chaotic system to a chaotic one. Since the Lyapunov exponent for this system is much higher compared to other chaotic systems, we shall highlight the difficulties of the simulations with respect to its accuracy. We wrap up our investigations to reveal that this direct symbolic-numeric scheme is effective and accurate.

Review of the genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae) with description of two new species.

Science.gov (United States)

Chang, Zhi-Min; Yang, Lin; Zhang, Zheng-Guang; Chen, Xiang-Sheng

2015-12-11

Two new species of the issid genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae): Neotetricodes longispinus Chang et Chen sp. nov. (China: Yunnan) and Neotetricodes xiphoideus Chang et Chen sp. nov. (China: Yunnan) are described and illustrated. The generic characteristic is redefined. A checklist and key to the species of the genus are provided. The female genitalia of the genus are firstly described.

Rap and Resistance: A Social Movement of the Wu-Tang Clan.

Science.gov (United States)

Chasteen, Amy L.; Shriver, Thomas

1998-01-01

Examines specific collective identity and political expression of the rap group the Wu-Tang Clan. Reveals a multi-layered political strategy that has been conscientiously designed and implemented to instigate a social movement. Prioritizes the voices of marginalized Black peoples and provides raw narratives about oppression. (MMU)

How Memory Is Tested Influences What Is Measured: Reply to Wyble and Chen (2017)

Science.gov (United States)

Swallow, Khena M.; Jiang, Yuhong V.; Tan, Deborah H.

2017-01-01

In this response to Wyble and Chen's (2017) commentary on attribute amnesia, we hope to achieve several goals. First, we clarify how our view diverges from that described by Wyble and Chen. We argue that because the surprise memory test is disruptive, it is an insensitive tool for measuring the persistence of recently attended target attributes in…

How Managers Sense and Seize “Hyped” Technologies

DEFF Research Database (Denmark)

Schiele, Kristen; Rydén, Pernille

A rapid proliferation of online consumer review systems has become common in diverse industries, such as tourism (Xiang and Gretzel 2010), box office movies (Duan, Gu, andWhinston 2008; Dellarocas, Zhang and Awad 2007), online books (Chevalier and Mayzlin 2006;Chen, Wu, and Yoon 2004), and video ...... (Dellarocas 2003), and the popularity of online reviews has increased acknowledgement of the potential of social media to provide the organization with information, resources, and networks (Constantinides and Fountain 2008).......A rapid proliferation of online consumer review systems has become common in diverse industries, such as tourism (Xiang and Gretzel 2010), box office movies (Duan, Gu, andWhinston 2008; Dellarocas, Zhang and Awad 2007), online books (Chevalier and Mayzlin 2006;Chen, Wu, and Yoon 2004), and video...

Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe

OpenAIRE

Spinner, Kaspar H.

2014-01-01

Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe. - In: Standardorientierung im Lese- und Literaturunterricht der Sekundarstufe I / Cornelia Rosebrock ; Heike Wirthwein. - Baltmannsweiler : Schneider-Verl. Hohengehren, 2014. - S. 126-132

Ronald Malt or Chen Zhongwei: Who performed the first surgical replantation?

Science.gov (United States)

Fan, Ka-Wai

2018-01-01

This article discusses the contributions of the two pioneers of the surgical procedure of replantation-Ronald Malt in the US and Chen Zhongwei in China. Ronald Malt performed the reattachment surgery on a boy who had an accident in 1962, but he published his case report two years later in 1964. Chen Zhongwei performed a similar surgery on a worker who cut off his forearm in 1963, but he published his case report the same year. There is some debate about which one of these reputed surgeons should be given credit for being the first one to perform this breakthrough surgery, because although Malt was the first to perform the procedure, Zhongwei was the first to report it. To shed light on this controversy, criteria for scientific priority suggested by Ronald Vale and Anthony Hyman were applied. Although the criteria mainly favored Zhongwei as the pioneer of this procedure, he did not entirely fulfill one of the criteria. Therefore, the article could not present a definitive answer to the question, and it concludes by pointing out the highly commendable achievements and contributions of both Ronald Malt and Chen Zhongwei.

Chaos control of Chen chaotic dynamical system

International Nuclear Information System (INIS)

Yassen, M.T.

2003-01-01

This paper is devoted to study the problem of controlling chaos in Chen chaotic dynamical system. Two different methods of control, feedback and nonfeedback methods are used to suppress chaos to unstable equilibria or unstable periodic orbits (UPO). The Lyapunov direct method and Routh-Hurwitz criteria are used to study the conditions of the asymptotic stability of the steady states of the controlled system. Numerical simulations are presented to show these results

Mellin-Barnes regularization, Borel summation and the Bender-Wu asymptotics for the anharmonic oscillator

International Nuclear Information System (INIS)

Kowalenko, V.; Rawlinson, A.A.

1998-01-01

We introduce the numerical technique of Mellin-Barnes regularization, which can be used to evaluate both convergent and divergent series. The technique is shown to be numerically equivalent to the corresponding results obtained by Borel summation. Both techniques are then applied to the Bender-Wu formula, which represents an asymptotic expansion for the energy levels of the anharmonic oscillator. We find that this formula is unable to give accurate values for the ground state energy, particularly when the coupling is greater than 0.1. As a consequence, the inability of the Bender-Wu formula to yield exact values for the energy level of the anharmonic oscillator cannot be attributed to its asymptotic nature. (authors)

Biodesulfurization of Naphthothiophene and Benzothiophene through Selective Cleavage of Carbon-Sulfur Bonds by Rhodococcus sp. Strain WU-K2R

Science.gov (United States)

Kirimura, Kohtaro; Furuya, Toshiki; Sato, Rika; Ishii, Yoshitaka; Kino, Kuniki; Usami, Shoji

2002-01-01

Naphtho[2,1-b]thiophene (NTH) is an asymmetric structural isomer of dibenzothiophene (DBT), and in addition to DBT derivatives, NTH derivatives can also be detected in diesel oil following hydrodesulfurization treatment. Rhodococcus sp. strain WU-K2R was newly isolated from soil for its ability to grow in a medium with NTH as the sole source of sulfur, and growing cells of WU-K2R degraded 0.27 mM NTH within 7 days. WU-K2R could also grow in the medium with NTH sulfone, benzothiophene (BTH), 3-methyl-BTH, or 5-methyl-BTH as the sole source of sulfur but could not utilize DBT, DBT sulfone, or 4,6-dimethyl-DBT. On the other hand, WU-K2R did not utilize NTH or BTH as the sole source of carbon. By gas chromatography-mass spectrometry analysis, desulfurized NTH metabolites were identified as NTH sulfone, 2′-hydroxynaphthylethene, and naphtho[2,1-b]furan. Moreover, since desulfurized BTH metabolites were identified as BTH sulfone, benzo[c][1,2]oxathiin S-oxide, benzo[c][1,2]oxathiin S,S-dioxide, o-hydroxystyrene, 2-(2′-hydroxyphenyl)ethan-1-al, and benzofuran, it was concluded that WU-K2R desulfurized NTH and BTH through the sulfur-specific degradation pathways with the selective cleavage of carbon-sulfur bonds. Therefore, Rhodococcus sp. strain WU-K2R, which could preferentially desulfurize asymmetric heterocyclic sulfur compounds such as NTH and BTH through the sulfur-specific degradation pathways, is a unique desulfurizing biocatalyst showing properties different from those of DBT-desulfurizing bacteria. PMID:12147483

On the de Rham–Wu decomposition for Riemannian and Lorentzian manifolds

International Nuclear Information System (INIS)

Galaev, Anton S

2014-01-01

It is explained how to find the de Rham decomposition of a Riemannian manifold and the Wu decomposition of a Lorentzian manifold. For that it is enough to find parallel symmetric bilinear forms on the manifold, and do some linear algebra. This result will allow to compute the connected holonomy group of an arbitrary Riemannian or Lorentzian manifold. (paper)

Madame Wu Chien-Shiung the first lady of physics research

CERN Document Server

Chiang, Tsai-Chien

2014-01-01

Narrating the well-lived life of the "Chinese Madame Curie" - a recipient of the first Wolf Prize in Physics (1978), the first woman to receive an honorary doctorate from Princeton University, as well as the first female president of the American Physics Society - this book provides a comprehensive and honest account of the life of Dr. Chien-Shiung Wu, an outstanding and leading experimental physicist of the 20th century.

TEST OF THE CHEN-ROLL-ROSS MACROECONOMIC FACTOR MODEL: EVIDENCE FROM CROATIAN STOCK MARKET

Directory of Open Access Journals (Sweden)

Denis Dolinar

2015-12-01

Full Text Available This paper empirically examines the well-known Chen-Roll-Ross model on the Croatian stock market. Modifications of definitions of the Chen-Roll-Ross model variables showed as necessary because of doubtful availability and quality of input data needed. Namely, some macroeconomic and market variables are not available in the originally defined form or do not exist. In that sense this paper gives some alternative definitions for some model variables. Also, in order to improve statistical analysis, in this paper we have modified Fama-MacBeth technique in the way that second-pass regression was substituted with panel regression analysis. Based on the two-pass regression analysis of returns of 34 Croatian stocks on 4 macroeconomic variables during the seven-and-half-year observation period the following conclusion is made. In contrast to the results of Chen, Roll and Ross (1986 for the U.S. stock market, their model is not successful when describing a risk-return relation of Croatian stocks. Nevertheless, one observed version of the Chen-RollRoss model showed certain statistical significance. Namely, two risk factors in that version of the model were statistically significant: default premium, measured as risk premium for the corporate short-term bank loan financing, and term structure premium, measured on short-run basis.

T'ai Chi

Science.gov (United States)

... are different styles of t'ai chi, including: Chen style Hao (or Wu Shi) style Hu Lei ... medical advice, diagnoses, and treatment, consult your doctor. © 1995- The Nemours Foundation. All rights reserved. Images provided ...

Chaos synchronization between Chen system and Genesio system

International Nuclear Information System (INIS)

Wu Xianyong; Guan Zhihong; Wu Zhengping; Li Tao

2007-01-01

This Letter presents two synchronization schemes between two different chaotic systems. Active control synchronization and adaptive synchronization between Chen system and Genesio system are studied, different controllers are designed to synchronize the drive and response systems, active control synchronization is used when system parameters are known; adaptive synchronization is employed when system parameters are unknown or uncertain. Simulation results show the effectiveness of the proposed schemes

Tensioned Fabric Structures with Surface in the Form of Chen-Gackstatter

Directory of Open Access Journals (Sweden)

Yee Hooi Min

2016-01-01

Full Text Available Form-finding has to be carried out for tensioned fabric structure in order to determine the initial equilibrium shape under prescribed support condition and prestress pattern. Tensioned fabric structures are normally designed to be in the form of equal tensioned surface. Tensioned fabric structure is highly suited to be used for realizing surfaces of complex or new forms. However, research study on a new form as a tensioned fabric structure has not attracted much attention. Another source of inspiration minimal surface which could be adopted as form for tensioned fabric structure is very crucial. The aim of this study is to propose initial equilibrium shape of tensioned fabric structures in the form of Chen-Gackstatter. Computational form-finding using nonlinear analysis method is used to determine the Chen-Gackstatter form of uniformly stressed surfaces. A tensioned fabric structure must curve equally in opposite directions to give the resulting surface a three dimensional stability. In an anticlastic doubly curved surface, the sum of all positive and all negative curvatures is zero. This study provides an alternative choice for structural designer to consider the Chen-Gackstatter applied in tensioned fabric structures. The results on factors affecting initial equilibrium shape can serve as a reference for proper selection of surface parameter for achieving a structurally viable surface.

PLE-wu, a new member of piggyBac transposon family from insect, is active in mammalian cells.

Science.gov (United States)

Wu, Chunxiao; Wang, Shu

2014-10-01

piggyBac, a highly active transposon in insect and mammalian cells, is a very useful tool in genome manipulation. A new piggyBac-like element (PLE), named PLE-wu, was identified from a mutant baculovirus cultured in sf9 insect cells. This new transposon is 2931 bp in length and encodes two active forms of transposase, a 708-amino acid-long transposase and a short 576-residue-long transposase translated from a downstream in-frame initiation codon. PLE-wu has asymmetric terminal structures, containing 6-bp inverted terminal repeats, 32-bp imperfect inverted and direct sub-terminal repeats. Similar to piggyBac, PLE-wu exhibits traceless excision activity in both insect and mammalian cells, restoring the original TTAA target sequence upon excision. It also retains the insertion activity in mammalian cells with a plasmid to chromosome transposition rate about 10-fold higher than random integration. Plasmid rescue assays revealed that the TTAA target sequence was duplicated at the junctions of the insertion site. Deletion of the terminal sequences including the sub-terminal repeats decreased the transposition activity of the 708-residue-long transposase, while the transposition activity of the short form of transposase was not affected. With its low sequence similarity to piggyBac, PLE-wu will contribute to the understanding the mechanism of PLE transposition, as well as design of new transposon systems with higher activity. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Development of a General Conceptual-numerical Model to Simulate the Fate and Subsurface Transport of Explosives, and the Moisture and Temperature Signatures Around Land Mines

Science.gov (United States)

2008-12-01

Chen, J. Gan, J. Šimůnek, A. C. Chang, and L. Wu, Leaching risk of N-nitrosodimethylamine ( NDMA ) in soil receiving reclaimed wastewater, Highlighted...Abstracts, published on a CD-ROM as abstract 5043, ASA, Madison, 2005. Haruta, S., J. Gan, and J. Šimunek, Numerical Analyses of NDMA Leaching Risk in...Gan, J. Šimůnek, A. C. Chang, and L. Wu, Leaching risk of N- nitrosodimethylamine ( NDMA ) in soil receiving reclaimed wastewater, Highlighted article

Analysing the Wu metric on a class of eggs in Cn–II

Indian Academy of Sciences (India)

Home; Journals; Proceedings – Mathematical Sciences; Volume 127; Issue 3. Analysing the Wu metric on a class of eggs in C C n – I I .... G P BALAKUMAR1 PRACHI MAHAJAN2. Indian Statistical Institute, Chennai 600 113, India; Department of Mathematics, Indian Institute of Technology – Bombay, Mumbai 400 076, India ...

Chen Jingrun, China's famous mathematician: devastated by brain injuries on the doorstep to solving a fundamental mathematical puzzle.

Science.gov (United States)

Lei, Ting; Belykh, Evgenii; Dru, Alexander B; Yagmurlu, Kaan; Elhadi, Ali M; Nakaji, Peter; Preul, Mark C

2016-07-01

Chen Jingrun (1933-1996), perhaps the most prodigious mathematician of his time, focused on the field of analytical number theory. His work on Waring's problem, Legendre's conjecture, and Goldbach's conjecture led to progress in analytical number theory in the form of "Chen's Theorem," which he published in 1966 and 1973. His early life was ravaged by the Second Sino-Japanese War and the Chinese Cultural Revolution. On the verge of solving Goldbach's conjecture in 1984, Chen was struck by a bicyclist while also bicycling and suffered severe brain trauma. During his hospitalization, he was also found to have Parkinson's disease. Chen suffered another serious brain concussion after a fall only a few months after recovering from the bicycle crash. With significant deficits, he remained hospitalized for several years without making progress while receiving modern Western medical therapies. In 1988 traditional Chinese medicine experts were called in to assist with his treatment. After a year of acupuncture and oxygen therapy, Chen could control his basic bowel and bladder functions, he could walk slowly, and his swallowing and speech improved. When Chen was unable to produce complex work or finish his final work on Goldbach's conjecture, his mathematical pursuits were taken up vigorously by his dedicated students. He was able to publish Youth Math, a mathematics book that became an inspiration in Chinese education. Although he died in 1996 at the age of 63 after surviving brutal political repression, being deprived of neurological function at the very peak of his genius, and having to be supported by his wife, Chen ironically became a symbol of dedication, perseverance, and motivation to his students and associates, to Chinese youth, to a nation, and to mathematicians and scientists worldwide.

An equilibrium point stabilization strategy for the Chen system

International Nuclear Information System (INIS)

Alvarez-Ramirez, Jose; Cevantes, Ilse; Femat, Ricardo

2004-01-01

The aim of this Letter is to address the equilibrium point stabilization problem of the Chen system by employing a simple linear feedback controller derived from time-scaling the dynamics of a single variable. The controller has the advantage of being easy to implement and a rigorous stability proof is provided based on singular perturbation arguments. Results are illustrated via numerical simulations

Generalized projective synchronization between Lorenz system and Chen's system

International Nuclear Information System (INIS)

Li Guohui

2007-01-01

On the basis of active backstepping design, this paper presents the generalized projective synchronization between two different chaotic systems: Lorenz system and Chen's system. The proposed method combines backstepping methods and active control without having to calculate the Lyapunov exponents and the eigenvalues of the Jacobian matrix, which makes it simple and convenient. Numerical simulations show that this method works very well

Reforming China’s Criminal Procedure Law

OpenAIRE

Winckler, Hugo

2014-01-01

Sources:- Wang Jianxun, “The provisions of the reform of criminal procedural law legalising secret investigations are a step backwards,” Caijing wang, 5 September 2011.- Chen Youxi, “The legalisation of secret investigations is an important violation of political integrity,” Zhongguo wangluo dianshitai – CNTV web site, Opinion section, 27 November 2011.- Wu Zhehua, “Chen Weidong discusses reform of the criminal procedure law: Behind each article there is a story,” Zhongguoguangbo wang, 8 Marc...

Profit rate performance optimization for a generalized irreversible ...

Indian Academy of Sciences (India)

fer law system generalized irreversible combined refrigeration cycle model with finite-rate heat ...... Chen L, Sun F, Wu C 2004b Optimum allocation of heat exchanger area for refrigeration and air conditioning plants. Appl. Energy 77(3): 339– ...

Strength-based Supervision: Frameworks, Current Practice, and Future Directions A Wu-wei Method.

Science.gov (United States)

Edwards, Jeffrey K.; Chen, Mei-Whei

1999-01-01

Discusses a method of counseling supervision similar to the wu-wei practice in Zen and Taoism. Suggests that this strength-based method and an understanding of isomorphy in supervisory relationships are the preferred practice for the supervision of family counselors. States that this model of supervision potentiates the person-of-the-counselor.…

to view fulltext PDF

Indian Academy of Sciences (India)

2013-02-09

Feb 9, 2013 ... potential invading pathogens and mount successful defences ...... methyl-SA strongly suggest that SA is not the mobile signal. (Vernooij et al. 1994 ...... Wang WH, Yi XQ, Han AD, Liu TW, Chen J, Wu FH, Dong XJ,. He JX, Pei ...

Investigation of the Livengood–Wu integral for modelling autoignition in a high-pressure bomb

NARCIS (Netherlands)

Hu, Zhixin; Somers, Bart L.M.T.; Cracknell, Roger F.; Bradley, Derek

2016-01-01

The reaction progress variable, which is widely used in premixed and diffusion combustion studies, comprises a set of pre-selected intermediate species to denote reaction progress. Progress towards autoignition can also be traced by the Livengood–Wu (LW) integral. Autoignition occurs when the LW

Development of liposomal pemetrexed for enhanced therapy against multidrug resistance mediated by ABCC5 in breast cancer

OpenAIRE

Bai,Fang; Yin,You; Chen,Ting; Chen,Jihui; Ge,Meixin; Lu,Yunshu; Xie,Fangyuan; Zhang,Jian; Wu,Kejin; Liu,Yan

2018-01-01

Fang Bai,1–3,* You Yin,4,* Ting Chen,1,* Jihui Chen,1 Meixin Ge,2 Yunshu Lu,2 Fangyuan Xie,5 Jian Zhang,1 Kejin Wu,3 Yan Liu1,6 1Department of Pharmacy, Xinhua Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, 2Department of General Surgery, Xinhua Hospital, Affiliated to Shanghai Jiao Tong University, School of Medicine, Shanghai, 3Department of Breast Surgery, Obstetrics and Gynaecology Hospital, Fudan University, Shanghai, 4Department of Neurology, Changzheng...

People’s Republic of China Scientific Abstracts, Number 195.

Science.gov (United States)

1978-08-01

76 15 CHIH-WU HSUEH-PAO [ACTA BOTANICA SINICA] No 1, March 1978 16 TI-CHEN CHAN-HSIEN [EARTHQUAKE FRONT] No 2, April 1978 26 K𔃺-HSUEH...steril^UMs! and Consolidate the contradiction between the hsien and 6168 CSO: 8111/1528 15 ACTA BOTANICA SINICA AUTHOR: CHANG Te-i [l72B 1795...of Cultured Tobacco Cells" SOURCE: Peking CHIH-WU H5UEH-PA0 [_ACTA BOTANICA SINICÄ] in Chinese No 1, Mar 78 pp 1-5 TEXT OF ENGLISH ABSTRACT

Journal of Genetics | Indian Academy of Sciences

Indian Academy of Sciences (India)

Yu-Song Guo Zhong-Duo Wang Cheng-Zhong Yan Yu-Lan Zhang Jin-Nan Zheng Yuan-Min Xu Tao Du Chu-Wu Liu · More Details Fulltext PDF ... Aifu Yang Dapeng Sun Shikai Liu Ying Dong Zhong Chen Zunchun Zhou · More Details Fulltext ...

Morphology and anatomical structure of the larval salt gland of ...

African Journals Online (AJOL)

Ezedom Theresa

2013-10-09

Oct 9, 2013 ... the morphology and fine structure of the ion transporting epithelium ... The general structure of the salt gland of nauplii cultured at 180 g/L disappeared. ...... Wu G, Zhang H, Sun J, Liu F, Ge X, Chen WH, Yu, J, Wang W (2011).

Analysing the Wu metric on a class of eggs in ℂn – I

Indian Academy of Sciences (India)

G P BALAKUMAR

An explicit description of the Wu metric on the Thullen domains (these are also ..... K(p,v), when p varies across Z. It suffices to focus attention on the case when p varies ... Substituting this into (6.3) and dividing throughout by ˜t2| ˆw|2p2. 1.

From Wang-Chen System with Only One Stable Equilibrium to a New Chaotic System Without Equilibrium

Science.gov (United States)

Pham, Viet-Thanh; Wang, Xiong; Jafari, Sajad; Volos, Christos; Kapitaniak, Tomasz

2017-06-01

Wang-Chen system with only one stable equilibrium as well as the coexistence of hidden attractors has attracted increasing interest due to its striking features. In this work, the effect of state feedback on Wang-Chen system is investigated by introducing a further state variable. It is worth noting that a new chaotic system without equilibrium is obtained. We believe that the system is an interesting example to illustrate the conversion of hidden attractors with one stable equilibrium to hidden attractors without equilibrium.

[Professor CHEN Xiuhua's experience in the treatment of atopic dermatitis].

Science.gov (United States)

Quan, Xiaohong; Li, Shuqian; Li, Ying

2017-03-12

Professor CHEN Xiuhua 's clinical experiences were introduced in the intervention on atopic dermatitis with external therapies of TCM acupuncture. On the basis of the theory as cultivating the earth and clearing the heart from professor CHEN Dacan and in terms of the disease stages and skin lesion characteristics, as well as in consideration of syndrome differen-tiation, the acupoints for strengthening the spleen and clearing heart fire are selected, such as Zhongwan (CV 12), Daheng (SP 15), Shuifen (CV 9), Tianshu (ST 25), Neiguan (PC 6) and Quchi (LI 11). For the repair of skin lesion, the integration of Chinese and western medicine is used, with the internal application and external use of Chinese herbal medicines involved. The topical ointments are selected rationally. The self-blood therapy is used with acupuncture, bleeding therapy and acupoint injection applied in combination on the basis of the theory of TCM zangfu organs and modern immunological mechanism, which stimulates the nonspecific immune response in the body and strengthens acupoint stimulus effects. Medical thread therapy of Guangxi Zhuang medicine is used in moxibustion for skin damage, which effectively stops itching and promotes wound healing and skin repair.

Ignition delay time correlation of fuel blends based on Livengood-Wu description

KAUST Repository

Khaled, Fathi

2017-08-17

In this work, a universal methodology for ignition delay time (IDT) correlation of multicomponent fuel mixtures is reported. The method is applicable over wide ranges of temperatures, pressures, and equivalence ratios. n-Heptane, iso-octane, toluene, ethanol and their blends are investigated in this study because of their relevance to gasoline surrogate formulation. The proposed methodology combines benefits from the Livengood-Wu integral, the cool flame characteristics and the Arrhenius behavior of the high-temperature ignition delay time to suggest a simple and comprehensive formulation for correlating the ignition delay times of pure components and blends. The IDTs of fuel blends usually have complex dependences on temperature, pressure, equivalence ratio and composition of the blend. The Livengood-Wu integral is applied here to relate the NTC region and the cool flame phenomenon. The integral is further extended to obtain a relation between the IDTs of fuel blends and pure components. Ignition delay times calculated using the proposed methodology are in excellent agreement with those simulated using a detailed chemical kinetic model for n-heptane, iso-octane, toluene, ethanol and blends of these components. Finally, very good agreement is also observed for combustion phasing in homogeneous charge compression ignition (HCCI) predictions between simulations performed with detailed chemistry and calculations using the developed ignition delay correlation.

Why Study Chinese Classics and How to Go about It: Response to Zongjie Wu's "Interpretation, Autonomy, and Transformation--Chinese Pedagogic Discourse in Cross-Cultural Perspective"

Science.gov (United States)

Tan, Sor-Hoon

2011-01-01

This response to Zongjie Wu's "Interpretation, autonomy, and interpretation" focuses on the "battle between East and West" which contextualizes Wu's proposal to counter the current Western domination of Chinese pedagogic discourse with an "authentic language" recovered from the Chinese classics. It points out that it…

Genetic diversity of bitter taste receptor gene family in Sichuan

Indian Academy of Sciences (India)

Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE Volume 95 Issue 3 September 2016 pp 675-681 ...

Methods and strategy for modeling daily global solar radiation with measured meteorological data - A case study in Nanchang station, China

International Nuclear Information System (INIS)

Wu, Guofeng; Liu, Yaolin; Wang, Tiejun

2007-01-01

Solar radiation is a primary driver for many physical, chemical and biological processes on the earth's surface, and complete and accurate solar radiation data at a specific region are quite indispensable to the solar energy related researches. This study, with Nanchang station, China, as a case study, aimed to calibrate existing models and develop new models for estimating missing global solar radiation data using commonly measured meteorological data and to propose a strategy for selecting the optimal models under different situations of available meteorological data. Using daily global radiation, sunshine hours, temperature, total precipitation and dew point data covering the years from 1994 to 2005, we calibrated or developed and evaluated seven existing models and two new models. Validation criteria included intercept, slope, coefficient of determination, mean bias error and root mean square error. The best result (R 2 = 0.93) was derived from Chen model 2, which uses sunshine hours and temperature as predictors. The Bahel model, which only uses sunshine hours, was almost as good, explaining 92% of the solar radiation variance. Temperature based models (Bristow and Campbell, Allen, Hargreaves and Chen 1 models) provided less accurate results, of which the best one (R 2 = 0.69) is the Bristow and Campbell model. The temperature based models were improved by adding other variables (daily mean total precipitation and mean dew point). Two such models could explain 77% (Wu model 1) and 80% (Wu model 2) of the solar radiation variance. We, thus, propose a strategy for selecting an optimal method for calculating missing daily values of global solar radiation: (1) when sunshine hour and temperature data are available, use Chen model 2; (2) when only sunshine hour data are available, use Bahel model; (3) when temperature, total precipitation and dew point data are available but not sunshine hours, use Wu model 2; (4) when only temperature and total precipitation are

Effects of traditional Chinese medicine on rats with Type II diabetes ...

African Journals Online (AJOL)

Effects of traditional Chinese medicine on rats with Type II diabetes induced by high-fat diet and streptozotocin: A urine metabonomic study. H Zhao, Z Li, G Tian, K Gao, Li Zhiyong, B Zhao, J Wang, L Luo, Q Pan, W Zhang, Z Wu, J Chen, W Wang ...

Journal of Chemical Sciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Chemical Sciences. Min Xu. Articles written in Journal of Chemical Sciences. Volume 126 Issue 6 November 2014 pp 1623-1627 Rapid Communications. Synthesis and properties of a dual responsive hydrogel by inverse microemulsion polymerization · Tao Wan Min Xu Liyi Chen Daqing Wu ...

Professor Ta-You Wu and his ideas of science

International Nuclear Information System (INIS)

Ye Minghan; Dai Nianzu

2005-01-01

The career of Professor Ta-You Wu and his contributions in the latter half of his life in Taiwan, China are briefly reviewed. The authors focus our discussion on some of his ideas in pushing forward the advancement of science and technology in Taiwan and in promoting scientific standards. These ideas include: emphasis on the importance of basic science and qualified personnel as the foundation for the development of science and technology, and while advocating applied science he pointed out that 'future profits depend on high technology'. Thus, he contributed greatly to the rise of the economy in Taiwan. His view of the dispute between Bohr and Einstein is also briefly reviewed, as well as his principles of leadership as the president of Academia Sinica, Taiwan. (author)

Bulletin of Materials Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Ping Chen1 2 Qing-Sheng Wu1 Ya-Ping Ding3 Pin-Shi Yuan1. Department of Chemistry, Tongji University, 1239 Siping Road, Shanghai 200092, P.R. China; Department of Chemistry, Chizhou College, Chizhou, Anhui 247000, P.R. China; Department of Chemistry, Shanghai University, Shanghai 200436, P.R. China ...

Journal of Biosciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Biosciences; Volume 31; Issue 5. Combinative effects of a bacterial type-III effector and a biocontrol bacterium on rice growth and disease resistance. Haiying Ren Ganyu Gu Juying Long Qian Yin Tingquan Wu Tao Song Shujian Zhang Zhiyi Chen Hansong Dong. Reviews Volume 31 Issue 5 ...

Flowers with Yeast α-Glucosidase Inhibitory Activity

African Journals Online (AJOL)

Cholesterol in Hamsters Fed High-Fat Diets. Supplemented with Blueberry Peels and Peel. Extract. J Agric Food Chem 2010; 58: 3984-3991. 7. Xie C, Kang J, Chen JR, Nagarajan S, Badger TM, Wu X. Phenolic Acids Are in Vivo Atheroprotective. Compounds Appearing in the Serum of Rats after. Blueberry Consumption.

High Serum 25-hydroxyvitamin D is Associated with Low Incidence of Stress Fractures

Science.gov (United States)

2011-06-01

of Family and Preventive Medicine, School of Medicine, University of California, San Diego, La Jolla, California 3 Osteoporosis Research Center...surveillance. Am J Public Health. 2002 Dec;92(12):1900-4. 19. Beck TJ, Petit MA, Wu G, LeBoff MS, Cauley JA, Chen Z. Does obesity really make the

Five newly recorded Cyprinid fish (Teleostei: Cypriniformes) in Myanmar

Science.gov (United States)

Qin, Tao; Chen, Zhi-Ying; Xu, Lu-Lu; Zaw, Paing; Kyaw, Yunn Mi Mi; Maung, Kyaw Win; Chen, Xiao-Yong

2017-01-01

Freshwater fish from the Putao and Myitkyina areas were collected in three ichthyofaunal surveys of the Mali Hka River and tributaries in and around Khakaborazi National Park and Hponkanrazi Wildlife Sanctuary, Kachin State, from 2014-2016. Tor yingjiangensis Chen et Yang 2004, Tor qiaojiensis Wu et al. 1977, Garra qiaojiensis Wu et al. 1977, Garra bispinosa Zhang 2005, and Schizothorax oligolepis Huang 1985, originally described from the upper Irrawaddy (Ayeyarwaddy) River in China, are first reported herein as new records to Myanmar. Counts, measurements, descriptions, photographs, and distributions of the specimens of the five newly recorded species are provided. PMID:29181904

Journal of Biosciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Biosciences. SONG XUE. Articles written in Journal of Biosciences. Volume 41 Issue 2 June 2016 pp 229-236 Article. Silencing of HMGA2 promotes apoptosis and inhibits migration and invasion of prostate cancer cells · Zhan Shi Ding Wu Run Tang Xiang Li Renfu Chen Song Xue Chengjing ...

Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing

Directory of Open Access Journals (Sweden)

Richard K. Payne

2016-03-01

Full Text Available Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between the expectations of the dominant religious culture and the immigrant culture in terms of the ways in which religious leaders represent themselves. Both Billy Graham and the Dalai Lama present themselves in very humble terms, consistent with the expectations of the Pietist background to American popular religion. Yogi Chen on the contrary tends toward a self-aggrandizing style, which although consistent with the competitive nature of premodern Tibetan religious culture is not congruent with the expectations of American popular religion.

Theoretical and experimental study of Chen chaotic system with notch filter feedback control

International Nuclear Information System (INIS)

Ming, Zhang Xiao; Jian-Hua, Peng; Ju-Fang, Chen

2010-01-01

Since the past two decades, the time delay feedback control method has attracted more and more attention in chaos control studies because of its simplicity and efficiency compared with other chaos control schemes. Recently, it has been proposed to suppress low-dimensional chaos with the notch filter feedback control method, which can be implemented in a laser system. In this work, we have analytically determined the controllable conditions for notch filter feedback controlling of Chen chaotic system in terms of the Hopf bifurcation theory. The conditions for notch filter feedback controlled Chen chaoitc system having a stable limit cycle solution are given. Meanwhile, we also analysed the Hopf bifurcation direction, which is very important for parameter settings in notch filter feedback control applications. Finally, we apply the notch filter feedback control methods to the electronic circuit experiments and numerical simulations based on the theoretical analysis. The controlling results of notch filter feedback control method well prove the feasibility and reliability of the theoretical analysis. (general)

The complete mitochondrial genome of a stonefly species, Kamimuria chungnanshana Wu, 1948 (Plecoptera: Perlidae).

Science.gov (United States)

Wang, Kai; Ding, Shuangmei; Yang, Ding

2016-09-01

This study determined the complete mitochondrial (mt) genome of the stonefly, Kamimuria chungnanshana Wu, 1948. The mt genome is 15, 943 bp in size and contains 37 canonical genes which include 22 transfer RNA genes, 13 protein-coding genes, and two ribosomal RNA genes, the control region is 1062 bp in length. The phylogenetic tree shows that Kamimuria chungnanshana is sister group of Kamimuria wangi.

Bulletin of Materials Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

... Refresher Courses · Symposia · Live Streaming. Home; Journals; Bulletin of Materials Science; Volume 36; Issue 4. Enhanced high temperature performance of LiMn2O4 coated with Li3BO3 solid electrolyte. Liu Jinlian Wu Xianming Chen Shang Liu Jianben He Zeqiang. Volume 36 Issue 4 August 2013 pp 687-691 ...

Browse Title Index

African Journals Online (AJOL)

Items 501 - 550 of 1309 ... HH Tamboura, B Bayala, M Lompo, IP Guissou, L Sawadogo ... X Wang, Y-G Chen, L Ma, Z-H Li, J-Y Li, X-G Liu, J-L Zou, J-H Wu. Vol 11, No 2 ... Zhi-Jiang Wang, Wei Xu, Jian-Wen Liang, Cai-Sheng Wang, Yani Kang.

Leaf Extract in ICR Mice Fed High-Fat Diet

African Journals Online (AJOL)

Chen1,2, Rong-Ji Dai1,2, Yu-Lin Deng1,2 and Chong-Ming Wu3*. 1School of Life Science, Beijing Institute of Technology, Beijing 100081, 2Beijing BIT&GY Pharmaceutical R&D, Beijing 100081,. 3Institute of Medicinal Plant Development, Chinese Academy of Medical Science & Peking Union Medical College, Beijing.

cDNA cloning and primary structure analysis of invariant chain in ...

African Journals Online (AJOL)

cDNA cloning and primary structure analysis of invariant chain in Chinese Pengze crucian carp. X Liu, W Yu, J Li, F Chen, S Liu, C Wu, J Xu. Abstract. Invariant chain (Ii) plays an important role in MHC class II molecules assembly and exogenous peptide presentation in vertebrates. Although mammalian Ii has been ...

His Excellency Professor Jiaer Chen President, National Natural Science Foundation, People's Republic of China

CERN Multimedia

Maximilien Brice

2002-01-01

L. to r.: Dr Diether Blechschmidt, Adviser for Non Member States Relations, Dr Peter Jenni, Spokesman, ATLAS Experiment, Prof. Chen, Mr Jean-Luc Baldy, Head of the LHC Civil Engineering Group and Dr John Ellis, Adviser for Non Member States Relations.

Photoluminescent (PL) or electroluminescent (EL) quantum dots for display, lighting, and photomedicine (Conference Presentation)

Science.gov (United States)

Dong, Yajie

2017-02-01

Quantum dots (QDs) have gone through a long journey before finding their ways into the display field. This talk will briefly touch on the history before trying to answer several key questions related to QDs applications in display: What are QDs? How are they made? What properties do they have and Why? How can these properties be used to improve color and efficiency of display, in either photoluminescence (PL) or electroluminescence (EL) mode? And what are the remaining challenges for QDs wide adoption in display industry? Lastly, some most recent progresses in our UCF lab at both PL and EL fronts will be highlighted. For PL, a cadmium-free perovskite-polymer composite films with exceptionally narrow emission green peaks (FWHM 20 nm) and good water and thermal stability will be reported. Together with red quantum dots or PFS/KSF phosphors as down-converters for blue LEDs, a white-light source with 95% Rec. 2020 color gamut was demonstrated [1]. For EL, red quantum dot light emitting devices (QLEDs) with record luminance of 165,000 Cd/m2 has been obtained at a current density of 1000 mA/cm2 with a low driving voltage of 5.8 V and CIE coordinates of (0.69, 0.31). [2] The potential of using these QLEDs for light sources for integrated sensing platform [3] or high efficiency, high color quality hybrid white OLED [4] will be discussed. [1] Y. N. Wang, J. He, H. Chen, J. S. Chen, R. D. Zhu, P. Ma, A. Towers, Y. Lin, A. J. Gesquiere, S. T. Wu, Y. J. Dong. Ultrastable, Highly Luminescent Organic-Inorganic Perovskite - Polymer Composite Films, Advanced Materials, accepted, (2016). [2] Y. J. Dong, J.M. Caruge, Z. Q. Zhou, C. Hamilton, Z. Popovic, J. Ho, M. Stevenson, G. Liu, V. Bulovic, M. Bawendi, P. T. Kazlas, S. Coe-Sullivan, and J. Steckel Ultra-bright, Highly Efficient, Low Roll-off Inverted Quantum-Dot Light Emitting Devices (QLEDs). SID Symp. Dig. Tech. Pap. 46, 270-273 (2015). [3] J. He, H. Chen, S. T. Wu, and Y. J. Dong, Integrated Sensing Platform Based on Quantum

Identification and comparative quantification of bio-active phthalides in essential oils from si-wu-tang, fo-shou-san, radix angelica and rhizoma chuanxiong.

Science.gov (United States)

Tang, Yuping; Zhu, Min; Yu, Sheng; Hua, Yongqing; Duan, Jin-Ao; Su, Shulan; Zhang, Xu; Lu, Yin; Ding, Anwei

2010-01-15

Phthalides are important bio-active constituents in Si-Wu-Tang and Fo-Shou-San, two commonly used Traditional Chinese Medicine (TCM) combined prescriptions mainly derived from Radix Angelica and Rhizoma Chuanxiong. In this paper, the contents of eight phthalides, including Z-ligustilide, E-ligustilide, Z-butylenephthalide, E-butylene-phthalide, 3-butylphthalide, neocnidilide and senkyunolide A were determined or estimated by gas chromatography-mass spectrometry (GC-MS). The results showed GC-MS was a simple, rapid, and high sensitive method for analyzing phthalides in Si-Wu-Tang, Fo-Shou-San, Radix Angelica and Rhizoma Chuanxiong, and the extractable contents of each phthalides including Z-ligustilide, E-ligustilide, Z-butylenephthalide, etc. varied after Radix Angelica, Rhizoma Chuanxiong were combined into a formulation, such as Si-Wu-Tang and Fo-Shou-San. Furthermore, inhibition activity of essential oils from Si-Wu-Tang, Fo-Shou-San, Radix Angelica and Rhizoma Chuanxiong on uterine contraction was tested in an in vitro assay, and the results showed that the activity of the essential oil is higher as the content of the phthalides increase, which demonstrated that phthalides are possibly main active components inhibiting mice uterine contraction in vitro. All of the results suggested that comparative analysis of chemical components and pharmacological activities of each herb and formula is possibly helpful to elucidate the active components in traditional Chinese medicine, and to reveal the compatibility mechanism of TCM formulae.

Biological Responses in Rats Exposed to Cigarette Smoke and Middle East Sand (Dust)

Science.gov (United States)

2012-01-01

Bergren DR. 2001. Chronic tobacco smoke exposure increases airway sensitivity to capsaicin in awake guinea pigs . J Appl Physiol 90:695–704. Bhalla DK...human health. Inhal Toxicol 21:1–31. Chu HW, Thaikoottathil J, Rino JG, Zhang G, Wu Q, Moss T, Refaeli Y, Bowler R, Wenzel SE, Chen Z, Zdunek J, Breed R

Berlinale tõstab kilbile "Teekonna Guatanamosse" / Grete Nootre

Index Scriptorium Estoniae

Nootre, Grete

2006-01-01

56. Berliini filmifestivali programmidest ja filmidest - Suurbritannia poliitiline mängufilm "Teekond Guatanamosse" ("The Road to Guatanamo") : režissöörid Michael Winterbottom, Mat Whitecross, Hiina mängufilm "Lubadus" ("Wu ji") : režissöör Chen Kaige, Suurbritannia - Saksamaa "V nagu vendette" ("V for Vendette") : režissöör James McTeigue

Anti-inflammatory Effects of Magnolia sieboldii Extract in ...

African Journals Online (AJOL)

Hao Li4 and Kang-Duk Choi1*. 1Genomic ... Methods: The whole plant of M. sieboldii was extracted with methanol at room temperature. The in vitro ... action of M. sieboldii in inflammation. Magnolia ..... Shih HC, Hwang TL, Chen HC, Kuo PC, Lee EJ, Lee. KH, Wu TS. ... Fu JY, Masferrer JL, Seibert K, Raz A, Needleman P.

Fulltext PDF

Indian Academy of Sciences (India)

[7] Mahdhi H, Ben Ayadi Z, Gauffier J L, Djessas K and Alaya S. 2015 Opt. Mater. ... [23] Wu D W, Yang M, Huang Z B, Yin G F, Liao X M, Kang Y. Q, Chen X F and ... [42] Lee P A, Said G, Davis R and Lim T H 1969 J. Phys. Chem. Solids 30 ...

Ultra high performance liquid chromatography coupled with electrospray ionization/quadrupole time-of-flight mass spectrometry for the rapid analysis of constituents in the traditional Chinese medicine formula Wu Ji Bai Feng Pill.

Science.gov (United States)

Duan, Shengnan; Qi, Wen; Zhang, Siwen; Huang, Kunkun; Yuan, Dan

2017-10-01

An ultra high performance liquid chromatography coupled with electrospray ionization quadrupole time-of-flight mass spectrometry method in both positive and negative ion modes was established in order to comprehensively investigate the major constituents in Wu Ji Bai Feng Pill. Briefly, a Waters ACQUITY UPLC HSS C 18 column was used to separate the aqueous extract of Wu Ji Bai Feng Pill. A total of 0.1% formic acid in acetonitrile and 0.1% aqueous formic acid v/v were used as the mobile phase. All analytes were determined using quadrupole time-of-flight mass spectrometry with electrospray ionization source in positive and negative ion modes. At length, a total of 173 components including flavones and their glycosides, monoterpene glycosides, triterpene saponins, phenethylalchohol glycosides, iridoid glycosides, phthalides, tanshinones, phenolic acids, sesquiterpenoids and cyclopeptides were identified or tentatively characterized in Wu Ji Bai Feng Pill in an analysis of 16.0 min based on the accurate mass and tandem mass spectrometry behaviors. The developed method is rapid and highly sensitive to characterize the chemical constituents of Wu Ji Bai Feng Pill, which could not only be used for chemical standardization and quality control of Wu Ji Bai Feng Pill, but also be helpful for further study in vivo metabolism of Wu Ji Bai Feng Pill. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Software-Lösungen in B2B-Verkaufsgesprächen wirkungsvoll einsetzen

OpenAIRE

Thoma, Axel Michael

2017-01-01

Dieser Beitrag befasst sich mit dem Einsatz von Software-Lösungen in B2B-Verkaufsgesprächen (auf Englisch: Digital Sales Enablement). Anhand aktueller Beispiele aus der Geschäftswelt wird erklärt, wie solche Lösungen helfen (1) die Produktivität zu steigern, (2) Kunden zu aktivieren und (3) Neugeschäft zu entwickeln. Ebenfalls werden die Konzeption und Umsetzung solcher Lösungen behandelt.

Time budgets of Snow Geese Chen caerulescens and Ross's Geese Chen rossii in mixed flocks: Implications of body size, ambient temperature and family associations

Science.gov (United States)

Jonsson, J.E.; Afton, A.D.

2009-01-01

Body size affects foraging and forage intake rates directly via energetic processes and indirectly through interactions with social status and social behaviour. Ambient temperature has a relatively greater effect on the energetics of smaller species, which also generally are more vulnerable to predator attacks than are larger species. We examined variability in an index of intake rates and an index of alertness in Lesser Snow Geese Chen caerulescens caerulescens and Ross's Geese Chen rossii wintering in southwest Louisiana. Specifically we examined variation in these response variables that could be attributed to species, age, family size and ambient temperature. We hypothesized that the smaller Ross's Geese would spend relatively more time feeding, exhibit relatively higher peck rates, spend more time alert or raise their heads up from feeding more frequently, and would respond to declining temperatures by increasing their proportion of time spent feeding. As predicted, we found that Ross's Geese spent more time feeding than did Snow Geese and had slightly higher peck rates than Snow Geese in one of two winters. Ross's Geese spent more time alert than did Snow Geese in one winter, but alert rates differed by family size, independent of species, in contrast to our prediction. In one winter, time spent foraging and walking was inversely related to average daily temperature, but both varied independently of species. Effects of age and family size on time budgets were generally independent of species and in accordance with previous studies. We conclude that body size is a key variable influencing time spent feeding in Ross's Geese, which may require a high time spent feeding at the expense of other activities. ?? 2008 The Authors.

Effects of electroacupuncture and electroacupuncture plus Tao Hong Si Wu Wan in treating primary dysmenorrhea.

Science.gov (United States)

Miao, Edwin Yong; Miao, Miranda Yi-mo; Kildea, Daniel George; Lao, Yi-Wen

2014-02-01

This study investigated the efficacies of electroacupuncture and electroacupuncture combined with Tao Hong Si Wu Wan in treating primary dysmenorrhea and compared the results with those obtained using conventional medical treatment. One treatment group, group 1, was administered Tao Hong Si Wu Wan (2625 mg) while the other, group 2, was administered a placebo (2625 mg) twice daily for 3 months. Electroacupuncture was used in both treatment groups: two sessions per menstrual cycle for three menstrual cycles. The reference group, group 3, was administered ibuprofen, 600 mg, twice daily, for five menstrual cycles. Uses of the herb, placebo and ibuprofen were blinded. A ridit analysis was used for testing and interpreting the effects of treatment. Pain intensity was determined using a qualitative grading method in a blinded manner. The ridit scores in groups 1 and 2 were significantly higher than those in reference group immediately after treatment and three months later. Twelve months after the treatment, group 1 had a higher ridit score than group 2. In comparison to the reference group, groups 1 and 2 achieved better menstrual pain relief both immediately and 3 months after treatment. In addition, group 1 had better long-term pain relief than group 2. Copyright © 2014. Published by Elsevier B.V.

[Academic thoughts on Practice of acupuncture and moxibustion written by CHEN Jingwen, the acupuncture master in the Republic of China].

Science.gov (United States)

Huang, Weiping; Li, Naiqi

2015-03-01

Through the collection of Practice of acupuncture and moxibustion written by CHEN Jingwen, the acupuncture master in the Republic of China, the academic characteristics on acupuncture and moxibusiton were analyzed. The literature comparison method was adopted to compare the works of LUO Zhaoju, ZENG Tianzhi and LI Wenxian, etc. at the same period. It was discovered that CHEN Jingwen was the medical master who systematicly brought up the theory of acupoint properties earlier in the modern times. Classifying drugs based on acupoints was his academic feature. Additionally, the compatibility therapy of Chinese medicine was introduced to explain the essential ideas on the acupoints combination. The treatment was determined on the basis of zangxiang theory and the reinforcing and reducing therapy of acupuncture was emphasized in the determination of treatment and prescription. CHEN Jingwen's theory of acupoint property had been stressed and spread among the medical scholars in the Republic of China and he had made the beneficial exploration for the development of modern acupuncture and moxibustion therapy.

(nanoclay and CaSiO3)-reinforced E-glass-reinforced epoxy

Indian Academy of Sciences (India)

For instance, Zhang et al. [6] have prepared 30 types of epoxy matrix reinforced with ... the resin in a high-speed metal blade rotation medium. The .... Tests were run for .... Figure 2. Mean effect plots showing the influence of load, nanoclay content and speed on ..... [8] Wang K, Chen L, Wu J, Toh M L, He C and Yee A F 2005.

Phylogeography of Sophora moorcroftiana Supports Wu's Hypothesis on the Origin of Tibetan Alpine Flora.

Science.gov (United States)

Cheng, Shanmei; Qiong, La; Lu, Fan; Yonezawa, Takahiro; Yin, Ganqiang; Song, Zhiping; Wang, Yuguo; Yang, Ji; Zhang, Wenju

2017-06-01

Wu hypothesized that the Tibetan flora originated mostly from the paleotropical Tertiary flora in the Hengduan Mountains by adapting to the cold and arid environments associated with the strong uplift of the Qinghai-Tibet Plateau (QTP). Here, we combine the phylogeographic history of Sophora moorcroftiana with that of Sophora davidii to explore the speciation of S. moorcroftiana to test this hypothesis. We collected 151 individuals from 17 populations and sequenced 2 chloroplast fragments and the internal transcribed spacer of rDNA. Five chlorotypes and 9 ribotypes were detected but no significant phylogeographic structure was revealed. The integrated results of phylogeographic studies of these 2 species clearly support the progenitor-derivative relationship between them. We infer that the western peripheral population of S. davidii migrated westwards from the Hengduan Mountains to the middle reaches of the Yarlung Zangbo River and differentiated from its ancestor in the process of adaptation to increasingly cold and arid environments with the uplift of the QTP and finally evolved into S. moorcroftiana during the Late Pliocene. In addition, our findings shed light on the idea that natural selection, as imposed by climate differentiation (especially mean diurnal range and precipitation seasonality), directly drove this peripatric speciation event after geographic isolation. The speciation of S. moorcroftiana is a strong case supporting Wu's hypothesis about the origin of Tibet's flora. © The American Genetic Association 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Review of the East Palaearctic and North Oriental Psyttalia Walker, with the description of three new species (Hymenoptera, Braconidae, Opiinae).

Science.gov (United States)

Wu, Qiong; van Achterberg, Cornelis; Tan, Jiang-Li; Chen, Xue-Xin

2016-01-01

The East Palaearctic and North Oriental species of the genus Psyttalia Walker (Hymenoptera, Braconidae, Opiinae) are reviewed. Three new species are described and illustrated: Psyttalia latinervis Wu & van Achterberg, sp. n . and Psyttalia majocellata Wu & van Achterberg, sp. n . from China, and Psyttalia spectabilis van Achterberg, sp. n. from Japan. Coeloreuteus formosanus Watanabe, 1934, Opius (Lissosema) proclivis Papp, 1981, Opius (Psyttalia) subcyclogaster Tobias, 1998, Opius (Psyttalia) darasunicus Tobias, 1998, Opius (Psyttalia) cyclogastroides Tobias, 1998, Psyttalia extensa Weng & Chen, 2001, and Rhogadopsis longicaudifera Li & van Achterberg, 2013, are new synonyms of Psyttalia cyclogaster (Thomson, 1895); Opius (Psyttalia) ophthalmicus Tobias, 1977, and Opius (Psyttalia) brevitemporalis Tobias, 1998, of Psyttalia carinata (Thomson, 1895) and both Opius (Psyttalia) vacuus Tobias, 1998, and Opius (Lissosema) longurius Chen & Weng, 1995, of Rhogadopsis mediocarinata (Fischer, 1963). Phaedrotoma daghestanicum (Telenga, 1950), Rhogadopsis mediocarinata (Fischer, 1963) and Rhogadopsis mystica (Fischer, 1963) are new combinations. New records are Psyttalia carinata (Thomson, 1895) from The Netherlands and Norway, and Psyttalia cyclogaster (Thomson, 1895) from Japan. A lectotype is designated for Psyttalia carinata (Thomson, 1895) and Psyttalia cyclogaster (Thomson, 1895). A key to the East Palaearctic and North Oriental species of the genus Psyttalia Walker is included.

Review of the East Palaearctic and North Oriental Psyttalia Walker, with the description of three new species (Hymenoptera, Braconidae, Opiinae

Directory of Open Access Journals (Sweden)

Qiong Wu

2016-11-01

Full Text Available The East Palaearctic and North Oriental species of the genus Psyttalia Walker (Hymenoptera, Braconidae, Opiinae are reviewed. Three new species are described and illustrated: P. latinervis Wu & van Achterberg, sp. n. and P. majocellata Wu & van Achterberg, sp. n. from China, and P. spectabilis van Achterberg, sp. n. from Japan. Coeloreuteus formosanus Watanabe, 1934, Opius (Lissosema proclivis Papp, 1981, O. (Psyttalia subcyclogaster Tobias, 1998, O. (P. darasunicus Tobias, 1998, O. (P. cyclogastroides Tobias, 1998, Psyttalia extensa Weng & Chen, 2001, and Rhogadopsis longicaudifera Li & van Achterberg, 2013, are new synonyms of Psyttalia cyclogaster (Thomson, 1895; Opius (Psyttalia ophthalmicus Tobias, 1977, and O. (P. brevitemporalis Tobias, 1998, of Psyttalia carinata (Thomson, 1895 and both O. (P. vacuus Tobias, 1998, and O. (Lissosema longurius Chen & Weng, 1995, of Rhogadopsis mediocarinata (Fischer, 1963. Phaedrotoma daghestanicum (Telenga, 1950, Rhogadopsis mediocarinata (Fischer, 1963 and R. mystica (Fischer, 1963 are new combinations. New records are Psyttalia carinata (Thomson, 1895 from The Netherlands and Norway, and P. cyclogaster (Thomson, 1895 from Japan. A lectotype is designated for Psyttalia carinata (Thomson, 1895 and P. cyclogaster (Thomson, 1895. A key to the East Palaearctic and North Oriental species of the genus Psyttalia Walker is included.

31 july 2014 - H. WU Ambassador Permanent Representative of the People's Republic of China to the United Nations

CERN Multimedia

Egli, Laurent

2014-01-01

His Excellency Mr Hailong WU Ambassador Permanent Representative of the People's Republic of China to the United Nations Office at Geneva and other international organizations in Switzerland visiting the ATLAS cavern with ATLAS Spokesperson D. Charlton and the LHC tunnel at Point 1 with Technology Department, Vacuum, Surfaces and Coatings Group P. Cruikshank.

Overexpression of the NADP+-specific isocitrate dehydrogenase gene (icdA) in citric acid-producing Aspergillus niger WU-2223L.

Science.gov (United States)

Kobayashi, Keiichi; Hattori, Takasumi; Hayashi, Rie; Kirimura, Kohtaro

2014-01-01

In the tricarboxylic acid (TCA) cycle, NADP(+)-specific isocitrate dehydrogenase (NADP(+)-ICDH) catalyzes oxidative decarboxylation of isocitric acid to form α-ketoglutaric acid with NADP(+) as a cofactor. We constructed an NADP(+)-ICDH gene (icdA)-overexpressing strain (OPI-1) using Aspergillus niger WU-2223L as a host and examined the effects of increase in NADP(+)-ICDH activity on citric acid production. Under citric acid-producing conditions with glucose as the carbon source, the amounts of citric acid produced and glucose consumed by OPI-1 for the 12-d cultivation period decreased by 18.7 and 10.5%, respectively, compared with those by WU-2223L. These results indicate that the amount of citric acid produced by A. niger can be altered with the NADP(+)-ICDH activity. Therefore, NADP(+)-ICDH is an important regulator of citric acid production in the TCA cycle of A. niger. Thus, we propose that the icdA gene is a potentially valuable tool for modulating citric acid production by metabolic engineering.

Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing

OpenAIRE

Richard K. Payne

2016-01-01

Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between ...

A Response to Professor Wu Zongjie's "Interpretation, Autonomy, and Transformation: Chinese Pedagogic Discourse in a Cross-Cultural Perspective"

Science.gov (United States)

Curran, Thomas D.

2014-01-01

In response to an essay by Prof Wu Zongjie that was published in the "Journal of Curriculum Studies" [43(5), (2011), 569-590], I argue that, despite dramatic changes that have taken place in the language of Chinese academic discourse and pedagogy, evidence derived from the fields of psychology and the history of Chinese educational…

[A Study on the quotations in the Wu xing da yi (The Gist of Five Phases) cited from Nei jing (Inner Canon)].

Science.gov (United States)

Wang, Zheng-Shan; Zhang, Qi-Cheng

2013-07-01

In the Wu xing da yi (The Gist of Five Phases), written by Xiao Ji of the Sui Dynasty, there were 9 quotations cited from Huang di nei jing (Inner Canon of Huangdi). By comparison with current version of Huang di nei jing, most of the descriptions are similar, yet still with some differences, such as yin-yang nature of the five zang visceras, the liver being the root of "pi ji", the spleen being the root of "cang lin" etc. Wu xing da yi epitomizes the books about yin-yang and five phases before the Sui Dynasty, while Xiao Ji's quotations from Huang di nei jing interpreted from the views of yin-yang and five phases, are different from the annotations of later ages.

I Know You Are, But What Am I? : Anti-Individualism in the Development of Intellectual Humility and Wu-Wei

NARCIS (Netherlands)

Robinson, Brian; Alfano, M.R.

2016-01-01

Virtues are acquirable, so if intellectual humility is a virtue, it’s acquirable. But there is something deeply problematic—perhaps even paradoxical—about aiming to be intellectually humble. Drawing on Edward Slingerland’s analysis of the paradoxical virtue of wu-wei in Trying Not To Try, we argue

Lanthanide metal-organic frameworks

International Nuclear Information System (INIS)

Cheng, Peng

2015-01-01

This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).

Lanthanide metal-organic frameworks

Energy Technology Data Exchange (ETDEWEB)

Cheng, Peng (ed.) [Nankai Univ., Tianjin (China). Dept. of Chemistry

2015-03-01

This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).

Le jeu de la création : Le mangeur (2005 de Ying Chen

Directory of Open Access Journals (Sweden)

Nicole Dunham

2013-11-01

Full Text Available Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005 de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants : le ventre du père, les tableaux peints par ce dernier et l’espace-temps de A., et la fenêtre. Ces éléments deviennent des aires de jeu, remettant en question les concepts de l’intérieur et de l’extérieur et du créateur et de l’œuvre. En nous servant du texte « Le Tunnel » écrit par Ying Chen, nous démontrerons que cette notion du jeu s’applique également à l’ensemble de son œuvre.

Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation

International Nuclear Information System (INIS)

Tam, L.M.; Chen, J.H.; Chen, H.K.; Wai Meng Si Tou

2008-01-01

A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, ε, and ω. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study

Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation

Energy Technology Data Exchange (ETDEWEB)

Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Chen, J.H. [Department of Mechanical Engineering, Chung Hua University, Hsinchu, Taiwan (China); Chen, H.K. [Department of Mechanical Engineering, Hsiuping Institute of Technology, Taichung, Taiwan (China); Wai Meng Si Tou [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)

2008-11-15

A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, {epsilon}, and {omega}. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study.

Enzymatic characterization and gene identification of aconitate isomerase, an enzyme involved in assimilation of trans-aconitic acid, from Pseudomonas sp. WU-0701.

Science.gov (United States)

Yuhara, Kahori; Yonehara, Hiromi; Hattori, Takasumi; Kobayashi, Keiichi; Kirimura, Kohtaro

2015-11-01

trans-Aconitic acid is an unsaturated organic acid that is present in some plants such as soybean and wheat; however, it remains unclear how trans-aconitic acid is degraded and/or assimilated by living cells in nature. From soil, we isolated Pseudomonas sp. WU-0701 assimilating trans-aconitic acid as a sole carbon source. In the cell-free extract of Pseudomonas sp. WU-0701, aconitate isomerase (AI; EC 5.3.3.7) activity was detected. Therefore, it seems likely that strain Pseudomonas sp. WU-0701 converts trans-aconitic acid to cis-aconitic acid with AI, and assimilates this via the tricarboxylic acid cycle. For the characterization of AI from Pseudomonas sp. WU-0701, we performed purification, determination of enzymatic properties and gene identification of AI. The molecular mass of AI purified from cell-free extract was estimated to be ~ 25 kDa by both SDS/PAGE and gel filtration analyses, indicating that AI is a monomeric enzyme. The optimal pH and temperature of purified AI for the reaction were 6.0 °C and 37 °C, respectively. The gene ais encoding AI was cloned on the basis of the N-terminal amino acid sequence of the protein, and Southern blot analysis revealed that only one copy of ais is located on the bacterial genome. The gene ais contains an ORF of 786 bp, encoding a polypeptide of 262 amino acids, including the N-terminal 22 amino acids as a putative periplasm-targeting signal peptide. It is noteworthy that the amino acid sequence of AI shows 90% and 74% identity with molybdenum ABC transporter substrate-binding proteins of Pseudomonas psychrotolerans and Xanthomonas albilineans, respectively. This is the first report on purification to homogeneity, characterization and gene identification of AI. The nucleotide sequence of ais described in this article is available in the DDBJ/EMBL/GenBank nucleotide sequence databases under the Accession No. LC010980. © 2015 FEBS.

76 FR 71048 - Sixth Annual Philip S. Chen, Jr. Distinguished Lecture on Innovation and Technology Transfer

Science.gov (United States)

2011-11-16

... present ``Treatment of Cancer with Recombinant Immunotoxins: From Technology Transfer to the Patient.'' Dr. Pastan is an NIH Distinguished Investigator and Chief, Laboratory of Molecular Biology, National Cancer Institute Center for Cancer Research. This annual series honors Dr. Philip S. Chen, Jr. for his almost 50...

[Professor WU Zhongchao's experience in the treatment of bi syndrome with fire needling therapy at lower he-sea points].

Science.gov (United States)

Zhou, Yu; Chen, Zhongjie; Liu, Chun; Wang, Bing; Zhang, Ning; Li, Caifen; Xie, Qian

2016-07-12

Bi syndrome is classified into five categories. Based on the syndrome differentiation of meridians and collaterals and zangfu theories, Professor WU Zhongchao proposed the fire needling therapy at the lower he -sea points for five types of bi syndromes. Professor WU stresses on the flexible application of fire needling therapy for bi syndrome at the lower he -sea points and innovated the unique five techniques of fire needling therapy, named lifting and threating needle of small amplitude at the lower he -sea points, the stimulation along the relevant meri-dians before fire needling, detecting the sensitive sites by gentle pressing the relevant lower he -sea points, combining the movement of affected upper limb or joint during fire needling, or combining with contralateral needling technique, and controlling the depth of fire needling based on the duration of sickness and depth of affected site. He pointed out that Shangjuxu (ST 37) is for skin bi syndrome, Zusanli (ST 36) for muscle bi syndrome, Yanglingquan (GB 34) for tendon bi syndrome, Weizhong (BL 40) for bone bi syndrome and Xiajuxu (ST 39) for vessel bi syndrome.

Magnetic resonance in superparamagnetic zinc ferrite

Indian Academy of Sciences (India)

in magnetization for smaller sized systems (Roy et al 2006;. Xue et al 2007; Singh et ... state (Chinnasamy et al 2000; Lee et al 2002; Shim et al. ∗. Author for .... Singh J P, Dixit G, Srivastava R C, Agrawal H M, Reddy V R and. Gupta A 2012 J. ... Wu K H, Chang Y C, Chen H B, Yang C C and Horng D N 2004. J. Magn. Magn.

Temporal Courses in EEG Theta and Alpha Activity in the Dynamic Health Qigong Techniques Wu Qin Xi and Liu Zi Jue

Directory of Open Access Journals (Sweden)

Diana Henz

2018-01-01

Full Text Available Health Qigong is a common technique of Traditional Chinese Medicine applied to strengthen mental and physical health. Several studies report increases in EEG theta and alpha activity after meditative Qigong techniques indicating a relaxed state of mind. To date, little is known on the effects of dynamic Health Qigong techniques that comprise bodily movements on brain activity. In the current study, we compared effects of two dynamic Health Qigong techniques on EEG brain activity. Subjects performed the techniques Wu Qin Xi (five animals play and Liu Zi Jue (six healing sounds in a within-subjects design. Eyes-open and eyes-closed resting EEG was recorded before and immediately after each 15-min practice block. Additionally, the Profile of Mood States (POMS questionnaire was administered at pretest, and after each 15-min practice block. Results show a decrease in alpha activity after 15 min, followed by an increase after 30 min in the Health Qigong technique Liu Zi Jue. Theta activity was decreased after 15 min, followed by an increase after 30 min in the technique Wu Qin Xi. Results of the POMS indicated an increased vigor-activity level with decreased fatigue and tension-anxiety levels in both techniques after 30 min of practice. Our results demonstrate different temporal dynamics in EEG theta and alpha activity for the Health Qigong techniques Wu Qin Xi and Liu Zi Jue. We hypothesize that the found brain activation patterns result from different attentional focusing styles and breathing techniques performed during the investigated Health Qigong techniques.

Dark energy fingerprints in the nonminimal Wu-Yang wormhole structure

Science.gov (United States)

Balakin, Alexander B.; Zayats, Alexei E.

2014-08-01

We discuss new exact solutions to nonminimally extended Einstein-Yang-Mills equations describing spherically symmetric static wormholes supported by the gauge field of the Wu-Yang type in a dark energy environment. We focus on the analysis of three types of exact solutions to the gravitational field equations. Solutions of the first type relate to the model, in which the dark energy is anisotropic; i.e., the radial and tangential pressures do not coincide. Solutions of the second type correspond to the isotropic pressure tensor; in particular, we discuss the exact solution, for which the dark energy is characterized by the equation of state for a string gas. Solutions of the third type describe the dark energy model with constant pressure and energy density. For the solutions of the third type, we consider in detail the problem of horizons and find constraints for the parameters of nonminimal coupling and for the constitutive parameters of the dark energy equation of state, which guarantee that the nonminimal wormholes are traversable.

Traditional uses, botany, phytochemistry, pharmacology and toxicology of Panax notoginseng (Burk.) F.H. Chen: A review.

Science.gov (United States)

Wang, Ting; Guo, Rixin; Zhou, Guohong; Zhou, Xidan; Kou, Zhenzhen; Sui, Feng; Li, Chun; Tang, Liying; Wang, Zhuju

2016-07-21

Panax notoginseng (Burk.) F.H. Chen is a widely used traditional Chinese medicine known as Sanqi or Tianqi in China. This plant, which is distributed primarily in the southwest of China, has wide-ranging pharmacological effects and can be used to treat cardiovascular diseases, pain, inflammation and trauma as well as internal and external bleeding due to injury. This paper provides up-to-date information on investigations of this plant, including its botany, ethnopharmacology, phytochemistry, pharmacology and toxicology. The possible uses and perspectives for future investigation of this plant are also discussed. The relevant information on Panax notoginseng (Burk.) F.H. Chen was collected from numerous resources, including classic books about Chinese herbal medicine, and scientific databases, including Pubmed, SciFinder, ACS, Ebsco, Elsevier, Taylor, Wiley and CNKI. More than 200 chemical compounds have been isolated from Panax notoginseng (Burk.) F.H. Chen, including saponins, flavonoids and cyclopeptides. The plant has pharmacological effects on the cardiovascular system, immune system as well as anti-inflammatory, anti-atherosclerotic, haemostatic and anti-tumour activities, etc. Panax notoginseng is a valuable traditional Chinese medical herb with multiple pharmacological effects. This review summarizes the botany, ethnopharmacology, phytochemistry, pharmacology and toxicology of P. notoginseng, and presents the constituents and their corresponding chemical structures found in P. notoginseng comprehensively for the first time. Future research into its phytochemistry of bio-active components should be performed by using bioactivity-guided isolation strategies. Further work on elucidation of the structure-function relationship among saponins, understanding of multi-target network pharmacology of P. notoginseng, as well as developing its new clinical usage and comprehensive utilize will enhance the therapeutic potentials of P. notoginseng. Copyright © 2016

Information Philosophy in China: Professor Wu Kun’s 30 Years of Academic Thinking in Information Philosophy

Directory of Open Access Journals (Sweden)

Guowu Li

2011-10-01

Full Text Available Professor Wu Kun, from Xi'an Jiaotong University of China, has been studying information philosophy for 30 years. He thinks information conception is one of the most fundamental areas in philosophy and has founded information philosophy. He has done original and pioneering research in information ontology, epistemology, social information theory, information production theory, information evolution theory, information value, and information thinking directions. He is the first scholar to develop a completely new view of theories, systems, and methods about information philosophy.

Security problems for a pseudorandom sequence generator based on the Chen chaotic system

Science.gov (United States)

Özkaynak, Fatih; Yavuz, Sırma

2013-09-01

Recently, a novel pseudorandom number generator scheme based on the Chen chaotic system was proposed. In this study, we analyze the security weaknesses of the proposed generator. By applying a brute force attack on a reduced key space, we show that 66% of the generated pseudorandom number sequences can be revealed. Executable C# code is given for the proposed attack. The computational complexity of this attack is O(n), where n is the sequence length. Both mathematical proofs and experimental results are presented to support the proposed attack.

A new species of Nemoura (Plecoptera: Nemouridae) from Jiangsu Province, China, with new illustrations for Nemoura nankinensis Wu.

Science.gov (United States)

Chen, Zhi-Teng; DU, Yu-Zhou

2017-04-12

A new species of Nemoura (Plecoptera: Nemouridae), N. fusiformis sp. nov. from Jiangsu Province, China, is described and illustrated. The new species is characterized by a strongly sclerotized large hook formed by outer margin of the outer lobe of the paraproct and by the outer sclerite of cercus with a sub-triangular medial process. The new species is compared with similar taxa. Additionally, supplementary illustrations for N. nankinensis Wu, 1926 are also provided.

Dark energy from cosmological fluids obeying a Shan-Chen non-ideal equation of state

OpenAIRE

Bini, Donato; Geralico, Andrea; Gregoris, Daniele; Succi, Sauro

2014-01-01

We consider a Friedmann-Robertson-Walker universe with a fluid source obeying a nonideal equation of state with ‘‘asymptotic freedom,’’ namely ideal gas behavior (pressure changes directly proportional to density changes) both at low and high density regimes, following a fluid dynamical model due to Shan and Chen. It is shown that, starting from an ordinary energy density component, such fluids naturally evolve towards a universe with a substantial ‘‘dark energy’’ component at the present tim...

Prof. Wu Xiaoqiu:China Is Striving for the World's Most Developed Capital Market

Institute of Scientific and Technical Information of China (English)

Sun Yongjian; Zhang Yue

2007-01-01

@@ China's capital market is a hot issue in the new year. The best strategy to develop the Chinese capital market in the coming 15 to 20 years was discussed in the China Capital Market Forum, which was held in China at Renmin University on January 13. Government officials, scholars, and entrepreneurs commented that by 2020, the Chinese capital market will develop into one of the best capital markets in the world,not only in terms of size, but also asset quality, liquidity and dynamic trade. Is this a realistic goal? What steps should we take to pursue this target? With these questions in mind, after the forum, China's Foreign Trade interviewed Prof. Wu Xiaoqiu, Vice President of Renmin University of China,and the Director of the Finance & Securities Institute of Renmin University.

Activation energy and R. Chen frequency factor in the Randall and Wilkins original equation for second order kinetics. Emission curve simulated in Microsoft Excel algebra

International Nuclear Information System (INIS)

Moreno M, A.; Moreno B, A.

2000-01-01

In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)

Tentative characterization of precursor compounds and co-factors of pigment formation in production of 'wu mi' from Vaccinium bracteatum Thunb. Leaves.

Science.gov (United States)

Fan, Mingcong; Fan, Yihui; Huang, Weiping; Wang, Li; Li, Yan; Qian, Haifeng; Zhang, Hui; Qi, Xiguang

2018-10-01

Vaccinium bracteatum leaves (VBTL) are traditionally used in China to dye rice grains, which assume a deep blue color, named 'Wu mi'. Information on the mechanism of pigment formation is limited. In this study, CIELAB color space parameters were used to represent the color of 'Wu mi'. Precursor compounds of pigments formed during the dyeing process were identified by UPLC Q-TOF MS analysis. The changes in co-factors for pigment formation in VBTL were measured at different growth stages. The L ∗ and b ∗ values of dyed rice increased as the leaves aged, whereas a ∗ values showed irregular changes. Six compounds were tentatively identified as pigment precursors by UPLC Q-TOF MS analysis. The pH and β-glucosidase activity at different growth stages of VBTL were indicated to be crucial co-factors for pigment formation. A tentative hypothesis is presented that iridoid glycosides are hydrolyzed by acids and β-glucosidases to form a dialdehyde structure that binds covalently with amino residues of lysine side chains in rice protein molecules. Copyright © 2018 Elsevier Ltd. All rights reserved.

Purification and in vitro antioxidant activities of tellurium-containing phycobiliproteins from tellurium-enriched Spirulina platensis

OpenAIRE

Chen, Tianfeng; Yang,Fang; Wong,Ka-Hing; Yang,Yufeng; Li,Xiaoling; Jiang,Jie; Wu,Hualian; Zheng,Wenjie

2014-01-01

Fang Yang,1 Ka-Hing Wong,2 Yufeng Yang,3 Xiaoling Li,1 Jie Jiang,1 Wenjie Zheng,1 Hualian Wu,1 Tianfeng Chen1 1Department of Chemistry, Jinan University, Guangzhou, People’s Republic of China; 2Department of Applied Biology and Chemical Technology, The Hong Kong Polytechnic University, Hong Kong, People’s Republic of China; 3Institute of Hydrobiology, College of Life Science and Technology, Jinan University, Guangzhou, People’s Republic of China Abstract: Tellu...

Hydrothermal synthesis of porous Co(OH)2 nanoflake array film and ...

Indian Academy of Sciences (India)

sented discharge current and M (mg), V (V) and t (s) designate mass of ..... Chang Z R, Li H J, Tang H W, Yuan X Z and Wang H J 2009 Int. J. Hydrogen. Energy ... Interfaces 3 99. Kong L B, Liu M C, Lang J W, Liu M, Luo Y C and Kang L 2011 ... Yuan Y F, Xia X H, Wu J B, Yang J L, Chen Y B and Guo S Y 2011. Electrochim.

Activation energy and R. Chen frequency factor in the Randall and Wilkins original equation for second order kinetics. Emission curve simulated in Microsoft Excel algebra; Energia de activacion y factor de frecuencia de R. Chen en la ecuacion original de Randall y Wilkins para cinetica de segundo orden. Curva de emision simulada en algebra de Microsoft Excel

Energy Technology Data Exchange (ETDEWEB)

Moreno M, A. [Departamento de Apoyo en Ciencias Aplicadas, Benemerita Universidad Autonoma de Puebla, 4 Sur 104, Centro Historico, 72000 Puebla (Mexico); Moreno B, A

2000-07-01

In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)

Chen-Nester-Tung quasi-local energy and Wang-Yau quasi-local mass

Science.gov (United States)

Liu, Jian-Liang; Yu, Chengjie

2017-10-01

In this paper, we show that the Chen-Nester-Tung (CNT) quasi-local energy with 4D isometric matching references is closely related to the Wang-Yau (WY) quasi-local energy. As a particular example, we compute the second variation of the CNT quasi-local energy for axially symmetric Kerr-like spacetimes with axially symmetric embeddings at the obvious critical point (0 , 0) and find that it is a saddle critical point in most of the cases. Also, as a byproduct, we generalize a previous result about the coincidence of the CNT quasi-local energy and Brown-York mass for axially symmetric Kerr-like spacetimes by Tam and the first author Liu and Tam (2016) to general spacetimes.

His Excellency Mr Ken WU Ambassador Extraordinary and Plenipotentiary of the People’s Republic of China to Switzerland

CERN Multimedia

Jean Claude Gadmer

2011-01-01

Photo 1-5:The delegation visiting the ATLAS visitor Center with P.Jenni, ATLAS Collaboration former Spokesperson Photo 6-14,15-20:visiting the ATLAS experimental area Photo 15:Y. YANG,Attaché-Q. WAN,First Secretary-Z. Ren,ATLAS Collaboration,High Energy Group,Shandong University-H.E. Mr K. Wu-P. Jenni-R. Voss,Adviser for the People’s Republic of China-H. FENG,Counsellor Photo 21-38:Signature of the Guest Book with CERN Director-General R. Heuer

Modern process study on Chen Co and Ranwu Lake of Tibetan Plateau

Science.gov (United States)

Ju, J.

2013-12-01

Lakes are important junctions of geospheres. There are many lakes distributed on the Tibetan Plateau (TP). Lake sediment is one of the important media for retrieving the past environmental changes. Because of the uniqueness of environment of the TP, sediment, water and ecological system in lakes has local characteristic inevitably. Modern process research on different lakes will benefit interpreting the proxies more accurately. The development of observation station makes the observation and sampling more convenient. Modern process of lakes can be fulfilled in two ways, spatial or seasonal variation study, with a same aim finding out the dominant factors controlling the variations. Chen Co is a closed lake locating at inland area of southern Tibet. Ranwu Lake is an open lake locating at outflow area of SE Tibet. In this study, I studied the spatial and (or) seasonal variation of lake water and sediment in the two distinct types of lakes to make clear the mechanism of modern process. Particular attention was given to the pattern and degree of influence of rivers supplied by glaciers on lakes. Preliminary conclusions are outlined as follow: (1) In the lakes with glacier melt supplying rivers, the patterns of supply of the rivers to the lake are different. In close lake Chen Co, the influence of glacier melt is mainly reflected in the south lake area. In the open lake Ranwu Lake, the influence is comprehensive and direct. This difference influencing patterns how the lake sediments reflected the glacier melt under the past environmental changes. (2) The supply of Kaluxiong Qu River, supplied mainly by glacier melt, to Chen co has North-South difference: more directly to south lake area, reflecting by lower value of conductivity and pH, finer grain size and west to east transporting trend, greater deposition rate, more allogenic fine sediments, not obvious biological and endogenic deposition there. This enlightens the site selection for lake cores and interpretation of

Fighting words: Four new document finds reignite old debates in Taijiquan historiography

OpenAIRE

Wile, Douglas

2017-01-01

Martial arts historiography has been at the center of China’s culture wars and a cause célèbre between traditionalists and modernizers for the better part of a century. Nowhere are the stakes higher than with the iconic art of taijiquan, where, based on a handful of documents in the Chen, Wu, and Yang lineages, traditionalists have mythologized the origins of taijiquan, claiming the Daoist immortal Zhang Sanfeng as progenitor, while modernizers won official government approval by tracing th...

A novel therapeutic strategy for cartilage diseases based on lipid nanoparticle-RNAi delivery system

OpenAIRE

Wang, Shaowei; Wei, Xiaochun; Sun, Xiaojuan; Chen, Chongwei; Zhou, Jingming; Zhang, Ge; Wu, Heng; Guo, Baosheng; Wei, Lei

2018-01-01

Shaowei Wang,1 Xiaochun Wei,1 Xiaojuan Sun,1 Chongwei Chen,1 Jingming Zhou,2 Ge Zhang,3 Heng Wu,3 Baosheng Guo,3 Lei Wei1,2 1Department of Orthopaedics, The 2nd Hospital of Shanxi Medical University, Taiyuan, Shanxi, China; 2Department of Orthopaedics, Rhode Island Hospital, The Warren Alpert Medical School of Brown University, Providence, RI, USA; 3Integrated Traditional Chinese and Western Medicine, School of Chinese Medicine, Hong Kong Baptist University, Hong Kong Background: C...

A novel imidazopyridine derivative, X22, attenuates sepsis-induced lung and liver injury by inhibiting the inflammatory response in vitro and in vivo

OpenAIRE

Ge, Xiangting; Feng, Zhiguo; Xu, Tingting; Wu, Beibei; Chen, Hongjin; Xu, Fengli; Fu, Lili; Shan, Xiaoou; Dai, Yuanrong; Zhang, Yali; Liang, Guang

2016-01-01

Xiangting Ge,1,2,* Zhiguo Feng,1,* Tingting Xu,2 Beibei Wu,3 Hongjin Chen,1 Fengli Xu,3 Lili Fu,1 Xiaoou Shan,3 Yuanrong Dai,2 Yali Zhang,1 Guang Liang11Chemical Biology Research Center, School of Pharmaceutical Sciences, 2Department of Pulmonary Medicine, The 2nd Affiliated Hospital, 3Department of Pediatrics, The 2nd Affiliated Hospital, Wenzhou Medical University, Wenzhou, People’s Republic of China*These authors contributed equally to this workAbstract: Sepsis remains a leading ...

[Textual research on Chen Ye and his Jia cang jing yan fang (Family-preserved Empirical Recipes) of the Song Dynasty].

Science.gov (United States)

Zhang, Xuedan; Zhang, Ruqing; Chen, Dexing

2014-01-01

Chen Ye, an official of the Southern Song Dynasty, also known as Chen Rihua as his styled name, was born in Changle, Fuzhou in the reign of Shaoxing, and died during the reign of Duanping. He had been consecutively in the positions of Jiang shi lang (Court Gentleman for Ceremonial Service), Zhi zhou (Prefect) of Lingding, the Ti xing (Judicial Commissioner) of Guangdong, the Zong ling (Overseer-general) of Sichuan, Shan ding (Reviser), Shu lin and other positions in Tongzhou, Yuanzhou. His works included 1 volume of Gu ling xian sheng nian pu (Mr. Guling's Chronological Biography), 1 volume of Tan xie (On Humor), 1 volume of Shi hua (Poetry), 8 volumes of Jin yuan li shu (Jin Yuan's Smart Technique), 3 volumes of Yi jian zhi lei bian (Classified Compilation of Yijian's Annals), (Zeng guang) Suo sui lu (Augmented Records of Trivial Matters), 5 volumes of Jia cang jing yan fang (Family-preserved Empirical Recipes). He also compiled the 8-volume Yin jiang zhi (Yinjiang's Annals), published the 2-volume Jia cang ji yao fang (Collected Essential Recipes from Family Preservation), and other proses and poetry. Jia cang jing yan fang was a formulary compiled by Chen Ye, which was lost. Altogether 74 of its recipes were cited in Fu ren da quan liang fang (Complete Effective Prescriptions for Women's Diseases), Shou qin yang lao shu (A Book for Pursuing Seniors' Longevity and Healthcare), Pu ji fang (Prescriptions for Universal Relief) and Yong le da dian (Yongle Encyclopedia).

Wu Shangshi: One of the outstanding founders of Chinese modern geography%吴尚时对中国近代地理学的贡献与学术思想探讨

Institute of Scientific and Technical Information of China (English)

陈吉余; 吴超羽; 司徒尚纪

2017-01-01

Wu Shangshi (1904-1947) is considered one of the outstanding modem geographers emerging in the early 20th century in China.It is partly a result of the introduction of modem sciences from the West.Wu graduated as a gold medalist in Sun Yat-sen University (SYU) in 1928.He was then granted scholarship to study geography in France.He studied at the University of Lyon and the University of Grenoble under the supervision of A.Allix,M.Pardé and R.Blanchard,who was one of the best known students of V.de la Blanche.In 1934,Wu finished his study in France and returned to SYU to serve as a professor of geography.He was head of the department in 1939-1945,the most difficult and perilous period during the Japanese invasion.The university moved constantly to flee the flames of war.The thousands of miles across south and south-west China became Wu's research field.To continue one's work under such circumstances required an extraordinary determination and dedication to science.Excessive hard work in tough environments ruined his health.Wu died in 1947 at the age of 43.Among the second generation of Chinese modem geographers,Wu was a rare example of an integrated geographer.He combined comprehensive and complex geographic thought with a balanced approach between holistic perspective and detailed research.In addition,he possessed an outstanding ability to conduct field work.As such,many of his research findings have withstood the test of time and remain relevant to this day.For instance,Wu proposed "one belt and three arcs" to summarize the distribution of the mountain ranges in China.On the long debates of the stratigraphic sequence of the red bed formations "Danxia" and "Nanxiong",Wu suggested an alternative viewpoint that the two formations could be deposited at approximately the same time but in different faces and it has been confirmed by modem geologic investigation some 50 years later.Both contributions were listed on the "Great Geographical Discoveries of China in 100

Le jeu de la création : Le mangeur (2005) de Ying Chen

OpenAIRE

Nicole Dunham

2013-01-01

Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005) de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants...

Reversal of multidrug resistance by magnetic Fe3O4 nanoparticle copolymerizating daunorubicin and 5-bromotetrandrine in xenograft nude-mice

OpenAIRE

Chen, Baoan

2009-01-01

Baoan Chen1,* Jian Cheng1,* Yanan Wu1, Feng Gao1, Wenlin Xu2, et al 1Department of Hematology;2Department of Hematology, The Affiliated People’s Hospital, Jiangsu University, Zhenjiang, PR China *These authors have contributed equally to this workAbstract: In this paper we establish the xenograft leukemia model with stable multidrug resistance in nude mice and to investigate the reversal effect of 5-bromotetrandrine (5-BrTet) and magnetic nanoparticle of Fe3O4 (MNP-Fe3O4) c...

A new species of Neoperla (Plecoptera: Perlidae) from Zhejiang Province of China.

Science.gov (United States)

Chen, Zhi-Teng

2016-03-24

The stonefly genus Neoperla Needham (1905) is primarily distributed in eastern North America, Tropical and Temperate Asia and central Africa, with at least 297 species known (Illies 1966, Zwick 1973, Stark & Gaufin 1976, DeWalt et al. 2016). Contributions to Chinese species of Neoperla were made by Chu (1929), Wu & Claassen (1934), Wu (1935, 1938, 1948, 1962, 1973), Yang & Yang (1992, 1995, 1998), Du (1999, 2000a, 2000b), Du et al. (1999, 2001), Du & Sivec (2004, 2005), Du & Wang (2005, 2007), Sivec & Zwick (1987), Li & Wang (2011), Li et al. (2011a, 2011b, 2012a, 2012b, 2013a, 2013b, 2014a, 2014b), Qin et al. (2013), Wang et al. (2013a, 2013b), Li & Zhang (2014), Kong et al. (2014), Wang et al. (2014), Chen & Du (2015). Herein, a new species of this genus is described from Taizhou, Zhejiang Province, of eastern coastal China.

Wu-Chia-Pi Solution Attenuates Carbon Tetrachloride-Induced Hepatic Injury through the Antioxidative Abilities of Its Components Acteoside and Quercetin

Directory of Open Access Journals (Sweden)

Ching-Chiung Wang

2012-12-01

Full Text Available Wu-Chia-Pi medicated wine, composed nine Chinese medicines soaked in 35% alcohol, is widely used in Asia for its health-promoting functions. However, long-term consumption of alcohol could result in liver dysfunction. In this study, Wu-Chia-Pi solution (WCPS and extract (WCPE were prepared by modification of the principals given by the Committee on Chinese Medicine and Pharmacy in Taiwan. The aim of this study was to explore the protective effect of WCPS against carbon tetrachloride (CCl4-induced liver injury and to clarify its active component(s. Antioxidative effects of the test samples were evaluated via MDA inhibition, catalase activity and DPPH-scavenging assays. HPLC was used to analysis the active components. Results showed that WCPS (1 and 5 mL/kg significantly prevented CCl4-induced liver injury without chronic liver toxicity. Referring to the antioxidative activities, WCPE displayed significant MDA inhibitory and DPPH-scavenging activities with IC50 values of 0.91 ± 0.03 and 0.60 ± 0.04 mg/mL, respectively. Catalase activity was also enhanced by treatment of WCPE, acteoside and quercetin. Therefore, we suggest that acteoside and quercetin are the major contributors to the antioxidative and hepatoprotective activities of WCPS, and a possible mechanism could be mediated through reduction of oxidative stress.

Monte Carlo study of the pure and dilute Baxter-Wu model

International Nuclear Information System (INIS)

Schreiber, Nir; Adler, Joan

2005-01-01

We studied the pure and dilute Baxter-Wu (BW) models using the Wang-Landau (WL) sampling method to calculate the density-of-states (DOS). We first used the exact result for the DOS of the Ising model to test our code. Then we calculated the DOS of the dilute Ising model to obtain a phase diagram, in good agreement with previous studies. We calculated the energy distribution, together with its first, second and fourth moments, to give the specific heat and the energy fourth order cumulant, better known as the Binder parameter, for the pure BW model. For small samples, the energy distribution displayed a doubly peaked shape, and finite size scaling analysis showed the expected reciprocal scaling of the positions of the peaks with L. The energy distribution yielded the expected BW α = 2/3 critical exponent for the specific heat. The Binder parameter minimum appeared to scale with lattice size L with an exponent θ B equal to the specific heat exponent. Its location (temperature) showed a large correction-to-scaling term θ 1 = 0.248 ± 0.025. For the dilute BW model we found a clear crossover to a single peak in the energy distribution even for small sizes and the expected α = 0 was recovered

Pitchfork bifurcation and circuit implementation of a novel Chen hyper-chaotic system

International Nuclear Information System (INIS)

Dong En-Zeng; Chen Zeng-Qiang; Chen Zai-Ping; Ni Jian-Yun

2012-01-01

In this paper, a novel four dimensional hyper-chaotic system is coined based on the Chen system, which contains two quadratic terms and five system parameters. The proposed system can generate a hyper-chaotic attractor in wide parameters regions. By using the center manifold theorem and the local bifurcation theory, a pitchfork bifurcation is demonstrated to arise at the zero equilibrium point. Numerical analysis demonstrates that the hyper-chaotic system can generate complex dynamical behaviors, e.g., a direct transition from quasi-periodic behavior to hyper-chaotic behavior. Finally, an electronic circuit is designed to implement the hyper-chaotic system, the experimental results are consist with the numerical simulations, which verifies the existence of the hyper-chaotic attractor. Due to the complex dynamic behaviors, this new hyper-chaotic system is useful in the secure communication. (general)

Role of Mitochondrial Inheritance on Prostate Cancer Outcome in African American Men. Addendum

Science.gov (United States)

2016-11-01

RK, Tan DJ. Comprehensive scanning of the entire mitochondrial genome for mutations. Clin Chem. 2002; 48:1901-12. 3. Zhang W, Cui H, Wong L-J...Yang J, Price R, Nicolas A, Nalls M, Tranah G, Franceschini N, Xu Z, Schulte C, Alonso A, Cummings S, Fornage M, Zaykin D, Li L, Huang X, Kritchevsky S...L, Liu X, Liu L, Xu P, Han B, Bai C, Zhao Y, Zhang H, Yan Y, Amos CI, Chen F, Tan W, Jin L, Wu T, Lin D, Shen H. Association analyses identify

Wormholes supported by phantom energy from Shan-Chen cosmological fluids

Energy Technology Data Exchange (ETDEWEB)

Wang, Deng [Nankai University, Theoretical Physics Division, Chern Institute of Mathematics, Tianjin (China); Meng, Xin-He [Nankai University, Department of Physics, Tianjin (China); Institute of Theoretical Physics, CAS, State key Lab of Theoretical Physics, Beijing (China)

2016-03-15

In the present paper, the exact solutions of spherically symmetrical Einstein field equations describing wormholes supported by phantom energy that violates the null energy condition from Shan-Chen background fluid are obtained. We have considered the important case of the model parameter ψ ∼ 1, which corresponds to the ''saturation effect'', and this regime corresponds to an effective form of ''asymptotic freedom'' for the fluids, but occurring at cosmological rather than subnuclear scales. Then we investigate the allowed range for the values of the model parameters g and ω when the spacetime metrics describe wormholes and discuss the possible singularities of the solutions, finding that the obtained spacetimes are geodesically complete. Furthermore, we construct two traversable wormholes through matching our obtained interior solutions to the exterior Schwarzschild solutions and analyze the traversabilities of the wormholes. Finally, we consider the case of anisotropic pressure and discover that the transverse pressure also crosses the phantom divide -1 with the growth of the wormhole dimension, and it tends to be the same as the radial pressure with the growth of the wormhole radius. (orig.)

Dissolving and biodegradable microneedle technologies for transdermal sustained delivery of drug and vaccine

Directory of Open Access Journals (Sweden)

Hong X

2013-09-01

Full Text Available Xiaoyun Hong,1,2,* Liangming Wei,3,* Fei Wu,2,* Zaozhan Wu,2 Lizhu Chen,2 Zhenguo Liu,1 Weien Yuan2 1Department of Neurology, Xinhua Hospital, Shanghai, People's Republic of China; 2School of Pharmacy, Shanghai JiaoTong University, Shanghai, People's Republic of China; 3Research Institute of Micro/Nano Science and Technology, Shanghai JiaoTong University, Shanghai, People's Republic of China *These authors contributed equally to this work Abstract: Microneedles were first conceptualized for drug delivery many decades ago, overcoming the shortages and preserving the advantages of hypodermic needle and conventional transdermal drug-delivery systems to some extent. Dissolving and biodegradable microneedle technologies have been used for transdermal sustained deliveries of different drugs and vaccines. This review describes microneedle geometry and the representative dissolving and biodegradable microneedle delivery methods via the skin, followed by the fabricating methods. Finally, this review puts forward some perspectives that require further investigation. Keywords: microneedle, dissolving, biodegradable, sustained release

Orbinia wui, a new species from China, with redescription of O. dicrochaeta Wu, 1962 (Annelida, Orbiniidae).

Science.gov (United States)

Sun, Yue; Li, Xinzheng

2018-04-04

Two species of the genus Orbinia Quatrefages, 1865 are described including Orbinia dicrochaeta Wu, 1962 and Orbinia wui sp. n. The new species can easily be identified from other species in the genus by a combination of characters: branchiae first present from chaetiger 5, thoracic region with 14-16 chaetigers; first six thoracic neuropodia with 4-5 rows of uncini, with the last row short and curving ventral to anterior rows; subsequent thoracic neuropodia with four rows of subuluncini and one short row of uncini, arranged more densely than anterior chaetigers; both uncini and subuluncini surrounded by long sheath all of its length on concave side, sheath with developed transverse rows of barbs. This study suggests that the species of Orbinia may be divided into two groups. A taxonomic key and comparative table to all species of Orbinia is provided.

Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige

OpenAIRE

Giafferri, Xiaomin

2008-01-01

Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authen...

Association between MDM2 SNP309 T>G polymorphism and the risk of bladder cancer: new data in a Chinese population and an updated meta-analysis

OpenAIRE

Xie, Linguo; Sun, Yan; Chen, Tao; Tian, Dawei; Li, Yujuan; Zhang, Yu; Ding, Na; Shen, Zhonghua; Xu, Hao; Nian, Xuewu; Sha, Nan; Han, Ruifa; Hu, Hailong; Wu, Changli

2015-01-01

Linguo Xie,1,2,* Yan Sun,2,* Tao Chen,1,2,* Dawei Tian,1,2 Yujuan Li,3 Yu Zhang,1,2 Na Ding,2 Zhonghua Shen,1,2 Hao Xu,1,2 Xuewu Nian,4 Nan Sha,1,2 Ruifa Han,1,2 Hailong Hu,1,2 Changli Wu1,2 Objective: Human murine double minute 2 protein (MDM2) is mainly a negative regulator of p53 tumor suppressor pathway. We aimed to investigate the association between MDM2 SNP309 polymorphism and bladder cancer risk. Methods: A total of 535 bladder cancer patients and 649 health controls were recruited f...

The impact of systematic landscape conservation planning on ecosystem: Chen Youlan river watershed

Science.gov (United States)

Chen, Chi-ju

2017-04-01

Heraclitus said that "no man ever steps in the same river twice." Everything continues to change. Land use change will keep redefine itself and subject the Earth and humankind to collateral changes. Humankind benefits from ecosystem in many ways. The ecosystem provides people with nutrients, enriches soil with sediment, and sustains all living organisms with water; these benefits are known as ecosystem services. In Taiwan, land use change has impacted ecosystem and biodiversity on various levels. Thus, we took six land use scenarios from 1999 to 2005 in Chen Youlan river watershed as our case study, intending to observe the course of ecosystem and biodiversity changes and the cause of it. Systematic Landscape conservation planning (SLCP) framework can be adopted when designing land use policy to safeguard human interests and ecosystem. This study use SLCP to develop ecosystem services and biodiversity protection strategies. Several strategies were designed by using 1999 to 2005 data as provision to protect the intactness of future ecosystem services and biodiversity. This research explores the potential and possible impacts of different land use protection strategies in the future. It is possible to identify the conservation priority of a certain region by using the Zonation meta-algorithm. This study selects the zonation critical protection area (Joint set of Yushan National Park) as strategy A, B and C. Strategy D takes Yushan National Park as a protected area; unstable hot spots in 1999/03 (Joint set of Yushan National Park) are selected as strategy E. Next, we used Kappa statistical method to find the minimal ecosystem services change and biodiversity hotspots change of the five aforementioned strategies and compared with those from 1999/03. By the Kappa statistical method, we further prioritized the important conservation areas by strategy A, B, C, E in the future. The results can not only serve as management reference for government agencies, but also develop

New contributions to the knowledge of Chinese flea beetle fauna (III): Revision of Meishania Chen & Wang with description of five new species (Coleoptera: Chrysomelidae: Galerucinae)

Science.gov (United States)

The flea beetle genus Meishania Chen & Wang is revised and five new species - M. cangshanensis sp. nov., M. flavipennis sp. nov., M. fulvotigera sp. nov., and M. sichuanica sp. nov. from China and M. bhutanensis sp. nov. from Bhutan - are described. All species of Meishania are illustrated and a key...

Information systems and computing technology

CERN Document Server

Zhang, Lei

2013-01-01

Invited papersIncorporating the multi-cross-sectional temporal effect in Geographically Weighted Logit Regression K. Wu, B. Liu, B. Huang & Z. LeiOne shot learning human actions recognition using key posesW.H. Zou, S.G. Li, Z. Lei & N. DaiBand grouping pansharpening for WorldView-2 satellite images X. LiResearch on GIS based haze trajectory data analysis system Y. Wang, J. Chen, J. Shu & X. WangRegular papersA warning model of systemic financial risks W. Xu & Q. WangResearch on smart mobile phone user experience with grounded theory J.P. Wan & Y.H. ZhuThe software reliability analysis based on

Hyaluronic acid-coated bovine serum albumin nanoparticles loaded with brucine as selective nanovectors for intra-articular injection

Directory of Open Access Journals (Sweden)

Chen Z

2013-10-01

Full Text Available Zhipeng Chen,* Juan Chen,* Li Wu, Weidong Li, Jun Chen, Haibo Cheng, Jinhuo Pan, Baochang CaiDepartment of Pharmacy, Nanjing University of Chinese Medicine, Nanjing, People's Republic of China*These authors contributed equally to this workObjective: To evaluate the potential of hyaluronic acid (HA-coated bovine serum albumin nanoparticles (BSANPs as a novel chondrocyte-targeting drug-delivery nanomedicine.Methods: The HA-BSANPs were characterized by dynamic light scattering, transmission electron microscopy, differential scanning calorimetry, and X-ray diffraction. Fluorescence imaging was used to visualize the distribution of nanoparticles after intra-articular injection. The chondrocyte-targeting efficiency and cellular uptake mechanism of HA-BSANPs were investigated using endocytic inhibitors.Results: HA-BSANPs were successfully prepared with HA coating the surface and amorphous drug in the core. Compared with BSANPs, HA-BSANPs exhibited improved uptake by chondrocytes through a receptor-mediated active uptake mechanism. The endocytosis process of BSANPs and HA-BSANPs involved clathrin-mediated endocytosis, caveolae-mediated endocytosis, and macropinocytosis. No apparent thickening or hyperplasia of the synovium was observed in either BSANPs or HA-BSANPs. The HA-BSANPs could reside in the articular cavity of rats for more than 14 days, which was significantly longer than BSANPs.Conclusion: HA-BSANPs are a promising carrier for articular-related diseases due to elongated articular residence and improved chondrocytic accumulation.Keywords: chondrocyte, intra-articular injection, hyaluronic acid, BSA, nanoparticles

Molecular diversity analysis of Tetradium ruticarpum (WuZhuYu) in China based on inter-primer binding site (iPBS) markers and inter-simple sequence repeat (ISSR) markers.

Science.gov (United States)

Xu, Jing-Yuan; Zhu, Yan; Yi, Ze; Wu, Gang; Xie, Guo-Yong; Qin, Min-Jian

2018-01-01

"Wu zhu yu", which is obtained from the dried unripe fruits of Tetradium ruticarpum (A. Jussieu) T. G. Hartley, has been used as a traditional Chinese medicine for treatment of headaches, abdominal colic, and hypertension for thousands of years. The present study was designed to assess the molecular genetic diversity among 25 collected accessions of T. ruticarpum (Wu zhu yu in Chinese) from different areas of China, based on inter-primer binding site (iPBS) markers and inter-simple sequence repeat (ISSR) markers. Thirteen ISSR primers generated 151 amplification bands, of which 130 were polymorphic. Out of 165 bands that were amplified using 10 iPBS primers, 152 were polymorphic. The iPBS markers displayed a higher proportion of polymorphic loci (PPL = 92.5%) than the ISSR markers (PPL = 84.9%). The results showed that T. ruticarpum possessed high loci polymorphism and genetic differentiation occurred in this plant. The combined data of iPBS and ISSR markers scored on 25 accessions produced five clusters that approximately matched the geographic distribution of the species. The results indicated that both iPBS and ISSR markers were reliable and effective tools for analyzing the genetic diversity in T. ruticarpum. Copyright © 2018 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

Orbital stability of solitary waves for Kundu equation

Science.gov (United States)

Zhang, Weiguo; Qin, Yinghao; Zhao, Yan; Guo, Boling

In this paper, we consider the Kundu equation which is not a standard Hamiltonian system. The abstract orbital stability theory proposed by Grillakis et al. (1987, 1990) cannot be applied directly to study orbital stability of solitary waves for this equation. Motivated by the idea of Guo and Wu (1995), we construct three invariants of motion and use detailed spectral analysis to obtain orbital stability of solitary waves for Kundu equation. Since Kundu equation is more complex than the derivative Schrödinger equation, we utilize some techniques to overcome some difficulties in this paper. It should be pointed out that the results obtained in this paper are more general than those obtained by Guo and Wu (1995). We present a sufficient condition under which solitary waves are orbitally stable for 2c+sυ1995) only considered the case 2c+sυ>0. We obtain the results on orbital stability of solitary waves for the derivative Schrödinger equation given by Colin and Ohta (2006) as a corollary in this paper. Furthermore, we obtain orbital stability of solitary waves for Chen-Lee-Lin equation and Gerdjikov-Ivanov equation, respectively.

Phyllanthus coi (Phyllanthaceae, a new herbaceous species from the Philippines

Directory of Open Access Journals (Sweden)

Ming-Jou WU

2017-11-01

Full Text Available Phyllanthus coi M.J. Wu, Ferreras & Y.J. Chen, a new species from Benguet Province, Island of Luzon, the Philippines, is described and illustrated. Compared to its congeners in the same section, P. coi can be differentiated by having long plagiotropic branchlets with up to 30 leaves per side, seeds with sharp honey-comb-like ridges on the dorsal side, and three free styles that are not lying flat on the top of the ovary. The floral, seed and some vegetative features that distinguish this new species from its nearest morphologically related species, P. erythrotrichus C.B. Rob., P. urinaria L. and P. hookeri Müll. Arg. are provided.

21 October 2008 - LHC Inauguration - IHEP Beijing representative Prof. Chen, People's Republic of China, welcomed by CERN Director-General R. Aymar, CERN Chief Scientific Officer J. Engelen and CERN Financial Officer S. Lettow.

CERN Multimedia

CERN Photo Service

2008-01-01

21 October 2008 - LHC Inauguration - IHEP Beijing representative Prof. Chen, People's Republic of China, welcomed by CERN Director-General R. Aymar, CERN Chief Scientific Officer J. Engelen and CERN Financial Officer S. Lettow.

A hard-knock life: the foraging ecology of Cape cormorants amidst ...

African Journals Online (AJOL)

A hard-knock life: the foraging ecology of Cape cormorants amidst shifting prey resources and industrial fishing pressure. MH Hamann, D Grémillet, PG Ryan, F Bonadonna, CD van der Lingen, L Pichegru ...

Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige

Directory of Open Access Journals (Sweden)

Xiaomin Giafferri

2008-12-01

Full Text Available Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authenticité s’établit à travers les mécanismes de la fictionnalisation de l’Histoire. L’observation de leur manifestation est amenée à considérer deux axes principaux : l’organisation du récit et la mise en scène des personnages.

Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.

CERN Multimedia

Maximilien Brice

2007-01-01

Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.

Psychometric properties of the Revised Chen Internet Addiction Scale (CIAS-R) in Chinese adolescents.

Science.gov (United States)

Mak, Kwok-Kei; Lai, Ching-Man; Ko, Chih-Hung; Chou, Chien; Kim, Dong-Il; Watanabe, Hiroko; Ho, Roger C M

2014-10-01

The Revised Chen Internet Addiction Scale (CIAS-R) was developed to assess Internet addiction in Chinese populations, but its psychometric properties in adolescents have not been examined. This study aimed to evaluate the factor structure and psychometric properties of CIAS-R in Hong Kong Chinese adolescents. 860 Grade 7 to 13 students (38 % boys) completed the CIAS-R, the Young's Internet Addiction Test (IAT), and the Health of the Nation Outcome Scales for Children and Adolescents (HoNOSCA) in a survey. The prevalence of Internet addiction as assessed by CIAS-R was 18 %. High internal consistency and inter-item correlations were reported for the CIAS-R. Results from the confirmatory factor analysis suggested a four-factor structure of Compulsive Use and Withdrawal, Tolerance, Interpersonal and Health-related Problems, and Time Management Problems. Moreover, results of hierarchical multiple regression supported the incremental validity of the CIAS-R to predict mental health outcomes beyond the effects of demographic differences and self-reported time spent online. The CIAS is a reliable and valid measure of internet addiction problems in Hong Kong adolescents. Future study is warranted to validate the cutoffs of the CIAS-R for identification of adolescents with Internet use problems who may have mental health needs.

Screening for Internet Addiction: An Empirical Study on Cut-off Points for the Chen Internet Addiction Scale

Directory of Open Access Journals (Sweden)

Chih-Hung Ko

2005-12-01

Full Text Available The aim of this study was to establish the optimal cut-off points of the Chen Internet Addiction Scale (CIAS, to screen for and diagnose Internet addiction among adolescents in the community by using the well- established diagnostic criteria of Internet addiction. This survey of 454 adolescents used screening (57/58 and diagnostic (63/64 cut-off points of the CIAS, a self-reported instrument, based on the results of systematic diagnostic interviews by psychiatrists. The area under the curve of the receiver operating characteristic curve revealed that CIAS has good diagnostic accuracy (89.6%. The screening cut-off point had high sensitivity (85.6% and the diagnostic cut-off point had the highest diagnostic accuracy, classifying 87.6% of participants correctly. Accordingly, the screening point of the CIAS could provide a screening function in two-stage diagnosis, and the diagnostic point could serve as a diagnostic criterion in one-stage massive epidemiologic research.

Ground-state magnetization of the Ising spin glass: A recursive numerical method and Chen-Ma scaling

Science.gov (United States)

Sepehrinia, Reza; Chalangari, Fartash

2018-03-01

The ground-state properties of quasi-one-dimensional (Q1D) Ising spin glass are investigated using an exact numerical approach and analytical arguments. A set of coupled recursive equations for the ground-state energy are introduced and solved numerically. For various types of coupling distribution, we obtain accurate results for magnetization, particularly in the presence of a weak external magnetic field. We show that in the weak magnetic field limit, similar to the 1D model, magnetization exhibits a singular power-law behavior with divergent susceptibility. Remarkably, the spectrum of magnetic exponents is markedly different from that of the 1D system even in the case of two coupled chains. The magnetic exponent makes a crossover from being dependent on a distribution function to a constant value independent of distribution. We provide an analytic theory for these observations by extending the Chen-Ma argument to the Q1D case. We derive an analytical formula for the exponent which is in perfect agreement with the numerical results.

Energy transfer ultraviolet photodetector with 8-hydroxyquinoline derivative-metal complexes as acceptors

International Nuclear Information System (INIS)

Wu Shuang-Hong; Chen Zhi; Li Shi-Bin; Wang Xiao-Hui; Wei Xiong-Bang; Li Wen-Lian

2015-01-01

We choose 8-hydroxyquinoline derivative-metal complexes (Beq, Mgq, and Znq) as the acceptors (A) and 4,4',4”-tri-(2-methylphenyl phenylamino) triphenylaine (m-MTDATA) as the donor (D) respectively to study the existing energy transfer process in the organic ultraviolet (UV) photodetector (PD), which has an important influence on the sensitivity of PDs. The energy transfer process from D to A without exciplex formation is discussed, differing from the working mechanism of previous PDs with Gaq [Zisheng Su, Wenlian Li, Bei Chu, Tianle Li, Jianzhuo Zhu, Guang Zhang, Fei Yan, Xiao Li, Yiren Chen and Chun-Sing Lee 2008 Appl. Phys. Lett. 93 103309)] and REq [J. B. Wang, W. L. Li, B. Chu, L. L. Chen, G. Zhang, Z. S. Su, Y. R. Chen, D. F. Yang, J. Z. Zhu, S. H. Wu, F. Yan, H. H. Liu, C. S. Lee 2010 Org. Electron. 11 1301] used as an A material. Under 365-nm UV irradiation with an intensity of 1.2 mW/cm 2 , the m-MTDATA:Beq blend device with a weight ratio of 1:1 shows a response of 192 mA/W with a detectivity of 6.5× 10 11 Jones, which exceeds those of PDs based on Mgq (146 mA/W) and Znq (182 mA/W) due to better energy level alignment between m-MTDATA/Beq and lower radiative decay. More photophysics processes of the PDs involved are discussed in detail. (paper)

Politics in the Western Maya Region (I: Ajawil/Ajawlel and Ch'e'n

Directory of Open Access Journals (Sweden)

Péter Bíró

2011-01-01

Full Text Available In a series of articles I reflect on the use of various expressions which are connected to what we call the political in the inscriptions of the Classic Maya Western Region. These words express concepts which help to understand the intricate details of the interactions between the political entities and their internal organisations in the Classic Maya Lowlands. Words such as 7ajawil, 7ajawlel, the kennings built on the base of ch'e7n (cave, pond, the emblem glyphs and titles will be examined in light of what they tell us about the functioning of the political organisation of the Classic Period in a constrained region.En una serie de artículos como éste investigo el uso de varias palabras en las inscripciones mayas de la época Clásica de la Región Occidental vinculadas con lo que nosotros llamamos "política". Estas palabras expresan conceptos que ayudan a entender los matices de las relaciones entre las entidades políticas de las Tierras Bajas Mayas y su organización interna. Términos como ajaw'ü I ajawlel, los difrasismos con base ch'e'n (cueva, pozo, los glifos emblemas y los títulos serán examinados tomando en cuenta la información que nos proporcionan sobre el funcionamiento de la organización política de la época Clásica en una región restringida.

African Journal of Marine Science - Vol 29, No 3 (2007)

African Journals Online (AJOL)

Abrupt environmental shift associated with changes in the distribution of Cape anchovy Engraulis encrasicolus spawners in the southern Benguela · EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. C Roy, CD van der Lingen, JC Coetzee, JRE Lutjeharms, 309-319.

Plasma biochemistry values in emperor geese (Chen canagica) in Alaska: comparisons among age, sex, incubation, and molt.

Science.gov (United States)

Franson, J. Christian; Hoffman, D.J.; Schmutz, J.A.

2009-01-01

Reduced populations of emperor geese (Chen canagica), a Bering Sea endemic, provided the need to assess plasma biochemistry values as indicators of population health. A precursory step to such an investigation was to evaluate patterns of variability in plasma biochemistry values among age, sex, and reproductive period. Plasma from 63 emperor geese was collected on their breeding grounds on the Yukon-Kuskokwim Delta in western Alaska, USA. The geese sampled included 18 incubating adult females captured, in mid June, on their nests by using bow nets, and 30 adults and 15 goslings captured in corral traps in late July and early August, when the adults were molting their wing feathers and the goslings were 5-6 weeks old. Plasma was evaluated for 15 biochemical parameters, by comparing results among age, sex, and sampling period (incubation versus wing-feather molt). Ten of the 15 biochemical parameters assayed differed among adults during incubation, the adults during molt, and the goslings at molt, whereas sex differences were noted in few parameters.

Body mass of prefledging Emperor Geese Chen canagica: Large-scale effects of interspecific densities and food availability

Science.gov (United States)

Lake, B.C.; Schmutz, J.A.; Lindberg, M.S.; Ely, Craig R.; Eldridge, W.D.; Broerman, F.J.

2008-01-01

We studied body mass of prefledging Emperor Geese Chen canagica at three locations across the Yukon-Kuskokwim Delta, Alaska, during 1990-2004 to investigate whether large-scale variation in body mass was related to interspecific competition for food. From 1990 to 2004, densities of Cackling Geese Branta hutchinsii minima more than doubled and were c. 2-5?? greater than densities of Emperor Geese, which were relatively constant over time. Body mass of prefledging Emperor Geese was strongly related (negatively) to interspecific densities of geese (combined density of Cackling and Emperor Geese) and positively related to measures of food availability (grazing lawn extent and net above-ground primary productivity (NAPP)). Grazing by geese resulted in consumption of ??? 90% of the NAPP that occurred in grazing lawns during the brood-rearing period, suggesting that density-dependent interspecific competition was from exploitation of common food resources. Efforts to increase the population size of Emperor Geese would benefit from considering competitive interactions among goose species and with forage plants. ?? 2008 The Authors.

Debris flow run off simulation and verification ‒ case study of Chen-You-Lan Watershed, Taiwan

Directory of Open Access Journals (Sweden)

M.-L. Lin

2005-01-01

Full Text Available In 1996 typhoon Herb struck the central Taiwan area, causing severe debris flow in many subwatersheds of the Chen-You-Lan river watershed. More severe cases of debris flow occurred following Chi-Chi earthquake, 1999. In order to identify the potentially affected area and its severity, the ability to simulate the flow route of debris is desirable. In this research numerical simulation of debris flow deposition process had been carried out using FLO-2D adopting Chui-Sue river watershed as the study area. Sensitivity study of parameters used in the numerical model was conducted and adjustments were made empirically. The micro-geomorphic database of Chui-Sue river watershed was generated and analyzed to understand the terrain variations caused by the debris flow. Based on the micro-geomorphic analysis, the debris deposition in the Chui-Sue river watershed in the downstream area, and the position and volume of debris deposition were determined. The simulated results appeared to agree fairly well with the results of micro-geomorphic study of the area when not affected by other inflow rivers, and the trends of debris distribution in the study area appeared to be fairly consistent.

[Reiner Nürnberg, Ekkehard Höxtermann, Martina Voigt. Elisabeth Schiemann 1881-1972. Vom AußBruch der Genetik und der Frauen in den UmBrüchen des 20. Jahrhunderts] / Monika von Hirschheydt

Index Scriptorium Estoniae

Hirschheydt, Monika von

2015-01-01

Arvustus: Nürnberg, Reiner, Höxtermann, Ekkehard, Voigt, Martina. Elisabeth Schiemann 1881-1972. Vom AußBruch der Genetik und der Frauen in den UmBrüchen des 20. Jahrhunderts. Beiträge eines Symposiums zum 200. Gründungsjubiläum der Humboldt-Universität Berlin. Rangsdorf: Basilisken-Presse 2014

The complete mitochondrial genome and its remarkable secondary structure for a stonefly Acroneuria hainana Wu (Insecta: Plecoptera, Perlidae).

Science.gov (United States)

Huang, Mingchao; Wang, Yuyu; Liu, Xingyue; Li, Weihai; Kang, Zehui; Wang, Kai; Li, Xuankun; Yang, Ding

2015-02-15

The Plecoptera (stoneflies) is a hemimetabolous order of insects, whose larvae are usually used as indicators for fresh water biomonitoring. Herein, we describe the complete mitochondrial (mt) genome of a stonefly species, namely Acroneuria hainana Wu belonging to the family Perlidae. This mt genome contains 13 PCGs, 22 tRNA-coding genes and 2 rRNA-coding genes that are conserved in most insect mt genomes, and it also has the identical gene order with the insect ancestral gene order. However, there are three special initiation codons of ND1, ND5 and COI in PCGs: TTG, GTG and CGA, coding for L, V and R, respectively. Additionally, the 899-bp control region, with 73.30% A+T content, has two long repeated sequences which are found at the 3'-end closing to the tRNA(Ile) gene. Both of them can be folded into a stem-loop structure, whose adjacent upstream and downstream sequences can be also folded into stem-loop structures. It is presumed that the four special structures in series could be associated with the D-loop replication. It might be able to adjust the replication speed of two replicate directions. Copyright © 2014 Elsevier B.V. All rights reserved.

FORTRAN Code for Glandular Dose Calculation in Mammography Using Sobol-Wu Parameters

Directory of Open Access Journals (Sweden)

Mowlavi A A

2007-07-01

Full Text Available Background: Accurate computation of the radiation dose to the breast is essential to mammography. Various the thicknesses of breast, the composition of the breast tissue and other variables affect the optimal breast dose. Furthermore, the glandular fraction, which refers to the composition of the breasts, as partitioned between radiation-sensitive glandular tissue and the adipose tissue, also has an effect on this calculation. Fatty or fibrous breasts would have a lower value for the glandular fraction than dense breasts. Breast tissue composed of half glandular and half adipose tissue would have a glandular fraction in between that of fatty and dense breasts. Therefore, the use of a computational code for average glandular dose calculation in mammography is a more effective means of estimating the dose of radiation, and is accurate and fast. Methods: In the present work, the Sobol-Wu beam quality parameters are used to write a FORTRAN code for glandular dose calculation in molybdenum anode-molybdenum filter (Mo-Mo, molybdenum anode-rhodium filter (Mo-Rh and rhodium anode-rhodium filter (Rh-Rh target-filter combinations in mammograms. The input parameters of code are: tube voltage in kV, half-value layer (HVL of the incident x-ray spectrum in mm, breast thickness in cm (d, and glandular tissue fraction (g. Results: The average glandular dose (AGD variation against the voltage of the mammogram X-ray tube for d = 4 cm, HVL = 0.34 mm Al and g=0.5 for the three filter-target combinations, as well as its variation against the glandular fraction of breast tissue for kV=25, HVL=0.34, and d=4 cm has been calculated. The results related to the average glandular absorbed dose variation against HVL for kV = 28, d=4 cm and g= 0.6 are also presented. The results of this code are in good agreement with those previously reported in the literature. Conclusion: The code developed in this study calculates the glandular dose quickly, and it is complete and

Discovery of estrogen receptor α modulators from natural compounds in Si-Wu-Tang series decoctions using estrogen-responsive MCF-7 breast cancer cells.

Science.gov (United States)

Liu, Li; Ma, Hongyue; Tang, Yuping; Chen, Wenxing; Lu, Yin; Guo, Jianming; Duan, Jin-Ao

2012-01-01

The binding between the estrogen receptor α (ER-α) and a variety of compounds in traditional Chinese formulae, Si-Wu-Tang (SWT) series decoctions, was studied using a stably-transfected human breast cancer cell line (MVLN). In 38 compounds tested from SWT series decoctions, the estrogen-like activity of 22 compounds was above 60% in 20 μg mL(-1). Furthermore, theoretical affinity of these compounds was certificated using the functional virtual screen of ER-α modulators by FlexX-Pharm. The accuracy of functional virtual screening of ER-α modulators could reach to 77.27%. The results showed that some compounds, such as organic acids and flavones in SWT series decoctions could be used as selective estrogen receptor modulators (SERMs) and could be selected for further development as potential agents for estrogen related diseases. Copyright © 2011 Elsevier Ltd. All rights reserved.

Indole and synthetic derivative activate chaperone expression to reduce polyQ aggregation in SCA17 neuronal cell and slice culture models

Directory of Open Access Journals (Sweden)

Kung PJ

2014-10-01

Full Text Available Pin-Jui Kung,1,* Yu-Chen Tao,1,* Ho-Chiang Hsu,1 Wan-Ling Chen,1 Te-Hsien Lin,1 Donala Janreddy,2 Ching-Fa Yao,2 Kuo-Hsuan Chang,3 Jung-Yaw Lin,1 Ming-Tsan Su,1 Chung-Hsin Wu,1 Guey-Jen Lee-Chen,1 Hsiu-Mei Hsieh-Li1 1Department of Life Science, 2Department of Chemistry, National Taiwan Normal University, Taipei, Taiwan; 3Department of Neurology, Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Taipei, Taiwan *These authors contributed equally to this work Abstract: In spinocerebellar ataxia type 17 (SCA17, the expansion of a translated CAG repeat in the TATA box binding protein (TBP gene results in a long polyglutamine (polyQ tract in the TBP protein, leading to intracellular accumulation of aggregated TBP and cell death. The molecular chaperones act in preventing protein aggregation to ameliorate downstream harmful events. In this study, we used Tet-On SH-SY5Y cells with inducible SCA17 TBP/Q79-green fluorescent protein (GFP expression to test indole and synthetic derivative NC001-8 for neuroprotection. We found that indole and NC001-8 up-regulated chaperone expression to reduce polyQ aggregation in neuronal differentiated TBP/Q79 cells. The effects on promoting neurite outgrowth and on reduction of aggregation on Purkinje cells were also confirmed with cerebellar primary and slice cultures of SCA17 transgenic mice. Our results demonstrate how indole and derivative NC001-8 reduce polyQ aggregation to support their therapeutic potentials in SCA17 treatment. Keywords: spinocerebellar ataxia type 17, TATA box binding protein, polyQ aggregation, indole and derivative, therapeutics

Energy transfer ultraviolet photodetector with 8-hydroxyquinoline derivative-metal complexes as acceptors

Science.gov (United States)

Wu, Shuang-Hong; Li, Wen-Lian; Chen, Zhi; Li, Shi-Bin; Wang, Xiao-Hui; Wei, Xiong-Bang

2015-02-01

We choose 8-hydroxyquinoline derivative-metal complexes (Beq, Mgq, and Znq) as the acceptors (A) and 4,4',4”-tri-(2-methylphenyl phenylamino) triphenylaine (m-MTDATA) as the donor (D) respectively to study the existing energy transfer process in the organic ultraviolet (UV) photodetector (PD), which has an important influence on the sensitivity of PDs. The energy transfer process from D to A without exciplex formation is discussed, differing from the working mechanism of previous PDs with Gaq [Zisheng Su, Wenlian Li, Bei Chu, Tianle Li, Jianzhuo Zhu, Guang Zhang, Fei Yan, Xiao Li, Yiren Chen and Chun-Sing Lee 2008 Appl. Phys. Lett. 93 103309)] and REq [J. B. Wang, W. L. Li, B. Chu, L. L. Chen, G. Zhang, Z. S. Su, Y. R. Chen, D. F. Yang, J. Z. Zhu, S. H. Wu, F. Yan, H. H. Liu, C. S. Lee 2010 Org. Electron. 11 1301] used as an A material. Under 365-nm UV irradiation with an intensity of 1.2 mW/cm2, the m-MTDATA:Beq blend device with a weight ratio of 1:1 shows a response of 192 mA/W with a detectivity of 6.5× 1011 Jones, which exceeds those of PDs based on Mgq (146 mA/W) and Znq (182 mA/W) due to better energy level alignment between m-MTDATA/Beq and lower radiative decay. More photophysics processes of the PDs involved are discussed in detail. Project supported by the National Natural Science Foundation of China (Grant Nos. 61371046, 61405026, 61474016, and 61421002) and China Postdoctoral Science Foundation (Grant No. 2014M552330).

African Journal of Marine Science - Vol 27, No 1 (2005)

African Journals Online (AJOL)

Estimating the lipid content of pelagic fish in the southern Benguela by visual assessment of their mesenteric fat · EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. C D van der Lingen, L Hutchings, 45-53. http://dx.doi.org/10.2989/18142320509504067 ...

Regular-, irregular-, and pseudo-character processing in Chinese: The regularity effect in normal adult readers

Directory of Open Access Journals (Sweden)

Dustin Kai Yan Lau

2014-03-01

Full Text Available Background Unlike alphabetic languages, Chinese uses a logographic script. However, the pronunciation of many character’s phonetic radical has the same pronunciation as the character as a whole. These are considered regular characters and can be read through a lexical non-semantic route (Weekes & Chen, 1999. Pseudocharacters are another way to study this non-semantic route. A pseudocharacter is the combination of existing semantic and phonetic radicals in their legal positions resulting in a non-existing character (Ho, Chan, Chung, Lee, & Tsang, 2007. Pseudocharacters can be pronounced by direct derivation from the sound of its phonetic radical. Conversely, if the pronunciation of a character does not follow that of the phonetic radical, it is considered as irregular and can only be correctly read through the lexical-semantic route. The aim of the current investigation was to examine reading aloud in normal adults. We hypothesized that the regularity effect, previously described for alphabetical scripts and acquired dyslexic patients of Chinese (Weekes & Chen, 1999; Wu, Liu, Sun, Chromik, & Zhang, 2014, would also be present in normal adult Chinese readers. Method Participants. Thirty (50% female native Hong Kong Cantonese speakers with a mean age of 19.6 years and a mean education of 12.9 years. Stimuli. Sixty regular-, 60 irregular-, and 60 pseudo-characters (with at least 75% of name agreement in Chinese were matched by initial phoneme, number of strokes and family size. Additionally, regular- and irregular-characters were matched by frequency (low and consistency. Procedure. Each participant was asked to read aloud the stimuli presented on a laptop using the DMDX software. The order of stimuli presentation was randomized. Data analysis. ANOVAs were carried out by participants and items with RTs and errors as dependent variables and type of stimuli (regular-, irregular- and pseudo-character as repeated measures (F1 or between subject�

6 June 2012 - Chinese Nanjing University President J.Chen in the ATLAS visitor centre with Member of the ATLAS Collaboration I. Wingerter and International Relations Office Adviser E. Tsesmelis. M. Qi, Nanjing University and ATLAS Collaboration, accompanies the delegation.

CERN Multimedia

Maximilien Brice

2012-01-01

6 June 2012 - Chinese Nanjing University President J.Chen in the ATLAS visitor centre with Member of the ATLAS Collaboration I. Wingerter and International Relations Office Adviser E. Tsesmelis. M. Qi, Nanjing University and ATLAS Collaboration, accompanies the delegation.

Satellite-derived land covers for runoff estimation using SCS-CN method in Chen-You-Lan Watershed, Taiwan

Science.gov (United States)

Zhang, Wen-Yan; Lin, Chao-Yuan

2017-04-01

The Soil Conservation Service Curve Number (SCS-CN) method, which was originally developed by the USDA Natural Resources Conservation Service, is widely used to estimate direct runoff volume from rainfall. The runoff Curve Number (CN) parameter is based on the hydrologic soil group and land use factors. In Taiwan, the national land use maps were interpreted from aerial photos in 1995 and 2008. Rapid updating of post-disaster land use map is limited due to the high cost of production, so the classification of satellite images is the alternative method to obtain the land use map. In this study, Normalized Difference Vegetation Index (NDVI) in Chen-You-Lan Watershed was derived from dry and wet season of Landsat imageries during 2003 - 2008. Land covers were interpreted from mean value and standard deviation of NDVI and were categorized into 4 groups i.e. forest, grassland, agriculture and bare land. Then, the runoff volume of typhoon events during 2005 - 2009 were estimated using SCS-CN method and verified with the measured runoff data. The result showed that the model efficiency coefficient is 90.77%. Therefore, estimating runoff by using the land cover map classified from satellite images is practicable.

Serum Metabolomic Characterization of Liver Fibrosis in Rats and Anti-Fibrotic Effects of Yin-Chen-Hao-Tang

Directory of Open Access Journals (Sweden)

Hongyang Zhang

2016-01-01

Full Text Available Yin-Chen-Hao-Tang (YCHT is a famous Chinese medicine formula which has long been used in clinical practice for treating various liver diseases, such as liver fibrosis. However, to date, the mechanism for its anti-fibrotic effects remains unclear. In this paper, an ultra-performance liquid chromatography-time-of-flight mass spectrometry (UPLC-TOF-MS-based metabolomic study was performed to characterize dimethylnitrosamine (DMN-induced liver fibrosis in rats and evaluate the therapeutic effects of YCHT. Partial least squares-discriminant analysis (PLS-DA showed that the model group was well separated from the control group, whereas the YCHT-treated group exhibited a tendency to restore to the controls. Seven significantly changed fibrosis-related metabolites, including unsaturated fatty acids and lysophosphatidylcholines (Lyso-PCs, were identified. Moreover, statistical analysis demonstrated that YCHT treatment could reverse the levels of most metabolites close to the normal levels. These results, along with histological and biochemical examinations, indicate that YCHT has anti-fibrotic effects, which may be due to the suppression of oxidative stress and resulting lipid peroxidation involved in hepatic fibrogenesis. This study offers new opportunities to improve our understanding of liver fibrosis and the anti-fibrotic mechanisms of YCHT.

Wu-Tou Decoction Inhibits Chronic Inflammatory Pain in Mice: Participation of TRPV1 and TRPA1 Ion Channels

Directory of Open Access Journals (Sweden)

Chao Wang

2015-01-01

Full Text Available Wu-tou decoction (WTD is a classic traditional Chinese medicine formula and has been used effectively to treat joint diseases clinically. Previous reports indicated that WTD possesses anti-inflammatory activity; however, its actions on pain have not been clarified. Here, we investigated the antinociceptive activity of WTD in CFA-induced mice, and its possible mechanism of the action associated with transient receptor potential (TRP ion channels was also explored. Our results showed that 1.58, 3.15, and 6.30 g/kg WTD significantly attenuated mechanical, cold, and heat hypersensitivities. Moreover, WTD effectively inhibited spontaneous nociceptive responses to intraplantar injections of capsaicin and cinnamaldehyde, respectively. WTD also effectively suppressed jumping and wet-dog-shake behaviors to intraperitoneal injection of icilin. Additionally, WTD significantly reduced protein expression of TRPV1 and TRPA1 in dorsal root ganglia and skins of injured paw. Collectively, our data demonstrate firstly that WTD exerts antinociceptive activity in inflammatory conditions by attenuating mechanical, cold, and heat hypersensitivities. This antinociceptive effect may result in part from inhibiting the activities of TRPV1, TRPA1, and TRPM8, and the suppression of TRPV1 and TRPA1 protein by WTD was also highly effective. These findings suggest that WTD might be an attractive and suitable therapeutic agent for the management of chronic inflammatory pain.

heT BoeK PrediKer: een verrAssende en uiTdAgende sTem in de ...

African Journals Online (AJOL)

Precies in deze context moeten qohelet's bespiege lingen over de 'ijdelheid' van de dingen begrepen worden. 10 cf. delitzsch (1875:197): “Wenn das buch Koheleth altsalomonisch ware, so gäbe es keine geschichte der hebräischen sprache”. 11 voor een omstandiger bespreking van en uitgebreide bibliografie omtrent de ...

Appendiks. Skolestøtte til børn i familiepleje – delrapport I

DEFF Research Database (Denmark)

Eiberg, Misja; Andersen, Luna Kragh; Scavenius Sonne-Schmidt, Christoffer

anden er en hjemmebaseret tutor-indsats kaldet ”Forældre som lektiehjælpere” (FsL). Dette appendiks indeholder tre analysedele: • En sammenligning af kontrol- og indsatsgrupper i forhold til plejeforældrenes baggrund/ud¬gangspunkt ved førmålingen • En sammenligning af kontrol- og indsatsgrupper i...

Lippe-Ems GmbH nuclear power stations. Annual report 1992

International Nuclear Information System (INIS)

1993-01-01

The Nuclear power company Lippe-Ems GmbH (KLE) runs the Emsland Nuclear Power Station (KKE) in Lingen (Ems) with a 1300 MW pressurized Water reactor. Partners of KLE are VEW and Elektromark. This 1992 annual report reveals numerous financial data of the operator (balance sheet, profit and loss account.) (orig./UA) [de

The potential of follicle-stimulating hormone peptide-modified triptolide-loaded nanoparticles to induce a mouse model of premature ovarian insufficiency

Directory of Open Access Journals (Sweden)

Chen XY

2015-04-01

Full Text Available Xiu-Ying Chen,1–3 Wu-Lian Chen,4 Min Ma,1–3 Chao Gu,1,2 Xi-Rong Xiao,1,2 Bin Li1,2 1Obstetrics and Gynecology Hospital, Fudan University, 2Department of Obstetrics and Gynecology of Shanghai Medical College, Fudan University, 3Shanghai Key Laboratory of Female Reproductive Endocrine Related Diseases, 4State Key Laboratory of Molecular Engineering of Polymers, Department of Macromolecular Science, Fudan University, Shanghai, People’s Republic of ChinaAbstract: The use of triptolide (TP is limited by its poor water solubility and severe toxicity. In this study, we developed an active drug delivery system (TP-loaded nanoparticles that could help improve the water solubility of TP and decrease its toxicity. Then, we investigated whether TP-loaded nanoparticles could be used to establish a novel premature ovarian insufficiency mouse model. The mice treated with TP-loaded nanoparticles for 35 days displayed normal growth, decreased serum antimullerian hormone, prominent ovarian fibrosis and vacuolar changes, fewer follicles and corpus lutea, increased collapsed oocytes and follicle apoptosis, and sterility. In conclusion, this model appears to show the reproductive characteristics associated with premature ovarian insufficiency in women and will allow us to study the mechanism of the effects of traditional Chinese medicine on gonadal toxicity. Keywords: peptide, nanoparticles, drug delivery, premature ovarian insufficiency, animal model

Browse Title Index

African Journals Online (AJOL)

Items 151 - 200 of 1038 ... Issue, Title. Vol 31, No 2 (2009), Assessing the utility of a continuous, underway fish egg sampler (CUFES) for sampling zooplankton, Abstract. S Sono, CL Moloney, CD van der Lingen. Vol 38, No 4 (2016), Assessing trophic adaptability is critical for understanding the response of predatory fishes to ...

Two phases of droplet evaporation during plasma arc spraying: reply to Chen's comment about the 'rocket' effect under conditions of thermal plasma spraying

Energy Technology Data Exchange (ETDEWEB)

Nemchinsky, V A [Key College, 225 Dania Beach Blvd, Dania Beach, FL 33040 (United States)

2007-07-07

The heating history of a droplet during its flight can be divided into two phases: (a) the initial phase when evaporation, although it occurs, does not change the heat balance of the droplet much (the case considered in our previous paper and (b) the final phase when the cooling due to evaporation balances the heat flux from the plasma. The later phase is considered in Chen's comment. In our reply, a very straightforward consideration demonstrates that even in the final phase of the droplet flight, the 'rocket' effect can be significant. (reply)

A variational numerical method based on finite elements for the nonlinear solution characteristics of the periodically forced Chen system

Science.gov (United States)

Khan, Sabeel M.; Sunny, D. A.; Aqeel, M.

2017-09-01

Nonlinear dynamical systems and their solutions are very sensitive to initial conditions and therefore need to be approximated carefully. In this article, we present and analyze nonlinear solution characteristics of the periodically forced Chen system with the application of a variational method based on the concept of finite time-elements. Our approach is based on the discretization of physical time space into finite elements where each time-element is mapped to a natural time space. The solution of the system is then determined in natural time space using a set of suitable basis functions. The numerical algorithm is presented and implemented to compute and analyze nonlinear behavior at different time-step sizes. The obtained results show an excellent agreement with the classical RK-4 and RK-5 methods. The accuracy and convergence of the method is shown by comparing numerically computed results with the exact solution for a test problem. The presented method has shown a great potential in dealing with the solutions of nonlinear dynamical systems and thus can be utilized in delineating different features and characteristics of their solutions.

Supplementary catalogue of the Anthomyiidae (Diptera of China

Directory of Open Access Journals (Sweden)

Mengmeng Wang

2014-11-01

Full Text Available The present catalogue of Anthomyiidae attempts to list all species (173 described or recorded from mainland China (165 and Taiwan (8 that for various reasons are not treated in “Flies of China” from 1998. The catalogue further lists Chinese species that are presently standing in new generic combinations compared to those of “Flies of China”, species that have changed name because of synonymy or misidentification, and species upgraded from subspecies to species. Regional distribution by province is specified for all species. Literature sources to descriptions or records of anthomyiid species from China are only given for those 173 species not covered by “Flies of China”. Four new combinations are proposed: Enneastigma fulva (Malloch, 1934, Enneastigma henanensis (Ge & Fan, 1982, Enneastigma lengshanensis (Xue, 2001 and Hylemya qinghaiensis (Fan, Chen & Ma, 1989. Eremomyia turbida Huckett, 1951 is revived from synonymy with Chortophila triticiperda Stein, 1900 (current name Eutrichota turbida. One subspecies is upgraded to species: Adia asiatica Fan, 1988. The following eight new synonymies are proposed: Delia pectinator fuscilateralis Fan in Fan & Zheng, 1992 with Delia pectinator Suwa, 1984; Eremomyia pilimana pilimarginata Fan & Qian in Fan, Chen, Ma & Ge, 1982 with Eremomyia turbida Huckett, 1951 (current name Eutrichota turbida; Lopesohylemya Fan, Chen & Ma, 1989 with Hylemya Robineau-Desvoidy, 1830; Deliomyia Fan in Fan et al., 1988 with Subhylemyia Ringdahl, 1933; Hydrophoria disticrassa Xue & Bai, 2009 with Hydrophoria pullata Wu, Liu & Wei, 1995 (current name Zaphne pullata; Heteroterma Wei, 2006 with Scathophaga Meigen, 1803; Heteroterma fanjingensis Wei, 2006 with Scathophaga curtipilata Feng, 2002; Scatomyza fansipanicola Ozerov in Ozerov & Krivosheina, 2011 with Scathophaga curtipilata Feng, 2002. The genus Heteroterma Wei, 2006 and species Heteroterma fanjingensis Wei, 2006 are reassigned from Anthomyiidae to

Si-Wu-tang extract stimulates bone formation through PI3K/Akt/NF-κB signaling pathways in osteoblasts.

Science.gov (United States)

Wu, Chi-Ming; Chen, Po-Chun; Li, Te-Mao; Fong, Yi-Chin; Tang, Chih-Hsin

2013-10-24

Si-Wu-Tang (SWT), a Traditional Chinese Medicine (TCM) formula, is widely used for the treatment of gynopathies diseases such as menstrual discomfort, climacteric syndrome, dysmenorrhea, and other estrogen-related diseases. Recent studies have shown that SWT can treat primary dysmenorrhea, have anti-pruritic anti-inflammatory effects, and protect against radiation-induced bone marrow damage in an animal model. It has been reported that anti-inflammatory and anti-oxidant agents have the potential to treat osteoporosis by increasing bone formation and/or suppressing bone resorption. However, the effect of SWT on bone cell function has not yet been reported. Alkaline phosphatase (ALP), bone morphogenetic proteins (BMP)-2, and osteopontin (OPN) mRNA expression was analyzed by qPCR. The mechanism of action of SWT extract was investigated using western blotting. The in vivo anti-osteoporotic effect of SWT extract was assessed in ovariectomized mice. Here, we report that SWT increases ALP, BMP-2, and OPN expression as well as bone mineralization. In addition, we show that the PI3K, Akt, and NF-κB signaling pathways may be involved in the SWT-mediated increase in gene expression and bone mineralization. Notably, treatment of mice with SWT extract prevented bone loss induced by ovariectomy in vivo. SWT may be used to stimulate bone formation for the treatment of osteoporosis.

Solar heating in Greenland

DEFF Research Database (Denmark)

Dragsted, Janne

Energi fra solen er en ren og naturlig energikilde. Solstrålingen på jordens overflade – inklusive i det Arktiske klima – er så stor, at det er muligt at udnytte solens energi i stor skala. Ved at udnytte solens energi nedsættes brugen af fossile brændstoffer. Anvendelsen af solenergi varierer fr...

Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007

CERN Multimedia

Maximilien Brice

2007-01-01

Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007

Un imaginaire dévoilé/déphasé. Stratégies narratives et mémoire culturelle dans le roman 54 des Wu Ming

Directory of Open Access Journals (Sweden)

Matteo Martelli

2015-02-01

Full Text Available This essay analyses the narrative strategies through which cultural memory is portrayed in 54, a novel in which Wu Ming (a collective of four Italian fiction writers suggests a literary mapping of the Fifties. This is obtained by a recovery of a shared imaginary tradition which is close to the reader, mixing fictional and historical characters, films, books, different genres of popular literature. Nevertheless, the rewriting of these imaginary traditions involves their displacement, a presentation which is constantly created from an unusual point of view. Thus, shifting the image of what is already known, the text inquires into several modalities of a questioning about cultural memory and its redefinition in relation to contemporary culture. By focusing on these elements, this study proposes an analysis which starts from the construction of the characters, the role of suspense and the adoption of multiple traditions of novel writing.

The prevalence and pathogenicity of gizzard nematodes of the genera Amidostomum and Epomidiostomum (Trichostrongylidae) in the lesser snow goose (Chen caerulescens caerulescens)

Science.gov (United States)

Tuggle, B.N.; Crites, John L.

1984-01-01

Three species of trichostrongylid nematodes were removed from the gizzards of 25 lesser snow geese, Chen caerulescens caerulescens, collected at Winisk, Ont. A 100% prevalence of infection was noted in the sampled population with each bird harboring two or more of the following species: Epomidiostomum crami (prevalence, 92%; mean intensity, 18.7 ± 13.3), Amidostomum anseris (prevalence, 84%; mean intensity, 9.6 ± 9.8), and Amidostomum spatulatum (prevalence, 84%; mean intensity, 11.2 ± 9.8). When large burdens (>30) of both A. anseris and A. spatulatum were present in the mucosal lining of the gizzard, progressive degeneration of the epithilium and koilin linings was noted in 16% of the geese examined. Severe necrotic granulomata observed in the gizzard muscle of 36% of the geese were associated with sizable burdens (>25) of E. crami which were found burrowed in the gizzard muscle.

Chlorpromazine-induced perturbations of bile acids and free fatty acids in cholestatic liver injury prevented by the Chinese herbal compound Yin-Chen-Hao-Tang.

Science.gov (United States)

Yang, Qiaoling; Yang, Fan; Tang, Xiaowen; Ding, Lili; Xu, Ying; Xiong, Yinhua; Wang, Zhengtao; Yang, Li

2015-04-16

Yin-Chen-Hao-Tang (YCHT), a commonly used as a traditional chinese medicine for liver disease. Several studies indicated that YCHT may improving hepatic triglyceride metabolism and anti-apoptotic response as well as decreasing oxidative stress .However, little is known about the role of YCHT in chlorpromazine (CPZ) -induced chlolestatic liver injury. Therefore, we aimed to facilitate the understanding of the pathogenesis of cholestatic liver injury and evaluate the effect of Yin-Chen-Hao-Tang (YCHT) on chlorpromazine (CPZ)-induced cholestatic liver injury in rats based on the change of bile acids (BAs) and free fatty acids (FFAs) alone with the biochemical indicators and histological examination. We conducted an experiment on CPZ-induced cholestatic liver injury in Wistar rats with and without YCHT for nine consecutive days. Serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB), total bilirubin (TBIL), total cholesterol (TC), triglycerides (TG), low density lipoprotein-cholesterol (LDL-C) were measured to evaluate the protective effect of YCHT against chlorpromazine (CPZ)-induced cholestatic liver injury. Histopathology of the liver tissue showed that pathological injuries were relieved after YCHT pretreatment. In addition, ultra-performance lipid chromatography coupled with quadrupole mass spectrometry (UPLC-MS) and gas chromatography coupled with mass spectrometry (GC-MS) was applied to determine the content of bile acids, free fatty acids, respectively. Obtained data showed that YCHT attenuated the effect of CPZ-induced cholestatic liver injury, which was manifested by the serum biochemical parameters and histopathology of the liver tissue. YCHT regulated the lipid levels as indicated by the reversed serum levels of TC, TG, and LDL-C. YCHT also regulated the disorder of BA and FFA metabolism by CPZ induction. Results indicated that YCHT exerted a protective effect on CPZ-induced cholestasis liver injury. The variance of

Writing Beyond the Wall: Translation, Cross-cultural Exchange, and Chen Ran's 'A Private Life'

Directory of Open Access Journals (Sweden)

Kay Schaffer

2006-09-01

Full Text Available The past decade has witnessed an unprecedented rise in the global flow of knowledge, nowhere more apparent in the exchange of ideas between China and modern western democracies. Our interest concerns one aspect of this global flow— the translation of Chinese women’s autobiographical writing into English. Taking Chen Ran’s A Private Life (English edition, 2004 as a point of departure, the paper explores issues of translingual practice and cross-cultural exchange. It considers what escapes or is lost in translation as well as the additive potential of the host text. It is sometimes the case that the translation can deliberately make certain ambiguities visible—whether from pragmatic, market-driven motivations or from more complex political, historical and cultural considerations. These negotiations of meaning that occur in the translation process can reverberate on the critical reception of texts in both the ‘guest’ and ‘host’ languages (Liu 1995, with open-ended, incomplete and indeterminate effects. The paper examines the effects of the omission of a brief parenthetical section of three paragraphs from one chapter of the Chinese edition of A Private Life. Yet, even that small emendation changes the original text as a cultural object and alters potential modes of its reception. In this case, the translation results in a loss of ambiguity, irony, philosophic and rhetorical sophistication while also offering additive potentials that enhance the generation of new meanings in the translingual exchange, here with reference Tiananmen and contemporary feminism in China. The translation process provides new channels for readers, writers and theorists to dialogue and communicate across gaps of difference, despite inhibiting factors like the imposition of local restraints, the universalising pressures of western modernity, and asymmetrical relations of power between guest and host language contexts.

Inhibition of Neoplastic Transformation and Chemically-Induced Skin Hyperplasia in Mice by Traditional Chinese Medicinal Formula Si-Wu-Tang

Directory of Open Access Journals (Sweden)

Mandy M. Liu

2017-03-01

Full Text Available Exploring traditional medicines may lead to the development of low-cost and non-toxic cancer preventive agents. Si-Wu-Tang (SWT, comprising the combination of four herbs, Rehmanniae, Angelica, Chuanxiong, and Paeoniae, is one of the most popular traditional Chinese medicines for women’s diseases. In our previous studies, the antioxidant Nrf2 pathways were strongly induced by SWT in vitro and in vivo. Since Nrf2 activation has been associated with anticarcinogenic effects, the purpose of this study is to evaluate SWT’s activity of cancer prevention. In the Ames test, SWT demonstrated an antimutagenic activity against mutagenicity induced by the chemical carcinogen 7,12-dimethylbenz(aanthracene (DMBA. In JB6 P+ cells, a non-cancerous murine epidermal model for studying tumor promotion, SWT inhibited epidermal growth factor (EGF-induced neoplastic transformation. The luciferase reporter gene assays demonstrated that SWT suppressed EGF-induced AP-1 and TNF-α-induced NF-κB activation, which are essential factors involved in skin carcinogenesis. In a DMBA-induced skin hyperplasia assay in ‘Sensitivity to Carcinogenesis’ (SENCAR mice, both topical and oral SWT inhibited DMBA-induced epidermal hyperplasia, expression of the proliferation marker Proliferating cell nuclear antigen (PCNA, and H-ras mutations. These findings demonstrate, for the first time, that SWT prevents tumor promoter and chemical-induced carcinogenesis in vitro and in vivo, partly by inhibiting DNA damage and blocking the activation of AP-1 and NF-κB.

Parameter identification of chaos system based on unknown parameter observer

International Nuclear Information System (INIS)

Wang Shaoming; Luo Haigeng; Yue Chaoyuan; Liao Xiaoxin

2008-01-01

Parameter identification of chaos system based on unknown parameter observer is discussed generally. Based on the work of Guan et al. [X.P. Guan, H.P. Peng, L.X. Li, et al., Acta Phys. Sinica 50 (2001) 26], the design of unknown parameter observer is improved. The application of the improved approach is extended greatly. The works in some literatures [X.P. Guan, H.P. Peng, L.X. Li, et al., Acta Phys. Sinica 50 (2001) 26; J.H. Lue, S.C. Zhang, Phys. Lett. A 286 (2001) 148; X.Q. Wu, J.A. Lu, Chaos Solitons Fractals 18 (2003) 721; J. Liu, S.H. Chen, J. Xie, Chaos Solitons Fractals 19 (2004) 533] are only the special cases of our Corollaries 1 and 2. Some observers for Lue system and a new chaos system are designed to test our improved method, and simulations results demonstrate the effectiveness and feasibility of the improved approach

Mobile Authoring of Open Educational Resources as Reusable Learning Objects

Directory of Open Access Journals (Sweden)

Dr Kinshuk

2013-06-01

Full Text Available E-learning technologies have allowed authoring and playback of standardized reusable learning objects (RLO for several years. Effective mobile learning requires similar functionality at both design time and runtime. Mobile devices can play RLO using applications like SMILE, mobile access to a learning management system (LMS, or other systems which deploy content to mobile learners (Castillo & Ayala, 2008; Chu, Hwang, & Tseng, 2010; Hsu & Chen, 2010; Nakabayashi, 2009; Zualkernan, Nikkhah, & Al-Sabah, 2009. However, implementations which author content in a mobile context do not typically permit reuse across multiple contexts due to a lack of standardization. Standards based (IMS and SCORM authoring implementations exist for non-mobile platforms (Gonzalez-Barbone & Anido-Rifon, 2008; Griffiths, Beauvoir, Liber, & Barrett-Baxendale, 2009; Téllez, 2010; Yang, Chiu, Tsai, & Wu, 2004. However, this paradigm precludes capturing learning where and when it occurs. Consequently, RLO authored for e-learning lack learner generated content, especially with timely, relevant, and location aware examples.

Redescription of the Indo-West Pacific scorpionfish (Scorpaenidae), Neomerinthe erostris (Alcock 1896), a senior synonym of Scorpaena gibbifrons Fowler 1938, N. rotunda Chen 1981, and N. bathyperimensis Zajonz & Klausewitz 2002.

Science.gov (United States)

Motomura, Hiroyuki; Causse, Romain; Béarez, Philippe; Mishra, Subhrendu Sekhar

2015-09-29

The Indo-West Pacific species, Neomerinthe erostris (Alcock 1896), originally described as Scorpaena erostris, is redescribed as a senior synonym of Scorpaena gibbifrons Fowler 1938, N. rotunda Chen 1981, and N. bathyperimensis Zajonz & Klausewitz 2002. Although the latter three nominal species have been regarded as valid species and N. erostris has not been reported since 1898, examinations of type specimens of the four nominal species revealed that they represent a single species. A lectotype of Scorpaena erostris is herein designated. Neomerinthe erostris is characterized by having a distinct longitudinal ridge on the lateral surface of the maxilla and a strongly rounded dorsal profile of the head.

Status and perspectives of the dismantling of nuclear power plants in Germany (Dismantling monitoring 2015); Stand und Perspektiven des Rueckbaus von Kernkraftwerken in Deutschland (''Rueckbau-Monitoring 2015'')

Energy Technology Data Exchange (ETDEWEB)

Wealer, Ben; Seidel, Jan Paul [Technische Univ. Berlin (Germany); Gerbaulet, Clemens; Hirschhausen, Christian von [Technische Univ. Berlin (Germany); Deutsches Institut fuer Wirtschaftsforschung, Berlin (Germany)

2015-11-15

The dismantling monitoring 2015 covers the nuclear power plants HDR Grosswelzheim, Niederaichbach (KKN), MZFR Karlsruhe, Lingen (KWL), Gundremmingen unit A (KRB-A), VAK Kahl, Muehlheim-Kaerlich (KMK), THTR-300 Hamm-Uentrop, AVR Juelich, Greifswald (KGR 1-5), KNK II Karlsruhe, Rheinsberg (KKR), Wuergassen (KWW), Stade (KKS), Obrigheim (KWO), SNR 300. The post-operational phase activities of other shut-down nuclear power plants and the active companies are summarized.

The complete mitochondrial genome of the styloperlid stonefly species Styloperla spinicercia Wu (Insecta: Plecoptera) with family-level phylogenetic analyses of the Pteronarcyoidea.

Science.gov (United States)

Wang, Ying; Cao, Jinjun; Li, Weihai

2017-03-13

We present the complete mitochondrial (mt) genome sequence of the stonefly, Styloperla spinicercia Wu, 1935 (Plecoptera: Styloperlidae), the type species of the genus Styloperla and the first complete mt genome for the family Styloperlidae. The genome is circular, 16,129 base pairs long, has an A+T content of 70.7%, and contains 37 genes including the large and small ribosomal RNA (rRNA) subunits, 13 protein coding genes (PCGs), 22 tRNA genes and a large non-coding region (CR). All of the PCGs use the standard initiation codon ATN except ND1 and ND5, which start with TTG and GTG. Twelve of the PCGs stop with conventional terminal codons TAA and TAG, except ND5 which shows an incomplete terminator signal T. All tRNAs have the classic clover-leaf structures with the dihydrouridine (DHU) arm of tRNASer(AGN) forming a simple loop. Secondary structures of the two ribosomal RNAs are presented with reference to previous models. The structural elements and the variable numbers of tandem repeats are described within the control region. Phylogenetic analyses using both Bayesian (BI) and Maximum Likelihood (ML) methods support the previous hypotheses regarding family level relationships within the Pteronarcyoidea. The genetic distance calculated based on 13 PCGs and two rRNAs between Styloperla sp. and S. spinicercia is provided and interspecific divergence is discussed.

The 2nd International Conference on Water Resource and Environment (WRE 2016

Directory of Open Access Journals (Sweden)

Zhouli Liu

2016-11-01

Full Text Available Table of contents 01 The eco-toxicological effects of cadmium stress on five ornamental plants Zhouli Liu, Wei Chen, Xingyuan He, Shuai Yu, Weihang Ding 02 Study on the formation and release mechanisms of hydrogen sulfide in Longtan coal mine Jianjun Liu, Yuliang Wu, Kaixiang Fan 03 Coral bleaching in the North Reef of China’s Xisha Islands in 2014 Yuanchao Li, Xinqing Zheng, Shiquan Chen, Haiqun Xie 04 Soil chemical characteristics in a Cunninghamia lanceolata stand suffering from ice-snow damage Jie Li, Zhuomin Wang, Li Xue 05 Diversity of understory vegetation was under a Cunninghamia lanceolata stand suffering from ice-snow damage Zhiyang Lie, Weilong Huang, Tongtong Zhou, Li Xue 06 The effect of water, nitrogen and harvesting time on yield and biomass allocation of Helianthus tuberosus L. Kai Gao, Tiexia Zhu 07 The vertical variation of microbial communities in the sediment of sea cucumber pond Weiteng Mao, Pei Yu, Xinfang Lv, Yunchun Li 08 Indicating significances of alpine plant functional groups to environmental change Peixi Su, Rui Shi 09 Research on the daily CH4 fluxes of soil in summer mangrove community at Yingluogang of Guangxi, China Yong Jiang, Xingbin Chen, Shichu liang 10 Beach protection structures in middle and lower reaches of Yangtze River Junfeng Xu 11 Social responsibility management of large dam project with owner as core: an empirical case in China Jiwei Zhu, Zhao Zhai, Linan Zhou, Yun Le, Li Cao 12 The ecological function value assessment analysis of urban waterfront Jiwei Zhu, Ping Lu, Zhiqian Huang, Bei Zhou 13 Mechanism of diurnal osmotic potential changes and adjustment of three Caragana species in different habitats of the Inner Mongolia Plateau Zhirong Zheng, Shihai Lv, Chaoyang Feng 14 Biodiversity of phytoplankton and environmental influences analysis of Longfeng Wetland, China Nan Song, Yan Liu, Xinxin Lu, Yawen Fan 15 The effect of human activities on culturable soil microbes from Yaoquan Mountain in

Pharmacokinetic determination of ephedrine in Herba Ephedrae and Wu Tou Tang decoctions in rats using ultra performance liquid chromatography tandem mass spectrometry.

Science.gov (United States)

Zheng, Zhijie; Yan, Tongmeng; Chen, Weiying; Ye, Ling; Tang, Lan; Liu, Zhongqiu

2012-08-01

A rapid and sensitive ultra performance liquid chromatography tandem mass spectrometry method was developed and validated for the determination and quantification of ephedrine in rat plasma samples. An Acquity UPLC BEH C18 column (1.7 μm, 2.1 mm × 50 mm) was used for chromatographic separation. Electrospray ionization in the positive mode was used, and the precursor-fragment ion pairs of m/z 166/148 and m/z 289/97 were adopted to characterize ephedrine and testosterone (internal standard), respectively. The method was validated using 10, 100 and 500 ng/mL of ephedrine. It demonstrated adequate levels of precision and accuracy, matrix effect, extraction recovery and stability. Linearity over the concentration range of 0.5-2000 ng/mL was acceptable with a correlation coefficient (r²) better than 0.990. To determine the pharmacokinetic behaviour of this sympathomimetic compound in the Sprague-Dawley rats, ephedrine hydrochloride, Herba Ephedrae single-herb and Wu Tou Tang decoctions were administered orally, and ephedrine hydrochloride was also administered by intravenous injection, and blood samples were collected over 24 h. Ephedrine was measured in plasma and pharmacokinetic parameters were determined by using the standard non-compartmental method and calculated by using Practical Pharmacokinetic Program-Version 87/97. The AUC(0-t) and T(max) values were significantly different (p Tang decoction compared to the other oral treatments, suggesting that some components in the decoction may reduce the bioavailability of ephedrine.

Structural and Biochemical Characterization of BdsA from Bacillus subtilis WU-S2B, a Key Enzyme in the “4S” Desulfurization Pathway

Directory of Open Access Journals (Sweden)

Tiantian Su

2018-02-01

Full Text Available Dibenzothiophene (DBT and their derivatives, accounting for the major part of the sulfur components in crude oil, make one of the most significant pollution sources. The DBT sulfone monooxygenase BdsA, one of the key enzymes in the “4S” desulfurization pathway, catalyzes the oxidation of DBT sulfone to 2′-hydroxybiphenyl 2-sulfonic acid (HBPSi. Here, we determined the crystal structure of BdsA from Bacillus subtilis WU-S2B, at the resolution of 2.2 Å, and the structure of the BdsA-FMN complex at 2.4 Å. BdsA and the BdsA-FMN complex exist as tetramers. DBT sulfone was placed into the active site by molecular docking. Seven residues (Phe12, His20, Phe56, Phe246, Val248, His316, and Val372 are found to be involved in the binding of DBT sulfone. The importance of these residues is supported by the study of the catalytic activity of the active site variants. Structural analysis and enzyme activity assay confirmed the importance of the right position and orientation of FMN and DBT sulfone, as well as the involvement of Ser139 as a nucleophile in catalysis. This work combined with our previous structure of DszC provides a systematic structural basis for the development of engineered desulfurization enzymes with higher efficiency and stability.

Wake-up radio systems : design, development, performance evaluation and comparison to conventional medium access control protocols for wireless sensor networks

OpenAIRE

Oller i Bosch, Joaquim

2015-01-01

During the recent years, the research related to Wake-up Radio (WuR) systems has gained noticeable interest. In WuR systems, a node initiating a communication first sends a Wake-up Call (WuC) by means of its Wake-up Transmitter (WuTx), to the Wake-up Receiver (WuRx) of a remote node to activate it in an on-demand manner. Until the reception of the WuC, the node's MCU and main data transceiver are in sleep mode. Hence, WuR drastically reduce the power required by wireless nodes. This thesis...

Dating young tephras - a distal solution to proximal controversy

Science.gov (United States)

Chen, Xuanyu; Blockley, Simon; Xu, Yigang; Menzies, Martin

2017-04-01

In-situ dating of young volcanic rocks (environmental data. Assessment of the temporal and spatial variations of such climatic events will help us better understand the dynamics of these rapid and short-lived climatic episodes. References: Broecker, W.S., 2001. Was the Medieval Warm Period Global? Science, 291(5508): 1497-1499. Chen, X.-Y., Blockley, S.P.E., Tarasov, P.E., Xu, Y.-G., McLean, D., Tomlinson, E.L., Albert, P.G., Liu, J.-Q., Müller, S., Wagner, M. and Menzies, M.A., 2016. Clarifying the distal to proximal tephrochronology of the Millennium (B-Tm) eruption, Changbaishan Volcano, northeast China. Quat. Geochronol., 33: 61-75. Ge, Q. and Wu, W., 2011. Climate during the Medieval Climate Anomaly in China. PAGES news, 19: 24-26. Sun, C., Plunkett, G., Liu, J., Zhao, H., Sigl, M., McConnell, J.R., Pilcher, J.R., Vinther, B., Steffensen, J.P. and Hall, V., 2014. Ash from Changbaishan Millennium eruption recorded in Greenland ice: Implications for determining the eruption's timing and impact. Geophys. Res. Lett., 2013GL058642.

Two days of films

CERN Document Server

2011-01-01

The Chinese community at CERN and the CERN CineClub, on the occasion of the Chinese New Year, invite everyone to two days of films Thursday 3 February 2011 at 20:30 - CERN Council Chamber Eat drink man woman Directed by Ang LEE (Taiwan, 1994) 122 min. With Sihung Lung, Yu-Wen Wang, Chien-Lien Wu, Kuei-Mei Yang Senior Master Chef Chu lives in a large house in Taipei with his three unmarried daughters, Jia-Jen, a chemistry teacher converted to Christianity, Jia-Chien, an airline executive, and Jia-Ning, a student who also works in a fast food restaurant. Life in the house revolves around the ritual of an elaborate dinner each Sunday, and the love lives of all the family members. Original version Mandarin with English subtitles Friday 4 February 2011 at 19:30 - CERN Council Chamber Adieu, ma concubine Directed by Chen KAIGE (China / Hong Kong, 1993) 171 min. With Leslie Cheung, Fengyi Zhang, Li Gong "Farewell, My Concubine" is a movie with two parallel, intertwined stories. It is the story of two performers in t...

Identification of Multiple Ingredients for a Traditional Chinese Medicine Preparation (Bu-yang-huan-wu-tang by Liquid Chromatography Coupled with Tandem Mass Spectrometry

Directory of Open Access Journals (Sweden)

Tung-Hu Tsai

2013-09-01

Full Text Available Bu-yang-huan-wu-tang (BYHWT is a popular Traditional Chinese Medicine formula consisting of seven herbal medicines (Astragalus membranaceus, Angelica sinensis, Paeonia lactiflora, Ligusticum chuanxiong, Carthamus tinctorius, Amygdalus persica and Pheretima aspergillum, that has been used in China for centuries to overcome stroke-induced disability. To ensure the consistency of quality, a reliable analytical method is required, therefore, we developed a liquid chromatography with tandem mass spectrometry (LC-MS/MS method for quantitative analysis of the major constituents in BYHWT. The herbal ingredients consisting of the cycloartane-type triterpene glycosides of astragaloside I, astragaloside II and astragaloside IV; isoflavones of formononetin, ononin calycosin, calycosin-7-O-β-d-glucoside; ligustilide and paeoniflorin were separated on a C18 column with gradient elution of methanol/10 mM ammonium acetate buffer–formic acid (100:0.1, v/v. This study was performed by a mass spectrometer using electrospray ionization (ESI with positive ionization ions monitored in the multiple reaction-monitoring (MRM mode. The linearity, accuracy, precision, limit of detection (LOD and lower limit of quantification (LLOQ were validated for this quantification method, and the sensitivity, reliability and reproducibility were all confirmed. The experiments provided a good method for analyzing BYHWT extracts. This study also quantitated the active components in various brands of commercially available products. The results indicated that the pharmaceutical industrial products of BYHWT exhibited considerable variation in their contents of the herbal compounds.

Contamination and Human Health Risk Assessment of Polycyclic Aromatic Hydrocarbons (PAHs) in Oysters After the Wu Yi San Oil Spill in Korea.

Science.gov (United States)

Loh, Andrew; Yim, Un Hyuk; Ha, Sung Yong; An, Joon Geon; Kim, Moonkoo

2017-07-01

After the collision of the Singapore-registered oil tanker M/V Wu Yi San into the oil terminal of Yeosu, Korea on January 31, 2014, approximately 900 m 3 of oil and oil mixture were released from the ruptured pipelines. The oil affected more than 10 km of coastline along Gwangyang Bay. Emergency oil spill responses recovered bulk oil at sea and cleaned up the stranded oil on shore. As part of an emergency environmental impact assessment, region-wide monitoring of oil contamination in oyster had been conducted for 2 months. Highly elevated concentrations of polycyclic aromatic hydrocarbons (PAHs) were detected at most of the spill affected sites. Four days after the spill, the levels of PAHs in oysters increased dramatically to 627-81,000 ng/g, the average of which was 20 times higher than those found before the spill (321-4040 ng/g). The level of PAHs in these oysters increased until 10 days after the spill and then decreased. Due to the strong tidal current and easterly winter winds, the eastern part of the Bay-the Namhae region-was heavily contaminated compared with other regions. The accumulation and depuration of spilled oil in oyster corresponded with the duration and intensity of the cleanup activities, which is the first field observation in oil spill cases. Human health risk assessments showed that benzo[a]pyrene equivalent concentrations exceeded levels of concern in the highly contaminated sites, even 60 days after the spill.

New World species of the genus Calliscelio Ashmead (Hymenoptera, Platygastridae, Scelioninae

Directory of Open Access Journals (Sweden)

Hua-yan Chen

2017-01-01

Full Text Available The genus Calliscelio Ashmead is presumed to be a diverse group of parasitoids of the eggs of crickets (Orthoptera: Gryllidae. A least one species has been found to be an important factor in depressing cricket pest populations. The New World species of Calliscelio are revised. Forty-two species are recognized, 3 are redescribed: C. bisulcatus (Kieffer, C. laticinctus Ashmead, C. rubriclavus (Ashmead, comb. n.; and 38 are described as new: C. absconditum Chen & Johnson, sp. n., C. absum Chen & Johnson, sp. n., C. alcoa Chen & Masner, sp. n., C. amadoi Chen & Johnson, sp. n., C. armila Chen & Masner, sp. n., C. bidens Chen & Masner, sp. n., C. brachys Chen & Johnson, sp. n., C. brevinotaulus Chen & Johnson, sp. n., C. brevitas Chen & Johnson, sp. n., C. carinigena Chen & Johnson, sp. n., C. crater Chen & Johnson, sp. n., C. crena Chen & Johnson, sp. n., C. eboris Chen & Johnson, sp. n., C. extenuatus Chen & Johnson, sp. n., C. flavicauda Chen & Johnson, sp. n., C. foveolatus Chen & Johnson, sp. n., C. gatineau Chen & Johnson, sp. n., C. glaber Chen & Masner, sp. n., C. granulatus Chen & Masner, sp. n., C. latifrons Chen & Johnson, sp. n., C. levis Chen & Johnson, sp. n., C. longius Chen & Johnson, sp. n., C. magnificus Chen & Masner, sp. n., C. migma Chen & Johnson, sp. n., C. minutia Chen & Johnson, sp. n., C. paraglaber Chen & Johnson, sp. n., C. pararemigio Chen & Masner, sp. n., C. prolixus Chen & Johnson, sp. n., C. punctatifrons Chen & Johnson, sp. n., C. remigio Chen & Masner, sp. n., C. ruga Chen & Johnson, sp. n., C. rugicoxa Chen & Masner, sp. n., C. sfina Chen & Johnson, sp. n., C. storea Chen & Johnson, sp. n., C. suni Chen & Johnson, sp. n., C. telum Chen & Johnson, sp. n., C. torqueo Chen & Johnson, sp. n., C. virga Chen & Johnson, sp. n. Four species are treated as junior synonyms of Calliscelio rubriclavus (Ashmead: Anteris nigriceps Ashmead, syn. n., Caloteleia marlattii Ashmead, syn. n., Caloteleia grenadensis Ashmead, syn. n

To the analysis of reactor noise in boiling water reactors

International Nuclear Information System (INIS)

Seifritz, W.

1972-01-01

The paper contains some basic thoughts on the problem of neutron flux oscillations in power reactors. The advantages of self-powered detectors and their function are explained. In addition, noise measurements of the boiling water reactors at Lingen and Holden are described, and the possibilities of an employment of vanadium detectors for the analysis of reactor noise are discussed. The final pages of the paper contain a complete list of the author's publications in the field of reactor noise analysis. (RW/AK) [de

Impact of lymphovascular invasion on recurrence and progression rates in patients with pT1 urothelial carcinoma of bladder after transurethral resection

Directory of Open Access Journals (Sweden)

Sha N

2015-11-01

Full Text Available Nan Sha,* Linguo Xie,* Tao Chen,* Chen Xing, Xiaoteng Liu, Yu Zhang, Zhonghua Shen, Hao Xu, Zhouliang Wu, Hailong Hu, Changli Wu Department of Urology, Tianjin Key Laboratory of Urology, Tianjin Institute of Urology, Second Hospital of Tianjin Medical University, Tianjin, People’s Republic of China *These authors contributed equally to this work Objective: To evaluate the clinical significance of lymphovascular invasion (LVI on recurrence and progression rates in patients with pT1 urothelial carcinoma of bladder after transurethral resection.Methods: This retrospective study was performed with 155 patients with newly diagnosed pT1 urothelial carcinoma of bladder who were treated with transurethral resection of bladder tumor at our institution from January 2006 to January 2010. The presence or absence of LVI was examined by pathologists. Chi-square test was performed to identify the correlations between LVI and other clinical and pathological features. Kaplan–Meier method was used to estimate the recurrence-free survival (RFS and progression-free survival curves and difference was determined by the log-rank test. Univariate and multivariate analyses were performed to determine the predictive factors through a Cox proportional hazards analysis model.Results: LVI was detected in a total of 34 patients (21.9%. While LVI was associated with high-grade tumors (P<0.001 and intravesical therapy (P=0.009. Correlations with age (P=0.227, sex (P=0.376, tumor size (P=0.969, tumor multiplicity (P=0.196, carcinoma in situ (P=0.321, and smoking (P=0.438 were not statistically significant. There was a statistically significant tendency toward higher recurrence rate and shorter RFS time in LVI-positive patients. However, no statistically significant differences were observed in progression rate between the two groups. Moreover, multivariate Cox proportional hazards analysis revealed that LVI, tumor size, and smoking were independent prognostic predictors of

Intravenous chemotherapy combined with intravesical chemotherapy to treat T1G3 bladder urothelial carcinoma after transurethral resection of bladder tumor: results of a retrospective study

Directory of Open Access Journals (Sweden)

Zhang Y

2016-01-01

Full Text Available Yu Zhang,1,* Linguo Xie,1,* Tao Chen,1,* Wanqin Xie,2 Zhouliang Wu,1 Hao Xu,1 Chen Xing,1 Nan Sha,1 Zhonghua Shen,1 Yunkai Qie,1 Xiaoteng Liu,1 Hailong Hu,1 Changli Wu1 1Department of Urology, The Second Hospital of Tianjin Medical University, Tianjin Institute of Urology, Tianjin, 2Key Laboratory of Genetics and Birth Health of Hunan Province, The Family Planning Research Institute of Hunan Province, Changsha, People’s Republic of China *These authors contributed equally to this work Objective: The management of stage 1 and grade 3 (T1G3 bladder cancer continues to be controversial. Although the transurethral resection of bladder tumor (TURBT followed by intravesical chemotherapy is a conservative strategy for treatment of T1G3 bladder cancer, a relatively high risk of tumor recurrence and progression remains regarding the therapy. This study aimed to compare the efficacy of intravenous chemotherapy combined with intravesical chemotherapy versus intravesical chemotherapy alone for T1G3 bladder cancer after TURBT surgery. Methods: We retrospectively reviewed the cases of 457 patients who were newly diagnosed with T1G3 bladder urothelial carcinoma between January 2009 and March 2014. After TURBT, 281 patients received intravesical chemotherapy alone, whereas 176 patients underwent intravesical chemotherapy in combination with intravenous chemotherapy. Tumor recurrence and progression were monitored periodically by urine cytology and cystoscopy in follow-up. Recurrence-free survival and progression-free survival of the two chemotherapy strategies following TURBT were analyzed. Univariable and multivariable Cox hazards analyses were performed to predict the prognostic factors for tumor recurrence and progression. Results: The tumor recurrence rate was 36.7% for patients who received intravesical chemotherapy alone after TURBT, compared with 19.9% for patients who received intravenous chemotherapy combined with intravesical chemotherapy after

Clinical effectiveness, toxicity, and failure patterns of helical tomotherapy for postoperative oral cavity cancer patients

Directory of Open Access Journals (Sweden)

Hsieh CH

2014-03-01

Full Text Available Chen-Hsi Hsieh,1–3 Pei-Wei Shueng,1,4 Li-Ying Wang,5 Li-Jen Liao,6 Yu-Chin Lin,7 Ying-Shiung Kuo,8 Wu-Chia Lo,6 Chien-Fu Tseng,8 Hui-Ju Tien,1 Hsiu-Ling Chou,9,10 Yen-Ping Hsieh,11 Le-Jung Wu,1 Yu-Jen Chen3,12–14 1Department of Radiation Oncology, Far Eastern Memorial Hospital, 2Department of Medicine, 3Institute of Traditional Medicine, School of Medicine, National Yang-Ming University, 4Department of Radiation Oncology, National Defense Medical Center, 5School and Graduate Institute of Physical Therapy, College of Medicine, National Taiwan University, 6Department of Otolaryngology, 7Division of Medical Oncology and Hematology, Department of Internal Medicine, 8Department of Dentistry and Oral Surgery, 9Department of Nursing, Far Eastern Memorial Hospital, 10Department of Nursing, Oriental Institute of Technology, Taipei, 11Department of Senior Citizen Service Management, National Taichung University of Science and Technology, Taichung, 12Department of Radiation Oncology, 13Department of Medical Research, Mackay Memorial Hospital, 14Graduate Institute of Sport Coaching Science, Chinese Culture University, Taipei, Taiwan Background: The outcome of postoperative high- and intermediate-risk oral cavity cancer (OCC patients receiving helical tomotherapy (HT remains limited. Materials and methods: Between November 2006 and November 2012, 53 postoperative high- and intermediate-risk OCC patients treated with HT were enrolled. Results: The 4-year locoregional, local, and regional control rates were 66%, 76.4%, and 94.3%, respectively. The 4-year locoregional control rates of oral tongue and buccal mucosa cancer were 88.3% and 37.1%, respectively (P=0.012. Eleven (20.8% patients experienced locoregional failure. In-field failure occurred in six of 53 (11.3% in the primary area and three of 53 (5.7% in the regional lymph-node area. No marginal failure was noted. Two of 53 (3.8% experienced out-of-field failure. The rates of grade 3 dermatitis

Nanoemulsion as a strategy for improving the oral bioavailability and anti-inflammatory activity of andrographolide

Directory of Open Access Journals (Sweden)

Yen CC

2018-01-01

Full Text Available Ching-Chi Yen,1 Yi-Chen Chen,1 Ming-Tsang Wu,2 Chia-Chi Wang,1,3 Yu-Tse Wu1,4 1School of Pharmacy, College of Pharmacy, Kaohsiung Medical University, Kaohsiung, Taiwan; 2Chinese Medicine Department, Ditmanson Medical Foundation, Chiayi Christian Hospital, Chiayi City, Taiwan; 3PhD Program in Toxicology, College of Pharmacy, Kaohsiung Medical University, Kaohsiung, Taiwan; 4Department of Medical Research, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan Background: Andrographolide (AG, a compound with low water solubility, possesses various pharmacological activities, particularly anti-inflammatory activity. However, its low oral bioavailability is a major obstacle to its potential use. This study developed and optimized an AG-loaded nanoemulsion (AG-NE formulation to improve AG oral bioavailability and its protective effects against inflammatory bowel disease. Methods: A high-pressure homogenization technique was used to prepare the AG-NE and solubility, viscosity, and droplet size tests were conducted to develop the optimized AG-NE composed of α-tocopherol, ethanol, Cremophor EL, and water. The permeability was assessed using everted rat gut sac method and in vivo absorption and anti-inflammatory effect in rats was also evaluated. The plasma concentration of AG was determined using our validated high performance liquid chromatography method, which was used to generate a linear calibration curve over the concentration range of 0.1–25 µg/mL in rat plasma (R2>0.999.Results: The optimized AG-NE had a droplet size of 122±11 nm confirmed using transmission electron microscopy and a viscosity of 28 centipoise (cps. It was stable at 4 and 25°C for 90 days. An ex vitro intestinal permeability study indicated that the jejunum was the optimal site for AG absorption from the optimized AG-NE, which was 8.21 and 1.40 times higher than that from an AG suspension and AG ethanol solution, respectively. The pharmacokinetic results indicate that

125I brachytherapy of locally advanced non-small-cell lung cancer after one cycle of first-line chemotherapy：a comparison with best supportive care

Directory of Open Access Journals (Sweden)

Song J

2017-03-01

Full Text Available Jingjing Song* Xiaoxi Fan* Zhongwei Zhao* Minjiang Chen* Weiqian Chen, Fazong Wu, Dengke Zhang, Li Chen, Jianfei Tu, Jiansong Ji Department of Interventional Radiology, Zhejiang University Lishui Hospital, The Fifth Affiliated Hospital of Wenzhou Medical University, Lishui Central Hospital, Lishui, Zhejiang, People’s Republic of China *These authors have contributed equally to this work Objectives: The objective of this study was to assess the efficacy of computed tomography (CT-guided 125I brachytherapy alone in improving the survival and quality of life of patients with unresectable locally advanced non-small-cell lung cancer (NSCLC after one cycle of first-line chemotherapy.Patients and methods: Sixteen patients with locally advanced NSCLC were treated with CT-guided 125I brachytherapy after one cycle of first-line chemotherapy (group A. Sixteen patients who received only best supportive care (group B were matched up with the patients in group A. Primary end point included survival, and secondary end point included assessment of safety, effectiveness of CT-guided 125I brachytherapy, and improvement in the quality of life.Results: The two groups were well balanced in terms of age, disease histology, tumor stage, tumor location, and performance status (P>0.05. The median follow-up time was 16 months (range, 3–30. The total tumor response rate was 75.0% in group A, which was significantly higher than that in group B (0.0% (P<0.01. The median progression-free survival time was 4.80 months for patients in group A and 1.35 months for patients in group B (P<0.001. Kaplan–Meier survival analysis showed that the median survival time of group A was 9.4±0.3 months versus 8.4±0.1 months in group B (P=0.013. Tumor-related symptoms of patients were significantly relieved, and the quality of life was markedly improved in group A than in group B.Conclusion: CT-guided 125I brachytherapy improved the survival of patients with locally advanced

Atrium and HTP fuel elements for the U.S. market

International Nuclear Information System (INIS)

Morgan, J.N.; Krebs, W.D.

1994-01-01

The international acitivities of Siemens in the nuclear fuel sector are the responsibility of the Nuclear Fuel Cycle Unit of the Power Generation Division (KWU) in Germany, the Nuclear Dividion of Siemens Power Corporation (SPC) in the Unites States, and the German Siemens subsidiaries, ANF GmbH (fuel element fabrication) in Lingen and NRG - Nuklearrohr Gesellschaft mbH (cladding tube production) in Duisburg. The requirements of the U.S. market for light water reactor fuel elements are met by products from the European market. (orig.) [de

Taxonomic notes on Neoperla (Plecoptera: Perlidae) from Sichuan Province of China with the description of two new species.

Science.gov (United States)

Li, Weihai; Wang, Ying; Wang, Rongfeng

2017-01-17

Species of the perlid genus Neoperla from Sichuan Province, China are reviewed. Two new species are described, Neoperla caii Li & Wang, sp. nov. and N. emeishana Li & Wang, sp. nov. The new species are compared with related congeners. Available types of several known Neoperla species from Sichuan Province were studied and complementary descriptions or brief taxonomic comments are presented for N. bilineata Wu & Claassen, N. chui Wu & Claassen, N. microtumida Wu & Claassen, N. quadrata Wu & Claassen and N. truncata Wu.

Overview of the KwaZulu-Natal sardine run | van der Lingen | African ...

African Journals Online (AJOL)

This paper provides an introduction to, and overview of, the natural phenomenon known as the KwaZulu-Natal sardine run. Previous literature on this topic and hypotheses about the reasons why, and the mechanisms how, the run occurs are briefly synthesised and described. Papers contributing to this suite that detail more ...

Effects of three warm-up regimens of equal distance on VO2 kinetics during supramaximal exercise in Thoroughbred horses.

Science.gov (United States)

Mukai, K; Hiraga, A; Takahashi, T; Ohmura, H; Jones, J H

2010-11-01

Several studies have indicated that even low-intensity warm-up increases O(2) transport kinetics and that high-intensity warm-up may not be needed in horses. However, conventional warm-up exercise for Thoroughbred races is more intense than those utilised in previous studies of equine warm-up responses. To test the hypothesis that warm-up exercise at different intensities alters the kinetics and total contribution of aerobic power to total metabolic power in subsequent supramaximal (sprint) exercise in Thoroughbred horses. Nine well-trained Thoroughbreds ran until fatigue at 115% of maximal oxygen consumption (VO2max) 10 min after warming-up under each of 3 protocols of equal running distance: 400 s at 30% VO2max (LoWU), 200 s at 60% VO2max (MoWU) and 120 s at 100% VO2max (HiWU). Variables measured during exercise were rates of O(2) and CO(2) consumption/production (VO2,VO2), respiratory exchange ratio (RER), heart rate, blood lactate concentration and accumulation rate and blood gas variables. VO2 was significantly higher in HiWU than in LoWU at the onset of the sprint exercise and HR was significantly higher in HiWU than in LoWU throughout the sprint. Accumulation of blood lactate, RER, P(a)CO(2) and PvCO2 in the first 60 s were significantly lower in HiWU than in LoWU and MoWU. There were no significant differences in stroke volume, run time or arterial-mixed venous O(2) concentration. These results suggest HiWU accelerates kinetics and reduces reliance on net anaerobic power compared with LoWU at the onset of the subsequent sprint. © 2010 EVJ Ltd.

"Is political behavior a viable coping strategy to perceived organizational politics? Unveiling the underlying resource dynamics": Correction to Sun and Chen (2017).

Science.gov (United States)

2017-10-01

Reports an error in "Is Political Behavior a Viable Coping Strategy to Perceived Organizational Politics? Unveiling the Underlying Resource Dynamics" by Shuhua Sun and Huaizhong Chen ( Journal of Applied Psychology , Advanced Online Publication, May 22, 2017, np). In the article, Table 1 contained a formatting error. Correlation coefficient values in the last four cells of column 6 were misplaced with correlation coefficient values in the last four cells of column 7. All versions of this article have been corrected. (The following abstract of the original article appeared in record 2017-22542-001.) We conduct a theory-driven empirical investigation on whether political behavior, as a coping strategy to perceived organizational politics, creates resource trade-offs in moderating the relationship between perceived organizational politics and task performance. Drawing on conservation of resources theory, we hypothesize that political behavior mitigates the adverse effect of perceived organizational politics on task performance via psychological empowerment, yet exacerbates its adverse effect on task performance via emotional exhaustion. Three-wave multisource data from a sample of 222 employees and their 75 supervisors were collected for hypothesis testing. Findings supported our hypotheses. Our study enhances understandings of the complex resource dynamics of using political behavior to cope with perceived organizational politics and highlights the need to move stress-coping research from a focus on the stress-buffering effect of coping on outcomes to a focus on the underlying competing resource dynamics. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Tilfredshedsundersøgelse af Palliativt Team Fyn

DEFF Research Database (Denmark)

Paulsen, Maja Skov

2007-01-01

Behandling af døende patienter i eget hjem kan være en vanskelig og udfor­ drende opgave. Målet med behand­ lingen skifter fra kurativt til lindrende, hvilket udfordrer selvopfattelsen som be­ handler, og samtidig vil palliativ behand­ ling ofte rumme komplicerede medicinsk faglige problemstillin...... problemstillinger samt eksisten­ tielle spørgsmål. Gennem de senere år er der etableret specialiserede palliative teams med udgående funktioner som støtte til de primære behandlere af dø­ ende mennesker....

A Disseminação das Estratégias Corporativas Baseadas no Balanced Scorecard: Um Estudo de Caso em uma Empresa de Prestação de Serviços Ambientais

Directory of Open Access Journals (Sweden)

Maria do Carmo Assis Todorov

2015-01-01

Full Text Available  O balanced scorecard (BSC é uma ferramenta de medição de desempenho, desenvolvida por Norton e Kaplan (1997. Segundo Wu e Chen (2012, Zangoueinezhad e Moshabaki, (2011 e Galas e Forte (2005, o BSC é um método inovador de avaliação de desempenho empresarial, mas a disseminação de seus conceitos e indicadores para todos os níveis hierárquicos da organização, segundo Kaplan e Norton (1999, é um dos fatores críticos na sua implantação. Dentro desse contexto, esta pesquisa teve como objetivo analisar como ocorre a disseminação das estratégias corporativas baseadas no BSC por meio de um estudo de caso em uma empresa de prestação de serviços ambientais. Como resultado, destaca-se que a empresa estudada dissemina as estratégias corporativas por meio de um método organizacional inovador, o Prêmio de Excelência em Gestão, levando em conta as três dimensões da sustentabilidade (econômica, social e ambiental.  

Bose-Einstein condensate in an optical lattice with Raman-assisted two-dimensional spin-orbit coupling

Science.gov (United States)

Pan, Jian-Song; Zhang, Wei; Yi, Wei; Guo, Guang-Can

2016-10-01

In a recent experiment (Z. Wu, L. Zhang, W. Sun, X.-T. Xu, B.-Z. Wang, S.-C. Ji, Y. Deng, S. Chen, X.-J. Liu, and J.-W. Pan, arXiv:1511.08170 [cond-mat.quant-gas]), a Raman-assisted two-dimensional spin-orbit coupling has been realized for a Bose-Einstein condensate in an optical lattice potential. In light of this exciting progress, we study in detail key properties of the system. As the Raman lasers inevitably couple atoms to high-lying bands, the behaviors of the system in both the single- and many-particle sectors are significantly affected. In particular, the high-band effects enhance the plane-wave phase and lead to the emergence of "roton" gaps at low Zeeman fields. Furthermore, we identify high-band-induced topological phase boundaries in both the single-particle and the quasiparticle spectra. We then derive an effective two-band model, which captures the high-band physics in the experimentally relevant regime. Our results not only offer valuable insights into the two-dimensional lattice spin-orbit coupling, but also provide a systematic formalism to model high-band effects in lattice systems with Raman-assisted spin-orbit couplings.

The 2nd International Conference on Agricultural and Biological Sciences (ABS 2016

Directory of Open Access Journals (Sweden)

Lei Pei

2016-10-01

Salvia of Labiatae in China Xiaojuan Li, Ning Xu, Guofu Zhou, Ming Wan, Qi Lin, Fanyun Meng, Jianxiu Li 15 Three pulling resistance models of pioneer plant in landslide area Yichang Chen, Koayung Yu, Chunpin Chang 16 The comparison of physiological and biochemical mechanisms of Reaumuria soongorica and Salsola passerine in different growth pattern Zijuan Zhou, Peixi Su, Rui Shi, Tingting Xie 17 Resources use efficiency of the cosmopolitan plant Potentilla anserina L. in different alpine habitats in China Rui Shi, Peixi Su, Zijuan Zhou 18 Cloning of PPDK gene from Red Amaranand transformation of Alfalfa Xuelan Liu, Yan Zhang, Xiangfa Wei 19 Variation and cluster analysis of morphological characters and nutrient content of Chucrasia tabularis seed Chong Wu, Yanlei Yin, Lijuan Feng, Xuemei Yang, Fei Wang 20 Effect of the planting density of the areca nut on the growth of intercropped Vanilla Hua Wang, Huifa Zhuang, Zihui Zhu, Hui Wang

[A molecular epidemiological study of KI polyomavirus and WU polyomavirus in children with acute respiratory infection in Tianjin, China].

Science.gov (United States)

Lin, Shu-Xiang; Wang, Wei; Guo, Wei; Yang, Hong-Jiang; Ma, Bai-Cheng; Fang, Yu-Lian; Xu, Yong-Sheng

2017-07-01

To investigate the relationship of KI polyomavirus (KIPyV) and WU polyomavirus (WUPyV) with acute respiratory infection in children in Tianjin, China. A total of 3 730 nasopharyngeal secretions were collected from hospitalized children with acute respiratory infection in Tianjin Children's Hospital from January 2011 to December 2013. Viral nucleic acid was extracted, and virus infection (KIPyV and WUPyV) was determined by PCR. Some KIPyV-positive and WUPyV-positive PCR products were subjected to sequencing. Sequencing results were aligned with the known gene sequences of KIPyV and WUPyV to construct a phylogenetic tree. Amplified VP1 fragments of KIPyV were inserted into the cloning vector (PUCm-T) transformed into E. coli competent cells. Positive clones were identified by PCR and sequencing. The nucleotide sequences were submitted to GenBank. In addition, another seven common respiratory viruses in all samples were detected by direct immunofluorescence assay. In the 3 730 specimens, the KIPyV-positive rate was 12.14% (453/3 730) and the WUPyV-positive rate was 1.69% (63/3 730). The mean infection rate of KIPyV was significantly higher in June and July, while the mean infection rate of WUPyV peaked in February and March. Most of the KIPyV-positive or WUPyV-positive children were infections with KIPyV, WUPyV, and other respiratory viruses were observed in the children. The co-infection rate was 2.31% (86/3 730) and there were nine cases of co-infections with WUPyV and KIPyV. Thirty-five KIPyV-positive and twelve WUPyV-positive PCR products were sequenced and the alignment analysis showed that they had high homology with the known sequences (94%-100% vs 95%-100%). The VP1 gene sequences obtained from two KIPyV strains in this study were recorded in GenBank with the accession numbers of KY465925 and KY465926. For some children with acute respiratory infection in Tianjin, China, the acute respiratory infection may be associated with KIPyV and WUPy

ACUTE EFFECTS OF STATIC STRETCHING, DYNAMIC EXERCISES, AND HIGH VOLUME UPPER EXTREMITY PLYOMETRIC ACTIVITY ON TENNIS SERVE PERFORMANCE

Directory of Open Access Journals (Sweden)

Ertugrul Gelen

2012-12-01

Full Text Available The purpose of this study was to compare the acute effects of static stretching; dynamic exercises and high volume upper extremity plyometric activity on tennis serve performance. Twenty-six elite young tennis players (15.1 ± 4.2 years, 167.9 ± 5.8 cm and 61.6 ± 8.1 kg performed 4 different warm-up (WU routines in a random order on non-consecutive days. The WU methods consisted of traditional WU (jogging, rally and serve practice (TRAD; traditional WU and static stretching (TRSS; traditional WU and dynamic exercise (TRDE; and traditional WU and high volume upper extremity plyometric activity (TRPLYP. Following each WU session, subjects were tested on a tennis serve ball speed test. TRAD, TRSS, TRDE and TRPLYO were compared by repeated measurement analyses of variance and post-hoc comparisons. In this study a 1 to 3 percent increase in tennis serve ball speed was recorded in TRDE and TRPLYO when compared to TRAD (p 0.05. ICCs for ball speed showed strong reliability (0.82 to 0.93 for the ball speed measurements.The results of this study indicate that dynamic and high volume upper extremity plyometric WU activities are likely beneficial to serve speed of elite junior tennis players.

Variation in foraging behavior and body mass in broods of Emperor Geese (Chen canagica): Evidence for interspecific density dependence

Science.gov (United States)

Schmutz, J.A.; Laing, K.K.

2002-01-01

Broods of geese spend time feeding according to availability and quality of food plants, subject to inherent foraging and digestive constraints. We studied behavioral patterns of broods of Emperor Geese (Chen canagica) on the Yukon–Kuskokwim Delta, Alaska, and examined how feeding and alert behavior varied in relation to habitat and goose density. During 1994–1996, time spent feeding by Emperor Goose goslings and adult females was positively related to multispecies goose densities near observation blinds, and not to just Emperor Goose density. Similarly, body mass of Emperor Goose goslings was more strongly related (negatively) to multispecies goose densities than intraspecific densities. A grazing experiment in 1995 indicated that most above ground primary production by Carex subspathacea, a preferred food plant, was consumed by grazing geese. Those results demonstrate that interspecific competition for food occurred, with greatest support for goslings whose behavioral repertoire is limited primarily to feeding, digesting, and resting. Although the more abundant Cackling Canada Geese (Branta canadensis minima) differed from Emperor Geese in their preferred use of habitats during brooding rearing (Schmutz 2001), the two species occurred in equal abundance in habitats preferred by Emperor Goose broods. Thus, Cackling Canada Geese were a numerically significant competitor with Emperor Geese. Comparing these results to an earlier study, time spent feeding by goslings, adult females, and adult males were greater during 1993–1996 than during 1985–1986. During the interval between those studies, densities of Cackling Canada Geese increased two to three times whereas Emperor Goose numbers remained approximately stable, which implies that interspecific competition affected foraging behavior over a long time period. These density-dependent changes in foraging behavior and body mass indicate that interspecific competition affects nutrient acquisition and gosling

Anti-tumor activity of polysaccharides extracted from Senecio ...

African Journals Online (AJOL)

*, Bao Zhang, Mingming Han, Xin Jin, Liyuan Sun and Tao Li. Department of ..... Yang J, Li X, Xue Y, Wang N, Liu W. Anti-hepatoma activity and mechanism of corn ... Peng W, Wu JG, Jiang YB, Liu YJ, Sun T, Wu N, Wu CJ. Antitumor activity of ...

Antimicrobial activity and the mechanism of silver nanoparticle thermosensitive gel

Directory of Open Access Journals (Sweden)

Chen M

2011-11-01

Full Text Available Meiwan Chen1,2,‡, Zhiwen Yang1,‡, Hongmei Wu1, Xin Pan1, Xiaobao Xie3, Chuanbin Wu11Research and Development Center of Pharmaceutical Engineering, School of Pharmaceutical Sciences, Sun Yat-sen University, Guangzhou, China; 2State Key Laboratory of Quality Research in Chinese Medicine, Institute of Chinese Medical Sciences, University of Macau, Macau, China; 3Guangdong Provincial Key Laboratory of Microbial Culture Collection and Application, Guangzhou, China ‡These authors contributed equally to this workPurpose: The purpose of the present study was to elucidate the antimicrobial activity and mechanism of silver nanoparticles incorporated into thermosensitive gel (S-T-Gel on Staphylococcus aureus, Escherichia coli, and Pseudomonas aeruginosa.Patients and methods: This study investigated the growth, permeability, and morphology of Staphylococcus aureus, Escherichia coli, and Pseudomonas aeruginosa cells in order to observe the action of S-T-Gel on the membrane structure of these three bacteria. The cell morphology of normal and treated bacteria cells was assessed by transmission electron microscopy (TEM, and the effects of S-T-Gel on genome DNA of bacterial cells were evaluated by agarose gel electrophoresis.Results: S-T-Gel showed promising activity against Staphylococcus aureus and moderate activity against Escherichia coli and Pseudomonas aeruginosa. The observation with TEM suggested that S-T-Gel may destroy the structure of bacterial cell membranes in order to enter the bacterial cell. S-T-Gel then condensed DNA and combined and coagulated with the cytoplasm of the damaged bacteria, resulting in the leakage of the cytoplasmic component and the eventual death of these three bacteria. In addition, the analysis of agarose gel electrophoresis demonstrated that S-T-Gel could increase the decomposability of genome DNA.Conclusion: These results about promising antimicrobial activity and mechanism of S-T-Gel may be useful for further research

Dual tumor-targeted poly(lactic-co-glycolic acid–polyethylene glycol–folic acid nanoparticles: a novel biodegradable nanocarrier for secure and efficient antitumor drug delivery

Directory of Open Access Journals (Sweden)

Chen J

2017-08-01

Full Text Available Jia Chen,1,2,* Qi Wu,1,* Li Luo,1 Yi Wang,1 Yuan Zhong,1 Han-Bin Dai,1 Da Sun,1,3 Mao-Ling Luo,4 Wei Wu,1 Gui-Xue Wang1 1Key Laboratory for Biorheological Science and Technology, Ministry of Education, State and Local Joint Engineering Laboratory for Vascular Implants, Bioengineering College, Chongqing University, Chongqing, 2Institute of Laboratory Animals, Sichuan Academy of Medical Science, Sichuan Provincial People’s Hospital, Chengdu, 3Institute of Life Sciences, Wenzhou University, Wenzhou, 4School of Medicine, Wuhan University, Wuhan, China *These authors contributed equally to this work Abstract: Further specific target-ability development of biodegradable nanocarriers is extremely important to promote their security and efficiency in antitumor drug-delivery applications. In this study, a facilely prepared poly(lactic-co-glycolic acid (PLGA–polyethylene glycol (PEG–folic acid (FA copolymer was able to self-assemble into nanoparticles with favorable hydrodynamic diameters of around 100 nm and negative surface charge in aqueous solution, which was expected to enhance intracellular antitumor drug delivery by advanced dual tumor-target effects, ie, enhanced permeability and retention induced the passive target, and FA mediated the positive target. Fluorescence-activated cell-sorting and confocal laser-scanning microscopy results confirmed that doxorubicin (model drug loaded into PLGA-PEG-FA nanoparticles was able to be delivered efficiently into tumor cells and accumulated at nuclei. In addition, all hemolysis, 3-(4,5-dimethylthiazol-2-yl-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl-2H-tetrazolium, and zebrafish-development experiments demonstrated that PLGA-PEG-FA nanoparticles were biocompatible and secure for biomedical applications, even at high polymer concentration (0.1 mg/mL, both in vitro and in vivo. Therefore, PLGA-PEG-FA nanoparticles provide a feasible controlled-release platform for secure and efficient antitumor drug

Revision of the subfamily Opiinae (Hymenoptera, Braconidae from Hunan (China, including thirty-six new species and two new genera

Directory of Open Access Journals (Sweden)

Li Xi-Ying

2013-02-01

postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915, O. ambiguus Weng & Chen, 2005 (not Wesmael, 1835 and O. mitis Chen & Weng, 2005 (not Fischer, 1963 are primary homonyms and are renamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. and O. wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005 comb. n., Diachasmimorpha longicaudata (Ashmead, 1905 and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957 comb. n. is new for China and Hunan; Xynobius maculipennis (Enderlein, 1912 comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005 comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005 comb. n., A. tracta (Weng & Chen, 2005 comb. n., Areotetes laevigatus (Weng & Chen, 2005 comb. n., Phaedrotoma dimidia (Chen & Weng, 2005 comb. n., P. improcera (Weng & Chen, 2005 comb. n., P. amputata (Weng & Chen, 2005 comb. n., P. larga (Weng & Chen, 2005 comb. n., P. osculas (Weng & Chen, 2005 comb. n., P. postuma (Chen & Weng, 2005 comb. n., P. rugulosa (Chen & Weng, 2005 comb. n., P. tabularis (Weng & Chen, 2005 comb. n., Rhogadopsis apii (Chen & Weng, 2005 comb. n., R. dimidia (Chen & Weng, 2005 comb. n., R. diutia (Chen & Weng, 2005 comb. n., R. longuria (Chen & Weng, 2005 comb. n., R. pratellae (Weng & Chen, 2005 comb. n., R. pratensis (Weng & Chen, 2005 comb. n., R. sculpta (Chen & Weng, 2005 comb. n., R. sulcifer (Fischer, 1975 comb. n., R. tabidula (Weng & Chen, 2005 comb. n., Xynobius complexus (Weng & Chen, 2005 comb. n

Stepwise encapsulation and controlled two-stage release system for cis-Diamminediiodoplatinum

Directory of Open Access Journals (Sweden)

Chen Y

2014-06-01

Full Text Available Yun Chen,1,* Qian Li,1,2,* Qingsheng Wu1 1Department of Chemistry, Key Laboratory of Yangtze River Water Environment, Ministry of Education, Tongji University, Shanghai; 2Shanghai Institute of Quality Inspection and Technical Research, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: cis-Diamminediiodoplatinum (cis-DIDP is a cisplatin-like anticancer drug with higher anticancer activity, but lower stability and price than cisplatin. In this study, a cis-DIDP carrier system based on micro-sized stearic acid was prepared by an emulsion solvent evaporation method. The maximum drug loading capacity of cis-DIDP-loaded solid lipid nanoparticles was 22.03%, and their encapsulation efficiency was 97.24%. In vitro drug release in phosphate-buffered saline (pH =7.4 at 37.5°C exhibited a unique two-stage process, which could prove beneficial for patients with tumors and malignancies. MTT (3-[4,5-dimethylthiazol-2-yl]-2, 5-diphenyltetrazolium bromide assay results showed that cis-DIDP released from cis-DIDP-loaded solid lipid nanoparticles had better inhibition activity than cis-DIDP that had not been loaded. Keywords: stearic acid, emulsion solvent evaporation method, drug delivery, cis-DIDP, in vitro

Diversity and uses of Zingiberaceae in Nam Nao National Park, Chaiyaphum and Phetchabun provinces, Thailand, with a new record for Thailand

Directory of Open Access Journals (Sweden)

Surapon Saensouk

2016-11-01

Full Text Available Three tribes, 12 genera and 38 species of the ginger family (Zingiberaceae along five routes in Nam Nao National Park were surveyed between January 2012 and December 2013 to determine their diversity, ecological data, phenology, uses and conservation status. The highest diversity was found in the tribe Zingibereae (6 genera and 21 species, of which the genera Curcuma and Zingiber comprised the highest number species (eight species each. A species key was constructed based on morphology. The ginger family was found in four forest-types—deciduous dipterocarp forest, mixed deciduous forest, dry evergreen forest and pine forest. The most flowering bloom of the ginger family in Nam Nao National Park was during March to August and the most fruiting bloom was during June to September. The popular uses of Zingiberaceae were as a food, spice, in medicine, as ornamentation and in rituals. Eight species have been evaluated as of least concern and are presented in the IUCN Red List, while two rare species were reported in Thailand Red Data: Plants, while six rare Zingiberaceae species were identified based on the evaluation criteria of Saensouk (2011. Four species were endemic to Thailand. Moreover, Etlingera yunnanensis (T. L. Wu & S. J. Chen R. M. Smith was a new record for Thailand.

Precooling and Warm-Up Effects on Time Trial Cycling During Heat Stress.

Science.gov (United States)

Al-Horani, Ramzi A; Wingo, Jonathan E; Ng, Jason; Bishop, Phillip; Richardson, Mark

2018-02-01

Heat stress limits endurance exercise performance. Combining precooling and warm-up prior to endurance exercise in the heat may exploit the benefits of both strategies while avoiding the potential negative consequences of each. This study tested the hypothesis that precooling combined with warm-up improves time trial cycling performance in the heat relative to either treatment alone. Nine healthy men completed three 16.1-km time trials in 33°C after: 1) precooling (ice slurry and ice vest) alone (PREC); 2) warm-up alone (WU); or 3) PREC plus WU (COMBO). Tre was lower after PREC compared to WU throughout exercise and lower than COMBO for the first 12 km; COMBO was lower than WU for the first 4 km. Tsk during PREC was lower than COMBO and WU for the first 8 km, and lower in COMBO than WU for the first 4 km. PREC lowered pre-exercise heart rate relative to COMBO and WU (68 ± 10, 106 ± 12, 101 ± 13 bpm, respectively), but it increased similarly during exercise. Local sweat rate (SR) was lower in PREC (0.1 ± 0.1 mg · cm-2 · min-1) than COMBO (0.5 ± 0.2 mg · cm-2 · min-1) and WU (0.6 ± 0.2 mg · cm-2 · min-1) for the first 4 km. Treatments did not differentially affect performance (PREC = 31.9 ± 1.9 min, COMBO = 32.6 ± 2.7 min, WU = 33.1 ± 2.9 min). We conclude precooling alone or with warm-up mitigated thermal strain during exercise, but did not significantly improve 16.1-km cycling time trial performance.Al-horani RA, Wingo JE, Ng J, Bishop P, Richardson M. Precooling and warm-up effects on time trial cycling during heat stress. Aerosp Med Hum Perform. 2018; 89(2):87-93.

Proceedings of the 2016 China Cancer Immunotherapy Workshop

Directory of Open Access Journals (Sweden)

Bin Xue

2016-10-01

Full Text Available Table of contents A1 Proceedings of 2016 China Cancer Immunotherapy Workshop, Beijing, China Bin Xue, Jiaqi Xu, Wenru Song, Zhimin Yang, Ke Liu, Zihai Li A2 Set the stage: fundamental immunology in forty minutes Zihai Li A3 What have we learnt from the anti-PD-1/PD-L1 therapy of advanced human cancer? Lieping Chen A4 Immune checkpoint inhibitors in lung cancer Edward B. Garon A5 Mechanisms of response and resistance to checkpoint inhibitors in melanoma Siwen Hu-Lieskovan A6 Checkpoint inhibitor immunotherapy in lymphoid malignancies Wei Ding A7 Translational research to improve the efficacy of immunotherapy in genitourinary malignancies Chong-Xian Pan A8 Immune checkpoint inhibitors in gastrointestinal malignancies Weijing Sun A9 What’s next beyond PD-1/PDL1? Yong-Jun Liu A10 Cancer vaccines: new insights into the oldest immunotherapy strategy Lei Zheng A11 Bispecific antibodies for cancer immunotherapy Delong Liu A12 Updates on CAR-T immunotherapy Michel Sadelain A13 Adoptive T cell therapy: personalizing cancer treatment Cassian Yee A14 Immune targets and neoantigens for cancer immunotherapy Rongfu Wang A15 Phase I/IIa trial of chimeric antigen receptor modified T cells against CD133 in patients with advanced and metastatic solid tumors Meixia Chen, Yao Wang, Zhiqiang Wu, Hanren Dai, Can Luo, Yang Liu, Chuan Tong, Yelei Guo, Qingming Yang, Weidong Han A16 Cancer immunotherapy biomarkers: progress and issues Lisa H. Butterfield A17 Shaping of immunotherapy response by cancer genomes Timothy A. Chan A18 Unique development consideration for cancer immunotherapy Wenru Song A19 Immunotherapy combination Ruirong Yuan A20 Immunotherapy combination with radiotherapy Bo Lu A21 Cancer immunotherapy: past, present and future Ke Liu A22 Breakthrough therapy designation drug development and approval Max Ning A23 Current European regulation of innovative oncology medicines: opportunities for immunotherapy Harald Enzmann, Heinz Zwierzina

China Report, Political, Sociological and Military Affairs, No. 445.

Science.gov (United States)

1983-08-11

2052 0981], Chen Dingming [7115 7844 6900], Jin Xiulan [6855 4423 5695] (F, Mongolian), Zhao Nanqi [6392 0589 6386] Korean), Suo Jingxian [4792...Pen Center and the Guangzhou Pen Center will be headed by Chen Huangmei, another vice-president of the China center and a noted critic. The...1728 4426 6311], Zhang Tengxiao [1728 7506 7197], Chen Dingmou [7115 0002 5399], Chen Lunfen [7115 0243 5358] (F), Chen Xitong [7115 1585 0681

Technical Digest of the 1998 Summer Topical Meeting on Organic Optics and Optoelectronics

Science.gov (United States)

1998-07-01

Larry Dalton, University of Southern California, Los Angeles, CA Harold Fetterman , University of California, Los Angeles, CA Steve Forrest...OPTIC MODULATORS H. Fetterman , D. Chen, A. Udupa. D. Bhattachaya, B. Tsap University of Califonia, Los Angeles 90024 S. Lee, A. Chen, J. Chen, W...Chen, H.R. Fetterman , A. Chen, W.H. Steier, and L. R. Dalton, Appl. Phys. Lett. 70, (1997). 2. T.A. Tumolillo and P.R. Ashley, Appl. Phys. Lett. 62

The efficacy and characteristics of warm-up and re-warm-up practices in soccer players: a systematic review.

Science.gov (United States)

Hammami, Amri; Zois, James; Slimani, Maamer; Russel, Mark; Bouhlel, Ezdine

2018-01-01

This review aimed 1) to evaluate the current research that examines the efficacy of warm-up (WU) and re-warm-up (RWU) on physical performance; and 2) to highlight the WU and RWU characteristics that optimise subsequent performance in soccer players. A computerized search was performed in the PubMed, ScienceDirect and Google Scholar (from 1995 to December 2015) for English-language, peer-reviewed investigations using the terms "soccer" OR "football" AND "warm-up" OR "stretching" OR "post-activation potentiation" OR "pre-activity" OR "re-warm-up" AND "performance" OR "jump" OR "sprint" OR "running". Twenty seven articles were retrieved. Particularly, 22 articles examined the effects of WU on soccer performance and 5 articles focused on the effects of RWU. Clear evidence exists supporting the inclusion of dynamic stretching or postactivation potentiation-based exercises within a WU as acute performance enhancements were reported (pooled estimate changes of +3.46% and +4.21%, respectively). The FIFA 11+ WU also significantly increases strength, jump, speed and explosive performances (changes from 1% to 20%). At half-time, active RWU protocols including postactivation potentiation practices and multidirectional speed drills attenuate temperature and performance reductions induced by habitual practice. The data obtained in the present review showed that the level of play did not moderate the effectiveness of WU and RWU on soccer performance. This review demonstrated that a static stretching WU reduced acute subsequent performance, while WU activities that include dynamic stretching, PAP-based exercises, and the FIFA 11+ can elicit positive effects in soccer players. The efficacy of an active RWU during half-time is also justified.

古今中西之間--陳垣與20世紀中國史學%Between the Ancient and the Present and between China and the West：Prof. Chen Yuan and Chinese Historiography in the 20 th Century

Institute of Scientific and Technical Information of China (English)

陳智超

2010-01-01

Every historian should answer two questions related to each other, i. e. what is the relationship between history and reality and what is that between historiography and reality. Moreover, Chinese historians should answer other two questions also re-lated to each other, namely what is the relationship between China and the West and what is that between Chinese culture and Western culture. Based on their own outlook on the ancient and the present as well as on China and the West, every conscious Chinese historian of the 20 th century was bound to cherish a definite sense of responsi-bility and determined what role they played and what way they chose when taking on this responsibility. The present paper expounds Prof. Chen Yuan’ s answers to the above questions andhis practice concerned with them in the four stages of his lifetime.

Revision of the subfamily Opiinae (Hymenoptera, Braconidae) from Hunan (China), including thirty-six new species and two new genera

Science.gov (United States)

Li, Xi-Ying; van Achterberg, Cornelis; Tan, Ji-Cai

2013-01-01

van Achterberg & Li, gen. n. (type species: Areotetes carinuliferus sp. n.) and Coleopioides van Achterberg & Li, gen. n. (type species: Coleopioides postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915), Opius ambiguus Weng & Chen, 2005 (not Wesmael, 1835) and Opius mitis Chen & Weng, 2005 (not Fischer, 1963) are primary homonymsandarerenamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. andOpius wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005) comb. n.,Diachasmimorpha longicaudata (Ashmead, 1905) and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957) comb. n. is new for China and Hunan; Xynobius maculipennis(Enderlein, 1912) comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005) comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005) comb. n., Apodesmia tracta (Weng & Chen, 2005) comb. n., Areotetes laevigatus (Weng & Chen, 2005) comb. n., Phaedrotoma dimidia (Chen & Weng, 2005) comb. n., Phaedrotoma improcera (Weng & Chen, 2005) comb. n., Phaedrotoma amputata (Weng & Chen, 2005) comb. n., Phaedrotoma larga (Weng & Chen, 2005) comb. n., Phaedrotoma osculas (Weng & Chen, 2005) comb. n., Phaedrotoma postuma (Chen & Weng, 2005) comb. n., Phaedrotoma rugulosa (Chen & Weng, 2005) comb. n., Phaedrotoma tabularis (Weng & Chen, 2005) comb. n., Rhogadopsis apii (Chen & Weng, 2005) comb. n., Rhogadopsis dimidia (Chen & Weng, 2005) comb. n., Rhogadopsis diutia (Chen & Weng, 2005) comb. n., Rhogadopsis

Reference: 291 [Arabidopsis Phenome Database[Archive

Lifescience Database Archive (English)

Full Text Available 291 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16244906i Chai Mao-Feng...d chloroplast protection. 4 553-64 16244906 2005 Nov Plant molecular biology An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Chen Ye-Miao|Wang Xue-Chen

Real-world hospital costs for nonchemotherapy drugs and nondrug care associated with platinum-based doublets in the first-line setting for advanced nonsquamous non-small-cell lung cancer in Chinese patients: a retrospective cohort study

Directory of Open Access Journals (Sweden)

Chen JH

2016-04-01

Full Text Available Jianhua Chen,1 Shengqi Wu,2 Chenping Hu,3 Yicheng Yang,4 Narayan Rajan,5 Yun Chen,4 Canjuan Yang,6 Jianfeng Li,6 Wendong Chen7 1Department of Medical Oncology, 2Department of Research and Education, Hunan Province Tumor Hospital, 3Department of Respiratory, Xiangya Hospital, Central South University, Changsha, Hunan, 4Lilly Suzhou Pharmaceutical Co., Ltd. Shanghai Branch, Shanghai, People's Republic of China; 5Global Health Outcomes Research, Eli Lilly and Co, Indianapolis, IN, USA; 6Division of Health Outcome Research, Normin Health Changsha Representative Office, Changsha, Hunan, People's Republic of China; 7Normin Health, Toronto, ON, Canada Objective: The objective of this study was to compare hospital costs per treatment cycle (HCTC for nonchemotherapy drugs and nondrug care associated with platinum-based doublets in the first-line setting for advanced nonsquamous non-small-cell lung cancer (AdvNS-NSCLC in Chinese patients. Methods: Patients receiving platinum-based doublets in the first-line setting for AdvNS-NSCLC from 2010 to 2012 in two Chinese tertiary hospitals were identified to create the retrospective study cohort. Propensity score methods were used to create matched treatment groups for head-to-head comparisons on HCTC between pemetrexed–platinum and other platinum-based doublets. Multiple linear regression analyses were performed to rank studied platinum-based doublets for their associations with the log10 scale of HCTC for nonchemotherapy drugs and nondrug care. Results: Propensity score methods created matched treatment groups for pemetrexed–platinum versus docetaxel–platinum (61 pairs, paclitaxel–platinum (39 pairs, gemcitabine–platinum (93 pairs, and vinorelbine–platinum (73 pairs, respectively. Even though the log10 scale of HCTC for nonchemotherapy drugs and nondrug care associated with pemetrexed–platinum was ranked lowest in all patients (coefficient –0.174, P=0.015, which included patients experiencing

Simultaneous determination of bioactive components in essential oil of Xiang-Fu-Si-Wu Formula in Beagle dog plasma by UPLC-MS/MS and its application to pharmacokinetics.

Science.gov (United States)

Liu, Pei; Li, Zhenhao; Qian, Dawei; Li, Wei; Shang, Er-Xin; Duan, Jin-Ao

2013-06-15

A highly sensitive and rapid ultraperformance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) has been developed and validated for simultaneous quantification of the three main bioactive compounds, i.e., ligustilide, dehydrocostuslactone and α-cyperone in dog plasma after oral administration of the essential oil of Xiang-Fu-Si-Wu Formula (XEO). Clarithromycin was used as an internal standard (IS). Plasma samples were processed by protein precipitation with methanol. The separation was performed on an Acquity BEH C18 column (100mm×2.1mm, 1.7μm) at a flow rate of 0.4mLmin(-1), using 0.1% formic acid-acetonitrile as mobile phase. The MS/MS ion transit ions monitored were 190.5→90.9 for ligustilide, 231.1→185.1 for dehydrocostuslactone, 219.2→123.0 for α-cyperone and 748.5→158.1 for IS. Method validation was performed as per Food and Drug Administration guidelines and the results met the acceptance criteria. The lower limit of quantification (LLOQ) achieved was 5.12ng/mL for ligustilide, 1.06ng/mL for dehydrocostuslactone and 1.89ng/mL for α-cyperone, respectively, and the calibration curves obtained were linear (r>0.99) over the concentration range approximately 1-1000ng/mL. The intra- and inter-day precision was less than 15% and the accuracy was within ±9.2%. After validation, this method was successfully applied to a pharmacokinetic study where dogs were orally given 0.3g/kg XEO, equivalent to 183.6mg/kg of ligustilide, 5.0mg/kg of dehydrocostuslactone and 26.2mg/kg of α-cyperone, respectively. Copyright © 2013 Elsevier B.V. All rights reserved.

Nomenclatural corrections to the taxonomic revision of The Old World species of Boehmeria (Urticaceae, tribus Boehmeriae) by Wilmot-Dear and Friis (2013)

DEFF Research Database (Denmark)

Wilmot-Dear, Christine Melanie; Friis, Ib; Govaerts, R. H. A.

2014-01-01

(H. Lév.) C.J. Chen in Chen et al. as the correct name for the variety named in the revision as B. zollingeriana Wedd. var. podocarpa (W.T. Wang) W.T. Wang & C.J. Chen in Chen et al., (3) that the combination B. spicata (Thunb.) Thunb., based on Urtica spicata Thunb., is not illegitimate, as stated...

MARGA_Chen et al_2016

Data.gov (United States)

U.S. Environmental Protection Agency — These data describe the chromatography characteristics of the MARGA instrument software as compared to an alternative, independent technique for chromatogram...

A Review on Gnetalean Megafossils: Problems and Perspectives

Directory of Open Access Journals (Sweden)

Yong Yang

2010-11-01

Full Text Available Gnetalean megafossils were accumulated in the last decade. Taxonomic positions of several of Ephedran megafossil species are, however, controversial, resulting in a complicated nomenclature. Liaoxia Z.Y. Cao & S.Q. Wu, “Eragrostis Z.Y. Cao & S.Q. Wu”, “Chaoyangia Duan”, and their type species “Liaoxia cheniae Z.Y. Cao & S.Q. Wu”, “Eragrostis changii Z.Y. Cao & S.Q. Wu”, “Chaoyangia liangii S.Y. Duan”, were not validly published in the original publication under the Vienna Code. The species “Liaoxia cheniae Z.Y. Cao & S.Q. Wu” was validly published as Ephedrites cheniae S.X. Guo & X.W. Wu but later combined into Liaoxia cheniae (S.X. Guo & X.W. Wu Z.Y. Cao & S.Q. Wu and further into Ephedra cheniae (S.X. Guo & X.W. Wu H.M. Liu et al. Some uncertain morphological characters are fundamental to elucidate the taxonomic position of Ephedrites cheniae S.X. Guo & X.W. Wu and “Chaoyangia liangii S.Y. Duan”, e.g. bract number, position, and connation in female cones, seed number and position in a female cone, and morphology of the furcated appendages of reproductive organs of “Chaoyangia liangii S.Y. Duan”.

People’s Republic of China Scientific Abstracts No. 178

Science.gov (United States)

1977-10-27

of hepatic colls were observed by eleotron microscopy after carbon tetrachloride intoxication in mice . The hepatic cellular injuries were protected...administration in [continuation of SHENG-WU HUA-HSUEH YU SHENG-WU WU-LI-HSUEH-PAO Vol 8, No A, Dec 76 pp 333-340] mice . It is transformed from lipid...preparations for monopolizing the technique by capi- talist and revisionist countries. In a socialist country, the author claims, the purpose of developing

Comparison of the effects of active, passive and mixed warm ups on swimming performance.

Science.gov (United States)

Adams, S; Psycharakis, S G

2014-10-01

The aim of this paper was to compare the effects of an active (AWU), passive (PWU) and mixed warm up (MWU) on swimming performance. Eight male competitive swimmers completed each type of WU and, following a 20-minute rest, performed a maximum 100m test on their specialised stroke. The order of WUs was randomized and there was a 7-day period between subsequent testing sessions. The time taken to complete the 100m trial was the performance measure. The rating of perceived exertion (RPE) was measured immediately post WU, while heart rate (HR) was measured pre and post WU and pre and post the maximum swim. During the 20-minute rest, the swimmers' psychological state was assessed with the CSAI-2 questionnaire. Post WU HR and RPE had the lowest values following the AWU and the highest values following the PWU (Pperformance HR increased significantly relative to pre WU HR for all conditions (P≤0.01). Swimmers had relatively low levels of anxiety and modest to high levels of self confidence for all conditions. No WU appeared to be superior to the others with respect to swimming performance. The MWU produced nearly identical values to the AWU for most variables, and was therefore found to be an appropriate alternative WU type that swimmers may use before competition. The PWU also seemed to be appropriate, but the somewhat worse performance and lower cognitive anxiety and self confidence scores recorded, albeit non-significant, suggested that more swimmers and distances are tested before any firm conclusions regarding its effectiveness can be drawn.

Effects of general, specific and combined warm-up on explosive muscular performance

Directory of Open Access Journals (Sweden)

David Cristobal Andrade

2015-02-01

Full Text Available The purpose of this study was to compare the acute effects of general, specific and combined warm-up (WU on explosive performance. Healthy male (n=10 subjects participated in six WU protocols in a crossover randomized study design. Protocols were: passive rest (PR; 15 min of passive rest, running (Run; 5 min of running at 70% of maximum heart rate, stretching (STR; 5 min of static stretching exercise, jumping [Jump; 5 min of jumping exercises – 3x8 countermovement jumps (CMJ and 3x8 drop jumps from 60 cm (DJ60], and combined (COM; protocols Run + STR + Jump combined. Immediately before and after each WU, subjects were assessed for explosive concentric-only (i.e. squat jump – SJ, slow stretch-shortening cycle (i.e. CMJ, fast stretch-shortening cycle (i.e. DJ60 and contact time (CT muscle performance. PR significantly reduced SJ performance (p =0.007. Run increased SJ (p =0.0001 and CMJ (p =0.002. STR increased CMJ (p =0.048. Specific WU (i.e. Jump increased SJ (p =0.001, CMJ (p =0.028 and DJ60 (p =0.006 performance. COM increased CMJ performance (p =0.006. Jump was superior in SJ performance vs. PR (p =0.001. Jump reduced (p =0.03 CT in DJ60. In conclusion, general, specific and combined WU increase slow stretch-shortening cycle (SSC muscle performance, but only specific WU increases fast SSC muscle performance. Therefore, to increase fast SSC performance, specific fast SSC muscle actions must be included during the WU.

EDITORIAL: Focus on Iron-Based Superconductors FOCUS ON IRON-BASED SUPERCONDUCTORS

Science.gov (United States)

Hosono, Hideo; Ren, Zhi-An

2009-02-01

-L Drechsler, N Kozlova, M Bartkowiak, J E Hamann-Borrero, G Behr, K Nenkov, H-H Klauss, H Maeter, A Amato, H Luetkens, A Kwadrin, R Khasanov, J Freudenberger, A Köhler, M Knupfer, E Arushanov, H Rosner, B Büchner and L Schultz Low-energy spin dynamics in the antiferromagnetic phase of CaFe2As2 N J Curro, A P Dioguardi, N ApRoberts-Warren, A C Shockley and P Klavins Muon spin rotation study of magnetism and superconductivity in BaFe2-xCoxAs2 and Pr1-xSrxFeAsO C Bernhard, A J Drew, L Schulz, V K Malik, M Rössle, Ch Niedermayer, Th Wolf, G D Varma, G Mu, H-H Wen, H Liu, G Wu and X H Chen Magnetic impurities in the pnictide superconductor Ba1-xKxFe2As2 Sutirtha Mukhopadhyay, Sangwon Oh, A M Mounce, Moohee Lee, W P Halperin, N Ni, S L Bud'ko, P C Canfield, A P Reyes and P L Kuhns Neutron scattering investigation of the magnetic order in single crystalline BaFe2As2 M Kofu, Y Qiu, Wei Bao, S-H Lee, S Chang, T Wu, G Wu and X H Chen An NMR study on the F-doping evolution of the iron oxypnictide LaFeAs(O1-xFx) Y Nakai, S Kitagawa, K Ishida, Y Kamihara, M Hirano and H Hosono The peculiar physical properties and phase diagram of BaFe2-xCoxAs2 single crystals X F Wang, T Wu, G Wu, R H Liu, H Chen, Y L Xie and X H Chen Synthesis of LnFeAsO1-y superconductors (Ln=La and Nd) using the high-pressure technique Kiichi Miyazawa, Kunihiro Kihou, Motoyuki Ishikado, Parasharam M Shirage, Chul-Ho Lee, Nao Takeshita, Hiroshi Eisaki, Hijiri Kito and Akira Iyo Correlation effects in the iron pnictides Qimiao Si, Elihu Abrahams, Jianhui Dai and Jian-Xin Zhu Competition/coexisitence of magnetism and superconductivity in iron pnictides probed by muon spin rotation Soshi Takeshita and Ryosuke Kadono Impurity-induced in-gap state and Tc in sign-reversing s-wave superconductors: analysis of iron oxypnictide superconductors Yuko Senga and Hiroshi Kontani Intrinsic magnetic properties of the superconductor NdFeAsO0.9F0.1 from local and global measurements R Prozorov, M E Tillman, E D Mun and P C Canfield

Et felteksperiment med Kærlighed i Kaos

DEFF Research Database (Denmark)

Christensen, Christiane Præstgaard; Scavenius Sonne-Schmidt, Christoffer

Som et nyt tilbud til danske forældre med børn med ADHD og ADHD-lignende vanskeligheder har ADHDforeningen udviklet forældretræningsprogrammet Kærlighed i Kaos, hvor frivillige hjælper forældre til børn med ADHD, der står med et særligt vanskeligt opdragelsesarbejde. Denne rapport har til formål......, når forældrene stiller krav til børnene. Resultaterne i denne rapport har interesse for fagpersoner, behandlere, undervisere, beslutningstagere, frivillige organisationer, foreninger og de mange nuværende og kommende familier, som dagligt kæmper med adfærdsvanskeligheder – såsom ADHD. Effektmålingen...

How the rock fabrics can control the physical properties - A contribution to the understanding of carbonate reservoirs

Energy Technology Data Exchange (ETDEWEB)

Duerrast, H.; Siegesmund, S. [Goettingen Univ. (Germany)

1998-12-31

The correlation between microfabrics and physical properties will be illustrated in detail on three dolomitic carbonate reservoir rocks with different porosity. For this study core segments from the Zechstein Ca2-layer (Permian) of the Northwest German Basin were kindly provided by the Preussag Energie GmbH, Lingen. The mineral composition was determined by using the X-ray diffraction method. Petrographic and detailed investigation of the microfabrics, including the distribution and orientation of the cracks were done macroscopally (core segments) and microscopally with the optical microscope and the Scanning Electron Microscope (thin sections in three orthogonally to each other oriented directions). Different kinds of petrophysical measurements were carried out, e.g. porosity, permeability, electrical conductivity, seismic velocities. (orig.)

KWL annual report 1984

International Nuclear Information System (INIS)

1985-01-01

The application for decommissioning the Lingen reactor has been filed on June 13, 1983. Response by the competent authority is expected to come in by mid-1985 at the earliest. At the beginning of 1985, preparatory work for the decommissioning phase has been started in the reactor containment, as e.g. removal of fuel elements, blow out of primary cooling circuit and evacuation of fuel storage pond. The number of personnel working at KWL reactor has been reduced to 108 in the period under review. The annual report 1984 has been worked out according to legal provisions; the profit and loss account is balanced at DM 35,43 millions. (orig./HSCH) [de

People’s Republic of China Scientific Abstracts, Number 177

Science.gov (United States)

1977-10-06

PAO [ARCHITECTURAL JOURNAL] No 2, June 1977 1 CHIH-WU HSUEH-PAO [ACTA BOTANICA SINICA] No 4, December 1976 13 CHIH-WU TSA-CHIH [JOURNAL OF BOTANY...10424 CSO: 4009 12 ACTA BOTANICA SINICA AUTHOR: None ORG: Three-in-one Combination Experimental Group of Peking Ch’ung-wen Vegetable Station...Physiological Processes of Stored Tomatoes" SOURCE: Peking CHIH-WU HSUEH-PAO [ACTA BOTANICA SINICA] in Chinese Vol 18, No 4, Dec 76 pp 278-283 TEXT OF

An inductive narrow-pulse RFID telemetry system for gastric slow waves monitoring.

Science.gov (United States)

Javan-Khoskholgh, Amir; Abukhalaf, Zaid; Ji Li; Miller, Larry S; Kiani, Mehdi; Farajidavar, Aydin

2016-08-01

We present a passive data telemetry system for real-time monitoring of gastric electrical activity of a living subject. The system is composed of three subsystems: an implantable unit (IU), a wearable unit (WU), and a stationary unit (SU). Data communication between the IU and WU is based on a radio-frequency identification (RFID) link operating at 13.56 MHz. Since wireless power transmission and reverse data telemetry system share the same inductive interface, a load shift keying (LSK)-based differential pulse position (DPP) coding data communication with only 6.25% duty cycle is developed to guarantee consistent wireless downlink power transmission and uplink high data transfer rate, simultaneously. The clock and data are encoded into one signal by an MSP430 microcontroller (MCU) at the IU side. This signal is sent to the WU through the inductive link, where decoded by an MSP432 MCU. Finally, the retrieved data at the WU are transmitted to the SU connected to a PC via a 2.4 GHz transceiver for real-time display and analysis. The results of the measurements on the implemented test bench, demonstrate IU-WU 125 kb/s and WU-SU 2 Mb/s data transmission rate with no observed mismatch, while the data stream was randomly generated, and matching between the transmitted data by the IU and received by the SU verified by a custom-made automated software.

Performance-intensity functions of Mandarin word recognition tests in noise: test dialect and listener language effects.

Science.gov (United States)

Liu, Danzheng; Shi, Lu-Feng

2013-06-01

This study established the performance-intensity function for Beijing and Taiwan Mandarin bisyllabic word recognition tests in noise in native speakers of Wu Chinese. Effects of the test dialect and listeners' first language on psychometric variables (i.e., slope and 50%-correct threshold) were analyzed. Thirty-two normal-hearing Wu-speaking adults who used Mandarin since early childhood were compared to 16 native Mandarin-speaking adults. Both Beijing and Taiwan bisyllabic word recognition tests were presented at 8 signal-to-noise ratios (SNRs) in 4-dB steps (-12 dB to +16 dB). At each SNR, a half list (25 words) was presented in speech-spectrum noise to listeners' right ear. The order of the test, SNR, and half list was randomized across listeners. Listeners responded orally and in writing. Overall, the Wu-speaking listeners performed comparably to the Mandarin-speaking listeners on both tests. Compared to the Taiwan test, the Beijing test yielded a significantly lower threshold for both the Mandarin- and Wu-speaking listeners, as well as a significantly steeper slope for the Wu-speaking listeners. Both Mandarin tests can be used to evaluate Wu-speaking listeners. Of the 2, the Taiwan Mandarin test results in more comparable functions across listener groups. Differences in the performance-intensity function between listener groups and between tests indicate a first language and dialectal effect, respectively.

Seven new species of Begonia (Begoniaceae) in Northern Vietnam and Southern China

Science.gov (United States)

Chen, Wen-Hong; Radbouchoom, Sirilak; Nguyen, Hieu Quang; Nguyen, Hiep Tien; Nguyen4, Khang Sinh; Shui, Yu-Min

2018-01-01

Abstract Since 2016, KIB (Kunming Institute of Botany) and CPC (Centre for Plant Conservation of Vietnam) have conducted several surveys in the transboundary karst regions in Northern Vietnam and Southern China and seven new species in the genus Begonia Linn. (Begoniaceae) are firstly described. Amongst them, two species, Begonia albopunctata Y.M. Shui, W.H. Chen & H.Q. Nguyen and B. erectocarpa H.Q. Nguyen, Y.M. Shui & W.H. Chen, respectively belong to section Sphenanthera with berry fruits and section Leprosae with clavate berry fruits; four species, B. gulongshanensis Y.M. Shui & W. H. Chen, B. minissima H.Q. Nguyen, Y.M. Shui & W.H. Chen, B. mollissima Y.M. Shui, H.Q. Nguyen & W.H. Chen, B. rhytidophylla Y.M. Shui & W.H. Chen, belong to section Coelocentrum with parietal placentation; one species, Begonia bambusetorum H.Q. Nguyen, Y.M. Shui & W.H. Chen, belongs to section Diploclinium with 3-loculed ovary and capsules. The diagnostic characters of these species are described and illustrated in the text and photographs. PMID:29416422

对格里埃尔《声乐协奏曲》的两种演唱诠释---吴碧霞与德赛演唱的《声乐协奏曲》之比较%Interpretation of Two Types of Singing Performance of Gliere's"Vocal Concerto":A Comparison of"Vocal Con-certo"Sung by Wu Bixia and Natalie Dessay

Institute of Scientific and Technical Information of China (English)

张艳

2015-01-01

吴碧霞被誉为“中西合璧”的夜莺，无论在美声唱法还是民族唱法领域都有一定的造诣，演唱的歌曲都有丰富的表现力与感染力。纳塔利·德赛同样也被誉为20世纪末的“声音奇迹”，两个来自不同国度的歌唱家在演绎这首《声乐协奏曲》时，也有着不同的演唱风格与音响效果。通过对吴碧霞与德赛演唱的这首《声乐协奏曲》的比较分析，让我们更加清楚地认识到我国声乐发展的前景，并对两种风格的演唱进行文化的理解与思考。%Wu Bixia is hailed as a "nightingale" integrating the East and the West, as she has certain attainments in both bel canto and nazionale cantanti, and the songs sung by her are all highly expressive and attractive. Natalie Dessay is honored as a"vocal marvel" at the end of the 20th century. The two singers from two different countries have different singing styles and vo-cal effects when they sing"Vocal Concerto". Through a compara-tive analysis on"Vocal Concerto"sung by Wu Bixia and Natalie Dessay, we can more clearly learn about the prospect of the de-velopment of vocal music in China, thus understanding and re-flecting more about the cultures of the two styles.

Prevalence and related factors of psychological distress among cancer inpatients using routine Distress Thermometer and Chinese Health Questionnaire screening

Directory of Open Access Journals (Sweden)

Chiou YJ

2016-10-01

Full Text Available Yu-Jie Chiou,1 Nien-Mu Chiu,1 Liang-Jen Wang,2 Shau-Hsuan Li,3 Chun-Yi Lee,1 Ming-Kung Wu,1 Chien-Chih Chen,1 Yi-Shan Wu,1 Yu Lee1 1Department of Psychiatry, 2Department of Child and Adolescent Psychiatry, 3Department of Hematology-Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan, Republic of China Background: Clinical practice guidelines suggest routine screening for distress among cancer patients for immediate early psychiatric care. However, previous studies focusing on routine screening for psychological distress among cancer inpatients in Taiwan are scant. Thus, the aim of this study was to evaluate the prevalence and related factors of psychological distress and mental illness among cancer inpatients in Taiwan. Patients and methods: This study was conducted as a retrospective chart review in a general hospital in southern Taiwan. Cancer inpatients were regularly screened by nursing staff using the Distress Thermometer and the 12-item Chinese Health Questionnaire. Positive screening results on either instrument were followed by a non-commanded referral to psychiatrists for clinical psychiatric diagnosis and treatment. Results: Of the 810 participants in this study, 179 (22.1% were recognized as having psychological distress. Younger age (odds ratio [OR] =1.82, having head and neck cancer (OR =2.43, and having not received chemotherapy (OR =1.58 were significantly related to psychological distress. Among the 56 patients (31.3% with psychological distress who were referred to psychiatrists, the most common mental illness was adjustment disorder (n=22, 39.2%, followed by major depressive disorder (n=13, 23.2%, depressive disorder not otherwise specified (n=6, 10.7%, and anxiety disorder not otherwise specified (n=4, 7.1%. Conclusion: Our study indicated that cancer inpatients with psychological distress were more likely to be younger in age, have head and neck cancer, and have not

Effect of Contract Compliance Rate to a Fourth-Generation Telehealth Program on the Risk of Hospitalization in Patients With Chronic Kidney Disease: Retrospective Cohort Study.

Science.gov (United States)

Hung, Chi-Sheng; Lee, Jenkuang; Chen, Ying-Hsien; Huang, Ching-Chang; Wu, Vin-Cent; Wu, Hui-Wen; Chuang, Pao-Yu; Ho, Yi-Lwun

2018-01-24

telehealth program and risk of hospitalization. Renal function status was associated with risk of hospitalization among these patients, and there was a significant interaction with contract compliance rate. ©Chi-Sheng Hung, Jenkuang Lee, Ying-Hsien Chen, Ching-Chang Huang, Vin-Cent Wu, Hui-Wen Wu, Pao-Yu Chuang, Yi-Lwun Ho. Originally published in the Journal of Medical Internet Research (http://www.jmir.org), 24.01.2018.

Top five medical innovations in China mainland since Xinhai revolution [1911]: results of AME survey-002.

Science.gov (United States)

Wáng, Yì-Xiáng J; Xiao, Fan

2015-06-01

This survey aims to scrutinize important medical innovations in Chinese mainland since Xinhai (Hsin-hai) revolution in 1911, which marked the end of Manchurian imperial rule and the beginning of China's republican era. An online cross-sectional survey was carried out during the period of Dec 29, 2014 to Feb 5, 2015, totaling 37 days. The survey was conducted on the platform provided by DXY (www.dxy.cn), which is the largest medical and paramedical related website in China. An email was sent to all DXY registered users to invite them to participate in a 5-minute survey. The participants were asked to nominate up to four important medical innovations in China mainland since Xinhai revolution. The participant could select 'zero' which means he/she felt there was no important medical innovations, or he/she did not know important medical innovations. It was noted that important medical innovations refer to (I) those with practical and almost immediate significance to improve healthcare; (II) should not only be introducing western technique to China, but those involve major improvement of existing western techniques count; (III) should not be those with important theoretical discovery but did not have almost immediate significance to improve healthcare. In total 1,513 DXY users participated in the voting. Totally 489 (32.3%), 441 (29.1%), 342 (22.6%), 150 (9.9%), 91 (6.0%) participants provided 0, 1, 2, 3, 4 nominations respectively. (I) Artemisine (Qinghaosu) for malaria treatment (Project 523 team, 1972); (II) arsenic Trioxide (As2O3) for acute promyelocytic leukemia (APL) treatment (ZHANG Ting-Dong and colleagues, 1970s); (III) limb re-plantation (CHEN Zhong-Wei and colleagues, 1963); (IV) all-trans retinoic acid (ATRA) for APL treatment (WANG Zhen-Yi and colleagues, 1988); and (V) Wu's mask for plague prevention (WU Lien-The, 1910), were voted as the top five innovations in China mainland since Xinhai revolution, with 375, 96, 91, 53, and 8 votes respectively. In

Construction of full-length cDNA library of white flower Salvia ...

African Journals Online (AJOL)

STORAGESEVER

2009-05-18

May 18, 2009 ... of S. miltiorrhiza bge (Yuan et al., 1990; Wang et al.,. 1998; Huang et al., 2000). Hairy roots and ... or A. tumefaciens strains (Chen et al., 1997; Song et al.,. 1997). ..... Chen H, Yuan JP, Chen F, Zhang YL, Song JY (1997).

Acute and Time-Course Effects of Traditional and Dynamic Warm-Up Routines in Young Elite Junior Tennis Players.

Directory of Open Access Journals (Sweden)

Francisco Ayala

Full Text Available Despite the large number of studies that have examined the acute effects of different warm up modalities (WU on physical performance, none of them have documented the time course of potential performance recovery in tennis players. The aim of this study was twofold: (a to analyze and compare the acute effects of two different WU modalities (traditional WU [TWU] and dynamic WU [DWU] on physical performance (i.e., CMJ, sprint, serve speed and accuracy in elite junior players, as well as (b to monitor the time course of any WU-induced changes after 30 and 60 min of simulated match-play. Twelve junior elite players completed both WUs modalities (TWU and DWU in a counterbalanced order on separate days. In each experimental session, counter movement jump (CMJ, 20-m sprint, tennis serve speed and accuracy tests were performed before (immediately after TWU or DWU during (30 min and after 60 min of a simulated match play. Measures were compared via four factorial (WU intervention and time repeated measures ANOVAs. There were main effects of WU (TWU and DWU throughout the time for all the variables analysed. The results indicate that DWU routine led to significantly faster 20 m sprint times and higher CMJs as well as faster and more accurate tennis serves at both post warm-up and 30 min match-play testing moments in comparison with the scores reported by the TWU routine (p 75-99%. No significant intergroup differences were found at 60-min match-play testing moment in any variable (except for the 20 m sprint. Therefore, the findings of this study recommend for optimal performance in these elite tennis players, DWU routines should be performed prior to formal training and competition rather than TWU routines.

Uncertainty of Wheat Water Use: Simulated Patterns and Sensitivity to Temperature and CO2

Science.gov (United States)

Cammarano, Davide; Roetter, Reimund P.; Asseng, Senthold; Ewert, Frank; Wallach, Daniel; Martre, Pierre; Hatfield, Jerry L.; Jones, James W.; Rosenzweig, Cynthia E.; Ruane, Alex C.;

Women in physics

CERN Document Server

Indovino, Shaina

2013-01-01

What does it take to be a physicist? Lise Meitner, Katharine Blodgett, Maria Goeppert-Mayer, Chien-Shiung Wu, Ursula Franklin, Argelia Velez-Rodriguez, Sau Lan Wu, Shirley Ann Jackson, Lisa Randall and opportunities for women in physics today.

Electromagnetic properties of low-spin states in 102,104Pd

International Nuclear Information System (INIS)

Luontama, M.; Julin, R.; Kantele, J.; Passoja, A.; Trzaska, W.; Baecklin, A.; Jonsson, N.G.; Westerberg, L.

1985-12-01

Electromagnetic transitions from low-lying 0 + , 2 + , 4 + and 3 - states in 102 , 104 Pd have been studied with (p,2n) and (p,p) reactions and with Coulomb excitation. The E2 transition probabilities from the 0 3 + state in 102 Pd (13 W.u.) and from the 0 2 + state in 104 Pd (14 W.u.) are somewhat low for two-phonon states. Generally, the E2 transition rates are reasonably well reproduced by the IBA-2 and by the boson-expansion description. The intruding 0 2 + state (tsub(1/2) = 14.3 ns) in 102 Pd is connected to the 2 2 + and 2 3 + states via strong E2 transitions: B(E2;0 2 + →2 2 + )=96+-40 W.u.; B(E2;2 3 + →0 2 + )=17+-8 W.u

Compilation of data on the release of radioactive substances in the vent air of nuclear power plants in the Federal Republic of Germany in 1975

International Nuclear Information System (INIS)

Winkelmann, I.; Endrulat, H.J.; Haubelt, R.; Westpfahl, U.

1976-04-01

The present compilation of data on the release of radioactive substances in the vent air of nuclear power plants in the FRG is a continuation of a report series on aerosol filter and iodine filter samples from the exhaust air control systems of the nuclear power plants Gundremmingen, Obrigheim, Wuergassen, Stade, Lingen and Biblis A. The reports have been issued by the Federal public health office since 1972. This report is supplemented by annual release values on radioactive noble gases, on short- and long-lived aerosols, and on gaseous 131 I, supplied by the individual nuclear power plants as in previous years on uniform questionnaires. Data on the release of tritium are also available from some nuclear power plants. (orig.) [de

Liposome-based polymer complex as a novel adjuvant: enhancement of specific antibody production and isotype switch

Directory of Open Access Journals (Sweden)

Chen CH

2012-02-01

Full Text Available Chia-Hung Chen1,*, Yu-Ling Lin1,*, Yen-Ku Liu1, Pei-Juin He2, Ching-Min Lin1, Yi-Han Chiu2, Chang-Jer Wu3, Tian-Lu Cheng4, Shih-Jen Liu5,6,**, Kuang-Wen Liao1,2,**1Institute of Molecular Medicine and Bioengineering, 2Department of Biological Science and Technology, National Chiao Tung University, Hsinchu, 3Department of Food Science, National Taiwan Ocean University, Keelung, 4Department of Biomedical Science and Environmental Biology, Kaohsiung Medical University, Kaohsiung, 5National Institute of Infectious Diseases and Vaccinology, National Health Research Institutes, Miaoli, 6Graduate Institute of Immunology, China Medical University, Taichung, Taiwan, , *Chia-Hung Chen and Yu-Ling Lin contributed equally to this work**Kuang-Wen Liao and Shih-Jen Liu contributed equally to this workAbstract: The aim of vaccination is to induce appropriate immunity against pathogens. Antibody-mediated immunity is critical for protection against many virus diseases, although it is becoming more evident that coordinated, multifunctional immune responses lead to the most effective defense. Specific antibody (Ab isotypes are more efficient at protecting against pathogen invasion in different locations in the body. For example, compared to other Ab isotypes, immunoglobulin (Ig A provides more protection at mucosal areas. In this study, we developed a cationic lipopolymer (liposome-polyethylene glycol-polyethyleneimine complex [LPPC] adjuvant that strongly adsorbs antigens or immunomodulators onto its surface to enhance or switch immune responses. The results demonstrate that LPPC enhances uptake ability, surface marker expression, proinflammatory cytokine release, and antigen presentation in mouse phagocytes. In contrast to Freund's adjuvant, LPPC preferentially activates Th1-immunity against antigens in vivo. With lipopolysaccharides or CpG oligodeoxynucleotides, LPPC dramatically enhances the IgA or IgG2A proportion of total Ig, even in hosts that have developed

Browse Title Index

African Journals Online (AJOL)

Items 51 - 100 of 1309 ... Li-Long Liu, Kai Xu, Lu-Mei Kang, Shu-Ping Jiang, Qing-Hua Wang, ... CR Sewani-Rusike, JE Iputo, EJ Ndebia, M Gondwe, DR Kamadyaapa ... K-M Man, W-C Chen, H-M Wang, H-Y Chen, J-L Shen, L-D Chen, F-J Tsai, ...

A weighted U-statistic for genetic association analyses of sequencing data.

Science.gov (United States)

Wei, Changshuai; Li, Ming; He, Zihuai; Vsevolozhskaya, Olga; Schaid, Daniel J; Lu, Qing

2014-12-01

With advancements in next-generation sequencing technology, a massive amount of sequencing data is generated, which offers a great opportunity to comprehensively investigate the role of rare variants in the genetic etiology of complex diseases. Nevertheless, the high-dimensional sequencing data poses a great challenge for statistical analysis. The association analyses based on traditional statistical methods suffer substantial power loss because of the low frequency of genetic variants and the extremely high dimensionality of the data. We developed a Weighted U Sequencing test, referred to as WU-SEQ, for the high-dimensional association analysis of sequencing data. Based on a nonparametric U-statistic, WU-SEQ makes no assumption of the underlying disease model and phenotype distribution, and can be applied to a variety of phenotypes. Through simulation studies and an empirical study, we showed that WU-SEQ outperformed a commonly used sequence kernel association test (SKAT) method when the underlying assumptions were violated (e.g., the phenotype followed a heavy-tailed distribution). Even when the assumptions were satisfied, WU-SEQ still attained comparable performance to SKAT. Finally, we applied WU-SEQ to sequencing data from the Dallas Heart Study (DHS), and detected an association between ANGPTL 4 and very low density lipoprotein cholesterol. © 2014 WILEY PERIODICALS, INC.

Developing institutional collaboration between Wageningen university and the Chinese academy of agricultural sciences

NARCIS (Netherlands)

Bonnema, A.B.; Lin, Z.; Qu, L.; Jacobsen, E.

2006-01-01

Scientific co-operation between the Chinese Academy of Agricultural Sciences (CAAS) and Wageningen University (WU) has been underway since 1990, especially in the field of plant sciences. In 2001, CAAS and WU initiated a formal joint PhD training programme to further structure their co-operation.

Fundamental Investigations into the Infrared Properties of Carbon Nanotubes

Science.gov (United States)

2013-01-23

Vallejo , Rongtao Lu, Judy Wu. Development of Textured Magnesium Oxide Templates on Amorphous Polymer SurfacesUsing Ion-Beam-Assisted Deposition, Applied...Applied Physics Letters 99, 023111 (2011) 18. A. Elliot, Vallejo , R.T. Lu, and J.Z. Wu, “Development of Textured Magnesium Oxides Templates on

DMPD: Mechanism of age-associated up-regulation in macrophage PGE2 synthesis. [Dynamic Macrophage Pathway CSML Database

Lifescience Database Archive (English)

Full Text Available 15331118 Mechanism of age-associated up-regulation in macrophage PGE2 synthesis. Wu...e-associated up-regulation in macrophage PGE2 synthesis. PubmedID 15331118 Title Mechanism of age-associated... up-regulation in macrophage PGE2 synthesis. Authors Wu D, Meydani SN. Publicatio

Three new species of the genus Gnamptogenys (Hymenoptera, Formicidae from southern China with a key to the known Chinese species

Directory of Open Access Journals (Sweden)

Zhilin Chen

2017-02-01

Full Text Available Three new species of the genus Gnamptogenys Roger, 1863 are described from southern China: Gnamptogenys dentihumera Chen, Lattke & Zhou, sp. n., Gnamptogenys nanlingensis Chen, Lattke & Zhou, sp. n. and Gnamptogenys quadrutinodules Chen, Lattke & Zhou, sp. n. A distribution map and an identification key to workers for the known species of China are provided.

Reference: 418 [Arabidopsis Phenome Database[Archive

Lifescience Database Archive (English)

Full Text Available 418 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16856986i Chai Mao-Feng...cid responses in Arabidopsis. 5 665-74 16856986 2006 Sep The Plant journal An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Wang Xue-Chen|Wei Peng-Cheng|Yang Shuhua

Characterization of new plasmids from methylotrophic bacteria.

Science.gov (United States)

Brenner, V; Holubová, I; Benada, O; Hubácek, J

1991-07-01

Several tens of methanol-utilizing bacterial strains isolated from soil were screened for the presence of plasmids. From the obligate methylotroph Methylomonas sp. strain R103a plasmid pIH36 (36 kb) was isolated and its restriction map was constructed. In pink-pigmented facultative methylotrophs (PPFM), belonging to the genus Methylobacterium four plasmids were detected: plasmids pIB200 (200 kb) and pIB14 (14 kb) in the strain R15d and plasmids pWU14 (14 kb) and pWU7 (7.8 kb) in the strain M17. Because of the small size and the presence of several unique REN sites (HindIII, EcoRI, NcoI), plasmid pWU7 was chosen for the construction of a vector for cloning in methylotrophs. Cointegrates pKWU7A and pKWU7B were formed between pWU7 and the E. coli plasmid pK19 Kmr, which were checked for conjugative transfer from E. coli into the methylotrophic host.

Experimental validation of the Wigner distributions theory of phase-contrast imaging

International Nuclear Information System (INIS)

Donnelly, Edwin F.; Price, Ronald R.; Pickens, David R.

2005-01-01

Recently, a new theory of phase-contrast imaging has been proposed by Wu and Liu [Med. Phys. 31, 2378-2384 (2004)]. This theory, based upon Wigner distributions, provides a much stronger foundation for the evaluation of phase-contrast imaging systems than did the prior theories based upon Fresnel-Kirchhoff diffraction theory. In this paper, we compare results of measurements made in our laboratory of phase contrast for different geometries and tube voltages to the predictions of the Wu and Liu model. In our previous publications, we have used an empirical measurement (the edge enhancement index) to parametrize the degree of phase-contrast effects in an image. While the Wu and Liu model itself does not predict image contrast, it does measure the degree of phase contrast that the system can image for a given spatial frequency. We have found that our previously published experimental results relating phase-contrast effects to geometry and x-ray tube voltage are consistent with the predictions of the Wu and Liu model

Untitled

Indian Academy of Sciences (India)

Smith and Carson ... Z. Physikal. Chenn., 1908, 6, 200. 13. Ephraim ... Z. anord. Chen., 190S, 58, 33S. 14. Wright ... J. Chen. Soc, 1915, 107, 1527. 15. Amadori ... Gazetta, 1922, 1, 52, 387. 16. Mori ... J. Chen. Soc., Japa), 1923, 44, 730. 17. Waradachari and Subra- Proc. Ind. Acad, Sci., 1936, 3 A, 428. Ilala. 18. Hervey and ...

Platelet–lymphocyte ratios: a potential marker for pulmonary tuberculosis diagnosis in COPD patients

Directory of Open Access Journals (Sweden)

Chen G

2016-11-01

Full Text Available Guozhong Chen, Chunling Wu, Zhiying Luo, Yiming Teng, Suping Mao Department of Respiratory Medicine, Yiwu Central Hospital, Yiwu, Zhejiang Province, People’s Republic of China Background: In recent decades, morbidity and mortality have been found to be significantly increased in patients with chronic obstructive pulmonary disease (COPD complicated with pulmonary tuberculosis (PTB. Platelet–lymphocyte ratio (PLR is an indicator for inflammatory diseases. This study aims to investigate whether PLR could act as a potential marker for patients with COPD complicated with PTB.Methods: In this retrospective study, laboratory characteristics of 87 COPD patients complicated with PTB (determined by Mycobacterium tuberculosis positive culture from sputum or bronchial lavage fluid and 83 COPD patients (as the control group, determined by M. tuberculosis culture negativity from sputum or bronchial lavage fluid were investigated. Data obtained on the day of admission were analyzed.Results: PLR >216.82 was identified as the optimal cutoff value for discriminating COPD patients with PTB (sensitivity 92.4%, specificity 84.5%, positive-predictive value 91.6%, negative-predictive value 86.2%, and area under the curve [AUC] was 0.87 from patients with COPD alone. The AUC of PLR was significantly greater than that of neutrophil–lymphocyte count ratio (AUC, 0.74; 95% confidence interval, 0.67–0.81; P<0.01.Conclusion: PLR could be developed as a valuable maker for identifying tuberculosis infection in COPD patients. Keywords: platelet to lymphocyte ratio, pulmonary tuberculosis, chronic obstructive pulmonary disease

Nanotechnology in the targeted drug delivery for bone diseases and bone regeneration

Directory of Open Access Journals (Sweden)

Gu W

2013-06-01

Full Text Available Wenyi Gu,1,2 Chengtie Wu,3 Jiezhong Chen,1 Yin Xiao1 1Institute of Health and Biomedical Innovation, Queensland University of Technology, Brisbane, QLD, Australia; 2Australian Institute for Bioengineering and Nanotechnology, The University of Queensland, Brisbane, QLD, Australia; 3State Key Laboratory of High Performance Ceramics and Superfine Microstructure, Shanghai Institute of Ceramics, Chinese Academy of Sciences, Shanghai, People's Republic of China Abstract: Nanotechnology is a vigorous research area and one of its important applications is in biomedical sciences. Among biomedical applications, targeted drug delivery is one of the most extensively studied subjects. Nanostructured particles and scaffolds have been widely studied for increasing treatment efficacy and specificity of present treatment approaches. Similarly, this technique has been used for treating bone diseases including bone regeneration. In this review, we have summarized and highlighted the recent advancement of nanostructured particles and scaffolds for the treatment of cancer bone metastasis, osteosarcoma, bone infections and inflammatory diseases, osteoarthritis, as well as for bone regeneration. Nanoparticles used to deliver deoxyribonucleic acid and ribonucleic acid molecules to specific bone sites for gene therapies are also included. The investigation of the implications of nanoparticles in bone diseases have just begun, and has already shown some promising potential. Further studies have to be conducted, aimed specifically at assessing targeted delivery and bioactive scaffolds to further improve their efficacy before they can be used clinically. Keywords: nanoparticles, nanostructured scaffold, cancer bone metastasis, bone diseases, target drug delivery, bone regeneration

S1P transporter SPNS2 regulates proper postnatal retinal morphogenesis.

Science.gov (United States)

Fang, Chao; Bian, Ganlan; Ren, Pan; Xiang, Jie; Song, Jun; Yu, Caiyong; Zhang, Qian; Liu, Ling; Chen, Kun; Liu, Fangfang; Zhang, Kun; Wu, Chunfeng; Sun, Ruixia; Hu, Dan; Ju, Gong; Wang, Jian

2018-02-08

Spinster homolog 2 (SPNS2) is the membrane transporter of sphingosine-1-phosphate (S1P), and it participates in several physiologic processes by activating different S1P receptors (S1PRs). However, its functions in the nervous system remain largely unclear. We explored the important role of SPNS2 in the process of retinal morphogenesis using a spns2-deficient rat model. In the absence of the functional SPNS2 transporter, we observed progressively aggravating laminar disorganization of the epithelium at the postnatal stage of retinal development. Disrupted cell polarity, delayed cell-cycle exit of retinal progenitor cells, and insufficient migration of newborn neurons were proposed in this study as potential mechanisms accounting for this structural disorder. In addition, we analyzed the expression profiles of spns2 and s1prs, and proposed that SPNS2 regulated retinal morphogenesis by establishing the S1P level in the eye and activating S1PR3 signaling. These data indicate that SPNS2 is indispensable for normal retinal morphogenesis and provide new insights on the role of S1P in the developing retina using an established in vivo model.-Fang, C., Bian, G., Ren, P., Xiang, J., Song, J., Yu, C., Zhang, Q., Liu, L., Chen, K., Liu, F., Zhang, K., Wu, C., Sun, R., Hu, D., Ju, G., Wang, J. S1P transporter SPNS2 regulates proper postnatal retinal morphogenesis.

Vegetation Impact on Soil Strength: A State of the Knowledge Review

Science.gov (United States)

2017-06-20

CRREL SR-17-2 3 soil layers. However, their more thorough look at the Wu (1976) and Wal- dron (1977) root–soil model for soil cohesion indicated a...trafficability and mobility simulations (Wu 1976; Waldron 1977; Wal- dron and Dakessian 1981 as cited in Pirnazarov and Sellgren 2015). Figure 6. Maximum

PREFACE: Dynamic crossover phenomena in water and other glass-forming liquids Dynamic crossover phenomena in water and other glass-forming liquids

Science.gov (United States)

Chen, Sow-Hsin; Baglioni, Piero

2012-02-01

protein hydration water Francesco Mallamace, Carmelo Corsaro, Piero Baglioni, Emiliano Fratini and Sow-Hsin Chen Common features in the microscopic dynamics of hydration water on organic and inorganic surfacesE Mamontov, H O'Neill, Q Zhang, W Wang and D J Wesolowski Water dynamics as affected by interaction with biomolecules and change of thermodynamic state: a neutron scattering studyA Orecchini, A Paciaroni, C Petrillo, F Sebastiani, A De Francesco and F Sacchetti Temperature dependence of structure and density for D2O confined in MCM-41-SWilliam A Kamitakahara, Antonio Faraone, Kao-Hsiang Liu and Chung-Yuan Mou Density profile of water confined in cylindrical pores in MCM-41 silicaAlan K Soper Dynamic crossover in hydration water of curing cement paste: the effect of superplasticizerHua Li, Wei-Shan Chiang, Emiliano Fratini, Francesca Ridi, Francesco Bausi, Piero Baglioni, Madhu Tyagi and Sow-Hsin Chen Water confined in MCM-41: a mode coupling theory analysisP Gallo, M Rovere and S-H Chen Computer simulations of dynamic crossover phenomena in nanoconfined waterG B Suffritti, P Demontis, J Gulín-Gonźlez and M Masia Hydrophobic nanoconfinement suppresses fluctuations in supercooled waterE G Strekalova, M G Mazza, H E Stanley and G Franzese Other glass-forming liquids Quasi-elastic neutron scattering studies of the slow dynamics of supercooled and glassy aspirinYang Zhang, Madhusudan Tyagi, Eugene Mamontov and Sow-Hsin Chen Colloids Phase diagram of trivalent and pentavalent patchy particlesFlavio Romano, Eduardo Sanz, Piero Tartaglia and Francesco Sciortino Distinguishing the monomer to cluster phase transition in concentrated lysozyme solutions by studying the temperature dependence of the short-time dynamicsPéter Falus, Lionel Porcar, Emiliano Fratini, Wei-Ren Chen, Antonio Faraone, Kunlun Hong, Piero Baglioni and Yun Liu Contrast variation in spin-echo small angle neutron scatteringXin Li, Bin Wu, Yun Liu, Roger Pynn, Chwen-Yang Shew, Gregory S Smith, Kenneth W

Breaking a chaos-based secure communication scheme designed by an improved modulation method

Energy Technology Data Exchange (ETDEWEB)

Li Shujun [Department of Electronic Engineering, City University of Hong Kong, Kowloon, Hong Kong (China)]. E-mail: hooklee@mail.com; Alvarez, Gonzalo [Instituto de Fisica Aplicada, Consejo Superior de Investigaciones Cientificas, Serrano 144-28006 Madrid (Spain); Chen Guanrong [Department of Electronic Engineering, City University of Hong Kong, Kowloon, Hong Kong (China)

2005-07-01

Recently Bu and Wang [Bu S, Wang B-H. Chaos, Solitons and Fractals 2004;19(4):919-24] proposed a simple modulation method aiming to improve the security of chaos-based secure communications against return-map-based attacks. Soon this modulation method was independently cryptanalyzed by Chee et al. [Chee CY, Xu D, Bishop SR. Chaos, Solitons and Fractals 2004;21(5):1129-34], Wu et al. [Wu X, Hu H, Zhang B. Chaos, Solitons and Fractals 2004;22(2):367-73], and Alvarez et al. [Alvarez G, Montoya F, Romera M, Pastor G. Chaos, Solitons and Fractals, in press, arXiv:nlin/0406065] via different attacks. As an enhancement to the Bu-Wang method, an improving scheme was suggested by Wu et al. by removing the relationship between the modulating function and the zero-points. The present paper points out that the improved scheme proposed by Wu et al. is still insecure against a new attack. Compared with the existing attacks, the proposed attack is more powerful and can also break the original Bu-Wang scheme. Furthermore, it is pointed out that the security of the modulation-based schemes proposed by Wu et al. is not so satisfactory from a pure cryptographical point of view. The synchronization performance of this class of modulation-based schemes is also discussed.

Breaking a chaos-based secure communication scheme designed by an improved modulation method

International Nuclear Information System (INIS)

Li Shujun; Alvarez, Gonzalo; Chen Guanrong

2005-01-01

Recently Bu and Wang [Bu S, Wang B-H. Chaos, Solitons and Fractals 2004;19(4):919-24] proposed a simple modulation method aiming to improve the security of chaos-based secure communications against return-map-based attacks. Soon this modulation method was independently cryptanalyzed by Chee et al. [Chee CY, Xu D, Bishop SR. Chaos, Solitons and Fractals 2004;21(5):1129-34], Wu et al. [Wu X, Hu H, Zhang B. Chaos, Solitons and Fractals 2004;22(2):367-73], and Alvarez et al. [Alvarez G, Montoya F, Romera M, Pastor G. Chaos, Solitons and Fractals, in press, arXiv:nlin/0406065] via different attacks. As an enhancement to the Bu-Wang method, an improving scheme was suggested by Wu et al. by removing the relationship between the modulating function and the zero-points. The present paper points out that the improved scheme proposed by Wu et al. is still insecure against a new attack. Compared with the existing attacks, the proposed attack is more powerful and can also break the original Bu-Wang scheme. Furthermore, it is pointed out that the security of the modulation-based schemes proposed by Wu et al. is not so satisfactory from a pure cryptographical point of view. The synchronization performance of this class of modulation-based schemes is also discussed

Untitled

Indian Academy of Sciences (India)

Beak P and Chen C W 1985 Tetrahedron Lett. 4979. Boatman R J, Whitlock B J and Whitlock H W 1977 J. An. Chen. Soc. 99 4822. Diamond S E, Szalkiewicz A and Mares F 1979 J. Ann. Chen. Soc. 101 490. Ellefson C R 1979 J. Org. Chem. 44 1533. Gschwend H W and Rodriguez H R 1979 Organic reactions 26 Chapter I.

Biisofraxidin on Apoptosis of Human Gastric Cancer BGC-823 Cells

African Journals Online (AJOL)

Wu et al. Trop J Pharm Res, October 2015; 14(10): 1803. Tropical Journal of Pharmaceutical Research ... Jian-Tao Wu1,2*, She-Min Lv1, Chun-Hui Lu1, Jun Gong1 and Jian-Bo An3 ..... Zhu AK, Zhou H, Xia JZ, Jin HC, Wang K, Yan J, Zuo JB,.

African Journal of Biotechnology - Vol 9, No 15 (2010)

African Journals Online (AJOL)

cDNA, genomic sequence cloning and overexpression of ribosomal protein S16 gene (RPS16) from the Giant Panda · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. W Hou, Y Hou, Y Hao, T Zhang, Z Peng, Y Wu, G Wu, 2185-2191 ...

JPRS Report, China

National Research Council Canada - National Science Library

1993-01-01

...; AGRICULTURE - Further Reform of Grain Circulation, Prices Advocated, Chen Yaobang on Market Challenges Facing Agriculture, Chen Yaobang on Restructuring of Crop Planting, MILITARY, PUBLIC SECURITY...

Zhu Qing Wang

Indian Academy of Sciences (India)

Home; Journals; Journal of Chemical Sciences. Zhu Qing Wang. Articles written in Journal of Chemical Sciences. Volume 121 Issue 4 July 2009 pp 543-548. Highly sensitive optical chemosensor for the detection of Cu using a rhodamine B spirolatam · Gen Hua Wu Dong Xiang Wang Da Yu Wu Yuan Gao Zhu Qing Wang.

Bulletin of Materials Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science. Anhua Wu. Articles written in Bulletin of Materials Science. Volume 27 Issue 4 August 2004 pp 333-336 Crystal Growth. Bridgman growth and defects of Nd : Sr3Ga2Ge4O14 laser crystals · Jiaxuan Ding Anhua Wu Jiayue Xu · More Details Abstract Fulltext PDF.

Hybrid Chaos Synchronization of Four-Scroll Systems via Active Control

Science.gov (United States)

Karthikeyan, Rajagopal; Sundarapandian, Vaidyanathan

2014-03-01

This paper investigates the hybrid chaos synchronization of identical Wang four-scroll systems (Wang, 2009), identical Liu-Chen four-scroll systems (Liu and Chen, 2004) and non-identical Wang and Liu-Chen four-scroll systems. Active control method is the method adopted to achieve the hybrid chaos synchronization of the four-scroll chaotic systems addressed in this paper and our synchronization results are established using Lyapunov stability theory. Since the Lyapunov exponents are not required for these calculations, the active control method is effective and convenient to hybrid synchronize identical and different Wang and Liu-Chen four-scroll chaotic systems. Numerical simulations are also shown to illustrate and validate the hybrid synchronization results derived in this paper.

Synthesis of agarose–metal/semiconductor nanoparticles having ...

Indian Academy of Sciences (India)

Wintec

Jawaharlal Nehru Centre for Advanced Scientific Research, Jakkur PO, Bangalore 560 064 b. Molecular Biology and Genetics Unit, Jawaharlal Nehru Centre for Advanced Scientific ..... Li P, Li J, Wu C, Wu Q and Li J 2005 Nanotechno- logy. 16 1912. 18. Gadi B and Jeffrey G 2005 Curr. Med. Chem. 12 2163. 19. Gadi B and ...

Spectrum-effect relationships between high performance liquid ...

African Journals Online (AJOL)

promoting effect on contractility of intestinal smooth was carried out to ... addition, the equation of spectrum-effect relationships {Y = 3.818 - 1.126X1 + ..... Peng W, Liu YJ, Wu N, Sun T, He XY, Gao YX, Wu CJ. ... Zheng QF, Zhao YL, Wang JB, Liu TT, Zhang B, Gong ... Zhao HY, Han X. Research thoughts and application.

New Jurassic tettigarctid cicadas from China with a novel example of disruptive coloration

Directory of Open Access Journals (Sweden)

Jun Chen

2016-12-01

Full Text Available Tettigarctidae is the most primitive family of Cicadoidea, with only two relict species. Although they are relatively well known from Eurasia, Australia, Africa, and South America, their Mesozoic examples are typically preserved only as isolated forewings. Herein, a new genus Sanmai Chen, Zhang, and B. Wang with three new species (Sanmai kongi Chen, Zhang, and B. Wang, S. mengi Chen, Zhang, and B. Wang, and S. xuni Chen, Zhang, and B. Wang are described based on fossil specimens from the Middle–Upper Jurassic of northeastern China, with well-preserved body structures, forewing and hindwing venations, making it the hitherto best known extinct tettigarctid taxon. The new genus, provisionally assigned to the tribe Turutanoviini, provides some new information about the evolution and palaeobiogeography of Mesozoic Tettigarctidae. The genus Paraprosbole is synonymized with Shuraboprosbole. In addition, the coloration pattern of forewing, prominent on some specimens of Sanmai kongi Chen, Zhang, and B. Wang sp. nov. and Sanmai xuni Chen, Zhang, and B. Wang sp. nov., represents a novel example of disruptive coloration in Tettigarctidae, which can effectively break up the body outline as well as surface, and so likely enabled these cicadas to reduce the detectability of potential predators.

Soil Behavior Under Blast Loading

Science.gov (United States)

2010-12-01

in detail (Lade 2005, Prevost and Popescu 1996, Chen and Baladi 1985). Models that are appropriate to be implemented into finite element programs...Chen and Baladi 1985). As the soil strain hardens, both the cone and the end cap expand. This concept of cap envelope was a major step forward...hardening cap model (Chen and Baladi 1985) 17 The modified Cam-clay model was developed at Cambridge University by Roscoe et al. (1963). This

Annexin A1 is elevated in patients with COPD and affects lung fibroblast function

Directory of Open Access Journals (Sweden)

Lai TW

2018-02-01

Full Text Available Tianwen Lai,1,* Yanyu Li,1,* Zongjiong Mai,2 Xiaoxia Wen,1 Yingying Lv,1 Zhanqing Xie,3 Quanchao Lv,1 Min Chen,1 Dong Wu,1 Bin Wu1 1Department of Respiratory and Critical Care Medicine, 2Department of Oncology, 3Department of Thoracic Surgery, The Affiliated Hospital of Guangdong Medical University, Zhanjiang, People’s Republic of China *These authors contributed equally to this work Purpose: Fibrosis in peripheral airways is responsible for airflow limitation in chronic obstructive pulmonary disease (COPD. Annexin A1 modulates several key biological events during inflammation. However, little is known about its role in airway fibrosis in COPD. We investigated whether levels of Annexin A1 were upregulated in patients with COPD, and whether it promoted airway fibrosis.Methods: We quantified serum Annexin A1 levels in never-smokers (n=12, smokers without COPD (n=11, and smokers with COPD (n=22. Correlations between Annexin A1 expression and clinical indicators (eg, lung function were assessed. In vitro, human bronchial epithelial (HBE cells were exposed to cigarette smoke extract (CSE and Annexin A1 expression was assessed. Primary human lung fibroblasts were isolated from patients with COPD and effects of Annexin A1 on fibrotic deposition of lung fibroblasts were evaluated.Results: Serum Annexin A1 was significantly higher in patients with Global Initiative for Chronic Obstructive Lung Disease (GOLD guidelines stage III or IV than in those with GOLD stages I or II (12.8±0.8 ng/mL versus 9.8±0.7 ng/mL; p=0.016. Annexin A1 expression was negatively associated with airflow obstruction (forced expiratory volume in one second % predicted; r=−0.72, p<0.001. In vitro, Annexin A1 was significantly increased in CSE-exposed HBE cells in a time- and concentration-dependent manner. Annexin A1 promoted lung fibroblasts proliferation, migration, differentiation, and collagen deposition via the ERK1/2 and p38 mitogen-activated protein kinase pathways

Kinetic investigation on enantioselective hydrolytic resolution of ...

African Journals Online (AJOL)

Kinetic investigation on enantioselective hydrolytic resolution of epichlorohydrin by crude epoxide hydrolase from domestic duck liver. X Ling, D Lu, J Wang, J Chen, L Ding, J Chen, H Chai, P Ouyang ...

77 FR 11620 - Notice of Request for the Extension of a Currently Approved Information Collection

Science.gov (United States)

2012-02-27

... Reduction Act of 1995, this notice announces the intention of the Federal Transit Administration (FTA) to... INFORMATION CONTACT: Roy Chen, FTA Office of Technology, (202) 366-0462, or email: royweishun.chen@dot.gov...

Wide Band Gap Semiconductors Symposium Held in Boston, Massachusetts on 2-6 December 1991. Materials Research Society Symposium Proceedings. Volume 242

Science.gov (United States)

1992-01-01

AND PROPERTIES OF WIDE BAND-GAP Il-VI STRAINED- LAYER SUPERLATTICE 227 Hailong Wang. Jie Cui. Aidong Shen. Liang Xu, Yunliang Chen. and Yuhua Shen IN...WANG JIE CUI AIDONG SHEN LIANG XU YUNLIANG CHEN AND YUHUA SHEN Shanghai Institute of Optics and Fine Mechanics, Academia Sinica P.O.Box 800-216 Shanghai...He Zujou, Cao Huazhe, Su Wuda, Chen Zhongcai, Zhon Feng and Wang Erguang, Thin Solid Films, 139,261(1986). 22) Xin Li and T.L.Tansley, J.AppI.Phys

Download this PDF file

African Journals Online (AJOL)

pc

2017-11-10

Nov 10, 2017 ... ts of alkyl chain length on particles morphology were primarily studied ..... [3] Li Z, Yu L, Zheng L, Li N, Han S, Li G. Characterization studies on the ionic ... [4] Chiang YD, Lian HY, Leo SY, Wang SG, Yamauchi Y, Wu KC. ... [20] Yu YJ, Xing JL, Pang JL, Jiang SH, Lam KF, Yang TQ, Xue QS, Zhang K, Wu P.

Effects of Estradiol on Post-Traumatic Stress Disorder Symptoms

Science.gov (United States)

2010-03-01

Directed By: T. John Wu, Ph.D. Associate Professor, Department of Obstetrics and Gynecology Post-traumatic stress disorder (PTSD) is a complex...Preventing post-traumatic stress disorder after mass exposure to violence . Biosecur Bioterror 2005;3:154-63; discussion 64-5. 16. Baker DG...John Wu* Affiliations: *Program in Neuroscience and § Program in Molecular and Cellular Biology, Department of Obstetrics and Gynecology Uniformed

The Frontier National Society Viewed by WU Luzhen:Case of East Simeng Survey in Inner Mongolia%吴禄贞视野中的边疆民族社会①--以内蒙古东四盟调查为例

Institute of Scientific and Technical Information of China (English)

王鹏辉

2015-01-01

Inner Mongolia Dongsimeng region formed Mongolian and Han mixed pattern of survival in Qing Dynasty, and formed an in-terdependent community of destiny. WU lu-zhen survey showing the internal crisis of Inner Mongolia Dongsimeng borderland ethnic society, involving many aspects,such as politics, livelihoods and economies, religion and customs, which showed its domestic policy and internation-al aggression interaction mechanism of social contradictions and resulted in the frontier ethnic society in Modern China.%有清一代，内蒙古东四盟地域已经形成蒙汉杂居的生存格局，并且结成相互依存的命运共同体。吴禄贞的调查呈现出内蒙古东四盟边疆民族社会的内在危机，涉及政治、生计与经济、宗教与风俗诸多方面，显现其国内新政与国际侵略互动的社会矛盾机制。内蒙古东四盟身处清末国内国际两种交冲的力量与历史传统的碰撞，逐渐生成中国近代的边疆民族社会。

Effects of water stress and seed mass on germination and ...

African Journals Online (AJOL)

enoh

2012-03-01

Mar 1, 2012 ... polyvinylpyrrolidone; TCA, trichloroacetic acid; NBT, nitroblue tetrazolium; TBA ..... seeds had weaker resistances to moderate stress (-0.6. MPa) compared with .... Chen YN，Chen YP，Li WH，Zhang HF (2003). Response of ...

Blazar Sequence in Fermi Era Liang Chen

Indian Academy of Sciences (India)

Abstract. In this paper, we review the latest research results on the topic of blazar sequence. It seems that the blazar sequence is phenomenally ruled out, while the theoretical blazar sequence still holds. We point out that black hole mass is a dominated parameter accounting for high-power- high-synchrotron-peaked and ...

Effects of HGF gene polymorphisms and protein expression on transhepatic arterial chemotherapeutic embolism efficacy and prognosis in patients with primary liver cancer

Directory of Open Access Journals (Sweden)

Chen HY

2017-02-01

Full Text Available Hai-Yong Chen,1,2 Yao-Min Chen,3 Jian Wu,1,2 Fu-Chun Yang,1,2 Zhen Lv,1,2 Yi-Gang Qian,1,2 Shu-Sen Zheng1,2 1Department of Surgery, Division of Hepatobiliary and Pancreatic Surgery, The First Affiliated Hospital, Zhejiang University, 2Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, 3Department of Breast Surgery, The First Affiliated Hospital, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China Objective: To investigate the correlations of two hepatocyte growth factor (HGF gene polymorphisms (rs5745652 and rs2074725 and their protein expression levels with the efficacy of transhepatic arterial chemotherapeutic embolism (TACE and prognosis in patients with primary liver cancer (PLC. Methods: From March 2011 to June 2012, 109 PLC patients (the case group who chose TACE as primary treatment and 80 healthy people (the control group who had undergone physical examination in The First Affiliated Hospital, Zhejiang University were selected during the same period. Gene polymorphisms of HGF rs5745652 and HGF rs2074725 were detected. Serum HGF level, treating efficacy, survival quality, and 3-year survival rate for PLC patients who received TACE were observed. Results: There were significant differences in genotype and allele frequencies of HGF rs5745652 and HGF rs2074725, between the case and control groups (all P<0.05. Compared with CT+TT genotype of HGF rs5745652, patients carrying CC genotype had lower serum HGF levels, higher efficacy, better survival quality, and prolonged 3-year survival rate (all P<0.05. In rs2074725, patients carrying CA+AA genotype had lower serum HGF levels, higher efficacy, better survival quality, and prolonged 3-year survival rate compared with patients carrying rs2074725 CC genotype (all P<0.05. Gene polymorphisms of HGF rs5745652 and HGF rs2074725, tumor size, and Barcelona Clinic Liver Cancer stage were independent prognostic factors for PLC (P<0.05. Conclusion: Our

Development of liposomal pemetrexed for enhanced therapy against multidrug resistance mediated by ABCC5 in breast cancer

Directory of Open Access Journals (Sweden)

Bai F

2018-03-01

Full Text Available Fang Bai,1–3,* You Yin,4,* Ting Chen,1,* Jihui Chen,1 Meixin Ge,2 Yunshu Lu,2 Fangyuan Xie,5 Jian Zhang,1 Kejin Wu,3 Yan Liu1,6 1Department of Pharmacy, Xinhua Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, 2Department of General Surgery, Xinhua Hospital, Affiliated to Shanghai Jiao Tong University, School of Medicine, Shanghai, 3Department of Breast Surgery, Obstetrics and Gynaecology Hospital, Fudan University, Shanghai, 4Department of Neurology, Changzheng Hospital Affiliated to Second Military Medical University, Shanghai, 5Department of Pharmacy, Shanghai Eastern Hepatobiliary Surgery Hospital, Shanghai, 6Department of Pharmacy, Changzheng Hospital Affiliated to Second Military Medical University, Shanghai, People’s Republic of China *These authors contributed equally to this work Purpose: Breast cancer is the most common cancer among women. Pemetrexed, a new generation antifolate drug, is one of the primary treatments for breast cancer. However, multidrug resistance (MDR in breast cancer greatly hampers the therapeutic efficacy of chemotherapies such as pemetrexed. Nanomedicine is emerging as a promising alternative technique to overcome cancer MDR. Thus, pemetrexed-loaded d-alpha tocopheryl polyethylene glycol 1000 succinate (vitamin E TPGS liposomes (liposomal pemetrexed were developed as a strategy to overcome MDR to pemetrexed in breast cancer. Materials and methods: Liposomal pemetrexed was developed using the calcium acetate gradient method. The cytotoxic effects, apoptosis-inducing activity, in vivo distribution, and antitumor activity of liposomal pemetrexed were investigated. Results: Liposomal pemetrexed was small in size (160.77 nm, with a small polydispersity of <0.1. The encapsulation efficacy of liposomal pemetrexed was 63.5%, which is rather high for water-soluble drugs in liposomes. The IC50 of liposomal pemetrexed following treatment with MDR breast cancer cells (MCF-7 cells overexpressing ABCC5

Stereotactic body radiation therapy via helical tomotherapy to replace brachytherapy for brachytherapy-unsuitable cervical cancer patients – a preliminary result

Directory of Open Access Journals (Sweden)

Hsieh CH

2013-02-01

Full Text Available Chen-Hsi Hsieh,1–3 Hui-Ju Tien,1 Sheng-Mou Hsiao,4 Ming-Chow Wei,4 Wen-Yih Wu,4 Hsu-Dong Sun,4 Li-Ying Wang,5 Yen-Ping Hsieh,6 Yu-Jen Chen,3,7–9 Pei-Wei Shueng1,101Department of Radiation Oncology, Far Eastern Memorial Hospital, Taipei, Taiwan; 2Department of Medicine, 3Institute of Traditional Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan; 4Department of Obstetrics and Gynecology, Far Eastern Memorial Hospital, Taipei, Taiwan; 5School and Graduate Institute of Physical Therapy, College of Medicine, National Taiwan University, Taipei, Taiwan; 6Department of Senior Citizen Service Management, National Taichung University of Science and Technology, Taichung, Taiwan; 7Department of Radiation Oncology, 8Department of Medical Research, Mackay Memorial Hospital, Taipei, Taiwan; 9Graduate Institute of Sport Coaching Science, Chinese Culture University, Taipei, Taiwan; 10Department of Radiation Oncology, National Defense Medical Center, Taipei, TaiwanAim: To review the experience and to evaluate the results of stereotactic body radiation therapy (SBRT via helical tomotherapy (HT, for the treatment of brachytherapy-unsuitable cervical cancer.Methods: Between September 1, 2008 to January 31, 2012, nine cervical cancer patients unsuitable for brachytherapy were enrolled. All of the patients received definitive whole pelvic radiotherapy with or without chemotherapy, followed by SBRT via HT.Results: The actuarial locoregional control rate at 3 years was 78%. The mean biological equivalent dose in 2-Gy fractions of the tumor, rectum, bladder, and intestines was 76.0 ± 7.3, 73.8 ± 13.2, 70.5 ± 10.0, and 43.1 ± 7.1, respectively. Only two had residual tumors after treatment, and the others were tumor-free. Two patients experienced grade 3 acute toxicity: one had diarrhea; and another experienced thrombocytopenia. There were no grade 3 or 4 subacute toxicities. Three patients suffered from manageable rectal bleeding in

Research on simulation and experiment of noninvasive intracranial pressure monitoring based on acoustoelasticity effects

Directory of Open Access Journals (Sweden)

Wu J

2013-08-01

Full Text Available Jun Wu1, Wei He2, Wei-min Chen1, Lian Zhu21Key Laboratory of Optoelectronic Technology and Systems, 2State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing, People’s Republic of ChinaAbstract: The real-time monitoring of intracranial pressure (ICP is very important for craniocerebrally critically ill patients, but it is very difficult to realize long-time monitoring for the traditional invasive method, which very easily infects patients. Many noninvasive methods have emerged, but these have not been able to monitor ICP for long periods in real time, and they are not ready for clinical application. In order to realize long-time, online, real-time, noninvasive monitoring for ICP, a new method based on acoustoelasticity of ultrasound is herein proposed. Experimental models were devised to research the new method for experiment and simulation. Polymethyl methacrylate and hydrogel were adopted for the experiment, and their mechanical properties were very close to the real brain. A numerical solution for acoustoelasticity theory was acquired by simulating calculation based on a finite-element method. This was compared to the experimental value. The results showed a consistent match between theoretical solution and experimental value, with maximum error at most 5%. Thus, the effectiveness of the new method was verified. Theoretical and practical foundation is provided for this new method, and it could be used for animal experimentation or clinical testing in further research.Keywords: medical instruments, noninvasive, intracranial pressure, ultrasonic, acoustoelasticity, biomechanics

A novel imidazopyridine derivative, X22, attenuates sepsis-induced lung and liver injury by inhibiting the inflammatory response in vitro and in vivo

Directory of Open Access Journals (Sweden)

Ge X

2016-06-01

Full Text Available Xiangting Ge,1,2,* Zhiguo Feng,1,* Tingting Xu,2 Beibei Wu,3 Hongjin Chen,1 Fengli Xu,3 Lili Fu,1 Xiaoou Shan,3 Yuanrong Dai,2 Yali Zhang,1 Guang Liang11Chemical Biology Research Center, School of Pharmaceutical Sciences, 2Department of Pulmonary Medicine, The 2nd Affiliated Hospital, 3Department of Pediatrics, The 2nd Affiliated Hospital, Wenzhou Medical University, Wenzhou, People’s Republic of China*These authors contributed equally to this workAbstract: Sepsis remains a leading cause of death worldwide. Despite years of extensive research, effective drugs to treat sepsis in the clinic are lacking. In this study, we found a novel imidazopyridine derivative, X22, which has powerful anti-inflammatory activity. X22 dose-dependently inhibited lipopolysaccharide (LPS-induced proinflammatory cytokine production in mouse primary peritoneal macrophages and RAW 264.7 macrophages. X22 also downregulated the LPS-induced proinflammatory gene expression in vitro. In vivo, X22 exhibited a significant protection against LPS-induced death. Pretreatment or treatment with X22 attenuated the sepsis-induced lung and liver injury by inhibiting the inflammatory response. In addition, X22 showed protection against LPS-induced acute lung injury. We additionally found that pretreatment with X22 reduced the inflammatory pain in the acetic acid and formalin models and reduced the dimethylbenzene-induced ear swelling and acetic acid-increased vascular permeability. Together, these data confirmed that X22 has multiple anti-inflammatory effects and may be a potential therapeutic option in the treatment of inflammatory diseases.Keywords: LPS, imidazopyridine derivative, sepsis, acute lung injury, inflammation

Effects of PEGylated lipid nanoparticles on the oral absorption of one BCS II drug: a mechanistic investigation

Directory of Open Access Journals (Sweden)

Zhang XW

2014-11-01

Full Text Available Xingwang Zhang,* Guijiang Chen,* Tianpeng Zhang, Zhiguo Ma, Baojian WuDivision of Pharmaceutics, College of Pharmacy, Jinan University, Guangzhou, People’s Republic of China*These authors contributed equally to this workAbstract: Lipid nanocarriers are becoming a versatile platform for oral delivery of lipophilic drugs. In this article, we aimed to explore the gastrointestinal behaviors of lipid nanoparticles and the effect of PEGylation on oral absorption of fenofibrate (FN, a Biopharmaceutics Classification System (BCS II model drug. FN-loaded PEGylated lipid nanoparticles (FN-PLNs were prepared by the solvent-diffusion method and characterized by particle size distribution, morphology, Fourier transform infrared spectroscopy, and drug release. Lipolytic experiments were performed to assess the resistance of lipid nanoparticles against pancreatic lipase. Pharmacokinetics was evaluated in rats after oral administration of FN preparations. The obtained FN-PLNs were 186.7 nm in size with an entrapment efficiency of >95%. Compared to conventional lipid nanoparticles, PLNs exhibited slower drug release in the lipase-containing medium, strikingly reduced mucin binding, and suppressed lipolysis in vitro. Further, oral absorption of FN was significantly enhanced using PLNs with relative bioavailability of 123.9% and 157.0% to conventional lipid nanoparticles and a commercial formulation (Lipanthyl®, respectively. It was demonstrated that reduced mucin trapping, suppressed lipolysis, and/or improved mucosal permeability were responsible for increased oral absorption. These results facilitated a better understanding of the in vivo fate of lipid nanoparticles, and suggested the potential of PLNs as oral carriers of BCS II drugs.Keywords: fenofibrate, lipid nanoparticles, PEGylation, oral bioavailability, absorption mechanism

SYNTHESES, STRUCTURES AND PROPERTIES Jian Wu1*, Fu

African Journals Online (AJOL)

Preferred Customer

Printed in Ethiopia. © 2014 Chemical Society of Ethiopia ... 1Guangxi Key Laboratory of Chemistry and Engineering of Forest Products, Guangxi University ... The O–H···O and C–H···Cl hydrogen-bonding interactions play a significant role in.

How Many Women Are Affected by or at Risk of Preeclampsia?

Science.gov (United States)

... pregnancy outcomes: Differences among 4 racial/ethnic groups. American Journal of Public Health, 95 (9), 1545–1551. Lin, H. C., Chen, S. F., Lin, H. C., & Chen, Y. H. (2010). Increased risk of adverse pregnancy outcomes ...

Proceedings – Mathematical Sciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Author Affiliations. Yanheng Chen1 2 Guiyun Chen1. School of Mathematics and Statistics, Southwest University, Chongqing 400715, People's Republic of China; School of Mathematics and Statistics, Chongqing Three Gorges University, Chongqing 404100, People's Republic of China ...

Unearthing the Past

DEFF Research Database (Denmark)

Bagger-Petersen, Mai Corlin

2013-01-01

Wu Wenguang, considered the father of independent Chinese documentary film, has since 2005 slowly but surely been handing over the camera to people on the margins and to younger generations of Chinese documentary filmmaking. In 2010 Wu and Caochangdi Workstation initiated the Folk Memory Document...... Documentary Project, where young filmmakers go to the countryside to gather and document memories of the Great Famine (1959-1961) from elderly villagers....

The validity and accuracy in foot-to-foot bioelectrical impedance ...

African Journals Online (AJOL)

The validity and accuracy in foot-to-foot bioelectrical impedance analysis measuring models referenced by dual-energy X-ray absorptiometry in body composition in standing position. KC Hsieh, HK Lu, CH Chen, TR Jang, YY Chen, MF Kao ...

Microbially-Mediated Precipitation of Calcium Carbonate Nanoparticles.

Science.gov (United States)

Kang, Ser Ku; Roh, Yul

2016-02-01

The objective of this study was to investigate the biomineralization of carbonate minerals using microorganisms (Wu Do-1) enriched from rhodoliths. A 16S rRNA sequence analysis showed that Wu Do-1 mainly contained Proteus mirabilis. The pH decreased from 6.5 to 5.3 over the first 4 days of incubation due to microbial oxidation of organic acids, after which it increased to 7.8 over the remaining incubation period. XRD analysis showed that the precipitates were Mg-rich cal- cite (MgxCa(1-x)CO3), whereas no precipitates were formed without the addition of Wu Do-1 in D-1 medium. SEM-EDS analyses showed that the Mg-rich calcite had a rhombohedron shape and consisted of Ca, Si and Mg with an extracelluar polymeric substance (EPS). In addition, TEM-EDS analyses revealed they were hexagon in shape, 500-700 nm in size, and composed of Ca, Mg, C, and O. These results indicated that Wu Do-1 induced precipitation of Mg-rich calcite on the cell walls and EPS via the accumulation of Ca and/or Mg ions. Therefore, microbial precipitation of carbonate nanoparticles may play an important role in metal and carbon biogeochemistry, as well as in carbon sequestration in natural environments.

Does Vibration Warm-up Enhance Kinetic and Temporal Sprint Parameters?

Science.gov (United States)

Cochrane, D J; Cronin, M J; Fink, P W

2015-08-01

The aim of this study was to investigate the efficacy of vibration warm-up to enhance sprint performance. 12 males involved in representative team sports performed 4 warm-up conditions in a randomised order performed at least 24 h apart; VbX warm-up (VbX-WU); Neural activation warm-up (Neu-WU); Dynamic warm-up (Dyn-WU) and Control (No VbX). Participants completed 5 m sprint at 30 s, 2:30 min and 5 min post warm-up where sprint time, kinetics, and temporal components were recorded. There was no significant (p>0.05) main effect or interaction effect between the split sprint times of 1 m, 2.5 m, and 5 m. There was a condition effect where vertical mean force was significantly higher (p0.05) main and interaction effects in sprint kinetic and temporal parameters existed. Overall, all 4 warm-up conditions produced comparable results for sprint performance, and there was no detrimental effect on short-duration sprint performance using VbX-WU. Therefore, VbX could be useful for adding variety to the training warm-up or be included into the main warm-up routine as a supplementary modality. © Georg Thieme Verlag KG Stuttgart · New York.

A Multiscale Modeling System: Developments, Applications, and Critical Issues

Science.gov (United States)

Tao, Wei-Kuo; Lau, William; Simpson, Joanne; Chern, Jiun-Dar; Atlas, Robert; Khairoutdinov, David Randall Marat; Li, Jui-Lin; Waliser, Duane E.; Jiang, Jonathan; Hou, Arthur;

Implementation of envelope detection based Wake-Up Receiver for IEEE 802.15.4 WPAN from off-the-shelf components

Science.gov (United States)

Arndt, Josua; Krystofiak, Lukas; Bonehi, Vahid; Wunderlich, Ralf; Heinen, Stefan

2017-09-01

Power consumption in wireless networks is crucial. In most scenarios the transmission time is short compared to the idle listening time for data transmission, the most power is consumed by the receiver. In low latency systems there is a need for low power wake-up receivers (WuRx) that reduce the power consumption when the node is idle, but keep it responsive. This work presents a WuRx designed out of commercial components to investigate the needs of a WuRx when it is embedded in a Wireless Personal Area Network (WPAN) system in a real environment setup including WLAN and LTE communication and considering interferer rejection. The calculation necessary for the attenuation of those interferers is explained in detail. Furthermore, a system design is presented that fulfills the requirements for this environment and is build from off-the-shelf components.

Stochastic spin-one massive field

International Nuclear Information System (INIS)

Lim, S.C.

1984-01-01

Stochastic quantization schemes of Nelson and Parisi and Wu are applied to a spin-one massive field. Unlike the scalar case Nelson's stochastic spin-one massive field cannot be identified with the corresponding euclidean field even if the fourth component of the euclidean coordinate is taken as equal to the real physical time. In the Parisi-Wu quantization scheme the stochastic Proca vector field has a similar property as the scalar field; which has an asymptotically stationary part and a transient part. The large equal-time limit of the expectation values of the stochastic Proca field are equal to the expectation values of the corresponding euclidean field. In the Stueckelberg formalism the Parisi-Wu scheme gives rise to a stochastic vector field which differs from the massless gauge field in that the gauge cannot be fixed by the choice of boundary condition. (orig.)

Dokumenterede metoder i bostøtteindsatsen over for mennesker med psykiske lidelser

DEFF Research Database (Denmark)

Amilon, Anna; Mehlsen, Line; Bengtsson, Steen

, som kan bistå borgeren efter forløbets afslutning. Konklusion/resultater: Overordnet set viser evalueringen, at borgerne profiterer af CTI-indsatsen. Der sker en statistisk signifikant forbedring af CTI-gruppens mentale trivsel fra første måling til 9-måneders-målingen. Borgernes funktionsniveau er...... blevet målt på tre livsområder: arbejde/uddannelse, socialt liv og familieliv/hjemlige forpligtelser. Resultaterne viser, at borgerne udvikler sig signifikant i positiv retning (oplever færre begrænsninger) efter 9 måneders forløb sammenholdt med ved forløbets opstart. Derudover viser resultaterne fra....... Indsatsborgerne oplevede forbedret psykisk trivsel, forbedret funktionsevne samt fik et stærkere socialt netværk. Baggrund: Evalueringen af metoden Critical Time Intervention (CTI), er udarbejdet som led i satspuljeinitiativet ’Dokumenterede metoder i bostøtteindsatsen over for mennesker med psykiske lidelser...

Mechanisms of all-trans retinoic acid-induced differentiation of acute ...

Indian Academy of Sciences (India)

Author Affiliations. Ji-Wang Zhang1 Jian Gu1 Zhen-Yi Wang1 Sai-Juan Chen1 Zhu Chen1. Shanghai Institute of Hematology, Ruijin Hospital Affiliated to Shanghai Second Medical University, 197 Ruijin Road II, Shanghai 200025, People's Republic of China ...

New St-chromosome-specific molecular markers for identifying ...

Indian Academy of Sciences (India)

et al. 1994) or JJsSt (Chen et al. 1998) was widely used in wheat breeding programme (Chen .... Japan). Table 1. The features of primers used in this study. Homologous ..... Redinbaugh M. G., Jones T. A. and Zhang Y. T. 2000 Ubiquity of.

Sadhana | Indian Academy of Sciences

Indian Academy of Sciences (India)

YUZHI CHEN1 2 XUDONG CHEN2 JINGWU BU3. Architectural Engineering Institute, Jinling Institute of Technology, Nanjing 211169, China; College of Civil and Transportation Engineering, Hobai University, Nanjing 210098, China; College of Water Conservancy and Hydropower Engineering, Hohai University, Nanjing ...

A comparative survey of the condition of tourism infrastructure in Iranian provinces using VIKOR and TOPSIS

OpenAIRE

Moslem Bagheri; Payam Shojaei; Maryam Tayebi Khorami

2018-01-01

Tourism infrastructure development in different regions of the world does not follow a symmetrically equal pattern. Because of the importance of infrastructure in the tourism development, the present research is an attempt to examine the hard elements of tourism infrastructure in different provinces of Iran, using the indicators proposed by Pearce and Wu (2015) [Pearce, P. L. & Wu, M. Y. (2015). Soft infrastructure at tourism sites: identifying key issues for Asian tourism from case studies. ...

LDRD 2013 Annual Report: Laboratory Directed Research and Development Program Activities

Energy Technology Data Exchange (ETDEWEB)

Bookless, W. [Brookhaven National Lab. (BNL), Upton, NY (United States)

2013-12-31

This LDRD project establishes a research program led by Jingguang Chen, who has started a new position as a Joint Appointee between BNL and Columbia University as of FY2013. Under this project, Dr. Chen will establish a new program in catalysis science at BNL and Columbia University. The LDRD program will provide initial research funding to start research at both BNL and Columbia. At BNL, Dr. Chen will initiate laboratory research, including hiring research staff, and will collaborate with the existing BNL catalysis and electrocatalysis research groups. At Columbia, a subcontract to Dr. Chen will provide startup funding for his laboratory research, including initial graduate student costs. The research efforts will be linked under a common Catalysis Program in Sustainable Fuels. The overall impact of this project will be to strengthen the BNL catalysis science program through new linked research thrusts and the addition of an internationally distinguished catalysis scientist.

Comparisons of pharmacokinetic and tissue distribution profile of four major bioactive components after oral administration of Xiang-Fu-Si-Wu Decoction effective fraction in normal and dysmenorrheal symptom rats.

Science.gov (United States)

Liu, Pei; Li, Wei; Li, Zhen-hao; Qian, Da-wei; Guo, Jian-ming; Shang, Er-xin; Su, Shu-lan; Tang, Yu-ping; Duan, Jin-ao

2014-07-03

Xiang-Fu-Si-Wu Decoction (XFSWD) has been widely used to treat primary dysmenorrhea in clinical practice for hundreds of years and shown great efficacy. One fraction of XFSWD, which was an elution product by macroporous adsorption resin from aqueous extract solution with 60% ethanol (XFSWE), showed great analgesic effect. The present study was conducted to investigate the possible pharmacokinetic and tissue distribution profiles of four major bioactive constituents (berberine, protopine, tetrahydrocoptisine and tetrahydropalmatine) after oral administration of XFSWE in dysmenorrheal symptom rats, and to compare the difference between normal and dysmenorrheal symptom rats. Estradiol benzoate and oxytocin were used to produce dysmenorrheal symptom rat model. The experimental period was seven days. At the final day of experimental period, both normal and dysmenorrheal symptom rats were orally administrated with XFSWE, and then the blood and tissues samples were collected at different time points. Berberine, protopine, tetrahydrocoptisine and tetrahydropalmatine in blood and tissue samples were determined by LC-MS/MS. Pharmacokinetic parameters were calculated from the plasma concentration-time data using non-compartmental methods. The differences of pharmacokinetic parameters among groups were tested by one-way analysis of variance (ANOVA). There were statistically significant differences (Pnormal and dysmenorrheal symptom rats that orally administered with same dosage of XFSWE. In tissue distribution study, the results showed that the overall trend was C(Spleen)>C(Liver)>C(Kidney)>C(Uterus)>C(Heart)>C(Lung)>C(Ovary)>C(Brain)>C(Thymus), C(M-60 min)>C(M-120 min)>C(M-30 min)>C(C-60 min)>C(C-120 min)>C(C-30 min). The contents of protopine in liver, spleen and uterus were more than that in other tissues of dysmenorrheal symptom rats. Compared to normal rats, partial contents of the compounds in dysmenorrheal symptom rats׳ tissues at different time points had significant

Enhancement of Radiation Therapy in Prostate Cancer by DNA-PKcs Inhibitor

Science.gov (United States)

2015-09-01

Center, Urology Habib , Amyn; UTSouthwestern Medical Center, Neurology & Neurotherapeutics Chen, Benjamin; UTSouthwestern Medical Center, Radiation...Tsong Hsieh 3,5,7 , Amyn A. Habib 4,5,6 , Benjamin Chen 1,4 and Debabrata Saha 1,4 1 Department of Radiation Oncology, 3 Department of Urology, 4

The effects of reciprocal cross on inheritance of DNA methylation in ...

African Journals Online (AJOL)

enoh

2012-03-20

Mar 20, 2012 ... DNA methylation plays an important role for regulation of gene expression. To study ... genes, and newly acquired epigenetic states of trans- ... GACTGCGTACCAATTCAGA(E6). ATCATGAGTCCTGCTCGGTAC(H6). GACTGCGTACCAATTCAGT(E7) ..... Chen XQ, Ma Y, Chen F, Song WQ, Zhang L (2009).

Pitfalls in VAR based return decompositions: A clarification

DEFF Research Database (Denmark)

Engsted, Tom; Pedersen, Thomas Quistgaard; Tanggaard, Carsten

in their analysis is not "cashflow news" but "inter- est rate news" which should not be zero. Consequently, in contrast to what Chen and Zhao claim, their decomposition does not serve as a valid caution against VAR based decompositions. Second, we point out that in order for VAR based decompositions to be valid......Based on Chen and Zhao's (2009) criticism of VAR based return de- compositions, we explain in detail the various limitations and pitfalls involved in such decompositions. First, we show that Chen and Zhao's interpretation of their excess bond return decomposition is wrong: the residual component...

New species and new records of Amphinemurinae (Plecoptera: Nemouridae) from Shaanxi Province of China.

Science.gov (United States)

Li, Weihai; Dong, Wenbin; Yang, Ding

2018-03-27

Three new species of the Amphinemurinae genus Amphinemura, A. dicroidea sp. nov., A. longihamita sp. nov. and A. microhamita sp. nov., are described from China. These new species are compared with related taxa. Amphinemura multispina (Wu) and Sphaeronemoura grandicauda (Wu) (also belonging to the Amphinemurinae) are recorded from Shaanxi Province, northwestern China for the first time. The adult male of A. multispina is redescribed and the adult female of S. grandicauda is also described based on new material.

Developing institutional collaboration between Wageningen University and the Chinese Academy of Agricultural Sciences

OpenAIRE

Bonnema, A.B.; Lin, Zhai; Qu, Liang; Jacobsen, E.

2006-01-01

Scientific co-operation between the Chinese Academy of Agricultural Sciences (CAAS) and Wageningen University (WU) has been underway since 1990, especially in the field of plant sciences. In 2001, CAAS and WU initiated a formal joint PhD training programme to further structure their co-operation. The goals of this co-operation are to: (1) initiate long-term institutional collaboration through capacity building; (2) jointly establish a modern laboratory; (3) jointly develop a cross-cultural sc...

People’s Republic of China Scientific Abstracts, Number 185

Science.gov (United States)

1978-02-14

CONTENTS PAGE HANG-K’UNG CHIH-SHIH [AERONAUTICAL KNOWLEDGE] No 10, October 1977 .... 1 CHIH-WU HSUEH-PAO [ACTA BOTANICA SINICA] No 3, September 1977 8...launch units; 3) Chairman Hua visiting an earthquake damaged region; 4) a group of female pilots of a minority race. 3012 CSO: 4009 ACTA BOTANICA ...CHIH-WU HSUEH-PAO [ACTA BOTANICA SINICä] in Chinese Vol 19 No 3, Sep 77 pp 167-171 TEXT OF ENGLISH ABSTRACT: 1. The process of microsporogenesis

Enhanced Performance & Functionality of Tunable Delay Lines

Science.gov (United States)

2012-08-01

Based Tunable Optical Delays”, Optics Letters, Vol. 33, Issue 13, pp. 1518-1520 (2008). 2. Louis Christen, Irfan Fazal , Omer F. Yilmaz, Xiaoxia Wu...2008. 3. Omer F. Yilmaz, Louis Christen, Xiaoxia Wu, Scott R. Nuccio, Irfan Fazal , and Alan E. Willner, “Time-Slot-Interchange of 40 Gb/s Variable...F. Yilmaz, S. Khaleghi, L. Christen, I. Fazal , and A. E. Willner, “503 ns, Tunable Optical Delay of 40 Gb/s RZ-OOK using Additional λ-Conversion

日清戦争後中国女子教育普及に向けた日本教育界の働きかけ : 呉汝綸の日本教育視察(1902)をめぐって

OpenAIRE

董, 秋艶; Dong, QiuYan

2013-01-01

This paper analyzes the intervention by Japanese educators to spread women's education in China that followed Wu Rulun's observation in Japan. Japanese educators used this opportunity to attempt to introduce Japanese influences into Chinese women's education in the post Sino-Japan War era. Wu made a trip to Japan in order to observe Japanese education and to develop ideas for pending reforms on Chinese women's education. Chapter one reports the Ministry of Education, Science and Culture showi...

African Journal of Traditional, Complementary and Alternative ...

African Journals Online (AJOL)

Anti-tumour effects of polysaccharides isolated from Artemisia Annua L by inducing cell apoptosis and immunomodulatory anti-hepatoma effects of polysaccharides · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Chen, J Chen, X Wang, C Liu, 15-22.

Trend analysis and change point detection of annual and seasonal ...

Indian Academy of Sciences (India)

elevation ranges from 0 m in the coastal areas of the. Persian Gulf to over ... been explained by Kang and Yusof (2012); Dhorde ...... J L 2004 Detection of statistically significant trends in ... Sun H, Chen Y, Li W, Li F, Chen Y, Hao X and Yang Y.

Root growth of Cynodon dactylon and Eleusine indica collected from motorways at different concentrations of lead.

Science.gov (United States)

Wong, M H; Lau, W M

1985-04-01

An ecological survey was conducted on the roadside vegetation at three different sites: Tai Po, a commercial and residential area (average annual daily traffic (AADT) = 23730; and Shek O and Wu Kai Sha, recreational areas (AADT = 1590 and 20, respectively). Cynodon dactylon and Eleusine indica were the two most dominant species recorded. The Tai Po site had higher Pb contents in both soil and plant, followed by Shek O, and then Wu Kai Sha. Tillers of C. dactylon and E. indica from the three sites were subjected to a series concentrations of Pb(NO3)2. By comparing their indexes of tolerance and values of 14-day EC50 (effective concentration reducing the normal root growth by 50%), roadside populations of the two grasses collected from Tai Po and Shek O, especially the former one, were more tolerant to elevated levels of Pb compared with those collected from Wu Kai Sha.

Response to Niklasson's comment on Lin, et al. (2012) : "the relation between postural movement and bilateral motor integration".

Science.gov (United States)

Lin, Chin-Kai; Kuo, Bor-Chen; Wu, Huey-Min

2014-10-01

In the study of Lin, Wu, Lin, Wu, Wu, Kuo, and Yeung (2012 ), the relationship between the validity of postural movement and bilateral motor integration in terms of sensory integration theory was examined. Postural movement is the ability to use the antigravity postures required for stabilization of the neck, trunk and upper extremities via muscle co-contractions in the neck and upper extremities, and balance. Niklasson's (2013 ) comment argued that postural movement should include primitive reflexes in terms of the general abilities approach. Niklasson (2013 ) focused on the efficacy of the treatment rather than the theoretical frameworks implied in the therapeutic activities. For that purpose Lin, et al. (2012 ) used sensory integration as the theoretical foundation, and the relationship between postural movement and bilateral motor integration was assessed via empirical data. The result of Lin, et al. (2012 ) was offered as a theoretical reference for therapeutic activities.

Abstracts from the 15th International Myopia Conference

Directory of Open Access Journals (Sweden)

Alexandra Benavente-Perez

2016-11-01

Full Text Available Table of contents O1 Changes in peripheral refraction associated with decreased ocular axial growth rate in marmosets Alexandra Benavente-Perez, Ann Nour, Tobin Ansel, Kathleen Abarr, Luying Yan, Keisha Roden, David Troilo O2 PPARα activation suppresses myopia development by increasing scleral collagen synthesis--a new drug target to suppress myopia development Chanyi Lu, Miaozhen Pan, Min Zheng, Jia Qu, Xiangtian Zhou O3 Evidence and possibilities for local ocular growth regulating signal pathways Christine F Wildsoet O4 Myopia researches at Eye Hospital of Wenzhou Medical University Fan Lu, Xiangtian Zhou, Jie Chen, Jinhua Bao, Liang Hu, Qinmei Wang, Zibing Jin, Jia Qu O5 Color, temporal contrast and myopia Frances Rucker, Stephanie Britton, Stephan Hanowsky, Molly Spatcher O6 The impact of atropine usage on visual function and reading performance in myopic school children in Taiwan Hui-Ying Kuo, Ching-Hsiu Ke, I-Hsin Kuo, Chien-Chun Peng, Han-Yin Sun O7 Increased time outdoors prevents the onset of myopia: evidence from randomised clinical trials Ian G Morgan O8 Environmental risk factors and gene-environment interactions for myopia in the ALSPAC cohort Jeremy A. Guggenheim, Rupal L. Shah, Cathy Williams O9 Retinal metabolic profiling identifies declines in FP receptor-linked signaling as contributors to form-deprived myopic development in guinea pigs Jinglei Yang, Peter S. Reinach, Sen Zhang, Miaozhen Pan, Wenfeng Sun, Bo Liu, Xiangtian Zhou O10 The study of peripheral refraction in moderate and high myopes after one month of wearing orthokeratology lens Jun Jiang, Haoran Wu, Fan Lu O11 Axial length of school children around the earth’s equatorial area and factors affecting the axial length Kazuo Tsubota, Hiroko Ozawa, Hidemasa Torii, Shigemasa Takamizawa, Toshihide Kurihara, Kazuno Negishi O12 Processing of defocus in the chicken retina by retinal ganglion cells Klaus Graef, Daniel Rathbun, Frank Schaeffel O13 Blue SAD light protects

The Response of Small Scale Rigid Targets to Shallow Buried Explosive Detonations

Science.gov (United States)

2011-09-01

properties as applied in this work was based on some of the standard defini- tions of soil constitutive properties as found in, e.g., Chen and Baladi [18...Technology Corporation; 2007. [18] Chen WF, Baladi GY. Soil plasticity: theory and implementation. New York: Elsevier Science; 1985. [19] Zimmerman

Enhanced Thermal Transport of Surfaces with Superhydrophobic Coatings

Science.gov (United States)

2015-07-01

resistance conferred by superhydrophobic fluorinated polyacrylate-silica composite coatings on cold-rolled steel. Journal of Applied Polymer Science... thiolates on metals as a form of nanotechnology. ChemInform. 2005:36. doi: 10.1002/chin.200532281. 9. Chen C-H, Cai Q, Tsai C, Chen C-L, Xiong G

Evaluation of effectiveness in a novel wound healing ointment ...

African Journals Online (AJOL)

Evaluation of effectiveness in a novel wound healing ointment-crocodile oil burn ointment. Hua-Liang Li, Yi-Tao Deng, Zi-Ran Zhang, Qi-Rui Fu, Ya-Hui Zheng, Xing-Mei Cao, Jing Nie, Li-Wen Fu, Li-Ping Chen, You-Xiong Xiong, Dong-Yan Shen, Qing-Xi Chen ...

Advances in SCA and RF-DNA Fingerprinting Through Enhanced Linear Regression Attacks and Application of Random Forest Classifiers

Science.gov (United States)

2014-09-18

22:477– 505 , 2007. [21] Bushnell, Michael L. and Vishwani Agrawal. Essentials of Electronic Testing for Digital, Memory, and Mixed-Signal VLSI...Investigation”. Knowledge and information systems, 10(4):453–472, 2006. [68] Liang, Nia -Chiang, Ping-Chieh Chen, Tony Sun, Guang Yang, Ling-Jyh Chen

A comparative study assessing a new tool for occluding ...

African Journals Online (AJOL)

0.630, p=0.068 and p=0.047, respectively) (Table 2). A comparative study assessing a new tool for occluding parenchymal blood flow during liver resection for hepatocellular carcinoma. S Zhou, X-J Xue, R-R Li, D-F Chen, W-Y Chen, G-X Liu, ...

A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...

Indian Academy of Sciences (India)

Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBand EFHC2gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN SONG YULAI ...

The roles of electronic books in the transformation of learning and instruction

NARCIS (Netherlands)

Huang, Ronghuai; Chen, Nian-Shing; Kang, Myunghee; McKenney, Susan; Churchill, Daniel

2014-01-01

Huang, R., Chen, N., Kang, M. McKenney, S. & Churchill, D. (2013). The roles of electronic books in the transformation of learning and instruction. In N. Chen, R. Huang, Kinshuk, Y. Li, D. G. Sampson (Eds.) Proceedings of the IEEE 13th International Conference on Advanced Learning Technologies

Impacts of DNAPL Source Treatment: Experimental and Modeling Assessment of the Benefits of Partial DNAPL Source Removal

Science.gov (United States)

2009-09-01

this project: A. Noman M. Ahsanuzzaman, Steve Acree, Nandita Basu, Sten Berglund, Carol Bratt, Gordon Brown, Xaisong Chen, Jaehyun Cho, Pat Clark...A.S.C. Chen (eds). Chapelle, F.H., J.S. Widdowson, J.S. Bruner, E. Mendez , and C.C. Casey (2003). Methodology for Estimating Times of Remediation

A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...

Indian Academy of Sciences (India)

Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBitalic> and EFHC2italic> gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN ...

Sadhana | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Sadhana. B Chen. Articles written in Sadhana. Volume 38 Issue 4 August 2013 pp 557-569. Flexibility-based structural damage identification using Gauss–Newton method · B Chen S Nagarajaiah · More Details Abstract Fulltext PDF. Structural damage will change the dynamic characteristics, including ...

Can Medical Herbs Stimulate Regeneration or Neuroprotection and Treat Neuropathic Pain in Chemotherapy-Induced Peripheral Neuropathy?

Directory of Open Access Journals (Sweden)

Sven Schröder

2013-01-01

Full Text Available Chemotherapy-induced neuropathy (CIPN has a relevant impact on the quality of life of cancer patients. There are no curative conventional treatments, so further options have to be investigated. We conducted a systematic review in English and Chinese language databases to illuminate the role of medical herbs. 26 relevant studies on 5 single herbs, one extract, one receptor-agonist, and 8 combinations of herbs were identified focusing on the single herbs Acorus calamus rhizoma, Cannabis sativa fructus, Chamomilla matricaria, Ginkgo biloba, Salvia officinalis, Sweet bee venom, Fritillaria cirrhosae bulbus, and the herbal combinations Bu Yang Huan Wu, modified Bu Yang Huan Wu plus Liuwei Di Huang, modified Chai Hu Long Gu Mu Li Wan, Geranii herba plus Aconiti lateralis praeparata radix , Niu Che Sen Qi Wan (Goshajinkigan, Gui Zhi Jia Shu Fu Tang (Keishikajutsubuto, Huang Qi Wu Wu Tang (Ogikeishigomotsuto, and Shao Yao Gan Cao Tang (Shakuyakukanzoto. The knowledge of mechanism of action is still limited, the quality of clinical trials needs further improvement, and studies have not yielded enough evidence to establish a standard practice, but a lot of promising substances have been identified. While CIPN has multiple mechanisms of neuronal degeneration, a combination of herbs or substances might deal with multiple targets for the aim of neuroprotection or neuroregeneration in CIPN.

People’s Republic of China Scientific Abstracts No. 164.

Science.gov (United States)

1977-02-23

of these articles. CONTENTS PAGE K’ O-HSUEH SHIH-YEN /SCIENTIFIC EXPERIMENT/ No 8, Äug 76 1 CHIH-WU HSUEH-PAO /ÄCTA BOTANICA SINICA/ Vol 18, No...AUTHOR: None ORG: Digital Control Teaching Group, Shanghai Sparetime Industrial University TITLE: "On the Principles of Digital Machine Tool Control...8217 College" SOURCE: Peking CHIH-WU HSUEH-PAO [AGTA BOTANICA SINICA] Vol 18 No 3, Sep 76 pp 198-201 EXCERPT OF ENGLISH ABSTRACT: The May-7 Agricultural

People’s Republic of China Scientific Abstracts No. 180

Science.gov (United States)

1977-11-25

translations of these articles. CONTENTS PAGE CHIH-WU HSUEH-PAO [ACTA BOTANICA SINICA] No 1, March 1977 1 K’UN-CH’UNG HSUEH-PAO [ACTA ENTOMOLOGICA...March 1977. 28 TUNG-WU HSUEH-PAO [ACTA ZOOLOGICA SINICA] No 2, June.1977 41 a - [III - CC - 70 S § T] ACTA BOTANICA SINICA AUTHOR...HSUEH-PAO [ACTA BOTANICA SINICA] in Chinese Vol 19 No 1, Mar 77 pp 7-10 TEXT OF ENGLISH ABSTRACT: In 1964, we some young teachers and students in

MATHEMATICS OF SENSING, EXPLOITATION, AND EXECUTION (MSEE) Sensing, Exploitation, and Execution (SEE) on a Foundation for Representation, Inference, and Learning

Science.gov (United States)

2016-07-01

Automation (ICRA), 2016. [50]. Y. Lu, S.C. Zhu and Y.N. Wu, Learning FRAME Models Using CNN Filters, 30th AAAI Conference on Artificial Intelligence ...Method Cross-Subject Cross-View Cross-Environment Virtual View 0.507 0.478 0.274 Hankelet 0.542 0.452 0.286 Action Bank 0.246 0.176 N/A Poselet... Intelligence , vol. 34, no.7, 1354-1367, 2012. [3]. N. Jiang, W. Liu and Y. Wu, “Order Determination and Sparsity-Regularized Metric Learning for Adaptive

Traitement du signal à temps continu dans le domaine digital pour des wake-up radios

OpenAIRE

Ratiu , Alin

2015-01-01

Wake-Up Receivers (WU-RX) have been recently proposed as candidates to reduce the communication power budget of wireless networks. Their role is to sense the environment and wake up the main receivers which then handle the bulk data transfer. Existing WU-RXs achieve very high sensitivities for power consumptions below 50uW but severely degrade their performance in the presence of out-of-band blockers. We attempt to tackle this problem by implementing an ultra low power, tunable, intermediate ...

THREE NEW SPECIES OF CRAMBINAE（LEPIDOPTERA ： PYRALIDAE） IN CHINA

Institute of Scientific and Technical Information of China (English)

CHENTie-mei; SONGShi-mei; YUANDe-cheng

2003-01-01

Three new species of Crambinae from China, Eschata truncata Song & Chen, sp. nov., Eschata tricornia Song & Chen, sp. nov., Pseudargyria acuta Song & Chen, sp. nov. and the female of Girdharia tau-romma Kapur are described, with figures and illustrations of genitalia provided. E. truncata resembles E.smithi Bleszynski, but valva with one short truncated process in costa; E. tricornia differed from all recorded species by valva with a triangular process on dorsum; P. acuta resembles P. marginepunctalis (Hampson), but with cucullus rapidly pointed and aedeagus with one group of cornuti. E. bleszynskiella Minet is proposed as a junior synonym of E. shanghaiensis Wang & Sung.

Application of an Arbitrary Lagrangian Eulerian Method to Describe High Velocity Gas-Particle Flow Behavior

Science.gov (United States)

2011-09-01

applied in this work was based on some of the standard definitions of soil constitutive properties as found in, e.g., Chen and Baladi [20], and...Livermore, CA. [20] Chen, W. F., and Baladi , G. Y., 1985. Soil Plasticity: Theory and Implementation. Elsevier Science, New York. [21] Zimmerman, H.D

WAIS-IV and WISC-IV Structural Validity: Alternate Methods, Alternate Results. Commentary on Weiss et al. (2013a) and Weiss et al. (2013b)

Science.gov (United States)

Canivez, Gary L.; Kush, Joseph C.

2013-01-01

Weiss, Keith, Zhu, and Chen (2013a) and Weiss, Keith, Zhu, and Chen (2013b), this issue, report examinations of the factor structure of the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) and Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV), respectively; comparing Wechsler Hierarchical Model (W-HM) and…

75 FR 4509 - Uniform Criteria for State Observational Surveys of Seat Belt Use

Science.gov (United States)

2010-01-28

... statistical issues: Ms. Chou-Lin Chen, Chief, Mathematical Analysis Division, National Center for Statistics..., Washington, DC 20590. Telephone number: 202-366-1048; E- mail: Chou-Lin.Chen@dot.gov . For legal issues: Ms..., and reduce burden. E. Paperwork Reduction Act Under the Paperwork Reduction Act of 1995, a person is...

Rural older people had lower mortality after accidental falls than non-rural older people

Directory of Open Access Journals (Sweden)

Huang JW

2017-01-01

Full Text Available Jen-Wu Huang,1,2 Yi-Ying Lin,2,3 Nai-Yuan Wu,4 Yu-Chun Chen5–7 1Department of Surgery, National Yang-Ming University Hospital, National Yang-Ming University, Yilan, Taiwan; 2Institute of Emergency and Critical Care Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan; 3Department of Pediatrics, Heping Fuyou Branch, Taipei City Hospital, Taipei, Taiwan; 4Institute of Biomedical Informatics, National Yang-Ming University, Taipei, Taiwan; 5Department of Medical Research and Education, National Yang-Ming University Hospital, Yilan, Taiwan; 6Faculty of Medicine and School of Medicine, National Yang-Ming University, Taipei, Taiwan; 7Institute of Hospital and Health Care Administration, School of Medicine, National Yang-Ming University, Taipei, Taiwan Objective: This study aimed to investigate the mortality rate after falls of rural and non-rural older people and to explore the risk factors of mortality after falls among older people. Patients and methods: This population-based case–control study identified two groups from a nationwide claim database (National Health Insurance Research Database in Taiwan: a rural group and a non-rural group, which included 3,897 and 5,541 older people, respectively, who were hospitalized for accidental falls (The International Classification of Diseases, Ninth Revision, Clinical Modification: E880–E888 during 2006–2009. Both groups were followed up for 4 years after falls. Four-year cumulative all-cause mortality rate after falls was calculated, and the demographic factor, comorbidity, and medications were considered as the potential risk factors of mortality after falls. Results: The rural group had a significantly higher frequency of fall-related hospitalizations (7.4% vs 4.3%, P<0.001, but a lower 4-year cumulative all-cause mortality rate after falls than the non-rural group (8.8% vs 23.4%, P<0.001. After adjusting for age, gender, comorbidity, and medication use, the rural group had

Beneficial effects of prolonged blood pressure control after carotid artery stenting

Directory of Open Access Journals (Sweden)

Chang A

2017-01-01

Full Text Available Anna Chang,1 Huei-Fong Hung,2 Fang-I Hsieh,3 Wei-Hung Chen,1,4 Hsu-Ling Yeh,1,5 Jiann-Horng Yeh,1,6 Hou-Chang Chiu,1,6 Li-Ming Lien1,4 1Department of Neurology, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, 2Department of Cardiology, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, 3School of Public Health, College of Public Health, Taipei Medical University, Taipei, 4School of Medicine, College of Medicine, Taipei Medical University, Taipei, 5Institute of Public Health, National Yang-Ming University, Taipei, 6School of Medicine, College of Medicine, Fu Jen Catholic University, Taipei, Taiwan Objectives: The main purpose of this study was to investigate whether carotid artery stenting (CAS plus medicine in patients with severe carotid artery stenosis provide a better long-term blood pressure (BP control compared to other medical treatments alone. The other aim was to explore the correlation between post-CAS hypotension within 6 h and long-term BP reductions after CAS. Materials and methods: Patients with severe carotid stenosis were recruited either in the CAS group or in the medication group. BPs and the number of classes of antihypertensive agents were recorded at baseline, 6, and 12 months. Extra BP information was collected at 6 h, 3 days, and 1 month after CAS. Univariate and multivariate linear regressions were performed to test the relationship of BP changes among CAS and medication groups after 6 and 12 months of follow-up. Univariate linear regressions were also used to determine the correlations between the mean or maximal systolic BP (SBP reductions at 6 h and 1 year post-CAS. Results: In total, 72 members in the CAS group and 82 members in the medication group were recruited. Compared with the medication group, patients in the CAS group had greater BP reductions at 6 and 12 months of follow-up after adjusting for confounding factors (13.56 mmHg at 6 months, P=0.0002; 16.98 mmHg at 12 months, P<0.0001. This study also shows significant

Batch fermentation of whey ultra filtrate by Lactobacillus helveticus for lactic acid production

Energy Technology Data Exchange (ETDEWEB)

Roy, D; Goulet, J; Le Duy, Q

1986-06-01

Cheese whey ultrafiltrate (WU) was used as the carbon source for the production of lactic acid by batch fermentation with Lactobacillus helveticus strain milano. The fermentation was conducted in a 400 ml fermentor at an agitation rate of 200 revolutions per minute and under conditions of controlled temperature (42 degrees C) and pH. In the whey ultrafiltrate-corn steep liquor (WU-CSL) medium, the optimal pH for fermentation was 5.9. Inoculum propagated in skim milk (SM) medium or in lactose synthetic (LS) medium resulted in the best performance in fermentation (in terms of growth, lactic acid production, lactic acid yield and maximum productivity of lactic acid), as compared to that propagated in glucose synthetic (GS) medium. The yeast extract ultrafiltrate (YEU) used as the nitrogen/growth factor source in the WU medium at 1.5% (w/v) gave the highest maximum productivity of lactic acid of 2.70 g/l-h, as compared to the CSL and the tryptone ultrafiltrate (TU). 27 references.

Dysfunction of different cellular degradation pathways contributes to specific β-amyloid42-induced pathologies.

Science.gov (United States)

Ji, Xuan-Ru; Cheng, Kuan-Chung; Chen, Yu-Ru; Lin, Tzu-Yu; Cheung, Chun Hei Antonio; Wu, Chia-Lin; Chiang, Hsueh-Cheng

2018-03-01

The endosomal-lysosomal system (ELS), autophagy, and ubiquitin-proteasome system (UPS) are cellular degradation pathways that each play a critical role in the removal of misfolded proteins and the prevention of the accumulation of abnormal proteins. Recent studies on Alzheimer's disease (AD) pathogenesis have suggested that accumulation of aggregated β-amyloid (Aβ) peptides in the AD brain results from a dysfunction in these cellular clearance systems. However, the specific roles of these pathways in the removal of Aβ peptides and the pathogenesis underlying AD are unclear. Our in vitro and in vivo genetic approaches revealed that ELS mainly removed monomeric β-amyloid42 (Aβ42), while autophagy and UPS clear oligomeric Aβ42. Although overproduction of phosphatidylinositol 4-phosphate-5 increased Aβ42 clearance, it reduced the life span of Aβ42 transgenic flies. Our behavioral studies further demonstrated impaired autophagy and UPS-enhanced Aβ42-induced learning and memory deficits, but there was no effect on Aβ42-induced reduction in life span. Results from genetic fluorescence imaging showed that these pathways were damaged in the following order: UPS, autophagy, and finally ELS. The results of our study demonstrate that different degradation pathways play distinct roles in the removal of Aβ42 aggregates and in disease progression. These findings also suggest that pharmacologic treatments that are designed to stimulate cellular degradation pathways in patients with AD should be used with caution.-Ji, X.-R., Cheng, K.-C., Chen, Y.-R., Lin, T.-Y., Cheung, C. H. A., Wu, C.-L., Chiang, H.-C. Dysfunction of different cellular degradation pathways contributes to specific β-amyloid42-induced pathologies.

Endothelial cell SHP-2 negatively regulates neutrophil adhesion and promotes transmigration by enhancing ICAM-1-VE-cadherin interaction.

Science.gov (United States)

Yan, Meiping; Zhang, Xinhua; Chen, Ao; Gu, Wei; Liu, Jie; Ren, Xiaojiao; Zhang, Jianping; Wu, Xiaoxiong; Place, Aaron T; Minshall, Richard D; Liu, Guoquan

2017-11-01

Intercellular adhesion molecule-1 (ICAM-1) mediates the firm adhesion of leukocytes to endothelial cells and initiates subsequent signaling that promotes their transendothelial migration (TEM). Vascular endothelial (VE)-cadherin plays a critical role in endothelial cell-cell adhesion, thereby controlling endothelial permeability and leukocyte transmigration. This study aimed to determine the molecular signaling events that originate from the ICAM-1-mediated firm adhesion of neutrophils that regulate VE-cadherin's role as a negative regulator of leukocyte transmigration. We observed that ICAM-1 interacts with Src homology domain 2-containing phosphatase-2 (SHP-2), and SHP-2 down-regulation via silencing of small interfering RNA in endothelial cells enhanced neutrophil adhesion to endothelial cells but inhibited neutrophil transmigration. We also found that VE-cadherin associated with the ICAM-1-SHP-2 complex. Moreover, whereas the activation of ICAM-1 leads to VE-cadherin dissociation from ICAM-1 and VE-cadherin association with actin, SHP-2 down-regulation prevented ICAM-1-VE-cadherin association and promoted VE-cadherin-actin association. Furthermore, SHP-2 down-regulation in vivo promoted LPS-induced neutrophil recruitment in mouse lung but delayed neutrophil extravasation. These results suggest that SHP-2- via association with ICAM-1-mediates ICAM-1-induced Src activation and modulates VE-cadherin switching association with ICAM-1 or actin, thereby negatively regulating neutrophil adhesion to endothelial cells and enhancing their TEM.-Yan, M., Zhang, X., Chen, A., Gu, W., Liu, J., Ren, X., Zhang, J., Wu, X., Place, A. T., Minshall, R. D., Liu, G. Endothelial cell SHP-2 negatively regulates neutrophil adhesion and promotes transmigration by enhancing ICAM-1-VE-cadherin interaction. © FASEB.

Propylthiouracil-induced liver failure and artificial liver support systems: a case report and review of the literature

Directory of Open Access Journals (Sweden)

Wu DB

2017-01-01

Full Text Available Dong-Bo Wu,1,2 En-Qiang Chen,1,2 Lang Bai,1,2 Hong Tang1,2 1Center of Infectious Diseases, West China Hospital of Sichuan University, 2Division of Molecular Biology of Infectious Diseases, State Key Laboratory of Biotherapy, Sichuan University, Chengdu, People’s Republic of China Background: Antithyroid drugs carry a potential risk of hepatotoxicity. Propylthiouracil (PTU is commonly prescribed for patients with hyperthyroidism. PTU, however, can induce liver injury, ranging from mild asymptomatic elevation of aminotransferases to acute liver failure (ALF.Case presentation: This case reports on a 16-year-old Chinese girl with hyperthyroidism, who was admitted to our hospital for jaundice, nausea, and fatigue associated with severe hyperbilirubinemia and coagulopathy. She had been prescribed PTU 5 months earlier. There was no history of hypersensitivity to drugs, viral liver diseases, blood transfusion, or surgery. On the basis of her symptoms and the clinical data, she was diagnosed with PTU-induced ALF. Due to the limited number of available donor organs for liver transplantation, she was started on treatment with artificial liver support system (ALSS. After four sessions of ALSS, her clinical signs and symptoms were found to be markedly improved, and she was discharged 25 days after admission. Four months later, her liver function normalized.Conclusion: Although PTU-induced liver failure is rare in clinical practice, liver function should be appropriately monitored during treatment with PTU. PTU-induced ALF in this patient was successfully managed with an ALSS, suggesting that the latter may be an alternative to liver transplantation. Keywords: propylthiouracil, liver injury, acute liver failure, artificial liver support systems 

Possible association between phantom vibration syndrome and occupational burnout

Directory of Open Access Journals (Sweden)

Chen CP

2014-12-01

Full Text Available Chao-Pen Chen,1 Chi-Cheng Wu,2 Li-Ren Chang,3 Yu-Hsuan Lin4 1Department of Education, National Taiwan University Hospital, 2Department of Family Medicine, Min-Sheng General Hospital, Taoyuan City, 3Department of Psychiatry, National Taiwan University, College of Medicine, 4Institute of Brain Science, National Yang-Ming University, Taipei, Taiwan Background: Phantom vibration syndrome (PVS and phantom ringing syndrome (PRS occur in many cell phone users. Previous studies have indicated an association between PVS/PRS and job stress. The aim of this study was to determine if PVS/PRS were also associated with occupational burnout.Methods: This was a cross-sectional study of 384 employees of a high-tech company in northern Taiwan. They all completed a phantom vibration and ringing questionnaire, the Hospital Anxiety and Depression Scale, and the Chinese version of the Occupational Burnout Inventory.Results: Significantly more women and people with at least a college education were in the population with PRS and PVS, respectively. Anxiety and depression had no associations with PVS/PRS. Higher scores for personal fatigue, job fatigue, and service target fatigue had an independent impact on the presence of PVS, but only a higher score for service target fatigue had an independent impact on the presence of PRS.Conclusion: The independent association between work-related burnout and PVS/PRS suggests that PVS/PRS may be a harbinger of mental stress or a component of the clinical burnout syndrome, and may even be a more convenient and accurate predictor of occupational burnout. Keywords: phantom vibration syndrome, phantom ringing syndrome, occupational burnout

Actual Situation and Further Development of Interim Storage of Spent Nuclear Fuel (SNF) and Highly Active Waste (HAW) from the View of the Competent Authority in the Field of section 6

International Nuclear Information System (INIS)

Gastl, Christoph; Drobniewski, Christian

2014-01-01

According to the German atomic law the storage of nuclear material has to be licensed following section 6 by the competent authority in this field, which is the Federal Office for Radiation Protection. Interim storage in its actual form started in 2002 in the interim storage facility next to the NPP Lingen. Since this time each NPP erected its own storage facilities and three central storage facilities have been built. The spent nuclear fuel (SNF) and the vitrified high level waste (HAW) will be stored there until final disposal. The time span from now on to the point of opening of a final disposal facility shall be presented from a regulators point of view, divided into different phase which could spread from years to decades. Special attention shall be drawn on the different aspects influencing the licensing process and its duration at the moment and in future including the capabilities of the competent authority. (authors)

Journal of Genetics | Indian Academy of Sciences

Indian Academy of Sciences (India)

... Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 95; Issue 1. Novel NPHS1 gene mutations in a Chinese family with congenital nephrotic syndrome. Fengjie Yang Yaxian Chen Yu Zhang Liru Qiu Yu Chen Jianhua Zhou. Research Note Volume 95 Issue 1 March 2016 pp 161- ...

A reviewof the pharmacologicalmechanism of traditional Chinese ...

African Journals Online (AJOL)

A reviewof the pharmacologicalmechanism of traditional Chinese medicine in the intervention of coronary heart disease and stroke. W Zhang, K Gao, K Gao, J Liu, J Liu, H Zhao, H Zhao, J Wang, J Wang, Y Li, Y Li, G Murtaza, G Murtaza, J Chen, J Chen, W Wang, W Wang ...

African Journal of Biotechnology - Vol 10, No 60 (2011)

African Journals Online (AJOL)

Microsatellite variability reveals significant genetic differentiation of giant pandas (Ailuropoda melanoleuca) in the Minshan A habitat · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Yang, R Hou, F Shen, X Yang, L Zhang, L Chen, W Chen, W Zhang, Q Zhu, Z Zhang ...

Journal of Chemical Sciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Chemical Sciences. Chen Chai. Articles written in Journal of Chemical Sciences. Volume 126 Issue 3 May 2014 pp 813-820 Regular Articles. First total synthesis of Boehmenan · Yamu Xia Xiaoli Dai Haixin Liu Chen Chai · More Details Abstract Fulltext PDF. The first total synthesis of dilignan ...

Revision of the Agathidinae (Hymenoptera, Braconidae) of Vietnam, with the description of forty-two new species and three new genera

Science.gov (United States)

van Achterberg, Cornelis; Long, Khuat Dang

2010-01-01

Abstract The species of seventeen genera of Agathidinae (Braconidae) from Vietnam are revised: Agathis Latreille, 1804, Bassus Fabricius, 1804; Biroia Szépligeti, 1900; Braunsia Kriechbaumer, 1894; Camptothlipsis Enderlein, 1920; Coccygidium de Saussure, 1892; Coronagathis gen. n. (type species: Coronagathis cornifera sp. n.); Cremnops Foerster, 1862; Disophrys Foerster, 1862; Earinus Wesmael, 1837; Euagathis Szépligeti, 1900; Gyragathis gen. n. (type species: Gyragathis quyi sp. n.), Gyrochus Enderlein, 1920; Lytopylus Foerster, 1862; Therophilus Wesmael, 1837; Troticus Brullé, 1846, and Zelodia gen. n. (type species: Zelomorpha varipes van Achterberg & Maetô, 1990). Keys to the Vietnamese species are given. Sixty-five species are recognised, of which twelve species are newly recorded for Vietnam: Bassus albifasciatus (Watanabe, 1934), Coccygidium angostura (Bhat & Gupta, 1977), Cremnops atricornis (Smith, 1874), stat. n., Disophrys erythrocephala Cameron, 1900, Gyrochus yunnanensis Wang, 1984, Lytopylus romani (Shestakov, 1940), comb. n., Therophilus festivus (Muesebeck, 1953), comb. n., Therophilus javanus (Bhat & Gupta, 1977), comb. n., Therophilus lienhuachihensis (Chou & Sharkey, 1989), comb. n., Therophilus marshi (Bhat & Gupta, 1977), comb. n., Zelodia absoluta (Chen & Yang, 1998), comb. n. and Zelodia longidorsata (Bhat & Gupta, 1977), comb. n. Forty-two species are new to science: Agathis citrinisoma sp. n., Bassus albobasalis sp. n., Bassus albozonatus sp. n., Biroia soror sp. n., Braunsia bicolorata sp. n., Braunsia devriesi sp. n., Braunsia maculifera sp. n., Braunsia nigrapiculata sp. n., Braunsia pumatica sp. n., Camptothlipsis hanoiensis sp. n., Coronagathis cornifera sp. n., Earinus aurantius sp. n., Earinus brevistigmus sp. n., Euagathis flavosoma sp. n., Disophrys maculifera sp. n., Disophrys quymanhi sp. n., Disophrys rhinoides sp. n., Gyragathis quyi sp. n., Therophilus annuliferus sp. n., Therophilus cattienensis sp. n., Therophilus

Lateral strukturierte Oberflächen zur THz-Strahlmanipulation

OpenAIRE

Jahn, David; Koch, Martin (Prof. Dr.)

2018-01-01

Die Terahertz-Zeitbereichsspektroskopie ist mittlerweile eine etablierte spektroskopische Methode im Frequenzbereich von 0;2 THz bis etwa 5 THz. Mit der stetigen Verbesserung von Zeitbereichs-Spektrometern, in den letzten Jahren hauptsächlich vorangetrieben durch die Verbesserung der Materialsysteme sowohl im photoleitenden Emitter als auch im Detektor sind heute Systeme mit bis zu 90 dB SNR und 4;5 THz Brandbreite verfügbar. Auch der Einfluss anderer Systemkomponenten, deren Beitrag zum...

C. Huang , G. Zhao , HW Zhang & YQ Chen

Indian Academy of Sciences (India)

the host stars' birth cloud with higher abundance of Si will make the cloud ... with the metallicity distribution of nearby field F, G, or K stars which are known to .... In the early stage of planetesimal accumulation, the rate of growth of planetesimal.

Chaos synchronization of the fractional-order Chen's system

International Nuclear Information System (INIS)

Zhu Hao; Zhou Shangbo; He Zhongshi

2009-01-01

In this paper, based on the stability theorem of linear fractional systems, a necessary condition is given to check the chaos synchronization of fractional systems with incommensurate order. Chaos synchronization is studied by utilizing the Pecora-Carroll (PC) method and the coupling method. The necessary condition can also be used as a tool to confirm results of a numerical simulation. Numerical simulation results show the effectiveness of the necessary condition.

People’s Republic of China Scientific Abstracts, Number 201

Science.gov (United States)

1978-10-24

original source materials or information as to the availability of full translations of these articles. CONTENTS PAGE CHIH-WU HSUEH-PAO [ACTA BOTANICA ...III - CC - 70 S § T] ACTA BOTANICA 5INICA AUTHOR: TS’AI Ch’i-kuei (5591 6386 6311 ] CH’IEN Ying-ch’ien [6929 66Q1 0241J CHDU...the Isolation and Culture of Rice (Qrvza sativa L.) Protoplasts" SOURCE: Peking CHIH-WU HSUEH-PA0 [ACTA BOTANICA SINICAj in Chinese No 2, Jun 78 pp

A review of the genus Saccharicoccus Ferris, 1950 (Hemiptera: Coccomorpha: Pseudococcidae) in China, with description of a new species.

Science.gov (United States)

Zhang, Jiang-Tao; Wu, Bo-Wen; Wu, San-An

2018-01-23

The mealybug genus Saccharicoccus Ferris includes three species: S. isfarensis (Borchsenius, 1949), S. sacchari (Cockerell, 1895) and a new species, S. chinensis Zhang, Wu Wu sp. n. The new species, collected on Miscanthus sp. (Poaceae) and other poaceous weeds in China, is described and illustrated, and molecular analyses based on the mitochondrial gene cytochrome c oxidase subunit I (COI) are provided. Additional data on the distribution and host-plants of each species are given, and a key to the adult females of Saccharicoccus species is provided.

Wu’s algorithm and its possible application in cryptanalysis

CSIR Research Space (South Africa)

Grobler, TL

2012-01-01

Full Text Available now classic book Differential Algebra: Ritt (1950). Later it was independently rediscovered and improved by the Chinese mathematician Wu Wen-Ts?n in the late seventies (Wen-Ts?n, 1978, 1984, 1986). Other resources describing Wu?s algorithm... set that is constructed from a polynomial set so that the characteristic set shares some of the properties of the original set (Gallo and Mishra, 1990b; Ritt, 1950). The algorithm has found wide usage in mechanical theorem proving (Wen-Ts?n, 1986...

Genome-Wide Chromosomal Targets of Oncogenic Transcription Factors

Science.gov (United States)

2008-04-01

Altman, W.E., Attiya, S., Bader, J.S., Bemben, L.A., Berka , J., Braverman, M.S., Chen, Y.J., Chen, Z., et al. 2005. Genome sequencing in microfabricated...software after filtering to exclude bad spots. qPCR validation. Primer pairs used in Figure 1 were designed to cover three peaks and three troughs in

Journal of Biosciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Biosciences. Chen Fang. Articles written in Journal of Biosciences. Volume 30 Issue 3 June 2005 pp 351-357 Articles. Expression of a ribosome inactivating protein (curcin 2) in Jatropha curcas is induced by stress · Wei Qin Huang Ming-Xing Xu Ying Zhang Xin-Shen Chen Fang · More Details ...

The genus Bryoerythrophyllum (Musci, Pottiaceae in Antarctica

Directory of Open Access Journals (Sweden)

Sollman Philip

2015-07-01

Full Text Available Antarctic material of the genus Bryoerythrophyllum P. C. Chen was studied from all specimens present in KRAM. Bryoerythrophyllum recurvirostrum (Hedw. P. C. Chen var. antarcticum L. I. Savicz & Smirnova is treated as a distinct species: B. antarcticum (L. I. Savicz & Smirnova P. Sollman, stat. nov. Three species are now known in the Antarctic region: B. antarcticum, B. recurvirostrum and B. rubrum (Jur. ex Geh. P. C. Chen. Bryoerythrophyllum rubrum is reported for the first time from the Antarctic. It is a bipolar species. A key to the taxa is given. These species are described and briefly discussed, with notes on illustrations, reproduction, habitat, world range, distribution and elevation in Antarctica.

(DEPSCOR FY 09) Obfuscation and Deobfuscation of Intent of Computer Programs

Science.gov (United States)

2012-12-21

increased as the malware distribution mechanism has moved to the web through infected sites. In this use a site is hacked so as to distribute malware to...Simpósio Brasileiro em Segurança da Informaçao e de Sistemas Computacionais (2009). (Chen et al., 2012) Jundong Chen, Matthias R. Brust, Vir V. Phoha

Browse Title Index

African Journals Online (AJOL)

Vol 9, No 1 (2006), Splenectomy in a rural surgical practice, Abstract PDF. E Alufohai, OO Odusanya. Vol 20, No 9 (2017), Spontaneous Retropharyngeal Emphysema: A Case Report, Abstract PDF. T-H Chi, C-C Hung, R-F Chen, C-H Yuan, J-C Chen. Vol 5, No 2 (2002), Spontaneous Rupture Of A Massive Hydrocephalus ...

Phase relation of LaFe11· 6Si1· 4 compounds annealed at different ...

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science; Volume 35; Issue 2. Phase relation of LaFe11.6Si1.4 compounds annealed at different high-temperature and the magnetic property of LaFe11.6−CoSi1.4 compounds. Xiang Chen Yungui Chen Yongbai Tang. Volume 35 Issue 2 April 2012 pp 175-182 ...

High School Students' Topic Preferences and Oral Development in an English-Only Short-Term Intensive Language Program

Science.gov (United States)

Hsieh, Hui-Chen

2016-01-01

Developing the ability to speak English is a daunting task that has long been omitted in a test-driven pedagogy context (Chang, 2011; Li, 2012a, 2012b; Chen & Tsai, 2012; Katchen, 1989, 1995). Since speaking is not tested for school admissions, most students are not motivated to learn it (Chang, 2011; Chen & Tsai, 2012). Now, globalization…

Supplementation of omega 3 fatty acids may improve hyperactivity, lethargy, and stereotypy in children with autism spectrum disorders: a meta-analysis of randomized controlled trials

Directory of Open Access Journals (Sweden)

Cheng YS

2017-10-01

Full Text Available Yu-Shian Cheng,1 Ping-Tao Tseng,1,2 Yen-Wen Chen,3 Brendon Stubbs,4–6 Wei-Chieh Yang,7 Tien-Yu Chen,8,9 Ching-Kuan Wu,1 Pao-Yen Lin10,11 1Department of Psychiatry, Tsyr-Huey Mental Hospital, Kaohsiung Jen-Ai’s Home, 2WinShine Clinics in Specialty of Psychiatry, 3Prospect Clinic for Otorhinolaryngology & Neurology, Kaohsiung, Taiwan, Republic of China; 4Physiotherapy Department, South London and Maudsley NHS Foundation Trust, 5Health Service and Population Research Department, Institute of Psychiatry, Psychology and Neuroscience, King’s College London, London, 6Faculty of Health, Social Care and Education, Anglia Ruskin University, Chelmsford, UK; 7Department of Pediatrics, DA-AN Women and Children Hospital, Tainan, 8Department of Psychiatry, Tri-Service General Hospital, Taipei, 9School of Medicine, National Defense Medical Center, Taipei, 10Department of Psychiatry, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, 11Institute for Translational Research in Biomedical Sciences, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung, Taiwan, Republic of China Aim: Deficiency of omega 3 fatty acids may be linked to autism spectrum disorder (ASD. Evidence about the potential therapeutic effects of supplementation of omega 3 fatty acids is lacking in ASD patients.Methods: We searched major electronic databases from inception to June 21, 2017, for randomized clinical trials, which compared treatment outcomes between supplementation of omega 3 fatty acids and placebo in patients with ASD. An exploratory random-effects meta-analysis of the included studies was undertaken.Results and conclusion: Six trials were included (n=194. Meta-analysis showed that supplementation of omega 3 fatty acids improved hyperactivity (difference in means =-2.692, 95% confidence interval [CI] =-5.364 to -0.020, P=0.048, studies =4, n=109, lethargy (difference in means =-1.969, 95% CI =-3.566 to -0.372, P=0.016, studies =4, n=109, and

Safety of high-dose daptomycin in patients with severe renal impairment

Directory of Open Access Journals (Sweden)

Tai CH

2018-03-01

Full Text Available Chih-Hsun Tai,1 Chi-Hao Shao,2 Chen-You Chen,2 Shu-Wen Lin,1–3 Chien-Chih Wu1,2 1Department of Pharmacy, National Taiwan University Hospital, College of Medicine, National Taiwan University, Taipei, Taiwan; 2School of Pharmacy, College of Medicine, National Taiwan University, Taipei, Taiwan; 3Graduate Institute of Clinical Pharmacy, College of Medicine, National Taiwan University, Taipei, Taiwan Background: Treatment options are limited for infections due to multidrug-resistant Gram-positive pathogens. Daptomycin is a lipopeptide antibiotic with concentration-dependent killing characteristic and dose-dependent post-antibiotic effect. To achieve optimized pharmacodynamic effect, some experts advocated using a high dose of daptomycin (≥9 mg/kg for severe infections. However, the safety of high-dose therapy in patients with renal impairment remains unknown. This study was aimed to evaluate the safety of daptomycin in patients with severe renal impairment. Methods: This was a retrospective study performed by reviewing electronic medical records. Patients with severe renal impairment who were treated with daptomycin in a tertiary teaching hospital between January 1, 2013, and June 30, 2016, were included for evaluation. The incidence rates of creatine kinase (CK elevation between high-dose (≥9 mg/kg and standard-dose (<9 mg/kg groups were compared. Results: Overall, 164 patients met the inclusion criteria, and 114 (69.5% of them were on renal replacement therapy. Vancomycin-resistant enterococci were the most common pathogens (61.3% of the patients with documented pathogens. The treatment success rate was 51.6% in the 91 patients with bacteremia. The average dose of daptomycin was 8.0±2.3 mg/kg, and 37 (22.6% patients received ≥9 mg/kg. CK levels were followed in 108 (65.9% patients. Significantly higher incidence of CK elevation was found in the high-dose group compared with that in the standard-dose group (10.8% vs 1.6%, P<0.05. Moreover

Incidence, risk factors, and phenomenological characteristics of postoperative delirium in patients receiving intravenous patient-controlled analgesia: a prospective cohort study

Directory of Open Access Journals (Sweden)

Lin YT

2016-12-01

Full Text Available Yao Tsung Lin,1 Kuo Mao Lan,1 Li-Kai Wang,1 Chin-Chen Chu,1 Su-Zhen Wu,1 Chia-Yu Chang,2 Jen-Yin Chen1,3 1Department of Anesthesiology, 2Department of Neurology, Chi Mei Medical Center, 3Department of the Senior Citizen Service Management, Chia Nan University of Pharmacy and Science, Tainan, Taiwan Background: Intravenous patient-controlled analgesia (IVPCA is a common method of relieving pain which is a risk factor of postoperative delirium (POD. However, research concerning POD in IVPCA patients is limited. Objective: We aimed to determine the incidence, risk factors, and phenomenological characteristics of POD in patients receiving IVPCA. Methods: A prospective, cohort study was conducted in post-general anesthesia IVPCA patients aged ≥60 years. POD was measured by the Nursing Delirium Screening Scale (NuDESC; 0–10. Delirium, pain severity at rest and/or on movement, and side effects of IVPCA during 3 postoperative days were examined twice-daily by the acute pain service team. Pain severity is measured by an 11-point verbal numerical rating scale (11-point VNRS (0–10. An 11-point VNRS >3 was considered inadequate pain relief. If POD (detected by NuDESC ≥1 is suspected, consulting a neurologist or a psychiatrist to confirm suspected POD is required. Results: In total, 1,608 patients were included. The incidence rate of POD was 2.2%. Age ≥70 years and American Society of Anesthesiologists physical status >III were the risk factors of POD in IVPCA patients. Approximately three-quarters of all POD cases occurred within the first 2 postoperative days. For pain at rest, patients with inadequate pain relief had significantly greater rates of POD than patients with adequate pain relief (day 1, 8.4% vs 1.5%, P<0.001; day 2, 9.6% vs 2.0%, P=0.028; day 3, 4.1% vs 2.1%, P=0.412. However, the incidence of POD was not associated with movement-evoked pain relief. Most (79.9% POD cases in IVPCA patients showed either one or two symptoms. The

Temperature Dependent Rubidium Helium Line Shapes and Fine Structure Mixing Rates

Science.gov (United States)

2015-09-01

tube biased at 1,275 V exhibited a dark signal bias of 4-6 nA with noise fluctuation of 0.04 nA, as monitored on a Keithley model 386 picoammeter with...Journal of Physical Chemistry, 74(1):187–196, 1970. [79] Wu, Sheldon SQ, Thomas F Soules , Ralph H Page, Scott C Mitchell, V Keith Kanz, and Raymond J...Society for Optics and Photonics, 2008. [80] Wu, Sheldon SQ, Thomas F Soules , Ralph H Page, Scott C Mitchell, V Keith Kanz, and Raymond J Beach

Temperature Dependent Rubidium-Helium Line Shapes and Fine Structure Mixing Rates

Science.gov (United States)

2015-09-17

tube biased at 1,275 V exhibited a dark signal bias of 4-6 nA with noise fluctuation of 0.04 nA, as monitored on a Keithley model 386 picoammeter with...Journal of Physical Chemistry, 74(1):187–196, 1970. [79] Wu, Sheldon SQ, Thomas F Soules , Ralph H Page, Scott C Mitchell, V Keith Kanz, and Raymond J...Society for Optics and Photonics, 2008. [80] Wu, Sheldon SQ, Thomas F Soules , Ralph H Page, Scott C Mitchell, V Keith Kanz, and Raymond J Beach

Stoneflies of the genus Neoperla (Plecoptera, Perlidae from Wuyi Mountain National Nature Reserve, Fujian of China

Directory of Open Access Journals (Sweden)

Xue-Feng Qin

2013-08-01

Full Text Available The species of the genus Neoperla are reviewed from Wuyi Mountain National Nature Reserve located in the Fujian Province of southeastern China, including the description of a new species, Neoperla brevistyla sp. n. The new species is compared to similar taxa. The first records of five Neoperla species, N. henana Li, Wu & Zhang, 2011, N. similiserecta Wang & Li, 2012, N. qingyuanensis Yang & Yang, 1995, N. xuansongae Li & Li, 2013 and N. tuberculata Wu, 1938 are given for the Wuyi Mountain. A provisional key is provided for facilitating the identification of these species.

Stoneflies of the genus Neoperla (Plecoptera, Perlidae) from Wuyi Mountain National Nature Reserve, Fujian of China.

Science.gov (United States)

Qin, Xue-Feng; Murányi, Dávid; Wang, Guo-Quan; Li, Wei-Hai

2013-01-01

The species of the genus Neoperla are reviewed from Wuyi Mountain National Nature Reserve located in the Fujian Province of southeastern China, including the description of a new species, Neoperla brevistyla sp. n. The new species is compared to similar taxa. The first records of five Neoperla species, Neoperla henana Li, Wu & Zhang, 2011, Neoperla similiserecta Wang & Li, 2012, Neoperla qingyuanensis Yang & Yang, 1995, Neoperla xuansongae Li & Li, 2013 and Neoperla tuberculata Wu, 1938 are given for the Wuyi Mountain. A provisional key is provided for facilitating the identification of these species.

On the security of a novel probabilistic signature based on bilinear square Diffie-Hellman problem and its extension.

Science.gov (United States)

Zhao, Zhenguo; Shi, Wenbo

2014-01-01

Probabilistic signature scheme has been widely used in modern electronic commerce since it could provide integrity, authenticity, and nonrepudiation. Recently, Wu and Lin proposed a novel probabilistic signature (PS) scheme using the bilinear square Diffie-Hellman (BSDH) problem. They also extended it to a universal designated verifier signature (UDVS) scheme. In this paper, we analyze the security of Wu et al.'s PS scheme and UDVS scheme. Through concrete attacks, we demonstrate both of their schemes are not unforgeable. The security analysis shows that their schemes are not suitable for practical applications.

Ultrafast Optics: Vector Cavity Laser - Physics and Technology

Science.gov (United States)

2016-06-14

with a quasi- vector cavity both numerically and experimentally. It is expected that through the study a deep and comprehensive understanding on the...799-801, Jun. 1997. 31. L. M. Zhao, D. Y. Tang, J. Wu, X. Q. Fu, and S. C. Wen , "Noise-like pulse in a gain-guided soliton fiber laser," Opt...solitons in a ring fiber laser," Optics Communications 281 (22), 5614 (2008). 110. L. M. Zhao, D. Y. Tang, J. Wu, X. Q. Fu, and S. C. Wen , "Noise-like

Ultrafast Optics - Vector Cavity Lasers: Physics and Technology

Science.gov (United States)

2016-06-14

with a quasi- vector cavity both numerically and experimentally. It is expected that through the study a deep and comprehensive understanding on the...799-801, Jun. 1997. 31. L. M. Zhao, D. Y. Tang, J. Wu, X. Q. Fu, and S. C. Wen , "Noise-like pulse in a gain-guided soliton fiber laser," Opt...solitons in a ring fiber laser," Optics Communications 281 (22), 5614 (2008). 110. L. M. Zhao, D. Y. Tang, J. Wu, X. Q. Fu, and S. C. Wen , "Noise-like

Ultrafast Optics: Vector Cavity Fiber Lasers - Physics and Technology

Science.gov (United States)

2016-06-14

with a quasi- vector cavity both numerically and experimentally. It is expected that through the study a deep and comprehensive understanding on the...799-801, Jun. 1997. 31. L. M. Zhao, D. Y. Tang, J. Wu, X. Q. Fu, and S. C. Wen , "Noise-like pulse in a gain-guided soliton fiber laser," Opt...solitons in a ring fiber laser," Optics Communications 281 (22), 5614 (2008). 110. L. M. Zhao, D. Y. Tang, J. Wu, X. Q. Fu, and S. C. Wen , "Noise-like

Comparison of Three Methods for Generating Superhydrophobic, Superoleophobic Nylon Nonwoven Surfaces (Postprint)

Science.gov (United States)

2011-04-01

film and onto a 100 g/ m2 nylon nonwoven substrate was carried out in a cylindri- cal , inductively coupled plasma reactor (10 cm diameter and 2700 cm3...the Nonwoven Institute (NI) for sharing hydro- entangled nonwoven fabric with us. References 1. Barthlott W, Neinhuis C (1997) Planta 202:1 2. Wu X...Faraday Soc 40:546 8. Lee H (2009) J Mater Sci 44:4645. doi:10.1007/s10853-009- 3711-5 9. Hoefnagels H, Wu D, de With G, Ming W (2007) Langmuir 23

Combined Effects of Primary and Tertiary Blast on Rat Brain: Characterization of a Model of Blast-induced Mild Traumatic Brain Injury

Science.gov (United States)

2013-03-01

injury in U.S. military personnel. N Engl J Med 364, 2091–2100 (2011) 27. Lu J, Ng KC , Ling GS, Wu J, Poon JF, Kan EM, Tan MH, Wu YJ, Li P...Moochhala S, Yap E, Lee LK, Teo AL, Yeh IB, Ser- gio DM, Chua F, Kumar SD, Ling EA: Effect of blast exposure on the brain structure and cognition in the...12689448] 32. Henderson D, Bielefeld EC, Harris KC , Hu BH. The role of oxidative stress in noise-induced hearing loss. Ear Hear. 2006;27(1):1–19. [PMID

Vehicle/Guideway Interaction in Maglev Systems

Science.gov (United States)

1992-03-01

Technology Division Materials and Components in Maglev Systems Technology Division Materials and Components Technology Division byY. Cai, S. S. Chen, and D. M...Transportation Systems Reports (UC-330, Vehicle/Guideway Interaction in Maglev Systems by Y. Cai and S. S. Chen Materials and Components Technology Division D. M...Surface Irregularities ...................................... 32 4 Vehicle/Guideway Interaction in Transrapid Maglev System .................. 34 4.1

Untitled

Indian Academy of Sciences (India)

20. Nevill GA and Cook D 1969 Can. J. Chen. 47 743. 21. Glasel GA 1969 Org. Magn. Reson. 1481. 22. Soundarajan S 1958 Trans. Faraday Soc. 54147. 23. Rein R 1971 Int. J. Quant. Chem., Symp, 4341. 24. Woet D 1972.J. Am. Chen, Soc. 94.8213. 25. Bideau.JP, Huong PV and Toure S 1976 Acta Crystallogr. B32481.

75 FR 7358 - Addition of Certain Persons to the Entity List: Addition of Persons Acting Contrary to the...

Science.gov (United States)

2010-02-19

... Company Ltd., 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan; and (4) Yi-Lan Chen, a.k.a., Kevin Chen, 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan, and 7th Floor, Number 17... the requirements of the Paperwork Reduction Act of 1995 (44 U.S.C. 3501 et seq.) (PRA), unless that...

Mathematical modeling and simulation of aquatic and aerial animal locomotion

Science.gov (United States)

Hou, T. Y.; Stredie, V. G.; Wu, T. Y.

2007-08-01

In this paper, we investigate the locomotion of fish and birds by applying a new unsteady, flexible wing theory that takes into account the strong nonlinear dynamics semi-analytically. We also make extensive comparative study between the new approach and the modified vortex blob method inspired from Chorin's and Krasny's work. We first implement the modified vortex blob method for two examples and then discuss the numerical implementation of the nonlinear analytical mathematical model of Wu. We will demonstrate that Wu's method can capture the nonlinear effects very well by applying it to some specific cases and by comparing with the experiments available. In particular, we apply Wu's method to analyze Wagner's result for a wing abruptly undergoing an increase in incidence angle. Moreover, we study the vorticity generated by a wing in heaving, pitching and bending motion. In both cases, we show that the new method can accurately represent the vortex structure behind a flying wing and its influence on the bound vortex sheet on the wing.

Extreme soil erosion rates in citrus slope plantations and control strategies. A literature review

Science.gov (United States)

Cerdà, Artemi; Ángel González Peñaloza, Félix; Pereira, Paulo; Reyes Ruiz Gallardo, José; García Orenes, Fuensanta; Burguet, María

2013-04-01

approach. Catena, 85 (3), 231-236. Cerdà, A., Jurgensen, M.F., Bodi, M.B. 2009. Effects of ants on water and soil losses from organically-managed citrus orchards in eastern Spain. Biologia, 64 (3), 527-531. Cerdà, A., Morera, A.G., Bodí, M.B. 2009. Soil and water losses from new citrus orchards growing on sloped soils in the western Mediterranean basin. Earth Surface Processes and Landforms, 34 (13), 1822-1830. Lavigne, C., Achard, R., Tixier, P., Lesueur Jannoyer, M. 2012. How to integrate cover crops to enhance sustainability in banana and citrus cropping systems. Acta Horticulturae, 928, 351-358. Le Bellec, F., Damas, O., Boullenger, G., Vannière, H., Lesueur Jannoyer, M., Tournebize, R., Ozier Lafontaine, H. 2012. Weed control with a cover crop (Neonotonia wightii) in mandarin orchards in Guadeloupe (FWI). Acta Horticulturae, 928, 359-366. Liu, Y., Tao, Y., Wan, K.Y., Zhang, G.S., Liu, D.B., Xiong, G.Y., Chen, F. 2012. Runoff and nutrient losses in citrus orchards on sloping land subjected to different surface mulching practices in the Danjiangkou Reservoir area of China. Agricultural Water Management, 110, 34-40. Lu, J., Wilson, M.J., Yu, J. 1997. Effects of trench planting and soil chiselling on soil properties and citrus production in hilly ultisols of China Soil and Tillage Research, 43 (3-4), 309-318. Lü, W., Zhang, H., Wu, Y., Cheng, J., Li, J., Wang, X. 2012. The impact of plant hedgerow in Three Gorges on the soil chemicophysical properties and soil erosion. Key Engineering Materials, 500, 142-148. Wang, L., Tang, L., Wang, X., Chen, F. 2010. Effects of alley crop planting on soil and nutrient losses in the citrus orchards of the Three Gorges Region. Soil and Tillage Research, 110 (2), 243-250. Wu J., Li Q., Yan L. 1997. Effect of intercropping on soil erosion in young citrus plantation - a simulation study. Chinese Journal of Applied Ecology, 8 (2), 143-146. Wu, D.-M., Yu, Y.-C., Xia, L.-Z., Yin, S.-X., Yang, L.-Z. 2011. Soil fertility indices of citrus

On the Unsteady-Motion Theory of Magnetic Forces for Maglev

Science.gov (United States)

1993-11-01

DivisionEnergy Technology Division Forces for Maglev Energy Technology DivisionEnergy Technology Division by S. S. Chen, S. Zhu, and Y. Cai APQ 4 袲...On the Unsteady-Motion Theory of Magnetic Forces for Maglev by S. S. Chen, S. Zhu, and Y. Cai Energy Technology Division November 1993 Work supported...vi On The Unsteady-Motion Theory of Magnetic Forces for Maglev by S. S

On integral equation methods for electromagnetic scattering by biperiodic structures

OpenAIRE

Bugert, Beatrice

2014-01-01

In der vorliegenden Arbeit verwenden wir Integralgleichungsmethoden, um die Streuung von zeitharmonischen elektromagnetischen ebenen Wellen an biperiodischen mehrschichtigen Strukturen zu untersuchen. Solche Strukturen modellieren wir durch die vertikale Anordnung einer endlichen Anzahl an sich nicht schneidenden, polyedrisch Lipschitz regulären Grenzflächen. Wir unterscheiden Streuobjekte bestehend aus einer Oberfläche und solche bestehend aus mindestens zwei Oberflächen. Das elektromagnetis...

Ühinemise ja iseolemise vastuseis. Ideaalid ja reaalsus / Rein Tootmaa

Index Scriptorium Estoniae

Tootmaa, Rein

2001-01-01

Mängufilmid "Keiser ja palgamõrtsukas" ("Jing ke ci qin wang") : režissöör Chen Kaige : Jaapan-Hiina-Prantsusmaa 1999 ja "Tiiger ja draakon" ("Wo hu chang long") : režissöör Ang Lee : Hiina-Hongkong-Ameerika Ühendriigid 2000. Lisa : Aare Ermeli koostatud Chen Kaige ja Ang Lee loomingu lühikokkuvõtted. Kokkuvõte inglise keeles lk. 128

Global existence of periodic solutions on a simplified BAM neural network model with delays

International Nuclear Information System (INIS)

Zheng Baodong; Zhang Yazhuo; Zhang Chunrui

2008-01-01

A simplified n-dimensional BAM neural network model with delays is considered. Some results of Hopf bifurcations occurring at the zero equilibrium as the delay increases are exhibited. Global existence of periodic solutions are established using a global Hopf bifurcation result of Wu [Wu J. Symmetric functional-differential equations and neural networks with memory. Trans Am Math Soc 1998;350:4799-838], and a Bendixson criterion for higher dimensional ordinary differential equations due to Li and Muldowney [Li MY, Muldowney J. On Bendixson's criterion. J Differ Equations 1994;106:27-39]. Finally, computer simulations are performed to illustrate the analytical results found

From the transnational to the Sinophone: lesbian representations in Chinese-language films.

Science.gov (United States)

Wong, Alvin Ka Hin

2012-01-01

This article theorizes global lesbian cinema in Chinese-language films through regionalism, diaspora studies, and Sinophone studies. Through an inter-regional analysis of Butterfly (Yan Yan Mak, 2004, Hong Kong) and diasporic and Sinophone readings of Saving Face (Alice Wu, 2005, USA), I argue that Mak's film illustrates a Hong Kong regional retranslation of a Taiwanese lesbian story, which complicates any claim to a stable "Chinese" identity. Finally, Wu's representation of lesbianism also troubles the politics of Chineseness by pointing to the ways diasporic reproduction of "community" works through the disciplining of other non-normative sexualities.

Stochastic quantization and gauge-fixing of the linearized gravitational field

International Nuclear Information System (INIS)

Hueffel, H.; Rumpf, H.

1984-01-01

Due to the indefiniteness of the Euclidean gravitational action the Parisi-Wu stochastic quantization scheme fails in the case of the gravitational field. Therefore we apply a recently proposed modification of stochastic quantization that works in Minkowski space and preserves all the advantages of the original Parisi-Wu method; in particular no gauge-fixing is required. Additionally stochastic gauge-fixing may be introduced and is also studied in detail. The graviton propagators obtained with and without stochastic gauge-fixing all exhibit a noncausal contribution, but apart from this effect the gauge-invariant quantities are the same as those of standard quantization. (Author)

Virtual Trackballs Revisited

DEFF Research Database (Denmark)

Henriksen, Knud; Sporring, Jon; Hornbæk, Kasper

2004-01-01

reviews and provides a mathematical foundation for virtual trackballs. The first, but still popular, virtual trackball was described by Chen et al. [CHECK END OF SENTENCE]. We show that the virtual trackball by Chen et al. does not rotate the object along the intended great circular arc on the virtual...... trackball and we give a correction. Another popular virtual trackball is Shoemake's quaternion implementation [CHECK END OF SENTENCE], which we show to be a special case of the virtual trackball by Chen et al.. Shoemake extends the scope of the virtual trackball to the full screen. Unfortunately, Shoemake......'s virtual trackball is inhomogeneous and discontinuous with consequences for usability. Finally, we review Bell's virtual trackball [CHECK END OF SENTENCE] and discuss studies of the usability of virtual trackballs....

Retraction: Nucleophagy in Human Disease: Beyond the Physiological Role. [Tohoku J. Exp. Med., 2018, 244 (1), 75-81. doi: 10.1620/tjem.244.75. Review.].

Science.gov (United States)

2018-02-01

Retracted Review article: Nucleophagy in Human Disease: Beyond the Physiological Role. [Tohoku J. Exp. Med., 2018, 244 (1), 75-81. doi: 10.1620/tjem.244.75.] The above Review article was published online on January 27, 2018. Soon after its publication (on February 1, 2018), Dr. Nian Fu and Prof. Linxi Chen informed the Editor-in-Chief, The Tohoku Journal of Experimental Medicine (TJEM), about serious violation of publication ethics. Indeed, Dr. Nian Fu and Prof. Linxi Chen were astonished to find their names as coauthors of this Review article, because they were not involved in the submission process of this Review article and they do not know any of other coauthors. In addition, the Review article is similar to their unpublished manuscript. After a thorough investigation in accordance with the recommendations of the Committee on Publication Ethics (COPE), the Editor-in-Chief of TJEM decided to retract this Review article. The reasons for Retraction are summarized below: forged authors and an unexpected case of plagiarism. Forged authors: Dr. Nian Fu and Prof. Linxi Chen were added as co-authors of the Review article without their knowledge. In fact, the signature provided by Prof. Linxi Chen is apparently different from the signature of a coauthor, named Linxi Chen, on the AUTHORS’ RESPONSIBILITY FORM, provided by the corresponding author of the Review article. More critically, the signature provided by Dr. Nian Fu is completely different from the signature of Nian Fu, because the Chinese characters are different between the two signatures. In addition, the replies from three authors (Ming Zhou, Hongwen Ji and Yong Xia) clearly indicate that they misunderstand the identity of Dr. Nina Fu. We also attempted to contact two authors, named Nian Fu and Linxi Chen, via e-mail. As expected, the forged authors did not respond to our inquiries, despite that their e-mail addresses appear to be active. An unexpected case of plagiarism: This Review article is similar to the

The History, Status, Gaps, and Future Directions of Neurotoxicology in China.

Science.gov (United States)

Cai, Tongjian; Luo, Wenjing; Ruan, Diyun; Wu, Yi-Jun; Fox, Donald A; Chen, Jingyuan

2016-06-01

Rapid economic development in China has produced serious ecological, environmental, and health problems. Neurotoxicity has been recognized as a major public health problem. The Chinese government, research institutes, and scientists conducted extensive studies concerning the source, characteristics, and mechanisms of neurotoxicants. This paper presents, for the first time, a comprehensive history and review of major sources of neurotoxicants, national bodies/legislation engaged, and major neurotoxicology research in China. Peer-reviewed research and pollution studies by Chinese scientists from 1991 to 2015 were examined. PubMed, Web of Science and Chinese National Knowledge Infrastructure (CNKI) were the major search tools. The central problem is an increased exposure to neurotoxicants from air and water, food contamination, e-waste recycling, and manufacturing of household products. China formulated an institutional framework and standards system for management of major neurotoxicants. Basic and applied research was initiated, and international cooperation was achieved. The annual number of peer-reviewed neurotoxicology papers from Chinese authors increased almost 30-fold since 2001. Despite extensive efforts, neurotoxicity remains a significant public health problem. This provides great challenges and opportunities. We identified 10 significant areas that require major educational, environmental, governmental, and research efforts, as well as attention to public awareness. For example, there is a need to increase efforts to utilize new in vivo and in vitro models, determine the potential neurotoxicity and mechanisms involved in newly emerging pollutants, and examine the effects and mechanisms of mixtures. In the future, we anticipate working with scientists worldwide to accomplish these goals and eliminate, prevent and treat neurotoxicity. Cai T, Luo W, Ruan D, Wu YJ, Fox DA, Chen J. 2016. The history, status, gaps, and future directions of neurotoxicology in

Association between muscle atrophy/weakness and health care costs and utilization among patients receiving total knee replacement surgery: a retrospective cohort study

Directory of Open Access Journals (Sweden)

Chen SY

2013-08-01

Full Text Available Shih-Yin Chen,1 Ning Wu,1 Yuan-Chi Lee,1 Yang Zhao21Health Economics and Epidemiology, Evidera, Lexington, Massachusetts, 2Health Economics and Outcomes Research, Novartis Pharmaceuticals Corporation, East Hanover, New Jersey, USAPurpose: The aim of the study reported here was to examine health care resource utilization, costs, and risk of rehospitalization for total knee replacement (TKR patients with and without muscle atrophy/weakness (MAW.Patients and methods: Individuals aged 50–64 years with commercial insurance or 65+ years with Medicare Supplemental Insurance (Medicare who had a hospitalization for TKR between January 1, 2006 and September 30, 2009 were identified from a large US claims database. First hospitalization for TKR was defined as the index stay. All patients were classified into three cohorts according to when MAW was diagnosed relative to TKR: pre-MAW, post-MAW, and no MAW. The association between MAW and health care costs over the 12-month post-index period and the probability of rehospitalization were assessed via multivariate regressions.Results: The study sample included 53,696 Medicare and 46,058 commercial insurance TKR patients. Controlling for cross-cohort differences, both the pre- and post-MAW cohorts had significantly higher total health care costs (Medicare US$4,201 and US$9,404 higher, commercial insurance US$2,737 and US$6,640 higher, respectively than the no MAW cohort (all P < 0.05. The post-MAW cohort in both populations was also more likely to have any all-cause or replacement-related rehospitalization compared with the no MAW cohort.Conclusion: Among US patients undergoing TKR, those with MAW had higher health care utilization and costs than patients without MAW.Keywords: rehospitalization, resource utilization, Medicare, health insurance, USA

Purification and in vitro antioxidant activities of tellurium-containing phycobiliproteins from tellurium-enriched Spirulina platensis

Directory of Open Access Journals (Sweden)

Yang F

2014-10-01

Full Text Available Fang Yang,1 Ka-Hing Wong,2 Yufeng Yang,3 Xiaoling Li,1 Jie Jiang,1 Wenjie Zheng,1 Hualian Wu,1 Tianfeng Chen1 1Department of Chemistry, Jinan University, Guangzhou, People’s Republic of China; 2Department of Applied Biology and Chemical Technology, The Hong Kong Polytechnic University, Hong Kong, People’s Republic of China; 3Institute of Hydrobiology, College of Life Science and Technology, Jinan University, Guangzhou, People’s Republic of China Abstract: Tellurium-containing phycocyanin (Te-PC and allophycocyanin (Te-APC, two organic tellurium (Te species, were purified from tellurium-enriched Spirulina platensis by a fast protein liquid chromatographic method. It was found that the incorporation of Te into the peptides enhanced the antioxidant activities of both phycobiliproteins. With fractionation by ammonium sulfate precipitation and hydroxylapatite chromatography, Te-PC and Te-APC could be effectively separated with high purity, and Te concentrations were 611.1 and 625.3 µg g-1 protein in Te-PC and Te-APC, respectively. The subunits in the proteins were identified by using MALDI-TOF-TOF mass spectrometry. Te incorporation enhanced the antioxidant activities of both phycobiliproteins, as examined by 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid assay. Moreover, Te-PC and Te-APC showed dose-dependent protection on erythrocytes against the water-soluble free radical initiator 2,2'-azo(2-asmidinopropanedihydrochloride-induced hemolysis. In the hepatoprotective model, apoptotic cell death and nuclear condensation induced by tert-butyl hydroperoxide in HepG2 cells was significantly attenuated by Te-PC and Te-APC. Taken together, these results suggest that Te-PC and Te-APC are promising Te-containing proteins with application potential for treatment of diseases related to oxidative stress. Keywords: tellurium, phycocyanin, allophycocyanin, purification, antioxidant activity

Female Contributions in Nuclear Science: Experiences at the Brazilian Commission for Nuclear Energy (CNEN/LAPOC)

International Nuclear Information System (INIS)

Carrijo da Silva Dias, D.; Leandro Bonifácio, R.; Augusto da Silva Alfenas, R.

2015-01-01

Female professional contributions in nuclear science and technology are no longer a novelty. Names such as Marie Curie, Chen Shiung Wu and Rosalyn Yalow are evidence of the incessant, worldwide efforts of women to take part in fields largely reserved for men. Although society has witnessed high level female achievements as early as in the 1800s, female scientists and technicians still face a long journey ahead in empowering themselves into full and equal participation in these areas. Today, the Laboratory of Poços de Caldas of the Brazilian Commission for Nuclear Energy (CNEN/LAPOC) experiences a process of women empowerment at all levels of the institution. At the Technical Section, two of the seven research departments are headed by female researchers who play essential roles in the institution’s quest for excellence. Today, their work include coordination of a major environmental research project involving most researchers at LAPOC, successful participations on international intercomparisons of radiometric analysis and development of new methodologies in nuclear field applications. At the administrative level, female collaborators lead the Administration Section, improving several aspects of internal management, promoting further interaction at the workplace and strengthening cooperation among all departments. Regarding the capacitation level, the Commission has a long tradition of welcoming students and junior researchers through institutional programmes of training and collaboration in several projects. Today CNEN/LAPOC works with twenty scholarship grantees — half of which are women. Not only the Laboratory has reached equality in participation, but unarguably the female participants have demonstrated the most remarkable achievements among the group, attested by their continuous academic pursuit through Master’s and Doctoral degrees, full collaboration in scientific publishing and attendance in training programmes at international level. The purpose

Elliptic Curve Integral Points on y2 = x3 + 3x ‑ 14

Science.gov (United States)

Zhao, Jianhong

2018-03-01

The positive integer points and integral points of elliptic curves are very important in the theory of number and arithmetic algebra, it has a wide range of applications in cryptography and other fields. There are some results of positive integer points of elliptic curve y 2 = x 3 + ax + b, a, b ∈ Z In 1987, D. Zagier submit the question of the integer points on y 2 = x 3 ‑ 27x + 62, it count a great deal to the study of the arithmetic properties of elliptic curves. In 2009, Zhu H L and Chen J H solved the problem of the integer points on y 2 = x 3 ‑ 27x + 62 by using algebraic number theory and P-adic analysis method. In 2010, By using the elementary method, Wu H M obtain all the integral points of elliptic curves y 2 = x 3 ‑ 27x ‑ 62. In 2015, Li Y Z and Cui B J solved the problem of the integer points on y 2 = x 3 ‑ 21x ‑ 90 By using the elementary method. In 2016, Guo J solved the problem of the integer points on y 2 = x 3 + 27x + 62 by using the elementary method. In 2017, Guo J proved that y 2 = x 3 ‑ 21x + 90 has no integer points by using the elementary method. Up to now, there is no relevant conclusions on the integral points of elliptic curves y 2 = x 3 + 3x ‑ 14, which is the subject of this paper. By using congruence and Legendre Symbol, it can be proved that elliptic curve y 2 = x 3 + 3x ‑ 14 has only one integer point: (x, y) = (2, 0).

Effect of magnetic nanoparticles on apoptosis and cell cycle induced by wogonin in Raji cells

Directory of Open Access Journals (Sweden)

Wang XM

2012-02-01

Full Text Available Lei Wang1,2,*, Haijun Zhang1,2,*, Baoan Chen1,2, Guohua Xia1,2, Shuai Wang1,2, Jian Cheng1,2, Zeye Shao1,2, Chong Gao1,2, Wen Bao1,2, Liang Tian1,2, Yanyan Ren1,2, Peipei Xu1,2, Xiaohui Cai1,2, Ran Liu1,2, Xuemei Wang3 1Department of Hematology and Oncology, Zhongda Hospital, Medical School, 2Faculty of Oncology, Medical School, 3State Key Laboratory of Bioelectronics (Chien-Shiung Wu Laboratory, Southeast University, Nanjing, China*These authors contributed equally to this workAbstract: Traditional Chinese medicine is gradually becoming a new source of anticancer drugs. One such example is wogonin, which is cytotoxic to various cancer cell lines in vitro. However, due to its low water solubility, wogonin is restricted to clinical administration. Recently, the application of drug-coated magnetic nanoparticles (MNPs to increase water solubility of the drug and to enhance its chemotherapeutic efficiency has attracted much attention. In this study, wogonin was conjugated with the drug delivery system of MNPs by mechanical absorption polymerization to fabricate wogonin-loaded MNPs. It was demonstrated that MNPs could strengthen wogonin-induced cell inhibition, apoptosis, and cell cycle arrest in Raji cells by methylthiazol tetrazolium assay, flow cytometer assay, and nuclear 4',6-diamidino-2-phenylindole staining. Furthermore, the molecular mechanisms of these phenomena were explored by western blot, in which the protein levels of caspase 8 and caspase 3 were increased significantly while those of survivin and cyclin E were decreased significantly in wogonin-MNPs group. These findings suggest that the combination of wogonin and MNPs provides a promising strategy for lymphoma therapy.Keywords: wogonin, magnetic nanoparticles, Raji cell, apoptosis, cell cycle, caspase 8, caspase 3, survivin, cyclin E

The preparation and characterization of gold-conjugated polyphenol nanoparticles as a novel delivery system

Directory of Open Access Journals (Sweden)

Hsieh DS

2012-03-01

Full Text Available Dar-Shih Hsieh1,2, Hsiu-Chin Lu5, Cheng-Cheung Chen1,3, Chang-Jer Wu1,*, Ming-Kung Yeh4,* 1Department of Food Science, National Taiwan Ocean University, Keelung, Taiwan; 2Division of Urology, 3Department of Pathology, Tri-Service General Hospital, 4Institute of Preventive Medicine, National Defence Medical Center, Taipei, Taiwan; 5Department of Laboratory Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan*These authors contributed equally to this workAbstract: Nanogold particles are commonly used in nanomedicine. We generated physical nanogold (pNG conjugated with different ratios of epigallocatechin-3-gallate (EGCG and evaluated its physicochemical properties, antioxidant activity, and cytotoxicity in vitro as well as anticancer activity in vivo. Results showed that the EGCG-pNG conjugates were successfully prepared at ratios between 23:1 and 23:5, with the percentage of EGCG content increasing with the EGCG:pNG ratio from 23:1 (2.0% ± 0.02% to 23:5 (28% ± 0.3%. EGCG-pNG particles at ratios of 23:1 and 23:5 demonstrated significantly decreased size from 500 to 20 nm and decreasing zeta potentials of 21 mV to –22 mV, respectively. At a ratio of 23:2.5, the EGCG-pNG particles (27% EGCG, 50 nm in size, zeta potential of –8 mV showed longer EGCG activity half-life (110 days vs 5 hours, controlled release (2 hours vs 30 minutes, and higher antioxidant activity (four times, as well as inhibition of tumor cell growth, than controls. The present study indicated that EGCG-pNG possesses promising therapeutic potential, based on its strong free-radical scavenging and anticancer activities.Keywords: EGCG, nanoparticles, antioxidant, antitumor activity, nanogold

Insights into the therapeutic potential of hypoxia-inducible factor-1α small interfering RNA in malignant melanoma delivered via folate-decorated cationic liposomes

Directory of Open Access Journals (Sweden)

Chen Z

2016-03-01

Full Text Available Zhongjian Chen,1,* Tianpeng Zhang,2,* Baojian Wu,2 Xingwang Zhang2 1Department of Pharmaceutics, Shanghai Dermatology Hospital, 2Division of Pharmaceutics, College of Pharmacy, Jinan University, Gangzhou, People’s Republic of China *These authors contributed equally to this work Abstract: Malignant melanoma (MM represents the most dangerous form of skin cancer, and its incidence is expected to rise in the coming time. However, therapy for MM is limited by low topical drug concentration and multidrug resistance. This article aimed to develop folate-decorated cationic liposomes (fc-LPs for hypoxia-inducible factor-1α (HIF-1α small interfering (siRNA delivery, and to evaluate the potential of such siRNA/liposome complexes in MM therapy. HIF-1α siRNA-loaded fc-LPs (siRNA-fc-LPs were prepared by a film hydration method followed by siRNA incubation. Folate decoration of liposomes was achieved by incorporation of folate/oleic acid-diacylated oligochitosans. The resulting siRNA-fc-LPs were 95.3 nm in size with a ζ potential of 2.41 mV. The liposomal vectors exhibited excellent loading capacity and protective effect toward siRNA. The in vitro cell transfection efficiency was almost parallel to the commercially available Lipofectamine™ 2000. Moreover, the anti-melanoma activity of HIF-1α siRNA was significantly enhanced through fc-LPs. Western blot analysis and apoptosis test demonstrated that siRNA-fc-LPs substantially reduced the production of HIF-1α-associated protein and induced the apoptosis of hypoxia-tolerant melanoma cells. Our designed liposomal vectors might be applicable as siRNA delivery vehicle to systemically or topically treat MM. Keywords: malignant melanoma, HIF-1α siRNA, chitosan, cationic liposomes, gene therapy

PREFACE: The 15th International Conference on X-ray Absorption Fine Structure (XAFS15)

Science.gov (United States)

Wu, Z. Y.

2013-04-01

Committees and Staff Chair of the Conference Ziyu Wu International Advisory Committee Adam Hitchcock, Canada Adriano Filipponi, Italy Alain Manceau, France Alexander Soldatov, Russia Andrea Di Cicco, Italy Britt Hedman, USA Bruce Bunker, USA Calogero R. Natoli, Italy Christopher T. Chantler, Australia Frank M. F. De Groot, Netherlands Hiroyuki Oyanagi, Japan Ingolf Lindau, USA J. Mustre de Leon, México James E Penner-Hahn, USA Joaquin Garcia Ruiz, Spain John Evans, UK John J. Rehr, USA Kiyotaka Asakura, Japan Majed Chergui, Switzerland Mark Newton, UK Shiqiang Wei, P. R. China Tsun-Kong Sham, Canada Ziyu Wu, P. R. China International Program Committee Antonio Bianconi, Italy Augusto Marcelli, Italy Emad Flear Aziz, Germany Jinghua Guo, USA Joly Yves, France Masaharu Nomura, Japan Maurizio Benfatto, Italy Pieter Glatzel, France Shiqiang Wei, China Tiandou Hu, China Toshihiko Yokoyama, Japan Way-Faung Pong, Taiwan Xinyi Zhang, China Yi Xie, China Yuying Huang, China Zhonghua Wu, China Ziyu Wu, China Local Organizing Committee Bo He Fengchun Hu Haifeng Zhao Jing Zhang Meijuan Yu Qin Yu Shuo Zhang Wangsheng Chu Wei He Wei Xu Wensheng Yan Xiaomei Gong Xing Chen Yang Zou Yi Xia Zheng Jiang Zhi Xie Zhihu Sun Zhiyun Pan Additional Staff Chengxun Liu

JPRS Report, China

Science.gov (United States)

1989-05-17

brand , which symbolizes feudal autocracy, in that the new form has been posited in the hopes that reform can forcefully be implemented so as to...ucts; name- brand and high-quality products; products of energy, communications, transportation, and raw mate- rial industries; aid agriculture...1986 election. Chen Weiye fought a skillful battle although he had been seen as an underdog . The smashing victory of Chen Weiye and Huang Wentai plus

Physikalische Grundlagen von chemischen Raman-Sensoren mit Schwerpunkt auf faseroptischen SERS-Sonden

OpenAIRE

Viets, Carmen

2001-01-01

Faseroptische SERS-Sensoren wurden durch die Beschichtung der Endflächen von optischen Fasern mit rauhen Metallfilmen erzeugt. Zu den verschiedenen Präparationstechniken, die angewendet und verglichen wurden, gehörten das langsame Aufdampfen von Metall-Inselfilmen und das Bedampfen von Nanopartikeln, aufgerauhten oder elektronenlithographisch strukturierten Oberflächen mit Metallfilmen. Der Einfluß der Laserleistung auf die Messungen mit SERS-Sensoren wurde untersucht, und es wurden maximale ...

Unconventional Density Wave and Superfluidity in Cold Atom Systems

Science.gov (United States)

2014-06-01

Tsai, Chairperson Professor Kirill Shtengel Professor Vivek Aji 3 Copyright by Chen-Yen Lai 2014 4 The Dissertation of Chen-Yen Lai is approved...thank my dissertation committee members, Professor Vivek Aji and Pro- fessor Kirill Shtengel, for their help, kindness, insightful comments and...near balance to a stripe-CDW ( red ) as the imbalance increases. The insert shows the strong imbalance region, where single species p-wave majority

Quasi-Static Evolution, Catastrophe, and Failed Eruption of Solar Flux Ropes

Science.gov (United States)

2016-12-30

Ropes James Chen Beam Physics Branch Plasma Physics Division December 30, 2016 Approved for public release; distribution is unlimited. i REPORT...pressure gradient force combine to balance the major radial hoop force. The macroscopic forces on the flux ropes and onset conditions are quantified...Solar physics theory 67-4989-07 Quasi-Static Evolution, Catastrophe, and “Failed” Eruption of Solar Flux Ropes James Chen1 Plasma Physics Division

Aerial Logistics Management for Carrier Onboard Delivery

Science.gov (United States)

2016-09-01

NAVAL POSTGRADUATE SCHOOL MONTEREY, CALIFORNIA THESIS AERIAL LOGISTICS MANAGEMENT FOR CARRIER ONBOARD DELIVERY by Samuel L. Chen September 2016...AND SUBTITLE AERIAL LOGISTICS MANAGEMENT FOR CARRIER ONBOARD DELIVERY 5. FUNDING NUMBERS 6. AUTHOR(S) Samuel L. Chen 7. PERFORMING ORGANIZATION NAME(S...delivery (COD) is the use of aircraft to transport people and cargo from a forward logistics site (FLS) to a carrier strike group (CSG). The goal of

The Role of Protein Elongation Factor eEF1A2 in Breast Cancer

Science.gov (United States)

2006-09-01

apoptosis . A summary of common EMT markers is listed in Table I. Importantly, these developmental regulators can induce EMT in a nondevelopmental...1978; Chen et al., 1997), apoptosis (Chen et al., 1997), and metabolic regulation (Bissell et al., 1977) has been known for decades, the molecular...marks the Spemann organizer in vertebrate gastrulation and is one of the fi rst identifi ed regulators of embryological patterning (De Robertis et al

Massive Star Formation: Accreting from Companion X. Chen1 ...

Indian Academy of Sciences (India)

Abstract. We report the possible accretion from companion in the mas- sive star forming region (G350.69–0.49). This region seems to be a binary system composed of a diffuse object (possible nebulae or UC HII region) and a Massive Young Stellar Object (MYSO) seen in Spitzer IRAC image. The diffuse object and MYSO ...

Mitochondrial genome of Taiwan pig ( Sus Scrofa ) | Chen | African ...

African Journals Online (AJOL)

The purpose of this study is to investigate the complete nucleotide sequence of the mitochondrial genome of the Taiwan Lanyu pig (Sus scrofa) and its phylogenetic relationships with other pig breeds. Thirty-four forward and reverse primers were designed. Sequencing was performed in both directions. The results showed ...

Food Fortification to Prevent and Control Iron Deficiency | Chen ...

African Journals Online (AJOL)

It is essential to prevent the fortification iron from reacting with the absorption inhibitors. To ensure adequate absorption therefore, various factors must be considered before initiating a fortification programme. These include cost effectiveness of fortification in increasing absorbable iron, palatability of the fortified food and the ...

Chemische Reaktionen auf Oberflächen - eine SFG Studie

OpenAIRE

Kirsch, Harald

2014-01-01

This thesis focused on the investigation of chemical reactions on surfaces by usage of Sum Frequency Generation (SFG) spectroscopy and Thermal Desorption Spectroscopy (TDS). Understanding of chemical reactions on surfaces is of critical importance for modification and optimization of a variety of environmental and industrial processes, but the complexity of the ongoing reactions under "realistic" conditions often hinders an understanding on a molecular level. The aim of this work was to get i...

Supply chain management in selected clothing retail businesses / Jianling Wu

OpenAIRE

Wu, Jianling

2004-01-01

In today's highly competitive, global market place the pressure on organizations to find new ways to create and deliver value to customers grows ever strong. At the same time, market maturity combined with new sources of global competition has led to over-capacity in many industries leading to an inevitable pressure on price. Managers are increasingly interested in actively managing their supply chains because of environmental changes. The study is aimed to identify the importa...

Existence of positive periodic solution of mutualism system with several delays

International Nuclear Information System (INIS)

Wu Haihui; Xia Yonghui; Lin Muren

2008-01-01

In this paper, by using Mawhin coincidence degree, some sufficient conditions are obtained for the global existence of positive periodic solutions of a mutualism systems with bounded and unbounded delays. Our results generalize significantly improve those of Gopalsamy and He [Gopalsamy K, He XZ. Persistence, attractivity, and delay in facultative mutualism. J Math Anal Appl 1997;215:154-73], Yang et al. [Yang F, Jiang D, Ying A. Existence of positive solution of multidelays facultative mutualism system. J Eng Math 2002;3:64-8], Chen et al. [Chen FD, Shi JL, Chen XX. Periodicity in Lotka-Volterra facultative mutualism system with several delays. J Eng Math 2004;21(3)] and Xia and Lin [Xia YH, Lin M, Existence of positive periodic solution of mutualism system with infinite delays. Ann Diff Eqs 2005;21(3):448-53

Robust anonymous authentication scheme for telecare medical information systems.

Science.gov (United States)

Xie, Qi; Zhang, Jun; Dong, Na

2013-04-01

Patient can obtain sorts of health-care delivery services via Telecare Medical Information Systems (TMIS). Authentication, security, patient's privacy protection and data confidentiality are important for patient or doctor accessing to Electronic Medical Records (EMR). In 2012, Chen et al. showed that Khan et al.'s dynamic ID-based authentication scheme has some weaknesses and proposed an improved scheme, and they claimed that their scheme is more suitable for TMIS. However, we show that Chen et al.'s scheme also has some weaknesses. In particular, Chen et al.'s scheme does not provide user's privacy protection and perfect forward secrecy, is vulnerable to off-line password guessing attack and impersonation attack once user's smart card is compromised. Further, we propose a secure anonymity authentication scheme to overcome their weaknesses even an adversary can know all information stored in smart card.

Dansk oversættelse af MiDAS, et redskab til assessment af musikterapi for personer med demens

DEFF Research Database (Denmark)

Ridder, Hanne Mette Ochsner; Lykkegaard, Chris; McDermott, Orii

2018-01-01

Music in Dementia Assessment Scales, MiDAS, er udviklet til at vurdere ændringer i trivsel hos borgere med demens som har deltaget i musikterapi. Målingen udføres af 1) personale før og efter musikterapien for at vurdere om der er en indflydelse i hverdagssituationer efterfølgende, eller af 2......) musikterapeuten umiddelbart efter sessionen for at vurdere forandringer i selve sessionen. Der har været stor interesse for at anvende MiDAS i flere Europæiske lande, herunder Danmark. Derfor undersøgte udviklerne af MiDAS hvilke procedurer der anvendes til oversættelse og kulturel tilpasning af...... assessmentredskaber, og anbefalede på den baggrund en ti-trins procedure. Vi anvendte denne procedure til oversættelsen af MiDAS og således udviklingen af den danske MiDAS-DK. Den danske version af MiDAS er afprøvet af mere end 20 fagpersoner på baggrund af 296 udfyldte MiDAS-skemaer. Målet med artiklen er...

Development of high temperature metallic melting processes related to detritiation of exhausted control rods

International Nuclear Information System (INIS)

Dworschak, H.; Mannone, F.; Modica, G.

1994-01-01

A rather critical problem to be faced in developing a safe strategy for the management of tritiated solid wastes is dealing with the outgassing property of tritium. Releases of tritium under elemental or oxide form may occur from waste items at different temperatures and rates depending upon the nature of tritium bonds into the waste matrix as well as on its 'contamination history'. Apart from the commercial value of tritium, its release from waste packages anyhow represents a risk of tritium exposure that cannot be accepted by skippers, by store and disposal site operators as well as by the general public. Consequently it is mandatory to carry out the detritiation of such wastes before their packaging and storage or disposal. In the boron carbide control rods from the Lingen BWR after about three years of operation, tritium generated by neutron reaction was essentially retained in the B 4 C matrix. The objectives of the study are to demonstrate the feasibility of two processes aimed at reducing to the maximum practicable extent the level of tritium contamination in such waste management are facilitated

Electrospun fibrous scaffolds combined with nanoscale hydroxyapatite induce osteogenic differentiation of human periodontal ligament cells

Directory of Open Access Journals (Sweden)

Wu XN

2014-08-01

Full Text Available Xiaonan Wu,1 Leiying Miao,2,# Yingfang Yao,3 Wenlei Wu,1 Yu Liu,1 Xiaofeng Chen,1 Weibin Sun1,# 1Department of Periodontology, Hospital of Stomatology, Medical School of Nanjing University, Nanjing, People’s Republic of China; 2Department of Cariology and Endodontics, Hospital of Stomatology, Medical School of Nanjing University, Nanjing, People’s Republic of China; 3Eco-materials and Renewable Energy Research Center, Department of Materials Science and Engineering, National Laboratory of Solid State Microstructures, Nanjing University, Nanjing, People’s Republic of China #These authors contributed equally to this work Abstract: Periodontal repair is a complex process in which regeneration of alveolar bone is a vital component. The aim of this study was to develop a biodegradable scaffold with good biocompatibility and osteoinductive ability. Two types of composite fibrous scaffolds were produced by electrospinning, ie, type I collagen/poly(є-caprolactone (COL/PCL and type I collagen/poly(є-caprolactone/nanoscale hydroxyapatite (COL/PCL/nHA with an average fiber diameter of about 377 nm. After a simulated body fluid (SBF immersion test, the COL/PCL/nHA-SBF scaffold developed a rough surface because of the calcium phosphate deposited on the fibers, suggesting that the presence of nHA promoted the mineralization potential of the scaffold. Energy dispersive X-ray spectroscopy clearly showed the calcium and phosphorus content in the COL/PCL/nHA and COL/PCL/nHA-SBF scaffolds, confirming the findings of nHA and calcium phosphate precipitation on scanning electron micrographs. Water contact analysis revealed that nHA could improve the hydrophilic nature of the COL/PCL/nHA-SBF scaffold. The morphology of periodontal ligament cells cultured on COL/PCL-SBF and COL/PCL/nHA-SBF was evaluated by scanning electron microscopy. The results showed that cells adhered to either type of scaffold and were slightly spindle-shaped in the beginning, then

Cisplatin induces protective autophagy through activation of BECN1 in human bladder cancer cells

Directory of Open Access Journals (Sweden)

Lin JF

2017-05-01

Full Text Available Ji-Fan Lin,1 Yi-Chia Lin,2 Te-Fu Tsai,2,3 Hung-En Chen,2 Kuang-Yu Chou,2,3 Thomas I-Sheng Hwang2–4 1Central Laboratory, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, 2Division of Urology, School of Medicine, Fu-Jen Catholic University, New Taipei, 3Division of Urology, Department of Surgery, Shin Kong Wu Ho-Su Memorial Hospital, 4Department of Urology, Taipei Medical University, Taipei, Taiwan Purpose: Cisplatin-based chemotherapy is the first line treatment for several cancers including bladder cancer (BC. Autophagy induction has been implied to contribute to cisplatin resistance in ovarian cancer; and a high basal level of autophagy has been demonstrated in human bladder tumors. Therefore, it is reasonable to speculate that autophagy may account for the failure of cisplatin single treatment in BC. This study investigated whether cisplatin induces autophagy and the mechanism involved using human BC cell lines.Materials and methods: Human BC cells (5637 and T24 were used in this study. Cell viability was detected using water soluble tetrazolium-8 reagents. Autophagy induction was detected by monitoring the levels of light chain 3 (LC3-II and p62 by Western blot, LC3-positive puncta formation by immunofluorescence, and direct observation of the autophagolysosome (AL formation by transmission electron microscopy. Inhibitors including bafilomycin A1 (Baf A1, chloroquine (CQ, and shRNA-based lentivirus against autophagy-related genes (ATG7 and ATG12 were utilized. Apoptosis level was detected by caspase 3/7 activity and DNA fragmentation.Results: Cisplatin decreased cell viability and induced apoptosis of 5637 and T24 cells in a dose- and time-dependent manner. The increased LC3-II accumulation, p62 clearance, the number of LC3-positive puncta, and ALs in cisplatin-treated cells suggested that cisplatin indeed induces autophagy. Inhibition of cisplatin-induced autophagy using Baf A1, CQ, or ATG7/ATG12 shRNAs significantly enhanced cytotoxicity of

Transparent and Stretchable High-Performance Supercapacitors Based on Wrinkled Graphene Electrodes

Science.gov (United States)

2013-12-18

2, 870–875. 38. Chen, T.; Dai, L. Carbon Nanomaterials for High- Performance Supercapacitors . Mater. Today 2013, 16, 272–280. 39. Stoller, M. D...High-Performance Supercapacitors Based onWrinkledGraphene Electrodes Tao Chen,† Yuhua Xue,† Ajit K. Roy,‡ and Liming Dai†,* †Center of Advanced Science...electrodes and the associated supercapacitor cells cannot be both trans- parent and stretchable.1318 It is highly desirable to integrate the

Magnetic resonance-guided regional gene delivery strategy using a tumor stroma-permeable nanocarrier for pancreatic cancer

OpenAIRE

Wang, Xiaolin; Wang,Qingbing; Li,Jianfeng; An,Sai; Chen,Yi; Jiang,Chen

2015-01-01

Qingbing Wang,1,2 Jianfeng Li,3 Sai An,3 Yi Chen,1 Chen Jiang,3 Xiaolin Wang1,2 1Department of Interventional Radiology, Zhongshan Hospital, Fudan University, 2Shanghai Institute of Medical Imaging, 3Key Laboratory of Smart Drug Delivery, Ministry of Education, Department of Pharmaceutics, School of Pharmacy, Fudan University, Shanghai, People’s Republic of China Background: Gene therapy is a very promising technology for treatment of pancreatic ductal adenocarci...

Activation of Hh Signaling: A Critical Biological Consequence of ETS Gene Anomalies in Prostate Cancer

Science.gov (United States)

2013-01-01

Mian BM. Hedgehog Signaling Pathway Activation in Bladder Transitional Cell Carcinoma (TCC). J Urol., 2010, 184(1):344-351. PMID: 20488474 3...Tanner MJ, Welliver RC Jr, Chen M, Shtutman M, Godoy A, Smith G, Mian BM, Buttyan R. Effects of Androgen Receptor and Androgen on Gene Expression in...activities. Proc. Natl. Acad. Sci. USA, 2012, 109(34):13799-804. PMID: 22869755 Manuscripts in Preparation 1. Chen M* (co-first author), Li N*, Carkner

CLEAR: Cross-Layer Exploration for Architecting Resilience

Science.gov (United States)

2017-03-01

unavailable, or in an economy mode (low resilience, low power mode) when ABFT is available. However, the overheads outweigh benefits (details in [Cheng 16b...layer r Design, Automation , & Test in Europe, 2010. [Chen 05] Chen, Z. and J. Dong table real number codes based on random m Lecture Notes in...tolerate soft errors in processor c ACM/EDAC/IEEE Design Automation Conf., 2016. [Cheng 16b] Cheng, E., et al. -layer exploration for architecting

Agent Reasoning Transparency: The Influence of Information Level on Automation-Induced Complacency

Science.gov (United States)

2017-06-30

automation performance using working memory capacity. Ergonomics . 2014;57(3):295–318. Barber D, Davis L, Nicholson D, Finkelstein N, Chen JYC. The...ELEMENT NUMBER 6. AUTHOR(S) Julia L Wright, Jessie YC Chen, Michael J Barnes, and Peter A Hancock 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK ...Appendix C. Cube Comparisons Test 131 Appendix D. Spatial Orientation Test 135 Appendix E. National Aeronautics and Space Administration-Task Load Index

Branching ratio for the isoscalar transition 2+, T = 1, 1.95 MeV→0+, T = 1, 0.66 MeV in 22Na

International Nuclear Information System (INIS)

Vermeer, W.J.; Poletti, A.R.

1982-01-01

The branching ratio for the isoscalar transition 2 + , T = 1, 1.95 MeV→0 + , T = 1, 0.66 MeV in 22 Na was measured as (0.29+-0.05)% of the total decays of the 1.95MeV level. This, together with the measured mean-life of this level, gives an E2 strength of (16+-5) Wu, in good agreement with the estimate of 18 Wu obtained from the analogue transitions in 22 Ne and 22 Mg assuming a linear relationship between M(E2) and Tsub(z). Upper limits for some weak decay branches in 19 F were also obtained. (author)

Development and characterization of a gastroretentive dosage form composed of chitosan and hydroxyethyl cellulose for alendronate

OpenAIRE

Chen YC; Ho HO; Chiu CC; Sheu MT

2013-01-01

Ying-Chen Chen,1,* Hsiu-O Ho,1,* Chiao-Chi Chiu,1 Ming-Thau Sheu1,2 1School of Pharmacy, College of Pharmacy, Taipei Medical University, 2Clinical Research Center and Traditional Herbal Medicine Research Center, Taipei Medical University Hospital, Taipei, Taiwan*These authors contributed equally to this workAbstract: In this study, alendronate, the most commonly used biphosphonate for treating osteoporosis, was formulated as gastroretentive dosage form (GRDF) tablets to enhance its oral bioav...

Astragalus polysaccharides protect cardiac stem and progenitor cells by the inhibition of oxidative stress-mediated apoptosis in diabetic hearts

OpenAIRE

Chen,Wei; Ju,Jing; Yang,Yehong; Wang,Hao; Chen,Wenjie; Zhao,Xuelan; Ye,Hongying; Zhang,Yu

2018-01-01

Wei Chen,1 Jing Ju,1 Yehong Yang,2 Hao Wang,3 Wenjie Chen,1 Xuelan Zhao,1 Hongying Ye,2 Yu Zhang1 1Department of Geriatrics, Huashan Hospital, Fudan University, Shanghai, China; 2Department of Endocrinology, Huashan Hospital, Fudan University, Shanghai, China; 3Core Center of Animal Facility, School of Medicine, Fudan University, Shanghai, China Introduction: Diabetic cardiomyopathy is characterized by an imbalance between myocyte death and regeneration mediated by the progressive loss of c...

Comparison of cumulative dissipated energy between the Infiniti and Centurion phacoemulsification systems

OpenAIRE

Chen, Ming; Anderson, Erik; Hill, Geoffrey; Chen, John J; Patrianakos, Thomas

2015-01-01

Ming Chen,1 Erik Anderson,2 Geoffrey Hill,3 John J Chen,4 Thomas Patrianakos2 1Department of Surgery, University of Hawaii, Honolulu, HI, 2Department of Ophthalmology, John H Stroger, Jr Hospital of Cook County, Chicago, IL, 3Department of Ophthalmology, UT Southwestern Medical Center, Dallas, TX, 4Biostatistics Core, John A Burns School of Medicine, University of Hawaii, Honolulu, HI, USA Purpose: To compare cumulative dissipated energy between two phacoemulsification mac...

A retrospective randomized study to compare the energy delivered using CDE with different techniques and OZil? settings by different surgeons in phacoemulsification

OpenAIRE

Chen, Ming; Sweeney, Henry W; Luke, Becky; Chen, Mindy; Brown, Mathew

2009-01-01

Ming Chen1, Henry W Sweeney2, Becky Luke3, Mindy Chen4, Mathew Brown51University of Hawaii, Honolulu, Hawaii, USA; 2Research Support Services, the Queens Medical Center, Honolulu, Hawaii, USA; 3Surgical Suite, Honolulu, Hawaii, USA; 4University of California, Irvine, CA, USA; 5University of California, San Diego, CA, USAAbstract: Cumulative dissipated energy (CDE) was used with Infiniti® Vision System (Alcon Labs) as an energy delivery guide to compare four different phaco techniques ...

A retrospective randomized study to compare the energy delivered using CDE with different techniques and OZil settings by different surgeons in phacoemulsification

OpenAIRE

Chen, Ming

2009-01-01

Ming Chen1, Henry W Sweeney2, Becky Luke3, Mindy Chen4, Mathew Brown51University of Hawaii, Honolulu, Hawaii, USA; 2Research Support Services, the Queens Medical Center, Honolulu, Hawaii, USA; 3Surgical Suite, Honolulu, Hawaii, USA; 4University of California, Irvine, CA, USA; 5University of California, San Diego, CA, USAAbstract: Cumulative dissipated energy (CDE) was used with Infiniti® Vision System (Alcon Labs) as an energy delivery guide to compare four different phaco techniques ...

Sensory integration dysfunction affects efficacy of speech therapy on children with functional articulation disorders

OpenAIRE

Tung, Li-Chen; Lin, Chin-Kai; Hsieh, Ching-Lin; Chen, Ching-Chi; Huang, Chin-Tsan; Wang, Chun-Hou

2013-01-01

Li-Chen Tung,1,# Chin-Kai Lin,2,# Ching-Lin Hsieh,3,4 Ching-Chi Chen,1 Chin-Tsan Huang,1 Chun-Hou Wang5,6 1Department of Physical Medicine and Rehabilitation, Chi Mei Medical Center, Tainan, 2Program of Early Intervention, Department of Early Childhood Education, National Taichung University of Education, Taichung, 3School of Occupational Therapy, College of Medicine, National Taiwan University, Taipei, 4Department of Physical Medicine and Rehabilitation, National Taiwan University Hospital, ...

A Nomogram to Predict Radiation Pneumonitis, Derived From a Combined Analysis of RTOG 9311 and Institutional Data

International Nuclear Information System (INIS)

Bradley, Jeffrey D.; Hope, Andrew; El Naqa, Issam; Apte, Aditya M.S.; Lindsay, Patricia E.; Bosch, Walter D.Sc.; Matthews, John D.Sc.; Sause, William; Graham, Mary V.; Deasy, Joseph O.

2007-01-01

Purpose: To test the Washington University (WU) patient dataset, analysis of which suggested that superior-to-inferior tumor position, maximum dose, and D35 (minimum dose to the hottest 35% of the lung volume) were valuable to predict radiation pneumonitis (RP), against the patient database from Radiation Therapy Oncology Group (RTOG) trial 9311. Methods and Materials: The entire dataset consisted of 324 patients receiving definitive conformal radiotherapy for non-small-cell lung cancer (WU = 219, RTOG 9311 = 129). Clinical, dosimetric, and tumor location parameters were modeled to predict RP in the individual datasets and in a combined dataset. Association quality with RP was assessed using Spearman's rank correlation (r) for univariate analysis and multivariate analysis; comparison between subgroups was tested using the Wilcoxon rank sum test. Results: The WU model to predict RP performed poorly for the RTOG 9311 data. The most predictive model in the RTOG 9311 dataset was a single-parameter model, D15 (r = 0.28). Combining the datasets, the best derived model was a two-parameter model consisting of mean lung dose and superior-to-inferior gross tumor volume position (r = 0.303). An equation and nomogram to predict the probability of RP was derived using the combined patient population. Conclusions: Statistical models derived from a large pool of candidate models resulted in well-tuned models for each subset (WU or RTOG 9311), which did not perform well when applied to the other dataset. However, when the data were combined, a model was generated that performed well on each data subset. The final model incorporates two effects: greater risk due to inferior lung irradiation, and greater risk for increasing normal lung mean dose. This formula and nomogram may aid clinicians during radiation treatment planning for lung cancer

List Decoding of Algebraic Codes

DEFF Research Database (Denmark)

Nielsen, Johan Sebastian Rosenkilde

We investigate three paradigms for polynomial-time decoding of Reed–Solomon codes beyond half the minimum distance: the Guruswami–Sudan algorithm, Power decoding and the Wu algorithm. The main results concern shaping the computational core of all three methods to a problem solvable by module...... Hermitian codes using Guruswami–Sudan or Power decoding faster than previously known, and we show how to Wu list decode binary Goppa codes....... to solve such using module minimisation, or using our new Demand–Driven algorithm which is also based on module minimisation. The decoding paradigms are all derived and analysed in a self-contained manner, often in new ways or examined in greater depth than previously. Among a number of new results, we...

Spinor monopole harmonics and the Pauli spin equation

International Nuclear Information System (INIS)

Pereira, J.G.; Ferreira, P.L.

1982-01-01

In the framework of Wu and Yang theory of U(1) magnetic monopoles, two problems are revisited: (i) the binding of spin-0 monopole to a spin-1/2 particle possessing an arbitrary magnetic dipole moment, and (ii) the energy levels and properties of the electron-dyon system. In both problems, the spin-1/2 particle is assumed to obey the Pauli spin equation. Spin-orbit and other higher order terms are treated as a perturbation, in connection with the second mentioned problem. Wu and Yang's spinor monopole harmonics allow an elegant and simplified treatment of those problems. The results obtained are in good agreement with those obtained in older papers. (Author) [pt

Scattering of plane waves by rough surfaces in the sense of Born approximation

OpenAIRE

Arnold, Thomas

2014-01-01

Das Thema dieser Arbeit ist die Streuung elektromagnetischer ebener Wellen an rauen Oberflächen, also an ebenen Oberflächen mit glatten und beschränkten Störungen. Darüber hinaus wird ein kleiner Kontrast der Materialkonstanten zwischen dem Deckmaterial und dem Material unter der rauen Oberfläche angenommen. Unter diesen Voraussetzungen wird ein Fernfeld-Formel für das gestreute Feld mit Hilfe von Born-Approximation und Fourier-Techniken hergeleitet. Dieser Ansatz basiert auf einer Modifikati...

Distributed mechatronics controller for modular wall climbing robot

CSIR Research Space (South Africa)

Tlale, NS

2006-07-01

Full Text Available - climbing robot for inspection in nuclear power plants.”, Proc. IEEE Int. Conf. on Robotics and Automation, pp. 409-1414. (Chen 2001) Chen, D-. J., 2001, “Architecture for Systematic Development of Mechatronics Software Systems”, Licentiate Thesis... provide a more cost effective solution to the problem (Luk et al 1991). Such robots are termed service robots by the International Service Robot Association (ISRA) (Pransky 1996). They are defined as machines that sense, think, and act to benefit (or...

miR-139-5p regulates proliferation, apoptosis, and cell cycle of uterine leiomyoma cells by targeting TPD52

OpenAIRE

Chen,Hong; Xu,Hong; Meng,Yugang; Zhang,Yun; Chen,Junying; Wei,Xiaoning

2016-01-01

Hong Chen,1 Hong Xu,1 Yu-gang Meng,1 Yun Zhang,2 Jun-ying Chen,1 Xiao-ning Wei1 1Department of Gynaecology, The First Affiliated Hospital of Guangxi Medical University, Nanning, Guangxi, 2Department of Gynaecology, The People’s Hospital of Suzhou High Tech District, Suzhou, Jiangsu, People’s Republic of China Background: Uterine leiomyoma is one of the most common benign tumors in women. It dramatically decreases the quality of life in the affected women. However, there ...

Qingryllus jiguanshanensis sp. n. from Sichuan, China, the second species of Qingryllus (Orthoptera, Gryllidae

Directory of Open Access Journals (Sweden)

Haoyu Liu

2017-03-01

Full Text Available A second species of Qingryllus Chen & Zheng is described and illustrated, Q. jiguanshanensis sp. n., from Sichuan, China. This new species is similar to Q. striofemorus Chen & Zheng, 1995, but differs from the latter by the posterior margin of pronotum being distinctly widened, the veins of tegmina yellowish-white only on lateral side of dorsal area, and the epiphallus distinctly widened posteriorly. A distribution map of the species of this genus and habitus photographs of the new species are presented.

Support from the Army Research Office to be Used Towards Student Travel Fellowships for the National Radio Science Meetings in January 2010, 2011, and 2012

Science.gov (United States)

2012-08-06

K2-2 COMPUTATIONAL STUDY OF EXTERNAL FIXATION DEVICES SURFACE HEATING IN 1.5T AND 3T MRI SYSTEMS Yan Liu*1, Jianxiang Shen1, Ji Chen1, Wolfgang...communications have been ex- panding rapidly with the proliferation of consumer wireless devices such as smart phones, tablet PCs, handheld gaming devices, and...Computational Study of External Fixation Devices Surface Heating in 1.5T and 3T MRI Systems Yan Liu* (1) , Jianxiang Shen (1) , Ji Chen (1) , and

Is the Chinese Army the Real Winner in PLA Reforms

Science.gov (United States)

2016-10-01

44 Commentary / The Chinese Army and PLA Reforms JFQ 83, 4th Quarter 2016 Is the Chinese Army the Real Winner in PLA Reforms? By Phillip C. Saunders...and John Chen G round force officers run China’s military, the People’s Liberation Army ( PLA ). About 70 percent of PLA soldiers serve in the PLA ...Saunders and Chen 45 services and arms of the PLA ” has meant reductions in “technologically backward” PLAA units and personnel increases for the other

Soil salinity and matric potential interaction on water use, water use efficiency and yield response factor of bean and wheat.

Science.gov (United States)

Khataar, Mahnaz; Mohhamadi, Mohammad Hossien; Shabani, Farzin

2018-02-08

We studied the effects of soil matric potential and salinity on the water use (WU), water use efficiency (WUE) and yield response factor (Ky), for wheat (Triticum aestivum cv. Mahdavi) and bean (Phaseoulus vulgaris cv. COS16) in sandy loam and clay loam soils under greenhouse conditions. Results showed that aeration porosity is the predominant factor controlling WU, WUE, Ky and shoot biomass (Bs) at high soil water potentials. As matric potential was decreased, soil aeration improved, with Bs, WU and Ky reaching maximum value at -6 to -10 kPa, under all salinities. Wheat WUE remained almost unchanged by reduction of matric potential under low salinities (EC ≤ 8 dSm -1 ), but increased under higher salinities (EC ≥ 8 dSm -1 ), as did bean WUE at all salinities, as matric potential decreased to -33 kPa. Wheat WUE exceeds that of bean in both sandy loam and clay loam soils. WUE of both plants increased with higher shoot/root ratio and a high correlation coefficient exists between them. Results showed that salinity decreases all parameters, particularly at high potentials (h = -2 kPa), and amplifies the effects of waterlogging. Further, we observed a strong relationship between transpiration (T) and root respiration (Rr) for all experiments.

Coulomb excitation of the proton-dripline nucleus Na20

Science.gov (United States)

Schumaker, M. A.; Cline, D.; Hackman, G.; Pearson, C. J.; Svensson, C. E.; Wu, C. Y.; Andreyev, A.; Austin, R. A. E.; Ball, G. C.; Bandyopadhyay, D.; Becker, J. A.; Boston, A. J.; Boston, H. C.; Buchmann, L.; Churchman, R.; Cifarelli, F.; Cooper, R. J.; Cross, D. S.; Dashdorj, D.; Demand, G. A.; Dimmock, M. R.; Drake, T. E.; Finlay, P.; Gallant, A. T.; Garrett, P. E.; Green, K. L.; Grint, A. N.; Grinyer, G. F.; Harkness, L. J.; Hayes, A. B.; Kanungo, R.; Lisetskiy, A. F.; Leach, K. G.; Lee, G.; Maharaj, R.; Martin, J.-P.; Moisan, F.; Morton, A. C.; Mythili, S.; Nelson, L.; Newman, O.; Nolan, P. J.; Orce, J. N.; Padilla-Rodal, E.; Phillips, A. A.; Porter-Peden, M.; Ressler, J. J.; Roy, R.; Ruiz, C.; Sarazin, F.; Scraggs, D. P.; Waddington, J. C.; Wan, J. M.; Whitbeck, A.; Williams, S. J.; Wong, J.

2009-10-01

The low-energy structure of the proton dripline nucleus Na20 has been studied using Coulomb excitation at the TRIUMF-ISAC radioactive ion beam facility. A 1.7-MeV/nucleon Na20 beam of ~5×106 ions/s was Coulomb excited by a 0.5-mg/cm2natTi target. Scattered beam and target particles were detected by the BAMBINO segmented Si detector while γ rays were detected by two TIGRESS HPGe clover detectors set perpendicular to the beam axis. Coulomb excitation from the 2+ ground state to the first excited 3+ and 4+ states was observed, and B(λL) values were determined using the 2+→0+ de-excitation in Ti48 as a reference. The resulting B(λL)↓ values are B(E2;3+→2+)=55±6e2fm4 (17.0±1.9 W.u.), B(E2;4+→2+)=35.7±5.7e2fm4 (11.1±1.8 W.u.), and B(M1;4+→3+)=0.154±0.030μN2 (0.086±0.017 W.u.). These measurements provide the first experimental determination of B(λL) values for this proton dripline nucleus of astrophysical interest.

Disorder effect on heat capacity, self-diffusion coefficient, and choosing best potential model for melting temperature, in gold–copper bimetallic nanocluster with 55 atoms

International Nuclear Information System (INIS)

Taherkhani, Farid; Akbarzadeh, Hamed; Feyzi, Mostafa; Rafiee, Hamid Reza

2015-01-01

Molecular dynamics simulation has been implemented for doping effect on melting temperature, heat capacity, self-diffusion coefficient of gold–copper bimetallic nanostructure with 55 total gold and copper atom numbers and its bulk alloy. Trend of melting temperature for gold–copper bimetallic nanocluster is not same as melting temperature copper–gold bulk alloy. Molecular dynamics simulation of our result regarding bulk melting temperature is consistence with available experimental data. Molecular dynamics simulation shows that melting temperature of gold–copper bimetallic nanocluster increases with copper atom fraction. Semi-empirical potential model and quantum Sutton–Chen potential models do not change melting temperature trend with copper doping of gold–copper bimetallic nanocluster. Self-diffusion coefficient of copper atom is greater than gold atom in gold–copper bimetallic nanocluster. Semi-empirical potential within the tight-binding second moment approximation as new application potential model for melting temperature of gold–copper bulk structure shows better result in comparison with EAM, Sutton–Chen potential, and quantum Sutton–Chen potential models

Disorder effect on heat capacity, self-diffusion coefficient, and choosing best potential model for melting temperature, in gold–copper bimetallic nanocluster with 55 atoms

Energy Technology Data Exchange (ETDEWEB)

Taherkhani, Farid, E-mail: faridtaherkhani@gmail.com, E-mail: f.taherkhani@razi.ac.ir [Razi University, Department of Physical Chemistry (Iran, Islamic Republic of); Akbarzadeh, Hamed [Hakim Sabzevari University, Department of Chemistry (Iran, Islamic Republic of); Feyzi, Mostafa; Rafiee, Hamid Reza [Razi University, Department of Physical Chemistry (Iran, Islamic Republic of)

2015-01-15

Molecular dynamics simulation has been implemented for doping effect on melting temperature, heat capacity, self-diffusion coefficient of gold–copper bimetallic nanostructure with 55 total gold and copper atom numbers and its bulk alloy. Trend of melting temperature for gold–copper bimetallic nanocluster is not same as melting temperature copper–gold bulk alloy. Molecular dynamics simulation of our result regarding bulk melting temperature is consistence with available experimental data. Molecular dynamics simulation shows that melting temperature of gold–copper bimetallic nanocluster increases with copper atom fraction. Semi-empirical potential model and quantum Sutton–Chen potential models do not change melting temperature trend with copper doping of gold–copper bimetallic nanocluster. Self-diffusion coefficient of copper atom is greater than gold atom in gold–copper bimetallic nanocluster. Semi-empirical potential within the tight-binding second moment approximation as new application potential model for melting temperature of gold–copper bulk structure shows better result in comparison with EAM, Sutton–Chen potential, and quantum Sutton–Chen potential models.

Size-controlled fabrication of zein nano/microparticles by modified anti-solvent precipitation with/without sodium caseinate

OpenAIRE

Li, Feng; Chen, Yan; Liu, Shubo; Qi, Jian; Wang, Weiying; Wang, Chenhua; Zhong, Ruiyue; Chen, Zhijun; Li, Xiaoming; Guan, Yuanzhou; Kong, Wei; Zhang, Yong

2017-01-01

Feng Li,1 Yan Chen,1,2 Shubo Liu,1 Jian Qi,1 Weiying Wang,1 Chenhua Wang,1 Ruiyue Zhong,1 Zhijun Chen,1 Xiaoming Li,1 Yuanzhou Guan,1 Wei Kong,1,2 Yong Zhang1,2 1National Engineering Laboratory for AIDS Vaccine, School of Life Sciences, Jilin University, Changchun, 2Key Laboratory for Molecular Enzymology and Engineering, the Ministry of Education, School of Life Sciences, Jilin University, Changchun, China Abstract: Zein-based nano/microparticles have been demonstrated to be promising carr...

Parameters identification and adaptive full state hybrid projective synchronization of chaotic (hyper-chaotic) systems

International Nuclear Information System (INIS)

Hu Manfeng; Xu Zhenyuan; Zhang Rong; Hu Aihua

2007-01-01

Based on the active control idea and the invariance principle of differential equations, a general scheme of adaptive full state hybrid projective synchronization (FSHPS) and parameters identification of a class of chaotic (hyper-chaotic) systems with linearly dependent uncertain parameters is proposed in this Letter. With this effective scheme parameters identification and FSHPS of chaotic and hyper-chaotic systems can be realized simultaneously. Numerical simulations on the chaotic Chen system and the hyper-chaotic Chen system are presented to verify the effectiveness of the proposed scheme

Relación heterófilo/linfocito, frecuencia espontánea de eritrocitos micronucleados y prolongaciones nucleares en el ganso nevado (Chen caerulescens: Una propuesta como posible biomonitor de estrés y genotóxicos ambientales

Directory of Open Access Journals (Sweden)

Martha C. Martínez Quintanilla

2017-04-01

Full Text Available Existen organismos silvestres que son altamente vulnerables ante estresores antropogénicos y naturales, estos organismos pueden ser de utilidad para evaluar la salud ambiental mediante diferentes indicadores confiables, sencillos, rápidos, económicos para determinar y si es posible reducir estos efectos negativos. En este estudio proponemos al ganso nevado (Chen caerulescens como posible biomonitor de estrés y genotóxicos ambientales mediante la relación heterófilo/linfocito (H/L, la prueba de micronúcleos (EMN, prolongaciones nucleares en eritrocitos (EPN y eritrocitos policromáticos (EPC. Durante la temporada de caza (2012-2013 en el humedal de Málaga, Durango, México, colectamos 18 organismos. Los eritrocitos fueron las células más abundantes, de núcleo y morfología elípticos, de tamaño 12.68 ± 0.89 µm. Observamos heterófilos (11.07±1.32 µm, eosinófilos (9.67±1.26 µm, basófilos (5.75 ± 0.78 µm, monocitos (10.49±1.36 µm y linfocitos (6.53±1.0 µm. No identificamos alteración en las proporciones ni en la morfología de leucocitos, sin embargo, es necesario un mayor número de organismos para establecer los parámetros sanguíneos de base normal para esta especie. La relación h/l fue de 0.41 ± 0.11 este valor es similar a lo reportado para esta y otras especies de aves consideradas como sanas. Establecimos la frecuencia basal de EMN (2.6±1.45, epn (249.2 ± 89.74 y EPC (156.5 ± 50. El ganso nevado es un organismo que se perfila como buen candidato a biomonitor ambiental debido a la frecuencia basal de su relación H/L, EMN, EPN y EPC, pero debe probarse en condiciones estandarizadas y a través de estudios en zonas con y sin contaminación.

Autism and green space_clean

Data.gov (United States)

U.S. Environmental Protection Agency — Autism and green space metrics in California elementary school districts. This dataset is associated with the following publication: Wu, J., and L. Jackson. Inverse...

A Brief Introduction of Air Traffic Management

Institute of Scientific and Technical Information of China (English)

1997-01-01

Air Traffic Management (ATM) started publication in 1995 by Air Traffic Management Bureau of CAAC. It is the first magazine about ATM field in CAAC. The chairman of Editorial Board of ATM is Mr. Bao Peide, Vice Minister of CAAC. Mr. Chen Ziye, Vice President of the 1st Research Institute of CAAC and Chen Xuhua, General Director of Air Traffic Management Bureau are vice chairmen of the editorial board, and six general directors of local air traffic management bureau and some professors and experts are members of the editorial board.

A glimpse into the littoral nutrient dynamics of a lake system connected to the sea

CSIR Research Space (South Africa)

Taljaard, Susan

2018-01-01

Full Text Available -situ sources are those situated in the floodplains of water bodies such as septic tank systems from low-lying developments (e.g. Chen, 1988; Fraterrigo and Downing, 2008). The smaller, dynamic and more linear nature of over 80% of South Africa’s estuaries... of agricultural watersheds in central Navarre (Spain). Agric. Water Manage. 95 1111–1128. https://doi.org/10.1016/j.agwat.2008.06.013 CHEN M (1988) Pollution of ground water by nutrients and fecal coliforms from lakeshore septic tank systems. Water Air Soil...

清末民初における『レ・ミゼラブル』の移入と日本 : 陳景韓訳「哀史之一節逸犯」を例として

OpenAIRE

梁, 艶; Liang, Yan

2011-01-01

Victor Hugo was introduced into China through his Japanese translations. However, the route of the reception of his masterpiece Les Misérables in China has not yet been explained clearly. In this paper, I will take Ai Shi Zhi Yi Jie Yi Fan, a Chinese translation by Chen Jinghan of a part of Les Misérables, as an example to see how Les Misérables was introduced into China. By examining Japanese translations of Les Misérables, I come to the conclusion that Chen was influenced by Kuroiwa Ruikô's...

The Secret of Guided Missile Re-Entry,

Science.gov (United States)

1986-06-25

I RD-PAI169 598 THE SECRET OF GUIDED MISSILE RE-ENTRY(U) FOREIGN / I TECHNOLOGY DIV NRIGHT-PATTERSON RFB OH J CHEN ET AL. I 25 JUN 96 FTD-ID(RS)T...TECHNOLOGY DIVISION THE SECRET OF GUIDED MISSILE RE-ENTRY by Chen Jingzhong, An Sehua J L 0 7 ’:;85’ ’ 0 *Approved for public release; Distribution...unlimite t d. :. 86 7 034.. FTD- ID(RS)T-0459-86 HUMAN TRANSLATION FTD-ID(RS)T-0459-86 25 June 1986 MICROFICHE NR: F - - 0Q 9? THE SECRET OF GUIDED

Effect of Zhen-wu decoction on chronic heart failure in rats

African Journals Online (AJOL)

... has been an increased hospitalization burden, and makes HF a global public health problem. The most effective and commonly used drugs for treatment of HF are angiotensin-converting enzyme (ACE) inhibitors, β-adrenoceptor blockers, and digitalis [5-7]. The American Heart. Association (AHA) and European Society of ...